Cancer Therapy Volume 3 Issue A by Cancer Therapy

CANCER THERAPY

Volume 3 Number 1 June, 2005

CANCER THERAPY FREE ACCESS www.cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!! ! Editor

Teni Boulikas Ph. D., CEO Regulon Inc. 715 North Shoreline Blvd. Mountain View, California, 94043 USA Tel: 650-968-1129 Fax: 650-567-9082 E-mail: teni@regulon.org

Teni Boulikas Ph. D., CEO, Regulon AE. Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9853849 Fax: +30-210-9858453 E-mail: teni@regulon.org

!!!!!!!!!!!!!!!!!!!!!!!! ! Assistant to the Editor Maria Vougiouka B.Sc., Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9858454 Fax: +30-210-9858453 E-mail: maria@cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!! ! Editorial Board

Ablin, Richard J., Ph.D., Arizona Cancer Center, University of Arizona, USA Armand, Jean Pierre, M.D. Ph.D., European Organization for Research and Treatment of Cancer (EORTC), Belgium Aurelian, Laure, Ph.D., University of Maryland School of Medicine, USA Berdel, Wolfgang E, M.D., University Hospitals, Germany Bertino, Joseph R., M.D., Cancer Institute of New Jersey, USA Beyan Cengiz, M.D.,!Gulhane Military Medical Academy, Turkey Bottomley, Andrew, Ph.D., European Organization for Research and Treatment of Cancer Data Center (EORTC), Belgium Bouros, Demosthenes, M.D., University Hospital of Alexandroupolis. Greece Cabanillas, Fernando, M.D, The University of Texas M. D. Anderson Cancer Center, USA Castiglione, Monica, MHA, SIAK/IBCSG Coordinating Center, Switzerland Chou, Kuo-Chen, Ph.D., D.Sc., Pharmacia Upjohn, USA Chu, Kent-Man, M.D., University of Hong Kong Medical Center, Queen Mary Hospital, Hong Kong, China Chung, Leland W.K, Ph.D., Winship Cancer Institute,

USA Coukos, George, M.D., Ph.D., Hospital of the University of Pennsylvania, USA Darzynkiewicz, Zbigniew, M.D., Ph.D., New York Medical College, USA Devarajan, Prasad M.D., Cincinnati Children's Hospital, USA Der Channing, J. Ph.D, Lineberger Comprehensive Cancer Center, USA Dritschilo, Anatoly, M.D., Georgetown University Hospital, USA Duesberg, Peter H., Ph.D, University of California at Berkeley, USA El-Deiry, Wafik S. M.D., Ph.D., Howard Hughes Medical Institute, University of Pennsylvania School of Medicine, USA Federico, Massimo, M.D. UniversitĂ di Modena e Reggio Emilia, Italy Fiebig, Heiner H, Albert-Ludwigs-UniversitĂ¤t, Germany Fine, Howard A., M.D., National Cancer Institute, USA Frustaci, Sergio, M.D., Centro di Riferimento Oncologico di Aviano, Italy Georgoulias, Vassilis, M.D., Ph.D., University General Hospital of Heraklion, Greece Giordano, Antonio, M.D., Ph.D., Sbarro Institute for Cancer Research and Molecular Medicine, Temple University, USA Greene, Frederick Leslie, M.D., Carolinas Medical

Center, USA Gridelli, Cesare M.D., Azienda Ospedaliera, "S.G.Moscati", Italy Hengge, Ulrich, M.D., Heinrich-Heine-University Duesseldorf, Germany Huber, Christian M.D., Johannes-GutenbergUniversity, Germany Hunt, Kelly, M.D., The University of Texas M. D. Anderson Cancer Center, USA Kamen, Barton A., M.D. Ph.D, Cancer Institute of New Jersey, USA Kaptan, Kürsat, M.D., Gülhane Military Medicine Academy, Turkey Kazuma, Ohyashiki, M.D., Ph.D., Tokyo Medical University, Japan Kinsella, Timothy J. M.D., The research Institute of University Hospitals in Cleveland, USA Kmiec, Eric B, Ph.D., University of Delaware, USA Kosmidis Paris, M.D., "Hygeia" Hospital, Athens, Greece Koukourakis Michael, M.D., Democritus University of Thrace, Greece Kroemer, Guido, M.D. Ph.D., Institut Gustave Roussy, France Kurzrock, Razelle, M.D., F.A.C.P., M. D. Anderson Cancer Center, USA Leung, Thomas Wai-Tong M.D., Chinese University of Hong Kong, China Levin, Mark M.D., Sister Regina Lynch Regional Cancer Center, Holy Name Hospital, USA Lichtor, Terry M.D., Ph.D., Rush Medical College, USA Liebermann, Dan A., Ph.D., Temple Univ. School of Medicine, USA Lipps, Hans J, Ph.D., Universität Witten/Herdecke, Germany Lokeshwar, Balakrishna L., Ph.D., University of Miami School of Medicine, USA Mackiewicz, Andrzej, M.D., Ph.D., University School of Medical Sciences (USOMS) at Great Poland Cancer Center, Poland Marin, Jose J. G., Ph.D., University of Salamanca, Spain McMasters, Kelly M., M.D., Ph.D., University of Louisville, J. Graham Brown Cancer Center, USA Morishita, Ryuichi, M.D., Ph.D., Osaka University, Japan Mukhtar, Hasan Ph.D., University of Wisconsin, USA Norris, James Scott, Ph.D., Medical University of South Carolina, USA Palu, Giorgio, M.D., University of Padova, Medical School, Italy

Park, Jae-Gahb, M.D., Ph.D., Seoul National University College of Medicine, Korea Perez-Soler, Roman M.D., The Albert Einstein Cancer Center, USA Peters, Godefridus J., Ph.D., VU University Medical Center (VUMC), The Netherlands Poon, Ronnie Tung-Ping, M.D., Queen Mary Hospital, Hong Kong, China Possinger, Kurt-Werner, M.D., Humboldt University, Germany Rainov G Nikolai M.D., D.Sc., The University of Liverpool. UK Randall, E Harris, M.D., Ph.D., The Ohio State University, USA Ravaioli Alberto, M.D. Ospedale Infermi, Italy Remick, Scot, C. M.D., University Hospitals of Cleveland, USA Rhim, Johng S M.D., Uniformed Services University of Health Sciences, USA Schadendorf, Dirk, M.D., Universitäts-Hautklinik Mannheim, Germany Schmitt, Manfred, Ph.D., Universität München, Klinikum rechts der Isar, Germany Schuller, Hildegard M., D.V.M., Ph.D., University of Tennessee, USA Slaga, Thomas J., Ph.D., AMC Cancer Research Center (UICC International Directory of Cancer Institutes and Organisations), USA Soloway, Mark S., M.D., University of Miami School of Medicine, USA Srivastava, Sudhir, Ph.D., MPH, MS, Division of Cancer Prevention, National Cancer Institute, USA Stefanadis, Christodoulos, M.D., University of Athens, Medical School, Greece, Stein, Gary S Ph.D., University Of Massachusetts, USA Tirelli, Umberto, National Cancer Institute, Italy Todo, Tomoki, M.D., Ph.D., The University of Tokyo, Japan van der Burg, Sjoerd H, Leiden University Medical Center, The Netherlands Wadhwa Renu, Ph. D., Nat. Inst. of Advan. Indust. Sci. and Technol. (AIST), Japan Waldman, Scott A. M.D., Ph.D., USA Walker, Todd Ph.D., Charles Sturt University, Australia Watson, Dennis K. Ph.D., Medical University of South Carolina, Hollings Cancer Center, USA Waxman, David J., Ph.D., Boston University, USA Weinstein, Bernard I., M.D., D.Sci (Hon.), Columbia University, USA

!!!!!!!!!!!!!!!!!!!!!!!! ! Associate Board Members

Chen, Zhong, M.D, Ph.D, National Institute of Deafness and other Communication Disorders, National Institutes of Health, USA Dietrich Pierre Yves, Hopitaux Universitaires de GenFve Switzerland Jeschke Marc G, M.D., Ph.D. Universität Erlangen-Nürnberg. Germany Limacher Jean-Marc, MD Hôpitaux Universitaires de Strasbourg, France Los Marek J, M.D., Ph.D. University of Manitoba, USA Mazda Osam, M.D., Ph.D. Kyoto Prefectural University of Medicine, Japan Merlin Jean-Louis, Ph.D Centre Alexis Vautrin, National Cancer Institute University Henri Poincaré France Okada Takashi, M.D., Ph.D. Jichi Medical School Japan Pisa Pavel, M.D, Ph.D. Karolinska Hospital, Sweden

Squiban Patrick, MD Transgene SA France Tsuchida Masanori, M.D, Ph.D Niigata University Graduate School of Medical and Dental Sciences Japan Ulutin, Cuneyt, M.D., Gulhane Military Medicine Academy, Turkey Xu Ruian, Ph.D., The University of Hong Kong, Hong Kong

!!!!!!!!!!!!!!!!!!!!!!!! ! For submission of manuscripts and inquiries: Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org

Instructions to authors: Cancer Therapy FREE ACCESS www.cancer-therapy.org

Scope This journal, bridging various fields is one of the most rapid with free access at www.cancer-therapy.org. The scope of Cancer Therapy is to rapidly publish original and in-depth review articles on cancer embracing all fields from molecular mechanisms to results on clinical trials. Articles (both invited and submitted) review or report novel findings of importance to a general audience in cancer therapy, molecular medicine, gene discovery, and molecular biology with emphasis to molecular mechanisms and clinical applications. The journal will accept papers on all aspects of cancer, at the clinical, preclinical or cell culture stage on chemotherapy and new experimental drugs, gene discovery, cancer immunotherapy, DNA vaccines, use of DNA regulatory elements in gene transfer, cell therapy and drug discovery related to cancer therapy. The authors are encouraged to elaborate on the molecular mechanisms that govern a cancer therapy approach. To make the publication attractive authors are encouraged to include color figures. Type of articles Both review articles and original research articles will be considered. Original research articles should contain a generous introduction in addition to experimental data. The articles contain information important to a general audience as the volume is addressed to researches outside the field. There is no limit on the length of the articles provided that the subject is interesting to a general audience and covers exhaustively a field. The typical length of each manuscript is 12-60 manuscript pages (approximately 420 printed pages) plus Figures and Tables. Free of Charge publication, Complimentary reprints & Subscriptions There are no charges for color figures or page numbers. Corresponding authors get a one-year free subscription (hard copy) plus 25 reprints free of charge. The free subscription can be renewed for additional years by having one paper per year accepted for publication. Sections of the manuscript Each manuscript should have a Title, Authors, Affiliation, Corresponding Author (with Tel, Fax, and Email), Summary, and Introduction; review articles are subdivided into headings I, II, III, etc. (starting with I. Introduction) and subdivided into A, B, C, etc. You can further subdivide into 1, 2, 3, etc. Research articles are divided into Summary; I. Introduction; II. Results; III Discussion; Acknowledgments IV. Materials and Methods and References. Please include in your text citations the name of authors and year in parenthesis; for three or more authors use: (name of first author et al, with year); for two authors please use both names. Please delete hidden text for references. In the reference list, please, type references with year and Journal in boldface and provide full title of the article such as:

Buschle M, Schmidt W, Berger M, Schaffner G, Kurzbauer R, Killisch I, Tiedemann J-K, Trska B, Kirlappos H, Mechtler K, Schilcher F, Gabler C, and Birnstiel ML (1998) Chemically defined, cell-free cancer vaccines: use of tumor antigen-derived peptides or polyepitope proteins for vaccination. Gene Ther Mol Biol 1, 309-321. Please use Microsoft Word, font “Times” (Mac users) or “Times New Roman” (PC users) and insert Greek or other characters using the “Insert/Symbol” function in the Microsoft Word rather than simple conversion to font “Symbol”. Please boldface Figure 1, 2, 3 etc. as well as Table 1, 2, etc. throughout the text. Please provide the highest quality of prints of your Figures; whenever possible, please provide in addition an electronic version of your figures (optional). Corresponding authors are kindly requested to provide a color (or black/white) head photo of themselves (preferably 4x5 cm or any size), as we shall include these in the publication. Submission and reviewing Peer reviewing is by members of the Editorial Board and external referees. Please suggest 2-3 reviewers providing their electronic addresses, mailing addresses and telephone/fax numbers. Authors are being sent page proofs. Cancer Therapy (Volume 1, 2003) is published on high quality paper with excellent reproduction of color figures and electronically. Reviewing is completed within 5-15 days from receiving the manuscript. Articles accepted without revisions (i.e., review articles) will be published online (www.cancertherapy.org) in approximately 1 month following submission. Please submit an electronic version of full text and figures preferably in jpeg format. The electronic version of the figures will be used for the rapid reviewing process. High quality prints or photograph of the figures and the original with one copy should be sent via express mail to the Editorial Office. Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org The free electronic access to articles published in "Cancer Therapy" to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in cancer, the anticipated high quality in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board being assembled are prognostic factors of a big success for the newly established journal.

Table of contents Cancer Therapy Vol 3 Number 1, June 2005

Pages

Type of Article

Article title

Authors (corresponding author is in boldface)

1-4

Case Report

5-28

Review Article

Cardiac metastasis from carcinoma of the cervix C-Kit signal transduction and involvement in cancer

29-30

Case Report

31-40

Research Article

Nadereh Behtash, Haleh Ayatollahi, Fereshteh Fakor, Morteza M Dini Johan Lennartsson, Olexandr Voytyuk, Elke Heiss, Christina Sundberg, Jianmin Sun and Lars Rönnstrand Malihe Hasanzadeh and Hasan Malekoti Eberhard Stoeckle, Jean-Michel Coindre, Guy Kantor, Laurence Thomas, Antoine Avril, Philippe Lagarde, Michèle Kind, Binh Nguyen Bui

41-56

Review Article

57-64

Review Article

65-67

Review Article

77-84

Review Article

85-94

Review Article

95-100

Review Article

101-104

Review Article

105-130

Review Article

131-138

Review

Miliary tuberculosis peritonitis mimicking advanced ovarian cancer Quality of surgery in soft tissue sarcoma: a single centre experience with the French Sarcoma Group (FSG) surgical system Current role of erythropoietin in the management of patients with haematological and solid malignancies Targeting of cytostatic bile acid derivatives toward tumours of the enterohepatic circuit Thalidomide and its use in renal and prostate cancer Genetic predisposition in preinvasive lesions of the breast Head and neck cancer in elderly patients

Radiotherapy and surgery in the management of non-small cell lung cancer in the elderly patients, a review of the recent literature P-glyco protein (multi drug resistance protein product) does not predict the response of laryngeal and hypopharyhgeal cancer to chemotherapy Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? Micro and nano drug delivery systems

Max Mano, Priska Butzberger, Anne Reid, Alan Rodger, Richard Soutar, John Welsh Jose J.G. Marin, Marta R. Romero, Marta Vallejo, Maria J. Monte Simon Pridgeon, Marcus Drake George C. Zografos, Flora Zagouri, Costantinos Fotiadis, John Bramis Daniele Bernardi, Domenico Errante, Luigi Barzan, Giovanni Franchin, Luigi Salvagno, Antonio Bianco, Luca Balestreri, Umberto Tirelli and Emanuela Vaccher H. Cuneyt Ulutin and Gorkem Aksu

Avi Khafif, Elizabeth Gillis, Jesus E. Medina

Daila S. Gridley, Jerry R. Williams and James M. Slater Gorka Orive, Rosa Mar£a Hern!ndez,

in cancer therapy Transvaginal color Doppler in the assessment of cervical carcinoma Outcomes of hysteroscopy and hysterectomy in breast cancer patients

139-146

Article Review Article

147-152

Research Article

153-158

Case Report

159-166

Review Article

167-176

Research Article

177-184

Research Article

Tumor-specific human monoclonal antibody GAH recognizes non-muscle myosin heavy chain type A as a cell surface antigen

185-188

Research Article

189-192

Research Article

193-200

Research Article

201-218

Research Article

219-226

Review Article

227-230

Research Article

Radical parametrectomy in the treatment of invasive cervical cancer after simple hysterectomy A summary on lamivudine primary prophylaxis of hepatitis B virus reactivation in chronic HBsAg carriers with non Hodgkin’s lymphoma treated with chemotherapy Meat consumption and risk of colorectal cancer: a case-control study in Uruguay FDG PET and PET-CT in uterine cancers Prevention of tumor progression as the ultimate goal of cancer therapy Outcome of subsequent pregnancy in patients with gestational trophoblastic disease

231-236

Review Article Research

237-242

Ovarian mixed germ cell tumor presenting as tuberculosis Role of somatostatin analogues in the treatment of androgen ablationrefractory prostate adenocarcinoma HER-2/neu overexpression in Croatian breast cancer patients: results of one-year multicentric prospective study

Cervical cancer screening Phase II trial of celecoxib plus

Alicia R. Gasc"n, José Luis Pedraz Juan Luis Alc!zar Pedro T. Ramirez, Charlotte C. Sun, Claudia I. Vidal, Veronica Schimp, Brian Slomovitz, Michael W. Bevers, and Diane C. Bodurka Fatemeh Ghaemmaghami, Azam Sadat Moosavi, Malihe Hasanzadeh Alessandro Sciarra, Gianna Mariotti, Anna Maria Autran Gomez, Franco Di Silverio Jasminka Jakic-Razumovic, Jadranka Bozikov, Bozena Sarcevic, Viktor Separovic, Smiljana Kosanovic, Nives Jonjic, Elvira Mustac, Snjezana Tomic, Josko Bezic, Bozo Kruslin, Majda Vucic, Davor Tomas, Branko Dmitrovic, Valerija Blazicevic V, Tratincica Jakovina, Drazen Svagelj, Igor Boric, Zdenko Njiric, Vesna Stitic, Mira Mlinac-Lucijanic, Nada RestekSamarzija, Hrvoje Predrijevac, Milan Gosev Yoko Hirakawa, Yoshiko Yoshiyama, Hisae Niki, Shinsuke Ooike, Jun Kondo, Saiko Hosokawa, Kazuhiro Takahashi, Kazuhiro Nagaike, Hideo Nakamura, Makoto Tsurufuji and Toshiaki Tagawa Nadereh Behtash, Haleh Ayatollahi, Fatemeh Ghaemmaghami,Malihe Hasanzadeh, Fatemeh Esfehani Viroj Wiwanitkit

Hugo Deneo-Pellegrini, Paolo Boffetta, Eduardo De Stefani, Alvaro L. Ronco, Pelayo Correa and Mar£a Mendilaharsu Tarik Z Belhocine and Perry W Grigsby Futoshi Okada and Junichi Fujii Azam Sadat Mousavi, Afsaneh Tehranian, Nadereh Behtash, Fatemeh Ghaemmaghami, Mitra Modares, Roudabeh Pourghorban, Zahra Samizadeh Malihe Hasanzadeh and Nadereh Behtash Frank E. Mott, Christian T. Cable, Jon

Article

243-248 249-266

Review Article Review Article

267-284

Review Article

285-292

Case Report

293-298

Review Article Review Article

299-320

321-324 325-340 341-346 347-356

357-358 359-364

carboplatin and gemcitabine for firstline therapy in stage IIIB/IV nonsmall cell lung cancer-a negative study Update on cervical cancer The Oncofetal H19 RNA in human cancer, from the bench to the patient Adenoviral vectors for prostate cancer gene therapy AML1-MTG16 gene rearrangement in a pediatric therapy related AML after Ewing sarcoma: a case discussion and review of literature Placental site trophoblastic tumor

Management of peritoneal carcinomatosis from colon cancer, gastric cancer and appendix malignancy Review Photodynamic therapy for Article nasopharyngeal cancer Research Glioma cell integrin expression and Article their interactions with integrin antagonists Review Radiation esophagitis, treatment Article strategies and prevention Research Association between MUC1mucin, EArticle cadherin and nm23-H1expression and clinicopathological features in patients with invasive carcinoma of the cervix Case report Improper simple hysterectomy in invasive cervical cancer Research Selective tumor cell growth on tissue Article culture polystyrene and PrimariaTM: a preliminary study

Herrington, Joel Marcus, Rebecca Griggs, Melissa Ainslie Aaron C Han, Maria Merzouk, Richard Z Belch Imad Matouk, Patricia Ohana, Suhail Ayesh, Ami Sidi, Abraham Czerniak, Nathan de Groot, Abraham Hochberg Shawn E. Lupold and Ronald Rodriguez Emanuela Frascella, Claudia Zampieron, Laura Sainati, Letizia Casula, Francesco Pasquali, Rossella Mura, Emanuela Maserati, Martina Pigazzi, Monica Spinelli, Silvia Disarâ&#x20AC;°, Pier Francesco Biddau, Giuseppe Basso Nadereh Behtash, Malihe Hasanzadeh Paulo Goldstein, Rodrigo Gomes da Silva, Jacobo Cabanas, Paul H. Sugarbaker Viroj Wiwanitkit Ralph-Heiko Mattern, Susana B. Read, Michael D. Pierschbacher, Chun-I Sze, Brian P. Eliceiri, Carol A. Kruse Gorkem Aksu, Hakan Bakkal, Merdan Fayda, Binnaz Celebioglu Sarper Veronica S. Jeyadoss, Chetlur Srinivasan Vijayalakshmi, Balaraman Nair M, Halagowder Devaraj, Niranjali Devaraj, Prabha Balaram Fatemeh Ghaemmaghami and Malihe Hasanzadeh Shamim A. Faruqi, Okeychukwu A. Ibeanu, Tariq Ali, Harvey b. Spector, Joel S. Noumoff

Cancer Therapy Vol 3, page 1 Cancer Therapy Vol 3, 1-4, 2005

Cardiac metastasis from carcinoma of the cervix Case Report

Nadereh Behtash*1, Haleh Ayatollahi1, Fereshteh Fakor1, Morteza M Dini2 1

Gynecology Oncology Department, Vali â&#x20AC;&#x201C;Asr Hospital, Tehran University of Medical Sciences, Keshavarz Blvd., Tehran 14194,Iran 2 Gynecologic Oncology, Advocate Illinois Masonic,Medical Center,Rush Medical College, 836 Wellington Chicago IL 60657

Summary The presence of cardiac metastasis from cervical carcinoma is extremely rare. Most of the cases were diagnosed postrmortem. There are a few cases of premortem diagnosis and it is believed that in these cases, the prognosis is extremely poor. We present the only case of premortem diagnosis of cardiac metastasis of more than 500 cases of cervical carcinoma in our center during the last 10 years. We present a 59 years-old woman with multiple ventricular metastasis from cervical carcinoma, 2.5 years after the primary diagnosis. She died 10 days after echocardiographic diagnosis of multiple metastatic lesions in heart, following a massive DIC. The rapidly progressive DIC, and death, in the presenting case, confirms the previous finding of poor prognosis of patients (pts) with premortem diagnosis of cardiac metastasis of cervical carcinoma. diagnosis.

I. Introduction Cervical carcinoma is the 3rd most common cancers in women throughout the world (Disaia and Creasman, 2002). In contrast to the industerialized world, cancer of the cervix remains the primary cancer killer of women in thirdâ&#x20AC;&#x201C;world countries (Disaia and Creasman, 2002). The incidence of cardiac metastases at autopsy ranges from 15% to 20% (mean 6%) in patients with malignant diseases (Abraham, 1990; MacGee, 1991; Lam et al, 1993). Carcinoma of the lung and breast, malignant melanoma, lymphoma, and leukemias rank among the most common tumors associated with this condition (Nelson and Rose, 1993; Shulman et al, 1997). The most common sites of extrapelvic metastasis in cervical carcinoma are lung, bone, cervical or supracervical lymph node (Brenner, 1982). The presence of cardiac metastases from cervical carcinoma is rare (1.8-3%) (Disaia and Creasman, 2002). Only with a high index of suspicious, it is possible to make a diagnosis antemortem. It is believed that, when present, cardiac metastasis from cervical carcinoma represents a rapidly fatal condition (Jamshed et al, 1996). Presented here is a case of right ventricular metastases from a stage IIa cervical carcinoma, who died rapidly after

II. Case A 59 yearâ&#x20AC;&#x201C;old female, Gravida 8 Para 7 had been referred to Gynecology Oncologic service in Vali Asr University Hospital in January 1999. She had postmenopausal bleeding for almost 2 years. In pelvic exam, there was a large firm endophytic tumoral cervical mass measured 45mm diameter. Biopsy showed SCC (squamous cell carcinoma). She underwent a class III Rutledge Radical Hysterectomy and pelvic and paraaortic lymphadenectomy and upper vaginectomy in February /99 following 3 courses of neoadjuvant chemotherapy (Bulky stage IIa) with vincristin plus cisplatin. Preoperative metastatic work up revealed no abnormal findings in pelvic and abdominal CT scan, and chest XR. Pathologic report showed involvement of one iliac node and lower segment of uterus, vaginal margine and parametrium were free of tumor. She had normal pelvic exam, pap smear ,chest XR and CT , and pelvic CT in follow-up period of 24 months. In early postoperative visits, she had some uninary retention symptoms, responded to antibiotic therapy. In June 2001, she was hospitalized with intractable cough, Chest XR and bronchoscopy showed no abnormal finding. 1

Behtash et al: Cardiac metastasis from carcinoma of the cervix Her respiratory symptoms diminished after medical management for asthma. The patient did well until she started to develop dyspnea, weakness and lower limb edema in early September 2001. Again admitted to the hospital, abdominal and pelvic CT showed free fluid in pelvis. Echocardiography revealed multiple right ventricular tumors (Figure 1).This was believed to be consistent with a myocardial metastasis. A few days later, the patient, deteriorated rapidly and developed DIC, cerebral hemorrhage and coma, she died on September 2001 one week from diagnosis of cardiac metastasis.

or retrograde lymphatic flow (Murphy et al, 1986; Kountz, 1993). The occurrences of cardiac metastasis in general are a relatively rare event. Prichard suggested four factors possibly contributing to the low incidence of cardiac metastasis: 1-.The strong kneading action of the myocardium, 2- metabolic pecularitites of striated muscle 3- the rapid flow of blood through the heart and 4- lymph flow normally moving away from the heart (Prichard, 1951). The incidence of heart metastases in two most large series, was 10.7%-11.6% in all kinds of human malignancies (Burke and Virmari, 1996; Senzaki et al, 1999). The literature lists breast, lung, lymphoma, lukemia and melanoma as the most frequent primary sites (Nelson and Rose, 1993; Shulman et al, 1997). The most common location of cardiac involvement is the pericardium and an endocardium site is very rare (Burke and Virmari, 1996). The right side of the heart is more commonly involved than the left side, probably due to direct seeding of the heart by microemboli from lymphatics and venous return (Yanuck et al, 1991). One of cardinal feature involving diagnosis of metastatic carcinoma to the heart is that there is no early symptom, this was the same as for our patient, she had respiratory problems and intractable cough for more than 4 months. As the condition progresses, however,patients will typically complain of dyspnea. Other symptoms include: pericardial effusion, pericarditis, cardiac tamponade, arrythmias and sudden death (Yanuck et al, 1991; Kountz, 1993; Okamoto et al, 1993). The diagnosis is usually made only by a strong index of suspicion.

III. Discussion Cardiac metastasis from malignant neoplasm was first described by Bonet in 1700, but the first antemortem diagnosis of cardiac metastasis was not made until 1924 (Hanfling, 1960). Of all malignancies involving the heart, more than 96% are metastatic compared to primary (Lam et al, 1993; Nelson and Rose, 1993). The incidence of cardiac metastasis from carcinoma has increased from 1% in 1891 to 12% in 1953 and has remained stable at about 10-15% since that time (Prichard, 1951; Murphy et al, 1986). It seems the more sophisticated diagnostic techniques, are the main cause of this increasing incidence. Because Patient live longer from their primary malignancy with metastatic disease in other sites controlled, less common sites of metastatic involvement have become evident. A number of theories have been advanced to explain routes of involvement of the heart by metastatic carcinoma. These include embolic tumor emptying into right side of the heart, other mechanisms include direct invasion through either direct extension through the lymphatics of the heart and mediastinal nodes

Figure 1. Echocardiography showing right ventricular tumor

Cancer Therapy Vol 3, page 3 Table 1. Cases of reported premortem diagnosis of cardiac metastasis from cervical carcinoma Year

Age (Years)

Stage

Charles et al, 1977 Richter and Yon, 1979 Krivokapich et al, 1981 Itoh et al, 1984 Yanuck et al, 1991 Okamoto et al, 1993 Lee and Fisher, 1989 Lee and Fisher, 1989 Hsuj et al, 1992 Kountz, 1993 Nelson and Rose, 1993 Nelson and Rose, 1993 Jamshed et al, 1996 Ando et al, 1997 Lemus et al, 1998 Lemus et al, 1998 Senzaki et al, 1999 Chiou et al, 1999 Harvey et al, 2000 Iwaki et al, 2001 Yasuda et al, 2002 Inamura et al 2004 Behtash et al 2004

46 33 32 64 43 49 42 37 36 28 61 51 57 41 53 49 28 56 44 49 38 58 59

IIIb IIb IIb IIa Ib IIa IIIb IIIb Ib IIb IIIb IV Ib IIb Ib Ib Ib III Ib IIa IIb Ib IIb

Histology & type SCC SCCII SCCIII SCCI SCCIII SCCIII SCCII SCC SCC SCCI SCC SCC SCCIII SCCI SCCIII SCC SCCII SCC SCC SCC SCC SCC SCC

Chest X- ray finding, can include pleural effusion and cardiomegaly, though the latter can be absent in cases of endomyocardial metastases, as with our patient. Other helpful diagnostic clues are electrocardiographic changes, echocardiography, cardiac catheterization, CT scanning, MRI scanning and transvenous biopsy (Hanfling, 1960; Cacciapuot et al, 1988; Lee and Fisher, 1989; Shulman et al, 1997). One report of 1100 gynecologic cancer patients revealed only 6 cases of cardiac metastases (Greenwald, 1980). The first antemortem diagnosis for cervical carcinoma was made by Charles et al, (1977).Badib and colleauges reported cases of cardiac metastasis from 278 consecutive autopsy cases with the carcinoma of the uterine cervix (Badib et al, 1968). Antemortem diagnosis of cervical carcinoma metastatic to the heart is, however exteremely rare, with only a few cases reported (Table 1). Interestingly, in many cases of heart metastases from cervical carcinoma, the tumor metastasizes only to the right ventricle, and no other site (including the lung) just the same as our case. A review of the English language literature revealed that 22 casesof antemortem diagnosis of cardiac metastasis from cervival carcinoma have been described (Table 1). The mean age of these patients is 45 years (range 2864). The clinical stage was Ib in 7cases, IIa in 3 cases, IIb is 6 cases, III is 5 cases, IV in 2 cases. The stage of the disease at initial presentation dose not predict the future development of cardiac metestasis. The common symptom was shortness of breath and dyspnea (78%). The prognosis of these cases was poor. Patient died

Symptom

Prognosis

Dyspnea Shortness of breath Dyspnea Shortness of breath Chest pain Dyspnea Dyspnea Couph and dyspnea Shortness of breath Ileus Shortness of breath Dyspnea Couphand dyspnea Abdominal pain Shortness of breath Dyspnea Dyspnea Couph and dyspnea Shortness of breath Couph and low grade Fever Dyspnea Dyspnea Couph and dyspnea

8m 15d 9m 10d 5m 9m 5d 3m 9m 3m 12m 4m 5m 17m 1m 7m 18m Died suddenly 8m 2m 2m 4m Died suddenly

on average of 5/5 month after diagnosis. In conclusion we report a case of stage IIa squamous cell carcinoma of the cervix, in a 59 year-old woman. She underwent a radical hysterectomy after 3 courses of neoadjuvant chemotherapy and presented with a long standing intractable cough and finally dyspnea 30 months after primary diagnosis. She died rapidly after echocardiographic diagnosis. Imaging investigations showed no other site of metastasis (Ando et al, 1997).

References Abraham JM (1990) Neoplasms metastatic to the heart, Review of 3314 consecutive autopsies. Am J Cardiovasc Pathol 3, 195-8. Ando KO, Kashilara KI, Haraola M et al (1997) Carcinoma of the uterine cervix with myocardial metastasis Gynecol Oncol 65, 169-172, Badib AO, Kurohara SS et al (1968) Metastasis to organs in carcinoma of the uterine cervix, Influence of treatment on incidence and distribution. Cancer 21, 434-439. Brenner D (1982) Carcinoma of the cervix, A review. Am J Med Sci 289, 31-48. Burke A, Virmari R (1996) Tumors of the heart and blood vessels. Athlas of tumor pathology, fascicle 16, series 3. Armed Forces Institute of Pathology, Washington DC. Cacciapuot F, Arpino GD, Dâ&#x20AC;&#x2122; Avino M (1988) Reliability of echocardiography in the detection of metastatic malignant pericardial masses. Int J Cardiol 18, 109-112. Charles EH, Condori J, Sall S (1977) Metastasis to the pericardium from squamous cell carcinoma of the cervix. Am J Obstet Gynecol 129, 349-351. Chiou JS, Wang PH, Yuan CC et al (1999) Intracavitary cardiac tumor secoundry to carcinoma of the cervix a case report.

Behtash et al: Cardiac metastasis from carcinoma of the cervix Zhonghua Yi Xue Za ZhI (Taipei) 62, 828-831. Disaia PJ, Creasman WT (2002) Germ cell, stromal and other ovarian tumors. In: DiSaia PJ, Creasman WT, editors. Clinical Gynecologic Oncology, 5th ed. St Louis: Mosby Year Book ,351-74 Greenwald EF (1980) Cardiac metastasis associated with gynecologic malignancies. Gynecol Oncol 10, 75-83. Hands ME, Lloyd Bl, Hopkins BE (1986) Carcinoma of uterine cervix with myocardial metastasis associated with chest pain and asystolic arrest. Int J Cardiol 11, 132-135. Hanfling SM (1960) Metastasis cancer to the heart review of the literature and report of 127cases. Circulation 23, 174-183, Harvey RL, Mychaskiw G, Sachdev V et al (2000) Isolated cardiac metastasis of cervival carcinoma presenting as disseminated intravascular coagulopathy.A case report. J Reprod Med 45, 603-606. Hsuj J, Chang TC, Hsueh S et al (1992) Cardiac tamponade resulting from recurrent small-cell carcinoma of the uterine cervix temporarily responding to CE/CAV chemotherapy. J Formosan Med Assoc 91, 828-830. Itoh KI, Mastsubara T, Yanagisawa K et al (1984) Right ventricular metastasis of cervical squamous cell carcinoma. Am Heart J 108, 1369-1370. Iwaki T, Kanaya H, Namura M et al (2001) Right ventricular metastasis from a primary cervical carcinoma. Jpn Circ J 65, 761-763. Jamshed A, Khafaga Y, EL-Husseiny G et al (1996) Pericardial metastasis in carcinoma of the uterine cervix. Gynecol Oncol 61, 451-53. Klatt EC, Heitz DR (1990) Cardiac Metastasis. Cancer 65, 14561459. Kountz DS (1993) Isolated cardiac metastasis from cervical carcinoma, presentation as acute anteroseptal myocardial infarction. South Med J 86, 228-230. Krivokapich J, Warren SE, Child JS et al (1981) M -Mode and cross -sectional echocardiographic diagnosis or right ventricular cavity masses. J Clin Ultrasound 9, 5-10. Lam KY, Dickens P, Chan ACL (1993) Tumor of the heart, A 20 year experience with a review of 12.485 consecutive autopsies. Arch Pathol Lab Med 117, 1027-31, Lee R, Fisher MR (1989) MR imaging of cardiac Metastasis from malignant fibrous histiocytoma. J Comput Assist Tomogr 13, 126-8.

Lemus JF, Abdulhay G et al (1998) Cardiac metastast from carcinoma of the cervix, report of two cases. Gynecol Oncol 69, 264-268. MacGee W (1991) Metastatic and invasive tumors involving the heart in a geriatric population, A necropsy study. Virchows Arch A Pathol Anat Histopathol 419, 183-189. Malriva VK, Casselberry JM, Perekh N et al (1990) Pericardial metastasis in squamous cell cancer of the cervix. J Reprod Med 35, 49-52. Murphy P, Alexander P, Kirkham N, Fleming J, Taylor I (1986) Pattern of spread of blood born tumor. Br J Surg 73, 829-34. Nelson BE, Rose PG (1993) Malignant pericardial effusion from squamous cell carcinoma of the cervix. J Surg Oncol 1993 52, 203-6. Okamoto H, Shinkai T, Yamakido M, Saijo N (1993) Cardiac tamponade caused by primary lung cancer and the management of pericardial effusion. Cancer 71, 93-98. Prichard RW (1951) Tumor of the heart, Review of the subject and report of one hundred and fifty cases. Arch Pathol, 51, 98-128. Richter N, Yon JL (1979) Squamous cell carcinoma of the cervix metastatic to the heart. Gynecol Oncol 7, 394-400. Rieke JW, Kapp DS (1988) Successful manangment of malignant pericardial effusion in metastatic squamous cell carcinoma of the uterine cervix. Gynecol Oncol 31, 338-351. Senzaki H, Uemura Y, Yamamoto D et al (1999) Right intra ventricular metastasis of squamous cell carcinoma of the uterine cervix, An autopsy case and literature review. Pathol Int 49, 447-52. Shulman LN, Braunwald E, Rosenthal DS (1997) Cardiac manifestations of neoplastic disease. In, Braunwald E, editor. Heart disease, A text book of cardiovascular medicine, 5th edn. Hematological disorders and heart disease. Philadelphia, saunders, 1794-1799. Yanuck MD, Kaufman RH, Woods KV, Adler Storthz K (1991) Cervical carcinoma metastatic to the skull, heart, and lungs, analysis for human papilomavirus DNA. Gynecol Oncol 42, 94-97. Yasuda N, Ishiki R, Agetsuma H (2002) Single large metastatic tumor growing progressively and occupying right ventricular cavity. Heart 87, 328.

Cancer Therapy Vol 3, page 5 Cancer Therapy Vol 3, 5-28, 2005

C-Kit signal transduction and involvement in cancer Review Article

Johan Lennartsson1, Olexandr Voytyuk2, Elke Heiss2, Christina Sundberg2, Jianmin Sun2 and Lars Rönnstrand2,* 1

Ludwig Institute for Cancer Research, Uppsala University, Box 595, SE-751 24 Uppsala, Sweden Experimental Clinical Chemistry, Lund University, Wallenberg Laboratory, Malmö University Hospital, SE-205 02 Malmö, Sweden 2

__________________________________________________________________________________ *Correspondence: Lars Rönnstrand; Experimental Clinical Chemistry, Lund University, Wallenberg Laboratory, Malmö University Hospital, SE-205 02 Malmö, Sweden; Tel. +46 40 33 72 22; Fax +46 40 92 90 23; Email Lars.Ronnstrand@expklkemi.mas.lu.se Key words: c-Kit signal transduction, cancer, Dimerization, Internalization, degradation, Ras/Erk pathway, PI3-kinase, Phospholipase C-!, tyrosine kinases, JAK/STAT pathway, Adapter proteins, Transcription factors, Protein tyrosine phosphatases, homeostasis, Fertility, Hematopoiesis, Pigmentation, Gastrointestinal tract, Nervous system, Mastocytosis, Melanoma, Small-cell lung cancer Abbreviations: acute myeloid leukemia (AML); basic Helix-Loop-Helix Leucine Zipper (bHLHZip); Bruton tyrosine kinase (Btk); diacylglycerol (DAG); epidermal growth factor (EGF); Extracellular Regulated Kinase (Erk); gastrointestinal stromal tumors (GIST); Hematopoietic stem cells (HSC); inositol-1, 4, 5-trisphosphate (IP3); Interstitial cells of Cajal (ICC); Janus kinases (JAKs); mitogen activated protein kinase (MAPK); phorbol myristate acetate (PMA); phosphatidylinositol-3,4,5-trisphosphate (PIP3); phosphoinositide 3’-kinase (PI3-kinase); phospholipase C-! (PLC-!); phospholipase D (PLD); phosphotyrosine binding (PTB); pleckstrin homology (PH); protein inhibitor of activated Stat3 (PIAS3); protein kinase C (PKC); protein tyrosine phosphatases (PTPs); small cell lung cancer (SCLC); Src family kinase (SFK); Src homology 2 (SH2); stem cell factor (SCF); suppressors of cytokine signaling (SOCS); Tec homology (TH); truncated form of c-Kit (tr-Kit) Received: 17 January 2005; Accepted: 20 January 2005; electronically published: January 2005

Summary Receptor tyrosine kinases, such as c-Kit, are proteins whose function it is to transduce signals from the environment into the cell leading to complex behaviors such as proliferation, migration, survival and differentiation. Many of these behaviors are deregulated in cancer, which is characterized by uncontrolled proliferation, insensitivity towards death stimuli, migration of tumor cells away from the primary tumor site and in some cases also block of cellular differentiation leaving the cell in an immature proliferative state. To be able to target these processes it is vital to have a detailed understanding of the receptor function and the downstream pathways activated. In this article we will review the mechanisms by which c-Kit induces signal transduction as well as describing tumors in which c-Kit function is perturbed. kinase activity of the receptor. Mutations in the so-called Steel (Sl) locus in mice, that encodes the ligand for c-Kit, stem cell factor (SCF), give rise to a phenotype very similar to mutations in c-Kit (Copeland et al, 1990; Williams et al, 1990). For a review on W and Sl mutations, see Lev et al, 1994.

I. Introduction A. c-Kit and Stem cell factor (SCF) The viral oncogene v-Kit was identified in 1986 as the transforming gene of the Hardy-Zuckerman 4 feline sarcoma virus (Besmer et al, 1986) and shortly thereafter its cellular homolog, c-Kit, was cloned and sequenced (Yarden et al, 1987). Within a few years time, c-Kit was found to be allelic with the dominant white spotting locus (W) of mice (Chabot et al, 1988; Geissler et al, 1988). Numerous naturally occurring loss-of-function mutations in c-Kit have been found in both mice and humans. Complete loss of c-Kit expression leads to death in utero or perinatally, most likely due to severe anemia. Heterozygous animals display anemia, reduced fertility and defects in pigmentation. The severity of the phenotype has been found to inversely correlate with the tyrosine

B. c-Kit alternative splicing Alternative mRNA splicing leads to the occurrence of four isoforms of c-Kit in humans and two in mice. In both mice and humans, two isoforms are characterized by the presence or absence of a tetrapeptide sequence (GNNK) in the extracellular part of the juxtamembrane region (Reith et al, 1991; Crosier et al, 1993; Zhu et al, 1994). This alternative splicing occurs due to alternate use of 5’ splice donor sites (Hayashi et al, 1991). In addition, splice variants exist that differ in the presence or absence 5

Lennartsson et al: c-Kit signal transduction of a single serine residue in the kinase insert region of human c-Kit, due to alternative splice acceptor site usage (Crosier et al, 1993). Furthermore, post meiotic germ cells of the testis have been found to express a shorter transcript of c-Kit. This transcript encodes a truncated version of cKit (tr-Kit) consisting only of the second part of the kinase domain. Thus, extracellular and transmembrane domains as well as the first part of the kinase domain are missing which results in a non-functional tyrosine kinase activity (Rossi et al, 1992). Nonetheless, tr-kit is able to signal. Microinjection of tr-kit into mouse eggs, triggers metaphase-to-anaphase transition by the sequential activation of the Src family kinase (SFK) Fyn and phospholipase C-!1 (PLC-!1), and their association with Sam68 (Paronetto et al, 2003). Interestingly, the truncated isoform of c-Kit has been found to be frequently expressed in prostate carcinoma, in particular in more advanced stages (Paronetto et al, 2004), where it induces activation of SFKâ&#x20AC;&#x2122;s. The two GNNK+ and GNNK- isoforms of c-Kit (also denoted Kit and KitA, respectively) are co-expressed in most tissues (Reith et al, 1991; Crosier et al, 1993; Zhu et al, 1994) with the GNNK- form predominating. Expression of the two isoforms has been studied in human acute myeloid leukemia (AML). It was shown that among various AML cell lines the ratio of the two isoforms varied from as low as 1.3 to as high as 12 (Piao et al, 1994). In contrast, the ratio in normal bone marrow was around 4.45.5. However, no correlation was found between the expression of either isoform and the response to therapy or other clinical parameters. Despite these findings, NIH3T3 cells expressing the different isoforms were shown to possess distinct transforming activity (Caruana et al, 1999). In the presence of the ligand SCF, the GNNK- form induced loss of contact inhibition, anchorage-independent growth and tumorigenicity, with no difference in ligand affinity between the two isoforms. Upon ligand stimulation, the GNNK- isoform was more highly tyrosine-phosphorylated, more rapidly internalized, and activated Extracellular Regulated Kinase (Erk) more strongly than the GNNK+ isoform. In a recent study, it was shown that the kinetics of phosphorylation of the adapter protein ShcA, previously demonstrated to be phosphorylated by SFKs downstream of c-Kit, was stronger and more rapid in the GNNK- form (Voytyuk et al, 2003). However, no functional evidence for a role of enhanced ShcA phosphorylation in mediating the increased activation of Erks has been reported. There is also a possibility that other docking proteins, such as Gab1 or Gab-2, that are known to be phosphorylated by SFKs might contribute to the activation of Erk. Inhibition of SFKs by treatment with the selective inhibitor SU6656 altered the kinetics of activation of the GNNK- form of cKit so that they resembled those of the GNNK+ form. Thus, to summarize, a very minor difference in amino acid sequence in a region with no apparent enzymatic function or substrate binding ability, appears to lead to dramatic differences in signaling. Alternative splicing has been described in several tyrosine kinases and interestingly, several of these isoforms differ in the extracellular part of the juxtamembrane region, as is the case with c-Kit.

Recently, Leibiger and colleagues described differences in the signal transduction pathways activated and the repertoire of gene expression induced upon stimulation of the two splice forms of the insulin receptor, INSR-A and INSR-B. The INSR-A isoform was shown to induce expression of the insulin gene, whereas the INSR-B isoform mediated induction of the glucokinase gene (Leibiger et al, 2001). Through differential use of exon 11, the two splice forms of the insulin receptor differ in only 12 amino acids in the C terminus of the a-subunit. Furthermore, splice variants involving deletion of parts of the juxtamembrane region of the extracellular domain have been described for both ErbB2 and ErbB4. In the case of ErbB2, a deletion of sixteen amino acids in the extracellular juxtamembrane region caused a stronger kinase activity and transforming ability of ErbB2 (Kwong and Hung, 1998).

II. Signal transduction through c-Kit Signaling downstream of c-Kit has been studied extensively in a variety of cell systems with mast cells, which express endogenous c-Kit, being the most commonly used model system. Several studies have used transient transfection systems that lead to strong overexpression, such as COS cells or HEK293. In particular in the early studies, investigators have used chimeras, i. e. the extracellular part of another receptor, e. g. the epidermal growth factor (EGF) receptor fused to the intracellular part of c-Kit. These differences in experimental setup make it difficult to directly compare the results obtained in different laboratories. Discrepancies in the literature will be discussed here. In this review the individual tyrosine phosphorylation sites of c-Kit are for simplicity, coherence and for the purpose of avoiding confusion numbered according to the human c-Kit sequence, even in cases where the murine c-Kit was studied.

A. Activation of c-Kit through ligand induced oligomerization Binding of SCF to c-Kit leads to oligomerization of the receptors followed by activation of its intrinsic tyrosine kinase activity (Blume-Jensen et al, 1991). It is hypothesized that oligomerization is driven by the simultaneous binding of a dimeric SCF molecule to two receptor monomers (Philo et al, 1996; Lemmon et al, 1997). The activated receptor becomes autophosphorylated on a number of tyrosine residues (Figure 1). These tyrosine residues are mainly located outside the kinase domain, and serve as docking sites for signal transduction molecules containing Src homology 2 (SH2) or phosphotyrosine binding (PTB) domains (for review, see Pawson, 2004). The c-Kit ligand, SCF, is expressed as a glycosylated transmembrane protein. Alternative splicing leads to two isoforms of SCF that differ in the absence or presence of a particular proteolytic cleavage site (Huang et al, 1992). The isoform containing the cleavage site undergoes proteolysis and becomes soluble upon release from the plasma membrane, whereas the isoform lacking the

Cancer Therapy Vol 3, page 7 become ubiquitinated upon ligand-stimulation (BlumeJensen et al, 1991). It was thought that RTKs become polyubiquitinated and degraded in the proteasomes, but recently it was shown that in the case of RTKs, monoubiqutination rather than polyubiqutination takes place (Haglund et al, 2003) and targets the receptors for internalization and degradation in the lysosomes. This is in contrast to polyubiquitination of cytosolic proteins that targets them for degradation in the proteasomes. Furthermore, other investigators have found that c-Kit is degraded both in the lysosomes and the proteasomes (Zeng et al, 2004). Important components of the ubiquitination machinery are the ubiquitin E3 ligases that covalently attach ubiquitin moieties to target proteins. In RTK signaling, one of the important E3 ligases is the adapter protein Cbl, and its close family members Cbl-B and Cblc, which bind to activated receptors and other tyrosine phosphorylated proteins via its SH2 domain (Joazeiro et al, 1999). Phosphorylation by SFKs leads to activation of Cbl (Yokouchi et al, 2001). Cbl is able to bind to activated c-Kit through the adapter proteins CrkL (Wisniewski et al, 1996; Sattler et al, 1997) and APS (Wollberg et al, 2003) and is phosphorylated in response to SCF stimulation. Several studies have shown that internalization of cKit is dependent on the activity of SFKs (Broudy et al, 1999; Jahn et al, 2002; Voytyuk et al, 2003). Given the role of monoubiquitination in internalization, it is likely that SFK-dependent activation of Cbl and subsequent monoubiquitination regulates internalization of c-Kit. Recently, Zeng et al, could demonstrate that degradation of c-Kit was partly mediated by the proteasomal and lysosomal pathway (Zeng et al, 2004).

Figure 1. Signal transduction molecules binding to the activated c-Kit receptor. Upon ligand-binding, c-Kit dimerizes and its intrinsic tyrosine kinase activity isactivated, leading to phosphorylation of key residues. These residues constitute high affinity binding sites for signal transduction molecules. The numbers refer to tyrosineresidues phosporylated in c-Kit and the corresponding signal transduction molecule isdepicted.

C. The Ras/Erk pathway Numerous studies have demonstrated the critical importance of the Ras/Erk pathway in cell division, survival and transformation (Lewis et al, 1998). Ras is a small G-protein that can alternate between an active GTPbound form and an inactive GDP-bound form. Although Ras can activate a number of signal transduction molecules such as PI3-kinase and Rac (Qiu et al, 1995; Rodriguez-Viciana et al, 1997), its role in the Ras/Erk cascade is the most well characterized. RTKs activate Ras through association with Sos, a guanine nucleotide exchange factor that facilitates exchange of GDP for GTP leading to activation of Ras (Buday and Downward, 1993). In the cell, Sos exists in a preformed complex with the adapter protein Grb2, which in turn associates via its SH2 domain to phosphorylated tyrosine residues within the consensus sequence pYXN. These tyrosine residues exist either in the receptor or in downstream signal transduction molecules such as the protein tyrosine phosphatase SHP-2, the adapter proteins ShcA (Lowenstein et al, 1992; Rozakis-Adcock et al, 1992; Li et al, 1994) Gab-1 or Gab-2 (Nishida et al, 1999). Thus, the Grb2-Sos complex is recruited to the vicinity of the plasma membrane, where it can act on Ras. Activated GTP-bound Ras has the ability to interact with the serine/threonine kinase Raf-1 leading to its activation. Raf-1 kinase phosphorylates and activates the dual-

cleavage site remains cell-associated. The two isoforms are not equivalent in their signaling capabilities. They each have specific abilities to transmit signals. Stimulation with the soluble isoform leads to a rapid and transient activation and autophosphorylation of c-Kit, followed by a fast degradation, whereas stimulation with the membraneassociated isoform leads to a more sustained activation of c-Kit (Miyazawa et al, 1995). Differences exist also in signaling downstream of c-Kit. The membrane-bound ligand induced a more persistent activation of Erk1/2 and p38 mitogen activated protein kinase (MAPK), when compared to the soluble ligand (Kapur et al, 2002). It is thought that the differences in signaling might in part arise from the fact that membrane anchoring of the ligand might prevent internalization of the receptor-ligand complex. Using immobilized agonistic anti-Kit monoclonal antibodies to induce receptor dimerization in the absence of internalization, Kurosawa et al. could mimic the action of membrane-bound SCF (Kurosawa et al, 1996).

B. Internalization and degradation of cKit Ligand-induced down-regulation of RTKs is an important means of modulating signaling in the normal physiology of cell surface receptors. RTKs including c-Kit 7

Lennartsson et al: c-Kit signal transduction specificity kinases Mek1 and Mek2 (Kyriakis et al, 1992). The serine/threonine kinases Erk1 and Erk2 are activated through phosphorylation by Mek1/2 (Crews and Erikson, 1992). Activated Erks dimerize and are translocated to the nucleus (Khokhlatchev et al, 1998) where transcription factors are phosphorylated. Phosphorylation of transcription factors, such as c-Fos, regulates their activity and thereby influences gene transcription (Murphy et al, 2002). A number of studies have demonstrated the ability of SCF to activate the Ras-Erk pathway. The adapter protein Grb2 can directly associate with c-Kit (Tauchi et al, 1994a) through phosphorylated Y703 and Y936 in c-Kit (Thömmes et al, 1999). In addition, Grb2 can associate with SHP-2, ShcA, Gab-1 and Gab-2 following SCF stimulation (Nishida et al, 1999; Tauchi et al, 1994a,b). The adaptor protein Gab-2 can link to the Ras/Erk pathway through association with SHP-2 (Dorsey et al, 2002). Several studies have suggested an important role for SCF-induced activation of SFKs in the activation of the Ras/Erk cascade (Bondzi et al, 2000; Ueda et al, 2002; Kimura et al, 2004; Lennartsson et al, 1999;). However, others have shown no effect for SFK inhibition on the activity of Erk (Timokhina et al, 1998). In the same study, an independence of PI3-kinase for activation of Erk in mast cells was also demonstrated. However, under certain conditions activation of Erk has been implicated to be dependent on the activity of PI3-kinase. Recently, Wandzioch et al. showed that inhibition of PI3-kinase with the pharmacological agent LY294002 effectively inhibited Erk phosphorylation in a hematopoietic progenitor cell line (Wandzioch et al, 2004). Moreover, it has been demonstrated that GM-CSF and SCF synergistically activated the Ras/Erk pathway in Mo7e cells in a PI3kinase dependent manner (Lennartsson et al, 2004). However, in these cells Erk phosphorylation by SCF or GM-CSF alone was independent on PI3-kinase.

with the adapter proteins such as CrkII, CrkL and Cbl, respectively (Hartley et al, 1995; Sattler et al, 1997). The activation of PI3-kinase by c-Kit has been linked to mitogenesis, differentiation, adhesion, secretion, survival, and actin cytoskeletal reorganization (Serve et al, 1995; Vosseller et al, 1997; Blume-Jensen et al, 1998; Kubota et al, 1998; Timokhina et al, 1998). In c-Kit, Y721 was found to directly interact with PI3-kinase (Serve et al, 1995). c-Kit promotes survival via PI3-kinase dependent activation of Akt and phosphorylation of Bad, a proapoptotic molecule, at S136 in vivo. Furthermore, mutation of S741 and S746 in c-Kit, the two serine sites involved in negative regulation by PKC, led to increased mitogenic response and increased activation of PI3-kinase, as well as enhanced Akt activation, Bad phosphorylation and survival (Blume-Jensen et al, 1998). Recently Jin et al. showed that in cultured primordial follicles of the ovary, stimulation of c-Kit led to prevention of apoptosis through a PI3-kinase mediated pathway (Jin et al, 2005). SCF stimulation led to upregulation of the anti-apoptotic proteins Bcl-2 and Bcl-xL, while it induced a downregulation of the expression of the pro-apoptotic factor Bax. Inhibition of PI3-kinase reversed the regulation of Bcl-xL and Bcl-2, but not Bax. An alternative pathway for c-Kit mediated survival is through Akt-mediated phosphorylation and inactivation of the forkhead transcription factor FoxO3a (Engström et al, 2003). Whether FoxO transcription factors or Bad are involved in the anti-apoptotic signaling induced by c-Kit seems to be cell type dependent. A number of studies have implicated the importance of PI3-kinase activity in transforming ability of mutated cKit. Using immortalized murine progenitor cells transduced with the Y721F mutant D816V c-Kit, Chian et al. showed that transformation by this constitutively active form of c-Kit is dependent on PI3-kinase (Chian et al, 2001). In another study, mutants with the cytoplasmic tyrosines of c-Kit individually mutated to phenylalanine residues were used to assess the role of individual signal transduction pathways in D816V transformation (Hashimoto et al, 2003). Two mutants, Y721F and a deletion mutant in which the two most distal tyrosines in the carboxyterminal tail were mutated, severely impaired receptor activation. The deletion included Y936, that previously was shown to be a docking site for Grb2, Grb7 and APS (Thömmes et al, 1999; Wollberg et al, 2003). Interestingly, in contrast to their effect on transformation, these mutants showed no effect on normal ligand-induced activation of c-Kit. The physiological role of c-Kit-mediated activation of PI3-kinase was demonstrated in two studies using transgenic mice expressing c-Kit with a Y721F mutation. Blume-Jensen et al. showed that c-Kit-induced activation of PI3-kinase was essential for male fertility, while in another study Kissel et al. also could demonstrate an effect on female fertility ((Blume-Jensen et al, 2000; Kissel et al, 2000). Thus, loss of c-Kit mediated PI3-kinase signaling may be compensated for in a number of physiological processes, but appears to be critical in gametogenesis. These findings assume that Y721 solely serves as the docking site for PI3-kinase and for no other signal

D. PI3-kinase PI3-kinase is a class of lipid kinases that phosphorylate the 3’-hydroxyl group of phosphoinositides. Although phosphatidylinositol can be phosphorylated by PI3-kinase in vitro, phosphatidylinositol-4,5-bisphosphate (PIP2) is the physiologically relevant substrate (for review, see Foster et al, 2003). The resulting product, phosphatidylinositol-3,4,5-trisphosphate (PIP3), is able to physically associate with proteins containing a pleckstrin homology (PH) domain, leading to their recruitment to plasma membrane where they can be activated. A majority of the published work on PI3-kinase has been focused on the classical class I PI3-kinases. The regulatory p85 subunit of PI3-kinase contains two SH2 domains by which it binds to target proteins. Upon binding, conformational changes are induced and PI3kinase enzyme is activated (Carpenter et al, 1993). The p110 subunit of PI3-kinase contains the enzymatic activity to phosphorylate phosphoinositides. The two subunits exist in the cell as a preformed complex. Interestingly, there is a stoichiometric excess of p85 subunit within the cell (Ueki et al, 2002), suggesting other functions of p85. It is well known that p85 also has the ability to associate 8

Cancer Therapy Vol 3, page 9 transduction molecule. This, however, remains to be proven. One of the PI3-kinase association sites present in the closely related PDGF "-receptor, Y751, has also been known to bind to the adapter protein Nck# (Nishimura et al, 1993). Thus, some of the found Y721F phenotypic outcomes might be due to blocking of additional, hitherto unknown interactions and signal transduction pathways. Bone-marrow-derived mast cells from mice with a targeted deletion of the p85# subunit of PI3-kinase demonstrated a dramatically reduced SCF-mediated proliferative response compared to wild-type cells, further emphasizing the role of PI3-kinase in c-Kit signaling (Fukao et al, 2002). This effect paralleled a reduction of SCF-induced activation of JNK in the p85#-deficient mast cells. Interestingly, SCF-stimulated activation of Akt was only partially impaired in p85#-deficient bone marrow derived mast cells, and no effect on c-Kit mediated survival was observed. Therefore additional, PI3-kinase independent signal transduction pathways may contribute to c-Kit-mediated survival. In addition, SCF-mediated chemotaxis has also been demonstrated to be dependent on p85# (Tan et al, 2003). It should be noted that discrepancies do exist in results obtained from p85#-deficient cells and Y721F mutant c-Kit. The reason for these differences could be that Y721 is able to dock to signal transduction molecules other than PI3-kinase, as mentioned above. Furthermore, p85# is known to bind to proteins other than the p110 subunit of PI3-kinase. In an elegant study, Ali and colleagues generated transgenic mice expressing a kinase inactive form of the p110$ subunit of PI3-kinase (Ali et al, 2004). Thus, the lipid kinase activity of PI3-kinase was targeted, while other possible functions of the p85 subunits were intact. It was shown that the p110$ isoform of PI3kinase plays an essential role in allergic response. Inactivation of p110$ in mast cells led to defective SCFmediated in vitro proliferation, adhesion and migration, as well as impaired allergen-IgE-induced degranulation and cytokine release. Furthermore, mice carrying an inactivated version of p110$ were protected against anaphylactic allergic responses. Apart from the classical type I forms of PI3-kinase, the type II isoform PI3KC2" was shown to physically associate with activated c-Kit and mediate part of the SCFdependent activation of Akt in small lung carcinoma cells (Arcaro et al, 2002). Interestingly, in contrast to the type I PI3-kinases, PI3KC2b association with c-Kit was ligandindependent and constitutive. However, ligand stimulation of c-Kit led to tyrosine phosphorylation of PI3KC2". The site of interaction with c-Kit is not known, although given that the association to c-Kit seems constitutive, and that other receptors previously shown to interact with the classical isoforms of PI3-kinase did not interact with PI3KC2", it appears likely that the classical PI3-kinase association site is not involved.

is ubiquitously expressed, PLC-!2 is mainly expressed in the hematopoietic system (for review, see Carpenter and Ji, 1999). The substrate upon which PLC acts is the phosphoinositide PIP2, whereby the second messengers DAG and inositol-1, 4, 5-trisphosphate (IP 3) are generated. DAG is an activator of the classical and novel forms of PKC, while IP3 binds to specific calcium channels present on the endoplasmic reticulum, triggering release of Ca2+ from internal stores. The intracellular concentration of free Ca2+ regulates a number of cellular processes (for review, see Berridge et al, 2003). Some studies have demonstrated association with and activation of PLC-! by c-Kit, while others have failed to do so. It has been claimed that Y730 is the site of association of PLC-!1. Using overexpression of EGFR-cKit chimeras and PLC-!1 in HEK293 cells, Herbst et al, demonstrated ligand-induced tyrosine phosphorylation of PLC-!1, although weaker than that seen with the EGF receptor (Herbst et al, 1991). In a later study, the same authors saw no association between PLC-!1 and the EGFR-c-Kit chimera unless they overexpressed PLC-!1 (Herbst et al, 1995). However, those studies were performed using chimeric receptors with the extracellular domain of the EGF receptor fused to the intracellular part of c-Kit. In addition, association was only seen when the receptor was overexpressed together with overexpressed PLC-!1. In a recent study, Gommerman et al. studied the differential signaling of various c-Kit mutants induced by membrane-bound and soluble SCF, respectively, using retrovirally transduced 32D cells (Gommerman et al, 2000). Using soluble SCF, a weak SCF-stimulated tyrosine phosphorylation of PLC-!1 was shown in wildtype murine c-Kit expressing cells, but in cells expressing the Y730F mutant, no phosphorylation of PLC-!1 was seen. Furthermore, cells expressing the Y730F mutant cKit did not respond with calcium release following treatment with SCF. Interestingly, PLC-!1 phosphorylation was much stronger in bone-marrowderived mast cells than in 32D infectants. Likewise, Trieselmann et al. showed that stimulation of mast cells by membrane-bound, but not soluble SCF, was dependent on PLC-! activation (Trieselmann et al, 2003). They also demonstrated ligand-induced tyrosine phosphorylation of PLC-!2. Other studies have shown that activation of PLC! by c-Kit might be involved in the SCF-mediated protection against apoptosis induced by radiation and chemotherapy (Plo et al, 2001; Maddens et al, 2002). Also studying bone marrow mast cells, Huber et al. detected a robust and sustained SCF-stimulated tyrosine phosphorylation of PLC-!2 (Huber et al, 1998). Others, however, failed to detect c-Kit mediated activation of PLC-!, but were able to detect SCF-dependent activation of phospholipase D (PLD; Koike et al, 1993). These data were further confirmed by Kozawa et al. who also could inhibit SCF-stimulated PLD activity with the PI3-kinase inhibitor LY294002 (Kozawa et al, 1997). There are several plausible explanations to these discrepancies. It is possible that some of the differences in the findings as to whether PLC-! is activated or not might arise from different expression levels of the two isoforms

E. Phospholipase C-! Two isoforms of PLC-! exists, PLC-!1 and PLC-!2, and they both consist of two SH2 domains, one SH3 domain, one PH domain and a catalytic domain. While -!1

Lennartsson et al: c-Kit signal transduction of PLC-! in different cell types, with the cell types expressing PLC-!2 showing stronger activation of PLC. Another possible explanation for differences in the data on activation of PLC-!1 might be the differential signaling abilities of alternative splice forms of c-Kit. It is known that the two alternative splice forms denoted GNNK+ and GNNK- do signal at quantitatively and qualitatively different levels (Caruana et al, 1999; Voytyuk et al, 2003). Thus, expression of various splice forms of c-Kit might influence the outcome of studies on PLC-! activation. A direct physical interaction between c-Kit and PLC-! isoforms has not been demonstrated, except in cells overexpressing the receptor and PLC-!1. Thus, it is possible that activation of PLC-! might be a result of activation of other tyrosine kinases downstream of c-Kit that might not necessarily require a direct physical association between PLC-! and c-Kit. One such candidate kinase is the Src family of tyrosine kinases.

pathway. This is in agreement with previous findings that SFKs play an important role in phosphorylating ShcA, thereby recruiting the Grb2-Sos complex, leading to activation of Ras (Lennartsson et al, 1999; Bondzi et al, 2000). In addition, SCF-induced activation of other signal transduction molecules such as Rac and JNK were shown to be restored by adding back Y568 and Y570. The function of SFKs in a more physiological context was addressed by Agosti et al, (2004) who generated transgenic mice carrying c-Kit with a Y568F mutation. They found that mutation of Y568, the primary binding site of SFKs in c-Kit, led to a block in pro T cell and pro B cell development, in contrast to the Y721F mutant (affecting PI3-kinase activation) that had no effect on hematopoiesis. These data suggest that SFKs mediate a critical signal for lymphocyte development. However, one of the difficulties in interpreting these data lies in the probability that additional signal transduction molecules apart from SFKs might be involved. For example, the protein tyrosine phosphatase SHP-2 (Kozlowski et al, 1998), the tyrosine kinase CHK (Jhun et al, 1995) and the adaptor protein APS (Wollberg et al, 2003) have also been shown to bind to phosphorylated Y568. Using a similar approach, Kimura et al. generated mice carrying the Y568F and Y570 of c-Kit. These tyrosine residues were shown to be crucial for the function of c-Kit in melanogenesis and mast cell development. In contrast, they were dispensable for the normal development of erythroid cells, interstitital cells of Cajal and germ cells. They also displayed splenomegaly, dysregulation of B-cell and megakaryocyte development (Kimura et al, 2004). However, since Y568 has been demonstrated to bind to the protein tyrosine phosphatase SHP-2 (Kozlowski et al, 1998) and the adapter protein APS (Wollberg et al, 2003), and Y570 has been shown to be associating with the protein tyrosine phosphatase SHP1 (Kozlowski et al, 1998), the phenotype of the Y568F/Y570F mice might not necessarily solely reflect a function of the SFK, but also the function of other signal transduction molecules.

F. The Src family of tyrosine kinases The SFK is named after its prototypic family member c-Src, the cellular homolog of the transforming protein of Rous sarcoma virus, v-Src. Some members, like Src, Yes and Fyn, are ubiquitously expressed, while others, such as Lck, Hck, Fgr, Lyn and Blk, display a more restricted expression pattern and are mainly expressed in cells of the hematopoietic lineages (Abram and Courtneidge, 2000). They consist of an N-terminal sequence which directs myristoylation and in some cases palmitoylation. These lipid modifications serve to anchor the kinases to the plasma membrane. They also contain an SH3 domain, an SH2 domain and a tyrosine kinase domain. They have been implicated in a number of cellular functions, including survival, chemotaxis, adhesion, proliferation and protein trafficking. Ligand-induced activation of c-Kit leads to a rapid increase in SFK activity (Linnekin et al, 1997; Krystal et al, 1998). A number of investigators have shown that SFKs associate primarily with phosphorylated Y568 in cKit, while Y570 contributes to the overall affinity of binding by acting as an acidic determinant (Price et al, 1997; Timokhina et al, 1998; Lennartsson et al, 1999). SCF-induced chemotaxis of Mo7e cells was dependent on SFK activity (Broudy et al, 1999). In another study, overexpression of a dominant negative form of Lyn in either primary hematopoietic progenitor cells or bone marrow derived mast cells led to inhibition of both SCFmediated proliferation and chemotaxis (O'LaughlinBunner et al, 2001). In Mo7e cells, activation of the SFK Lyn was demonstrated to occur during the late G1 phase of SCF-stimulated cell cycle progression (Mou and Linnekin, 1999). Using an approach where 32D cells were transfected with chimeric c-Kit containing the extracellular domain of the M-CSF receptor, and by mutating seven tyrosine residues of the intracellular part of c-Kit, Hong et al. demonstrated a complete loss of mitogenic response of 32D cells (Hong et al, 2004). However, by adding back Y568 and Y570 to this mutant, the mitogenic response was restored, as well as survival and migration. Furthermore, restoration of the Src binding sites also lead to restored activation of the Ras/Erk

G. Other tyrosine kinases: Tec, CHK, Fer and Fes Tec belongs to a family of tyrosine kinases that also includes the Bruton tyrosine kinase (Btk), Bmx, Itsk/Tsk, and Rlk/Txk (Smith et al, 2001). They each contain a pleckstrin homology (PH) domain, and a Tec homology (TH) domain in the amino-terminus followed by SH3, SH2 and tyrosine kinase domains. In contrast to the SFKs, they lack membrane targeting myristoylation site, but are recruited to the plasma membrane through the PH domain interacting with membrane-bound PIP3. Activation of Tec family kinases is thought to be mediated by members of the Src family. Tec is phosphorylated on tyrosine residues and activated upon ligand stimulation of c-Kit (Tang et al, 1994). More recent studies have shown that Tec forms multiprotein complexes with Lyn and the adapter protein Dok-1 (van Dijk et al, 2000; Liang et al, 2002). Phosphorylation of Tec and Dok-1 was dependent on their recruitment to the plasma membrane through activation of 10

Cancer Therapy Vol 3, page 11 PI3-kinase (van Dijk et al, 2000). Both Lyn and Tec were capable of phosphorylating Dok-1, but using cells derived from animals with a targeted deletion of Lyn (Liang et al, 2002) it was shown that Lyn was required for SCFdependent phosphorylation of Dok-1. CHK (for Csk Homologous Kinase, also known as MATK) displays an about 50 % sequence identity with Csk, and like Csk it phosphorylates and inactivates SFKs. Similarly to SFKs, CHK has been shown to associate to the phosphorylated Y568 in the juxtamembrane region of ligand-stimulated c-Kit (Jhun et al, 1995). The cytoplasmic tyrosine kinases Fer and Fes belong to a separate family of tyrosine kinases. They both contain an SH2 domain immediately aminoterminal to the kinase domain. Following SCF-stimulation Fer associates with cKit and becomes phosphorylated on tyrosine residues (Kim and Wong, 1995). Using mast cells derived from transgenic mice carrying a kinase inactivating mutation of Fer, Craig and Greer found a requirement for Fer kinase activity for sustained p38 kinase activation and maximal chemotactic response to SCF (Craig and Greer, 2002). Fes has been found to bind to c-Kit (Masuhara et al, 2000), although its role in c-Kit signaling remains to be shown.

constitutively active D816H mutant of c-Kit in order to be tumorigenic (Ning et al, 2001). However, as is the case with the activation of PLC-!, there are discrepancies in the literature. Some investigators have failed to detect activation of the JAK/STAT pathway by c-Kit (Jacobs-Helber et al, 1997; O'Farrell et al, 1996; Pearson et al, 1998). A possible explanation is cell type specific signaling or differences in the experimental setup as well as the very rapid and transient JAK2 activation by SCF.

I. Adapter proteins Adapter proteins are proteins with several domains that specify protein-protein interactions. The multiple domains enable them to interact with several proteins simultaneously. The ability of linking proteins together through specific and many times regulated protein-protein interactions, enables signaling to be sequentially and spatially regulated (for review, see Pawson and Scott, 1997). Grb2 was originally identified as a protein interacting with the phosphorylated EGF receptor (Lowenstein et al, 1992) and found to mediate activation of the Ras/Erk pathway by RTKs. Grb2 is a ubiquitously expressed protein containing one SH2 domain and two SH3 domains. Tyrosine phosphorylated c-Kit has been shown to associate with Grb2 (see above under C “The Ras/Erk pathway”) through Y703 and Y936 of c-Kit (Thömmes et al, 1999). The adapter protein Gads (also denoted Mona, Grap2, GrpL or Grf40) is closely related to Grb2 and expressed in hematopoietic cells (for review, see Liu et al, 2001) and has been shown to interact with c-Kit in a manner similar to Grb2 (Liu and McGlade, 1998). However, it is not known whether Gads interact with the same tyrosine residues as Grb2. Another member of the same family of adapter proteins with a very similar structure, Grap, also interacts with c-Kit (Feng et al, 1996). ShcA is a ubiquitously expressed adapter protein that contains one SH2 domain and a PTB domain, that both enable ShcA to interact with phosphorylated proteins (for review, see Ravichandran, 2001). Phosphorylation of ShcA by RTKs, directly or indirectly via SFKs, leads to the creation of high affinity binding sites for Grb2, which in turn leads to activation of the Ras/Erk pathway. In vitro data suggest that ShcA interacts with the juxtamembrane domain of c-Kit (Price et al, 1997). The adapter protein Grb7 belongs to a family of closely related proteins consisting of Grb7, Grb10 and Grb14 that each exist as several alternatively spliced variants (for review, see Han et al, 2001). Grb7 contains an SH2 and a so-called GM region (for Grb and Mig) which includes a PH domain and shows sequence homology with the C. elegans protein Mig-10, that has been implicated in embryonic migration. Grb7 interacts with activated c-Kit through Y936 in the carboxyterminal tail of the receptor (Thömmes et al, 1999). However, the exact role of Grb7 in c-Kit signaling remains to be elucidated. Grb10 was identified in a yeast two-hybrid screen using the D816V constitutively active mutant of c-

H. The JAK/STAT pathway The Janus kinases (JAKs) are a family of closely related cytoplasmic tyrosine kinases that are activated through ligand stimulation of cytokine receptors or RTKs. Downstream targets of the JAKs are the signal transducers and activators of transcription (STAT) that are phosphorylated by JAKs and thereby activated. STAT proteins are a class of transcription factors with DNA binding domains, an SH2 domain and a carboxy-terminal transactivating domain. Upon tyrosine phosphorylation, STATs dimerize through interaction between the phosphorylated tyrosine residues and the SH2 domain of STAT, leading to dimerization. STATs can form both homodimers of identical STATs or heterodimers between different members of the STAT family. The dimerized STATs translocate to the nucleus, where they regulate expression of responsive genes (for review, see Kerr et al, 2003). The JAK/STAT pathway is activated following SCF stimulation. c-Kit stimulates rapid and transient tyrosine phosphorylation of JAK2 (Brizzi et al, 1994). JAK2 was found to be constitutively associated with c-Kit, with increased association after ligand stimulation of c-Kit (Weiler et al, 1996). A role of JAK2 in c-Kit mediated signaling was suggested by the finding that treatment of cells with JAK2 antisense oligonucleotides resulted in a marked decrease in SCF-induced proliferation. In addition, SCF-induced growth of fetal liver cells from mice carrying a targeted deletion of JAK2 was shown to be reduced compared to cells from wild-type mice (Radosevic et al, 2004). Furthermore, JAK2 was also required for differentiation of the Kit+ progenitor cells into mast cells. Ligand-stimulated activation of c-Kit leads to physical association with and activation of STAT1# STAT3, STAT5A and STAT5B (Brizzi et al, 1999; Deberry et al, 1997; Ning et al, 2001; Ryan et al, 1997). It has been shown that STAT3 activation is required for the

Lennartsson et al: c-Kit signal transduction Kit as a bait (Jahn et al, 2002). The interaction between Grb10 and c-Kit was shown to be mediated through its SH2 domain, while the PH domain mediates interaction with the serine/threonine kinase Akt. It was further demonstrated that Grb10 and c-Kit are able to activate Akt in a synergistic manner. The adaptor protein Lnk belongs, together with APS and SH2-B, to a family of closely related adapter proteins. All three proteins share a common domain structure in that they contain a conserved amino-terminal domain that includes a proline-rich stretch, a PH domain and an SH2 domain. They all contain a conserved tyrosine residue in their carboxy-termini that is presumed to be a phosphorylation site mediating interaction with Cbl (Iseki et al, 2000). Using transgenic mice lacking the expression of Lnk, it was shown that B cell precursor cells were hypersensitive to SCF stimulation (Takaki et al, 2000), leading to proportional accumulation of B cell precursors in the bone marrow and B cells in the spleen of transgenic mice. Thus, these data suggest that Lnk has a negative regulatory role in B cell production. APS was originally identified in a yeast two-hybrid screen using constitutively active c-Kit as bait (Yokouchi et al, 1997). When APS is phosphorylated in its carboxyterminal tail, it physically associates with Cbl (Wakioka et al, 1999; Yokouchi et al, 1999). Being a ubiquitin E3-ligase, Cbl is able to monoubiquitinate activated RTKs, leading to their internalization and degradation in the lysosomes (Haglund et al, 2003). The primary associations sites for APS in c-Kit have been shown to be phosphorylated Y568 and Y936 (Wollberg et al, 2003). Mutation of both Y568 and Y936 was necessary to completely block binding of APS to c-Kit. Recently it was shown that APS exists as a dimer (Hu et al, 2003), which might explain why both sites are needed for full binding of APS to c-Kit. Interestingly, in the viral form of kit, v-Kit, both Y568 and Y936 are missing (Herbst et al, 1995). Thus, it has been speculated that loss of binding of APS, or maybe SH2-B or Lnk, in v-Kit could possibly lead to reduced ubiquitination and prolonged receptor signaling, that could possibly contribute to transformation. A number of transforming mutants of RTKs have been shown to lack association sites for Cbl, leading to reduced ubiqutination and stabilization of active receptors (Peschard and Park, 2003). However, the physiology of mice with a targeted deletion of APS does not support a major role for APS in c-Kit signaling. The effects are mainly related to the immune system (Iseki et al, 2004), although mast cells derived from APS knock-out animals show a markedly augmented degranulation in response to c-Kit stimulation, as well as lower levels of F-actin (Kubo-Akashi et al, 2004). In contrast, targeted deletion of either Lnk or SH2B did not lead to any marked effect on mast cell behavior. Dok-1 is an adapter protein of 62 kDa originally identified as a tyrosine-phosphorylated protein associated with p120-RasGAP in fibroblasts transfected with v-Src (Ellis et al, 1990). It contains a phosphotyrosine binding (PTB) domain and a PH domain. Cells from Dok-1 knockout mice hyperproliferate in response to stimulation with a number of growth factors and cytokines, suggesting

a role of Dok-1 as a negative regulator of cell proliferation (Yamanashi et al, 2000). Dok-1 was found to associate with activated c-Kit in chronic myelogenous leukemia progenitor cells (Carpino et al, 1997). The Gab/Dos family of adaptor proteins are a family of scaffolding adaptors with similar overall structural organization (reviewed in Gu and Neel, 2003), containing an N-terminal PH domain, proline-rich motifs that can interact with SH3 domains and multiple tyrosine phosphorylation sites that can serve as docking sites for SH2 domain containing proteins. Both Gab-1 and Gab-2 are phosphorylated in response to SCF-stimulation (Nishida et al, 1999). Gab-2 is required for mast cell development and c-Kit signaling (Nishida et al, 2002), while Gab-1 does not seem to be essential for c-Kit signaling. Bone marrow mast cells derived from Gab-2deficient mice grew poorly in response to SCF and activation of both Erk and Akt were impaired. The Crk family of adapter proteins consists of one SH2 domain, as well as one or two SH3 domains. The family consists of four members: CrkI and CrkII (alternative splice forms of the same gene), CrkL (Feller, 2001) and the recently discovered CrkIII (Prosser et al, 2003). Ligand stimulation of c-Kit leads to phosphorylation of CrkL (Sattler et al, 1997), which indirectly associates with c-Kit through the p85 subunit of PI3-kinase. In addition, CrkL mediates interaction with Cbl, which thus likely contributes to c-Kit ubiquitination and degradation. The closely related protein CrkII was also shown to be phosphorylated in response to SCF stimulation and interact with c-Kit also indirectly via the p85 subunit of PI3-kinase (Lennartsson et al, 2003). This interaction was dependent on phosphorylation of Y900 in the second part of the kinase domain, which is not an autophosphorylation site but is phosphorylated through the action of SFKs.

J. Protein tyrosine phosphatases The two closely related protein tyrosine phosphatases (PTPs) SHP-1 and SHP-2 constitute a family of proteins consisting of two amino-terminal SH2 domains, a PTP domain and a carboxyterminal tail (Neel et al, 2003). A number of SHP binding proteins have been reported including activated cytokine receptors and RTKs, as well as scaffolding adaptors, such as the Gab proteins. Activation of SHPs occurs through binding of the SH2 domains to tyrosine phosphorylated peptides, in particular biphosphorylated. Binding of the phosphopeptide leads to opening up of the phosphatase structure. SHP-1 associates with phosphorylated Y570 in c-Kit (Kozlowski et al, 1998) and is involved in negative regulation of c-Kit signaling (see also â&#x20AC;&#x153;Negative regulation of c-Kit signalingâ&#x20AC;?). In contrast, SHP-2 is, despite the fact that it is a phosphatase, a positive regulator of signaling. SHP-2 physically interacts with SCF-stimulated c-Kit and becomes phosphorylated on tyrosine residues (Tauchi et al, 1994). The site of interaction was shown to be Y568 in the juxtamembrane region of c-Kit (Kozlowski et al, 1998), which also constitutes the docking site for a number of other signal transduction molecules, such as SFKs, CHK and APS. In most RTK signaling, SHP-2 12

Cancer Therapy Vol 3, page 13 activation is required for full activation of the Ras/Erk pathway, e. g. the PDGF "-receptor (Rรถnnstrand et al, 1999). SHP-2 also plays an important role in mediating embryonic stem cell differentiation and hematopoiesis (Chan et al, 2003). The tyrosine phosphatase PTP-RO is despite its lack of SH2 domains still able to associate with the c-Kit receptor (Taniguchi et al, 1999). Furthermore, PTP-RO becomes phosphorylated on tyrosine residues after SCF stimulation. By use of antisense oligonucleotides the function of PTP-RO could be inhibited, which led to significantly inhibited proliferation of Mo7e cells (Taniguchi et al, 1999). Similar to PTP-RO, the protein tyrsoine phosphatase PTP-PEST was shown to bind to c-Kit in a liganddependent manner (Markova et al, 2003). However, the mode of interaction, the site of interaction and its role in cKit signaling remains to be elucidated.

tuning of the regulation of transcriptions factors downstream of c-Kit. Another transcription factor involved in c-Kit signaling is Slug, a member of the Snail family of zinc finger transcription factors. Mice with a targeted deletion of Slug show pigment deficiency, gonadal defects, and impairment of hematopoiesis, very much reminiscent of the phenotype of loss-of-function mutations in c-Kit (Perez-Losada et al, 2002). It was demonstrated that cells from Slug knockout animals despite the expression of cKit were defective in SCF-induced migration, suggesting a role for Slug downstream of c-Kit. It was recently shown that Slug function in c-Kit mediated radioprotection (Perez-Losada et al, 2003). Furthermore, in malignant mesothelioma, which is often resistant to conventional chemotherapy, it was established that c-Kit-dependent upregulation of Slug conferred drug resistance (Catalano et al, 2004). In contrast, down-regulation of Slug using RNAi made the cells susceptible to apoptosis induced by chemotherapeutic drugs. Thus, Slug appears to have a central position in SCF-mediated protection from apoptosis induced by chemotherapy. Therefore development of therapeutic agents that target Slug or Slug regulated genes may provide ways to sensitize tumors for conventional chemotherapy.

K. Transcription factors A number of genes are induced upon SCFstimulation of cells. One is the Mitf protein, which is a member of the MYC superfamily of transcription factors (Hodgkinson et al, 1993; Hughes et al, 1993; Boissy and Nordlund, 1997) and is closely related to three other basic Helix-Loop-Helix Leucine Zipper (bHLHZip) transcription factors, Tfe3, Tfeb and TfeC. The phenotype of Mitf mutant mice is strikingly similar to that of mice with loss-of-function mutations of c-Kit or its ligand (spotted fur color, mast cell deficiency; reviewed in Boissy and Nordlund, 1997). This suggested a functional link between the Mitf transcription factor and c-Kit and its ligand. This has been proven by a number of investigators. In vitro experiments have demonstrated that the activity of the Mitf transcription factor is regulated by signaling through the c-Kit receptor tyrosine kinase. Ultimately, this signaling results in effects on the activation potential and/or stability of the Mitf protein (Hemesath et al, 1998; Wu et al, 2000; Weilbaecher et al, 2001). SCF stimulation of c-Kit results in Erk2-dependent phosphorylation of S73 of Mitf, which regulates its transcriptional activity. Furthermore, Price et al. have shown that only the phosphorylated version of Mitf can interact with the p300 co-activator protein (Price et al, 1998). Phosphorylation of S409 by the p90/Rsk kinase, downstream of Erk, is a second phosphorylation event that has been shown to link c-Kit and Mitf. This phosphorylation has been shown to affect the protein stability such that Mitf protein phosphorylated on S409 is degraded more rapidly than a mutant S409A Mitf protein. The increased degradation was shown to correlate with increased polyubiquitination of the protein that targets it for proteosome-dependent degradation (Wu et al, 2000). Recently, a functional cross talk between Mitf, protein inhibitor of activated Stat3 (PIAS3) and Stat3 was demonstrated (Sonnenblick et al, 2004). PIAS proteins are a class of proteins that act as inhibitors of Stat activity (Wormald and Hilton, 2004). Upon SCF-stimulation, PIAS3 is translocated from Mitf to the activated Stat3 due to phosphorylation of Mitf at S409. It is sugggested that such a mechanism leads to a fine-

L. Other signal trandsduction molecules SWAP-70 is an unusual protein that was originally found as a part of a multiprotein DNA recombination complex in activated B cells (Borggrefe et al, 1998). It was later shown to also be expressed in mast cells. It carries a PH domain, that is required for membrane localization, three nuclear localization motifs and a nuclear export signal, and a Dbl domain. Recently, it was shown that mast cells derived from mice carrying a targeted deletion of SWAP-70 display impaired responses to c-Kit activation (Sivalenka and Jessberger, 2004). SCFinduced migration was deficient both in in vitro and in vivo assays. The reduced chemotaxis could be explained by aberrant polymerization of F-actin and impaired Rac activation. Furthermore, both SCF-induced calcium fluxes and Akt activation were impaired in SWAP-70-/- mast cells.

M. Negative regulation of c-Kit signaling In a number of cases, receptor tyrosine kinases have been shown to be regulated by serine/threonine kinases, such as protein kinase C (PKC), including the Met receptor (Gandino et al, 1994), the EGF receptor (Morrison et al, 1993) and the insulin receptor (Bollag et al, 1986). Blume-Jensen et al. could demonstrate that also the tyrosine kinase activity of c-Kit can be modulated through phosphorylation by PKC (Blume-Jensen et al, 1994). Down-modulation of c-Kit activity by PKC occurs through dual mechanisms. Activated PKC phosphorylates S741 and S746 in the kinase insert region of c-Kit, which leads to inhibition of kinase activity (Blume-Jensen et al, 1994; Blume-Jensen et al, 1995). Conversely, treatment of cells with the PKC inhibitor calphostin C, resulted in enhanced kinase activity of c-Kit and, furthermore, selectively increased activation of PI3-kinase (Blume13

Lennartsson et al: c-Kit signal transduction Jensen et al, 1994). Mutation of S741 and S746 to alanine residues, resulted in a gain of function and markedly increased tyrosine kinase activity of c-Kit (Blume-Jensen et al, 1998). In addition, treatment of cells with phorbol myristate acetate (PMA), an activator of PKC, results in proteolytic release of the ligand-binding domain of c-Kit, that leads to decreased responsiveness to SCF stimulation (Yee et al, 1993, 1994). Stimulation of c-Kit with soluble SCF results in phosphoinositide 3â&#x20AC;&#x2122;-kinase (PI3-kinase) dependent activation of phospholipase D (Kozawa et al, 1997), leading to release of phosphatidic acid, which can be dephosphorylated to yield diacylglycerol (DAG), an activator of PKC. The protein tyrosine phosphatase SHP-1 interacts with Y570 of c-Kit and negatively regulates c-Kit signaling (Yi and Ihle, 1993; Kozlowski et al, 1998). SHP1 consists of two SH2 domains and a carboxyterminal protein tyrosine phosphatase domain. The motheaten (me) mice express a loss-of-function mutation in SHP-1 and show a hyperproliferative phenotype of their hematopoietic progenitor cells (Shultz et al, 1993). However, loss of SHP-1 function did not affect SCFinduced proliferation of bone-marrow derived mast cells, suggesting that the role of SHP-1 might to some extent be cell-type specific (Lorenz et al, 1996). The suppressors of cytokine signaling (SOCS) are a family of proteins that were originally cloned based on their ability to suppress cytokine signaling (for review, see (Wormald and Hilton, 2004)). They have a central SH2 domain flanked by an N-terminal domain of variable length and a C-terminal domain of 40 amino acids denoted the SOCS box. In a yeast two-hybrid screen using c-Kit as a bait, SOCS-1 was identified as an interactor with c-Kit (De Sepulveda et al, 1999). Its expression is induced upon stimulation of mast cells with SCF, and it associates with c-Kit via its SH2 domain. In contrast to its function in cytokine signaling, SOCS-1 selectively suppressed c-Kitstimulated mitogenesis, while not affecting survival signals. The mechanism does not involve inactivation of the tyrosine kinase activity of c-Kit, but rather binding of Grb2 to SOCS-1 via its SH3 domain. SOCS-1 in its turn binds to Vav (De Sepulveda et al, 1999). Interestingly, targeted deletion of SOCS-1 did not lead to enhanced cKit signaling in bone marrow derived mast cells, as one might have expected, but rather a reduced proliferative response to SCF-stimulation (Ilangumaran et al, 2003). Furthermore, deletion of SOCS-1 led to increased levels of proteases, leading to degradation of signal transduction molecules.

functions of this receptor/ligand pair in the hematopoietic system, fertility, pigmentation, gut movement as well as in the nervous system (Russell, 1979; Keshet et al, 1991; Lev et al, 1994). Below is a short summary of the major in vivo functions of c-Kit signaling.

A. Hematopoiesis Hematopoietic stem cells (HSC) have the ability to self-renew as well as differentiate into all hematopoietic cell lineages. HSC often divide asymmetrically, i.e. the daughter cells become a new HSC whereas the other starts to differentiate and lose the ability to self-renew. During the process of lineage commitment the ability to selfrenew decreases but the proliferative activity increases leading to an expansion of cell number. In general, c-Kit is expressed on primitive hematopoietic cells such as stemand progenitor cells and is lost during differentiation (Ogawa et al, 1991; Okada et al, 1991; Broudy, 1997; Lyman and Jacobsen, 1998). In fact, less than 0.1% of peripheral blood cells express c-Kit suggesting a minor role for c-Kit in differentiated hematopoietic cells (Ashman et al, 1991; Papayannopoulou et al, 1991; Broudy et al, 1992). Primitive hematopoietic cells depend on SCF for growth and survival, often in synergy with other growth factors and cytokines. An important exception among the hematopoietic cells are mast cells that retain a high c-Kit expression even as fully differentiated cells and depend on c-Kit signal transduction for their survival, growth and function (Oliveira and Lukacs, 2003). As a single factor SCF can induce differentiation of primitive hematopoietic cells from fetal mouse livers into mast cells (Radosevic et al, 2004). Hematopoietic defects in W and Sl mice include the development of erythrocytes, megakaryocytes and mast cells (Lev et al, 1994; Russell, 1979). W/W mice can be rescued by transplantation of wild-type HSC indicating that the lethality of these mice is due to anemia. A recent study demonstrated that transgenic expression of Epo can rescue W/W mice and thus support hematopoiesis in the absence of c-Kit (Waskow et al, 2004). This indicates that signals emanating from c-Kit that support hematopoiesis are not unique and can be replaced, at least in a mouse model, by signals from other receptor/ligand pairs. Among the lymphoid lineages, c-Kit plays a role for the maintenance of the immune system in adult animals (Waskow et al, 2002). Thus, treatment with c-Kit inhibitors for an extended time period might affect the immune system. Indeed, in older mice, treatment with the kinase inhibitor STI-571 (Gleevec, imatinib mesylate) leads to a defect in development of pro-B and pro-T-cells (Agosti et al, 2004). These results are important to consider before initiating a long-term STI-571 treatment in patients.

III. c-Kit in homeostasis There exist a large number of natural loss-of-function mutations in the W and Sl loci in mice, encoding for c-Kit and SCF respectively. The consequence of these mutations range from minor defects in catalytic activity to complete loss of c-Kit kinase activity as well as reduced to complete loss of expression of both c-Kit and SCF (Lev et al, 1994). These mutations have enabled scientists to appreciate the diverse effect c-Kit signaling has during mouse development and adult life. Detailed analysis of this extensive panel of mouse mutants has suggested critical

B. Fertility The fertility deficiency in W and Sl mice is probably linked to the loss of the normal ability of c-Kit to protect germ cells from apoptosis and to induce their migration and proliferation (Loveland and Schlatt, 1997). One important pathway for the ability of c-Kit to inhibit apoptosis is the PI3-kinase/Akt pathway (Blume-Jensen et 14

Cancer Therapy Vol 3, page 15 al, 1998). Indeed, knock-in studies using a mutant c-Kit receptor (c-Kit Y719F) unable to activate PI3-kinase resulted in sterile male mice (Blume-Jensen et al, 2000 ; Kissel et al, 2000). In the work by Kissel et al. also female mice had a reduced fertility (Kissel et al, 2000). These studies suggest that c-Kit in germ cell biology is involved in the processes of oogenesis, folliculogenesis and spermatogenesis. Furthermore, the function of c-Kit in germ cells is strictly dependent on its ability to activate PI3-kinase. Interestingly, these mice displayed no other phenotype, indicating that other cell types have redundant systems to compensate for the loss of PI3-kinase signaling downstream of c-Kit. In addition there exists a truncated form of c-Kit (tr-Kit) that is produced by an alternative intronic promotor which is active during spermatogenesis (Rossi et al, 2003). Even though tr-Kit lacks kinase activity it can activate the mouse egg if microinjected, in a SFK- and PLC-! dependent manner (Sette et al, 1997, 1998, 2002). It is likely that tr-Kit becomes phosphorylated by intracellular kinases, e.g. Src family kinases, and functions as an adaptor protein. However, the molecular function is presently not clear. The fact that trKit was recently discovered in human prostate cancer (Paronetto et al, 2004) warrants further investigation of this protein also in relation to cancer.

function of the hippocampal region of the brain (Motro et al, 1996; Katafuchi et al, 2000). Moreover, c-Kit expression has been found in neuroproliferative zones in the adult rat brain as well as in neuronal cultures (Jin et al, 2002). Furthermore, administration of SCF leads to proliferation of primitive neurons in vivo. It was recently demonstrated that c-Kit signaling is important for the migration of neuronal stem- and progenitor cells to injured areas of the brain (Sun et al, 2004). The precise role of cKit signal transduction for the development and function of the nervous system is not clear and needs further investigation.

IV. c-Kit as a therapeutic target in cancer treatment The tyrosine kinase receptor c-Kit is associated with several malignant human diseases. As mentioned above, cKit is expressed in the hematopoietic system, in certain cells in the gastrointestinal system (i.e. ICC), nervous system, germ cells, and melanocytes. Indeed, c-Kit driven tumors in these tissues have been observed. Mechanisms leading to uncontrolled activation of c-Kit involve both autocrine loops as well as mutational activation. Autocrine loops, i.e. the same cells produce both c-Kit and its ligand SCF, have been found in small cell lung cancer (SCLC), gynecological tumors and neuroblastomas (Inoue et al, 1994; Krystal et al, 1996; Vitali et al, 2003). Mutational activation of c-Kit has been found in patients with mastocytosis, gastrointestinal stromal tumors (GIST) and acute myeloid leukemia (AML). These mutations are predominantly located within the kinase domain or in the juxtamembrane region of c-Kit. The juxtamembrane mutations are believed to release an inhibitory alpha-helix and thereby result in uncontrolled receptor activation (Ma et al, 1999). In a study using molecular modelling Torrent et al. showed that kinase domain mutations in c-Kit and FLT3, a close relative to c-Kit, result in constitutive activation by destabilizing the inactive conformation, and not by directly stabilizing the active structure (Torrent et al, 2004). Unregulated c-Kit activity probably contributes to malignancies through increased proliferation and suppression of apoptosis. In all tumors in which c-Kit is the driving force for cellular transformation its kinase activity is essential. This is irrespective of the mode of kinase activation, whether it is activated by mutation(s) or by autocrine stimulation. Thus, inhibitors that specifically inhibits c-Kit enzymatic activity should be promising therapeutic agents. Several of these have been developed and perhaps the clinically approved STI-571 is the best known. This inhibitor was developed to target the kinase activity of the fusion oncoprotein Bcr-Abl, which is a result of the Philadelphia chromosome translocation and is commonly associated with chronic myelogenous leukemia. Subsequently STI-571 has been found to efficiently inhibit also c-Kit and the PDGFRs (Buchdunger et al, 2000). Recently, STI-571 was co-crystallized with the c-Kit kinase domain (Mol et al, 2004). This study showed that STI-571 binds to c-Kit in a way that is similar to its interaction with the Abl tyrosine kinase, i.e. near the active site of the inactive kinase and thereby stabilizing this conformation (Nagar et al, 2002). The crystal structure

C. Pigmentation The observation that mice with reduced c-Kit function have defective pigmentation is believed to be linked to the ability of SCF to induce proliferation and guide migration of melanocytes from the neuronal crest to the dermis (Scott et al, 1994; Mackenzie et al, 1997; Wehrle-Haller, 2003). A recent study from Bernstein and co-workers demonstrated that the two tyrosine residues 568 and 570 in the juxtamembrane region of c-Kit, which among other proteins couple the receptor to SFKs, are needed for normal pigmentation (Kimura et al, 2004). Moreover, loss-of-function mutations in c-Kit have been detected in the majority of humans with Piebaldism syndrome which is characterized by areas of hypopigmentation on the stomach, extremities and hair due to a lack of melanocytes (Spritz, 1994).

D. Gastrointestinal tract In the W and Sl mice there is a depletion of Interstitial cells of Cajal (ICC). ICC, also known as pacemaker cells, regulate the gut movement by their ability to communicate with both nerve and smooth muscle cells. Loss of ICC is connected with several human diseases involving defects in gut movement such as slow transit constipation (Lyford et al, 2002). ICC express !c-Kit and in the W and Sl mice there is a constipation phenotype suggesting an important role for c-Kit in ICC development and/or function (Huizinga et al, 1995; Ward et al, 1995; Ward et al, 1994). In addition, treatment of mice with an inhibitory c-Kit antibody leads to loss of ICC and consequently impaired gut movement. (Maeda et al, 1992)

E. Nervous system Studies using W and Sl mutant animals have established a role for c-Kit signaling in the spatial learning 15

Lennartsson et al: c-Kit signal transduction of STI-571 in complex with c-Kit also revealed that optimization of the STI-571 structure, removing unfavorable sterical interactions, could lead to a c-Kit inhibitor with higher affinity and specificity (Mol et al, 2004). Notably, STI-571 interacts with the inactive conformation of the kinase and hence will have limited efficacy on c-Kit with mutations in the kinase domain resulting in constitutive activity. Indeed, it has been shown that STI-571 does not effectively inhibit the c-KitD816V mutant (Frost et al, 2002; Ma et al, 2002). Therefore, the development of an inhibitor that targets the activating mutants of c-Kit would be beneficial for the treatment of many c-Kit driven tumors. Optimally this inhibitor will only inhibit the mutant form of c-Kit but not the wild-type protein, resulting in minimal side-effects. Effective treatment with kinase inhibitors requires exact knowledge regarding the presence or absence of specific mutations in c-Kit. Thus, development of methods to diagnose the c-Kit status in tumor tissues at the molecular level, e.g. using DNA sequencing as well as probing tumor tissues with antibodies raised against active and/or mutated forms of cKit, will be critical for successful treatment of these patients. As with most, if not all, enzymatic inhibitors used in cancer treatment the tumors eventually become tolerant or even resistant to the drug. This can occur through different mechanisms including increased expression of the oncoprotein, point mutations and/or expression of drugresistance-proteins that can for example remove the drug from the cell or interact with the drug in a way that blocks its therapeutic activity. In the case of STI-571 resistance has been observed due to increased oncoprotein expression as well as point mutations within the kinase domain (Gorre et al, 2001; Weisberg and Griffin, 2001; Shah and Sawyers, 2003). Strategies to overcome problems with resistance include combinational therapy using several drugs that simultaneously target the receptor and/or downstream signal transduction pathways. Thus, a detailed understanding of the cell biological and biochemical properties of receptors and their downstream effectors is critical for the development of novel targeted therapeutic interventions. Below follows a brief account of some of the cancers in which c-Kit has been implicated. The list is by no means complete and is constantly growing as more tumors are found to express c-Kit.

Kit kinase domain (D816V or D816Y) (Ferrao et al, 1997). Interestingly, the mutant c-Kit is often found in combination with mutations in the core-binding transcription complex (Beghini et al, 2000). However, a functional connection between c-Kit and the core-binding mutations has not been established. It has been speculated that the mutation(s) in the core binding factor result in defects in differentiation and c-Kit activation provides anti-apoptotic and proliferative signals complying with the 2-hit hypothesis of AML etiology (one hit affecting differentaition and one hit affecting proliferation) (Reilly, 2002). Notably, also the c-Kit related tyrosine kinase FLT3 has been found activated in AML (O'Farrell et al, 2003). Using the low molecular weight inhibitors SU5416 and SU6668, that target c-Kit, FLT3 and VEGFR-2, leads to reduction of c-Kit phosphorylation and increased apoptosis in human AML blasts (Smolich et al, 2001; O'Farrell et al, 2004). These data support the idea that cKit (and/or FLT3 and VEGFR-2) can drive AML blast proliferation and survival. A recent phase I trial of SU11248, an inhibitor of FLT3, c-Kit, VEGFR-2 and PDGFRs, in treatment for AML showed partial short term remission and reduced c-Kit, Stat3, Akt and VEGFR-2 phosphorylation (Fiedler et al, 2004). In two studies analyzing the effect of STI-571 on bcr-abl-negative AML patients, one showed a hematological response whereas the other did not (Cortes et al, 2003; Kindler et al, 2004). However, in the study that failed to observe a response the investigators used a lower dose (400mg/d) compared to the study where a response was seen (600mg/d). Thus more work is needed before we can fully appreciate the efficacy of STI-571 in the treatment of bcr-abl-negative AML patients. For detailed information on c-Kit and FLT3 in leukemogenesis refer to (Reilly, 2002).

B. GIST GIST are the most common cancer in the digestive tract with mesenchymal origin. However, this class of cancers only accounts for about 1% of all tumors in the gastrointestinal tract. There is evidence to suggest that GIST originate from ICC, which are known to express cKit (Wang et al, 2000; Duensing et al, 2004). Gain-offunction mutations found in GISTs are commonly located in the c-Kit intracellular juxtamembrane domain, but mutations have also been found in the extracellular domain (duplication of A501 and Y502) and in the kinase domain (K642E, N822K and N822H) (Lux et al, 2000: Rubin et al, 2001; Kinoshita et al, 2003). GISTs that contain mutated c-Kit have high cellularity and mitotic activity (Kim et al, 2004). In addition, the presence of cKit mutations indicates poor prognosis. However, all GISTs do not have mutations in c-Kit and it was recently shown that 35% of these c-Kit mutation negative patients had an activated mutation in the related PDGFR# (Heinrich et al, 2003). Moreover, activating mutations in c-Kit or PDGFR# appear to be mutually exclusive since no tumor has been found expressing both these oncoproteins. Primary GIST can be treated with surgical removal of the tumor. In the case of metastatic GIST this treatment is combined with conventional chemotherapy. Lately the

A. AML AML is exceedingly variable with relation to cell morphology and genetic changes. Expression of c-Kit has been found in about 85% of human AML cells (Heinrich et al, 2002). Since c-Kit primarily is expressed on stemand progenitor cells in the hematopoietic system this suggests that AML cells are in a primitive differentiation stage. In many AML samples c-Kit is constitutively phosphorylated. This is achieved through different mechanisms. First, SCF stimulates proliferation of AML cells in vitro and a co-expression of SCF and c-Kit has been detected in AML blasts (Ikeda et al, 1991, 1993; Kanakura et al, 1993; Pietsch, 1993). Thus, autocrine stimulation is probably involved in driving tumorigenesis. Second, activating mutations have been detected in the c16

Cancer Therapy Vol 3, page 17 tyrosine kinase inhibitor STI-571 that targets c-Kit, PDGFRs and Bcr-Abl fusion protein has been demonstrated to be therapeutically successful against GIST (Joensuu et al, 2001; Tuveson et al, 2001). Actually, STI-571 is the first effective treatment for GIST and more than 80% of patients respond to this drug. This highlights the importance of c-Kit signaling in this type of cancer. Recently, point mutations in the c-Kit kinase domain (V654A or T670I) making the GIST tumor resistant to STI-571 have been found in patients treated for a prolonged period of time with this drug (Chen et al, 2004; Tamborini et al, 2004). For detailed information on GIST biology and tumorigenesis please refer to Duensing et al, 2004 and Corless et al, 2004.

One obvious phenotype of W and Sl mice is their lack of fur pigmentation, which is due to a loss of melanocytes (Lev et al, 1994). Thus melanocytes depend on c-Kit for their function and therefore melanomas have been investigated in regard to c-Kit involvement (WehrleHaller, 2003). In general, it appears that c-Kit is downregulated during tumor progression towards metastatic cutaneous melanoma (Easty and Bennett, 2000). In addition, re-expression of c-Kit into certain melanoma cell lines leads to reduced tumor growth and SCF-induced apoptosis (Huang et al, 1996). Hence it is possible that loss of c-Kit allows the transformed melanocytes to escape from apoptosis. In contrast, c-Kit expression has been detected on choroidal and uveal melanoma cell lines (Mouriaux et al, 2003; Lefevre et al, 2004). Furthermore, a significant c-Kit phosphorylation has been found in uveal melanoma cell lines, but no activating mutations (AllEricsson et al, 2004; Lefevre et al, 2004). However, coexpression of SCF was observed thus establishing an autocrine/paracrine loop. Therefore the efficacy of STI571 was tested on these cell lines and the results are encouraging with reduced proliferation (All-Ericsson et al, 2004; Lefevre et al, 2004). Welker et al. demonstrated reduced expression of membrane-associated SCF but not soluble SCF in melanoma cell lines, particularly those that metastasize in vivo, compared to normal melanocytes (Welker et al, 2000). Thus, it is possible that the membrane-restricted form of SCF makes it difficult for melanocytes to move. Loss of this anchor allows the transformed melanocyte to metastasize to distant regions of the body. In conclusion, the involvement of c-Kit in melanoma is complex and varies between different types of melanoma, e.g. cutaneous versus choroidal and uveal melanomas. Hence, further investigation is needed to clarify the importance of c-Kit as a therapeutic target in choroidal and uveal melanomas.

C. Mastocytosis Mastocytosis is a disease characterized by accumulation of mast cells in various tissues. The disease shows large variations in clinical symptoms, with prognosis varying form non-lethal to lethal. c-Kit and its ligand SCF are critical for normal development and function of mast cells. In fact, mast cells are the only differentiated hematopoietic cell type that relies on c-Kit for its function. Activating mutations in the c-Kit kinase domain (D816V) have been identified in mast cells from patients with mastocytosis. This mutation renders c-Kit constitutively active. Notably, familial and pediatric mastocytosis may occur without mutations in the kinase domain of c-Kit indicating that the molecular reasons behind mastocytosis is variable and not exclusively dependent on a single oncoprotein. However, it is also possible that these patients have not yet identified mutations in other regions of c-Kit. Currently, there is no effective treatment of mastocytosis and consequently pharmacological interventions aim to reduce discomfort. Unfortunately, the catalytic domain mutant of c-Kit, most often found in mastocytosis patients, is not well inhibited by STI-571 rendering this drug inefficient in treatment of mastocytosis (Zermati et al, 2003). Thus, there is a need to develop therapeutic agents that target the kinase activity of the cKitD816V mutant. Recently Corbin et al. published a study demonstrating that the kinase inhibitor MLN518 could inhibit the activity of c-KitD816V (Corbin et al, 2004). Moreover, MLN518 showed low toxicity in a phase I trial for AML (DeAngelo et al, 2003). Thus, this is a promising compound for treatment of mastocytosis expressing activating mutation in c-Kit kinase domain. Furthermore, it has also been demonstrated that inhibition of NF-%B using IMD-0354 reduced proliferation of mast cells expressing c-Kit V560G and/or D816V but not normal mast cells (Tanaka et al, 2004). This suggests that interfering with NF-%B function might provide a novel therapeutic approach for mastocytosis. For detailed discussion of mastocytosis refer to Castells, 2004.

E. SCLC SCLC represents about 20% of all lung cancers, and if untreated it is a very aggressive form. The molecular biology behind SCLC is not clear, but it has been reported that about 70% of small-cell lung cancer cell lines overexpress c-Kit (Krystal et al, 1996; Sekido et al, 1991). Indeed c-Kit kinase inhibitors, such as STI-571, SU11248, SU5416 and SU6597, have been shown to reduce growth of SCLC cell lines and human SCLC xenografts in mice (Krystal et al, 2000; Wang et al, 2000: Krystal et al, 2001; Abrams et al, 2003). The in vivo activity of STI-571 on SCLC needs to be addressed in patients with tumors that are positive for c-Kit overexpression. Notably, a recent study failed to detect a correlation between the expression or mutation status of c-Kit and SCLC survival (Boldrini et al, 2004). Moreover, Haas and co-workers showed in a retrospective study of 203 patients with SCLC that lack of c-Kit expression was associated with shorter survival compared to patients with tumors that expressed c-Kit (Rohr et al, 2004). In contrast, Micke et al. found that high c-Kit expression is correlated with poor prognosis (Micke et al, 2003). Thus the involvement and importance of c-Kit

D. Melanoma The genetic changes that occur in melanoma are tremendously variable, but a common characteristic is an increased presence of tyrosine phosphorylated proteins compared to normal melanocytes (McArdle et al, 2003). 17

Lennartsson et al: c-Kit signal transduction in SCLC is not clear and further investigations are justified. Since SCLC is generally sensitive to both chemoand radiotherapy these are the standard therapies for this disease (Stupp et al, 2004). However, the overall prognosis of SCLC is poor due to its tendency to metastasize early in the disease (Jafri et al, 2003). Autocrine and paracrine loops are believed to be important for the ability of SCLC to form metastases. Thus, development of strategies that interfere with the autocrine loops could result in significantly better long-term prognosis for patients with SCLC. A recent study found that simultaneous targeting both c-Kit/SCF and IGF-1R/IGF-1 signaling using the inhibitors AG1024 and AG1296 synergistically reduced growth and increased apoptosis in SCLC cells (Camirand and Pollak, 2004).

understood. Some studies were conducted on transfected fibroblasts that express a different repertoire of signal transduction molecules than hematopoietic cells, possibly giving rise to activation of different signal transduction pathways. Also the differentiation state of hematopoietic cell lines is likely to influence the response elicited by SCF stimulation. Several splice forms of c-Kit have been demonstrated to exist, with sometimes different signaling capabilities, both quantitatively and qualitatively. Very little is known about how the expression of these different splice forms is regulated during development and differentiation. It is not unlikely that differences in signaling shown in the literature might be due to differences in expression of various splice forms of c-Kit in different cell types. Furthermore, the qualitative differences in signaling of the membrane bound versus soluble form of SCF have been demonstrated in a number of studies. The use of transgenic animals with targeted deletions of individual signal transduction molecules and the use of so-called knock-in methodology to introduce specific mutants of c-Kit in animals, have proven invaluable tools for our understanding of c-Kit signaling. In order to be able to study c-Kit signaling in hematopoietic development, more sensitive methods for the study of signaling in individual cells will be of utmost importance. Understanding of the mechanisms of synergy between SCF and various cytokines is also a challenging field for future research. Increased knowledge of molecular mechanisms of c-Kit signaling in diseases, such as cancer, is paramount to the potential development of targeted therapies. It is likely that c-Kit signal transduction, resulting in suppression of apoptosis and enhanced proliferation, at least contributes to the progression of many tumors. Hence, c-Kit is a clinically relevant target for drug development. Importantly, in cases where c-Kit activation is due to overexpression or an autocrine loop, the tumors are likely to respond to drugs that target wild-type c-Kit, e.g. STI-571. In contrast, tumors that contain c-Kit with mutations in the catalytic domain will not respond well to STI-571. Therefore we would like to emphasize the importance to develop new therapeutic agents which target the catalytic domain mutant of c-Kit that can be applied in the clinic. Moreover, it is important to identify differences in signal transduction pathways downstream of normal and oncogenic forms of c-Kit since these would be excellent targets for therapeutic intervention, with minimal effect on the function wild-type c-Kit, in order to complement drugs acting directly on the receptor. It is likely that simultaneous targeting of different signaling molecules will lead to synergistic anticancer effects and circumvent or at least delaying the emergence of drug resistance.

F. Other tumors Expression of c-Kit has been detected in several other tumors not described above including neuroblastoma, cervical, testicular, thyroid, breast, colon, bladder and renal carcinoma (Arber et al, 1998; Bellone et al, 2001; Caceres-Cortes et al, 2001; Hines et al, 1999; Lin et al, 2004; Pan et al, 2004; Tian et al, 1999; Vitali et al, 2003). In the case of breast cancer, c-Kit expression is lost during transformation from normal breast tissue to invasive breast cancer (Ulivi et al, 2004; Yared et al, 2004). Thus monitoring c-Kit expression can be of prognostic value. A recent report identified expression of the tr-Kit in a prostate cancer cell line and in 28% of primary prostate cancers (Paronetto et al, 2004). Tr-Kit has been thought only to be expressed in sperm. Therefore tr-Kit might provide an almost tumor specific target. Two recent investigations regarding the involvement of c-Kit in neuroblastoma have highlighted the complexity of this disease. In one study it was shown that c-Kit expression indicates a good prognosis (Krams et al, 2004). c-Kit expression was associated with differentiation and this is a possible explanation for c-Kit being a favorable prognostic marker. On the other hand, Beppu et al, demonstrated using neuroblastoma cell lines that STI-571 treatment leads to reduced proliferation and viability (Beppu et al, 2004). Furthermore, STI-571 treatment was associated with reduced c-Kit and PDGFR" phosphorylation as well as reduced VEGF expression. In order to target c-Kit clinically these discrepancies between in vitro and in vivo studies must be resolved.

V. Concluding remarks Since the discovery of SCF as the ligand of c-Kit almost fourteen years ago, numerous studies have contributed to our knowledge about the mechanism of action of c-Kit. A multitude of signaling pathways are activated by SCF leading to diverse biological responses, such as chemotaxis, proliferation, differentiation and survival. Using a number of different cell systems, investigators have many times found similar mechanisms of action of c-Kit, but sometimes also differences. The exact reason for these discrepancies is not fully

References Abram CL and Courtneidge SA (2000) Src family tyrosine kinases and growth factor signaling. Exp Cell Res 254, 1-13. Abrams TJ, Lee LB, Murray LJ, Pryer NK and Cherrington JM (2003) SU11248 inhibits KIT and platelet-derived growth factor receptor beta in preclinical models of human small cell lung cancer. Mol Cancer Ther 2, 471-478.

Cancer Therapy Vol 3, page 19 Agosti V, Corbacioglu S, Ehlers I, Waskow C, Sommer G, Berrozpe G, Kissel H, Tucker CM, Manova K, Moore MA, et al (2004) Critical Role for Kit-mediated Src Kinase But Not PI 3-Kinase Signaling in Pro T and Pro B Cell Development. J Exp Med 199, 867-878. Ali K, Bilancio A, Thomas M, Pearce W, Gilfillan AM, Tkaczyk C, Kuehn N, Gray A, Giddings J, Peskett E, et al (2004) Essential role for the p110delta phosphoinositide 3-kinase in the allergic response. Nature 431, 1007-1011. All-Ericsson C, Girnita L, Muller-Brunotte A, Brodin B, Seregard S, ร stman A and Larsson O (2004) c-Kitdependent growth of uveal melanoma cells: a potential therapeutic target? Invest Ophthalmol Vis Sci 45, 20752082. Arber DA, Tamayo R and Weiss LM (1998) Paraffin section detection of the c-kit gene product (CD117) in human tissues: value in the diagnosis of mast cell disorders. Hum Pathol 29, 498-504. Arcaro A, Khanzada UK, Vanhaesebroeck B, Tetley TD, Waterfield MD and Seckl MJ (2002) Two distinct phosphoinositide 3-kinases mediate polypeptide growth factor-stimulated PKB activation. EMBO J 21, 5097-5108. Ashman LK, Cambareri AC, To LB, Levinsky RJ and Juttner CA (1991) Expression of the YB5.B8 antigen (c-kit protooncogene product) in normal human bone marrow. Blood 78, 30-37. Beghini A, Peterlongo P, Ripamonti CB, Larizza L, Cairoli R, Morra E and Mecucci C (2000) C-kit mutations in core binding factor leukemias. Blood 95, 726-727. Bellone G, Carbone A, Sibona N, Bosco O, Tibaudi D, Smirne C, Martone T, Gramigni C, Camandona M, Emanuelli G and Rodeck U (2001) Aberrant activation of c-kit protects colon carcinoma cells against apoptosis and enhances their invasive potential. Cancer Res 61, 2200-2206. Beppu K, Jaboine J, Merchant MS, Mackall CL and Thiele CJ (2004) Effect of imatinib mesylate on neuroblastoma tumorigenesis and vascular endothelial growth factor expression. J Natl Cancer Inst 96, 46-55. Berridge MJ, Bootman MD and Roderick HL (2003) Calcium signalling: dynamics, homeostasis and remodelling. Nat Rev Mol Cell Biol 4, 517-529. Besmer P, Murphy JE, George PC, Qiu FH, Bergold PJ, Lederman L, Snyder HW, Jr., Brodeur D, Zuckerman EE and Hardy WD (1986) A new acute transforming feline retrovirus and relationship of its oncogene v-kit with the protein kinase gene family. Nature 320, 415-421. Blume-Jensen P, Claesson-Welsh L, Siegbahn A, Zsebo KM, Westermark B and Heldin CH (1991) Activation of the human c-kit product by ligand-induced dimerization mediates circular actin reorganization and chemotaxis. EMBO J 10, 4121-4128. Blume-Jensen P, Janknecht R and Hunter T (1998) The kit receptor promotes cell survival via activation of PI 3-kinase and subsequent Akt-mediated phosphorylation of Bad on Ser136. Curr Biol 8, 779-782. Blume-Jensen P, Jiang G, Hyman R, Lee KF, O'Gorman S and Hunter T (2000) Kit/stem cell factor receptor-induced activation of phosphatidylinositol 3'-kinase is essential for male fertility. Nat Genet 24, 157-162. Blume-Jensen P, Rรถnnstrand L, Gout I, Waterfield MD and Heldin C (1994) Modulation of kit/stem cell factor receptor induced signaling by protein kinase C. J Biol Chem 269, 21793-21802. Blume-Jensen P, Wernstedt C, Heldin CH and Rรถnnstrand L (1995) Identification of the major phosphorylation sites for protein kinase C in kit/stem cell factor receptor in vitro and in intact cells. J Biol Chem 270, 14192-14200.

Boissy RE and Nordlund JJ ( 1997) Molecular basis of congenital hypopigmentary disorders in humans: a review. Pigment Cell Res 10, 12-24. Boldrini L, Ursino S, Gisfredi S, Faviana P, Donati V, Camacci T, Lucchi M, Mussi A, Basolo F, Pingitore R and Fontanini G (2004) Expression and mutational status of c-kit in smallcell lung cancer: prognostic relevance. Clin Cancer Res 10, 4101-4108. Bollag GE, Roth RA, Beaudoin J, Mochly-Rosen D and Koshland DE, Jr. (1986) Protein kinase C directly phosphorylates the insulin receptor in vitro and reduces its protein-tyrosine kinase activity. Proc Natl Acad Sci U S A 83, 5822-5824. Bondzi C, Litz J, Dent P and Krystal GW (2000) Src family kinase activity is required for Kit-mediated mitogenactivated protein (MAP) kinase activation, however loss of functional retinoblastoma protein makes MAP kinase activation unnecessary for growth of small cell lung cancer cells. Cell Growth Differ 11, 305-314. Borggrefe T, Wabl M, Akhmedov AT and Jessberger R ( 1998) A B-cell-specific DNA recombination complex. J Biol Chem 273, 17025-17035. Brizzi MF, Dentelli P, Rosso A, Yarden Y and Pegoraro L (1999) STAT protein recruitment and activation in c-Kit deletion mutants. J Biol Chem 274, 16965-16972. Brizzi MF, Zini MG, Aronica MG, Blechman JM, Yarden Y and Pegoraro L (1994) Convergence of signaling by interleukin3, granulocyte-macrophage colony-stimulating factor and mast cell growth factor on JAK2 tyrosine kinase. J Biol Chem 269, 31680-31684. Broudy V (1997) Stem Cell Factor and Hematopoiesis. Blood 90, 1345-1364. Broudy VC, Lin NL, Liles WC, Corey SJ, O'Laughlin B, Mou S and Linnekin D (1999) Signaling via Src family kinases is required for normal internalization of the receptor c-Kit. Blood 94, 1979-1986. Broudy VC, Smith FO, Lin N, Zsebo KM, Egrie J and Bernstein ID (1992) Blasts from patients with acute myelogenous leukemia express functional receptors for stem cell factor. Blood 80, 60-67. Buchdunger E, Cioffi CL, Law N, Stover D, Ohno-Jones S, Druker BJ and Lydon NB (2000) Abl protein-tyrosine kinase inhibitor STI571 inhibits in vitro signal transduction mediated by c-kit and platelet-derived growth factor receptors. J Pharmacol Exp Ther 295, 139-145. Buday L and Downward J (1993) Epidermal growth factor regulates p21ras through the formation of a complex of receptor, Grb2 adapter protein and Sos nucleotide exchange factor. Cell 73, 611-620. Caceres-Cortes JR, Alvarado-Moreno JA, Waga K, RangelCorona R, Monroy-Garcia A, Rocha-Zavaleta L, UrdialesRamos J, Weiss-Steider B, Haman A, Hugo P, et al (2001) Implication of tyrosine kinase receptor and steel factor in cell density-dependent growth in cervical cancers and leukemias. Cancer Res 61, 6281-6289. Camirand A and Pollak M (2004) Co-targeting IGF-1R and c-kit: synergistic inhibition of proliferation and induction of apoptosis in H 209 small cell lung cancer cells. Br J Cancer 90, 1825-1829. Carpenter CL, Auger KR, Chanudhuri M, Yoakim M, Schaffhausen B, Shoelson S and Cantley LC (1993) Phosphoinositide 3-kinase is activated by phosphopeptides that bind to the SH2 domains of the 85-kDa subunit. J Biol Chem 268, 9478-9483. Carpenter G and Ji Q (1999) Phospholipase C-gamma as a signal-transducing element. Exp Cell Res 253, 15-24. Carpino N, Wisniewski D, Strife A, Marshak D, Kobayashi R, Stillman B and Clarkson B (1997) p62(dok): a constitutively

Lennartsson et al: c-Kit signal transduction tyrosine-phosphorylated, GAP-associated protein in chronic myelogenous leukemia progenitor cells. Cell 88, 197-204. Caruana G, Cambareri AC and Ashman LK (1999) Isoforms of c-KIT differ in activation of signalling pathways and transformation of NIH3T3 fibroblasts. Oncogene 18, 55735581. Castells MC (2004) Mastocytosis: classification, diagnosis and clinical presentation. Allergy Asthma Proc 25, 33-36. Catalano A, Rodilossi S, Rippo MR, Caprari P and Procopio A (2004) Induction of stem cell factor/c-Kit/slug signal transduction in multidrug-resistant malignant mesothelioma cells. J Biol Chem 279, 46706-46714. Chabot B, Stephenson DA, Chapman VM, Besmer P and Bernstein A (1988) The proto-oncogene c-kit encoding a transmembrane tyrosine kinase receptor maps to the mouse W locus. Nature 335, 88-89. Chan RJ, Johnson SA, Li Y, Yoder MC and Feng GS (2003) A definitive role of Shp-2 tyrosine phosphatase in mediating embryonic stem cell differentiation and hematopoiesis. Blood 102, 2074-2080. Chen LL, Trent JC, Wu EF, Fuller GN, Ramdas L, Zhang W, Raymond AK, Prieto VG, Oyedeji CO, Hunt KK, et al (2004) A missense mutation in KIT kinase domain 1 correlates with imatinib resistance in gastrointestinal stromal tumors. Cancer Res 64, 5913-5919. Chian R, Young S, Danilkovitch-Miagkova A, Rรถnnstrand L, Leonard E, Ferrao P, Ashman L and Linnekin D (2001) Phosphatidylinositol 3 kinase contributes to the transformation of hematopoietic cells by the D816V c-Kit mutant. Blood 98, 1365-1373. Copeland NG, Gilbert DJ, Cho BC, Donovan PJ, Jenkins NA, Cosman D anderson D, Lyman SD and Williams DE (1990) Mast cell growth factor maps near the steel locus on mouse chromosome 10 and is deleted in a number of steel alleles. Cell 63, 175-183. Corbin AS, Griswold IJ, La Rosee P, Yee KW, Heinrich MC, Reimer CL, Druker BJ and Deininger MW (2004) Sensitivity of oncogenic KIT mutants to the kinase inhibitors MLN518 and PD180970. Blood. Corless CL, Fletcher JA and Heinrich MC (2004) Biology of gastrointestinal stromal tumors. J Clin Oncol 22, 3813-3825. Cortes J, Giles F, O'Brien S, Thomas D, Albitar M, Rios MB, Talpaz M, Garcia-Manero G, Faderl S, Letvak L, et al (2003) Results of imatinib mesylate therapy in patients with refractory or recurrent acute myeloid leukemia, high-risk myelodysplastic syndrome and myeloproliferative disorders. Cancer 97, 2760-2766. Craig AW and Greer PA (2002) Fer kinase is required for sustained p38 kinase activation and maximal chemotaxis of activated mast cells. Mol Cell Biol 22, 6363-6374. Crews CM and Erikson RL (1992) Purification of a murine protein-tyrosine/threonine kinase that phosphorylates and activates the Erk-1 gene product: relationship to the fission yeast byr1 gene product. Proc Natl Acad Sci U S A 89, 8205-8209. Crosier PS, Ricciardi ST, Hall LR, Vitas MR, Clark SC and Crosier KE (1993) Expression of isoforms of the human receptor tyrosine kinase c-kit in leukemic cell lines and acute myeloid leukemia. Blood 82, 1151-1158. De Sepulveda P, Okkenhaug K, Rose JL, Hawley RG, Dubreuil P and Rottapel R (1999) Socs1 binds to multiple signalling proteins and suppresses steel factor-dependent proliferation. EMBO J 18, 904-915. DeAngelo D, Stone R, Bruner R, Caligiuri M, Heany M, Nimer S, Paquette R, Sawyers C, Lambing J, Loker N, et al (2003) Phase I clinical results with MLN518, a novel Flt3 antagonist:

tolerability, pharmacokinetics and pharmacodynamics. Blood 102, 219a. Deberry C, Mou S and Linnekin D (1997) Stat1 associates with c-kit and is activated in response to stem cell factor. Biochem J 327, 73-80. Dorsey JF, Cunnick JM, Mane SM and Wu J (2002) Regulation of the Erk2-Elk1 signaling pathway and megakaryocytic differentiation of Bcr-Abl(+) K562 leukemic cells by Gab2. Blood 99, 1388-1397. Duensing A, Heinrich M, Fletcher C and Fletcher J (2004) Biology of gastrointestinal stromal tumors: KIT mutations and beyond. Cancer Invest 22, 106-116. Easty D and Bennett D (2000) Protein tyrosine kinases in malignant melanoma. Melanoma Res 10, 401-411. Ellis C, Moran M, McCormick F and Pawson T (1990) Phosphorylation of GAP and GAP-associated proteins by transforming and mitogenic tyrosine kinases. Nature 343, 377-381. Engstrรถm M, Karlsson R and Jรถnsson JI (2003) Inactivation of the forkhead transcription factor FoxO3 is essential for PKBmediated survival of hematopoietic progenitor cells by kit ligand. Exp Hematol 31, 316-323. Feller SM (2001) Crk family adaptors-signalling complex formation and biological roles. Oncogene 20, 6348-6371. Feng GS, Ouyang YB, Hu DP, Shi ZQ, Gentz R and Ni J (1996) Grap is a novel SH3-SH2-SH3 adaptor protein that couples tyrosine kinases to the Ras pathway. J Biol Chem 271, 12129-12132. Ferrao P, Gonda TJ and Ashman LK (1997) Expression of constitutively activated human c-Kit in Myb transformed early myeloid cells leads to factor independence, histiocytic differentiation and tumorigenicity. Blood 90, 4539-4552. Fiedler W, Serve H, Dohner H, Schwittay M, Ottmann OG, O'Farrell AM, Bello CL, Allred R, Manning WC, Cherrington JM, et al (2004) A phase I study of SU11248 in the treatment of patients with refractory or resistant acute myeloid leukemia (AML) or not amenable to conventional therapy for the disease. Blood. Foster FM, Traer CJ, Abraham SM and Fry MJ (2003) The phosphoinositide (PI) 3-kinase family. J Cell Sci 116, 30373040. Frost MJ, Ferrao PT, Hughes TP and Ashman LK (2002) Juxtamembrane mutant V560GKit is more sensitive to Imatinib (STI571) compared with wild-type c-kit whereas the kinase domain mutant D816VKit is resistant. Mol Cancer Ther 1, 1115-1124. Fukao T, Yamada T, Tanabe M, Terauchi Y, Ota T, Takayama T, Asano T, Takeuchi T, Kadowaki T, Hata Ji J and Koyasu S (2002) Selective loss of gastrointestinal mast cells and impaired immunity in PI3K-deficient mice. Nat Immunol 3, 295-304. Gandino L, Longati P, Medico E, Prat M and Comoglio PM (1994) Phosphorylation of serine 985 negatively regulates the hepatocyte growth factor receptor kinase. J Biol Chem 269, 1815-1820. Geissler EN, Ryan MA and Housman DE (1988) The dominantwhite spotting (W) locus of the mouse encodes the c-kit proto-oncogene. Cell 55, 185-192. Gommerman JL, Sittaro D, Klebasz NZ, Williams DA and Berger SA (2000) Differential stimulation of c-Kit mutants by membrane-bound and soluble Steel Factor correlates with leukemic potential. Blood 96, 3734-3742. Gorre ME, Mohammed M, Ellwood K, Hsu N, Paquette R, Rao PN and Sawyers CL (2001) Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Science 293, 876-880. Gu H and Neel BG (2003) The "Gab" in signal transduction. Trends Cell Biol 13, 122-130.

Cancer Therapy Vol 3, page 21 Haglund K, Sigismund S, Polo S, Szymkiewicz I, Di Fiore PP and Dikic I (2003) Multiple monoubiquitination of RTKs is sufficient for their endocytosis and degradation. Nat Cell Biol 5, 461-466. Han DC, Shen TL and Guan JL (2001) The Grb7 family proteins: structure, interactions with other signaling molecules and potential cellular functions. Oncogene 20, 6315-6321. Hartley D, Meisner H and Corvera S (1995) Specific association of the beta isoform of the p85 subunit of phosphatidylinositol-3 kinase with the proto-oncogene c-cbl. J Biol Chem 270, 18260-18263. Hashimoto K, Matsumura I, Tsujimura T, Kim D, Ogihara H, Ikeda H, Ueda S, Mizuki M, Sugahara H, Shibayama H, et al (2003) Necessity of tyrosine 719 and phosphatidylinositol 3'kinase-mediated signal pathway in constitutive activation and oncogenic potential of c-Kit receptor tyrosine kinase with the Asp814Val mutation. Blood 101, 1094-1102. Hayashi S, Kunisada T, Ogawa M, Yamaguchi K and Nishikawa S (1991) Exon skipping by mutation of an authentic splice site of c-kit gene in W/W mouse. Nucleic Acids Res 19, 1267-1271. Heinrich MC, Blanke CD, Druker BJ and Corless CL (2002) Inhibition of KIT tyrosine kinase activity: a novel molecular approach to the treatment of KIT-positive malignancies. J Clin Oncol 20, 1692-1703. Heinrich MC, Corless CL, Duensing A, McGreevey L, Chen CJ, Joseph N, Singer S, Griffith DJ, Haley A, Town A, et al (2003) PDGFRA activating mutations in gastrointestinal stromal tumors. Science 299, 708-710. Hemesath TJ, Price ER, Takemoto C, Badalian T and Fisher DE (1998) MAP kinase links the transcription factor Microphthalmia to c-Kit signalling in melanocytes. Nature 391, 298-301. Herbst R, Lammers R, Schlessinger J and Ullrich A (1991) Substrate phosphorylation specificity of the human c-kit receptor tyrosine kinase. J Biol Chem 266, 19908-19916. Herbst R, Munemitsu S and Ullrich A (1995) Oncogenic activation of v-kit involves deletion of a putative tyrosinesubstrate interaction site. Oncogene 10, 369-379. Herbst R, Shearman MS, Jallal B, Schlessinger J and Ullrich A (1995) Formation of signal transfer complexes between stem cell and platelet- derived growth factor receptors and SH2 domain proteins in vitro. Biochemistry 34, 5971-5979. Hines SJ, Litz JS and Krystal GW (1999) Coexpression of c-kit and stem cell factor in breast cancer results in enhanced sensitivity to members of the EGF family of growth factors. Breast Cancer Res Treat 58, 1-10. Hodgkinson CA, Moore KJ, Nakayama A, Steingrimsson E, Copeland NG, Jenkins NA and Arnheiter H (1993) Mutations at the mouse microphthalmia locus are associated with defects in a gene encoding a novel basic-helix-loophelix-zipper protein. Cell 74, 395-404. Hong L, Munugalavadla V and Kapur R (2004) c-Kit-mediated overlapping and unique functional and biochemical outcomes via diverse signaling pathways. Mol Cell Biol 24, 14011410. Hu J, Liu J, Ghirlando R, Saltiel AR and Hubbard SR (2003) Structural basis for recruitment of the adaptor protein APS to the activated insulin receptor. Mol Cell 12, 1379-1389. Huang EJ, Nocka KH, Buck J and Besmer P (1992) Differential expression and processing of two cell associated forms of the kit-ligand: KL-1 and KL-2. Mol Biol Cell 3, 349-362. Huang S, Luca M, Gutman M, McConkey DJ, Langley KE, Lyman SD and Bar-Eli M (1996) Enforced c-KIT expression renders highly metastatic human melanoma cells susceptible to stem cell factor-induced apoptosis and inhibits their tumorigenic and metastatic potential. Oncogene 13, 23392347.

Huber M, Helgason CD, Scheid MP, Duronio V, Humphries RK and Krystal G (1998) Targeted disruption of SHIP leads to Steel factor-induced degranulation of mast cells. EMBO J 17, 7311-7319. Hughes MJ, Lingrel JB, Krakowsky JM and Anderson KP (1993) A helix-loop-helix transcription factor-like gene is located at the mi locus. J Biol Chem 268, 20687-20690. Huizinga JD, Thuneberg L, Kluppel M, Malysz J, Mikkelsen HB and Bernstein A (1995) W/kit gene required for interstitial cells of Cajal and for intestinal pacemaker activity. Nature 373, 347-349. Ikeda H, Kanakura Y, Furitsu T, Kitayama H, Sugahara H, Nishiura T, Karasuno T, Tomiyama Y, Yamatodani A, Kanayama Y, et al (1993) Changes in phenotype and proliferative potential of human acute myeloblastic leukemia cells in culture with stem cell factor. Exp Hematol 21, 16861694. Ikeda H, Kanakura Y, Tamaki T, Kuriu A, Kitayama H, Ishikawa J, Kanayama Y, Yonezawa T, Tarui S and Griffin JD (1991) Expression and functional role of the proto-oncogene c-kit in acute myeloblastic leukemia cells. Blood 78, 2962-2968. Ilangumaran S, Finan D, Raine J and Rottapel R (2003) Suppressor of cytokine signaling 1 regulates an endogenous inhibitor of a mast cell proteaseo. J Biol Chem 278, 4187141880. Inoue M, Kyo S, Fujita M, Enomoto T and Kondoh G (1994) Coexpression of the c-kit receptor and the stem cell factor in gynecological tumors. Cancer Res 54, 3049-3053. Iseki M, Kubo C, Kwon SM, Yamaguchi A, Kataoka Y, Yoshida N, Takatsu K and Takaki S (2004) Increased numbers of B-1 cells and enhanced responses against TI-2 antigen in mice lacking APS, an adaptor molecule containing PH and SH2 domains. Mol Cell Biol 24, 2243-2250. Iseki M, Takaki S and Takatsu K (2000) Molecular cloning of the mouse APS as a member of the Lnk family adaptor proteins. Biochem Biophys Res Commun 272, 45-54. Jacobs-Helber SM, Penta K, Sun Z, Lawson A and Sawyer ST (1997) Distinct signaling from stem cell factor and erythropoietin in HCD57 cells. J Biol Chem 272, 68506853. Jafri NF, Ma PC, Maulik G and Salgia R (2003) Mechanisms of metastasis as related to receptor tyrosine kinases in small-cell lung cancer. J Environ Pathol Toxicol Oncol 22, 147-165. Jahn T, Seipel P, Coutinho S, Urschel S, Schwarz K, Miething C, Serve H, Peschel C and Duyster J (2002) Analysing c-kit internalization using a functional c-kit-EGFP chimera containing the fluorochrome within the extracellular domain. Oncogene 21, 4508-4520. Jahn T, Seipel P, Urschel S, Peschel C and Duyster J (2002) Role for the adaptor protein Grb10 in the activation of Akt. Mol Cell Biol 22, 979-991. Jhun BH, Rivnay B, Price D and Avraham H (1995) The MATK tyrosine kinase interacts in a specific and SH2-dependent manner with c-Kit. J Biol Chem 270, 9661-9666. Jin K, Mao XO, Sun Y, Xie L and Greenberg DA (2002) Stem cell factor stimulates neurogenesis in vitro and in vivo. J Clin Invest 110, 311-319. Jin X, Han CS, Yu FQ, Wei P, Hu ZY and Liu YX (2005) Antiapoptotic action of stem cell factor on oocytes in primordial follicles and its signal transduction. Mol Reprod Dev 70, 8290. Joazeiro CA, Wing SS, Huang H, Leverson JD, Hunter T and Liu YC (1999) The tyrosine kinase negative regulator c-Cbl as a RING-type, E2-dependent ubiquitin-protein ligase. Science 286, 309-312. Joensuu H, Roberts PJ, Sarlomo-Rikala M andersson LC, Tervahartiala P, Tuveson D, Silberman S, Capdeville R, Dimitrijevic S, Druker B and Demetri GD (2001) Effect of

Lennartsson et al: c-Kit signal transduction the tyrosine kinase inhibitor STI571 in a patient with a metastatic gastrointestinal stromal tumor. N Engl J Med 344, 1052-1056. Kanakura Y, Ikeda H, Kitayama H, Sugahara H and Furitsu T (1993) Expression, function and activation of the protooncogene c-kit product in human leukemia cells. Leuk Lymphoma 10, 35-41. Kapur R, Chandra S, Cooper R, McCarthy J and Williams DA (2002) Role of p38 and ERK MAP kinase in proliferation of erythroid progenitors in response to stimulation by soluble and membrane isoforms of stem cell factor. Blood 100, 1287-1293. Katafuchi T, Li AJ, Hirota S, Kitamura Y and Hori T (2000) Impairment of spatial learning and hippocampal synaptic potentiation in c-kit mutant rats. Learn Mem 7, 383-392. Kerr IM, Costa-Pereira AP, Lillemeier BF and Strobl B (2003) Of JAKs, STATs, blind watchmakers, jeeps and trains. FEBS Lett 546, 1-5. Keshet E, Lyman SD, Williams DE anderson DM, Jenkins NA, Copeland NG and Parada LF (1991) Embryonic RNA expression patterns of the c-kit receptor and its cognate ligand suggest multiple functional roles in mouse development. EMBO J 10, 2425-2435. Khokhlatchev AV, Canagarajah B, Wilsbacher J, Robinson M, Atkinson M, Goldsmith E and Cobb MH (1998) Phosphorylation of the MAP kinase ERK2 promotes its homodimerization and nuclear translocation. Cell 93, 605615. Kim L and Wong TW (1995) The cytoplasmic tyrosine kinase FER is associated with the catenin-like substrate pp120 and is activated by growth factors. Mol Cell Biol 15, 4553-4561. Kim TW, Lee H, Kang YK, Choe MS, Ryu MH, Chang HM, Kim JS, Yook JH, Kim BS and Lee JS (2004) Prognostic significance of c-kit mutation in localized gastrointestinal stromal tumors. Clin Cancer Res 10, 3076-3081. Kimura Y, Jones N, Kluppel M, Hirashima M, Tachibana K, Cohn J, Wrana J, Pawson T and Bernstein A ( 2004) Targeted mutations of the juxtamembrane tyrosines in the Kit receptor tyrosine kinase selectively affect multiple cell lineages. Proc Natl Acad Sci USA 101, 6015-6020. Kindler T, Breitenbuecher F, Marx A, Beck J, Hess G, Weinkauf B, Duyster J, Peschel C, Kirkpatrick CJ, Theobald M, et al (2004) Efficacy and safety of imatinib in adult patients with c-kit-positive acute myeloid leukemia. Blood 103, 36443654. Kinoshita K, Isozaki K, Hirota S, Nishida T, Chen H, Nakahara M, Nagasawa Y, Ohashi A, Shinomura Y, Kitamura Y and Matsuzawa Y ( 2003) c-kit gene mutation at exon 17 or 13 is very rare in sporadic gastrointestinal stromal tumors. J Gastroenterol Hepatol 18, 147-151. Kissel H, Timokhina I, Hardy MP, Rothschild G, Tajima Y, Soares V, Angeles M, Whitlow SR, Manova K and Besmer P (2000) Point mutation in kit receptor tyrosine kinase reveals essential roles for kit signaling in spermatogenesis and oogenesis without affecting other kit responses. EMBO J 19, 1312-1326. Koike T, Hirai K, Morita Y and Nozawa Y (1993) Stem cell factor-induced signal transduction in rat mast cells. Activation of phospholipase D but not phosphoinositidespecific phospholipase C in c-kit receptor stimulation. J Immunol 151, 359-366. Kozawa O, Blume-Jensen P, Heldin CH and Rönnstrand L (1997) Involvement of phosphatidylinositol 3'-kinase in stem-cell-factor- induced phospholipase D activation and arachidonic acid release. Eur J Biochem 248, 149-155. Kozlowski M, Larose L, Lee F, Le DM, Rottapel R and Siminovitch KA (1998) SHP-1 binds and negatively modulates the c-Kit receptor by interaction with tyrosine 569

in the c-Kit juxtamembrane domain. Mol Cell Biol 18, 20892099. Krams M, Parwaresch R, Sipos B, Heidorn K, Harms D and Rudolph P (2004) Expression of the c-kit receptor characterizes a subset of neuroblastomas with favorable prognosis. Oncogene 23, 588-595. Krystal GW, DeBerry CS, Linnekin D and Litz J (1998) Lck associates with and is activated by Kit in a small cell lung cancer cell line: inhibition of SCF-mediated growth by the Src family kinase inhibitor PP1. Cancer Res 58, 4660-4666. Krystal GW, Hines SJ and Organ CP ( 1996) Autocrine growth of small cell lung cancer mediated by coexpression of c-kit and stem cell factor. Cancer Res 56, 370-376. Krystal GW, Honsawek S, Kiewlich D, Liang C, Vasile S, Sun L, McMahon G and Lipson KE (2001) Indolinone tyrosine kinase inhibitors block Kit activation and growth of small cell lung cancer cells. Cancer Res 61, 3660-3668. Krystal GW, Honsawek S, Litz J and Buchdunger E (2000) The selective tyrosine kinase inhibitor STI571 inhibits small cell lung cancer growth. Clin Cancer Res 6, 3319-3326. Kubo-Akashi C, Iseki M, Kwon SM, Takizawa H, Takatsu K and Takaki S (2004) Roles of a conserved family of adaptor proteins, Lnk, SH2-B and APS, for mast cell development, growth and functions: APS-deficiency causes augmented degranulation and reduced actin assembly. Biochem Biophys Res Commun 315, 356-362. Kubota Y, Angelotti T, Niederfellner G, Herbst R and Ullrich A (1998) Activation of phosphatidylinositol 3-kinase is necessary for differentiation of FDC-P1 cells following stimulation of type III receptor tyrosine kinases. Cell Growth Differ 9, 247-256. Kurosawa K, Miyazawa K, Gotoh A, Katagiri T, Nishimaki J, Ashman LK and Toyama K (1996) Immobilized anti-KIT monoclonal antibody induces ligand-independent dimerization and activation of Steel factor receptor: biologic similarity with membrane-bound form of Steel factor rather than its soluble form. Blood 87, 2235-2243. Kwong KY and Hung MC (1998) A novel splice variant of HER2 with increased transformation activity. Mol Carcinog 23, 62-68. Kyriakis JM, App H, Zhang XF, Banerjee P, Brautigan DL, Rapp UR and Avruch J (1992) Raf-1 activates MAP kinase-kinase. Nature 358, 417-421. Lefevre G, Glotin AL, Calipel A, Mouriaux F, Tran T, Kherrouche Z, Maurage CA, Auclair C and Mascarelli F (2004) Roles of stem cell factor/c-Kit and effects of Glivec/STI571 in human uveal melanoma cell tumorigenesis. J Biol Chem 279, 31769-31779. Leibiger B, Leibiger IB, Moede T, Kemper S, Kulkarni RN, Kahn CR, de Vargas LM and Berggren PO (2001) Selective insulin signaling through A and B insulin receptors regulates transcription of insulin and glucokinase genes in pancreatic beta cells. Mol Cell 7, 559-570. Lemmon MA, Pinchasi D, Zhou M, Lax I and Schlessinger J (1997) Kit receptor dimerization is driven by bivalent binding of stem cell factor. J Biol Chem 272, 6311-6317. Lennartsson J, Blume-Jensen P, Hermanson M, Pontén E, Carlberg M and Rönnstrand L (1999) Phosphorylation of Shc by Src family kinases is necessary for stem cell factor receptor/c-kit mediated activation of the Ras/MAP kinase pathway and c-fos induction. Oncogene 18, 5546-5553. Lennartsson J, Shivakrupa R and Linnekin D (2004) Synergistic growth of stem cell factor and granulocyte macrophage colony-stimulating factor involves kinase-dependent and independent contributions from c-Kit. J Biol Chem 279, 44544-44553. Lennartsson J, Wernstedt C, Engstrom U, Hellman U and Rönnstrand L (2003) Identification of Tyr900 in the kinase

Cancer Therapy Vol 3, page 23 domain of c-Kit as a Src-dependent phosphorylation site mediating interaction with c-Crk. Exp Cell Res 288, 110118. Lev S, Blechman JM, Givol D and Yarden Y (1994) Steel factor and c-kit protooncogene: genetic lessons in signal transduction. Crit Rev Oncog 5, 141-168. Lewis TS, Shapiro PS and Ahn NG (1998) Signal transduction through MAP kinase cascades. Adv Cancer Res 74, 49-139. Li W, Yu J, Michieli P, Beeler JF, Ellmore N, Heidaran MA and Pierce JH (1994) Stimulation of the platelet-derived growth factor beta receptor signaling pathway activates protein kinase C-delta. Mol Cell Biol 14, 6727-6735. Liang X, Wisniewski D, Strife A, Shivakrupa, Clarkson B and Resh MD (2002) Phosphatidylinositol 3-kinase and Src family kinases are required for phosphorylation and membrane recruitment of Dok-1 in c-Kit signaling. J Biol Chem 277, 13732-13738. Lin ZH, Han EM, Lee ES, Kim CW, Kim HK, Kim I and Kim YS (2004) A distinct expression pattern and point mutation of c-kit in papillary renal cell carcinomas. Mod Pathol 17, 611-616. Linnekin D, DeBerry CS and Mou S (1997) Lyn associates with the juxtamembrane region of c-Kit and is activated by stem cell factor in hematopoietic cell lines and normal progenitor cells. J Biol Chem 272, 27450-27455. Liu SK, Berry DM and McGlade CJ (2001) The role of Gads in hematopoietic cell signalling. Oncogene 20, 6284-6290. Liu SK and McGlade CJ (1998) Gads is a novel SH2 and SH3 domain-containing adaptor protein that binds to tyrosinephosphorylated Shc. Oncogene 17, 3073-3082. Lorenz U, Bergemann AD, Steinberg HN, Flanagan JG, Li X, Galli SJ and Neel BG (1996) Genetic analysis reveals cell type-specific regulation of receptor tyrosine kinase c-Kit by the protein tyrosine phosphatase SHP1. J Exp Med 184, 1111-1126. Loveland KL and Schlatt S (1997) Stem cell factor and c-kit in the mammalian testis: lessons originating from Mother Nature's gene knockouts. J Endocrinol 153, 337-344. Lowenstein EJ, Daly RJ, Batzer AG, Li W, Margolis B, Lammers R, Ullrich A, Skolnik EY, Bar-Sagi D and Schlessinger J (1992) The SH2 and SH3 domain-containing protein GRB2 links receptor tyrosine kinases to ras signaling. Cell 70, 431-442. Lux ML, Rubin BP, Biase TL, Chen CJ, Maclure T, Demetri G, Xiao S, Singer S, Fletcher CD and Fletcher JA (2000) KIT extracellular and kinase domain mutations in gastrointestinal stromal tumors. Am J Pathol 156, 791-795. Lyford GL, He CL, Soffer E, Hull TL, Strong SA, Senagore AJ, Burgart LJ, Young-Fadok T, Szurszewski JH and Farrugia G (2002) Pan-colonic decrease in interstitial cells of Cajal in patients with slow transit constipation. Gut 51, 496-501. Lyman SD and Jacobsen SE (1998) c-kit ligand and Flt3 ligand: stem/progenitor cell factors with overlapping yet distinct activities. Blood 91, 1101-1134. Ma Y, Cunningham ME, Wang X, Ghosh I, Regan L and Longley BJ (1999) Inhibition of spontaneous receptor phosphorylation by residues in a putative a-helix in the Kit intracellular juxtamembrane region. J Biol Chem 274, 13399-13402. Ma Y, Zeng S, Metcalfe DD, Akin C, Dimitrijevic S, Butterfield JH, McMahon G and Longley BJ (2002) The c-KIT mutation causing human mastocytosis is resistant to STI571 and other KIT kinase inhibitors; kinases with enzymatic site mutations show different inhibitor sensitivity profiles than wild-type kinases and those with regulatory-type mutations. Blood 99, 1741-1744. Mackenzie MA, Jordan SA, Budd PS and Jackson IJ (1997) Activation of the receptor tyrosine kinase Kit is required for

the proliferation of melanoblasts in the mouse embryo. Dev Biol 192, 99-107. Maddens S, Charruyer A, Plo I, Dubreuil P, Berger S, Salles B, Laurent G and Jaffrezou JP (2002) Kit signaling inhibits the sphingomyelin-ceramide pathway through PLC gamma 1: implication in stem cell factor radioprotective effect. Blood 100, 1294-1301. Maeda H, Yamagata A, Nishikawa S, Yoshinaga K, Kobayashi S, Nishi K and Nishikawa S (1992) Requirement of c-kit for development of intestinal pacemaker system. Development 116, 369-375. Markova B, Herrlich P, Rรถnnstrand L and Bรถhmer FD (2003) Identification of protein tyrosine phosphatases associating with the PDGF receptor.Biochemistry 42, 2691-2699. Masuhara M, Nagao K, Nishikawa M, Sasaki M, Yoshimura A and Osawa M (2000) Molecular cloning of murine STAP-1, the stem-cell-specific adaptor protein containing PH and SH2 domains. Biochem Biophys Res Commun 268, 697-703. McArdle L, Bergin O, Fallowfield ME, Dervan PA and Easty DJ (2003) Tyrosine phosphate in melanoma progression. Br J Dermatol 149, 289-295. Micke P, Basrai M, Faldum A, Bittinger F, Rรถnnstrand L, Blaukat A, Beeh KM, Oesch F, Fischer B, Buhl R and Hengstler JG (2003) Characterization of c-kit expression in small cell lung cancer: prognostic and therapeutic implications. Clin Cancer Res 9, 188-194. Miyazawa K, Williams DA, Gotoh A, Nishimaki J, Broxmeyer HE and Toyama K (1995) Membrane-bound Steel factor induces more persistent tyrosine kinase activation and longer life span of c-kit gene-encoded protein than its soluble form. Blood 85, 641-649. Mol CD, Dougan DR, Schneider TR, Skene RJ, Kraus ML, Scheibe DN, Snell GP, Zou H, Sang BC and Wilson KP (2004) Structural basis for the autoinhibition and STI-571 inhibition of c-Kit tyrosine kinase. J Biol Chem 279, 3165531663. Morrison P, Takishima K and Rosner MR (1993) Role of threonine residues in regulation of the epidermal growth factor receptor by protein kinase C and mitogen-activated protein kinase. J Biol Chem 268, 15536-15543. Motro B, Wojtowicz JM, Bernstein A and van der Kooy D (1996) Steel mutant mice are deficient in hippocampal learning but not long- term potentiation. Proc Natl Acad Sci U S A 93, 1808-1813. Mou S and Linnekin D (1999) Lyn is activated during late G1 of stem-cell-factor-induced cell cycle progression in haemopoietic cells. Biochem J 342, 163-170. Mouriaux F, Kherrouche Z, Maurage CA, Demailly FX, Labalette P and Saule S (2003) Expression of the c-kit receptor in choroidal melanomas. Melanoma Res 13, 161166. Murphy LO, Smith S, Chen RH, Fingar DC and Blenis J (2002) Molecular interpretation of ERK signal duration by immediate early gene products. Nat Cell Biol 4, 556-564. Nagar B, Bornmann WG, Pellicena P, Schindler T, Veach DR, Miller WT, Clarkson B and Kuriyan J (2002) Crystal structures of the kinase domain of c-Abl in complex with the small molecule inhibitors PD173955 and imatinib (STI-571) Cancer Res 62, 4236-4243. Neel BG, Gu H and Pao L (2003) The 'Shp'ing news: SH2 domain-containing tyrosine phosphatases in cell signaling. Trends Biochem Sci 28, 284-293. Ning Z, Li J, McGuinness M and Arceci RJ (2001) STAT3 activation is required for Asp816 mutant c-Kit induced tumorigenicity. Oncogene 20, 4528-4536. Nishida K, Wang L, Morii E, Park SJ, Narimatsu M, Itoh S, Yamasaki S, Fujishima M, Ishihara K, Hibi M, et al ( 2002)

Lennartsson et al: c-Kit signal transduction Requirement of Gab2 for mast cell development and KitL/cKit signaling. Blood 99, 1866-1869. Nishida K, Yoshida Y, Itoh M, Fukada T, Ohtani T, Shirogane T, Atsumi T, Takahashi-Tezuka M, Ishihara K, Hibi M and Hirano T (1999) Gab-family adapter proteins act downstream of cytokine and growth factor receptors and T- and B-cell antigen receptors. Blood 93, 1809-1816. Nishimura R, Li W, Kashishian A, Mondino A, Zhou M, Cooper J and Schlessinger J (1993) Two signaling molecules share a phosphotyrosine-containing binding site in the plateletderived growth factor receptor. Mol Cell Biol 13, 68896896. O'Farrell AM, Abrams TJ, Yuen HA, Ngai TJ, Louie SG, Yee KW, Wong LM, Hong W, Lee LB, Town A, et al (2003) SU11248 is a novel FLT3 tyrosine kinase inhibitor with potent activity in vitro and in vivo. Blood 101, 3597-3605. O'Farrell AM, Ichihara M, Mui AL and Miyajima A (1996) Signaling pathways activated in a unique mast cell line where interleukin-3 supports survival and stem cell factor is required for a proliferative response. Blood 87, 3655-3668. O'Farrell AM, Yuen HA, Smolich B, Hannah AL, Louie SG, Hong W, Stopeck AT, Silverman LR, Lancet JE, Karp JE, et al (2004) Effects of SU5416, a small molecule tyrosine kinase receptor inhibitor, on FLT3 expression and phosphorylation in patients with refractory acute myeloid leukemia. Leuk Res 28, 679-689. O'Laughlin-Bunner B, Radosevic N, Taylor ML, Shivakrupa, DeBerry C, Metcalfe DD, Zhou M, Lowell C and Linnekin D (2001) Lyn is required for normal stem cell factor-induced proliferation and chemotaxis of primary hematopoietic cells. Blood 98, 343-350. Ogawa M, Matsuzaki Y, Nishikawa S, Hayashi S, Kunisada T, Sudo T, Kina T, Nakauchi H and Nishikawa S (1991) Expression and function of c-kit in hemopoietic progenitor cells. J Exp Med 174, 63-71. Okada S, Nakauchi H, Nagayoshi K, Nishikawa S, Nishikawa S, Miura Y and Suda T (1991) Enrichment and characterization of murine hematopoietic stem cells that express c-kit molecule. Blood 78, 1706-1712. Oliveira S and Lukacs N (2003) Stem cell factor: a hemopoietic cytokine with important targets in asthma. Curr Drug Targets Inflamm Allergy 2, 313-318. Pan CX, Yang XJ, Lopez-Beltran A, Maclennan GT, Eble JN, Koch MO, Jones TD, Lin H, Nigro K, Papavero V, et al (2004) c-kit expression in small cell carcinoma of the urinary bladder: prognostic and therapeutic implications. Mod Pathol. Papayannopoulou T, Brice M, Broudy VC and Zsebo KM (1991) Isolation of c-kit receptor-expressing cells from bone marrow, peripheral blood and fetal liver: functional properties and composite antigenic profile. Blood 78, 14031412. Paronetto MP, Farini D, Sammarco I, Maturo G, Vespasiani G, Geremia R, Rossi P and Sette C (2004) Expression of a truncated form of the c-Kit tyrosine kinase receptor and activation of Src kinase in human prostatic cancer. Am J Pathol 164, 1243-1251. Paronetto MP, Venables JP, Elliott DJ, Geremia R, Rossi P and Sette C (2003) Tr-kit promotes the formation of a multimolecular complex composed by Fyn, PLCgamma1 and Sam68. Oncogene 22, 8707-8715. Pawson T (2004) Specificity in signal transduction: from phosphotyrosine-SH2 domain interactions to complex cellular systems. Cell 116, 191-203. Pawson T and Scott JD (1997) Signaling through scaffold, anchoring and adaptor proteins. Science 278, 2075-2080. Pearson MA, O'Farrell AM, Dexter TM, Whetton AD, OwenLynch PJ and Heyworth CM (1998) Investigation of the

molecular mechanisms underlying growth factor synergy: the role of ERK 2 activation in synergy. Growth Factors 15, 293-306. Perez-Losada J, Sanchez-Martin M, Perez-Caro M, PerezMancera PA and Sanchez-Garcia I (2003) The radioresistance biological function of the SCF/kit signaling pathway is mediated by the zinc-finger transcription factor Slug. Oncogene 22, 4205-4211. Perez-Losada J, Sanchez-Martin M, Rodriguez-Garcia A, Sanchez ML, Orfao A, Flores T and Sanchez-Garcia I (2002) Zinc-finger transcription factor Slug contributes to the function of the stem cell factor c-kit signaling pathway. Blood 100, 1274-1286. Peschard P and Park M (2003) Escape from Cbl-mediated downregulation: a recurrent theme for oncogenic deregulation of receptor tyrosine kinases. Cancer Cell 3, 519-523. Philo JS, Wen J, Wypych J, Schwartz MG, Mendiaz EA and Langley KE (1996) Human stem cell factor dimer forms a complex with two molecules of the extracellular domain of its receptor, Kit. J Biol Chem 271, 6895-6902. Piao X, Curtis JE, Minkin S, Minden MD and Bernstein A (1994) Expression of the Kit and KitA receptor isoforms in human acute myelogenous leukemia. Blood 83, 476-481. Pietsch T (1993) Paracrine and autocrine growth mechanisms of human stem cell factor (c-kit ligand) in myeloid leukemia. Nouv Rev Fr Hematol 35, 285-286. Plo I, Lautier D, Casteran N, Dubreuil P, Arock M and Laurent G (2001) Kit signaling and negative regulation of daunorubicin-induced apoptosis: role of phospholipase Cgamma. Oncogene 20, 6752-6763. Price DJ, Rivnay B, Fu Y, Jiang S, Avraham S and Avraham H (1997) Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated cKIT in megakaryocytes. J Biol Chem 272, 5915-5920. Price ER, Ding HF, Badalian T, Bhattacharya S, Takemoto C, Yao TP, Hemesath TJ and Fisher DE (1998) Lineagespecific signaling in melanocytes. C-kit stimulation recruits p300/CBP to microphthalmia. J Biol Chem 273, 1798317986. Prosser S, Sorokina E, Pratt P and Sorokin A (2003) CrkIII: a novel and biologically distinct member of the Crk family of adaptor proteins. Oncogene 22, 4799-4806. Qiu RG, Chen J, Kirn D, McCormick F and Symons M (1995) An essential role for Rac in Ras transformation. Nature 374, 457-459. Radosevic N, Winterstein D, Keller JR, Neubauer H, Pfeffer K and Linnekin D (2004) JAK2 Contributes to the Intrinsic Capacity of Primary Hematopoietic Cells to Respond to SCF. Exp Hematol 32, 149-156. Ravichandran KS (2001) Signaling via Shc family adapter proteins. Oncogene 20, 6322-6330. Reilly JT (2002) Class III receptor tyrosine kinases: role in leukaemogenesis. Br J Haematol 116, 744-757. Reith AD, Ellis C, Lyman SD anderson DM, Williams DE, Bernstein A and Pawson T (1991) Signal transduction by normal isoforms and W mutant variants of the Kit receptor tyrosine kinase. EMBO J 10, 2451-2459. Rodriguez-Viciana P, Warne PH, Khwaja A, Marte BM, Pappin D, Das P, Waterfield MD, Ridley A and Downward J (1997) Role of phosphoinositide 3-OH kinase in cell transformation and control of the actin cytoskeleton by Ras. Cell 89, 457467. Rohr UP, Rehfeld N, Pflugfelder L, Geddert H, Muller W, Steidl U, Fenk R, Graf T, Schott M, Thiele KP, et al (2004) Expression of the tyrosine kinase c-kit is an independent prognostic factor in patients with small cell lung cancer. Int J Cancer 111, 259-263.

Cancer Therapy Vol 3, page 25 Rรถnnstrand L, Arvidsson AK, Kallin A, Rorsman C, Hellman U, Engstrรถm U, Wernstedt C and Heldin CH (1999) SHP-2 binds to Tyr763 and Tyr1009 in the PDGF beta-receptor and mediates PDGF-induced activation of the Ras/MAP kinase pathway and chemotaxis. Oncogene 18, 3696-3702. Rossi P, Dolci S, Sette C and Geremia R (2003) Molecular mechanisms utilized by alternative c-kit gene products in the control of spermatogonial proliferation and sperm-mediated egg activation. Andrologia 35, 71-78. Rossi P, Marziali G, Albanesi C, Charlesworth A, Geremia R and Sorrentino V (1992) A novel c-kit transcript, potentially encoding a truncated receptor, originates within a kit gene intron in mouse spermatids. Dev Biol 152, 203-207. Rozakis-Adcock M, McGlade J, Mbamalu G, Pelicci G, Daly R, Li W, Batzer A, Thomas S, Brugge J, Pelicci PG and et al. (1992) Association of the Shc and Grb2/Sem5 SH2containing proteins is implicated in activation of the Ras pathway by tyrosine kinases. Nature 360, 689-692. Rubin BP, Singer S, Tsao C, Duensing A, Lux ML, Ruiz R, Hibbard MK, Chen CJ, Xiao S, Tuveson DA, et al (2001) KIT activation is a ubiquitous feature of gastrointestinal stromal tumors. Cancer Res 61, 8118-8121. Russell ES (1979) Hereditary anemias of the mouse: a review for geneticists. Adv Genet 20, 357-459. Ryan JJ, Huang H, McReynolds LJ, Shelburne C, Hu-Li J, Huff TF and Paul WE (1997) Stem cell factor activates STAT-5 DNA binding in IL-3-derived bone marrow mast cells. Exp Hematol 25, 357-362. Sattler M, Salgia R, Shrikhande G, Verma S, Pisick E, Prasad KV and Griffin JD (1997) Steel factor induces tyrosine phosphorylation of CRKL and binding of CRKL to a complex containing c-kit, phosphatidylinositol 3-kinase and p120(CBL) J Biol Chem 272, 10248-10253. Scott G, Ewing J, Ryan D and Abboud C (1994) Stem cell factor regulates human melanocyte-matrix interactions. Pigment Cell Res 7, 44-51. Sekido Y, Obata Y, Ueda R, Hida T, Suyama M, Shimokata K, Ariyoshi Y and Takahashi T (1991) Preferential expression of c-kit protooncogene transcripts in small cell lung cancer. Cancer Res 51, 2416-2419. Serve H, Yee NS, Stella G, Sepp-Lorenzino L, Tan JC and Besmer P (1995) Differential roles of PI3-kinase and kit tyrosine 821 in kit receptor-mediated proliferation, survival and cell adhesion in mast cells. EMBO J 14, 473-483. Sette C, Bevilacqua A, Bianchini A, Mangia F, Geremia R and Rossi P (1997) Parthenogenetic activation of mouse eggs by microinjection of a truncated c-kit tyrosine kinase present in spermatozoa. Development 124, 2267-2274. Sette C, Bevilacqua A, Geremia R and Rossi P (1998) Involvement of phospholipase Cgamma1 in mouse egg activation induced by a truncated form of the C-kit tyrosine kinase present in spermatozoa. J Cell Biol 142, 1063-1074. Sette C, Paronetto MP, Barchi M, Bevilacqua A, Geremia R and Rossi P (2002) Tr-kit-induced resumption of the cell cycle in mouse eggs requires activation of a Src-like kinase. EMBO J 21, 5386-5395. Shah N and Sawyers C (2003) Mechanisms of resistance to STI571 in Philadelphia chromosome-associated leukemias. Oncogene 22, 7389-7395. Shultz LD, Schweitzer PA, Rajan TV, Yi T, Ihle JN, Matthews RJ, Thomas ML and Beier DR (1993) Mutations at the murine motheaten locus are within the hematopoietic cell protein-tyrosine phosphatase (Hcph) gene. Cell 73, 14451454. Sivalenka RR and Jessberger R (2004) Swap-70 regulates c-kitinduced mast cell activation, cell-cell adhesion, and migration Mol Cell Biol 24, 10277-10288

Smith CI, Islam TC, Mattsson PT, Mohamed AJ, Nore BF and Vihinen M (2001) The Tec family of cytoplasmic tyrosine kinases: mammalian Btk, Bmx, Itk, Tec, Txk and homologs in other species. Bioessays 23, 436-446. Smolich BD, Yuen HA, West KA, Giles FJ, Albitar M and Cherrington JM (2001) The antiangiogenic protein kinase inhibitors SU5416 and SU6668 inhibit the SCF receptor (ckit) in a human myeloid leukemia cell line and in acute myeloid leukemia blasts. Blood 97, 1413-1421. Sonnenblick A, Levy C and Razin E (2004) Interplay between MITF, PIAS3 and STAT3 in Mast Cells and Melanocytes. Mol Cell Biol 24, 10584-10592. Spritz R (1994) Molecular basis of human piebaldism. J Invest Dermatol 103, 137S-140S. Stupp R, Monnerat C, Turrisi AT, 3rd, Perry MC and Leyvraz S (2004) Small cell lung cancer: state of the art and future perspectives. Lung Cancer 45, 105-117. Sun L, Lee J and Fine HA (2004) Neuronally expressed stem cell factor induces neural stem cell migration to areas of brain injury. J Clin Invest 113, 1364-1374. Takaki S, Sauer K, Iritani BM, Chien S, Ebihara Y, Tsuji K, Takatsu K and Perlmutter RM (2000) Control of B cell production by the adaptor protein lnk. Definition Of a conserved family of signal-modulating proteins. Immunity 13, 599-609. Tamborini E, Bonadiman L, Greco A, Albertini V, Negri T, Gronchi A, Bertulli R, Colecchia M, Casali PG, Pierotti MA and Pilotti S (2004) A new mutation in the KIT ATP pocket causes acquired resistance to imatinib in a gastrointestinal stromal tumor patient. Gastroenterology 127, 294-299. Tan BL, Yazicioglu MN, Ingram D, McCarthy J, Borneo J, Williams DA and Kapur R (2003) Genetic evidence for convergence of c-Kit- and a4 integrin-mediated signals on class Ia PI-3kinase and the rac pathway in regulating integrin-directed migration in mast cells. Blood 101, 47254732. Tanaka A, Konno M, Muto S, Kambe N, Morii E, Nakahata T, Itai A and Matsuda H (2004) A novel NF-%B inhibitor, IMD0354, suppresses neoplastic proliferation of human mast cells with constitutively activated c-kit receptors. Blood. Tang B, Mano H, Yi T and Ihle JN (1994) Tec kinase associates with c-kit and is tyrosine phosphorylated and activated following stem cell factor binding. Mol Cell Biol 14, 84328437. Taniguchi Y, London R, Schinkmann K, Jiang S and Avraham H (1999) The receptor protein tyrosine phosphatase, PTP-RO, is upregulated during megakaryocyte differentiation and Is associated with the c-Kit receptor. Blood 94, 539-549. Tauchi T, Boswell HS, Leibowitz D and Broxmeyer HE (1994a) Coupling between p210bcr-abl and Shc and Grb2 adaptor proteins in hematopoietic cells permits growth factor receptor-independent link to ras activation pathway. J Exp Med 179, 167-175. Tauchi T, Feng GS, Marshall MS, Shen R, Mantel C, Pawson T and Broxmeyer HE (1994b) The ubiquitously expressed Syp phosphatase interacts with c-kit and Grb2 in hematopoietic cells. J Biol Chem 269, 25206-25211. Thรถmmes K, Lennartsson J, Carlberg M and Rรถnnstrand L (1999) Identification of Tyr-703 and Tyr-936 as the primary association sites for Grb2 and Grb7 in the c-Kit/stem cell factor receptor. Biochem J 341, 211-216. Tian Q, Frierson HF, Jr., Krystal GW and Moskaluk CA (1999) Activating c-kit gene mutations in human germ cell tumors. Am J Pathol 154, 1643-1647. Timokhina I, Kissel H, Stella G and Besmer P (1998) Kit signaling through PI 3-kinase and Src kinase pathways: an essential role for Rac1 and JNK activation in mast cell proliferation. EMBO J 17, 6250-6262.

Lennartsson et al: c-Kit signal transduction Torrent M, Rickert K, Pan BS and Sepp-Lorenzino L (2004) Analysis of the activating mutations within the activation loop of leukemia targets Flt-3 and c-Kit based on protein homology modeling. J Mol Graph Model 23, 153-165. Trieselmann NZ, Soboloff J and Berger SA (2003) Mast cells stimulated by membrane-bound, but not soluble, steel factor are dependent on phospholipase C activation. Cell Mol Life Sci 60, 759-766. Tuveson DA, Willis NA, Jacks T, Griffin JD, Singer S, Fletcher CD, Fletcher JA and Demetri GD (2001) STI571 inactivation of the gastrointestinal stromal tumor c-KIT oncoprotein: biological and clinical implications. Oncogene 20, 50545058. Ueda S, Mizuki M, Ikeda H, Tsujimura T, Matsumura I, Nakano K, Daino H, Honda Z, Sonoyama J, Shibayama H, et al (2002) Critical roles of c-kit tyrosine residues 567 and 719 in stem cell factor-induced chemotaxis: contribution of src family kinase and PI3-kinase on calcium mobilization and cell migration. Blood 99, 3342-3349. Ueki K, Fruman DA, Brachmann SM, Tseng YH, Cantley LC and Kahn CR (2002) Molecular balance between the regulatory and catalytic subunits of phosphoinositide 3kinase regulates cell signaling and survival. Mol Cell Biol 22, 965-977. Ulivi P, Zoli W, Medri L, Amadori D, Saragoni L, Barbanti F, Calistri D and Silvestrini R (2004) c-kit and SCF expression in normal and tumor breast tissue. Breast Cancer Res Treat 83, 33-42. Wakioka T, Sasaki A, Mitsui K, Yokouchi M, Inoue A, Komiya S and Yoshimura A (1999) APS, an adaptor protein containing Pleckstrin homology (PH) and Src homology-2 (SH2) domains inhibits the JAK-STAT pathway in collaboration with c-Cbl. Leukemia 13, 760-767. van Dijk TB, van Den Akker E, Amelsvoort MP, Mano H, Lowenberg B and von Lindern M (2000) Stem cell factor induces phosphatidylinositol 3'-kinase-dependent Lyn/Tec/Dok-1 complex formation in hematopoietic cells. Blood 96, 3406-3413. Wandzioch E, Edling CE, Palmer RH, Carlsson L and Hallberg B (2004) Activation of the MAP kinase pathway by c-Kit is PI-3 kinase dependent in hematopoietic progenitor/stem cell lines. Blood 104, 51-57. Wang L, Vargas H and French SW (2000) Cellular origin of gastrointestinal stromal tumors: a study of 27 cases. Arch Pathol Lab Med 124, 1471-1475. Wang WL, Healy ME, Sattler M, Verma S, Lin J, Maulik G, Stiles CD, Griffin JD, Johnson BE and Salgia R (2000) Growth inhibition and modulation of kinase pathways of small cell lung cancer cell lines by the novel tyrosine kinase inhibitor STI 571. Oncogene 19, 3521-3528. Ward SM, Burns AJ, Torihashi S, Harney SC and Sanders KM (1995) Impaired development of interstitial cells and intestinal electrical rhythmicity in steel mutants. Am J Physiol 269, C1577-C1585. Ward SM, Burns AJ, Torihashi S and Sanders KM (1994) Mutation of the proto-oncogene c-kit blocks development of interstitial cells and electrical rhythmicity in murine intestine. J Physiol 480 (Pt 1), 91-97. Waskow C, Paul S, Haller C, Gassmann M and Rodewald H (2002) Viable c-Kit(W/W) mutants reveal pivotal role for ckit in the maintenance of lymphopoiesis. Immunity 17, 277288. Waskow C, Terszowski G, Costa C, Gassmann M and Rodewald HR (2004) Rescue of lethal c-KitW/W mice by erythropoietin. Blood 104, 1688-1695. Wehrle-Haller B (2003) The role of Kit-ligand in melanocyte development and epidermal homeostasis. Pigment Cell Res 16, 287-296.

Weilbaecher KN, Motyckova G, Huber WE, Takemoto CM, Hemesath TJ, Xu Y, Hershey CL, Dowland NR, Wells AG and Fisher DE (2001) Linkage of M-CSF signaling to Mitf, TFE3 and the osteoclast defect in Mitf(mi/mi) mice. Mol Cell 8, 749-758. Weiler SR, Mou S, DeBerry CS, Keller JR, Ruscetti FW, Ferris DK, Longo DL and Linnekin D (1996) JAK2 is associated with the c-kit proto-oncogene product and is phosphorylated in response to stem cell factor. Blood 87, 3688-3693. Weisberg E and Griffin JD (2001) Mechanisms of resistance imatinib (STI571) in preclinical models and in leukemia patients. Drug Resist Updat 4, 22-28. Welker P, Schadendorf D, Artuc M, Grabbe J and Henz BM (2000) Expression of SCF splice variants in human melanocytes and melanoma cell lines: potential prognostic implications. Br J Cancer 82, 1453-1458. Williams DE, Eisenman J, Baird A, Rauch C, Van Ness K, March CJ, Park LS, Martin U, Mochizuki DY, Boswell HS and et al. (1990) Identification of a ligand for the c-kit protooncogene. Cell 63, 167-174. Wisniewski D, Strife A and Clarkson B (1996) c-kit ligand stimulates tyrosine phosphorylation of the c-Cbl protein in human hematopoietic cells. Leukemia 10, 1436-1442. Vitali R, Cesi V, Nicotra MR, McDowell HP, Donfrancesco A, Mannarino O, Natali PG, Raschella G and Dominici C (2003) c-Kit is preferentially expressed in MYCN-amplified neuroblastoma and its effect on cell proliferation is inhibited in vitro by STI-571. Int J Cancer 106, 147-152. Wollberg P, Lennartsson J, Gottfridsson E, Yoshimura A and Rรถnnstrand L (2003) The adapter protein APS associates to the multifunctional docking sites Tyr568 and Tyr936 in cKit: possible role in v-Kit transformation. Biochem J 370, 1033-1038. Wormald S and Hilton DJ (2004) Inhibitors of cytokine signal transduction. J Biol Chem 279, 821-824. Vosseller K, Stella G, Yee NS and Besmer P (1997) c-kit receptor signaling through its phosphatidylinositide-3'kinase- binding site and protein kinase C: role in mast cell enhancement of degranulation, adhesion and membrane ruffling. Mol Biol Cell 8, 909-922. Voytyuk O, Lennartsson J, Mogi A, Caruana G, Courtneidge S, Ashman LK and Rรถnnstrand L (2003) Src family kinases are involved in the differential signaling from two splice forms of c-Kit. J Biol Chem 278, 9159-9166. Wu M, Hemesath TJ, Takemoto CM, Horstmann MA, Wells AG, Price ER, Fisher DZ and Fisher DE (2000) c-Kit triggers dual phosphorylations, which couple activation and degradation of the essential melanocyte factor Mi. Genes Dev 14, 301-312. Yamanashi Y, Tamura T, Kanamori T, Yamane H, Nariuchi H, Yamamoto T and Baltimore D (2000) Role of the rasGAPassociated docking protein p62(dok) in negative regulation of B cell receptor-mediated signaling. Genes Dev 14, 11-16. Yarden Y, Kuang WJ, Yang-Feng T, Coussens L, Munemitsu S, Dull TJ, Chen E, Schlessinger J, Francke U and Ullrich A (1987) Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand. EMBO J 6, 3341-3351. Yared MA, Middleton LP, Meric F, Cristofanilli M and Sahin AA (2004) Expression of c-kit proto-oncogene product in breast tissue. Breast J 10, 323-327. Yee NS, Hsiau CW, Serve H, Vosseller K and Besmer P (1994) Mechanism of down-regulation of c-kit receptor. Roles of receptor tyrosine kinase, phosphatidylinositol 3'-kinase and protein kinase C. J Biol Chem 269, 31991-31998. Yee NS, Langen H and Besmer P (1993) Mechanism of kit ligand, phorbol ester and calcium-induced down- regulation

Cancer Therapy Vol 3, page 27 of c-kit receptors in mast cells. J Biol Chem 268, 1418914201. Yi T and Ihle JN (1993) Association of hematopoietic cell phosphatase with c-Kit after stimulation with c-Kit ligand. Mol Cell Biol 13, 3350-3358. Yokouchi M, Kondo T, Sanjay A, Houghton A, Yoshimura A, Komiya S, Zhang H and Baron R (2001) Src-catalyzed phosphorylation of c-Cbl leads to the interdependent ubiquitination of both proteins. J Biol Chem 276, 3518535193. Yokouchi M, Suzuki R, Masuhara M, Komiya S, Inoue A and Yoshimura A (1997) Cloning and characterization of APS, an adaptor molecule containing PH and SH2 domains that is tyrosine phosphorylated upon B-cell receptor stimulation. Oncogene 15, 7-15. Yokouchi M, Wakioka T, Sakamoto H, Yasukawa H, Ohtsuka S, Sasaki A, Ohtsubo M, Valius M, Inoue A, Komiya S and Yoshimura A (1999) APS, an adaptor protein containing PH and SH2 domains, is associated with the PDGF receptor and c-Cbl and inhibits PDGF-induced mitogenesis. Oncogene 18, 759-767. Zeng S, Xu Z, Lipkowitz S and Longley JB (2004) Regulation of stem cell factor receptor signaling by CBL family proteins (CBL-B/c-CBL) Blood. Zermati Y, De Sepulveda P, Feger F, Letard S, Kersual J, Casteran N, Gorochov G, Dy M, Dumas AR, Dorgham K, et al (2003) Effect of tyrosine kinase inhibitor STI571 on the kinase activity of wild-type and various mutated c-kit

receptors found in mast cell neoplasms. Oncogene 22, 660664. Zhu WM, Dong WF and Minden M (1994) Alternate splicing creates two forms of the human kit protein. Leuk Lymphoma 12, 441-447.

Lars Rรถnnstrand

Johan Lennartsson

Lennartsson et al: c-Kit signal transduction

Cancer Therapy Vol 3, page 29 Cancer Therapy Vol 3, 29-30, 2005

Miliary tuberculosis peritonitis mimicking advanced ovarian cancer Case Report

Malihe Hasanzadeh* and Hasan Malekoti Gynecology Oncology, Mashhad University of Medical Sciences, Mashhad, Iran.

__________________________________________________________________________________ *Correspondence: Malihe Hasanzadeh, Obstetric Gynecology Department Cheam Hospital, Mashhad, Iran.Phon/Fax: 98-511-8409612; e-mail:Malhasanzadeh@yahoo.com Key words: Ovarian cancer, Peritoneal Tuberculosis, Abdominal mass, CA-125 Received: 17 January 2005; Accepted: 28 January 2005; electronically published: February 2005

Summary Primary peritoneal tuberculosis is a rare presentation of this disease. It is usually associated with ascites, raised CA125 levels and abdominal mass. A patient with a pelvic mass, ascites, raised CA-125 underwent an exploratory laparatomy for presumed ovarian cancer. Final pathology revealed peritoneal tuberculosis without any pulmonary involvement. Acid -Fast bacilli were confirmed with polymerase chain reaction in the surgical specimen. This case demonstrated a high rate of misdiagnosis between advanced ovarian cancer and peritoneal tuberculosis. An elevated CA- 125 is not specific for ovarian malignancy. In her first visit, she had abdominal pain and increasing abdominal girth and weigh loss (20 pound) from 3 month ago. CT-Scan showed a huge heterogenic ovarian mass (solid-cystic components). Serum CA125 was elevated at 200(u/ml). The patient had any history of fever, chills, night sweats. The patient's family history was significant for a brother who treated tuberculosis 2 year ago. Laboratory data revealed a normal white blood cell count. A preoperative chest X-ray was normal. The patient underwent an exploratory laparatomy.We could not enter to abdominal cavity. There are disseminated nodules in the peritoneum of the parietal wall. The specimen send to pathologic department, frozen section was performed. Pathology revealed chronic granulomatous changes and no malignancy. Post operatively all sputum samples, blood cultures and peritoneal fluid analyses were negative for acid-fast bacilli. Polymerase chain reaction was positive for acidfast bacilli in the surgical tissue specimen. The patient was treated with Isoniazid, Rifampicin, Pyrazinamide and Etamburol. After 4 months, in her visit abdominal mass was disappeared. Treatment continued for 1 year.

I. Introduction Ovarian cancer is the leading cause of death from gynecologic malignancies. Because early ovarian cancer produces few specific symptoms, most women present with advanced stage disease where the prognosis is poor. Although there have been advanced in the evaluation and treatment of ovarian cancer, most patients continue to present with advanced disease when survival is limited (Disaia and Creasman, 2002). Annual serum CA-125 levels, pelvic examination and transvaginal ultrasound are being used for screening, has not adequate sensitivity or specificity (Karl and Platt, 1995). In advanced stages, there are many nonspecific signs and symptoms and we require surgery and pathologic evaluation for diagnosis. Tuberculosis of the peritoneum is a rare disease. There are several case reports that point to uncertainly in the preoperative differential diagnosis of peritoneal tuberculosis and advanced ovarian cancer (Lachman et al, 1985; Gurgan et al, 1993; Groutz et al, 1998). This paper presents one additional case of peritoneal tuberculosis and emphasize that we must be careful when interpreting a positive results.

III. Discussion

II. Case

This patient is a case of tuberculosis peritonitis diagnosed with tissue pathology. Peritoneal tuberculosis is one of the generalized pathologies that present with nonspecific sign and symptoms such as ascites and pelvic,

In May 2002,a 22 year old woman(primiparous)was referred to obstetric Gynecology Department in Ghaem hospital, Mashhad, Iran.

Hasanzadeh and Malekoti: Miliary tuberculosis peritonitis mimicking advanced ovarian cancer abdominal pain and mass, which mimic ovarian cancer (Martin and Bradsher, 1986). The pelvic tuberculosis most often in patients between the ages of 20 and 40 years. Ovarian cancer is rare before the age of 40 and peaks at age 65 to 75 (Sutherland, 1980). An elevated serum CA-125 level in a patient with a pelvic mass and ascites raises the suspicion of ovarian cancer (Gurgan et al, 1993). Many malignancies that are not ovarian, such as endometrial and gastrointestinal adenocarcinoma,have also been associated with elevated serum CA-125 levels (Kramer et al, 1993; Simsek et al, 1996). Differential diagnosis in elevated serum CA-125 is extremely difficult and needs surgical intervention. Futhermore,elevation in CA-125 serum levels are present in a number of benign ovarian tumors, including endometrioma, inflammatory disease of the ovaries and serous cyst adenoma (Barbieri et al, 1986). More than two thirds of the cases (tuberculosis peritonitis) are diagnosed at the time of laparatomy performed for some other diagnosis. This disease should be included in the differential diagnosis of this devastating malignancy, especially in developing countries where it remains endemic. Progression of tuberculosis peritonitis often takes months or even years. Chest Roentgenograms are not of help either in distinguishing patients with Tuberculosis peritonitis (Bhansali, 1977). Son graphic features of tuberculosis peritonitis illustrate adenexal mass, adhesions and septated or particulate ascites (Kramer et al, 1993). In computerized tomography examination, presence of a smooth peritoneum with minimal thickening and pronounced enhancement suggest peritoneal tuberculosis, where as nodular implants and irregular peritoneal thickening suggest peritoneal carcinomatosis (Rodriguez and Pombo, 1996). The literature reports other cases of tuberculosis peritonitis diagnosed solely by tissue pathology. Final pathology provided the crucial information and diagnosis for this patient. Frozen section can be used to confirm malignancy intraoperatively (Straughn et al, 2000). In this case frozen section would have revealed chronic granulomatous reaction and inflammation which would be consistent but not diagnostic for tuberculosis. Histology confirmation of Tuberculosis peritonitis can be difficult, but the lack of malignant cell would have made extra ovarian carcinoma less likely.

In addition standard microscopic section, the specimen can be examined by fluorescent antibody technique. Acid-fast Staining of tissue is effective in detecting the organism (Bilgin et al, 2001). Tuberculosis peritonitis should be considered in the differential diagnosis of a patient with pelvic mass and elevated CA-125.

References Barbieri RL, Niloff JM, Bast RC, Schaetzl E, Kistner RW, Knapp RC (1986) Elevated serum concentrations of CA-125 in patients with advanced endometriosis. Fertil 45, 630-40. Bhansali SK (1977) Abdominal tuberculosis. Am J Gastroenterol 67, 324-37. Bilgin T, Karabay A, Dolar E, Develioglu OH (2001) Peritoneal tuberculosis with pelvic abdominal mass, ascites and elevated CA-125 mimicking advanced ovarian carcinoma: A series of 10 cases. Int J Gynecol Cancer 11, 290-294. Disaia PJ, Creasman W (2002) Epithelial ovarian cancer, in Disaia PJ, Creasman WT editors.Clin Gynecology Oncol, Sixth ed.St.louis Mosby-year book, pp 289-351. Groutz A, Carmon E, Gat E (1998) Peritoneal tuberculosis versus advanced ovarian cancer: a diagnostic dilemma. Obstet Gynecol 91, 868. Gurgan T, Zeyneloglu H, Urman B, Develioglu O, Yarah H (1993) Pelvic peritoneal tuberculosis with elevated serum and peritoneal fluid CA-125 levels. Gynecol Obstetric Invest 53, 60-1. Karl BY, Platt LD (1995) Ovarian cancer screening. The role of ultrasound in early detection of ovarian cancer. Cancer 76, 2011-5. Kramer BS, Gohagan J, Prorok PC, Smart C (1993) A national cancer institute sponsored trial for prostatic, lung, colorectal and ovarian cancers. Cancer 71, 589-93. Lachman E, Moodley J, Pitsoe SB (1985) Peritoneal tuberculosis initiating ovarian carcinoma (special category). Acta Obstetric Gynecol Scand 64, 677-79. Martin RE, Bradsher RW (1986) Elusive diagnosis of tuberculosis peritonitis. South Med J 79, 1076-1079. Rodriguez E, Pombo E (1996) Peritoneal tuberculosis versus peritoneal carcinomatosis: distinction based on CT findings. J Comput Assist Tomogr 20, 269-72. Simsek H, Kadayifci A, Okan E (1996) Importance of serum CA-125 levels in malignant peritoneal mesothelioma. Tumor Biol 17, 1-4. Straughn JM, Robertson ME, Partridge EE (2000) Case Report: A patient presenting with a pelvic mass, Elevated CA-125 and fever. Gynecol Oncol 77, 471-472. Sutherland AM (1980) Surgical treatment of tuberculosis of the female genital tract. Br J Obstetric Gynecol 87, 610-612.

Cancer Therapy Vol 3, page 31 Cancer Therapy Vol 3, 31-40, 2005

Quality of surgery in soft tissue sarcoma: a single centre experience with the French Sarcoma Group (FSG) surgical system Research Article 1

Eberhard Stoeckle *, Jean-Michel Coindre , Guy Kantor , Laurence Thomas , 1 3 4 5 Antoine Avril , Philippe Lagarde , Michèle Kind , Binh Nguyen Bui 1

Department of Surgery,

Department of Pathology,

Department of Radiotherapy,

Department of Radiology,

Department of Medicine, Institut Bergonié, Regional Cancer Centre, 33076 Bordeaux Cedex, France

__________________________________________________________________________________ *Correspondence: Dr. E. Stoeckle, Department of Surgery, Institut Bergonié, Regional Cancer Centre, 229 cours de l’Argonne, 33076 Bordeaux Cedex, France; Phone: (33) 5 56 33 33 33; Fax: (33) 5 56 33 33 87; E-mail: stoeckle@bergonie.org Key words: Soft tissue sarcoma, Local recurrence, Quality of surgery, French Sarcoma Group (FSG), FSG surgical system, Resection type, UICC, Abbreviations: co-operative group of surgical oncology, (CAO); External beam radiotherapy, (EBRT); French Federation of Cancer Centres, (FNCLCC); French Sarcoma Group, (FSG); local recurrence, (LR); patients, (pts.); soft tissue sarcoma, (STS) Received: 24 January 2005; revised: 28 January 2005 Accepted: 1 February 2005; electronically published: February 2005

Summary The UICC recommends to report results of surgery in soft tissue sarcoma (STS) according resection type (R), but does not indicate how to determine (R). For this purpose, the French Sarcoma Group (FSG) developed a surgical system, based on a collective determination of (R), evaluated here in a single institution. One hundred ten patients (pts.) with primary trunk wall and extremity STS operated consecutively at Institut Bergonié from 1996 to 1999 were prospectively allocated to resection types (R) by FSG criteria. Evaluation of the FSG system was based on repartition of resection types (R) and on local recurrence rates according to resection types (R). There were 75 (68%) resections R0, 32 (29%) resections R1 and 3 (3%) resections R2. Repartition of resection type (R) depended on tumour invasion. At a median follow-up of 70 months (range: 43 - 106 months) for surviving pts., local recurrence (LR) occurred in 10/107 pts (9%) with initial gross excisions, giving an actuarial local control rate of 91% at 5 years. LR was 4% (3/75 pts.) after resection R0 and 22% (7/32 pts.) after resection R1 (p< 0,01). By this system, patients R0 can be foreseen not to recur locally in 96% of cases, whereas patients R1 harbour a 22% risk of LR. The FSG surgical system combines simplicity and accuracy in determining quality of surgery. Highly predictive of local outcome, it may be useful in decision making concerning multidisciplinary treatment and help to improve local outcome of STS.

UICC does not give instructions, how to determine resection type (R)! Therefore, quality of surgery in STS is often determined individually by either surgeons or pathologists. Surgeons mostly transpose Enneking’s classification (Enneking et al, 1980) to the Rclassification, meaning wide margins = R0, close margins = R1 and intra-lesional excision = R2. However, surgeons

I. Introduction Reporting quality of surgery in soft tissue sarcoma (STS) should be done according resection - type (R) as recommended by the UICC (Union Internationale Contre le Cancer), meaning resection R0 = in sano, resection R1 = microscopic residual disease, resection R2 = macroscopic residual disease (Hermanek et al, 1992). However, the 31

Stoeckle et al: French Surgical System in sarcoma tend to overestimate quality of surgery. This fact has been demonstrated in an overview of practice within the German co-operative group of surgical oncology (CAO) by Junginger, et al (2001), where resection rates R0 are reported in up to 82% of assessable extremity sarcoma and in 64% of retroperitoneal sarcoma, a rate hardly achievable in this localisation (Stoeckle et al, 2001). Pathologists, on the other hand, do not see the ongoing of excision, but a post-operative specimen. Analysis of margins can be erroneous, especially after shrinkage of the specimen, giving falsely view to the tumour capsule, due to the retraction of muscles initially covering the tumour surface. Currently however, in about half of cases of re-excisions recommended for contaminated margins, no residual tumour is found in the re-excision specimen. Hence, at a period where soft tissue sarcoma are treated conservatively by a multidisciplinary approach (Rosenberg et al, 1982; Brennan et al, 1987; Sarcoma Meta-Analysis, 1997; Yang et al, 1998), an inexact appreciation of quality of surgery, either by overor underestimation, leads to inadequate treatment, concluding either to over- or undertreatment. The consequences are excessive sequels or high local recurrence rates. Moreover, the results of the different series are to be considered with caution as the initial definitions may differ. In order to clarify reporting of surgical results in soft tissue sarcoma, the French Sarcoma Group (FSG) decided to elaborate a surgical system deemed to be easily reproducible. A first step consisted in 1995 to review retrospectively ten operation forms of sarcoma patients in each of the eight participating centres in order to gather pertinent information about surgery. As a result, technique of surgery was well described, but information concerning the tumour (size, localisation, depth) was sparse and

moreover, quality of surgery mostly could not be determined correctly. A check-list of surgery reporting was therefore established (Table 1). Importance was given to descriptive items, asking the surgeon to describe excision, but not to interpret it. Essential terms for this purpose were the notions whether the tumour was seen, whether there was rupture of tumour and how theses critical margins were managed. Good acceptance of this check-list was confirmed after a multicentric survey by questionnaire. It confirmed reliability to pathological findings especially in primary operations, whereas more difficulties were seen in re-excisions (Stoeckle et al, 1997). A third step consisted to establish recommendations for pathological reporting in soft tissue sarcoma (Ghnassia et al, 1998) (Table 2). Finally, the FSG recommended to determine quality of surgery collegially according resection type R, by confronting surgical and pathological reports, at a regular common staff meeting. This procedure was aimed to gain more objectivity in defining quality of surgery by confronting purely descriptive reports from each, surgeon and pathologist, allocating surgery to resection type (R) as a result of a consensual decision. At Institut Bergonié, one of the participating centres to FSG, this procedure was introduced in 1996. The objective of the present study is to report the prospective experience with the FSG surgical system in this single centre. Endpoints considered for validation of the procedure were distribution of resection types (R) and local recurrence (LR) rates, reflecting finally optimal adequacy between result of surgery and complementary treatment. To obtain sufficient follow-up data, the four-year period from 1996 to 1999 was considered for analysis. The final follow-up date was December 2004.

Table 1. FSG check-list for surgery reporting in soft tissue sarcoma The operative form is established according to the surgeon’s own practice. For soft tissue sarcoma, the following informations should figure systematically: 1. Title of operation 2. Clinical presentation • tumour size • tumour depth/fascia 3. What has been done? • excised structures (muscles, nerves, vessels, organs). • tumour bed marked • description of tumour (if seen): pseudcapsula, focality, site 4. Conclusion: what remains? • excision complete?

yes/no

• tumour seen?

yes/no? site? re-excision?

• rupture of tumour?

yes/no? site? re-excision?

• margins?

site? quality? distance (mm)?

Cancer Therapy Vol 3, page 33 Table 2. FSG recommendations for pathology reporting in soft tissue sarcoma (from (Ghnassia et al, 1998), modified) 1. Presentation of operative specimen • fresh, unprepared specimen (avoid picric acid) • presentation following previous agreement with surgeon • do not change afterwards 2. Pathological report • Macroscopy – tumour size – depth/fascia • Microscopy – confirmation of malignancy – histological type – histological grade – local extension: focality, neurovascular involvement, tumour emboli • Status of margins – localisation of nearest margin – description of margins: distance (in mm), quality (fascia) – status of complementary margins 3. Conclusion (descriptive, do not interpret quality of surgery!) • Definition of tumour type and grade • Description of margins (distance in mm, quality) primary treatment failure: (1) one patient with an extensive, rapidly growing, inoperable radiation-induced sarcoma of the thoracic wall had primary excisional biopsy only and progressed under chemotherapy; (2) one patient with an advanced angiosarcoma of the forearm refused amputation and underwent incomplete, conservative surgery; (3) one patient with an advanced liposarcoma of the groin involving the femoral bifurcation underwent two successive incomplete surgeries and refused proposed amputation. Post-operative radiotherapy was indicated after resection of deep tumours (stages T1b and T2b). Twelve patients with deep tumours did not undergo irradiation because of previous radiotherapy in 4 cases, post-operative complications in 4 cases, palliative treatment in three cases, refusal in one case. Eighty seven patients (79%) underwent post-operative radiotherapy. The treatment volume included the tumour compartment when present, comprising the tendons and insertions of the muscles involved, but sparing a strip of unirradiated tissue in the extremities. External beam radiotherapy (EBRT) was delivered by high energy photons from a linear accelerator in accordance with a technique described elsewhere (Lagarde et al, 1990). Treatment recommendations at our Institut required a dose of 50 Gy after resections R0, whereas a complementary boost was indicated after resections R1, either by post-operative radiotherapy, delivering 10 Gy to a reduced volume in the tumour bed, or by afterloading brachytherapy delivering 15 Gy according to a technique described elsewhere (Thomas et al, 1994). In cases of previous brachytherapy, the dose of postoperative radiotherapy was lowered to 45 Gy. Twenty seven patients received a radiation boost, 15 in patients R1, 12 in patients R0. The total delivered radiation dose was 52 Gy (range: 44-65 Gy). Apart from the indication as first-line treatment in patients with locally advanced tumours, complementary chemotherapy was usually recommended for criteria other than quality of surgery (e.g. metastatic presentation, high tumour grade, highrisk pathology). During the study period, an anthracyclin-based chemotherapy was used, mostly by combination chemotherapy with the MAID regimen (Mesna, Doxorubicin 60 mg/m2, Ifosfamide 7.5 mg/m2, Dacarbazine 900 mg/m2; days 1-3), exceptionally with Doxorubicin alone.

II. Materials and methods A. Selection of patients From January 1996 to December 1999, all consecutive patients undergoing resection of primary STS at Institut Bergonié, a regional cancer centre in south west of France, were prospectively included in the study. For the present analysis, only primary STS of the extremities and trunk wall, operated first at the centre, or re-operated after referral, were considered. This excluded patients operated elsewhere and having subsequent, non surgical treatment at our Institut, patients with other locations of STS, or not true soft tissue sarcoma, e.g. fibromatosis, and patients with recurrent STS. One hundred and ten patients fulfilled the inclusion criteria and are analysed here.

B. Patient and tumour characteristics (Table 3) There were 54 females and 56 males. Median age was 60 years (range: 15-84 years). Median tumour size was 10 cm (range: 2-30 cm). Malignant fibrous histiocytoma, liposarcoma and leiomyosarcoma predominated among a wide variety of histopathologic subtypes. Most tumours were high grade and deep. Locally advanced disease, as defined by neurovascular or bone involvement, multifocal spread or both, was present in 37% of patients. Four patients had sarcoma located within radiation fields. Table 3 details tumour characteristics. Sixty one patients were re-operated after referral from another institute. Forty nine patients had their first operation at Institut Bergonié, preceded by biopsy in 46 cases (16 core needle biopsies, 30 surgical biopsies).

C. Realised treatment Function-sparing conservative surgery was the goal in all patients. In 21 patients with high grade, locally advanced tumours not suitable directly to conservative surgery, tumour reductive first-line chemotherapy was performed. In 18 patients with a close dissection between the tumour and a functional structure, intra-operative brachytherapy was performed in order to allow a conservative resection. With this multidisciplinary approach, satisfactory conservative surgery could be performed in 106 patients. One patient with a sarcoma of the hand underwent a finger amputation. Three patients experienced

Stoeckle et al: French Surgical System in sarcoma Table 3. Characteristics of tumours in 110 operated patients Tumour characteristics

Median tumour size (range) Location Upper extremity Shoulder girdle (shoulder, axilla) Trunk wall Pelvic girdle (buttock, groin) Lower extremity

(%) 10 cm

(2-30 cm)

(15) (12) (18) (8) (57)

(14) (11) (16) (7) (52)

Major tissue invasion (41) (multifocal: 24 pts; neurovascular/bone involvement: 23 pts; both: 6 pts)

(37)

(9) (22) (2) (77)

(8) (20) (2) (70)

(9)

(8)

(30) (22) (16) (9) (5) (5) (3) (3) (3) (7) (7)

(27) (20) (14) (8) (5) (5) (3) (3) (3) (6) (6)

(21) (19) (70)

(19) (17) (64)

T1a T1b T2a T2b

N1 or M1 (N1: 4 pts; M1: 7 pts; both: 2 pts) Histological subtypes Malignant fibrous histiocytoma Liposarcoma Leiomyosarcoma Synovial sarcoma Clear cell sarcoma Extraskeletal osteosarcoma Rhabdomyosarcoma MPNST Angiosarcoma Others Undifferentiated, unclassified sarcoma Grade

G1 G2 G3

Six cycles of treatment were usually delivered According to former experience with concomitant radio- and chemotherapy (Lagarde et al, 1998) showing no supplementary toxicity despite the use of anthracyclins, post-operative chemotherapy was usually associated with post-operative radiotherapy. Sixty-six patients (60%) underwent chemotherapy.

2.Standardised pathological report Pathological work-up was done in accordance with the recommendations from the pathologists of the FSG (Ghnassia et al, 1998) (Table 2). Histological subtype was established according to WHO recommendations (Weiss et al, 1994). Grading was done in accordance with the French Federation of Cancer Centres (FNCLCC) classification (Trojani et al, 1984).

D. Determination of resection quality

3. Definition of quality of surgery

1.Surgical report

As recommended by the FSG, resection type was determined collegially at a weekly group meeting. After

Surgery was prospectively encoded in accordance with the FSG checklist for surgery (Table 1).

Cancer Therapy Vol 3, page 35 confrontation between the surgical and pathological reports, type of resection was then expressed according to UICC R criteria.

square test. Actuarial local recurrence-free estimations were made with the Kaplan-Meier method.

E. Database, follow-up and statistics

F. Outcome of patients

Information on patientsâ&#x20AC;&#x2122; charts comprised patient identification, tumour specification, treatment and follow-up data. Final follow-up date was December 2004. The interval of follow-up was calculated for surviving patients from date of surgery to date of last follow-up. For deceased patients, the intervals between first surgery and death were calculated. Comparisons between frequencies were obtained using the Chi-

At update on December 31, 2004, seventy eight patients were alive and 32 patients were dead, twenty four of whom have died from cancer and two from treatment complications. Median interval to death was 19 months. Median follow-up of living patients was 70 months (range 43 â&#x20AC;&#x201C; 106 months). Ninety six percent of patients (75/78 patients) were followed-up over four years and seventy seven percent (60/78 patients) over five years. Actuarial overall survival at 5 years was 75% (Figure 1).

Figure 1. Actuarial overall survival in 110 patients.

Figure 2. Actuarial local control rate in 107 patients with complete tumour excision

Stoeckle et al: French Surgical System in sarcoma

G. Validation criteria

wall, for whom quality of surgery was determined prospectively in accordance to the surgical system of FSG. Determination of type of resection at a weekly staff meeting rapidly proved to be consensual. Decisions for reexcision or complementary treatment were made collegially. The reliability of the system showed to be good. The current series reports a resection rate R0 of 68% and an actuarial local recurrence rate at five years of 9%. At a median follow-up of 70 months, the risk of LR is 4% in patients R0, 22% in patients R1, reaching 35% in patients R1 lacking a radiation boost. The rate of resections R0 in the current monocentric series (68%) is lower than that reported by Junginger (Junginger et al, 2001) in their multicentric survey (82%), notwithstanding the fact that monocentric studies usually show superior results when compared to multicentric studies. In the current patient group, 37% of patients had locally advanced disease with vasculonervous – or bone invasion, or multifocal spread. Vasculonervous or bone invasion has shown to be an independent, negative prognostic factor for resectability of STS (Sastre et al, 1997). The difficulty to obtain satisfactory resection in this patient subgroup with locally advanced disease is underlined in the current study by a significant lower resection rate R0 in this subgroup when compared to the subgroup of patients with limited disease. In our mind, a rate of 68% of resections R0 is a rate closer to what really can be done by surgery in a continuous series of patients with soft tissue sarcoma. Without doubt, the collegial determination of resection type R gives a more objective appreciation of quality of surgery as if it was determined by the sole surgeon. Local recurrence rates beneath 10% are usually reported only in series of selected patients, like limited tumours selected for surgery alone (Rydholm et al, 1991; Baldini et al, 1999), superficial tumours (Gibbs et al, 1997) or in patients responding to neoadjuvant therapy (Eilber et al, 2001) or selected for pre-operative radiotherapy excluding patients already operated (Sadoski et al, 1993). In unselected series, local recurrence rates rank from 10 to 30% (Le Vay et al, 1993; Coindre et al, 1996; Lewis et al, 1997; Karakousis et al, 1999; Fleming et al, 1999; Pitcher et al, 2000; Trovik et al, 2000; Zagars et al, 2003: pp 2530 - 2543). We think that the better local results observed in the current series, are mostly due to the better appreciation of quality of surgery, allowing therefore to adapt best treatment strategy. That includes reexcision, which surely allows to obtain more resections R0, as shown in patients re-operated after prior surgery elsewhere with higher resection rates R0 (74% vs. 61%) than in patients operated directly at our centre who underwent mostly one single operation. The same findings have been made by others (Zagars et al, 2003: pp 25442553). Furthermore, knowing best quality of surgery, complementary treatment can be better adapted. In our patient subgroup R1, LR is only 7% when a radiation boost is added to external beam radiotherapy as recommended, but attains 35% when the boost is omitted. On the contrary, given the 96% probability of absence of local recurrence in patients defined R0 by the FSG system,

The reliability of the FSG surgical system was measured on (1) the repartition of resection types, and (2) local recurrence rates.

III. Results A. Repartition of resection types 1. All patients Resections R0 were performed in 75 patients (68%), resections R1 in 32 (29%) and resections R2 in three patients (3%).

2. Resection types according to referral In order to achieve a satisfactory resection, 52 of 61 referred patients were re-operated once, six patients two times and three patients three times. Residual tumour was found in 31 patients (51%). Final distribution of resection types in referred patients was resections R0 in 45 patients (74%), R1 in 14 patients (23%), R2 in 2 patients (3%). In 49 patients operated directly at Institut Bergonié, re-operations for insufficiency of surgery were performed in six patients. Distribution of resection type was resections R0 in 30 patients (61%), R1 in 18 patients (37%) and R2 in 1 patient (2%).

3. Resection types according to tumour growth In 69 patients with limited disease there were 61 resections R0 (88%) and 8 resections R1 (12%). In 41 patients with locally advanced disease (multifocality or neurvascular or bone involvement) there were 14 resections R0 (34%), 24 resections R1 (59%) and three resections R2 (7%). The difference in resection rates R0 between limited disease (61/69 patients) and locally advanced disease (14/41 patients) was significant (p < 0.001).

B. Local recurrence LR was considered in 107 patients with complete tumour excision (R0 + R1). Ten patients recurred locally giving a crude LR rate of 9%. Actuarial local recurrencefree rate at 5 years was 91% (Figure 2). Median interval to LR was 12 months (range: 5-70 months). Nine of ten LR’s occurred within 33 months. The incidence of LR differed significantly between patients of groups R0 and R1 with respectively 3/75 (4%) and 7/32 (22%) LR’s (p < 0.01). Therefore, in the current series, the prevalence of LR is 9% (9/107 patients), the positive predictive value (risk for patients R1 having LR) is 22% (7/32 patients) and the negative predictive value (probability of patients R0 not having LR) is 96% (72/75 patients). There was a difference in LR within 32 patients R1 whether or not a radiation boost was delivered. In 15 patients with a boost, one LR occurred (7%), whereas in 17 patient with no boost, six LR occurred (35%). This difference is significant (p < 0.05).

IV. Discussion We report a continuous series of patients operated at our centre for primary STS of the extremities and trunk 36

Cancer Therapy Vol 3, page 37 complementary radiotherapy could probably be withdrawn in a selected subgroup of these patients. Before testing this hypothesis, the results of an ongoing multicentric evaluation of the FSG system are awaited in order to confirm the multicentric reproducibility of the system. Meanwhile, results of the current study (e.g. lack of radiation boost in 17 patients R1, excessive boost in 12 patients R0) have already permitted to improve treatment strategy for soft tissue sarcoma at Institut Bergonié, helping to elaborate the current algorithm for local treatment as shown Figure 3. The cornerstone of the FSG surgical system is the collegial determination of quality of surgery. In groups with a similar, collective approach defining surgery, equal low rates of local recurrences are reported (Gerrand et al, 2003). In this Canadian series, local recurrences are 10% in 480 consecutive patients with extremity soft tissue sarcoma. Whatever the system which has been elaborated, it seems that a collective determination of quality of surgery shows to be superior, more precise, than an individual approach, either by the surgeon or the pathologist. The advantage of the FSG system is its simplicity, with easily reproducible items (tumour seen or

ruptured) and the descriptive approach, allowing rapid consensus within the participants.

V. Conclusion The surgical classification for STS presented in this study is simple to apply. It shows to reflect most accurately the real tumour extent and therefore the possibilities of resection and complementary treatment. The cornerstone of the FSG system is a consensual, multidisciplinary and not an individual determination of quality of surgery. Such a multidisciplinary approach means that STS should be treated in specialised centres, in accordance with former recommendations (Gustafson et al, 1994). This strategy ensures patients to be treated with an individually tailored, tumour extension adapted treatment, a guarantee for better outcome.

Acknowledgements Special thanks to Véronique Picot for statistical analysis and to Dorothée Quincy for assistance in preparing the manuscript.

Figure 3. Algorithm for local treatment strategy at Institut Bergonié according to resection type (R).

Stoeckle et al: French Surgical System in sarcoma

Lagarde P, Kantor G, Tawfiq N, Salem N, Thomas L, Stöckle E, Bui NB (1998) Chimiothérapie des sarcomes des tissus mous de l’adulte. Cancer Radiother 2, 747-751. LeVay J, O’Sullivan B, Catton C, Bell R, Fornasier V, Cummings B, Hao Y, Warr D, Quirt I (1993) Outcome and prognostic factors in soft tissue sarcoma in the adult. Int J Radiat Oncol Biol Phys 27, 1091-1099. Lewis JL, Leung D, Heslin M, Woodruff JM, Brennan MF (1997) Association of local recurrence with subsequent survival in extremity soft tissue sarcoma. J Clin Oncol 15, 646-652. Pitcher ME, Ramathan RC, Fish S, A’Hern A, Thomas JM (2000) Outcome of treatment for limb and limb girdle sarcomas at the Royal Marsden Hospital. Eur J Surg Oncol 26, 548-551. Rosenberg SA, Tepper J, Glatstein E, Costa J, Baker A, Brennan M, DeMoss EV, Seipp C, Sindelar WF, Sugarbaker P, Wesley R (1982) The treatment of soft-tissue sarcomas of the extremities. Prospective randomized evaluations of (1) limbsparing surgery plus radiation therapy compared with amputation and (2) the role of adjuvant chemotherapy. Ann Surg 196, 305-315. Rydholm A, Gustafson P, Röoser B, Willen H, Akerman M, Herrlin K ( 1991) Limb-sparing surgery without radiotherapy based on anatomic location of soft tissue sarcoma. J Clin Oncol 9, 1757-1765. Sadoski C, Suit HD, Rosenberg A, Mankin H, Efird J (1993) Preoperative radiation, surgical margins, and local control of extremity sarcomas of soft tissues. J Surg Oncol 52, 223230. Sarcoma meta-analysis collaboration (1997) Adjuvant chemotherapy for localised resectable soft-tissue sarcoma of adults: meta-analysis of individual data. Lancet 350, 16471654. Sastre-Garau X, Coindre JM, Leroyer A, Terrier P, Ollivier L, Stoeckle E, Bonichon F, Collin F, Le Doussal V, Contesso G, Vilain MO, Jacquemier J, Bui BN (1997) Predictive factors for complete removal in soft tissue sarcomas: a retrospective analysis in a series of 592 cases. J Surg Oncol 65, 175-182. Stoeckle E, Coindre JM, Bonvalot S, Kantor G, Terrier P, Bonichon F, Bui BN (2001) Prognostic factors in retroperitoneal sarcoma. A multivariate analysis of a series of 165 patients of the French Cancer Federation Sarcoma Group. Cancer 92: 359-368. Stoeckle E (1997) Nouvelles techniques chirurgicales des sarcomes des tissus mous. Cancer Radiother 1, 453-456. Thomas L, Delannes M, Stoeckle E, Martel P, Bui BN, DalySchveitzer N, Pigneux J, Chevreau C, Kantor G (1994) Intraoperative interstitial Iridium brachytherapy in the management of soft tissue sarcomas : preliminary results of a feasibility phase II study. Radiother Oncol 33, 99-105. Trojani M, Contesso G, Coindre JM, Rouëssé J, Bui NB, de Mascarel A, Goussot JF, David M, Bonichon F, Lagarde C (1984) Soft-tissue sarcoma of adults; study of pathological prognostic variables and definition of a histopathological grading system. Int J Cancer 33, 37-42. Trovik CS, Bauer HC, Alvegard TA, Anderson H, Blomqvist C, Berlin O, Gustafson P, Saeter G, Walloe A (2000) Surgical margins, local recurrence and metastasis in soft tissue sarcoma: 559 surgically-treated patients from the Scandinavian Sarcoma Group Register. Eur J Cancer 36, 710-716. Weiss SW, Sobin LH (1994) Histological typing of soft tissue tumors. WHO International Classification of Tumours. 2nd ed. Berlin: Springer Verlag.

References Baldini EH, Goldberg J, Jenner C, Manola JB, Demetri GD, Fletcher CD, Singer S (1999) Long-term outcomes after function-sparing surgery without radiotherapy for soft tissue sarcoma of the extremities and trunk. J Clin Oncol 17, 32523259. Brennan MF, Hilaris B, Shiu MH, Lane J, Magill G, Friedrich C, Hajdu SI (1987) Local recurrence in adult soft tissue sarcoma. A randomized trial of brachytherapy. Arch Surg 122, 1289-1293. Coindre JM, Terrier P, Bui NB, Bonichon F, Collin F, Le Doussal V, Mandard AM, Vilain MO, Jacquemier J, Duplay H, Sastre X, Barlier C, Henry-Amar M, Mace-Lesech J, Contesso G (1996) Prognostic factors in adult patients with locally controlled soft tissue sarcoma. A study on 546 patients from the French Federation of Cancer Centers sarcoma group. J Clin Oncol 14, 869-877. Eilber FC, Rosen G, Eckardt J, Forscher C, Nelson SD, Selch M, Dorey F, Eilber FR (2001) Treatment-induced pathologic necrosis: a predictor of local recurrence and survival in patients receiving neoadjuvant therapy for high-grade extremity soft tissue sarcomas. J Clin Oncol 19, 3203-3209. Enneking WF, Spanier SS, Godman MD (1980) A system for the surgical staging of musculoskeletal sarcoma. Clin. Orthoped. 153, 106-120. Fleming JB, Berman RS, Cheng SC, Chen NP, Hunt KK, Feig BW, Respondek PM, Yasko AW, Pollack A, Patel SR, Burgess MA, Papadopoulos NE, Plager C, Zagars G, Benjamin RS, Pollock RE, Pisters PW (1999) Long-term outcome of patients with American Joint Committee on Cancer stage IIB extremity soft tissue sarcomas. J Clin Oncol 17, 2772-2780. Gerrand CH, Bell RS, Wunder JS, Kandel RA, O’Sullivan B, Catton CN, Griffin AM, Davis AM (2003) The influence of anatomic location on outcome in patients with soft tissue sarcoma of the extremity. Cancer 97, 485-492. Ghnassia JP, Vilain MO, Coindre JM, Bertrand G, Château MC, Collin F, Depardieu C, Fiche M, Guillou L, Jacquemier J, Larsimont D, Le Doussal V, Leroux-Broussier A, Mandard AM, Marques B, Ranchère D, Sastre X, Terrier P, Trassard M (1998) Recommandations pour la prise en charge anatomo-pathologique des sarcomes des tissus mous de l’adulte. Ann Pathol 18, 505-511. Gibbs CP, Peabody TD, Mundt AJ, Montag AG, Simon MA (1997) Oncological outcomes of operative treatment of subcutaneous soft-tissue sarcomas of the extremities. J Bone Joint Surg 6, 888-897. Gustafson P, Dreinhofer KE, Rydholm A (1994) Soft tissue sarcoma should be treated at a tumor center. A comparison of quality of surgery in 375 patients. Acta Orthop Scand 65, 47-50. Hermanek P, Sobin LH (1992) TNM classification of malignant tumours. Fifth edition, second revision, Springer, Berlin. Junginger TH, Kettelhack C, Schönfelder M, Saeger HD, Rieske H, Krummenauer F, Hermanek P (2001) Therapeutische Strategien bei malignen Weichteiltumoren. Ergebnisse der Weichteiltumor-Registrierstudie der CAO. Chirurg 72, 138148. Karakousis CP, Driscoll DL (1999) Treatment and local control of primary extremity soft tissue sarcoma. J Surg Oncol 71, 155-161. Lagarde P, Kantor G, Bussières E, Stöckle E, Coindre JM, Tramond P, Avril A, Bui NB, Marée D (1990) Radiothérapie post-opératoire des sarcomes des parties molles des membres. Analyse des volumes et des doses d’irradiation sur une série de 31 cas. Bull Cancer Radiother 77, 101-109.

Cancer Therapy Vol 3, page 39 Yang JC, Chang AE, Baker AR, Sindelar WF, Danforth DN, Topalian SL, DeLaney T, Glatstein E, Steinberg SM, Merino MJ, Rosenberg SA (1998) Randomized prospective study of the benefit of adjuvant radiation therapy in the treatment of soft tissue sarcomas of the extremity. J Clin Oncol 16, 197203. Zagars GK, Ballo MT, Pisters PW, Pollock RE, Patel SR, Benjamin RS, Evans HL (2003) Prognostic factors for patients with localized soft-tissue sarcoma treated with conservation surgery and radiation therapy: an analysis of 225 patients. Cancer 97, 2530-2543. Zagars GK, Ballo MT, Pisters PW, Pollock RE,Patel SR, Beamin RS (2003) Surgical margins and resection in the management of patients with soft tissue sarcoma using conservative surgery and radiation therapy. Cancer 97, 2544-2553.

Eberhard Stoeckle

Stoeckle et al: French Surgical System in sarcoma

Cancer Therapy Vol 3, page 41 Cancer Therapy Vol 3, 41-56, 2005

Current role of erythropoietin in the management of patients with haematological and solid malignancies Review Article

Max Mano*, Priska Butzberger, Anne Reid, Alan Rodger, Richard Soutar, John Welsh Beatson Oncology Centre, Glasgow

__________________________________________________________________________________ *Correspondence: Dr Max Mano, Consultant in Medical Oncology, Beatson Oncology Centre, Western Infirmary, Dumbarton Rd, Glasgow G11 6NT; Tel: 0044 141 116299; Fax: 0044 141 2111866; Email: max.mano@northglasgow.scot.nhs.uk Key words: erythropoietin, haematological and solid malignancies, clinical activity, anaemia, Quality of Life (QOL), Iron supplementation, cognitive impairment Abbreviations: blood transfusions, (BT); chemotherapy, (CT); Epoetin, (EPO); European Cancer Anaemia Survey, (ECAS); European Organisation for Research and Treatment of Cancer`s, (EORTC); haematological response, (HR); haemoglobin, (Hb); intravenous, (IV); National Cancer Institute, (NCI); overall survival, (OS); performance status, (PS); Quality of Life, (QOL); radiotherapy, (RT); recombinant human erythropoietin, (RHuEPO) Received: 20 January 2005; Accepted: 28 January 2005; electronically published: February 2005

Summary Epoetin (EPO) proteins have been considered the treatment of choice for chemotherapy (CT)-induced anaemia (after exclusion of other causes), and there is growing evidence that this should also be the case for cancer-related anaemia. However, the impact of EPO on survival is currently unknown. Although two recent randomised trials have suggested a negative impact of EPO on outcome, in a recent meta-analysis (of trials with a lower haemoglobin (Hb) target, i.e. 12-13 g/dL) EPO was associated with a trend toward an improved survival. All currently available agents and schedules seem to have similar efficacy. Serious complications with these agents are unusual, though the incidence of thromboembolic events seems to be slightly increased in cancer patients. The use of EPO for cancer and/or CT-induced anaemia significantly reduces the need for blood transfusions (BT) and spares stocks of blood, but is likely to result in increased costs. Therefore, its cost-effectiveness should be determined on a local basis (EORTC) toxicity grading criteria (Table 1). Table 2 depicts the prevalence of anaemia in patients with different tumour types. During the survey, the frequency of anaemia at some point increased to 67% (Hb <10 g/dL in 39%). In this study, the mean Hb level that triggered initiation of treatment was 9.7 g/Dl, and the anaemia was treated in only 39% of the cases ((EPO)= 17.4%; blood transfusion (BT)= 14.9%; and iron= 6.5%). This landmark study has also confirmed what was already known from the clinical practice, i.e. that there is a strong correlation between levels of Hb and PS (Ludwig et al, 2004).

I. Introduction Prevalence of anaemia in cancer patients Anaemia is a common problem in patients with cancer. In a large survey of patients with non-myeloid malignancies included in (published) chemotherapy clinical trials (therefore, presumably with a good baseline performance status (PS)), the incidence of anaemia requiring transfusion was as high as 50-60% in patients with lymphoma, lung, gynaecological and genito-urinary cancer (Groopman and Itri, 1999). Recent results of the European Cancer Anaemia Survey (ECAS), which investigated a total of 15,367 cancer patients (approximately 80% with solid and 20% with haematological malignancies) from 748 centres in 24 countries, reported a baseline prevalence of anaemia of 39.3% (Hb <10g/dL in 10%). In this study, anaemia was defined as haemoglobin (Hb) <12 g/dL, based on the National Cancer Institute (NCI) and the European Organisation for Research and Treatment of Cancer`s

II. Anaemia and changes in Quality of Life (QOL) As in chronic renal failure, the correlation between anaemia and QOL has been well described in cancer patients (Demetri, 2001; Glaspy, 2001; Littlewood et al, 2001; Ludwig and Strasser, 2001; Fallowfield et al, 2002; Straus, 2002). However, the best data so far are the recently published results of ECAS (Ludwig et al, 2004). 41

Mano et al: EPO in haematological and solid malignancies management In this study, Hb levels significantly correlated with mean PS at enrolment (p<0.001) (Table 3), and similar trends were observed all over the survey. Performance Status scores of 3-4 were uncommon in patients with higher Hb values, but much more frequent in patients with lower Hb levels (2.5%, 5.5%, 12.3% and 24% in patients with Hb levels of >=12 g/dL, 10-11.9 g/dL, 8-9.9 g/dL and <8 g/dL, respectively).

III. Correction of improvements in QOL

anaemia

the use of EPO. Most of these studies have shown consistent improvements in QOL with increases in Hb levels (Abels, 1993; Glaspy et al, 1997; Pawlicki et al, 1997; Demetri et al, 1998; Dammacco et al, 2001; Gabrilove et al, 2001; Littlewood et al, 2001; Seidenfeld et al, 2001; Quirt et al, 2001; Wilkinson et al, 2001; Crawford et al, 2002; Fallowfield et al, 2002; Osterborg et al, 2002; Pronzato et al, 2002; Thomas et al, 2002; Vansteenkiste et al, 2002; Boogaerts et al, 2003; Hedenus et al, 2003; Janinis et al, 2003; Iconomou et al, 2003; Shasha et al, 2003; Chang et al, 2004; Charu et al, 2004; Jones et al, 2004; Savonije et al, 2004; Witzig et al, 2004) (Table 4).

and

Several studies have looked at changes in QOL with the use of interventions aiming at increasing Hb, such as

Table 1. Grading of anaemia used in ECAS and that proposed by NCI (Hb in g/dL)

MILD MODERATE SEVERE LIFE-THREATENING

ECAS 11.9-10.0 9.9-8.0 <8.0 NA

NCI 10.0-WNL 8.0-10.0 6.5-7.9 <6.5

Hb= haemoglobin; NA= not applicable; WNL= within normal limits (12-16 for women, 14-16 for men); NCI= National Cancer Institute

Table 2. Prevalence of anaemia per tumour type (Ludwig et al, 2004)

Hb<12

Breast (n*=3123)

Lung (n=2002)

GI-CRC (n=2402)

H&N (n=684)

Gyn (n=1675)

30.4%

37.6%

38.9%

24.9%

49.1%

g/dL

Lymphoma/ Myeloma (n=2260) 52.5%

Leukaemia (n=624)

U-G (n=894)

53%

29.2%

OVERALL PREVALENCE= 39.3%

n= number of patients; Hb= haemoglobin; GI-CRC= gastro-intestinal and colorectal; H&N= head & neck; Gyn= gynaecology; U-G= uro-genital * Evaluable population

Table 3. Correlation between Hb levels and PS in ECAS, at enrolment (Ludwig et al, 2004) Hb (g/dL) n Mean (WHO) PS

<8 187 1.7

8-9.9 1242 1.4

10-11.9 4214 1.0

>=12 8750 0.8

Hb= haemoglobin; WHO= World Health Organisation; n= number of patients; PS= performance status; ECAS= European Cancer Anaemia Survey

Table 4. Changes in QOL in patients receiving interventions to correct Hb Trial

Abels, 1993

413

Osterborg et al, 2002

349

Design

Population RANDOMISED TRIALS r-HuEPO (100 U/kg 3xw Anaemic (Hb<=10.5g/dL) for non-CT, 150 U/kg pts on CT (n=289) or not 3xw for CT pts) (n=124) vs placebo EPO-! (150 IU/kg 3xw) Transfusion-dependent pts with haematological vs malignancies and low serum placebo erythropoietin concentration

Results EPO corrected anaemia in all groups, and seemed to improve functional capacity in responding pts Significant improvements in QOL in the EPO-! group

Cancer Therapy Vol 3, page 43 Witzig et al, 2004

344

EPO-" (40,000) U qw vs placebo

Anaemic (Hb<11.5 g/dL and <10.5 g/dL for males and females, respectively), after receiving CT

Littlewood et al, 2001

375

EPO-" (150 to 300 IU/kg 3xw) (2:1) vs placebo

Anaemic (Hb <=10.5 g/dL, or > 10.5 g/dL but <or= 12 g/dL after a Hb #of >or= 1.5 g/dL per cycle since starting CT) pts with solid or nonmyeloid haematological malignancies receiving nonplatinum CT

Chang et al, 2004 Boogaerts et al, 2003

354

Anaemic (Hb =12 g/dL) breast cancer pts on CT Anaemic (Hb<or=11 g/dL) pts with lymphoid or solid tumour malignancies

EPO-" was effective in improving QOL Baseline to final visit changes in QOL scores were significantly greater with EPO-!

Savonije et al, 2004

315

Mildly anaemic (Hb<= 12 g/dL) pts with solid malignancies receiving platinum-based CT

EPO-"improved QOL scores at the end of the study.

Charu et al, 2004)

170

Anaemic (Hb<=11 g/dL) pts not on CT or RT

Improvements in QOL with DA in the first 12 weeks

Vansteenkiste et al, 2002

320

Anaemic (Hb<=11 g/dL) lung cancer pts receiving CT

Pts on DA had better improvements in fatigue scores

Hedenus et al, 2003

344

Anaemic lymphoma or myeloma pts receiving CT

DA improved QOL

Pronzato et al, 2002

223

Anaemic (Hb 10-12 g/dL) breast cancer pts receiving CT

Early treatment with EPO-" resulted in significant improvements in QOL scores

Thomas et al, 2002

130

Wilkinson et al, 2001

182

Iconomou et al, 2003

122

Mildly anaemic (Hb < 12.0g/dL) cancer pts undergoing CT Anaemic (Hb 10-12 g/dL) ovarian cancer pts on platinum-based CT Anaemic (Hb </=11.0 g/dl) pts on CT

Early treatment with EPO-" resulted in significant improvements in QOL scores Preliminary results from 160 pts showed significant improvements in QOL Significant improvement in QOL with EPO

Janinis et al, 2003

372

Anaemic (Hb <11 g/dL) pts on CT

Dammacco et al, 2001

145

EPO-" (40,000 U qw) vs BSC EPO-! (initial dose 150 IU kg 3xw) vs BSC EPO-" (10.000 3xw; $ 20.000 3xw as necessary) (2:1) vs BSC DA (3mcg/kg q2w);(2:1) vs observation (for 12 weeks, then DA) DA (2.25mcg/kg/qw, doubled as necessary) vs placebo DA vs placebo EPO-" (10000-20000 3xw) vs BSC EPO-" (10000 3xw) vs BSC EPO-"(10000 3xw)(2:1) vs BSC rHuEPO vs placebo EPO-"(10000 3xw) vs no EPO EPO-" (150 UI/kg 3xw) vs placebo

Positive impact on QOL which was independent of anti-tumour response Benefit seen only on univariate analysis

Fallowfield et al, 2002

262

Anaemic (Hb<11 g/dL) pts with myeloma

Changes in the average QOL scores from baseline to the end of the study were similar in the two study arms; a benefit was seen in the subgroup of Hb responders only. Improvement of all primary cancer- and anaemia-specific QOL domains was significantly greater for EPO-". Vast majority of pts in this trial had Hb levels <10.0 g/dL. This QOL data has been later more extensively evaluated and the significant QOL gains confirmed (Fallowfield 2002)

Mano et al: EPO in haematological and solid malignancies management

Gabrilove et al, 2001

3012

Crawford et al, 2002

4382

Shasha et al, 2003

777

Quirt et al, 2001

401

Demetri et al, 1998

2370

Glaspy et al, 1997

2342

Pawlicki et al, 1997

215

Jones et al, 2004

Seidenfeld et al, 2001

11459

851

NON-RANDOMISED TRIALS Community-based; Anaemic (Hb <or= 10.5 g/dL, multicentre, openor > 10.5 g/dL but <or= 12 label(EPO-" 40,000 U g/dL after a Hb # of >or= 1.5 3xw; $ to 60,000 U 3xw g/dL per cycle since starting CT) pts with non-myeloid depending on the Hb malignancies on CT response at 4 weeks) Retrospective review of Anaemic (Hb 8-14 g/dL) pts data from 2 open-label, undergoing chemotherapy community-based trials of EPO-" (given 3xw)

Multicentre, open-label (EPO-" 40,000 U qw; $ to 60,000 U qw if Hb $ to < or = 1 g/dL after 4 weeks) Prospective, open-label (EPO-" 150 IU/kg 3xw; $ 300 IU/kg after 4 weeks is insufficient response) Community-based (EPO-" 10,000 U 3x week; $ to 20,000 U 3xw depending on the Hb response at 4 weeks) Community-based, openlabel (EPO-" 150 U/kg 3xw; $ to 300 U/kg if insufficient response)

Anaemic (Hb <or=11 g/dL) pts with non-myeloid malignancies receiving RT concomitantly or sequentially with CT Anaemic (symptomatic or Hb<11 g/dL) pts on CT (n=218) or not (n=183) Anaemic (Hb <= 11g/dL) pts with non-myeloid malignancies on CT

Anaemic (non-specified) pts receiving CT

Open-label, multinational Cancer pts with anaemia (EPO-" 150 IU/kg 3xw) secondary to platinum- or non-platinum-based CT META-ANALYSES Meta-analysis of 23 Anaemic pts with cancer published and unpublished, randomised/ controlled and single-arm studies that included at least 20 pts per arm Meta-analysis of 22 trials Cancer pts undergoing anti(n=1927) to estimate the cancer treatment and receiving odds of BT EPO Also, evaluation of 9 trials (n=581 evaluable) that have reported QOL analysis

Significant improvements in functional status and fatigue; improvements in QOL parameters correlated significantly with increases in Hb levels Non-linear relationship and significant positive correlation between high Hb levels and high QOL scores; a benefit was seen at all levels of Hb but was the largest when Hb levels of 11-13 g/dL were achieved In 359 pts who were evaluable for QOL assessment, EPO-" significantly improved overall QOL from baseline to the time of final evaluation. Improvements in QOL scores, which correlated with increases in Hb levels; similar benefits were observed in the 2 cohorts EPO-" increased Hb levels, which correlated with an improvement in QOL scores; this was independent of tumour response EPO-" was effective in improving the functional status and QOL, as well as increasing Hb level and decreasing BT requirements; improvement in functional status was attributed to increases in Hb levels. Significant improvement in QOL and PS.

EPO-" improved QOL in pts with cancer. Results adjusted for confounding factors remained consistent. The favourable impact on QOL was significant only in studies with mean baseline Hb <10 g/dL Insufficient data to show whether initiating EPO before Hb drops to less than 10 g/dL resulted in improved QOL; these data were however considered insufficient for a meta-analysis.

QOL= quality of life; Hb= haemoglobin; EPO= epoetin; CT=chemotherapy; vs= versus; BT= blood transfusion; RT= radiotherapy; pts= patients; qw= once a week; $ = increase; #= decrease; WHO= World Health Organisation; PS= performance status; 3xw= three times a week; DA= darbepoetin; r-HuEPO= recombinant human epoetin; BSC= best standard of care

Cancer Therapy Vol 3, page 45 The cloning of the erythropoietin gene in the mid 1980s allowed the development and quick introduction of recombinant human erythropoietin (RHuEPO) into clinical practice. These agents were first used in the management of anaemia of chronic renal failure, but their use has been extended to other conditions such malignant diseases, HIV infection, prematurity and surgery. Four different RHuEPOs are currently available: alpha, beta, delta and omega, with some differences in pharmacokinetics and pharmacodynamics. Alpha and beta have been the most commonly used RHuEPOs in Europe. The erythropoietin analogue darbepoetin alfa is a unique molecule that carries two additional glycosylation sites. This agent stimulates erythropoiesis through the same mechanism as endogenous erythropoietin, but has a longer half-life allowing less frequent administration. In summary, there is currently substantial evidence that the use of EPO improves QOL in patients with CTinduced (non-platinum or platinum-based) or cancerrelated anaemia, as compared to conventional care (comprising BT as necessary). This is supported by a number of randomised trials and recently ratified by at least one meta-analysis (level I evidence (i.e., based on randomised controlled clinical trials and/or metaanalyses)). In this meta-analysis, EPO-" improved Cancer Linear Analog Scale (CLAS) (20-25%), Functional Assessment of Cancer Therapy (FACT)-Fatigue (17%), and FACT-Anemia (12%) scores (P = 0.05) and, whilst PS worsened for control cohorts (P = 0.05), EPO-" cohorts remained unchanged. Four of the Short-form 36 Questionnaire (SF-36) subscales, namely Physical Function, Role Physical, Vitality, and Social Function, improved with EPO-" (P = 0.05) (Jones et al, 2004). Despite this, ECAS revealed that more than 60% of the patients who were ever anaemic (at baseline or during the study) did not receive any treatment for this, and most of those who did had their treatment initiated only when Hb levels dropped below 10 g/dL. At present, the most robust evidence of a favourable impact of EPO on QOL is in patients with Hb <= 10 mg/dL, and this was actually the threshold recommended by an ASCO panel in 2002 (Rizzo et al, 2002). However, it is important to point out that losses in QOL scores can be observed with even more subtle drops in Hb levels (<12g/dL) (Ludwig et al, 2004), and there is some clinical data suggesting that the maximal gain in QOL occurs when Hb levels of 12 g/dL (range 1113 g/dL) are achieved (Crawford et al, 2002). This concept has also been supported by the results of several randomised trials that are assessing the impact of earlier intervention with EPO (Hb 10-12 g/dL) on QOL (Wilkinson et al, 2001; Pronzato et al, 2002; Thomas et al, 2002; Chang et al, 2004; Rearden et al, 2004). Of note, a European panel has recently recommended levels of 9-11 g/dL to be used as threshold for initiation of EPO treatment (Bokemeyer et al, 2004).

randomised clinical trials (Table 4) (Abels, 1993; Glaspy et al, 1997; Pawlicki et al, 1997; Demetri et al, 1998; Dammacco et al, 2001; Gabrilove et al, 2001; Littlewood et al, 2001; Seidenfeld et al, 2001; Quirt et al, 2001; Wilkinson et al, 2001; Crawford et al, 2002; Fallowfield et al, 2002; Osterborg et al, 2002; Pronzato et al, 2002; Thomas et al, 2002; Vansteenkiste et al, 2002; Boogaerts et al, 2003; Hedenus et al, 2003; Janinis et al, 2003; Iconomou et al, 2003; Shasha et al, 2003; Chang et al, 2004; Charu et al, 2004; Jones et al, 2004; Savonije et al, 2004; Witzig et al, 2004). Overall, these trials have shown HR in the range of 50% to 80%, and the mean increase in Hb is in the range of 1.8 to 2.0 g/dL. There seems to be little difference in activity among the various agents and schedules currently available. Doubling the dose in nonresponding patients has typically resulted in a further 1015% HR rate (Bokemeyer et al, 2004). In a recent metaanalysis of 14 trials, the HR rate was 48%, and there were significant reductions in requirements for BT (Table 5) (Bohlius et al, 2004). These findings were similar to those reported in a previous meta-analysis of 12 trials (Seidenfeld et al, 2001). In the largest trials, the HR rates were in the range of 60-70% (Tables 4 and 5) (Abels, 1993; Glaspy et al, 1997; Pawlicki et al, 1997; Demetri et al, 1998; Dammacco et al, 2001; Gabrilove et al, 2001; Littlewood et al, 2001; Seidenfeld et al, 2001; Quirt et al, 2001; Wilkinson et al, 2001; Crawford et al, 2002; Fallowfield et al, 2002; Osterborg et al, 2002; Pronzato et al, 2002; Thomas et al, 2002; Vansteenkiste et al, 2002; Boogaerts et al, 2003; Hedenus et al, 2003; Janinis et al, 2003; Iconomou et al, 2003; Shasha et al, 2003; Chang et al, 2004; Charu et al, 2004; Jones et al, 2004; Savonije et al, 2004; Witzig et al, 2004). Therefore, there is currently level I evidence supporting the role of EPO in raising the Hb and reducing the need for BT (of about 20%) in patients with cancer-associated and CT-induced anaemia (Bokemeyer et al, 2004). The Cohcrane meta-analysis has also provided level I evidence that prophylactic use of EPO in non-anaemic patients receiving cytotoxic CT can prevent anaemia (Bohlius et al, 2004), though the safety and clinical significance of this approach has not been fully established.

V. Impact of anaemia on cancer outcomes The presence of anaemia has been considered an adverse prognostic factor in patients with cancer (Caro et al, 2001). This has been better demonstrated in gynaecological (Girinski et al, 1989; Pedersen et al, 1995; Lentz et al, 1998; Obermair et al, 1998; Grogan et al, 1999; Obermair et al, 2001, 2003; Dunst et al, 2003; Lavey et al, 2004; Munstedt et al, 2004) and head & neck cancer (Bryne et al, 1991; van Acht et al, 1992; Fein et al, 1995; Dubray et al, 1996; Kumar et al, 1997; Glaser et al, 2001; Reichel et al, 2003; Chua et al, 2004; Haugen et al, 2004), but has also been shown in other solid tumours such as lung (Albain et al, 1991; Armour et al, 2003; Langendijk et al, 2003) and testicular cancer (Bokemeyer et al, 2002), and in several lymphoproliferative diseases (in some of which Hb levels have been incorporated into the staging system) (Caro et al, 2001).

IV. Evidence of clinical activity: haematological response (HR) rates The HR rates to EPO in anaemic cancer patients have been evaluated by numerous randomised and non-

Mano et al: EPO in haematological and solid malignancies management Table 5. Meta-analyses evaluating the efficacy of EPO agents (as assessed by HR rates) Trial Seidenfeld et al, 2001

n 1390

Design Meta-analysis of 12 trials to estimate the odds of BT

Population Cancer pts undergoing anti-cancer treatment and receiving EPO

Bohlius et al, 2004

2347 and 3069

Meta-analysis of 14 trials for estimation of HR (n=2347) and 25 trials for estimation of odds for BT (n=3069)

Anaemic cancer pts receiving EPO

Results EPO reduced the odds of BT (RR= 0.38 [95% CI 0.28-0.51] The number of pts needed to prevent one transfusion was 4.4. Insufficient data to show whether initiating EPO before Hb drops to less than 10 g/dL resulted in reduction of BTs HR= 48% (vs 11% in the control group) Hazard ratio for HR= 3.60 (95% CI 3.07-4.23) EPO reduced the odds of BT (0.44 [95% CI 0.36 to 0.54]); there was a reduction in the risk of BT of approximately 33% ; in the subgroup of responding pts (48%), this benefit is likely to be higher but could not be analysed

rHuEPO= recombinant human epoetin; EPO= epoetin; 3x= three times; Hb= haemoglobin; vs= versus; RR= response rate; EPO-"= epoetin; CI=confidence Intervals; alpha; HR= haematological response; qw= once a week, q2w= twice a week; q3w= three times a week

Interestingly, there is some preclinical data showing that optimal tissue oxygenation can improve the efficacy of radiotherapy (RT) and CT in cancer, and EPO is one of the agents that has been investigated in this context (Thews et al, 1998; Silver and Piver, 1999). There is also some evidence that these agents could potentially compensate for the negative impact of anaemia on outcome, though this is either based on retrospective data, or on studies in which the clinical outcome had not been the primary endpoint (which were therefore underpowered for such conclusions) (Table 6) (Littlewood et al, 2001; Bohlius et al, 2004; Glaser et al, 2001; Antonadou et al, 2001; Littlewood et al, 2003; Sloan et al, 2002; Henke et al, 2003; Leyland-Jones, 2003; MĂśbus et al, 2004). Based on these encouraging data, several prospective randomised trials looking at the specific question of the impact of EPO on survival have been initiated. Unfortunately, preliminary results of these trials were disappointing, two of those having been prematurely closed due to a potential negative impact of EPO on survival and loco-regional control (Henke et al, 2003; Leyland-Jones, 2003). In the BEST trial (Leyland-Jones, 2003), 939 nonanaemic (Hb>13g/dL) patients with metastatic breast cancer receiving first-line CT were randomised to receive EPO-" or placebo. The one-year overall survival (OS) was significantly worse in the EPO-" arm (70% vs 76%, p=0.0117). Curiously, most of the deaths occurred within the first 4 months, and were due to either disease progression, thromboembolic and/or vascular events. Of note, this trial had some design problems, comprising an imbalance of baseline prognostic factors (worse in the EPO arm). Similarly in the ENHANCE trial (Henke et al, 2003), 351 patients with head & neck cancer (T3/4 or nodepositive) and Hb level <12 g/dL (for women) or <13 g/dL (for men) were randomised to receive EPO-! plus RT

(starting 10-14 days prior to RT) or RT alone. After 208 events, loco-regional progression free survival, locoregional progression and survival were significantly worse with EPO-! (adjusted relative risk 1.62 (p=0.0008), 1.69 (p=0.007) and 1.39 (p=0.02), respectively). Interestingly, EPO-! had a particular negative impact on the outcome of patients irradiated for manifested cancer. This trial also had an imbalance of prognostic factors, i.e. more smoking patients in the EPO-! arm, and it is important to point out that more than 80% of the patients achieved very high Hb levels (more than 14 g/dL in women and 15 g/dL in men). This trial has also been criticised for unusually poor outcomes by international standards and by the large number of protocol violations (the differences in outcome between treatment and control groups were no longer significant when the analysis was limited to the â&#x20AC;&#x153;perprotocolâ&#x20AC;? population). More vascular disorders have been reported in the EPO-! arm (11% vs 5%). The authors correctly point out that EPO receptors, which may be targeted by EPO, are known to be present in tumour cells (Okuno et al, 1990; Acs et al, 2001) and seem to be functional (Arcasoy et al, 2002). Furthermore, it is possible that tumour cells can use EPO for angiogenesis and growth (Miller et al, 1992; Yasuda et al, 2003). However, in contrast with these data, EPO has already been shown to have anti-tumour activity in preclinical models (Mittelman et al, 2001). In summary, for the time being, the clinical significance of these interesting preclinical data remains largely unknown. The results of these two clinical trials are in clear contrast with those of a recent meta-analysis of 19 randomised trials (n=2865) (Bohlius et al, 2004), which showed a trend towards an improved survival in patients receiving EPO in addition to anti-cancer treatment. It is worth noting that the final mean Hb in these trials ranged from 10.01 g/dL to 13.86 g/dL, thus significantly lower than those achieved in the 2 trials above. 46

Cancer Therapy Vol 3, page 47 Table 6. Studies investigating the effect of EPO on the outcome of patients receiving anti-cancer treatment Trial

Glaser et al, 2001

191

Littlewood et al, 2001 Littlewood et al, 2003

375

Sloan et al, 2002

344

Antonadou et al, 2001

385

Henke et al, 2003

351

LeylandJones, 2003

939

Möbus et al, 1284 2004

Bohlius et al, 2004

2865

Design

Population Results RETROSPECTIVE Retrospective. Pts with SCC of the oral On multivariate analysis, Hb level and Pts with a low Hb before or cavity or oropharynx treated use of r-HuEPO were independent during CH-RT received rwith neoadjuvant CH-RT prognostic factors for response to CHHuEPO 10,000 IU/kg s.c. 3- and surgery RT and locoregional control (p < 0.01). 6x week until surgery Placebo-controlled, double- Anaemic (<or= 10.5 g/dL, Kaplan-Meier estimates showed a trend blind, randomised (EPO-" or > 10.5 g/dL but <or= 12 in OS favouring EPO-" (P =.13, logg/dL after a Hb # of >or= vs placebo; 2:1). rank test), and Cox regression analysis EPO-" 150 to 300 IU/kg 1.5 g/dL per cycle since showed an estimated hazards ratio of starting CT) pts with solid 1.309 (P =.052) favouring EPO-" 3xw or non-myeloid (retrospective analysis) haematological malignancies receiving nonplatinum CT Double-blind, placeboPts with advanced cancer Tumour response and survival between controlled, randomised and with anaemia (Hb<11.5 the two groups were virtually identical (EPO-" vs placebo). g/dL and 10.5 g/dL for (17% vs 20% response for EPO and males and females, placebo respectively, p=0.57; 7% vs 6% EPO-" 40,000 U qw respectively) after receiving death rate at study completion myelosuppressive CT respectively, p=0.65) PROSPECTIVE, RANDOMISED, MULTICENTRE RT ± r-HuEPO 10.000 U Pts with pelvic The addition of r-HuEPO to the daily 5x/week malignancies receiving RT treatment course of RT significantly improved 4-year DFS and local control RT ± EPO-! Anaemic (Hb <12g/dL for Significantly worse loco-regional women and <13 g/dL for control and survival in EPO-! arm; men) pts receiving radical however, the design has been criticized RT for locally-advanced head and neck cancer CT ± EPO-" Non-anaemic metastatic Significantly worse one-year OS in breast cancer pts receiving EPO-" arm; however, the design has CT been criticized CT ± EPO-" (2nd Non-anaemic early breast No impact on DFS or survival cancer pts receiving randomisation) adjuvant CT META-ANALYSES Meta-analysis of 19 Anaemic pts receiving anti- Inconclusive effect of EPO on survival, randomised clinical trials cancer treatment (in 14 but a trend for improved survival with (none designed to baseline Hb <10g/dL; in 2 the use of EPO was observed (HR investigate survival as between 10-12 g/dL,; in 3 0.81;95% CI 0.67-0.99) primary endpoint) Hb > 12 g/dL) In 9 studies the CT was platin-based, in 7 nonplatin-based

AWNH= average weekly nadir Hb; BT= blood transfusion; DFS= disease-free survival; OS= overall survival; SCC= squamous cell carcinoma; RT= radiotherapy; CH-RT= chemoradiotherapy; CT= chemotherapy r-HuEPO= recombinant human epoetin; EPO= epoetin; RR= relative risk; PFS= progression-free survival; pts= patients; 3xw= three times a week; 5xw= five times a week

Furthermore, in another prospective randomised trial in non-anaemic early breast cancer patients receiving adjuvant CT, EPO had no detrimental effect on outcome (Möbus et al, 2004). In short, in light of statistical and design problems (especially targeting non-anaemic patients or the use of high Hb targets), and also of conflicting results from other studies (Bohlius et al, 2004; Möbus et al, 2004), the

interpretation of the results of these 2 prospective trials remains difficult. It is unlikely, based on the results depicted in Table 6, that patients with lower Hb levels (in whom EPO is licensed for use) could also be at risk of increased mortality when treated with EPO. Although this question is currently being investigated by a number of clinical trials, in the meantime physicians should avoid over-increasing the Hb (to more than 13-14 g/dL) or 47

Mano et al: EPO in haematological and solid malignancies management prolonging the treatment duration (to more than 16 weeks, as in the pivotal trials). Also, patients with Hb levels higher than 12 g/dL should not receive these agents outside the context of a clinical trial. Of interest, some (retrospective) studies in the past have looked at the impact of BT on the outcome of cancer patients, with some also conflicting results in terms of its effect on outcome (Girinski et al, 1989; Lentz et al, 1998; Landers et al, 1996; Grogan et al, 1999).

VI. Optimal schedule and agent There is little evidence that either agent or schedule could make a significant difference in terms of efficacy or toxicity. However, there may be some differences in terms of convenience and costs (Ng et al, 2003; Cremieux et al, 2004). As shown in Table 7, the efficacy of different agents and schedules seemed very similar in the pivotal trials.

Table 7. Comparisons between different EPO agents and schedules Trial

Design RANDOMISED TRIALS Pts with lymphoproliferative disorders Randomised (EPO-! 10.000 U 3xw vs 30.000 U qw) Randomised (1:1), open-label, multicentre EPO-" 40000 U qw vs DA 200 mcg q2w; pts on CT

Cazzola et al, 2003 Waltzman et al, 2004

241

Mirtsching et al, 2002

375

Pooled analysis of 3 DA trials

Schwartzberg et al, 2004

312

Rearden et al, 2004

204

Thatcher et al, 1999

130

Pooled analysis of 3 identical multicentre, prospective, randomised 1:1 (DA 200 mcg q2w or EPO-" 40000 U qw Randomised, prospective Early (immediate treatment) vs late intervention (when Hb dropped below 10 g/dL) Agent: DA 300 mcg q3w Multicentre, randomised (no additional treatment [n = 44], EPO-" 150 IU kg 3xw [n = 42] or 300 IU kg 3xw [n = 44]) Pts on CT

Hesketh et al, 2004 Granetto et al, 2003

242

McKenzie et al, 2002 Schwartzberg et al, 2003

Patton et al, 2004 Thames et al, 2004

Gabrilove et al, 2001

First 123

Results Comparable efficacy Preliminary results suggested that EPO-" may be slightly more active rHuEPO and DA were equality effective, but DA seemed to result in less BT requirements No differences in efficacy and safety Early intervention resulted in reductions in BTs and improved QOL Significantly fewer (P < 0.05) EPO-" pts experienced anaemia (Hb <10 g/dL) during the course of CT (300 IU kg= 39%; 150 IU kg= 48%; untreated= 66%); Comparable efficacy

Randomised phase II (fixed or weight-based dose after a front-loading schedule) 546 Multicentre, open-label, randomised (EPO-" fixed Similar efficacy vs weight-based dose) RETROSPECTIVE AND PROSPECTIVE/NON-RANDOMISED STUDIES 1238 Retrospective, community-based analysis of pts Comparable efficacy receiving EPO-" 40000 U qw(50%), q2w(32%), or q3w or less frequently(17%) 1391 Multicentre, retrospective cohort study (practice Both agents seemed equally patterns of the use of DA-" and EPO-" for CTeffective. Darbepoetin-" (q2w) induced anaemia) has reduced frequency of dosing as compared to EPO-" (qw) 408 Retrospective, observational (practice patterns of the Comparable efficacy use of DA-" and EPO-") 330 Retrospective, multicentre chart review DA-" is effective in treating CTinduced anaemia in both EPO-"na誰ve pts and those switched from EPO-" 3012 Community-based; multicentre, open-label, nonComparable efficacy (with that randomised. of a historical control arm) EPO-" 40,000 U 3xw; $ to 60,000 U 3x week depending on the Hb response at 4 weeks

q2w= every 2 weeks; q3w= every 3 weeks; qw= once a week; EPO= epoetin; CT= chemotherapy; n= number of patients; HR= haematological response; 3xw= three times a week; DA= darbepoetin; Hb= haemoglobin; rHuEPO= recombinant human erythropoietin; pts= patients; BT= blood transfusion

Cancer Therapy Vol 3, page 49 More recently, prospective randomised trials have compared different schedules and agents, with no major surprises. As expected, surveys have shown that patients prefer less frequent visits to clinics to receive EPO injections (Schwartzberg et al, 2004; Tauer et al, 2004). Considering the currently available agents, the possible schedules for use in daily practice are: EPO-" (10.000 U thrice a week or 40.000 U once a week); EPO-! (10.000 U thrice a week or 30.000 U once a week) and Darbepoetin (100 mcg once a week or 200 mcg once every 2 weeks). Other schedules may also be feasible, but have been less extensively investigated and should not be recommended routinely. The optimal duration of treatment seems to be 12-16 weeks, as in most clinical trials. The optimal target Hb is currently unknown, but 12-13g/dL has been accepted as a reasonable target. The treatment should be probably interrupted if the Hb rises above 13-14 g/dL.

transferrin saturation <20% and baseline serum ferritin >100ng/mL, the typical picture of anaemia of chronic disease. In short, the role of IV iron supplementation as an adjunct treatment to EPO in patients with cancerassociated anaemia deserves further investigation. Preliminary evidence suggests that IV, but not oral iron, may increase HR rates in subgroups of anaemic cancer patients receiving EPO agents. It remains to be determined whether this increased activity could result in cost savings (by further reducing the need for BT and/or allowing the use of lower doses of EPO).

VIII. Prediction of response EPO is a costly treatment, and is not exempt from toxicity. Considering that up to 30-50% of patients will not respond to this treatment, it would be important to identify those anaemic cancer patients who are most likely to respond. As discussed in the previous section, patients with functional or absolute iron deficiency may be less likely to respond to treatment with EPO, but the HR rate may be significantly improved by the administration of IV iron supplementation. In a small study, the presence of <5% of hypochromic erythrocytes at baseline and an increase in reticulocytes of >= 50% after 2 weeks of treatment were strongly predictive of response to EPO, whilst the presence of >5% hypochromic erythrocytes at baseline indicated functional iron deficiency, requiring the use of IV iron (Katodritou et al, 2004). There is also good evidence that low levels of endogenous erythropoietin may be predictive of response to EPO (Cazzola et al, 1995; Osterborg et al, 2002; Boogaerts et al, 2003; Bamias et al, 2003; Hedenus et al, 2003). Since the majority of the patients included in these studies had haematological malignancies, the evidence is currently considered less robust for solid malignancies (Bokemeyer et al, 2004). Furthermore, not all studies have confirmed the predictive value of low levels of endogenous erythropoietin (Littlewood et al, 2003; Chang et al, 2004). There is also general agreement that HR in the first 4 weeks is predictive of response to EPO (Gonzalez-Baron et al, 2002), though it is also known that a further 10-15% of patients may still respond to EPO after the starting dose is doubled. There is also some data suggesting that baseline Hb levels (>=90 g/dL) (Bokemeyer et al, 2004; Chang et al, 2004) and age (<60 years) (Bokemeyer et al, 2004) may also be predictive factors of response to EPO in patients with CT-induced anaemia. In short, apart perhaps from erythropoietin endogenous concentration in patients with haematological malignancies and the presence of functional or absolute iron deficiency, for the time being the variables above cannot be routinely used for prediction of response to EPO in daily practice.

VII. Iron supplementation Despite these encouraging results, approximately 30% to 50% of cancer patients with CT-related anaemia fail to achieve a meaningful response to EPO. As already demonstrated in patients with anaemia of chronic renal failure (Fishbane et al, 1995; Macdougall et al, 1996; Sepandj et al, 1996), intravenous (IV) iron seems to increase HR rates in patients with CT-related anaemia. The rationale for this is the fact that, during treatment with EPO, large amounts of iron are required to sustain the demands of accelerated erythropoiesis. In patients with chronic renal failure, oral iron supplementation has not resulted in a meaningful benefit (Fishbane et al, 1995; Macdougall et al, 1996). Of note, the risk of anaphylaxis, a feared complication of earlier IV iron preparations, seems to be a rare occurrence (<1%), at least in patients with chronic renal failure (Sepandj et al, 1996). In a recent randomised clinical trial (Auerbach et al, 2004), 157 patients with CT-induced anaemia ((Hb <or= 105 g/L, serum ferritin <or= 450 pmol/L or <or= 675 pmol/L with transferrin saturation <or= 19%) were randomised to one of 4 arms: (1) EPO alone, (2) EPO plus iron 325 twice daily orally, (3) EPO plus iron Dextran 100 mg IV or (4) EPO plus iron Dextran total dose IV. The best HR rates were seen in both IV iron arms, though these results will need confirmation in larger randomised trials. Serious side effects were uncommon in this trial. As a note of caution, the HR rates to EPO in the “no iron supplementation” and “oral iron” arms seemed significantly lower than those reported in the pivotal trials, though this may be because of the selected population of patients with functional or absolute iron deficiency included in this trial, who may well be poor responders to EPO. Similar results were observed in another trial (Henry et al, 2004), in which 187 anaemic (Hb <11 g/dL, with ferritin >100 ng/mL and/ or transferrin saturation >15%) cancer patients receiving CT and EPO were randomised to no iron, iron 325 mg tid orally or IV ferric gluconate. Haematological response rates were better with IV iron than with no iron supplementation or oral iron (73% vs 41%(p=.0029) vs 46%(p=.0099), respectively). The benefit seemed to be the highest among patients with

IX. Effect on cognitive impairment Several studies have linked the administration of CT to a degree of cognitive impairment (van Dam et al, 1998; Schagen et al, 1999; Brezden et al, 2000; Wefel et al, 49

Mano et al: EPO in haematological and solid malignancies management 2004). Interestingly, EPO receptors are known to be expressed throughout the central nervous system (Marti et al, 1997; Juul et al, 1999; Nagai et al, 2001), and at least one small randomised trial has suggested that EPO may have a “neuroprotectant” effect in patients receiving cytotoxic CT for early breast cancer (O'Shaughnessy et al, 2002). Although this potential “neuroprotectant” effect of EPO in patients with CT-induced cognitive dysfunction (and other neurological diseases/brain injury) has been an area of intense research, for the time being this should not be considered an indication for the use of EPO in daily practice.

probably need to be assessed taking into account local realities, so that results of studies are not automatically applicable in different countries or services. In a retrospective study of patients receiving CT for breast cancer, EPO-" given prophylactically was significantly more costly than BTs, though one confusing factor was the absence of guidelines for the indication of BT (Meadowcroft et al, 1998). In another American retrospective study performed in 1997, conventional treatment (with BT as necessary) resulted in cost savings of more than US$ 8,000 per patient, compared to EPO (Sheffield et al, 2003). In a more recent study of 55 metastatic breast cancer patients receiving non-platinum-based CT, a high probability of favourable cost-utility outcomes with EPO" was suggested by the authors (Martin et al, 2003). Stage IV breast cancer therapy costs were collected by surveying UK oncologists, and utilities for associated health states were from published sources. In short, though such estimations are usually difficult, the use of EPO in anaemic patients with cancer is likely to result in increased costs. This should be weighed against the benefits, i.e. improved QOL and saving of blood stocks/risks associated with BT and, in countries like the UK, the risk of variant Creutzfeldt-Jacob disease transmission. Interestingly, in health services that rely totally on BT for the treatment of cancer-associated anaemia, an interesting dilemma has been observed: despite compelling evidence that QOL is improved by the correction of anaemia, there is considerable reluctance to offer early BT to patients, mainly because of potentially unknown risks.

X. Safety profile Epoetin proteins have been generally considered safe agents. There is a larger experience in patients with chronic renal failure, and data is starting to accumulate in cancer patients. The most feared toxicities with these compounds are thromboembolic events and hypertension, both having been shown to be slightly increased in patients with CT induced anaemia receiving EPO (level I evidence) (Bokemeyer et al, 2004). In the BEST study (Leyland-Jones, 2003), a prospective randomised trial closed early because of an increased mortality associated with the use of EPO, some of the early deaths were attributed to thromboembolic events, though it is important to point out that this trial was investigating the role of EPO in patients with normal baseline Hb levels. Another prospective randomised trial investigating the role of EPO in patients with breast cancer has also been prematurely closed due to an increased incidence of thromboembolism (Rosenzweig et al, 2004). In the ENHANCE trial, a prospective randomised trial investigating the role of EPO in patients with head and neck cancer, an increased incidence of vascular events was noted in the EPO arm (11% vs 5%) (Henke et al, 2003). As in the BEST trial, very high levels of Hb were achieved in this study, suggesting that this may be a risk factor for thromboembolic events in this population. In the Cochrane meta-analysis (Bohlius et al, 2004), which included 1738 patients from 12 clinical trials, thromboembolic events occurred in 43/1019 and 14/719 patients in the EPO and control groups respectively (absolute risk difference of 0.02 (95% CI 0.00 to 0.04)). In this review, neither thromboembolism nor hypertension could be definitively linked to the administration of EPO, but under-reporting was a concern with the former. In this same meta-analysis, there was no definite evidence that EPO increased the risk of other adverse events such as rash, irritation, pruritus, haemorrhage and thrombocytopenia. So far, pure red-cell aplasia, a rare but grave complication of treatment with EPO, has been seen only in patients with chronic renal failure (Casadevall et al, 2002; Locatelli and Del Vecchio, 2003), possibly because of the deficient immunity typically present in cancer patients.

XII. Conclusion Although EPO has been considered the preferred treatment for CT-induced anaemia (after exclusion of other causes), there is a surprising variation in its use in different countries. In addition, there is emerging evidence that EPO should also be considered the treatment of choice for cancer-related anaemia. However, the impact of EPO on survival is currently unknown. The disappointing results of some recent prospective randomised trials, which showed a possible negative impact of EPO on outcome, must be balanced against evidence from other trials showing just minor or no increased incidence of thromboembolism and no negative impact on outcome, particularly when a lower Hb target is used (such as 12-13 g/dL). All currently available agents and schedules seem to have similar efficacy. Serious complications are unusual with these agents, the most feared in cancer patients being the risk of thromboembolic events. The use of EPO for cancer and/or CT-induced anaemia significantly reduces the need for BT and spares stocks of blood, but is likely to result in increased costs. Therefore, its cost-effectiveness should be determined on a local basis, and in light of the resources available. It is still too early to routinely use predictive factors of response to EPO in the clinical practice, though serum baseline erythropoietin levels in patients with haematological malignancies and the presence of functional or absolute iron deficiency may be occasionally useful. The role of IV iron supplementation

XI. Cost-utility analysis There is very limited data on the cost-effectiveness of EPO in anaemic cancer patients. Furthermore, costs 50

Cancer Therapy Vol 3, page 51 B, Mayeux P (2002) Pure red-cell aplasia and antierythropoietin antibodies in patients treated with recombinant erythropoietin. N Engl J Med 346, 469-75. Cazzola M, Beguin Y, Kloczko J, Spicka I, Coiffier B (2003) Once-weekly epoetin ! is highly effective in treating anaemic patients with lymphoproliferative malignancy and defective endogenous erythropoietin production. Br J Haematol 122, 386-9 Cazzola M, Messinger D, Battistel V, Bron D, Cimino R, EnllerZiegler L, Essers U, Greil R, Grossi A, Jager G, et al (1995) Recombinant human erythropoietin in the anemia associated with multiple myeloma or non-Hodgkin's lymphoma, dose finding and identification of predictors of response. Blood 86, 4446-53. Chang J, Couture F, Young S, McWatters KL, Lau CY (2004) Once Weekly Epoetin " Maintains Hemoglobin, Improves Quality of Life, and Reduces Transfusion in Breast Cancer Patients Receiving Chemotherapy. J Clin Oncol, in press Charu V, Belani C. P, Gill A. N, Bhatt M, Ben-Jacob A, Tomita D, Katz D (2004) A controlled, randomized, open-label study to evaluate the effect of every-2-week darbepoetin " for anemia of cancer. J Clin Oncol, ASCO Annual Meeting Proceedings (Post-Meeting Edition). Vol 22, No 14S (July 15 Supplement), 8084 Chua DT, Ma J, Sham JS, Mai HQ, Choy DT, Hong MH, Lu TX, Min HQ (2004) Prognostic impact of hemoglobin levels on treatment outcome in patients with nasopharyngeal carcinoma treated with sequential chemoradiotherapy or radiotherapy alone. Cancer 101, 307-16 Crawford J, Cella D, Cleeland CS, Cremieux PY, Demetri GD, Sarokhan BJ, Slavin MB, Glaspy JA (2002) Relationship between changes in hemoglobin level and quality of life during chemotherapy in anemic cancer patients receiving epoetin " therapy. Cancer 95, 888-95. Cremieux PY, Fastenau JM, Kosicki G, Piech CT, Fendrick AM (2004) Cost-minimization analysis of once-weekly versus thrice-weekly epoetin " for chemotherapy-related anemia. J Manag Care Pharm. 10, 531-7. Dammacco F, Castoldi G, Rodjer S (2001) Efficacy of epoetin " in the treatment of anaemia of multiple myeloma. Br J Haematol 113, 172-9. Demetri GD (2001) Anaemia and its functional consequences in cancer patients, current challenges in management and prospects for improving therapy. Br J Cancer 84 (Suppl 1), 31-7. Demetri GD, Kris M, Wade J, Degos L, Cella D (1998) Qualityof-life benefit in chemotherapy patients treated with epoetin " is independent of disease response or tumor type, results from a prospective community oncology study. Procrit Study Group. J Clin Oncol 16, 3412-25. Dubray B, Mosseri V, Brunin F, Jaulerry C, Poncet P, Rodriguez J, Brugere J, Point D, Giraud P, Cosset JM (1996) Anemia is associated with lower local-regional control and survival after radiation therapy for head and neck cancer, a prospective study. Radiology 201, 553-8. Dunst J, Kuhnt T, Strauss HG, Krause U, Pelz T, Koelbl H, Haensgen G (2003) Anemia in cervical cancers, impact on survival, patterns of relapse, and association with hypoxia and angiogenesis. Int J Radiat Oncol Biol Phys. 56, 77887. Fallowfield L, Gagnon D, Zagari M, Cella D, Bresnahan B, Littlewood TJ, McNulty P, Gorzegno G, Freund M; Epoetin Alfa Study Group (2002) Multivariate regression analyses of data from a randomised, double-blind, placebo-controlled study confirm quality of life benefit of epoetin " in patients receiving non-platinum chemotherapy. Br J Cancer 87, 1341-53.

as an adjunct to EPO in subgroups of patients with cancerassociated anaemia should be further investigated.

References Abels R (1993) Erythropoietin for anaemia in cancer patients. Eur J Cancer 29A (Suppl 2), S2-8. Acs G, Acs P, Beckwith SM, Pitts RL, Clements E, Wong K, Verma A (2001) Erythropoietin and erythropoietin receptor expression in human cancer. Cancer Res. 61, 3561-5. Albain KS, Crowley JJ, LeBlanc M, Livingston RB (1991) Survival determinants in extensive-stage non-small-cell lung cancer, the Southwest Oncology Group experience. J Clin Oncol 9, 1618-26. Antonadou D, Cardamakis E, Puglisi M, Malamos N, Throuvalas N (2001) Erythropoietin enhances radiation treatment efficacy in patients with pelvic malignancies. Final results of a randomised phase III study. Eur J Cancer 37 (Suppl 6), 144. Arcasoy MO, Amin K, Karayal AF, Chou SC, Raleigh JA, Varia MA, Haroon ZA (2002) Functional significance of erythropoietin receptor expression in breast cancer. Lab Invest 82, 911-8. Armour A, et al (2003) The prognostic importance of haemoglobin in lung cancer patients. 10th World Conference on the Lung Cancer, Vancouver, Canada Auerbach M, Ballard H, Trout JR, McIlwain M, Ackerman A, Bahrain H, Balan S, Barker L, Rana J (2004) Intravenous iron optimizes the response to recombinant human erythropoietin in cancer patients with chemotherapy-related anemia, a multicenter, open-label, randomized trial. J Clin Oncol 22, 1301-7. Bamias A, Aravantinos G, Kalofonos C, Timotheadou N, Siafaka V, Vlahou I, Janinis D, Pectasides D, Pavlidis N, Fountzilas G; Hellenic Cooperative Oncology Group (2003) Prevention of anemia in patients with solid tumors receiving platinumbased chemotherapy by recombinant human Erythropoietin (rHuEpo, a prospective, open label, randomized trial by the Hellenic Cooperative Oncology Group. Oncology 64, 10210. Bohlius J, Langensiepen S, Schwarzer G, Seidenfeld J, Piper M, Bennet C, Engert A (2004) Erythropoietin for patients with malignant disease. The Cochrane Database of Systematic Reviews, Issue 3. Bokemeyer C, Aapro MS, Courdi A, Foubert J, Link H, Osterborg A, Repetto L, Soubeyran P (2004) EORTC guidelines for the use of erythropoietic proteins in anaemic patients with cancer. Eur J Cancer 40, 2201-16. Bokemeyer C, Oechsle K, Hartmann JT, Schoffski P, Schleucher N, Metzner B, Schleicher J, Kanz L (2002) Treatmentinduced anaemia and its potential clinical impact in patients receiving sequential high dose chemotherapy for metastatic testicular cancer. Br J Cancer 87, 1066-71. Boogaerts M, Coiffier B, Kainz C; Epoetin beta QOL Working Group (2003) Impact of epoetin ! on quality of life in patients with malignant disease. Br J Cancer 88, 988-95. Brezden CB, Phillips KA, Abdolell M, Bunston T, Tannock IF (2000) Cognitive function in breast cancer patients receiving adjuvant chemotherapy. J Clin Oncol 18, 2695-701 Bryne M, Eide GE, Lilleng R, Langmark F, Thrane PS, Dabelsteen E (1991) A multivariate study of the prognosis of oral squamous cell carcinomas. Are blood group and hemoglobin new prognostic factors? Cancer 68, 1994-8 Caro JJ, Salas M, Ward A, Goss G (2001) Anemia as an independent prognostic factor for survival in patients with cancer, a systemic, quantitative review. Cancer 91, 2214-21. Casadevall N, Nataf J, Viron B, Kolta A, Kiladjian JJ, MartinDupont P, Michaud P, Papo T, Ugo V, Teyssandier I, Varet

Mano et al: EPO in haematological and solid malignancies management Fein DA, Lee WR, Hanlon AL, Ridge JA, Langer CJ, Curran WJ Jr, Coia LR (1995) Pretreatment hemoglobin level influences local control and survival of T1-T2 squamous cell carcinomas of the glottic larynx. J Clin Oncol 13, 2077-83. Fishbane S, Frei GL, Maesaka J (1995) Reduction in recombinant human erythropoietin doses by the use of chronic intravenous iron supplementation. Am J Kidney Dis 26, 41-46 Fishbane S, Ungureanu VD, Maesaka JK, Kaupke CJ, Lim V, Wish J (1996) The safety of intravenous iron dextran in hemodialysis patients. Am J Kidney Dis 28, 529-534 Gabrilove JL, Cleeland CS, Livingston RB, Sarokhan B, Winer E, Einhorn LH (2001) Clinical evaluation of once-weekly dosing of epoetin " in chemotherapy patients, improvements in hemoglobin and quality of life are similar to three-timesweekly dosing. Oncol 19, 2875-82. Girinski T, Pejovic-Lenfant MH, Bourhis J, Campana F, Cosset JM, Petit C, Malaise EP, Haie C, Gerbaulet A, Chassagne D (1989) Prognostic value of hemoglobin concentrations and blood transfusions in advanced carcinoma of the cervix treated by radiation therapy, results of a retrospective study of 386 patients. Int J Radiat Oncol Biol Phys. 16, 37-42. Glaser CM, Millesi W, Kornek GV, Lang S, Schull B, Watzinger F, Selzer E, Lavey RS (2001) Impact of hemoglobin level and use of recombinant erythropoietin on efficacy of preoperative chemoradiation therapy for squamous cell carcinoma of the oral cavity and oropharynx. Int J Radiat Oncol Biol Phys 50, 705-15. Glaspy J (2001) Anemia and fatigue in cancer patients. Cancer 92 (Suppl 6), 1719-24. Glaspy J, Bukowski R, Steinberg D, Taylor C, Tchekmedyian S, Vadhan-Raj S (1997) Impact of therapy with epoetin " on clinical outcomes in patients with nonmyeloid malignancies during cancer chemotherapy in community oncology practice. Procrit Study Group. J Clin Oncol 15, 1218-34. Gonzalez-Baron M, Ordonez A, Franquesa R, Constenla M, Montalar J, Gili F, Camps C, Sancho JF, Perez-Cachot P (2002) Response predicting factors to recombinant human erythropoietin in cancer patients undergoing platinum-based chemotherapy. Cancer 95, 2408-13. Granetto C, Ricci S, Martoni A, Pezzella G, Testore F, Mattioli R, Lampignano M, Tacconi F, Porrozzi S, Gasparini G, Mantovani G; EPO-ITA3 Study Group (2003) Comparing the efficacy and safety of fixed versus weight-based dosing of epoetin " in anemic cancer patients receiving platinumbased chemotherapy. Oncol Rep 10, 1289-96. Grogan M, Thomas GM, Melamed I, Wong FL, Pearcey RG, Joseph PK, Portelance L, Crook J, Jones KD (1999) The importance of hemoglobin levels during radiotherapy for carcinoma of the cervix. Cancer 86, 1528-36. Groopman JE, Itri LM (1999) Chemotherapy-induced anemia in adults, incidence and treatment. J Natl Cancer Inst 91, 1616-34. Haugen H, Magnusson B, Svensson M, Mercke C (2004) Preradiotherapy Hemoglobin Level but not Microvessel Density Predicts Locoregional Control and Survival in Laryngeal Cancer Treated with Primary Radical Radiotherapy. Clin Cancer Res 10, 7941-9. Hedenus M, Adriansson M, San Miguel J, Kramer MH, Schipperus MR, Juvonen E, Taylor K, Belch A, Altes A, Martinelli G, Watson D, Matcham J, Rossi G, Littlewood TJ; Darbepoetin Alfa 20000161 Study Group (2003) Efficacy and safety of darbepoetin " in anaemic patients with lymphoproliferative malignancies, a randomized, doubleblind, placebo-controlled study. Br J Haematol 122, 394403. Henke M, Laszig R, Rube C, Schafer U, Haase KD, Schilcher B, Mose S, Beer KT, Burger U, Dougherty C, Frommhold H

(2003) Erythropoietin to treat head and neck cancer patients with anaemia undergoing radiotherapy, randomised, doubleblind, placebo-controlled trial. Lancet 362, 1255-60. Henry DH, et al (2004) Intravenous Ferric Gluconate (FG) for Increasing Response to Epoetin (EPO) in Patients with Anemia of Cancer Chemotherapy - Results of a Multicenter, Randomized Trial (abstract 3696). Blood, 104, 11 Hesketh PJ, Arena F, Patel D, Austin M, D'Avirro P, Rossi G, Colowick A, Schwartzberg L, Bertoli LF, Cole JT, Demetri G, Dessypris E, Dobbs T, Eisenberg P, Fleischman R, Hall J, Hoffman PC, Laber DA, Leonard J, Lester EP, McCachren S, McMeekin S, Meza L, Miller DS, Nand S, Oliff I, Paroly W, Pawl L, Perez A, Raftopoulos H, Rigas J, Rowland K, Scullin DC Jr, Tezcan H, Waples J, Ward J, Yee LK (2004) A randomized controlled trial of darbepoetin " administered as a fixed or weight-based dose using a front-loading schedule in patients with anemia who have nonmyeloid malignancies. Cancer 10, 859-68. Iconomou G, Koutras A, Rigopoulos A, Vagenakis AG, Kalofonos HP (2003) Effect of recombinant human erythropoietin on quality of life in cancer patients receiving chemotherapy, results of a randomized, controlled trial. J Pain Symptom Manage 25, 512-8. Janinis J, Dafni U, Aravantinos G, Kalofonos H. P, Papakostas P, Tsavdaridis D, Koutras A, Samelis G, Tsolakidis D, Fountzilas G (2003) Quality of life (QoL) outcome of epoietin-" (EPO-A) in anemic cancer patients undergoing platinum or non-platinum-based chemotherapy, A randomized study conducted by the Hellenic Cooperative Oncology Group (abstract 3172). Proc Am Soc Clin Oncol 22, 789 Jones M, Schenkel B, Just J, Fallowfield L (2004) Epoetin " improves quality of life in patients with cancer, results of metaanalysis. Cancer 101, 1720-32. Juul SE, Yachnis AT, Rojiani AM, Christensen RD (1999) Immunohistochemical localization of erythropoietin and its receptor in the developing human brain. Pediatr Dev Pathol 2, 148-58. Katodritou E, et al (2004) Evaluation of Traditional and Novel Predictive Markers of Anemia Response to Recombinant Human Erythropoietin (rh-EPO) in Patients with Multiple Myeloma and Lymphoma, Emerging Role of Functional Iron Deficiency (abstract 3690). Blood, 104, 11 Kumar P, Wan J, Viera F (1997) Analysis of survival outcome and prognostic factors (PF) in the treatment of unresectable head and neck (H/N) squamous cell carcinoma (SCCa) using supradose intra-arterial targeted cisplatin (SIT-P) and concurrent radiation therapy (RT) (abstract 1394). Proc Am Soc Clin Oncol 16, 390a Landers DF, Hill GE, Wong KC, Fox IJ (1996) Blood transfusion-induced immunomodulation. Anesth Analg 82, 187-204. Langendijk H, de Jong J, Wanders R, Lambin P, Slotman B (2003) The importance of pre-treatment haemoglobin level in inoperable non-small cell lung carcinoma treated with radical radiotherapy. Radiother Oncol 6, 321-5. Lavey RS, Liu PY, Greer BE, Robinson WR 3rd, Chang PC, Wynn RB, Conrad ME, Jiang C, Markman M, Alberts DS (2004) Recombinant human erythropoietin as an adjunct to radiation therapy and cisplatin for stage IIB-IVA carcinoma of the cervix, a Southwest Oncology Group study. Gynecol Oncol 95, 145-51. Lentz SS, Shelton BJ, Toy NJ (1998) Effects of perioperative blood transfusion on prognosis in early-stage cervical cancer. Ann Surg Oncol 5, 216-9. Leyland-Jones B (2003) BEST Investigators and Study Group. Breast cancer trial with erythropoietin terminated unexpectedly. Lancet Oncol 4, 459-60.

Cancer Therapy Vol 3, page 53 Littlewood TJ, Bajetta E, Nortier JW, Vercammen E, Rapoport B; Epoetin Alfa Study Group (2001) Epoetin " Study Group. Effects of epoetin " on hematologic parameters and quality of life in cancer patients receiving nonplatinum chemotherapy, results of a randomized, double-blind, placebo-controlled trial. J Clin Oncol 19, 2865-74. Littlewood TJ, Nortier J, Rapoport B, Pawlicki M, de Wasch G, Vercammen E, Schuette W, Wils J, Freund M; Epoetin Alfa Study Group (2003) Epoetin " corrects anemia and improves quality of life in patients with hematologic malignancies receiving non-platinum chemotherapy. Hematol Oncol 21, 169-80. Littlewood TJ, Zagari M, Pallister C, Perkins A (2003) Baseline and early treatment factors are not clinically useful for predicting individual response to erythropoietin in anemic cancer patients. Oncologist 8, 99-107. Locatelli F, Del Vecchio L (2003) Pure red cell aplasia secondary to treatment with erythropoietin. J Nephrol 16, 461-6. Ludwig H, Strasser K (2001) Symptomatology of anemia. Semin Oncol 28 (2 Suppl 8), 7-14. Ludwig H, Van Belle S, Barrett-Lee P, Birgegard G, Bokemeyer C, Gascon P, Kosmidis P, Krzakowski M, Nortier J, Olmi P, Schneider M, Schrijvers D (2004) The European Cancer Anaemia Survey (ECAS), a large, multinational, prospective survey defining the prevalence, incidence, and treatment of anaemia in cancer patients. Eur J Cancer 40, 2293-306 Macdougall IC, Tucker B, Thompson J, Tomson CR, Baker LR, Raine AE (1996) A randomized controlled study of iron supplementation in patients treated with erythropoietin. Kidney Int 50, 1694-1699 Marti HH, Gassmann M, Wenger RH, Kvietikova I, MorgantiKossmann MC, Kossmann T, Trentz O, Bauer C (1997) Detection of erythropoietin in human liquor, intrinsic erythropoietin production in the brain. Kidney Int 51, 416-8. Martin SC, Gagnon DD, Zhang L, Bokemeyer C, Van Marwijk Kooy M, van Hout B (2003) Cost-utility analysis of survival with epoetin-" versus placebo in stage IV breast cancer. Pharmacoeconomics 21, 1153-69. McKenzie SR, Heifetz LJ, Duh MS, et al (2002) Effectiveness of Epoetin " beyond Once-Weekly Dosing Schedules in the Oncology Community Practice Setting (abstract 5591). Blood 100, 501b-502b. Meadowcroft AM, Gilbert CJ, Maravich-May D, Hayward SL (1998) Cost of managing anemia with and without prophylactic epoetin " therapy in breast cancer patients receiving combination chemotherapy. Am J Health Syst Pharm 55, 1898-902. Miller CB, Platanias LC, Mills SR, Zahurak ML, Ratain MJ, Ettinger DS, Jones RJ (1992) Phase I-II trial of erythropoietin in the treatment of cisplatin-associated anemia. J Natl Cancer Inst 84, 98-103 Mirtsching B, Charu V, Vadhan-Raj S, Colowick AB, Rossi G, Tomita D, McGuire WP (2002) Every-2-week darbepoetin " is comparable to rHuEPO in treating chemotherapy-induced anemia. Results of a combined analysis. Oncology (Huntingt). 16(10 Suppl 11), 31-6. Mittelman M, Neumann D, Peled A, Kanter P, Haran-Ghera N (2001) Erythropoietin induces tumor regression and antitumor immune responses in murine myeloma models. Proc Natl Acad Sci USA 98, 5181-86. MĂśbus VJ, Untch M, du Bois A, Lueck HJ, Thomssen C, Kuhn W, Kurbacher C, Nitz U, Kreienberg R, Jackisch C (2004) Dose-dense sequential chemotherapy with epirubicin (E), paclitaxel (T) and cyclophosphamide (C) (ETC) is superior to conventional dosed chemotherapy in high-risk breast cancer patients (% 4 +LN). First results of an AGO-trial (abstract 513). J Clin Oncol, ASCO Annual Meeting

Proceedings (Post-Meeting Edition). Vol 22, No 14S (Suppl 15). Munstedt K, Johnson P, Von Georgi R, Vahrson H, (2004) Adjuvant radiotherapy in carcinomas of the uterine cervix â&#x20AC;&#x201C; The prognostic role of hemoglobin levels (abstract 5113). Proc Am Soc Clin Oncol 476s. Nagai A, Nakagawa E, Choi HB, Hatori K, Kobayashi S, Kim SU (2001) Erythropoietin and erythropoietin receptors in human CNS neurons, astrocytes, microglia, and oligodendrocytes grown in culture. J Neuropathol Exp Neurol 60, 386-92. Ng T, Marx G, Littlewood T, Macdougall I (2003) Recombinant Erythropoetin in Clinical Practice. Postgrad Med J 79, 367376 Obermair A, Cheuk R, Horwood K, Janda M, Bachtiary B, Schwanzelberger B, Stoiber A, Nicklin JL, Perrin LC, Crandon AJ (2001) Impact of hemoglobin levels before and during concurrent chemoradiotherapy on the response of treatment in patients with cervical carcinoma, preliminary results. Cancer 92, 903-8. Obermair A, Cheuk R, Horwood K, Neudorfer M, Janda M, Giannis G, Nicklin JL, Perrin LC, Crandon AJ (2003) Anemia before and during concurrent chemoradiotherapy in patients with cervical carcinoma, Effect on progression-free survival. Int J Gynecol Cancer 13, 633-9. Obermair A, Handisurya A, Kaider A, Sevelda P, Kolbl H, Gitsch G (1998) The relationship of pretreatment serum hemoglobin level to the survival of epithelial ovarian carcinoma patients, a prospective review. Cancer 83, 72631. Okuno Y, Takahashi T, Suzuki A, Ichiba S, Nakamura K, Hitomi K, Sasaki R, Imura H (1990) Expression of the erythropoietin receptor on a human myeloma cell line. Biochem Biophys Res Commun 170, 1128-34. O'Shaughnessy J, Vukelja S, Savin M, et al (2002) Impact of epoetin " on cognitive function, asthenia, and quality of life in women with breast cancer receiving adjuvant or neoadjuvant chemotherapy, analysis of 6-month follow-up data (abstract 550). Breast Cancer Res Treat 76 (suppl 1): S138. Osterborg A, Brandberg Y, Molostova V, Iosava G, Abdulkadyrov K, Hedenus M, Messinger D; Epoetin Beta Hematology Study Group (2002) Randomized, double-blind, placebo-controlled trial of recombinant human erythropoietin, epoetin !, in hematologic malignancies. J Clin Oncol 20, 2486-94. Patton J, Reeves J, Walla J (2004) Effectiveness of darbepoetin " versus epoetin " in patients with chemotherapy-induced anemia treated in clinical practice. Oncologist 9, 451-8. Pawlicki M, Jassem J, Bosze P, Lotan C, Kurteva GP, Siddiqui M, Kosmidis PA, Rigatos GA, Kansu E, Durkovic P, Aziz Z, Al Idrissi H, Roth A, Cozma G (1997) A multicenter study of recombinant human erythropoietin (epoetin ") in the management of anemia in cancer patients receiving chemotherapy. Anticancer Drugs. 8, 949-57. Pedersen D, Sogaard H, Overgaard J, Bentzen SM (1995) Prognostic value of pretreatment factors in patients with locally advanced carcinoma of the uterine cervix treated by radiotherapy alone. Acta Oncol 34, 787-95. Pronzato P, Cortesi E, van der Rijt C, et al (2002) Early intervention with epoetin " in breast cancer (BC) patients (pts) undergoing chemotherapy (CT, Results of a randomized, multicenter, phase IIIb study (EPO-INT-47 Study Group). Ann Oncol 13 (Suppl 5), 168 Quirt I, Robeson C, Lau CY, Kovacs M, Burdette-Radoux S, Dolan S, Tang SC, McKenzie M, Couture F; Canadian Eprex Oncology Study Group (2001) Epoetin " therapy increases hemoglobin levels and improves quality of life in patients

Mano et al: EPO in haematological and solid malignancies management with cancer-related anemia who are not receiving chemotherapy and patients with anemia who are receiving chemotherapy. J Clin Oncol 19, 4126-34. Rearden TP, Charu V, Saidman B, Ben-Jacob A, Justice GR, Manaim A. S, Tomita D, Rossi G (2004) Results of a randomized study of every three-week dosing (Q3W) of darbepoetin " for chemotherapy-induced anemia (CIA). J Clin Oncol, ASCO Annual Meeting Proceedings (PostMeeting Edition). Vol 22, No 14S (Suppl 15), 8064 Reichel O, Panzer M, Wimmer C, Duhmke E, Kastenbauer E, Suckfull M (2003) Prognostic implications of hemoglobin levels before and after surgery as well as before and after radiochemotherapy for head and neck tumors. Eur Arch Otorhinolaryngol 260, 248-53. Rizzo JD, Lichtin AE, Woolf SH, Seidenfeld J, Bennett CL, Cella D, Djulbegovic B, Goode MJ, Jakubowski AA, Lee SJ, Miller CB, Rarick MU, Regan DH, Browman GP, Gordon MS; American Society of Clinical Oncology. American Society of Hematology (2002) Use of epoetin in patients with cancer, evidence-based clinical practice guidelines of the American Society of Clinical Oncology and the American Society of Hematology. J Clin Oncol 20, 4083107. Rosenzweig MQ, Bender CM, Lucke JP, Yasko JM, Brufsky AM ( 2004) The decision to prematurely terminate a trial of R-HuEPO due to thrombotic events. J Pain Symptom Manage 27, 185-90 Savonije J, Van Groeningen C, Van Bochove A, Pinedo H, Giaccone G (2004) Early intervention with epoetin-" during platinum-based chemotherapy. J Clin Oncol, ASCO Annual Meeting Proceedings (Post-Meeting Edition). Vol 22, No 14S, 8111 Schagen SB, van Dam FS, Muller MJ, Boogerd W, Lindeboom J, Bruning PF (1999) Cognitive deficits after postoperative adjuvant chemotherapy for breast carcinoma. Cancer 85, 640-50. Schwartzberg L, Shiffman R, Tomita D, Stolshek B, Rossi G, Adamson R (2003) A multicenter retrospective cohort study of practice patterns and clinical outcomes of the use of darbepoetin "and epoetin "for chemotherapy-induced anemia. Clin Ther 25, 2781-96. Schwartzberg L, Yee L, Senecal F, Charu V, Tomita D, Rossi G (2004) Darbepoetin " (DA) 200 mcg every 2 weeks (Q2W) vs epoetin " (Epo) 40,000 U weekly (QW) in anemic patients (pts) receiving chemotherapy (ctx) (abstract 8063). J Clin Oncol; Proc Am Soc Clin Oncol (Post-Meeting Edition). Vol 22, No 14S (July 15 Supplement) Seidenfeld J, Piper M, Flamm C, Hasselblad V, Armitage JO, Bennett CL, Gordon MS, Lichtin AE, Wade JL 3rd, Woolf S, Aronson N (2001) Epoetin treatment of anemia associated with cancer therapy, a systematic review and meta-analysis of controlled clinical trials. J Natl Cancer Inst 93, 1204-14 Sepandj F, Jindal K, West M, Hirsch D (1996) Economic appraisal of maintenance parenteral iron administration in treatment of anaemia in chronic haemodialysis patients. Nephrol Dial Transplant 11, 319-322 Shasha D, George MJ, Harrison LB (2003) Once-weekly dosing of epoetin-" increases hemoglobin and improves quality of life in anemic cancer patients receiving radiation therapy either concomitantly or sequentially with chemotherapy. Cancer 98, 1072-9. Sheffield R, Sullivan SD, Saltiel E, Nishimura L (2003) Cost comparison of recombinant human erythropoietin and blood transfusion in cancer chemotherapy-induced anemia. Ann Pharmacother 31, 15-22. Silver DF, Piver MS (1999) Effects of recombinant human erythropoietin on the antitumor effect of cisplatin in SCID

mice bearing human ovarian cancer, A possible oxygen effect. Gynecol Oncol 73, 280-4. Sloan JA, Witzig T, Silberstein P (2002) Quality of Life, Blood Transfusions, and Toxicity, in Anemic Patients with Advanced Cancer Receiving Weekly Erythropoietin While on Chemotherapy, Results from a Phase III Randomized Double-Blind Placebo-Controlled Study (abstract 1103). Blood 100, 287aâ&#x20AC;&#x201C;287b. Straus DJ (2002) Epoetin " as a supportive measure in hematologic malignancies. Semin Hematol 39 (Suppl 3), 2531. Tauer KW, Zhu L, Fortner BV (2004) The impact of anemia treatment visits on the patient and their caregiver (abstract 8114). J Clin Oncol, ASCO Annual Meeting Proceedings (Post-Meeting Edition). Vol 22, No 14S. Thames WA, Smith SL, Scheifele AC, Yao B, Giffin SA, Alley JL (2004) Evaluation of the US Oncology Network's recommended guidelines for therapeutic substitution with darbepoetin " 200 microg every 2 weeks in both naĂŻve patients and patients switched from epoetin ". Pharmacotherapy 24, 313-23. Thatcher N, De Campos ES, Bell DR, Steward WP, Varghese G, Morant R, Vansteenkiste JF, Rosso R, Ewers SB, Sundal E, Schatzmann E, Stocker H (1999) Epoetin " prevents anaemia and reduces transfusion requirements in patients undergoing primarily platinum-based chemotherapy for small cell lung cancer. Br J Cancer 80, 396-402. Thews O, Koenig R, Kelleher DK, Kutzner J, Vaupel P (1998) Enhanced radiosensitivity in experimental tumours following erythropoietin treatment of chemotherapy-induced anaemia. Br J Cancer 78, 752-6. Thomas H, et al (2002) Early intervention with Epoetin " for treatment of anaemia and improvement of quality of life in cancer patients undergoing myelotoxic chemotherapy. Ann Oncol 13 (Suppl 5), 177 van Acht MJ, Hermans J, Boks DE, Leer JW (1992) The prognostic value of hemoglobin and a decrease in hemoglobin during radiotherapy in laryngeal carcinoma. Radiother Oncol 23, 229-35. van Dam FS, Schagen SB, Muller MJ, Boogerd W, vd Wall E, Droogleever Fortuyn ME, Rodenhuis S (1998) Impairment of cognitive function in women receiving adjuvant treatment for high-risk breast cancer, high-dose versus standard-dose chemotherapy (abstract. J Natl Cancer Inst 210-218. Vansteenkiste J, Pirker R, Massuti B, Barata F, Font A, Fiegl M, Siena S, Gateley J, Tomita D, Colowick AB, Musil J; Aranesp 980297 Study Group (2002) Double-blind, placebocontrolled, randomized phase III trial of darbepoetin " in lung cancer patients receiving chemotherapy. J Natl Cancer Inst 94, 1211-20. Waltzman RJ, Fesen M, Justice GR, Croot C, Williams D (2004) Epoetin " 40,000 U QW vs darbepoetin " 200 mcg Q2W in anemic cancer patients receiving chemotherapy, Preliminary results of a comparative trial (abstract 8153). J Clin Oncol, ASCO Annual Meeting Proceedings (Post-Meeting Edition). Vol 22, No 14S (July 15 Supplement). Wefel JS, Lenzi R, Theriault RL, Davis RN, Meyers CA (2004) The cognitive sequelae of standard-dose adjuvant chemotherapy in women with breast carcinoma, results of a prospective, randomized, longitudinal trial. Cancer 100, 2292-9. Wilkinson PM, et al (2001) Early intervention with epoetin " treats anaemia and improves quality of life in ovarian cancer patients undergoing chemotherapy (abstract 980). Eur J Cancer 37 (Suppl 6), S144. Witzig TE, Silberstein PT, Loprinzi CL, Sloan JA, Novotny PJ, Mailliard JA, Rowland KM, Alberts SR, Krook JE, Levitt R, Morton RF (2004) Phase III, Randomized, Double-Blind

Cancer Therapy Vol 3, page 55 regulates tumour growth Carcinogenesis 24, 1021-29

Study of Epoetin " Versus Placebo in Anemic Patients With Cancer Undergoing Chemotherapy. J Clin Oncol, in press Yasuda Y, Fujita Y, Matsuo T, Koinuma S, Hara S, Tazaki A, Onozaki M, Hashimoto M, Musha T, Ogawa K, Fujita H, Nakamura Y, Shiozaki H, Utsumi H (2003) Erythropoietin

human

malignancies.

Mano et al: EPO in haematological and solid malignancies management

Cancer Therapy Vol 3, page 57 Cancer Therapy Vol 3, 57-64, 2005

Targeting of cytostatic bile acid derivatives toward tumours of the enterohepatic circuit Review Article

Jose J.G. Marin*, Marta R. Romero, Marta Vallejo, Maria J. Monte Laboratory of Experimental Hepatology and Drug Targeting, University of Salamanca, Salamanca, Spain

__________________________________________________________________________________ *Correspondence: Dr. Jose J.G. Marin, Department of Physiology and Pharmacology, Campus Miguel de Unamuno, E.D. S-09, 37007Salamanca, Spain; Phone: 34 923 294674; Fax: 34 923 294669; E-mail: jjgmarin@usal.es Key words: Cancer, Chemotherapy, Drug targeting, Intestine, Liver Abbreviations: bile salt export pump, (BSEP); cis-diammine-bisursodeoxycholate-platinum(II), (Bamet-UD2); cis-diamminechlorocholylglycinate-platinum(II), (Bamet-R2); ileal bile acid transporter, (IBAT); Na+-taurocholate cotransporting polypeptide (NTCP); organic anion-transporting polypeptides, (OATP) Received: 8 February 2005; Accepted: 11 February 2005; electronically published: February 2005

Summary Two important limitations to the chemotherapy available for the treatment of tumours of the enterohepatic circuit are low patient response to cytostatic agents, together with the appearance of undesirable side effects. One interesting strategy to overcome these drawbacks consists of using drugs with enhanced tumour cell selectivity. In this sense, based upon the existence in the plasma membrane of hepatocytes, cholangiocytes and cells of the intestinal mucosa of proteins able to carry out efficient uptake of bile acids and their derivatives, several targeted agents have been synthesized by coupling cytostatic moieties to these natural acid steroids. The best results in preclinical screenings have been obtained for cisplatin derivatives such as cis-diamminechloro-cholylglycinateplatinum(II) (Bamet-R2) and, in particular, cis-diammine-bisursodeoxycholate-platinum(II) (Bamet-UD2). These compounds are efficiently incorporated into hepatic and intestinal tumour cells and they are also taken up and efficiently excreted into bile by normal hepatocytes. The potential clinical usefulness of Bamets as anti-tumour agents is based on their strong ability to form adducts with DNA, which results in pro-apoptotic and cytostatic activity and in vivo anti-tumour effects, together with enhanced liver and intestinal organotropism, which probably accounts for minor non-specific toxicity and a marked overall increase in the life span of nude mice bearing liver implants of wild-type or cisplatin-resistant liver or colon tumours. This beneficial effect is enhanced by the encapsulation of Bamets into liposomes. In conclusion, novel cytostatic agents with enhanced targeting towards enterohepatic tumours are now available for further investigations in the preclinical stage and, eventually, in clinical trials. resistance to the cytostatic drug (Canon et al, 1990). Thus, in order to treat tumours of the enterohepatic circuit, more efficient anticancer drugs are needed. One way to increase the beneficial characteristics of novel drugs is to enhance their cell selectivity. The objective of drug targeting, especially for cancer chemotherapy, is to enhance the effectiveness of the drug by concentrating it at the target site and minimizing its effects at non-target sites. This is one of the main aims of modern research in the field of gut and liver cancer chemotherapy. To achieve this goal, many different strategies have been devised and several targeting systems, usually based on the biological properties of several molecules coupled to cytostatic agents, have been proposed.

I. Introduction A large proportion of diagnosed cancers are found in tissues of the enterohepatic circuit, which includes the liver, the biliary tree, the gallbladder and the intestine, and the incidence of some of them, such as hepatocellular carcinoma, is rapidly increasing (Cahill et al, 2004). In addition, their prognosis is usually very poor and some of them are quite difficult to treat (Jarnagin et al, 2003; O'Connell et al, 2003; Si et al, 2003). Current therapy for these types of tumour includes surgery, when feasible, and this is often combined with radiotherapy and/or chemotherapy (Cahill et al, 2004). However, the latter alternative very often faces two major drawbacks that seriously limit its clinical usefulness. These are the appearance of noxious side effects and the development of

Marin et al: Targeting of cytostatic agents toward enterohepatic tumours Examples of research into intestinal drug targeting include studies on the usefulness of cisplatin-encapsulated transferrin-polyethylene glycol liposomes to treat the peritoneal dissemination of gastric cancer (Iinuma et al, 2002). Moreover, several targeted drug delivery systems for the delivery of anticancer drugs to the colon have been reviewed recently (Minko, 2004). One of these possibilities is the targeting/drug delivery of celecoxib using guar gum as a carrier (Krishnaiah et al, 2002). Regarding liver targeting, owing to the existence in parenchymal hepatic cells of specific plasma membrane receptors for asialoglycoproteins there exists the posibility of coupling antitumour drugs to moieties containing branched galactose residues (Yu et al, 2000; Ohya et al, 2001; Wu et al, 2002). Other interesting alternatives include albumin-conjugates (Stehle et al, 1997), combinations with biotinyl saccharides (Ouchi et al, 2004), the gelatin powder (Gelfoam) used in regional chemotherapy (Pohlen et al, 2001) and nanoparticles (Yamada et al, 2003). Intracellular targets have been also explored, and include the use of anti-sense oligonucleotides and ribozymes (Huesker et al, 2002). Furthermore, plasma membrane proteins expressed in both hepatic and intestinal cells and involved in the efficient uptake of the so-called cholephilic organic anions, such as bile acids (Meier et al, 2002), have been investigated by our group, and others, for use as molecular targets for directing anticancer drugs towards tumours of the enterohepatic circuit (Marin et al, 2001).

in bile acid secretion into bile (Meier et al, 2002). Most bile acid molecules secreted into bile are re-absorbed at the intestine, mainly in the ileum, by very efficient uptake mechanisms, including the ileal bile acid transporter (IBAT, gene symbol SLC10A2). Thus, a minor daily faecal loss (approximately 5% of the total bile acid pool) occurs, which is replaced by de novo synthesis. The sodiumdependent transporter NTCP (gene symbol SLC10A1), and several members of the organic anion-transporting polypeptides (OATP) family, in particular OATP-C or according to the new nomenclature (Hagenbuch et al, 2004) OATP1B1 (gene symbol SLCO1B1), and OATP8 or OATP1B3 (gene symbol SLCO1B3) are responsible for the efficient uptake of bile acids from sinusoidal blood (Meier et al, 2002). As a result, only a small proportion of the bile acid pool escapes from the enterohepatic circuit to the systemic circulation, where bile acid concentrations are usually lower than 10 ÂľM. The marked enterohepatic organotropism of these compounds has prompted several investigators to propose the possible usefulness of bile acids or their analogues as shuttles for drugs towards tissues located in the enterohepatic circuit (Ho, 1987; Betebenner et al, 1991; Stephan et al, 1992; Kramer et al, 1996). The most evident advantage of this strategy in cancer chemotherapy is that selective drug uptake will be enhanced if the resulting molecule is recognized as a substrate by plasma membrane carrier proteins expressed in tumours of the enterohepatic circuit. Therefore, a key aspect in designing these new drugs is to know at exactly which point of the bile acid molecule the active agent should be bound. In principle, the possibilities for conjugating a drug to a bile acid include the hydroxyl groups, in particular the one located at the 3!-position, and the carboxyl group on the side chain (Figure 1).

II. Enterohepatic organotropism of bile acid derivatives Bile acids are synthesized from cholesterol in hepatocytes. Proteins of the superfamily of ATP binding cassette proteins or ABC proteins, such as the bile salt export pump (BSEP, gene symbol ABCB11) are involved

Figure 1. Schematic representation of a typical bile acid (cholic acid) showing potential positions for coupling to pharmacologically active moieties. (A) Chemical structure (3!, 7!, 12!-trihydroxy-5"-cholanoic acid). (B) Spatial representation of the amphipathic characteristics endowing bile acid derivatives the ability to be efficiently encapsulated into liposomes.

Cancer Therapy Vol 3, page 59 Some bile acid transporters, such as NTCP in hepatocytes and IBAT in cells of the intestinal epithelium and cholangiocytes, which carry out efficient co-transport of bile acids with sodium (Figure 2A) seem to interact with the side chain of the bile acid molecule (Kramer et al, 2001), and therefore this part of the molecule must not be

used to bind the active agent if it is desired that the resulting drug be taken up by these transporters. In contrast, bile acid derivatives obtained by coupling an active agent to the bile acid side chain are efficiently taken up by several members of the human OATP family when expressed in Xenopus laevis oocytes (Briz et al, 2002).

Figure 2. Schematic representation of the plasma membrane carriers involved in normal uptake/secretion of bile acids (BA) by normal hepatocytes (A) and targeting of cytostatic bile acid derivatives to liver tumour cells (B). NTCP, Na+-taurocholate-cotransporting polypeptide; OATP, organic anion-transporting polypeptide; A-, exchanged anion; BSEP, bile salt export pump; MRP2, multidrug resistance-associated protein-2.

Marin et al: Targeting of cytostatic agents toward enterohepatic tumours The whole of the strategy described above is based on the hypothesis that proteins able to take up bile acids are expressed in enterohepatic tumours. But is this in fact true? Although markedly reduced, the expression of carrier proteins and the ability to take up cholephilic organic anions that are typically substrates of OATPs and NTCP are still present in several, but not all, tumour cell lines of enterohepatic origin (Kroker et al, 1978; Von Dippe et al, 1990; Marchegiano et al, 1992; Kullak-Ublick et al, 1996). Moreover the specific expression of several of these transporters has been found in human hepatocellular carcinomas (Kullak-Ublick et al, 1997). Using real-time quantitative RT-PCR we have also recently detected the expression of these transporters in biopsies collected from intestinal adenomas and carcinomas (unpublished results). Moreover, the ability of liver tumour cells to take up bile acids has been confirmed in laboratory animals. Thus, cells isolated from the liver of rats undergoing a protocol of hepatocarcinogenesis induction were able to take up bile acid derivatives in a selective and sodium-independent way (Monte et al, 1999). This was consistent with the major role of members of the OATP family in this process. Although the efficiency of tumour cells to take up bile acids could be expected to be lower than that of normal epithelial cells, it should be noted that tumour cells are not polarized, and hence drug uptake might not be accompanied by efflux to a similar extent (Figure 2B). Indeed, when overall drug accumulation was analyzed after administering bile acid derivatives to nude mice that had previously been ortothopically implanted with murine liver tumour cells, the amount of drug in the tumours was higher than that found in healthy tissue of the same liver (Briz et al, 2003). Moreover, as expected, there is a relationship between tumour cell load and sensitivity to the cytostatic effect of these compounds (Larena et al, 2002). Although originally the main reasons for synthesizing cytostatic bile acid derivatives were to use them against tumours located in tissues of the enterohepatic circuit (Marin et al, 2001) or to enhance their water miscibility (Maeda et al, 1990), an additional interest coming from their organotropic characteristics is to extend their use to regional treatment of tumours located outside to the enterohepatic circuit. In these cases, the pharmacological advantage of these compounds would be due to the ability of the liver to efficiently take up and eliminate into bile the drug that, escaping from the tumour, might reach the general circulation during regional therapy (Macias et al, 1998; Larena et al, 2001).

the characteristic shared by all members of this family of compounds is that they contain a bile acid-like moiety and an atom of a DNA-reactive transition metal. The reason for choosing this tandem is the small size of the resulting molecule, which would increase the probability of maintaining both the substrate properties as regards bile acid transporters and the reactivity versus DNA, and hence the antiproliferative effect of these metals, in particular platinum(II) such as in cisplatin - cisdiamminedichloro platinum(II) - (Muggia, 1991). Bamets containing transition metal atoms other than platinum, such as gold (Carrasco et al, 2001) are less efficient cytostatic agents than those containing Pt(II) in the reactive moiety. Regarding the organic moiety of the molecule, two types of variable have been assayed. These are the bile acid moiety and the nature of the linker placed between this and the transition metal atom alone or as part of cisplatin-derivatives (Marin et al, 2001). More recently, other groups have expanded the list of variations in the Bamet family by synthesizing several carboplatin-bile acid derivatives (Paschke et al, 2003). Two of the best studied and most promising compounds of the Bamet family are cis-diamminechloro-cholylglycinate platinum(II) (BametR2) (Criado et al, 1997) and cis-diamminebisursodeoxycholate platinum(II) (Bamet-UD2) (Criado et al, 2000).

IV. Mechanism of the cytostatic effect The mechanism of DNA-Bamet interactions is expected to be similar to that of the moiety endowing them with cytostatic ability; namely, cisplatin in the case of Bamet-R2 and Bamet-UD2. Cisplatin forms DNA adducts mainly at the guanine-N7 position (Horacek et al, 1971; Pinto et al, 1985). By different approaches, indirect evidence for the existence of Bamet-induced changes in DNA structure have also been found (Marin et al, 1998a; Martinez-Diez et al, 2000). Thus, in vitro experiments have shown that Bamets are able to change the eletrophoretic mobility of supercoiled covalently-closed and open forms of the circular plasmid pUC18 from Escherichia coli. Moreover, incubation of double-strand DNA with Bamets resulted in an increase in the DNA melting temperature, suggesting the existence of stronger interactions between both strands. This would presumably be due to the formation of inter-strand Bamet-DNA adducts. Scatchard analysis of the results obtained from ethidium bromide displacement assays reveal a marked reduction in the number of DNA sites for ethidium bromide intercalation after in vitro incubation of DNA with Bamets. The Bamet-DNA interaction probably plays an important role in the ability of these compounds to induce the inhibition of DNA synthesis by proliferating cells, as has been determined by measurement of the incorporation of radiolabeled thymidine into DNA using rat hepatocytes in primary culture and several tumour cell lines (Marin et al, 1998a; Martinez-Diez et al, 2000). The sensitivity to the cytostatic effect of Bamets is not similar for all compounds and all cell lines assayed. However, in general,

III. Coupling bile acids to transition metals to generate cytostatic agents Although the possibilities of targeting cytostatic agents to the enterohepatic circuit are very broad, and in this respect the coupling of bile acids to organic antitumour drugs, such as chlorambucil (Kramer et al, 1992) as well as other organic moieties (Eunok et al, 2001) has been achieved and investigated, we shall focus the present review on the family of compounds for which this targeting strategy has been most deeply explored so far, i.e., Bamets. This name is an acronym for BA (bile acids) and MET (metal), since 60

Cancer Therapy Vol 3, page 61 in the case of Bamet-R2 and Bamet-UD2 this ability is comparable to that of cisplatin. In addition to blocking DNA replication, the cytostatic effect of Bamets is believed to be due to both a mild pro-necrotic effect and strong pro-apoptotic activity. This is a relevant issue, since cytostatic activity due to the induction of necrosis may lead to the appearance in vivo of noxious inflammation-associated side effects. Apoptosis has been suggested to be an important mechanism in cell killing by cisplatin (Ormerod et al, 1994). In studies on enterohepatic tumour cells, the release of lactate dehydrogenase to the culture medium and caspase 3 activity in treated cells have been measured to evaluate pro-necrotic versus pro-apoptotic effects, respectively. Apoptosis was confirmed by DNA fragmentation as studied by DNA-ladder formation, TUNEL, single-cell electrophoresis or â&#x20AC;&#x153;cometâ&#x20AC;? assays, Hoechst-33258 staining, and flow cytometry. Bamet-UD2, Bamet-R2, and cisplatin induce a similarly low degree of necrosis. However, pro-apoptotic ability in tumour cells is particularly high for Bamet-UD2. When administered orally, this compound is also able to induce an increase in the rate of apoptosis observed in normal intestinal mucosa of mouse small intestine, although this effect is mild enough as to not affect the structure and function of this organ (Marin et al, 2004).

When after multiple drug administration to rats for 40 days, the platinum contents in different tissues were measured by flameless atomic absorption spectrometry, the amounts of platinum found in kidney, nerve, brain, bone marrow, lung, heart and muscle were significantly lower in rats treated with Bamet-R2 and Bamet-UD2 than in those receiving cisplatin. By contrast, platinum liver contents at short-term (3 h after administration of a single dose) were higher in Bamet-treated rats than in animals receiving cisplatin. Nevertheless, the level of platinum in liver tissue was more efficiently reduced later on (14 days after administration of a single dose) in animals receiving Bamets. This particular time course in the liver handling of these drugs is probably due to the following three features: i) The ability of hepatocytes to take up Bamets (Macias et al, 1998); ii) Bamets are efficiently secreted into bile, with no major biotransformation (Macias et al, 1998; Larena et al, 2001); iii) Although Bamets are absorbed in the intestine, such absorption is significantly lower than the biliary excretion rate (Marin et al, 1996). Thus, Bamets differ from the parent drug cisplatin in their cholephilic characteristics, which are responsible for an important shift in the predominance of faecal versus renal pathways of elimination from the body (Marin et al, 1998b; Macias et al, 1998; Palomero et al, 1998; Macias et al, 1999; Larena et al, 2001).

V. Efficient fecal elimination and low systemic toxicity

VI. Circumvention of resistance to chemotherapy

As mentioned above, two important drawbacks, also limit the clinical usefulness of chemotherapy based on cisplatin-related cytostatic drugs (Muggia, 1991). These are the development of resistance by tumour cells (Canon et al, 1990), and the appearance of undesirable side effects, which mainly include nephrotoxicity, but also myelotoxicity, and neurotoxicity (Von Hoff et al, 1979; Zhang et al, 1994). By coupling cisplatin to bile acids these drawbacks can be markedly reduced. One of the most interesting properties of certain members of the Bamet family is their low overall toxicity. However, this characteristic is not shared by all Bamets. For instance, Bamet-D3, which proved to be highly effective as a cytostatic agent was found to induce renal toxicity in rats (Larena et al, 2001). The side effects induced by Bamet-R2 are significantly lower that those induced by cisplatin in rats (Dominguez et al, 2001). Moreover, and more importantly, despite the marked antitumour activity of Bamet-UD2, no toxicity to the liver, kidney, bone marrow or nervous system has been detected for this drug in in vivo studies (Dominguez et al, 2001). The reason for the low toxicity of Bamets, in particular Bamet-UD2, as compared to cisplatin is most probably related to the organotropic properties of these compounds, which are assumed to be due to the presence of the bile acid moiety in the molecule. In addition, in the case of Bamet-UD2 the bile acid moiety is ursodeoxycholic acid, a bile acid with well-known cytoprotective properties (Botla et al, 1995; Saksena et al, 1997) that cooperate to reduce the noxious effects of the cisplatin moiety on normal cells exposed to the drug.

Another interesting aspect of cytostatic bile acid derivatives is their potential ability to circumvent resistance of tumour cells to chemotherapy. To evaluate this possibility, monoclonal cell lines of enterohepatic origin with several-fold enhanced resistance to cisplatin have been obtained. In all cases, resistance was characterized as mainly being due to an up-regulation of the export pumps of the ABC superfamily of proteins; namely multidrug resistance-associated protein-2 (MRP2), which is believed to play a key role in cisplatin resistance (Cui et al, 1999; Leonard et al, 2003). As free drugs, Bamet-R2 and Bamet-UD2 are not able to overcome cisplatin resistance in cells of nonenterohepatic origin, such as resistant COR-L23/R nonsmall-cell lung cancer cells. In contrast, both drugs were equally effective as cytostatic agents in wild-type and cisplatin-resistant cells derived from intestinal and liver tumours. This can probably be explained in terms of the ability of these cells to strongly reduce the intracellular content of cisplatin, whereas they are not able to prevent the efficient uptake of Bamet-R2 and Bamet-UD2 (Briz et al, 2000). In addition to their interaction with carrier proteins located in the plasma membrane of normal and tumour cells, which is responsible for the specific drug targeting of cytostatic bile acid derivatives, they have another physicochemical characteristic of great interest in the fight to overcome resistance to chemotherapy: as they are amphypathic compounds, that is, they have a hydrophilic region while another part of the molecule is hydrophobic, they can be efficiently encapsulated into liposomes. 61

Marin et al: Targeting of cytostatic agents toward enterohepatic tumours Liposomes can be used both to encapsulate hydrophilic compounds in the aqueous core and to load lipophilic compounds in the hydrophobic layers, while amphipathic molecules can be loaded in both regions of the liposomes. This is particularly interesting in the case of multilamellar liposomes, in which the encapsulation of Bamets is several fold more efficient than that obtained for cisplatin (Briz et al, 2003). When cisplatin-resistant tumour cells were treated with Bamet-R2 or Bamet-UD2 encapsulated in different types of liposomes the cytostatic effect was enhanced to values similar or even higher than those found for cisplatin in wild-type cells (Briz et al, 2003).

BFI2003-03208) and the Junta de Castilla y Leon (Grant SA013/04), Spain. The group is member of the Spanish Network for Cooperative Research on Hepatitis. Instituto de Salud Carlos III, Spain (Grant G03/015). Secretarial help by M.I. Hernandez, technical help by E. Flores and English revision of the manuscript by N. Skinner are gratefully acknowledged.

References Betebenner DA, Carney PL, Zimmer AM and Kazikiewicz JM (1991) Hepatobiliary delivery of polyaminopolycarboxylate chelates: Synthesis and characterization of a cholic acid conjugate of EDTA and biodistribution and imaging studies with its indium-111 chelate. Bioconjug Chem 2, 117-123. Botla R, Spivey JR, Aguilar H, Bronk SF and Gores GJ (1995) Ursodeoxycholate (UDCA) inhibits the mitochondrial membrane permeability transition induced by glycochenodeoxycholate: a mechanism of UDCA cytoprotection. J Pharm Exp Ther 272, 930-938. Boulikas T and Vougiouka M (2003) Cisplatin and platinum drugs at the molecular level. Review. Oncol Rep 10, 16631682. Briz O, Serrano MA, Macias RIR and Marin JJG (2000) Overcoming in vitro of cisplatin-resistance by a free and liposome-encapsulated bile acid derivative, Bamet-R2. Int J Cancer 88, 287-292. Briz O, Serrano MA, Rebollo N, Hagenbuch B, Meier PJ, Koepsell H and Marin JJG (2002) Carriers involved in targeting the cytostatic bile acid-cisplatin derivatives cisdiamminechloro-cholylglycinate platinum(II) and cisdiammine-bisursodeoxycholate platinum(II) toward liver cells. Mol Pharmacol 61, 853-860. Briz O, Macias RIR, Vallejo M, Silva A, Serrano MA and Marin JJG (2003) Usefulness of liposome-encapsulated cytostatic bile acid derivatives to circumvent chemotherapy resistance of enterohepatic tumors. Mol Pharmacol 63, 742-750. Cahill BA and Braccia D (2004) Current treatment for hepatocellular carcinoma. Clin J Oncol Nurs 8, 393-399. Canon JL, Humblet Y and Symann M (1990) Resistance to cisplatin. How to deal with the problem? Eur J Cancer 26, 1-3. Carrasco J, Criado JJ, Macias RIR, Manzano JL, Marin JJG, Medarde M and Rodriguez E (2001) Structural characterization and cytostatic activity of chlorobischolylglycinatogold(III). J Inorg Chem 84, 287292. Criado JJ, Macias RIR, Medarde M, Monte MJ, Serrano MA and Marin JJG (1997) Synthesis and characterization of the new cytostatic complex cis-diammineplatinum (II)chlorocholylglycinate. Bioconjug Chem 8, 453-458. Criado JJ, Dominguez MF, Medarde M, Fernandez ER, Macias RIR and Marin JJG (2000) Structural characterization, kinetic studies and in vitro biological activity of new cisdiamminebis-cholylglycinate (O,Oâ&#x20AC;&#x2122;) Pt(II) and cisdiamminebis-ursodeoxycholate (O,Oâ&#x20AC;&#x2122;) Pt(II) complexes. Bioconjug Chem 11, 167-174. Cui Y, Konig J, Buchholz JK, Spring H, Leier I and Keppler D (1999) Drug resistance and ATP-dependent conjugate transport mediated by the apical multidrug resistance protein, MRP2, permanently expressed in human and canine cells. Mol Pharmacol 55, 929-937. Dominguez MF, Macias RIR, Izco-Basurko I, de la Fuente A, Pascual MJ, Criado JM, Monte MJ, Yajeya J and Marin JJG (2001) Low in vivo toxicity of a novel cisplatinursodeoxycholic derivative (Bamet-UD2) with enhanced

VII. In vivo antitumoral activity Although cisplatin-related drugs are among the most effective cytostatic agents against certain types of tumours (Boulikas et al, 2003), so far regimens including these drugs have had only moderate success in the treatment of hepatic and intestinal tumours (Lee et al, 2003; Mancini et al, 2003; O'Dwyer et al, 2003). Enhanced targeting of cisplatin using Bamets may change this situation, and such expectations are indeed supported by preclinical investigation in laboratory animals. Subcutaneous implantation of human colon carcinoma cells or mouse hepatoma cells into the backs of nude mice resulted in the formation of single tumours. When these animals were treated by intratumour injection of saline, cisplatin, Bamet-R2 or Bamet-UD2, cisplatin, as well as the Bamets assayed, significantly reduced tumour growth. The order of antitumour activity at all doses used was cisplatin>Bamet-UD2>Bamet-R2. However, at the most effective anti-tumour dose, cisplatin caused 33% mortality, versus no deaths recorded in any of the groups of animals during treatment with Bamets (Dominguez et al, 2001). Similar results have been obtained in a model closer to the clinical situation. After subcutaneous implantation and growth in the back of a donor nude mouse wild-type or resistant enterohepatic tumours were harvested and re-implanted in the livers of several nude mice. These animals were then treated by intraperitoneal injection of saline, cisplatin or Bamet-UD2. Both cisplatin and Bamet-UD2 were able to inhibit tumour growth. However, although some mice treated with cisplatin survived longer than those receiving only saline, no significant differences in mean survival times were found between these two groups. By contrast, treatment with Bamet-UD2 significantly prolonged the survival of mice bearing a tumour in their livers. This difference in antitumour effectiveness was particularly evident when cisplatin-resistant tumours were implanted. The life span of animals treated with Bamet-UD2 was markedly increased when the mice were treated with Bamet-UD2 encapsulated in anionic liposomes, and even more so when this drug was loaded into cationic liposomes (Briz et al, 2003).

Acknowledgements This study was supported in part by the Ministerio de Ciencia y Tecnologia, Plan Nacional de Investigacion Cientifica, Desarrollo e Innovacion Tecnologica (Grant

Cancer Therapy Vol 3, page 63 cytostatic activity versus liver tumors. J Pharm Exp Ther 297, 1106-1112. Eunok IM, Yung HC, Kee-Joo P, Hongsuk S, Youngeup J, KyuWon K, Young HY and Nam DK (2001) Novel bile acid derivatives induce apoptosis via a p53-independent pathway in human breast carcinoma cells. Cancer Letters 163, 83-93. Hagenbuch B and Meier PJ (2004) Organic anion transporting polypeptides of the OAT/SLC21 family: phylogenetic classification as OATP/SLCO superfamily, new nomenclature and molecular/functional properties. Review. Pflugers Arch 447, 653-665. Ho NFH (1987) Utilizing bile acid carrier mechanisms to enhance liver and small intestine absorption. Ann NY Acad Sci 907, 315-329. Horacek P and Drobnik J (1971) Interaction of cisdichlorodiammineplatinum (II) with DNA. Biochim Biophys Acta 254, 341-347. Huesker M, Folmer Y, Schneider M, Fulda C, Blum HE and Hafkemeyer P (2002) Reversal of drug resistance of hepatocellular carcinoma cells by adenoviral delivery of antiMDR1 ribozymes. Hepatology 36, 874-884. Iinuma H, Maruyama K, Okinaga K, Sasaki K, Sekine T, Ishida O, Ogiwara N, Johkura K and Yonemura Y (2002) Intracellular targeting therapy of cisplatin-encapsulated transferrin-polyethyleneglycol liposome on peritoneal dissemination of gastric cancer. Int J Cancer 99, 130-137. Jarnagin WR, Ruo L, Little SA, Klimstra D, D'Angelica M, DeMatteo RP, Wagman R, Blumgart LH and Fong Y (2003) Patterns of initial disease recurrence after resection of gallbladder carcinoma and hilar cholangiocarcinoma: implications for adjuvant therapeutic strategies. Cancer 98, 1689-1700. Kramer W, Wess G, Schubert G, Bickel M, Girbig F, Gutjahr U, Kowalewski S, Baringhaus KH, Enhsen A, Glombik H, Mullner S, Neckermann G, Schulz S and Petzinger E (1992) Liver-specific drug targeting by coupling to bile acids. J Biol Chem 267, 18598-18604. Kramer W and Wess G (1996) Bile acid transport systems as pharmaceutical targets. Eur J Clin Invest 26, 715-732. Kramer W, Girbig F, Glombik H, Corsiero D, Stengelin S and Weyland C (2001) Identification of a ligand-binding site in the Na +/bile acid cotransporting protein from rabbit ileum. J Biol Chem 276, 36020-36027. Krishnaiah YS, Satyanarayana V, Kumar BD and Karthikeyan RS (2002) Studies on the development of colon-targeted delivery systems for celecoxib in the prevention of colorectal cancer. J Drug Target 10, 247-254. Kroker R, Anwer MS and Hegner D (1978) The lack of active bile acid transport in AS-30D ascites hepatoma cells. Naunyn Schmiedeberg's Arch Pharmacol 303, 299-301. Kullak-Ublick GA, Beuers U and Paumgartner G (1996) Molecular and functional characterization of bile acid transport in human hepatoblastoma HepG2 cells. Hepatology 23, 1053-1060. Kullak-Ublick GA, Glasa J, BĂśker C, Oswald M, GrĂźtzner U, Hagenbuch B, Stieger B, Meier PJ, Beuers U, Kramer W, Wess G and Paumgartner G (1997) Chlorambucyltaurocholate is transported by bile acid carriers expressed in human hepatocellular carcinomas. Gastroenterology 113, 1295-1305. Larena MG, Martinez-Diez MC, Monte MJ, Dominguez MF, Pascual MJ and Marin JJG (2001) Liver organotropism and biotransformation of a novel platinum-ursodeoxycholate derivative, Bamet-UD2, with enhanced antitumor activity. J Drug Target 9, 185-200. Larena MG, Martinez-Diez MC, Macias RIR, Dominguez MF, Serrano MA and Marin JJG (2002) Relationship between tumor cell load and sensitivity to cytostatic effect of two

novel platinum-bile acid complexes, Bamet-D3 and BametUD2. J Drug Target 10, 397-404. Lee GY, Kim BS, Seo YT, Choi SH, Kim HJ, Choi DS, Ko JY, Yang SH and Byun JH (2003) Phase II study to topotecan and cisplatin in advanced hepatocellular carcinoma. Korean J Intern Med 18, 104-108. Leonard GD, Fojo T and Bate SE (2003) The role of ABC transporters in clinical practice. Oncolologist 8, 411-424. Macias RIR, Monte MJ, El-Mir MY, Villanueva GR and Marin JJG (1998) Transport and biotransformation of the new cytostatic complex cis-diammineplatinum(II)chlorocholylglycinate (Bamet-R2) by the rat liver. J Lipid Res 39, 1792-1798. Macias RIR, El-Mir MY, Monte MJ, Serrano MA, Garcia MJ and Marin JJG (1999) Cholephilic characteristics of a new cytostatic complex of cisplatin with glycocholate (BametR2). J Control Release 57, 161-169. Maeda M, Takasuka N, Suga T and Sasaki T (1990) New antitumor platinum(II) complexes with both lipophilicity and water miscibility. Japan J Cancer Res 81, 567-569. Mancini R, Tedesco M, Garufi C, Filippini A, Arcieri S, Caterino M, Pizzi G, Cortesi E, Spila A, Sperduti I and Cosimelli M (2003) Hepatic arterial infusion (HAI) of cisplatin and systemic fluorouracil in the treatment of unresectable colorectal liver metastases. Anticancer Res 23, 1837-1841. Marchegiano P, Carubbi F, Tiribelli C, Amarri S, Stebel M, Lunazzi GC, Levy D and Bellentani S (1992) Transport of sulfobromophthalein and taurocholate in the HepG2 cell line in relation to the expression of membrane carrier proteins. Biochem Biophys Res Comm 183, 1203-1208. Marin JJG, Macias RIR, Herrera MC, Palomero MF, Monte MJ, Villanueva GR, El-Mir MY, Criado JJ and Serrano MA (1996) Liver and ileum transport of cytostatic platinated bile acids. Hepatology 24, 543A. Marin JJG, Macias RIR, Criado JJ, Bueno A, Monte MJ and Serrano MA (1998a) DNA interaction and cytostatic activity of the new liver organotropic complex of cisplatin with glycocholic acid: Bamet-R2. Int J Cancer 78, 346-352. Marin JJG, Herrera MC, Palomero MF, Macias RIR, Monte MJ, El-Mir MY and Villanueva GR (1998b) Rat liver transport and biotransformation of a new cytostatic complex of bischolylglycinate and platinum(II). J Hepatol 28, 417-425. Marin JJG, Macias RIR, Monte MJ, El-Mir MY and Serrano MA (2001) Liver targeting of cisplatin-derived cytostatic drugs (Bamets) by coupling to bile acids, in: Biology of Bile Acids in Health and Diseases (van Berge Henegouwen GP, Keppler D, Leuschner U, Paumgartner G and Stiehl A, eds) pp 271-277, Kluwer Academic Publishers, Dordrecht. Marin JJG, Vallejo M, Macias RIR, Briz O, Ballestero MR, Monte MJ and Serrano MA ( 2004) Anticancer drug targeting toward enterohepatic tumours. Anticancer Res 24, 3559. Martinez-Diez MC, Larena MG, Serrano MA, Macias RIR, IzcoBasurko I and Marin JJG (2000) Relationship between DNAreactivity and cytostatic effect of two novel bile acidplatinum derivatives, Bamet-UD2 and Bamet-D3. Anticancer Res 20, 3315-3321. Meier PJ and Stieger B (2002) Bile salt transporters. Annu Rev Physiol 64, 635-661. Minko T (2004) Drug targeting to the colon with lectins and neoglycoconjugates. Adv Drug Delivery Rev 56, 491-509. Monte MJ, Dominguez S, Palomero MF, Macias RIR and Marin JJG (1999) Further evidence for the usefulness of bile acids as carrier molecules for cytostatic drugs toward liver tumors. J Hepatol 31, 521-528. Muggia FM (1991) Cisplatin update. Semin Oncol 18, 1-4. O'Connell JB, Maggard MA, Liu JH, Etzioni DA, Livingston EH and Ko CY (2003) Rates of colon and rectal cancers are increasing in young adults. Am Surg 69, 866-872.

Marin et al: Targeting of cytostatic agents toward enterohepatic tumours O'Dwyer PJ and Johnson SW (2003) Current status of oxaliplatin in colorectal cancer. Semin Oncol 30, 78-87. Ohya Y, Oue H, Nagatomi K and Ouchi T (2001) Design of macromolecular prodrug of cisplatin using dextran with branched galactose units as targeting moieties to hepatoma cells. Biomacromolecules 2, 927-933. Ormerod MG, Orr RM and Peacock JH (1994) The role of apoptosis in cell killing by cisplatin - A flow cytometric study. Brit J Cancer 69, 93-100. Ouchi T, Yamabe E, Hara K, Hirai M and Ohya Y (2004) Design of attachment type of drug delivery system by complex formation of avidin with biotinyl drug model and biotinyl saccharide. J Control Release 94, 281-291. Palomero MF, Herrera MC, Macias RIR, El-Mir MY, Villanueva GR and Marin JJG (1998) In vivo cholephilic characteristics of the new cytostatic drug bischolylglycinate-platinum(II) (Bamet-H2). Intern J Pharmacol 172, 79-88. Paschke R, Kalbitz J, Paetz C, Luckner M, Mueller T, Schmoll H-J, Mueller H, Sorkau E and Sinn E (2003) Cholic acid窶田arboplatin compounds (CarboChAPt) as models for specific drug delivery: synthesis of novel carboplatin analogous derivatives and comparison of the cytotoxic properties with corresponding cisplatin compounds. J Inorg Biochem 94, 335-342. Pinto AL and Lippard SJ (1985) Binding of the antitumor drug cis-diamminedichloroplatinum (II) (cis-platin) to DNA. Biochim Biophys Acta 780, 167-180. Pohlen U, Berger G, Reszka R, Binnenhei M and Buhr HJ (2001) Improved tumor targeting by regional carboplatin application combined with Gelfoam. An experimental study on liver tumor-bearing rabbits. Chemotherapy 47, 143-149. Saksena S and Tandon RK (1997) Ursodeoxycholic acid in the treatment of liver diseases. Review. Postgrad Med J 73, 7580.

Si MS, Amersi F, Golish SR, Ortiz JA, Zaky J, Finklestein D, Busuttil RW and Imagawa DK (2003) Prevalence of metastases in hepatocellular carcinoma: risk factors and impact on survival. Am Surg 69, 879-885. Stehle G, Sinn H, Wunder A, Schrenk HH, Schutt S, Maier-Borst W and Heene DL (1997) The loading rate determines tumor targeting properties of methotrexate-albumin conjugates in rats. Anticancer Drugs 8, 677-685. Stephan ZF, Yurachek EC, Sharif R, Wasvary JM, Steele RE and Howes C (1992) Reduction of cardiovascular and thyroxinesuppressing activities of L-T3 by liver targeting with cholic acid. Biochem Pharmacol 43, 1969-1974. Von Dippe P and Levy D (1990) Expression of the bile acid transport protein during liver development and in hepatoma cells. J Biol Chem 265, 5942-5945. Von Hoff DD, Schilsky R, Reichert CM, Reddick RL, Rozencweig M, Young RC and Muggia FM (1979) Toxic effects of cis-diamminedichoroplatinum(II) in man. Cancer Treat Rep 63, 1527-1531. Wu J, Nantz MH and Zern MA (2002) Targeting hepatocytes for drug and gene delivery: emerging novel approaches and applications. Front Biosci 7, d717-d725. Yamada T, Iwasaki Y, Tada H, Iwabuki H, Chuah MK, VandenDriessche T, Fukuda H, Kondo A, Ueda M, Seno M, Tanizawa K and Kuroda S (2003) Nanoparticles for the delivery of genes and drugs to human hepatocytes. Nat Biotechnol 21, 885-890. Yu HY and Lin JH (2000) Intracellular delivery of membraneimpermeable hydrophilic molecules to a hepatoblastoma cell line by asialoglycoprotein-labeled liposomes. J Formos Med Assoc 12, 936-941. Zhang JG and Lindup WE (1994) Cisplatin nephrotoxicity. Decreases in mitochondrial protein, sulphidryl concentration and calcium uptake by mitochondria from rat renal cortical slices. Biochem Pharmacol 47, 1127-1135.

Cancer Therapy Vol 3, page 65 Cancer Therapy Vol 3, 65-76, 2005

Thalidomide and its use in renal and prostate cancer Review Article

Simon Pridgeon1, Marcus Drake2,* 1

Department of Urology, Freeman Hospital, High Heaton Road, Newcastle Upon Tyne, NE7 3DN, UK School of Surgical Sciences, The Medical School, University of Newcastle, NE2 4HH, UK

__________________________________________________________________________________ *Correspondence: Marcus Drake, School of Surgical Sciences, 3 rd Floor Wm Leech building, Medical School, University of Newcastle, NE2 4HH, UK; Tel: +44 191 222 7157; Fax: +44 191 222 8514; E-mail: M.J.Drake@ncl.ac.uk Key words: Prostate cancer, Pharmacology, Adverse drug effects, Tumour biology and angiogenesis, Renal cell carcinoma, Clinical trials Abbreviations: androgen independent prostate cancer, (AIPC); cyclooxygenase-2, (COX-2); fibroblast growth factor, (FGF); Genedirected Enzyme Prodrug Therapy, (GDEPT); I!B kinase, (I!K); interferon-"2a, (IFN-"2a); interferon–"2b, (IFN-"2b); Prostatic Specific Antigen, (PSA); Renal cell carcinoma, (RCC); System for Thalidomide Education and Prescribing Safety, (S.T.E.P.S); vascular endothelial growth factor, (VEGF) Received: 9 February 2005; Accepted: 11 February 2005; electronically published: February 2005

Summary Thalidomide was marketed as a sedative and antiemetic in the 1950’s, but it was withdrawn due to teratogenicity. It has since shown clinical benefit in certain benign diseases, and recently interest has focussed on its potential use in cancer management. It has anti-angiogenic properties, which are mediated by a variety of mechanisms including growth factor inhibition. First line management of advanced prostate cancer generally uses androgen ablation therapy. Progression and metastasis of prostate cancer following androgen ablation arises from growth factormediated mechanisms, in which angiogenesis is an important component. Clinical trials with thalidomide have shown partial response in a proportion of patients with androgen-independent prostate cancer. These trials provide some insight into possible mechanisms of cancer progression, and support future research into the role of thalidomide as an adjunctive therapeutic agent. Progression of renal cell cancer is poorly understood. Management of metastatic disease is unsatisfactory, since the tumours show little response to chemotherapy or radiotherapy, while systemic immunotherapy is effective in a minority of patients. Several clinical trials in renal cell cancer have employed thalidomide, but results have generally not suggested substantial benefit. related cachexia. In addition, substantial interest surrounds the immunomodulatory, anti-inflammatory and antiangiogenic properties of thalidomide in the treatment of malignant diseases. A number of studies have demonstrated it has significant activity in the treatment of multiple myeloma (Singhal et al, 1999; Rajkumar et al, 2002) as well as other haematological malignancies. This article reviews the mechanism of action of thalidomide and its potential use as an anti-cancer agent in the treatment of urological malignancies.

I. Introduction Thalidomide was introduced in the 1950’s as an over-the-counter sedative and subsequently an anti-emetic for the treatment of pregnancy-induced morning sickness. Reported association between thalidomide use and severe congenital abnormalities prompted its withdrawal in 1961. By this time about 12,000 children had been affected with birth defects, including dysmelia (stunted limb growth) and deformities of the heart, kidneys, eyes and spinal cord. Thalidomide has re-emerged as a drug of scientific interest following recognition of its activity in reactive lepromatous leprosy (Sheskin, 1965). Thalidomide was approved by the U.S. Food and Drug Administration in 1998 as a treatment for the acute cutaneous manifestations of erythema nodosum leprosum and as maintenance therapy to prevent its recurrence. Thalidomide has since been shown to be effective in the treatment of other nonmalignant diseases including mycobacterium tuberculosis infection, graft-versus-host disease, rheumatoid arthritis, systemic lupus erythematosis, Crohn’s disease and HIV-

II. Pharmacology Thalidomide –"- (N-phthalimido )glutarimide– contains a phthalimide ring and a glutarimide ring (Figure 1). The glutarimide ring has a chiral centre with dextrorotatory (R) and levorotatory (S) forms. The enantiomers have different biological properties; sedative effects are associated with the R-enantiomer, whereas immunological effects are more closely associated with the S-enantiomer. They readily interconvert at physiologic 65

Pridgeon and Drake: Thalidomide and its use in urological malignancies an axonal neuropathy. By nine months all three patients who continued the trial developed a neuropathy. Further reported side effects of thalidomide include somnolence, nausea, dry mouth and skin, constipation, increased appetite, headache, hypertension, bradycardia, dizziness and orthostatic hypotension, altered temperature sensitivity, irregularities in menstrual cycles, hypothyroidism and peripheral oedema (Stirling, 2000). Constipation can be controlled with an aggressive laxative regimen. Somnolence, nausea, and skin rashes are dosedependent and generally resolve with discontinuation of therapy. Thalidomide-induced sedation can be antagonized with the central nervous system stimulants methylphenidate and methylamphetamine (Somers, 1960) but this has not been evaluated in controlled trials. The impact of somnolence can be minimized by administration of the drug at bedtime. The immunomodulatory action of thalidomide does not appear to be associated with an increased incidence of infections; evidence suggests that thalidomide does not directly suppress lymphocyte proliferation (Geitz et al, 1996) although inhibition of proliferation of already stimulated lymphocytes has been shown (Keenan et al, 1991). Thalidomide is teratogenic when taken in early pregnancy (Nowack, 1965). The drug was found to be teratogenic only during days 34-50 after the last menstruation. To safeguard patients and prevent foetal exposure, the U.S. manufacturer of thalidomide developed a restricted prescribing and dispensing program called S.T.E.P.S. (System for Thalidomide Education and Prescribing Safety) (Warren, 2001). This program requires registration of doctors and pharmacists involved in the dispensing process as well as the provision of educational material. Women of child bearing age are instructed to use two forms of contraception and undergo pregnancy testing before and during a course of treatment. Males are required to abstain from sexual intercourse or use a condom during therapy and up to one month thereafter. The optimal dosing strategy for thalidomide is uncertain, and is influenced by the biology of the disease being treated, the idiosyncratic nature of the adverse effects profile and the unpredictable gastrointestinal absorption. Most clinical trials for cancer have used doses from 100-1200 mg per day either as a single dose at night or in two divided doses. Intolerance of the side effect profile is an important factor in patient withdrawal from trials.

Figure 1: The chemical structure of thalidomide

pH making total separation of their clinical effects unfeasible. Thalidomide has poor solubility in both water and ethanol. Its poor aqueous solubility means that no intravenous preparation is available and enteral absorption of the drug is slow. The time to peak plasma levels following oral administration increases with increasing dose, ranging from 3 to 6 hours (Warren, 2001). Thalidomide undergoes rapid spontaneous non-enzymatic hydrolysis which is affected by both pH and temperature, generating at least 12 metabolites in humans. In vitro studies suggest thalidomide induces cytochrome P-450 isoenzymes in rats. However, in humans thalidomide does not inhibit or induce its own metabolism over a 21-day period, and thus very little metabolism of thalidomide is thought to occur via the hepatic cytochrome P-450 system (Tsambaos et al, 1994; Scheffler et al, 1999). The mean elimination half life in healthy individuals is 4.7 hours with an apparent mean clearance of 10 and 21 L/h for the R- and S- enantomers respectively. Both single and multiple dosing of thalidomide in older prostate cancer patients revealed a significantly longer half-life at a higher dose (1200 mg daily) than at a lower dose (200 mg daily) â&#x20AC;&#x201C; 18.52h and 6.52h respectively (Figg et al, 1999). Metabolites of thalidomide are rapidly eliminated in urine, but little unchanged thalidomide is excreted this way.

III. Adverse drug effects Thalidomide-associated peripheral neuropathy is generally characterized by painful symmetric paraesthesiae in the toes and feet; electrophysiologic findings suggest axonal degeneration without demyelination (Fullerton and O'Sullivan, 1968; Aronson et al, 1984; Clemmensen et al, 1984). Related symptoms include muscle cramps or weakness, signs of pyramidal tract involvement, and carpal tunnel syndrome. Improvement is usually observed with discontinuation of therapy; however, cases of irreversible or longstanding sensory loss have been reported. The incidence of neuropathy is increased in older patients and after administration of high cumulative doses. Molloy et al, (2001) investigated the incidence of thalidomide-induced neuropathy in a group of patients treated for metastatic prostate cancer. Seventy five percent of the patients who remained on treatment for 6 months or longer developed

IV. Mechanisms of action The anti-inflammatory, anti-angiogenic and immunomodulatory properties of thalidomide have been studied both in vitro and in vivo and are likely to be due to its ability to affect cytokine production and cell function. The understanding of the in vivo modes of action of thalidomide have been difficult to elucidate due to the spontaneous inter-conversion between S- and Renantiomers, making total separation of their effects impossible. Thalidomide appears to undergo an as yet uncharacterised metabolic activation since its in vitro

Cancer Therapy Vol 3, page 67 effects are modest when compared to its observed potency in vivo (Bauer et al, 1998; Stirling, 2000). Initial clues as to thalidomide’s role in angiogenesis came from observations by D’Amato et al, who found that it inhibited neovascularisation induced by basic fibroblast growth factor (FGF) and vascular endothelial growth factor (VEGF) in the rabbit cornea micropocket assay (D'Amato et al, 1994). Because this inhibition occurred only after oral administration of thalidomide it has been suggested that an active metabolite is formed in vivo (D'Amato et al, 1994; Bauer et al, 1998). Animal studies support the antiangiogenic effect of thalidomide since treatment has been shown to decrease vascular density in granulation tissue (Adeoti et al, 1998). The antiangiogenic effects are thought to be clinically beneficial in diseases dependant on new vessel formation Thalidomide decreases production of tumour necrosis factor-· (TNF-") in monocytes and macrophages by accelerating degradation of TNF-" mRNA (Sampaio et al, 1991; Moreira et al, 1993). An alternative action is via binding to "1-acid glycoprotein, which is known to have anti- TNF-" activity (Keifer et al, 2001). In addition thalidomide decreases the binding activity of the transcription factor nuclear factor-!B (NF-!B), an antiapoptotic gene product involved in immune responses and cellular growth, which in turn controls the activation of the TNF-" gene (Turk et al, 1996). Anti TNF-" activity may

play a role in thalidomide treatment of multiple myeloma. Increased pre-treatment TNF-" levels appear to predict progression- free survival after thalidomide. In addition DNA polymorphisms involving the TNF-" gene have been correlated with response to thalidomide treatment in myeloma (Thompson et al, 2003). A role for the enzyme CYP2C19 has recently been reported for thalidomide metabolism. It is suggested that thalidomide undergoes hydroxylation under the influence of this enzyme (Ando et al, 2002). A mechanism has been proposed whereby CYP2C19 converts thalidomide to a bioactive form that interferes with NF!B activation. NF!B is usually bound to the inhibitory protein I!B" in the cytoplasm and dissociates from this complex following activation of the enzyme I!B kinase (I!K). NF!B is then free to translocate into the nucleus to activate genes which promote cellular proliferation, angiogenesis and inhibition of apoptosis (Figure 2). The hydroxylated metabolites of thalidomide reduce I!K activity through interleukin-1‚ (IL-1#) and TNF-" thereby inhibiting the release of free NF!B (Ando et al, 2002). Pro-angiogenic factors other than TNF-" are altered by thalidomide. Thalidomide inhibits interleukin-6, a potent growth factor for malignant cells, and interleukin12 production by monocytes (D'Amato et al, 1994).

Figure 2 : Mechanisms of action of thalidomide. Metabolites formed from the oxidation of thalidomide by CYP2C19 inhibits TNF-" and/or IL-1# activation of I!K. This in turn prevents the dissociation of of I!K from the I!K-NF!B complex. NF !B usually enters the nucleus to induce genes that promote angiogenesis, cellular proliferation and inhibition of apoptosis as well as promoting further TNF-" transcription; this function of NF!B is thus inhibited by thalidomide and its metabolites. Thalidomide also promotes the degredation of TNF-" mRNAand interacts with "-1 acid glycoprotein to inhibit the actions of TNF-" function.

Pridgeon and Drake: Thalidomide and its use in urological malignancies Further effects of thalidomide may be relevant to clinical management of malignancy. Inhibition of polymorphonuclear leukocyte chemotaxis has been reported in an in vitro model (Faure et al, 1980). Thalidomide also inhibits neutrophil chemotaxis (Dunzendorfer et al, 1997). Leukocyte migration to sites of inflammation may be affected by downregulation of cellular adhesion molecules (Settles et al, 2001). Thalidomide has been reported to decrease the ratio of circulating T-helper cells to suppressor T cells in healthy subjects as the result of a reduction in the production of helper cells and increase in production of suppressor cells. Another possible mode of action for thalidomide involves modulation of cyclooxygenase-2 (COX-2), a key enzyme in the synthesis of prostaglandins (Fujita et al, 2001). COX-2 is highly expressed in various human cancers including prostate cancer, and has been shown to be required for angiogenesis in a rat corneal model (Yamada et al, 1999; Daniel et al, 1999). The results are in keeping with the anti-angiogenic response of human prostate cancer cells treated both in vitro and in vivo with a COX-2 Inhibitor (Kirschenbaum et al, 2001). Thalidomide has been demonstrated to inhibit COX-2 and subsequent prostaglandin-E2 biosynthesis in a dose dependant manner (Fujita et al, 2001).

stage. Mean microvessel counts are significantly greater in the primary tumours of patients with metastatic disease than in those without metastases, and a correlation between microvessel density and increasing pathological grade has been observed. Increased microvascularity also correlates with a poorer prognosis (Lissbrant et al, 1997). Rogatsch et al (1997) investigated whether the quantification of tumour microvessels can be reliably applied to prostatic core biopsies, as a means of detecting likely local tumour extension prior to radical prostatectomy. They observed a high degree of correlation between microvessel density in biopsies and the subsequent prostatectomy samples. The median microvessel density in core biopsies predicted the local tumour stage. Malignant prostatic epithelial cells show increased expression of numerous angiogenic substances, including; basic FGF, (Mansson et al, 1989; Gleave et al, 1992; Nakamoto et al, 1992; Warren, 2001) transforming growth factor (TGF) " and -#, (Ikeda et al, 1987; Hofer et al, 1991; Harper et al, 1993; Truong et al, 1993; Cohen et al, 1994; Eastham et al, 1995; Steiner et al, 1994) epidermal growth factor (Ching et al, 1993; Ware, 1993) and platelet derived growth factor (Fudge et al, 1994; Sitaras et al, 1988). Elevated serum levels of TNF-" and basic FGF can be seen in patients with prostate cancer (Meyer et al, 1995; Nakashima et al, 1995).

V. Prostate cancer Prostate cancer is the most commonly diagnosed malignancy affecting men beyond middle age in developed countries. Although detection of early prostate cancer is increasing, many patients still present with metastatic disease. Hormone treatment in the form of androgen deprivation is an established therapeutic option for metastatic prostate cancer. In patients who respond to hormone manipulation, subsequent clonal expansion of hormone insensitive cancer cells results in loss of response with a mean time to tumour progression of less than 18 months. Prostatic Specific Antigen (PSA) is used as a clinical marker of tumour load and a serial increase in PSA values after initial successful androgen ablation usually indicates clinical progression to androgen independent prostate cancer (AIPC). Androgenindependence can be defined as a rising PSA value of at least 20ng ml-1 on two consecutive occasions after the nadir of response to androgen ablation therapy, or a rise of at least 5ng ml-1 if the absolute PSA value was less than 20 ng ml-1 (Bubley et al, 1999). Various agents have been tested in an attempt to achieve second-line response in AIPC, including; corticosteroids, diethylstilboestrol, tamoxifen, aminoglutethamide, ketoconazole, suramin, estramustine, taxanes, mitozantrone and herceptin. Benefits in terms of disease suppression and survival are uncertain. The prognosis for patients with hormone refractory disease is poor; median overall survival is 12 18 months.

B. Clinical trials With the emergence of evidence implicating the involvement of angiogenesis in prostate cancer, the use of thalidomide as a potential therapeutic agent has been investigated. Figg et al, (2001b) have compared low-dose (200mg/day) and high dose (up to 1200 mg/day) thalidomide in patients with AIPC. The high dose regime commenced at 200mg/day with incremental rises of 200mg /day every two weeks up to a maximum of 1200mg where tolerated. Fifty patients were randomised to the low dose arm. In the high dose arm, thirty percent of patients were unable to tolerate doses of above 200mg/day due to the side effect profile. As a result of the high incidence of adverse effects, and since no patient showed a substantial decline in PSA, the high dose arm was discontinued after 13 patients were enrolled. The median time on study was 2.1 months for the low dose arm and 2.0 months for the high dose arm (range 35-247 days). Response to treatment was evaluated in terms of PSA reduction, changes in metastatic lesions on bone scan and measured tumour load as detected on serial CT scans. The assessment of circulating growth factors (basic FGF, VEGF, TNF-" and TGF-#) was also carried out. Reductions in PSA were observed in 58% of patients in the low dose arm and 68% of the high dose arm. Nine out of the 63 patients (14%) showed declines in PSA of $50%, all of whom were in the low dose arm of the study. The failure of PSA response in the high dose arm may result from the up-regulation of PSA secretion which is seen in prostate cancer cell lines exposed to thalidomide (Dixon et al, 1999). Of the patients who had measurable disease on CT scanning, 14% had some reduction in tumour load. Two patients had radiographic improvement of bone scan lesions and both

A. Tumour biology and angiogenesis The role of angiogenesis in the growth and metastasis of prostate cancer has been demonstrated by Weidner et al, (1993) who showed that increased microvessel density in prostate cancer specimens can predict advanced tumour 68

Cancer Therapy Vol 3, page 69 had sustained reductions in serum PSA. Declines in serum TGF-# were seen in the eight patients with PSA reductions at four months. There were also reductions in basic FGF in six of these patients. Figg and colleagues concluded from this trial that thalidomide may have modest anti-tumour activity through its anti-angiogenic properties in patients with hormone refractory prostate cancer. Drake et al, (2003) examined the benefits of low dose thalidomide in patients with rising PSA after initial response to hormone manipulation therapy. Response to treatment was evaluated in terms of serum PSA reduction and growth factor levels. Twenty patients were enrolled in this study and given 100mg thalidomide once daily at bedtime. The mean time on study was 109 days (range 4–184 days) with 16 patients continuing thalidomide treatment for more than two months. Three men had PSA falls of $50% with five other patients showing some decline. Of the 16 men who tolerated treatment for more than two months, six showed a fall in their serum PSA by a mean of 48%. In this study serum growth factors were analysed in 11 patients at three months. There was an overall mean rise in both basic FGF and VEGF. However, when analysed according to PSA response, five out of the six men who manifested a decline in PSA showed a decline in mean values of both basic FGF and VEGF; at the time of loss of PSA response, there was a coincident rise in growth factor levels. Patients who demonstrated increasing PSA levels had associated rises in growth factors. Three patients discontinued low dose thalidomide due to adverse effects. The most commonly reported adverse reaction was constipation (n=9) followed by sedation hangover (n=3) and dizziness (n=2). Clinical trials of single agent docetaxel in AIPC have demonstrated response rates of 20-60% (Logothetis, 2002). Accordingly, thalidomide has also been studied in combination with docetaxal in a phase II trial enrolling 75 patients with AIPC (Figg et al, 2001a; Dahut et al, 2004). Patients were treated with intravenous docetaxel, with or without a single night-time dose of thalidomide 200mg. 35% of those receiving docetaxel alone showed decrease in PSA of at least 50%, while 53% of patients in the combination arm demonstrated an equivalent response. At 18 months, overall survival in the docetaxel group was 42.9%. Compared with 68.2% in the combined arm. Of the first 43 patients treated with docetaxel and thalidomide, nine patients developed deep venous thrombosis and a further three suffered a cerebrovascular incident. There were no thromboembolic complications in the docetaxel group. Subsequent patients enrolled into the combined group were given low molecular weight heparin, preventing further thrombotic events. Thalidomide combination therapy with the cytotoxic agents paclitaxel and estramustine has been evaluated (Daliani, 2003). Thirty patients with AIPC were given weekly paclitaxel for 2 of 3 weeks together with oral estramustine and escalating doses of thalidomide, titrating from 200 mg a day to 600 mg a day. Seventy-two percent of the 25 evaluable patients achieved a sustained decline in PSA levels of 50% or more. Twelve percent showed a drop of 80% or more. The men who experienced a drop in

PSA also reported less bone pain. Four of the 29 men evaluable for toxicity developed Grade 3-4 deep venous thrombosis, despite warfarin prophylaxis, requiring treatment discontinuation in two patients. There were no cases of grade 2-4 neuropathy. The U.S. National Cancer Institute is undertaking a phase II trial of Estramustine, Docetaxel and Thalidomide in AIPC. A phase II trial using a combination of thalidomide (100-200mg) with granulocyte macrophage colony stimulating factor in 17 AIPC patients with soft tissue or bone disease has been carried out (Dreicer et al, 2002). Partial response was seen in five of 13 evaluable patients. Treatment was generally well tolerated

VI. Renal cell carcinoma Renal cell carcinoma (RCC) accounts for 3% of all adult malignancies. Incidence of RCC has risen over the last 30 years, with greater use of ultrasonography and CT scanning increasingly detecting incidental tumours. The identification of early tumours has seemingly led to improved survival. However, the overall mortality rates for RCC have increased over this time, suggesting a possible change in tumour biology, perhaps due to environmental factors (Chow et al, 1999). One third of patients with RCC present with metastatic disease and 40% of the rest eventually develop distant metastases. The prognosis for these patients is poor, as RCC is resistant to most chemotherapeutic agents. Patients who have nonbulky metastatic disease and who are of good performance status may be suitable for immunotherapy. Nonetheless, only 10-15% of patients experience an objective response to immunotherapy with either interleukin-2 (IL-2) or "interferon (·-IFN)(Negrier et al, 1998).

A. Tumour biology and angiogenesis RCC is one of the few tumours in which spontaneous regression is recognised, with an estimated incidence of 0.3% (Vogelzang et al, 1992). Most cases have been in patients with pulmonary metastases and have occurred after nephrectomy, but regression of primary RCC has also been documented even in the absence of any treatment (Vogelzang et al, 1992). RCC’s are highly vascular tumours, as demonstrated by the distinctive neovascular pattern on renal angiography. The up-regulation of a variety of angiogenic factors and the renin angiotensin system has been reported (Nicol et al, 1997; Hii et al, 1998; Horie et al, 1999). Increased levels of mRNA for VEGF have been found in the majority of hypervascular renal cell carcinomas, while hypovascular tumours have exhibited low levels of this transcript (Brown et al, 1993; Takahashi et al, 1994). Increased levels of VEGF have also been found in the serum of patients with RCC and a correlation with stage and grade has been noted (Kato et al, 2000). Elevated serum levels of basic FGF have also been demonstrated in RCC and other possible angiogenic growth factors contributing include placental growth factor, TGF-#1, angiogenin, interleukin-8 and hepatocyte growth factor (Campbell, 1997). Sporadic and familial RCC’s commonly demonstrate mutations or deletions in the Von Hippel Lindau gene, and this genetic change may lead to 69

Pridgeon and Drake: Thalidomide and its use in urological malignancies increased expression of VEGF (Stebbins et al, 1999). The angiogenic dependence of RCCâ&#x20AC;&#x2122;s and the involvement of such genes and growth factors have led to the investigation of a variety of antiangiogenic treatments including thalidomide, endostatin, interleukin-2, squalamine and neutralising antibodies to VEGF.

metastatic melanoma, renal cell carcinoma and ovarian and breast cancer. Three of 18 patients with RCC showed a partial response to treatment (100mg daily). A further three patients had stable disease for at least three months. A further phase II trial by the same group evaluated the use of high dose oral thalidomide (600mg daily) (Stebbing et al, 2001). 25 patients were enrolled in this study with advanced metastatic RCC. Nearly all had undergone prior surgery and systemic immunotherapy or immunochemotherapy. Progressive disease was identified in all patients prior to study entry. Three patients were removed from the trial at an early stage due to toxicity

B. Clinical trials Numerous trials employing thalidomide in RCC have been undertaken. These are summarised in Table 1. Eisen et al, (2000) carried out a study to assess the efficacy and toxicity of thalidomide in the treatment of patients with

Table 1. Summary of trials of thalidomide in renal cell carcinoma Trial

Eisen, (1999)

No. of Additional Thalidomide Prior patients drug dose nephrectomy

% Stebbing No (2001) % Novik No (2001) % Motzer No (2002) % Daliani No (2002) % Li (2001) No

Srinivas (2002)

% No

none

100mg

Efficacy: Complete response

Partial response

n/s

Stable disease /minor response 13

17 2

Progres Median Median sion free survival time to survival progression 17% >3 months

n/s

72 12

n/s

9 months

n/s

32% > 6 months

n/s

4 months

n/s

18.3 months

4.7 months

32% >5 months

n/s

9.3 months

n/s

24% >6 10 months months

n/s

none

100-600mg

0 0

none

100-1000mg

96 21

0 0

9 0

54.5 7

0 0

26 16

none

200-800mg

78 15

none

200-1200mg

58 19

0 0

0 2

64 9

0 0

10.5 2

47 9

none

200-1200mg

95 31

none

200-1200mg

86 11

0 0

6 0

31 6

400-1200mg

79 32

0 0

46 9

400-1200mg

80 19

0 1

6 2

27 3

n/s

3.5 months

2.3 months

100-400mg

79 n/s

0 0

4 0

12.5 0

n/s

100-1000mg

0 0

0 2

0 8

n/s

68 weeks

n/s

200-1000mg

57 190

0 0

6.7 5

26.7 50

n/s

10.8 months

n/s

100-200mg

74 29

0 1

3.1 1

31.3 0

n/s

200-600mg

93 15

3 1

3 5

0 2

n/s

100

% Escudier No 40 none (2002) % Minor No 29 none (2002) % Nathan No 13 IFN-"2a (2002) % IFN-" Clarke No 30 (2004) % Gordon No 175 in IFN-"2b (2004) thalidom ide arm % Olenki No 31 IL-2 (2003) % Amato No 15 IL-2 (2002) %

Cancer Therapy Vol 3, page 71 and five other patients required dose reduction due to peripheral neuropathy. Of the 22 assessable patients, two (9%) achieved a partial response and 12 had stable disease for 12 months, with dose reduction due to toxicity. In many of these patients there was a significant reduction in serum TNF-". Minor et al, (2002) investigated the activity of thalidomide in patients with advanced RCC in a phase two study involving 29 patients. All patients had advanced progressive metastatic RCC disease and many were poor performance status. 72% had received prior therapy in the form of interleukin-2, "-interferon and cytotoxic chemotherapy. Patients were started on a daily dose of thalidomide of 400mg rising in increments of 200 mg to a maximum dose of 1200 mg. Tumour responses were evaluated using South Western Oncology Group criteria and in some patients serum levels of VEGF 165 was monitored. Of the 24 patients assessable for response, only one demonstrated a partial response. Three patients had stable disease for over six months. The median time to progression for all 29 patients was 2.3 months and median survival was 3.5 months. VEGF 165 was measured in 8 patients and no obvious change in plasma levels was demonstrated. The largest trial to date involved 40 patients treated with thalidomide doses starting at 400mg daily rising to 800mg and then 1200mg (Escudier et al, 2002). At 12, 18 and 24 weeks 31, 25 and 17 patients remained on treatment respectively. At nine months, only eight patients were still on study therapy, with all patients stopping treatment after one year due to severe neuropathy. After 6 months, two patients (5%) achieved partial response, with 9 patients (22%) having stable disease. The one year survival was 38%. In this study, neuropathy and thromboembolism were significant side effects. A further trial examining the use of escalating doses of thalidomide was carried out by Daliani et al, (2002). Twenty patients with metastatic RCC were enrolled and treated with doses starting at 200mg, increasing in weekly increments up to a target maximum dose of 1200mg per day. Nineteen patients were evaluable for response, of whom two patients (10.5%) had a partial response and nine patients had stable disease. Median time to progression was 4.7 months (range 0.7-31.3 months). Thirteen patients remained on the study at three months and 12 of these tolerated a maximum dose of 1200mg. Delayed dose reductions were required for three patients because of peripheral sensory neuropathy. A further three patients developed thomboembolic events believed to be related to thalidomide. Motzer used doses of thalidomide up to 800mg in advanced RCC (Motzer et al, 2002). Twenty five patients were assessable for response. No patient achieved a partial or complete response; stable disease was observed in 16 patients (64%), which was maintained for a mean duration of 6 months. The median time to disease progression was 4 months. The one-year survival was 57%. A further small study recruited 14 patients (Srinivas and Guardino, 2002) comparing low dose thalidomide (200mg/day) to higher escalating doses (800–1200mg/day). Six patients (46%) achieved stable disease, mainly in the low dose arm, with

no objective responses. Stable disease was the best response obtained by Novik et al, (2001) in a phase II trial involving 27 patients with metastatic RCC, including lung, brain and liver metastases. Li et al, (2001) treated 36 patients with thalidomide (200-1200mg) All of these patients had failed to respond to prior interleukin-2 therapy. Seventeen of the patients managed to tolerate the maximum dose. Partial responses were seen in 2 of the 29 evaluable patients with stable disease in 9 further patients. Thalidomide has also been investigated in combination with immunotherapeutic agents for the treatment of RCC. In a phase II trial to examine the efficacy of interferon "-2a (IFN"-2a) with thalidomide (Nathan et al, 2002), no responses to treatment were seen. Five patients experienced serious adverse side effects, which were attributed to the membrane destabilising effects of both of these agents. The authors concluded that caution is needed in combining these two therapies. A further phase II trial (Clarke et al, 2004) looking at thalidomide in combination with IFN-" in 30 patients reported an objective response rate of 7% with no complete responses, 2 partial responses and 8 patients achieving stable disease. One third of patients experienced toxicity that required discontinuation of thalidomide. In a phase III study of the Eastern Co-operative Oncology Group (Gordon et al, 2004), interferon–"2b (IFN-"2b) in combination with thalidomide (200-1000mg daily) was compared with IFN–"2b alone. There was no difference in objective response, but there was a higher percentage of patients with stable disease in the combination therapy arm (31.3% vs 18.5%). This is consistent with thalidomide’s known cytostatic activity, but there was no discernable difference in the progression free survival curves. Furthermore, no clinically significant difference in quality of life was achieved between the arms at baseline or through treatment. As single therapy for metastatic RCC, IL-2 can elicit clinical responses, but only in a minority of patients. A phase I trial of combination IL-2 and oral thalidomide involving 31 patients (Olencki et al, 2003) demonstrated moderate to severe toxicity with one complete response and one partial response. More promising responses have been reported by (Amato et al, 2002), administering combination therapy for 9 months, followed by 6 months of thalidomide monotherapy. An initial phase I trial, involving only a small number of patients (n=15), showed 5 partial responses and 1 complete response. Later data from the same trial reported further responses, which were sustained for at least 12-18 months. A phase II trial recruited 37 patients, of whom 33 were assessable for response. This produced an objective response rate of 39% with 2 complete responses, 11 partial responses and 10 patients with stable disease.

VII. Conclusions Thalidomide has numerous biological actions; suppression of growth factor levels gives rise to antiangiogenic and tumour cytostatic effects, but also substantial adverse drug reactions. The biological actions have led to the application of thalidomide in various clinical scenarios on an empirical basis, particularly where 71

Pridgeon and Drake: Thalidomide and its use in urological malignancies human prostate tissue and cell lines. Mol Cell Biochem 126, 151-8.

current management options are limited. The current treatment options for AIPC and advanced RCC are primarily palliative. The events leading to progression in prostate cancer include angiogenesis. Clinical trials of thalidomide in AIPC indicate a response in a subgroup of patients, which correlates with alterations in growth factor levels. This has not been translated into a clinical management option as yet, but does provide some insight into the biology of androgen-independence and the potential for pharmacological manipulation of this complex process. The use of thalidomide in combination with other chemotherapeutic drugs appears more promising. RCCs are chemotherapy-resistant; objective responses to thalidomide also appear to be infrequent (Table 1). The greater clinical benefit with low dose thalidomide in certain clinical trials in AIPC and RCC indicates that the immunomodulatory effects of thalidomide can outweigh the cytokine responses.

Chow WH, Devesa SS, Warren JL and Fraumeni JF Jr (1999) Rising incidence of renal cell cancer in the United States. JAMA 281, 1628-31. Clarke PE, Hall C, Miller A, Ridenhour KP, Stindt D, Lovato JF, Patton SE, Brinkley W, Das S and Torti FM. (2004) Phase II trial of combination interferon-" and thalidomide as first-line therapy in metastatic renal cell carcinoma. Urol. 63, 10611064. Clemmensen OJ, Olsen PZ and Andersen KE (1984) Thalidomide neurotoxicity. Arch Dermatol 120, 338-41. Cohen DW, Simak R, Fair W R, MelamedJ, Scher HI and Cordon-Cardo C (1994) Expression of transforming growth factor-" and the epidermal growth factor receptor in human prostate tissues. J Urol 152, 2120-4. Dahut WL, Gulley JL, Arlen PM, Liu Y, FedenkoK M, SteinbergS M, Wright JJ, Parnes H, Chen CC, Jones E, Parker CE, Linehan W M and Figg WD (2004) Randomized phase II trial of docetaxel plus thalidomide in androgenindependent prostate cancer. J Clin Oncol 22, 2532-9.

References

Daliani D (2003) A Tolerance and efficacy Study of Thalidomide Paclitaxel and Estramustine for Patients with Chemotherapy Refractory Androgen Independent Prostate cancer. Chemotherapy Foundation Symposium XXI, Abstract 48.

Adeoti AG, Vega KJ, Dajani EZ, Trotman BW and Kloser PC (1998) Idiopathic esophageal ulceration in acquired immunodeficiency syndrome: successful treatment with misoprostol and viscous lidocaine. Am J Gastroenterol 93, 2069-74.

Daliani DD, Papandreou CN, Thall PF, Wang X, Perez C, Oliva R, Pagliaro L and Amato R (2002) A pilot study of thalidomide in patients with progressive metastatic renal cell carcinoma. Cancer 95, 758-65.

Amato R, Breheny S and Tracy E (2002) Phase I/II study of thalidomide + interleukin II (IL-2) for patients with metastatic renal cell carcinoma (abstract 759). Proc Am Soc Clin Oncol 21, 190a Ando Y, Fuse E, Figg WD (2002) Thalidomide metabolism by the CYP2C subfamily. Clin Cancer Res 8, 1964-73.

D'Amato RJ, Loughnan MS, Flynn E and Folkman J (1994) Thalidomide is an inhibitor of angiogenesis. Proc Natl Acad Sci USA 91, 4082-5.

Aronson IK, Yu R, West D P, Van den Broek H and Antel J (1984) Thalidomide-induced peripheral neuropathy. Effect of serum factor on nerve cultures. Arch Dermatol 120, 146670.

Daniel TO, Liu H, Morrow JD, Crews BC and MarnettL J ( 1999) Thromboxane A2 is a mediator of cyclooxygenase-2dependent endothelial migration and angiogenesis. Cancer Res 59, 4574-7.

Bauer KS, Dixon SC and Figg WD (1998) Inhibition of angiogenesis by thalidomide requires metabolic activation, which is species-dependent. Biochem Pharmacol 55, 182734.

Dixon SC, Kruger EA, Bauer KS and Figg WD (1999) Thalidomide up-regulates prostate-specific antigen secretion from LNCaP cells. Cancer Chemother Pharmacol 43 Suppl, S78-84.

Brown LF, Berse B, JackmanR W, Tognazzi K, Manseau EJ, Dvorak HF and Senger DR (1993) Increased expression of vascular permeability factor (vascular endothelial growth factor) and its receptors in kidney and bladder carcinomas. Am J Pathol 143, 1255-62.

Drake MJ, Robson W, Mehta P, Schofield I, Neal DE and Leung HY (2003) An open-label phase II study of low-dose thalidomide in androgen-independent prostate cancer. Br J Cancer 88, 822-7. Dreicer R, Elson P, Klein EA, Peereboom D, ByzovaT and Plow E (2002) Phase II trial of GM-CSF + thalidomide in patients with androgen-independent metastatic prostate cancer (abstract 782). Proc Am Soc Clin Oncol 21, 196a

Bubley GJ, Carducci M, DahutW, Dawson N, Daliani D, Eisenberger M, FiggWD, Freidlin B, Halabi S, Hudes G, Hussain M, Kaplan R, Myers C, Oh W, Petrylak DP, Reed E, Roth B, Sartor O, Scher H, Simons J, Sinibaldi V, Small EJ, Smith M R, Trump DL, Wilding G et al (1999) Eligibility and response guidelines for phase II clinical trials in androgen-independent prostate cancer: recommendations from the Prostate-Specific Antigen Working Group. J Clin Oncol 17, 3461-7.

Dunzendorfer S, Schratzberger P, Reinisch N, Kahler CM and WiedermannC J (1997) Effects of thalidomide on neutrophil respiratory burst chemotaxis and transmigration of cytokineand endotoxin-activated endothelium. Naunyn Schmiedebergs Arch Pharmacol 356, 529-35. Eastham JA, Truong LD, Rogers E, KattanM, Flanders KC, Scardino PT and Thompson TC (1995) Transforming growth factor-# 1: comparative immunohistochemical localization in human primary and metastatic prostate cancer. Lab Invest 73, 628-35.

Campbell SC (1997) Advances in angiogenesis research: relevance to urological oncology. J Urol 158, 1663-74. Capitosti SM, Hansen TP and Brown ML (2004) Thalidomide analogues demonstrate dual inhibition of both angiogenesis and prostate cancer. Bioorg Med Chem 12, 327-36.

Eisen T, Boshoff C, Mak I, Sapunar F, Vaughan MM, Pyle L, JohnstonS R, Ahern R, Smith IE and Gore ME (2000) Continuous low dose Thalidomide: a phase II study in

Ching KZ, Ramsey E, Pettigrew N, D'Cunha R, Jason M and Dodd JG (1993) Expression of mRNA for epidermal growth factor transforming growth factor-" and their receptor in

Cancer Therapy Vol 3, page 73 advanced melanoma, renal cell,ovarian and breast cancer. Br J Cancer 82, 812-7.

xenograft model of human renal cell carcinoma. Br J Cancer 77, 880-3.

Escudier B, Lassau N, Couanet D, Angevin E, Mesrati F, Leborgne S, Garofano A, Leboulaire C, Dupouy N and Laplanche A (2002) Phase II trial of thalidomide in renal-cell carcinoma. Ann Oncol 13, 1029-35.

Hofer DR, Sherwood ER, Bromberg WD, Mendelsohn J, Lee C and Kozlowski JM (1991) Autonomous growth of androgenindependent human prostatic carcinoma cells: role of transforming growth factor ". Cancer Res 51, 2780-5.

Faure M, Thivolet J and Gaucherand M (1980) Inhibition of PMN leukocytes chemotaxis by thalidomide. Arch Dermatol Res 269, 275-80.

Horie S, Aruga S, Kawamata H, Okui N, Kakizoe T and Kitamura T (1999) Biological role of HGF/MET pathway in renal cell carcinoma. J Urol 161, 990-7.

Figg WD, Arlen P, Gulley J, Fernandez P, Noone M, Fedenko K, Hamilton M, Parker C, Kruger EA, Pluda J and Dahut WL (2001a) A randomized phase II trial of docetaxel (taxotere) plus thalidomide in androgen-independent prostate cancer. Semin Oncol 28, 62-6.

Ikeda T, Lioubin MN and Marquardt H (1987) Human transforming growth factor type # 2: production by a prostatic adenocarcinoma cell line purification and initial characterization. Biochemistry 26, 2406-10. Kato T, Tsuchiya N, Sato K, Ogawa O, Sasaki R, Shimoda N, Satoh T, Habuchi T (2000) Elevated vascular endothelial growth factor (VEGF) and normal level of basic fibroblast growth factor (bFGF) in the sera of patients with renal cell carcinoma. Aktuelle Urolgie 31(S1), 15-17

Figg WD, Dahut W, Duray P, Hamilton M, Tompkins A, Steinberg SM, Jones E, Premkumar A, Linehan WM, Floeter MK, Chen CC, Dixon S, Kohler DR, Kruger EA, Gubish E, Pluda JM and Reed E (2001b) A randomized phase II trial of thalidomide, an angiogenesis inhibitor, in patients with androgen-independent prostate cancer. Clin Cancer Res 7, 1888-93.

Keenan RJ, Eiras G, Burckart GJ, StuartR S, Hardesty RL, Vogelsang G, Griffith BP and Zeevi A (1991) Immunosuppressive properties of thalidomide Inhibition of in vitro lymphocyte proliferation alone and in combination with cyclosporine or FK506. Transplantation 52, 908-10.

Figg WD, Raje S, Bauer K S, Tompkins A, Venzon D, Bergan R, Chen A, Hamilton M, Pluda J and Reed E (1999) Pharmacokinetics of thalidomide in an elderly prostate cancer population. J Pharm Sci 88, 121-5.

Keifer JA, Guttridge DC, Ashburner BP and Baldwin AS Jr (2001) Inhibition of NF-!B activity by thalidomide through suppression of I!B kinase activity. J Biol Chem 276, 223827.

Fudge K, Wang CY and Stearns ME (1994) Immunohistochemistry analysis of platelet-derived growth factor A and B chains and platelet-derived growth factor " and # receptor expression in benign prostatic hyperplasias and Gleason-graded human prostate adenocarcinomas. Mod Pathol 7, 549-54.

Kirschenbaum A, Liu X, Yao S and Levine AC (2001) The role of cyclooxygenase-2 in prostate cancer. Urology 58, 127-31. Li Z, Amato R, Papandreou CN, Pagliaro L, Kim J, Millikan R, Loggins-Coffman J, Perez C, Logothetis CJ and Daliani D (2001) Phase II Study of Thalidomide for patients with metastatic Renal Cell Carcinoma (MRCC) Progressing after Interleukin-2 (IL-2)-Based Therapy (Rx) (abstract 717). Proc Am Soc Clin Oncol 20, 180a.

Fujita J, Mestre J R, Zeldis J B, Subbaramaiah K and Dannenberg AJ (2001) Thalidomide and its analogues inhibit lipopolysaccharide-mediated Iinduction of cyclooxygenase2. Clin Cancer Res 7, 3349-55. Fullerton PM and O'Sullivan DJ (1968) Thalidomide neuropathy: a clinical electrophysiological and histological follow-up study. J Neurol Neurosurg Psychiatry 31, 543-51.

Lissbrant IF, Stattin P, Damber JE and Bergh A (1997) Vascular density is a predictor of cancer-specific survival in prostatic carcinoma. Prostate 33, 38-45.

Geitz H, Handt S and Zwingenberger K (1996) Thalidomide selectively modulates the density of cell surface molecules involved in the adhesion cascade. Immunopharmacology 31, 213-21.

Logothetis CJ (2002) Docetaxel in the integrated management of prostate cancer. Current applications and future promise. Oncology (Huntingt) 16, 63-72. Mansson PE, Adams P, Kan M and McKeehan WL (1989) Heparin-binding growth factor gene expression and receptor characteristics in normal rat prostate and two transplantable rat prostate tumors. Cancer Res 49, 2485-94.

Gleave ME, Hsieh JT, von Eschenbach AC and Chung LW (1992) Prostate and bone fibroblasts induce human prostate cancer growth in vivo: implications for bidirectional tumorstromal cell interaction in prostate carcinoma growth and metastasis. J Urol 147, 1151-9.

Marriott JB, Westby M and Cookson S (1998) CC-3052: a watersoluble analog of thalidomide and potent inhibitor of activation-induced TNF-" production. J Immunol 161, 4236-4243.

Gordon MS, Manola J, Fairclough D, Cella D, Richardson R, Sosman J, Kasimis B, Dutcher JP and Wilding G (2004) Low dose interferon-a2b (IFN) + thalidomide (T) in patients with previously untreated renal cell cancer (RCC). Improvement in progression-free survival (PFS) but not quality of life (QoL) or overall survival (OS). A phase III study of the Eastern Cooperative Oncology Group (E2898) (abstract 4516). Proc Am Soc Clin Oncol 22, 14S (July 15 Supplement), 4516.

Meyer GE, Yu E, Siegal J A, Petteway J C, Blumenstein BA and Brawer M K (1995) Serum basic fibroblast growth factor in men with and without prostate carcinoma. Cancer 76, 230411. Minor DR, Monroe D, Damico LA, Meng G, Suryadevara U and Elias L (2002) A phase II study of thalidomide in advanced metastatic renal cell carcinoma. Invest New Drugs 20, 38993.

Harper ME, Goddard L, Glynne-Jones E, Wilson DW, PriceThomas M, Peeling WB and Griffiths K (1993) An immunocytochemical analysis of TGF " expression in benign and malignant prostatic tumors. Prostate 23, 9-23.

Molloy FM, Floeter MK, Syed NA, Sandbrink F, Culcea E, Steinberg SM, Dahut W, Pluda J, Kruger EA, Reed E and Figg WD (2001) Thalidomide neuropathy in patients treated for metastatic prostate cancer. Muscle Nerve 24, 1050-7.

Hii SI, Nicol DL, Gotley DC, Thompson LC, Green MK and Jonsson JR (1998) Captopril inhibits tumour growth in a

Pridgeon and Drake: Thalidomide and its use in urological malignancies Moreira AL, Sampaio EP, Zmuidzinas A, Frindt P, Smith KA and Kaplan G (1993) Thalidomide exerts its inhibitory action on tumor necrosis factor " by enhancing mRNA degradation. J Exp Med 177, 1675-80.

Sheskin J (1965) Thalidomide in the Treatment of Lepra Reactions. Clin Pharmacol Ther 40, 303-6.

Motzer RJ, Berg W, Ginsberg M, Russo P, Vuky J, Yu R, Bacik J and Mazumdar M (2002) Phase II trial of thalidomide for patients with advanced renal cell carcinoma. J Clin Oncol 20, 302-6.

Singhal S, Mehta J, Desikan R, Ayers D, Roberson P, Eddlemon P, Munshi N, Anaissie E, Wilson C, Dhodapkar M, Zeddis J and Barlogie B (1999) Antitumor activity of thalidomide in refractory multiple myeloma. N Engl J Med 341, 1565-71.

Muller GW, Chen R and Huang SY (1999) Amino-substituted thalidomide analogs: potent inhibitors of TNF-" production. Bioorg Med Chem Lett 9, 1625-1630.

Sitaras NM, Sariban E, Bravo M, Pantazis P and Antoniades HN (1988) Constitutive production of platelet-derived growth factor-like proteins by human prostate carcinoma cell lines. Cancer Res 48, 1930-5.

the anti-TNF-" agent thalidomide. Cell Mol Biol 47, 110514.

Muller GW, Corral LG and Shire MG (1996) Structural modifications of thalidomide produce analogs with enhanced tumor necrosis factor inhibitory activity. J Med Chem 39, 3238-3240.

Somers GF (1960) Pharmacological properties of thalidomide ("-phthalimido glutarimide) a new sedative hypnotic drug. Bri Pharm Chemother 15, 111-6.

Nakamoto T, Chang CS, Li AK and Chodak GW (1992) Basic fibroblast growth factor in human prostate cancer cells. Cancer Res 52, 571-7.

Srinivas S and Guardino AE (2002) Randomized trial of high and low dose thalidomide in metastatic renal cell carcinoma (abstract 2403). Proc Am Soc Clin Oncol 21,

Nakashima J, Tachibana M, Ueno M, Baba S and Tazaki H (1995) Tumor necrosis factor and coagulopathy in patients with prostate cancer. Cancer Res 55, 4881-5.

Stebbing J, Benson C, Eisen T, Pyle L, Smalley K, Bridle H, Mak I, Sapunar F, Ahern R and Gore ME (2001) The treatment of advanced renal cell cancer with high-dose oral thalidomide. Br J Cancer 85, 953-8.

Nathan PD, Gore ME and Eisen TG (2002) Unexpected toxicity of combination thalidomide and interferon "-2a treatment in metastatic renal cell carcinoma. J Clin Oncol 20, 1429-30.

Stebbins CE, Kaelin WG Jr and Pavletich NP (1999) Structure of the VHL-ElonginC-ElonginB complex: implications for VHL tumor suppressor function. Science 284, 455-61.

Negrier S, Escudier B, Lasset C, Douillard J Y, Savary J, Chevreau C, Ravaud A, Mercatello A, Peny J, Mousseau M, Philip T and Tursz T (1998) Recombinant human interleukin-2, recombinant human interferon alfa-2a, or both in metastatic renal-cell carcinoma. Groupe Francais d'Immunotherapie. N Engl J Med 338, 1272-8.

Steiner MS, Zhou ZZ, Tonb DC and Barrack ER (1994) Expression of transforming growth factor-# 1 in prostate cancer. Endocrinology 135, 2240-7. Stirling D (2000) Pharmacology of Thalidomide. Semin Haematol 37, 5-14.

Nicol D, HiiS I, Walsh M, Teh B, Thompson L, Kennett C and Gotley D (1997) Vascular endothelial growth factor expression is increased in renal cell carcinoma. J Urol 157, 1482-6.

Takahashi A, Sasaki H, Kim SJ, Tobisu K, Kakizoe T, Tsukamoto T, Kumamoto Y, Sugimura T and Terada M (1994) Markedly increased amounts of messenger RNAs for vascular endothelial growth factor and placenta growth factor in renal cell carcinoma associated with angiogenesis. Cancer Res 54, 4233-7.

Novik Y, Dutcher JP, Larkin M and Wiernik PH (2001) Phase II Study of Thalidomide in Advanced Refractory Metastatic Renal Cell Cancer: A Single Institute Experience (abstract 1057). Proc Am Soc Clin Oncol 13, 243.

Thompson MA, Witzig TE, Kumar S, Timm MM, Haug J, Fonseca R, Greipp PR, Lust JA and Rajkumar SV (2003) Plasma levels of tumour necrosis factor " and interleukin-6 predict progression-free survival following thalidomide therapy in patients with previously untreated multiple myeloma. Br J Haematol 123, 305-8.

Nowack E (1965) [The sensitive phase in thalidomide embryopathy]. Humangenetik 1, 516-36. Olencki T, Malhi S, Mekhail T, Dreicer R, Elson P, Wood L and Bukowski RM (2003) Phase I trial of thalidomide and interleukin-2 (IL-2) in patients with metastatic renal cell carcinoma (RCC) (abstract 1554). ASCO 22, 387.

Truong LD, Kadmon D, McCune BK, Flanders KC, Scardino PT and Thompson TC (1993) Association of transforming growth factor-# 1 with prostate cancer: an immunohistochemical study. Hum Pathol 24, 4-9.

Rajkumar SV, Mesa RA and Tefferi A (2002) A review of angiogenesis and anti-angiogenic therapy in hematologic malignancies. J Hematother Stem Cell Res 11, 33-47.

Tsambaos D, Bolsen K, Georgiou S, Monastirli A and Goerz G (1994) Effects of oral thalidomide on rat liver and skin microsomal P450 isozyme activities and on urinary porphyrin excretion: interaction with oral hexachlorobenzene. Arch Dermatol Res 286, 347-9.

Rogatsch H, Hittmair A, Reissigl A, Mikuz G and Feichtinger H (1997) Microvessel density in core biopsies of prostatic adenocarcinoma: a stage predictor? J Pathol 182, 205-10. Sampaio EP, Sarno EN, Galilly R, Cohn ZA and Kaplan G (1991) Thalidomide selectively inhibits tumor necrosis factor " production by stimulated human monocytes. J Exp Med 173, 699-703.

Turk BE, Jiang H and Liu JO (1996) Binding of thalidomide to "1-acid glycoprotein may be involved in its inhibition of tumor necrosis factor " production. Proc Natl Acad Sci USA 93, 7552-6.

Scheffler MR, Colburn W, Kook A and Thomas SD (1999) Thalidomide does not alter estrogen-progesterone hormone single dose pharmacokinetics. Clin Pharmacol Ther 65, 483-90.

Vogelzang NJ, Priest ER and Borden L (1992) Spontaneous regression of histologically proved pulmonary metastases from renal cell carcinoma: a case with 5-year followup. J Urol 148, 1247-8.

Settles B, Stevenson A, Wilson K, Mack C, Ezell T, Davis MF and Taylor LD (2001) Down-regulation of cell adhesion molecules LFA-1 and ICAM-1 after in vitro treatment with

Ware JL (1993) Growth factors and their receptors as determinants in the proliferation and metastasis of human prostate cancer. Cancer Metastasis Rev 12, 287-301.

Cancer Therapy Vol 3, page 75 Warren NJ (2001) Thalomid Capsules [package insert]. Celgene Corporation.

Yamada M, Kawai M, Kawai Y and Mashima Y (1999) The effect of selective cyclooxygenase-2 inhibitor on corneal angiogenesis in the rat. Curr Eye Res 19, 300-4.

Weidner N, Carroll PR, Flax J, Blumenfeld W and Folkman J (1993) Tumor angiogenesis correlates with metastasis in invasive prostate carcinoma. Am J Pathol 143, 401-9.

Dr. Simon Pridgeon

Dr. Marcus Drake

Pridgeon and Drake: Thalidomide and its use in urological malignancies

Cancer Therapy Vol 3, page 77 Cancer Therapy Vol 3, 77-84, 2005

Genetic predisposition in preinvasive lesions of the breast Review Article

George C. Zografos1,*, Flora Zagouri1, Costantinos Fotiadis2, John Bramis1 1

1st Department of surgery, School of Medicine, Athens Univrsity, Greece, 3rd Department of surgery, School of Medicine, Athens University, Greece,

__________________________________________________________________________________ *Correspondence: George C. Zografos, Professor of Surgery, University of Athens, Vas. Sofias 101, 11521 Ampelokipi, Athens Greece; Tel: +302106426390; e-mail: gzografo@med.uoa.gr Key words: Genetic predisposition, precancerous lesions, breast cancer, histological models, invasine cancer, preinvasive cancer, ALH/LCIS, UDH/ADH, DCIS Abbreviations: atypical ductal hyperplasia, (ADH); atypical lobular hyperplasia, (ALH); ductal carcinoma in situ, (DCIS); lobular carcinoma in situ, (LCIS); Relative risk, (r.r); Van Nuys Prognostic Index (VNPI) Received: 25 January 2005; Accepted: 16 February 2005; electronically published: February 2005

Summary Preinvasive breast lesions, which include: atypical ductal hyperplasia, ductal carcinoma in situ, atypical lobular hyperplasia, and lobular carcinoma in situ, represent a spectrum of diseases some of which are more aggressive. Uncertainities in the prognosis have caused a controversial discussion about adequate treatment, with a wide range of treatment approaches from observation to mastectomy, resulting in diverse and confusing clinical recommendations. The aim of this review article is to help the clinician, in the common clinical practice, to estimate the risk for each individual patient of developing invasive cancer, by evaluating her genetic predisposition. Significant genetic changes are present in all preinvasive breast lesions. Knowledge of genetic alterations specific for certain phenotypes of premelignant disease, and for the subsequent transition to invasive carcinomas, should provide clues for the development of mechanism-based treatments. The aim of this review article is to identify genetic changes in preinvasive breast lesions and to correlate the relative risk of these lesions for the subsequent transition to invasive carcinoma, in order to give certain answers, and to improve treatment decision in the common clinical practice. According to our knowledge there is only one review article in the English literature focused on genetic changes in preinvasive lesions and their role in the clinical and therapeutical decision.

I. Introduction Breast cancer, is thought to involve through a sequential progression from normal to proliferate epithelium, to in situ, and finally to invasive carcinoma (Dupont and Page, 1985; Buerger et al, 1999a). Preinvasive lesions of the breast, which include: atypical ductal hyperplasia (ADH), ductal carcinoma in situ (DCIS), atypical lobular hyperplasia (ALH), and lobular carcinoma in situ (LCIS), have an increased relative risk for the development of infiltrating carcinoma (Bradley et al, 1990; Rosen and Obermann, 1993; Fitzgibbons et al, 1998). It has become apparent, that preinvasive breast lesions represent a spectrum of neoplasmatic disease, some of which are more aggressive, while others display a more protracted course. Uncertainties in the prognosis have caused a controversial discussion about adequate treatment, with a wide rage of treatment approaches from observation to mastectomy, resulting in diverse and confusing clinical recommendations, distressing to both patients and clinicians (Buerger et al, 1999a; Schnitt, 2003).

II. Methods We searched for published manuscripts, of molecular markers with a positive prognostic value in all precancerous lesions of the breast, that means in UDH, ADH, DCIS, ALH, and in LCIS. We systematically searched MEDLINE from January 1982 to June 2004 using the Medical Subject Heading terms or key words: precancerous lesions of the breast, preinvasive breast lesions, ADH, DCIS, ALH, LCIS combined with genetic changes, genes, genetic predisposition, c-erbB2, p53, Ecathedrine, bcl-2, ki67, p27, apoptosis, apoptotic index, proliferation, proliferative index, necrosis, oestrogen 77

Zografos et al: Genetic predisposition in preinvasive lesions of the breast receptor. We manually searched bibliographies of original and review articles identified in MEDLINE.

true precursor of invasive carcinoma, and belongs to preinvasive lesions of the breast (Reis-Filho and Lakhani, 2003). ALH is “a small amount of LCIS”, with a relative risk of breast cancer 3. Differences in risk between ALH and LCIS were the main reason to distinguish these lesions (Page et al, 2003; Van de Vijver and Peterse, 2003). Over the past twenty years or so, a histological model of human breast cancer evolution was predominant. Stem cells in normal TDLUs give rise to atypical hyperplasias (ADH, ALH), which progress to in situ carcinoma (DCIS, LCIS), which eventually develop into invasive and metastatic disease (Allred et al, 2001) (Table 3). Although, recently new models have been proposed. Farabegoli et al, (2002) proved, that DCIS is a possible but not an obligate precursor of invasive breast cancer and suggest that, pure DCIS and DCIS associated with IDC may be genetically distinct (Boecker et al, 2001). The evolution from DCIS to IDC may follow multiple pathways and not a linear model. Leong et al, (2001) suggested that in most cases low-grade DCIS is associated with low-grade invasive carcinoma and high-grade DCIS with high-grade invasive carcinoma, ie, a horizontal progression. They supported that intermediate-grade DCIS is heterogenous, so it is possible that this group represents some cases of DCIS that have progressed from low-grade DCIS and cases that may progress to high-grade DCIS, so progression may not be entirely horizontal in intermediategrade DCIS (Table 4). It has become apparent though, that preinvasive lesions of the breast biologically and clinically represent a spectrum of neoplastic diseases, some of which are more aggressive. It is important to evaluate the individual relative risk of developing invasive breast carcinoma rather than the relative risk of each preinvasive lesion. Accounting for this fact, various morphological classification schemes of preinvasive lesions have been proposed (Schulze-Garg et al, 2000).

III. Preinvasive lesions of the breasthistological models of their progression to invasine cancer Preinvasive lesions of the breast, as noted above, include four diseases: ADH, DCIS, ALH, and LCIS that have an elevated risk for developing invasive carcinoma (Table 1). The most compelling evidence that all these lesions may be procusors comes from studies showing identical genetic abnormalities with synchronous ipsilateral IBC (O'Connell et al, 1998) (Table 2). ADH represents a proliferative lesion that fulfils some but, not all the criteria for a diagnosis of low-grade, non-comedo type DCIS and represents usually an early stage in the formation of low-grade DCIS. ADH, identified in only 4% of bening breast biopsies, is associated with a relative risk for subsequent cancer 4.4. When ADH is combined with a positive family history the relative risk for invasive cancer arises to 9.7 (Dupont et al, 1993; Oyama et al, 1999; Van de Vijver and Peterse, 2003; Locke et al, 2004). DCIS of the mammary gland, that represents an early, pre-invasive stage in the development of invasive breast cancer, is increasingly diagnosed since the introduction of high-quality mammography screening (Schulze-Garg et al, 2000). Presently constitutes 10-20% of screen detected malignancies of the breast (Schnitt et al, 1988; Zografos et al, 2004), and it is known that a diagnosis of this form confers an 8-10-fold elevated risk for the development of infiltrating ductal breast cancer (Page et al, 1982; Lagios, 1995). LCIS, an uncommon lesion with a distinctive appearance, is a “marker of increased risk” rather than a Table 1. Precancerous lesions of the breast

Relative risk (r.r) • Atypical Ductal Hyperplasia (ADH) • Ductal Carcinoma In Situ (DCIS) • Atypical Lobular Hyperplasia (ALH) • Lobular Carcinoma In Situ (LCIS)

4,4 8–10 3 7

Table 2. Genetic predisposition in precancerous breast lesions

ADH: ALH: DCIS: LCIS:

Genetic predisposition Losses 1q, 2p, 6q, 9p, 11p, 11q, 13q, 14q, 16q, 17p, 17q, Xq 11q, 16p, 16q, 17p, 22q 1p, 7q, 2p, 2q, 3p, 3q, 4p, 6p, 6q, 7p, 7q, 8p, 8q, 9p, 11p, 11q, 12p, 13q, 14q, 15q, 16p, 16q, 17p, 17q, 18q, 21q 11q, 13q, 16p, 16q, 17p, 17q, 22q

Gains Unknown 6q 1q, 3q, 6q, 6p, 8q, 17q, 20q, Xq 6q

Cancer Therapy Vol 3, page 79 Table 3. Fischerâ&#x20AC;&#x2122; s model

Table 4. Horizontal progression

Nevertheless, these approaches still leave a host of open questions with respect to practical and conceptual matters, as mirrored by our difficulties in diagnosis and treatment.

IV. Classifications breast disease

V. Genetic predisposition preinvasive breast lesions

It has become apparent, that preinvasive lesions of the breast are a heterogenous group and a uniform approach to treatment is therefore not appropriate. Some lesions require no treatment other than excisional biopsy; others benefit from complete excision plus radiation therapy, and some will require mastectomy. The challenge is to use available clinical and pathologic data to select the most appropriate therapy for each individual patient. Significant genetic changes are present in all preinvasive breast lesions. Knowledge of genetic alterations specific for certain phenotypes of premelignant disease, and for the subsequent transition to invasive carcinomas, should provide clues for the development of mechanism-based treatments (Schulze-Garg et al, 2000) (Table 2).

preinvasive

Currently the decision for treatment of preinvasive lesions is solely based on morphological criteria. In fact, there is no specific classification for ADH, ALH, LCIS while for DCIS the Van Nuys classification is the most widely accepted method for risk estimation and has replaced the Holland, the Bellamy, the Leal and the Lagios classifications (Leong et al, 2001). The Van Nuys Prognostic Index (VNPI) combines three significant predictors of local reccurance: tumor size, margin width, and pathologic classification (nuclear grade, comedo-type necrosis). Scores of 1 (best) to 3 (worst) were assigned for each of the three predictors and then totaled to give an overall VNPI score ranging from 3 to 9, by which DCIS is classified into three groups with low, intermediate, or high risk of local reccurence after breast conserving therapy (Bellamy et al, 1993; Silverstein et al, 1996) (Table 5). It is obvious that, genetic predisposition associated with specific forms of preinvasive lesions and their progression to invasive carcinoma should provide improved and, more reliable tools for the diagnosis and prognosis.

A. ALH/LCIS Loss of material from 16p, 16q, 17p, and 22q and gain of material from 6q have been found at similar high frequencies in both LCIS and atypical lobular hyperplasia (ALH) (Lu et al, 1998; Moinfar et al, 2000; Reis-Filho and Lakhani, 2003). Comparison of the CGH results from LCIS/ALH with those from DCIS and invasive carcinoma showed some similarities at the chromosomal level, but it also showed significant differencies, including gain of 1q and 8q and evidence for genomic amplification, which were not found in LCIS/ALH (Lu et al, 1998).

Zografos et al: Genetic predisposition in preinvasive lesions of the breast

Table 5. Van Nuys prognostic index scoring system

•

Van Nuys prognostic index scoring system Size (mm) Score I: less than 15 mm Score II: 15-40 mm Score III: more than 41mm Margin width (mm) Score I: 10mm or more Score II: 1 – 9mm Score III: < 1mm Pathologic classification (nuclear grade, necrosis) Score I: absence of high nuclear grade, absence of comedo-type necrosis Score II: absence of high nuclear grade, presence of comedo-type necrosis Score III: presence of high nuclear grade, presence of comedo-type necrosis Total VN score 3 – 4: well differentiated DCIS 5 – 6 – 7: intermed differentiated DCIS 8 – 9: poorly differentieted DCIS

other hand, cytoceratin expression can be influenced by nutritional and hormonal factors as has been shown for vitamin A and oestrogens (Moll et al, 1982; Raju et al, 1990; Aldaz et al, 1995; Clover et al, 1997). This study provides evidence that cells undergoing malignant transformation tend to be fairly advanced in the glandular lineage of differentiation (Boecker et al, 2002).

B. UDH/ADH Lakhani et al, (1995) demonstrated that LOH identified at loci on 16q and 17p in DCIS is also present in ADH with a similar frequency. Their findings also demonstrated that ADH is a monoclonal, and hence, neoplastic proliferation rather than a hyperplastic (polyclonal) condition as its name suggests (Noguchi et al, 1994; Walker, 2001) Similar results were reported by Amari et al, (1999). As expected, owing to the morphological overlap with low grade DCIS, losses of 16q and 17p were the most frequent changes found in ADH (Reis-Filho and Lakhani, 2003). Gong et al, (2001) and Gong et al, (2001) saw in their study frequent sharing of genetic changes between ADH and UDH in the same biopsy. These data support the likelihood that UDH is a precursor of ADH, at least in some cases representing neoplastic growth. The frequencies of 16q and 17p losses suggest that alterations of candidate genes located in these chromosomal regions may play a role early in breast carcinogenesis. Candidate genes that might be responsible for some of these losses include E-cathedrin on 16q and p53 on 17p, also17q12 is the locus of erbB2/HER2-neu and 11q13 the locus of cyclin D1 (Buerger et al, 1999b) On the other hand, Boecker et al, (2002) and Otterbach et al, (2000) supported the idea that UDH of the breast is a committed stem (progenitor) cell lesion distinct from ADH and DCIS, as UDH appears to be a Ck5-positive committed stem (progenitor) cell lesion with the same differentiation potential as seen in the normal breast. This is in sharp contrast to ADH/DCIS, which display the differentiated glandular immunophenotype (Ck8/18/19positive, but Ck5-negative) (Bocker et al, 1992; Moinfar et al, 1999; Boecker et al, 2001) There are two possible explanations for the lack of cytokeratin 5 in neoplastic breast epithelia. On the one hand, neoplastic cells of ADH, DCIS, and infiltratig carcinomas may develop from Ck 5negative glandular precursor cell, since cytoceratin polypeptide patterns are largely preserved during malignant transformation (Kasami et al, 1997). On the

C. DCIS It is known, that significant qualitive and quantitive genetic changes are assossiated with clinical stage and morphological phenotype. According to Aldaz et al, (1995) in DCIS there is a tendency for association between high nuclear grade and higher frequency of allelic losses and imbalances. This is in agreement with previous histopathological studies that indicated that high nuclear grade appears to identify subsets of DCIS with worse prognosis (Radford et al, 1993) The broad spectrum of phenotypically heterogenous DCIS with significantly different aberrations raises the question of multiple pathways for invasive breast cancer with DCIS as a precursor lesion. Considering the wide rage of genetic alterations overall and, particularly, within the subgroups of DCIS, it is obvious that DCIS is far more heterogenous as a group than its morphology suggests. The loss of genetic material of 16q22-24 is almost exclusive restricted to DCIS, well and intermediately differentiated (James et al, 1997; Buerger et al, 1999a). Studying allelic imbalances, a correlation of loss of heterozygosity of 16q22-24 with the grading of the tumours was discussed in cotroversial form (Tsuda et al, 1994, 1995; Radford et al, 1995; Fujii et al, 1996) Losses of 16q material were seen almost exclusively in well- and intermidiately differentiated DCIS. These two groups differed in the average number of genetic imbalances, 2.5 and 5.5 respectively. Additionally, a higher frequency of gains of 1q and losses of 11q material was seen in intermediatellydifferentiated in contrast to well differentiated DCIS. The

Cancer Therapy Vol 3, page 81 high overall frequency of LOH of 16q in poorlydifferentiated DCIS might reflect a gross genetic instability of this chromosomal locus. Losses of putative tumour suppressor genes such as BBC1 and E-cathedrin therefore seem to mark an important stage during the onset of a low-grade neoplastic disease (Cleton-Jansen et al, 1995; Gupta et al, 1997) DCIS poorly differentiated reveals a decreased rate of gains of 1q and losses of 16q compared with DCIS, intermediately differentiated. Poorly-differentiated DCIS displayed a higher frequency of amplifications (17q12, 11q13) and a higher average rate of genetic inbalances (7.1) (Buerger et al, 1999a, b; Moore et al, 1999) Findings supported by several studies showing amplifications of ERBB2 and immunohistogically detectable overexpression of the erbb2 protein (De Potter et al, 1993; Tsuda et al, 1993; Zafrani et al, 1994; Coene et al, 1997). Although the biological impact of these findings is not yet known, it is likely that DCIS differs biologically depending on the type and number of such alterations.

VII. Summary In conclusion, it can be said that even if the characterization of preinvasive breast lesions by immunohistochemistry, fluorescent in situ hybridisation, analysis of LOH, CGH, and, more recently, cDNA microarrays and proteomics analysis will one day allow a better genetic grading with prognostic implications (Buerger et al, 1999a; Jeffrey and Pollack, 2003; ReisFilho and Lakhani, 200), today the clinician, in the common clinical practice, can estimate the risk for each individual patient with preinvasive lesion of the breast of developing invasive cancer, by evaluating morphological classification, prognostic markers and genetic predisposition. Evaluating these data the clinician can select the preinvasive lesions of the breast which are at high risk of developing to malignacies, and chose the most appropriate therapy for each individual patient.

VI. Therapeutical decision

References

Therapeutical decision should be taken after concisuous and persistant study of the above mentioned genetic changes and molecular markers (c-erbB2, p53, bcl2, ki-67, p27, AAMP, gene 14-3-3!, 67LR, estrogen receptor, TGF-") (Petersen et al, 1987; Hockenbery et al, 1991; Williams et al, 1991; Pike et al, 1993; Bobrow et al, 1994; Basolo et al, 1996; Bodis et al, 1996; Bose et al, 1996; Karayiannakis et al, 1996; Siziopikou et al, 1996; Clarke et al, 1997; Fontanini et al, 1997; Kapucuoglu et al, 1997; Rudas et al, 1997; Viacava et al, 1997; El-Deiry, 1998; Henderson et al, 1998; Khan et al, 1998; Potten et al, 1998; Gobbi et al, 1999; Shoker et al, 1999; Viacava et al, 1999; Roger et al, 2001; Umbricht et al, 2001; Vogelstein et al, 2001; Wykoff et al, 2001; Adeyinka et al, 2002; Gasco et al, 2002; Man et al, 2003). The clinician should be aware on the recent progress of the molecular biology, individualising every patient based on her risk factors, her genetic profile, her tumour markers, her complete histological evaluation, her psychological and social status, etc. All these parameters should be carefully evaluated before the final decision be undertaken. In Table 6 is shown the genetic changes with a bad prognostic value for developing IBC.

Adeyinka A, Emberley E, Niu Y, Snell L, Murphy LC, Sowter H, Wykoff CC, Harris AL, Watson PH (2002) Analysis of gene expression in ductal carcinoma in situ of the breast. Clin Cancer Res 8, 3788-3795. Aldaz M, Chen T, Sahin A, Cunningham J, Bondy M (1995) Comperative allelotype of in situ and invasive human breast cancer, High frequency of microsatellite instability in lobular breast carcinomas. Cancer Res 55, 3976-3981. Allred DC, Mohsin SK, Fuqua SA (2001 Histological and biological evolution of human premalignant breast disease. Endocr Relat Cancer 8 47-61 Amari M, Suzuki A, Moriya T, Yoshinaga K, Amano G, Sasano H, Ohuchi N, Satomi S, Horii A (1999) LOH analyses of premalignant and malignant lesions of human breast: frequent LOH in 8p, 16q, and 17q in atypical ductal hyperplasia. Onc Rep 6, 1277-1280. Basolo F, Pollina L, Pacini F, Fontanini G, Menard S, Castronovo V, Bevilacqua G (1996) Expression of the Mr 67, 000 laminin receptor is an adverse prognostic indicator in human thyroid cancer: an immunohistochemical study. Clin Cancer Res 2, 1777-1780. Bellamy CO, McDonald C, Salter DM, Chetty U, Anderson TJ (1993) Noninvasive ductal carcinoma of the breast: the relevance of histologic categorization. Hum Pathol 24, 1623. Bobrow LG, Happerfield LC, Gregory WM, Springall RD, Millis RR (1994) The classification of ductal carcinoma in situ and its association with biological markers. Semin Diagn Pathol 11, 199-207. Bocker W, Bier B, Freytag G, Brommelkamp B, Jarasch ED, Edel G, Dockhorn-Dworniczak B, Schmid KW (1992) An immunohistochemical study of the breast using antibodies to basal and luminal keratins, #-smooth muscle actin, vimentin, collagen IV and laminin. Part II: Epitheliosis and ductal carcinoma in situ. Virchows Arch A Pathol Anat Histopathol 421, 323-330. Bodis S, Siziopikou KP, Schnitt SJ, Harris JR, Fisher DE (1996) Extensive apoptosis in ductal carcinoma in situ of the breast. Cancer 77, 1831-1835 Boecker W, Buerger H, Schmitz K, Ellis IA, van Diest PJ, Sinn HP, Geradts J, Diallo R, Poremba C, Herbst H (2001) Ductal epithelial proliferations of the breast: a biological continuum? Comparative genomic hybridization and high-

Table 6. Molecular markers of preinvasive breast lesions – – – – – – – – – – – –

c – erbB2 (Her – 2neu) p – 53 E – cathedrine TGF – " AAMP Ki – 67 p 27 bcl – 2 67 LR Gene 14-3-3 ! (!) Estrogen receptors Progesteron receptors

Zografos et al: Genetic predisposition in preinvasive lesions of the breast molecular-weight cytokeratin expression patterns. J Pathol 195, 415-421. Boecker W, Moll R, Dervan P, Buerger H, Poremba C, Diallo RI, Herbst H, Schmidt A, Lerch MM, Buchwalow IB (2002) Usual ductal hyperplasia of the breast is a committed stem (progenitor) cell lesion distinct from atypical ductal hyperplasia and ductal carcinoma in situ. J Pathol 198, 458467. Bose S, Lesser ML, Norton L, Rosen PP (1996) Immunophenotype of intraductal carcinoma. Arch Pathol Lab Med 120, 81-85. Bradley SJ, Weaver DW, Bouwman DL (1990) Alternatives in the surgical management of in situ breast cancer. A metaanalysis of outcome. Am Surg 56, 428-432. Buerger H, Otterbach F, Simon R, Poremba C, Diallo R, Decker T, Riethdorf L, Brinkschmidt C, Dockhorn-Dworniczak B, Boecker W (1999) Comparative genomic hybridization of ductal carcinoma in situ of the breast-evidence of multiple genetic pathways. J Pathol 187, 396-402 Buerger H, Otterbach F, Simon R, Schafer KL, Poremba C, Diallo R, Brinkschmidt C, Dockhorn-Dworniczak B, Boecker W (1999) Different genetic pathways in the evolution of invasive breast cancer are associated with distinct morphological subtypes. J Pathol 189, 521-526. Clarke RB, Howell A, Potten CS, Anderson E (1997) Dissociation between steroid receptor expression and cell proliferation in the human breast. Cancer Res 57, 49874991. Cleton-Jansen AM, Moerland HW, Callen DF, Doggett NA, Devilee P, Cornelisse CJ (1995) Mapping of the breast basic conserved gene (D16S444E) to human chromosome band 16q24. 3. Cytogenet Cell Genet 68, 49-51. Clover J, Oates J, Edwards C (1997) Anti-cytokeratin 5/6: a positive marker for epithelioid mesothelioma. Histopathology 31, 140-143. Coene ED, Schelfhout V, Winkler RA, Schelfhout AM, Van Roy N, Grooteclaes M, Speleman F, De Potter CR (1997) Amplification units and translocation at chromosome 17q and c-erbB-2 overexpression in the pathogenesis of breast cancer. Virchows Arch 430, 365-372. De Potter CR, Foschini MP, Schelfhout AM, Schroeter CA, Eusebi V (1993) Immunohistochemical study of neu protein overexpression in clinging in situ duct carcinoma of the breast. Virchows Arch A Pathol Anat Histopathol 422, 375-380. Dupont WD, Page DL (1985) Risk factors for breast cancer in women with proliferative breast disease. N Engl J Med 312, 146-151. Dupont WD, Parl FF, Hartmann WH, Brinton LA, Winfield AC, Worrell JA, Schuyler PA, Plummer WD (1993) Breast cancer risk associated with proliferative breast disease and atypical hyperplasia. Cancer 71, 1258-1265. El-Deiry WS (1998) Regulation of p53 downstream genes. Semin Cancer Biol 8, 345-357. Farabegoli F, Champeme MH, Bieche I, Santini D, Ceccarelli C, Derenzini M, Lidereau R (2002) Genetic pathways in the evolution of breast ductal carcinoma in situ. J Pathol 196, 280-286 Fitzgibbons PL, Henson DE, Hutter RV (1998) Benign breast changes and the risk for subsequent breast cancer: an update of the 1985 consensus statement. Cancer Committee of the College of American Pathologists. Arch Pathol Lab Med 122, 1053-5 Fontanini G, Vignati S, Chine S, Lucchi M, Mussi A, Angeletti CA, Menard S, Castronovo V, Bevilacqua G (1997) 67Kilodalton laminin receptor expression correlates with worse prognostic indicators in non-small cell lung carcinomas. Clin Cancer Res 3, 227-231.

Fujii H, Szumel R, Marsh C, Zhou W, Gabrielson E (1996) Genetic progression, histological grade, and allelic loss in ductal carcinoma in situ of the breast. Cancer Res 56, 52605265. Gasco M, Shami S, Crook T (2002) The p53 pathway in breast cancer. Breast Cancer Res 4, 70-76. Gobbi H, Dupont WD, Simpson JF, Plummer WD Jr, Schuyler PA, Olson SJ, Arteaga CL, Page DL (1999) Transforming growth factor-" and breast cancer risk in women with mammary epithelial hyperplasia. J Natl Cancer Inst 91, 2096-2101. Gong G, DeVries S, Chew KL, Cha I, Ljung BM, Waldman FM (2001) Genetic changes in paired atypical and usual ductal hyperplasia of the breast by comparative genomic hybridization. Clin Cancer Res 7, 2410-2414. Gupta SK, Douglas-Jones AG, Jasani B, Morgan JM, Pignatelli M, Mansel RE (1997) E-cadherin (E-cad) expression in duct carcinoma in situ (DCIS) of the breast. Virchows Arch 430, 23-28. Henderson BE, Ross R, Bernstein L (1998) Estrogens as a cause of human cancer: the Richard and Hinda Rosenthal Foundation award lecture. Cancer Res 48, 246-253. Hockenbery DM, Zutter M, Hickey W, Nahm M, Korsmeyer SJ (1991) BCL2 protein is topographically restricted in tissues characterized by apoptotic cell death. Proc Natl Acad Sci U S A 88, 6961-6965. James LA, Mitchell EL, Menasce L, Varley JM (1997) Comparative genomic hybridization of ductal carcinoma in situ of the breast: identification of regions of DNA amplification and deletion in common with invasive carcinoma. Oncogene 14, 1059-1065. Jeffrey SS, Pollack JR (2003) The diagnosis and management of pre-invasive breast disease: promise of new technologies in understanding pre-invasive breast lesions. Breast Cancer Res 5, 320-328. Kapucuoglu N, Losi L, Eusebi V (1997) Immunohistochemical localization of Bcl-2 and Bax proteins in in situ and invasive duct breast carcinomas. Virchows Arch 430, 17-22. Karayiannakis AJ, Bastounis EA, Chatzigianni EB, Makri GG, Alexiou D, Karamanakos P (1996) Immunohistochemical detection of oestrogen receptors in ductal carcinoma in situ of the breast. Eur J Surg Oncol 22, 578-582. Kasami M, Vnencak-Jones CL, Manning S, Dupont WD, Page DL (1997) Loss of heterozygosity and microsatellite instability in breast hyperplasia. No obligate correlation of these genetic alterations with subsequent malignancy. Am J Pathol 150, 1925-32. Kasami M, Vnencak-Jones CL, Manning S, Dupont WD, Page DL (1997) Loss of heterozygosity and microsatellite instability in breast hyperplasia. No obligate correlation of these genetic alterations with subsequent malignancy. Am J Pathol 150, 1925-32. Khan SA, Rogers MA, Khurana KK, Meguid MM, Numann PJ (1998) Estrogen receptor expression in benign breast epithelium and breast cancer risk. J Natl Cancer Inst 90, 3742. Lagios MD (1995) Heterogeneity of duct carcinoma in situ (DCIS): relationship of grade and subtype analysis to local recurrence and risk of invasive transformation. Cancer Lett 90, 97-102. Lakhani SR, Collins N, Stratton MR, Sloane JP (1995) Atypical ductal hyperplasia of the breast, clonal proliferation with loss of heterozigosity on chromosomes 16q and 17p. J Clin Pathol 48, 611-615 Lakhani SR, Slack DN, Hamoudi RA, Collins N, Stratton MR, Sloane JP (1996) Detection of allelic imbalance indicates that a proportion of mammary hyperplasia of usual type are clonal, neoplastic proliferations. Lab Invest 74, 129-135

Cancer Therapy Vol 3, page 83 Leong AS, Sormunen RT, Vinyuvat S, Hamdani RW, Suthipintawong C (2001) Biologic markers in ductal carcinoma in situ and concurrent infiltrating carcinoma. A comparison of eight contemporary grading systems. Am J Clin Pathol 115, 709-18. Locke I, Mitchell G, Eeles R (2004) Ductal approaches to assessment and management of women at high risk for developing breast cancer. Breast Cancer Res 6, 75-81. Lu YJ, Osin P, Lakhani SR, Di Palma S, Gusterson BA, Shipley JM (1998) Comparative genomic hybridization analysis of lobular carcinoma in situ and atypical lobular hyperplasia and potential roles for gains and losses of genetic material in breast neoplasia. Cancer Res 58, 4721-4727. Man YG, Tai L, Barner R, Vang R, Saenger JS, Shekitka KM, Bratthauer GL, Wheeler DT, Liang CY, Vinh TN, Strauss BL (2003) Cell clusters overlying focally disrupted mammary myoepithelial cell layers and adjacent cells within the same duct display different immunohistochemical and genetic features: implications for tumor progression and invasion. Breast Cancer Res 5, 231-41. Moinfar F, Man YG, Bratthauer GL, Ratschek M, Tavassoli FA (2000) Genetic abnormalities in mammary ductal intraepithelial neoplasia-flat type ("clinging ductal carcinoma in situ"): a simulator of normal mammary epithelium. Cancer 8, 2072-2081. Moinfar F, Man YG, Lininger RA, Bodian C, Tavassoli FA (1999) Use of keratin 35"E12 as an adjunct in the diagnosis of mammary intraepithelial neoplasia-ductal type--benign and malignant intraductal proliferations. Am J Surg Pathol 23, 1048-1058. Moll R, Franke WW, Schiller DL, Geiger B, Krepler R (1982) The catalog of human cytokeratins: patterns of expression in normal epithelia, tumors and cultured cells. Cell 31, 11-24. Moore E, Magee H, Coyne J, Gorey T, Dervan PA (1999) Widespread chromosomal abnormalities in high-grade ductal carcinoma in situ of the breast. Comparative genomic hybridization study of pure high-grade DCIS. J Pathol 187, 403-409 Noguchi S, Motomura K, Inaji H, Imaoka S, Koyama H (1994) Clonal analysis of predominantly intraductal carcinoma and precancerous lesions of the breast by means of polymerase chain reaction. Cancer Res 54, 1849-1853. O'Connell P, Pekkel V, Fuqua SA, Osborne CK, Clark GM, Allred DC (1998) Analysis of loss of heterozygosity in 399 premalignant breast lesions at 15 genetic loci. J Natl Cancer Inst 90, 697-703 Otterbach F, Bankfakvi A, Bergner S, Decker T, Krech R, Boecker W (2000) Cytoceratin 5/6 immunohistochemistry assists the differential diagnosis of atypical proliferations of the breast Histopathology 37, 232-240. Oyama T, Maluf H, Koerner F (1999) Atypical cystic lobules: an early stage in the formation of low-grade ductal carcinoma in situ. Virchows Arch 435, 413-421 Page DL, Dupont WD, Rogers LW, Landenberger M (1982 Intraductal carcinoma of the breast: follow-up after biopsy only. Cancer 49, 751-758. Page DL, Schuyler PA, Dupont WD, Jensen RA, Plummer WD Jr, Simpson JF (2003) Atypical lobular hyperplasia as a unilateral predictor of breast cancer risk: a retrospective cohort study. Lancet 361, 125-129. Petersen OW, Hoyer PE, van Deurs B (1987) Frequency and distribution of estrogen receptor-positive cells in normal, nonlactating human breast tissue. Cancer Res 47, 57485751. Pike MC, Spicer DV, Dahmoush L, Press MF (1993) Estrogens, progestogens, normal breast cell proliferation, and breast cancer risk. Epidemiol Rev 15, 17-35

Potten CS, Watson RJ, Williams GT, Tickle S, Roberts SA, Harris M, Howell A (1998) The effect of age and menstrual cycle upon proliferative activity of the normal human breast. Br J Cancer 58, 163-170. Radford DM, Fair K, Thompson AM, Ritter JH, Holt M, Steinbrueck T, Wallace M, Wells SA Jr, Donis-Keller HR (1993) Allelic loss on a chromosome 17 in ductal carcinoma in situ of the breast. Cancer Res 53, 2947-2949. Radford DM, Fair KL, Phillips NJ, Ritter JH, Steinbrueck T, Holt MS, Donis-Keller H (1995) Allelotyping of ductal carcinoma in situ of the breast: deletion of loci on 8p, 13q, 16q, 17p and 17q. Cancer Res 55, 3399-3405. Raju U, Crissman JD, Zarbo RJ, Gottlieb C (1990) Epitheliosis of the breast. An immunohistochemical characterization and comparison to malignant intraductal proliferations of the breast. Am J Surg Pathol 14, 939-947. Reis-Filho JS, Lakhani SR (2003) The diagnosis and management of pre-invasive breast disease: genetic alterations in pre-invasive lesions. Breast Cancer Res 5, 313-319. Roger P, Sahla ME, Makela S, Gustafsson JA, Baldet P, Rochefort H (2001) Decreased expression of estrogen receptor " protein in proliferative preinvasive mammary tumors. Cancer Res 61, 2537-41 Rosen PP and Obermann HA (1993) Tumours of the Mammary Gland. Washington (DC): Armed Forces Institute of Pathology Rudas M, Neumayer R, Gnant MF, Mittelbock M, Jakesz R, Reiner A (1997) p53 protein expression, cell proliferation and steroid hormone receptors in ductal and lobular in situ carcinomas of the breast. Eur J Cancer 33, 39-44. Schnitt SJ (2003) The diagnosis and management of pre-invasive breast disease: flat epithelial atypia--classification, pathologic features and clinical significance. Breast Cancer Res 5, 263-268 Schnitt SJ, Silen W, Sadowsky NL, Connolly JL, Harris JR (1988 Ductal carcinoma in situ (intraductal carcinoma) of the breast. N Engl J Med 318, 898-903. Schulze-Garg C, Lohler J, Gocht A, Deppert W (2000) A transgenic mouse model for the ductal carcinoma in situ (DCIS) of the mammary gland. Oncogene 19, 1028-1037. Shoker BS, Jarvis C, Sibson DR, Walker C, Sloane JP (1999) Oestrogen receptor expression in the normal and precancerous breast. J Pathol 188, 237-244. Silverstein MJ, Lagios MD, Craig PH, Waisman JR, Lewinsky BS, Colburn WJ, Poller DN (1996 A prognostic index for ductal carcinoma in situ of the breast. Cancer 77, 2267-74. Siziopikou KP, Prioleau JE, Harris JR, Schnitt SJ (1996) Bcl-2 expression in the spectrum of preinvasive breast lesions. Cancer 77, 499-506. Tsuda H, Fukutomi T, Hirohashi S (1995) Pattern of gene alterations in intraductal breast neoplasms associated with histological type and grade. Clin Cancer Res 1, 261-267. Tsuda H, Iwaya K, Fukutomi T, Hirohashi S (1993) p53 mutations and c-erbB-2 amplification in intraductal and invasive breast carcinomas of high histologic grade. Jpn J Cancer Res 84, 394-401. Tsuda H, Uei Y, Fukutomi T, Hirohashi S (1994) Different incidence of loss of heterozygosity on chromosome 16q between intraductal papilloma and intracystic papillary carcinoma of the breast. Jpn J Cancer Res 85, 992-996. Umbricht CB, Evron E, Gabrielson E, Ferguson A, Marks J, Sukumar S (2001) Hypermethylation of 14-3 ! (stratifin) is an early event in breast cancer. Oncogene 20, 3348-3353. Van de Vijver MJ, Peterse H (2003) The diagnosis and management of pre-invasive breast disease: pathological diagnosis--problems with existing classifications. Breast Cancer Res 5, 269.

Zografos et al: Genetic predisposition in preinvasive lesions of the breast Viacava P, Naccarato AG, Bevilacqua G (1999) Different proliferative patterns characterize different preinvasive breast lesions. J Pathol 188, 245-251. Viacava P, Naccarato AG, Collecchi P, Menard S, Castronovo V, Bevilacqua G (1997) The spectrum of 67-kD laminin receptor expression in breast carcinoma progression. J Pathol 182, 36-44. Vogelstein B, Lane D, Levine AJ (2001) Surfing the p53 network. Nature 408, 307-310. Walker RA (2001) Are all ductal proliferations of the breast premalignant? J Pathol; 195, 401-403 Williams G, Anderson E, Howell A, Watson R, Coyne J, Roberts SA, Potten CS (1991) Oral contraceptive (OCP) use increases proliferation and decreases oestrogen receptor content of epithelial cells in the normal human breast. Int J Cancer 48, 206-210. Wykoff CC, Beasley N, Watson PH, Campo L, Chia SK, English R, Pastorek J, Sly WS, Ratcliffe P, Harris AL (2001) Expression of the hypoxia-inducible and tumor-associated carbonic anhydrases in ductal carcinoma in situ of the breast. Am J Pathol 158, 1011-1019. Zafrani B, Leroyer A, Fourquet A, Laurent M, Trophilme D, Validire P, Sastre-Garau X (1994) Mammographicallydetected ductal in situ carcinoma of the breast analyzed with

a new classification. A study of 127 cases: correlation with estrogen and progesterone receptors, p53 and c-erbB-2 proteins, and proliferative activity. Semin Diagn Pathol 11, 208-214. Zografos GC, Panou M, Panou N (2004) Common risk factors of breast and ovarian cancer: recent view. Int J Gynecol Cancer 14, 721-740.

George C. Zografos

Cancer Therapy Vol 3, page 85 Cancer Therapy Vol 3, 85-94, 2005

Head and neck cancer in elderly patients Review Article

Daniele Bernardi1,2,*, Domenico Errante1, Luigi Barzan5, Giovanni Franchin3, Luigi Salvagno1, Antonio Bianco1, Luca Balestreri4, Umberto Tirelli2 and Emanuela Vaccher2 1

Division of Medical Oncology, Ospedale Civile, Vittorio Veneto (TV), Italy Division of Medical Oncology A, National Cancer Institute, Aviano (PN), Italy 3 Division of Radiotherapy, National Cancer Institute, Aviano (PN), Italy 4 Department of Radiology, National Cancer Institute, Aviano (PN), Italy 5 Division of Otolaryngology, Ospedale S. Maria degli Angeli, Pordenone, Italy 2

__________________________________________________________________________________ *Correspondence: Dr. Daniele Bernardi, U.O. Oncologia Medica, Ospedale Civile, Via Forlanini 71, 31021 Vittorio Veneto (TV), Italy; Tel. +39 0438 665371; Fax. +39 0438 665432; e-mail: daniele.bernardi@ulss7.it Key words: Head and neck, cancer, elderly, review Abbreviations: 5-fluorouracil, (5-FU); American Society of Anesthesiology, (ASA); complete remission, (CR); Comprehensive Geriatric Evaluation, (CGA); erythropoietin, (rhEpo); Geriatric Radiation Oncology Group, (GROG); Head and Neck, (H-N); local control, (LC); loco-regional control, (LRC); no evidence of disease, (NED); Performance status, (PS); quality of life, (QOL); Radiation Therapy and Oncology Group, (RTOG); Surveillance, Epidemiology and End Results data base, (SEER) Received: 21 February 2005; Accepted: 23 February 2005; electronically published: March 2005

Summary Head and Neck cancers occur mostly in the fifth and sixth decade; their onset in patients older than 60 years is not a rare event, though. In almost all case series from the literature, radical treatments have a lower prevalence among elderly as compared to younger patients, in particular surgery and combined treatment. The advances in anesthesiology techniques, in peri-operative monitoring and in post-operative support allow now to deal with lower risks surgical procedures also in older patients. Elderly patients with N0 disease but at high risk of relapse or distant metastases should be offered appropriate surgical treatment and chronological age should not be considered a limit for neck dissection. Radiotherapy is a feasible treatment in elderly patients, and, in the era of organ preservation, the combination of chemotherapy and radiotherapy has a paramount importance, even if very few data exist on combined treatment in the elderly patients. Elderly patients who are functionally independent and do not show severe comorbidities must be treated in the same manner as younger patients, but during anti-cancer treatment, special attention should be paid to supportive treatment as well. Therapeutical planning must be based not only on tumor characteristics, but also on the physiological, rather than the chronological age of the patient. Therefore, in patients aged 70 or older, a selection of patients to be administered anticancer treatment has to be performed. A Complete Geriatric Assessment and a multidisciplinary approach are the crucial points. Cefaro 1997). Elderly patients aged 70 to 75 years represent 6 to 32% of all patients with H-N cancers in mono-institutional case series. The most frequent histologic type is squamous cell carcinoma and the most common sites of disease are larynx and oral cavity and, less frequently, oropharynx and hypopharynx. The distribution of stages does not differ from that of the younger patients, with the exception of some case series where a prevalence of stage N0 is present in elderly patients (Table 1). A peculiar characteristic of almost all case series from the literature is the lower prevalence of radical treatments among elderly patients as compared to younger patients (30-74% vs 67-91%, p<0.001), in

I. Introduction Approximately 60% of all tumors arise in patients older than 65 years and 70% of all deaths due to cancer occur in this age (Fentiman et al, 1990; Kennedy, 2000; Balducci and Beghe, 2001; Repetto et al, 2001). Although the majority of Head and Neck (H-N) cancers are seen between the fifth and sixth decade, their occurrence in elderly patients is not rare. In a retrospective survey conducted by the Italian Geriatric Radiation Oncology Group (GROG), H-N cancers were present in 12% of patients older than 70 years with different tumors, referred to 37 radiation therapy centers in Italy (Olmi and Ausili-

Bernardi et al: Head and neck cancer in elderly patients

Table 1. Clinical characteristics of H-N cancers in elderly patients in the main case series from literature

Tot Age, years Year of diagnosis Site of disease: Oral cavity Oropharynx Larynx Hypopharynx TNM Stage - T1-T2 T3-T4 - N0 N1 N2-N3 - M1 UICCb Stage I-II III-IV a

Olmi (1997) % 365/1114 (32%) >70 1960-92

Hirano (1998) % 751/2508 (30%) >70 1971-95

Sarini (2001) % 273/4610 (6%) >75 1974-83

SEER (2001) % 9386 >65 1985-93

Vaccher (2002) % 181/2143 (8%) >75 1975-98

32 28 40 --

12 17 22 25

40 29 25 9

39 20 42 --

23 17 49 10

61 39 72 13 14 2

62 38 81a

40 60 60 --1

19 --

31 69

52 48

N0+N1; UICC = Union Internationale Contre le Cancer.

particular surgery and combined treatment of surgery plus radiation therapy or chemotherapy and radiation therapy. Overall, survival is significantly lower in elderly patients, with an actuarial rate at 5 years of 17-31% vs 30-44% (p<0.001) in younger patients in the same case series (Olmi et al, 1997; Hirano and Mori 1998; Barzan et al, 1999; Sarini et al, 2001; Reid et al, 2001; Vaccher et al 2002). In the analysis of the case-control study from the Surveillance, Epidemiology and End Results data base (SEER), on 2508 case of carcinoma of the larynx, tongue and tonsil in patients older than 50 years, cancer specific survival of patients older than 70 years has been shown to be similar to that of patients of 50-69 years, with the exception of stage I and IV glottic carcinoma and stage III tonsil carcinoma, whose cancer-specific prognosis has been demonstrated to be worse and better in elderly patients, respectively (Bhattacharyya et al, 2003). Both groups were homogeneous according to sex, year of diagnosis, tumor characteristics and type of treatment. According to the same study, the overall medical morbidity and mortality rates were 5.65% and 2.98%, respectively. Postoperative pneumonia was the most common medical complication (3.26%) and was associated with a mortality rate of 10.94% (odd ratio for mortality, 4.4). Acute myocardial infarction and stroke were rare and were not statistically associated with increased mortality. Procedures that involved the esophagus carried the highest mortality rate (8.38%). Nevertheless, in the analysis of the prognostic factors for overall survival performed on the whole case-series in the SEER elderly patients, constituted by 9386 patients older than 65 years with the same type of H-N tumor but not

selected by stage and/or therapy, the main prognostic factor has been shown to be comorbidity according to the Charlson score. The presence of one comorbidity whatsoever is prognostically more important in patients with an age between 65 and 74 years as compared to those older than 85 years, probably due to the lower life expectancy of the latter group (HR 1.53, 95% CI 1.38-1.69 vs 1.32, 95% CI 1.09-1.84) (Reid et al, 2001). Ageing is always associated with a multiorgan functional decline, an increase in comorbidity and a decline of cognitive functions (Kennedy 2000; Balducci and Beghe 2001; Repetto et al, 2001). The presence of these failures is very heterogeneous in the population of elderly patients and anagraphic age by itself cannot be the only criterion for the therapeutic planning. In a quality of life (QOL) analysis carried out by a Dutch group, treatment does not affect QOL differently in older (!70 years) and younger (45-60 years) patients affected by H-N cancer (Derks et al 2004).

II. Surgery In general, solid tumors, including H-N cancer, are still most frequently treated with surgery. Elderly patients, though, have a higher potential operative risk of morbidity and mortality due to the presence of comorbidity and physiologic reduction of functional reserve connected to ageing. Elderly patients are more sensitive than younger patients to the volume depletions that are often associated to wide resections and/or longer surgical procedures typical of surgical oncology, and less resistant to postoperative infections due to the progressive impairment of the immune system (Kemeny et al 2000; Kennedy 2000; Balducci and Beghe 2001; Repetto et al, 2001). The first 86

Cancer Therapy Vol 3, page 87 studies on demolitive surgery in H-N cancers in elderly patients date back to the 1970s and 1980s and show a significant increase in mortality in patients older than 6570 years with a rate ranging from 3.5-7.4% vs 0.8-1.4% in younger patients (Morgan et al, 1982; McGuirt et al, 1997). The first study of the 1990s was published by Barzan and co-workers and focused on the impact of demolitive surgery on a group of 107 patients older than 70 years, compared with 135 patients aged 60-69 years and 196 patients younger than 59 years. As predictable, systemic contraindications to surgery and/or refusal of surgery were more frequent in elderly patients as compared to other patients. The number of patients undergoing “en-bloc” surgery was higher in the group of younger patients, but post-operative local or systemic complications were similar in all age groups (Table 2). Moreover, no difference was shown in loco-regional control (LRC) and in cancer specific survival among the age groups. Performance status (PS) and stage of disease, but not age, were the main prognostic factors for survival (Barzan et al, 1990). In a group of 43 patients older than 80 years, compared with 79 patients younger than 65 years, Clayman and co-workers demonstrated the feasibility of demolitive surgery even in very old patients. Although 93% of elderly patients fit in the high anesthesiologic risk category (Group 3-4 according the American Society of Anesthesiology [ASA]) classification) vs 63% of other patients (p<0.001), the complications were similar in the two groups, with a rate of major complication of 23% in elderly patients vs 20% in younger patients and of minor complications respectively in 28% and 23% of cases. The type of complications was different among the groups, with a higher prevalence of systemic complications, in particular cardiovascular and pulmonary, in the older patients and a higher prevalence of local complications in the younger patients. Post-operative mortality was 2% in the elderly and absent in the younger patients. LRC at 2 and 5 years in patients stratified by stage of disease was similar in the two groups, whereas overall survival was lower in elderly patients as compared to the control group (at 5-years 33% vs 63%, p<0.001), but similar to that of the population of the same age group (Clayman et al, 1998). Patients older than 75 years with locally advanced stage of disease have a higher operative morbidity and

mortality risk as compared to the other age groups (McGuirt and Davis 1995). Conservation surgery, such as supraglottic laryngectomy, reconstructive subtotal laryngectomy, conservation surgery of base of tongue and of hypopharynx, showed a moderate mortality rate in elderly patients (0-7%). The low compliance to rehabilitation in elderly patient, due to refusal and/or the lack of an adequate familial and social support, seriously affects the functional outcome of surgery and is frequently associated with an increased risk of aspiration pneumonia (Barzan et al 1999). Supracricoid partial laryngectomy, one of the surgical treatments with a higher risk of inhalation of food in the airways, is feasible in cooperative elderly patients. In fact, in a series of 69 patients older than 65 years (median age 71 years), with a carcinoma of the glottic and supraglottic larynx (stage I-II 61%), mortality was shown to be absent and the rates of surgical complications (13%) and medical complications (10%) during the operative procedure and in the immediate post-operative period were similar to that reported in younger patients. Twenty-two percent of patients showed an inhalation pneumonia in the first 6 months of follow-up and 1% died after 3 years, due to pulmonary complications. Therefore, nutritional rehabilitation after this surgical procedure must be continued for a long period of time (Lacourreye et al, 1998). Age does not affect the outcome of reconstructive surgery with free flaps, where engraftment occurs overall in 95-100% of elderly patients (Shestak et al, 1992, Bridger et al, 1994, Malata et al 1996, Shaari et al, 1998, Pompei et al, 1999, Blackwell et al, 2002). Nevertheless, patients older than 70 years, with important comorbidities, show a rate of local complications, such as ischemic necrosis, significantly higher as compared to younger patients without comorbidities (12% vs 8% in the case series of Pompei). Patients older than 80 years, 92 % with high ASA anesthesiologic risk, have a rate of medical intra- and post-surgical complications higher than that of younger patients (62% vs 15%, p=0.02), after reconstructive surgery with free flaps. Considering the same ASA class, the incidence of complications is still higher in patients older than 80 years and correlates with the duration of the surgical procedure (Blackwell et al, 2002).

Table 2. Surgical treatment and post-operative complications in a case series of 438 patients with H-N cancers, stratified by age.

Surgery Resection “En bloc” Complications Local Systemic

AGE (years) <59 % 48 a 47 a

60-69 % 33a 35a

>70 % 19 a 20 a

25 25

40 27

p<0.001 From Barzan et al, 1990, modified.

Bernardi et al: Head and neck cancer in elderly patients The advances in anesthesiology techniques, in perioperative monitoring and in post-operative support allow now to face with lower risks surgical procedures in older patients as well. In general, in tumors of the oral cavity, surgical procedures including wide reconstructions (skinbone-mucosa) and revascularized flaps are more difficult to perform. In the carcinoma of the oropharynx, wide resections of base of tongue or of the lateral wall more easily can lead to chronic inhalation and therefore should not be performed. In the carcinoma of the larynx and hypopharynx, conservation surgical procedures must be weighted in relation to the entity of the predictable resection, the patientâ&#x20AC;&#x2122;s respiratory function and his/her possibility to cooperate in a post-operative rehabilitation program. Chronological age should not be considered a limit for neck dissection. Appropriate surgery treatment should be offered to elderly patients with N0 disease but at high risk of relapse or distant metastases. The deterioration of the general conditions and the diagnostic delay following the impossibility of an adequate follow-up, can often render non-feasible the salvage surgery in elderly patients (Barzan et al, 1999) In this setting, despite advances in conservative laryngeal surgery and radiotherapy, total laryngectomy remains a valuable and reliable treatment for advanced pharyngo-laryngeal cancers in elderly patients The classification of the operative risk according to the ASA score does not seem to have a predictive value in elderly patients. Transoral laser surgery, most commonly with CO2 laser, has achieved a key position in minimally invasive treatment concepts in the ears, nose and throat area, especially for the treatment of malignancies of the upper aerodigestive tract. In the hands of experienced surgeons it remains a valuable option for elderly patients since it is a minimally invasive, functional and rapidly performed treatment (Werner et al, 2002).

of Florence, Italy, published the biggest case series on 446 cases of carcinoma of the larynx, oropharynx and oral cavity in patients older than 70 years, treated exclusively with RT with curative intent, whose outcome was compared to that of patients <70 years with the same type and stage of tumor. In this case series, laryngeal cancers were mostly at early stage (T1-T2), while in both groups the other neoplasias were mostly in advanced locoregional stage. No differences in 5-year actuarial local control (LC) or survival with no evidence of disease (NED) were seen between the two age groups for laryngeal and oropharyngeal cancer. For patients with cancer of the oral cavity, LC was better in the younger patients than in those aged 70 years and older (50% vs 28%, p=0.04). There was no statistically significant difference in the NED survival between the two groups. Acute or late reactions from RT in older patients were not different from those observed in younger patients (Olmi et al, 1997). The Gustave Roussy Institute reported the experience on 331 elderly patients with an age >70 years affected by carcinoma of the larynx (28%), oropharynx (27%) and oral cavity (16%) treated with radical RT (65-70 Gy) in 84% of cases and with palliative RT (30 Gy) in the remaining 16% in poor general conditions. Overall, the treatment was well tolerated with a grade 3-4 toxicity according to the Radiation Therapy and Oncology Group (RTOG) score as follows: cutaneous 1%, mucositis only in 17%, but nasoenteral feeding was required in 54% of cases. A reduced psychological tolerance due to depression, confusion or inability to cooperate, affected the feasibility of RT in 6% of patients, with a heterogeneous distribution in the age groups (5% in patients 70-75 years old, 9% and 21%, respectively, in patients 75-80 years and 80-85 years). Overall, the LC at 3-years was 71% for patients treated with radical dose and 19% for those treated with a palliative dose. The analysis of the LC by stage of disease showed similar data to those of historical control groups with an age lower than 70 years (Table 3). Five-year survival rates of 30%, 27%, 21% and 0% were observed for the 70-75, 75-79, 80-85 and over 84 age groups, respectively. In patients treated with palliative dose, the survival rate at 5-years was only 5% (Lusinchi et al, 1990).

III. Radiotherapy A. Conventional fractionation The most widely used treatment in H-N tumors in elderly patients is represented by external beam radiotherapy with conventional fractionation (180-200 cGy/day for 5 days/week) (standard-RT). The University

Table 3. Loco-regional control (LRC) in 331 patients >70 years with H-N tumorsa treated with radiotherapy and stratified by stage (TNM) STAGE

LRC at 3 years %

Primary tumor T1-T2 T3-T4 Nodal disease N0 N1-N2 N3

89-66 47-41 88 71 46

oropharynx 30%, larynx 28% From Lusinchi et al, 1990, modified.

Cancer Therapy Vol 3, page 89 Thompson and co-workers reported 2 case series in patients older than 75 years, 68 of whom had laryngeal carcinoma, treated with radical RT in 59% of cases and 33 patients with carcinoma of the hypopharynx, treated with curative intent in 52% of cases. The 3-year actuarial survival was 57% in the group of patients with laryngeal carcinoma and 22% in the group of patients with carcinoma of the hypopharynx (Thompson et al, 1996). The GROG evaluated prospectively the feasibility of radical radiotherapy in 91 elderly patients (age 70-88 years) with laryngeal carcinoma, mainly (56%) in stage III. Overall, the treatment was well tolerated, with a mild cutaneous and mucosal toxicity, respectively in 11% and 38%, and severe (G3-G4) in 1% and 5% (Olmi et al, 1997). The impact of age on the development of an acute or chronic toxicity was evaluated by Pignon and coworkers on 589 patient with H-N carcinoma treated with radical RT in 5 protocols of the EORTC, activated between 1980 and 1995. The acute normal tissue reactions (mucositis and weight loss) in elderly patients (>70 years) was not different from that of younger patients, but, considering the same objective damage, the severe subjective intolerance, defined as G3-4 functional acute toxicity, was significantly more frequent in elderly patients (Table 4). No difference was shown in the analysis of the late toxicity. In these studies, where usually patients in very good general conditions and without important comorbidities were enrolled, LRC and cancerspecific survival were similar in all age groups (Pignon et al, 1996). Data on the use of RT in very old patients (>80-90 years) are limited to few case series and have mostly been reported together with other tumors. In the case-series of Zachariah, on 203 patients older than 80 years, 50 patients (25%) had H-N cancer in different sites and stage of disease. Thirty-five of them (70%) were treated with radical RT and 15 (30%) with palliative RT. In the group treated with higher dose, 51% of patients developed a mild mucositis (G1-G2 according to RTOG), 29% a moderatesevere mucositis (G3) and only 3% a severe hemorrhagic mucositis (G4). With supportive therapy, mucositis disappeared in 4-6 weeks. In the group treated with palliative RT, G1-G2 mucositis was demonstrated in only 13% of patients. The objective response rate was 86%,

with 66% complete remission (CR) in the radically treated group, while a palliation of the symptoms of the disease was obtained in 67% of patients treated with low dose RT. Overall, patients achieving a CR presented a longer median survival of 25 months (Zachariah et al, 1997). Mitsuhashi reported on 32 patients older than 90 years, 14 of whom (44%) affected by H-N tumors, 11 (79%) treated with radical RT (median dose 61.2 Gy) and 3 (21%) with palliative RT (40 Gy). The treatment had to be discontinued for 2-3 weeks in 4 (36%) patients of the first group due to G2-G3 mucositis. The median survival in the radically treated patients was 8 months (range 3-55) while that of patients treated with palliative intent was 6 months (Mitsuhashi et al, 1999).

B. Unconventional fractionation A promising method to improve the treatment outcome in patients with H-N carcinoma is constituted by accelerated RT (fraction size of daily dose >200 cGy) and hyperfractionated RT (more than one fraction per day), often used in combination. Nonetheless, in general, elderly patients are excluded from protocols with unconventional fractionated RT, due to the fear of an increased toxicity, sometimes relevant also in younger patients. A Swiss group recently published the first study with an unconventional RT regimen (accelerated concomitant boost RT schedule), in a group of 39 patients older than 70 years with carcinoma of the hypopharynx-larynx (49%) and of the oral cavity-oropharynx (46%), compared with 81 patients < 70 years. Elderly patients were in 79% of cases in good general conditions (PS 0-1) and, in comparison with younger patients, had a more advanced T stage (T3-T4 54% vs 30%, p=0.01) but a less advanced N stage (N0 46% vs 72%, p=0.01). The primary tumor area and both sides of the neck down to the clavicles received a dose of 50.4 Gy over 5.5 weeks given daily fractions of 1.8 Gy, 5 times a week. The boost to the initial involved sites comprised 13 fractions of 1.5 Gy (total 19.5 Gy) given as a second daily fraction beginning the last day of the second week. Withdrawal of treatment due to toxicity occurred in only 8% of elderly patients and in none of the younger patients. The median dose administered and the

Table 4. EORTC Radiation Trials in H-N cancers (1589 patients): evaluation ad the impact of age on acute toxicity AGE ACUTE TOXICITY Objectivec G0 G1-G2 G3 Functionald G0 G1-G2 G3-G4

<70 years %

>70 years %

1 48 51

2 41 58

2 49 49

0 34 67

<0.001

X2 test; c1307 evaluable patients; d868 evaluable patients. From Pignon et al, 1996, modified.

Bernardi et al: Head and neck cancer in elderly patients median treatment time were similar in the two groups. Acute and late toxicities were similar in the two age groups, as well as LRC and overall survival (Allal et al, 2000).

drugs and reduce the capacity of healthy tissues to recuperate. Moreover, polypharmacy, typical of the older age, can be responsible for pharmacokinetic and pharmacodynamic interactions between the different types of drugs. Table 5 shows data on potential toxicity of cisplatin and 5-FU in elderly patients in solid tumors (Kennedy 2000, Balducci and Beghe 2001, Repetto et al, 2001, Balducci and Corcoran 2000, Zagonel et al, 1998). Cisplatin is associated with an increase in peripheral neuropathy, anemia, and nephropathy. Generally, sensorymotor peripheral neuropathy initially arises with paresthesia, loss of deep tendinous reflex and tactile sensitivity and then with muscular weakness that sometimes severely affects patient’s autonomy (Rudd et al, 1995; Zagonel et al, 1998; Balducci and Corcoran, 2000). In vitro studies have clearly demonstrated that elderly patients have a reduced capacity to repair cisplatininduced DNA damages. Treatment with 5-FU, mostly administered in continuous infusion at high dose, determines in elderly patients a potential increase in cardiotoxicity, mucositis and leukopenia. Cardiotoxicity has its main cause in the frequent co-existence of a cardiomyopathy and/or alterations in electrolytes that occur during treatment. Mucositis is in general more severe than in younger patients and requires significantly longer time to recuperate. Leukopenia is mostly determined by a reduction in the bone marrow functional reserve and its severity is strictly related to the age of the patient (Stein et al, 1995; Zagonel et al, 1998; Balducci and Corcoran, 2000). An interesting study was performed on 71 patients aged 70 or older treated with cisplatin and 5-FU, with an age-adjusted dose regimen. Patients aged 70-79 years were treated with standard-dosage of cisplatin 100 mg/m2 day 1 and 5-FU 1000 mg/ m 2/day continuous infusion for 5 days, while those aged 80-84 years with a reduction of the dosage by 20% and those older than 85 years with a reduction of the dosage by 30%. The objective response rate was 79% (CR 52%) among the 54 patients aged 70-79 years and only 31% (CR 6%) among the 17 patients aged 80 or older. In the group of patient older than 80 years, patients responsive to chemotherapy were in better general conditions as compared to the non-responsive patients.

C. Conclusions In conclusion, RT is a feasible treatment in elderly patients, also in very advanced age groups and even with innovative schedules with unconventional fractionation. When radical doses are employed, the LRC is almost superimposable to that obtained in younger patients with the same type of neoplasia. Acute and chronic toxicities are similar to those showed in younger patients, but subjective tolerance and sometimes compliance are significantly lower as compared to the other age groups. Therefore, this data show the need to increase supportive medical and psychological therapy always during and after treatment. Frail patients seem to tolerate well palliative radiation treatment, but the data from the literature are at the moment too unclear to provide treatment guidelines in this subset of patients. Finally, the fact that in certain stages or sites of disease, in patients treated with radical therapy, the outcome in elderly patients is more unfavorable as compared to the younger ones prompts the activation of studies aimed at evaluating the impact of age on the tumor biology.

IV. Chemotherapy A background exists for an increased toxicity from chemotherapy in elderly patients, but clinical studies, aimed at evaluating the relationship between toxicity from chemotherapy and age, are very few (Balducci and Corcoran, 2000; Argiris et al, 2004). Nonetheless, elderly patients are often excluded from chemotherapy clinical trials (Fentiman et al, 1990). Standard chemotherapy for H-N carcinomas is the Al-Sarraf regimen, a sequential combination of cisplatin and infusional 5-fluorouracil (5FU) that, in the treatment of locoregional recurrences and/or distant metastases achieves a response rate of 4050% (CR 5-10%) and in neoadjuvant setting (CT-RT) for organ preservation of 70-88% (CR 40-60%) (Posner et al, 2000). The reduced functional reserve of elderly patients can potentially alter the pharmacokinetics of cytotoxic

Table 5. Possible causes of increased acute toxicity from Cisplatin and 5-Fluorouracil in elderly patients TOXICITY CISPLATIN Peripheral neuropathy Anemia Nefrotoxicity 5-FLUOROURACIL Cardiotoxicity Mucositis

CAUSE • • • •

Reduced capacity of DNA-damage reparation. Pharmacokinetic alterations. Multiorgan functional reduction. Reduced glomerular filtration rate.

• • • •

Cardiomiopathy. Pharmacokinetic alterations. Reduced intracellular concentration of dihydropirimidine carboxilase. Reduced bone marrow reserve.

Leukopenia

Cancer Therapy Vol 3, page 91 Myocardial ischemia, the only form of cardiotoxicity that was examined in this study, was very low and similar in the two age groups, with a rate of 2% in the first group and 3% in the second (Schneider et al, 1994). Chemotherapy seems to be feasible also in patients aged 80 years or older, but a reduction in the dosage dependent only on the chronological age can seriously affect the efficacy of the treatment. The Eastern Cooperative Oncology Group (ECOG) has recently analyzed data from two randomized studies employing intensive cisplatin-based regimen for the treatment of patients with recurrent/metastatic H-N carcinoma, to evaluate the outcome of elderly patients. Fifty-three patients aged 70-80 years had comparable response rates (28% vs 33%) and survival outcomes (1year survival 26% vs 33%) compared with 346 younger patients. However, severe nephrotoxicity, thrombocytopenia and diarrhea were more common in the elderly than in the younger patients, occurring in 8% vs 2% (p=0.04), 26% vs 12% (p=0.009) and 17% vs 3% (p=0.0002), respectively (Argiris et al, 2004). Strategies to ameliorate toxicity should be pursued in the elderly. In the era of organ preservation, chemotherapy combined with RT has a paramount importance in the treatment of H-N tumors (Posner et al, 2000). Elderly patients, an emerging problem for public health in the industrialized countries, cannot be excluded a priori from organ preservation programs. Older patients who are functionally independent and do not show severe comorbidities must be treated in the same exact manner as younger patients, but during the treatment, supportive treatment must be increased. In particular, the administration of bone marrow growth factors, such as GCSF and erythropoietin (rhEpo) must be always evaluated. Data concerning the use of rhEpo in the prevention of chemotherapy-related anemia in early or advanced H-N cancer are not extensive (Tsukuda et al, 1993; Dunphy et al, 1997; Oettle et al, 2001). The role of recombinant rhEpo in preventing or correcting chemotherapy-related anemia in elderly patients with H-N cancer has been recently described (Gebbia et al, 2003). Acoording to this study, recombinant rhEpo is able to prevent anemia, to reduce transfusion requirements and to improve quality of life parameters in patients treated with carboplatin and 5FU as compared to untreated controls. The use of amifostine in the prevention of mucositis from CT is still controversial and should be eventually considered only when RT is administered (Schuchter et al, 2002). On the other hand, topical use of GM-CSF, administered as oral gargles, might accelerate the resolution of mucositis, even if an improvement of the quality of life has never been clearly demonstrated. In all patients particular attention should be paid to maintaining an adequate nutritional status, since malnutrition can affect both efficacy of chemotherapy and patients survival (Zagonel et al, 1998; Balducci and Corcoran 2000; Kennedy 2000; Balducci and Beghe 2001; Repetto et al, 2001). In fact, nutrition is often deficient in elderly patients in general, due to several reasons, such as depression, poor dentition, functional impairment, cognitive impairment, lack of appetite due to chronic

comorbid disease, and lack of caregiver. Elderly patients with cancer may also face additional problems brought on by chemotherapy, such as nausea, vomiting, diarrhea, and painful oral ulcerations. Correcting malnutrition and establishing a suitable dietary plan are simple measures that can substantially improve the patient’s clinical outcome and quality of life. The main concern with respect to emotional conditions in these patients is depression, which is common in both geriatric and oncology populations, and is therefore especially common in elderly patients with cancer. Depression and cognitive disorders can be mistaken for each other and either type of condition could adversely affect the patient’s functional status and the outcome of cancer treatment. Patients older than 80 years, patients not functionally independent and/or with severe associated comorbidities, must be treated in the setting of new treatment protocols, in which the choice of the regimen employed and the dose of the drugs must be adjusted according to a Comprehensive Geriatric Evaluation (CGA). CGA is an instrument aimed at evaluating the overall status of the patient and its efficacy has been documented by several randomized studies (Monfardini et al, 1996; Zagonel et al, 1998; Balducci and Corcoran 2000; Kennedy 2000; Balducci and Beghe 2001; Repetto et al, 2001). The preliminary results have been published of an ongoing trial using CGA to tailor the treatment of patients affected by aggressive non-Hodgkin’s lymphoma; to date, 23 patients have been treated with reasonable efficacy and toxicity (Bernardi et al, 2003). Noteworthy is the fact that in none of the studies concerning treatment in H-N cancers that have been published so far in the literature, a CGA has been used in the evaluation of the clinical status of the elderly patient.

V. Combined treatment A number of important factors should be considered in deciding the best therapy for the patient when chemoradiotherapy is used in a combined modality plan for the curative treatment of locally advanced H-N cancer (Vokes et al, 2000). No data exists in the literature on combined chemo-radiotherapy in the elderly, and there are very few experiences on retrospective subgroup analysis. It is essential to identify appropriate patients for combination therapy. Patients with underlying severe comorbidities, age-related frailty, or underlying severe psychosocial problems are not good candidates for highly intensive treatment plans. These patients may benefit less complicated or less potentially toxic treatment plans. The biology of the patient’s disease also must be considered in selecting or planning a combined modality approach. Patients with rapidly growing tumors or with advanced nodal presentation are less likely to be cured with surgery or radiation therapy alone and are most likely to benefit from the addition of chemotherapy. The location of the primary tumor is also an important factor in selecting therapy. Small lesions in the larynx, base of tongue and hypopharynx may benefit from an organ preservation approach, while similarly sized lesions in the anterior oral cavity might be better treated with direct surgical and 91

Bernardi et al: Head and neck cancer in elderly patients and neck cancer treated with cisplatin-based chemotherapy. J Clin Oncol 22, 262-268. Balducci L, Beghe C (2001) Cancer and age in the USA. Crit Rev Oncol Hematol 37, 137-45. Balducci L, Corcoran MB (2000) Antineoplstic chemotherapy of the older cancer patient. Hematol Oncol Clin North Am 14, 193-12. Barzan L, Olmi P, Franchin G, Vaccher E, Politi D, Loreggian L, Grando G, Tirelli U (1999) Carcinomi del distretto ORL. Argomenti di Oncologia 20,149-54. Barzan L, Veronesi A, Caruso G, Serraino D, Magri D, Zagonel V, Tirelli U, Comoretto R, Monfardini S (1990) Head and neck cancer and ageing: a retrospective study in 438 patients. J Laryngol Otol 104, 634-40. Bernardi D, Milan I, Balzarotti M, Spina M, Santoro A, Tirelli U (2003) Comprehensive Geriatic Evaluation in elderly patients with lymphoma: feasibility of a patient-tailored treatment plan. J Clin Oncol 21,754. Bhattacharyya N (2003) A matched survival analysis for squamous cell carcinoma of the head and neck in the elderly. Laryngoscope 113, 368-72. Blackwell KE, Azizzadeh B, Ayala C, Rawnsley JD (2002) Octogenarian free flap reconstruction: complications and cost of therapy. Otolaryngol Head Neck Surg 126, 301-06. Bridger AG, O’Brien CJ, Lee KK (1994) Advanced patient age should not preclude the use of free-flap reconstruction for head and neck cancer. Am J Surg 168, 425-28. Clayman G, Eicher SA, Sicard MW, Razmpa E, Goepfert H (1998) Surgical outcomes in head and neck cancer patients 80 years of age and older. Head Neck 20, 216-23. Derks W, de Leeuw RJ, Hordijk GJ, Winnubst JA (2004) Quality of life in elderly patients with head and neck cancer one year after diagnosis. Head Neck 26, 1045-1052. Dunphy FR, Dunleavy TL, Harrison BR, Boyd JH, Varvares MA, Dunphy CH, Rodriguez JJ, McDonough EM, Minster JR, McGrady MD (1997) Erythropoietin reduces anemia and transfusions after chemotherapy with paclitaxel and carboplatin. Cancer 79, 1623-1628. Fentiman IS, Tirelli U, Monfardini S, Schneider M, Festen J, Cognetti F, Aapro MS (1990) Cancer in the elderly: why so badly treated? Lancet 335, 1020-1022. Gebbia V, Di Marco P, Citarella P (2003) Systemic chemotherapy in elderly patients with locally advanced and/or inoperable squamous cell carcinoma of the head and neck: impact of anemia and role of recombinant human erythropoietin. Crit Rev Oncol Hematol 48 (suppl.), S4955. Hirano M, Mori K (1998) Management of cancer in the elderly: therapeutic dilemmas. Otolaryngol Head Neck Surg 118, 110-14. Kemeny MM, Busch-Deverauz E, Merriam LT, O’Hea BJ (2000) Cancer surgery in the elderly. Hematol Oncol Clin North Am 14, 169-92. Kennedy BJ. Aging and cancer. Oncology (Huntingt) 2000, 14, 1731-33. Laccourreye O, Brasnu D, Périé S, Muscatello L, Ménard M, Weinstein G (1998) Supracricoid partial laryngectomies in the elderly: mortality, complications, and functional outcome. Laryngoscope 108, 237-42. Lusinchi A, Bourhis J, Wibault P, Le Ridant AM, Eschwege F (1990) Radiation therapy for head and neck cancers in the elderly. Int J Radiation Oncology Biol Phys 18, 819-23. Malata CM, Cooter RD, Batchelor AG, Simpson KH, Browning FS, Kay SP (1996) Microvascular free-tissue transfers in elderly patients: the Leeds experience. Plast Reconstr Surg 98, 1234-41.

radiotherapy approaches. The goals of the addition of chemotherapy in a treatment plan must be considered in determining the best therapy: appropriate goals in the curative treatment of locally advanced H-N cancer include organ preservation, improved survival, optimization of quality of life and reduction in metastases (Posner et al, 2000). A recent study (Airoldi et al, 2004) assessed treatment toxicity, patient compliance, and clinical results in 40 patients >70 years who were treated with concomitant adjuvant chemoradiotherapy. The results of this study confirm previously established beliefs that adjuvant chemioradiotherapy can be successfully applied in older patients who are fit to receive such treatment. The role of the combination therapy in the postoperative setting can only be validated by phase III trials. A comparison of the results of the study by Airoldi with those of the group 70 years or older treated with radiotherapy alone suggests that superior results can be obtained with chemoradiotherapy compared with radiotherapy alone in this age group.

VI. Closing remarks The physiological, rather than the chronological age of the patient, together with tumor characteristics, should be considered when planning the treatment of H-N cancers in older patients. Elderly patients who are functionally independent and do not show severe comorbidities must be treated in the same manner as younger patients, but during anti-cancer treatment, special attention should also be paid to supportive treatment. Patients with underlying severe comorbidities, age-related frailty, or severe psychosocial problems are not good candidates for highly intensive treatment plans. The key issue is, therefore, the selection of patients to be administered anticancer treatment. In patients aged 70 or older, CGA and a multidisciplinary approach are the crucial points for an adequate therapeutical planning. A determinant factor in the prognosis of the patient with H-N tumors of any age is the multidisciplinary management of the disease. Surgeons, radiation-therapy specialists, medical oncologists and geriatricians must actively cooperate in a multidisciplinary setting.

Acknowledgements The skillful and patient assistance of Mrs. Paola Favetta in the preparation of the manuscript is gratefully acknowledged.

References Airoldi M, Cortesina G, Giordano C, Pedani F, Gabriele AM, Marchionatti S, Bumma C (2004) Postoperative adjuvant chemoradiotherapy in older patients with head and neck cancer. Arch Otolaryngol Head Neck Surg 130, 161-166. Allal AS, Maire D, Becker M, Dulguerov P (2000) Feasibility and early results of accelerated radiotherapy for head and neck carcinoma in the elderly. Cancer 88, 648-52. Argiris A, Ly Y, Murphy B, Longer CJ, Forastiere AA (2004) Outcome of elderly patients with recurrent or metastatic head

Cancer Therapy Vol 3, page 93 McGuirt WF, Davis SP III. (1995) Demographic portrayal and outcome analysis of head and neck cancer surgery in the elderly. Arch Otolaryngol. Head Neck Surg 121, 150. McGuirt WF, Loevy S, Krause CJ (1977) The risks of major head and neck surgery in the aged population. Laryngoscope 87, 1378-82. Mitsuhashi N, Hayakawa K, Yamakawa M, Sakurai H, Saito Y, Hasegawa M, Akimoto T, Hayakawa K, Niibe H (1999) Cancer in patients aged 90 years or older: radiation therapy. Radiology 211, 829-33. Monfardini S, Ferrucci L, Fratino L, del Lungo I, Serraino D, Zagonel V (1996) Validation of a multidimensional evaluation scale for use in elderly cancer patients. Cancer 77, 395-401. Morgan RF, Hirata RM, Jaques DA, Hoopes JE (1982) Head and neck surgery in the aged. Am J Surg 144, 449-51. Oettle H, Riess H, Raguse JD, Bier J, Gath HJ (2001) Recombinant human erythropoietin in the treatment of head and neck tumour anemia. Int J Maxillofac Surg 30, 148155. Olmi P, Ausili-Cefaro G (1997) Radiotherapy in the elderly: a multicentric prospective study on 2060 patients referred to 37 Italian radiation therapy centers. Rays 22, 53-56. Olmi P, Ausili-Cefaro G, Loreggian L (1997) Radiotherapy in the elderly with head and neck cancer. Rays 22, 77-81. Pignon T, Horiot JC, Van den Bogaert, Van Glabekke M, Scalliet P (1996) No age limit for radical radiotherapy in head and neck tumours. Eur J Cancer 32A, 2075-81. Pompei S, Tedesco M, Pozzi M, Varanese A, Basile A, Marzetti F (1999) Age as a risk factor in cervicofacial reconstruction. J Exp Clin Cancer Res 18, 209-12. Posner MR, Colevas D, Tishler RB (2000) The role of induction chemotherapy in the curative treatment of squamous cell cancer of the head and neck. Semin Oncol 27 (suppl 8), 1324. Reid BC, Alberg AJ, Klassen AC, Samet JM, Rozier RG, Garcia I, Winn DM (2001) Comorbidity and survival of elderly head and neck carcinoma patients. Cancer 92, 2109-16. Repetto L, Comandini D, Mammoliti S (2001) Life expectancy, comorbidity and quality of life: the treatment equation in the older cancer patients. Crit Rev Oncol Hematol 37, 147-52. Rudd GN, Hartley JA, Souhami RL (1995) Persistence of cisplatin-induced DNA interstrand crosslinking in peripheral blood mononuclear cells from elderly and young individuals. Cancer Chemother Pharmacol 35, 323-26. Sarini J, Fournier C, Lefebvre JL, Bonafos G, Ton Van J, CocheDequĂŠant B ( 2001) Head and neck squamous cell carcinoma in elderly patients. Arch Otolaryngol Head Neck Surg 127, 1089-92. Schneider M, Thyss A, Ayela P, Gaspard MH, Otto J, Creisson A (1994) Chemotherapy for patients aged over 80. In Fentiman IS, Monfardini S, editors. Cancer in the elderly. Oxford University Press 53-60. Schuchter LM, Hensley ML, Meropol NJ, Winer EP; American Society of Clinical Oncology Chemotherapy and Radiotherapy Expert Panel (2002) 2002 update of recommendations for the use of chemotherapy and radiotherapy protectants: clinical practice guidelines of the American Society of Clinical Oncology. J Clin Oncol 20, 2895-2903

Shaari CM, Buchbinder D, Costantino PD, Lawson W, Biller HF, Urken ML (1998) Complications of microvascular head and neck surgery in the elderly. Arch Otolaryngol Head Neck Surg 124, 407-11. Shestak KC, Jones NF, Wu W, Johnson JT, Myers EN (1992) Effect of advanced age and medical disease on the outcome of microvascular reconstruction for head and neck defects. Head Neck 14, 14-18. Stein BN, Petrelli NJ, Douglass HO, Driscoll DL, Arcangeli G, Meropol NL (1995) Age and sex are independent predictors of 5-fluorouracil toxicity. Cancer 75, 11-17. Thompson AC, Quraishi SM, Morgan DL, Bradley PJ (1996) Carcinoma of the larynx and hypopharynx in the elderly. Eur J Surg Oncol 22, 65-68. Tsukuda M, Mochimatsu I, Nagahara T, Kokatsu T, Sawaki S, Kubota A, Furkawa M, Arai Y (1993) Clinical application of recombinant human erythropoietin for treatments in patients with head and neck cancer. Cancer Immunol Immunother 36, 52-56. Vaccher E, Talamini R, Franchin G, Tirelli U, Barzan L for the Head and Neck Cancer Group (2002) Elderly head and neck (H-N) cancer patients: a monoinstitutional series. Tumori 88 (Suppl 1), S63-66. Vokes EE, Haraf DJ, Kies MS (2000) The use of concurrent chemotherapy and radiotherapy for locoreginally advanced head and neck cancer. Semin Oncol 27 (Suppl 8), 34-38. Werner JA, DĂźnne AA, Folz BJ, Lippert BM (2002) Transoral laser microsurgery in carcinomas of the oral cavity, pharynx and larynx.. Cancer Control 9, 379-386. Zachariah B, Balducci L, Venkattaramanabalaji GV, Casey L, Greenberg HM, DelRegato JA (1997) Radiotherapy for cancer patients aged 80 and older: a study of effectiveness and side effects. Int J Radiation Oncology Biol Phys 39, 1125-29. Zagonel V, Pinto A, Monfardini S (1998) Strategies to prevent chemotherapy-related toxicity in the older person. In Balducci L, Lyman GH, Ershler WB (eds): Comprehensive Geriatric Oncology. Amsterdam, Harwood Academic Publishers, 481-500.

Daniele Bernardi

Bernardi et al: Head and neck cancer in elderly patients

Cancer Therapy Vol 3, page 95 Cancer Therapy Vol 3, 95-100, 2005

Radiotherapy and surgery in the management of non-small cell lung cancer in the elderly patients, a review of the recent literature Review Article

H. Cuneyt Ulutin* and Gorkem Aksu Gulhane Military Faculty of Medicine, Radiation Oncology Department

__________________________________________________________________________________ *Correspondence: Dr. Cuneyt Ulutin; Kizilcik sok. Kizilcikapt. 10/10 Anittepe Ankara Turkey; Telephone: 90-312-3044684; Fax: 90312-3044150; e-mail: culutin@yahoo.com Key words: Radiotherapy, surgery, non-small cell lung cancer, elderly patients Abbreviations: biologic effective dose, (BED); cancer-directed surgery, (CDS); continuous hyperfractionated accelerated radiotherapy, (CHART); gray, (Gy); gross tumor volumes, (GTV); Non-small-cell lung cancer, (NSCLC); three-dimensional conformal radiotherapy, (3D-CRT); wedge resection, (WR) Received: 27 December 2004; Accepted: 8 February 2005; electronically published: March 2005

Summary More than 50% of all patients with NSCLC are older than 65 years and about one-third of all patients are >70 years old at the time of diagnosis. However, there is no standard chronological age to consider a person as “ elderly”. In most of the historical series this was defined by the age of 65 or older, but it is not an exact definition since health status differs and there is a great heterogeneity of patients in this group according to functional organ capacity. Therefore, biological age should be defined individually and before making a treatment decision a careful evaluation of functional status, coexisting diseases, nutritional status, psychological functioning and social support should be performed. Surgery is the treatment of choice for patients in early stage (I/II) NSCLC. . Resection for stage IIIA NSCLC patients is acceptable if the affected N1 lymph nodes can be resected, or only micrometastatic disease is present in N2 lymph nodes, or restaging after neoadjuvant therapy shows no residual cancer in N2 lymph nodes. Radical radiation therapy is also used for curative intent in elderly patients who are not candidates to surgery because of poor performance status, old age or refusal of surgery in early stage NSCLC or who can not tolerate chemoradiotherapy in locally advanced disease, however, the survival rates are lower than those reported after surgery. In this review, we evaluated the role of surgery and radical radiotherapy in the management of NSCLC in the elderly patients. status, coexisting diseases, nutritional status, psychological functioning, and social support should be performed.

I. Introduction Non-small-cell lung cancer (NSCLC) accounts for approximately 80% of all lung cancers. The population of elderly people increases and lung cancer is also the most common cause of cancer deaths aong this population. More than 50% of all patients with NSCLC are older than 65 years and about one-third of all patients are >70 years old at the time of diagnosis (Mountain, 1997). However, there is no standard chronological age to consider a person as “ elderly”. In most of the historical series this was defined by the age of 65 or older, but it is not an exact definition since health status differs and there is a great heterogeneity of patients in this group according to functional organ capacity. Therefore, biological age should be defined individually and before making a treatment decision a careful evaluation of functional

II. Surgery in elderly patients with early stage NSCLC The five-year survival rate for patients with Stage I NSCLC is better than 60% and surgery is the treatment of choice for patients in early stage (I/II) NSCLC. Resection for Stage IIIA patients is acceptable if the affected N1 lymph nodes can be resected, or only micrometastatic disease is present in N2 lymph nodes, or restaging after neoadjuvant therapy shows no residual cancer in N2 lymph nodes. (Mountain, 1997). Although, lung cancer resection in elderly patients is justified and has decreasing morbidity and mortality rates, age is sometimes used as an 95

Ulutin and Aksu: Radiotherapy and surgery in the management of NSCLC in the elderly patients excuse not to resect lung cancer. In a recent analyze by Dexter et al. it was determined that of the 33% of elderly patients who had stage I or II disease, only 6% underwent surgical resection (Dexter et al, 2004). Oâ&#x20AC;&#x2122;Connell et al, (2004) recently reviewed elderly patients for cancer-directed surgery for localized adenocarcinoma of the breast, esophagus, stomach, pancreas, colon, rectum, non-small-cell lung carcinoma and sarcoma and found out that rates of cancer-directed surgery (CDS) declined steadily with increasing age for all these tumors beginning at 60 years (O'Connell et al, 2004). Despite the fact that curative resection should be performed in older patients, the type of the resection is discussed in many studies since the extent of surgery directly influences the overall morbidity and mortality. In most of the studies (Bates, 1970; Whittle et al, 1991; Damhuis and Schutte, 1996; Janssen-Heijnen et al, 2004), pneumonectomy is accompanied by an increase in the morbidity and mortality in elderly patients thus especially right pneumonectomy should be performed only in highly selected patients (Teeter et al, 1987; Au et al, 1994). Lobectomy or sub-lobar resection is preferred as a curative resection in many studies for older adults. The postoperative complications are lower than the patients who undergo pneumonectomy. Oliaro et al. analyzed patients who were 70 years and older undergoing curative resection. Postoperative complication rates were 78.5% for patients receiving pneumonectomy and 58% for patients undergoing lobectomy or wedge resection. All cases of postoperative death occurred in patients who were treated with pneumonectomy. Prognostic factors were poor performance status (WHO 2 or more), chronic obstructive pulmonary disease, and elevated levels of blood urea nitrogen (Oliaro et al, 1999). In a different study by Whittle et al. most of the patients were treated with standard lobectomy. The major complication rate was 11%, and per operative death was seen in 3.7% of patients. The survival rates for patients with Stage I disease were 86% at one year, 62% at three years, and 43% at five years. The authors concluded that postoperative mortality rises with increasing age (Whittle et al, 1991). Lobectomy is now the most frequently performed procedure in the elderly NSCLC patients, though pneumonectomy can be performed in selected cases. However lobectomy, and pneumonectomy can hardly be compared directly some recent studies report similar results for pneumonectomy and lobectomy (Au et al, 1994; Sioris et al, 1999) while most of the studies report higher operative mortalities (17%-30%) with pneumonectomy (Bates, 1970; Kirsh et al, 1976; Harviel et al, 1978; Yellin et al, 1985). Since almost all deaths are caused by cardiopulmonary adverse effects (Harviel et al, 1978; Sherman and Guidot, 1987; Mane et al, 1994), it is necessary to carefully evaluate patients preoperatively and select appropriate surgical procedures (Ishida et al, 1990; Roxburgh et al, 1991). Using modern surgical and imaging techniques and advances in anesthesiology and per operative care can also reduce postoperative mortality and morbidity (Tsuchiya et al, 1981; Ginsberg et al, 1983;

Ishida et al, 1990; Thomas et al, 1993; Morandi et al, 1997). The effect of increasing age on the incidence of major complications or postoperative death is controversial. While some studies (Ginsberg et al, 1983; Sherman and Guidot, 1987; Deneffe et al, 1988; Whittle et al, 1991; Romano and Mark, 1992; Thomas et al, 1993; Cangemi et al, 1996; Damhuis and Schutte, 1996) demonstrated older age as an adverse prognostic factor, there are also studies that found no significant relationship between age and postoperative complications (Ishida et al, 1990; Breyer et al, 1981; Nagasaki et al, 1982; Kadri and Dussek, 1991). Yamamoto, et al, 2003 analyzed the surgical results of 797 patients with Stage I NSCLC and found out that patients aged 70 and older had similar 5- and 10-year survival rates compared with younger patients (Yamamoto et al, 2003). In a different study, older age (defined as 65 years or more), anemia, and higher stage were found as prognostic factors for patients who underwent surgical resection for Stages I and II NSCLC. Patients older than 65 had a shorter event-free survival time (34 vs. 55 months, p= 0.002) and overall survival (39 versus 58 months, p= 0.002) compared with younger patients (Jazieh et al, 2000). Van Rens et al. analyzed 2,361 patients who were treated with curative resection for Stages I, II, and IIIA NSCLC. The overall five-year survival rate for patients younger than 65 was 44% compared with 38% for older patients (p= 0.001); however, the authors noted that survival rates were similar for as long as four years after surgery, and thus the five-year survival rate difference may be secondary to comorbid disease (Van Rens et al, 2000). Kamiyoshihara et al. analyzed 160 patients with nonsmall cell lung cancer underwent lobectomy or pneumonectomy with mediastinal lymph node dissection. Of these, 37 (23%) were 70 years of age or older. The outcome of this group was compared with 123 non-elderly patients. Five- and 10-year survivals in the elderly patients were 35.1%, and 24.3%, respectively. In outcome more than 5 years from operation, elderly patients had a significantly poorer prognosis than non-elderly patients by any causes of death, but a similar prognosis by primary death (p=0.04). Deaths from non-tumoral reasons were more in the elderly group than non-elderly patients with no significant difference (p=0.6) (Kamiyoshihara et al, 2000). Mane et al. reviewed 1433 patients with lung cancer concerning tobacco use, stage of disease, treatment and survival rate of patients treated surgically. A comparison was made between patients aged 65 or less with those over 65. The stage of disease at the time of diagnosis was similar in both groups but the distribution by histological type showed significant differences (p < 0.05) with a higher percentage of squamous carcinoma in the younger group (54% versus 44%). Surgery was performed in 30% of the patients aged 65 years or less but only in 19% of the older cases (p < 0.05). There was no difference in the survival of younger and older patients (Mane et al, 1994).

Cancer Therapy Vol 3, page 97 Froeschle et al. analyzed 70 patients with 70 years of age or older who underwent surgery for lung cancer. Standard lung resections were performed in 42 cases and 17 patients underwent enlarged resections. In the postoperative period, complications occurred in 32 cases (47%). The overall operative mortality rate of 13% was mainly due to concomitant cardiovascular diseases and enlarged lung resections (Froeschle et al, 1996). Pagni et al. analyzed 1506 patients with NSCLC treated by lung resection for perioperative morbidity and mortality. 385 (25.6%) patients aged 70 years and older were operated. Operations included 293 (77%) lobectomies, 24 pneumonectomies (6%), 16 bilobectomies (4%) and 52 wedge or segmental resections (13%). The pathology was bronchogenic carcinoma in 89% and metastasis or other tumours in 11% of patients. The mortality for all resections in elderly group was 4.2% (16/385) and was 1.6% for the control group. Mortality in the octogenarian group was 2.8%. Female gender correlated with a decreased risk of death, with only two of 16 deaths in females (P < 0.005). Overall morbidity was higher in the study than in control patients (34% vs. 25%), although major morbidity was similar in both groups (13.2% vs. 13%). Abnormal pulmonary-function testing and positive cardiac history did not correlate with increase overall or specific risk. Pneumonectomy carried a higher risk for death, with three of 24 deceased (12.5%; P < 0.05). The authors concluded that, age alone no longer appears to be a risk factor for mortality and pneumonectomy should undertaken cautiously in this age group. Based on this data, functional elderly patients should not be denied curative lung resection based on age alone (Pagni et al, 1998). Although Romano and Mark, (1992) identified advanced age (>79 years) as the strongest risk factor for death, Harvey et al, (1995) and Higgins and Beebe, (1967) reported that survival after surgery was negatively correlated with increasing age. In a recent study by Port et al, (2004) 61 elderly patients were evaluated. The surgical techniques were 46 lobectomies, 6 segmentectomies, 5 wedge resections, and 4 pneumonectomies. There was one perioperative death (1.6%) and the overall complication rate was 38% with a major complication rate of 13%. Overall 5-year survival was 82% for stage IA patients. Patients with more advanced disease had a significantly worse survival. The authors agree that appropriately selected elderly patients with early stage disease should be offered anatomic surgical resection for cure and should not be denied an operation on the basis of age alone (Port et al, 2004). Videothoracoscopic lobectomy can be used in the treatment of stage I and II lung cancer. Roviaro et al, (2004) analyzed 257 patients with stage I lung cancer, 193 patients underwent VATS lobectomy. There was no intraoperative mortality and no recurrence. The survival rates at 3 years and 5 years were 77.7% and 63.64%, respectively. T1N0 patients had a better survival curve at 3 years and 5 years (83.50% and 70.21%, respectively) compared to T2N0 patients (71.13% and 56.12%). Patients < 70 years of age had better 3-year and 5-year survival rates (82.37% and 73.32%, respectively) than those > 70

years of age (57.49% and 37.09%). The results showed that VATS approach match the "best" results reported in literature following conventional surgery and this minimally invasive surgery seems to imply reduced tissue damage and decreased impairment of immunologic function especially in elderly patients (Roviaro et al, 2004). The results of these studies show that surgery is the main treatment for early stage NSCLC in both young and elderly patients. The risk of postoperative complications can be minimized with the selection of the surgical procedure, careful preoperative evaluation and attentive postoperative care.

III. Radical radiotherapy in early stage NSCLC Radical radiation therapy is used for curative intent in elderly patients who are not candidates to surgery because of poor performance status, old age or refusal of surgery in early stage NSCLC or who can not tolerate chemoradiotherapy in locally advanced disease, however, the survival rates are lower than those reported after surgery. Gauden et al retrospectively analyzed 347 patients with T1 and T2N0M0 tumours who were treated with radical radiotherapy. The median age was 70 years and the minimum radiation dose was 50 Gray. 5-year survivals were 22% in the patients aged < 70 years and 34% in patients > or=70 years. Median survivals were 22 months and 26 months respectively. 5-year disease free survivals were 18% and 30% with no statistical significance. The 75-79-year group showed better survival than other age groups with the 5-year overall survival for this group being 53%, while the 5-year recurrence free survival was 45%. The toxicity in both groups was minimal. The authors concluded that radical radiation therapy with curative intent may be a viable alternative to surgery in those elderly patients who either refuse surgery or are judged to be unfit for operation (Gauden et al, 2001). Pignon et al, 1998 analyzed 1208 patients receiving chest irradiation in six EORTC randomized trials. Patients were split into six age ranges from 50 to 70 years and over. Data regarding age and acute toxicity were available for 1208 patients who experienced 640 grade > or =1 toxicities. The difference in distribution over age was not significant for acute nausea, dyspnea, oesophagitis, weakness and WHO performance status alteration. Weight loss was significantly different with regards to age with a trend toward increased weight loss in older age groups (P=0.002). 1082 grade > or =1 late toxicities were recorded in 935 patients. The mean time to complication was 13 months and was similar in all age groups. Forty percent of patients were free of complication at 4 years showing no significant difference between age groups (P=0.57). For grade >2 side-effects, late dyspnea and late weakness, there was also no significant difference, including grade >2 late oesophagitis (P = 0.1). The results of this study showed that age alone is not a sufficient reason to exclude patients in good general condition with thoracic tumor from curative radiotherapy when medically indicated (Pignon et al, 1998). 97

Ulutin and Aksu: Radiotherapy and surgery in the management of NSCLC in the elderly patients The proportion of patients who receive radiation decreases with increasing age. Among patients who receive treatment, the likelihood of receiving radiation is higher than any other therapy (p=0.0008)(41). Hillner et al. evaluated 1706 NSCLC patients of whom 1212 were age > or=65 years ("elderly"). Radiation was used more often in elderly patients compared with younger patients with local disease (30.5% vs. 14.0%) but less often in patients with distant disease (76.2% vs. 54.9%). In comparison with elderly patients, younger patients more often were treated with surgery for local disease (80.2% vs. 54.8%) and surgery alone or in combination with radiation for regional disease (51.9% vs. 32.0%) (Hillner et al, 1998). Different fractionation schedules and new applications of radiotherapy are currently available due to improvements in technology. In a recent study by Ghosh et al, 2003 lobectomy, wedge resection (WR) or continuous hyperfractionated accelerated radiotherapy (CHART) were compared in 215 patients with T1N0 NSCLC aged >70 years. Survivals at 1 and 5 years for patients undergoing WR, lobectomy and CHART were 98% and 74% vs. 97% and 68% vs. 80% and 39%, respectively (P=0.0484). The frequency of local/regional recurrence in the WR group (19.1%) was not significantly higher than in the lobectomy group (18.4%, P=0.38) when compared to the CHART group (27%, P=0.07). The results of this study showed that loco-regional recurrence and survival after WR, and lobectomy in elderly patients with stage I NSCLC were comparable and CHART was a reasonable treatment option for those who are not suitable candidates for surgery (Ghosh et al, 2003). Lester et al. used CT-planned accelerated hypofractionated radiotherapy in the radical treatment of non-small cell lung cancer. 135 patients with stage I-IIIB NSCLC were treated with CT-planned accelerated hypofractionated radical radiotherapy to a dose of 5055Gy in 15-20 fractions over 3-4 weeks. The 2-year overall and cause-specific survival for all patients was 44.4% and 47.8% respectively. Overall median survival was 21 months. There were no reports of severe acute or late treatment-related toxicities (Lester et al, 2004). Stereotactic hypofractionated high-dose irradiation for stage I nonsmall cell lung carcinoma was evaluated by Onishi et al, 2004 245 patients with a median age of 76 years (T1N0M0, n=155; T2N0M0, n=90) were treated with stereotactic hypofractionated high-dose radiotherapy. A total dose of 18-75 gray (Gy) at the isocenter was administered in 1-22 fractions. The median calculated biologic effective dose (BED) was 108 Gy (range, 57-180 Gy). Grade > 2 toxicities were observed in only 6 patients (2.4%). Local progression occurred in 33 patients (14.5%), and the local recurrence rate was 8.1% for BED > or=100 Gy compared with 26.4% for < 100 Gy (P < 0.05). The 3year overall survival rate of medically operable patients was 88.4% for BED > or=100 Gy compared with 69.4% for < 100 Gy (P < 0.05). The authors concluded that hypofractionated high-dose STI with BED < 150 Gy was feasible and beneficial for curative treatment of patients with Stage I NSCLC (Onishi et al, 2004).

Wulf et al used stereotactic radiotherapy for primary lung cancer and pulmonary metastasis in 61 medically inoperable patients.The patients were treated with stereotactic radiotherapy at 3 x 10 Gy (n=19), 3 x 12-12.5 Gy to the planning target volume enclosing 100%-isodose, with normalization to 150% at the isocenter; n=26) or 1 x 26 Gy to the planning target volume enclosing 80%isodose (n=26). The actuarial local control rate was 92% for lung cancer patients and 80% for metastasis patients > or =1 year after treatment and was significantly improved by increasing the dose from 3 x 10 Gy to 3 x 12-12.5 Gy or 1 x 26 Gy (p=0.038). The overall survival rate after 1 and 2 years was 52% and 32%, respectively, for lung cancer patients and 85% and 33%, respectively, for patients with metastasis, was impaired because of systemic disease progression. No severe acute or late toxicity was observed, and only 2 patients (3%) developed symptomatic Grade 2 pneumonitis, which was successfully treated with oral steroids (Wulf et al, 2004). The results show that stereotactic radiotherapy is a very effective treatment option for lung cancers without significant complications in medically impaired patients who are not amenable to surgery. Respiratory gated radiation therapy is developed for minimizing respiratory-induced anatomic motion and found to be practical during both simulation and treatment. With proper patient selection and training, this system is currently being used in some radiotherapy departments. Regarding the results of these studies doses ! 65 Gy with continuous fractionation are recommended and the target volume should enclose the location of tumor volume with the ipsilateral hilum and the adjacent mediastinum (Dosoretz et al, 1993).

IV. Radiotherapy alone in locally advanced NSCLC Radical radiotherapy is also a good management for locally advanced NSCLC in the elderly patients who canâ&#x20AC;&#x2122;t tolerate chemoradiotherapy. Zachariah et al. evaluated elderly patients who were treated with 59.40â&#x20AC;&#x201C;66 Gy with standard fractionation. The response rate was 43% and only 24% of patients had progressive disease The authors concluded that aggressive radiotherapy should not be withheld from older patients because of chronological age alone since older patients with good functional status tolerate radiotherapy as well as younger patients and have comparable tumor response and survival rates (Zachariah et al, 1997). Lonardi et al. evaluated the outcome of 48 patients, aged 75 years and over, treated with radiation therapy for advanced (stage IIIA-B), inoperable, symptomatic NSCLC. A median dose of 50 Gy was delivered to the primary site and mediastinum with standard fractionation. 21 patients had partial remission, 17 stable disease, and nine had progressive disease. Toxicity was negligible and mainly consisted of grade I-II esophagitis. Overall median survival was 5 months but dose-related survival was much better in patients given at least 50 Gy than in those treated with lower doses: 52% versus 35% at 6 months, and 28% versus 4% at 13 months. The results confirmed that

Cancer Therapy Vol 3, page 99 radiation therapy could be safely delivered to very aged patients with advanced NSCLC (Lonardi et al, 2000). In a retrospective trial by Nakano et al. in locally advanced NSCLC patients, median survival was 11.5 months in the younger group and 6.3 months in the elderly group (p=0.0043). A good performance status, age of <75 years, and good response to treatment were found as significant prognostic factors (Nakano et al, 1999). Tombolini et al. analyzed 41 medically inoperable IIIA and IIIB elderly patients (aged > or=70 years), treated with radiotherapy alone. The 2-year overall survival and disease free survival were respectively 27% and 14.6%. Patients presenting with weight loss > 10% experienced 14% overall survival at 2 years compared to 58% for those without weight loss (p=0.0027). Patients with tumor size less than 4 cm had a overall survival of 64% at 2 years but patients with tumor size > 4 cm had only a 2 year survival of 7% (p=0.0009). They concluded that radiotherapy is a good management for locally advanced NSCLC in elderly patients assuring good quality of life, high rates of relief of symptoms and overall and disease free survival similar to those obtained with chemotherapy and chemotherapy plus radiotherapy (Tombolini et al, 2000). Rengan et al, 2004 investigated 72 patients with Stage III NSCLC and gross tumor volumes (GTV) of greater than 100 cc which were treated with threedimensional conformal radiotherapy (3D-CRT) to understand whether high-dose radiation improved local control. Patients were divided into two groups: those treated to less than 64 Gy (37 patients) and those treated to 64 Gy or higher (35 patients). The 1-year and 2-year local failure rates were 27% and 47%, respectively, for Stage III patients treated to 64 Gy or higher, and 61% and 76%, respectively, for those treated to less than 64 Gy (p=0.024). The median survival time for patients treated to 64 Gy or higher was 20 months vs. 15 months for those treated to less than 64 Gy (p=0.068). A 10 Gy increase in dose resulted in a 36.4% decreased risk of local failure. These data suggested that administration of higher doses using 3D-CRT improves local control in Stage III NSCLC patients with large GTVs (Rengan et al, 2004). Radiation is frequently used for palliation of lung cancer-related symptoms. Radiotherapy can palliate thoracic pain and hemoptysis in 60% to 80% of cases and control other local symptoms in approximately 50% to 70% of cases. The median duration of benefit is 7 to 14 weeks. The main toxicity is self-limiting esophagitis (Higgins and Beebe, 1967).

advanced disease but the survival rates are lower than those reported after surgery.

References Au J, el-Oakley R, Cameron EW (1994) Pneumonectomy for bronchogenic carcinoma in the elderly. Eur J Cardiothorac Surg 8, 247-250. Bates M (1970) Results of surgery for bronchial carcinoma in patients aged 70 and over. Thorax 25, 77-78. Breyer RH, Zippe C, Pharr WF et al (1981) Thoracotomy in patients over age seventy years, ten-year experience. J Thorac Cardiovasc Surg 81, 187-193. Cangemi V, Volpino P, Dâ&#x20AC;&#x2122;Andrea N et al (1996) Lung cancer surgery in elderly patients. Tumori 82, 237-241. Damhuis RA, Schutte PR (1996) Resection rates and postoperative mortality in 7,899 patients with lung cancer. Eur Respir J 9, 7-10. Deneffe G, Lacquet LM, Verbeken E et al (1988) Surgical treatment of bronchogenic carcinoma, a retrospective study of 720 thoracotomies. Ann Thorac Surg 45, 380-383. Dexter EU, Jahangir N, Kohman LJ (2004) Resection for lung cancer in the elderly patient. Thorac Surg Clin 14, 163-71. Dosoretz DE, D. Galmarini JH, et al (1993) Local control in medically inoperable lung cancer, an analysis of its importance in outcome and factors determining the probability of tumor eradication. Int. J. Radiat Oncol Biol Phys 27, 507-516. Froeschle P, Friedel G, Pfeiffer S et al (1996) Thoracic surgery in advanced age. Langenbecks Arch Chir Suppl Kongressbd 113, 24-827. Gauden SJ, Tripcony L (2001) The curative treatment by radiation therapy alone of Stage I nonsmall cell lung cancer in a geriatric population. Lung Cancer 32, 71-9. Ghosh S, Sujendran V, Alexiou C et al (2003) Long term results of surgery versus continuous hyperfractionated accelerated radiotherapy (CHART) in patients aged >70 years with stage 1 non-small cell lung cancer. Eur J Cardiothorac Surg 24, 1002-7. Ginsberg RJ, Hill LD, Eagan RT et al (1983) Modern thirty-day operative mortality for surgical resections in lung cancer. J Thorac Cardiovasc Surg 86, 654-658. Harvey JC, Erdman C, Pisch J et al (1995) Surgical treatment of non-small cell lung cancer in patients older than seventy years. J Surg Oncol 60, 247-249. Harviel JD, McNamara JJ, Straehley CJ et al (1978) Surgical treatment of lung cancer in patients over the age of 70 years. J Thorac Cardiovasc Surg 75, 802-805. Higgins GA, Beebe GW (1967) Bronchogenic carcinoma. Factors in survival. Arch Surg 94, 539-549. Hillner BE, McDonald MK, Desch CE et al (1998) A comparison of patterns of care of nonsmall cell lung carcinoma patients in a younger and Medigap commercially insured cohort. Cancer 83, 1930-7. Ishida T, Yokoyama H, Kaneko S et al (1990) Long-term results of operation for non-small cell lung cancer in the elderly. Ann Thorac Surg 50, 919-922. Janssen-Heijnen ML, Smulders S, Lemmens VE et al (2004) Effect of comorbidity on the treatment and prognosis of elderly patients with non-small cell lung cancer. Thorax 59, 602-7. Jazieh AR, Hussain M, Howington JA et al (2000) Prognostic factors in patients with surgically resected stages I and II non-small cell lung cancer. Ann Thorac Surg 70, 1168-71. Kadri MA, Dussek JE (1991) Survival and prognosis following resection of primary non small cell bronchogenic carcinoma. Eur J Cardiothorac Surg 5, 132-136.

V. Conclusion Appropriate treatment for elderly patients with early stage non-small cell lung cancer should be surgical resection for cure and these patients should not be denied for an operation on the basis of age. Patients who have good performance status and no other medical problems should be offered standard resection. Extended resections should be avoided when possible. Radical radiation therapy is used for curative intent in elderly patients who are not candidates to surgery because of poor performance status, old age or refusal of surgery in early stage NSCLC or who can not tolerate chemoradiotherapy in locally 99

Ulutin and Aksu: Radiotherapy and surgery in the management of NSCLC in the elderly patients Kamiyoshihara M, Kawashima O, Ishikawa S et al (2000) Longterm results after pulmonary resection in elderly patients with non-small cell lung cancer. J Cardiovasc Surg 41, 483-486. Kirsh MM, Rotman H, Bove E, et al (1976) Major pulmonary resection for bronchogenic carcinoma in the elderly. Ann Thorac Surg 22, 369-373. Lester JF, Macbeth FR, Brewster AE et al (2004) CT-planned accelerated hypofractionated radiotherapy in the radical treatment of non-small cell lung cancer. Lung Cancer 45, 237-42. Lonardi F, Coeli M, Pavanato G et al (2000) Radiotherapy for nonsmall cell lung cancer in patients aged 75 and over, safety, effectiveness and possible impact on survival. Lung Cancer 28, 43-50. Mane JM, Estape J, Sanchez-Lloret J et al (1994) Age and clinical characteristics of 1433 patients with lung cancer. Age Ageing 23, 28-31. Morandi U, Stefani A, Golinelli M et al (1997) Results of surgical resection in patients over the age of 70 years with non small-cell lung cancer. Eur J Cardiothorac Surg 11, 432-439. Mountain CF (1997) Revisions in the International System for Staging Lung Cancer. Chest 111, 1710-7. Nagasaki F, Flehinger BJ, Martini N et al (1982) Complications of surgery in the treatment of carcinoma of the lung. Chest 82, 25-29. Nakano K, Hiramoto T, Kanehara M et al (1999) Radiotherapy alone for elderly patients with stage III non-small cell lung cancer. Nihon Kokyki Gakkai Zasshi 37, 276-281. O'Connell JB, Maggard MA, Ko CY (2004) Cancer-directed surgery for localized disease, decreased use in the elderly. Ann Surg Oncol 11, 962-9. Oliaro A, Leo F, Filosso PL, et al (1999) Resection for bronchogenic carcinoma in the elderly. J Cardiovasc Surg 40, 715-719. Onishi H, Araki T, Shirato H et al (2004) Stereotactic hypofractionated high-dose irradiation for stage I nonsmall cell lung carcinoma, clinical outcomes in 245 subjects in a Japanese multiinstitutional study. Cancer 101, 1623-31. Pagni S, McKelvey A, Riordan C et al (1998) Pulmonary resection for malignancy in the elderly, is age still a risk factor? Eur J Cardiothorac Surg 14, 40-44; discussion 4445. Pignon T, Gregor A, Schaake Koning C et al (1998) Age has no impact on acute and late toxicity of curative thoracic radiotherapy. Radiother Oncol 46, 239-48. Port JL, Kent M, Korst RJ et al (2004) Surgical resection for lung cancer in the octogenarian. Chest 126(3, 733-8. Rengan R, Rosenzweig KE, Venkatraman E et al (2004) Improved local control with higher doses of radiation in large-volume stage III non-small-cell lung cancer. Int J Radiat Oncol Biol Phys 60, 741-7. Romano PS, Mark DH (1992) Patient and hospital characteristics related to in-hospital mortality after lung cancer resection. Chest 101, 1332-1337. Roviaro G, Varoli F, Vergani C et al (2004) Long-term survival after videothoracoscopic lobectomy for stage I lung cancer. Chest 126, 725-32. Roxburgh JC, Thompson J, Goldstraw P (1991) Hospital mortality and long-term survival after pulmonary resection in the elderly. Ann Thorac Surg 51, 800-803.

Sherman S, Guidot CE (1987) The feasibility of thoracotomy for lung cancer in the elderly. JAMA 258, 927-930. Sioris T, Salo J, Perhoniemi V et al (1999) Surgery for lung cancer in elderly. Scand Cardivasc J 33, 222-227. Smith TJ, Penberthy L, Desch CE et al (1995) Differences in initial treatment patterns and outcomes of lung cancer in the elderly. Lung Cancer 13, 235-52. Teeter SM, Holmes FF, McFarlane MJ et al (1987) Lung carcinoma in the elderly population. Influence of histology on the inverse relationship of stage to age. Cancer 60, 13311336. Thomas P, Sielezneff I, Ragni J et al (1993) Is lung cancer resection justified in patients aged over 70 years? Eur J Cardiothorac Surg 7, 246-250; discussion 250-251. Tombolini V, Bonanni A, Donato V, et al (2000) Radiotherapy alone in elderly patients with medically inoperable stage IIIA and IIIB non-small cell lung cancer. Anticancer Res 20, 4829-4833. Tsuchiya R, Miyazawa N, Naruke T et al (1981) Lung resection in patients over age of 70 years]. Kyobu Geka 34, 416-420. Van Rens MT, De La Riviere AB, Elbers HR et al (2000) Prognostic assessment of 2,361 patients who underwent pulmonary resection for non-small cell lung cancer, stage I, II, and IIIA. Chest 117, 374-9. Whittle J, Steinberg EP, Anderson GF et al (1991) Use of Medicare claims data to evaluate outcomes in elderly patients undergoing lung resection for lung cancer. Chest 100, 729734. Wulf J, Haedinger U, Oppitz U et al (2004) Stereotactic radiotherapy for primary lung cancer and pulmonary metastases, a noninvasive treatment approach in medically inoperable patients. Int J Radiat Oncol Biol Phys 60, 18696. Yamamoto K, Padilla Alarcon J, Calvo Medina V et al (2003) Surgical results of stage I non-small cell lung cancer, comparison between elderly and younger patients. Eur J Cardiothorac Surg 23, 21-5. Yellin A, Hill LR, Lieberman Y (1985) Pulmonary resections in patients over 70 years of age. Isr J Med Sci 21, 833-840. Zachariah B, Balducci L, Venkattaramanabalaji GV et al (1997) Radiotherapy for cancer patients aged 80 and older, a study of effectiveness and side effects. Int J Radiat Oncol Biol Phys 39, 1125-1129.

Drs Cuneyt Ulutin and Gorkem Aksu

100

Cancer Therapy Vol 3, page 101 Cancer Therapy Vol 3, 101-104, 2005

P-glyco protein (multi drug resistance protein product) does not predict the response of laryngeal and hypopharyhgeal cancer to chemotherapy Research Article

Avi Khafif1, Elizabeth Gillis2, Jesus E. Medina3, * 1

Department of Otorhinolaryngology the Tel-Aviv Sourasky Medical Center, Tel-Aviv, Israel, Department of Pathology and 3 Department of Otorhinolaryngology, The University of Oklahoma Health Sciences Center Oklahoma City, Oklahoma 2

__________________________________________________________________________________ *Correspondence: Avi Khafif, Department of Otorhinolaryngology, Tel Aviv Sourasky Medical Center, 6 Wiezman street, Tel Aviv; Tel: (9723) 540-0526; E-mail: khafif@tasmc.health.gov.il Key words: G-glyco protein, hypopharyhgeal cancer, chemotherapy, Immunohistochemistry, Clinical study Abbreviations: 5-fluorouracil, (5-FU); diaminobenzidenetertrahydrochloride, (DAB); multidrug resistance gene, (MDRG); proliferating cell nuclear antigen, (PCNA); P-glycoprotein, (P-GP); squamous cell carcinoma, (SCC) Received: 26 December 2004; Revised: 28 February 2005 Accepted: 28 February 2005; electronically published: March 2005

Summary Larynx preservation protocols using combinations of chemotherapy and radiation are effective in some patients with advanced resectable head and neck cancer. The purpose of the current study was to investigate whether Pglycoprotein (P-GP), the product of the multi-drug resistance gene, correlates with tumor response to chemotherapy, survival and the rate of laryngeal preservation using a larynx preservation protocol for advanced squamous cell carcinomas of the larynx and hypopharynx. Twenty-four patients with advanced cancer of the larynx and hypopharynx, were prospectively assigned to receive two cycles of cis-platinum and 5-FU followed by radiation. Immunohistochemistry for P-GP was performed and staining correlated with response to chemotherapy, survival, and the rate of laryngeal preservation. Six patients (25%) had tumors that exhibited positive staining for P-GP. Four of these patients (66%) responded to chemotherapy and three (50%) are alive at the time of last follow-up. Of the 18 patients with tumors that exhibited negative staining for P-GP, 15 (83%) responded to chemotherapy, and 9 (50%) are alive at the time of the last follow-up. The response to chemotherapy, survival and rate of laryngeal preservation was similar in the two groups of patients. Positive staining for P-GP did not correlate with a response to cis-platinum and 5-FU in patients with SCC of the larynx and hypopharynx, nor did it predict a decreased survival or a lower rate of laryngeal preservation in these small cohort of patients. significantly correlated with the rate of laryngeal preservation. However, only tumor stage correlated with response to chemotherapy and none of these factors correlated with survival. Glutathione and Glutathione STransferase play a major role in cellular protection against free radicals and oxidative stress but their levels did not predict tumor response to platinum or 5-FU in patients with SCC of the Head and Neck (Bier et al, 1996). Etienne et al, (1995) studied the effect of Dihydropyrimidine dehydrogenase, the enzyme responsible for the degradation of 5-fluorouracil (5-FU), on response of 62 patients with head and neck cancer to 5-FU. They concluded that 5-FU catabolism in target cells is probably a determinant factor for 5-FU responsiveness in cancer

I. Introduction Larynx preservation regimens using chemotherapy and radiation are being used extensively as part of experimental larynx preservation protocols in the treatment of patients with advanced squamous cell carcinoma (SCC) of the larynx and hypopharynx. The resistance of tumor cells to chemotherapy, however, is a major problem, and recent studies have focused on understanding the mechanisms of this resistance. Bradford et al (Bradford et al, 1999) investigated factors affecting the response in patients treated as part of the Veterans Affairs Laryngeal Cancer Cooperative Study. They found that a high T-stage, positive staining for p-53 and high levels of proliferating cell nuclear antigen (PCNA)

101

Khafif et al: G-glyco protein as a response predictor of laryngeal and hypopharyhgeal cancer patients. This enhanced catabolism may be mediated by high expression of the multidrug resistance gene (MDRG). The purpose of this study was to determine whether response to chemotherapy could be predicted by an immunohistochemistry staining for P-Glycoprotein (PGP), the protein product of the MDRG.

Twelve patients are alive with no evidence of disease and 12 are dead of disease. The larynx was preserved in 9 patients and only three patients were salvaged with a total laryngectomy and were alive with no evidence of disease at the time of last follow-up. Altogether, six patients had tumors that exhibited a positive staining for P-GP while 18 patients had tumors that had negative staining. Four of the patients with positive staining for P-GP (66.6%) and 15 of the patients with negative staining (83%) responded (PR or CR) to chemotherapy (p>0.05, table 1). Three of the six patients with positive staining (50%) died of their disease, comparable to 9 of the 18 patients (50%) with negative staining for P-GP (p>0.05). Two of the six patients (33%) that had a positive staining for P-GP are alive with their larynx preserved compared to 7 of the 18 (38%) that had negative staining (p > 0.05).

II. Materials and Methods A. Clinical study Patients with advanced, resectable SCC of the larynx and hypopharynx were enrolled onto the study and were treated with two cycles of chemotherapy including cis-platinum (100mg/M2) and 5-FU (1gr/M2/24h for 5 days). Patients with cardiac comorbidity received carboplatin and 5-FU. If the tumor decreased to less than 50% of its original size, a third cycle of chemotherapy was usually added and was followed by a full course of radiation. If less than 50% response was observed, salvage surgery (i.e. total laryngectomy) was performed. End points for analysis were death or recurrent disease and laryngeal preservation. Follow-up data was collected for a minimal period of two years or until death. The study was approved by the institutional review board (IRB).

IV. Discussion The MDRG P-GP had been suggested as a reliable predictor of response of tumor cells to chemotherapy drugs. The results of the present study suggest that immunohistochemical staining of SCCa of the larynx and hypopharynx does not correlate with the response of the tumor to chemotherapy with cis-platinum and 5-FU patient survival or rate of larynx preservation. These results are interesting because the tumors studied represent a relatively homogeneous group of advanced tumors of only two sites within the head and neck, which were treated with a single chemotherapeutic regimen and were systematically evaluated for response to therapy. These results may shed some light on the controversy existing in the literature about the role of P-GP expression as a predictor of tumor response to chemotherapy. Recently, Lo-Muzio et al, (2000) studied tumors from 30 patients with squamous cell carcinomas of the oral cavity and normal tissues from 6 patients by immunohistochemistry staining to P-GP. They found that 66% of their normal and 80% of their tumoral tissues showed a positive staining. Interestingly, in 4 patients the tumor showed strong staining while the surrounding normal tissues were negative, and in 6 patients a strong positive staining was observed in areas of higher degree of differentiation. The authors suggest that activation of the MDRG may occur early in the carcinogenesis process and may be involved in tumor response to chemotherapy. This is supported by a recent study (Warnakulasuriya et al, 2000) reporting a significant correlation of P-GP expression and response to chemotherapy and radiation in 111 patients with advanced head and neck cancer. Cordon-Cardo et al, (1990) performed immunohistochemistry staining for P-GP in various tissues and concluded that although P-GP expression can be detected in a variety of tumors, further studies are needed to establish the significance of such findings. Filiptis et al, (1997) investigated the association between expression of the MDRG and survival or response to chemotherapy in patients with acute leukemia. Positive immunocytochemistry staining for MDRG had no impact on survival or response to induction chemotherapy in these

B. Immunohistochemistry The histopathology biopsy specimens of the 24 patients included on the study were retrieved. Representative tumor tissue slide preparations made from the formalin fixed paraffin embedded tissue. These were immunostained using antibody, NCL- PGLYm (Novocastra Labs) with specificity for Human Pglycoprotein,C-terminal cytoplasmic domain. Immunohistochemistry was performed by the avidin-biotin complex method of Hsu et al*. Following deparaffinization, inhibitor solution was optimized to remove endogenous peroxidase activity for 4 minutes at 37째C.The optimized antibody is applied and incubated for 32 mins. at 37째C. This was followed by a biotinylated horse anti-mouse immunoglobulin with 8 mins incubation at 37째C and Avidin-HRPO for another 8 mins (Ventana, Tuczon, AR). Chromogen solution consisted of 0.05% diaminobenzidenetertrahydrochloride (DAB) with 0.07% H202. Sections were counterstained with hematoxylin and carefully examined. Membrane immunoreactivity in tumor was scored as follows: positive, trace (< 10% of tumor cells staining), and negative. Liver was used as the recommended positive control. Negative controls lacking primary antibody were also evaluated in each case for background staining. Diffuse weak and diffuse strong staining were considered positive staining while focal traces or no staining were reported as a negative staining. Degree of staining was correlated with survival, response to chemotherapy and the rate of laryngeal preservation. A twotailed t-test was used to evaluate the statistical significance of this correlation and a p value equal or smaller than 0.05 was considered a significant difference.

III. Results Twenty-four patients (18 men and 6 women) were enrolled in the study between the years 1993-1995. All had locally advanced (T3-T4) primary tumors located in the larynx (n=19) and hypopharynx (n=5). Nineteen patients had a complete or partial response and received all three cycles of chemotherapy followed by radiation. Five patients failed to show more than 50% reduction and had a salvage laryngectomy. Thirteen patients (54%) had a salvage laryngectomy either for persistent or recurrent disease. All patients had a minimal follow-up of 2 years. 102

Cancer Therapy Vol 3, page 103 Bradford CR, Wolf GT, Carey TE et al (1999) Predictive markers for response to chemotherapy, organ preservation, and survival in patients with advanced laryngeal carcinoma. Otolaryngol Head and Neck Surg 121, 534-8. Cordon-Cordo C, Oâ&#x20AC;&#x2122;Brien JP, Boccia J, Casals D, Bertino JR, Melamed MR (1990) Expression of the Multidrug resistance gene product (P-glycoprotein) in human normal and tumor tissues. J Hitochem Cytochem 38, 1277-87. Darnton SJ, Jenner K, Steyn RS, Ferry DR, Matthews HR (1997) Lack of correlation of P-glycoprotein expression with response to MIC chemotherapy in esophageal cancer. J Clin Pathol 48, 1064-6. Etienne MC, Cheradame S, Fischel JL et al (1995) Response of fluorouracil therapy in cancer patients, the role of tumoral dihydropyrimidine dehydrogenase activity. J Clin Oncol 13, 1663-70. Filipits M, Suchomel RW, Zochbauer S, Brunner R, Lechner K, Pirker R. (1997) Multidrug resistance-associated protein in acute myeloid leukemia, No impact on treatment outcome. Clin Cancer Res 3, 1419-25. Hsu SM, Raine L, Fanger H (1981) Use of avidin-biotinperoxidase complex (ABC) in immunoperoxidase techniques, a comparison between ABC and unlabelled (PAP) procedures. J Histochem Cytochem 29, 577 Lo-Muzio L, Staibano S, Pannone G, et al (2000) The human multidrug resistance gene (NDRG-1), immunohistochemistry detection of its expression in oral SCC. Anticancer Res 20, 2891-7. Rabkin D, Chhieng DC, Miller MB, Jennings T, Feustel P, Steiniger J, Parnes SM (1995) P-glycoprotein expression in the squamous cell carcinoma of the tongue base. Laryngoscope 105, 1294-9. Warnakulasuriya S, Jia C, Johnson N, Houghton J (2000) p53 and P-glycoprotein expression are significant prognostic markers in advanced head and neck cancer treated with chemo/radiotherapy. J Pathol 191, 33-8.

patients. Darnton et al. investigated the response of 27 patients with esophageal cancer to MIC chemotherapy (mitomycin, ifosfamide, cisplatin) and found that 20/27 (70%) of patients with squamous cell carcinoma responded to chemotherapy and only one expressed P-GP, whereas 3/10 (30%) of the patients with adenocarcinoma responded to chemotherapy and of these 7 showed over expression of the P-GP. These concluded that the presence of P-GP might explain the lower response of adenocarcinoma to MIC chemotherapy; however, it cannot explain the variable response rates in patients with SCC since all these tumors showed low expression of P-GP. Rabkin et al, (1995) on the other hand, reported over expression of P-GP in all squamous cell carcinomas of the base of the tongue. Analysis of these two later studies reveals that the rate of expression of P-GP was not different in most patients with squamous cell carcinomas and the different rates of expression may reflect various sensitivity for detecting P-GP. The use of P-GP as a predictor of response in these patients is thus questioned, a fact that is supported in the current study; P-GP did not predict the outcome after chemotherapy in patients with advanced Laryngeal and Hypopharyngeal squamous cell carcinomas. The reliability of P-GP expression as a predictor of response to chemotherapy in patients with laryngeal and hypopharyngeal Squamous cell carcinomas is questioned.

References Bier H, Hoffmann T, Eickelmann P, Hafner D (1996) Chemosensitivity of head and neck squamous carcinoma cell lines is not primarily correlated with glutathione levels but is modified by glutathione depletion. J Cancer Res Clin Oncol 122, 653-8.

103

Khafif et al: G-glyco protein as a response predictor of laryngeal and hypopharyhgeal cancer

104

Cancer Therapy Vol 3, page 105 Cancer Therapy Vol 3, 105-130, 2005

Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? Review Article

Daila S. Gridley1,2, Jerry R. Williams1 and James M. Slater1 1

Department of Radiation Medicine and

Department of Biochemistry & Microbiology, Loma Linda University and Medical Center, Loma Linda, CA 92354, USA

__________________________________________________________________________________ *Correspondence: Daila S. Gridley, Ph.D., Chan Shun Pavilion, Room A-1010, 11175 Campus Street, Loma Linda, CA 92354; Telephone: (909) 558-8361; Fax: (909) 558-0825; E-mail: dgridley@dominion.llumc.edu Key words: radiosensitivity, radioresistance, radio-adaptation, dose-rate effect, inverse dose-rate effect Abbreviations: atomic bomb, (A-bomb); Central nervous system, (CNS); chronic myelogenous leukemia, (CML); computed tomography, (CT); different poly(ADP-ribose) polymerase-1, (PARP-1); epidermal growth factor receptors, (EGFR); Epstein-Barr virus, (EBV); Food and Drug Administration, (FDA); gastrointestinal tract, (GI); human lung fibroblasts, (HFL-1); hypoxanthine-guanine phosphoribosyl transferase, (HPRT); Lewis lung carcinoma, (LLC); intensity-modulated radiation therapy, (IMRT); linear energy transfer, (LET); lipopolysaccharide, (LPS); magnetic resonance imaging, (MRI); major histocompatibility complex, (MHC); monoclonal antibodies, (Mab); Natural killer, (NK); positron emission tomography, (PET); retinoblastoma, (Rb); subcutaneous, (s.c.); T cytotoxic, (Tc); T helper, (Th); thymidine kinase, (tk); total-body irradiation, (TBI); vascular endothelial growth factor, (VEGF) Received: 28 January 2005; Accepted: 4 February 2005; electronically published: March 2005

Summary Ionizing radiation has been a major cancer treatment modality for more than five decades. Its use has resulted in increased cure rates and prolonged survival time. The treatment paradigms that are currently applied in the clinic are limited in terms of total dose and the temporal patterns used. Part of the reason for this is due to the historical effectiveness of smaller fractions, i.e., ~2 Gy, delivered at dose rates of approximately 50 Gy/hr in near daily fractions to a total dose of approximately 60 Gy. Larger fractions have sometimes led to unacceptable normal tissue toxicity. Lower dose-rates have not been widely used due to two reasons: 1) limited studies generally indicate that reduced dose-rates delivered to the same total dose are less effective in producing tumor regression and 2) the mechanisms by which lower dose rates induce cell death and other relevant endpoints are not well understood. However, many reports now suggest that lower dose rates may be effective in cancer therapy, albeit not always when used in the same way that higher dose rates are used in conventional therapy. In addition, increasing advances in radiotherapy technologies with improved spatial dose-distribution have rejuvenated interest in optimizing radiotherapy time-dose regimens. Especially intriguing from the radiation oncology point of view are reports that 1) low-dose/low-dose-rate irradiation can be more effective in killing tumor cells than high dose-rate irradiation under certain conditions, 2) lower dose irradiation delivered over an extended period of time may preferentially sensitize neoplastic cells to a subsequent high-dose-rate exposure and 3) low-dose/low-dose-rate radiation can induce radioresistance in some normal cells. The phenomenon of radiation-induced protection against acute exposure, originally known as ‘hormesis’ and today referred to as radio-adaptation, has been especially well studied in lymphocytes. Indeed, it has been proposed that radio-adaptation in lymphocytes and perhaps other immune system cells, together with the “danger” signal provided by damaged neoplastic cells, may contribute to tumor control. Collectively, these observations suggest that alternative but effective radiotherapy may produce an improved therapeutic ratio by combining low- and high-dose-rate radiotherapy. These observations also indicate a need to better understand the dose-rate effect as it modulates tumor and normal tissue responses. This review will consider the effect of dose-rate as a variable in radiotherapy and the mechanistic processes that may underlie doserate effects. We accept that the consequences of low-dose/low-dose-rate radiation on both tumor and normal cell responses have not yet been firmly established. Published reports are sometimes contradictory, indicating that priming with protracted low dose-rate exposures may increase, decrease, or have no effect on radiosensitivity. The apparent discrepancies can be at least partly explained by the dependence of low-dose/low-dose-rate irradiation effects upon many variables, including specific cell type, dose rate, total dose delivered, radiation quality, time of testing, endpoint measured and in vitro versus in vivo exposure. Historically, the differences in biological 105

Gridley et al: Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? consequences observed between low- and high-dose-rate irradiation have been largely attributed to variations in the length of time available for DNA repair and accumulation of cells in G2 (considered to be the most radiosensitive phase of the cell cycle) during intermittent low-dose or continuous low dose-rate exposure. However, it appears now that the underlying mechanisms are more complex than originally assumed. Here we seek to accomplish three goals: 1) suggest an analytical grouping of dose-rates based on the time frame of irradiation and the time frame of relevant biological processes, 2) propose an analytical framework for analyzing lower dose-rate cell survival responses and 3) review the reported effects of low-dose/low-dose-rate radiation on the responses of both tumor and normal cells. Potential for increased tumor control with radiotherapy protocols that combine low dose-rate and high dose-rate irradiation is also discussed. It is important for this review to use terminology that is internally consistent and to conform, as far as possible, with conventions in the literature. For this review, we use six dose-rate groups and abbreviations to describe doserate ranges: ultra-high dose rate, UHDR (~105 Gy/hr); high-dose rate, HDR (10-100 Gy/hr); intermediate-dose rate, IDR (1.0-10 Gy/hr); low-dose rate, LDR (0.1-1.0 Gy/hr); very-low dose rate, VLDR (0.01-0.1 Gy/hr); and ultra-low dose rate, ULDR (<0.01 Gy/hr). These groups, together with comments are summarized in Table 1. It is also important to point out that while we use these groupings in this review, the dose-rate is not an absolute constant for any radiation because the microdosimetry that describes the relative number of ionizations produced within a microvolume varies even with so called minimally-ionizing radiation such as x-rays or !-rays. The time pattern for delivering radiotherapy has always been recognized as an important variable in outcome. Use of five daily fractions per week (9-10 Gy total/week) has emerged as the standard time-dose regimen for treating many solid tumors. Hyperfractionation and now also hypofractionation, has been evaluated in limited studies in which the fraction size, time between radiation fractions and the total dose are either reduced or increased. However, these protocols still use HDR during radiation delivery. While we believe such experiments may involve some of the same mechanisms that are involved in doserate effects, we will not emphasize these types of experiments in this review. Cellular studies of those dose rates that are used most often in the clinic, ranging from ~0.1 Gy/hr to several Gy/min, have been largely derived from experiments with cultured cells (Hall and Brenner, 1991). The higher dose rates are within the range that we refer to as the HDR range, whereas the lower rates used in brachytherapy (i.e. implantating a radioactive source) extend into the IDR and LDR ranges. Thus, we suggest that the mechanisms that influence cell killing over these different ranges may differ and need to be considered in a more detailed, segmented analysis. Overall, the regimens employed for radiotherapy have been based on empirical observation of outcome, equipment limitations and patient and staff convenience.

I. Introduction A. Overview In spite of numerous improvements in cancer management, there is an urgent need to implement new treatment approaches. Estimates made by the American Cancer Society indicate that there were 1,368,030 newly diagnosed cases and 563,700 cancer-related deaths in 2004 (Jemal et al, 2004). With current therapies almost 50% of patients will eventually die because of local recurrence, metastatic disease, or a combination of both (Lichter 2000). Furthermore, the rapid expansion of elderly individuals in the United States, as well as in many other countries, will undoubtedly lead to a substantial increase in the prevalence of cancer. Since the discovery of x-rays by Wilhelm Roentgen more than 110 years ago, radiation has become an important and often indispensable modality for cancer treatment. The development of improved radiotherapy protocols has been closely allied with understanding of factors that determine treatment outcome. One of these has been improved definition of tumors in three-dimensions with the development of magnetic resonance imaging (MRI), computed tomography (CT), positron emission tomography (PET) and molecular imaging. Another improvement has been in the understanding of the physical and chemical processes associated with predicting dose and microdose in tumors and normal tissues. Finally, there has been a better understanding of the radiobiology associated with the response of tumor and normal tissues to different temporal patterns of dose delivery. These areas of improvement could be combined into highly sophisticated radiation therapy protocols using more advanced planning systems. For example, planning systems originally proposed by Slater and colleagues in 1974 have provided guidance in newer treatment modalities such as the use of charged heavy particle and intensity-modulated radiation therapy (IMRT) (Slater et al, 1988, 1992; Purdy, 1996; Mackie and Smith, 1999; Bastasch et al, 2002; Baumert et al, 2003; Teh et al, 2003). All of these advances have contributed to more accurate tumor targeting and thus also to increased sparing of normal tissues. However, understanding is still lacking as to how this improved dose distribution can be used to optimize the therapeutic ratio (tumor cure/normal tissue toxicity). Better understanding of dose-rate effects may aid in such optimization and thus also decrease the need to sometimes underdose the tumor in order to prevent severe normal tissue complications.

B. Proton therapy as a model of a mixed dose-rate radiation Proton radiotherapy has several characteristics that relate to dose and dose-rate considerations. These characteristics are: 1) protons are administered as a rapid sequence of â&#x20AC;&#x153;spillsâ&#x20AC;? or small packets of protons and thus

106

Cancer Therapy Vol 3, page 107 Table 1. Assignment of dose-rates into groups based on temporal chemical and biological processes Dose-rate group

Dose-rate 5

Comments

Ultra-high dose-rate, UHDR

~10 Gy/hr

While some studies have been performed with “flash x-rays,” this range of dose is not well studied. We define this dose-rate as generating multiple ionizations within a time frame that is short compared to the mean lifetime of induced chemical species. Although these data are not reviewed here, this category is included since it may represent effective dose-rate in some irradiated microvolumes when densely ionizing particles traverse a microvolume.

High dose-rate, HDR

10 to 100 Gy/hr

This class of dose-rates is representative of most dose-rates used in standard multi-fraction radiotherapy. We suggest the data show that small changes, up to a factor of 2, in HDR does not induce significant modulation of radiation response.

Intermediate dose-rate, IDR

1.0 to 10 Gy/hr

This class of dose-rates has been studied in a limited number of experiments. Steele has suggested that the lower limit of this dose-rate range is the rate at which there is no longer a perceivable sparing of cell killing when cells are subjected to higher dose-rates (Steele, 1996). This encompasses a range of dose-rates over which the time needed to deliver clinically relevant dose fractions (1.5 to 5.0 Gy) varies from 1.5 to 5 hours. This is a time frame at the lower end of the duration over which survival can be manipulated by splitting the dose or maintaining cells under sub-optimum growth conditions.

Low dose-rate, LDR

0.1 to 1.0 Gy/hr

This is a range of dose-rates over which the time needed to deliver clinically relevant fractions (1.5 to 5.0 Gy) varies over times in which many biological processes that are considered relevant to cell survival are changing the response status of the cell. These include: induction of altered gene expression, sub-lethal damage repair, potentially-lethal damage repair, induction of perturbation in cell cycle redistribution and susceptibility to apoptosis. Most reports of dose-rate effects have used dose-rates in this range.

Very low dose-rate, VLDR

0.01 to 0.1 Gy/hr

This range of dose-rates has not been extensively studied due to lack of observed effects. We propose that radiosensitivity of tumor cells can be altered within this dose-rate range when challenged by larger, acutely-delivered fractions.

Ultra low dose-rate, ULDR

<0.01 Gy/hr

This is a hypothetical range and we suggest that at some doserate less than 0.01 Gy/hr it will not be possible with present tools to identify effects relevant to radiotherapy.

the dose delivered is not continual but discontinuous over a very small time scale: While the “average dose-rate” at which protons are administered are comparable to photon high dose-rate (circa 50 Gy/hr) irradiation, instantaneous dose-rates during a “spill” can reach 600 Gy/hr; 2) protons produce a higher proportion of ionization clusters so that for some cell/tissue volumes, there is an increase in effective dose-rate; and 3) improved spatial dosedistribution of deposited radiation with protons permits using larger fractions with lower risk for toxicity compared to photons, a characteristic that we suggest can be used to exploit cell sensitization by low-dose-rate irradiation. Proton therapy is maturing as a first-line radiotherapy for a large number of patients. The clearest example has occurred at the proton treatment facility at the Loma Linda University Medical Center (Slater et al, 1988,

1990; Archambeau et al, 1992). Proton beams, consisting of charged particles that deposit the bulk of their energy as they approach their stopping edge (Bragg peak), are modulated such that the Bragg peak is distributed throughout the intended treatment volume. This then distributes microregions of higher dose-rate through the tumor mass. Because of the lower integral dose delivered during proton radiotherapy, the risk for normal tissue damage is minimized, as evidenced by data presented in rapidly accumulating publications (Matsuzaki et al, 1994; Gridley et al, 1996, 1998, 2004; McAllister et al, 1997; Yonemoto et al, 1997; Slater et al, 1998, 2004; Bush et al, 1999; Rossi 1999; Lin et al, 2000; Schulte et al, 2000; Bonnet et al, 2001; Hug et al, 2002; Kirsch and Tarbell, 2004).

107

Gridley et al: Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? assumed that accumulation in G2 was the major mechanism by which protracted LDR radiation sensitizes tumor cells to HDR radiation. Many reports utilizing a variety of neoplastic cell types have supported this possibility (Terasima and Tolmach, 1961; Bedford and Hall, 1963; Kal et al, 1975; Mitchell et al, 1979; van Oostrum et al, 1990; Knox et al, 1993; Skladowski et al, 1993; Fowler, 2003). The increased sensitivity in G2 may be the result of insufficient DNA repair before cells reach this stage (Parshad et al, 1984) and/or incomplete repair in G2 (Walters et al, 1974; Bases et al, 1980). However, other studies have found no association between G2 arrest and radiosensitivity (Cao et al, 1983; DeWeese et al, 1998; Mitchell et al, 2002). Most recently, it has been demonstrated that exposure to LDR radiation reduces activation of the DNA damage sensor ATM and its downstream target H2AX, resulting in decreased clonogenic survival compared to HDR radiation (Collis et al, 2004). Most data on dose-rate effects are presented as surviving fraction versus total dose. However the duration of exposure can vary from a few minutes to days. It is important, we suggest, to consider the variation of the rate of cell kill per unit dose as a function of duration of exposure. We illustrate this by replotting data previously reported by Marin, Dillehay and colleagues (Marin et al, 1991) utilizing human U251 glioblastoma cells. These authors observed little dose-rate effects from 0.086 Gy/hr to 49.0 Gy/hr, with survival clustering around the survival pattern for acute exposure. However when these data are plotted as the rate of cell kill per unit time, a different pattern is observed as shown in Figure 1.

C. Mechanisms involved in dose-rate effects 1. Fractionation over times ranging from 1 to 14 hours Early studies by Elkind and Sutton utilized split-dose radiation (i.e. fractionation) to simulate low-dose rates (Elkind and Sutton, 1959). Their findings led to the theoretical prediction that biological response to LDR radiation would be decreased compared to the same total dose delivered acutely and that the difference in the effect depended upon the repair efficiency of the resulting damage (Lajtha and Oliver, 1961). The existence of this dose rate sparing was subsequently supported by studies of HeLa cells that were also shown to accumulate in the G2 phase of the cell cycle during LDR exposure (Hall and Bedford, 1964; Bedford and Mitchell, 1973; Mitchell and Bedford, 1977). While the molecular mechanisms that underlie split dose recovery after acute irradiation are unknown, it is important to consider whether this phenomenon relates directly to dose-rate effects.

2. Inverse dose-rate effect Later studies, however, demonstrated greater HeLa cell death when radiation was delivered at an LDR rate of 0.37 Gy/hr instead of at 1.54 Gy/hr (Mitchell et al, 1979). This phenomenon became known as the inverse dose-rate effect. The explanation put forth for the increased sensitivity was that cells irradiated at LDR over an extended period of time do not repair all damage; with increasing accumulation in G2, the most radiosensitive phase of the cell cycle, enhanced radiosensitivity is manifested (Mitchell et al, 1979). Indeed, it was long

Figure 1. Survival curves for human U251 glioblastoma cells exposed to 57Cs at variable dose rates. Rate of cell killing expressed as log surviving fraction per Gy as a function of exposure time for dose rates in the very low dose-rate range (0.086 Gy/hr) and in the low dose-rate range (0.123, 0.25, and 0.49 Gy/hr) compared to the rate of cell kill for high dose-rate irradiation (~50 Gy/hr). Data were extracted from the work of Marin et al, 1991 and calculated by measuring the change in surviving fraction in logs for the preceding radiation interval and dividing it by the absorbed dose over the same time interval. The horizontal dotted lines are the rates of cell kill by high dose-rate radiation (~50 Gy/hr) measured as the slope of the survival curve at ~2 Gy (alpha) and for doses higher than 4 Gy (omega). U251 is a very radioresistant cell line derived from a human glioblastoma.

108

Cancer Therapy Vol 3, page 109 In this figure we compare the rate of cell kill for these several low dose-rates to the rate of cell kill for radiation delivered acutely expressed as the slope at doses circa 2 Gy and at doses higher than 4 Gy. Alpha is the rate of cell kill induced per unit dose by high dose-rate (~50 Gy/hr) at approximately 2 Gy. Alpha is identical to the coefficient alpha as determined by linear-quadratic analysis of the acute survival curve. Omega is related to the inverse of the Do and is calculated by reiterative bestfit analysis of the terminal slope (> 4 Gy) of the acute survival curve. Thus omega represents the maximum rate of cell kill per Gy for acute irradiation. These data when plotted in a time-based format illustrate three important points. First, the rate of cell kill changes dramatically over time for different dose-rates. Second, for this cell line, the rate of cell killing increases as dose rate increases from 0.086 cGy/hr in the VLDR range and reaches a maximum at approximately 0.25 Gy/hr. Increasing the dose-rate to 0.49 cGy/hr does not increase further the rate of cell killing. The third point is most important for considering dose rates other than the HDR used in the clinic, i.e. the data in Figure 1 show that for some time points, the rate of cell kill is equally effective or more effective when delivered at 0.086 to 0.49 cGy/hr, than at rates usually associated with conventional cancer radiotherapy. A fourth point must be made to place these observations into a clinical context. There is a dramatic difference in cellspecific variation between human tumor cell lines observed by Joiner and his colleagues (Marples et al, 1997; Short et al, 1999; Joiner et al, 2001) and by Williams and his colleagues (unpublished data). In some of these studies, the rate of cell kill can be more effective for dose-rates as low as 2 cGy/hr than for acute irradiation but only in some cell lines. In other cell lines this dose-rate is completely ineffective. Joiner and his colleagues suggest this response to low dose-rate correlates with cell susceptibility to induced hypersensitivity by low acute doses (< .05 Gy). Thus, there seems to us to be a strong imperative for further study of dose-rate as a possible important clinical tool, defining the molecular and cellular characteristics that will predict the response of tumor cells to lower dose-rates. Selecting an appropriate dose rate and dose per fraction would, of course, be important. It has been proposed that a minimum dose-rate effect is most likely to occur within the range of 0.06 to 0.6 Gy/hr (Vilencheck and Knudson, 2000). Table 2 presents examples of studies in which an inverse dose-rate effect has been observed with protracted exposure to low-linear energy transfer (LET) radiations such as x-rays and !-rays.

3. Radio-adaptation augmentation

and

lymphoma (Ishii et al, 1996b) and increase the number of cells needed to produce a progressively growing tumor (Sakamoto et al, 1987). The low-dose radiation-initiated immune augmentation appears to be related to enhanced secretion of cytokines needed for immune cell activation (Sherman et al, 1991; Ishii et al, 1996a; Hosoi et al, 2001), increased expression of adhesion molecules that facilitate leukocyte trafficking (Hallahan, 1996; Hallahan et al, 1996, 1997) and preferential destruction of cells with immunosuppressive properties (Tilkin et al, 1981; North, 1986). The rationale for the latter mechanism is based partly on observations that infiltrating tumor-specific T cells are converted from a radiosensitive to a more radioresistant state due to activation by tumor antigens (Dunn and North 1991). Activated lymphocytes have long been known to be more resistant to radiation than their resting (non-activated) counterparts (Anderson and Warner, 1976). Further investigation in this area may contribute to greater efficacy of both localized and more general application of low-dose LDR radiotherapy. It has even been proposed that a radiation regimen could be implemented to enhance response to tumor antigens in individuals immunized with cancer vaccines (Friedman, 2002).

D. Dose-rate in clinical studies Interstitial and intracavitary implantation of radioactive sources (i.e. brachytherapy) was first practiced in the early 1900s and, with the exception of gynecologic malignancies, abandoned owing to poor results. However, recent improvements in placement and imaging have generated renewed interest in this form of radiotherapy. Brachytherapy is an extremely important model to consider the effectiveness of LDR irradiation. Brachytherapy delivers a mixture of dose-rates from HDR to LDR to VLDR. It can deliver very high total doses that are supra-lethal to tumor volumes immediately contiguous to implanted sources and failure of brachytherapy is usually attributed to tumor volumes on the periphery of the irradiated volume that escape lethal exposure. Although peripheral volumes receive essentially lower dose-rate irradiations (Lichter, 2000), there is little or no evidence to indicate that susceptibility of the peripheral cells to acute external-beam radiation treatment is altered. Radioimmunotherapy, involving infusion of radiolabelled monoclonal antibodies (Mab), is experiencing renewed interest. Many Mab conjugated to radionuclides such as 111In and 99mTc have already been approved by the Food and Drug Administration (FDA) for tumor imaging and conjugation to high-energy therapeutic radionuclides such as 131I or 90Y has resulted in some success. Thus, it appears that radiolabelled Mab could be exploited to concentrate low doses of LDR radiation to tumors (Knox et al, 1990, 1993; Kroger et al, 2001; Eriksson et al, 2003; Hernandez and Knox 2003) and to induce low dose-rate effects that would increase the efficacy of focal external beam therapy. It is clear that a better understanding of the key mechanisms responsible for both tumor and normal cell responses to low-dose protracted irradiation is needed before widespread clinical application can be seriously contemplated. This most

immune

Studies of low-dose total-body irradiation (TBI) with external beam sources suggest that additional benefit may be gained through up-regulation of immunological mechanisms that contribute to the overall anti-tumor effect. Pre-clinical reports indicate that low doses of TBI can significantly delay tumor growth (Anderson et al, 1982), decrease incidence of lung metastases (Hosoi and Sakamoto 1993), decrease incidence of spontaneous 109

Gridley et al: Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? Table 2. Studies in which an inverse dose-rate effect has been reported after low-LET irradiation Cells L5178Y (also known as LY-R) cells WI-L2-NS cells V79 cells (and sublines including V79-S85) TK6 cells

HeLa cells T98G cells A7 cells PC-3 cells DU145 cells RKO cells R1 cells

PC-3 cells PPC-1 cells TSU-Pr1 cells NHK 3025 cells U251 cells U87 cells Bp8 cells

38C13 tumor Lewis lung carcinoma (LLC)

Description mouse lymphoma/ leukemia cell line human lymphoblastoid cell line Chinese hamster lung fibroblast cell line human lymphoblastoid cell line human cervical carcinoma cell line human glioblastoma human glioblastoma human prostate cancer cell lines human prostate human colon cancer cell lines rat rhabdomyosarcoma cell line

human prostate cancer cell lines human cervical carcinoma cell line human glioblastoma cell lines mouse ascites sarcoma cell line

mouse B cell lymphoma mouse lung carcinoma

Endpoints HPRT mutations

Dose rate 0.006 Gy/hr

HPRT mutations

0.1998 Gy/hr

mutations that induce 6-thioguanine resistance HPRT mutations

0.0045-0.029 Gy/hr

0.027 Gy/hr

Amundson & Chen 1996

survival of single cells

0.37 Gy/hr

clonogenic survival

<1 Gy/hr

Mitchell JB et al, 1979 Mitchell CR et al, 2002

clonogenic survival

0.094 Gy/hr

Collis et al, 2004

lipid peroxidation, DNA damage, cell morphology (micronuclei, apoptosis, necrosis) clonogenic survival

4.26 Gy/hr

Przybyszewski et al, 2002

0.25 Gy/hr

DeWeese et al, 1998

clonogenic survival

<0.86 Gy/hr

Furre et al, 1999

clonogenic survival

<0.49 Gy/hr

Marin et al, 1991

flow cytometry: mitotic index, total tumor cell no., cell cycle analysis tumor growth

1.11 Gy/hr

Cao et al, 1983

0.183 Gy/hr

micronuclei (apoptosis) of LLC cells in vitro after tumor irradiation

20.4 Gy/hr

Knox et al, 1990, 1993 Widel & Przybyszewski 1998

certainly also holds true for the immune-related mechanisms that are triggered by radiation exposure.

References Furuno-Fukushi et al, 1988 Colussi & Lohman 1997 Crompton et al, 1990

reported variability and sometimes contradictory results make generalizations difficult. Selected relevant publications are summarized on the basis of tumor type in the following sections.

II. Dose-rate effects on malignant cells As noted above, evaluation of dose-rate effects on the survival of tumor cells began more than 40 years ago. Some of the early findings are described in detail in publications from the 1980s and 1990s (Kelland and Steel, 1986; Steel et al, 1987; Steel, 1991, 1996). Dose rate dependence has been noted for some, but not all, of the malignant cell populations that have been tested. The

A. Brain tumor In 2004, 18,400 new cases of brain and other nervous system cancers and 12,690 deaths were estimated to have occurred in the United States (Jemal et al, 2004). Although not among the most common neoplasms, high-grade malignant tumors of the brain are among the most deadly 110

Cancer Therapy Vol 3, page 111 and also among the most radioresistant type of cancer. The radioresistance has been well documented in reports of local recurrence within the targeted volume even after relatively high radiation doses (Wallner et al, 1989). Proposed mechanisms that may account for the resistance include radiation-induced up-regulation of antioxidant enzymes within the tumor cells (Lee et al, 2004), overexpression of epidermal growth factor receptors (EGFR) (Barker et al, 2001) and low expression of bax, a pro-apoptotic protein (Shu et al, 1998; Streffer et al, 2002). In addition, the possibility of tumor escape from immune surveillance by the production of transforming growth factor-"2 (TGF-"2), a highly immunosuppressive cytokine that is secreted by the majority of glioblastomas, is under investigation (Kingsley-Kallesen et al, 2001; Strege et al, 2004). Although TGF-"2 was not tested for, the pattern of cytokine mRNA expression in five human glioblastoma cell lines has been shown to be dependent upon radiation dose rate (Ross et al, 1997). Dose rates of 0.0035 Gy/min and 0.01 Gy/min generally reduced the mRNA levels for IL-1" and IL-6 compared to unirradiated control cells. On the other hand, exposures at 0.041 Gy/min and 2 Gy/min increased mRNA for both cytokines. This study also showed that the 0.041 Gy/min intermediate dose rate was less toxic than the lower and higher dose rates. Although cytokine gene expression did not have a clear effect on glioblastoma cell survival in this in vitro study, the investigators speculated that tumorderived cytokines may be important to radiation response in vivo by affecting immune cells, tumor stroma, vasculature, or surrounding tissues. The response of five human glioblastoma cells lines (T98G, A7, U87MG, U138 and HGL21) and one grade III astrocytoma cell line (U373) to low-dose radiation was investigated in culture (Short et al, 1999). All of these cell lines had been previously shown to be relatively radioresistant. Clonogenic survival was the measured end point after single doses of X-rays (0.05 to 5 Gy) were applied to the cells at 0.2 - 0.4 Gy/min. Low-dose hypersensitivity (i.e. less clonogenic survival than is predicted by a linear-quadratic fit to higher doses) was observed in five of the six cell lines below a total dose of 1 Gy, with the most dramatic effect occurring with the A7, U138 and T98G cells; no hypersensitivity was noted for the U373 astrocytoma cells. Lack of an inverse dose-rate effect on U373 cell survival has also been reported in other studies (Mitchell et al, 2002). Overall, this work supports the premise that low-dose hypersensitivity is a common, although not universal, feature of radioresistant human glioma cell lines. It also suggests that repair mechanisms induced by high, but not low, radiation doses may be an important component of tumor radioresistance. Large, acute doses may generate damage above a certain threshold that is needed to activate repair processes that are more efficient than those that function in constitutive DNA maintenance. However, recent studies by Marples and colleagues, in which a flow cytometry-based clonogenic survival assay was utilized to assess responses of hamster V79 and human T98G and U373 cells, have demonstrated that low-dose hyper-radiosensitivity exists for asynchronous and G2-phase enriched cell populations

(Marples et al, 2003). These findings indicate that the underlying mechanism for increased radiosensitivity at low doses may be a consequence of radiation-damaged G2-phase cells entering mitosis prematurely, rather than induction of DNA repair. These and similar data suggest the possibility that delivering a series of small doses per day (â&#x20AC;&#x2DC;ultrafractionationâ&#x20AC;&#x2122;) could result in increased destruction of radioresistant tumors compared to the same total dose given in conventional 2 Gy fractions (Marin et al, 1991; Short et al, 2001). Results for most human tumor cell lines indicate that increased sensitivity per unit dose occurs when radiation is delivered acutely within the range of 0.05 Gy to 0.5 Gy/fraction (Joiner et al, 2001). In a follow-up publication, the effect of ultrafractionated radiation on A7 glioma growing subcutaneously (s.c.) in athymic nude mice was determined (Krause et al, 2003). The A7 cells were among those that had previously shown a striking increase in radiosensitivity with ultrafractionated irradiation in vitro. Tumors were irradiated either with 126 fractions at 0.4 Gy/fraction or with 30 fractions at 1.68 Gy/fraction over a period of 6 weeks. A total dose of 50.4 Gy was delivered to both groups of animals. No increase in radiosensitivity was evident with ultrafractionation. In fact, a significant decrease in tumor growth delay occurred with ultrafractionation compared to the more conventional 1.68 Gy/fraction. The investigators noted that simplistic extrapolation from data obtained in vitro is not sufficient to predict the outcome in vivo and that comprehensive evaluation of new treatment options in animal models is essential before contemplating translation to the clinic. Other investigators have also noted lack of correlation between human glioma cell lines when exposed to fractionated radiation schemes in vitro and when treated as xenografted tumors in athymic rodents (Baumann et al, 1992), as well as increasing glioma cell survival as the radiation dose rate is reduced (Yang et al, 1990). In one of these studies, Yang and colleagues evaluated 16 clones of an early-passage human glioma cell line (IN859) based on DNA content, modal chromosome number, morphology and radiosensitivity (Yang et al, 1992). The radiation dose that gave a survival fraction of 0.01 varied by a factor of ~1.5. Comparison of the most sensitive and most resistant clones at a fixed total dose surprisingly demonstrated that the sensitive clone exhibited greater survival after split-dose irradiation. Finally, with T98G glioblastoma cells, a sparing effect was noted when the dose rate was reduced from 60 cGy/hr to 30 cGy/hr (Mitchell et al, 2002). The above findings, although somewhat disappointing, certainly do not disprove the existence of low-dose hyper-radiosensitivity for tumors originating in the CNS. In a very recent study by Chalmers and colleagues, the effects of four different poly(ADP-ribose) polymerase-1 (PARP-1) inhibitors on low-dose (0.5 â&#x20AC;&#x201C; 0.3 Gy) radiosensitivity were evaluated using T98G and U373-MG human glioma cell lines (Chalmers et al, 2004). Hamster fibroblasts (V79-379A and CHO-K1) and mouse embryo fibroblasts (3T3) were also included in this study. Inhibition of PARP-1 resulted in sensitization of the glioma and most of the other cell lines to the low-dose

111

Gridley et al: Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? radiation; the only exception was the mouse 3T3 fibroblast line (i.e. PARP-1 knockout cells). The investigators suggested that PARP-1 inhibitors may be therapeutically valuable in radiotherapy regimens that consist of multiple small doses or continuous LDR radiation because of the enhanced inhibition of PARP-1 on rapidly dividing tumor cells. PARP-1 is an enzyme that binds rapidly to singleand double-stand DNA breaks and modulates the activity of many nuclear proteins (Dâ&#x20AC;&#x2122;Amours et al, 1999; Herceg and Wang, 2001). Deficiency in PARP-1 results in severely impaired base excision repair and genomic instability in response to low-dose radiation (Shall and de Murcia, 2000). An encouraging in vivo study by Williams and colleagues combined ULDR radiation together with HDR radiation using athymic mice that were s.c. implanted with U251 human malignant glioma cells (Williams et al, 1998). The ULDR radiation was delivered locally as intratumorally implanted 125I seeds (0.05 Gy/hr) or from an external 137Cs source (0.037 Gy/hr) that provided wholebody exposure. The external beam HDR radiation treatments were initiated 3 days later and consisted of 2 Gy x 8 daily fractions and 5 Gy x 2 daily fractions. These time-dose regimens were selected because they are clinically feasible and because previous experiments predicted equal growth delay of the tumor. The ULDR radiation alone had little or no effect on tumor progression and the two HDR external beam schedules resulted in a 20-25 day growth delay. However, the continuous administration of ULDR radiation with either 125I seeds or whole-body exposure to 137Cs significantly increased efficacy of the HDR treatments. A delay of 33-35 days in growth of the glioma was obtained with the combination treatments. 125 I seed implants together with fractionated HDR external beam radiation have been explored in treating patients with malignant brain tumors. In one study, a comparison was made between temporary 125I implants with a dose rate of 0.4 Gy/hr (total dose was 60 Gy) and permanent 125I seeds with a dose rate of 0.04 - 0.07 Gy/hr (total dose was 100-120 Gy); the two protracted regimens were delivered concurrently with external beam radiotherapy to a total of 50 Gy (Zamorano et al, 1992). The investigators concluded that use of either of these implants together with external radiation seemed to offer the best chance for long-term survival without deterioration of the clinical condition. In another report, 48 patients (after brain tumor resection) received permanent low-activity 125I implants together with conventional external beam therapy; 38 of these subjects were implanted 1-2 weeks before external beam treatment was initiated and 10 received external radiation before the implant (Fernandez et al, 1995). At the time of publication, median survival was greater than 31 months for patients with anaplastic astrocytoma and greater than 23 months in cases of glioblastoma. These are promising results, since median survival after sequential conventional radiotherapy and HDR temporary 125I implantation is only ~22 months (Scharfen et al, 1992).

B. Prostate tumor Adenocarcinoma of the prostate is the leading cancer diagnosed and the second most common cause of cancerrelated mortality in males residing in the United States. According to estimates of the American Cancer Society, there were approximately 230,110 newly diagnosed cases of prostate cancer and 29,900 deaths due to the disease in 2004 (Jemal et al, 2004). Most patients presenting with prostate cancer have localized disease and are candidates for radiation therapy. Exposure to fractionated HDR radiation is a standard treatment for localized prostate cancer. With conventional radiation time-dose regimens, historical local recurrence rates range from 25% to 62%, leaving considerable room for improvement. Protocols that increase local control are likely to be very important in mitigating the subsequent development of distant metastases and prolonging survival (Fuks et al, 1991; Kaplan et al, 1994). The still relatively high incidence of side effects (e.g. proctitis, rectal bleeding, increased urinary frequency, urethral stricture and gastrointestinal complications) is also a major concern. Studies describing tumor cell responses to LDR/HDR radiation combinations present the possibility that radiotherapy of prostate cancer could be substantially improved. Most prostate cancer cell lines require relatively large doses of HDR radiation to produce significant cell death (Wollin et al, 1989; Smalley et al, 1991; Kaver et al, 1991; Leith et al, 1993; Leith, 1994). Prostate cancer cells subjected to a single acute dose of 2 Gy (a commonly used dose/fraction in prostate cancer radiotherapy) generally have a survival fraction of approximately 0.56 (DeWeese et al, 1998), whereas the survival fraction of the more radiosensitive lymphomas is often <0.35 under similar conditions (Jones et al, 1973; Malaise et al, 1986). A study by DeWeese and colleagues showed that the LNCaP prostate cancer cell line with wild type p53 is relatively sensitive to killing by LDR radiation (0.25 Gy/hr), but that protracted exposure does not result in increased killing compared to fractionated HDR exposure (1 Gy/min) (DeWeese et al, 1998). On the other hand, PC3 cells, a human prostate cancer cell line with mutant p53, were relatively resistant to LDR radiation, but a higher fraction were killed with protracted LDR exposure than with fractionated radiation delivered at a high-dose rate. It was also found, using flow cytometry analysis, that LDR irradiation of LNCaP cells resulted in their accumulation at both G1/S and G2/M cell cycle transition points, whereas PC-3 cells were arrested only at G2/M. The investigators concluded that, rather unexpectedly, the radiation-induced cell cycle distribution pattern (G1/S and G2/M versus G2/M alone) seemed to have little effect on survival after irradiation at low-dose rates. TP53 gene status also appeared to play no significant role. In another study, these same investigators found that two related sublines exhibited different cell cycle phase distributions, but similar degrees of increased radiosensitivity after LDR irradiation (DeWeese et al, 1997). Our pilot experiments comparing the efficacy of photons (60Co !-rays) and protons have demonstrated that human LNCaP prostate carcinoma cells have a significantly lower surviving cell fraction when irradiated with proton radiation (modulated 112

Cancer Therapy Vol 3, page 113 Bragg peak of 250 MeV) than photon radiation at the same physical dose between the range of 2 â&#x20AC;&#x201C; 4 Gy (p = 0.02); by 16 hours DNA synthesis was lower for LNCaP cells irradiated with protons compared to photons (p = 0.01) (Baer et al, 2000). Based on several characteristics, the LNCaP cells resemble prostate tumor cells in patients with localized disease more closely than most other human prostate tumor cell lines in that they: a) are hormone responsive (Newmark et al, 1992); b) possess wild-type TP53 and the level of p53 protein increases upon exposure to DNA-damaging agents (Nelson et al, 1996; Newmark et al, 1992); and c) produce prostate acid phosphatase (PAP) and prostate-specific antigen (PSA) (Gau et al, 1997; Young et al, 1991). Collectively, these observations together with the greater accuracy of proton beams in tumor targeting, support dose escalation with protons in combination with LDR protocols. In a clinical trial at the Mayo Clinic and William Beaumont Hospital, 57 patients with newly diagnosed bulky prostatic carcinoma (9% with stage B2 and 91% with stage C) were treated preoperatively with 5 Gy in one fraction, underwent pelvic lymphadenectomy and received 30-35 Gy from interstitially implantated iridium-192 ( 192Ir) seeds and received 30.6 Gy external beam irradiation in 17 fractions (Stromberg et al, 1994). The radiation from the 192 Ir seeds had an LDR of 0.7-0.8 Gy/hour and was delivered over a period of approximately 3 weeks between the two external beam treatments. The 5-year actuarial survival rate of 85% compared favorably with 5-year survival rates of 58-62% for stage C prostate cancer reported with external beam radiotherapy alone (Hanks et al, 1987; Bagshaw et al, 1990). The 5-year disease-free survival of 63% was similar to that observed after only external beam therapy (Arcangeli et al, 1991; Perez et al, 1988), indicating that distant spread is an important factor in the final outcome. The investigators suggested that the relatively high 5-year actuarial local control rates of 94% and 79.5% (clinical and pathological, respectively) may reflect a higher radiobiologically effective dose delivered to the prostate gland by the 192Ir implants. By modifying the 192Ir implantation technique, the initially high rate of rectal ulceration (24%) was reduced to 13% and only 4.5% of patients required surgical diversion.

Asynchronous and synchronized cervical carcinoma cells have been exposed to 60Co !-rays at 0.33 and 0.86 Gy/hr (Furre et al, 1999). Clonogenic survival data indicated the same degree of radiation sensitivity for exposure periods of less than 20 hr. However, with exposures of >20 hr, a 2-fold greater radiosensitivity was noted and was found to occur when 80% of the cells had accumulated in G2. Thus, in this study of cervical carcinoma cells, an inverse dose-rate effect was demonstrated (i.e. more efficient cell inactivation at lower compared to higher dose rates) when total radiation doses exceeded 7 Gy. Other investigators have also demonstrated that the total dose delivered over an extended time period can influence radiosensitivity (Lamerton and Lord, 1964; Hall et al, 1966). Dose-rate effects on human adenocarcinomas of the uterine cervix (NHIK-3025, HeLa, HeLa S3) and human squamous cell carcinomas (Me180 from the cervix and A431 from the vulva) have been investigated in xenotransplanted athymic mice (van Oostrum et al, 1990). Intratumorally implanted cesium-157 (157Cs; 117 MBq) needles 15 mm in length were used to deliver radiation at 0.5 Gy/hr. Tumor biopsies were taken from 21-160 hr after radiation initiation. One biopsy was taken from tissue that received a 10 Gy dose, whereas other biopsies were taken toward the tumor periphery that had received total doses of 2-9 Gy. Tumors were also exposed to a much higher dose rate of 3-4 Gy/min to total doses ranging from 3-10 Gy using a linear accelerator. Biopsies of these tumors were taken at times corresponding to biopsy times after the 0.5 Gy/hr irradiation. Changes in tumor cell cycle distribution were determined by flow cytometry analysis. All five tumor cell lines were arrested in G2 after the 3-4 Gy/min exposure, whereas only four were arrested in G2 after 0.5 Gy/hr irradiation. Me180 was the exception that accumulated primarily in the S phase. Maximum G2 accumulation was related to cell cycle time and not the dose. Both irradiation conditions resulted in similar changes in cell cycle progression, but a greater maximum G2 accumulation was observed with the higher dose-rate exposure. In a separate experiment, the investigators showed that the enhancement of cells in G2 correlated with radiosensitivity as determined by measurements of delay in tumor regrowth. In another study, the radiation response of three cervical carcinoma cell lines (HX155c, HX156c and HX160c) was compared in vitro and in vivo as xenografted tumors (Tonkin et al, 1989). 60Co !-rays were delivered at continuous rates of 0.03 â&#x20AC;&#x201C; 0.05 Gy/min and 0.7 â&#x20AC;&#x201C; 1.0 Gy/min. Two of the three cell lines showed significant low-dose sparing in vitro and there was a tendency for the in vivo tumors to reflect a similar pattern. However, there was less tumor growth delay in vivo than that predicted from the in vitro data. The effects of protracted radiation delivered by Mabs conjugated to radionuclides are being explored in combination with HDR external beam radiation in preclinical studies of gynecological tumors. This technique is also known as radioimmunotherapy. Success with this combination treatment was demonstrated in a recent study by Eriksson and colleagues utilizing athymic mice with

C. Cervical carcinoma In the United States, cervical carcinoma and other cancers of the female genital system accounted for about 82,550 new cases and 28,720 deaths in 2004 (Jemal et al, 2004). High-grade, advanced and/or recurrent gynecological malignancies tend to have a poor prognosis. They are difficult to cure with conventional external irradiation or any other therapeutic modality. Thus, patients with gynecological cancers are often selected for HDR, pulsed-dose-rate and other variations of brachytherapy (Jensen et al, 1998; Lessard et al, 2002; Rose, 2003). A regimen that includes low-dose protracted exposure has reportedly been beneficial in at least some of these cases. Increasing knowledge from pre-clinical studies, some of which are described below, should eventually help refine these protocols in patients.

113

Gridley et al: Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? s.c. implanted human HeLa Hep2 cervical carcinoma cells (Eriksson et al, 2003). Treatments with external beam radiation at 3 x 5 Gy and/or 100 Âľg 131I-labelled Mab against placental alkaline phosphatase or 131I-Mab against cytokeratin were administered separately or in combination; specific activity of the Mab was 120-200 Mbq/mg antibody. Although tumor growth retardation was observed with both external beam and the radiolabelled Mab, combination treatment enhanced the therapeutic effects further, resulting in a significant reduction in tumor volume. The long-lasting tumor growth inhibition was related to increases in tumor necrosis and apoptosis. The investigators suggest that this combination approach could increase therapeutic efficiency for epithelial cell-derived tumors in general.

dose rate-independent group are known to be involved in cell cycle regulation, whereas the majority of those in the dose rate-dependent cluster have roles in apoptosis. The findings were consistent with the significant decline in the percentage of apoptotic cells with decreasing dose rate that was observed with fluorescence microscopy. In spite of this, the investigators stated that for the majority of genes responding to low doses of radiation, a protective doserate effect does seem to apply in the case of this human myeloid leukemia cell line. A slight, but statistically significant, increase in survival has also been reported for LX830 mouse leukemia cells with dose rates decreasing from 30 mGy/hr to 6.2 mGy/hr (Furuno-Fukushi and Matsudaira, 1989). In this latter study, no differences in mutation frequency were associated with dose rate. Other investigators have found little or no dose-rate effects on survival of repair-deficient mutants such as mouse lymphoma LYS-s, xrs5, xrs6 and irs20 cells (Evans et al, 1985; Nagasawa et al, 1989; Stackhouse and Bedford, 1993).

D. Leukemias and lymphomas Approximately 110,960 individuals were newly diagnosed and 55,100 deaths occurred in the United States in 2004 owing to hematological malignancies (Jemal et al, 2004). Collectively, leukemia, lymphoma and multiple myeloma represent the fourth most common form of cancer. Current radiation and multiple-agent chemotherapy regimens can be curative in a substantial percentage of patients with certain forms of these diseases. Nonetheless, more children die of leukemia than any other disease and the death rates for non-Hodgkinâ&#x20AC;&#x2122;s lymphoma and multiple myeloma are increasing in the U.S.A. It seems possible that implementation of LDR radiation may be beneficial in at least some of these cases. In some studies of hematological malignancies, the apoptotic effect of protracted radiation has been demonstrated to be independent of p53 status. In one of these investigations, the Raji model that mimics therapyresistant human lymphomas with mutant p53 and increased bcl-2 expression was used (Kroger et al, 2001). Athymic nude mice bearing Raji lymphoma xenografts were treated with 67Cu-2IT-BAT-Lym-1 antibody (335500 ÂľCi) and observed for toxicity and tumor response for 84 days. Subsets of animals were euthanized at 3, 6 and 24 hr after therapy so that tumors could be examined for evidence of apoptosis and for p53, bcl-2, p21, GADD45, TGF-"1 and c-myc gene expression and protein level. Apoptosis was greatly increased in the treated xenografts, whereas bcl-2 gene and protein expression were substantially decreased. These changes occurred despite only modest cumulated radiation doses of approximately 0.56 Gy at 3 hr. Apoptosis preceded tumor regression by 4-6 days and 29% of the tumors were cured by cumulated tumor doses of ~18 Gy. Amundson and colleagues have studied gene expression patterns following LDR and acute !-irradiation of the human ML-1 myeloid leukemia cell line (Amundson et al, 2003). ML-1 cells have wild type p53 and are relatively responsive to ionizing radiation in that gene expression changes have been induced with as little as 0.1 Gy. The study evaluated a wide range of genes by cDNA microarray after irradiating the ML-1 cells at dose rates of 0.0028 Gy/min to 2.9 Gy/min, with total doses ranging from 0.02 Gy to 0.5 Gy. Two major clusters of genes were radiation-induced. The majority of genes in the

E. Other tumor types In a study by Williams and co-workers, four human tumor cell lines were evaluated in colonial survival assays after exposure to protracted irradiation: colon (GEO and LS174T), squamous cell (SQ-20B) and hepatocellular (HepG2) carcinoma (Williams et al, 1992). Analysis of cell survival data was performed using a 7-parameter simulation model (Dillehay, 1990). Tritiated water added to cell culture media was used for ULDR irradiation according to the formula 0.08 mCi/ml = 0.01 Gy/hr, whereas HDR radiation at 1.1 Gy/min was administered using a !-ray irradiator. Data for three of the cell lines (GEO, LS174T and SQ-20B) showed diverging rates of cell kill per unit dose of HDR radiation. With protracted irradiation, inactivation rates diverged at low doses, but tended to converge at higher doses. The HepG2 cells, tested only with LDR radiation at 0.03 Gy/hr, exhibited no redistribution in the cell cycle after 24, 48, or 72 hours of exposure. Neuroblastoma is a common malignancy of early childhood, most often arising from the adrenal medulla. A study of two human neuroblastoma cell lines (HX138 and HX12) demonstrated no dose-rate effects above 0.02 Gy/min (Holmes et al, 1990). In addition, when the dose rate was reduced below 0.02 Gy/min, both cell lines exhibited increased survival. Clonogenic survival and double-strand DNA breaks were examined in the RT112 human bladder carcinoma cell line using radiation dose rates ranging from 0.01 Gy/min to 1.28 Gy/min (Ruiz de Almodovar et al, 1994). Immediately after irradiation, cell survival increased with decreasing dose rate, as did the number of double-strand breaks measured by pulsed-field gel electrophoresis. However, when a 4-hour repair period was allowed after exposure, all dose rates resulted in approximately the same amount of damage. The investigators concluded that the level of un-rejoined double-strand DNA breaks did not correlate with survival at different dose rates, when detected by this particular gel electrophoresis technique.

114

Cancer Therapy Vol 3, page 115 Tumor cells vary in terms of their radiosensitivity dependence on cell cycle distribution, as well as expression of pro-apoptotic genes (Grdina, 1980; Keng et al, 1984; Brock et al, 1987). In the case of some tumor cell types, the degree of radiosensitivity has been associated with levels of pro-apoptotic proteins such as p53 and bax. Ohnishi and collaborators found that cultured human squamous carcinoma cells primed with !-radiation at 0.001 Gy/min to a total dose of 1.5 Gy and then challenged with !-rays at 1 Gy/min exhibited decreased apoptosis and depressed accumulation of p53 and bax (Ohnishi et al, 2001). A recent study by Furre and co-workers investigated the radiosensitivity of T-47D human breast cancer cells (Furre et al, 2003). 60Co !-rays were delivered at dose rates of 0.37 and 0.94 Gy/hr; cell survival was quantified by the colony formation assay. No increase in radiation sensitivity was noted when the T-47D cells were accumulated in G2 (i.e. no inverse dose-rat effect). Irradiation at both dose rates resulted in nearly the same degree of radiosensitivity. Two-parametric flow cytometry analysis for presence of the retinoblastoma (Rb) protein and DNA content revealed that ~15% of the cells in G2 had the Rb gene product bound in the nucleus. The investigators proposed that the Rb protein could play a role in protecting the G2-arrested cells against radiationinduced death. In a study of TP53 gene mutational status and expression levels of related genes (p21, GADD45 and bcl-2), HBT 3477 human breast carcinoma cells were xenotransplanted into immunodeficient mice (Winthrop et al, 1997). The animals were injected with 260 ÂľCi of yttrium-90 (90Yt)-DOTA-peptide-ChL6 (Y-90-ChL6), before and after tumor cell implantation and then euthanized at 3, 24 and 48 hr later. Tumor growth rate was also determined. The investigators found that tumors regressed 4-7 days after treatment with Y-90-ChL6, resulting in a 79% tumor response that was due to p53independent apoptosis. In addition, down-regulation of bcl-2 appeared to be the key to the apoptotic response induced by the relatively low dose-rate radioimmunotherapy. Induction of micronuclei was used as an indicator of apoptosis in Lewis lung carcinoma (LLC) subjected to !radiation dose rates of 0.34 Gy/min and 1 Gy/min while growing in mice (Widel and Przybyszewski, 1998). Tumors were excised, cultured in vitro and scored for micronuclei at 24-hour intervals. In the range of 0 to 6 Gy, the frequency of cells containing micronuclei was linearly dependent on dose. However, an inverse dose-rate effect was evident, with the lower dose rate resulting in a higher frequency of micronuclei per cell than the higher dose rate. Since the difference in exposure times between the two dose rates was not great, the investigators speculated that a differential radiation effect on cell kinetics during tumor irradiation could not explain the results. Rather, it appeared possible that the differential effect was dependent upon division delay and redistribution of cells in the phases of the cell cycle during in vitro incubation. In other words, they hypothesized that more cells in the higher dose-rate group died in culture because of interphase death than in the lower dose-rate group and

hence the cells were no longer available for the micronucleus assay.

III. Dose-rate effects on normal cells Normal cells respond to ionizing radiation with a delay in progression through the cell cycle so that DNA damage can be repaired before DNA replication and mitosis take place. The delay decreases the chance that genomic instability or mutant phenotypes will appear among the cell progeny. However, if the damage is too extensive, the cell will be eliminated because of postmitotic or apoptotic death. Surviving cells reenter the cell cycle after various lengths of time, depending upon the radiation dose and the specific cell type involved. The delay occurs primarily in the G2 phase, although radiation can also delay cells in G1 and S. Expression of the TP53 tumor suppressor gene is especially important in these events (Grdina, 1980; Keng et al, 1984; Rauth, 1992; Bristow et al, 1996). If TP53 is lacking or is functionally deficient, survival of cells with DNA damage and thus also risk for subsequent malignancy, is increased (Kato et al, 2002). However, the degree of radiosensitivity varies substantially among normal cell populations, especially under conditions of protracted low-dose exposure.

A. Radiation-induced normal toxicities during radiotherapy

tissue

1. Acute versus late effects With conventional radiotherapy protocols, both acute and late toxicities are possible (Lichter, 2000; Yamada et al, 2000; Gopal et al, 2001). Acute effects, seen during and up to 3 months following the end of treatment, occur primarily in rapidly proliferating tissues such as the skin, bone marrow and mucosa of the oropharynx, gastrointestinal tract, rectum and bladder. Erythema, esophagitis, pneumonitis, diarrhea, dysuria and leukopenia are among the most common manifestations. Late effects occur 3 months or longer after the end of radiotherapy and can involve virtually any organ or tissue. Most late reactions include progressively increasing fibrosis, blockage of blood vessels resulting in tissue anoxia and/or ulceration. Late effects are generally more serious and more difficult to manage than the acute toxicities. Eventually, death may occur due to organ failure or other complications. Development of secondary tumors within the irradiated volume is another consequence of radiotherapy that is likely to become more prevalent with increasing survival of cancer patients (Schneider et al, 2000; Strojan et al, 2000; Kranzinger et al, 2001).

2. Total-body irradiation (TBI) Injury to normal lung tissue and the gastrointestinal tract (GI) remains a major problem after totalâ&#x20AC;&#x201C;body irradiation (TBI) in bone marrow recipients with refractory hematological malignancies and serious immunodeficiencies (e.g. severe combined immunodeficiency disease). It was proposed several decades ago that radiation-induced lung toxicity may be ameliorated by the use of continuous protracted or fractionated radiation, since repair of sublethal damage is greater for the lung and 115

Gridley et al: Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? GI tract than for hematopoietic tissue and probably also leukemic cells (Dutreix et al, 1981). Many preclinical studies have employed localized lung irradiation, rather than TBI. In a study with mice, radiation was delivered to the upper body at dose rates ranging from 0.02 to 1.0 Gy/min (Down et al, 1986). A continuous increase in normal tissue tolerance was observed for early radiation-induced pneumonitis with decreasing dose rate, but a less pronounced sparing effect was noted for late complications. To evaluate the effects of adriamycin on radiation-induced pulmonary and upper GI tract toxicity, the thoracic region of mice was irradiated at dose rates of 0.05, 0.15 and 0.70 Gy/min (Sherman et al, 1982). The beneficial effect of the lower dose rates was markedly diminished, although still evident when the drug was administered pre-irradiation. In other words, this study showed that adriamycin can significantly increase the oral esophageal and pulmonary toxicity of radiation and can almost abrogate the sparing effect of dose rate. In a mouse model of bone marrow transplantation, Safwat and colleagues compared TBI delivered at a rate of 0.08Gy/min with TBI administered at a rate of 0.71 Gy/min, both with and without cyclophosphamide (Safwat et al, 1996). The drug was administered 24 hr before irradiation and the transplant was performed 4-6 hr after the last treatment. Lung damage, assessed using ventilation rate and mouse lethality, was decreased using the lower dose-rate regimen. However, administration of the drug markedly facilitated the TBI-induced damage. Somewhat unexpectedly, the combination of protracted radiation plus drug was found to be more toxic than acute radiation plus drug. In another study, mice given cyclophosphamide before thoracic irradiation at dose rates ranging from 0.05 Gy/min to 1.0 Gy/min developed pneumonitis at 4-9 weeks post-exposure (Lockhart et al, 1986). Without the drug, pneumonitis appeared at 14-16 weeks, regardless of radiation dose rate. In a rat model of TBI, fractionation had little effect on bone marrow ablation, but resulted in increased gastrointestinal and renal tolerance (Moulder and Fish, 1989). Results from studies in patients receiving various TBI regimens in association with bone marrow or stem cell transplantation have generally supported use of LDR or increased fractionation as a means to minimize normal tissue toxicities, increase the total dose of radiation that can be safely delivered and improve tumor control (Evans, 1983; Regnier, 1992; Corvo et al, 1999; Gopal et al, 2001; Song et al, 2003). Radiation therapy at low doses is now commonly employed in cases of chronic lymphocytic leukemia and low-grade non-Hodgkinâ&#x20AC;&#x2122;s lymphoma. The radiation is administered to the entire body at a very low dose per fraction (0.1 to 0.25 Gy) several times a week until a total dose of approximately 1.5 to 2 Gy is reached. Interestingly, the anti-tumor effects have been reported to be more pronounced than what would be expected from direct tumor cell destruction by radiation. It appears that immune enhancement is among the mechanisms by which TBI results in long-term remissions in the majority of patients. Pre-clinical studies have demonstrated that TBI up-regulates immune responsiveness in a number of ways: a) increases IFN-! and IL-2 production; b) increases

expression of IL-2 receptors on T lymphocytes; c) enhances signal transduction in T cells; d) augments T cell proliferation in response to mitogens; e) lowers serum corticosterone and increases catecholamine in spleen; and f) eliminates T cells with immunosuppressive activity (Anderson et al, 1982, 1988; Safwat, 2000a, 2000b). Low-dose TBI has been recently tested in combination with IL-2. In one study, mice were inoculated i.v. with B167F1 malignant melanoma cells on day 0 (Safwat et al, 2003a). A single whole-body dose of 0.75 Gy was administered on day 7; IL-2 was initiated on day 8 and given twice daily for 5 consecutive days. Pulmonary tumors were quantified and examined for tumorinfiltrating cells on day 14. In groups treated with either modality alone, tumor burden was similar to that in nontreated controls. However, the combination of low-dose TBI and IL-2 resulted in a synergistic anti-tumor effect. Natural killer (NK) cells and macrophages were identified as the most likely participants in the highly significant outcome of combination treatment. In a subsequent study of malignant melanoma, these same investigators used two doses of TBI and IL-2 (Safwat et al, 2004). Combining TBI with high-dose IL-2 led to a further significant reduction in tumor and less severe vascular leakage syndrome compared to high-dose IL-2 alone. In this case, therapeutic efficacy was associated with the number of tumor-infiltrating NK cells. The investigators concluded that the combination treatment was not only more effective, but also less toxic than IL-2 alone. Although very few human studies have been conducted in this area, data suggest that low-dose radiation-induced immune defense mechanisms may be operating (Safwat 2003b). Based on these types of data, some have suggested that administration of low-dose TBI may be beneficial for patients with AIDS (Shen et al, 1989; Shen et al, 1997). In contrast, TBI has also been associated with enhanced tumor progression (Duhrsen and Metcalf, 1988; Gridley et al, 1997). The discrepancies in reported data may be related to tumor type and load, as well as the dose rates and total doses of radiation utilized.

3. Central nervous system (CNS) Radiotherapy for neoplasms of the brain inevitably results in some damage to neurons. The damage can trigger a series of events, leading to destruction and malfunction of a relatively large volume of tissue due to secondary degeneration (Ikonomidou and Turski, 1996; Yoles and Schwartz, 1998). Side effects ranging from headaches, dizziness, nausea and cognitive defects to development of secondary CNS neoplasms following treatment remain problematic and are likely to become more obvious with increased survival times (Leibel SA and Sheline 1987; Schultheiss et al, 1995; Strojan et al, 2000; Kranzinger et al, 2001). The success of antiinflammatory drugs such as corticosteroids in controlling edema and increased intracranial pressure suggests that cells of the immune system play a role in the development of at least some of the observed toxicities. Corticosteroids have a number of non-specific anti-inflammatory and immunosuppressive properties including: a) they inhibit

116

Cancer Therapy Vol 3, page 117 neutrophil migration to sites of tissue damage and thus minimize the level of neutrophil-derived vasoactive amines that increase vascular permeability and produce edema; b) they suppress IL-1 production by cells of the monocyte/macrophage lineage, a cytokine that is needed for T cell activation: and c) they impair synthesis and secretion of IL-2 by T lymphocytes, which in turn reduces the ability of the T cells to proliferate and produce proinflammatory cytokines. For many decades, the CNS was considered to be an immunologically privileged site, with little or no interaction occurring between the immune and central nervous systems; if immune activity did occur, it was thought to be detrimental (Streilein, 1993; Popovich et al, 1996). However, a series of recent studies have demonstrated that recruitment of systemic T lymphocytes to the injured site helps the innate branch of the immune system to ward off toxicity (Moalem et al, 1999; Schwartz and Cohen, 2000; Fisher et al, 2001; Kipnis et al, 2001, 2002). In contrast to healthy tissue, the injured CNS is more accessible to circulating lymphocytes because of blood-brain barrier breakdown and expression of adhesion molecules, chemokines and major histocompatibility complex (MHC) class II molecules. The in-migrating T cells belong to the Th1 subset that secretes cytokines such as IL-2 and IFN-!. In addition, they are autoreactive and respond to specific â&#x20AC;&#x2DC;selfâ&#x20AC;&#x2122; antigens (e.g. anti-myelin protein) that are presented to them by activated microglia. Indeed, it has been demonstrated that rats and mice that are either deficient in mature T cells or that lack autoreactive T cells lose their ability to withstand injury to the CNS (Kipnis et al, 2000; Schori et al, 2001). The existence of a protective role for the immune system has been strengthened by the demonstration that passive transfer of a subpopulation of T suppressor cells (i.e. the naturally occurring regulatory CD4+/CD25+ T cells) can eradicate irradiation-induced Th1 cell-derived neuroprotection (Kipnis et al, 2002). Most recently, a study was done to determine whether !-radiation benefits neuronal survival by alterating immune system status (Kipnis et al, 2004). Mice and rats were subjected to optic nerve crush or contusive injury to the spinal cord. Total-body or totallymphoidal irradiation (3.5 Gy) resulted in significant increases in neuronal survival (in some cases more than 3fold) and more rapid recovery from injury. The beneficial effects were noted when radiation was administered up to 3 days post-injury.

with HDR exposure. Since the majority (>60%) of cells irradiated with HDR were in G1 and those irradiated with LDR went through the S-phase and on into G2, the investigators proposed that the difference in mutation size may be related to the stage of the cell cycle. Other studies have demonstrated that decreasing the dose rate results in an inverse dose-rate effect as manifested by increased mutagenesis (Furuno-Fukushi et al, 1988; Crompton et al, 1990; Amundson and Chen, 1996). In contrast, some investigators have reported that protracted radiation exposures protect against mutation induction both in vitro (Evans et al, 1990) and in vivo (Lorenz et al, 1994) or have no significant effect compared to acute irradiation (Furuno-Fukushi et al, 1996). In some cases, discrepancies have been observed between in vitro and in vivo data (Lorenz et al, 1993). Reports by Furuno-Fukushi and colleagues using non-transformed, near-diploid m5S mouse cells demonstrated that cell proliferation during protracted irradiation has a strong influence on mutagenesis (Furuno-Fukushi et al, 1993). In plateauphase cultures, lowering the dose rate from 30 Gy/hr to 13 mGy/hr resulted in an increase in cell survival and a marked decrease in mutation frequency. However, when the cells were in log-phase culture, the magnitude of the dose-rate effect was not nearly as marked, especially when the total dose was below 5 Gy. An interesting study of mutagenesis was recently performed in which chronic low-dose rate !-irradiation was used to mimic the environment experienced by residents during the Chernobyl accident (Wickliffe et al, 2003). Big Blue# mice were exposed to !-rays for 90 days, resulting in a cumulative dose of 3 Gy (0.0014 Gy/hr). No significant increase in mutation frequency was observed in the irradiated mice based on DNA analysis of liver tissue (Big Blue# Transgenic Rodent Mutagenesis Assay System). The above-mentioned studies, as well as others, indicate that variations in experimental conditions may at least partly account for the apparent contradictions that have been noted in radiation-induced mutagenesis. Overall, the preponderance of evidence indicates that the risk for radiation-induced mutagenesis in somatic and germ line cells decreases with decreasing dose rate (Vilencheck and Knudsen, 2000).

B. Radio-adaptive response The consensus that radiation is harmful to normal cells has prevailed for many decades. Among the most serious consequences are immunodeficiency, mutations and development of malignancies such as leukemia and multiple myeloma (reviewed by Dainiak 2002). Numerous studies of radiation-induced chromosomal and DNA aberrations have been performed on lymphocytes and lymphoid cells (Hofer et al, 1994; Kronenberg, 1994; Moiseenko et al, 1997; Wu et al, 1997, 1999; Blakely and Kronenberg, 1998; Durante et al, 1998, 1999, 2000, 2002; Yamada et al, 2000; Gauny et al, 2001; Grosovsky et al, 2001; Holl et al, 2001; Wiese et al, 2001; Schulz-Ertner et al, 2002). These studies have revealed important radiationinduced genomic abnormalities, as well as variations due to differences in radiation quality. Although lymphoid organs have long been known to be highly radiosensitive,

4. Mutations and carcinogenesis Numerous studies of dose-rate effects on mutagenesis have been performed using human and rodent lymphoid cells (Lorenz et al, 1993; Lorenz et al, 1994; Amundson and Chen, 1996; Furuno-Fukushi et al, 1996). The hypoxanthine-guanine phosphoribosyl transferase (HPRT) and thymidine kinase (tk) loci have arguably received the greatest attention. In a study of mutation size at the HPRT locus in human lymphoblastoid WI-L2-NS cells, an inverse dose-rate effect was found after a total dose of 4 Gy (Colussi and Lohman, 1997). Significantly larger deletions were produced by LDR exposure than

117

Gridley et al: Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? the susceptibility of different lymphocyte populations varies greatly, possibly owing to differences in repair mechanisms, maturation stage, activation state and/or innate rate of proliferation (Stefani and Schrek 1964; Miller and Cole, 1967; Anderson and Warner 1976; Anderson et al, 1977, 1988; Prasad 1995). An additional important observation is that irradiation can up-regulate many genes, including some that encode cytokines that can modify cellular responses to radiation (Hallahan et al, 1993; Hallahan, 1996; Barcellos-Hoff, 1998;). It is clear that radiation, when delivered at a slow continuous rate or by fractionation may have strikingly different effects compared to the same dose delivered acutely. Early studies demonstrated that monkeys could tolerate whole-body exposures up to 19 Gy with minimal suppression of the hematopoietic system when the radiation was delivered at a rate of 1 Gy/year (Spalding et al, 1972). The 19 Gy is approximately three times the lethal dose when applied acutely. Soon thereafter, it was reported that protracted radiation exposure may induce beneficial effects (i.e. radio-adaptation, previously known as â&#x20AC;&#x2DC;hormesisâ&#x20AC;&#x2122;) (Anderson and Warner, 1976; Anderson et al, 1977). The radio-adaptive response has gained much attention in recent years because of its obvious importance in setting accurate guidelines for radiation-associated human health risks, in basic radiobiology research and now also in radiation therapy. The phenomenon has been extensively discussed in a number of publications (Bhattacharjee and Ito, 2001; Feinendegen 2003; Pollycove and Feinendegen, 2003). In this review, only a few highlights of special interest are mentioned. Various endpoints have been used to detect and quantify radio-adaptation, including chromosome aberrations (Shadley et al, 1987; Wolff et al, 1988; Sankaranarayanan et al, 1989; Farooqi and Resavan, 1993), mutations and DNA strand breaks (Shadley and Wolff, 1987; Kelsey et al, 1991; Rigaud et al, 1993), micronucleus formation (Azzam et al, 1994) and cell survival (Olivieri et al, 1984; Yoshida et al, 1993; Sasaki, 1995). In many of these studies, low-dose irradiation of lymphocytes has been found to minimize the harmful effects of a subsequently delivered high dose of radiation. For example, although lymphocytes from individuals occupationally exposed to chronic doses of radiation have higher frequencies of spontaneous micronuclei than nonexposed individuals, after 1 and 2 Gy irradiation of the lymphocytes in vitro this frequency is lower for the radiation workers (Gourabi and Mozdarani, 1998). It has also been reported that low-dose irradiation can enhance the production of IL-1 by lipopolysaccharide (LPS)stimulated splenocytes, responsiveness to T cell mitogens (Ishii and Watanabe 1996) and expression of IL-2 receptors on the surface of peripheral blood lymphocytes (Xu et al, 1996). Many of these types of reports indicate that a significant radio-adaptive response is measurable within a few hours after low-dose priming (Farooqi and Resavan, 1993; Ishii and Watanabe, 1996; Park et al, 2000; Venkat et al, 2001). With intact mammalian models, radio-adaptation in immune cells has been shown to protect mice injected with the Friend leukemia virus, a member of the retrovirus

family that includes HIV-1 (Shen et al, 1989; Wolff et al, 1989; Fujiki and Suganuma, 1994). It has also been noted that the onset of thymic lymphoma is significantly delayed in Swiss mice pre-conditioned with 0.01 Gy and then acutely irradiated with 2 Gy (Bhattacharjee, 1996). Similar results have been obtained for acute myeloid leukemia (Mitchell et al, 1999) and some transplanted solid tumors in mice (Bhattacharjee and Sarma, 1999). In one very recent report, mice were subjected to single low-level exposures of 0.1 Gy or 0.2 Gy X-rays and injected i.v. 2 hr later with syngeneic L1 sarcoma cells (Cheda et al, 2004). Pre-treatment with either dose of radiation significantly reduced the number of tumor colonies in the lungs compared to the non-irradiated counterparts. In addition, significantly enhanced NK cell cytotoxic activity was observed in spleens from the irradiated animals and elimination of the NK cells by injection of anti-asialo GM 1 antibody totally abrogated the radiation-induced tumorinhibitory effect. Studies by other investigators support these findings. Suppression of pulmonary nodule development with single doses of X-rays (0.05 Gy to 0.15 Gy) 24 hr before i.v. injection of B16 melanoma and Lewis lung cancer cells has been reported in mice (Cai, 1999). Hashimoto and co-workers have shown that lung and lymph node metastases are decreased and that metastatic foci are infiltrated by lymphocytes in rats exposed to 0.2 Gy !-rays 14 days after s.c. injection of hepatoma cells (Hashimoto et al, 1999). In this latter study, in vitro irradiation of the tumor cells or localized irradiation of tumor in vivo at the same dose did not affect either primary tumor growth or degree of spontaneous metastases. Irradiation of mice with X-ray doses of <0.2 Gy has also been reported to suppress local tumor growth when malignant cells are injected after the radiation exposure (Anderson et al, 1982; Cai, 1999). Some investigators have suggested that the enhanced anti-tumor effect may be related to secretion of TNF-$ and other cytokines by cells of the monocyte-macrophage series that become activated by debris due to radiation-induced damage (Hallahan et al, 1989; Sherman et al, 1991; Weichselbaum et al, 1991). TNF-$ may add to the lethality of radiation because it has both direct and indirect anti-tumor effects. Although radio-adaptation was not specifically addressed, our previous studies have demonstrated that s.c. growth of Lewis lung carcinoma in C57BL/6 mice is consistently slower when the animals are exposed to 3 Gy !-rays 2 hr prior to tumor cell implantation (i.e. representing a small neoplastic focus that appears after the irradiation event has taken place) and that the anti-tumor effect was related to immune enhancement during repair of normal tissue damage (Miller GM et al, 2002, 2003a, 2003b). The data also showed that a dramatic expansion of NK cells occurred in the blood and spleen of tumorbearing animals 10 days after irradiation (28.0 x 105 NK cells/spleen in irradiated mice compared to 8.9 x 105 NK cells/spleen in non-irradiated controls). Enhanced production of IL-12 and IL-18 by spleen cells was consistent with augmentation of the NK cell response. Significant reductions in TGF-"1 and vascular endothelial growth factor (VEGF), both of which are associated with 118

Cancer Therapy Vol 3, page 119 immune suppression, were also noted. Enhanced NK cell activity after total-body irradiation with 0.075 to 0.5 Gy X- or !-rays has been reported by other investigators (Kojima et al, 2002, 2004; Liu et al, 1994). The important role of NK cells in nonspecific immune surveillance against aberrant cells and metastatic growth has been well established (Talmadge et al, 1980; Hanna, 1985; Wiltrout et al, 1985; Moretta et al, 1994; Reyburn et al, 1997; Barao and Ascensao, 1998). These findings are consistent with the radiation-induced â&#x20AC;&#x153;dangerâ&#x20AC;? signal originally proposed by Matzinger in 1994 and recently reviewed by Friedman (2002). Based on studies such as those above, it has been suggested that low-dose whole-body irradiation may be useful in treating some cancer patients (Pollycove and Feinendegen, 2000). However, it should be mentioned that the incidence of radiation-induced carcinogenesis increases in humans when doses exceed approximately 0.3 Gy (Pollycove and Feinendegen, 2003). Radio-adaptation has also been reported in normal cells other than those of the immune system. Broome and colleagues demonstrated that exposure of cultured AG1522 human fibroblasts to total doses ranging from 0.0001 Gy to 0.5 Gy at dose rates ranging from 0.001 to 0.003 Gy/min prior to a challenge dose of 4 Gy !-rays exhibited reduced frequency of micronuclei (Broome et al, 2002). There was no significant difference in the degree of protection induced by the two extremes of total doses used and a similar degree of protection was induced with protracted exposure to !-rays and 3H beta particles. These latter findings demonstrated that doses as low as one track per cell (0.0001 Gy) produced the same maximum adaptive response as did doses that resulted in many tracks per cell (0.5 Gy) and that the two types of radiations were similar in this respect. In addition, induction of radioadaptation in the fibroblasts occurred even when the cells were incubated at 0o C during delivery of the priming dose, a temperature at which DNA repair and other metabolic processes are inactive. In a study of human erythrocytes subjected to !radiation, identical total doses delivered in a single fraction or split into two identical fractions with a 3.5 hr interval between exposures, resulted in a 2.4-fold reduction in hemolysis when the split doses were administered (Koziczak et al, 2003). The results also suggested that the reduced damage to the red blood cells occurred because of a decrease in the level of damage to membrane lipids. An interesting study of genetic damage in erythrocytes in the bone marrow of SHK mice has been recently performed (Zaichkina et al, 2003). The effect of low-dose !-radiation (0.1 and 0.2 Gy total doses at 0.125 Gy/min) on high-dose (1.5 Gy total dose at 1 Gy/min) radiation-induced and spontaneous levels of cytogenetic damage was evaluated over the entire lifetime of the animals. The amount of micronucleated polychromatic erythrocytes in primed, primed and challenged and control groups was assessed at various time points. A single lowdose exposure induced cytogenetic radio-adaptation at 1, 3, 6, 9 and 12 months after priming, regardless of mouse age at the time of priming irradiation. In addition, the lowdose priming exposure resulted in decreases in cytogenetic damage to a level below the spontaneous rate at the end of

the lifetime (20 months) of the animals. These data demonstrated that the mechanisms underlying radioadaptation in erythrocytes protect against chromosome damage induced by high-dose irradiation and appear to also minimize spontaneous mutagenesis during aging. Although the mechanisms underlying radio-adaptive responses remain unclear, a possible scenario has been proposed by Ikushima and colleagues (1996.) and reviewed by Bhattacharjee and Ito (2001). In this model, low dose pre-irradiation damages a small amount of nuclear DNA, ultimately leading to enhanced capacity to repair serious DNA damage induced by a subsequent high dose irradiation event. In support of this possibility are recent studies demonstrating that continuous exposure to X-rays at a low-dose rate leads to no detectable misrejoining of double-strand DNA breaks in cultured mammalian cells (Kuhne et al, 2002). This finding suggests that the probability of inappropriate repair decreases dramatically when the breaks are separated in time and space. Using cell lines deficient in nonhomologous end-joining, the investigators concluded that this is an efficient pathway for correct rejoining of separated broken ends, but that it generates genomic rearrangements if the breaks are close in time and space. In this same study there was no significant decrease in double-strand DNA misrejoining after exposure of the cells to fractionated doses of alpha particles, indicating that radiation quality may be a significant factor in determining whether or not protracted low-dose radiation results in protection. However, the overall evidence for more efficient DNA repair in radio-adaptation is largely indirect and efforts continue to identify other mechanisms. For example, Takahashi et al, reported that splenocytes from C57BL/6N mice primed with whole-body irradiation to a total dose of 1.5 Gy !-rays delivered at a dose rate of 0.001 Gy/min over 25 hr, exhibited significant suppression in p53, bax and apoptosis after a 3 Gy challenge dose of Xrays delivered at a high-dose rate (1 Gy/min) (Takahashi et al, 2001). In subsequent studies, these same investigators demonstrated that the apoptosis induced by acute 3 Gy irradiation was significantly suppressed in the splenic white pulp of wild-type, but not SCID (severe combined immunodeficiency), mice and that DNA-dependent protein kinase activity may play a major role in the radioadaptive response following pre-irradiation at low doses (0.15 - 0.6 Gy) (Takahashi et al, 2002, 2003). Others have reported that protein kinase C-mediated signaling may be a key step for transducing the low dose-induced protective signal (Rigaud and Moustacchi, 1996). Using chromosomal aberrations as the indicator of damage in human lymphocytes, it has been demonstrated that the anti-mutagenic action observed with low-dose irradiation is similar to that seen with interferon pre-treatment (Tskhovrebova et al, 1995; Makedonov et al, 2000). These results suggest that priming with low-dose radiation and the action of IFN-! may induce common pathways of protection. Some reports indicate that reactive oxygen species play an important role in inducing radioprotection. In the body, oxygen radicals are generated not only by the direct effects of ionizing radiation, but also by

119

Gridley et al: Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? inflammatory cells that migrate to the site of tissue damage (Gridley et al, 2005). Feinendegen has recently proposed that the site, type and size of oxygen radical bursts, as well as the time interval between them, may be an integral component of the mechanisms leading to cellular radio-adaptation (Feinendegen, 2002). Reactive oxygen species at low concentrations appear to induce cellular protection, whereas the reverse is true at high concentrations. In a study of bystander effects, Iyer and Lehnert transferred supernatants from human lung fibroblasts (HFL-1) irradiated with a 0.01 Gy dose of !rays to non-irradiated HFL-1 cells (Iyer and Lehnert, 2002). When the unirradiated cells were subjected to 2 and 4 Gy doses of acute !-radiation, clonogenic survival was enhanced. The radio-adaptive bystander effect was preceded by an increase in intracellular oxygen radicals, an increase in the redox and DNA repair protein APendonuclease and a decrease in p53 protein. Studies with plants suggest that exposure to very low-dose-rate !-rays (66 mSv/hr or approximately 66 mGy/hr) leads to an efficient induction of superoxide dismutase and other enzymes that protect against reactive oxygen species (Zaka et al, 2002).

et al, 1998), frequency of T cells capable of secreting type 1 cytokines (Kusunoki et al, 2001), T cell reactivity to mitogens (Akiyama et al, 1983) and T cell response to allogeneic cells (Akiyama et al, 1989). Signs of T cell impairment, including increased reactivation of the potentially oncogenic Epstein-Barr virus (EBV), have been reported in these individuals (Kanamitsu et al, 1966; Kato et al, 1980; Akiyama et al, 1989, 1993). Yamoaka and associates recently demonstrated that A-bomb exposure induced long-lasting deficits in both naĂŻve T helper and T cytotoxic cell populations, along with increased proportions of memory T cells belonging to these subsets (Yamoaka et al, 2004). These findings indicate poor maintenance of T cells that are newly generated post-exposure. Additional data in support of defective T cell activities come from studies of persons exposed to fallout from the nuclear power plant accident at Chernobyl (Lukjanova et al, 1995; Stepanova et al, 1995; Chernyshov et al, 1997). In one of these investigations it was found that long-lasting depletion in the Th1 subset exists concomitantly with excessive proliferation of the Th2 subset and that an activating stimulus may be necessary to reveal radiation-induced immune disturbances (Dainiak, 2002). Studies of Belarussians residing near Chernobyl report differences in gene expression patterns for subjects exposed to >10 mSv compared to those receiving <10 mSv (Karkanitsa et al, 2000). In these investigations, the upregulated genes were primarily those encoding proteins associated with mitotic and apoptotic death in T cells and monocytes. Emphasis has also been placed on radiation-induced mutations that lead to carcinogenesis. In vitro exposure of human peripheral blood lymphocytes to low doses of Xrays (0.25 to 1.5 Gy) at a dose-rate of 1 Gy/min resulted in increased expression of several proto-oncogenes at 5 hr and 17 hr post-exposure (Miller AC et al, 2002). The upregulation was especially striking for c-Haras. The investigators suggested that c-Haras may be useful as an early biomarker indicative of radiation exposure. In Abomb survivors, increased incidence of leukemias, especially chronic myelogenous leukemia (CML) and other myeloproliferative diseases has been reported (Ichimaru et al, 1991). The threshold for CML in Hiroshima is thought to be between 0.09 Gy to 0.5 Gy, whereas for acute leukemia the threshold appears to be approximately 1 Gy. Some epidemiological studies of low-level exposures have concluded that cancer incidence and mortality among residents living in high versus low background areas is not significantly different (Jagger, 1998; Luckey, 1999). The effects of long-term, low-level !-irradiation among individuals exposed in radiocontaminated buildings has also been studied. Increased frequencies of various chromosomal aberrations, especially breakpoints, inversions and translocations on chromosomes 7 and 14, have been reported (Hsieh et al, 2002). This is of interest, since the genes that code for the T cell antigen receptor and the heavy chains of antibodies are found on these two chromosomes. Thus, mutations in these chromosomes could lead to significant immunodeficiency.

C. General population Studies of human populations previously exposed to various radiation doses and dose rates may provide information that is useful in radiotherapy, especially with respect to effects on cells that constitute the immune system. The functions of these cells include continuous surveillance for aberrantly (including neoplastically) transformed cells, as well as destruction of tumor cell targets, and hence they may contribute to the final outcome in radiotherapy patients. In addition, preservation of the bone marrow (hematopoietic system) is of great importance in mitigating the risk for infection, anemia, and other complications in cancer patients. Studies of survivors after accidental irradiation events, such as those that took place at Three Mile Island and Chernobyl (Lenschow et al, 1996; Thompson, 1994), may help elucidate dose and dose rate effects on bone marrow and other normal cells and tissues. Furthermore, in recent years the possibility of radiation exposure due to a nuclear (radiological) terrorism attack has come to the forefront of public and government attention. There is now great urgency to identify the best radioprotectants already available, as well as develop and validate new and better compounds. It is very likely that one or more of these radioprotectants will become incorporated into radiotherapy regimens for normal tissue protection before, during, and perhaps even after treatment to minimize damage due to oxygen radicals released by inflammatory cells. Much attention has been paid to the lymphocytes, especially the T cells, because they regulate the bodyâ&#x20AC;&#x2122;s most sophisticated immune defenses. Loss or malfunction of these cells can lead to dire consequences as exemplified by AIDS patients and organ transplant recipients. Studies of atomic bomb (A-bomb) survivors have revealed significant decreases in mature T lymphocytes, T helper (Th) cells (but not T cytotoxic, B, or NK cells) (Kusunoki 120

Cancer Therapy Vol 3, page 121 Some additional findings indicate that doses as low as 0.05 Gy to 1 Gy increased the incidence of cardiovascular disease in both A-bomb survivors and victims of the Chernobyl accident (reviewed by Trivedi and Hannan, 2004). Furthermore, wounds heal more slowly under conditions of radiation exposure, with the delay in wound healing being related directly to the dose of radiation (Ran et al, 2003; Shi et al, 2003). During wartime, large numbers of military personnel may experience prolonged exposure to radiation that occurs simultaneously with wounding. Astronauts are inevitably exposed to chronic irradiation and may also become injured while on board a spacecraft. Combined injury also occurs when surgery and radiation are used for cancer therapy. The mechanisms by which radiation delays wound healing are not clear, but may include reduction in the number of platelets and inflammatory and other tissuerepairing cells that accumulate at the injured site (Qu et al, 2003).

the significant anti-tumor effect following whole-body irradiation that exceeds what is seen when the same dose is delivered only to the tumor are phenomena that also warrant further investigation. From the information currently available, it appears likely that hyperradiosensitivity and adaptation leading to increased radioresistance are distinct examples of â&#x20AC;&#x2DC;activeâ&#x20AC;&#x2122; responses to low-dose radiation exposure that are associated, at least partly, with the rate of DNA damage and the extent of DNA repair (Joiner et al, 1999; Marples et al. 1997). With the rapid progress currently on-going in elucidating radiation-induced chromosomal events, genes that control DNA repair and signal transduction pathways, incorporation of protracted low-dose radiation in cancer therapy may eventually become common in the clinic. We suggest that the data, when taken in toto, indicate that future application of reduced dose-rates in the clinic may have several important roles: 1) direct tumor cell cytotoxicity that is greater than what is observed with acute irradiation; 2) induced changes that result in greater tumor control by HDR external-beam radiation; 3) radioadaptation in normal cell populations that decrease risk for complications; and 4) up-regulation of anti-tumor immune responses. Increased knowledge of mechanistic effects of reduced dose-rate irradiation on both tumor and normal tissues and the subsequent impact on the therapeutic ratio is needed for future clinical utility. Finally, we accept that the database that we have reviewed is complex and currently it is difficult to proceed to clinical trials with confidence in the application of low dose-rate therapy. However, we do suggest that there are laboratory and clinical research projects that should be undertaken with some priority. First, we need increased knowledge of mechanistic effects of reduced dose-rate irradiation on tumor cells, especially defining the molecular processes that are shared by induced hypersensitivity, adaptive response, and their contribution to cell killing by mitotic and apoptotic processes. Further, it is important that these observations be extended to model tumor systems such as xenografts growing in the nude mouse to determine whether cell-based observations in vitro can be extended to in vivo response of model tumors comprised of cells that do or do not exhibit low dose, low dose-rate radiosensitivity. We think that certain clinical studies should be considered. First, the combination of low dose-rate irradiation delivered by brachytherapy and radiolabelled antibody therapy with external beam high dose-rate radiotherapy is immediately feasible. Second, as soon as variation of response to low dose-rate irradiation and to combined LDR and HDR of brain tumors can be predicted for such tumors with some confidence, then such therapy should be given priority. Also, radioresistant tumors such as certain sarcomas, when located in sites accessible to direct injection of carriers of radionuclides could be considered for LDR/HDR therapy. Last, but not least, a better understanding of the response of normal tissues and the subsequent impact on the therapeutic ratio is needed for future clinical utility.

IV. Conclusions It is often stated that the major goal of cancer radiotherapy is to select a treatment regimen that has the highest probability for uncomplicated cure. A large amount of data suggests that differences in radiosensitivity between tumor and normal cell populations could be exploited to achieve a substantial increase in the therapeutic ratio. The overall implication of the discussed studies is that increased control of at least some types of cancers may be achieved by combining protracted irradiation with standard external beam therapy. However, at this point in time, it is difficult to predict with a high degree of certainty the tumor types for which this treatment approach may be beneficial and those for which the strategy may be a poor choice. Induction of hyper-radiosensitivity in tumor cells by protracted radiation exposure is clearly not a universal phenomenon. In addition, there appears to be lack of a consistent trend in the extent that tumor cells repair sublethal radiation-induced damage compared to normal cells, although a correlation between the degree of sublethal damage repair and radioresistance does appear to exist. Using a series of assumptions and mathematical modeling, Hahnfeldt and Hlatky have demonstrated that there is a tendency toward an inverse dose-rate effect even when heterogenous and cycling cell populations are exposed to low-LET radiations (e.g., photons and protons) in a protracted manner (Hahnfeldt and Hlatky, 1998). However, the mechanisms by which protracted irradiation increases tumor cell radiosensitivity in relation to acute iurradiation remain elusive. A recent publication by Marples and colleagues elegantly summarizes the most pertinent literature in this regard (Marples et al, 2004). The paper also proposes a three-component model consisting of damage recognition, signal transduction and damage repair. Undoubtedly, many questions still remain unanswered. Especially intriguing is why some tumor cells fail to exhibit hyper-radiosensitivity and why there is inconsistency between accumulation in the radiosensitive G2 phase of the cell cycle and hyper-radiosensitivity. The mechanisms underlying the radio-adaptive response and 121

Gridley et al: Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? Immunol Ther Exp (Warsz) 46, 213- 229. Barcellos-Hoff MH (1998) How do tissues respond to damage at the cellular level? The role of cytokines in irradiated tissues. Radiat Res 150(Suppl), S109-S120. Barker FG 2nd, Simmons ML, Chang SM, Prados MD, Larson DA, Sneed PK, Wara WM, Berger MS, Chen P, Israel MA and Aldape KD (2001) EGFR overexpression and radiation response in glioblastoma multiforme. Int J Radiat Oncol Biol Phys 51, 410-418. Bases R, Mendez F, Liebeskind D, Elequin F and Neubort S (1980) DNA of HeLa cells during caffeine- promoted recovery from X-ray induced G2 arrest. Int J Radiat Biol Relat Stud Phys Chem Med 37, 437-445. Bastasch MD, Teh BS, Mai WY, Carpenter LS, Lu HH, Chiu JK, Woo SY, Grant WH 3rd, Miles BJ, Kadmon D and Butler EB ( 2002) Post-nerve-sparing prostatectomy, dose-escalated intensity- modulated radiotherapy: effect on erectile function. Int J Radiat Oncol Biol Phys 54, 101-106. Baumann M, DuBois W, Pu A, Freeman J and Suit HD (1992) Response of xenografts of human malignant gliomas and squamous cell carcinomas to fractionated irradiation. Int J Radiat Oncol Biol Phys 23, 803-809. Baumert BG, Norton IA and Davis JB (2003) Intensitymodulated stereotactic radiotherapy vs. stereotactic conformal radiotherapy for the treatment of meningioma located predominantly in the skull base. Int J Radiat Oncol Biol Phys 57, 580-592. Bedford JS and Hall EJ (1963) Survival of HeLa cells cultured in vitro and exposed to protracted !- irradiation. Int J Radiat Biol Relat Stud Phys Chem Med 45, 377-383. Bedford JS and Mitchell JB (1973) Dose-rate effects in synchronous mammalian cells in culture. Radiat Res 54, 316-327. Bhattacharjee D (1996) Role of radio-adaptation on radiationinduced thymic lymphoma in mice. Mutat Res 358, 231235. Bhattacharjee D and Ito A (2001) Deceleration of carcinogenic potential by adaptation with low dose ! irradiation. In Vivo 15, 87-92. Bhattacharjee D and Sarma HD (1999) Suppression of tumor growth in mice by low dose ! radiation. In: Advances in Radiation Biology & Peace (Goel SC, ed), The U.P. Zoological Society, Muzaffarnagar, India, pp 187-192. Blakely EA and Kronenberg A (1998) Heavy-ion radiobiology: new approaches to delineate mechanisms underlying enhanced biological effectiveness. Radiat Res 150(5 Suppl), S126-145. Bonnet RB, Bush D, Cheek GA, Slater JD, Panossian D, Franke and Slater JM (2001) Effects of proton and combined proton/photon beam radiation on pulmonary function in patients with respectable but medically inoperable non-small cell lung cancer. Chest 120, 1803-1810. Bristow RG, Benchimol S and Hill RP (1996) The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy (review). Radiother Oncol 40, 197-223. Brock WA, Williams M and Bhadkamkar VA (1987) Radiosensitivity testing of primary cultures derived from human tumors. In: Progress in Radio-Oncology III. Vienna, Austria: International Club for Radio-Oncology. (Karcher KH, Kogelnik HD and Szepesi T, eds) pp. 300-306. Broome EJ, Brown DL and Mitchel RE (2002) Dose responses for adaption to low doses of (60)Co ! rays and (3)H beta particles in normal human fibroblasts. Radiat Res 158, 181186. Bush DA, Dunbar RD, Bonnet R, Slater JD, Cheek GA and Slater JM (1999) Pulmonary injury from proton and conventional radiotherapy as revealed by CT. AJR Am J Roentgenol 172, 735-739.

Acknowledgements We thank Larry E. Dillehay, Ph.D., Research Associate and Director of Experimental Radiators in the Department of Radiation Oncology & Molecular Biology at Johns Hopkins School of Medicine for use of data depicted in the figure and William Preston, Ed.D. for expert editorial assistance.

References Akiyama M, Kusunoki Y, Kyoizumi S, Ozaki K, Mizuno S and Cologne JB (1993) Study of the titers of anti-Epstein-Barr virus antibodies in the sera of atomic bomb survivors. Radiat Res 133, 297-302. Akiyama M, Yamakido M, Kobuke K, Dock DS, Hamilton HB, Awa AA and Kato H (1983) Peripheral lymphocyte response to PHA and T cell population among atomic bomb survivors. Radiat Res 93, 572-580. Akiyama M, Zhou O-L, Kusunoki Y, Kyoizumi S, Kohno N, Akiba S and Delongchamp RR (1989) Age- and dose-related alteration of in vitro mixed lymphocyte culture response of blood lymphocytes from A-bomb survivors. Radiat Res 117, 26-34. Amundson SA and Chen DJ (1996) Inverse dose-rate effect for mutation induction by !-rays in human lymphoblasts. Int J Radiat Biol 69, 555-563. Amundson SA, Lee RA, Koch-Paiz CA, Bittner ML, Meltzer P, Trent JM and Fornace AJ Jr (2003) Differential responses of stress genes to low dose-rate ! irradiation. Mol Cancer Res 1, 445- 452. Anderson RE, Olson GB, Autry JR, Howarth JL, Troup GM and Bartels PH (1977) Radiosensitivity of T and B lymphocytes. IV. Effects of whole-body irradiation upon various lymphoid tissues and numbers of recirculating lymphocytes. J Immunol 118, 1191-1194. Anderson RE, Tokuda S, Williams WL and Warner NL (1982) Radiation-induced augmentation of the response of A/J mice to SaI tumor cells. Am J Pathol 108, 24-37. Anderson RE and Warner N (1976) Ionizing radiation and the immune response. Adv Immunol 24, 215- 335. Anderson RE, Williams WL and Tokuda S (1988) Effect of lowdose irradiation upon T cell subsets involved in the response of primed A/J mice to SaI cells. Int J Radiat Biol Relat Stud Phys Chem Med 53, 103-118. Arcangeli G, Micheli A, Arcangeli G, Pansadoro V, De Paula F, Giannarelli D and Benassi M (1991) Definitive radiation therapy for localized prostatic adenocarcinoma. Int J Radiat Oncol Biol Phys 20, 439-446. Archambeau JO, Slater JD, Slater JM and Tangeman R (1992) Role for proton beam irradiation in treatment of pediatric CNS malignancies. Int J Radiat Oncol Biol Phys 22, 287294. Azzam EI, Raaphorst GP and Mitchel REJ (1994) Radiationinduced adaptive response for protection against micronucleus formation and neoplastic transformation in C3H 10T1/2 mouse embryo cells. Radiat Res 38(Suppl), S28-S31. Baer JR, McAllister CJ, Kim DW, Miller GM, Slater JM and Gridley DS (2000) A pilot study comparing the effects of proton and photon irradiation on colony cell survival and 3Hthymidine uptake on LNCaP and LS174T human adenocarcinoma cell lines. Radiol (Suppl) 217, 157. Bagshaw MA, Cox RS and Ramback JE (1990) Radiation therapy for localized prostate cancer. Justification by longterm follow-up. Urol Clin North Am 17, 787-802. Barao I and Ascensao JL (1998) Human natural killer cells. Arch

122

Cancer Therapy Vol 3, page 123 Cai L (1999) Research of the adaptive response induced by lowdose radiation: where have we been and where should we go? Hum Exp Toxicol 18, 419-425. Cao S, Skog S and Tribukait B (1983) Comparison between protracted and conventional dose rates of irradiation on the growth of the Bp8 mouse ascites sarcoma. Acta Radiol Oncol 22, 35-47. Chalmers A, Johnston P, Woodcock M, Joiner M and Marples B (2004) PARP-1, PARP-2 and the cellular response to low doses of ionizing radiation. Int J Radiat Oncol Biol Phys 58, 410-419. Cheda A, Wrembel-Wargocka J, Lisiak E, Nowosielska EM, Marciniak M and Janiak MK (2004) Single low doses of X rays inhibit the development of experimental tumor metastases and trigger the activities of NK cells in mice. Radiat Res 161, 335-340. Chernyshov VP, Vykhovanets EV, Slukvin II, Antipkin YG, Vasyuk AN and Strauss KW (1997) Analysis of blood lymphocyte subsets in children living on territory that received high amounts of fallout from Chernobyl accident. Clin Immunol Immunopathol 84, 122-128. Collis SJ, Schwaninger JM, Ntambi AJ, Keller TW, Nelson WG, Dillehay LE and Deweese TL. (2004) Evasion of early cellular response mechanisms following low level radiationinduced DNA damage. J Biol Chem 279, 49624-49632. Colussi N and Lohman PH (1997) Low dose-rate X-irradiation induces larger deletions at the human HPRT locus than high dose-rate X-irradiation. Int J Radiat Biol 72, 531-536. Corvo R, Paoli G, Barra S, Bacigalupo A, Van Lint MT, Franzone P, Frassoni F, Scarpati D, Bacigalupo A and Vitale V (1999) Total body irradiation correlates with chronic graft versus host disease and affects prognosis of patients with acute lymphoblastic leukemia receiving an HLA identical allogeneic bone marrow transplant. Int J Radiat Oncol Biol Phys 43, 497-503. Crompton NE, Barth B and Kiefer J (1990) Inverse dose-rate effect for the induction of 6-thioguanine- resistant mutants in Chinese hamster V79-S cells by 60Co ! rays. Radiat Res 124, 300-308. Dainiak N (2002) Hematological consequences of exposure to ionizing radiation. Exp Hematol 30, 513- 528. D'Amours D, Desnoyers S, D'Silva I and Poirier GG (1999) Poly(ADP-ribosyl)ation reactions in the regulation of nuclear functions. Biochem J 342, 249-268. DeWeese TL, Shipman JM, Dillehay LE and Nelson WG (1998) Sensitivity of human prostatic carcinoma cell lines to low dose rate radiation exposure. J Urol 159, 591-598. DeWeese TL, Walsh JC, Dillehay LE, Kessis TD, Hedrick L, Cho KR and Nelson WG (1997) Human papillomavirus E6 and E7 oncoproteins alter cell cycle progression but not radiosensitivity of carcinoma cells treated with low-dose-rate radiation. Int J Radiat Oncol Biol Phys 37, 145-154. Dillehay LE (1990) A model of cell killing by low-dose-rate radiation including repair of sublethal damage, G2 block and cell division. Radiat Res 124, 201-207. Down JD, Easton DF and Steel GG (1986) Repair in the mouse lung during low dose-rate irradiation. Radiother Oncol 6, 29-42. Duhrsen U and Metcalf D (1988) A model system for leukemic transformation of immortalized hemopoietic cells in irradiated recipient mice Leukemia 2, 329-333. Dunn PL and North RJ (1991) Selective radiation resistance of immunologically induced T cells as the basis for irradiationinduced T-cell-mediated regression of immunogenic tumor. J Leukoc Biol 49, 388-396. Durante M, Furusawa Y, George K, Gialanella G, Greco O, Grossi G, Matsufuji N, Pugliese M and Yang TC (1998)

Rejoining and misrejoining of radiation-induced chromatin breaks. IV. Charged particles. Radiat Res 149, 446-454. Durante M, Furusawa Y, Majima H, Kawata T and Gotoh E (1999) Association between G2-phase block and repair of radiation-induced chromosome fragments in human lymphocytes. Radiat Res 151, 670- 676. Durante M, George K, Wu H and Cucinotta FA (2002) Karyotypes of human lymphocytes exposed to high-energy iron ions. Radiat Res 158, 581-590. Durante M, Yamada S ando K, Furusawa Y, Kawata T, Majima H, Nakano T and Tsujii H (2000) X- rays vs. carbon-ion tumor therapy: cytogenetic damage in lymphocytes. Int J Radiat Oncol Biol Phys 47, 793-798. Dutreix J, Dutreix A and Naudy S (1981) Biological and technical principles of total body irradiation for bone marrow graft conditioning. Bull Cancer 68, 63-70. Duvall E and Wyllie AH (1986) Death and the cell. Immunol Today 7, 115-119. Elkind MM and Sutton H (1959) X-ray damage and recovery in mammalian cells in culture. Nature 184, 1293-1295. Eriksson D, Joniani HM, Sheikholvaezin A, Lofroth PO, Johansson L, Riklund Ahlstrom K and Stigbrand T (2003) Combined low dose radio- and radioimmunotherapy of experimental HeLa Hep 2 tumours. Eur J Nucl Med Mol Imaging 30, 895-906. Evans HH, Horng MF, Mencl J, Glazier KG and Beer JZ (1985) The influence of dose rate on the lethal and mutagenic effects of X-rays in proliferating L5178Y cells differing in radiation sensitivity. Int J Radiat Biol Relat Stud Phys Chem Med 47, 553-562. Evans HH, Nielsen M, Mencl J, Horng MF and Ricanati M (1990) The effect of dose rate on X-radiation- induced mutant frequency and the nature of DNA lesions in mouse lymphoma L5178Y cells. Radiat Res 122, 316-325. Evans RG (1983) Radiobiological considerations in magna-field irradiation. Int J Radiat Oncol Biol Phys 9, 1907-1911. Farooqi Z and Resavan PC (1993) Low-dose radiation-induced adaptive response in bone marrow cells of mice. Mutat Res 302, 83-89. Feinendegen LE (2002) Reactive oxygen species in cell responses to toxic agents. Hum Exp Toxicol 21, 85-90. Feinendegen LE (2003) Relative implications of protective responses versus damage induction at low dose and lowdose-rate exposures, using the microdose approach. Radiat Prot Dosimetry 104, 337- 346. Fernandez PM, Zamorano L, Yakar D, Gaspar L and Warmelink C (1995) Permanent iodine-125 implants in the up-front treatment of malignant gliomas. Neurosurg 36, 467-473. Fisher J, Levkovitch-Verbin H, Schori H, Yoles E, Butovsky O, Kaye JF, Ben-Nun A and Schwartz M (2001) Vaccination for neuroprotection in the mouse optic nerve: implications for optic neuropathies. J Neurosci 21, 136-142. Fowler JF. (2003) What can we expect from dose escalation using proton beams? Clin Oncol (R Coll Radiol) 15, S10S15. Friedman EJ (2002) Immune modulation by ionizing radiation and its implications for cancer immunotherapy. Curr Pharm Des 8, 1765-1780. Fujiki H and Suganuma M (1994) Tumor necrosis factor-alpha, a new tumor promoter, engendered by biochemical studies of okadaic acid. J Biochem (Tokyo) 115, 1-5. Fuks Z, Leibel SA, Wallner KE, Begg CB, Fair WR anderson LL, Hilaris BS and Whitmore WF (1991) The effect of local control on metastatic dissemination in carcinoma of the prostate: long-term results in patients treated with 125I implantation. Int J Radiat Oncol Biol Phys 21, 537-547. Furre T, Furre EI, Koritzinsky M, Amellem O and Pettersen EO (2003) Lack of inverse dose-rate effect and binding of the

123

Gridley et al: Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? retinoblastoma gene product in the nucleus of human cancer T-47D cells arrested in G2 by ionizing radiation. Int J Radiat Biol 79, 413-422. Furre T, Koritzinsky M, Olsen DR and Pettersen EO (1999) Inverse dose-rate effect due to pre-mitotic accumulation during continuous low dose-rate irradiation of cervix carcinoma cells. Int J Radiat Biol 75, 699-707. Furuno-Fukushi I and Matsudaira H (1989) Mutation induction by different dose rates of ! rays in radiation-sensitive mutants of mouse leukemia cells. Radiat Res 120, 370-374. Furuno-Fukushi I, Aoki K and Matsudaira H (1993) Mutation induction by different dose rates of ! rays in near-diploid mouse cells in plateau- and log-phase culture. Radiat Res 136, 97-102. Furuno-Fukushi I, Tatsumi K, Takahagi M and Tachibana A (1996) Quantitative and qualitative effect of !-ray dose-rate on mutagenesis in human lymphoblastoid cells. Int J Radiat Biol 70, 209-217. Furuno-Fukushi I, Ueno AM and Matsudaira H (1988) Mutation induction by very low dose rate ! rays in cultured mouse leukemia cells L5178Y. Radiat Res 115, 273-280. Gau JT, Salter RD, Krill D, Grove M, and Becich MJ (1997) The biosynthesis and secretion of prostate-specific antigen in LNCaP cells. Cancer Res 57, 3830-3834. Gauny S, Wiese C and Kronenberg A (2001) Mechanisms of mutagenesis in human cells exposed to 55 MeV protons. Phys Med 17, 235-237. Gopal R, Ha CS, Tucker SL, Khouri IF, Giralt SA, Gajewski JL andersson BS, Cox JD and Champlin RE (2001) Comparison of two total body irradiation fractionation regimens with respect to acute and late pulmonary toxicity. Cancer 92, 1949-1958 Gourabi H and Mozdarani H (1998) A cytokinesis-blocked micronucleus study of the radioadaptive response of lymphocytes of individuals occupationally exposed to chronic doses of radiation. Mutagenesis 13, 475-480. Grdina DJ (1980) Variations in radiation response of tumor subpopulations. In: Radiation Biology in Cancer Research (Meyn RE and Withers HR, eds). New York: Raven Press, pp 353-363. Gridley DS andres ML and Slater JM (1997) Enhancement of prostate cancer xenograft growth with whole-body radiation and vascular endothelial growth factor. Anticancer Res 17, 923-928. Gridley DS, Bonnet RB, Bush DA, Franke C, Cheek GA, Slater JD and Slater JM (2004a) Time course of serum cytokines in patients receiving proton or combined photon/proton beam radiation for resectable but medically inoperable non-smallcell lung cancer. Int J Radiat Oncol Biol Phys 60, 759-766. Gridley DS, Green LM, Nelson GA, Pecaut MJ and Slater JM (2005) Cancer, radiotherapy and SOD mimetics. In: Therapeutic Applications of Superoxide Dismutase and Its Mimetics (Salvemini D and Cuzzocrea S, eds), Georgetown, TX: Landes Bioscience (In press). Gridley DS, Loredo LN, Slater JD, Archambeau JO, Bedros AA and Slater JM (1998) Pilot Evaluation of cytokines in patients undergoing radiotherapy for brain tumor. Cancer Detect Prevent 22, 20-29. Gridley DS, Slater JD, Yonemoto L, Miller DW, Rossi C, Archambeau JO and Slater JM (1996) Pilot study of cytokine profiles in prostate cancer patients undergoing proton or conventional radiotherapy. Int J Oncol 8, 175-178. Grosovsky A, Bethel H, Parks K, Ritter L, Giver C, Gauny S, Wiese C, Kronenberg A (2001) Genomic instability in human lymphoid cells exposed to 1 GeV/amu Fe ions. Phys Med 17, 238-240.

Hall EJ and Bedford JS (1964) Dose rate: its effect on the survival of HeLa cells irradiated with ! rays. Radiat Res 22, 305-315. Hall EJ and Brenner DJ (1991) The dose-rate effect revisited: radiobiological considerations of importance in radiotherapy. Int J Radiat Oncol Biol Phys 21, 1403-1414. Hall EJ, Oliver R, Shepstone BJ and Bedford JS (1966) On the population kinetics of the root meristem of Vicia faba exposed to continuous irradiation. Radiat Res 27, 597-603. Hallahan DE (1996) Radiation-mediated gene expression in the pathogenesis of the clinical radiation response. Sem Radiat Oncol 6, 250-267. Hallahan DE, Haimovitz-Friedman A, Kufe DW, Fuks Z and Weichselbaum RR (1993) The role of cytokines in radiation oncology. In: Important Advances in Oncology (VT DeVita, S Hellman and SA Rosenberg, eds), JB Lippincott Co: Philadelphia, p 71-80. Hallahan D, Kuchibhotla J and Wyble C (1996) Cell adhesion molecules mediate radiation-induced leukocyte adhesion to the vascular endothelium. Cancer Res 56, 5150-5155. Hallahan DE, Kuchibhotla J and Wyble C (1997) Sialyl Lewis X mimetics attenuate E-selectin-mediated adhesion of leukocytes to irradiated human endothelial cells. Radiat Res 147, 41-47. Hallahan DE, Spriggs DR, Beckett MA, Kufe DW and Weichselbaum RR (1989) Increased tumor necrosis factor alpha mRNA after cellular exposure to ionizing radiation. Proc Natl Acad Sci USA 86, 10104-10107. Hahnfeldt P and Hlatky L (1998) Cell resensitization during protracted dosing of heterogeneous cell populations. Radiat Res 150, 681-687. Hanks GE, Diamond JJ, Krall JM, Martz KL and Kramer S (1987) A ten year follow-up of 682 patients treated for prostate cancer with radiation therapy in the United States. Int J Radiat Oncol Biol Phys 13, 499-505. Hanna N (1985) The role of natural killer cells in the control of tumor growth and metastasis. Biochim Biophys Acta 780, 213-226. Hashimoto S, Shirato H, Hosokawa M, Nishioka T, Kuramitsu Y, Matushita K, Kobayashi M and Miyasaka K (1999) The suppression of metastases and the change in host immune response after low- dose total-body irradiation in tumorbearing rats. Radiat Res 151, 717-724. Herceg Z and Wang ZQ (2001) Functions of poly(ADP-ribose) polymerase (PARP) in DNA repair, genomic integrity and cell death. Mutat Res 477, 97-110. Hernandez MC and Knox SJ (2003) Radiobiology of radioimmunotherapy with 90Y ibritumomab tiuxetan (Zevalin). Semin Oncol 30(6 Suppl 17), 6-10. Hofer M, Viklicka S, Gerasimenko VN and Kabachenko AN (1994) Effects of sublethal irradiation with helium ions (300 MeV/nucleon) on basic hematological parameters of mice. Acta Astronaut 32, 757- 760. Holl,V, Coelho D, Weltin D, Dufour P, Denis JM, Florentin I, Mathieu J, Gueulette J and Bischoff P (2001) Induction of apoptosis of splenic lymphocytes in mice by accelerated carbon ions. Can J Physiol Pharmacol 79, 109-113. Holmes A, McMillan TJ, Peacock JH and Steel GG (1990) The radiation dose-rate effect in two human neuroblastoma cell lines. Br J Cancer 62, 791-795. Hosoi Y, Miyachi H, Matsumoto Y, Enomoto A, Nakagawa K, Suzuki N and Ono T (2001) Induction of interleukin-1beta and interleukin-6 mRNA by low doses of ionizing radiation in macrophages. Int J Cancer 96, 270-276. Hosoi Y and Sakamoto K (1993) Suppressive effect of low dose total body irradiation on lung metastasis: dose dependency and effective period. Radiother Oncol 26, 177-179.

124

Cancer Therapy Vol 3, page 125 Hsieh WA, Ni C, Hwang JJ, Fang JS, Lin SP, Lin YA, Huang TW and Chang WP (2002) Evaluation of the frequencies of chromosomal aberrations in a population exposed to prolonged low dose-rate 60Co !-irradiation. Int J Radiat Biol 78, 625-633. Hug EB, Muenter MW, Archambeau JO, DeVries A, Liwnicz B, Loredo LN, Grove RI, Slater JD (2002) Conformal proton radiation therapy for pediatric low-grade astrocytomas. Strahlenther Onkol 178, 10-17. Ichimaru M, Tomonaga M, Amenomori T and Matsuo T (1991) Atomic bomb and leukemia. J Radiat Res (Tokyo). 32(Suppl), 14-19. Ikonomidou C and Turski L (1996) Prevention of traumainduced neurodegeneration in infant and adult rat brain: glutamate antagonists. Metab Brain Dis 11, 125-141. Ikushima T, Aritomi H and Morisita J (1996) Radioadaptive response: efficient repair of radiation- induced DNA damage in adapted cells. Mutat Res 358, 193-198. Ishii K, Hosoi Y, Ono T and Sakamoto K (1996a) Enhanced proliferation and IL-1 production of mouse splenocytes by low-dose whole-body X-irradiation. Physiol Chem Phys Med NMR 28, 7-14. Ishii K, Hosoi Y, Yamada S, Ono T and Sakamoto K (1996b) Decreased incidence of thymic lymphoma in AKR mice as a result of chronic, fractionated low-dose total-body X irradiation. Radiat Res 146, 582-585. Ishii K and Watanabe M (1996) Participation of gap-junctional cell communication on the adaptive response in human cells induced by low dose of X-rays. Int J Radiat Biol 69, 291299. Iyer R and Lehnert BE (2002) Low dose, low-LET ionizing radiation-induced radioadaptation and associated early responses in unirradiated cells. Mutat Res 503, 1-9. Jagger J (1998) Natural background radiation and cancer death in Rocky Mountain states and Gulf Coast states. Health Phys 75, 428-430. Jemal A, Tiwari RC, Murray T, Ghafoor A, Samuels A, Ward E, Feuer EJ and Thun MJ (2004) American Cancer Society. Cancer statistics, 2004. CA Cancer J Clin 54, 8-29. Jensen PT, Roed H, Engelholm SA and Rosendal F (1998) Pulsed dose rate (PDR) brachytherapy as salvage treatment of locally advanced or recurrent gynecologic cancer. Int J Radiat Oncol Biol Phys 42, 1041-1047. Joiner MC, Lambin P and Marples B (1999) Adaptive response and induced resistance. C R Acad Sci III 322, 167-175. Joiner MC, Marples B, Lambin P, Short SC and Turesson I (2001) Low-dose hypersensitivity: current status and possible mechanisms. Int J Radiat Oncol Biol Phys 49, 379-389. Jones SE, Fuks Z, Kaplan HS and Rosenberg SA (1973) NonHodgkin's lymphoma, V: Results of radiotherapy. Cancer 32, 682-691. Kal HB, Barendsen GW, Bakker-van Haue R and Roeke H (1975) Increased radiosensitivity of rat rhabdomyosarcoma cells induced by protracted irradiation. Radiat Res 63, 521530. Kanamitsu M, Morita K, Finch SC, Kato H and Onishi S (1966) Serologic response of atomic bomb survivors following Asian influenza vaccination. Jpn J Med Sci Biol 19, 73-84. Kaplan ID, Cox RS and Bagshaw MA (1994) Radiotherapy for prostatic cancer: patient selection and the impact of local control. Urology 43, 634-639. Karkanitsa L, Mitskevitch P, Uss A, Ostapenko V and Dainiak N (2000) Elevated levels of cytokine expression in leukemic hematopoietic cells of Belarussians exposed to ionizing radiation following the Chernobyl catastrophe. Blood 96, 295-299. Kato F, Kakihara H, Kunugita N, Ootsuyama A and Norimura T (2002) Role of p53 gene in apoptotic repair of genotoxic

tissue damage in mice. J Radiat Res (Tokyo) 43 Suppl, S209-S212 Kato H, Mayumi M, Nishioka K and Hamilton HB (1980) The relationship of HBs antigen and antibody to atomic bomb radiation in the adult health study sample, 1975-77. TR 1380. Radiation Effects Research Foundation, Hiroshima. Kaver I, Ware JL, Wilson JD and Koontz WW (1991) Effect of radiation combined with hyperthermia on human prostatic carcinoma cell line in culture. Urol 38, 88-92. Kelland LR and Steel GG (1986) Dose-rate effects in the radiation response of four human tumour xenografts. Radiother Oncol 7, 259-268. Kelsey KT, Memisoglu A, Frenkel D and Liber HL (1991) Human lymphocytes exposed to low doses of X-rays are less susceptible to radiation-induced mutagenesis. Mutat Res 263, 197-201. Keng PC, Siemann DW and Wheeler KT (1984) Comparison of tumour age response to radiation for cells derived from tissue culture or solid tumours. Br J Cancer 50, 519-526. Kingsley-Kallesen M, Luster TA and Rizzino A (2001) Transcriptional regulation of the transforming growth factorbeta2 gene in glioblastoma cells. In Vitro Cell Dev Biol Anim 37, 684-690. Kipnis J, Avidan H, Markovich Y, Mizrahi T, Hauben E, Prigozhina TB, Slavin S and Schwartz M (2004) Low-dose !-irradiation promotes survival of injured neurons in the central nervous system via homeostasis-driven proliferation of T cells. Eur J Neurosci 19, 1191-1198. Kipnis J, Mizrahi T, Hauben E, Shaked I, Shevach E and Schwartz M (2002) Neuroprotective autoimmunity: naturally occurring CD4+CD25+ regulatory T cells suppress the ability to withstand injury to the central nervous system. Proc Natl Acad Sci USA 99, 15620-15625. Kipnis J, Yoles E, Porat Z, Cohen A, Mor F, Sela M, Cohen IR and Schwartz M (2000) T cell immunity to copolymer 1 confers neuroprotection on the damaged optic nerve: possible therapy for optic neuropathies. Proc Natl Acad Sci USA 97, 7446-7451 Kipnis J, Yoles E, Schori H, Hauben E, Shaked I and Schwartz M (2001) Neuronal survival after CNS insult is determined by a genetically encoded autoimmune response. J Neurosci 21, 4564-4571. Kirsch DG and Tarbell NJ (2004) New technologies in radiation therapy for pediatric brain tumors: the rationale for proton radiation therapy. Pediatr Blood Cancer 42, 461-464. Knox SJ, Levy R, Miller RA, Uhland W, Schiele J, Ruehl W, Finston R, Day-Lollini P, Goris ML (1990) Determinants of the antitumor effect of radiolabeled monoclonal antibodies. Cancer Res 50(16), 4935-4940. Knox SJ, Sutherland W and Goris ML (1993) Correlation of tumor sensitivity to low-dose-rate irradiation with G2/Mphase block and other radiobiological parameters. Radiat Res 135, 24-31. Kojima S, Ishida H, Takahashi M and Yamaoka K (2002) Elevation of glutathione induced by low-dose ! rays and its involvement in increased natural killer activity. Radiat Res 157, 275-280. Kojima S, Nakayama K and Ishida H (2004) Low dose !-rays activate immune functions via induction of glutathione and delay tumor growth. J Radiat Res (Tokyo) 45, 33-39. Koziczak R, Gonciarz M, Krokosz A and Szweda-Lewandowska Z (2003) The influence of split doses of !-radiation on human erythrocytes. J Radiat Res (Tokyo) 44, 217-222. Kranzinger M, Jones N, Rittinger O, Pilz P, Piotrowski WP, Manzl M, Galvan G and Kogelnik HD (2001) Malignant glioma as a secondary malignant neoplasm after radiation therapy for craniopharyngioma: report of a case and review of reported cases. Onkologie 24, 66-72.

125

Gridley et al: Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? Krause M, Hessel F, Wohlfarth J, Zips D, Hoinkis C, Foest H, Petersen C, Short SC, Joiner MC and Baumann M (2003) Ultrafractionation in A7 human malignant glioma in nude mice. Int J Radiat Biol 79, 377-383. Kroger LA, DeNardo GL, Gumerlock PH, Xiong CY, Winthrop MD, Shi XB, Mack PC, Leshchinsky T and DeNardo SJ (2001) Apoptosis-related gene and protein expression in human lymphoma xenografts (Raji) after low dose rate radiation using 67Cu-2IT-BAT-Lym-1 radioimmunotherapy. Cancer Biother Radiopharm 16, 213-225. Kronenberg A (1994) Mutation induction in human lymphoid cells by energetic heavy ions. Adv Space Res 14, 339-346. Kuhne M, Rothkamm K and Lobrich M (2002) Physical and biological parameters affecting DNA double strand break misrejoining in mammalian cells. Radiat Prot Dosimetry 99, 129-132. Kusunoki Y, Hayashi T, Morishita Y, Yamaoka M, Maki M, Bean MA, Kyoizumi S, Hakoda M and Kodama K (2001) Tcell responses to mitogens in atomic bomb survivors: a decreased capacity to produce interleukin 2 characterizes the T cells of heavily irradiated individuals. Radiat Res 155(1 Pt 1), 81-88. Kusunoki Y, Kyoizumi S, Hirai Y, Suzuki T, Nakashima E, Kodama K and Seyama T (1998) Flow cytometry measurements of subsets of T, B and NK cells in peripheral blood lymphocytes of atomic bomb survivors. Radiat Res 150, 227-236. Lajtha LG and Oliver R (1961) Some radiobiological considerations in radiotherapy. Br J Radiol 34, 252-257. Lamerton IF and Lord BI (1964) Studies of cell proliferation under continuous irradiation. Natl Cancer Inst Monogr 14, 185-198. Lee HC, Kim DW, Jung KY, Park IC, Park MJ, Kim MS, Woo SH, Rhee CH, Yoo H, Lee SH and Hong SI (2004) Increased expression of antioxidant enzymes in radioresistant variant from U251 human glioblastoma cell line. Int J Mol Med 13, 883-887. Leibel SA and Sheline GE (1987) Tolerance of the central and peripheral nervous system to therapeutic irradiation. Adv Radiat Biol 12, 257-293. Leith JT (1994) In vitro radiation sensitivity of the LNCaP prostate cell line. Prostate 24, 119-124. Leith JT, Quaranto L, Padfield G, Michelson S and Hercbergs A (1993) Radiobiological studies of PC-3 and DU-145 human prostate cancer cells: x-ray sensitivity in vitro and hypoxic fractions of xenografted tumors in vivo. Int J Radiat Oncol Biol Phys 25, 283-287. Lenschow DJ, Walunas TL and Bluestone JA (1996) CD28/B7 system of T cell costimulation. Ann Rev Immunol 14, 233258. Lessard E, Hsu IC and Pouliot J (2002) Inverse planning for interstitial gynecologic template brachytherapy: truly anatomy-based planning. Int J Radiat Oncol Biol Phys 54, 1243-1251. Lichter AS (2000) Radiation Therapy. In: Clinical Oncology (Abeloff MD, Armitage JO, Lichter AS and Niederhuber JE, eds), Second ed. New York: Churchill Livingstone, p 423470. Lin R, Hug EB, Schaefer RA, Miller DW, Slater JM and Slater J.D (2000) Conformal proton radiation therapy of the posterior fossa: A study comparing protons with threedimensional planned photons in limiting dose to auditory structures. Int J Radiat Oncol Biol Phys 48, 1219-1226. Liu SZ, Su X, Han ZB, Zhang YC and Qi J (1994) Effect of low dose radiation on intracellular calcium and protein kinase C in lymphocytes. Biomed Environ Sci 7, 2842-2891. Lockhart SP, Down JD and Steel GG (1986) The effect of low dose-rate and cyclophosphamide on the radiation tolerance of

the mouse lung. Int J Radiat Oncol Biol Phys 12, 14371440. Lorenz R, Deubel W, Leuner K, Gollner T, Hochhauser E and Hempel K (1994) Dose and dose-rate dependence of the frequency of HPRT deficient T lymphocytes in the spleen of the 137Cs !- irradiated mouse. Int J Radiat Biol 66, 319-326. Lorenz R, Leuner K, Deubel W, Gollner T and Hempel K (1993) Normal and reverse dose-rate effect for the induction of mutants in somatic cells by ionizing radiation. Toxicol Lett 67, 353-363. Luckey TD (1999) Nurture with ionizing radiation: a provocative hypothesis. Nutr Cancer 34, 1-11. Lukjanova EM, Stepanova YG, Antipkin YG and Nagornaja AM (1995) The health of children population. In: The Chernobyl Accident (Barjakhtar VG, ed), Kiev: Naukova Dumka, pp 426-429. Makedonov GP, Tskhovrebova LV, Semiachkina AN and Zasukhinam GD (2000) A defense mechanism of human cells in the radioadaptive response and antimutagenic activity of interferon has common paths. Genetika 36, 393-398. Malaise EP, Fertil B, Chavaudra N and Guichard M (1986) Distribution of radiation sensitivities for human tumor cells of specific histological types: comparison of in vitro and in vivo data. Int J Radiat Oncol Biol Phys 12, 617-624. Marin LA, Smith CE, Langston MY, Quashie D and Dillehay LE (1991) Response of glioblastoma cell lines to low dose rate irradiation. Int J Radiat Oncol Biol Phys 21, 397-402. Marples B, Lambin P, Skov KA and Joiner MC (1997) Low dose hyper-radiosensitivity and increased radioresistance in mammalian cells. Int J Radiat Biol 71, 721-735. Marples B, Wouters BG and Joiner MC (2003) An association between the radiation-induced arrest of G2-phase cells and low-dose hyper-radiosensitivity: a plausible underlying mechanism? Radiat Res 160. 38-45. Marples B, Wouters BG, Collis SJ, Chalmers AJ and Joiner MC (2004) Low-dose hyper-radiosensitivity: a consequence of ineffective cell cycle arrest of radiation-damaged G2-phase cells. Radiat Res 161, 247-255. Matsuzaki Y, Osuga T, Saito Y, Chuganji Y, Tanaka N, Shoda J, Tsuji H and Tsujii H (1994) A new, effective and safe therapeutic option using proton irradiation for hepatocellular carcinoma. Gastroenterol 106, 1032-1041. Matzinger P (1994) Tolerance, danger and the extended family. Annu Rev Immunol 12, 991-1045. McAllister B, Archambeau JO, Nguyen MC, Slater JD, Loredo L, Schulte R, Alvarez O, Bedros AA, Kaleita T, Moyers M, Miller D and Slater JM (1997) Proton therapy for pediatric cranial tumors: preliminary report on treatment and diseaserelated morbidities. Int J Radiat Oncol Biol Phys 39, 455460. Miller AC, Luo L, Chin WK, Director-Myska AE, Prasanna PG and Blakely WF (2002) Proto-oncogene expression: a predictive assay for radiation biodosimetry applications. Radiat Prot Dosimetry 99, 295-302. Miller GM andres ML and Gridley DS (2003a) NK cell depletion results in accelerated tumor growth and attenuates the antitumor effect of total body irradiation. Int J Oncol 23, 1585-1592. Miller GM, Kim DW andres ML and Gridley DS (2003b) Changes in the activation and reconstitution of lymphocytes resulting from total-body irradiation correlates with slowed tumor growth. Oncology 65, 229-241. Miller GM, Kajioka EH andres ML and Gridley DS (2002) Dose and timing of total-body irradiation mediate tumor progression and immunomodulation. Oncol Res 13, 9-18. Miller JJ and Cole LJ (1967) The radiation resistance of longlived lymphocytes and plasma cells in mouse and rat lymph nodes. J Immunol 98, 982-985.

126

Cancer Therapy Vol 3, page 127 Mitchell CR, Folkard M, and Joiner MC (2002) Effects of exposure to low-dose-rate (60)co !-rays on human tumor cells in vitro. Radiat Res 158, 311-318. Mitchell JB and Bedford JS (1977) Dose-rate effects in synchronous mammalian cells in culture. II. A comparison of the life cycle of HeLa cells during continuous irradiation or multiple-dose fractionation. Radiat Res 71, 547-560. Mitchell JB, Bedford JS and Bailey SM (1979) Dose-rate effects in plateau-phase cultures of S3 HeLa and V79 cells. Radiat Res 79, 552-567. Mitchell RE, Jackson JS, McCann RA and Boreham DR (1999) The adaptive response modifies latency for radiation-induced myeloid leukemia in CBA/H mice. Radiat Res 152, 273279. Moalem G, Leibowitz-Amit R, Yoles E, Mor F, Cohen IR and Schwartz M (1999) Autoimmune T cells protect neurons from secondary degeneration after central nervous system axotomy. Nat Med 5, 49- 55. Moiseenko VV, Edwards AA, Nikjoo H and Prestwich WV (1997) The influence of track structure on the understanding of relative biological effectiveness for induction of chromosomal exchanges in human lymphocytes. Radiat Res 147, 208-214. Moretta L, Ciccone E, Poggi A, Mingari MC and Moretta A (1994) Origin and functions of human natural killer cells. Int J Clin Lab Res 24, 181-186. Moulder JE and Fish BL (1989) Late toxicity of total body irradiation with bone marrow transplantation in a rat model. Int J Radiat Oncol Biol Phys 16, 1501-1509. Nagasawa H, Chen DJ and Strniste GF (1989) Response of Xray-sensitive CHO mutant cells to ! radiation. I. Effects of low dose rates and the process of repair of potentially lethal damage in G1 phase. Radiat Res 118, 559-567. Nelson WG and Kastan MB (1996) DNA strand breaks: the DNA template alterations that trigger p53-dependent DNA damage response pathways. Molec Cell Biol 14, 1815-1823. Newmark JR, Hardy DO, Tonb DC, Carter BS, Epstein JI, Isaacs WB, Brown TR, and Barrack ER (1992) Androgen receptor gene mutations in human prostate cancer. Proc Natl Acad Sci USA 89, 6319-6323. North RJ (1986) Radiation-induced, immunologically mediated regression of an established tumor as an example of successful therapeutic immunomanipulation. Preferential elimination of suppressor T cells allows sustained production of effector T cells. J Exp Med 164, 1652-1666. Ohnishi T, Takahashi A, Ohnishi K, Yonezawa M. Tumor suppressor p53 response is blunted by low- dose radiation. Phys Med 17(Suppl 1), 215-216. Olivieri G, Bodycote J and Wolff S (1984) Adaptive response of human lymphocytes to low concentrations of radioactive thymidine. Science 223, 594-597. Park SH, Lee SJ, Chung HY, Kim TH, Cho CK, Yoo SY and Lee YS (2000) Inducible heat-shock protein 70 is involved in the radioadaptive response. Radiat Res 153, 318-326. Parshad R, Gantt R, Sanford KK and Jones GM (1984) Chromosomal radiosensitivity of human tumor cells during the G2 cell cycle period. Cancer Res 44, 5577-5582. Perez CA, Pilepich MV, Garcia D, Simpson JR, Zivnuska F and Hederman MA (1988) Definitive radiation therapy in carcinoma of the prostate localized to the pelvis: experience at the Mallinckrodt Institute of Radiology. NCI Monogr 7, 85-94. Pollycove M and Feinendegen LE (2000) Low level radiation improvement of health and therapy of cancer. In: Harmonization of Radiation, Human Life and the Ecosystem IRPA-10. Abstr Proc 10th Int Cong of IRPA, Hiroshima, Japan, p 290.

Pollycove M and Feinendegen LE (2003) Radiation-induced versus endogenous DNA damage: possible effect of inducible protective responses in mitigating endogenous damage. Hum Exp Toxicol 22, 290-306; discussion 307, 315-317, 319-323. Popovich PG, Stokes BT and Whitacre CC (1996) Concept of autoimmunity following spinal cord injury: possible roles for T lymphocytes in the traumatized central nervous system. J Neurosci Res 45, 349-363. Prasad KN (1995) Radiation immunology. In: Handbook of Radiobiology, CRC Press: New York, p 193- 200. Purdy JA (1996) Intensity-modified radiation therapy. Int J Radiat Oncol Biol Phys 35, 845-6. Qu J, Cheng T, Shi C, Lin Y, Yan G and Ran X (2003) Reduced presence of tissue-repairing cells in wounds combined with whole-body irradiation injury is associated with both suppression of proliferation and increased apoptosis. Med Sci Monit 9, BR370-377. Ran X, Cheng T, Lin Y, Qu J, Liu D, Ai G, Yan G, Wang W and Xu R (2003) Dose-effect relationships in total body irradiation on the healing of cutaneous wounds. Chin Med J (Engl) 116, 878-882. Rauth AM (1992) Radiation carcinogenesis. In: The Basic Science of Oncology. Second edition (Tannock IF, Hill RP, eds) New York: McGraw-Hill Inc, pp 119-135. Przybyszewski WM, Widel M and Palyvoda O (2002) Lipid peroxidation, DNA damage and cellular morphology of R1 Rhabdomyosarcoma cell line irradiated in vitro by !-rays with different dose rates. Teratog Carcinog Mutagen 22, 93-102. Regnier R (1992) Whole body irradiation. Rev Med Brux 13, 172-176. Reyburn H, Mandelboim O, Vales-Gomez M, Sheu EG, Pazmany L, Davis DM and Strominger JL (1997) Human NK cells: their ligands, receptors and functions. Immunol Rev 155, 119-125. Rigaud O and Moustacchi E (1996) Radioadaptation for gene mutation and the possible molecular mechanisms of the adaptive response. Mutat Res 358, 127-134. Rigaud O, Papadopoulo D and Moustacchi E (1993) Decreased deletion mutation in radio-adapted human lymphocytes. Radiat Res 133, 94-101. Rose PG (2003) Stage IIB-IVA cancer of the cervix. Cancer J 9, 404-414. Ross HJ, Canada AL, Antoniono RJ and Redpath JL (1997) High and low dose rate irradiation have opposing effects on cytokine gene expression in human glioblastoma cell lines. Eur J Cancer 33, 144-152. Rossi CJ (1999) Conformal proton beam therapy of prostate cancer â&#x20AC;&#x201C; update on the Loma Linda University Medical Center experience. Strahlenther Onkol 175, 82-84. Ruiz de Almodovar JM, Bush C, Peacock JH, Steel GG, Whitaker SJ and McMillan TJ (1994) Dose-rate effect for DNA damage induced by ionizing radiation in human tumor cells. Radiat Res 138(1 Suppl), S93-S96. Safwat A (2000a) The immunobiology of low-dose total-body irradiation: more questions than answers. Radiat Res 153(5 Pt 1), 599-604. Safwat A (2000b) The role of low-dose total body irradiation in treatment of non-Hodgkin's lymphoma: a new look at an old method. Radiother Oncol 56, 1-8. Safwat A, Aggerholm N, Roitt I, Overgaard J and Hokland M (2003a) Low-dose total body irradiation augments the therapeutic effect of interleukin-2 in a mouse model for metastatic malignant melanoma. J Exp Ther Oncol 3, 161168. Safwat A, Aggerholm N, Roitt I, Overgaard J and Hokland M (2004) Tumour burden and interleukin-2 dose affect the

127

Gridley et al: Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? interaction between low-dose total body irradiation and interleukin 2. Eur J Cancer 40, 1412-1417. Safwat A, Bayoumy Y, El-Sharkawy N, Shaaban K, Mansour O and Kamel A (2003b) The potential palliative role and possible immune modulatory effects of low-dose total body irradiation in relapsed or chemo-resistant non-Hodgkin's lymphoma. Radiother Oncol 69, 33-36. Safwat A, Nielsen OS, El-Badawy S and Overgaard J (1996) Effect of radiation dose rate and cyclophosphamide on pulmonary toxicity after total body irradiation in a mouse model. Int J Radiat Oncol Biol Phys 34, 85-91. Sakamoto K, Miyamoto M and Watanabe N (1987) The effect of low-dose total body irradiation on tumor control. Jpn J Cancer Chemother 14, 1545-1549. Sankaranarayanan K, von Duyn A, Loos MJ and Natarajan AT (1989) Adaptive response of human lymphocytes to lowlevel radiation from radioisotopes or X-rays. Mutat Res 211, 7-12. Sasaki S (1995) On the reactive kinetics of the radio-adaptive response in cultured mouse cells. Int J Radiat Biol 68, 281291. Scharfen CO, Sneed PK, Wara WM, Larson DA, Phillips TL, Prados MD, Weaver KA, Malec M, Acord P, Lamborn KR, Lamb SA, Ham B and Gutin PH (1992) High activity iodine125 interstitial implant for gliomas. Int J Radiat Oncol Biol Phys 24, 583-591. Schneider U, Lomax A and Lombriser N (2000) Comparative risk assessment of secondary cancer incidence after treatment of Hodgkinâ&#x20AC;&#x2122;s disease with photon and proton radiation. Radiat Res 154, 382-388. Schori H, Kipnis J, Yoles E, WoldeMussie E, Ruiz G, Wheeler LA and Schwartz M (2001) Vaccination for protection of retinal ganglion cells against death from glutamate cytotoxicity and ocular hypertension: implications for glaucoma. Proc Natl Acad Sci USA 98, 3398-3403. Schulte RW, Slater J.D, Rossi Jr C.J and Slater JM (2000) Value and perspectives of proton radiation therapy for limited stage prostate cancer. Strahlenther Onkol 176, 3-8. Schultheiss TE, Kun LE, Ang KK and Stephens LC (1995) Radiation response of the central nervous system. Int J Radiat Oncol Biol Phys 31, 1093-1112. Schulz-Ertner D, Haberer T, Jakel O, Thilmann C, Kramer M, Enghardt W, Kraft G, Wannenmacher M and Debus J (2002) Radiotherapy for chordomas and low-grade chondrosarcomas of the skull base with carbon ions. Int J Radiat Oncol Biol Phys 53, 36-42. Schwartz M and Cohen IR (2000) Autoimmunity can benefit self-maintenance. Immunol Today 21, 265- 268. Shadley JD, Atzal V and Wolff S (1987) Characterization of the adaptive response to ionizing radiation induced by low doses of X-rays in human lymphocytes. Radiat Res 111, 511-516. Shadley JD and Wolff S (1987) Very low doses of X-rays can cause human lymphocytes to become less susceptible to ionizing radiation. Mutagenesis 2, 95-96. Shall S and de Murcia G (2000) Poly(ADP-ribose) polymerase-1: what have we learned from the deficient mouse model? Mutat Res 460, 1-15. Shen R-N, Hornback NB, Lu L, Chen LT, Brahmi Z and Broxmeyer HE (1989) Low dose total body irradiation: a potent anti-retroviral agent in vivo. Int J Radiat Oncol Biol Phys 16, 165-170. Shen RN, Lu L, Kaiser HE and Broxmeyer HE (1997) Murine AIDS cured by low dosage total body irradiation. Adv Exp Med Biol 407, 451-458. Sherman DM, Carabell SC, Belli JA and Hellman S (1982) The effect of dose rate and adriamycin on the tolerance of thoracic radiation in mice. Int J Radiat Oncol Biol Phys 8, 45-51.

Sherman ML, Datta R, Hallahan DE, Weichselbaum RR and Kufe DW (1991) Regulation of tumor necrosis factor gene expression by ionizing radiation in human myeloid leukemia cells and peripheral blood monocytes. J Clin Invest 87, 1794-1797. Shi CM, Qu JF and Cheng TM (2003) Effects of the nerve growth factor on the survival and wound healing in mice with combined radiation and wound injury. J Radiat Res (Tokyo) 44, 223-228. Short SC, Kelly J, Mayes CR, Woodcock M and Joiner MC (2001) Low-dose hypersensitivity after fractionated low-dose irradiation in vitro. Int J Radiat Biol 77, 655-664. Short SC, Mitchell SA, Boulton P, Woodcock M and Joiner MC (1999) The response of human glioma cell lines to low-dose radiation exposure. Int J Radiat Biol 75, 1341-1348. Shu HK, Kim MM, Chen P, Furman F, Julin CM and Israel MA (1998) The intrinsic radioresistance of glioblastoma-derived cell lines is associated with a failure of p53 to induce p21(BAX) expression. Proc Natl Acad Sci U S A 95, 14453-14458. Skladowski K, McMillan TJ, Peacock J, Titley J and Steel GG (1993) Cell-cycle progression during continuous low dose rate irradiation of a human bladder carcinoma cell line. Radiother Oncol 28, 219-227. Slater JD, Rossi CJ Jr, Yonemoto LT, Bush DA, Jabola BR, Levy RP, Grove RI, Preston W and Slater JM (2004) Proton therapy for prostate cancer: the initial Loma Linda University experience. Int J Radiat Oncol Biol Phys 59, 348-352. Slater JD, Yonemoto LT, Rossi CJ Jr, Reyes-Molyneux NJ, Bush DA, Antoine JE, Loredo LN, Schulte RW, Teichman SL and Slater JM (1998) Conformal proton therapy for prostate carcinoma. Int J Radiat Oncol Biol Phys 42, 299-304. Slater JM, Archambeau JO, Miller DW, Notarus MI, Preston W and Slater JD (1992) The proton treatment center at Loma Linda University Medical Center: rationale for and description of its development. Int J Radiat Oncol Biol Phys 22, 383-389. Slater JM, Miller DW and Archambeau JO (1988) Development of a hospital-based proton beam treatment center. Int J Radiat Oncol Biol Phys 14, 761-775. Slater JM, Neilsen IR, Chu WT, Carlsen EN and Chrispens JE (1974) Radiotherapy treatment planning using ultrasoundsonic graph pen-computer system. Cancer 34, 96-99. Slater JM and Preston W (1990) Proton beam therapy: a promising method of locoregional cancer control. Compr Ther 16, 3-6. Smalley SR, Kimler BF and Evans RG (1991) 5-fluorouracil modulation of radiosensitivity in cultured human carcinoma cells. Int J Radiat Oncol Biol Phys 20, 207-211. Song DY, Jones RJ, Welsh JS, Haulk TL, Korman LT, Noga S, Goodman S, Herman M, Mann R, Marcellus D, Vogelsang G, Ambinder RF and Abrams RA (2003) Phase I study of escalating doses of low-dose-rate, locoregional irradiation preceding Cytoxan-TBI for patients with chemotherapyresistant non-Hodgkin's or Hodgkin's lymphoma. Int J Radiat Oncol Biol Phys 57, 166-171. Spalding JF, Holland LM and Prine JR (1972) The effects of dose protraction on hematopoiesis in the primate and dog. Life Sci Space Res 10, 155-164. Stackhouse MA and Bedford JS (1993) An ionizing radiationsensitive mutant of CHO cells: irs-20. II. Dose-rate effects and cellular recovery processes. Radiat Res 136, 250-254. Steel GG (1996) From targets to genes: a brief history of radiosensitivity. Phys Med Biol 41, 205-222. Steel GG (1991) The ESTRO Breur lecture. Cellular sensitivity to low dose-rate irradiation focuses the problem of tumour radioresistance. Radiother Oncol 20, 71-83.

128

Cancer Therapy Vol 3, page 129 Steel GG, Deacon JM and Duchesne GM (1987) Horwich A, Kelland LR, Peacock JH. The dose-rate effect in human tumour cells. Radiother Oncol 9, 299-310. Stefani S and Schrek R (1964) Cytotoxic effect of 2 and 5 roentgens on human lymphocytes irradiated in vitro. Radiat Res 22, 126-130. Stepanova EI, Mozalevsky AF and Kolpakov EE (1995) The respiratory system in children. In: The Chernobyl Accident (Barjakhtar VG, ed). Kiev: Naukova Dumka, pp 493-497. Streffer JR, Rimner A, Rieger J, Naumann U, Rodemann HP and Weller M (2002) BCL-2 family proteins modulate radiosensitivity in human malignant glioma cells. J Neurooncol 56, 43-49. Strege RJ, Godt C, Stark AM, Hugo HH and Mehdorn HM (2004) Protein expression of Fas, Fas ligand, Bcl-2 and TGFbeta2 and correlation with survival in initial and recurrent human gliomas. J Neurooncol 67, 29-39. Streilein JW (1993) Immune privilege as the result of local tissue barriers and immunosuppressive microenvironments. Curr Opin Immunol 5, 428-432. Strojan P, Popovic M and Jereb B (2000) Secondary intracranial meningiomas after high-dose cranial irradiation: report of five cases and review of the literature. Int J Radiat Oncol Biol Phys 48, 65-73. Stromberg J, Martinez A, Benson R, Garton G, Diokno A, Gonzalez J, Zincke H, Schray M, Edmundson G and Brabbins D (1994) Improved local control and survival for surgically staged patients with locally advanced prostate cancer treated with up-front low dose rate iridium-192 prostate implantation and external beam irradiation. Int J Radiat Oncol Biol Phys 28, 67-75. Takahashi A, Asakawa I, Yuki K, Matsumoto T, Kumamoto M, Kondo N, Ohnishi K, Tachibana A and Ohnishi T (2002) Radiation-induced apoptosis in the scid mouse spleen after low dose-rate irradiation. Int J Radiat Biol 78, 689-693. Takahashi A, Kondo N, Inaba H, Uotani K, Kiyohara Y, Ohnishi K and Ohnishi T ( 2003) Radiation- induced apoptosis in scid mice spleen after low dose irradiation. Adv Space Res 31, 1569-1573. Takahashi A, Ohnishi K, Asakawa I, Kondo N, Nakagawa H, Yonezawa M, Tachibana A, Matsumoto H and Ohnishi T (2001) Radiation response of apoptosis in C57BL/6N mouse spleen after whole-body irradiation. Int J Radiat Biol 77, 939-945. Talmadge JE, Meyers KM, Prieur DJ and Starkey JR (1980) Role of natural killer cells in tumor growth and metastasis: C57BL/6 normal and beige mice. J Natl Cancer Inst 65, 929-35. Teh BS, Bastasch MD, Wheeler TM, Mai WY, Frolov A, Uhl BM, Lu HH, Carpenter LS, Chiu JK, McGary J, Woo SY, Grant WH 3rd and Butler EB (2003) IMRT for prostate cancer: defining target volume based on correlated pathologic volume of disease. Int J Radiat Oncol Biol Phys 56, 184- 191. Terasima T and Tolmach LJ (1961) Changes in the X-ray sensitivity of HeLa cells during the division cycle. Nature 190, 1210-1211. Thompson M (1994) Radiological health physics. In: Principles of Imaging Science and Protection. (Thompson MA, Hattawat MP, Hall JD and Dowd SB, eds.) Philadelphia, PA: WB Saunders, pp 453-456. Tilkin AF, Schaaf-Lafontaine N, Van Acker A, Boccadoro M and Urbain J (1981) Reduced tumor growth after low-dose irradiation or immunization against blastic suppressor T cells. Proc Natl Acad Sci USA 78, 1809-1812. Tonkin KS, Kelland LR and Steel GG (1989) A comparison of the in vivo and in vitro radiation response of three human cervix carcinomas. Radiother Oncol 16, 55-63.

Trivedi A and Hannan MA (2004) Radiation and cardiovascular diseases. J Environ Pathol Toxicol Oncol 23, 99-106. Tskhovrebova LV, Makedonov GP, L'vova GN, Chekova VV, Maksimova TN and Zasukhina GD ( 1995) The radioadaptive response in the lymphocytes of schizophrenia patients. Radiats Biol Radioecol 35, 665-669. van Oostrum IEA, Erkens-Schulze S, Petterson M, Wils IS and Rutgers DH (1990) The relationship between radiosensitivity and cell kinetic effects after low- and high-dose-rate irradiation in five human tumors in nude mice. Radiat Res 122, 252-261. Venkat S, Apte SK, Chaubey RD and Chauhan PS (2001) Radioadaptive response in human lymphocytes in vitro. J Environ. Pathol Toxicol Oncol 20, 165-175. Vilenchik MM and Knudson AG Jr (2000) Inverse radiation dose-rate effects on somatic and germ-line mutations and DNA damage rates. Proc Natl Acad Sci USA 97, 53815386. Wallner KE, Galicich JH, Krol G, Arbit E and Malkin MG (1989) Patterns of failure following treatment for glioblastoma multiforme and anaplastic astrocytoma. Int J Radiat Oncol Biol Phys 16, 1405- 1409. Walters RA, Gurley LR and Tobey RA (1974) Effects of caffeine on radiation-induced phenomena associated with cell-cycle traverse of mammalian cells. Biophys J 14, 99-118. Weichselbaum RR, Hallahan DE, Sukhatme V, Dritschilo A, Sherman ML and Kufe DW (1991) Biological consequences of gene regulation after ionizing radiation exposure. J Natl Cancer Inst 83, 480-484. Wickliffe JK, Bickham AM, Rodgers BE, Chesser RK, Phillips CJ, Gaschak SP, Goryanaya JA, Chizhevsky I and Baker RJ (2003) Exposure to chronic, low-dose rate !-radiation at Chornobyl does not induce point mutations in Big Blue mice. Environ Mol Mutagen 42, 11-18. Widel M and Przybyszewski WM (1998) Inverse dose-rate effect for the induction of micronuclei in Lewis lung carcinoma after exposure to cobalt-60 ! rays. Radiat Res 149, 98-102. Wiese C, Gauny SS, Liu W-C, Cherbonnel-Lasserre CL, Kronenberg A (2001) Different mechanisms of radiationinduced loss of hetrozygosity in two human lymphoid cell lines from a single donor. Cancer Res 61, 1129-1137. Williams JA, Williams JR, Yuan X and Dillehay LE (1998) Protracted exposure radiosensitization of human malignant glioma. Radiat Oncol Investig 6, 255-263. Williams JR, Zhang YG and Dillehay LE (1992) Sensitization processes in human tumor cells during protracted irradiation: possible exploitation in the clinic. Int J Radiat Oncol Biol Phys 24, 699-704. Wiltrout RH, Herberman RB, Zhang SR, Chirigos MA, Ortaldo JR, Green KM Jr and Talmadge JE (1985) Role of organassociated NK cells in decreased formation of experimental metastases in lung and liver. J Immunol 134, 4267-4275. Winthrop MD, DeNardo SJ, Muenzer JT, Chi SG and Gumerlock PH (1997) p53-independent response of a human breast carcinoma xenograft to radioimmunotherapy. Cancer 80, 2529-2537. Wolff S, Afzal V, Wiencke JK, Olivieri G and Michaeli A (1988) Human lymphocytes exposed to low doses of ionizing radiation become refractory to high doses of radiation as well as to chemical mutagens that induce double-strand breaks in DNA. Int J Radiat Biol 53, 39-48. Wolff S, Wiencke JK, Afzal V, Youngblom J and Cortes F (1989) The adaptive response of human lymphocytes to very low dose ionizing radiation: a case of induced chromosomal repair with the induction of specific proteins. In: Low Dose Radiation: Biological Basis of Risk Assessment (Baverstock KF and Stather JW, eds). London: Taylor & Francis, pp 446454.

129

Gridley et al: Low-dose/low-dose-rate radiation: a feasible strategy to improve cancer radiotherapy? Wollin M, Fitzgerald TJ, Santucci MA, Menon M, Longcope C, Reale F, Carlson J, Sakakeeny MA and Greenberger JS (1989) Radiosensitivity of human prostate cancer and malignant melanoma cell lines. Radiother Oncol 15, 285293. Wu H, Durante M, George K and Yang TC (1997) Induction of chromosome aberrations in human cells by charged particles. Radiat Res 148(Suppl, S102-S107. Wu H, George K and Yang TC (1999) Estimate of the frequency of true incomplete exchanges in human lymphocytes exposed to 1GeV/_ Fe ions in vitro. Int J Radiat Biol 75, 593-599. Xu Y, Greenstock CL, Trivedi A and Mitchel RE (1996) Occupational levels of radiation exposure induce surface expression of interleukin-2 receptors in stimulated human peripheral blood lymphocytes. Radiat Environ Biophys 35, 89-93. Yamada S, Durante M ando K, Furusawa Y, Kawata T, Majima H and Tsujii H (2000) Complex- type chromosomal exchanges in blood lymphocytes during radiation therapy correlate with acute toxicity. Cancer Lett 150, 215-221. Yamaoka M, Kusunoki Y, Kasagi F, Hayashi T, Nakachi K and Kyoizumi S (2004) Decreases in percentages of naive CD4 and CD8 T cells and increases in percentages of memory CD8 T-cell subsets in the peripheral blood lymphocyte populations of A-bomb survivors. Radiat Res 161, 290- 298. Yang X, Darling JL, McMillan TJ, Peacock JH and Steel GG (1992) Heterogeneity of radiosensitivity in a human glioma cell line. Int J Radiat Oncol Biol Phys 22, 103-108. Yang X, Darling JL, McMillan TJ, Peacock JH and Steel GG (1990) Radiosensitivity, recovery and dose-rate effect in three human glioma cell lines. Radiother Oncol 19, 49-56. Yoles E and Schwartz M (1998) Degeneration of spared axons following partial white matter lesion: implications for optic nerve neuropathies. Exp Neurol 153, 1-7. Yonemoto LT, Slater JD, Rossi CJ Jr, Antoine JE, Loredo L, Archambeau JO, Schulte RW, Miller DW, Teichman SL and Slater JM (1997) Combined proton and photon conformal radiation therapy for locally advanced carcinoma of the prostate: preliminary results of a phase I/II study. Int J Radiat Oncol Biol Phys 37, 21-29. Yoshida N, Imada H, Kunugita N and Norimura T (1993) Low dose radiation-induced adaptive survival response in mouse spleen T-lymphocytes in vivo. J Radiat Res (Tokyo) 34, 269-276.

Young CY, Montgomery BT, Andrews PE, Qui SD, Bilhartz DL, and Tindall DJ (1991) Hormonal regulation of prostatespecific antigen messenger RNA in human prostatic adenocarcinoma cell line LNCaP. Cancer Res 51, 37483752. Zaichkina SI, Rozanova OM, Klokov DI, Aptikaeva GF, Akhmadieva AKh and Smirnova EN (2003) Low doses of radiation decrease the level of spontaneous and !-induced chromosomal mutagenesis in bone marrow cells of mice in vivo. Radiats Biol Radioecol. 43, 153-155. Zaka R, Vandecasteele CM and Misset MT (2002) Effects of low chronic doses of ionizing radiation on antioxidant enzymes and G6PDH activities in Stipa capillata (Poaceae). J Exp Bot 53, 1979-1987. Zamorano L, Yakar D, Dujovny M, Sheehan M and Kim J (1992) Permanent iodine-125 implant and external beam radiation therapy for the treatment of malignant brain tumors. Stereotact Funct Neurosurg 59, 183-192.

Daila S. Gridley

130

Cancer Therapy Vol 3, page 131 Cancer Therapy Vol 3, 131-138, 2005

Micro and nano drug delivery systems in cancer therapy Review Article

Gorka Orive, Rosa María Hernández, Alicia R. Gascón, José Luis Pedraz* Laboratory of Pharmacy and Pharmaceutical Technology, Faculty of Pharmacy, University of the Basque Country, Vitoria–Gasteiz, Spain

__________________________________________________________________________________ *Correspondence: Dr. José Luis Pedraz, Professor of the Laboratory of Pharmacy and Pharmaceutical Technology, Faculty of Pharmacy, University of the Basque Country, Vitoria -Gasteiz. Spain; Phone: +34 945-013091; Fax: +34 945-013040; E-mail: knppemuj@vc.ehu.es Key words: Micro and nano drug delivery systems, Micro and nanotechnologies, cancer therapy, Macromolecular conjugation Abbreviations: blood-brain barrier, (BBB); Food and Drug Administration, (FDA); leuteinizing-hormone-releasing hormone, (LHRH); permeability and retention effect, (EPR); polyethylene glycol, (PEG); poly(lactic-co-glycolic), (PLGA); recombinant human growth hormone, (rhGH); tissue inhibitor of metalloproteinase, (TIMP) Received: 23 February 2005; Accepted: 1 March 2005; electronically published: March 2005

Summary The delivery of any drug at the right time and in the target where it is needed and at the level that is required is essential to realize the full potential of therapeutic molecules. These requirements are already more important in the case of cancer chemotherapies due to their high toxicity which could lead to serious side effects. In the last few years, a great number of new drug delivery technologies have been optimised including the micro and nano-systems as well as polymer conjugation. Together, these drug delivery systems would not only improve drug administration and the efficiency and safety of conventional chemotherapies, but also revolutionize the pharmaceutical and biomedical industries in cancer therapy. Currently, a variety of drug delivery approaches are FDA-approved or are in clinical development as anticancer treatments, including polymer microcapsules and microspheres, liposomes, polymer conjugates and nanoparticles (Figure 1). Others such as chemotherapy wafers, microchips and osmotic pumps are also in testing stage to treat human cancers but will not be the scope of this work since they have been reviewed in detail elsewhere (Moses et al, 2003b). This article focuses on the potential of micro and nanotechnology as well as polymer conjugation as a platform for developing drug delivery systems in cancer treatment.

I. Introduction The development of drug delivery systems has improved the therapeutic and toxicological properties of existing chemotherapies and facilitated the implementation of new ones. By including the drug in technologically optimized drug delivery systems or conjugating the drugs with different polymers, it is possible to modify the pharmacokinetics and biodistribution of the drugs, improving the efficacy and security of the therapy (Moses et al, 2003a). Some of the strongest arguments for the use of drug delivery systems are that they avoid or at least reduce some potential disadvantages of cancer chemotherapy including toxicity, pain management, short in vivo halflives and repeated administrations (Allen and Cullis, 2004). The possibility of designing different drug delivery systems for a controlled and continuous release of the therapeutic molecule has impact broadly the clinical application of the chemotherapies and improve the lifequality of the patients.

II. Current chemotherapies

limitations

One of the main limitations of chemotherapies is their high toxicity which could lead to serious side effects, reducing the administrable and the therapeutic effect. To address this issue, it is essential to transport the therapeutically active molecule mainly to the target where

131

Orive et al: Micro and nano drug delivery systems in cancer therapy

Figure 1. Examples of different drug delivery approaches that are FDA-approved or are in clinical development as anticancer treatments. Reproduced from Moses et al, 2003 with kind permission from Cancer Cell.

it is needed and at the required time and level (Orive et al, 2003a). This could be achieved by embedding the drugs into nontoxic and biodegradable polymers from which the drug will be released in a sustained manner (Duncan, 2003). For example, the use of doxorubicin in the treatment of metastatic breast cancer is associated with cardiotoxicity. But when the drug is included in a liposome, it is possible to obtain a controlled release of doxorubicin, reducing the peak levels of the drug and consequently its toxicity (Theodoulou and Clifford, 2004). Another strategy to concentrate cancer drugs only in their target tissue is through a mechanism known as enhanced permeability and retention effect (EPR) which happens in some pathological conditions such as solid tumors (Maeda et al, 2000; Hashizume et al, 2001). In fact, the network of blood vessels in many solid tumors has been shown to differ considerably from normal vasculature and to contain gaps in which tumor cells lack close contact with perfusing vessels, which ultimately leads to increased permeability (Jain, 2001; Bergers and Benjamin, 2003). In this situation, drug delivery systems which are usually excluded from entering into tissues can extravasate into tumors and increase drug concentration 10-fold or more than administration of the same dose of free drug (Northfelt et al, 1996). In the last few years, many peptides and proteins have shown biological activity which makes them potential candidates as anticancer agents (Torchilin and Lukyanov, 2003). However, their use as therapeutic drugs is often

hampered by the uptake by the reticulo endothelial system and their short half-lives in vivo which makes difficult their administration. The inclusion of a drug into a micro or nanoparticle or the coupling of a polymer decreases renal or hepatic drug clearance and immune recognition, altering the pharmacokinetics and biodistribution of the free drug. In fact, when a drug is associated with a carrier the volume of distribution and the clearance decreases, the area under time-versus-concentration increases and the half-life of the drug increases administrations (Allen and Cullis, 2004). This knowledge has provided the basis for different commercially available injectable delivery systems such as Decapeptyl速 and Zoladex速 (http://hcp.zoladex.net/Article/501611.aspx). Drug lifetime can also be prolonged by conjugating the drug molecules with water-soluble molecules such as polyethylene glycol (PEG) (Harris and Chess, 2003). The complex created is designed to increase protein solubility, stability and to reduce protein immunogenicity. In fact, by preventing rapid renal clearance and protein uptake of cells by reticuloendothelial system, conjugates with PEG are used to prolong plasma half-time (Gabizon et al, 2003; Shorr et al, 2004). The use of drug delivery systems have revolutionised the areas of cancer prevention and pain management related to classical cancer chemotherapy. Furthermore, the encapsulation of the drug in a microreservoir can improve drug solubility and stability as well as reduce drug resistance in some human carcinomas. For instance,

132

Cancer Therapy Vol 3, page 133 recently it has been demonstrated that liposomally encapsulated tamoxifen not only induces pharmacological effects but reduces anti-estrogen resistance in several breast tumour models (Reiner et al, 2004). Finally, the entrapment of labile therapeutic agents can protect the latter from premature degradation by hydrolysis or by enzymes present in the plasma.

particle differs also considerably and the scale-up could be a challenge for some of these devices. An important issue to be considered when fabricating these systems is the drug load that the reservoir can carry. This drug load depends on the size and the structure of the device, ranging from some few molecules of the drug to a few tens. Therefore, selection of drugs with potent pharmaceutical activity is necessary in order to have therapeutic effects in the released dose. Furthermore, it is essential that the drug will not be altered during the fabrication process and the storage. Finally, interactions between drug and the reservoir must be optimized to facilitate drug release only in the target where it is needed and at the desired kinetic-release. Natural and synthetic polymers including albumin, fibrinogen, alginate, chitosan and collagen have been used for the fabrication of micro and nanoparticles . However, among all of them, lactic-glycolic acid copolymers are the most frequently employed materials due to their biocompatibility and biodegradability. Following a multiple emulsion process, a drug can be entrapped into a poly(lactic-co-glycolic) (PLGA) microsphere and released

III. Micro and nanotechnologies Tremendous opportunities exist for using micro and nanoparticles as controlled drug delivery systems for cancer treatment (Panyam and Labhasetwar, 2003; Birnbaum and Brannon-Peppas, 2004). The term “microparticle” refers to a particle with a diameter of 11000 µm, while “nanopaticle” is used when the particle is <1 µm in size. However, under this term it is possible to distinguish several reservoirs including micro/nanocapsules, micro/nano-spheres, liposomes, etc. All these devices differ not only in the structure (Figure 2) but also in their biopharmaceutical properties and therapeutic uses (Orive et al, 2003b). The fabrication protocol of each

Figure 2. Schematics of different nanotechnology based drug delivery systems for cancer therapy. Reproduced from Sahoo and Labhasetwar, 2003 with kind permission from Drug Discovery Today.

133

Orive et al: Micro and nano drug delivery systems in cancer therapy at a zero-order kinetic by diffusion of the drug through the polymer reservoir and the slow degradation of the polymer matrix. These advantages resulted in the first two PLGAmicroparticle extended-release formulations that were approved by the US Food and Drug Administration (FDA). One of them released the recombinant human growth hormone (rhGH) (Cleland, 1997) whereas the other microparticle-based drug delivery system released the leuteinizing-hormone-releasing hormone (LHRH) agonist leuprorelin acetate (Okada, 1997). The latter is currently on the market under the name of LupronÂŽ Depot and it is approved in the United States for the palliative treatment of advanced prostate cancer. However, there are still few microencapsulated formulations on clinical trials addressing cancer treatments. In fact, a recent review of National Centre Institute revealed that from the 1200 open clinical trials in the United States only one to be testing a microparticulate system for controlled drug delivery (Birnbaum and Brannon-Peppas, 2004). Experts, however, predict that within the next 5-10 years some of the formulations currently under study might progress to the clinical evaluation and perhaps become marketed therapy not so far (http://www.zycos.com/press/release15.html; Hedley et al, 1998). Nanotechnology is a multidisciplinary field which encompasses research and development at the atomic, molecular or macromolecular level (Emerich and Thanos, 2003). Due to their extremely small size, nanoscale structures have unique properties for the controlled and targeted release of therapeutic products (Sahoo and Labhasetwar, 2003). In the last few years, investment in nanotechnology worldwide has increased considerably and recently the National Cancer Institute has announced a major commitment to nanotechnology for cancer research in the form of $144.3 million, five-year initiative.

Although the total drug-load is reduced considerably and the manufacture process is more complex, the nanoscale devices present some advantages over the micro-systems. In fact, submicron systems show higher intracellular uptake than microsized particles, thereby allowing drug-release in different cellular compartments such as cytoplasm and nucleus. Nanoparticles can be also easily conjugated with a ligand to favour a targeted therapeutic approach and as it has been reported, some nanoparticles can cross the blood-brain barrier (BBB). For example, doxorubicin bound to polysorbate-coated nanoparticles can cross the intact BBB, reaching therapeutic concentrations in the brain. When these particles were administered in glioblastoma-bearing rats, a very aggressive human cancer with short survival times, significantly higher survival times were observed in the treated animal group compared with all other groups (Steiniger et al, 2004). Depending on the elaboration method and the materials employed different nanosystems can be distinguished including micelles, nanocapsules, dendrimers, nanospheres, solid lipid nanoparticles and ceramic nanoparticles. The principal characteristics and some of the recent research using each nano-systems is reviewed in Table 1. Liposomes are one of the most well-known drug delivery carriers employed in the treatment of cancer. Due to their advantages, liposomal formulations provide a substantial increase in antitumor efficacy comparing with the free drug or standard chemotherapy regimens (Drummond et al, 2004). Liposomes are composed of a double lipid bilayer which encloses an aqueous space that can be employed to transport anticancer drugs.

Table 1. Examples of different nanoparticles and their applications as cancer treatments Nanoparticle

Description

Nanocapsules

Vesicular systems in which the drug is surrounded by a polymeric membrane

Nanospheres

Matrix systems in which the drug is physically and uniformly dispersed

Micelles

Amphiphilic block copolymers that can self-associate in aqueous solution Nanoparticles fabricated using inorganic compounds including silica, titaniaâ&#x20AC;Ś Artificial spherical vesicles produced from natural phospholipids and cholesterol Macromolecular compound that comprise a series of branches around an inner core Nanoparticles made from solid lipids

Ceramic nanoparticles Liposomes Dendrimers SLN particles

Recent applications

Reference

Stability of the cisplatin nanocapsules has been optimized by varying the lipid composition of the bilayer coat Bovine serum albumin nanospheres containing 5-fluorouracil show higher tumour inhibition than the free drug Micelle delivery of doxorubicin increases cytotoxicity to prostate carcinoma cells Ultra fine silica based nanoparticles releasing water insoluble anticancer drug Radiation-guided drug delivery of liposomal cisplatin to tumor blood vessels results in improved tumour growth delay Targeted delivery within dendrimers improved the cytotoxic response of the cells to methotrexate 100-fold over free drug SLN powder formulation of all-trans retinoic acid may have potential in cancer chemoprevention and therapeutics.

Velinova, 2004

134

Santhi, 2002 McNaealy , 2004 Roy, 2003 Geng, 2004 Quintana, 2002 SooJeong, 2004

Cancer Therapy Vol 3, page 135 Some factors must be taken into account when preparing the liposomal formulations including the size, the surface charge (Senior, 1987) and the membrane fluidity (Gregoriadis and Senior, 1980). All these formulation issues have implications on the pharmacokinetics, biodistribution and bioavailability of the entrapped therapeutic product. There are many liposomes for the treatment of malignancies that are already approved, awaiting approval or in clinical trials. The most frequently studied drug family is the anthracyclines since they present activity against a wide range of tumours (Young et al, 1981). For example, doxorubicin liposomes have shown significant activity against AIDS-related Kaposi´s sarcoma, breast and ovarian cancers in different clinical trials (Amantea et al, 1997; Muggia, 1997; Ranson et al, 1997). Liposomes containing daunorubicin have been also successfully employed in the treatment of Kaposi´s sarcoma and are currently currently being evaluated with some effectiveness for the treatment of central nervous system tumors (Zucchetti et al, 1999). Another promising liposomal product is the vincristine liposome. In fact, in a preliminary phase II trial for the treatment of nonHodgin´s lymphomas, liposomal-vincristine showed efficacy against the transformed or aggressive nonHodgin´s lymphomas and presented less neurotoxicity than the free-drug (Sarris et al, 2000). Another interesting approach is the immobilization of therapeutic product-secreting cells within microcapsules (Orive et al, 2003c, 2004). Enclosing the biologically active material within a polymeric matrix surrounded by a semipermeable membrane it is possible to circumvent immune rejection while enabling the controlled and continuous release of the active substance. Several attemps of applying this technology to treatment of different malignancies have been described and reviewed in the literature (Orive et al, 2003d). For instance, using CYP2B1-transfected cells which activate the prodrug ifosfamide at the site of tumor, the median survival of mice transplanted with a human pancreatic carcinoma was the double than the control group (Lörh et al, 2002). The safety of this protocol was evaluated in a phase I/II trial in 14 patients with pancreatic cancer. Results showed that the tumours of four patients regressed after treatment and those of other ten individuals who followed the study remain stable (Lörh et al, 2001). However, the inhibition of tumour angiogenesis has been so far the most frequently targeted phenomenon by microencapsulated cells. Angiogenesis is the process by which new blood vessels are formed to promote tumour growth and metastasis (Folkman, 1971). The available evidence suggest that optimal anti-angiogenic therapy requires prolonged exposure to low drug concentrations (Cristofanalli et al, 2002; Kerbel and Folkman, 2002; Sweeney et al, 2003). Furthermore, the discovery of endogenous antiangiogenic factors (O´Really et al, 1994, 1997) has opened the door to the genetic manipulation of cells and consequently their encapsulation in polymer matrices (Boüard et al, 2003; Cirone et al, 2003). Using this strategy, genetically engineered kidney epithelial cells expressing the anti-angiogenic agent endostatin were

assayed for the treatment of glioblastomas (Joki et al, 2001). Mice inoculated with human glioma U87MG cells were divided in three groups. The first group received a single injection of microcapsules containing endostatin secreting cells (BHK-endo). The second received an injection of neomycin-resistant gene-transfected cells that did not secrete endostatin (BHK-neo) and the third group did not receive any treatment (control). Results showed that in comparison with controls, the growth of glioma tumours was suppressed by 62% by 21 days post administration of the encapsulated BHK-neo cells (Figure 3A). Furthermore, the BHK-endo group showed a 72% reduction in tumour weight when compared to the other two groups (Figure 3B) (Joki et al, 2001). A similar approach done by other research group resulted in analogous results with a tumor growth reduction of >70% (Read et al, 2001). In addition, encapsulated cells secreting angiostatin have been combined with immunotherapy against a mouse melanoma model showing improved survival with 30% of the animals surviving tumour free (Cirone et al, 2004).

IV. Macromolecular conjugation The pharmacokinetics and biodistribution of the cancer drugs can be improved by conjugating the latter with water soluble polymers, peptides and proteins. PEG is the main representative of the polymers used to conjugate with the therapeutic drug in order to improve the pharmacokinetics of the latter. In fact, since the first PEGylated protein (PEG-adenosine deaminase) entered the market in 1990 (Levy et al, 1988), a large number PEGylated pharmaceuticals have followed. For instance, PEGinterferon !-2b is under clinical evaluation in a phase II randomized study in patients with metastatic or unresectable carcinoid tumours whereas PEGylated-Lasparaginase (Oncospar ®) is used in the treatment of acute leukaemia. The latter can be administered every 2 weeks instead of the 2-3 times per week needed for the native enzyme. In addition, a Phase II clinical trial is undergoing to evaluate PEGylated-L-asparaginase in multiple myeloma (http://www.clevelandclinic.org/myeloma /pegasp.htm. This strategy can be also used to improve targeting and EPR effect of polymer particles. In fact, by conjugating specific vector molecules to micro and nanoparticles it is possible to improve the affinity towards different tissues or tumours. Targeted therapy enables a higher bioavailability of the therapeutic molecules whereas reduces considerably possible side-effects. Vector molecules capable of recognizing tumors include antibodies, lectins, peptides, hormones, folate and vitamins. For example, monoclonal nuclear antibodies can be attached to the drug carriers to promote drug release only to tumour cells and not normal cells (Iakoubov et al, 1995). Interestingly, the high affinity of folic acid for folate receptors provides a unique opportunity to use folic acid as a targeting ligand to deliver chemotherapeutic agents to cancer cells. In vitro experiments using folatetethered liposomes containing calcein or doxorubicin showed a selective drug release in both human cervical cancer HeLa-IU1 cells and human colon cancer Caco-2 cells overexpressing folate receptors (Zhang et al, 2004) 135

Orive et al: Micro and nano drug delivery systems in cancer therapy Figure 3. The effect of encapsulated endostating secreting cells (BHKendo), encapsulated cells that did not secrete endostatin (BHK-neo) and no treatment (control) on tumor growth in vivo. A) Tumour size and B) tumour weight of subcutaneous U87MG human glioma cell xenograft. Reproduced from Joki et al, 2001 with kind permission from Nature Biotechnololy.

In another approach, Hasokawa et al. used a human monoclonal antibody formulated as PEG-modified immunoliposomal doxorubicin to treat selectively human stomach cancer. In vivo experiments showed greater antitumor activity than the unmodified liposome or the free drug (Hosokawa et al, 2003). Anti-tumor antibodyconjugated polymeric micelles called immunomicelles have shown successful in vitro and in vivo delivery of taxol into various cancer cells (Torchilin et al, 2003). In

fact, when inhibition of murine Lewis lung carcinoma tumour growth in mice was evaluated with different taxol preparations, the average weight of excised tumours in the group treated with taxol incorporated in immunomicelles was 0.67±0.35 g compared with 1.58±0.48 g and 1.37±0.36 g in groups treated with free taxol or taxol in plain PEG-PE micelles, respectively (P < 0.05 in both cases) (Figure 4). Figure 4. Inhibition of murine Lewis lung carcinoma tumour growth in mice with different taxol preparations including free taxol, plain micelles and taxol releasing 2C5-immunomicelles. Reproduced from Torchilin et al, 2003 with kind permission from Proc. Natl. Acad. Sci. U.S.A.

136

Cancer Therapy Vol 3, page 137 delivery systems in cancer therapy, Ed. Brown DM, Humana Press, 191-213. Duncan R (2003) The dawning era of polymer therapeutics. Nat Rev Drug Discov 2, 347- 360. Emerich DF, Thanos CG (2003) Nanotechnology and medicine. Expert Opin Biol Ther 3, 655-663. Folkman J (1971) Tumor angiogenesis: therapeutic implications. N Engl J Med 285, 1182-1186. Gabizon A, Shmeeda H, Barenholz Y (2003) Pharmacokinetics of pegylated liposomal doxorubicin - Review of animal and human studies. Clinical Pharmacokinetics 42, 419-436. Geng L, Osusky K, Konjeti S, Fu A, Hallahan D (2004) Radiation-guided drug delivery to tumor blood vessels results in improved tumor growth. J Control Rel 99, 369381. Gregoriadis G, Senior J (1980) The phospholipid component of small unilamellar liposomes controls the rate of clearance of entrapped solutes from the circulation. FEBS Lett 119, 4346. Harris JM, Chess RB (2003) Effect of pegylation on pharmaceuticals. Nat Rev Drug Discov 2, 214-221. Hashizume H, Baluk P, Morikawa S, McLean JW, Thurston G, Roberge S, Jain RK, McDonald DM (2000) Openings between defective endothelial cells explain tumor vessel leakiness. Am J Pathol 156, 1363-1380. Hedley ML, Curley JM, Langer RS (1998) Microparticles for delivery of nucleic acid, USA Patent 5783567, July 21; assigned to Pangaea Pharmaceuticals. Hosokawa S, Tagawa T, Niki H, Hirakawa Y, Nohga K, Nagaike K (2003) Efficacy of immunoliposomes on cancer models in a cell-surface-antigen-density-dependent manner. Br J Cancer 89, 1545-1551. Iakoubov L, Rokhlin O, Torchilin V (1995) Antinuclear autoantibodies of the aged reactive against the surface of tumor but not normal cells. Immunol Lett 47, 147-149. Jain, RK (2001) Normalizing tumor vasculature with antiangiogenic therapy: a new paradigm for combination therapy. Nat Med 7, 987-989. Joki T, Machluf M, Atala A, Zhu J, Seyfried NT, Dunn IF, Abe T, Carroll RS, Black P.McL (2001) Continuous release of endostatin from microencapsulated engineered cells for tumor therapy. Nat Biotechnol 19, 35-39. Kerbel R, Folkman J (2002) Clinical translation of angiogenesis inhibitors. Nat Rev Cancer 2, 727-739. Levy Y, Hershfield MS, Fernandez C, Polmar SH, Scudiery D, Berger M, Sorensen, RU (1988) Adenosine deaminase deficiency with late onset or recurrent infections: response to treatment with polyethylene glycol modified adenosine deaminase. J Pediatr 113, 312-317. Lim SJ, Lee MK, Kim CK (2004) Altered chemical and biological activities of all-trans retinoic acid incorporated in solid lipid nanoparticle powders. J Control Rel 100, 53-61. Lörh M, Hoffmeyer A, Kröger JC, Freund M, Hain J, Holle A, Karle P, Knöfel WT, Liebe S, Müller P, Nizze H, Renner M, Saller RM, Wagner T, Hauenstein K, Günzburg WH, Salmons B (2001) Microencapsulated cell-mediated treatment of inoperable pancreatic carcinoma. Lancet 357, 1591-1592. Lörh M, Hummel F, Faulmann G, Ringel J, Saller R, Hain J, Günzburg WH, Salmons B (2002) Microencapsulated, CYP2B1-transfected cells activating ifosfamide at the site of the tumor: the magic bullets of the 21st century. Cancer Chemother. Pharmacol. 49, 21-24. Maeda H, Wu J, Sawa T, Matsumura K, Hori K (2000) Tumor vascular permeability and the EPR effect in macromolecular therapeutics: a review J Control Rel 65, 271-284.

Finally, modified dendrimers have been also fully investigated for targeted drug delivery. Dendrimers associated with an anionic oligomer were elaborated for delivering angiostatin and tissue inhibitor of metalloproteinase (TIMP)-2. In vivo results showed that angiostatin release inhibited tumour growth by 71% while (TIMP)-2 by 84%. Moreover, combined therapy resulted in 96% inhibition of tumour growth (Vincent et al, 2003).

V. Conclusions The present paper reviews the use of micro and nanotechnology as well as macromolecular conjugation as strategies to deliver existing chemotherapies and novel therapeutic molecules in a controlled manner to malignancies. These technologies come along with other exciting drug delivery approaches such as patches, microchips and osmotic pumps. In general, the technologies described here improve significantly the pharmacokinetics and biodistribution of the free drugs and reduce considerably their side-effects. Furthermore, some of them have been approved by FDA and are currently in the market. In the future, some challenges need to be addressed including the adaptation of each drug delivery system to the particular needs of each malignancy, improvement of interactions between the drug and some of the components of the carrier and development of multifunctional systems able to deliver several drugs at the same or different time with different kinetic releases.

References Allen TM, Cullis PR (2004) Drug delivery systems: entering the mainstream. Science 303, 1818-1822. Amantea MA, Forrest A, Northfelt DW, Mamelok R (1997) Population pharmacokinetics and pharmacodynamics of pegylated-liposomal doxorubicin in patients with AIDSrelated Kaposi´s sarcoma. Clin Pharmacol Therap 61, 301311. Bergers G, Benjamin LE (2003) Tumorigenesis and the angiogenic switch. Nat Rev Cancer 3, 401-410. Birnbaum DT, Brannon-Peppas L (2004) Microparticle drug delivery systems. In Drug delivery systems in cancer therapy, Ed. Brown DM, Humana Press, 117-135. Boüard S, Guillamo J, Christov C, Lefévre N, Brugiéres P, Gola E, Devanz P, Indraccolo S, Peschanski M (2003) Antiangiogenic therapy against experimental glioblastoma using genetically engineered cells producing interferon-·, angiostatin or endostatin. Hum Gene Ther 14, 883-895. Cirone P, Bourgeois JM, Chang PL (2003) Antiangiogenic cancer therapy with microencapsulated cells. Hum Gene Ther 14, 1065-1077. Cirone P, Bourgeois JM, Shen F, Chang PL (2003) Combined immunotherapy and antiangiogenic therapy of cancer with microencapsulated cells. Hum Gene Ther 15, 956-959. Cleland JL (1997) Recombinant human growth hormone poly(lactic-co-glycolic acid) microsphere formulation development. Adv Drug Deliv Rev 28, 71-84. Cristofanilli M, Charnsangavej C, Hortobagyi (2002) Angiogenesis modulation in cancer research: novel clinical approaches. Nat Rev Drug Discov 1, 415-426. Drummond DC, Kirpotin D, Benz CC, Park JW, Hong K (2004) Liposomal drug delivery systems for cancer therapy In Drug

137

Orive et al: Micro and nano drug delivery systems in cancer therapy McNealy TL, Trojan L, Knoll T, Alken P, Michel MS (2004) Micelle delivery of doxorubicin increases cytotoxicity to prostate carcinoma cells. Urological Res 32, 255-260. Moses MA, Brem H, Langer R (2003a) Novel delivery systems in cancer chemotherapy. Science & Medicine 9, 264-273. Moses MA, Brem H, Langer R (2003b) Advancing the field of drug delivery: taking aim at cancer. Cancer Cell 4, 337-341. Muggia FM (1997) clinical efficacy and prospects for use of pegylated liposomal doxorubicin in the treatment of ovarian and breast cancers. Drugs 54, 22-29. Northfelt DW, Martin FJ, Working P, Volberding PA, Russell J, Newman M, Amantea MA, Kaplan LD (1996) Doxorubicin encapsulated in liposomes containing surface-bound polyethylene glycol: Pharmacokinetics, tumor localization, and safety in patients with AIDS-related Kaposi's sarcoma. J Clin Pharmacol 36, 55-63. Okada H (1997) One and three month release injectable microspheres of the LH-RH superagonist leuprorelin acetate. Adv Drug Deliv Rev 28, 43-70. Orive G, Hernández RM, Gascón AR, Calafiore R, Chang TMS, De Vos P, Hortelano G, Hunkeler D, Lacík I, Shapiro AMJ, Pedraz JL ( 2003c) Cell encapsulation: promise and progress. Nat Med 9, 104-107. Orive G, Hernández RM, Gascón AR, Calafiore R, Chang TMS, De Vos P, Hortelano G, Hunkeler D, Lacík I, Pedraz JL (2004) History, challenges and promises of cell microencapsulation. Trends Biotechnol 22, 87-92. Orive G, Hernández RM, Gascón AR, Domínguez-Gil A, Pedraz JL (2003a) Drug delivery in biotechnology: present and future. Current Opin Biotechnol 14, 659-664. Orive G, Hernández RM, Gascón AR, Domínguez-Gil A, Pedraz JL (2003b) New approaches in the delivery of biopharmaceuticals. Trends Pharm Sci 25, 382-387. Orive G, Hernández RM, Gascón AR, Igartua M, Pedraz JL (2003d) Cell encapsulation technology for biomedical purposes: novel insights and challenges. Trends Pharm Sci 24, 207-210. O´Really MS, Boehm T, Shing Y, Fukai N, Vasios G, Lane WS, Flynn E, Birkhead JR, Olsen BR, Folkman J (1997) Endostatin: an endogeneous inhibitor of angiogenesis and tumor growth. Cell 88, 277-285. O´Really MS, Holmgren L, Shing Y, Chen C, Rosenthal RA, Moses M, Lane WS, Cao Y, Sage EH, Folkman J (1994) Angiostatin: a novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma. Cell 79, 315-328. Panyam J, Labhasetwar V (2003) Biodegradable nanoparticles for drug and gene delivery to cells and tissue. Adv Drug Deliv Rev 55, 329-347. Quintana A, Raczka E, Piehler L, Lee I, Myc A, Majoros I, Patri AK, Thomas T, Mule J, Baker JR (2002) Design and function of a dendrimer-based therapeutic nanodevice targeted to tumor cells through the folate receptor. Pharm Res 19, 1310-1316. Ranson MR, Carmichael J, O´Byrne K, Stewart S, Smith D, Howell A (1997) Treatment of advanced breast cancer with sterically stabilized liposomal doxorubicin: results of a multicenter phase II trial. J Clin Oncol 15, 3185-3191. Read TA, Sorensen DR, Mahesparan R, Enger P, Timpl R, Olsen BR, Hjelstuen HB, Haraldseth O, Bjerkvig R (2001) Local endostatin treatment of gliomas administered by microencapsulated producer cells. Nat Biotechnol 19, 29-34. Reiner Z, Dominik R, Iduna F (2004) Reduction of tamoxifen resistance in human breast carcinomas by tamoxifencontaining liposomes in vivo. Anti-Cancer Drugs 15, 707714.

Roy I, Ohulchanskyy TY, Pudavar HE, Bergey EJ, Oseroff AR, Morgan J, Dougherty TJ, Prasad PN (2003) Ceramic-based nanoparticles entrapping water insoluble photosensiting anticancer drugs: a novel drug-carrier system for photodynamic therapy. J Am Chem Soc 125, 7860-7865 Sahoo SK, Labhasetwar V (2003) Nanotech approaches to drug delivery and imaging. Drug Discov Today 8, 1112-1120. Santhi K, Dhanaraj SA, Joseph V, Ponnusankar S, Suresh B (2002) A study on the preparation and anti-tumor efficacy of bovine serum albumin nanospheres containing 5-fluorouracil. Drug Develop Industrial Pharm 28, 1171-1179. Sarris AH, Hagemeister F, Romaguera J, Rodriguez MA, McLaughlin P, Tsimberidou AM, Medeiros LJ, Samuels B, Pate O, Oholendt M, Kantarjian H,Burge C, Cabanillas F (2000) Liposomal vincristine in relapsed non-Hodking´s lymphomas: early results of an ongoing phase II trial. Ann Oncol 11, 69-72. Senior JH (1987) Fate and behaviour of liposomes in vivo: a review of controlling factors. Crit Rev Ther Drug Carrier Syst 3, 123-193. Shorr RGL, Bentley M, Zhsao S, Parker R, Whittle B (2004) Polyethylene glycol conjugation of protein and small molecule drugs: past present and future. In Drug delivery systems in cancer therapy, Ed. Brown DM, Humana Press, 175-187. Steiniger SCJ, Kreuter J, Khalansky AS, Skidan IN, Bobruskin AI, Smirnova ZS, Severin SE, Uhl R, Kock M, Geiger KD, Gelperina SE (2004) Chemotherapy in rats with doxorubicinloaded nanoparticles. Int J Cancer 109, 759-767. Sweeney CJ, Miller KD, Sledge GW (2003) Resistance in the anti-angiogenic era: nay-saying or a word of caution. Trends Mol Med 9, 24-29. Theodolou M, Clifford H (2004) Cardiac profiles of liposomal anthracyclines: greater cardiac safety versus conventional doxorubicin? Cancer 100, 2052-2063. Torchilin VP, Lukyanov AN (2003) Peptide and protein drug delivery to and into tumors: challenges and solutions. Drug Discov Today 8, 259-266. Torchilin VP, Lukyanov AN, Gao ZG, PapahadjopoulosSternberg B (2003) Immunomicelles: targeted pharmaceutical carriers for poorly soluble drugs. Proc Natl Acad Sci USA 100, 6039-6044. Velinova MJ, Staffhorst RWHM, Mulder WJM, Dries AS, Jansen BAJ, de Kruijff B, de Kroon AIPM (2004) Preparation and stability of lipid-coated nanocapsules of cisplatin: anionic phospholipid specificity. Biochem Biophys Biomemb 1663, 135-142. Vincent L, Varet J, Pille JY, Bompais H, Opolon P, Maksimenko A, Malvy C, Mirshahi M, Lu H, Vannier JP, Soria C, Li H (2003) Efficacy of dendrimer-mediated angiostatin and TIMP-2 gene delivery on inhibition of tumor growth and angiogenesis: In vitro and in vivo studies. Int J Cancer 105, 419-429. Young RC, Ozols RF, Myers CE (1981) The anthracycline antineoplastic drugs. N Engl J Med 305, 139-153. Zhang Y, Guo L, Roeske RW, Antony AC, Jayaram HN (2004) Pteroyl-"-glutamate-cysteine synthesis and its application in folate receptor-mediated cancer cell targeting using folatetethered liposomes. Anal Biochem 332, 168-177. Zucchetti M, Boiardi A, Silvani A, Parisi I, Piccolrovazzi S, D´Incalci M (1999) Distribution of daunorubicin and daunorubicinol in human glioma tumors after administration of liposomal daunorubicin. Cancer Chemother Pharmacol 44, 178-179.

138

Cancer Therapy Vol 3, page 139 Cancer Therapy Vol 3, 139-146, 2005

Transvaginal color Doppler in the assessment of cervical carcinoma Review Article

Juan Luis Alcázar* Department of Obstetrics and Gynecology, Clínica Univeristaria de Navarra, School of Medicine, University of Navarra, Pamplona, Spain

__________________________________________________________________________________ *Correspondence: Juan Luis Alcázar, Department of Obstetrics and Gynecology, Clínica Univeristaria de Navarra, School of Medicine, University of Navarra, Pamplona, Spain, Avenida Pio XII, 36 31008 Pamplona, Spain; e-mail: jlalcazar@unav.es Key words: Transvaginal color Doppler, cervical carcinoma Abbreviations: flow velocity waveform, (FVW); pulsatily index, (PI); peak systolic velocity, (PSV); resistance index, (RI); vascular index, (VI) Received: 13 January 2005; revised: 28 January 2005 Accepted: 2 March 2005; electronically published: March 2005

Summary Transvaginal color Doppler is a non-invasive ultrasound-based technique that allows an in vivo assessment of tumor vascularization. Several papers in the last decade have evaluated the role of this technique in assessing carcinoma of the cervix. In this paper we will review the role of transvaginal color Doppler sonography in assessing cervical carcinoma vascularization and its correlation with tumor characteristics as well as for predicting therapeutic response to treatment such as radiotherapy and chemotherapy. waveform (FVW). And calculating velocity of blood flow throughout the cardiac cycle, including peak systolic velocity (PSV, cm/sec), mean velocity and end-diastolic velocity, and resistance to flow by calculating some velocimetric indexes such as resistance index (RI) or pulsatility index (PI). The higher the velocity and the lower the RI or PI would means the higher blood flow (Figure 1). 2. Color Doppler. It is based in the same principle than pulsed Doppler (Doppler frequency shift) and allows the visualization of vessels by color-coding. This method is useful to determine the presence of vessels and provides information about the amount of vessels (subjective), their distribution and arrangement. It is usually used in combination with pulsed Doppler (Figure 2). 3. Power Doppler. This method is based in the amplitude shift of Doppler signal but not in frequency shift. It has some advantages over color Doppler, which make it more suitable for assessing vascularity (Guerriero et al, 1998) (Figure 3). As a matter of fact, recent studies have shown that color and power Doppler sonography can be used to depict flow within arterioles and venules (> 100 µm) (Fleischer et al, 2000). Furthermore, the recent development of sonographic microbubble contrast agents and the ability to use harmonics and pulse inversion techniques have

I. Introduction Angiogenesis is the production of new vessels in a specific area (Folkman et al, 1989). It has been demonstrated that neoangiongenesis is an essential event for tumor growth and progression (Folkman et al, 1989). The process of angiogenesis initiates with the degradation of the capillary vessel basement membrane, through which migrating endothelial cells form a sprout and proliferate to create new lumen and further vessel maturation (Abulafia et al, 2000) Specifically, in cancer of the cervix, angiogenesis has been shown to be an independent prognostic factor (Schelenger et al, 1995; Tjalma et al, 1995; Kaku et al, 1998; Obermair et al, 1998) and to predict recurrence (Wiggins et al, 1995; Dinh et al, 1996) Tumoral angiogenesis is usually assessed by inmunohistochemical staining of factor VIII (Schelenger et al, 1995; Tjalma et al, 1995; Kaku et al, 1998; Obermair et al, 1998). This means that a histological piece is needed to perform the assessment. Transvaginal Doppler ultrasound allows an in-vivo non-invasive assessment of tumor angiogenesis (Cosgrove et al, 2003). Doppler ultrasound may be used in several modes (Maulik et al, 1997): 1. Pulsed Doppler. Allows the assessment of blood flow velocity and resistance in a given vessel at a given moment by analyzing the so-called flow velocity 139

Alcรกzar et al: Transvaginal color Doppler in the assessment of cervical carcinoma

Figure 1. Flow velocity waveform from two cases of cervical cancer. In one (a) resistance and pulsatility indexes are high (RI = 0.57, PI = 0.89), whereas in the other case (b) are low (RI = 0.30, PI = 0.34).

140

Cancer Therapy Vol 3, page 141

Figure 2. Transvaginal color Doppler from a cervical carcinoma. A highly vascularized area is clearly seen within the cervix. Vessels are seen on red or blue depending on blood flow direction. Yellow vessels indicate that blood flow velocity is too high to ascertain direction of flow.

Figure 3. Transvaginal power Doppler from a cervical cancer. All vessels are depicted on the same color (no information of blood flow direction is provided by this method). However, vessels are more clearly defined.

141

Alcázar et al: Transvaginal color Doppler in the assessment of cervical carcinoma enabled depiction of microvasculature (< 7-10 µm) (Foster, 2000). The objective of this paper is to review the application of transvaginal color and power Doppler in the assessment of angiogenesis in cervical cancer.

reported that this method was highly reproducible and they found that the higher VI was, the higher tumoral stage, the deeper stromal invasion, the higher lymphovascular space invasion rate and the higher pelvic lymph node metastases rate was. More interestingly, this VI had a good correlation with intratumoral microvessel density as assessed inmunohistochemically (r=0.586). Although this paper was the first to demonstrate the correlation between inmunohistochemically assessed angiogenesis and power Doppler assessed angiogenesis, the main problem that the method is a two-dimensional assessment of tumor vascularity in a given scanning section of the tumor. But the tumor is a three-dimensional structure. Furthermore, other authors have not reproduced this method. The same group reported a further series but using color Doppler in 60 women diagnosed as having a stage Ib-IIa cervical cancer (Cheng et al, 1999b). They found color signals in 58% of the cases. The presence of color signals was associated with a higher probability of lymph node metastases (sensitivity 80%, specificity 48%) and parametrial involvement (sensitivity 91%, specificity 57%). In our experience color signals may be identified in 100% of cervical cancers (Alcázar et al, 2003). We found that tumor blood flow as assessed by transvaginal color Doppler was correlated with some tumor characteristics. Tumor vascularization was higher in squamous cell cancers, moderately or poorly differentiated lesions and advanced – stage tumors. However, in all these studies assessment of tumor blood flow color mapping has the inherent bias of subjectivity and this may represent a problem for interand intra-observer reproducibility when applying this technique in clinical settings. In the last years three-dimensional power-Doppler has been introduced as a new method for assessing tumor vascularization (Figure 4). This technique allows a global assessment of vascularization in a giver area including the whole region of interest, thus representing a more accurate and actual estimation of tumor vascularity (Suren et al, 1998). Furthermore, this technique has been demonstrated to be highly reproducible (Raine-Fenning et al, 2003). To date reported results on the use of 3 D Power Doppler sonography for assessing tumor vascularization in cervical cancer are controversial. Testa et al, (2004) did not find any correlation between 3D-derived vascular indices and clinicpathological characteristics in a series of 74 cervical cancer. However, they found that 2D spectral and color Doppler parameters were correlated with tumor stage and diameter. The higher vascularization was the larger tumor and advanced stage were these results were similar to ours (Alcázar, 2003). On the other hand, Hsu et al has reported the results of applying 3D Power-Doppler in 141 patients with earlystage cervical cancer. They found blood flow in 85% of the tumors and tumor vascularization was correlated with tumor volume (Hsu et al, 2004). In our experience, vascularization as assessed by 3D power Doppler ultrasonography was higher in invasive

II. Transvaginal color and powerDoppler and its correlation with tumoral features in cervical cancer Initial studies assessing blood flow hemodynamics in cervical cancer in the early 90’s focused on the main feeding cervical vessels: the uterine artery (Enzelsberger et al, 1991) and the cervical branch of the uterine artery (Breyer et al, 1993). This was due basically to the technical limitations of Doppler ultrasound in those days. Enzelsberger et al, (1991) found that mean PI in the uterine arteries of women with cervical cancer was significantly lower than in healthy women. Similar findings were reported by Breyer et al, (1993) when analysing the cervical artery. Tepper et al reported that intratumoral RI was lower in patients with cervical cancer as compared with healthy women (Tepper et al, 1996). Wu et al compared color and power Doppler in assessing intratumoral vascularization in 35 women with cervical cancer 30 healthy women (Wu et al, 2000). They reported color signals in 97% of cancers and found that both PI and a vascular ratio (cross-section area of intratumoral vessels / cross-section area of the tumor) defined by the authors were significantly lower in patients with cervical cancer. They concluded that power Doppler angiography was more useful than color Doppler because the vascular ratio provided more sonographic characteristics among different subclassifications of cervical cancer. Hsieh et al, (1995) found that 46.2% of cervical cancers exhibited blood flow color signals as assessed by transvaginal color Doppler sonography. They reported that in those patients with detectable color signals lymph node involvement was more frequent as compared with those without color signals detectable (33% vs 5.7%, p = 0.005) and this also correlated with a higher cell proliferation index. They did not find differences in tumoral stage, patient’s age, clinical staging, histologic type and DNA ploidy status. These papers indicated that intratumoral blood flow in cervical cancer could be assessed by transvaginal color Doppler. However, blood flow detection rate was very low to be practical from the clinical point of view. Furthermore, Carter challenged these previous studies reporting that no differences would exist in RI or PI between benign and malignant cervical tumors (Carter, 1999). Cheng et al, (1999a) reported a novel vascular index (VI) for the in vivo assessment of angiogenesis in patients with cervical carcinoma. They evaluated 35 patients with stage Ib-IIa cervical carcinoma by transvaginal power Doppler ultrasound, and using image processor software they developed a vascular index (VI = number of colored pixels/number of total pixels) for each tumor. They 142

Cancer Therapy Vol 3, page 143 cancers than in â&#x20AC;&#x153;in situâ&#x20AC;? carcinoma and normal cervix

(Table 1).

Figure 4. Three-dimensional power-Doppler ultrasound from a case of cancer of the cervix. (a) Tumor volume estimation, depicting the lesion contour. (b) Vascular indexes (VI, FI, VFI) within the tumor estimated using this method.

143

Alcázar et al: Transvaginal color Doppler in the assessment of cervical carcinoma Table 1. 3D power Doppler vascular indexes in cervical cancer

VI (Vascular index)* FI (Flow index)† VFI (Vascular-flow index) ‡

Normal cervix “In situ” (n=5) carcinoma (n=5) 1.68% (1.89) 6.29% (10.2)

Invasive early-stage Invasive advanced-stage carcinoma (n=7) carcinoma (n=16) 32.50% (10.0) 40.42% (14.1)

21.57 (2.6)

20.69 (3.1)

29.80 (6.3)

31.1 (6.5)

0.49 (0.5)

1.51 (2.1)

10.07 (4.3)

12.44 (6.02)

Data expressed as mean, standard deviation in parentheses. * p < 0.001 † p < 0.05 ‡ p < 0.05

tumors had the better response. These results could be explained by several facts. First, it has been demonstrated that correlation between blood supply and oxygenation is absent in large tumors (Asomov et al, 1984). Second, tumor oxygenation would depend no only on the extent of angiogenesis, but also in the capability of the newly formal vessels to supply oxygen. It has been shown that this capability is impaired in neoangiogenesis vessels (Fenton and Way, 1993). Third, as indicated earlier the higher the vascularization is the more aggressive the tumor is (Ueda et al, 1998). This could indicate that highly vascularized tumors could be more resistant to chemotherapy and radiotherapy (Alcázar and Jurado, 1999). Despite these initially surprising results, we performed a second study in an extended series of patients with locally advanced cervical carcinoma (Alcázar, 2004). The results of this second study confirmed the preliminary results. We found that the likelihood ratio for complete response to chemorradiation for tumors with a PI > 0.45 was 3.3 (95% CI: 2.1-4.5). Chen et al reported that the use of the vascularity index described by their group would be useful to predict the response to neoadjuvant chemotherapy in cervical carcinoma (Chen et al, 2004). They found that nonresponders had higher vascularized tumors than responders do and persisted highly vascularized during treatment these findings are in agreement with our data.

However, as Testa et al, (2004) we did not find any correlation between 3D power Doppler derived vascular indexes and tumor characteristics among invasive cervical cancer.

III. Transvaginal color Doppler for predicting treatment response Several studies have evaluated the role of transvaginal color Doppler for assessing or predicting the response to treatment in women with cervical cancer. Pirhonen and col. analyzed intratumoral vascularization by color mapping in 14 patients with advanced cervical carcinoma treated with external radiotherapy (Pirhonen et al, 1995). They used a subjective color map grading (Grade 1: normal amount of vessels to grade 5: extremely high amount of vessels). They evaluated patients prior to start treatment and then five follow-up examinations during treatment. These authors found that a decrease in tumor vascularization during radiotherapy was associated with a better outcome, whereas persistence of high vascularity was associated with a poor response. They concluded that color Doppler ultrasound might be useful in early assessment of therapeutic response during RT. Similar findings were reported by Greco et al, (1997) in a series of 14 women with advanced cervical cancer. These authors evaluated intratumoral vascularization by means of transvaginal color Doppler before and after neoadyuvant chemotherapy. Ten out of 14 patients had a successful therapeutic response. The authors reported that in these cases a significant increase on intratumoral RI and PI was observed after treatment, whereas no differences were found in those four women who did not respond to chemotherapy. We hypothesized that, since oxygenation plays an essential role in the response to radiotherapy in solid tumors and as tumor oxygenation depends on angiogenesis, the higher vascularized tumors would have a higher oxygen delivery to tissue and, therefore, would have a better response to chemoradiation in locally advanced cervical cancer. We tested this hypothesis in a preliminary study on 10 patients (Alcázar et al, 1999). However, surprisingly, we found that poorly vascularized

IV. Conclusions Transvaginal color or power Doppler allows a noninvasive assessment of tumor vascularization in cervical carcinoma. Although most published studies come from two groups they have shown that tumor vascularization as assessed by this technique correlates with some individual tumor characteristics such as tumor volume, lymph node involvement and tumoral stage. However, there is no consensus about which Doppler parameter or parameters correlate better with tumor characteristics. Regarding the role of this technique for predicting response to treatment all published studies indicate that it may be useful for this purpose. However, most series are small and, therefore, studies in larger series are needed to confirm these results. Should be this confirmed it would

144

Cancer Therapy Vol 3, page 145 Foster FS, Burns PN, Simpson DH, Wilson SR, Christopher DA, Goertz DE (2000). Ultrasound for the visualization and quantification of tumor microcirculation. Cancer Mestastasis Rev 19, 131-8 Greco P, Cormio G, Vimercati A, Nacci G, Di Vagnio G, Loverro G, Selvaggi L (1997) Transvaginal color Doppler ultrasound for monitoring the response to neoadjuvant chemotherapy in advanced cervical cancer. Acta Obstet Gynecol Scand 76, 169-72 Guerriero S, Ajossa S, Lai MP, Risalvato A, Paoletti AM, Melis GB. (1999) Clinical applications of colour Doppler energy imaging in the female reproductive tract and pregnancy. Hum Reprod Update 5, 515-29 Hsieh CY, Wu CC, Chen TM, Chen CA, Chen CL, Wang JF, Chang CF, Hsieh FJ. (1995) Significance of intratumoral blood flow in cervical carcinoma assessed by color Doppler ultrasound. Cancer 75, 2518-22. Hsu KF, Su JM, Huang SC, Cheng YM, Kang CY, Shen MR, Chang FM, Chou CY. (2004) Three-dimensional power Doppler imaging of early-stage cervical cancer. Ultrasound Obstet Gynecol 24, 664-71. Kaku T, Hirakawa T, Kamura T, Amada S, Kinukawa N, Kobayashi H, Sakai K, Ariyoshi K, Sonoda K, Nakano H. (1998) Angiogenesis in adenocarcinoma of the uterine cervix. Cancer 83, 1384-90. Maulik D (1997) Doppler in Obstetrics and Gynecology. Springer-Verlag, New York USA Obermair A, Wanner C, Bilgi S, Speiser P, Kaider A, Reinthaller A, Leodolter S, Gitsch G. (1998) Tumor angiogenesis in stage IB cervical cancer: correlation of microvessel density with survival. Am J Obstet Gynecol 178, 314-9. Pirhonen JP, Grenman SA, Bredbacka AB, Bahado-Singh RO, Salmi TA (1995) Effects of external radiotherapy on uterine blood flow in patients with advanced cervical carcinoma assessed by color Doppler ultrasonography Cancer 76, 67-71 Raine-Fenning NJ, Campbell BK, Clewes JS, Kendall NR, Johnson IR. (2004) The interobserver reliability of threedimensional power Doppler data acquisition within the female pelvis. Ultrasound Obstet Gynecol 23, 501-8. Schlenger K, Hockel M, Mitze M, Schaffer U, Weikel W, Knapstein PG, Lambert A. (1995) Tumor vascularity--a novel prognostic factor in advanced cervical carcinoma. Gynecol Oncol 59, 57-66. Suren A, Osmers R, Kuhn W (1998) 3D color power angio imaging: a new method to assess intracervical vascularization in benign and pathological conditions. Ultrasound Obstet Gynecol 11, 133-7 Tepper R, Zalel Y, Altaras M, Ben-Baruch G, Beyth Y (1996) Transvaginal color Doppler ultrasound in the assessment of invasive cervical carcinoma Gynecol Oncol 60, 26-9 Testa AC, Ferrandina G, Distefano M, Fruscella E, mansueto D, Basso D, Salutari V, Scambia G (2004) Color Doppler velocimetry and three-dimensional color power angiography of cervical carcinoma. Ultrasound Obstet Gynecol 24, 44552 Tjalma W, Van Marck E, Weyler J, Dirix L, Van Daele A, Goovaerts G, Albertyn G, van Dam P. (1998) Quantification and prognostic relevance of angiogenic parameters in invasive cervical cancer. Br J Cancer 78, 170-4. Ueda M, Ueki K, Kumagai K, Terai Y, Okamoto Y, Ueki M, Otsuki Y (1998) Apoptosis and tumor angiogenesis incervical cancer after preoperative chemotherapy Cancer Res 58, 2343-6

be very interesting because the use of this technique could allow a more tailored treatment protocol for any given patient. Another problem to be solved is the reproducibility of the technique in order to be introduced into clinical practice. This problem may be solved by the use of 3D power-Doppler ultrasound.

References Asomov IS, Karakulov RK, Sazonova NA, Malygina AI, Morozova TG (1984) Oxigen status and angioarchitectonics of different types of tumors and their changes after radiotherapy Radiobiologiia 24, 630-5 Abulafia O, Sherer DM (2000) Angiogenesis of the uterine cervix Int J Gynecol Cancer 10, 349-57. Alcรกzar JL, Jurado M (1999) Transvaginal color Doppler for predicting pathological response to preoperative chemoradiation in locally advanced cervical carcinoma: a preliminary study Ultrasound Med Biol 25, 1041-5. Alcรกzar JL, Castillo G, Jurado, M, L_pez-Garc_a G (2003) Intratumoral blood flow in cervical cancer as assessed by trasnvaginal color Doppler ultrasonography: correlation with tumor characteristics Int J Gynecol Cancer 13, 510-4. Alcรกzar JL, Castillo G, Martinez-Monge R, Jurado M (2004) Transvaginal color Doppler for predicting response to concurrent chemoradiotherapy for locally advanced cervical carcinoma J Clin Ultrasound 32, 267-72. Breyer B, Despot A, Predanic M, Judin S (1993) Characteristics of blood flow in cancer of the uterine cervix Ultrasound Obstet Gynecol 3, 268-70. Carter JR (1999) Cervical tumor characterization by transvaginal color flow Doppler ultrasound Int J Gynecol Cancer 9, 27984 Chen CA, Cheng WF, Lee CN, Su YN, Hsieh CY, Hsieh FJ (2004) Power Doppler vascularity index for predicting the response to neoadjuvant chemotherapy in cervical carcinoma Acta Obstet Gynecol Scand 83, 591-7 Cheng WF, Le CN, Chu JS, Chen CA, Chen TM, Shau WY, Hsieh CY, Hsieh FJ (1999a) Vascularity index as a novel parameter for the in vivo assessment of angiogenesis in patients with cervical carcinoma Cancer 85, 651-7 Cheng WF, Wei LH, Su YN, Cheng SP, Chu JS, Lee CN (1999b) The possible use of color flow Doppler in planning treatment in early invasive carcinoma of the cervix Br J Obstet Gynecol 106, 1137-42 Cosgrove D (2003) Angiogenesis imaging-ultrasound Br J Radiol 76, S43-S49 Dinh TV, Hannigan EV, Smith ER (1996) Tumor angiogenesis as predictor of recurrence in stage Ib squamous cell carcinoma of the cervix. Gynecol Oncol 87, 751-4 Enzelsberger H, Skodler WD, Vavra N, Reinold E (1991) Ultrasonic Doppler flow studies of the uterine artery in women with cervix cancer Gynecol Obstet Invest 32, 112-4 Fenton BM, Way BA (1993) Vascular morphometry of KHT and RIF-1 murine sarcomas Radiother Oncol 28, 57-62 Fleischer AC, Niermann KJ, Donnelly EF, Yankeelov TE, Canniff KM, Hallahan DE, Rothenberg ME (2004). Sonographic depiction of microvessel perfusion. J Ultrasound Med 23, 1499-506 Folkman J, Watson K, Ingber D, Hanahan D (1989) Induction of angiogenesis during the transition from hyperplasia to neoplasia Nature 339, 58-61

145

Alcรกzar et al: Transvaginal color Doppler in the assessment of cervical carcinoma Wiggins DL, Granai CO, Steinhoff MM, Calabresi P. (1995) Tumor angiogenesis as a prognostic factor in cervical carcinoma. Gynecol Oncol 56, 353-6. Wu YC, Yuan CC, Hung JH, Chao KC, Yen MS, Ng HT. (2000) Power Doppler angiographic appearance and blood flow velocity waveforms in invasive cervical carcinoma. Gynecol Oncol 79,181-6.

Juan Luis Alcรกzar

146

Cancer Therapy Vol 3, page 147 Cancer Therapy Vol 3, 147-152, 2005

Outcomes of hysteroscopy and hysterectomy in breast cancer patients Research Article

Pedro T. Ramirez 1,*,Charlotte C. Sun 1, Claudia I. Vidal2, Veronica Schimp 3, Brian Slomovitz1, Michael W. Bevers1, and Diane C. Bodurka1 1

Department of Gynecologic Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, TX 77030 Department of Genitourinary Medical Oncology, The University of Texas Health Science Center, Houston, TX 77030 3 Department of Gynecologic Oncology, Wayne State University, Detroit, MI 48201 2

__________________________________________________________________________________ *Correspondence: Pedro T. Ramirez, M.D., Department of Gynecologic Oncology, Unit 440, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Houston, Texas 77030; Phone: (713) 745-5498; Fax: (713) 792-7586; E-mail: peramire@mdanderson.org Key words: breast cancer, mastectomy, hysteroscopy, hysterectomy Received: 23 December 2004; Accepted: 24 February 2005; electronically published: March 2005

Summary The purpose of this study was to identify symptoms that led to gynecologic consultations and findings on diagnostic studies and pathologic evaluation in breast cancer patients treated with mastectomy that underwent hysteroscopy and hysterectomy. We searched the patient database at The University of Texas M. D. Anderson Cancer Center. Records were reviewed to determine demographic and clinical characteristics. Two hundred and seventeen patients were included in our study. A total of 122 patients (56%) received chemotherapy for their breast cancer, 107 (49%) received radiotherapy, and 99 (46%) received hormones. Of those treated with hormones, 96 (97%) received tamoxifen. The most common reasons for gynecologic consultations were vaginal bleeding (43%) and abnormal ultrasound findings (21%). A total of 176 patients (81%) underwent hysterectomy and 54 (31%) had malignancy in final pathology. Of the 69 patients who used tamoxifen and underwent a hysterectomy, 10 (14%) patients were diagnosed with endometrial cancer.In women who have undergone mastectomy for breast cancer and subsequently undergo hysteroscopy or hysterectomy, the number of abnormal findings on ultrasound studies and endometrial evaluation is high, as is the likelihood of malignant uterine or ovarian lesion. by ultrasonography is not confirmed by hysteroscopic or histologic pathology review. Endometrial sampling by microcurettage in tamoxifen-treated patients has not proved to be as sensitive and accurate as hysteroscopy and curettage (Powles et al, 1998; Neven and Vernaeve, 2000). It has been our observation that in the Gynecologic Oncology Center in our institution, many patients with a history of breast cancer who seek the advice of a gynecologist or gynecologic oncologist do so for symptoms of vaginal bleeding either secondary to anovulatory cycles caused by the chemotherapeutic agents used to treat their breast cancer or secondary to tamoxifen use. There is also significant anxiety in asymptomatic patients undergoing treatment with tamoxifen who are found to have abnormalities on routine transvaginal ultrasonography. The purpose of this study was to identify the symptoms in breast cancer patients who previously underwent mastectomy and subsequently presented to the

I. Introduction An estimated 211,300 new cases of invasive breast cancer were diagnosed among women in the United States during 2003. During the same year, approximately 40,200 women died of this disease (Ries et al, 1975-2000). Most patients with breast cancer are offered mastectomy or breast conservation therapy at the time of diagnosis. For over 20 years, tamoxifen has been widely used in the chemoprevention of breast cancer. It is administered as a potential breast cancer chemopreventive agent because studies have shown that tamoxifen given for 5 years reduces the incidence of recurrent breast cancer by 42% and reduces the incidence of contralateral breast cancer by 47% (Fisher et al, 1998). There is poor correlation between sonographic, hysteroscopic, and histologic findings in most patients using tamoxifen (Hulka and Hall, 1993; Goldstein, 1994; Mourits et al, 1999). In 45-90% of postmenopausal longterm tamoxifen users, an increased endometrial thickness 147

Ramirez et al: Outcomes of hysteroscopy and hysterectomy in breast cancer patients outpatient Gynecologic Oncology Center in our institution. We also sought to identify the diagnostic studies used in the evaluation of these patients prior to clinical disposition. Finally, we analyzed the histopathologic findings of hysteroscopy and hysterectomy.

A. Breast cancer diagnosis and treatment The median age at the time of breast cancer diagnosis was 46.5 years (range, 22 to 82 years). The majority of the patients (146, 67%) had a diagnosis of invasive ductal carcinoma. Location of breast cancer was as follows: left breast, 92, (42%); right breast, 102, (47%); bilateral, 23 (11%). Estrogen receptor status was documented for 140 patients. Of these, 98 (70%) were estrogen receptor positive and 42 (30%) were estrogen receptor negative. Similarly, progesterone receptor status was documented for 128 patients, and 80 (62%) were progesterone receptor positive while 48 (38%) were progesterone receptor negative. Information for HER2-neu receptor was available for 49 patients. Of these, 18 (37%) patients tested positive for the HER2-neu receptor. A total of 122 (56%) of the 217 patients received some form of chemotherapy as treatment for their breast cancer. The most common regimen was 5-fluorouracil, doxorubicin, and cyclophosphamide. In addition, 107 (49%) of 215 patients were treated with radiotherapy and 99 (46%) of 212 patients were treated with hormonal therapy. Ninety-six of the 99 patients (97%) treated with hormones received tamoxifen. The median time elapsed between the breast cancer diagnosis and the gynecologic consultation was 34 months (range, 1 to 338 months).

II. Materials and Methods We conducted a retrospective analysis of all patients with breast carcinoma who underwent mastectomy at The University of Texas M. D. Anderson Cancer Center between January 1990 and December 2001. We then identified patients from this group who had been referred to and evaluated in our outpatient Gynecologic Oncology Center and ultimately underwent either dilatation and curettage (D and C) with hysteroscopy or total hysterectomy. All cases were identified and retrieved by the Department of Medical Informatics at our institution. The investigation was conducted after Institutional Review Board approval was obtained. The medical records of all identified patients were reviewed, and the following information was gathered: patient age, race, family history of breast, ovarian or endometrial cancer, time of diagnosis of breast cancer, history of chemotherapy administration, radiation therapy, and hormonal therapy, reason for gynecologic oncology consultation, imaging studies performed at the time of consultation, results of these studies, type of definitive treatment, and histopathologic findings from D and C and hysteroscopy or hysterectomy. We excluded all patients who presented to the Gynecologic Oncology Center for any of the following reasons: a routine annual examination in an asymptomatic patient, vaginal dryness, infectious vaginal discharge, request for tubal ligation, treatment of endomyometritis, or evaluation of urinary incontinence. Additional exclusion criteria included hysterectomy prior to breast cancer diagnosis, gynecologic consultation or diagnosis of gynecologic malignancy prior to breast cancer diagnosis, hysterectomy and breast cancer surgery performed simultaneously, and missing medical record or no patient information available. We also excluded patients who were advised to undergo a D and C and hysteroscopy or hysterectomy and subsequently were lost to follow-up. Statistical analysis was performed using SPSS version 11.5.1. Descriptive statistics were used to evaluate demographic and clinical characteristic of the patients.

B. Gynecologic treatment

consultations

and

The most common reasons for gynecologic consultations were vaginal bleeding, 92 (43%); abnormal finding on ultrasonography, 45 (21%); recommended by breast oncologist, 16 (7%); evaluation of abnormal Pap smear, 14 (6%); concerns due to positive family history of breast or ovarian cancer, 9 (4%); and self-reported anxiety, 3 (1%). After initial evaluation, a total of 139 (64%) of the 217 patients had sonography performed. Other studies ordered included chest radiography, 164 (76%) and computed tomography scan of the abdomen and pelvis, 53 (24%). Prior to the D and C and hysteroscopy or hysterectomy, 120 (55%) of 217 patients underwent endometrial evaluation by endometrial biopsy. Findings on biopsy were considered abnormal in 35 cases (29%). A total of 64 patients (29%) underwent a D and C and hysteroscopy. Forty-four (69%) of the 64 patients who underwent a D and C also had an endometrial biopsy performed in the office prior to the D and C. The majority of patients underwent at least two diagnostic studies prior to the D and C and hysteroscopy. The most frequently ordered imaging study prior to D and C and hysteroscopy was transvaginal ultrasonography, which was ordered in 84% of patients. A total of 176 patients (81%) underwent a hysterectomy after their consultation in the Gynecologic Oncology Center. The median time from breast cancer diagnosis to hysterectomy was 42 months (range, 1 to 338 months). Findings on pathology review of the hysterectomy specimen were available for 163 patients.

III. Results A total of 262 patients were identified during the initial search. Forty-five patients were excluded according to the criteria outlined above. The remaining 217 patients were included in the final analysis. The median age for this group at presentation to the Gynecologic Oncology Center was 52 years (range, 28 to 83 years). The median follow-up time from the date of the first visit to the Gynecologic Oncology Center to the date of last contact was 25 months (range, 1 to 323 months). The ethnicity of the patients in our study was White, 77%; African American, 11%; Hispanic, 10%; and Asian, 2%. Information regarding family history was available for 199 patients. Of these patients, 69 (35%) had a history of maternal breast cancer, and 17 (8%) had a history of paternal breast cancer. Information regarding family history of ovarian cancer was available for 204 patients. Of these, 14 (7%) had a family history of ovarian cancer.

148

Cancer Therapy Vol 3, page 149 The pathology results were malignant in 54 cases (33%) (Table 1). Of the 176 patients who ultimately underwent a hysterectomy, 24 (14%) also underwent a D and C and hysteroscopy prior to the hysterectomy. A median of three (range, 0 to 13) diagnostic studies was performed in the patients who underwent a hysterectomy. Of the 96 patients who had a history of tamoxifen use or were current users of tamoxifen, 62 (64%) underwent an endometrial biopsy. A D and C and hysteroscopy was performed in 47 (49%) of the 96 patients who received tamoxifen. Ultimately, 69 (72%) of the 96 patients who received tamoxifen underwent a hysterectomy. The most common malignancy was endometrial cancer, which was found in 10 patients. All of these tumors were categorized as stage I disease. However, two patients were found to have uterine papillary serous carcinoma, and three patients were diagnosed with uterine sarcomas (carcinosarcoma in 2 patients and leiomyosarcoma in 1).

There seems to be significant debate as to whether patients receiving tamoxifen should undergo routine evaluation of the endometrium. The current recommendations of the American College of Obstetrics and Gynecology are outlined in Table 2. However, it is not uncommon for an asymptomatic patient to consult a gynecologic oncologist following the recommendation of her medical oncologist or on her own initiative to discuss the risk of endometrial cancer in the setting of tamoxifen exposure. The evaluation of patients receiving tamoxifen is often difficult. Findings on ultrasonography alone may be misleading because tamoxifen produces an echogenic, thick, irregular, cystic appearance of the endometrial stroma and the myometrium. Fong et al, (2001) evaluated the performance characteristics of transvaginal ultrasonography and hysterosonography for the diagnosis of endometrial abnormalities in 138 asymptomatic postmenopausal patients with breast cancer who were receiving tamoxifen. The authors concluded that an endometrial thickness of 6 mm should be considered the upper limit of normal in this patient population. In addition, they suggested that hysterosonography improves specificity by reducing the false-positive rate of transvaginal ultrasonography. Others have suggested that office hysteroscopy can also serve as a conclusive diagnostic tool for the evaluation of the endometrium in this group of patients (Timmerman et al, 1998; Garuti et

IV. Discussion Earlier detection and treatment of breast cancer will likely translate into better survival. In addition, continued research in the treatment and surveillance of breast cancer will also likely lead to better survival. Gynecologic oncologists are consultants for many women who routinely inquire about their risks of gynecologic malignancies or who need to be treated for conditions that develop as a result of breast cancer treatment. A significant percentage of the patients in our study were treated with hormones, and the majority of these were treated with tamoxifen. The estrogenic effects of tamoxifen on the vaginal epithelium of postmenopausal women with breast cancer have previously been documented (Ferrazzi et al, 1977). In addition, tamoxifen has a stimulatory effect on the endometrium (Boccardo et al, 1984). In 1985, Killackey et al, were the first to report an association between tamoxifen use and the development of endometrial cancer. Tamoxifen has been shown to increase the risk of developing endometrial cancer regardless of the dose recommended (van Leeuwen et al, 1994; Fisher et al, 1998).

Table 2. American college of obstetrics and gynecology recommendations for evaluation of patients receiving tamoxifen • Women taking tamoxifen should be monitored closely for symptoms of endometrial hyperplasia or cancer and should have a gynecologic examination at least once a year • Women taking tamoxifen should be educated about the risks of endometrial proliferation, endometrial hyperplasia, and endometrial cancer. Women should be encouraged to promptly report any abnormal vaginal symptoms, including bloody discharge, spotting, staining, or leukorrhea • Any abnormal vaginal bleeding, bloody vaginal discharge, staining, or spotting should be investigated • Because screening tests have not been effective in increasing the early detection of endometrial cancer in women using tamoxifen and may lead to more invasive and costly diagnostic procedures, they are not recommended • Tamoxifen use should be limited to 5 years’ duration because a benefit beyond this time has not been documented • If atypical endometrial hyperplasia develops, appropriate gynecologic management should be instituted, and the use of tamoxifen should be reassessed. If tamoxifen therapy must be continued, hysterectomy should be considered in women with atypical endometrial hyperplasia. Tamoxifen use may be reinstituted following hysterectomy for endometrial carcinoma in consultation with the physician responsible for the woman’s breast care

Table 1. Malignant surgical pathology findings on hysterectomy (n=54) Finding Ovarian tumor Primary invasive carcinoma Metastatic breast carcinoma Uterine tumor Primary: Endometrioid Sarcoma Papillary serous carcinoma Metastatic breast carcinoma Primary invasive fallopian tube carcinoma Primary peritoneal carcinoma Primary appendiceal carcinoma

No. of patients

(%)

8 5

15 9

23 5 5 3 1

42 9 9 6 2

3 1

6 2

149

Ramirez et al: Outcomes of hysteroscopy and hysterectomy in breast cancer patients al, 2002). It is important to note, however, that the same parameters used for endometrial evaluation in the general population should not be applied to postmenopausal patients who are undergoing treatment with tamoxifen (Achiron et al, 1995). In our study, we found that the majority of patients who developed endometrial carcinoma developed the more common endometrioid type. However, another group of patients developed higher risk histologic subtypes, such as papillary serous carcinoma and sarcoma. This has previously been reported in other studies. From our own institution, Silva et al, (1995) demonstrated that breast cancer patients treated with tamoxifen were at increased risk not only for endometrioid adenocarcinoma but also for other histological subtypes, such as papillary serous and clear cell carcinoma. Not only have there been cases of tamoxifen-associated endometrial cancers that are deeply invasive and of higher grade (Malfetano, 1990), but there have also been a number of reports of tamoxifenrelated uterine carcinosarcomas (Clarke, 1993; Kloos et al, 2002), as well as rare cases of stromal sarcomas, adenosarcomas, and leiomyosarcomas (Clement et al, 1996; Sabatini et al, 1999). We also found that a number of patients in our study were diagnosed with ovarian masses benign tumors, malignant primary tumors, and metastatic tumors from other primary sites. Previous reports (Cohen et al, 1994, 1996) have shown that in a select group of postmenopausal breast cancer patients treated with tamoxifen, the rate of ovarian tumors was 5.7%. This was four to five times higher than the rate of similar pathologic conditions in nonselected, asymptomatic and untreated postmenopausal women. A partial explanation of this finding may be the fact that women with breast malignancies, regardless of tamoxifen use, are more likely to develop benign or malignant ovarian tumors because of genetic factors. A small number of patients in our study also had metastatic breast cancer to the endometrium. This finding has previously been reported by Horn et al, (2000). In summary, we found that women who had undergone a mastectomy and subsequently underwent a hysteroscopy or hysterectomy often had several diagnostic studies before gynecologic surgery. In addition, these patients frequently underwent several invasive procedures before definitive treatment was performed. In our study, a significant number of patients ultimately had a malignancy diagnosed. Although most of these malignancies were diagnosed in the uterus and were the more common endometrioid type, some were of a more aggressive histologic subtype. In addition, a number of invasive ovarian carcinomas were also detected. These findings highlight the importance of prudent and expeditious evaluation in this patient population. Given these data the focus of future studies should address whether patients undergoing mastectomy should be offered a prophylactic hysterectomy and bilateral salpingo-oophorectomy at the same time. Another very important question that remains unanswered is how patients undergoing treatment with tamoxifen should be followed after diagnosis and treatment of their breast cancer. Until prospective studies

show the efficacy of screening tests or diagnostic modalities, we must continue to follow the recommendations of the American College of Obstetrics and Gynecology.

References Achiron R, Lipitz S, Sivan E, Goldenberg M, Horovitz A, Frenkel Y, Mashiach S (1995) Changes mimicking endometrial neoplasia in postmenopausal, tamoxifen-treated women with breast cancer, a transvaginal Doppler study. Ultras Obstet Gynecol 6, 116-20. Boccardo F, Guarneri D, Rubagotti A, Casertelli GL, Bentivoglio G, Conte N, Campanella G, Gaggero G, Comalli G, Zanardi S, Nicolo G (1984) Endocrine effects of tamoxifen in postmenopausal breast cancer patients. Tumori 70, 61-8. Clarke MR (1993) Uterine malignant mixed mullerian tumor in a patient on long-term tamoxifen therapy for breast cancer. Gynecol Oncol 51, 411-5. Clement PB, Oliva E, Young RH (1996) Mullerian adenosarcoma of the uterine corpus associated with tamoxifen therapy, a report of six cases and a review of tamoxifen-associated endometrial lesions. Int J Gynecol Pathol 15, 222-9. Cohen I, Altaras MM, Lew S, Tepper R, Beyth Y, Ben-Baruch G (1994) Ovarian endometrioid carcinoma and endometriosis developing in a postmenopausal breast cancer patient during tamoxifen therapy, a case report and review of the literature. Gynecol Oncol 55, 443-7. Cohen I, Beyth Y, Tepper R, Shapira J, Zalel Y, Figer A, Cordoba M, Yigael D, Altaras MM (1996) Ovarian tumors in postmenopausal breast cancer patients treated with tamoxifen. Gynecol Oncol 60, 54-8. Ferrazzi E, Cartei G, Mattarazzo R, Fiorentino M (1977) Oestrogen-like effect of tamoxifen on vaginal epithelium. BMJ 1, 1351-2. Fisher B, Costantino JP, Wickerham DL, Redmond CK, Kavanah M, Cronin WM, Vogel V, Robidoux A, Dimitrov N, Atkins J, Daly M, Wieand S, Tan-Chiu E, Ford L, Wolmark N (1998) Tamoxifen for prevention of breast cancer, report of the National Surgical Adjuvant Breast and Bowel Project P-1 Study. J Natl Cancer Inst 90, 1371-88. Fong K, Kung R, Lytwyn A, Trudeau M, Chapman W, Nugent P, Glanc P, Manchul L, Szabunio D, Myhr T (2001) Endometrial evaluation with transvaginal US and hysterosonography in asymptomatic postmenopausal women with breast cancer receiving tamoxifen. Radiology 220, 76573. Garuti G, Cellani F, Grossi F, Colonnelli M, Centinaio G, Luerti M (2002) Saline infusion sonography and office hysteroscopy to assess endometrial morbidity associated with tamoxifen intake. Gynecol Oncol 86, 323-9. Goldstein SR (1994) Unusual ultrasonographic appearance of the uterus in patients receiving tamoxifen. Am J Obstet Gynecol 170, 447-51. Horn LC, Einenkel J, Baier D (2000) Endometrial metastasis from breast cancer in a patient receiving tamoxifen therapy. Gynecol Obstet Investig 50, 136-8. Hulka CA, Hall DA (1993) Endometrial abnormalities associated with tamoxifen therapy for breast cancer, sonographic and pathologic correlation. AJR Am J Roentgenol 160, 809-12. Killackey MA, Hakes TB, Pierce VK (1985) Endometrial adenocarcinoma in breast cancer patients receiving antiestrogens. Cancer Treat Rep 69, 237-8. Kloos I, Delaloge S, Pautier P, Di Palma M, Goupil A, Duvillard P, Cailleux PE, Lhomme C ( 2002) Tamoxifen-related uterine carcinosarcomas occur under/after prolonged treatment,

150

Cancer Therapy Vol 3, page 151 report of five cases and review of the literature. Int J Gynecol Cancer 12, 496-500. Malfetano JH (1990) Tamoxifen-associated endometrial carcinoma in postmenopausal breast cancer patients. Gynecol Oncol 39, 82-4. Mourits MJ, Van der Zee AG, Willemse PH, Ten Hoor KA, Hollema H, De Vries EG (1999) Discrepancy between ultrasonography and hysteroscopy and histology of endometrium in postmenopausal breast cancer patients using tamoxifen. Gynecol Oncol 73, 21-6. Neven P, Vernaeve H (2000) Guidelines for monitoring patients taking tamoxifen treatment. Drug Safety,22, 1-11. Powles TJ, Bourne T, Athanasiou S, Chang J, Grubock K, Ashley S, Oakes L, Tidy A, Davey J, Viggers J, Humphries S, Collins W (1998) The effects of norethisterone on endometrial abnormalities identified by transvaginal ultrasound screening of healthy post-menopausal women on tamoxifen or placebo. Br J Cancer 78, 272-5. Ries LAG, Eisner MP, Kosary CL, Hankey BF, Miller BA, Clegg L, Mariotto A, Fay MP, Feuer EJ, Edwards BK editors. SEER Cancer Statistics Review, 1975-2000. National Cancer Institute. Bethesda, MD, 2003.http,

//seer.cancer.gov/csr/1975 2000) Sabatini R, Di Fazio F, Loizzi P (1999) Uterine leiomyosarcoma in a postmenopausal woman treated with tamoxifen, case report. Eur J Gynaecol Oncol 20, 327-8. Silva EG, Tornos C, Malpica A, Mitchell MF (1995) Uterine neoplasms in patients treated with tamoxifen. J Cell Biochem 3, 179-83. Timmerman D, Deprest J, Bourne T, Van den Berghe I, Collins WP, Vergote I (1998) A randomized trial on the use of ultrasonography or office hysteroscopy for endometrial assessment in postmenopausal patients with breast cancer who were treated with tamoxifen. Am J Obstet Gynecol 179, 62-70. van Leeuwen FE, Benraadt J, Coebergh JW, Kiemeney LA, Gimbrere CH, Otter R, Schouten LJ, Damhuis RA, Bontenbal M, Diepenhorst FW, et al (1994) Risk of endometrial cancer after tamoxifen treatment of breast cancer. Lancet 343, 448-52.

151

Ramirez et al: Outcomes of hysteroscopy and hysterectomy in breast cancer patients

152

Cancer Therapy Vol 3, page 153 Cancer Therapy Vol 3, 153-158, 2005

Ovarian mixed germ cell tumor presenting as tuberculosis Case Report

Fatemeh Ghaemmaghami*, Azam Sadat Moosavi, Malihe Hasanzadeh Gynecologist Oncologist, Tehran University of Medical Sciences

__________________________________________________________________________________ *Correspondence: Fatemeh Ghaemmaghami, Associate Professor, Gynecologist Oncologist, Tehran University of Medical Sciences. Address: Gynecology Oncology Department, Vali-e-Asr Hospital, Imam Khomeini Hospital Complex, Keshavarz Blvd., Tehran 14194, Iran. Phone: #98-21-6939320, Fax: #98-21-6937321, E-mail: valrec2@yahoo.com, ftghaemmagh@yahoo.com Key words: germ cell tumor, GTN, Tuberculosis, Endodermal sinus tumor, tumor marker, EMA-EP, MEP Abbreviations: Received: 17 January 2005; Accepted: 28 January 2005; electronically published: March 2005

Summary To introduce a patient with rare ovarian mixed germ cell tumor who presented as miliary tuberculosis.Patient was a 25 year old Afghani woman who had admitted with complains of fever, dyspenea, abdominal pain. She had a fixed pelvic mass in physical examination, abnormal findings in auscultation of the lungs, and chest X-ray.We suggested miliary tuberculosis at the first time due to socio economic nature and chest X-ray appearance. We found positive pregnancy test and echogenic mass with ultrasound in paraclinic work up. We suggested high risk GTN due to pulmonary manifestation (dyspenea and chest X-ray appearance) at the second time. So she received EMA-EP regimen.She found acute abdomen cause to hemorrhage, when she had received EMA part. Mixed germ cell tumor was confirmed by histological examination after laparatomy and removing tumoral mass. Then she received MEP regimen four courses and lived being time. In women of reproductive age who has pulmonary symptoms, GTN and mixed germ cell tumor with choriocarcinoma element should be considered. Approximately 10% of patients presents with an acute abdomen secondary to intracapsular hemorrhage, torsion and/or rupture (Hurteau and Williams, 2001). Ovarian germ cell tumors present at a relatively early stage; stage I (75%); and only few cases present stage IV (5%) (Disaia and Creasman, 2002). Mixed germ cell tumors may secret either AFP, HCG, both or neither depending on components of tumor (Hurteau and Williams, 2001). There are several case reports about peritoneal tuberculosis mimicking advanced ovarian cancer (Straughn et al, 2000; Bilgin et al, 2001; Protopapas et al, 2003). In contrast, ovarian cancer which presented as tuberculosis may be rare.

I. Introduction Mixed germ cell ovarian tumors represent a relatively small proportion of all ovarian tumors (Disaia and Creasman, 2002). Since germ cell tumors of the ovary consist fewer than 5% of ovarian cancer and mixed germ cell tumors accounting for approximately 19% of all cases (Hurteau and Williams, 2001). These ovarian tumors accounts for about 1% of ovarian malignancies. Mixed germ cell tumors contain at least, two components of malignant germ cell tumors (Disaia and Creasman, 2002). In a case series, the most common components of such tumors were reported as; dysgerminoma (80%), endodermal sinus tumor (70%), immature teratoma (%53), choriocarcinoma (20%), and embryonal carcinoma (16%). The most common combination was dysgerminoma and EST (Gershenson et al, 1984). The most presenting symptom in ovarian germ cell tumors is abdominal pain with or without pelvic pain that could be seen in %75 of cases (Disaia and Creasman, 2002).

II. Case A 25 year-old, Gravid 3, Parity 3 Afghani woman was referred to Vali-e-Asr hospital in October 2003 with a history of abdominal pain, low grade fever during 3 months ago. In physical examination a fixed mass in lower abdomen which extends upper the hilus was revealed. In pelvic examination, uterus and ovary could not be distinguished separately and a fixed pelvic mass could be 153

Ghaemmaghami et al: Ovarian mixed germ cell tumor presenting as tuberculosis palpated. Temperature at admission and during hospitalization was about 38Â°C, in auscultation of the lungs, abnormal sounds could be heard. In urgent chest X-ray showed multiple nodular lesions suggested metastasis lesions, but pulmonary tuberculosis could not rule out by radiologist (Figure 1). In abdominal ultrasound examination a huge mass was revealed. Abdominal and pelvic CT-scan showed abdominal heterogeneous mass but it was not possible distinct uterus and ovaries (Figure 2).

Miliary tuberculosis with pulmonary and peritoneal involvement was suggested due to these signs in Afghani lady at the first time. We found positive pregnancy test in routine laboratory examination. We requested sputum samples, blood cultures, tuberculin test for Acid-Fast bacilli which were negative. Serum tumor markers measurement were done, !â&#x20AC;&#x201C;hCG=815000 mIU/ml, but results of other tumor markers, CA-125 and AFP took about one week to be ready. Chest CT-scan showed multiple metastatic lesions (Figure 3).

Figure 1. Chest X-ray with multiple nodular lesions.

Figure 2. Chest CT-scan with multiple metastatic lesions.

154

Cancer Therapy Vol 3, page 155

Figure 3. Abdominal and pelvic CT-scan with heterogeneous mass.

We suggest choriocarcinoma with pulmonary involvement and stage III, score 13, due to sever pulmonary symptoms, dyspenea, and elevated !–hCG. So we considered combined chemotherapy with EMA-EP. When she had received part of EMA, other tumor markers measurement that was taken before chemotherapy was ready as follows (CA-125= 54 IU/ml, AFP=2650 ng/ml), so we suggested mixed germ cell tumors with choriocarcinoma thirdly and we decided to laparatomy so we scatuleated for elective surgery. But she had acute abdomen, urgent laparatomy was performed. A large cystic and solid mass weighted 5000gr arising from right ovary was found, it was firmly adhered to the sigmoid colon. Tumoral mass was removed intact without rupture. Mixed germ call tumor with components of Endodermal sinus tumor and choriocanainoma was reported by histological examination (Figures 4, 5). We considered BEP regimen chemotherapy in patients with germ cell tumors. Patient could not receive Bleomycin due to abnormal pulmonary function test. We considered MEP regimen (Methotrexate, Etoposide, and Cisplatin). Patient received four courses of MEP (once every three weeks) 7 days after surgery. The MEP regimen was given to the patient as follows: Methotrexate Etoposide Cisplatin

40 mg/m2 100 mg/m2 20 mg/m2

III. Discussion Different variables make report of this case an important issue. First, it was a rare case of mixed germ cell tumors which presented at stage IV. Second, it was presenting as miliary tuberculosis due to pulmonary symptoms, signs and fever. Third, it was mimicking to GTN stage III after paraclinic work up due to positive pregnancy test and chest X-ray appearance. Cases of mixed choriocarcinoma and Endodermal sinus tumor are rare and reported just in a few cases reports (Disaia and Creasman, 2002). Also stage IV of germ cell tumors are just in 5% of cases (Disaia and Creasman, 2002). Many points are mimicking this case as miliary tuberculosis. First, a fever which is prevalent in three categories; infections, malignancies, and collagen diseases (Zamir et al, 2003). Second, It is estimated that 8 million new cases of TB occurred world wide in 1997 that 95 percent of them were occurred in developing countries; Asia (5 million), Latin American (0.4 million), the Middle East (0.6 million) (Braunwald et al,2001). It means that in developing countries, tuberculosis remains endemic and present with non-specific symptoms and signs such as pelvic and abdominal pain, mass, ascites and hence mimic ovarian cancer (Straughn et al, 2000; Bilgin et al, 2001; Protopapas et al, 2003). And the last point is that respiratory symptoms, signs and radiological patterns of the lungs in choriocarcinoma are similar to primary pulmonary disease (Hurteau and Williams, 2001). There are many reports of peritoneal tuberculosis mimicking as advanced ovarian cancer. In contrast, we could not find any report that ovarian cancer presented as peritoneal tuberculosis. This patient may be the first case in this matter. Such a mimicking is due to Afghani patient who had fever and pulmonary manifestations.

IV or IM day 1 q 3 weeks IV daily 1-5 q 3 weeks IV daily 1-5 q 3 weeks

After 2 courses of chemotherapy AFP and CA-125 were both decreased to normal measurement. After 3 courses of chemotherapy !–hCG was normal (!–hCG<5). Last course of chemotherapy was received by the patient after negative !–hCG and now about 9 months after surgery, she is under observation and follow up.

155

Ghaemmaghami et al: Ovarian mixed germ cell tumor presenting as tuberculosis

Figure 4. elements of Endodermal sinus tumor where are reticular pattern and extra cellular and intra cellular hyaline droplets were detected.

Figure 5. Elements of choriocarcinoma where necrosis and hemorrhage and biphasic neoplastic cell was detected.

156

Cancer Therapy Vol 3, page 157 Mixed germ cell tumors containing Endodermal sinus tumor elements have elevated serum AFP levels, ranging from >100 to far higher than 1000ng/ml. The titer of serum AFP in this case was higher than common range (Aoki et al, 2003). The presence or absence of choriocarcinoma is considered to influence overall survival or clinical outcome of the patients with mixed germ cell tumor. Several cases of mixed germ cell tumor were reported with metastasis foci composed of pure choriocarcinoma (Peccatori et al, 1995). EMA-EP regimen as first line chemotherapy in management of high risk GTN has showed good response (Ghaemmaghami et al, 2004a, b). But Cisplatin containing combination chemotherapy such as Bleomycin, Etoposide and cisplatin (BEP) chemotherapy recommend in germ cell tumors. Usually 3 to 4 courses of chemotherapy should be performed .In mixed germ cell tumors another additional courses, after negative results of tumor markers, should be considered (Berek and Hacker, 2000). The prognosis of patients with mixed germ cell tumor can be poor because of the presence of a choriocarcinoma element and these patients to require more aggressive chemotherapy (Peccatori et al, 1995). Methotrexate is the best chemotherapic agent in management of choriocarcinoma. Since MEP (Methotrexate, Etoposide, Cisplatin) may be good regimen in mixed germ cell tumor with choriocarcinoma elements which BEP regimen is not justify due to pulmonary dysfunction. In conclusion, although the diagnosis of gestational trophoblastic neoplasia should be considered in any woman of reproductive age who has pulmonary symptoms, mixed germ cell tumor also should be consider especially when she has pelvic mass. Combined chemotherapy with MEP regimen may be good regimen in mixed germ cell tumor with chorionic elements.

References Aoki Y, Kase H, Fujita K (2003) Dysgerminoma with a slightly elevated alpha-fetoprotein level diagnosed as a mixed germ cell tumor after recurrence. Gynecol Obstet Invest 55, 58-9. Berek JS, Hacker NF (2000) Non epithelial ovarian and fallopian tube cancers Chapter 12, in Practical Gynecologic Oncology, third edition. Lippinkot Williams and Wilkins, 523-551. Bilgin T, Karabay A, Dolar E et al (2001) Peritoneal tuberculosis with pelvic abdominal mass, ascites and elevated CA-125 mimicking advanced ovarian carcinoma, A series of 10 cases. Int J Gynecol Cancer 11, 290-299. Braunwald E,Hauser S,Fauci A et al: Principals of internal medicin,15 th edition, New York McGraw-hill 2001;1:10241025. Disaia PJ, Creasman WT (2002) Germ cell, stromal and other ovarian tumors. In: DiSaia PJ, Creasman WT, editors. Clinical Gynecologic Oncology, 5th ed. St Louis: Mosby Year Book ,351-74 Gershenson DM, Deljunco G, Copelaned LJ, Ruthledge FN (1984) Mixed germ cell tumors of the ovary. Obstet Gynecol 64, 200-206. Ghaemmaghami F, Behtash N, Soleimani K, Hanjani P (2004) Management of patients with metastasic GTN. Gynecol Oncol (in press). Ghaemmaghami F, Modares M, Arab M et al (2004) EMA-EP regimen, as first line of multiple agent chemotherapy in high risk GTN patient (stage II-IV). Int J Gynecol Cancer 14, 360-365. Hurteau JA and Williams JS (2001) Ovarian germ cell tumors chapter 20 in ovarian cancers, Book Edited by Steephen C, Rubin. G and Sutton P. Lippincott Williams & Wilkins. Peccatori F, Bonzzi C, Chiari S et al (1995) Surgical management of malignant ovarian germ cell tumors, 10 years experience of 12 patients. Obstet Gynecol. 86, 367-377. Protopapas A, Milingos S, Diakomanolis E et al (2003) Miliary tuberculosis peritonitis mimicking advanced ovarian cancer. Gynecol Obstet Invest 56, 89-92. Straughn JM, Robertson MW, Partridge E (2000) A patient presenting with a pelvic mass, Elevated CA-125, and fever, a case report. Gynecol Oncology 77, 471-472. Zamir D, Leibovitz I, Polychuck I et al (2003) Fever of unknown origin. Acta Clin Belg 58, 356-9.

157

Ghaemmaghami et al: Ovarian mixed germ cell tumor presenting as tuberculosis

158

Cancer Therapy Vol 3, page 159 Cancer Therapy Vol 3, 159-166, 2005

Role of somatostatin analogues in the treatment of androgen ablation-refractory prostate adenocarcinoma Review Article

Alessandro Sciarra*, Gianna Mariotti, Anna Maria Autran Gomez, Franco Di Silverio Department of Urology, University La Sapienza, Rome, Italy

__________________________________________________________________________________ *Correspondence: Dr. Sciarra Alessandro, Department of Urology, University La Sapienza, Via Nomentana 233, 00161 Rome, Italy; Tel./Fax +39 6 44 6959 ; e-mail: sciarrajr@hotmail.com Key words: prostate neoplasms, somatostatina analogues, neuroendocrine Abbreviations: antisurvival, (ASF); chromogranin A, (CgA); combined androgen blockade, (CAB); computerized tomography scan, (CT); Growth Hormone, (GH); insuline-like growth factor, (IGF); neuroendocrine, (NE); progression â&#x20AC;&#x201C;free survival, (PFS); prostate specific antigen, (PSA); somatostatin receptors, (SSTR); Received: 15 February 2005; Accepted: 9 March 2005; electronically published: March 2005

Summary The progression to androgen ablation-refractory stage (D3) of prostate cancer corresponds to cancer cell escape from androgen withdrawal-induced apoptosis. Of note, salvage chemotherapy cannot extend the median survival of approximately 10 months for stage D3 patients. Novel therapeutic strategies that target the molecular basis of androgen resistance are therefore required. We reviewed the literature on the use of somatostatin analogues in the treatment of D3 prostate adenocarcinoma and we analysed the rationale and clinical results of our combination therapy using lanreotide and ethinylestradiol. Negative experiences have been reported on the use of somatostatin analogues in monotherapy. On the other hand, interesting results have been obtained as combination therapy and the median progression free survival reported in our experience using lanreotide acetate plus ethinylestradiol, clearly surpassed the 10 months survival historically described for stage D3 patients. The use of somatostatin analogues in combination therapy for the treatment of D3 prostate cancer, sustains the novel concept in cancer treatment in which therapies may target not only cancer cell itself but, in combination, also its microenvironment, which can confer protection from apoptosis.

on the use of somatostatin analogues in the treatment of prostate adenocarcinoma and to analyse the rationale and clinical results of our combination therapy.

I. Introduction The progression to androgen ablation-refractory stage (D3) of prostate cancer corresponds to cancer cell escape from androgen withdrawal-induced apoptosis (Landstrom et al, 1994). Of note, salvage chemotherapy can extend the median survival of approximately 10 months for stage D3 patients (Koutsilieris et al, 1990; Hudes et al, 1992). Novel therapeutic strategies that target the molecular basis of androgen resistance are therefore required. We previously proposed a combination therapy of ethinylestradiol and somatostatin analogue to reintroduce objective clinical responses in metastatic androgen ablation-refractory prostate cancer patients (Di Silverio and Sciarra, 2003). The purpose of this article is to review the literature

II. Somatostatin monotherapy

analogues

Native somatostatin is characterised as an inhibitory peptide with exocrine, endocrine and autocrine activity (Newman et al, 1987). The general inhibitory function of somatostatin is wide ranging and affects a number of organ systems.The effect of somatostatin on various organ systems are thought to be mediated via specific somatostatin receptors (SSTR). To date, five different subtypes (SSTR 1-5) have been identified and cloned in human tissue (Hejna et al, 2002). While all five subtypes

159

Sciarra et al: Somatostatin analogues in f androgen ablation-refractory prostate adenocarcinoma display a similar affinity to somatostatin, there are major differences in binding of currently available somatostatin analogues (Pollak and Schally, 1998) to various SSTR subtypes. Investigations concerning the exact intracellular mechanisms effected by different SSTRs with regards to cellular proliferation and induction of apoptosis are ongoing. Recently, SSTR subtype expression has been characterized in various neoplastic tissues (Reubi et al, 2001). There appears to be a predominance of only one or two SSTR subtypes in most tumors investigated. There is a clear predominance of SSTR 1 expression in prostate cancers, which may also express SSTR 5. The highly SSTR 2 affine octapeptide somatostatin analogues such as octreotide remains the drugs of choice for application in a majority of pure neuroendocrine tumors, since such tumors most often express predominantly SSTR 2 (Pollak and Schally, 1998). However, other somatostatin derivates, such as lanreotide, which have a good affinity of SSTR 5 in addition to that for SSTR 2, may advantageously identify SSTR 5 expressing tumors, such as prostate adenocarcinoma. Somatostatin analogues, however, seem to interact at tissue level, also through a receptor binding independent mechanism (Hejna et al, 2002). Long-acting somatostatin analogues have been developed, specifically designed for antitumor activity. Schally, (1988) synthesised > 300 analogues using solidphase methods resulted in octapeptide “super analogues”, which are more potent and have longer durations of action than either native somatostatin and octreotide.

Several clinical trials have demonstrated impressive efficacy of somatostatin analogues in a variety of hypersecretory disorders resistant to standard therapy (Hejna et al, 2002). They have also proved useful for the management of symptoms caused by neuroendocrine diseases. The primary effect of somatostatin analogues is not a direct cytotoxic effect of neuroendocrine cells but the inhibition of the release of various peptides hormones secreted by neuroendocrine cells (Hejna et al, 2002). The observation that somatostatin analogues inhibit the release of various neuroendocrine products has stimulated interest in its use as an antiproliferative and proapoptotic agent. Antiproliferative and proapoptotic actions of somatostatin analogues have been demonstrated in various tumor models including breast, prostate, colon, pancreatic (Murphy et al, 1987; Schally, 1988; Smith and Solomon, 1988). Moreover, somatostatin analogues have a wide therapeutic index and are apparently free of major side effects (Schally, 1988). Most of the reported side-effects are gastrointestinal in nature and include minor nausea, diarrhoea, constipation. Clinical trials and experiences on the use of somatostatin analogues as monotherapy for the treatment of prostate cancer, reported negative results (Table 1) (Carteni et al, 1990; Dupont et al, 1990; Logothetis et al, 1994; Verhelst et al, 1994; Figg et al, 1995; Maulard et al, 1995; Vainas et al, 1997; Koutsilieris et al, 2001; Di Silverio and Sciarra, 2003). Octreotide was used to treat patients with advanced hormonal-refractory prostate cancer in a study by Logothetis et al, (1994).

Table 1. Hormone-refractory prostate cancer: clinical experiences with somatostatin analogues Treatment

Dosage

Number cases

Results

Reference

Octreotide

100µg tds s.c.

Pain reduction

Carteni et al, 1990

Octreotide

600-1350µg/day s.c.

Disease progression after 21 days

Dupont et al, 1990

Octreotide

400-1000µg/day s.c.

Temporary halt in PSA rising

Verhelst (28)

Octreotide

100mg qds s.c.

Stimulation of prostate tumor growth

Logothetis et al, 1994

Lanreotide

30mg once a week i.m.

20% partial response (PSA decrease)

Maulard et al, 1995

40% improvement performance status Lanreotide

4-24 mg/day s.c.

No modifications

Figg et al, 1995

Octreotide

Not clarified

Symptom-free responses

Vainas et al, 1997

30 mg/14 days i.m. + 4 mg/day os

90% objective (PSA decrease) and symptomatic response

Koutsilieris 2001

Lanreotide dexamethasone

plus

al,

Progression-free survival =7 months Lanreotide acetate ethinylestradiol

plus

73.9 mg i.m. every 4 weeks + 1 mg/day os

90% objective (PSA decrease) and symptomatic response Progression-free survival = 18.5 months

160

Di Silverio Sciarra, 2003

and

Cancer Therapy Vol 3, page 161 The dose of octreotide applied to 24 cases was 0.1 mg s.c. every 8 h for 6 weeks. No patients had objective evidence of tumor regression and in 10 cases serum prostate acid phospatase level rose at an accelerated rate after 1-2 months of treatment. However, 6 patients underwent salvage chemotherapy after octreotide therapy and 5 of whom achieved objective tumor regression. The authors therefore concluded that octreotide monotherapy might stimulate prostatic tumor growth but may also sensitise tumor cells to subsequent chemotherapy. A total of 30 patients with hormone-refractory prostate cancer were treated with a slow-release formulation of lanreotide (30 mg i.m. once a week) by Maulard et al, (1995). Toxicity related to the treatment was minor, performance status and bone pain improved in 40% and 35% of patient respectively, but a PSA decrease by at least 50% was reported only in 20% of cases.

mechanisms (Sciarra et al, 2003a). These mechanisms result from the interaction of the tumor cells with the local microenvironment, either at local or metastatic sites. Major mediators of this interaction are neuropeptides secreted by neuroendocrine (NE) cells in prostate tissue and insuline-like growth factor (IGF) â&#x20AC;&#x201C;1. The locally bioavailability of these peptides and growth factors on prostate cancer cells, activates anti-apoptotic mechanisms more than proliferative direct effects. These represent real survival pathways involved in prostate cancer progression and androgen-deprivation therapy resistancy. The development of survival factor-mediated resistance to anticancer therapies is a major hurdle preventing longlasting clinical responses to conventional or investigational therapies (Koutsilieris et al, 2002). This realisation has led to the novel concept of antisurvival (ASF) therapy for prostate cancer as a component of anticancer treatments and to the concept of a combination therapy for hormone-refractory disease.This approach is novel as instead of attempting to directly induce cancer cell apoptosis, it aims at neutralising the protective effect conferred upon cancer cells by the survival factors. This neutralisation alone may not induce apoptosis, but it can enhance the sensitivity or reverse the resistance of tumors cells to other anticancer strategies with direct cytotoxic effects (Reyes-Moreno et al, 1998; Koutsilieris et al, 2000, 2002). On these basis, Koutisileris et al, (2001) firstly proposed a combination therapy with dexamethasone and long acting somatostatin analogue in stage D3 prostate cancer patients, i.e. patients with metastatic prostate cancer who had become refractory to combined androgen blockade. In this setting, Growth Hormone (GH) â&#x20AC;&#x201C; independent and GH-dependent production of IGF-1 has been implicated in the development of a epigenetic form of cancer cells resistance to pro-apoptotic therapies. Among its diverse pharmacological effects, dexamethasone acts to downregulate the GH-independent production of IGF-1, whereas somatostatin analogue suppresses the level of GH-dependent IGF-1. This paradigm of an ASF therapy, which was practically an anti-IGF-1 therapy, yielded objective responses and major improvement of bone pain and performance status in D3 cases. The treatment schedule includes administration of oral dexamethasone plus long acting somatostatin analogue (lanreotide or octreotide in i.m. injections) in combination with androgen ablation therapy.In the initial cohort of patients receiving the combination therapy the median overall survival clearly surpassed 12 months and also their post-relapse performance status and bone pain were still significantly improved compared to their baseline status, even months after relapse. The stimulating feature of this ASF approach is that its combination with LHRH-analogues can reintroduce clinical responsiveness to LHRH analogues.

III. Somatostatin analogues in combination therapy: it exist a rationale The mechanism of action of somatostatin analogues may suggest the use of these drugs not in monotherapy but in combination therapy for tumors such as prostate cancer. Also in breast cancer favourable results have been obtained by the use of somatostatin analogues in combination therapy. Twenty-two post-menopausal patients with metastatic breast cancer were randomised to receive either 40mg/day of tamoxifen or a combination consiting of 40 mg tamoxifen plus 0.2 mg of octreotide tds s.c. (Bontenbal et al, 1998). An objective response was found in 36% of the patients treated with tamoxifen alone and in 55% of patients treated with the combination therapy. The management of metastatic neoplasias has traditionally relied on therapeutic modalities, which almost exclusively aim at directly inducing cancer cell death. However, the in vivo response of malignant cells to anticancer therapies is directly influenced by the local microenvironment in which they reside (or metastasise) (Koutsilieris et al, 2002).Microenvironment factors may attenuate the antitumor activity of several cytotoxic agents on neopalstic cells.In particular, organ sites frequently involved in metastatic advanced diseases, appear to confer to neoplastic cells protection from anticancer drug-induced apoptosis. This protection may be mediated by several mechanisms including growth factors cytokines released by the normal cellular constituents of the host-tissue microenvironment (Koutsilieris et al, 2000). Therefore additional emphasis should be placed on the design of novel treatments that can neutralise the protection that the microenvironment offers to tumors cells. An example of the role of the microenvironment in protecting tumor cells from anticancer therapies is within the setting of hormonerefractory prostate cancer. For years, it has been a widely accepted notion that resistance to hormonal therapy is an outcome exclusively determined at the genetic level and involving mutations that neutralise pro-apoptotic intracellular pathways and/or activates anti-apoptotic ones (Koutsilieris et al, 2002). It is now well documented that this resistance can also be conferred by epigenetic

IV. Somatostatin analogues combination with estrogens

We previously analysed (Di Silverio and Sciarra, 2003) for the first time in the literature, whether, in

161

Sciarra et al: Somatostatin analogues in f androgen ablation-refractory prostate adenocarcinoma patients with stage D3 prostate cancer, the combination of ethinylestradiol and lanreotide can offer objective responses and/or symptomatic improvements. We followed the study design used by Koutsilieris et al, (2001). As Koutsilieris et al, (2001) we evaluated patients with metastatic androgen ablation-refractory prostate cancer. However, differently to Koutsilieris et al, we discontinued the LHRH analogue and we started a combination therapy with ethinylestradiol and lanreotide acetate. The rationale for our combination therapy is: 1- to inhibit the protective (antiapoptotic) effect of NE system on prostate adenocarcinoma cells (somatostatin analogue); 2- to use a new mechanism to induce castration (estrogen); 3- to add a direct cytotoxic effect on prostate cells (estrogen) (Figure 1). Some studies have shown that the number of NE tumor cells (25-25) and chromogranin A (CgA) serum levels increase during hormonal therapy (Abrahamsson, 1996; Angelsen et al, 1997; Monti et al, 2000; Sciarra et al, 2003a, b) for prostate adenocarcinoma. As previously underlined, at the cellular level, refractoriness to androgen ablation therapy occurs principally because prostate cancer cells can be rescued from androgen ablation-induced apoptosis. It has been shown that Bcl2 proto-oncogen, which is an antiapoptotic factor, is preferentially expressed in foci of prostate adenocarcinoma cells in the vicinity of NE differentiation (Segal and Cohen, 1994; Jongsma et al, 2000). In hormone- refractory (D3) prostate cancer, NE cells may protect prostate adenocarcinoma cells from anticancer therapies through the neutralization of pro-apoptotic intracellular pathways. The rationale for somatostatin-analogue therapy in D3 prostate tumor is not to directly induce cancer cell apoptosis but to neutralize the protective effect conferred upon cancer cells by the survival factors derived by NE prostate cells. The antigonadotropic effect of estrogens has been exploited therapeutically. Both experimental and clinical evidence suggest that estrogen therapy may be superior to

castration in terms of efficacy for the treatment of advanced prostate cancer (Robinson et al, 1995; Chang et al, 1996; Rosenbaum et al, 2000; Smith et al, 2000). Moreover, analysing prostatectomy specimens of untreated and treated (CAB) prostate cancer patients, Kruithof-Dekker et al, (1996) showed that androgen deprivation leads to an upregulation of estrogen receptor expression in prostate cancer tissue. It has been supposed that the beneficial effect of estrogens is based not only on reduction of the androgen concentration but also on a simultaneous direct cytotoxic effect (Hudes et al, 1992) on prostate cancer cells. All these data support our rationale: to discontinue LHRH-analogue and to substitute it with estrogen therapy. An important question is whether responses achieved in our study most likely constitute an indirect evidence of a potential survival benefit offered by the combination therapy rather than a response to lanreotide only or ethinylestradiol only. As previously showed, in advanced hormonalrefractory prostate cancer, negative experiences have been reported on the use of somatostatin analogues in monotherapy (Carteni et al, 1990; Dupont et al, 1990; Logothetis et al, 1994; Verhelst et al, 1994; Figg et al, 1995; Maulard et al, 1995; Vainas et al, 1997). On the other hand, the median progression free survival reported in our study clearly surpassed the 10 months survival historically described for stage D3 patients, even when estrogen therapy or salvage chemotherapy is administered (Hudes et al, 1992; Chang et al, 1996). However, additional studies will be required to fully elucidate the precise in vivo mechanism of action for the combination of estrogens with somatostatin analogues. As for the study of Koutsilieris et al, (2001) the design of our pilot trial involved a longitudinal methodology, as defined by Spilker (1991), which is appropriate for study of even small cohorts of patients. In our first experience (Di Silverio and Sciarra, 2003), we prospectively evaluated 10 consecutive patients with stage D3 disease, who received a combination therapy

Figure 1. Rationale for our combination therapy with somatostatin analogue and estrogen

162

Cancer Therapy Vol 3, page 163 consisting of the following: 1)oral ethinylestradiol (1mg daily); 2) lanreotide (lanreotide acetate 73.9 mg in every 4 weeks). None of these cases had a history of severe cardiovascular diseases, neither a history of other disorders or therapies or conditions known to interfere with CgA levels. All patients had diffuse skeletal metastases (> 3 metastatic foci) documented by radionuclide bone scan and computerized tomography scan (CT). All patients had previously experienced objective clinical responses to combined androgen blockade (CAB) using triptorelin plus antiandrogen (flutamide, bicalutamide) documented by prostate specific antigen (PSA) decline by more than 50% of baseline, which had lasted for less than 24 months. Upon progression, all patients were withdrawan from antiandrogens for at least 6 weeks (no patients responded). Therefore, all patients discontinued CAB and received the combination therapy ethinylestration plus lanreotide (Figure 2). In this first experience, 90% (95%CI =55.599.8%) of cases had objective (complete= PSA < 4 ng/ml, or partial= at least 50% PSA decrease from baseline) clinical response to the combination therapy, corresponding to a statistically significant (in comparison to the baseline refractoriness) rate of re-introduction of responsiveness to the combination with lanreotide and ethinylestradiol (McNemar’s paired !2 test; p<0.01). In responders, median time to PSA nadir was 5 months (range 3-12 months; 95% CI 4-8 months). In all cases, the PSA responses were accompanied by concomitant statistically significant reduction in bone pain score (p=<0.0001), as well as significant improvement in the ECOG performance status score (p<0.0001). The symptomatic improvement of pain and performance status appeared to be temporally associated with the changes in objective response markers and it is suggested that the main mechanism of action of this combination therapy

affects those mechanisms regulating the growth and/or survival of the metastatic cells, rather than involving a non-specific anti-inflammatory or analgesic effect (Koutsilieris et al, 2001). The rates and the time to achieve the symptomatic and objective responses that we described, are comparable to those reported in the study of Koutsilieris et al, (2001). However, with our combination therapy we obtained a longer duration of objective responses. In particular, median duration of bone pain response, ECOG response and progression –free survival (PFS) was 17.5 (95% CI 12-19), 18 (95% CI 12-19) and 18.5 (95% CI 14-21) months respectively in our study and 13 (95% CI 12-14), 19 (95% CI 13-25) and 7 (95% CI 310) months in the study of Koutsilieris et al, (2001) We analysed modifications in serum CgA levels during the combination therapy. Comparison of serum CgA levels at baseline, during follow-up, at maximal response and at relapse from therapy revealed a significant change of CgA levels during the course of the combination therapy (P<0.0001; Friedman’s nonparametric ANOVA). We observed a significant decrease in serum CgA levels during the administration of the combination therapy (median value of maximal CgA decline = 38.4% of baseline levels; 95%CI 33.2-50.3% range 28.6%-64.9%), as compared with the baseline CgA levels. In our patients, time to CgA nadir was lower than time to PSA nadir; therefore it seems that CgA response preceded PSA response. Our baseline levels of CgA were similar to those reported in other experiences on metastatic prostate cancer cases (Jongsma et al, 2000; Sciarra et al, 2003b). The significant reduction of circulating CgA, documented in this cohort of patients suggests that a reduction of NE activity on prostate cancer cells may be a mechanism accounting for at least part of the encouraging responses that were observed. Interestingly, the patients’serum CgA levels were not significantly increased

Figure 2. Study design for our trial (4) on lanreotide acetate and ethinylestradiol combination therapy in D3 prostate cancer cases.

163

Sciarra et al: Somatostatin analogues in f androgen ablation-refractory prostate adenocarcinoma at relapse suggesting that NE activity may be not involved at relapse from this combination therapy. The modifications in CgA levels reported in our study are lower if compared with those observed in pathologically confirmed NE tumors such as small cell carcinoma of the lung. However, we must remember that NE differentiation of prostate adenocarcinoma consists of the presence of NE cells with a focal distribution in the common prostatic adenocarcinoma (Jongsma et al, 2000; Sciarra et al, 2003b). A limit of our analysis may be the determination of only serum expression of CgA. However, none of our cases presented a history of other disorders known to interfere with CgA levels. Some authors reported a significant correlation between serum and tissue expression of CgA in prostate cancer (Jongsma et al, 2000; Sciarra et al, 2003b). Moreover, in 8 cases we had the opportunity to analyse CgA expression at prostate tissue level by immunohistochemistry. Prostate tissue specimens were obtained by transrectal ultrasound-guided prostate biopsy and formalin fixed and paraffin embedded prostate specimens were sectioned to 5Âľm thick prior to the analysis. Diffuse immunohistochemical staining for CgA was found in biopsies obtained in D3 cases at baseline from our therapy. On the contrary a limited and focal staining for CgA was showed in cases with objective clinical response to our combination therapy. No major treatment related side effects were reported during the combination therapy. In particular no serious cardiovascular renal, or liver-gastrointestinal events were found during the follow-up, with the exception of transient mild epigastric discomfort, effectively controlled with antacid regimen. None of our 10 cases discontinued the treatment due to side effects related to the combination therapy. All cases developed gynecomastia and mild breast pain. It is true that none of our cases had a history of severe cardiovascular diseases at baseline, but the dose (1 mg) of ethinylestradiol and the duration of follow-up (no longer than 24 months) may also contribute for differences with other experiences on estrogen therapy (Robinson et al, 1995; Rosenbaum et al, 2000; Smith et al, 2000). At January 2004, 20 D3 cases have been included in our analysis and submitted to the combination therapy with ethinylestradiol and lanreotide (Sciarra et al, 2004). Criteria for inclusion and study protocol were similar to those previously described (Di Silverio and Sciarra, 2003). Results continue to be encouraging and supporting the rational for our combination therapy.In particular, at January 2004 19 out of the 20 cases (95%) showed objective (complete = 5 cases (25%) or partial = 14 cases (70%)) clinical response to the combination therapy demonstrated by at least 50% PSA decrease from baseline. In only one case the biochemical response was accompanied by a reduction in the number of bone metastases at bone scan. Two out of the 20 patients (10%) died, both of prostate cancer (at 10 and 16 months respectively) and 6 cases (30%) developed clinical progression (rising PSA levels to more than 50% of PSA nadir) (mean of 7.8 months, median of 7 months, range 412 months) during the follow-up. All other 14 patients (70%) are still alive without disease progression after a

median of 16.5 months (mean of 13.9 months, range 4-24 months) of follow-up during the combination therapy (Sciarra et al, 2004).

V. Conclusions It should be emphasized that any conclusion regarding the usefulness of this combination therapy, in comparison to other proposed treatment strategies for stage D3 prostate cancer, can only be drawn in randomised controlled clinical trials. The results of our study indicate that such randomised trials are warranted, because the combination of ethinylestradiol and lanreotide had a favourable toxicity profile, offered objective and symptomatic responses in patients with limited treatment options and refractoriness to conventional hormonal therapy strategies and in particular, offered a median overall survival that was superior to the 10 -month median survival for hormone-refractory patients. This combination therapy also sustains the novel concept in cancer treatment in which therapies may target not only cancer cell itself but, in combination, also its microenvironment, which can confer protection from apoptosis.

References Abrahamsson PA (1996) Neuroendocrine differentiation and hormone-refractory prostate cancer. Prostate suppl 6, 3-8. Angelsen A, Syversen U, Stridsberg M, Haugen OA, Mjolnerod OKR, Waldum HL (1997) Use of neuroendocrine serum markers in the follow-up of patients with cancer of the prostate. Prostate 31, 110-117. Bontenbal M, Foekens JA, Lamberts SW (1998) Feasibility, endocrine and anti-tumor effects of a triple endocrine therapy with tamoxifen, a somatostatin analogue and an antiprolactin in post-menopausal metastatic breast cancer, a randomized study with long-term follow-up. Br J Cancer 77, 115-122. Carteni G, Biglietto M, Tucci A, Pacilio G (1990) Sandostatin, a long-acting somatostatin analogue in the treatment of advanced metastatic prostate cancer. Eur J Cancer 26, 161A. Chang A, Yeap B, Davis T (1996) Double-blind, randomized study of primary hormonal treatment of stage D2 prostate carcinoma, flutamide versus diethylstilbestrol. J Clin Oncol 14, 2250-57. Di Silverio F, Sciarra A (2003) Combination therapy of ethinylestradiol and somatostatin analogue reintroduces objective clinical responses and decreases chromogranin a in patients with androgen ablation refractory prostate cancer. J Urol 170, 1812-6.. Dupont A, Boucher H, Cusan L (1990) Octreotide and bromocriptine in patients with stage D2 prostate cancer who relapsed during treatment with flutamide and castration. Eur J Cancer 26, 770-771. Figg WD, Thibault A, Cooper MR (1995) A phase I study of the somatostatin analogue somatuline in patients with metastatic hormone-refractory prostate cancer. Cancer 75, 2159-2164. Hejna M, Schmidinger M, Raderer M (2002) The clinical role of somatostatin analogues as antineopalstic agents, much ado about nothing ? Annals of Oncol 13, 653-668. Hudes GR, Greenberg R, Krigel RL, Fox S, Scher R, Litwin S, et al (1992) Phase II study of estramustine andvinblastine, two microtubule inhibitors, in hormone-refractory prostate cancer. J Clin Oncol 10, 1754-1761.

164

Cancer Therapy Vol 3, page 165 Jongsma J, Oomen MHA, Noordzij MA, Romijn JC, Van Der Kwast TH, Schroder FH et al (2000) Androgen independent growth is induced by neuropeptides in human prostate cancer cell lines. Prostate 42, 34-44. Koutsilieris M, Laroche B, Thabet M, Fradet Y (1990) The assessment of disease aggressivity in stage D2 prostate cancer patients. Anticancer Res 10, 333-336.. Koutsilieris M, Mitsiades C, Dimopoulos T, Iannidis A, Ntounis A, Lambou T (2001) A combination therapy of dexamethasone and somatostatin analog reintroduces objective clinical responses to LHRH analog in androgen ablation-refractory prostate cancer patients. J Clin Endocrin Metab 86, 5729-5736. Koutsilieris M, Mitsiades C, Dimopoulos T, Vacalicos J, Lambou T, Tsintavis A (2002) Combination of dexamethasone and a somatostatin analogue in the treatment of advanced prostate cancer. Exp Opin Investig Drugs 11, 283-293. Koutsilieris M, Mitsiades C, Sourla A (2000) Insulin-like growth factors I and urokinase-type plasminogen activator bioregulation system as a survival mechanism of prostate cancer cells in osteoblastic metastases, development of antisurvival factor therapy for hormone-refractory prostate cancer. Mol Med 6, 251-267. Kruithof-Dekker IG, Tetu B, Janssen PJ, Van der Kwast TH (1996) Elevated estrogen receptor expression in human prostate stromal cells by androgen ablation therapy. J Urol 156, 1194-7. Landstrom M, Damber JE, Bergh A (1994) Prostatic tumor regrowth after initially successful castration therapy may be related to a decreased apoptotic cell death rate. Cancer Res 54, 4281-4284. Logothetis CJ, Hossan EA, Smith TL (1994) SMS 201-995 in the treatment of refractory Prostatic cancer. Anticancer Res 14, 2731-2734. Maulard C, Richaud P, Droz JP (1995) Phase I-II study of the somatostatin analogue lanreotide in hormone-refractory prostate cancer. Cancer Chemother Pharmacol 36, 259-62. Monti S, Sciarra A, Falasca P, Di Silverio F (2000) Serum concentrations and prostatic gene expression of chromogranin A and PSA in patients affected by prostate cancer and benign prostatic hyperpalsia. J Endocrinol Invest 23 (suppl 8), 53-54. Murphy WA, Lance VA, Moreau S (1987) Inhibition of rat prostate tumor growth by an ocatpeptide analog of somatostatin. Life Sci 40, 2515-2522. Newman JB, Lluis F, Townsend CM Jr (1987) Somatostatin. In, Thompson JC, Greeley GH Jr, Rayford PL, Townsend CM Jr editors, Gastrointestinal Endocrinology. New York. McGraw-Hill Book Co., 286-299. Pollak MN, Schally AV (1998) Mechanisms of antineoplastic action of somatostatin analogs. Proc Soc Exp Biol Med 217, 143-152.

Reubi JC, Waser B, Schaer JC, Laissue JA (2001) Somatostatin receptor sst1-sst5 expression in normal and neoplastic human tissues using receptor autoradiography with subtype-selective ligands. Eur J Nucl Med 28, 836-846.. Reyes-Moreno C, Sourla A, Choki I (1998) Osteoblast-derived survival factors protect PC-3 human prostate cancer cells from adriamycin apoptosis. Urology 52, 341-347. Robinson MR, Smith PH, Richards B (1995) The final analysis of the EORTC Genito-Urinary Tract Cancer Co-Operative Group phase III clinical trial (protocol 30805) comparing orchidectomy, orchidectomy plus cyproterone acetate and low dose stilboestrol in the management of metastatic carcinoma of the prostate. Eur Urol 28, 273-283.. Rosenbaum E, Wygoda M, Gips M (2000) Diethylstilbestrol is an active agent in prostate cancer patients after failure to complete androgen blockade. Proc Am Soc Clin Oncol 19, 1372A. Schally AV (1988) Oncological applications of somatostatin analogues. Cancer Res 48, 6977-6985. Sciarra A, Bosman C, Monti, G, Gentile, V, Ciccariello M, Pastore A, Salvatori G, Fattore F, Di Silverio F (2004) Somatostatin analogues and estrogens in the treatment of androgen ablation refractory prostate adenocarcinoma. J Urol 5 (5 Pt 1), 1775-83. Sciarra A, Mariotti G, Gentile V, Voria G, Pastore A, Monti S, Di Silverio F (2003a) Neuroendocrine differentiation in human prostate tissue, is it detectable and treatable? BJU Int 91, 438-45.. Sciarra A, Monti S, Gentile V, Mariotti G, Cardi A, Voria G, Lucera R, Di Silverio F (2003b) Variation in chromogranin A serum levels during intermittent versus continuous androgen deprivation therapy for prostate adenocarcinoma. Prostate 55, 168-79. Segal G, Cohen F (1994) Bcl2 protooncogen expression in prostate cancer and its relationship to the Prostatic neuroendocrine cell. Arch Pathol Med 118, 616-8. Smith DC, Redman BG, Flaherty LE, Li L, Strawderman M, Pienta KJ (1998) A phase II trial of oral diethilstilbestrol as a second-line hormonal agent in advanced prostate cancer. Urology 52, 257-60. Smith JP, Solomon TE ( 1988) Effects of gastrin, proglumide and somatostatin on growth of human colon cancer. Gastroenterology 95, 1541-48. Spilker B (1991) Guide to clinical trias. New York, Raven Press. Vainas G, Pasaitou V, Galaktidou G (1997) The role of somatostatin analogues in complete antiandrogen treatment in patients with prostatic carcinoma. J Exp Clin Cancer Res 16, 119-126. Verhelst J, De Longueville M, Ongena P (1994) Octreotide in advanced prostatic cancer relapsing under hormonal treatment. Acta Urol Belg 62, 83-88

165

Sciarra et al: Somatostatin analogues in f androgen ablation-refractory prostate adenocarcinoma

166

Cancer Therapy Vol 3, page 167 Cancer Therapy Vol 3, 167-176, 2005

HER-2/neu overexpression in Croatian breast cancer patients: results of one-year multicentric prospective study Research Article

Jasminka Jakic-Razumovic1,*, Jadranka Bozikov2, Bozena Sarcevic3, Viktor Separovic3 Smiljana Kosanovic3, Nives Jonjic4, Elvira Mustac4, Snjezana Tomic5, Josko Bezic5, Bozo Kruslin6, Majda Vucic6, Davor Tomas6, Branko Dmitrovic7, Valerija Blazicevic V7, Tratincica Jakovina8, Drazen Svagelj9, Igor Boric10, Zdenko Njiric10, Vesna Stitic11, Mira Mlinac-Lucijanic M11, Nada Restek-Samarzija12, Hrvoje Predrijevac12, Milan Gosev13 1

Department of pathology, Clinical Hospital Center and Medical School Zagreb Andrija Stampar School of Public Health-Medical School Zagreb 3 Department of pathology Clinic for tumors Zagreb 4 Department of pathology Medical faculty Rijeka 5 Department of pathology Clinical Hospital Split 6 Department of pathology Clinical Hospital â&#x20AC;&#x153; Sestre milosrdniceâ&#x20AC;? Zagreb 7 Department of pathology Clinical Hospital Osijek 8 Department of pathology General Hospital Slavonski Brod 9 Department of pathology General Hospital Vinkovci 10 Department of pathology General Hospital Dubrovnik 11 Department of pathology General Hospital Karlovac 12 Hoffmann-La Roche Zagreb11, Croatia 2

__________________________________________________________________________________ *Correspondence: Jasminka Jakic-Razumovic M.D, Ph.D., Department of Pathology, Clinical Hospital Center Zagreb, Kispaticeva 12, 10000 Zagreb, Croatia; phone: + 385 1 2388 523; fax: + 385 1 2421 861; e-mail: drazumov@hotmail.com Key words: breast carcinoma, HER-2/neu, overexpression, prognostic factors Abbreviations: cyclophosphamide, metothrexate and fluorouracil, (CMF); disease free survival, (DFS); estrogen, (ER); progesterone, (PR); vascular invasion, (VI); Received: 28 February 2005; Accepted: 8 March 2005; electronically published: March 2005

Summary Treatment approaches and prognosis for breast carcinoma patients depend on different prognostic factors. Uniform reporting of breast carcinoma specimens in sense of traditional prognostic and additional factors such as HER-2/neu is very important for oncologists managing breast carcinoma patients. The aim of this study was to uniform reporting of breast carcinoma specimens, to standardize HER-2/neu testing and reporting as part of routine pathological report in multicentric study for Croatian population, and to correlate HER-2/neu overexpression with other prognostic factors. In this study 1442 breast carcinoma patients during one year from 9 Hospitals in Croatia were prospectively collected and analyzed with data of age, menopausal status, tumor size, type and grade, nuclear grade, axillary node status, intratumoral and extratumoral vascular invasion (VI), estrogen (ER) and progesterone (PR) receptor status, and HER-2/neu expression. The standardization of HER-2/neu staining by HercepTest (Dako, Glostrup, Denmark) was made by repeated collective analysis of doubtful slides, and by repeating of staining in one referral center. All traditional prognostic factors were compared with HER-2/neu status. The results showed that there is statistically significant correlation between HER-2/neu expression and histological grade, nuclear grade, tumor size, lymph node status (p<0.001), extratumoral vascular invasion

167

Jakic-Razumovic et al: HER-2/neu overexpression in Croatian breast cancer patients (p=0.039), and premenopausal status (p=0.040). Negative correlation was found between HER-2/neu overexpression and steroid receptor positivity (p<0.001). When lymph node status was correlated with other prognostic factors lymph node positivity correlates with extratumoral VI (p<0.001). It seems that this prospective study showed correlation between HER-2/neu and some traditional prognostic factors. Oncologists will follow this prospectively collected group of patients carefully, and prognostic influence of investigated factors will be determined in the future.

II. Materials and methods

I. Introduction

In this study 1442 consecutive breast carcinoma patients during one year (September 2001 to September 2002) from 9 centers in Croatia were collected. For all patients data of age, menopausal status, hystological type, tumor size, grade, nuclear grade, axillary node status, intratumoral and extratumoral VI, ER and PR status by immunohistochemistry were collected (Table 1). The median age was 60 years (range, 23 to 94). Figure 1 shows age distribution in investigated breast carcinoma patients. The tumor size ranged from 0.1 cm to 20.0 cm (median 2.0 cm). Majority of breast carcinomas were of ductal invasive type (77.2%), lobular invasive carcinoma was found in 145 (10.1%) patients, while other types as mixed, mucinous, papillar, medullar, tubular or other rare types were found in 184 (12.7%) patients. Peritumoral and intratumoral lymphatic/vascular invasion was assessed in hematoxillin and eosin stained slides, and were determined as negative and positive. Peritumoral VI was present in 346 (24%) cases, while intratumoral VI was found in 111 (7.7%) cases. There were 544 cases (37.7%) with and 662 cases (45.9%) without axillary lymph node metastases. For 236 (16.4%) patients axillary node status was unknown. Histological grade 1 and 3 were equally distributed, while grade 2 was found in 767 (55.7%) of patients (Elston et al, 1991; Frierson et al, 1995). Majority of patients were postmenopausal (74.0%), while 374 (26.0%) were premenopausal. Imunohistochemistry was carried out in formalin fixed, paraffin-embedded tissue sections by streptavidin-biotin peroxidase complex method using an automatized immunostainer (TechMate, Dako). The antibodies employed in the study were anti-ER (clone ER1D5), diluted at 1/100, Dako), PR (clone 1A6, diluted at 1/100, Dako). Positive scoring of immunohistochemistry for ER and PR was assessed on the basis of the visually estimated percentage of neoplastic cells with nuclear staining. All cases without any staining were considered as negative. Positive nuclear staining was semiquantitatively divided in three groups of positivity as mild staining (<10% cells), moderate (10-50% cells) and strong staining (> 50% cells), but for final statistical analysis any nuclear staining was used as positive reaction. For all patients HER-2/neu status was determined using standard Herceptest (Dako). At the beginning of this study there were some differences in intensity of staining interpretation even all participants were using the same scoring system proposed by the manufacturer. Given the potential clinical importance HER-2/neu status in patients management, interlaboratory variability in HER-2/neu IHC results is a matter of legitimate concern. Because of that, slides were first read in each institution, and after that two experts evaluated only positive stained slides (2+, 3+) in blinded fashion. Expert pathologists after adequate training in HercepTest evaluation could reach excellent intraobserver (!=0.921) and interobserver reproducibility (!=0.832). The experts discussed discordant results and complete agreement was achieved. After that the results from the 9 laboratories and experts were compared. Discrepancy between negative (0.1+) and positive (3+) results occurred in few cases (!=0.96, !=0.98 respectively). Distinguishing weakly (2+) from strongly (3+) positive results showed agreement in only 62% of positive cases (!=0.37). After consensus was agreed by analyzing doubtful slides by all

In Croatian female population the incidence and mortality of breast carcinoma is unfortunately very high. The mammography-screening program for female population in Croatia does not exists, except some sporadic actions in certain regions of country. That is probably reason for detection primary breast carcinomas of larger size and advanced clinical stage in comparison with some other European countries. Despite of that, in recent years mortality rate is slightly dropping down, which is probably result of improvement of therapeutic approaches. It is known that the choice of therapy regiments in primary breast carcinoma patients is based on clinical stage and pathological predictive and prognostic factors such as tumor size, grade, lymph node and steroid receptor status 1. For that reason uniform reporting of breast carcinoma specimens is very important for oncologists making predictions for patient therapy respond and survival. Uniform pathological management and reporting, which among others includes standardization of HER-2/neu testing and reporting, is very important not only for metastatic breast carcinoma patients, than probably also for at least some certain group of newly diagnosed patients (Jacobs et al, 2000; Rampaul et al, 2001; Hsu et al, 2002). The aim of this study was to uniform reporting of breast carcinoma specimens, as well as to standardize HER-2/neu testing and reporting as part of routine pathological report in prospective multicentric study including 9 centers in Croatia. Additionally, verification of association of HER-2/neu expression with other prognostic factors was done. This group of prospectively collected patients will be clinically carefully followed, and effect of combination of prognostic factors in lymph node negative and positive patients on disease free survival (DFS) and overall survival will be investigated in the future. It is known that HER-2/neu positivity is prognostic and predictive factor for therapy respond in patients with metastatic disease, and that selection of patients with strongly HER-2/neu positive tumors is required to obtain clinical benefit from the HER-2/neu targeted therapy in the metastatic breast cancer studies. In some reports HER2/neu is very powerful prognostic factor indicating poor prognosis in primary diagnosed patients, as well as predictive factor for certain adjuvant therapy respond in particular group of patients. Indeed, several studies suggest that HER-2/neu positive patients experience decreased responses to hormonal therapy. Therefore, HER-2/neu status probably should be part of pathologic report in patients with primary breast cancer, as is recently recommended in St. Gallen conference in January 2005.

168

Cancer Therapy Vol 3, page 169

Table 1. Distribution of breast carcinoma patients in 9 centers in Croatia during one year (September 2001 to September 2002) Institution Clinical Hospital Split Clinical hospital center Zagreb General Hospital Vinkovci Clinical Hospital Osijek General Hospital Slavonski Brod Medical School Rijeka Clinic for tumors Zagreb Clinical Hospital â&#x20AC;&#x153;Sisters of mercyâ&#x20AC;? Zagreb General Hospital Dubrovnik Total

Number

196 219 30 163 44 293 369 85 43

13.6 15.2 2.1 11.3 3.1 20.3 25.6 5.9 3.0 1442

Figure 1. Age distribution in investigated breast carcinoma patients pathologists included in this study, the generalized ! values indicated substantial agreement (!=0.85).

positive, while PR were positive in 972 (59.5%) breast carcinoma patients. Almost equal number of patients was treated by mastectomy and spearing surgery procedure (quadrantectomy and tumorectomy with free margins). There was a difference between 9 centers in type of surgical procedure, e.g. in some centers majority of cases were treated with spearing surgery, while in others simple mastectomy was performed in majority of patients (Table 2). The association of HER-2/neu overexpression with classical prognostic factors is shown in Table 3. Statistically significant association between HER-2/neu expression and lymph node status (p<0.001), tumor size (p<0.001), histological (p<0.001) and nuclear grade (p<0.001), extratumoral VI (p=0.039) and premenopausal status (p=0.040) were found. Statistically significant negative association between HER-2/neu and steroid receptor expression was found (p<0.001).

A. Statistical analysis Analysis was carried out using data analysis software package Statistica ver. 6.0 (StatSoft, 2001). Results were expressed as median and range for quantitative variables and as frequencies and percentages for categorical variables that were grouped following logical classes. Association of categorical variables was tested using the Pearson chi-square test. Results were considered statistically significant at p<0.05.

III. Results Table 2 shows the distribution of all investigated parameters in 1442 breast carcinoma patients. Of 1442 tumors 197 (13.7%) were HER-2/neu positive and 1241 were negative (86.3%). There were 312 (21.8%) patients younger than 50 years, and majority of patients (78.2%) were 50 years or older. In 865 (65.0%) patients ER were

169

Jakic-Razumovic et al: HER-2/neu overexpression in Croatian breast cancer patients

Table 2. Distribution of all investigated parameters in 1442 breast carcinoma patients Factors Age < 50 " 50 Menopause no yes Histologic type ductal invasive lobular invasive others Tumor size < 1cm 1 - 2 cm 2 - 5 cm > 5 cm Grade 1 2 3 Nuclear grade 1 2 3 VI (intratumoral) no yes VI (extratumoral) no yes ER negative positive PR negative positive Lymph nodes negative positive unknown HER-2/neu negative positive Type of surgery quadrantectomy mastectomy

Number

312 1120

21.8 78.2

374 1067

26.0 74.0

1113 145 184

77.2 10.1 12.7

128 506 674 101

9.1 35.9 47.8 7.2

295 767 316

21.4 55.7 22.9

267 750 326

19.9 55.8 24.3

1330 111

92.3 7.7

1094 346

76.0 24.0

465 865

35.0 65.0

538 972

40.5 59.5

662 544 236

45.9 37.7 16.4

1241 197

86.3 13.7

741 701

51.4 48.6

170

Cancer Therapy Vol 3, page 171 Table 3. Crosstabulation of HER-2/neu expression with other prognostic factors in 1442 breast carcinoma patients Factors Lymph nodes negative positive Tumor size < 1cm 1-2 cm 2-5 cm > 5 cm Grade 1 2 3 Nuclear grade 1 2 3 VI (intratumoral) negative positive VI (extratumoral) negative positive ER negative positive PR negative positive Menopause no yes

HER-2/neu (%) negative

positive

Hi2

595 (90.1) 455(84.0)

65 (10.9) 87(16.0)

10.37

<0.001

121 (94.5) 449(88.9) 556 (82.7) 84 (84.0)

7 (5.5) 56 (11.1) 116 (17.3) 16 (16.0)

17.67

<0.001

278 (94.2) 665 (87.0) 236 (74.9)

17 (5.8) 99 (13.0) 79 (25.1)

48.83

<0.001

248 (92.9) 657 (88.1) 246 (75.5)

19 (7.1) 89 (11.9) 80 (24.5)

43.14

<0.001

1148 (86.6) 92 (82.9)

178 (13.4) 19 (17.1)

1.18

0.277

952 (87.3) 287 (83.0)

138 (12.7) 59 (17.0)

4.28

0.039

365 (78.7) 785 (90.8)

99 (21.3) 80 (9.2)

37.86

<0.001

420 (78.2) 730 (92.2)

117 (21.8) 62 (7.8)

53.51

<0.001

311 (83.2) 929 (87.4)

63 (16.8) 134 (12.6)

4.20

0.040

Lymph node status is crosstabulated with other investigated parameters and results are shown in Table 4. It is found statistically significant association between lymph node status and tumor size (p<0.001), histological (p<0.001) and nuclear grade (p<0.001) and intra (p=0.038) and extratumoral VI (p<0.001), while association was negative with both, ER and PR positivity (p<0.001). Menopausal status and other investigated parameters were crosstabulated and results are shown on the Table 5. No association was observed between menopausal status and lymph node status, tumor size, intratumoral VI, and PR status. Postmenopausal patients more often had ER negative tumors (p<0.001), higher-grade tumors

(p=0.007), higher tumor nuclear grade (p=0.037), and presence of extratumoral VI (p<0.001) than premenopausal.

IV. Discussion Treatment and prognosis of breast carcinoma patients depend on histological diagnosis including basic prognostic factors and additional markers. Recently, a number of studies have indicated that overexpression of HER-2/neu in breast carcinoma patients indicate worse prognosis and lower probability of responsiveness to some therapy protocols (Ellis et al, 2001; Love et al, 2003; Schiff et al, 2004). Particularly, it is shown that HER171

Jakic-Razumovic et al: HER-2/neu overexpression in Croatian breast cancer patients 2/neu positive breast cancer is resistant to endocrine therapy, and that HER-2/neu positivity is associated with shortened survival in ER-positive breast cancer patients treated with hormonal agents, compared with those who are HER-2/neu negative. It is known that testing of HER2/neu overexpression or amplification is in usage in metastatic breast carcinoma patients because trastuzumab is widely established as an essential and well-tolerated treatment for the management of previously treated HER2/neu positive metastatic breast caracinoma patients. The testing of newly diagnosed breast cancer specimens for HER-2/neu still not has achieved â&#x20AC;&#x153;standard of practiceâ&#x20AC;? status for the management of breast carcinoma patients in the United States and Europe. According to the St. Gallen,s conference highlights the Panel was not ready to accept the information suggesting that overexpression of HER-2/neu may indicate a lower probability of

responsiveness to tamoxifen and perhaps cyclophosphamide, metothrexate and fluorouracil (CMF) (Paik et al, 2000; Osborne et al, 2003) as currently useful for patient care. Therefore, the predictive utility of HER2/neu overxpression in newly diagnosed breast carcinoma patients still awaits confirmation, but it seems that after collecting valuable data the Panel finally accepted HER2/neu testing as a part of routine pathological report at the last St.Gallen conference in January 2005 (data not published yet). Additionally, the discussion as to the best method to determine HER-2/neu status in breast carcinoma samples continuous, with the fluorescenece in situ hybridization method gaining popularity, owing to the recent evidence that in comparison with immunohistochemical analysis this method gives more reliable results.

Table 4. Crosstabulation of lymph node status with other prognostic factors in 1442 breast carcinoma patients Factors Tumor size < 1cm 1-2 cm 2-5 cm > 5 cm Grade 1 2 3 Nuclear grade 1 2 3 VI (intratumoral) negative positive VI (extratumoral) negative positive ER negative positive PR negative positive Menopause no yes

lymph node status (%) negative positive

Hi2

81 (63.3) 272(53.8) 282 (41.8) 19 (18.8)

17 (13.3) 149 (29.4) 308 (45.7) 66 (65.3)

94.85

<0.001

174 (69.3) 347 (53.1) 120 (44.6)

77 (30.7) 306 (46.9) 149 (55.14

33.35

<0.001

156 (65.6) 351 (54.5) 122 (45.4)

82 (34.5) 293 (45.5) 147 (54.6)

20.79

<0.001

619 (55.8) 43 (44.8)

491 (44.2) 53 (55.2)

4.29

0.038

550 (60.0) 112 (38.8)

367 (40.0) 177 (61.1)

39.98

<0.001

182 (47.6) 433 (59.0)

200 (52.4) 301 (41.0)

13.08

<0.001

215 (48.9) 400 (59.2)

225 (51.1) 276 (40.8)

11.45

<0.001

162 (52.4) 500 (55.7)

147 (47.6) 397 (44.3)

1.02

0.313

172

Cancer Therapy Vol 3, page 173 Table 5. Crosstabulation of menopausal status with other prognostic factors in 1442 breast carcinoma patients Factors Lymph nodes negative positive Tumor size < 1cm 1-2 cm 2-5 cm > 5 cm Grade 1 2 3 Nuclear grade 1 2 3 VI (intratumoral) negative positive VI (extratumoral) negative positive ER negative positive PR negative positive

Menopause (%)

Hi2

yes

162 (24.5) 147(27.0)

500 (75.5) 397 (73.0)

1.02

0.31

33 (25.8) 132(26.1) 170 (25.2) 30 (29.7)

95 (74.2) 373 (73.9) 504 (74.8) 71 (70.3)

0.94

0.816

84 (28.5) 176 (23.0) 100 (31.7)

211 (71.5) 590 (77.0) 216 (68.3)

9.76

0.007

66 (24.7) 182 (24.30) 103 (31.6)

201 (75.3) 567 (75.7) 223 (68.4)

6.62

0.037

352 (26.5) 22 (19.8)

977 (73.5) 89 (80.2)

2.37

0.124

302 (80.7) 72 (91.7)

791 (19.3) 274 (8.4)

33.14

<0.001

153 (32.9) 187 (21.6)

312 (67.1) 677 (78.4)

20.13

<0.001

143 (26.6) 197 (24.9)

395 (73.4) 594 (75.1)

0.47

0.492

However, at this point it is accepted that HER-2/neu testing by immunohistochemistry is valid method for screening and should be supplemented by FISH method in some cases of doubtful positive reaction (2+ staining intensity) before the trastuzumab treatment (Falo et al, 2003; Goldhirsch et al, 2003). Standardization of these parameters remains an important objective to optimize interlaboratory agreement, and therefore to compare HER2/neu immunohistochemical staining results obtained in 9 pathology departments the evaluation of the reproducibility of staining and assessments was done. After some repeating of staining in one referral center, and discussing of doubtful slides, there was good interlaboratory and interobserver agreement, and valuable data were collected that may be used in the development of quality assurance policies. The present study showed the usefulness of multicentric comparative studies in initiating the development guidelines as has been shown in

some other studies (Jacobs et al, 2000; Hsu et al, 2002; Santinelli et al, 2002; Gunhan et al, 2004). Investigation of adjuvant monoclonal antibody treatment against HER-2/neu for breast carcinoma patients overexpressing HER-2/neu are currently ongoing, but this type of treatment in the adjuvant setting outside of clinical trials is not currently justified. Ongoing prospective studies will show importance of HER-2/neu testing in making decisions of antibody usage in some subgroups of primary breast carcinoma patients with HER-2/neu overexpression in combination with other poor prognostic markers. Well-established diagnosis of breast cancer with all relevant traditional prognostic markers is a basis of good patients treatment. Therefore, we conducted this study to make consensus about histological prognostic factors (tumor size, grade, nuclear grade, vascular invasion), immunohistochemical predictive factors (ER, PR) and

173

Jakic-Razumovic et al: HER-2/neu overexpression in Croatian breast cancer patients HER-2/neu overexpression in newly diagnosed breast carcinoma patients during one year in Croatian population. The aim also was to make quality control study for HercepTest in 9 centers in Croatia. Since recently HER2/neu overexpression has gained therapeutic implications and following these developments demand for pathologists to evaluating properly HER-2/neu in breast cancer specimens has been rapidly increasing. For all that we succeeded in great amount, and finally an consensus was made for uniform reporting of prognostic factors in breast carcinoma patients. Particularly, cconsensus was made about using Nottingham model for determination of histological grade in breast carcinoma patients, which is more objective, has excellent reproducibility when used by experienced pathologists (Elston et al, 1991; Frierson et al, 1995; Robbins et al, 1995). Using this scheme incidence of G1-G3 was similar as described in many publications. Additionally, according to the St.Gallen,s recommendation there was agreement to use immunohistochemical method and scale of positivity for determination of ER and PR in breast carcinoma patients (Goldhirsch et al, 2003). It is known that most laboratories worldwide have switched to immunohistochemistry to assess steroid receptors, and it is shown in some studies that PR by immunohistochemistry provided significantly better results than by ligand-binding assay in predicting outcome. It is also shown that ER and PR are codependent variables and PR was a weaker predictor of response to endocrine therapy (Mohsin et al, 2004). Using immunohistochemical method and St.Gallen,s criteria we found 65.0% ER positive and 59.5 % PR positive breast carcinomas, which is very similar to other published studies using the same method (Colon et al, 2002). Controversy surrounds the correlation between HER2/neu expression and other prognostic markers, as has been discussed in preclinical and clinical studies. The objective of the current study was to investigate association of HER-2/neu overexpression with parameters that are assessed routinely in clinical practice (age, hormonal status, cancer grade, nuclear grade, vascular invasion and axilary lymph node status). The results showed that HER-2/neu overexpression was associated significantly with negative ER and PR status, tumor and nuclear high grade, larger tumors, extratumoral VI, positive lymph nodes and menopausal status, as similarly showed some other authors (Coradini and Daidone, 2004). In subgroup of patients presenting with hormoneresponsive Taucher et al, (2003) also showed recently that likelihood of HER-2/neu overexpression in G1/G2 tumors is very small, and therefore, that the assessment of HER2/neu status in this group of patients with breast carcinoma may be considered unnecessary, unless the role of HER2/neu status in adjuvant treatment has been proven. Despite relevant research efforts and identification of many putative good prognostic factors, few of these factors are clinically useful for identifying patients at minimal risk of relapse and with worse prognosis, or patients likely to benefit from specific treatments. Some of them such as HER-2/neu, EGFr, cyclin E, VEGF, urokinase type plasminogen activator-1 and recently discovered anti-apoptosis protein survavin, are suggested

to fit in the category high-level clinico-laboratory effective biomarkers. However, it is known that there is no single biomarker that is able to identify patients with the best (or worse) prognosis or those that would be responsive to a given therapy. Rapid implementation of laboratory findings to clinical practice is followed by many difficulties, including technical statistical concerns, a lack of assay standardization and comparability, and the modern design of studies. Many studies are performed on too small group of patients to provide reliable results. The studies are often heterogeneous in terms of treatment, patients and tumor characteristics, and data may be evaluated using different analytical approaches and thus no easily comparable. Adequately planned prospective studies are required to assess clinical utility of biomarker determinations. The present study showed the usefulness of multicentric comparative studies in initiating the development guidelines, and we hope that collected data will serve as a reference point for future studies of the epidemiological aspect breast cancer among women living in Croatia.

Acknowledgements The authors greatly acknowledge the contribution and support of Ankica Ajdukovic, Smilja BumberBolanca, and Hoffmann-La Roche Zagreb for providing HercepTests for all study participants, and their generous guidance, suggestions and human support during this period. We also appreciate the assistance of the pathology laboratory staff from all pathology departments included in this study.

References Colon E, Reyes JS, Gonzales Keelana C, Climent, Peras C (2002) Prevalence of steroid receptors and HER-2/neu in breast cancer biopsies of women living in Puerto Rico. Health Sci J 21, 299-303. Coradini D, Daidone MG (2004) Biomolecular prognostic factors in breast cancer. Curr Opin Obstet Gynecol 16, 49-55. Ellis MJ, Coop A, Singh B, Muriac L, Llombert-Cussac A, Janicke F, Miller WR, Evans DB, Dugan M, Brady C, Quebe-Fehling E, Borgs M (2001) Letrozole is more effective neoadjuvant endocrine therapy than tamoxifen for Erb-1-and/or Erb-2- positive, estrogen receptor-positive primary breast cancer: Evidence from a phase III randomized trial. J Clin Oncol 19,3808-16. Elston CW, Ellis IO (1991) Pathological prognostic factors in breast cancer I. The value of histological grade in breast cancer: experience from large study with long-term followup. Histopathol 19, 403-10. Falo C, Moreno A, Lloveras B, Figueras A, Varela M, Escobedo A (2003) Algorithm for the diagnosis of HER-2/neu status in breast-infiltrating carcinoma. Am J Clin Oncol 26, 465-70. Frierson HF, Wolber RA, Berean KW, Franquemont DW, Gaffey MJ, Boyd JC, Wilbur DC (1995) Interobserver reproducibility of the Nottingham modification of the Bloom and Richardson histological grading scheme for infiltrating ductal carcinoma. Am J Clin Pathol 105, 195-8. Goldhirsch A, Wood WC, Gelber RD, Coates AS, Thurlimann B, Senn HJ (2003) Meeting Highlights: Updated International Expert Consensus on the Primary Therapy of Early Breast Cancer. J Clin Oncol 21, 3357-65. Gunhan O, Kafousi M, Kurt B, Koutsopoulos AV, Karslioglu Y,

174

Cancer Therapy Vol 3, page 175 Stathopoulos E, Celasun B. (2004) Comparison of C-erbB2 (HER-2/Neu) immunohistochemistry results on invasive breast carcinomas. Experience of 2 pathology departments in Turkey and Greece. Anal Quant Cytol Histol 26, 251-4. Hsu CY, Ho DM, Yang CF, Lai CR, Yu IT, Chiang H (2002) Interobserver reproducibility of HER-2/neu protein overexpression in invasive breast carcinoma using DAKO HerecepTest. Am J Clin Pathol 118, 693-8. Jacobs TW, Gown AM, Yaziji H, Barnes MJ, Schnitt SJ (2000) HER-2/neu protein expression in breast cancer evaluated by immunohistochemistry. A study of interlaboratory agreement. Am J Clin Pathol 113, 251-8. Love RR, Duc NB, Havighurst TC, Mohsin SK, Zhang Q, DeMets DL, Allred DC (2003) HER-2/neu overexpression and response to oophorectomy plus tamoxifen adjuvant therapy in estrogen receptor-positive premenopausal women with operable breast cancer. J Clin Oncol 21, 453-7. Mohsin SK, Weiss H, Havighurst T, Clark GM, Berardo M, Roanh I, To TV, Zho Q, Love RR, Allred DC (2004) Progesterone receptor by immunohistochemistry and clinical outcome in breast cancer: a validation study. Mod Pathol July 23 (advance online publication) Osborne CK, Bardou V, Hopp TA, Chamness GC, Hilsenbeck SG, Fuqua SA, Wong J, Allred DC, Clarck GM, Schiff R (2003) Role of the estrogen receptor coactivator AIB1 (SRC3) and HER-2/neu in tamoxifen resistance in breast cancer. J Natl Cancer Inst 95, 53-61. Paik S, Bryant J, Tan-Chiu E, Yothers G, Park C, Wickerham DL, Wolmark N (2000) HER-2 and choice of adjuvant chemotherapy for invasive breast cancer. National Surgical Adjuvant Breast and Bowel Project Protocol B-15. J Natl Cancer Inst 92, 1991-8. Rampaul RS, Pinder SE, Elston CW, Ellis IO (2001) Prognostic and predictive factors in primary breast cancer and their role in patient management: The Nottingham Breast Team. EJSO 27, 229-38. Robbins P, Pinder S, de Klerk, Dawkins H, Harvey J, Sterrett G, Ellis J, Elston C (1995) Histological grading of breast

carcinomas. A study of interobserver agreement. Hum Pathol 26, 873-9. Santinelli A, Baccarini M, Colanzi P, Stramazzotti D, Fabris G (2002) Immunohistochemical evaluation of HER-2/neu expression in infiltrating breast carcinoma: a study of reproducibility. Anal Quant Cytol Histol 24, 54-62. Schiff R, Massarweh SA, Shou J, Bharwani L, Mohsin SK, Osborne CK (2004) Cross-talk between estrogen receptor and growth factor pathways as a molecular target for overcoming endocrine resistance. Clin Cancer Res 10, 331S-6S. StatSoft, Inc. Statistica [computer program]. Version 6.0. Tulsa (OK, USA): StatSoft; 2001. Taucher S, Rudas M, Mader RM, Gnant M, Dubsky P, Bachleitner T, Roka S, Fitzal F, Kandioler D, Sporn E, Fridl J, Mittlbock M, Jakes S (2003) Do we need HER-2/neu testing for all patients with primary breast carcinoma? Cancer 15, 2547-53.

Jasminka Jakic-Razumovic

175

Jakic-Razumovic et al: HER-2/neu overexpression in Croatian breast cancer patients

176

Cancer Therapy Vol 3, page 177 Cancer Therapy Vol 3, 177-184, 2005

Tumor-specific human monoclonal antibody GAH recognizes non-muscle myosin heavy chain type A as a cell surface antigen Research Article

Yoko Hirakawa1,*, Yoshiko Yoshiyama4, Hisae Niki1, Shinsuke Ooike1, Jun Kondo1, Saiko Hosokawa1, Kazuhiro Takahashi2, Kazuhiro Nagaike3, Hideo Nakamura1, Makoto Tsurufuji1 and Toshiaki Tagawa1 1

Pharmaceuticals Research Unit, Mitsubishi Pharma Corporation, Yokohama, Japan Pharmaceuticals Development Unit, Mitsubishi Pharma Corporation, Tokyo, Japan 3 Science & Technology Research Center, Mitsubishi Chemical Corporation, Yokohama, Japan 4 ZOEGENE Corporation, Yokohama, Japan 2

__________________________________________________________________________________ *Correspondence: Yoko Hirakawa, Pharmaceuticals Research Unit, Mitsubishi Pharma Corporation, 1000, Kamoshida-cho, Aoba-ku, Yokohama 227-0033, Japan; Tel: +81-45-963-4724; Fax: +81-45-963-4641; E-mail: Hirakawa.Youko@ma.m-pharma.co.jp Key words: human monoclonal antibody, GAH, non-muscle myosin heavy chain type A, tumor antigen Abbreviations: carcinoembryonic antigen, (CEA); Chinese hamster ovary, (CHO); immunoliposomal doxorubicin, (ILD); monoclonal antibody, (MAb); non muscle myosin heavy chain type B, (nmMHCB); non-muscle myosin heavy chain type A, (nmMHCA); polyethyleneglycol, (PEG); propidium iodide, (PI) Received: 3 March 2005; Accepted: 15 March 2005; electronically published: March 2005

Summary We previously obtained the human monoclonal antibody (MAb) GAH produced by a human-mouse hybridoma derived from lymphocytes of a cancer patient through screening solely based on selective binding to the surface of human tumor cells. The MAb reacts to a high percentage of human solid tumor cells with good selectivity, is internalized by GAH-positive cultured tumor cells in vitro, and when conjugated to polyethyleneglycol-modified immunoliposomal doxorubicin improves the anti-tumor efficacy of the formulation in vitro and in vivo. Here, we report for the first time on the identification of human non-muscle myosin heavy chain type A (nmMHCA) as an unusual tumor cell-surface antigen which GAH recognizes. We found that a chromatographic fraction of extract of GAH-positive MKN45 human stomach tumor cells containing an approximately 200 kDa protein was positive for GAH-staining on a dot-blot assay, and peptide sequences obtained from the same fraction mainly consisted of those of 200 kDa nmMHCA. In addition, GAH could immunoprecipitate nmMHCA from lysates of COS-7 cells transfected with its cDNA or MKN45 cells, and a 200 kDa protein could be recovered from the surface of MKN45 cells labeled with biotin and was found to be nmMHCA using a specific polyclonal antibody. Although the mechanisms by which the epitope of GAH on a cytoskeletal component is selectively exposed on tumor cell surface and internalized is unknown, this finding emphasizes the potential of such â&#x20AC;&#x153;non-membrane proteinsâ&#x20AC;? as new targets for antibody therapy to treat cancer.

MAb technology is anticipated to provide safe and efficacious therapies for these patients, primarily based upon the strict specificity of antigen recognition by antibody. Our laboratory has been conducting research on MAb for the treatment of solid tumors, especially focusing on its application in liposome delivery, mainly because efficacious anti-cancer activity with a broad spectrum should be possible when nanoparticles containing potent

I. Introduction Almost 30 years of biomedical research on MAbs for cancer treatment have resulted in the discovery of significant benefits to some patients using drugs such as rituximab, gemtuzumab, and trastuzumab among others (Baselga, 2001; King and Younes, 2001; Giles et al, 2003). However, there are still unresolved needs for cancer therapy, especially for that against solid tumors. 177

Hirakawa et al: Non-muscle myosin heavy chain type A as a tumor antigen with P3U1 mouse myeloma cells to produce hybridomas. They were then screened for the production of human antibody which reacted against the human tumor cell surface by Cell-ELISA and flowcytometric analysis. One of the selected human monoclonal antibodies was named GAH. Its cDNA was cloned and recombinant GAH (IgG 1) was obtained from established Chinese hamster ovary (CHO) cells transfected with GAH expression vectors (Hosokawa et al, 2004). As a control antibody, human immunoglobulin huIgG was purified from human serum (SCANTIBODIES Laboratory, Inc., Santee, CA) or purchased from Cappel (West Chester, PA). Anti-nmMHC rabbit polyclonal antibody (BT-561) and normal rabbit IgG were purchased from Biomedical Ltd, (Acacia Ridge, Queensland, Australia) and Biogenesis Ltd. (Poole, UK), respectively, and horseradish peroxidase (HRP)-labeled anti-human immunoglobulin and HRP-labeled anti-rabbit IgG were acquired from Cappel. FITC-labeled antibody was prepared as previously described (Hosokawa et al, 2004).

cytotoxic agent is conjugated with a MAb that can recognize “pan-tumor” antigens selectively expressed on tumor cell surface. For this purpose, we previously screened a panel of human-mouse hybridomas derived from lymphocytes cells of cancer patients based on the binding reactivity to the surface of tumor cells freshly isolated from human cancer tissue, and obtained a tumor-specific human monoclonal antibody named GAH (Hosokawa et al, 2004). GAH selectively stains cancer cells in human tissue sections from 13/14 stomach, 4/11 colon, 5/11 mammary, and 0/7 lung cancers, while no positive staining was observed for those of non-tumor and various normal specimens (Hosokawa et al, 2004). Furthermore, polyethyleneglycol (PEG)-modified immunoliposomal doxorubicin (ILD) with GAH has in vivo anti-tumor efficacy selectively against GAH-reactive stomach and colorectal cancer xenografts (Hamaguchi et al, 2004; Hosokawa et al, 2004). Additionally, we reported that ILD exhibits selective antitumor efficacy in vitro and in vivo against tumor cell lines with a positive correlation between the number of GAH-binding sites on tumor cell surfaces and the ILD therapeutic index (Hosokawa et al, 2003). While the usefulness of GAH for liposome delivery to tumor cells was examined, the nature of the antigen on the tumor cell surface recognized by the antibody remains to be clarified since GAH is selected solely dependent on the binding activity to the tumor cell surface without knowing or assuming what antigen the antibody recognizes. We have been pursuing the molecular nature of the antigen expressed on the cell surfaces of a wide range of human solid tumors to obtain deeper insight into the mechanism responsible for this binding and the behavior of GAH selectively observed against tumor cells. Consequently, we found that non-muscle myosin heavy chain type A, which is a cytoskeletal component inside cells, is a component of the antigen exposed on the tumor cell surface recognized by GAH using biochemical approaches and confirmatory experiments involving gene transfer.

C. Flow cytometric analysis of antibody reactivity against the cell surface of viable cells The cells were incubated with FITC-labeled antibody diluted with human serum, and after washing they were analyzed in the presence of propidium iodide (PI) with a flow cytometer (FACScan, Becton Dickinson, San Jose, CA). For the PInegative cell population, the mean fluorescence intensity of FITC was measured and converted to the total amount of bound FITC per cell using a Quantitative kit (Flow Cytometry Standards Co., San Juan, PR) as a calibration standard (Hosokawa et al, 2004).

D. Partial purification of GAH antigen from MKN45sc To prepare a crude membrane fraction of MKN45sc, a resected tumor mass of MKN45sc was first homogenized in TNE buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA and protease inhibitors) with an ultrasonic homogenizer. The supernatant after centrifugation at 400 g for 5 min was then layered on top of 45% sucrose in TNE buffer and was ultracentrifuged (104,000 g) for 1 hour. The interface fraction was subsequently collected and solublized by adding sodium deoxycholate to a final concentration of 1%, and the cleared extract was applied to a Q-Sepharose-HP column. After a linear concentration gradient was developed from 50 mM to 1 M NaCl, it was further eluted with 20 mM Tris-HCl (pH 7.5) containing 8 M urea. The obtained fractions were analyzed by 7.5% SDSPAGE under reduced conditions and dot-blot assay, where each fraction was spotted on a PVDF membrane and incubated with GAH followed by HRP-labeled anti-human immunoglobulin. The binding reaction of GAH to the spotted materials was visualized by Konica Immunostain HRP-1000 (Konica Corp., Tokyo, Japan).

II. Materials and methods A. Cell lines Human stomach tumor cell line MKN45 cells were purchased from IBL Co., (Fujioka, Japan) and human colon cancer cell line HCT-15 and monkey cell line COS-7 cells were obtained from the Cell Resource Center for Biomedical Research, Tohoku University (Sendai, Japan). All cell lines were cultured in DMEM supplemented with 10% FBS at 37°C in humidified 5% CO2 and 95% air. To obtain cells from transplanted tumor tissues, MKN45 xenografts subcutaneously grown on the backs of BALB/C nude mice (CLEA Inc., Tokyo, Japan) were processed as previously described (Hosokawa et al, 2004). In brief, the tissues were minced and passed through nylon mesh and then centrifuged to remove cell debris. Cells derived from the transplanted tumor were designated MKN45sc, while cultured MKN45 cells were designated MKN45cul.

E. Peptide sequence analysis Chromatographic fractions which were positive for GAH binding on the dot-blot assay or CBB-stained 200 kDa protein derived from GAH-immunoprecipitates within SDS-PAGE gel fragments were subjected to conventional peptide sequence analysis including degradation by CNBr (Nakarai Tesque, Kyoto, Japan) or treatment with lysyl endopeptidase (Wako Pure Chemicals, Osaka, Japan), respectively. The resulting peptides were separated using reversed phase HPLC followed by peptide sequence analysis with a peptide sequencer. Sequence homology was then searched for using FASTA (Sequence Similarity Search by GenomeNet).

B. Antibodies GAH (IgG1, !)-producing cells were established by a conventional hybridoma technique (Hosokawa et al, 2004). Lymphocytes obtained from a colon cancer patient were fused

178

Cancer Therapy Vol 3, page 179

F. Analysis of cell surface protein

binding sites for GAH than the same cell line cultured in vitro does. For example, the number of GAH molecules bound to the subcutaneous transplanted tumor cells (MKN45sc) was 1.2 x 105/cell, while the number against cultured MKN45 (MKN45cul) was 1 x 104/cell. On the other hand, this increase was not observed for antibody against carcinoembryonic antigen (CEA). This phenomenon was observed not only for the MKN45 cell line, but also for other human cancer cell lines such as HCT-15, a colon cancer cell line (data not shown). We further used MKN45sc for the purification of antigen because of this higher binding of GAH. In our pilot study involving flow cytometry, the binding reactivity of GAH to the cell surface was decreased to approximately 50% by trypsin treatment, but not by periodic acid treatment, which inactivated the sugar moieties. This suggests that proteins might be a component of the antigen molecule and that glycolipid or carbohydrate is not likely an antigenic determinant. Based upon these observations, we tried to purify the antigen from the crude membrane fraction of MKN45sc solublized with sodium deoxycholate by Q-Sepharose HP ion-exchange column chromatography. Since GAH antigen could not retain its antigenesity upon SDS treatment, conventional SDS-PAGE/Western blotting analysis of tumor cell lysate probed with GAH was not performed. A dot-blot analysis as described in “Materials and methods” was therefore employed for tracing GAH binding reactivity among the fractions. As a result, fractions eluted with 8 M urea containing a 200 kDa protein on SDS-PAGE in common were found to be positive for GAH-staining (Figure 1). Then, these GAHpositive fractions were pooled and treated with CNBr, and each of the chromatographically isolated peptide fragments was analyzed for its amino acid sequence. The peptide sequences were found to be identical to that of some regions of the human non-muscle myosin heavy chain type A protein sequence (nmMHCA; SWISS-PROT P35579, Figure 2), for which the deduced molecular weight was 227 kDa.

The surface molecules on intact cells were chemically labeled with biotin as described by Yanase et al, 1997. Cell suspensions of MKN45cul and MKN45sc were labeled by incubation for 30 minutes in 1 mg/ml sulfo-NHS-biotin (PIERCE, Rockford, IL) in PBS at 4°C. The labeled cells were next lysed by adding TNE buffer with 1% NP40 and homogenized with an ultrasonic homogenizer, and soluble supernatant was applied to Protein A Sepharose CL-4B (Amersham Biosciences) bound with GAH or huIgG, and incubated overnight rotating at 4°C. Then the resins were washed and bound materials were run on SDS-PAGE using 4-12 % gradient gels under reduced conditions, transferred to a PVDF membrane and probed with HRP-labeled avidin (Vector Laboratories, Burlingame, CA) or BT-561 followed by HRP labeled anti-rabbit IgG. After this, bound HRP-conjugate was visualized by ECL (Amersham Biosciences).

G. Preparation of nmMHCA expression vector and transfection into COS-7 cells The nmMHCA 5' cDNA clone HA1.0 ,GenBank M81105, (Toothaker et al, 1991) and the 3' cDNA clone HALES, GenBank M31013, (Saez et al, 1990) were kindly provided by Dr. Robert S. Adelstein (National Institutes of Health, Bethesda, MD). The expression vector of the full-length nmMHCA was constructed from 5' and 3' fragments of nmMHCA cDNA and recloned into appropreate sites of the pEF1B-HALES. The obtained expression vector was then transfected into COS-7 cells with PolyFect (QIAGEN, Hilden, Germany), and after 48 hours culture, the cells were processed and subjected to immunoprecipitation as described above.

III. Results A. Characterization purification of GAH antigen

and

partial

While we have already evaluated and reported on the antitumor efficacy of ILD conjugated with GAH (Hosokawa et al, 2003, 2004; Hamaguchi et al, 2004), efforts have also been made to identify the antigen which GAH recognizes. When we looked for the most efficient material for the purification of GAH antigen, we found by flow cytometric analysis that tumor cells isolated from xenotransplants in nude mice usually possesses more

Figure 1. Isolation of antigen from a crude membrane fraction of MKN45sc. A sodium deoxycholate soluble crude membrane fraction of MKN45sc was separated using QSepharose HP with a linear gradient of NaCl (dotted line) followed by 8 M urea, and the elution was monitored at 280 nm (solid line). The peak eluted with 8 M urea (bar) was then subjected to SDS-PAGE followed by Coomassie Brilliant Blue staining (insert).

179

Hirakawa et al: Non-muscle myosin heavy chain type A as a tumor antigen

Figure 2. Amino acid sequence of human nmMHCA. The amino acid sequence of nmMHCA is shown (SWISS-PROT P35579). The protein from Q-Sepharose chromatography was fragmented by CNBr and resulting peptide sequences were determined (shaded). The 200 kDa band of immunoprecipitation was treated with lysyl endopeptidase and the sequences were analyzed (outlined).

antigenic complex containing the protein. The first case implies that the nmMHCA should be exposed on the tumor cell surface, although the molecule is regarded an intracellular cytoskeltal protein (Herman and Pollard, 1981). To test this, the cell surface of intact MKN45sc or MKN45cul cells, among which cell surface reactivity against GAH is different, was labeled with sulfo-NHSbiotin, and the immunoprecipitates with GAH or control human IgG were probed with HRP-conjugated avidin on a SDS-PAGE/Western blot. A prominent 200 kDa band was detected only for the case of the GAH-immunoprecipitate from MKN45sc (Figure 4, Lane 1), but hardly any biotinylated band was detected for the MKN45cul preparation (Figure 4, Lane 4). The control human IgG did not recover any detectable molecule from either cell preparation (Figure 4, Lanes 7, 8). In contrast, when immunoprecipitates prepared in the same manner were probed with BT-561 and anti-rabbit Ig-HRP instead of HRP-labeled avidin, the 200 kDa band was detected not

B. Immunoprecipitation of nmMHCA by GAH To examine whether GAH could recognize and immunoprecipitate nmMHCA protein, we transfected an expression vector of its cDNA into COS-7 cells which express the type B non muscle myosin heavy chain (nmMHCB) but not nmMHCA (Sellers, 2000). nmMHCA expression in whole cell lysate was confirmed by Western blot analysis using an anti-nmMHC rabbit polyclonal antibody (BT-561), where a 200 kDa band was observed in COS-7 transfected with the nmMHCA expression vector (Figure 3, Lane 1), but not in mock-treated cells as a negative control (Figure 3, Lane 4). When immunoprecipitates with GAH from the lysate of cells transfected with the expression vector were analyzed by Western blotting with BT-561, the 200 kDa band was detected (Figure 3, Lane 2), but was not seen in the immunoprecipitate with control human IgG (Figure 3, Lane 3). These results suggest that GAH directly binds to the 200 kDa nmMHCA, or alternatively binds to the 180

Cancer Therapy Vol 3, page 181 Figure 3. Immunoprecipitation of transiently expressed nmMHCA. The soluble supernatant of the nmMHCA transient transformant of COS-7 cells and mock cells were immunoprecipitated with GAH or huIgG and then stained with BT-561. Lanes 1-3: nmMHCA transformants, Lane 4: mock cells, Lane 2: immunoprecipitation with GAH, Lane 3: immunoprecipitation with huIgG, Lanes 1 and 4: cell soluble supernatant stained with BT-561.

only for MKN45sc but also for MKN45cul (Figure 4, Lane 2, 5). These results show that the nmMHCA molecule was present in MKN45cul and MKN45sc but was exposed on the cell surface of the latter, which might explain the difference in GAH-reactivity against MKN45sc and MKN45cul as seen by FCM analysis. Whereas the results above showed that GAH reactivity coincided with the expression of nmMHCA on the tumor cell surface, there remains the possibility that GAH recognized the antigenic complex containing nmMHCA, coimmunoprecipitating nmMHCA together with the target molecule. We therefore analyzed the 200 kDa band as well as other bands detected on the 4-12% SDS-PAGE of GAH-immunoprecipitates from MKN45sc cells. As a result of peptide sequence analysis, the 200 kDa band was again identified as human nmMHCA (SWISS-PROT P35579) (Figure 2). The faint bands A and B shown in Figure 4 were determined to be the Nterminus fragments of nmMHCA, and band C was identified as human "-actin. Although actin might be associated with nmMHCA, it was shown that GAH did not directly bind to an authentic sample of human plateletderived actin containing ":85% and #:15% (Cytoskeleton, Inc. Denver, USA ) by dot blot analysis (data not shown). From these results showing GAH could recover nmMHCA, we concluded that it was likely that the antibody recognized a portion of nmMHCA selectively exposed on the MKN45 tumor cell surface.

tumor cell lysate, and that this coincides with tumor cell surface expression of the protein. Although the direct binding of GAH to nmMHCA should be investigated, these results imply that nmMHCA works as a cell surface

Figure 4. Immunoprecipitation of cell surface protein. The cell surface of MKN45sc (lanes 1-3, 7) and MKN45cul (lanes 4-6, 8) was biotinylated and the solubilized supernatant was then immunoprecipitated with GAH (lanes 1-6) or huIgG (lanes 7 and 8), and analyzed by SDSâ&#x20AC;&#x201C;PAGE and Western blotting (4-12% polyacrylamide gradient gel) using HRP-labeled avidin (lanes 1, 4, 7, and 8), BT-561 (lanes 2 and 5) or normal rabbit IgG (lanes 3 and 6). Bands A and B are N-terminus fragments of nmMHCA and band C is "-actin.

IV. Discussion In this report, we showed that the new human monoclonal IgG1 antibody GAH, which selectively binds to tumor cell surfaces, can recover nmMHCA protein from 181

Hirakawa et al: Non-muscle myosin heavy chain type A as a tumor antigen antigen which GAH recognizes. We are currently trying to examine whether GAH can directly bind to highly purified recombinant nmMHCA protein and to identify its epitope. While nmMHCA is a cytoskeletal protein, several previous reports (Willingham et al, 1974; Olden et al, 1976) investigated myosin expression on the surface of some non-muscle, non-tumor cells including mouse L929 fibroblast, although the type of myosin among the family of myosin molecules was not specified (Sellers, 2000). While the mechanism by which nmMHCA can be located and exposed on the cell surface is unknown, our finding that nmMHCA is present on the cell surface of tumor cells including MKN45 grown in vivo to a much more extent than for those cultured in vitro, should help clarify this mechanism. Moreover, in conjunction with our previous data on GAH reactivity (Hamaguchi et al, 2004; Hosokawa et al, 2004), which is limited to tumor cells, it seems that cell surface expression of nmMHCA is required but not sufficient for the explanation of the tumor specific reactivity. It is possible that some accessory molecules may have to be associated with nmMHCA to permit the binding by GAH. Several minor bands were also visualized by the immunoprecipitation results; two of them were nmMHCA fragments, and one of them was "-actin, which GAH can not directly bind. Further detailed analysis of other minor bands might be needed to understand the precise mechanism of GAH-tumor cell interaction. Additionally, this GAH-reactivity of nmMHCA on the tumor cell surface might reflect the cells malignant behavior, since it is the high percentage of reactivity against human malignant tumors that distinguishes GAH from other human MAbs. Several cancer-reactive human monoclonal antibodies derived from the lymphocytes of cancer patients recognize such cytoskeletal proteins; CLNIgG recognizes a portion of vimentin (Hagiwara et al, 2001), while AE6F4 and COU-1 bind to cytokeratin (Borup-Christensen et al, 1990; Ichikawa et al, 1997). The epitope for COU-1, which binds to surface of cancer cells, is a cancer associated cleavage product of the cytokeratin 8/18 complex (Ditzel et al, 2002). Together with our present study, these reports suggest that even ubiquitously distributed cytoskeletal proteins act as surface antigens in a tumor-specific manner, which might need structural changes or the association of other molecules. We believe that our approach by which GAH was successfully obtained should be significant for finding new targets for cancer treatment that can not be obtained by conventional approaches, where researchers have postulated dealing with a category of â&#x20AC;&#x153;plasma membrane proteinâ&#x20AC;? predicted from primary structural similarity. We have prepared anti-nmMHCA polyclonal antibodies using a set of deca-peptides originated from nmMHCA sequence. One of the antibodies, raised against a peptide on the carboxy-terminal side, showed cancer specific reactivity when normal and cancerous tissue sections were immunostained; the specificity was similar to that of GAH. The polyclonal antibody, however, did not share all of its properties with GAH, it reacted against non-epidermal cells, such as vascular endothelial cells

unlike GAH (Niki, unpublished observation). These differences in reactivity might be due to the difference in the epitopes that they recognize, as observed in the case of above-mentioned COU-1, which showed an abnormal staining pattern compared to conventional anti-cytokeratin 8 and cytokeratin 18 antibodies (Ditzel et al, 2002). In summary, this is the first report to reveal that nmMHCA can be a new tumor-associated cell surface antigen and thus a new target of monoclonal antibody therapy for cancer. GAH-conjugated ILD is being evaluated in a phase I clinical study in Japan involving cancer patients with digestive organ tumors.

Acknowledgements We are grateful to Dr. Robert Adelstein for his generous gift of the nmMHCA cDNA clones HA1.0 and HALES. We also thank Dr. Takayuki Miyanishi at Nagasaki University for his review of the manuscript.

References Baselga J (2001) Clinical trials of Herceptin R (trastuzumab). Eur J Cancer 37, Suppl 1, S18-24. Borup-Christensen P, Erb K, Ditzel H, Nielsen B, Larsen JK, Svehag SE, and Jensenius JC (1990) Human-human hybridoma producing monoclonal antibodies against colorectal cancer-associated antigens. APMIS 98, 674-684. Ditzel HJ, Strik MC, Larsen MK, Willis AC, Waseem A, Kejling K, and Jensenius JC (2002) Cancer-associated cleavage of cytokeratin 8/18 heterotypic complexes exposes a neoepitope in human adenocarcinomas. J Biol Chem 277, 21712-21722. Giles F, Estey E, and O'Brien S (2003) Gemtuzumab ozogamicin in the treatment of acute myeloid leukemia. Cancer 98, 2095-2104. Hagiwara H, Aotsuka Y, Yamamoto Y, Miyahara J, and Mitoh Y (2001) Determination of the antigen/epitope that is recognized by human monoclonal antibody CLN-IgG. Hum Antibodies 10, 77-82. Hamaguchi T, Matsumura Y, Nakanishi Y, Muro K, Yamada Y, Shimada Y, Shirao K, Niki H, Hosokawa S, Tagawa T, and Kakizoe T (2004) Antitumor effect of MCC-465, pegylated liposomal doxorubicin tagged with newly developed monoclonal antibody GAH, in colorectal cancer xenografts. Cancer Sci 95, 608-613. Herman IM, and Pollard TD (1981) Electron microscopic localization of cytoplasmic myosin with ferritin-labeled antibodies. J Cell Biol 88, 346-351. Hosokawa S, Tagawa T, Niki H, Hirakawa Y, Ito N, Nohga K, and Nagaike K. (2004) Establishment and evaluation of cancer-specific human monoclonal antibody GAH for targeting chemotherapy using immunoliposomes. Hybrid Hybridomics 23, 109-120. Hosokawa S, Tagawa T, Niki H, Hirakawa Y, Nohga K, and Nagaike K (2003) Efficacy of immunoliposomes on cancer models in a cell-surface-antigen-density-dependent manner. Br J Cancer 89, 1545-1551. Ichikawa A, Tachibana H, Kawamoto S, Kamei M, Honjoh T, Hashizume S, and Shirahata S (1997) Cytokeratin 8 and 19 as antigens recognized by adenocarcinoma-reactive human monoclonal antibody AE6F4. Hum Antibodies 8, 195-202. King KM, and Younes A (2001) Rituximab: review and clinical applications focusing on non-Hodgkin's lymphoma. Expert Rev. Anticancer Ther 12, 177-186. Olden K, Willingham M, and Pastan I (1976) Cell surface myosin in cultured fibroblasts. Cell 8, 383-390.

182

Cancer Therapy Vol 3, page 183 Saez CG., Myers JC, Shows TB, and Leinwand LA (1990) Human nonmuscle myosin heavy chain mRNA: generation of diversity through alternative polyadenylylation. Proc Natl Acad Sci USA 87, 1164-1168. Sellers JR (2000) Myosins: a diverse superfamily. Biochimica et Biophysica Acta 1496, 3-22. Toothaker LE, Gonzalez DA, Tung N, Lemons RS, Le Beau MM, Arnaout MA, Clayton LK, and Tenen DG (1991) Cellular myosin heavy chain in human leukocytes: isolation of 5' cDNA clones, characterization of the protein, chromosomal localization, and upregulation during myeloid differentiation. Blood 78, 1826-1833. Willingham MC, Ostlund RE, and Pastan I (1974) Myosin is a component of the cell surface of cultured cells. Proc Natl Acad Sci USA 71, 4144-4148. Yanase K, Smith RM, Puccetti A, Jarett L, and Madaio MP (1997) Receptor-mediated cellular entry of nuclear localizing anti-DNA antibodies via myosin 1. J. Clin Invest 100, 2531.

Yoko Hirakawa

183

Hirakawa et al: Non-muscle myosin heavy chain type A as a tumor antigen

184

Cancer Therapy Vol 3, page 185 Cancer Therapy Vol 3, 185-188, 2005

Radical parametrectomy in the treatment of invasive cervical cancer after simple hysterectomy Research Article

Nadereh Behtash1,*, Haleh Ayatollahi1, Hasanzadeh, Fatemeh Esfehani2

Fatemeh

Ghaemmaghami1,Malihe

Gynecology Oncology, Tehran University of Medical Sciences, Tehran, Iran. Epidemiology, Tehran University of Medical Sciences, Tehran, Iran.

__________________________________________________________________________________ *Correspondence: Nadereh Behtash, Associate Professor, Tehran University of Medical Sciences. Gynecology Oncology Department, Vali-e-Asr Hospital, Keshavarz Blvd., Tehran 14194, Iran. Phone: #98-21-6939320, Fax: #98-21-6937321, E-mail: nadbehtash@yahoo.com Key words: Radical Parametrectomy, Invasive cervical cancer Abbreviations: neoadjuvant chemotherapy, (NACT); radical parametrectomy (RP) Received: 24 December 2004; Revised: 31 January 2005 Accepted: 8 February 2005; electronically published: March 2005

Summary To assess the morbidity and efficacy of radical parametrectomy (RP) following simple hysterectomy in patients with invasive cervical carcinoma. Seven year retrospective chart review identified 5 patients that underwent RP with pelvic and paraaortic lymphadenectomy and upper vaginectomy. Data were collected on demographics, tumor stage, histology and survival. One patient had stage IA lesion, one stage IB1, 2patients had stage IIA, and one with unknown stage. One of these patients had adenocarcinoma. Median age was 41.6 years. The most indication for hysterectomy was abnormal vaginal bleeding (3 out of 5, 60%). Two patients had pelvic node metastases. Surgical margins in all 5 patients were tumor free at the time of RP. Two patients with positive pelvic nodes received adjuvant radiotherapy. Mean follow up time was 48.8 months. Four patients are alive without disease, and one patient who had been node positive, died 12 months after receiving radiation. RP is an acceptable option for patients diagnosed with incidental finding of invasive cervical cancer at the time of simple hysterectomy. Careful selection of RP for patients not having residual tumor, will obviate adjuvant radiotherapy in most cases.

carcinoma as incidental finding in simple hysterectomy specimen (Behtash et al, 2003). Overall survival in cervical carcinoma treated with simple hysterectomy is less than 50% at 5 years (Jones and Jones, 1943; Daniel and Brunschwig, 1961; Barber et al, 1968). Additional therapy in these patients include radiation therapy (Cosbie, 1963; Green Jr and Morse Jr, 1969; Andras et al, 1973; Davy et al, 1977; Papavasiliou et al, 1980; Perkins et al, 1984; Behtash et al, 2003), or additional surgery (Barber et al, 1968; Green Jr and Morse Jr, 1969; Orr et al, 1986; Chapman et al, 1992; Kinney et al, 1992; Behtash et al, 2003). Described in 1961 by Daniel and Brunschwig, RP is a surgical procedure that allows one to complete the evaluation of the tissues of concern, namely upper vagina, parametrium and the regional lymphatics.

I. Introduction The management of early stage cervical carcinoma is primarily surgical in the majority of patients. Invasive cervical carcinoma after simple hysterectomy, can be treated with radiotherapy or reoperation involving a pelvic and/or paraaortic lymphadenectomy, radical Parametrectomy, and upper vaginectomy (Orr et al, 1986; Hopkins et al, 1990; Chapman et al, 1992; Roman et al, 1993; Crane and Schneider, 1999). Since radiation therapy results in loss of ovarian function and greater frequency of sexual dysfunction than operative techniques, RP seems more beneficial option. It can be performed safely in most patients, who have an early stage invasive carcinoma of the cervix with the expectation of an acceptable rate of long term disease free survival (Kinney et al, 1992). Due to inadequate screening and diagnostic work up, we have frequent cases of cervical

185

Behtash et al: Radical parametrectomy for cervical cancer after simple hysterectomy The objective of our study is to evaluate the morbidity and efficacy of RP in patients with cervical carcinoma in their simple hysterectomy specimen.

Chemotherapy treatment consisted of Cisplatinum 20 mg/q 10 days/ for 3 courses, Vincristine 1 mg/q 10 days/ for 3 courses. After radical surgery, both of these patients had positive lymph nodes in pelvis, residual tumor in vaginal specimen with clear margins. They received post operative external beam radiotherapy (6800-7000 cGy). One of these patients is alive without disease after 89 months. But the other one died about 15 months after completing adjuvant radiotherapy with progressive disease. Two patients (stage IA2, IB1) had no residual disease in preoperative and pathologic evaluation following RP. Although one of these two patients, in preoperative colposcopic exam, showed moderate dysplasia in cuff. Both of these patients are alive without disease in 65 months and 23 months follow up. One patient, who underwent subtotal hysterectomy due to abnormal vaginal bleeding, had stage IB2 adenocarcinoma of cervix and received 5400 cGy external radiotherapy before RP. After 6 weeks, she underwent radical cervicectomy plus RP plus upper vaginectomy plus pelvic and paraaortic lymphadenectomy. She had no residual tumor in pathologic specimens, and is alive without disease 48 months after radical surgery. Overall, the 5 year survival for our patients with completed RP is 80% with a median follow up of 48 months. With a median follow up of 48 months (17-89) four patients are still alive without disease (23, 48, 65, and 89 months). One patient died due to progressive disease at 17 months after surgery.

II. Materials and methods A retrospective chart review identified 150 patients with early stage cervical carcinomas (FIGO stage IA-IIA) treated at Vali-e-Asr University Hospital of Tehran University of Medical Sciences, Tehran, Iran from 1997-2003. Five of these patients were evaluated for RP secondary to the diagnosis of invasive cervical cancer in cervical specimen following simple hysterectomy. To be considered eligible for RP patients were required to have a normal pelvic exam before surgery with no evidence of residual disease in the parametrium (stage IA-IIA). RP was performed on 2 months, 4months, 4months, 18 months, and 10 years after simple hysterectomy. Clinicopathologic information including demographics, indication for hysterectomy, tumor stage, histology, nodal status, operative complications, length of stay, recurrence and survival was collected. One patient had subtotal hysterectomy in the first procedure. Follow up data were obtained by review of the medical records or by the patient correspondence.

III. Results Two patients had stage IIA lesions; one patient had stage IB1; one patient IA2 and one stage IB2. Demographic information is listed in Tables 1 and 2. Four patients underwent RP, upper vaginectomy, pelvic and/or paraaortic lymphadenectomy, and the fifth one had an additional cervicectomy due to previous subtotal hysterectomy. Median number of dissected pelvic lymph nodes was 12. We had no major operative and post operative complications. Mean post operative length of stay was 5 days. Two patients had cuff biopsy (large cell nonkeratinizing SCC) in preoperative evaluation. They received 3 courses of neoadjuvant chemotherapy (NACT) before operation (RP).

IV. Discussion Incidental finding of cervical carcinoma is rather frequent following simple hysterectomy for apparently benign diseases. In our series, the most common primary diagnosis was CIN and abnormal uterine bleeding. Based on our previous study, inadequate preoperative (prehysterectomy) evaluation for patients with abnormal Papsmear and vaginal bleeding, were the main reasons of inappropriate management (Behtash et al, 2003). Unfortunately, in our series (Behtash et al, 2003), even patients with biopsy proven SCC of cervix underwent simple hysterectomy, although even adequate preoperative evaluation could not find occult cervical carcinoma. Simple hysterectomy is considered to be adequate surgery only for patients with microinvasion (stage IA1) (Jones and Jones, 1943; Daniel and Brunschwig, 1961; Barber et al, 1968). Additional treatment for more invasive carcinoma finding after simple hysterectomy is radiation therapy with or without chemotherapy or RP with lymphadenectomy. In appropriate candidates, it seems radical reoperation, especially in a young patient, allows ovarian preservation and functional vagina (Orr et al, 1986; Chapman et al, 1992; Kinney et al, 1992). Selection of an eligible patient for RP is critical. Leath III, et al, (2004) showed patients with no clinical evidence of residual at the vaginal apex and parametrium have an excellent overall survival. They had a rather high operative morbidity (30%) including 2 incidental

Table 1. Age Gravidity Para Menarche First intercourse

Mean 41.6 4.75 3.7 12.5 15.75

Range 35-47 1-9 1-6 12-13 12-21

Table 2.

Stage

Pathology Indications simple hysterectomy

for

IA2 IB1 IB2 IIA SCC Adenocarcinoma CIN Abnormal uterine bleeding

Number of patients 1 1 1 2 4 1 2 3

186

Cancer Therapy Vol 3, page 187 cystectomy and massive transfusion in 4 patients. In other series, there are rate of morbidity following RP (Orr et al, 1986; Chapman et al, 1992; Kinney et al, 1992). We had no massive transfusion, no major surgical or postoperative morbidity in these five patients. In a study Leath III et al, (2004), the length of hospital stay was 3.6 days, which is much shorter than our series, although different insurance problems in two countries may influence this point. Postoperative adjuvant radiotherapy may increase morbidity dramatically, which has been reported in radical hysterectomy (Martimbeau et al, 1978; Barter et al, 1989; Fiorica et al, 1990). We planned NACT before radical surgery in two patients with disease in central culf, to minimize the likelihood of postoperative radiotherapy. Due to positive pelvic node and residual tumor in vaginal specimen (with clear margin), they received adjuvant radiotherapy. As Orr et al, (1986) noted the decision for planning radiation can only be made after surgery. Four largest series that evaluated RP in the management of cervical cancer included 18-27 patients (RP (Orr et al, 1986; Chapman et al, 1992; Kinney et al, 1992; Leath III et al, 2004). Seventeen patients out of 23 in Orr series (Orr et al, 1986) had negative RP specimen and all were with no evidence of recurrence with a modest 36 month follow up. With a median follow up of 72 months, Chapman et al (1992) reported 89% five year survival. Their study also confirmed that extended survival can be obtained in patients with a negative RP specimen. Furthermore, the absence of long term morbidities, such as urinary fistula, was encouraging. Kinney et al, (1992) reported 82% survival with a median follow up of 8.4 years. In their series, all the recurrences occurred within 4 years. The incidence of positive nodes in these four large series was 10% (9/93), while the incidence of positive vaginal margin or positive parametrium is 7% (7/93). Eighty percent of patients were able to have a completed RP without evidence of residual disease. Cosbie, (1963) reported 116 patients with cervical cancer over 3 decades that received radiotherapy following simple hysterectomy. In spite of 16 patients with microinvasive disease, their 5 year survival rate was only 71%. Green and Morse, (1969) evaluated outcome of 84 patients that received either surgery or radiation following extrafacial or subtotal hysterectomy in cervical cancer. Five year overall survival in radiation group was 30% while 67% in radical operation patients. Importantly, the authors demonstrated that a delay in further therapy of greater than 4 months was associated with an overall 5 year survival of 18% as compared to 42% when patients were treated within 4 months (Andras et al, 1973; Davy et al, 1977). Survival data from the University of Virginia utilizing radiation therapy were 93% at 5 years (Crane and Schneider, 1999). However, 12/18 patients suffered either grade 1 or 2 acute toxicities and 2 had long term complications consisting of chronic diarrhea and small bowel obstruction

that necessitated surgical exploration. Survival statistics in these series may be influenced by inclusion of patients with higher risk factors such as large diameter tumors, tumors at the cervical margin or involving the parametrium and/or vagina and nodal metastasis. Although radiotherapy is quite effective for patientsâ&#x20AC;&#x2122; early invasive carcinoma of cervix after simple hysterectomy, its serious potential morbidity and costs should be considered. In our country, long waiting list for radiotherapy, frequent cases of inappropriately managed, common incidence of cervical carcinoma are additional reasons that make RP as an acceptable and safe alternative for carefully selected patients. To our knowledge this is the first report of radical parametrectomy in our country.

References Andras EJ, Fletcher GH, Rutledge F (1973) Radiotherapy of carcinoma of the cervix following simple hysterectomy. Am J Obstet Gynecol 115, 647-55. Barber HR, Pece GV, Brunschwig A (1968) Operative management of patients previously operated upon for a benign lesion with cervical cancer as surprise finding. Am J Obstet Gynecol 101, 959-65. Barter JF, Soong SJ, Shingleton HM, Hatch KD, Orr Jr JW (1989) Complications of combined radical hysterectomypostoperative radiation therapy in women with early stage cervical cancer. Gynecol Oncol 32, 292-6. Behtash N, Mousavi A, Mohit M, Modares M, Khanafshar N, Hanjani P (2003) Simple hysterectomy in the presence of invasive cervical cancer in Iran. Int J Gynecol Cancer 13, 177-81. Chapman JA, Mannel RS, Disaia PJ, Walker JL, Berman ML (1992) Surgical treatment of unexpected invasive cervical cancer found at total hysterectomy. Obstet Gynecol 80, 9314. Cosbie W (1963) Radiotherapy following hysterectomy performed for or in the presence of cancer of the cervix. Am J Obstet Gynecol 85, 332-7. Crane CH, Schneider BF (1999) Occult carcinoma discovered after simple hysterectomy treated with postoperative radiotherapy. Int J Radiot Oncolo Biol Phys 43, 1049-53. Daniel W, Brunschwig A (1961) The management of recurrent carcinoma of cervix following simple total hysterectomy. Cancer 14, 582-6. Davy M, Bentzen H, Jahren R (1977) Simple hysterectomy in the presence of invasive cervical cancer. Acta Obstet Gynecol Scand 56, 105-8. Fiorica JV, Roberts WS, Greeberg H, Hoffman MS, Lapolla JP, Cavangh D (1990) Morbidity and survival patterns in patients after radical hysterectomy and postoperative adjuvant pelvic radiotherapy. Gynecol Oncol 36, 343-7. Green TH Jr, Morse WJ Jr (1969) Management of invasive cervical cancer following inadvertent simple hysterectomy. Obstet Gynecol 33, 763-9. Hopkins MP, Peters WAIII, Anderson W, Morley GW (1990) Invasive cervical cancer treated initially by standard hysterectomy. Gynecol Oncol 36, 7-12. Jones H, Jones G (1943) Panhysterectomy versus irradiation in early cancer of cervix. JAMA 122, 930-2. Kinney WK, Egorshin EU, Ballard DJ, Podratz KC (1992) Long term survival and sequelae after surgical management of invasive cervical carcinoma diagnosed at the time of simple hysterectomy. Gynecol Oncol 44, 24-7.

187

Behtash et al: Radical parametrectomy for cervical cancer after simple hysterectomy Leath III CA, Straughn Jr JM, Bhoola Snehal M, Patridge EE et al (2004) The role of radical Parametrectomy in the treatment of occult cervical carcinoma after extrafascial hysterectomy. Gynecol Oncol 92, 215-19. Martimbeau PW, kjorstad KE, Kolstad P (1978) Stage IB carcinoma of the cervix, the Norwegian Radium Hospital, 1968-1970, results of treatment and major complications, Lymphedema. Am J Obstet Gynecol 131, 389-94. Orr JW, Ball GC, Soong SJ, Hatch KD, Partridge EE, Austin JM (1986) Surgical treatment of women found to have invasive cervix cancer at the time of total hysterectomy. Obstet Gynecol 68, 353-6.

Papavasiliou C, Yiogarakis D, Pappaskeramopoulos A (1980) Treatment of cervical carcinoma by total hysterectomy and post operative external irradiation. Int J Radiot Oncol biol Phys 6, 871-4. Perkins PL, Chu AM, Jose B, Achino E, Tobin DA (1984) Posthysterectomy mega voltage irradiation in the treatment of cervical carcinoma. Gynecol Oncol 17, 340-8. Roman LD, Morris M, Mitchell MF, Eifel PJ, Burke TW, Atkinson EN (1993) Prognostic factor for patients undergoing simple hysterectomy in the presence of invasive cancer of cervix. Gynecol Oncol 50, 179-83.

188

Cancer Therapy Vol 3, page 189 Cancer Therapy Vol 3, 189-192, 2005

A summary on lamivudine primary prophylaxis of hepatitis B virus reactivation in chronic HBsAg carriers with non Hodgkin’s lymphoma treated with chemotherapy Research Article

Viroj Wiwanitkit Department of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok Thailand 10330

Summary Several hepatitis viruses have been mentioned as a risk factor for development of Hodgkin’s lymphoma. In addition, the reactivation of hepatitis in Hodgkin’s lymph patients co-infected with hepatitis virus treated with chemotherapy is reported. It is noted that hepatitis B virus (HBV) reactivation of various degrees of severity. Lamivudine , a nucleoside analogue that can directly suppress HBV replication, is tried as a prophylaxis and treatment of the HBV reactivation. Here, the author summarized the recent report on using lamivudine primary prophylaxis of hepatitis B virus reactivation in chronic HbsAg carriers with non Hodgkin’s lymphoma treated with chemotherapy. A literature review to find the previous reports about using lamivudine primary prophylaxis of hepatitis B virus reactivation in chronic HbsAg carriers with non Hodgkin’s lymphoma treated with chemotherapy was performed. According to this study, there are 4 recruited reports covering 31 cases of using lamivudine primary prophylaxis of hepatitis B virus reactivation in chronic HBsAg carriers with non Hodgkin’s lymphoma treated with chemotherapy. Of these cases, 10 cases were prescribed for lamivudine primary prophylaxis and the results showed no reactivation of fulminant hepatitis while in the other 21 cases without prophylaxis the reactivation were noted in 15 cases. Therefore, the preventive effect of having lamivudine primary prophylaxis is 100 % (odds ratio is uncountable high). Here, the author concluded that lamivudine prophylaxis might be effective, when chemotherapy is given to an HBsAg-positive patient with non-Hodgkin's lymphoma. However, before further implication, a larger case-control study is required for making a final conclusion. Hodgkin’s lymph patients co-infected with hepatitis virus treated with chemotherapy is reported (Rossi et al, 2001). Rossi et al noted that hepatitis B virus (HBV) reactivation of various degrees of severity, including fulminant hepatitis, might develop in 20-50% of hepatitis B virus surface antigen (HbsAg)-positive patients undergoing immunosuppressive or cytostatic treatment (Rossi et al, 2001). Management of the reactivation of HBV becomes a new insight for the present therapy of any cases with Hodgkin’s lymphoma. Lamivudine, a nucleoside analogue that can directly suppress HBV replication, is tried as a prophylaxis and treatment of the HBV reactivation. Here, the author summarized the recent report on using lamivudine primary prophylaxis of

I. Introduction Keresztes et al, (2003) said that numerous observations implied that the pathogenesis of malignant lymphomas is multifactorial and that viruses probably play an important etiologic role (Keresztes et al, 2003). Lymphoma is a common hematological malignancy. Fisher and Fisher said that several pathogens have been linked to the risk of lymphoma, including Epstein-Barr virus, human immunodeficiency virus, hepatitis virus, and simian virus 40 (Fisher and Fisher, 2004). Several hepatitis viruses have been mentioned as a risk factor for development of Hodgkin’s lymphoma (Chow, 1993; Takada, 1999). In addition, the reactivation of hepatitis in

189

Wiwanitkit: Lamivudine primary prophylaxis of HBV reactivation in chronic HbsAg Table 1. Previous reports on using lamivudine primary prophylaxis of hepatitis B virus reactivation in chronic HbsAg carriers with non Hodgkin’s lymphoma treated with chemotherapy Reports Tsutsumi et al, 2004a Silvestri et al, 2000 Nakagawa et al, 2002

Number of patients 4 4 2

Dosage lamivudine regimen 100 mg/day 100 mg/day 100 mg/day

Number of patients with reactivation/ number of patients receive prophylaxis 0/1 0/4 0/2

* Indeed, there is another additional report (Shibolet et al, 2002;) on using lamivudine primary prophylaxis of hepatitis B virus reactivation in chronic HBsAg carriers with non Hodgkin’s lymphoma treated with chemotherapy, however, there is no complete data on the outcome specifically to non Hodgkin’s lymphoma in this study.

hepatitis B virus reactivation in chronic HbsAg carriers with non Hodgkin’s lymphoma treated with chemotherapy.

with the episomal form of HBV. This can also be a problem in chemotherapy. Prophylaxis of lamivudine treatment for hepatitis B patients undergoing chemotherapy is therefore recommended. Lau et al (2003) noted that preemptive lamivudine therapy more effectively prevented the development of hepatitis than deferred lamivudine treatment in HBsAg-positive cancerous patients undergoing chemotherapy. Chemotherapy administration to patients with lymphoproliferative diseases and lymphoma that are carriers of hepatitis B can be complicated by reactivation of Hepatitis B and this may lead to morbidity and mortality due to liver failure (Shtalrid et al, 2001). Shtalrid et al noted that lamivudine inhibited replication of HBV and probably ameliorated the severity of already reactivated hepatitis (Shtalrid et al, 2001). In 1999, Maguire et al said that treatment with lamivudine resulted in rapid loss of hepatitis B virus-DNA, resolution of hepatitis and clinical recovery (Maguire et al, 1999). After administration of lamivudine, the patients gradually recovered from liver failure (Tsutsumi et al, 2004b). Therefore, the lamivudine is recommended for treatment of HBV reactivation in chronic HBsAg carriers with Hodgkin’s lymphoma treated with chemotherapy. Presently, there is a new attempt to use lamivudine for primary prophylaxis of HBV reactivation in chronic HBsAg carriers with lymphoma treated with chemotherapy. Indeed, there are many reports on the use of lamivudine for treatment of HBV reactivation in chronic HBsAg carriers with lymphoma treated with chemotherapy but there are only a few reports on the use of lamivudine for primary prophylaxis purpose. In addition, there is no previous report on the preventive property of this regimen. A metanalysis to assess the preventive property is warranted. Here the author performed a retrospective study to summarize the previous reports on use lamivudine for primary prophylaxis of HBV reactivation in chronic HBsAg carriers with non Hodgkin’s lymphoma treated with chemotherapy. According to this study, there are some recent studies on this topic. According to the summative analysis, the effectiveness or prophylaxis rate is very high. In addition, the preventive odds ratio is very high (infinity). Of interest, this is the first report proving the good preventive property of the regimen by case-control analysis. Here, the author concluded that lamivudine prophylaxis might be effective, when chemotherapy is given to an HBsAg-positive patient with non-Hodgkin's

II. Materials and methods A literature review to find the previous reports about using lamivudine primary prophylaxis of hepatitis B virus reactivation in chronic HBsAg carriers with non Hodgkin’s lymphoma treated with chemotherapy was performed. The author used the electronic search engine PubMed in searching for the literatures. Any reports that did not present complete details or contain English details were excluded. The available reports were collected and extracted for the clinical data. Those primary data were used for further metanalysis study. Concerning the metanalysis study, the summative descriptive analysis was performed where appropriate. The SPSS 11.0 for Windows was used for statistical analysis in this study.

III. Results According to this study, there are 4 recruited reports (Silvestri et al, 2000; Nakagawa et al, 2002; Persico et al, 2000; Tsutsumi et al, 2004a) covering 31 cases of using lamivudine primary prophylaxis of hepatitis B virus reactivation in chronic HBsAg carriers with non Hodgkin’s lymphoma treated with chemotherapy. Of these cases, 10 cases were prescribed for lamivudine primary prophylaxis and the results showed no reactivation of fulminant hepatitis while in the other 21 cases without prophylaxis the reactivation were noted in 15 cases. Therefore, the preventive effect of having lamivudine primary prophylaxis is 100 % (odds ratio is uncountable high).

IV. Discussion HBV reactivation has been reported in cancer patients following administration of chemotherapy or immunosuppressive therapy and may result in liver damage of varying degrees of severity (Saif et al, 2001). Vento et al (2002) said that, in carriers of HBV, liver damage due to reactivation of viral replication could occur after withdrawal of immunosuppressive drugs. They also noted that there were difficulties in drug prevention and treatment for the reactivation (Vento et al, 2002). In addition, latent HBV infection in healthy individuals with antibodies to hepatitis B core antigen (anti-HBc) can be seen (Murasawa et al, 2000). Murasawa et al (2000) indicated that the majority of healthy individuals positive for anti-HBc, which had been assumed to denote a past history of transient HBV infection, were latently infected 190

Cancer Therapy Vol 3, page 191 of hepatitis B following chemotherapy. Gastroenterol Hepatol 14, 801-3. Murasawa H, Uemoto S, Hijikata M, Ueda Y, Tanaka K, Shimotohno K, Chiba T. (2000) Latent hepatitis B virus infection in healthy individuals with antibodies to hepatitis B core antigen. Hepatology 31, 488-495. Nakagawa M, Simizu Y, Suemura M, Sato B (2002) Successful long-term control with lamivudine against reactivated hepatitis B infection following intensive chemotherapy and autologous peripheral blood stem cell transplantation in nonHodgkin's lymphoma, experience of 2 cases. Am J Hematol 70, 60-3. Pelizzari AM, , Motta M, Cariani E, Turconi P, Borlenghi E, Rossi G (2004) Frequency of hepatitis B virus mutant in asymptomatic hepatitis B virus carriers receiving prophylactic lamivudine during chemotherapy for hematologic malignancies. Hematology J 5, 325-328. Persico M, De Marino F, Russo GDG, Severino A, Palmentieri B, Picardi M, Morante A, Rotoli B, Torella R, De Renzo A (2002) Efficacy of lamivudine to prevent hepatitis reactivation in hepatitis B virus-infected patients treated for non-Hodgkin lymphoma. Blood 99, 724-725. Rossi G, Pelizzari A, Motta M, Puoti M (2001) Primary prophylaxis with lamivudine of hepatitis B virus reactivation in chronic HbsAg carriers with lymphoid malignancies treated with chemotherapy. Br J Haematol 115, 58-62. Saif MW, Little RF, Hamilton JM, Allegra CJ, Wilson WH (2001) Reactivation of chronic hepatitis B infection following intensive chemotherapy and successful treatment with lamivudine, a case report and review of the literature. Ann Oncol 12, 123-9. Shtalrid M, Haran M, Klepfish A, Lurie Y, Malnick S (2001) Effective treatment with Lamivudine of patients with reactivation of hepatitis B following chemotherapy administration. Harefuah 140, 1159-62. Shibolet O, Ilan Y, Gillis S, Hubert A, Shouval D, Safadi R. (2002) Lamivudine therapy for prevention of immunosuppressive-induced hepatitis B virus reactivation in hepatitis B surface antigen carriers. Blood 100, 391-396. Silvestri F, Ermacora A, Sperotto A, Patriarca F, Zaja F, Damiani D, Fanin R, Baccarani M (2000) Lamivudine allows completion of chemotherapy in lymphoma patients with hepatitis B reactivation. Br J Haematol 108, 394-6. Takada K (1999) Virus-associated malignancies. Ryoikibetsu Shokogun Shirizu (25 Pt 3), 421-4. Tsutsumi Y, Kawamura T, Saitoh S, Yamada M, Obara S, Miura T, Kanamori H, Tanaka J, Asaka M, Imamura M, Masauzi N (2004a) Hepatitis B virus reactivation in a case of nonHodgkin's lymphoma treated with chemotherapy and rituximab, necessity of prophylaxis for hepatitis B virus reactivation in rituximab therapy. Leuk Lymphoma 45, 6279. Tsutsumi Y, Tanaka J, Kawamura T, Miura T, Kanamori H, Obara S, Asaka M, Imamura M, Masauzi N ( 2004b) Possible efficacy of lamivudine treatment to prevent hepatitis B virus reactivation due to rituximab therapy in a patient with nonHodgkin's lymphoma. Ann Hematol 83, 58-60. Vento S, Cainelli F, Longhi MS (2002) Reactivation of replication of hepatitis B and C viruses afterimmunosuppressive therapy: an unresolved issue. Lancet Oncol 3, 333-340.

lymphoma. However, before further implication, a larger case-control study is required for making a final conclusion. In addition, the problems of the prophylaxis of lamivudine treatment for hepatitis B patients must be discussed. One is resistance to lamivudine, and the other is the treatment duration of the prophylactic administration of lamivudine. Lok et al, (2004) recommended that lamivudine prophylaxis be continued for six months after completion of chemotherapy or immunosuppressive therapy. On the other hand, several durations of the administration of lamivudine prophylaxis, which reportedly delayed hepatitis B reactivation, were observed after lamivudine prophylaxis treatments were discontinued one to seven months after the end of chemotherapy with rituximab (Dai et al, 2004; Pelizzari et al, 2004). Dai et al, (2004) noted that delayed HBV reactivation could occur in lymphoma patients receiving R+CHOP after withdrawal of preemptive lamivudine. They noted that more protracted lamivudine therapy may be an alternative to close monitoring following chemotherapy, and further studies were needed to define optimal duration of lamivudine therapy (Dai et al, 2004). Pelizzari et al (2004) noted that among HBV carriers treated with chemotherapy for haematologic malignancies, the emergence of HBV YMMD mutant occurred in 3.1% of prophylactic lamivudine courses and was of little clinical relevance. Treatment duration is mentioned for its association with the resistance of lamivudine (Lok AS et al, 2001; Lok ASF et al, 2001). This caution should also be bewared.

References Chow WT (1993) Cancer and viruses. Ann Acad Med Singapore 22, 163-9. Dai MS, Chao TY, Kao WY, Shyu RY, Liu TM (2004) Delayed hepatitis B virus reactivation after cessation of preemptive lamivudine in lymphoma patients treated with rituximab plus CHOP. Ann Hematol 83, 769-774. Fisher SG, Fisher RI (2004) The epidemiology of Hodgkin's lymphoma. Oncogene 23, 6524-34. Keresztes K, Takacs M, Horanyi M, Miltenyi Z, Illes A (2003) HCV and HGV infection in Hodgkin's disease. Pathol Oncol Res 9, 222-5. Lau GK, Yiu HH, Fong DY, Cheng HC, Au WY, Lai LS, Cheung M, Zhang HY, Lie A, Ngan R, Liang R (2003) Early is superior to deferred preemptive lamivudine therapy for hepatitis B patients undergoing chemotherapy. Gastroenterology 125, 1742-1749. Lok AS, Heathcote EJ, Hoofnagle JH (2001) Management of hepatitis B: 2000--summary of a workshop. Gastroenterology 120, 1828-1853. Lok ASF, McMahon BJ (2001) Chronic hepatitis B. Hepatology 34, 1225-1241. Lok ASF, McMahon BJ (2004) Chronic hepatitis B: update of recommendations. Hepatology 39, 857-861. Maguire CM, Crawford DH, Hourigan LF, Clouston AD, Walpole ET, Powell EE (1999) Case report, lamivudine therapy for submassive hepatic necrosis due to reactivation

191

Wiwanitkit: Lamivudine primary prophylaxis of HBV reactivation in chronic HbsAg

192

Cancer Therapy Vol 3, page 193 Cancer Therapy Vol 3, 193-200, 2005

Meat consumption and risk of colorectal cancer: a case-control study in Uruguay Research Article

Hugo Deneo-Pellegrini 1, Paolo Boffetta2, Eduardo De Stefani1,*, Alvaro L. Ronco3, Pelayo Correa4 and María Mendilaharsu1 1

Departamento de Patología, Instituto Nacional de Oncología, Montevideo, Uruguay. Unit of Environmental Cancer Epidemiology, International Agency for Research on Cancer, Lyon, France. 3 División de Epidemiología, Instituto de Radiología y Centro de Lucha contra el Cáncer, Hospital Pereira Rossell, Montevideo, Uruguay. 4 Department of Pathology, Louisiana State University Health Sciences, New Orleans, Louisiana, United States. 2

__________________________________________________________________________________ *Correspondence: Dr. Eduardo De Stefani, Avenida Brasil 3080 dep. 402, Montevideo, Uruguay.; Tel.: (598) 2 708 23 14; E-Mail: estefani@adinet.com.uy Key words: Meat consumption, colorectal cancer, fried meat, barbecued meat, heterocyclic amines Abbreviations: Age-standardized incidence rates, (ASIR); food frequency questionnaire, (FFQ); heterocyclic amines, (HCA); odds ratios, (OR’s); ninety five percent intervals (95 % CI).

Supported by a grant from the International Agency for Research on Cancer, Lyon, France Received: 29 March 2005; Accepted: 06 April 2005; electronically published: April 2005

Summary In the time period 1996-2003 a case-control study on the relation between meat consumption and colorectal cancer risk was conducted in Montevideo, Uruguay. The study included 556 newly diagnosed cases and 1112 hospitalized controls. Red meat was directly associated with a significant risk of colorectal cancer (OR for men 3.1, 95 % CI 1.85.3 and OR for women 2.0, 95 % CI 1.1-3.6). Also fried meat was positively associated with colon cancer in men (OR 2.2, 95 % CI 1.3-3.5), whereas barbecued meat displayed an elevated risk for women with rectal cancer (OR 2.3, 95 % CI 1.2-4.4). Finally, estimated intake of total heterocyclic amines was consistently associated with colorectal carcinoma (OR 2.0, 95 % CI 1.4-2.8, p-value for trend=0.0001). According to these results, red meat consumption (and estimated exposure to total HCAs) appears to be a strong risk factors for colorectal cancer. plant foods (Comisión Honoraria de Lucha contra el Cáncer, 1993; Matos and Brandani, 2002). This dietary pattern is probably responsible for the high rates observed in Uruguay. Thus, Uruguay is a rather convenient country to perform observational studies. Most case-control studies reported an increased risk of colorectal cancer associated with high consumption of meat, particularly red meat (Manousos et al, 1983; Marchand et al, 1997; La Vecchia et al, 1988; Tuyns et al, 1988; Benito et al, 1990; Gerhardsson de Verdier et al, 1991). Nevertheless, some prospective studies failed to confirm this effect (Phillips and Snowdon, 1985; Bostick et al, 1994; Goldbohm et al, 1994; Knekt et al, 1994). It has been suggested that recall bias could be responsible for this discrepancy between retrospective and prospective studies (Goldbohm et al, 1994). On the other hand, Potter has suggested that case-control studies have the advantage

I. Introduction Colorectal cancer is the second malignancy in frequency among Uruguayan population (Parkin et al, 2002). Age-standardized incidence rates (ASIR) are of 36.1 per 100,000 men and 25.7 per 100,000 women (Parkin et al, 1997). Moreover, in international comparisons among Latin American registries, Uruguayan rates occupy the first place, both in men and women (Parkin et al, 2002). According to several reviews (Potter, 1996; World Cancer Research Fund, 1997), diet is probably the major risk factor in colorectal cancer. In particular, high consumption of red meat and fat and low intake of vegetables and fruits are strongly associated with high risk of colorectal cancer (Potter, 1996; World Cancer Research Fund, 1997). Uruguayan population is characterized by high consumption of red meat and low consumption of 193

Deneo-Pellegrini et al: Meat consumption and risk of colorectal cancer eggs (boiled eggs, fried eggs, mayonnaise), desserts (milk with sugar, rice pudding, custard, marmalade, cake), grains (white rice, maize, polenta, pasta, white bread), high-fat foods (red meat, processed meat, dairy foods, eggs, desserts), raw vegetables (carrot, tomato, lettuce, onion), cooked vegetables (garlic, swiss chard, spinach, potato, sweet potato, beetroot, winter squash, cabbage, cauliflower, zucchini, red pepper), total vegetables (raw vegetables, cooked vegetables), citrus fruits (orange, tangerine), other fruits (apple, pear, grape, peach, banana, plum, fig, fruit cocktail), total fruits (citrus fruits, other fruits), total vegetables and fruits (total vegetables, total fruits), all tubers (potato, sweet potato), legumes (chickpea, kidney bean, lentil). Also red meat was analyzed by the cooking method: fried, barbecued and boiled (stewed) red meat. Finally, estimation of heterocyclic amines exposure was calculated according to the method of Sinha and Rothman (1997).

over prospective ones of a larger age range (Potter, 2000). This age range allowed both genetically and nongenetically participants in retrospective studies (Potter, 2000). Taking into account this discrepancy and the dietary pattern observed in Uruguay, we decided to conduct a case-control study on the relationship between meat consumption and colorectal cancer risk in this high-risk area.

II. Material and methods A. Selection of cases In the time period 1996-2003, all newly diagnosed and microscopically confirmed adenocarcinomas of the colon and rectum were considered eligible for this study. Five thousand and sixty five patients so diagnosed were identified in the four major hospitals of Montevideo, Uruguay. Nine patients refused the interview, leaving a final total of 556 cases of colorectal carcinomas (response rate 98.4 %). Cases were distributed by sex as follows: men (330, 59.3 %) and women (226, 40.7 %). Concerning subsite, 69 patients presented lesions of the right colon (12.4 %), 222 showed tumors of the left colon (39.9 %) and 265 patients presented carcinomas of the rectum (47.7 %).

D. Statistical analysis Relative risks of colorectal cancer, approximated by the odds ratios (OR’s) and its corresponding ninety five per cent confidence intervals (95 % CI), were estimated by multiple unconditional logistic regression (Breslow and Day, 1980). Comparisons between colonic and rectal carcinomas were carried out by polytomous (multinomial) logistic regression (Hosmer and and Lemeshow, 1989). The basic model included terms for age (categorical, 6 strata), sex (ordinal), residence (ordinal), urban/rural status (ordinal), education (categorical, 3 strata), body mass index (categorical, 4 strata), tobacco smoking (categorical, 5 strata), alcohol drinking (categorical, 5 strata), total energy intake (continuous), total vegetables and fruits (categorical, 4 strata) and total fat intake (categorical). Tests for trend were performed after entering categorical variables as ordinal (continuous) in the same model. Departure from the multiplicative model was determined by assessing the likelihood ratio test statistic. An alpha of 0.05 was used as the indicator of statistical significance and, accordingly 95 % CI’s were reported. All p-values were derived from two-sided statistical tests. All the calculations were done with the STATA programme (1999).

B. Selection of controls In the same time period and in the same hospitals, 1375 patients hospitalized for non-neoplastic diseases were considered eligible for the study. These patients presented diseases not related with tobacco smoking, alcohol drinking and without recent changes in their diets. Nineteen patients refused the interview, leaving a final number of 1356 (response rate 98.6 %). From this pool of potential controls, 1112 patients were frequency matched to the cases on age (in ten-years intervals), sex and residence (Montevideo, other counties). These patients presented the following diseases: eye disorders (317 patients, 28.5 %), abdominal hernia (235, 21.1 %), skin diseases (95, 8.5 %), acute appendicitis (75, 6.7 %), varicose veins (82, 7.4 %), urinary stones (62, 5.6 %), injuries (81, 7.3 %), blood disorders (55, 4.9 %), hydatid cyst (57, 5.1 %), fractures (36, 3.2 %) and bone diseases (17, 1.5 %).

III. Results The distribution of cases and controls by sociodemographic variables and selected risk factors is shown in Table 1. As expected from the frequency matched design, age, sex and residence were rather similar. Also the percentage of cases living in rural areas was similar to the percentage of rural controls. Education and income were similar in both series of patients. The proportion of cases with family history of colon cancer was significantly higher compared with controls (OR 4.7, 95 % CI 2.1-10.6). The estimates were similar for each tumor subsite (results not shown). Body mass index was similar in both series of patients and total energy intake was slightly higher among controls compared with cases, but the differences were not significant. Finally, cases and controls smoked and drank alcohol in similar amounts. Odds ratios of colorectal cancer for meat consumption in men are shown in Table 2. Beef consumption was positively associated with colon cancer risk (OR 3.4, 95 % CI 1.8-6.4). Similar estimates were observed for rectal cancer and for both tumor sites together (p-value for trend <0.0001). On the contrary, lamb intake was not associated with colorectal cancer risk. Red meat (beef plus lamb) was significantly associated with increased risk of colorectal adenocarcinoma (OR 3.1,

C. Questionnaire All participants were interviewed face-to-face in the hospitals by two trained social workers. They were administered a questionnaire which included the following sections: sociodemographics, a complete occupational history based in jobs and their duration, self-reported height and weight five years before the date of the interview, family history of cancer in firstdegree relatives, a complete tobacco smoking history, a complete alcohol drinking history, a complete maté drinking history (maté is the folk name of a herbal tea which is drunk every hot), menstrual and reproductive events and a food frequency questionnaire (FFQ) on 64 food items.This FFQ allowed the calculation of total energy intake and is considered as representative of the usual Uruguayan diet. Although it was not validated, it was tested for reproducibility with good results.

D. Definition of food groups The following food groups were created: red meat (beef, lamb), white meat (poultry, fish), processed meat (bacon, sausage, blood pudding, mortadella, salami, saucisson, hot dog, ham, salted meat), total meat (red meat, white meat, processed meat, liver), dairy foods (cheese, butter, whole milk, ice cream),

194

Cancer Therapy Vol 3, page 195 95 % CI 1.8-5.3, p-value for trend <0.0001). Poultry consumption was directly associated with rectal cancer risk, but the trend was only marginally significant (OR 1.5, 0.9-2.3, p-value for trend=0.07). Both colon cancer and colorectal cancer were not associated with poultry

intake. Fish consumption, an uncommon item in the Uruguayan diet, was not associated with colorectal cancer risk. The same was observed for white meat consumption (poultry plus fish). Unexpectedly processed meat displayed an inverse association with colorectal

Table 1. Distribution of cases and controls by sociodemographic variables and selected risk factors. Cases Variable Age (in years)

Sex Residence Urban/rural status Education (years)

Income (US dollars)

Family history of colon cancer Body mass index

Total calories

Cigarettes per day

Alcohol drinking

Nยบ patients

Controls

Category 30-39 40-49 50-59 60-69 70-79 80-89 Males Females Montevideo Other counties Urban Rural 0-2 3-5 6+

Nยบ 10 47 92 179 187 41 330 226 285 271 461 95 141 232 183

% 1.8 8.4 16.5 32.2 33.6 7.4 59.4 40.6 51.3 48.7 82.9 17.1 25.4 41.7 32.9

Nยบ 20 94 185 358 374 81 660 452 565 547 903 209 307 386 419

% 1.8 8.4 16.6 32.2 33.6 7.3 59.4 40.6 50.8 49.2 81.2 18.8 27.6 34.7 37.7

<=140 141+ Missing

220 228 108

39.6 41.0 19.4

449 442 221

40.4 39.7 19.9

No Yes <=23.0 23.1-25.3 25.4-27.9 28.0+ <=1857 1858-2283 2284-2688 2689+ Never smokers 1-9 10-19 20-29 30+ Never drinkers 1-60 61-120 121-240 241+

517 39 141 142 137 136 124 144 127 167 124 30 38 59 55 163 65 37 30 11 556

93.0 7.0 25.4 25.5 24.6 24.5 22.3 25.9 22.8 29.0 40.5 9.8 12.4 19.3 18.0 53.3 21.2 12.1 9.8 3.6 100.0

1090 22 278 288 269 277 278 278 278 278 251 56 108 92 81 319 110 71 51 37 1112

98.0 2.0 25.0 25.9 24.2 24.9 25.0 25.0 25.0 25.0 42.7 9.5 18.4 15.6 13.8 54.2 18.7 12.1 8.7 6.3 100.0

195

Deneo-Pellegrini et al: Meat consumption and risk of colorectal cancer Table 2. Odds ratios of colorectal cancer for meat consumption in men1.

Meat variable Colon/Rectum (cutpoints)2 /Controls3 Beef 24/34/199 208 51/61/212 365 76/84/249 p-value trend Lamb 54/59/201 0 46/46/213 12 51/74/246 p-value trend Red meat 28/33/182 260 52/63/220 377 71/83/258 p-value trend Poultry 54/58/262 24 63/66/204 52 34/55/194 p-value trend Fish 50/56/254 12 57/67/211 52 44/56/195 p-value trend White meat 58/65/263 52 53/64/203 104 40/50/194 p-value trend Processed meat 50/62/199 70 51/56/219 182 50/61/242 p-value trend Total meat 34/48/197 481 51/48/218 682 66/83/245 p-value trend

OR 1.0 2.1 3.4 0.0001 1.0 0.8 0.9 0.59 1.0 2.0 3.1 0.001 1.0 1.5 0.8 0.60 1.0 1.2 1.0 0.96 1.0 1.1 0.9 0.71 1.0 0.8 0.7 0.13 1.0 1.4 1.7 0.10

Colon 95 % CI

OR 1.0 1.8 2.6 0.001 1.0 0.7 0.9 0.94 1.0 2.1 3.1 0.001 1.0 1.5 1.5 0.07 1.0 1.4 1.3 0.28 1.0 1.3 1.2 0.31 1.0 0.8 0.7 0.16 1.0 0.9 1.5 0.07

1.2-3.8 1.5-4.5

0.5-1.3 0.5-1.4

1.1-3.6 1.6-6.2

0.9-2.2 0.5-1.3

0.8-1.9 0.6-1.6

0.7-1.7 0.5-1.4

0.5-1.2 0.4-1.1

0.8-2.4 0.9-3.0

Rectum 95 % CI

1.3-2.9 1.9-4.6

0.5-1.2 0.6-1.5

1.2-3.7 1.6-6.0

1.0-2.3 0.9-2.3

0.9-2.2 0.8-1.9

0.9-2.0 0.8-1.9

0.5-1.2 0.5-1.1

0.5-1.5 0.9-2.6

Both sites OR 95 % CI 1.0 1.9 2.9 <0.0001 1.0 0.8 0.9 0.52 1.0 2.0 3.1 <0.0001 1.0 1.5 1.1 0.35 1.0 1.3 1.1 0.44 1.0 1.2 1.1 0.63 1.0 0.8 0.7 0.06 1.0 1.1 1.6 0.03

1.3-2.9 1.9-4.6

0.5-1.1 0.7-1.3

1.3-3.2 1.8-5.3

1.1-2.1 0.8-1.6

0.9-1.9 0.8-1.6

0.9-1.7 0.7-1.5

0.6-1.1 0.5-1.0

0.7-1.7 1.0-2.4

Adjusted for age, residence, urban/rural status, education, family history of colon cancer in first-degree relatives, body mass index, tobacco smoking, alcohol drinking, total energy intake, total fat and total vegetables and fruits. 2 Cut-off points in servings per year. 3 Number of cases of colon, rectum and number of controls.

adenocarcinoma, which was marginally significant (pvalue for trend=0.06). Finally, total meat consumption displayed a moderate increase in risk of colorectal cancer (OR 1.6, 95 % CI 1.0-2.4, p-value for trend=0.03). Odds ratios of colorectal cancer for meat consumption in women are shown in Table 3. Beef consumption was positively associated with colorectal cancer risk (OR 1.7, 95 % CI 0.9-2.8, p-value for trend=0.05). As was observed in men, lamb intake was not associated with risk of colorectal adenocarcinoma. Red meat intake was associated with a moderate increase in

risk for female colon cancer. On the other hand, rectal carcinoma displayed an OR of 2.3 for high intake of red meat intake (p-value for trend=0.03). Also, ORâ&#x20AC;&#x2122;s for both sites together (colon and rectum) displayed an increased risk of 2.0 (95 % CI 1.1-3.6, p-value for trend=0.01). Poultry consumption increased the risk of female colon cancer (OR 1.7, 95 % CI 0.9-2.9, p-value for trend=0.03). This food item was not associated with rectal cancer. Also fish and white meat intakes were not associated with colorectal cancer risk. Processed meat consumption was associated with a modest increase in risk of female

196

Cancer Therapy Vol 3, page 197

Table 3. Odds ratios of colorectal cancer for meat consumption in women1.

Meat variable (cutpoints)2 Beef 208 365 Lamb 0 12 Red meat 260 377 Poultry 24 52 Fish 12 52 White meat 52 104 Processed meat 70 182 Total meat 481 682

Colon/Rectum/ Controls3 41/24/171 55/30/159 45/31/122 p-value trend 49/28/169 58/35/158 34/22/125 p-value trend 45/24/188 54/32/151 42/29/113 p-value trend 27/26/108 45/25/167 69/34/177 p-value trend 41/29/116 55/26/160 45/30/176 p-value trend 31/26/108 52/25/167 58/34/177 p-value trend 46/30/171 45/23/152 50/32/129 p-value trend 40/23/173 57/33/153 44/29/126 p-value trend

OR 1.0 1.3 1.6 0.15 1.0 1.5 1.0 0.98 1.0 1.5 1.8 0.13 1.0 1.1 1.7 0.03 1.0 1.1 0.8 0.40 1.0 1.1 1.3 0.29 1.0 0.9 1.4 0.15 1.0 1.7 1.8 0.09

Colon 95 % CI

0.8-2.2 0.8-2.9

0.9-2.6 0.6-1.8

0.8-2.5 0.9-3.6

0.6-1.9 0.9-2.9

0.7-1.9 0.5-1.4

0.6-1.9 0.8-2.2

0.6-1.6 0.9-2.4

1.0-2.8 0.9-3.3

OR 1.0 1.2 1.9 0.06 1.0 1.6 0.9 0.76 1.0 1.6 2.3 0.03 1.0 0.6 0.8 0.65 1.0 0.7 0.7 0.30 1.0 0.5 0.8 0.69 1.0 0.8 1.3 0.15 1.0 1.5 1.7 0.06

Rectum % CI

0.6-2.4 0.9-3.9 0.05 0.8-2.8 0.5-1.7

0.8-3.2 1.0-5.3

0.3-1.1 0.4-1.5

0.4-1.3 0.4-1.3

0.3-1.0 0.4-1.4

0.4-1.4 0.7-2.4

0.8-2.9 0.8-3.5

Both sites OR95 % CI 1.0 1.3 1.7 1.0 1.5 0.9 0.85 1.0 1.5 2.0 0.01 1.0 0.8 1.2 0.21 1.0 0.9 0.8 0.28 1.0 0.8 1.1 0.63 1.0 0.9 1.4 0.11 1.0 1.6 1.7 0.03

0.8-2.0 0.9-2.8

1.0-2.4 0.6-1.5

0.9-2.4 1.1-3.6

0.5-1.3 0.8-1.9

0.6-1.5 0.5-1.2

0.5-1.3 0.7-1.6

0.6-1.4 0.9-2.1

1.1-2.5 1.1-2.9

colorectal cancer, whereas total meat consumption showed a direct association with colorectal cancer risk (OR 1.7, 95 % CI 1.1-2.9, p-value for trend=0.03). The effect of fried meat in colorectal cancer is shown in Table 4. This cooking method of red meat was positively associated with colon cancer in men (OR 2.1, 95 % CI 1.3-3.1, p-value for trend=0.001). Fried meat was not associated with colon cancer among females. The difference between sexes was significant (p-value for

heterogeneity=0.04). Rectal carcinoma, at difference with colon cancer risk, was not associated with fried meat (pvalue for heterogeneity=0.0005). This heterogeneity between colon and rectal cancers precluded a reliable estimate for fried meat consumption. Odds ratios of colorectal cancer for barbecued meat consumption are shown in Table 4. Females with colon cancer displayed an increased risk of 1.5 (95 % CI 0.9-2.7, p-value for trend=0.08). Also, women were directly

197

Deneo-Pellegrini et al: Meat consumption and risk of colorectal cancer associated with rectal carcinoma risk (OR 2.5, 95 % CI 1.3-5.0, p-value for trend=0.006). As expected from the previous results, women were directly associated with colorectal cancer (OR 1.9, 95 % CI 1.2-2.9, p-value for trend=0.005). Men with colon, rectum and colorectal cancers were not associated with risk for barbecued meat. The effect of boiled red meat is also shown in Table 4. Men presented lack of association in colon, rectal and colorectal cancers. Females afflicted with colon carcinoma displayed a modest increase in risk which was nonsignificant, whereas those who presented adenocarcinoma of the rectum showed an inverse association. The p-value

for heterogeneity between both tumor sites was significant (p=0.03). Finally, boiled meat consumption was not associated with colorectal carcinoma risk. Odds ratios of colorectal cancer for estimated heterocyclic amine intake are shown in Table 5. Total heterocyclic amines (HCAâ&#x20AC;&#x2122;s) were consistently associated with risks of colon, rectal, and colorectal cancers. Moreover, high intake of HCAâ&#x20AC;&#x2122;s were similar across genders (OR 1.9, 95 % CI 1.4-2.7, p-value for trend=0.0001). Further adjustment for protein and iron left the results unchanged (results not shown).

Table 4. Odds ratios of colorectal carcinoma for cooking method of red meat1. Males Method (cutpoints) Fried 2 78 130 Barbecued 24 64 Boiled 104 208 Females Method (cutpoints)2 Fried 78 130 Barbecued 24 64 Boiled 104 208

Colon/Rectum/ Controls 36/67/223 40/56/226 75/56/211 p-value trend 42/46/191 57/62/211 52/71/371 p-value trend 52/58/205 50/66/224 49/55/231 p-value trend Colon/Rectum /Controls 43/34/147 48/25/145 50/26/160 p-value trend 44/20/179 57/36/160 40/29/113 p-value trend 34/35/166 59/28/146 48/22/140 p-value trend

OR 1.0 1.0 2.1 0.001 1.0 1.2 0.9 0.47 1.0 0.9 1.0 0.96 Colon OR 1.0 0.9 0.9 0.85 1.0 1.5 1.5 0.008 1.0 1.7 1.5 0.14

Colon 95 % CI

0.6-1.7 1.5-3.4

0.7-1.9 0.5-1.4

0.6-1.4 0.6-1.6

95 % CI

0.6-1.5 0.5-1.5

0.9-2.4 0.9-2.7

1.0-2.9 0.9-2.6

OR 1.0 0.7 0.8 0.28 1.0 1.2 1.1 0.59 1.0 1.0 0.9 0.93 Rectum OR 1.0 0.6 0.6 0.09 1.0 2.2 2.5 0.006 1.0 0.7 0.6 0.17

Rectum 95 % CI

Both sites 95 % CI

0.7-1.6 0.6-1.5

1.0 0.8 -3 1.0 1.2 1.0 0.93 1.0 0.9 0.9

95 % CI

0.98 Both sites OR 95 % CI

0.5-1.1 0.5-1.2

0.7-1.8 0.7-1.8

0.6-1.2

0.8-1.7 0.7-1.5

0.7-1.4 0.7-1.4

1.0 0.3-1.1 0.3-1.0

1.2-4.1 1.3-5.0

0.4-1.3 0.3-1.2

0.8 0.8 0.29 1.0 1.7 1.9 0.005 1.0 -

0.5-1.2 0.5-1.2

1.1-2.6 1.2-2.9

- 4

Adjusted for age, residence, urban/rural status, education, family history of colon cancer among first-degree relatives, tobacco smoking, alcohol drinking, total energy intake, total vegetables and fruits, total fat intake and for each other. 2-In servings per year. 3 p-value for heterogeneity 0.0005 4 p-value for heterogeneity 0.03

198

Cancer Therapy Vol 3, page 199 Table 5. Odds ratios of colorectal cancer for estimated intake of heterocyclic amines1. Colon Males Cutpoints 160.5 2 258.6

Colon/Rectum/ Controls 68/203 112/216 150/241 p-value trend

Females Cutpoints 160.5 2 258.6

Colon/Rectum /Controls 59/168 81/154 86/130 p-value trend

OR 1.0 1.5 1.8 0.06

Rectum

95 % CI 0.9-2.6 0.9-3.4

OR 1.0 1.4 2.0 0.009

Colon OR 1.0 1.7 2.3 0.01

95 % CI 0.8-2.3 1.2-3.6 Rectum

95 % CI 0.9-2.9 1.2-4.3

OR 1.0 1.7 1.7 0.17

95 % CI 0.9-3.1 0.8-3.5

Both sites OR 95 % CI 1.0 1.5 0.9-2.2 1.9 1.2-3.0 0.004 Both sites OR 1.0 1.7 2.0 0.01

95 % CI 1.1-2.6 1.2-3.4

1991; Sinha et al, 1998, 1999). Most of these studies consistently showed a significant increase in risk of colorectal and breast carcinomas. In the present study fried meat was associated with an increased risk of colon cancer, whereas rectal carcinoma displayed a null effect. On the other hand, barbecued meat was a strong risk factor for female rectal carcinoma, whereas the effect on colon cancer was rather small. This discrepancy between fried and barbecued meat, two proxy variables of HCA’s exposure, could be due to unknown factors or, taking into account the numerous comparisons made, be a chance finding. In fact, doneness of red meat is a better proxy variable of HCA’s exposure than cooking methods (Sinha et al, 1998). We also employed an estimated amount of total heterocyclic amines (HCA’s). High exposure to HCA’s was associated with a two-fold increase in risk. This finding, albeit subject to misclassification, replicates findings in the recent review of Sinha (2002). Like other case-control studies, our report has limitations. Selection bias is almost impossible to eliminate. In order to minimize its effect, we frequency matched cases and controls on age, sex and residence. Recall bias is always a potential problem in retrospective studies on diet and cancer. Since cases and controls were hospitalized it is probable that both series of participants were subjected to similar forces of recall. Furthermore, cases and controls were drawn from a low socioeconomic strata of the Uruguayan population. This segment of the population is mostly unawere of the potential danger of high consumption of red meat. Also, both interviewers were participating in a large multisite case-control study on environmental factors and several cancer sites. Therefore, it is unlikely that the interviewers have a precise knowledge of the role of diet in colorectal cancer. Our study has also strengths. Perhaps the most important strength is the high response rate observed both in cases

V. Discussion According to the results of our study, beef and red meat were associated with a significant increase in risk for colorectal cancer in men and women. These results were rather similar in colon and rectal cancer. These findings are in accordance with most of the previous case-control and prospective studies (Manousos et al, 1983; Tuyns et al, 1988; La Vecchia et al, 1988; Benito et al, 1990; Gerhardsson de Verdier et al, 1991; Potter, 1996; Le Marchand et al, 1997; World Cancer Research Fund, 1997; Potter, 2000). Moreover, we included a term for total fat intake in all models and, whereas fat displayed a null effect, red meat increased its risk. Aside from its content in fat, red meat is a rich source of iron and protein. Adjustment for these variables left the OR’s for red meat without any change, Thus, other components of red meat should be responsible for the deleterious effect of this food item. Strong candidates for explaining the carcinogenic effect of red meat in colorectal cancer risk are the heterocyclic amines (HCA). These chemicals are formed in muscle meat cooked by frying or barbecuing (Weisburger, 2002). More precisely, the presence of creatine is required in the formation of HCA’s. The carcinogenicity was discovered by Sugimura and Sato in experimental animal studies (Sugimura 2000). Since then, numerous experimental and epidemiological studies have increased the consistence of the noxious effect of HCA’s in colorectal cancer (De Stefani et al, 1997; Sinha et al, 1999, 2001; Le Marchand et al, 2002; Nowell et al, 2002). Moreover, HCA’s have been suggested as carcinogens for several cancer sites, like breast and lung (De Stefani et al, 1997; Sinha et al, 1998). In fact, some case-control studies have found an increased risk for colorectal cancer and breast cancer, after using an estimated variable for PhIP (25, 28). Other studies have employed proxy variables like type of cooking and doneness of meat consumed (Gerhardsson de Verdier et al, 199

Deneo-Pellegrini et al: Meat consumption and risk of colorectal cancer Le Marchand L, Hankin J, Pierce LM et al (2002) Well-done red meat, metabolic phenotypes and colorectal cancer in Hawaii. Mutat Res 506-507, 205-214. Le Marchand L, Wilkens L, Hankin J et al (1997) A case-control study of diet and colorectal cancer in a multiethnic population in Hawaii (United States): lipids and foods of animal origin. Cancer Causes Control 8, 637-648. Manousos O, Day NE, Trichopoulos D et al (1983) Diet and colorectal cancer: A case-control study in Greece. Int J Cancer 32, 1-5. Matos E and Brandani A (2002) Review on meat consumption and cancer in South America. Mutat Res 506-507, 243-249. Nowell S, Coles B, Sinha R et al (2002) Analysis of total meat intake and exposure to individual heterocyclic amines in a case-control study of colorectal cancer: contribution of metabolic variation to risk. Mutat Res 506-507, 175-185. Parkin DM, Whelan SL, Ferlay J, Teppo, L and Thomas DB) Cancer Incidence in Five Continents. Volume VIII. (2002) IARC scientific publications N° 155. Lyon, IARC. Phillips RL and Snowdon DA (1985) Dietary relationships with fatal colorectal cancer among Seventh-Day Adventists. J Natl Cancer Inst. 74, 307-317. Potter JD (1996) Nutrition and colorectal cancer. Cancer Causes Control 7, 127-146. Potter JD (2000) Colorectal neoplasia and meat: Epidemiology and mechanisms. In I.T. Johnson and G.R.Fenwick (editors): Dietary anticarcinogens and antimutagens. Chemical and Biological Aspects. Royal Society of Chemistry. Sinha R (2002) An epidemiologic approach to studying heterocyclic amines. Mutat Res 506-507, 197-204. Sinha R and Rothman N (1997) Exposure assessment of heterocyclic amines (HCAs) in epidemiologic studies. Mutat Res 376, 195-202. Sinha R Kulldorff M, Chow WH, Denobile J and Rothman N (2001) Dietary intake of heterocyclic amines, meat derived mutagenic activity, and risk of colorectal adenoms. Cancer Epidemiol Biomarkers Prev 10, 559-562. Sinha R, Chow WH, Kulldorff M et al (1999) Well-done grilled red meat increases the risk of colorectal adenomas. Cancer Res 59, 4320-4324. Sinha R, Kulldorff M, Curtin J et al (1998) Fried, well-done red meat and risk of lung cancer in women (United States). Cancer Causes Control 9, 621-630. Stata Reference Manual Release (1999) Version 6 Stata Press College Station Texas Sugimura T (2000) Nutrition and dietary carcinogens. Carcinogenesis 21, 387-395. Tuyns AJ, Kaaks R and Haelterman M (1988) Colorectal cancer and the consumption of foods: a case-control study in Belgium. Nutr Cancer 11, 189-204. Weisburger JH (2002) Comments on the history and importance of aromatic and heterocyclic amines in public heath. Mutat Res 506-507, 9-20. World Cancer Research Fund (1997) Food nutrition and the prevention of cancer: a global perspective American Institute for Cancer Research Washington DC.

and controls. In summary, the present study gives further support to the noxious effect of red meat in colorectal carcinoma. This strong association was observed for high consumption of beef and red meat. The positive association was observed in colon and rectal cancers and in men and women. Also, the cooking method, that is the exposure to fried and barbecued meat, was associated with increased risks for colorectal cancer. Nevertheless, these associations were inconsistent by tumor site and by gender, suggesting that doneness is a better proxy variable of HCA’s than cooking method. Finally, estimated exposure to total HCA’s was consistently associated with high OR’s for colorectal cancer. Further studies on effect modifiers of the carcinogenic risk of red meat and HCA’s are needed.

References Benito E, Obrador A, Stiggelbout A, et al (1990) Nutritional factors in colorectal cancer risk: A case-control study in Majorca: I Dietary factors. Int J Cancer 45, 69-76. Bostick RM, Potter JD, Kushi LH, et al (1994) Sugar, meat, and fat intake, and non-dietary risk factors for colon cancer incidence in Iowa women (United States). Cancer Causes Control 5, 38-52. Breslow NE and Day NE (1980) Statistical methods in cancer research. Volume 1-The analysis of case-control studies. IARC Scientific Publications N° 32. Lyon, IARC. Comisión Honoraria de Lucha contra el Cáncer (1993) Conocimientos creencias actitud y prácticas sobre cáncer Encuesta de población Cooperación técnica OPP/BID/PNUD Comisión Honoraria de Lucha contra el Cáncer (In Spanish) De Stefani E, Deneo-Pellegrini H, Mendilaharsu M and Ronco A (1997) Meat intake, heterocyclic amines and risk of colorectal cancer: a case-control study in Uruguay. Int J Oncol 10, 573-580. De Stefani E, Ronco A, Mendilaharsu M et al (1997) Meat intake, heterocyclic amines, and risk of breast cancer: a casecontrol study in Uruguay. Cancer Epidemiol Biomarkers Prev 6, 573-581. Gerhardsson de Verdier M, Hagman U, Peters RK et al (1991) Meat, cooking methods and colorectal cancer: a case-referent study in Stockholm. Int J Cancer 49, 520-525. Goldbohm RA, van den Brandt PA, van’t Veer P et al (1994) A prospective cohort study on the relation between meat consumption and the risk of colon cancer. Cancer Res. 54, 718-723. Hosmer DW, and Lemeshow S (1989) Applied logistic regression. New York: John Wiley & Sons. Knekt P, Steineck G, Jaervinen R et al (1994) Intake of fried meat and risk of cancer: a follow-up study in Finland. Int J Cancer 59, 756-760. La Vecchia C, Negri E, Decarli A et al (1988) A case-control study of diet and and colorectal cancer in northern Italy. Int J Cancer 41, 492-498.

200

Cancer Therapy Vol 3, page 201 Cancer Therapy Vol 3, 201-218, 2005

FDG PET and PET-CT in uterine cancers Review Article

Tarik Z Belhocine1,* and Perry W Grigsby2 1

Department of Nuclear Medicine, Jules Bordet Cancer Institute, PET-CT Unit, Brussels, Belgium Department of Radiation Oncology/Nuclear Medicine, Mallinckrodt Institute of Radiology, St.Louis, MO, USA

__________________________________________________________________________________ *Correspondence: Tarik Z Belhocine MD., Ph.D., Department of Nuclear Medicine, Jules Bordet Cancer Institute, PET-CT Unit, Brussels, Belgium; Tel: 322-541-3093; Fax: 322-541-3094; e-mail: tarikbelhocine@yahoo.fr Key words: FDG, PET, PET/CT, cervical cancer, endometrial cancer Abbreviations: 18F-fluoro-2-deoxy-D-glucose positron emission tomography, (FDG PET); body weight, (BW); gynecologic oncology group, (GOG); intensity modulated radiation therapy, (IMRT); lymphatic mapping and sentinel lymphadenectomy, (LM/SL); magnetic resonance imaging, (MRI); ordered-subsets expectation expectation maximization (OSEM); positron emission tomography, (PET); positron emission tomography: computed tomography, (PET/CT) Received: 28 February 2005; Accepted: 04 April 2005; electronically published: April 2005

Summary Despite early diagnosis of uterine cancers and more efficient combined therapy modality, the optimal management of such gynecological malignancies remains a challenging debate. In the last few years, increasing data highlighted the potential of positron emission tomography (PET) using 18F-fluoro-2-deoxy-D-glucose (FDG) in various cancer types including cervical and endometrial cancers. Accordingly, metabolic imaging was found useful for localization of primary tumor, staging of nodal and distant metastases, and detection of symptomatic and asymptomatic recurrences. Besides, pilot studies pointed out on the prognostic value of FDG PET in treated and untreated cervical cancers. In the present review, we evaluated the clinical added-value that may offer a high-end imaging modality such as FDG PET, eventually combined with CT/MRI, in pre-treatment staging and post-treatment surveillance of uterine cancers. FDG tracer (Kikuchi Y et al, 1972; Marshall MJ et al, 1978; Marshall MJ et al, 1979; Mendez LE et al, 2002; Yen TC et al, 2004). Accordingly, increasing evidence showed the clinical advantages offered by metabolic imaging in the diagnosis, staging, re-staging, and treatment monitoring of such gynecological malignancies. In the present chapter, we summarize the current knowledge on FDG PET in cervical and endometrial cancer. We also highlight the perspectives expected from PET/CT image fusion in the management of women suffering from uterine cancers.

I. Introduction 18

During the last decade, the introduction of F-fluoro2-deoxy-D-glucose positron emission tomography (FDG PET) in the management of various cancers has been shown to significantly improve the pre-treatment staging as well as the post-treatment follow-up of disease (Gambhir et al, 2001; Maisey et al, 2002). For instance, metabolic imaging findings may precede by several weeks conventional imaging results. Growing data also indicate that FDG PET is not just a valuable diagnostic tool, but it may yield unique prognostic information. Moreover, FDG PET may detect active disease in asymptomatic patients, which is critical in terms of treatment efficacy and prolonged survival. The recent development of combined PET/CT devices opened new perspectives in nuclear oncology by allowing an anatometabolic characterization of cancers (Townsend DW et al, 2003). Of particular interest is the clinical added-value of PET/CT in terms of diagnostic accuracy and the potential expected for targeted therapy (Hany TF et al, 2002). Because uterine cancers exhibit an overexpression of glucose transporter-1 (Glut-1) and increased activity of key-enzymes of the glycolytic pathway (Hexokinases I and II), they avidly take up the

II. Cervical cancer Cervical cancer is a public health problem. Worldwide, the disease ranks second to breast cancer in incidence (Parkin et al, 2001). In the United States, about 10.370 cases of invasive cervical cancer will be diagnosed in 2005 with a related mortality estimated to 3710 women (ACS key-statistics, 2005). Besides early screening of cervical cancer, the optimal management of women with invasive disease may nowadays benefit from more efficient treatments (Keys et al, 1999; Rose et al, 1999; Peters et al, 2000; Chi et al, 2001; Grigsby et al, 2001). To this end, we addressed the 201

Belhocine and Grigsby: 18FDG PET and PET-CT in uterine cancers actual potential of metabolic imaging, eventually combined with morphological imaging, in the clinical work-up of cervical cancer.

study, GLUT-1 overexpression was intimately correlated to the malignant transformation of cervical tissues from pre-cancerous dysplastic patterns (i.e. CIN 1, CIN 2, and CIN 3) to cancerous forms. Conversely, in benign cervical epithelium, only weak to moderate GLUT-1 expression was noted, which was related to the proliferating basal cell layers of the mucosa, inflammatory changes, squamous atypia, immature metaplasia, or basal cell hyperplasia (Rudlowski et al, 2003). Thus, human cervical carcinomas and their metastases selectively overexpress GLUT-1, thereby, providing a strong rationale to the feasibility of FDG imaging (Mendez et al, 2002; Rudlowski et al, 2003; Yen et al, 2004). Although pre-neoplastic patterns overexpress GLUT-1, they are not detected by FDG PET; these dysplastic forms likely escape the spatial resolution of current PET devices. Other biological and morphological factors may actually contribute to the high FDG-avidity of invasive cervical cancers such as tumor vascularization, hexokinase expression, hypoxia, proliferative activity, and tumor size (Marshall et al, 1978; Dellas et al, 1996; Bar et al, 2001; Morgan et al, 1998). Metabolic imaging may detect all tumor types including squamous cell carcinoma, adenocarcinoma, adenosquamous carcinoma, small-cell carcinoma, and clear-cell carcinoma. As one may expect, FDG PET is most often limited by its spatial resolution, which prevents the detection of FIGO stage 0 in situ tumors and FIGO stage IA lesions. Besides the tumor size and the FDG PET methodology, the few false negatives reported in stages IIIII disease may be eventually explained by a low GLUT-1 expression (Table 2). To improve the signal-tobackground ratio, some authors suggested a continuous bladder irrigation using a Foley urinary catheter (Sugawara et al, 1999; Koyama et al, 2003). Others have showed the utility of post-void images to better localize

A. Pre-treatment staging In pre-treatment setting, the International Federation of Gynecology and Obstetrics (FIGO classification) (Table 1) is commonly used for the staging of cervical cancer (Benedet et al, 2000). Such a staging system provides practical guidelines to assess the disease extent locally as well as to adjacent and distant organs. However, the FIGO clinical staging has major limitations. Firstly, the lack of diagnostic accuracy in comparison to the surgical staging may lead to underestimate the scale of disease (Van Nagell et al, 1971; Hricak et al, 1996; Yu et al, 1997). Secondly, nodal involvement, an important prognostic factor, is not taken into account by the FIGO clinical staging, which may affect the treatment planning (Kupets et al, 2001). Below, we have analyzed the performances of FDG PET for assessing the key-parameters that may actually affect the treatment and the prognosis of women with newly diagnosed cervical cancers.

1. T staging As a rule, cervical cancers avidly take up the glucose tracer with a sensitivity ranging from 85% to 100% (Table 2). Moreover, FDG PET was found as accurate as magnetic resonance imaging (MRI) (MRI) in localizing the primary tumor (Narayan et al, 2001; Belhocine et al, 2002; Narayan et al, 2003). Surprisingly, in a prospective study of 219 cervical cancers, the accuracy of metabolic imaging to localize primary tumors (n=75) was not significantly impaired by the patients' glycemia at the time of the PET study (Chang et al, 2005). In a recent basic

Table 1. Carcinoma of the Cervix Uteri: FIGO Staging Classification (September 2000). FIGO Stages 0 I IA IA1 IA2 IB IB1 IB2 II IIA IIB III IIIA IIIB IVA IVB

Definitions Carcinoma in situ (pre-invasive carcinoma) Cervical carcinoma confined to uterus Invasive carcinoma diagnosed only by microscopy. All macroscopically visible lesions – even with superficial invasion – are Stage IB. Stromal invasion ! 3.0 mm in depth and ! 7.0 mm in horizontal spread. Stromal invasion > 3.0 mm and ! 5.0 mm with horizontal spread ! 7.0 mm. Clinically visible lesion confined to the cervix or microscopic lesion > IA2. Clinically visible lesion ! 4.0 cm in greatest dimension. Clinically visible lesion > 4.0 cm in greatest dimension. Tumor invades beyond the uterus but not to pelvic wall or to lower third of the vagina. Without parametrial invasion. With parametrial invasion. Tumor extends to pelvic wall and/or involves lower third of vagina and/or causes hydronephrosis or nonfunctioning kidney. Tumor involves lower third of vagina – no extension to pelvic wall. Tumor extends to pelvic wall and/or causes hydronephrosis or non-functioning kidney. Tumor invades mucosa of bladder or rectum and/or extends beyond true pelvis. Distant metastasis

202

Cancer Therapy Vol 3, page 203 Table 2. T Staging of cervical cancer with FDG PET: Literature Data Authors

Years

Primary Staging

FIGO Stages

Tumor Types

Rose et al

1999

32/32

IIB-IVA

Sugawar a et al Umesaki et al Reinhard t et al Kerr et al Kühnel et al Grigsby et al

1999

17/21

IB-IVA

2000

09/13

IA-IIIB

SqCC, ASC, ADC SqCC, ASC, ADC SqCC, ADC

2001

35/35

IB-IIA

2001 2001

10/13 15/15

IB-IVB IB-IIB

2001

101/101

IA-IVB

Narayan et al Nakamot o et al Belhocine et al Singh et al Narayan et al Tsai et al

2001

24/27

IB-IVB

2002

20/20

IB-IVA

2002

22/60

IA-IVA

2003

47/47

IIIB

2003

69/70

IB-IVB

2004

19/19

IB-IIIB

SqCC, ADC, non-SqCC SqCC SqCC, ASC, ADC SqCC, ASC, ADC, CCA, SmCC SqCC, ADC, CCA SqCC, ASC, ADC SqCC, ADC SqCC, ASC, ADC SqCC, ADC SqCC, ASC, ADC

Primary Tumors Detection Rates (SUV-BW max) 30/32 = 93% 16/17 = 94% * (mean SUV = 10.31) 09/09 = 100% (mean SUV = 7.7) 35/35 = 100%

False-Negative Results 2 FN: SqCC, IIB, IIIB 1 FN: SqCC, IIB FN: none FN: none

10/10 = 100% 15/15 = 100%

FN: none FN: none

100/101 = 99%

1 FN: SqCC, IA2

24/24 = 100%

FN: none

17/20 = 85% * (mean SUL = 7.77) 20/22 = 91% (mean SUV = 9.0) 47/47 = 100%

3 FN: SqCC, IB, IIB, IIIB 2 FN: SqCC, IA

69/69 = 100%

FN: none

18/19 = 95% (mean SUV > 8) †

1 FN: IIA

FN: none

Abbreviations: SqCC: squamous cell carcinoma, ASC: adenosquamous carcinoma, ADC: adenocarcinoma, CCA: clear-cell carcinoma, SmCC: small-cell carcinoma, SUV-BW: standardized uptake value-body weight (or decay-corrected tissue activity divided by the injected dose per patient body weight). SUL: SUV-BW corrected by predicted lean body mass. † Moderately differentiated tumors had mean SUV max =11.56 (8.0-18.0) and poorly differentiated tumors had mean SUV max = 17.96 (8.1-41.7). * Overall results including post-void images and semi-quantitative analysis.

poorly FDG-avid primary tumors (Sugawara et al, 1999; Nakamoto et al, 2002). In our experience, however, no particular acquisition (i.e. dynamic sequences, late images, abdominal and pelvic fields of view) was needed to accurately localize the primary tumor. Rather, we routinely use a static whole-body acquisition with eventually the administration of diuretics. Such a protocol allows the detection of primary FDG-avid sites with a high confident using a simple qualitative interpretation, especially from the transaxial and sagittal slices (Figure 1). Importantly, the use of iterative methods for data reconstruction (i.e. OSEM) helps reduce streak artifacts, especially in the vicinity of the bladder. Additionally, semi-quantitative analysis of FDG uptake showed that cervical cancers mostly present with a high mean standardized uptake value-body weight (or decay-corrected tissue activity divided by the injected dose per patient body weight (SUV-BW) ranging from 7.7 to 10.3. Interestingly, in a series of 53 newly diagnosed squamous cell type cervical cancers, the peak SUV values (pSUV) were measured from the primary tumor mass and compared to patients’ survival (Jang et al, 2002). As a

result, the survival of patients with high pSUV (>13) was worse than the low pSUV group (<13) to a p value of 0.053 (Hazard ratio=6.8; 95% CI=0.97-68.7). Overall, the 2-year survivals were 76.0% and 92.3% for the high and the low pSUV groups, respectively. Based on our experience and others, however, no statistical correlation was found between the SUV-BW and the FIGO stage of disease (Sugawara et al, 1999; Belhocine et al, 2002). Similarly, in a recent study, no statistical correlation was found between the FDG uptake and the primary tumor size measured by MRI/CT. So far, a relationship was evidenced between the SUV-BW and the degree of differentiation with no statistical significance (Narayan et al, 2003). Data from literature regarding the performances of FDG PET for T staging are summarized in Table 2. Owing to its sub-centimetric spatial resolution, metabolic imaging cannot assess key-prognostic factors such as tumor volume, stromal invasion, and parametrial involvement. Similarly, FDG PET is inherently limited for the detection of microscopic tumor spreading to adjacent organs (i.e. vagina, uterine corpus, vulva, bladder, rectum). On the other hand, a number of normal and 203

Belhocine and Grigsby: 18FDG PET and PET-CT in uterine cancers

Figure 1. A typical aspect of cervical cancer in FDG PET. Metabolic imaging showed an intense FDG uptake at the level of the primary tumor and no other FDG-avid abnormality on the rest of the body. Tm: tumor; B: bladder; T: Transaxial; S: sagittal; C: coronal.

abnormal conditions may impair the diagnostic accuracy of FDG PET for loco-regional staging of uterine cancers; diagnostic pitfalls including ureteral stasis, bowel retention, as well as inflammatory or infectious changes secondary to cervical stenosis, endometriosis, and irradiation, which may be falsely interpreted as FDG tumor uptake (Nakamoto et al, 2002; Jeffry et al, 2004; Lerman et al, 2004). Of note, endometrial and ovarian FDG uptakes may be seen around the menstrual and ovulatory phases (Lerman et al, 2004). Therefore, physiological and benign FDG uptake patterns in the gynecological sphere (ovaries, endometrium, and cervix) should be kept in mind when performing a PET study for a uterine cancer, especially in pre-menopausal women. Also, in pre-treatment setting, MRI remains the modality of choice for staging loco-regional extension of disease. Beyond the FIGO clinical staging, FDG PET and MRI may provide complementary information on primary tumor status, thereby, optimizing the clinical utility of each modality (Belhocine et al, 2002, Narayan et al, 2003). Also, in pre-treatment setting, MRI remains the modality of choice for staging loco-regional extension of disease. Beyond the FIGO clinical staging, FDG PET and MRI may provide complementary information on primary tumor status, thereby, optimizing the clinical utility of each modality (Belhocine et al, 2002, Narayan et al, 2003). As a practical consequence, for in situ and localized cervical cancers (stages IA-IIB), FDG PET cannot meet the current FIGO staging criteria. Nonetheless, in these patients with early FIGO stages, a negative whole-body FDG PET outside the pelvis, especially for nodal staging (Grigsby et al, 2001; Grigsby et al, 2005), may be of the utmost importance for treatment planning and prognosis. Because the pre-test likelihood of tumor spreading is higher in FIGO stages " IIB, the contribution of metabolic imaging may be particularly significant in more advanced forms of disease by staging suspected and unsuspected nodal and visceral metastases (Narayan et al, 2003). Overall, FDG PET is likely more suitable for UICC/TNM staging system, at least for N and M staging (Table 3). Fused images using either PET/MRI software systems or

PET/CT hybrid devices, may help better assess T staging (Lemke et al, 2004; Yap et al, 2004). So far, beyond the anatomical tumor characterization, metabolic imaging may provide functional insights on tumor behavior (Miller et al, 2001, 2002, 2003).

2. N staging In lymphophilic malignancies such as cervical cancer, nodal status is a key-step in pre-treatment staging (Anderson et al, 1997; Chi et al, 2001). Accordingly, the 5-year overall survival dramatically drops from 87-92% in N0 patients to 42-67% in those of women classified as N1 (Buchsbaum et al, 1979; Tanaka et al, 1984). Also critical is the level of nodal involvement (i.e. pelvic vs. para-aortic vs. supra-clavicular) for treatment planning and prognosis (Benedetti-Panici et al, 1996; Michel et al, 1998; Sakuragi et al, 1999). For instance, low-risk patients with localized cervical cancer but no extra-pelvic nodal involvement may be efficiently managed by pelvic surgery and/or irradiation; thus, avoiding the side effects of systemic chemotherapy. On the other hand, those of patients with FDG-avid para-aortic sites may best benefit from combined therapy modality including platinum-based chemotherapy plus radiation (Landoni et al, 1997; Varia et al, 1998; Rose et al, 1999; Sedlis et al, 1999; Whitney et al, 1999; Grigsby et al, 2001). Also important is the utility of whole-body FDG PET to re-orient the treatment intent from curative to palliative, especially in patients with disseminated disease including supra-clavicular sites (Grigsby et al, 2001; Tran et al, 2003). Hence, an accurate imaging work-up is needed for staging the full extent of nodal disease, thereby, determining the patients' prognosis and selecting the most appropriate treatments. Cumulative data from literature including prospective and retrospective series with variable levels of confidence highlighted the added-value of FDG PET for detecting nodal metastases at each stage of disease spreading (Table 4). The strength of metabolic imaging primarily relies upon its capability to assess, in one session, pelvic, paraaortic, mediastinal, axillary, and

204

Cancer Therapy Vol 3, page 205 supra-clavicular lymph node metastases with a high sensitivity (Figure 2). So far, the performances of FDG PET for detection of nodal involvement may vary from a level to another. For instance, the sensitivity of metabolic imaging is optimal for localizing supra-clavicular metastases (Tran et al, 2003), and most often excellent for the detection of para-aortic metastases (Rose et al, 1999; Grigsby et al, 2001; Yeh et al, 2002; Belhocine et al, 2003; Lin et al, 2003; Ma et al, 2003; Tsai et al, 2004). At the pelvic level, the sensitivity of FDG PET is also high for staging nodal metastases, knowing that microscopic involvement may escape the spatial resolution of current PET devices (Benedetti-Panici et al, 1996; Reinhardt et al,

2001; Kühnel et al, 2001; Williams et al, 2001; Belhocine et al, 2002). Interestingly enough, the use of late imaging (3 hours post-injection) was found particularly useful for detection of additional lymph node metastases compared to early imaging (40 min post-injection), especially at the level of lower para-aortic, iliac, and pelvic chains (Ma et al, 2003; Yen et al, 2003). Such a dual-time protocol may also help reduce false positive results (i.e. ureteral stasis, inflammatory nodes). Nonetheless, in patients with a low pre-test likelihood of nodal involvement, especially in early stage disease, the use of lymphatic mapping and sentinel lymphadenectomy (LM/SL) may be an attractive

Table 3. Carcinoma of the Cervix Uteri: FIGO Stage Grouping and UICC/TNM Classification FIGO Stages 0 IA1 IA2 IB1 IB2 IIA IIB IIIA IIIB

IVA IVB

UICC Classification N N0 N0 N0 N0 N0 N0 N0 N0 N1 N1 N1 Any N Any N Any N

T Tis T1A1 T1A2 T1B1 T1B2 T2A T2B T3A T1 T2 T3A T3B T4 Any T

M M0 M0 M0 M0 M0 M0 M0 M0 M0 M0 M0 M0 M0 M1

Table 4. N Staging of Cervical Cancer with FDG PET: Literature Data Authors

Years

FIGO Stages

1999 1999

Primary Staging 32/32 11/23

Rose et al Grigsby et al Sugawara et al Umesaki et al Reinhardt et al Kerr et al Kühnel et al Grigsby et al Narayan et al Belhocine et al Yeh et al Lin et al Ma et al, Yen et al,

1999 2000 2001 2001 2001 2001 2001 2002 2002 2003 2003 2003

17/21 09/13 35/35 10/13 15/15 101/101 24/27 22/60 42/42 50/50 104/104 47/135

IB-IVA IA-IIIB IB-IIA IB-IVB IB-IIB IA-IVB IB-IVB IA-IVA IIB-IVA IIB-IVA IB-IVB IB2-IVB

Tsai et al,

2004

19/19

IB-IIIB

IIB-IVA IA-IVA

FDG-avid Lymph FDG-avid Metastases Nodes missed my CT/MRI Pv – Pa Pv – Pa Pv – Pa – Sc Pv – Pa – Sc Pv – Pa Pv Pv – Pa Pv – Pa – Ax Pv – Pa Pv – Pa – Sc Pv – Pa Pv – Pa – Md – Sc Pa Pa Pa Ig – Pv – Ic – Pa Md – Sc Ig – Pv – Pa Md – Sc – Nc

Pv – Pa Pv Pv – Pa Pv Pv – Pa Pv – Pa – Sc Pv – Pa Pa – Md – Sc Pa Pa Pa Ig – Pv – Ic – Pa Md – Sc Ig – Pv – Pa Md – Sc – Nc

Abbreviations: Axillary, (Ax); Iliac, (Ic); inguinal, (Ig); Mediastinal, (Md); Neck, (Nc); Para-aortic, (Pa); Pelvic, (Pv); Supra-clavicular, (Sc)

205

Belhocine and Grigsby: 18FDG PET and PET-CT in uterine cancers

Figure 2. Pre-treatment staging of cervical cancer with FDG PET. In one session, metabolic imaging revealed multiple FDG-avid sites including the primary tumor and bilateral inguinal, iliac, para-aortic, and supra-clavicular nodal metastases. The patient was upstaged from FIGO stage IB to PET stage IVB (T+N+M+), thereby, re-orienting the treatment from hysterectomy with pelvic lymphadenectomy to concomitant chemo-radiation. Tm: tumor; Ig: inguinal; Il: iliac; Pa: para-aortic; Sc: supra-clavicular.

alternative; such a minimally invasive technique may either detect microscopic lymph node metastases eventually missed by FDG PET or spare the patients unnecessary lymphadenectomies in cases of uninvolved sentinel lymph nodes (Levenback et al, 2002; Belhocine et al, 2003). Importantly, compelling evidence indicate that metabolic imaging is more sensitive and specific than conventional imaging. Not infrequently, FDG PET may detect unsuspected nodal metastases, which are missed by CT/MRI (Rose et al, 1999; Grigsby et al, 2001; Yeh et al, 2002; Belhocine et al, 2003; Ma et al, 2003; Tsai et al, 2004). Therefore, metabolic imaging may significantly impact the treatment choices (i.e. field/volume of irradiation, concurrent cisplatin-based chemotherapy), although the FIGO clinical staging is not taking into account nodal involvement (Grigsby et al, 2001; Narayan et al, 2001; Talbot et al, 2001; Yeh et al, 2002; Belhocine et al, 2002; Grigsby et al, 2005). In accordance with the body corpus of literature, the initial staging of cervical cancer was recently approved as a new reimbursed PET indication in the United States (http://www.cms.hhs.gov/manuals/). In the expectation of extended US medicare coverage, the performance of FDG PET was restricted to the patients with a negative conventional work-up. The inclusion of FDG PET into the routine staging of newly diagnosed cervical cancers appears to be particularly useful in locally advanced disease (FIGO IIB-IVA); a subset of women with a nonnegligible likelihood of extra-pelvic involvement, which may best benefit from whole-body FDG PET (Rose et al, 1999; Narayan et al, 2001; Yeh et al, 2002; Lin et al, 2003; Yen et al, 2003, Grigsby et al, 2003). Because FDG PET may provide prognostic information about patients' outcomes and treatment planning, its incorporation into the initial work-up of early stage disease should be also considered (Grigsby et al, 2001; Reinhardt et al, 2001; K端hnel et al, 2001; Grigsby et al, 2005). Further studies remain needed however, to refine stage-by-stage the optimal indications of metabolic imaging in pre-treatment staging of cervical cancer. Data from literature regarding

the performances of FDG PET for N staging are summarized in Table 4.

3. M staging Because FDG PET is a whole-body and non-invasive imaging technique, it allows the detection of distant metastases in one session. This is particularly relevant for M staging of cervical cancers, especially in advanced stages of disease. From our experience and others, metabolic imaging was able to detect suspected and unsuspected visceral metastases including liver, peritoneal, lung, and bone localizations. Moreover, whole-body FDG PET was found more accurate than routinely used protocols (FIGO staging including CT/MRI) for detection of distant sites (Grigsby et al, 1999; Kerr et al, 2001; Belhocine et al, 2002; Yen et al, 2003). So far, as observed for other cancer types, false positive results may occur in a particular context (i.e. inflammation, infection, ureteral stasis, bowel retention). Causes of misinterpretation are summarized in Table 9. A dual-phase protocol (40 min and 3 hours) may be useful to distinguish either benign disease or physiological uptake from malignancy (Yen et al, 2003; Tsai et al, 2004). The recent introduction of combined PET/CT may significantly improve the diagnostic accuracy of both PET and CT either by detecting non FDG-avid sites (i.e. infracentimetric lung metastases) or by precising the anatomic localization of FDG-avid sites. Last but not least, a single and efficient examination such as whole-body FDG PET, and more so PET/CT, is most often well tolerated in the initial work-up of patients. Data from literature regarding the performances of FDG PET for M staging are summarized in Table 5.

B. Post-treatment surveillance The major issue in women previously treated for cervical cancer is the lack of standardized guidelines (Chi et al, 2001; Olaitan et al, 2001). Hence, the post-treatment surveillance may considerably vary from one center to another. Also critical is the suboptimal sensitivity of routine protocols including the clinical examination at control visits and conventional imaging procedures for the 206

Cancer Therapy Vol 3, page 207 Table 5. M Staging of Cervical Cancer with FDG PET: Literature Data Authors

Years

Primary Staging

FIGO Stages

FDG-avid distant Metastases

Grigsby et al,

1999

11/23

IA-IVA

Lung

Kerr et al,

2001

10/13

IB-IVB

Lung – Liver

Belhocine et al,

2002

22/60

IA-IVA

Bone – Lung

Yen et al,

2003

47/135

IB2-IVB

Peritoneum – Bone – Liver – Lung

Tsai et al,

2004

19/19

IB-IIIB

Bone – Lung

detection of recurrent disease (Ansink et al, 1996; Salvesen et al, 2001). On the other hand, the efficacy of new chemo-radiation regimens stresses the need for early recognition of recurrences, especially in asymptomatic women (Bodurka-Bevers et al, 2000; Maiman, 2002). Compelling data from literature indicate the ability of FDG PET to detect local (i.e. cervix, vagina, rectal, pelvic wall), nodal (local and distant sites), and distant recurrences (lung, bone, liver, peritoneum). Also, FDG PET may play a useful role in the surveillance work-up of treated cervical cancers (Belhocine et al, 2004). For instance, metabolic imaging may distinguish localized recurrences (i.e. pelvic or extra-pelvic sites) from disseminated disease (Grigsby et al, 1999; Park et al, 2000; Sun et al, 2001; Belhocine et al, 2002; Havrilesky et al, 2003; Tsai et al, 2004; Lai et al, 2004; Wong et al, 2004). Therefore, whole-body FDG PET may impact the treatment choices in terms of surgery (i.e. pelvic exenteration) ± radiation versus systemic chemotherapy ± radiation. Because metabolic imaging has the ability to assess the tumor biology, it may reveal recurrences early in the course of disease, before the onset of clinical symptoms and radiological evidence; such FDG PET precession might be used to give the patient the best chance of salvage therapies and prolonged survival. In the largest series of women with previously treated cervical cancers but no evidence of recurrence at the time of the PET study (n = 249), metabolic imaging revealed FDGavid abnormalities in 32.1% of patients; among them, 11.2% had clinically or histologically confirmed recurrences (Ryu et al, 2003). In another series (n = 44), FDG PET detected asymptomatic recurrences in 30.8% of patients (Unger et al, 2004). Similarly, in 38 patients with cervical cancer, we showed the added-value of FDG PET for detecting unsuspected disease in 11 of out 25 patients (44%) with confirmed recurrences (Belhocine et al, 2002) (Figure 3). On the other hand, a negative FDG PET was able to reliably rule out macroscopic recurrences with no evidence of disease after a minimal follow-up of 12 months. Therefore, the costs and the side effects of unnecessary treatments were avoided. In line with our results, recent data from a large study group of 381 patients with cervical cancer confirmed the high negative predictive value of metabolic imaging when performed 9

to 14 months after completion of therapy; accordingly, ‘no evidence of disease’ state on PET corresponded to a disease-free period > 2 years with a recurrence rate of 2.5% (1.06%/year) after a negative PET (Kim et al, 2004). Remarkably, in another large sample of patients (n=152) treated by radiation and concurrent weekly chemotherapy, those of patients who were free of FDG-avid sites, on average 3 months post-therapy, had a 5-year overall survival of 92% (Grigsby et al, 2004). As reported for many types of cancers, this initial study also highlighted the feasibility of FDG PET to monitor women previously treated by concurrent chemo-radiation, thereby, allowing the classification of patients into three groups: complete metabolic response (no FDG uptake), partial metabolic response (persistent abnormal FDG uptake in the irradiated cervix or lymph nodes), and progressive disease (new sites of abnormal FDG uptake outside the irradiated volume). The impact of FDG PET findings on treatment strategy and patients’ survival are detailed below. To optimize the surveillance of women with treated cervical cancers, one should note the complementary information provided by a highly sensitive in vivo imaging such as FDG PET and a highly specific in vitro marker such as SCC-Ag (Belhocine, 2003). In a phase II study including 27 cases of cervical cancer explored by FDG PET for unexplained elevation of SCC-Ag serum levels in the follow-up, metabolic imaging was able to detect FDGavid lesions in 17 of out 18 patients with recurrent disease. In this series, not only FDG PET helped avoid futile therapeutic intervention but it significantly increased the patients’ overall survival (Chang et al, 2004). In another pilot study, the same group showed the utility of FDG PET to detect recurrent disease in asymptomatic patients with elevated SCC-Ag serum levels (Chang et al, 2004). Further studies are needed to confirm these promising data, and to refine the combination of FDG PET and PET/CT with SCC-Ag, especially in terms of marker cutoff and control intervals in the follow-up. Based on our experience and others, the following indications may be proposed in the work-up of previously treated cervical cancers: 1) the localization of recurrences in symptomatic patients as well as in cases of elevated tumor markers (SCC-Ag) and radiological suspicion, 2) the early detection of asymptomatic recurrences in the

207

Belhocine and Grigsby: 18FDG PET and PET-CT in uterine cancers

Figure 3. Post-treatment re-staging of cervical cancer with FDG PET. In a patient with a cervical cancer previously treated by hysterectomy and radiotherapy, the routine follow-up work-up was normal. Metabolic imaging showed peri-hepatic FDG-avid sites, which were consistent with recurrences. Histology concluded to peritoneal involvement from cervical cancer. T: Transaxial; S: sagittal; C: coronal.

post-therapy surveillance, especially in high-risk patients, 3) the exclusion of active disease in the routine follow-up, 4) the treatment monitoring, especially after chemotherapy and/or radiotherapy. Recent data also highlighted the prognostic significance of FDG uptake in terms of 5yoverall survival and 5y-cause-specific survival in patients previously treated by radiotherapy and concurrent weekly chemotherapy (Grigsby et al, 2003; Grigsby et al, 2004). Besides well-known prognostic variables (clinical status, tumor markers, treatment modality), FDG PET has been proposed as another parameter that might be incorporated into the treatment-decision making of previously treated cervical cancers (Yen et al, 2004; Lai et al, 2004). So far, cost-effective studies are still needed to best incorporate FDG PET into routine surveillance of treated cervical cancer. Similarly, the optimal timing for monitoring chemo-radiation remains to be defined yet (Nakamoto et al, 2002; Laking et al, 2003; Yen et al, 2003). Because most recurrences from cervical cancers occur during the two first years following the primary therapy, the use of FDG PET, and nowadays of PET/CT, eventually combined with SCC-Ag should be focused over this follow-up period (Bodurska-Bevers et al, 2000; Olaitan et al, 2001). Importantly, early after radiation therapy (< 12 weeks) or surgery (< 6 weeks), the inflammatory changes (or “flare phenomenon”) surrounding the resected primary tumor and/or the irradiated nodes may dramatically hamper the interpretation of PET images (Nakamoto et al, 2002). Besides, no clear data are available regarding the minimal timing for the performance of PET controls in patients with treated cervical cancers without compromising the sensitivity of the metabolic technique; of note, a temporary “metabolic shut-down” was previously reported within the 2 first weeks after chemotherapy in patients with germ cell cancer (Cremerius et al, 1998). Also, in the expectation of clinical evidence, a rational schedule for the post-therapy

surveillance of cervical cancer may include a PET study every 3-4 months the first year, and every 6 months the second year, and then once a year on a patient-by-patient basis (Maiman et al, 2002; Belhocine et al. 2003, Grigsby et al, 2003; Grigsby et al, 2004). Dedicated prospective studies are needed to best define the place of FDG PET and PET/CT for monitoring cervical cancers. Data from literature regarding the performances of FDG PET for detection of recurrences are summarized in Table 6.

C. Treatment impact The use of FDG PET for pre-treatment clinical staging has had a significant impact on the therapeutic management of patients with advanced stage disease (Belhocine et al, 2003). Standard therapy for advanced stage cervical cancer is irradiation with concurrent chemotherapy (Grigsby et al, 2001). Irradiation is directed to the pelvis to include the primary cervical cancer and the pelvic lymph nodes. Para-aortic irradiation is given only to those patients that have positive para-aortic lymph nodes. Patients that have tumor spread beyond the para-aortic region at the time of initial diagnosis have little chance for cure. Therefore, from the treatment perspective, the extent of disease at the time of diagnosis is crucial. Palliative therapy should be administered to patients with spread of disease beyond the para-aortic lymph nodes chain. In our patients population, 6% of patients were found to have biopsy-proven clinically occult lymph node metastases to the supra-clavicular lymph node region. With current best therapy, these patients are not curable and should be administered palliative therapy directed toward symptomatic sites of disease. In our study of the comparison of CT and total body FDG PET, we found that 6% of patients had abnormal lymph nodes in the paraaortic region by CT of the abdomen. These abnormal lymph nodes were confirmed by FDG PET to have increased FDG uptake and an additional 12% of patients 208

Cancer Therapy Vol 3, page 209 Table 6. Detection of Recurrences from Cervical Cancer with FDG PET: Literature Data Authors

Years Patients

Grigsby et al, Park et al, Sun et al, Belhocine et al, Havrilesky et al, Ryu et al, Lai et al, Wong et al, Unger et al,

1999 2000 2001 2002 2003 2003 2004 2004 2004

12 36 20 38 28 249 40 35 44

Suspicion of Recurrence - Clinical - Clinical, Ag-SCC or CEA - Clinical, Radiological, Ag-SCC - Clinical, Radiological, None * - Clinical, Radiological - None * - Histology, Clinical, Radiological - Clinical, Radiological - Clinical, None *

Sites of FDG-avid Recurrences - Pelvis, Extra-pelvis - Pelvis, Extra-pelvis - Pelvis, Extra-pelvis - Pelvis, Extra-pelvis - Pelvis, Extra-pelvis - Pelvis, Extra-pelvis - Pelvis, Extra-pelvis - Pelvis, Extra-pelvis - Pelvis, Extra-pelvis

FDG-avid Recurrences missed by CT/MRI -Pelvis, Extra-pelvis -Pelvis, Extra-pelvis - Not Available - Pelvis, Extra-pelvis - Pelvis, Extra-pelvis - Pelvis, Extra-pelvis - Pelvis, Extra-pelvis - Pelvis, Extra-pelvis - Pelvis, Extra-pelvis

Abbreviations: * None: Women with no clinical, radiological, and biological evidence of recurrent disease at the time of the PET study.

were found to have abnormal FDG uptake in the paraaortic lymph nodes. Thus, these patients with FDG avid para-aortic lymph nodes received curative irradiation to this region whereas no irradiation would have been administered to the para-aortic lymph node region in the absence of increased FDG uptake (Grigsby et al, 2001; Esthappan et al, 2003). Our study also demonstrated similar findings in the pelvis. Abnormal lymph nodes by CT were present in 22% of patients but 60% had abnormal FDG uptake. Thus, 38% of patients received additional irradiation dose to the pelvis due to positive pelvic lymph nodes. In our population of over 300 patients undergoing FDG PET for initial staging evaluation for cervical cancer the patient specific treatment management was changed in over one-half of the patients. Curative therapy was not administered to those with disease beyond the para-aortic lymph nodes and in the remaining patients either the irradiation portal or the irradiation was altered in the majority. One consideration with regard to the treatment of patients with presumed advanced stage disease is the use of concurrent chemotherapy with irradiation. A recent study from the Gynecologic Oncology Group (GOG 109) administered concurrent chemotherapy and irradiation in patients with pathologically positive lymph nodes (Peters et al, 2000). This study was updated and demonstrated no benefit to the use of concurrent chemotherapy in patients with only one positive lymph node (Monk et al, 2005). We demonstrated a similar finding with FDG PET (Grigsby et al, 2005). In this study, there was no apparent clinical benefit to the use of concurrent chemotherapy with irradiation in patients who do not have metastatic lymph node involvement as evaluated by FDG PET. Therefore, FDG PET may prove useful in selecting a subgroup of patients with locally advanced cervical cancer without lymph node metastases that will not benefit from the administration of concurrent chemotherapy.

population the only significant pre-treatment prognostic factor, as evaluated by Cox Multivariate Logistic Regression, for the development of recurrent cervical cancer and for death from cervical cancer was the extent of lymph node metastases as determined by pre-treatment whole body FDG PET (Grigsby et al, 2001; Singh et al, 2003). In Figure 4, survival curves related to FDG nodal uptake illustrate the prognostic information brought by metabolic imaging in untreated cervical cancers. Although pre-treatment extent of metastatic disease as determined by FDG PET is the most significant prognostic factor, the post-treatment response to therapy has proven to be of greater clinical significance. We have demonstrated that a post-treatment total body FDG PET performed at three months after the completion of irradiation with or without concurrent chemotherapy can show no FDG uptake, persistent FDG uptake, or new abnormal foci of FDG uptake (Grigsby et al, 2004). About three-forths of patients will have no abnormal foci of FDG uptake and their long term cancer survival is about 90%. Conversely, those of patients who presented with any FDG uptake (persistent or new foci) after the completion of their initial therapy had a very poor prognosis. Current and future clinical indications that may derive a benefit from FDG PET and PET/CT in the workup of cervical cancers are summarized in Table 7.

III. Endometrial cancer Endometrial cancer is primarily a malignancy of post-menopausal women (Rose, 1996; Barakat et al, 2001). In the United States, the disease is the most common gynecological cancer. According to the American Cancer Society, about 40.880 new cases of uterine cancers (body of the uterus) will be diagnosed during 2005 with a related mortality estimated to 7310 women (ACS keystatistics, 2005). So far, only few data are available on the contribution of FDG PET in the management of endometrial cancer. Herewith, we report our own experience in pre-treatment nodal staging and posttreatment follow-up of such gynecological cancer.

D. Prognosis Multiple prognostic factors have been identified in patients with advanced stage carcinoma of the cervix. Some of the pre-treatment factors that are considered to be of importance are patient age, tumor size, lymph node metastases, and clinical stage of the disease. In our patient

A. Pre-treatment nodal staging In newly diagnosed endometrial cancer, various pretreatment imaging studies have been performed to identify 209

Belhocine and Grigsby: 18FDG PET and PET-CT in uterine cancers

Figure 4. Survival curves related to FDG nodal uptake in pre-treatment staging of cervical cancer

Table 7. Cervical Cancer and FDG PET or PET/CT: Current and Future Clinical Indications Clinical Indications Initial Staging

Re-Staging

Added-Value of FDG PET and PET/CT - PET/CT measurement of primary tumor volume - Nodal staging - Distant staging - PET/CT guided-biopsy - Treatment planning : ! Definition of fields/volumes of irradiation to pelvic and/or para-aortic chains ! 3D PET/CT-based intracavitary brachytherapy ! Selection of patients for surgery and/or irradiation ! Selection of patients for concurrent chemo-radiation * - Prognosis Detection of suspected recurrences based on TM, symptoms, and CI Simple follow-up surveillance Treatment monitoring following chemo-radiation Prognosis

Abbreviations: * A baseline study is warranted in patients scheduled for chemo-radiation; TM: tumor markers (SCC-Ag); CI: conventional imaging.

extent of disease. However, none have proven to be particularly useful. The current FIGO staging system calls for a lymph node dissection to complete their surgical staging but there are complications associated with this procedure. Conventional imaging methods such as CT and MRI have been unreliable in evaluating pelvic and paraaortic lymph nodes (Connor et al, 2000; Hricak et al, 1991). We performed a prospective pilot study to evaluate the performance of total body FDG PET pre-operatively to detect pelvic and para-aortic lymph node metastases. In our study, twenty patients underwent total body FDG PET before surgical staging. The sensitivity and specificity were 67% and 94% respectively for FDG detection of tumor spread to lymph nodes (Horowitz et al, 2004).

B. Post-treatment surveillance In a retrospective series of 34 women with previously treated endometrial carcinomas (FIGO stages IB-IVA), FDG PET was compared to routine protocols including the clinical examination and conventional imaging procedures (Belhocine et al, 2002). In this seminal study, metabolic imaging was able to detect all recurrences suspected by the routine follow-up but one case of lung micrometastases, which were detected on thoracic CT. FDG-avid recurrences were located above and below the diaphragm in 50% of patients, which included lung, pleural, liver, peritoneal, central pelvic, nodal, ureteral, and bone localizations. In 35% of cases, FDG-avid recurrences were located below the diaphragm including central pelvic,

210

Cancer Therapy Vol 3, page 211 pelvic wall, abdominal and pelvic lymph nodes, liver, and peritoneal sites. In 15% of patients, FDG-avid recurrences were located above the diaphragm only, which included lung metastases, mediastinal and supra-clavicular nodes. Importantly, 85% and 15% of FDG-avid recurrences were detected in patients with advanced stages (FIGO II-IV) and early stages of disease (FIGO IB), respectively (Figure 5). Interestingly enough, in 12% of patients, FDG PET detected unsuspected recurrences in women with asymptomatic disease. Overall, FDG PET had an actual impact on treatment choices in 35% of patients (9/26); 6 patients being symptomatic while 3 had no symptoms at the time of the PET study. These data are in line with those published by Saga et al, in a series of 21 patients with treated endometrial carcinomas (FIGO IA-IVB) explored by FDG PET either for detecting a recurrence or for treatment monitoring (Saga et al, 2003). The study group included women with endometrioid carcinoma (n=11) and non-endometriod tumors including serous papillary carcinoma (n=6), small cell neuroendocrine carcinomas (n=1), mixed endometrioid and serous carcinoma (n=2), and mixed endometriod and clear cell carcinoma (n=1). Interestingly, FDG PET was found more sensitive than abdominal CT

plus pelvic MRI for detecting loco-regional recurrences. In addition, metabolic imaging was able to detect unknown lesions in 19% of patients. As reported in our series, FDG PET was most often positive in women with advanced stage of disease (III-IV), non-endometrioid tumors, and high grade endometrioid tumors (G 3). Equally, metabolic imaging findings influenced the treatment choices in 33.3% of patients (7/21). Last but not least, FDG PET had a high negative predictive value to rule out recurrence (no false negative result after a minimal follow-up of 5 months); this is also in line with our data demonstrating only 1 false negative result (lung micrometastases) among 11 patients with a negative FDG PET and a minimum follow-up of 6 months (Table 8). In another series of 9 women with treated endometrial carcinomas, Grigsby et al, also showed the usefulness of metabolic imaging for detection of recurrences, which were unsuspected by the routine protocol (Grigsby et al, 1999). In this preliminary study, histologic confirmation of clinically suspected recurrent disease was obtained in all cases. Among the 7 patients with local recurrence in the vaginal apex, a focal abnormality was detected in 4 patients by FDG PET

Figure 5. Post-treatment surveillance of endometrial cancer with FDG PET. In the follow-up of a patient with previously treated endometrial carcinoma, metabolic imaging was able to detect disseminated recurrent disease. FDG-avid sites included lung, liver, nodal, and peritoneal metastases.

Table 8. Detection of Recurrences from Endometrial Cancer with FDG PET: Literature Data Authors Years Number of patients Prevalence of Recurrences Patterns of PET Recurrences Types of Recurrences Detection of unknown Recurrences (%patients) False Negative Results Sensitivity Specificity Diagnostic Accuracy Treatment Impact

Belhocine et al, 2002 34 Stage III-IV LocalDistantLocal and Distant NodalVisceral 12%

Saga et al, 2003 21 Stage III-IVHigh grade endometrioid tumors (G3) Non-endometrioid tumors LocalDistantLocal and Distant Nodal Visceral 19%

Lung micrometastases 96% 78% 90% 35%

None 100% 88.2% 93% 33.3%

211

Belhocine and Grigsby: 18FDG PET and PET-CT in uterine cancers Table 9. Causes of Inaccuracies with FDG PET in Uterine Cancers: Literature Data Causes of False Positive Results - Ureteral stasis - Bowel retention - Post-radiation changes - Post-surgery changes - Recent traumas - Inflammation / Infection: reactive nodes, granulation tissue, anthracosis, endometriosis, tuberculosis - Functional ovarian cysts - Ovulatory and menstruating phases versus 2 patients by CT. Vaginal recurrences missed by metabolic imaging were ! 2 cm. In 1 patient, both FDG PET and CT missed brain metastases, while detecting clinically unknown metastases in the mediastinum. In 3 of out 7 women with a vaginal recurrence, metabolic imaging also detected pelvic lymph node, umbilical, and lung metastases, respectively. In another patient with known para-aortic nodal recurrence, only FDG PET was able to detect lung metastases. Based on the few data from literature, FDG PET appears to be feasible in the assessment of treated endometrial carcinomas. Moreover, metabolic imaging may significantly impact the patient's management by detecting recurrent foci on the entire body, thereby, differentiating localized from disseminated recurrence patterns. Also critical is the ability of FDG PET to detect clinically and radiologically unsuspected recurrences, which may help initiate the appropriate treatment early in the course of disease. From this perspective, metabolic imaging may be a substantial adjunct to the routine followup of endometrial cancer (Shumsky, 1994). Large prospective studies are warranted to confirm these promising results.

Causes of False Negative Results - Small (< 1cm) or microscopic disease : cervix, nodes, lung, bladder, rectum - Stromal invasion - Parametrial involvement - Indolent malignant disease - Previous radiotherapy - Low GLUT-1 expression - Lack of anatomic landmarks

from FDG PET plus CT in treatment planning and survival prediction.

A. PET/CT software image fusion 1. Diagnosis In a recent study, Tsai et al, assessed the added-value of side-by-side interpretation of FDG PET and CT/MRI in gynecological cancers (Tsai CC et al, 2003). Their analysis was focused on the imaging discrepancies, which were correlated to pathology results in 32 patients (22 cervical cancers, 7 ovarian cancer, 2 endometrial cancers, and 1 leiomyosarcoma). Among the 24 women with uterine cancers, the software fusion contribution was found significant for localization of biopsy sites (12 patients), treatment planning (5 patients), accurate diagnosis (9 patients: change of FDG PET results in 5 and MRI/CT results in 4), differentiation between pathological and physiological uptake (11 patients). As a conclusion, the authors showed the clinical benefit derived from software image fusion in gynecological cancers based on amore confident and more precise interpretation of FDG PET findings and MRI/CT results as well.

2. Treatment outcomes

IV. Perspectives Although FDG PET may significantly improve the management of patients with gynecological cancers, inherent technical and biological limitations have been shown to impair both the sensitivity and specificity of metabolic imaging. Causes of inaccuracies with FDG PET in uterine cancers are summarized in Table 9 In recent years, combined imaging modalities have allowed both metabolic and anatomic characterization of cancer. By using either software image fusion (i.e. sideby-side PET and CT/MRI systems) or hardware image fusion (i.e. hybrid PET/CT devices), FDG uptakes may be precisely located into diverse organs (Schaffler et al, 2000; Wahl, 2004). In cervical and endometrial cancers, initial results highlighted the incremental clinical value of anatometabolic imaging, especially in terms of diagnostic accuracy. Pilot studies also suggest the potential expected

planning

and

patientsâ&#x20AC;&#x2122;

Current treatment planning in radiation therapy for patients with gynecologic cancers is based on the patient specific extent of the known disease. We have shown that FDG PET clearly identifies more sites of disease than any other current imaging method. Radiation treatment planning is now often administered utilizing intensity modulated radiation therapy (IMRT) to increase the irradiation dose to the tumor while decreasing the irradiation dose to normal tissue. This aspect of irradiation therapy and treatment planning is most evident in patients with cervical cancer with positive para-aortic lymph nodes (Figure 6). Fused PET/CT images can be imported into current radiation therapy treatment planning systems. Increased doses to positive lymph nodes can be administered. We are currently performing a phase I/II study to evaluate this treatment planning process.

212

Cancer Therapy Vol 3, page 213

Figure 6. Treatment planning in a patient with FDG-avid para-aortic involvement. Fused PET-CT images can be imported into current radiation therapy treatment planning systems. Increased doses to positive lymph nodes can be administered, while decreasing doses to normal tissues.

An interesting area of development has been the use of FDG PET as a guide to the evaluation and planning of intracavitary brachytherapy for patients with cervical cancer. We have developed a process whereby the brachytherapy irradiation applicators can be visualized within the metabolic tumor volume (Mutic et al, 2001). Isodose distributions can then be generated to demonstrate the irradiation dose distributions to the metabolic tumor volumes. This process has great potential to increase the irradiation dose to the primary cervical tumor while decreasing the dose to normal structures. In another pilot study, the metabolic volume as determined by FDG PET and CT software image fusion allowed to selecting the patients who may best benefit from radiation therapy; these patients had a tumor volume < 60cm3 and no lymph node disease. Alternatively, patients with other combinations suggestive of poor prognosis (V " 60cm3 and/or nodal involvement) may be treated by more aggressive therapies (Miller and Grigsby, 2002).

physiological endometrial and ovarian patterns may have been falsely interpreted as tumor uptake by using FDG PET alone (Lerman et al, 2004). Hence, FDG PET may benefit from the anatomic details provided by a concomitant CT; a "one-stop-shop" imaging aimed at increasing the diagnostic accuracy of both techniques, especially in treatment planning. Additionally, whole-body PET/CT may reduce the number, and then the cost and irradiation, of separated CT and PET studies. In a recent study, Blodgett et al compared the performances of PET/CT versus CT alone in staging and re-staging of 18 patients with cervical cancers (Blodgett et al, 2002). In 50% of cases (9/18), PET/CT detected additional tumor sites, which were missed by CT. Besides, PET/CT significantly altered the stages of disease in 33% of women (6/18). Moreover, in 33% of patients (6/18), PET/CT modified the treatment options from observation or surgery to chemotherapy or IMRT to cover para-aortic and pelvic chains. In another study, Israel et al, compared the performances of PET/CT versus PET and/or CT alone in 57 patients with gynecological cancers, including 38 cervical cancers, 6 endometrial cancers, and 13 ovarian cancers (Israel et al, 2003). As a main conclusion, PET/CT improved image interpretation over PET and/or CT in 51% of patients. Combined imaging technique led to a change in management of 11 patients with uterine cancers (25%) including 10/38 patients with cervical cancer and 1/6 patients with endometrial cancer. These results are in line with those obtained by Cohade et al, who directly compared PET and PET/CT in a series of 15 patients with

B. Hardware PET/CT image fusion With the advent of combined PET/CT devices, a single multimodality imaging is nowadays feasible in clinical routine. In gynecological cancers, this allows to avoiding many artifacts due to internal organs motion (i.e. abdominal peristalsis, urine stasis) and patients' repositioning between PET and MRI/CT (Wahl, 2004). In a reference study including 285 consecutive female patients, Lerman et al. also showed the usefulness of PET/CT for differentiating normal from abnormal FDG uptakes within the gynecological sphere; otherwise, benign and 213

Belhocine and Grigsby: 18FDG PET and PET-CT in uterine cancers endometrial cancer. In this later study, 12 of out 49 tumor sites (+24.5%) detected by PET/CT and PET were mislocalized or misdiagnosed by PET alone (Cohade et al, 2003). In particular, PET/CT helped to correctly reclassify 5 equivocal FDG-avid foci by PET alone as either benign or malignant lesions. The same group also evaluated the added-value of PET/CT over PET in 13 patients with cervical cancer. Similarly, combined imaging was found particularly contributive for a better anatomic localization (physiological versus pathological) and characterization (benign versus malignant) of foci with increased FDG uptake, which were difficult either to localize (>1/3 foci) or to diagnose (# 1/5 foci) on PET alone (Tatsumi et al, 2003). More recently, Grisaru et al, compared the value of PET/CT versus standard imaging procedures (STD = CT/MRI) in 53 patients with gynecological cancers including 21 cervical cancers, 8 endometrial cancers, 19 ovarian cancers, 1 primary peritoneal tumor, 1 vulvar cancer, 1 vaginal cancer, 1 tubar cancer, and 1 gestational trophoblastic neoplasia (Grisaru et al, 2004). In pretreatment staging, the diagnostic accuracy of PET/CT was optimal in 15 patients with either cervical cancers (n=9) or uterine cancers (n=6). Conversely, STD had 2 false positive results (1 CT and 1 MRI) and 3 false negative results (3 CT). Hence, in 5 of out 15 patients (33%), PET/CT accurately staged the extent of disease versus CT/MRI. In post-treatment staging, PET/CT was also more sensitive and specific than STD. Among 14 patients who were previously treated for either cervical cancer (n=12) or uterine cancer (n=2), PET/CT detected additional recurrences in 8 patients (8 false negatives from STD) and ruled out a recurrence suspected by CT in 1 patient (1 false positive from STD). In this clinical setting, PET/CT was contributive in 9 of out 14 patients (64%) versus standard conventional imaging. The added-value of PET/CT was particularly significant in localizing primary uterine tumor missed by CT as well as in detecting lung metastases missed by STD protocol, spinal cord compression missed by MRI, local and distant lymph nodes missed by CT. Based on the current data, the clinical added-value of PET/CT primarily relies upon its ability to accurately localize FDG-avid sites compared to either PET alone or CT alone. So far, the role of PET/CT remains limited for the detection of non FDG-avid sites, especially normalsized metastatic nodes (i.e. microscopic tumors). In a recent study by Sironi et al, including 35 patients with early stage cervical cancer (FIGO IA-IIA), integrated PET/CT was found a reliable modality for pre-operative lymph node staging except for lesions smaller than 0.5 cm (micrometastases) (Sironi et al, 2004). These findings are in line with previous data showing the limitation of FDG PET for detecting microscopically involved pelvic nodes (Reinhardt et al, 2001; Kühnel et al, 2001; Williams et al, 2001; Belhocine et al, 2002). On the other hand, recent data showed that (un)treated cervical cancers with no FDG-avid nodal sites presented with a better prognosis than those with lymph node metastases detected by FDG PET (Grigsby et al, 2001; Grigsby et al, 2004; Yen et al, 2004). Besides, initial results from a prospective study

showed the lack of benefit of concurrent irradiation with weekly cisplatin chemotherapy (versus radiotherapy alone) in patients with cervical cancer and negative lymph nodes by FDG PET (Grigsby et al, 2005). Although the size/volume is a key-factor in the lesion detectability by PET and PET/CT, the metabolic activity of tumor is another important parameter to be considered. For instance, < 1cm nodes that are metabolically active may be detected by PET and PET/CT, while " 1cm (nodes) with a low FDG uptake (i.e. metastases with a low metabolic activity, benign nodes, irradiated nodes) may be missed by metabolic imaging. Further prospective studies are still warranted to investigate the clinical significance of FDGavid versus non FDG-non avid nodal micrometastases. Controlled trials are also needed to assess the impact of FDG PET and PET/CT in patients enrolled into conventional and new therapeutic regimens.

V. Conclusion Growing evidence indicates the usefulness of FDG PET in uterine cancers. In cervical cancers, metabolic imaging provides valuable diagnostic information in the staging, re-staging, and treatment monitoring. In many circumstances, FDG PET may actually improve the routine management of either newly diagnosed or previously treated cervical cancers. Recent data also highlight the prognostic value of FDG uptake in such malignancy. In endometrial cancer, a few reports showed the clinical added-value of metabolic imaging in posttherapy surveillance. In pre-treatment nodal staging, initial data conclude to the moderate sensitivity of FDG PET in detecting lymph node metastases. FDG PET and MRI/CT image fusion by means of either multimodality software or hybrid hardware opens promising perspectives in the assessment of gynecological cancers. Combined imaging systems allow an anatometabolic characterization of disease, which is critical for accurate staging, targeted therapy, and treatment monitoring.

Acknowledgements Many thanks to Drs. Pierre Rigo (Division of Nuclear Medicine-University Hospital of Liège) and Frédéric Kridelka (Department of Gynecology-Hospital of La Citadelle) for sharing their valuable experience in the assessment of uterine cancers with FDG PET.

References American Cancer Society website: http://www.cancer.org. Anderson MC, Coulter CAE, Mason WP, et al (1997) Malignant disease of the cervix. In: Shaw RW, Soutter WP, Stanton SI, editors. Gynecology, 2nd ed. New York: Churchill Livingston, 541-568. Ansink A, de Barros Lopes A, Naik R, Monaghan JM (1996) Recurrent stage IB cervical carcinoma: evaluation of the effectiveness of routine follow up surveillance. Br J Obstet Gynaecol 103, 1156-1158. Bar JK, Harlozinska A, Sedlaczek P, Kasiak J, Markowska J (2001) Relations between the expression of p53, c-erbB-2,

214

Cancer Therapy Vol 3, page 215 Ki-67 and HPV infection in cervical carcinomas and cervical dysplasias. Anticancer Res 21, 1001-1006. Barakat RR, Greven K, Markman M, and Thigpen JT (2001) Cancer management: A multidisciplanry Approach. In: PRR, Inc., NY. Endometrial Cancer, Fifth Edition. Belhocine T, De Barsy C, Hustinx R, Willems-Foidart J (2002) Usefulness of 18F-FDG PET in the post-therapy surveillance of endometrial carcinoma. Eur J Nucl Med Mol Imaging 29, 1132-1139. Belhocine T, Kridelka F, Thille A, et al (2003) Staging of primary cervical cancers: the role of nuclear medicine. Critical Rev Oncol Hematol 46, 275-284. Belhocine T, Thille A, Fridman V, et al (2002) Contribution of whole-body 18FDG PET imaging in the management of cervical cancer. Gynecol Oncol 87, 90-97. Belhocine T (2003) An appraisal of 18F-FDG PET imaging in post-therapy of uterine cancers: clinical evidence and a research proposal. Int J Gynecol Cancer 13, 228-233. Belhocine T (2004) 18F-FDG PET Imaging in Posttherapy Monitoring of Cervical Cancer: From Diagnosis to Prognosis. J Nucl Med 45, 1062-1064. Belhocine T (2004) Whole-body 18FDG PET plus pelvic MRI in the pre-treatment assessment of cervical cancers: an alternative to the FIGO clinical staging. Gynecol Surg 1, 95100. Benedet JL, Bender H, Jones H 3rd, Ngan HY, Pecorelli S (2000) FIGO staging classifications and clinical practice guidelines in the management of gynecologic cancers. FIGO Committee on Gynecologic Oncology. Int J Gynaecol Obstet 70, 209-262. Benedetti-Panici P, Maneschi F, Scambia G, et al (1996) Lymphatic spread of cervical cancer: an anatomical and pathological study based on 225 radical hysterectomies with systematic pelvic and aortic lymphadenectomy. Gynecol Oncol 62, 19-24. Blodgett TM, Meltzer CC, Townsend DW, et al (2002) PET/CT in staging and re-staging patients with cervical cancer. Proceedings of the SNM 49th Annual Meeting â&#x20AC;&#x201C; Poster # 1250. J Nucl Med 45, 310. Bodurka-Bevers D, Morris M, Eifel PJ, et al (2000) Posttherapy surveillance of women with cervical cancer: an outcomes analysis. Gynecol Oncol 78, 187-193. Buchsbaum HJ (1979) Extrapelvic lymph node metastasis in cervical carcinoma. Am J Obstet Gynecol 133, 814-824. Chang TC, Law KS, Hong JH, et al (2004) Positron emission tomography for unexplained elevation of serum squamous cell carcinoma antigen levels during follow-up for patients with cervical malignancies: a phase II study. Cancer 101, 164-171. Chang WC, Hung YC, Lin Cc, Shen YY, Kao CH (2004) Usefulness of FDG-PET to detect recurrent cervical cancer based on asymptomatically elevated tumor marker serum levels a preliminary report. Cancer Invest 22, 180-184. Chang YC, Yen TC, Ng KK, et al (2005) Does diabetes mellitus influence the efficacy of FDG-PET in the diagnosis of cervical cancer? Eur J Nucl Med Mol Imaging 32, in press Chi DS, Lanciano RM, and Kudelka AP (2001) Cancer management: A multidisciplanry Approach. In: PRR, Inc., NY. Cervical Cancer, Fifth Edition. Cohade C, Tatsumi M, Mourtzikos K, Bristow R, Wahl R (2003) Initial experience in imaging endometrial carcinoma with FDG and PET/CT: direct comparison with PET. J Nucl Med 44, 130P. Dellas A, Schultheiss E, Oberholzer M, Torhorst J, Gudat F (1996) Analysis of proliferative activity using Ki-67 of cervical precancerous lesions and the relationship to p53 expression. Anticancer Res 16, 3403-3407.

Gambhir SS, Czernin J, Schwimmer J, et al (2001) A tabulated summary of the FDG PET literature. J Nucl Med 42, S1S39. Cremerius U, Effert PJ, Adam G, Sabri O, Zimmy M, Wagenknecht G, Jakse G, Buell U (1998) FDG PET for detection and therapy control of metastatic germ cell tumor. J Nucl Med 39, 815-822. Grigsby PW, Dehdashti F and Siegel BA (1999) FDG-PET evaluation of recurrent endometrial carcinoma. 7th Biennial Meeting of the International Gynecologic Cancer Society; Rome, Italy, 26-30 September. Grigsby PW, Dehdashti F, Siegel BA (1999) FDG-PET Evaluation of Carcinoma of the Cervix. Clin Positron Imaging 2, 105-109. Grigsby PW, Herzog TJ (2001) Current management of patients with invasive cervical carcinoma. Clinical Obstetric and Gynecology 44, 531-537. Grigsby PW, Mutch DG, Rader J, et al (2005) Lack of benefit of concurrent chemotherapy in patients with cervical cancer and negative lymph nodes by FDG PET. Int J Radiat Oncol Biol Phys 61, 444-449. Grigsby PW, Siegel BA, Dehdashti F, and Mutch DG (2003) Posttherapy surveillance monitoring of cervical cancer by FDG-PET. Int J Radiat Oncol Biol Phys 55, 907-913. Grigsby PW, Siegel BA, Dehdashti F, Rader J, Zoberi I (2004) Post-therapy 18F-Fluorodeoxyglucose Positron Emission Tomography in Carcinoma of the Cervix: response and Outcome. Cervical cancer: combined modality therapy. J Clin Oncol. 22, 2167-2171. Grigsby PW, Siegel BA, Dehdashti F (2001) Lymph node staging by positron emission tomography in patients with carcinoma of the cervix. J Clin Oncol 19, 3745-3749. Grisaru D, Almog B, Levine C, et al (2004) The diagnostic accuracy of 18F-Fluorodeoxyglucose PET/CT in patients with gynecological malignancies. Gynecol Oncol 94, 680684. Hany TF, Steinert HC, Goerres GW, Buck A, von Schulthess GK (2002) PET diagnostic accuracy: improvement with in-line PET-CT system: initial results. Radiology 225, 575-581. Havrilesky LJ, Wong TZ, Secord AA, Berchuck A, ClarkePearson DL, Jones EJ (2003) The role of PET scanning in the detection of recurrent cervical cancer. Gynecol Oncol 90, 186-190. Horowitz NS, Dehdashti F, Herzog TJ, et al (2004) Prospective evaluation of FDG-PET for detecting pelvic and para-aortic lymph node metastasis in uterine corpus cancer. Gynecol Oncol 95, 546-551. Hricak H, Yu KK (1996) Radiology in invasive cervical cancer. AJR 167, 1101-1118. Israel O, Keidar Z, Bar-Shalom R, Gaitini D, Beck D, Amit A (2003) Hybrid PET/CT imaging with FDG in management of patients with gynecologic malignancies. J Nucl Med 44, 394P Jang HJ, Lee KH, Kim YH, et al (2002) The role of FDG PET for predicting prognosis in squamous cell type uterine cervical carcinoma patients. J Nucl Med 43, 28P. Jeffry L, Kerrou K, Camatte S, Metzger U, LeliĂ¨vre L, Talbot JN, and Lecuru F (2004) Endometriosis with FDG uptake on PET. Eur J Obst Gynecol Reprod Biol 117, 236-239. Kerr IG, Manji MF, Powe J, Bakheet S, Al Suhaibani H, Subhi J (2001) Positron emission tomography for the evaluation of metastases in patients with carcinoma of the cervix: a retrospective review. Gynecol Oncol 81, 477-480. Keys HM, Bundy BN, Stehman FB, et al (1999) Cisplatin, radiation, and adjuvant hysterectomy compared with radiation and adjuvant hysterectomy for bulky stage IB cervical carcinoma. N Engl J Med 340, 1154-1161.

215

Belhocine and Grigsby: 18FDG PET and PET-CT in uterine cancers Kikuchi Y, Sato S, and Sugimura T (1972) Hexokinase isozyme patterns of human uterine tumors. Cancer 30, 444-446. Kim E (2004) Whole-body positron emission tomography and positron emission tomography / computed tomography in gynecologic oncology. Int J Gynecol Cancer 14, 12-22. Koyama K, Okamura T, Kawabe J, et al (2003) Evaluation of 18 F-FDG PET with Bladder Irrigation in Patients with Uterine and Ovarian Tumors. J Nucl Med 44, 353-358. KĂźhnel G, Horn LC, Fischer U, et al (2001) 18F-FDG positronemission-tomography in cervical carcinoma: preliminary findings. Zentralbl Gynakol 123, 229-235. Kupets R, Covens A (2001) Is the International Federation of Gynecology and Obstetrics staging system for cervical carcinoma able to predict survival in patients with cervical carcinoma? An assessment of clinimetric properties. Cancer 92, 796-804. Lai CH, Huang KG, Yen TC, et al (2004) Restaging of Recurrent Cervical Carcinoma with Dual-Phase 18F-Fluoro-2-Deoxy-DGlucose Positron Emission Tomography. Cancer 100, 544552. Laking GR, Price PM, and EORTC functional imaging group (2003) On the development of rational standards for nuclear response evaluation. Q J Nucl Med 47, 3-7. Landoni F, Maneo A, Colomb A, et al (1997) Randomized study of radical surgery versus radiotherapy for stage Ib-IIa cervical cancer. Lancet 350, 535-540. Lemke AJ, Niehues SM, Amthauer H, Rohlfing T, Hosten N, Felix R (2004) Clinical use of digital retrospective image fusion of CT, MRI, FDG-PET, and SPECT â&#x20AC;&#x201C; fields of indications and results. Rofo 176, 1811-1818. Lerman H, Metser U, Grisaru D, Fishman A, Lievshitz G, EvenSapir E (2004) Normal and abnormal 18F-FDG endometrial and ovarian uptake in pre- and postmenopausal patients: Assessment by PET/CT. J Nucl Med 45, 266-271. Levenback C, Coleman RL, Burke TW, et al (2002) Lymphatic mapping and sentinel node identification in patients with cervix cancer undergoing radical hysterectomy and pelvic lymphadenectomy. J Clin Oncol 20, 688-693. Lin WC, Hung YC, Yeh LS, Kao CH, Yen RF, and Shen YY (2003) Usefulness of 18F-fluorodeoxyglucose positron emission tomography to detect para-aortic lymph nodal metastasis in advanced cervical cancer with negative computed tomography findings. Gynecol Oncol 89, 73-76. Ma SY, See LC, Lai CH, et al (2003) Delayed 18F-FDG PET for Detection of Paraaortic Lymph Node Metastases in Cervical Cancer Patients. J Nucl Med 44, 1775-1783. Maiman M (2002) The clinical application of serum squamous cell carcinoma antigen level monitoring in invasive cervical carcinoma. Gynecol Oncol 84, 4-6. Maisey MN (2002) Overview of clinical PET. Br J Radiol 75, S1-S5. Marshall MJ, Goldberg DM, Neal FE, and Millar DR (1978) Enzymes of glucose metabolism in carcinoma of the cervix and endometrium of the human uterus. Br J Cancer 37, 9901001. Marshall MJ, Neal FE, and Goldberg DM (1979) Isoenzymes of hexokinase, 6-phosphogluconate deshydrogenase, phosphoglucomutase and lactate deshydrogenase in uterine cancer. Br J Cancer 40, 380-390. Mendez LE, Manci N, Cantuaria G, et al (2002) Expression of Glucose Transporter-1 in Cervical Cancer and its Precursors. Gynecol Oncol 86, 138-143. Michel G, Morice, P, Castaigne D, et al (1998) Lymphatic spread in stage IB and II cervical carcinoma: anatomy and surgical implications. Obstet Gynecol 91, 360-363. Miller TR, Grigsby PW (2002) Measurement of tumor volume by PET to evaluate prognosis in patients with cervical cancer. Int J Radiat Oncol Biol Phys 53, 353-359.

Miller TR, Pinkus E, Dehdashti F, Grigsby PW (2003) Improved prognostic value of 18F-FDG PET using a simple visual analysis of tumor characteristics in patients with cervical cancer. J Nucl Med 44, 192-197. Monk BJ, Wang J, Im S, et al (2005) Rethinking the use of radiation and chemotherapy after radical hysterectomy: a clinical-pathologic analysis of a Gynecologic Oncology Group/Southwest Oncology/Radiation Therapy Oncology Group Trial. Gynecol Oncol 96, 721-728. Morgan MG, Wilkinson N, Buckley H (1998) Tumour angiogenesis and prognosis. Histopathology 32, 379. Mutic S, Grigsby MS, Daniel AL, et al ( 2001) PET-guided threedimensional treatment planning of intracavitary gynecologic implants. Int J Radiat Oncol Biol Phys 52, 1104-1110. Nakamoto Y, Eisbruch A, Achtyes ED, et al (2002) Prognostic value of positron emission tomography using F-18fluorodeoxyglucose in patients with cervical cancer undergoing radiotherapy. Gynecol Oncol 84, 289-295. Narayan K, Hicks RJ, Jobling T, Bernshaw D, McKenzie AF (2001) A comparison of MRI and PET scanning in surgically staged loco-regionally advanced cervical cancer: potential impact on treatment. Int J Gynecol Cancer 11, 263-271. Narayan K, McKenzie AF, Hicks RJ, Fisher D, Bernshaw D, Bau S (2003) Relation between FIGO stage, primary tumor volume, and presence of lymph node metastases in cervical cancer patients referred for radiotherapy. Int. J. Gynecol Cancer 13, 657-663. Olaitan A, Murdoch J, Anderson R, James J, Graham J, Barley V (2001) A critical evaluation of current protocols for the follow-up of women treated for gynecological malignancies: a pilot study. Int J Gynecol Cancer 11, 349-353. Parkin DM, Bray F, Ferlay J, Pisani P (2001) Estimating the world cancer burden: Globocan 2000. Int J Cancer 94, 153156. Pauwels EK, Ribeiro MJ, Stoot JH, et al (1998) FDG accumulation and tumor biology. Nucl Med Biol 25, 318322. Peters WA 3rd, Liu PY, Barrett RJ 2nd, et al (2000) Concurrent chemotherapy and pelvic radiation therapy compared with pelvic radiation therapy alone as adjuvant therapy after radical surgery in high-risk early-stage cancer of the cervix. J Clin Oncol 18, 1606-1613. Reinhardt MJ, Ehritt-Braun C, Vogelgesang D, et al (2001) Metastatic lymph nodes in patients with cervical cancer: detection with MR imaging and FDG PET. Radiology 218, 776-782. Rose PG, Adler LP, Rodriguez M, Faulhaber PF, Abdul-Karim FW, Miraldi F (1999) Positron emission tomography for evaluating para-aortic nodal metastasis in locally advanced cervical cancer before surgical staging: A surgicopathologic study. J Clin Oncol 17, 41-45. Rose PG, Bundy BN, Watkins EB, et al (1999) Concurrent cisplatin-based radiotherapy and chemotherapy for locally advanced cervical cancer. N Engl J Med 340, 1144-1153. Rose PG (1996) Endometrial Carcinoma. N Engl J Med 335, 640-649. Ryu SY, Kim MH, Choi SC, Choi CW, and Lee KH (2001) Detection of Early Recurrence with 18F-FDG PET in Patients with Cervical Cancer. J Nucl Med 44, 347-352. Saga T, Higashi T, Ishimori T, et al (2003) Clinical value of FDG-PET in the follow-up of post-operative patients with endometrial cancer. Ann Nucl Med 17, 197-203. Sakuragi N, Satoh C, Takeda N, et al (1999) Incidence and distribution pattern of pelvic and paraaortic lymph node metastasis in patients with stages IIB, IIA, and IIB cervical carcinoma treated with radical hysterectomy. Cancer 85, 1547-1554. Salvesen HB (2001) Routine follow up after treatment for

216

Cancer Therapy Vol 3, page 217 gynecological cancer. Tidsskr Nor Laegeforen 121, 12531265. Schaffler GJ, Groell R, Schoellnast H, et al (2000) Digital image fusion of CT and PET data sets–clinical value in abdominal/pelvic malignancies. J Comput Assist Tomogr 24, 644-647. Sedlis A, Bundy BN, Rotman MZ, Lentz SS, Muderspach LI, Zaino RJ (1999) A randomized trial of pelvic radiation therapy versus no further therapy in selected patients with stage IB carcinoma of the cervix after radical hysterectomy and pelvic lymphadenectomy: A Gynecologic Oncology Group Study. Gynecol Oncol 73, 177-83. Shumsky AG, Stuart GC, Brasher PM, et al (1994) An evaluation of routine follow-up of patients treated for endometrial carcinoma. Gynecol Oncol 55, 229-233. Singh AK, Grigsby PW, Dehdashti F, Herzog TJ, Siegel BA (2003) FDG-PET lymph node staging and survival of patients with FIGO stage IIIB cervical carcinoma. Int J Radiat Oncol Biol Phys 56, 489-493. Sironi S, Messa C, Zangheri B, Buda A, Mangioni C, Fazio F (2004) Uterine Cervical Cancer: Detection of Metastatic Lymph Nodes With Integrated FDG PET/CT. RSNA Annual Meeting. Stehman FB, Bundy BN, DiSaia PJ, Keys HM, Larson JE, and Fowler WC (1991) Carcinoma of the Cervix Treated With Radiation Therapy I. A Multi-Variate Analysis of Prognostic Variables in the Gynecologic Oncology Group. Cancer 67, 2776-2785. Sugawara Y, Eisbruch A, Kosuda S, Recker BE, Kison PV, Wahl RL (1999) Evaluation of FDG PET in patients with cervical cancer. J Nucl Med 40, 1125-1131. Sun SS, Chen TC, Yen RF, Shen YY, Changlai SP, Kao A (2000) Value of whole body 18F-fluoro-2-deoxyglucose positron emission tomography in the evaluation of recurrent cervical cancer. Anticancer Res 21, 2957-2961. Talbot JN, Grahek D, Kerrou K, et al (2001) La TEP au 18Ffluoro-2-déoxyglucose dans l'imagerie des cancers gynécologiques. Gynécol Obstét Fertil 29, 775-798. Tanaka Y, Sawada S, Murata T (1984) Relationship between lymph node metastases and prognosis in patients irradiated postoperatively for carcinoma of the uterine cervix. Acta Radiol Oncol 23, 455-459. Townsend DW, Carney J, Yap JT, Hall NC (2003) PET/CT today and tomorrow. J Nucl Med 45, S4-S14. Tran BN, Grigsby PW, Dehdashti F, Herzog TJ, Siegel BA (2003) Occult supraclavicular lymph node metastasis identified by FDG PET with carcinoma of the uterine cervix. Gynecol Oncol 90, 572-576. Tsai CC, Chang TC, Lai CH, et al (2004) Preliminary report of using FDG-PET to detect extrapelvic lesions in cervical cancer patients with enlarged pelvic lymph nodes on MRI/CT. Int J Radiat Oncol Biol Phys 58, 1506-1512. Tsai CC, Tsai CS, Ng KK, et al (2003) The impact of image fusion in resolving discrepant findings between FDG-PET and MRI/CT in patients with gynaecological cancers. Eur J Nucl Mol Imaging 30, 1674-1683. Umesaki N, Tanaka T, Miyama M, et al (2000) The role of 18Ffluoro-2-deoxy-D-glucose positron emission tomography (18F-FDG-PET) in the diagnosis of recurrence and lymph node metastasis of cervical cancer. Oncol Rep 7, 1261-1264. Unger JB, Ivy JJ, Connor P, et al (2005) Detection of Recurrent Cervical Cancer by Whole-Body FDG PET Scan in Asymptomatic and Symptomatic Women. Obstet Gynecol Surv 60, 29-31.

Van Nagell JR Jr, Roddick JW Jr, Lowin DM (1971) The staging of cervical cancer: inevitable discrepancies between clinical staging and pathologic findings. Am J Obstet Gynecol 110, 973-978. Varia MA, Bundy BN, Deppe G, et al ( 1998) Cervical carcinoma metastatic to para-aortic nodes: extended field radiation therapy with concomitant 5-fluorouracil and cisplatin chemotherapy: a gynecologic oncology group study. Int J Radiat Oncol Biol Phys 42, 1015-1023. Wahl RL (2004) Why Nearly All PET of Abdominal and Pelvic Cancers Will Be Performed as PET/CT. J Nucl Med 45, 8295. Whitney CW, Sause W, Bundy BN, et al (1999) Randomized comparison of fluorouracil plus cisplatin versus hydroxyurea as an adjunct to radiation therapy in stage IIB-IVA carcinoma of the cervix with negative para-aortic lymph nodes: a Gynecologic Oncology Group and Southwest Oncology Group study. J Clin Oncol 17, 1339-1348. Williams AD, Cousins C, Soutter WP, et al (2001) Detection of pelvic lymph node metastases in gynecologic malignancy: A comparison of CT, MR Imaging, and Positron Emission Tomography. AJR 177, 343-348. Wong TZ, Jones EL, Coleman RE (2004) Positron Emission Tomography with 2-Deoxy-2-18F-Fluoro-D-Glucose for Evaluating Local and Distant Disease in Patients with Cervical Cancer. Mol Imag Biol 6, 55-62. Yap JT, Carney JP, Hall NC, Townsend DW (2004) Imageguided cancer therapy using PET/CT. Cancer J 10, 221-233. Yeh LS, Hung YC, Shen YY, Kao CH, Lin CC, Lee CC (2002) Detecting para-aortic lymph nodal metastasis by positron emission tomography of 18F-fluorodeoxyglucose in advanced cervical cancer with negative magnetic resonance imaging findings. Oncol Rep 9, 1289-1292. Yen TC, Ng KK, Ma SY, et al (2003) Value of Dual-Phase 2Fluoro-2-Deoxy-D-Glucose Positron Emission Tomography in Cervical Cancer. J Clin Oncol 21, 3651-3658. Yen TC, See LC, Lai CH, et al (2004) 18F-FDG Uptake in Squamous Cell Carcinoma of the Cervix is Correlated with Glucose Transporter 1 Expression. J Nucl Med 45, 22-29. Yen TC, See LC, Tchang TC, et al (2004) Defining the priority of using 18F-FDG PET for recurrent cervical cancer. J Nucl Med 45, 1602-1604. Yu KK, Forstner R, Hricak H (1997) Cervical carcinoma: role of imaging. Abdom Imaging 22, 208-215.

Tarik Z Belhocine

217

Belhocine and Grigsby: 18FDG PET and PET-CT in uterine cancers

218

Cancer Therapy Vol 3, page 219 Cancer Therapy Vol 3, 219-226, 2005

Prevention of tumor progression as the ultimate goal of cancer therapy Review Article

Futoshi Okada* and Junichi Fujii Department of Biomolecular Function, Graduate School of Medical Science, Yamagata University, Yamagata, 990-9585, Japan

__________________________________________________________________________________ *Correspondence: Futoshi Okada, Ph.D., Department of Biomolecular Function, Graduate School of Medicine, Yamagata University, 2-2-2, Iidanishi, Yamagata, 990-9585, Japan; Tel: 81-23-628-5229; Fax: 81-23-628-5230; e-mail: fuokada@med.id.yamagata-u.ac.jp Key words: Prevention of tumor progression, cancer therapy, carcinogenesis, inflammation on tumor development. Abbreviations: cytotoxin-associated gene, (cagA); hypoxanthine-guanine phosphoribosyl transferase, (HGPRT); interferon, (IFN); manganese superoxide dismutase, (Mn-SOD); nicotinamide adenine dinucleotide phosphate, (NADPH); protein-bound polysaccharide K, (PSK); reactive oxygen species, (ROS); transforming growth factor, (TGF); tumor necrosis factor, (TNF)

Supported in part by Grant-in-Aid for Cancer Research (14-11, 16-1) from the Japanese Ministry of Health, Labor and Welfare; a Grant-in-Aid from the Japanese Ministry of Education. Culture, Sports, Science and Technology and grants from the Japan Society for the Promotion of Science (15390367). Received: 21 February 2005; Accepted: 8 March 2005; electronically published: March 2005

Summary Carcinogenesis takes two steps, tumor development and progression, and cancer patients’ fear of death is mainly of the latter. For its high mortality, cancer prevention, particularly in a cancer-high-risk group (inherent cancer-prone people, cancer-carriers or cancer-survivors), must be adeptly tackled. In this article, we introduce a model of inflammation-associated tumor progression, presenting the results of our experiments. From our findings, we propose a new effective cancer-prevention strategy utilizing biological mechanisms with emphasis that prevention of tumor progression is one of the most potent cancer therapies. inflammation and cancer, and shed light on inflammatorycell-derived reactive oxygen species (ROS) as a universal factor for tumor development and progression. We also introduce an inflammation-based tumor progression model and suggest theoretical prevention of tumor progression. Clinically it is not always possible to distinguish between therapy for cancer and its prevention. We would like to propose a paradigm shift to a new strategy in cancer chemoprevention.

I. Introduction Cancer death can be prevented by our efforts in three directions. First of all, we need to understand and recognize the causes of cancer and avoid them. The second is to detect tumor growth in a very early stage and to treat it as soon as possible. The third is to prevent tumor cells’ acquisition of malignant phenotypes during its growing stages at the primary site (tumor progression stage). In this article, we focus on tumor progression process which involves expansion of tumor cell population and, more importantly, tumor cells’ acquirement of aggressiveness accompanied with genetic alterations (Foulds, 1954, 1965). The overall 5-year survival rate of cancer patients is less than 20%; this is because tumor cells are converted into progressed tumor cells. Cancer patients’ fear of its mortality at the diagnosis of their primary tumor even at its early stage. But more importantly we must realize that growing tumors convert themselves into malignant ones and the progression process is indeed the menace (Landis et al, 1998). We review the causes of cancer, discuss the close link between

II. Identification of possible causes of carcinogenesis is the primary step to cancer prevention Researches in a newly emerging field of oncology which comprises biological chemistry, pathology and epidemiology have explored the basic mechanisms of carcinogenesis common in human cancers. It is generally believed that approximately 75% of all cancers are due to smoking, dietary factors or inflammation/infection (Doll and Peto, 1981; Parkin, 2000). And it is evidenced that mutagenic activities underlie commonly in the above 219

Okada and Fujii: Prevention of tumor progression factors as we have seen that typical occupational carcinogenesis and experimental carcinogenesis are both brought about by particular mutagenic carcinogens (McCann and Ames, 1976; Sugimura et al, 1976; Nagao et al, 1978; Zeiger et al, 1992). There is sufficient evidence that either environmental tobacco smoke or second-hand smoke (involuntary smoking) has strong mutagenicity (Husgafvel-Pursiainen, 2004). Diet itself contains mutagenic substances [for example, mycotoxins (IARC monographs, 1987), plant alkaloids (Laqueur, 1964) and food additives (Sano et al, 1977)]; or mutagenic substances naturally and chemically emerge following conventional cooking [i.e., heterocyclic amines (Sugimura et al, 2004)]; or a combination of the ingested meal contents [i.e., N-nitroso compounds (Bartsch, 1989)] is mutagenic. Chronic inflammation is also mutagenic because activated inflammatory cells release mutagenic intermediates (reactive nitrogen oxides) (Okada, 2002). Since smoking and diet closely link to individual lifestyle and taste, appropriate guidance on these should be started in health education, hopefully at young age. However, inflammation/infection-associated carcinogenesis needs to be intervened otherwise. It was reported that about 16% (1,450,000 cases) of the worldwide incidences of cancer in 1990 was attributable to inflammation (Pisani, 1997). The rate is considerably high, and we speculate that inflammation-caused cancer incidences are persistently high throughout the following years. In the next segment, we will specify the inflammation/infection-associated cancers.

play a role in inducing genetic alterations in proliferating epithelial cells, acting like a tumor initiator. Epidemiological studies have revealed apparent connections between parasite infection and tumor development. Opisthorchis viverrini or Clonorchis sinensis has been known to be associated with cholangiocarcinoma frequent in South-East Asia (Parkin et al 1991; Haswell-Elkins et al 1992); or schistosomiasis (Schistosoma haematobium) accompanies bladder cancer frequent in Northern Africa and the Middle East, respectively (Davis et al 1984; Kantor et al 1984; La Vecchia et al 1991). One of the mechanisms is verified that parasite infestation induces chronic inflammation and that upregulation of nitric oxide synthase at the inflamed region increases mutagenic nitrosation potential in the host (Srivatanakul et al, 1991; Ohshima et al, 1992). Hepatitis viruses, especially hepatitis B and C viruses, are thought to cause hepatocellular carcinoma (Tiollais et al, 1985; Hayashi et al, 1999). While hepatitis viruses do not involve any known oncogenes, it is thought that the integrated virus sequence may activate cellular proto-oncogene (Himeno et al, 1988; Pasquinelli et al, 1992). This is an example that persistent inflammation can induce mutations in tumor suppressor genes and extensive chromosomal abnormalities in hepatocytes (Kasai and Nishimura, 1986; Cheng et al, 1992; Hsu et al, 1993; Kuroki et al, 1995; Kato et al, 2001). This process is explained that large envelope protein of the hepatitis virus is used for generating ROS, which triggers oxidative DNA damage to hepatocytes (Hagen, 1994). Whereas the pathogens that cause typical inflammatory diseases as mentioned above are unrelated to each other, the essential pathological changes are commonly accompanied by continuous inflammation and infiltration of activated phagocytes. It is thus assumed that continuous generation of ROS by phagocytes is injurious to cells. This could, in turn, cause compensatory cell proliferation, which will effectively accumulate DNA damage and gene mutations; all these steps lead to tumor development. Generation of ROS from activated inflammatory phagocytes is mainly through respiratory metabolism (Badwey and Karnovsky, 1980). Phagocytes have mutagenic activity as evidenced in the following. By using the bacteria-based mutation assay (Ames assay), it was demonstrated that phagocytes had mutagenic activity and the mutation was inhibited by addition of antioxidative enzymes or antioxidants, and that phagocyte-induced mutagenesis was led by ROS (Weitzman and Stossel, 1981; Weitzman and Stossel, 1982; Barak et al, 1983; Fulton et al, 1984). If the nicotinamide adenine dinucleotide phosphate (NADPH)-oxidase (ROS generating system) in phagocytes is disrupted, mutagenicity is markedly reduced. From base-pair mutation at the hypoxanthine-guanine phosphoribosyl transferase (HGPRT) locus we can detect mutations in mammalian cells. There are reports that phagocyte-derived ROS induce mutations (Weitzman and Stossel, 1984) and that the mutations are suppressed by addition of ROS scavengers (Yamashina et al, 1986). Weitzman et al, (1985) demonstrated definitive

III. Impact of inflammation on tumor development and its possible reactive intermediates The relationship between inflammation and cancer was first reported by Virchow in 1863, in which he reflects lymphoreticular infiltrates cause incipient cancer at the sites of chronic inflammation (Balkwill and Mantovani, 2001). Chronic infection and tissue inflammation are well recognized as risk factors for various types of human cancers as described below (Heppner and Dorcey, 1988; Ohshima and Bartsch, 1994), and we know that reactive oxygen species (ROS) generated in inflamed tissues can cause injury to cells and damage to DNA, which could also contribute to tumor development (Ames et al, 1993; Halliwell, 1994; Ohshima and Bartsch, 1994). In this chapter, we overview tangible clinical and experimental evidence that inflammation and its-derived ROS are powerful endogenous mediators for tumor development. Chronic infection with Helicobacter pylori, the most common bacterial pathogen of the gastrointestinal tract in humans, is associated with gastroduodenal inflammation, peptic ulceration, and gastric carcinoma (Harris et al, 1996). The degree of Helicobacter pylori infection and the severity of mucosal injury are directly correlated with the extent of infiltration of neutrophils (Kozol et al, 1991; Bayerdorffer et al, 1992). The cytotoxin-associated gene (cagA)-coded protein of Helicobacter pylori is believed to induce proliferation of gastric epithelial cells, acting like a tumor promoter. And emigrated neutrophil-derived ROS

220

Cancer Therapy Vol 3, page 221 evidence that phagocyte-derived ROS were carcinogenic. They discovered that human neutrophils directly converted murine fibroblast cells into malignant tumors in their coculturing in vitro (Weitzman et al, 1985). The same conversion was also seen after the fibroblast cells were exposed to ROS-generating system in vitro. From these, we may conclude that inflammatory phagocytes and the phagocytes-derived ROS are one of the driving forces for tumor development. ROS have been recognized as a mediator of carcinogenesis. Innumerable papers have demonstrated that ROS contribute to both initiation and promotion of carcinogenesis. Since ROS mainly consist of superoxide anion (O2-_), hydrogen peroxide (H2O2), and hydroxyl radical (OH_), they act not only as mutagen but also as complete carcinogen (Shamberger 1972; McCann et al, 1975; Ito et al, 1981; Kennedy et al, 1984; Zimmerman and Cerutti 1984). There is evidence that prolonged oxidative stress can result in cell injury and promote various stages of carcinogenesis (Cerutti, 1985; Kozumbo et al, 1985). And in general, a number of initiators and promoters of cancer have been shown to produce ROS, and moreover ROS are involved in the activation of carcinogens (Floyd et al, 1978; Ames 1983; Sun, 1990; Nakayama et al, 1983). Pryor suggested possible five mechanisms responsible for the activation and binding of chemical carcinogens to DNA; in three of them ROS are involved (Pryor 1986, 1987). Namely, ROS are an intrinsic factor for initiation and promotion of carcinogenesis.

IV. In vivo model of inflammationbased tumor development and progression We established a unique animal model in which we can consistently observe that regressive and non-metastatic tumors naturally progress into malignant tumors acquiring highly tumorigenic and metastatic behavior with genetic alterations in the concomitant presence of inflammation (Okada et al, 1992; Habelhah et al, 1999; Kobayashi et al, 2002; Tazawa et al, 2003). As shown in the Figure 1A, QR-32 tumor cells are benign and do not develop tumors or form metastasis after subcutaneous (2 x 105 cells) or intravenous (1 x 106 cells) injection into normal mice (Ishikawa et al, 1987). However, they are converted to grow lethally after coimplanted with a piece of gelatin sponge that induces inflammation at the site of implantation (Okada et al, 1992). This step mimics tumor development from precancerous lesion (or benign tumors); we defined this as tumor development stage. The gelatin sponge used in this model serves as a specific bed where tumor cells can efficiently contact infiltrated inflammatory cells. One advantage of this model is that we are able to see the final step of carcinogenesis, i.e., tumor progression stage. In this stage, tumor cell itself acquires malignant phenotypes such as metastasis, invasion, recurrence, drug resistance and so on. To see whether primarily growing tumors acquire malignant phenotypes, we established culture cell lines from the primarily growing tumors and examined their metastatic potential in other syngeneic mice (Figure 1B) (Okada et al, 1992).

Figure 1. Experimental model of tumor progression of benign mouse fibrosarcoma cells by foreign-body-induced inflammation. (A). QR-32 tumor cells were very weakly tumorigenic and non-metastatic when 2x105 cells and 1x106 cells were injected subcutaneously and intravenously in normal syngeneic C57BL/6 mice, respectively. (B). One x 105 QR-32 tumor cells were injected into a pre-inserted piece of gelatin sponge at the subcutaneous space. They grew lethally in the mice. The mice were then sacrificed for establishment of culture tumor cell lines from the arising tumors. Tumor progression was assessed from the metastatic ability of individual culture cell lines after injection of the cells into normal mice (i.v., 1x106 cells).

221

Okada and Fujii: Prevention of tumor progression We confirmed the involvement of inflammation in carcinogenesis in this model, and elucidated as follows. Separately inflamed cells by gelatin sponge implantation converted QR-32 tumor cells into tumorigenic ones after they were mixed-injected into mice (Okada et al, 1992). On the other hand, acquisition of metastatic phenotypes was impaired in mice with depletion of neutrophils infiltrated into gelatin sponge by administration of antineutrophil antibody (Tazawa et al, 2003). We further confirmed the phenomena by using integrin-beta-2knockout mice (C57BL/6JItgb2tm1Bay; CD18-deficient) that had impaired neutrophil infiltration into inflamed sites; in the knockout mice, neutrophils hardly infiltrated into the gelatin sponge and the tumors showed dramatically suppressed metastatic phenotype as compared with those in wild-type mice (Tazawa et al, 2003). Immunohistochemical analysis demonstrated that expressions of 8-hydroxy-2'-deoxyguanosine, a marker of ROS-mediated nucleic acid damage, in the tumor tissues were parallel to those of neutrophils (Tazawa et al, 2003). Those lines of evidence show that inflammation and itsderived ROS induce not only tumor development but also accelerate progression of tumor cells.

been used in adjuvant immunochemotherapy for gastric and colorectal cancer patients in Japan (Torisu et al, 1990; Mitomi et al, 1992; Ohwada et al, 2004). PSK is one of the immunopotentiators, which activates host immune systems, for instance, increasing production of several cytokines, thereby stimulating antitumor effector cells (Habelhah et al, 1998). We have found that PSK increases antioxidative enzymes, especially Mn-SOD, locally at the site of tumor tissues and inhibits inflammation-promoted tumor progression in mice (Habelhah et al, 1998). However, in the animal model, neither primary tumor growth nor tumor incidence was reduced by PSK administration, while malignancy of primarily growing tumors was markedly reduced. Namely, PSK neither has direct therapeutic effects nor exerts SOD activity as far as examined in the QR-32 tumor cell system. Figure 2 shows the mechanism by which tumor progression is prevented. Initially PSK activates immune effector cells. The activated immune effector cells produce SOD-inducible cytokines (IFN-gamma and TNF-alpha), and then those secreted SOD-inducible cytokines secondarily induce SOD at tumor growing sites. Furthermore, production of immune-cell-derived TGF-beta, which is known to lower Mn-SOD levels (Kayanoki et al, 1994), is reduced in the tumor tissues treated with PSK (Habelhah et al, 1998). These findings were confirmed by re-constituted in vitro system. An addition of IFN-gamma combined with TNFalpha into cultured QR-32 cells elevated the Mn-SOD level more effectively than did any of the cytokines singly. Furthermore, in vitro treatment of QR-32 cells with TGFbeta lowered the Mn-SOD levels (Habelhah et al, 1998). These results suggest that PSK prevents inflammationstimulated tumor progression of QR-32 cells by physiologically increasing Mn-SOD through modulation of inflammatory cytokines; that is, by increasing IFNgamma and TNF-alpha and decreasing TGF-beta. The advantages of our suggested method are (i) side effect is avoided because the target protein is synthesized in the hostâ&#x20AC;&#x2122;s physiological condition and (ii) by using clinically available existing drugs, there is no need to wait governmental approval of the use.

V. Theoretical prevention of inflammation-based tumor progression Among the regressive QR tumor clones, a variation was observed in the frequency of tumor progression after co-implantation with gelatin sponge. We determined that the variation was due to intracellular antioxidative enzyme (manganese-superoxide dismutase; Mn-SOD) levels in the QR tumors. An inverse correlation was observed between the contents/activities of Mn-SOD and the progression rate of QR tumor clones (Okada et al, 1999). In other words, the QR tumor cells with low Mn-SOD levels are prone to tumor progression stimulated by the presence of inflammation. Theoretically upregulation of Mn-SOD in tumor cells or tumor tissues will prevent their acquisition of malignant properties. There are several methods to elevate SOD levels in tumor cells or tumor tissues. Since SOD behaves as other proteins do, it is necessary to modify the protein characteristics so that it can escape from degradation or digestion in the body (Beckman et al, 1988; Oda et al, 1989). Another way to elevate SOD levels is by transfection of its DNA into either tumor cells directly, or mesenchymal cells (i.e., fibroblast cells), which are then transplanted into desired organs (Tanaka et al, 2001). Unfortunately, we do not have orally available SOD to date. Even if it could be administered orally, only its small amount (approximately less than 10%) would be absorbed through gastrointestinal tract (Giri and Misra, 1984), and most of it would be digested, similarly to other proteins, before being transported into the blood stream. Apart from these vexatious preparations, a new and most effective method would be induction of SOD by utilizing host physiological responses to ready-made drugs, which has in fact already been utilized clinically. Orally available protein-bound polysaccharide K (PSK), extracted from the mycelia of Coriolus versicolor, has

VI. Conclusion Chemoprevention is defined as the use of specific agents to suppress or reverse carcinogenesis and thereby to prevent the development of cancers for general population (Greenwald and Kelloff, 1996). Cancer chemoprevention may therefore target various processes of carcinogenesis as depicted by Kelloff (1996). He grouped the approaches of chemoprevention into three: (i) To avoid exposure to known cancer-causing agents; in this way formation, activation or uptake of carcinogens is inhibited and binding of carcinogens to DNA is reduced. Moreover, it enhances deactivation/detoxication of carcinogens and DNA repair systems. (ii) To induce substances which are antioxidant/anti-inflammatory and scavengers of ROS molecules. It includes induction of antioxidative enzymes and antioxidative scavengers, i.e., N-acetyl-L-cysteine, beta-carotene, vitamin C & E; inhibition of arachidonic acid metabolism is also included in this group. (iii) To

222

Cancer Therapy Vol 3, page 223

Figure 2. Biological mechanisms for induction of Mn-SOD in tumor cells by administering immunopotentiator.

Figure 3. Inflammation-based tumor progression and its possible prevention by antioxidative enzymes physiologically induced in tumor tissues.

223

Okada and Fujii: Prevention of tumor progression Balkwill F and Mantovani A (2001) Inflammation and cancer: back to Virchow? Lancet 357, 539-545. Barak M, Ulitzur S, Merzbach D (1983) Phagocytosis-induced mutagenesis in bacteria. Mutat Res 121, 7-16. Bartsch H, Ohshima H, Pignatelli B and Calmels S (1989) Human exposure to endogenous N-nitroso compounds: quantitative estimates in subjects at high risk for cancer of the oral cavity, oesophagus, stomatch and urinary bladder. Cancer Surv 8, 335-362. Bayerdorffer E, Lehn N, Hatz R, Mannes GA, Oertel H, Sauerbruch T, Stolte M (1992) Difference in expression of Helicobacter pylori gastritis in antrum and body. Gastroenterology 102, 1575-1582. Beckman JS, Minor RL, White CW, Repine JE, Rosen GM and Freeman BA (1988) Superoxide dismutase and catalase conjugated to polyethylene glycol increases endothelial enzyme activity and oxidant resistance. J Biol Chem 263, 6884-6892. Cerutti PA (1985) Prooxidant states and tumor promotion. Science 227, 375-381. Cheng KC, Cahill DS, Kasai H, Nishimura S, Loeb LA (1992) 8Hydroxyguanine, an abundant form of oxidative DNA damage, causes G-T and A-C substitutions. J Biol Chem 267, 166-172. Davis CP, Cohen MS, Gruber MB, Anderson MD, Warren MM (1984) Urothelial hyperplasia and neoplasia: a response to chronic urinary tract infections in rats. J Urol 132, 10251031. Doll R and Peto R (1981) The causes of cancer: quantitative estimates of avoidable risks of cancer in the United States today. J Natl Cancer Inst 66, 1191–1308. Floyd RA, Soong LM, Stuart MA Reigh DL (1978) Spin trapping of free radicals produced from nitrosoamine carcinogens. Photochem Photobiol 28, 857-862. Foulds L ( 1954) The experimental study of tumor progression: a review. Cancer Res 14, 327-339. Foulds L (1965) Multiple etiologic factors in neoplastic development. Cancer Res 25, 1339-1347. Fulton AM, Loveless SE, Heppner GH (1984) Mutagenic activity of tumor-associated macrophages in Salmonella typhimurium strains TA98 and TA100. Cancer Res 44, 4308-4311. Giri SN and Misra HP (1984) Fate of superoxide dismutase in mice following oral rout of administration. Med Biol 62, 285. Greenwald P, Kelloff GJ (1996) The role of chemoprevention in cancer control. In: Stewart BW, McGregor D, Kleihues P, editors. Principles of Chemoprevention. IARC Sci Publ 139, 13–22. Habelhah H, Okada F, Nakai K, Choi SK, Hamada J-I, Kobayashi M and Hosokawa M (1998) Polysaccharide K induses Mn superoxide dismutase (Mn-SOD) in tumor tissues and inhibits malignant progression of QR-32 tumor cells: possible roles of interferon gamma, tumor necrosis factor alpha and transforming growth factor beta in Mn-SOD induction by polysaccharide K. Cancer Immunol Immunother 46, 338-344. Habelhah H, Okada F, Kobayashi M, Nakai K, Choi S, Hamada J, Moriuchi T, Kaya M, Yoshida K, Fujinaga K, Hosokawa M (1999) Increased E1AF expression in mouse fibrosarcoma promotes metastasis through induction of MT1-MMP expression. Oncogene 18, 1771-1776. Hagen TM, Huang S, Curnutte J, Fowler P, Martinez V, Wehr CM, Ames BN, Chisari FV (1994) Extensive oxidative DNA damage in hepatocytes of transgenic mice with chronic active hepatitis destined to develop hepatocellular carcinoma. Proc Natl Acad Sci USA 91, 12808-12812.

provide anti-proliferation/anti-progression molecules. Modulators of signal transduction and hormonal/growth factor activity, and inhibitors of polyamine metabolism are included. Enhancement of host defense mechanisms is also included in this group. Our proposed strategy of chemoprevention would be in groups (ii) and (iii); we focus on prevention of tumor cell’s acquisition of malignant phenotypes (quality but not quantity of tumor cells). It is therefore particularly for high-risk groups (i.e., inherent cancer-prone people, cancer-carriers or cancersurvivors). In our experimental model, the immunomodulator PSK has no effect on the primary tumor growth, but the frequency of acquisition of malignant phenotypes is reduced by physiologically induced antioxidative enzymes in tumor cells. The mechanism is shown in Figure 3. It is unfortunate that most anti-tumor drugs are evaluated by their potency of reducing primary tumor growth, and drug potentials to prevent the conversion of tumor from benign to malignant tend to be automatically overlooked. This is largely because there are few screening systems for evaluating such cancer-preventive drugs. In this respect, we need to pay our attention to re-screening the ready-foruse drugs using animal models. Advantages are more in using the ready-for-use drugs rather than in newly determining natural or chemically synthesized products for this purpose for the following reasons: (i) We can avoid consuming huge amounts of funds to conduct serial clinical trials (phase I, II and III studies) to pick up new drugs; (ii) The target population of the chemoprevention is a high-risk group for specific cancers. It should be feasible to use the anti-tumor drugs which we evaluate effective in the group. In our proposed strategy, “therapy” and “prevention” may not be distinguished since we intend to utilize anti-tumor drugs. In this sense we may need to alter paradigms of cancer prevention and its therapy because the group of people we aim at are cancer high-risk group. We dare to propose that prevention of tumor progression should proceed evaluation whether the current cancer therapies could reduce the mortality of cancer-carriers or cancer survivors instead of we argue which is superior. In other words, the preventive therapy may include chemotherapy against premalignant or benign tumors. We believe it will reduce cancer mortality and prolong patients’ survival with quality of life in the near future.

Acknowledgements We thank Dr. Hiroshi Kobayashi for invaluable advice and Miss Masako Yanome for her help in English revision of this manuscript.

References Ames BN (1983) Dietary carcinogens and anticarcinogens. Oxygen radicals and degenerative diseases. Science 221, 1256-1264. Ames BN, Shigenaga M, Hagen TM (1993) Oxidants, antioxidants, and the degenerative disease of aging. Proc Natl Acad Sci USA 90, 7915-7922. Badwey JA, Karnovsky ML (1980) Active oxygen species and the functions of phagocytic leukocytes. Annu Rev Biochem 49, 695-726.

224

Cancer Therapy Vol 3, page 225 Halliwell B (1994) Free radicals, antioxidants, and human disease: curiosity, cause, or consequence? Lancet 344, 721724. Harris PR, Mobley HLT, Perez-Perez GI, Blaser MJ, Smith PD (1996) Helicobacter pylori urease is a potent stimulus of mononuclear pagocyte activation and inflammatory cytokine production. Gastroenterology 111, 419-425. Haswell-Elkins MR, Satarug S, Elkins DB (1992) Opisthorchis viverrini infection in northeast Thailand and its relationship to cholangiocarcinoma. J Gastroenterol Hepatol 7, 538548. Hayashi J, Aoki H, Arakawa Y, Hino O (1999) Hepatitis C virus and hepatocarcinogenesis. Intervirology 42, 205-210. Heppner G and Dorcey L (1988) Macrophages and development of cancer. In: Heppner GH Fulton AM eds. Macrophages and cancer, Florida, Boca Raton, CRC Press, 197-208. Himeno Y, Fukuda Y, Hatanaka M, Imura H (1988) Expression of oncogenes in human liver disease. Liver 8, 208-212. Hsu IC, Tokiwa T, Bennett W, Metcalf RA, Welsh JA, Sun T, Harris CC ( 1993) p53 gene mutation and integrated hepatitis B viral DNA sequences in human liver cancer cell lines. Carcinogenesis 14, 987-992. Husgafvel-Pursiainen K (2004) Genotoxicity of environmental tobacco smoke: a review. Mutat Res 567, 427-445. IARC monographs on the evaluation of carcinogenic risks to humans. Overall evaluations of carcinogenicity: An updating of IARC monographs volumes 1 to 42 (1987) IARC monographs supplement 7, 83–87. Ishikawa M, Okada F, Hamada J-I, Hosokawa M and Kobayashi H (1987) Changes in the tumorigenic and metastatic properties of tumor cells treated with quercetin or 5azacytidine. Int J Cancer 39, 338-342. Ito A, Watanabe H, Naito M, Naito Y (1981) Induction of duodenal tumors in mice by oral administration of hydrogen peroxide. Gann 72, 174-175. Kantor AF, Hartge P, Hoover RN, Narayana AS, Sullivan JW, Fraumeni JF Jr. (1984) Urinary tract infection and risk of bladder cancer. Am J Epidemiol 119, 510-515. Kasai H, Nishimura S (1986) Hydroxylation of guanine in nucleosides and DNA at the C-8 position by heated glucose and oxygen radical-forming agents. Environ Health Perspect 67, 111-116. Kato J, Kobune M, Nakamura T, Kuroiwa G, Takada K, Takimoto R, Sato Y, Fujikawa K, Takahashi M, Takayama T, Ikeda T, Niitsu Y (2001) Normalization of elevated hepatic 8-hydroxy-2’-deoxyguanosine levels in chronic hepatitis C patients by phlebotomy and low iron diet. Cancer Res 61, 8697-8702. Kayanoki Y, Fujii J, Suzuki K, Kawata S, Matsuzawa Y, Taniguchi N (1994) Suppression of antioxidative enzyme expression by transforming growth factor-beta 1 in rat hepatocytes. J Biol Chem 269, 15488-15492. Kelloff GJ, Boone CW, Steele VE, Crowell JA, Lubet RA, Greenwald P, Hawk ET, Fay JR, Sigman CC (1996) Mechanistic considerations in the evaluation of chemopreventive data. IARC Sci Publ 139, 203–219. Kennedy AR, Troll W, Little JB (1984) Role of free radicals in the initiation and promotion of radiation transformation in vitro. Carcinogenesis 5, 1213-1218. Kobayashi T, Okada F, Fujii N, Tomita N, Ito S, Tazawa H, Aoyama T, Choi SK, Shibata T, Fujita H, Hosokawa M (2002) Thymosin beta 4 regulates motility and metastasis of malignant mouse fibrosarcoma cells. Am J Pathol 160, 869882. Kozol R, Domanowski A, Jaszewski R, Czanko R, McCurdy B, Prasad M, Fromm B, Calzada R (1991) Neutrophil chemotaxis in gastric mucosa: a signal-to-response comparison. Dig Dis Sci 36, 1277-1280.

Kozumbo WJ, Trush MA, Kensler TW (1985) Are free radicals involved in tumor promotion? Chem Biol Interact 54, 199207. Kuroki T, Fujiwara Y, Tsuchiya E, Nakamori S, Imaoka S, Kanematsu T, Nakamura Y (1995) Accumulation of genetic changes during development and progression of hepatocellular carcinoma: loss of heterozygosity on chromosome arm 1p occurs at an early stage of hepatocarcinogenesis. Genes Chromosomes Cancer 13, 163-167. Landis SH, Murray T, Bolden S and Wingo PA (1998) Cancer statistics, 1998. CA Cancer J Clin 48, 6-29. La Vecchia C, Negri E, D’Avanzo B, Savoldelli R, Franceschi S (1991) Genital and urinary tract diseases and bladder cancer. Cancer Res 51, 629-631. Laqueur GL (1964) Carcinogenic effects of cycad meal and cycasin, methyl-azoxymethanol glycoside, in rats and effects of cycasin in germ free rats. Fed Proc 23, 1386-1388. McCann J, Choi E, Yamasaki E, Ames BN (1975) Detection of carcinogens as mutagens in the Salmonella/microsome test: assay of 300 chemicals. Proc Natl Acad Sci USA 72, 51355139. Mitomi T, Tsuchiya S, Iijima N, Aso K, Suzuki K, Nishiyama K, Amano T, Takahashi T, Murayama N, Oka H, Noto T, Ogawa N (1992) Randomized, controlled study on adjuvant immunochemotherapy with PSK in curatively resected colorectal cancer. The Cooperative Study Group of Surgical Adjuvant Immunochemotherapy for Cancer of Colon and Rectum (Kanagawa). Dis Colon Rectum 35, 123–130. McCann J and Ames BN (1976) Detection of carcinogens as mutagens in the Salmonella/microsome test: assay of 300 chemicals: discussion. Proc Natl Acad Sci USA 73, 950–954. Nagao M, Sugimura T, and Matsushima T (1978) Environmental mutagens and carcinogens. Annu Rev Genet 12, 117–159. Nakayama T, Kimura T, Kodama M, Nagata C (1983) Generation of hydrogen peroxide and superoxide anion from active metabolites of naphthylamines and aminoazo dyes: its possible role in carcinogenesis. Carcinogenesis 4, 765-769. Oda T, Akaike T, Hamamoto T, Suzuki F, Hirano T, Maeda H (1989) Oxygen radicals in influenza-induced pathogenesis and treatment with pyran polymer-conjugated SOD. Science 244, 974-976. Ohshima H, Brouet IM, Bandaletova T, Adachi H, Oguchi S, Iida S, Kurashima Y, Morishita Y, Sugimura T, Esumi H (1992) Polyclonal antibody against an inducible form of nitric oxide synthase purified from the liver of rats treated with Propionibacterium acnes and lipopolysaccharide. Biochem Biophys Res Commun 187, 1291-1297. Ohshima H and Bartsch H (1994) Chronic infections and inflammatory processes as cancer risk factors; possible role of nitric oxide in carcinogenesis. Mutation Res 305, 253564. Ohwada S, Ikeya T, Yokomori T, Kusaba T, Roppongi T, Takahashi T, Nakamura S, Kakinuma S, Iwazaki S, Ishikawa H, Kawate S, Nakajima T and Morishita Y (2004) Adjuvant immunochemotherapy with oral Tegafur/Uracil plus PSK in patients with stage II or III colorectal cancer: a randomised controlled study. Br J Cancer 90, 1003-1010. Okada F., Hosokawa M, Hamada JI, Hasegawa J, Kato M, Mizutani M, Ren J, Takeichi N, Kobayashi H (1992) Malignant progression of a mouse fibrosarcoma by host cells reactive to a foreign body (gelatin sponge). Br J Cancer 66, 635-639. Okada F, Nakai K, Kobayashi T, Shibata T, Tagami S, Kawakami Y, Kitazawa T, Kominami R, Yoshimura S, Suzuki K, Taniguchi N, Inanami O, Kuwabara M, Kishida H, Nakae D, Konishi Y, Moriuchi T, Hosokawa M (1999)

225

Okada and Fujii: Prevention of tumor progression Inflammatory-cell-mediated tumour progression and minisatellite mutation correlate with the decrease of antioxidative enzymes in murine fibrosarcoma cells. Br J Cancer 79, 377-385. Okada F (2002) Inflammation and free radicals in tumor development and progression. Redox Report 7, 357-368. Parkin DM (2001) Global cancer statistics in the year 2000. Lancet Oncol 2, 533–543. Pasquinelli C, Bhavani K, Chisari FV (1992) Multiple oncogenes and tumor suppressor genes are structurally and functionally intact during hepatocarcinogenesis in hepatitis B virus transgenic mice. Cancer Res 52, 2823-2829. Pisani P, Parkin DM, Munoz N, Ferlay J (1997) Cancer and infection: estimates of the attributable fraction in 1990. Cancer Epidemiol Biomark Prev 6, 387-400. Pryor WA (1986) Cancer and free radicals. In: Shankel DM, Hartman P, Kada T, Hollaender A eds. Antimutagenesis and anticarcinogenesis. New York, Plenum Press 45-59. Pryor WA (1987) The involvement of free radicals in chemical carcinogenesis. In: Cerutti PA, Nygaard OF, Simic MG, eds. Anticarcinogenesis and radiation protection. New York, Plenum Press, 1-9. Sano T, Kawachi T, Matsukura N, Sasajima K and Sugimura T (1977) Carcinogenicity of food additive, AF-2, in hamsters and mice. Z Krebsforsch 89, 61-68. Shamberger RJ (1972) Increase of peroxidation in carcinogenesis. J Natl Cancer Inst 48, 1491-1497. Sugimura T, Sato S, Nagao M, Yahagi T, Matsushima T, Seino Y, Takeuchi M, and Kawachi T (1976) Overlapping of carcinogens and mutagens. In: Magee PN, Takayama S, Sugimura T, Matushima T, editors. Fundamentals in cancer prevention. Univ Tokyo Press/Baltimore, 191–215. Sugimura T, Wakabayashi K, Nakagama H and Nagao M (2004) Heterocyclic amines: Mutagens/carcinogens produced during cooking of meat and fish. Cancer Sci 95, 290–299. Srivatanakul P, Parkin DM, Khlat M, Chenvidhya D, Chotiwan P, Insiripong S, L’Abbe KA, Wild CP (1991) Liver cancer in Thailand. I. A case-control study of cholangiocarcinoma. Int J Cancer 48, 329-332. Srivatanakul P, Ohshima H, Khlat M, Parkin M, Sukaryodhin S, Brouet I, Bartsch H (1991) Opisthorchis viverrini infestation and endogenous nitrosamines as risk factors for cholangiocarcinoma in Thailand. Int J Cancer 48, 821-825. Sun Y (1990) Free radicals, antioxidant enzymes, and carcinogenesis. Free Rad Biol Med 8, 583-599. Tanaka M, Kogawa K, Nakamura K, Nishihori Y, Kuribayashi K, Hagiwara S, Muramatsu H, Sakamaki S, Niitsu Y (2001) Anti-metastatic gene therapy utilizing subcutaneous inoculation of EC-SOD gene transduced autologous fibroblast suppressed lung metastasis of Meth-A cells and 3LL cells in mice. Gene Ther 8, 149-156. Tazawa H, Okada F, Kobayashi T, Tada M, Mori Y, Une Y, Sendo F, Kobayashi M and Hosokawa M (2003) Infiltration

of neutrophils is required for acquisition of metastatic phenotype of benign murine fibrosarcoma cells: Implication of inflammation-associated carcinogenesis and tumor progression. Am J Pathol 163, 2221-2232. Tiollais P, Pourcel C, Dejean A (1985) The hepatitis B virus. Nature 317, 489-495. Torisu M, Hayashi Y, Ishimitsu T, Fujimura T, Iwasaki K, Katano M, Yamamoto H, Kimura Y, Takesue M, Kondo M, Nomoto K (1990) Significant prolongation of disease-free period gained by oral polysaccharide K (PSK) administration after curative surgical operation of colorectal cancer. Cancer Immunol Immunother 31, 261–268. Weitzman SA, Stossel TP (1981) Mutation caused by human phagocytes. Science 212, 546-547. Weitzman SA, Stossel TP (1982) Effects of oxygen radical scavengers and antioxidants on phagocyte induced mutagenesis. J Immunol 128, 2770-2772. Weitzman SA, Stossel TP (1984) Phagocyte-induced mutation in Chinese hamster ovary cells. Cancer Lett 22, 337-341. Weitzman SA, Weitberg AB, Clark EP, Stossel TP (1985) Phagocytes as carcinogens: malignant transformation produced by human neutrophils. Science 227, 1231-1233. Yamashina K, Miller BE, Heppner GH (1986) Macrophageinduced induction of drug-resistance variants in a mouse mammary tumor cell line. Cancer Res 46, 2396-2401. Zeiger E, Anderson B, Haworth S, Lawlor T, and Mortelmans K (1992) Salmonella mutagenicity tests. V. Results from the testing of 311 chemicals. Environ Mol Mutagen 19, 2–141. Zimmerman R, Cerutti P (1984) Active oxygen acts as a promoter of transformation in mouse embryo C3H/10T1/2/C18 fibroblasts. Proc Natl Acad Sci USA 81, 2085-2087.

From left to right Drs. Futoshi Okada and Junichi Fujii

226

Cancer Therapy Vol 3, page 227 Cancer Therapy Vol 3, 227-230, 2005

Outcome of subsequent pregnancy in patients with gestational trophoblastic disease Research Article

Azam Sadat Mousavi*, Afsaneh Tehranian, Nadereh Behtash, Fatemeh Ghaemmaghami, Mitra Modares, Roudabeh Pourghorban, Zahra Samizadeh Department of Gynecology and Oncology Vali asr Hospital, Reproductive Health Research Center University of Tehran, Iran 2004

__________________________________________________________________________________ *Correspondence: Azam Sadat Mousavi Department of Gynecology and Oncology Vali asr Hospital, Reproductive Health Research Center University of Tehran, Iran 2004e-mail: fatemeh_ayat@yahoo.com Key words: Gestational Trophoblastic Disease, Subsequent pregnancy Abbreviations: Actinomycin, (ACT-D); Gestational Trophoblastic disease, (GTD); methotrexate, (MTX); premature rupture of membranes, (PROM) Received: 19 January 2005; Revised: 8 March 2005 Accepted: 28 March 2005; electronically published: April 2005

Summary Gestational Trophoblastic disease (GTD) is only neoplasia that is really curable and Patients can preserve Fertility after cure with different medical and surgical treatment modalities. This study followed 213 patients with GTD who were treated in valli-e-Asr hospital, Tehran Iran. 47 (22.6%) Patients conceived at first year after pregnancy was permitted, and 33 (70.2%) women be come pregnant within 2 years after permission. They had 33 (70.2%) subsequent conceptions. 6 (12.7%) women had secondary infertility, and 8 (17%) cases continued contraception because they were scared of side effects of chemotherapy on their fetus. There were 20 (60.6%) term live births, 3 (9%) premature deliveries, 1 (30%) stillbirth, 5 (12.1%) abortion. This study showed that the rates of Term and preterm deliveries, stillbirth, abortion, ectopic pregnancy and congenital anomalies in former GTD patients, are consistent with the overall average rates. (ACT-D), etopeside, chemotherapy regimen.

I. Introduction Gestational trophoblastic diseases (GTD) Comprise a group of interrelated diseases including molar pregnancy, invasive mole, Placental-site trophoblastic tumor, and choriocarcinoma that have varying propensities for local invasion and metastases (Bagshawe, 1976). However in the past, the outcome of disease was disastrous for young patients, modern therapy has resulted in high cure rates (>90%), and preservation of Fertility (Newland et al, 1986). Since the disease occurs mostly in women under the age of 35 (Kim et al, 1995), most of them desire future pregnancy after treatment. In actuality, 42% to 63% of GTD Patients fear the result of later pregnancies (Berkowitz et al, 1994). There were limited data concerning the first pregnancy, which might be at greatest risk of genetic damages or teratogenic effects induced by the anticancer drugs (Kim et al, 199). In this study, we conducted research on the outcome of first pregnancy in patients treated for molar pregnancy and persistent GTT by methotrexate (MTX), actinomycin

and

several

combination

II. Patients and Methods From 1998 To 2003, 213 Patients with GTD were treated in valli-e-Asr Hospital. We evaluated subsequent pregnancy after one year remission 123 patients with mole who underwent suction curettage, and had natural cured, and 90 GTT (67 Patients with low Risk, and 23 patients with high risk GTT), who were cured after chemotherapy. Among 90 patients, 60 (66.6%) were in stage I, 9 (10%) in stage II, 13 (14.4%) in stage III and 8 (8.8%) in stage IV. Patients with low Risk GTT were initially treated with single agent chemotherapy (MTX, ACT-D), and high Risk were treated with a combination regimen consisting of etoposide, MTX, ACTD, and cisplatinum (EMA-EP) (Newland et al, 1986; Surwit and Childers, 1991). Patients were advised not to become pregnant, for at least one year after completing treatment.

III. Results Patients age ranged between 20 and 36, averaging 27.5 years. 47 (22.06%) Patients desire for subsequent pregnancy at first year after permission, and 33 (70.2%)

227

Mousavi et al: Outcome of subsequent pregnancy in patients with GTD women become pregnant within 2 years after permission. Between 1998 and 2003, 213 patients with GTD were treated at our center, 47 patients who were successfully treated, desired future pregnancies. They had 33 (70.2%) subsequent conceptions. 6 (12.7%) women had secondary infertility, and 8 (17%) cases continued contraception, because they were scared of side effects of chemotherapy on their fetus. The pregnancy outcome is shown in Table 1. There were 20 (60.6%) term live births, 3 (9.09%) premature deliveries, 1 (3.03%) still birth, 4 (12.1%) abortion and ectopic pregnancy was not. Congenital anomaly occurred in 2 (6.6%) cases, with no particular anomaly detected. Repeat mole observed in 5 (15.12%) of cases ,3 of them had previous molar pregnancy. cesarean section was done in 7 (21.2%) of deliveries. The most common indication for cesarean section was placenta previa that occurred in 7 (21.2%) cases. The premature rupture of membranes (PROM) occurred in 7 (23/3%) cases, as the most common antepartum complication. In addition, there were 3 (9.09%) preterm labor, 3 (9.9%) cases of pregnancy â&#x20AC;&#x201C; induced hypertension (PIH), 2 (6.6%) cases of third trimester hemorrhage, and 4 (13.2%) postpartum bleeding. Neonatal sex and weight characteristics are shown in Table 2.

IV. Discussion Gestational trophoblastic diseases occur more often in women with the age of 20 to 40 years, during which period they can conceive. Since the discovery of effective chemotherapy, most patients even in the setting of widespread metstases attain remission, while preserving fertility. Nevertheless, patients and partners fear related to future pregnancies, especially the possibility of recurrent disease, or fetal anomalies. Therefore data related to subsequent pregnancy outcome after treatment for GTD are essential. This study Showed that the rates of term and preterm deliveries, still birth, abortion, ectopic pregnancy, and congenital anomalies in former GTD patients, are consistent with the overall average rates. Data from other centers similarly show that the subsequent pregnancy experience in patients treated for GTD, is similar to that of general population (Goldstein et al, 1984; Berkowitz et al, 1994; Kim et al, 1998). In GTT patients who received anticancer drugs, which are preferentially toxic to rapidly dividing cells, such as developing follicles in ovaries, exists a possibility that anticancer medicine, may affect conceivability or generation of the fetus, and therefore the result of pregnancy are very controversial. In addition infertility associated with ACT-D and vincristine treatment (Rustin et al, 1984), and specific toxicities to gonads caused by etoposide have been reported (Rustin et al, 1996; Matsui et al, 1997). However, several previous studies (Goldstein et al, 1984; Rustin et al, 1984; Surwit and Childers, 1991; Berkowitz et al, 1994; Kim et al, 1998) reported that chemotherapy does not influence later pregnancies. Woolas et al, (1998) did not observe a difference in conception rate or pregnancy outcome between patients who were treated with single agent MTX and those who received multiple â&#x20AC;&#x201C; agent chemotherapy. However, as pointed out by Van Thiel et al (1970), most of the mutations are recessive and so, may not be easily detected in the first generation of the patients. Observation over several generations would be required. None of our patients treated with chemotherapy developed premature ovarian failure. Secondary infertility occurred in 6 (12,7%) cases. However, as reported in another study, it was 4.4% (Berkowitz et al, 1987). The other fear expressed by patients, is repetition of mole. According to some studies, the rate of repeat mole increases to 1% (Goldstein et al, 1984; Berkowitz et al, 1994). In the present series, repeat mole Occurred in 5 (15.12%) cases, and in GTT patients, accrued in 1 (3%). 3 of 5 patients pregnancies were after two moles. This number of repeat mole could be a result of low socioeconomic state of our patients and our hospital is a referral centre for complicated patients. The only remarkable obstetric complication was placenta previa, as noted by Ross, (1976). This may be the result of the destruction of endometrium by disease itself and repeated curettage. Therefore more attention should be paid to the management of these patients. Rates related to neonatal sex and weight were similar to these in normal pregnancies, as reported by Song et al, (1988).

Table 1. Pregnancy outcomes in women with GTD Outcome Total pregnancies Term delivery Preterm delivery Still birth Spontaneous abortion Therapeutic abortion Ectopic pregnancy Repeat mole Congenital anomaly Cesarean section

Mole No of cases (%) 20 (60.6%) 12 (60%) 3 (9.09) 0

GTT No of cases (%) 13 (39.3%) 8 (40%) 0 1 (3.02) 3 (9.9%)

1 0

4 (12.12%) 0

1 (3%) 2 (6.6%)

6 (21/7%)

1 (7.6%)

Table 2. Neonatal sex and weight

Sex

Male Female <2 2-2.5 2-5-3 Weigh (kg) 3-3.5 3.5-4 >4 Total

No of cases 6 17 2 2 3 8 5 3 23

% 26 74 8.7 8.7 13.04 34.7 21.7 13.04 100 228

Cancer Therapy Vol 3, page 229 Newland ES, Bagishawe KD, begent RHJ, et al (1986) Development in chemotherapy for median and high risk patient with gestational trophoblastic tumors. Br J obstet Gynecol 93: 63-9. Parazzini F, Mangili G, Belloni C, La Vecchia C, Liati P, Marabini R (1988) The problem of identification of prognostic factors for persistent trophoblastic disease. Gynecol Oncol, 57-62. Ross GT (1976) Congenital anomalies among children born of mothers receiving chemotherapy for gestational trophoblastic neoplasms. Cancer 37, 1043-7. Rustin GJ, Newlands ES, Lutz JM, Holden L, Bagshawe KD, Hiscox JG, Foskett M, Fuller S, Short D (1996) Combination but no single-agent methotrexate chemotherapy for gestational trophoblastic tumors increases the incidence of second tumors. J Clin Oncol 14, 2769-73. Rustin GJS, Booth M, Dent J, Salt S, Rustin F, Bagshawe KD (1984) pregnancy after cytotoxic chemotherapy for gestational trophoblastic tumours. Brit Med J (Clin Res Ed) 288, 103-6. Song HZ, Wu PC, Wang YE, Yang XY, Dong SY (1988) Pregnancy outcomes after successful chemotherapy for choriocarcinoma and invasive mole: long-term follow-up. Am J Obstet Gynecol 158, 538-45. Surwit EA, Childers JA (1991) High-risk metastatic gestational trophoblastic disease. A new dose-intensive, multiagent chemotherapeutic regimen. J Reprod Med 36, 45-8. Van Thiel DH, Ross GT, Lipsett MB (1970) Pregnancies after chemotherapy of trophoblastic neoplasms. Science 169, 1326-7. Woolas RP, Bower M, Newlands ES, Seckl M, Short D, Holden L (1998) Influence of chemotherapy for gestational trophoblastic disease on subsequent pregnancy outcome. Br J Obstet Gynaecol 105, 1032-5.

V. Conclusions Patients after successful treatment of GTD can expect a normal outcome in subsequent pregnancies (SooKate KHOO, 2003). In addition, the anticancer drugs used to treat GTT patients may not have harmful effects on later pregnancies. Later pregnancies require careful monitoring with early ultrasound and HCG follow up.

References Bagshawe KD (1976) Risk and prognostic factors in trophoblastic neoplasia. Cancer 38, 1373 -85. Berkowitz RS, Bernstein MR, Laborde O, Goldstein DP (1994) Subsequent pregnancy experience in patients with gestational trophoblastic disease. New England Trophoblastic Disease Center, 1965-1992. J Reprod Med. Mar 39, 228-32. Berkowitz RS, Goldstein DP, Bernstein MR, Sablinska B (1987) Subsequent pregnancy outcome in patients with molar pregnancy and gestational trophoblastic tumors. J Reprod Med 32. 680-4. Goldstein DP, Berkowitz RS, Bernstein MR (1984) eproductive performance after molar pregnancy and gestational trophoblastic tumors. Clin Obstet Gynecol 27, 221-7. Kim JH, Kim KS, BAEKIS, et al (1995) A clinical study on gestational trophoblastic disease. Kor J obstet Gynecol 38: 1510-17. Kim JH, Park DC, Bae SN, Namkoong SE, Kim SJ (1998) Subsequent reproductive experience after treatment for gestational trophoblastic disease. Gynecol Oncol 71, 108-12. Khoo SK (2003) Clinical aspects of gestational trophoblastic disease: A review based partly on 25-year experience of a statewide registry. Aust N Z J Obstet Gynaecol 43, 280289. Matsui H, Seki K, Sekiya S, Takamizawa H ( 1997) Reproductive status in GTD treated with etoposide. J Reprod Med. 42, 104-10.

229

Mousavi et al: Outcome of subsequent pregnancy in patients with GTD

230

Cancer Therapy Vol 3, page 231 Cancer Therapy Vol 3, 231-236, 2005

Cervical cancer screening Review Article

Malihe Hasanzadeh and Nadereh Behtash* Gynecology Oncology Department, Vali â&#x20AC;&#x201C;Asr Hospital, Tehran University of Medical Sciences, Keshavarz Blvd., Tehran 14194, Iran

__________________________________________________________________________________ *Correspondence: Nadereh Behtash, Associate Professor, Gynecologist Oncologist, Tehran University of Medical Sciences. Gynecology Oncology Department, Vali-e-Asr Hospital, Imam Khomeini Hospital Complex, Keshavarz Blvd., Tehran 14194, Iran. Phone: #98-21-6939320, Fax: #98-21-6937321, E-mail: valrec2@yahoo.com, nadbehtash@yahoo.com Key words: Cervical cancer screening, cervical cytology, Pap smear, Human papilloma virus, Cervicography, Speculoscopy, Truscan (Polarprobe), Visual inspection with acetic acid (VIA) Abbreviations: cervical intraepithelial neoplasi,a (CIN); human papilomavirus, (HPV); Papilloma viruses, (PV); Visual inspection with acetic acid, (VIA) Received: 28 February 2005; Accepted: 8 March 2005; electronically published: April 2005

Summary Cervical cancer is the second most common cancer in women throughout the world and it is the leading cause of cancer death among the women in underdeveloped countries. Regarding the known etiology, availability of the organ, the possibility of proper screening test and the long latency between the precancerous lesion and the full blown clinical cancer, screening programs have been able to drastically curtail the incidence and fatality rate of the disease. The extent of the reduction in mortality achieved is related directly to the proportion of the population that has been screened. In this article, we discuss about different screening methods for cervical cancer.

beginning of a screening program in a previous unscreened population, by detecting prevalent cases of invasive cancer in earlier stages. Although it has not been proved in a prospective randomized study, all investigators credit screening as a major contributor to this reduction in death rate. In contrast to the industrialized world, cancer of the cervix remains the primary cancer killer in women in third-world countries (Disia and Cresman, 2002). During the last decade there has been increasing emphasis on cervical cancer screening in both governmental health services and private medical practitioners in our country (Annual report of Tehran university of medical sciences, district cancer registry (TUMS- DCR), 1997; Behtash et al, 2003). Cancer deaths may also be prevented by detecting disease at a stage when it is more curable. To be successful, a screening program must be directed at a suitable disease with a suitable screening test (Cole and Morrison, 1980). A suitable disease must be one that has serious consequences, as most cancers do. Treatment must be available so that when such therapy is applied to screendetected (preclinical) disease, it will be more effective than when applied after symptoms of the disease have appeared. Also, the preclinical phase of the disease must

I. Introduction Invasive squamous cell carcinoma of the cervix is the end stage of a process beginning with atypical transformation of cervical epithelium at the squamocolumnar junction, leading to cervical intraepithelial neoplasia (CIN) of advancing grades and eventual invasive disease (Berek et al, 2000). Cervical cancer is the second most common cancer in women throughout the world and it is the leading cause of cancer death among women in underdeveloped countries (Solar et al, 2000; Cohn de and Herzog, 2001; Naud et al, 2001). There is convincing evidence that cytologic screening programs are effective in reducing mortality from carcinoma of the cervix. The extent of the reduction in mortality achieved is related directly to the proportion of the population that has been screened. In fact all studies worldwide show that screening for cancer not only decreases mortality but also probably does so by decreasing the incidence. Numerous paper and lengthy discussions have focused on the optimal screening interval, unfortunately numerous recommendations during the last decade and a half have resulted in a confused public and dissatisfied professionals. Screening decreases cervical cancer mortality by detecting pre-invasive disease and, specially at the 231

Hasanzadeh and Behtash: Cervical cancer screening be long enough that the chances are good that a person will be screened. There must also be a suitable screening test as defined by simplicity, acceptability to patients, low cost, and high validity (Berek et al, 2000).

The sample is unrolled onto the slide in the opposite direction from which it was collected by twirling the handle of the brush. Based on a meta- analysis of 84 appropriately designed and conducted studies, the Agency for Health Care Policy and Research reported that conventional cytology has a specificity of 98% and a sensitivity of 51%. It has become clear the sensitivity of conventional cytology is even lower that traditionally recognized (Apgar et al, 2002). However, even with this limited sensitivity, if three consecutive tests are negative, there is less than a 1% chance that the patient will have a cervical abnormality(Rock and Jones, 2003). A false- negative Papanicolaou smear may result from either screening or interpretation problems. Screening problems include lesions that do not shed cells or that are not sampled by the clinician, or, sometimes, the diagnostic cells are not transferred from the spatula or collection device to the glass slide(Rock and Jones, 2003), Rarely, the slide preparation or staining is unsatisfactory. In other patients, problems with interpretation include failure to identify abnormal cells or misinterpretation of cells that are diagnosed as reactive or metaplastic when a dysplastic lesion exists. Various studies have shown the women who are diagnosed with invasive cervical cancer after a reportedly "negative" Papanicolaou smear, most often have abnormal cells on review of their slides. The diagnostic cells may be few in number or obscured by blood or inflammatory changes (Rock and Jones, 2003).

II. Terminology in cervical cytology George Papanicolaou devised the first system of reporting cervical cytology results and based the classification on the degree of certainty that malignant cells were present (Davey et al, 1992). The current cytologic terminology, the Bethesda system was the result of the work of an expert panel which convened in 1988 under the auspices of the National Cancer Institute. It was revised in 1991 and again in 2001 (National Cancer Institute Workshop, 1989).

III. The cervical cytology After the introduction of cervical cytology for cancer screening more than 50 years ago, multiple screening programs from all parts of the world have reported decreased rates of invasive cervical cancer and decreased death rates from a malignancy that had previously been the number one worldwide cause of cancer death in women(Disia and Cresman, 2002). Despite the effectiveness of cervical cytology screening programs, there are several limitations of Papaniclaou smear screening. A single Pap smear has a sensitivity of only about 51% (Apgar et al, 2002). The cytologic sample should not be collected during the menstrual period. The patient should avoid vaginal medications, vaginal contraceptive or duches during the 48 hours before the appointment and intercourse is not recommended on the night before or the day of the examination(Apgar et al, 2002). From the standpoint of obtaining ideal cytology, postpartum Pap smears should not be performed until at least 6 or even 8 weeks after delivery, by which time the cervix has undergone reparative changes (Rarick and Tchabo, 1994). If the woman is postmenopausal and previous smears have lacked endocervical cells or have demonstrated atrophy with inflammation, the cervix may be primed with 3 weeks of treatment with intravaginal estrogen cream followed by repeat cytologic sampling use of a combination of the Ayre spatula for sampling the ectocervix and a brush for sampling the endocervix has been shown to be superior to other techniques for obtaining a conventional Pap smear (Toffler et al, 1993). The quality of the smear can be improved by using the spatula first, followed by the endocervical brush, because fewer smears will be obscured by blood (Eisenberger et al, 1997). The spatula is first placed at the cervical os, using the end the best conforms to the cervical anatomy. It is rotated 360 degrees about the circumference of the maintaining contact with the ectocervix. The sample smeared on the slide must be fixed immediately. Both slides of the spatula should be smeared on the slide. The brush is then inserted in to the os and rotated 180 degrees similarly.

IV. Liquid-based, thinâ&#x20AC;&#x201C;layer cytology To decrease the false- negative rate of cervical cytology, attempts have been made to improve both specimen collection and quality and to reduce errors of interpretation. Over the past several years, several liquidbased techniques have been approved by Food and Drug Administration in United States. Those techniques differ from the conventional method of Papaniclaou smear, once the clinician obtain a scraping of the squamo columnar junction and transformation zone, the spatula and brush are dipped and agitated in a small bottle of fixation solution to elute the cell rather than being smeared on a glass slide. Once in the lab, a machine prepares a slide containing about 40,000 representative epithelial cells in a thin layer. The slide is the stained and reviewed by the cytologist (Rock and Jones, 2003). Liquid- based, thin -layer technology was developed to address the five major limitation posed by conventional Pap smear: failure to capture the entire specimen, inadequate fixation, random distribution of abnormal cells, obscuring elements, and technical variability in the quality of the smear. Despite the limitations of the current data, more than 500,000 subjects have been studied, with a preponderance of data indicating a significant benefit of liquidbased, thinlayer technology in the detection of cervical cancer precancer lesions and in the improvement of specimen adequacy (Apgar et al, 2002). Only one published study to date failed to find more squamous intraepithelial lesion in the liquidbased slides 232

Cancer Therapy Vol 3, page 233 than in the conventional Pap smear, showing a nonsignificant 3% decrease in the detection of squamous intraepithelial lesions (Takahashi and Naito, 1997). Liquid-based cytology has been shown to aid in reducing the proportion of ASCUS diagnoses, probably based on improvements in both the fixation and the quality of the slide. Also Ashfaq et al reported a signigicant improvement in the detection of adenocarcinoma of the cervix, with a 65% decrease in the false negative rate for the diagnosis of adenocarcinoma by Thin-prep over the conventional Pap smear, as well as 64% increase in the specificity of a diagnosis of AGUS or adenocarcinoma (Ashfaq et al, 1999). Re-training of cytotechnologists on liquid-based cytology is needed because the characteristics of the cells differ from conventional cytology.

hybridization and quantification by chemiluminescence reaction to identify the presence of any of 13 different, oncogenic types HPV. Because HPV is difficult to culture one or more of three nucleic acid- based tests have been used for detecting and typing HPV in specimens: the Polymerase Chain Reaction, the Hybrid Capture II System and In Situ Hybridization (Apgar et al, 2002). Nevertheless, HPV testing is easy to perform and is a relatively inexpensive test that can be automated in the laboratory and requires no interpretation (a problem with the Papanicolaou test). HPV testing has been shown to be 15% to 20% more sensitive than the conventional Pap smear and at least 10% more sensitive than liquidbased Pap smears while exhibiting an equivalent specificity in the relevant defined subgroups of women (Cuzick et al, 1999; Krumholz, 2000; Wright et al, 2000). The most compelling data for clinical utility of HPV DNA testing in patient management relates to women with ASCUS Pap smears. Based on data, the immediate HPVbased triage of ASCUS would result in a sensitivity of 90% to 96% compared with 75% to 85% for the repeat Pap smear (Kuperman et al, 2000). The Pap smear was slightly more specific than HPV DNA testing for the presence of high grade cervical disease (Apgar et al, 2002). HPV testing does not appear to be beneficial in young women, who are known to have predominantly transient HPV infection. Thus, most HPV screening strategies call for HPV DNA testing in women older than 30 years (Clavel et al, 1999). HPV testing combined with cytology is a reasonable approach in elderly women in order to increase the screening interval to 3-5 years (Fehr and Welti, 2004).

V. Computer-assisted diagnosis These techniques have been used mostly for quality control to identify slides that have been read as normal by cytotechnology screeners but that have cellular characteristics recognized by the computer as suspicious (Duggan, 2000). There is good evidence to suggest that computerassisted diagnosis is even better when liquidbased, thinlayer slides are used because the background is much cleaner and there are fewer cell clumps with diagnostic cells obscuring another. Although the initial cost of a computer- based system is large, considerable saving should be realized by the around- the-clock work reduced need for cytotechnologists who could concentrate on the diagnostic evaluation of high- risk slides identified by the computer on primary screening (de Villiers, 1997). More clinical experience with these computer techniques is needed but results are promising.

VII. Adjunctive testing A. Cervicography

VI. Human papilloma virus typing

Cervicography has been proposed as a adjunctive test that would increase the sensitivity and specificity of the Pap test in detecting precancerous and invasive cervical disease. Cervicography is not promoted as an independent or stand â&#x20AC;&#x201C; alone test. In 1980, Adolf Stafl, invented a diagnostic methods, he called cervicography using an apparatus he called the cervicograph. The procedure uses the cerviscope camera to take a color picture of the cervix after 5% acetic acid has been applied to it. The film is developed in to 35mm slides, and the resulting slide image is projected on to a screen and evaluated by an expert colposcopist. Cervigram are reported in one of four categories: negative, atypical, positive, and technically defective. Early studies of cervicography reported a sensitivity the ranged from 89% to 92% for the detection of highgrade lesions or invasive disease, but the specificity was low. Changes on the cervigram report form have resulted in increased specificity, but at the expense of a decreased sensitivity as low as 49.2% in one study (Stafl, 1981; Tawa et al, 1988). In several studies, cervicography has detected cervical cancer when the cervical cytology was normal(Apgar et al, 2002).

Papilloma viruses (PV) are ubiquitous microorganisms that cause productive and/ or latent infections in a wide variety of species and tissues. To date, more than 90 types of human papilomavirus (HPV) have been detected (de Villiers, 1997). Many of the newly discovered HPV types in the male and female anogenital tract were associated with cervical cancer and cancer precursors. The most prevalent anogenital HPV can be divided in to three groups: low, intermediate and high oncogenic risk. Emerging technologies such as HPV vaccines (Kulasingam and Myers, 2003), HPV tests (Mandelblatt et al, 2002) and enhanced pap screening methods are leading policy markers to evaluate new guidelines for incorporating these technologies into current care practices, and to consider changes to the frequency of cervical cancer screening and management of cervical HPV- related disease (Insinga et al, 2004). HPV testing in the past has been inaccurate and the complex laboratory techniques are not conductive to large volume clinical work. However, with the newer secondgeneration Hybrid Capture techniques, these problems seem to have been resolved. Current technology uses DNA

233

Hasanzadeh and Behtash: Cervical cancer screening In addition to being as an adjunctive test, cervicography has been used as a valuable research tool, for chart documentation, for teaching colposcopy recognition skills, and in the testing and monitoring of colposcopic skills (Apgar et al, 2002).

approach in underdeveloped countries (Ghaemmaghami et al, 2004; Millogo et al, 2004). The major concern about VIA test is its low specificity (a high false- positive rate), which means that many subjects must be recalled for colposcopy (Sankaranarayanan et al, 1997). Advantages of VIA are easy learning, inexpensiveness, and immediate availability to assess results. Thus, VIA is likely to assume a feasible method of screening in cervical cancer in many parts of the world, especially in poorly resourced locations, where largescale Papanicolaou smear screening is not available and establishing and maintaining the quality of screening program based on cytology is difficult. However, there is much to be learned concerning the most effective techniques for training provides (both medical and paramedical) to detect acetowhite lesions with the naked eye (Ghaemmaghami et al, 2004). VIA decreased the number of patients lost at followup (Jeronimo et al, 2005)

B. Visual methods 1. Speculoscopy The performance of colposcopy involves significant clinician time and financial expenditures. Colposcopy requires special training, is expensive, and is not available in the majority of clinical setting. Therefore, it has not been used during routine screening. Colposcopy is a diagnostic test, however, visual test may also be used as screening tools. The false- positive rate of a visual screening tool may appear higher if the gold standard (colposcopically directed biopsy) misses some disease (Buxton et al, 1991; Massad et al, 1996). The appearance of intravaginal structures is improved using chemiluminescent light energy,compared with using bright room light. Visualization of the cervix and lower genital tract with speculoscopy is indicated whenever a patient is having a pap smear for cervical cancer screening. Speculoscopy is no longer used. Speculoscopy visualizes the cervix with blue white chemiluminescent illumination and low power, portable magnification following the application of dilute acetic acid. According to published data screening with chemiluminescence, as opposed to other light sources, imparts the overcall rate. Colposcopy is a more sensitive test than speculoscopy for very small lesions (Wertlake et al, 1997). Speculoscopy can be effectively performed by all clinicians currently performing Pap smears, including nurse practitiones, with an improvement in screening sensitivity of 200% to 300% (Edwards et al, 1997; Wertlake et al, 1997). The negative predictive value of the combined speculoscopy and Pap smear (Pap Sure) is more than 99% and provides that option of widened screening intervals in women who test negative. A study comparing the conventional Pap test performed usually with Pap Sure performed biannually showed Pap Sure to be cost- effective while reducing the cervical cancer prevalence and death rate using a Markov prediction model (Taylor et al, 2000).

3. Truscan (Polarprobe) The Truscan device employs a real time approach to the detection of tissue abnormalities. The device includes a pen- shaped handpiece that is connected by a cable to a console containing a microprocessor control module and a digital signal processor. The handpiece makes contact with the cervix, emitting low- level electrical pulses and optical signals. The probe alerts the operator through the array of lights on the probe handle if proper contact is being made between the probe on the cervix. When an electrical voltage is applied to tissue and a bruptly turned off, the tissue behaves like a decaying battery, lasting for a fraction of a second. Because both the decay time and the waveform will differ among different types of tissue, the voltage decay waveform can provide a dynamic signature of the tissue that can assist in its classification. Truscan also uses the transmission and scattering properties of electromagnetic radiation in tissue, in a process called diffuse reflectance. By combining the electrical decay and spectroscopic information from a particular area on the cervix, Truscan is able, by means of a classification algorithm, to categorize the tissue. Seventeen tissue types have been programmed in to the system and divided to three categories: normal, lowgrade abnormality, and cancer or high grade abnormality. Truscan has a significantly better sensitivity and a lower false- positive rate than does repeat cytology (Wundermann et al, 1995; Singer, 1997; Quek, 1999). Women experienced less anxiety, less pain and fewer after effects like bleeding and discomfort with Truscan than with the Pap smear (Campion et al, 1988). This method have been conducted or are being conducted in several centers in different countries for data collection refine the tissue classification algorithm. A smaller- diameter handpiece is being developed to enable tissue measurements within the endocervical canal. In addition, the technology is potentially applicable to other sites in the body.

2. Visual inspection with acetic acid (VIA) Papanicolaou smear has been the norm for cervical cancer screening for many years in developed countries. However, in most underdeveloped countries, screening program are not routinely available (Wesley et al, 1997; Bulmenthal et al, 2001). VIA meets most generally agreed criteria of a good screening test (Bulmenthal et al, 2001). In this method, at first, 3-5% acetic acid applicate on the cervix. The cervix was examined often 60 (second) under adequate light (100 w lamp). Several studies have shown the potential value of visual inspection with acetic acid (VIA) as a screening 234

Cancer Therapy Vol 3, page 235 Jeronimo J, Morales O, Horna J, Pariona J, Manrique J, Rubinos J, Takahashi R(2005)Visual inspection with acetic acid for cervical cancer screening outside of low-resource settings. Pan Am J Public Health 17(1),1-5. Krumholz BA (2000) Value of Human Papillomavirus testing. Am J Obstet Gynecol 182, 479-480. Kulasingam SL, Myers ER ( 2003) Potential health and economic impact of adding a Human Papillomavirus vaccine to screening programs. JAMA 290, 781-9. Kuperman L, Krumholz BA (2000) The triage of women with ASCUS cytology using human papillomavirus DNA testing. J Lower Gen Tract Dis 4, 1-6. Mandelblatt JS, Lawrence EF, Womack SM, Jacobson D, Yi B, H wany YT et al (2002) Benefits and costs of using HPV testing to screen for cervical cancer. JAMA 287, 2372-81. Massad LS, Halperin CJ, Bitterman P. (1996) Correlation between colposcopically directed biopsy and cervical loop excision. Gynecol Oncol 60, 400-403. Millogo FT, Akotionga M, Lankoande J. (2004) Cervix cancer screening in a health district (Burkina Faso) by voluntary biopsies after the application of acetic acid and lugol. Bull Soc Pathol Exot 97, 135-138. Naud P, Matos J, Hammes L, Prolla J, Schwartsmann G, Vetorazzi J, Quadros C, Gomes T, Lemos A, D'ávila A, ManfróI A, Marc C, Berti C, Born C, Vettori D, Santos D, Dias E, Cislaghi G (2001) Cervical cancer screening in porto Alegre, Brazil, alternative methods for detecting cancer precursors in developing country. J Lower Genital Tract Dis 1, 24-28. No authors listed (1989) National Cancer Institute Workshop the 1988 Bethesda system for reporting cervical/ vaginal cytological diagnoses. JAMA 262, 931-934. Quek SC (1999) A comparative study of the polarprobe with histopathology and repeat cytology in women with abnormal referral smears. Proceedings of the British society of colposcopy and cervical pathology, Annual conference, 1999 April 8-10, Sutherland, England. Birmingham, England, British Society of Colposcopy and Cervical Pathology. Rarick TL, Tchabo JG (1994) Timing of the postpartum Papanicoalaou smear. Obstet Gynecol 83, 761-765. Rock JA, Jones III HW (2003) Cervical cancer precursors and their management in The Linde's Operative Gynecology, Ninth Edition by Lippincott Williams and Wilkins 45, 13511373. Sankaranarayanan R, Syamalakunary B, Wesley R, et al (1997) Visual inspection as a screening test for cervical cancer control in developing countries. In, franco E, Monsonego J. eds. Developments in cervical cancer screening and prevention. Oxford, Blackwell Sciences 411, 21. Singer A (1997) Clinical experience with the usage of the polarprobe. Proceedings of the EuROGIN third international congress, 1997 March 24- 27, Paris, France. Paris, European Research Organization on Genital infection and Neoplasia. Solar ME, Gaffikine L, Blumenthat P (2000) Cervical cancer screening in developing countries, primary care update. Obstet Gynecol 7, 118- 23. Stafl A (1981) Cervicography, A new method for cervical cancer detection. Am J Obstet Gynecol 139, 815. Takahashi M, Naito M (1997) Application of the CytoRich monolayer preparation system for cervical cytology. A prelude to automated primary screening. Acta Cytol 41, 1785-1789. Tawa K, Forsythe A, Cove JK, Saltz A, Peters HW, Watring WG. (1988) A comparison of the Papanicolaou smear and the cervigram, sensitivity, specificity, and cost analysis. Obstet Gynecol 71, 229-235. Taylor L, Sorensen S, Ray N, Halpern MT, Harper DM (2000) Cost-effectiveness of the conventional Papanicolaou test with

References Annual report of Tehran university of medical sciences, district cancer registry (TUMS- DCR) (1997). Apgar BS, Spitzer M, Brotzman GL, Ignatavicius DD (2002) Colposcopy: Principles and Practice: An Integrated Textbook and Atlas. Philadelphia, Saunders Company 3, 52-56. Ashfaq R, Gibbons D, Vela C et al (1999) ThinPrep Pap Test. Accuracy for glandular disease. Acta Cytol 43, 81-85. Behtash N, Mousavi A, Mohit M, Modares M et al (2003) Simple hysterectomy in the presence of invasive cervical cancer in Iran. Int J Gynecol Cancer 13, 177-181. Berek JS, Hacker NF (2000) Epidemiology and Biostatistics, practical Gynecologic Oncology, third edition, by Lippincott Williams and Wilkins 7, 258. Blumenthal PD, Gaffikin L, Chirenje ZM, McGrath J, Womack S, Shah K. (2001) Adjunctive testing for cervical cancer in low resource settings with visual inspection, HPV, and the Pap smear. Int J Gynaecol Obstet 72, 47-53. Buxton EJ, Luesley DM, Shafi MI, Rollason M. (1991) Colposcopically directed punch biopsy, A potentially misleading investigation. Br J Obstet Gynecol 98, 12731276. Campion MJ, Brown JR, McCance DJ, Atia W, Edwards R, Cuzick J, Singer A. (1988) Psychosexual trauma of an abnormal cervical smear. Br J Obstet Gynecol 95, 175-181. Clavel C, Masure M, Bory JP, Putaud I, Mangeonjean C, Lorenzato M, Gabriel R, Quereux C, Birembaut P. (1999) Hybrid Capture II-based human papillomavirus detection, a sensitive test to detect in routine high-grade. Br J Cancer 80, 1306-1311. Cohn de, Herzog TJ (2001) News innovations in cervical cancer screening. Clin Obstet Gynecol 44, 538- 49. Cole P, Morrison A (1980) Basic issues in population screening for cancer. J Natl Cancer Inst 64, 1263-1272. Cuzick J, Beverley E, Ho L, Terry G, Sapper H, Mielzynska I, Lorincz A, Chan WK, Krausz T, Soutter P. (1999) HPV testing in primary screening of older women. Br J Cancer 81, 554-558. Davey DD, Nielsen ML, Rosenstock W, Kline TS (1992) Terminology and specimen adequacy in cervicovaginal cytology, the college of American pathologists Interlaboratory comparison program Experience. Arch Pothol Lab Med 116, 903-907. de Villiers EM (1997) Papillomavirus and HPV typing. Clin Dermatol 15, 199-206. Disia PJ, Cresman WT (2002) Preinvasive disease of the cervix, in Disaia PJ, Creasman WT, editors. Clin Gynecol Oncol. 6th ed. St. Louis, Mosby year book 1, 1-35. Duggan MA (2000) Papnet –assisted, primary screening of cervico vaginal smears. Eur J Gynecol Oncol 21, 35-42. Edwards G, Rutkowski C, Palmer C (1997) Cervical cancer screening with Papanicolaou smear plus speculoscopy by nurse practitiones in a health maintenance organization. J Low Gen Tract Dis 3, 141-147. Eisenberger D, Hernandez E, Tener T, Atkinson BF. (1997) Order of endocervical and ectocervical cytologic sampling and the quality of the Papanicolaou smear. Obstet Gynecol 90, 755-758. Fehr MK, Welti S (2004) Human Papillomavirus testing in cervical cancer screening. Gynakol Geburtshilfliche Rundsch 44, 131-7. Ghaemmaghami F, Behtash N, Modares Gilani M, Mousavi A, Marjani M, Moghimi R (2004) Visual inspection with acetic acid as a feasible screening test for cervical neoplasia in Iran. Int J Gynecol Cancer 14, 465-469. Insinga R, Glass A, Glass A, Rush B (2004) Diagnosis and outcomes in cervical cancer screening, A population- based study. Am J Obstet Gynecol 191, 105-13.

235

Hasanzadeh and Behtash: Cervical cancer screening a new adjunct to cytological screening for squamous cell carcinoma of the uterine cervix and its precursors. Arch Fam Med 9, 713-721. Toffler WL, Pluedeman CK, Sinclair AE, Ireland KM, Byrne BJ (1993) Comparative cytologic yield and quality of three Pap smear instruments. Clin Res Method 25, 403-407. Wertlake PT, Francus K, Newkirk GR, Parham GP. (1997) Effectiveness of the Papanicolaou smear and speculoscopy as compared with the Papanicolaou smear alone: a communitybased clinical trial. Obstet Gynecol 90, 421-427.

Wesley R, Sankaranarayanan R, Mathew B, Aysha Beegum A, Amma NS, Nair MK (1997) Evaluation of visual inspection as a screening test for cervical cancer. Br J Cancer 75, 436440. Wright TC Jr, Denny L, Kuhn L et al (2000) HPV DNA testing of self collected vaginal samples compared with cytologic screening to detect cervical cancer. JAMA 283, 81-6. Wunderman I, Coppleson M, Skladnev, V, Reid BL (1995) Polarprobe, A precancer detection instrument. J Gynecol Tech 1, 105-109.

236

Cancer Therapy Vol 3, page 237 Cancer Therapy Vol 3, 237-242, 2005

Phase II trial of celecoxib plus carboplatin and gemcitabine for first-line therapy in stage IIIB/IV non-small cell lung cancer-a negative study Research Article

Frank E. Mott*, Christian T. Cable, Jon Herrington, Joel Marcus, Rebecca Griggs, Melissa Ainslie Lung Cancer Clinic, Scott & White Clinic, Texas A&M University HSC, 2401 South 31st Street, Temple, TX, USA

__________________________________________________________________________________ *Correspondence: Frank E. Mott, MD FACP, Assistant Professor of Medicine, Director Lung Cancer Clinic, Scott & White Clinic, Texas A&M University HSC, 2401 South 31st Street, Temple, TX 76508; Tel: 254-724-7048; fax: 254-724-4904; e-mail: fmott@swmail.sw.org Key words: celecoxib, carboplatin, gemcitabine, non-small cell lung cancer Abbreviations: absolute neutrophil count, (ANC); bone scan, (BS); complete blood count, (CBC); computerized tomographic, (CT); creatinine clearance, (CrCl); Cyclo-oxygenase 1, (COX-1); cyclo-oxygenase 2, (COX-2); Eastern Cooperative Oncology Group, (ECOG); Functional Assessment of Cancer Therapy â&#x20AC;&#x201C; Lung,, (FACT-L); Magnetic resonance imaging, (MRI); non-small cell lung cancer, (NSCLC); non-steroidal anti-inflammatory drugs, (NSAID); partial response, (PR); partial response, (PR); performance status, (PS); prostaglandin E2, (PGE2); Quality of Life, (QOL); Response Evaluation Criteria in Solid Tumors, (RECIST); time to progression, (TTP); upper limit of normal, (ULN); white blood cell, (WBC)

This study was supported by a grant from Bristol-Myers-Squibb Pharmaceutical Company Received: 2 March 2005; Revised: 31 March 2005 Accepted: 8 April 2005; electronically published: April 2005

Summary The cyclo-oxygenase 2, (COX-2), inhibitor celecoxib has been described as having pro-apoptotic activity both invitro and in-vivo. To assess its clinical merit, we conducted a phase II trial of celecoxib in combination with a carboplatin-gemcitabine chemotherapy regimen in good performance status patients with untreated, advanced nonsmall cell lung cancer (NSCLC). Treatment consisted of gemcitabine 1100 mg/m2 days 1,8; carboplatin area under the curve (AUC) of 5 day 8; repeated every 28 days for four cycles and given concurrently with celecoxib 400 mg orally twice daily. Thirteen patients were enrolled and twelve were evaluable. The study was stopped early due to sub-optimal response and due to emerging evidence from external sources of potential cardiovascular risks with COX-2 inhibitors. Two patients demonstrated a partial response (PR), three were stable, and seven had progression. Time to progression ranged from one to eight months with a median of two months. Survival ranged from one to 21 months, with a median of six months; only two patients were still alive at the time of study closure. Grade 3 or 4 toxicities included myelosuppression and one myocardial infarction. Quality of Life (QOL) analysis was included in the assessment. on day eight, but also used a 28-day cycle (Iaffaioli et al, 1999). Our previous trial8 utilized this same regimen and schedule but in a more homogeneous population of advanced NSCLC. We studied thirty patients with advanced NSCLC treated with gemcitabine 1100 mg/m2 on days one and eight and carboplatin at an AUC of five on day eight, given every 28 days up to six cycles (Mott et al, 2003). Ten percent of the patients had a partial response and 45% had stable disease. Median time to progression (TTP) was 5.8 months. Median, one-, and

I. Introduction The combination of carboplatin and gemcitabine as a treatment regimen for advanced non-small cell lung cancer has been well described (Carmichael et al, 1996; Edelman et al, 1998; Carrato et al, 1999; Iaffaioli et al, 1999; Jovtis et al, 1999; Ng et al, 1999; Sederholm, 1999; Mott et al, 2003). Only two published trials have given carboplatin on day eight of the treatment cycle (Iaffaioli et al, 1999; Mott et al, 2003). While most regimens employed a 21-day cycle, the trial by Iaffaioli, et al not only gave carboplatin 237

Mott et al: Phase II trial for first-line therapy in stage IIIB/IV NSCLC resonance imaging (MRI) of the brain was also required only if the patient exhibited neurological signs or symptoms, mental status changes, or frequent headaches. Patients were excluded if they had received any prior chemotherapy for the diagnosis of NSCLC. Prior radiotherapy to focal lesions was allowed but must not have been to any sites of measurable disease and at least three weeks must have elapsed before enrolling on the protocol. Patients with an allergy to sulfa compounds were ineligible to take celecoxib at the study doses and were excluded from the study. Patients were not allowed to use any other COX-2 inhibitors or non-steroidal anti-inflammatory drugs (NSAID). Corticosteroids were allowed only as part of the antiemetic regimen. The Institutional Review Committee approved the study design and all patients gave informed, written consent to participate. The study was initially designed to accrue 40 patients. Endpoints were primarily response and time to disease progression. Survival was a secondary endpoint.

two-year survivals were 8.3 months, 27%, and 16% respectively. Based on the results of our trial, we decided to investigate the same chemotherapy regimen in combination with the COX-2 inhibitor, celecoxib. The enzyme cyclo-oxygenase converts arachidonic acid to prostaglandins. Cyclo-oxygenase 1 (COX-1) is constitutively present in the body with predominance in gastric mucosa, vascular endothelium, platelets, and the kidney; while COX-2 is inducible and is present mainly in smooth muscle, neurons, monocytes, and macrophages (Fosslien, 2000). A number of tumors have been shown to over-express COX-2, including mammary, gastric, colorectal, and lung carcinomas (Hida et al, 1998; Ochiai et al, 1999; Fosslien, 2000; Hosomi et al, 2000; Soslow et al, 2000; Dempke et al, 2001). The mechanism by which COX-2 mediates cancer growth is complex and still not fully defined; however, it has been established that it can increase prostaglandin E2 (PGE2), bcl-2, and IL-6, thus inhibiting apoptosis and enhancing angiogenesis and metastasis (Fosslien, 2000). Inhibitors of COX-2 have reduced polyp formation in familial adenomatous polyposis and demonstrated anti-angiogenic and antitumor activity both in-vitro and in-vivo (Masferrer et al, 2000; Reddy et al, 2000; Steinbach et al, 2000). The specific COX-2 inhibitor, celecoxib, has been the most tested agent in its class. In NSCLC, it has been used alone in resectable disease, in combination with chemotherapy for recurrent or relapsed disease, and in combination with chemotherapy and radiation for locally advanced disease (Carbone et al, 2002; Csiki et al, 2002; Gadgeel et al, 2003; Johnson et al, 2003; Shehadeh et al, 2003; Choy 2004). These studies have suggested that the appropriate “pro-apoptotic” dose be 400 mg twice daily, which is double the recommend arthritis dosing. Quality of life, (QOL), is important in patients with ultimately incurable cancers. Therefore, any treatment that is recommended for palliation of the disease should not produce a negative impact on QOL. Even though this was a phase II trial, we determined to measure QOL at baseline and then throughout chemotherapy to see if there was any measurable effect, positive or negative.

B. Treatment Celecoxib was provided at a dose of 400 mg by mouth twice daily, beginning on the first day of chemotherapy and taken indefinitely, until either disease progression, unacceptable toxicity related to the drug, or patient preference to discontinue. If the baseline creatinine increased by two-fold or greater, celecoxib was held for up to two weeks until the creatinine returned to within 20% above the baseline value, then celecoxib was resumed at a 50% dose reduction. If another hold was required, celecoxib was discontinued. If any patient developed hypertension on celecoxib, then anti-hypertensive agents were allowed; however, if the hypertension could not be adequately controlled, celecoxib was discontinued. Chemotherapy consisted of gemcitabine administered intravenously at a dose of 1100 mg/m2 on day one and eight and carboplatin administered intravenously at an AUC of 5 on day eight of each treatment cycle. Cycles were repeated at 28-day intervals. The antiemetic regimen consisted of prochlorperazine 10 mg by mouth on day one prior to administration of gemcitabine and ondansetron 24 mg plus dexamethasone 16 mg orally on day eight prior to the combination of gemcitabine and carboplatin administration. Doses of both gemcitabine and carboplatin were reduced by 25% if the absolute neutrophil count (ANC) was less than 1000/mm3 or the platelet count was less than 100,000/mm3 and they were held if the ANC was less than 500/mm3or the platelet count was less than 50,000/mm3. Any non-hematologic toxicity, (except alopecia and nausea), that was grade 3 required a 50% dose reduction and any grade 4 toxicities required holding doses until resolution. Held doses were not made up. The protocol was initially written with the plan to administer up to six cycles of chemotherapy, similar to our initial trial. However, a number of studies indicated that four cycles of treatment was comparable in efficacy with less toxicity and, therefore, the protocol was revised (Socinski et al, 2003).

II. Patients and methods A. Patient eligibility Patients had to have histologically confirmed NSCLC and advanced stage. This included anyone with stage IV disease, except with brain metastases, and stage IIIB disease with a malignant pleural effusion. All patients had to have an Eastern Cooperative Oncology Group (ECOG) performance status (PS) of 0 or 1 at the time of enrollment. Evaluation included a computerized tomographic (CT) scan of the chest and abdomen to the level of the adrenal glands, complete blood count (CBC), comprehensive metabolic profile (CMP), and creatinine clearance (CrCl). At a minimum, patients were required to have a white blood cell (WBC) count > 3000/mmÑ with absolute neutrophil count > 1500/mm3, hemoglobin ! 8 g/dl, platelets ! 100,000/mm3, total bilirubin < 1.4 mg/dl, AST < 3 times the upper limit of normal (ULN), serum creatinine < 1.6 mg/dL, and a creatinine clearance > 39 ml/min. A whole body bone scan (BS) was required only if the patient had bone pains and/or an elevated alkaline phosphatase and/or calcium level. Magnetic

C. Assessment Sites of measurable and evaluable disease were imaged midway through chemotherapy and at the end of chemotherapy, then at three-month intervals thereafter until disease progression or patient withdrawal. Laboratory monitoring was performed weekly during therapy, then at three-month intervals or as clinically necessary. Additional evaluations were allowed as deemed clinically necessary by the patient’s doctor. Patients were also allowed to receive additional therapy if deemed appropriate. Response was defined by the Response Evaluation Criteria in Solid Tumors (RECIST) (Therasse et al, 2000). A complete response was defined as disappearance of disease at all known

238

Cancer Therapy Vol 3, page 239 sites. A partial response (PR) was defined as a 30% reduction in the sum of maximal diameters of all measurable lesions. Progression was defined as the development of one or more new lesions or a 20% increase in the sum of maximal diameters of any one lesion. Stable disease did not meet the criteria for either progression or response. Adverse events were assessed using the Common Toxicity Criteria of the National Cancer Institute of the United States.26 Survival and time to progression (TTP) were calculated from the date of enrollment. Quality of life (QOL) was assessed using the Functional Assessment of Cancer Therapy – Lung, (FACT-L), questionnaire administered at enrollment, midway through, and at the end of chemotherapy. (Cella, 1995; Chang et al, 2002).

adjustments necessary for celecoxib administration. Disease progression and myelosuppression were the most common reasons why patients did not complete the full four cycles of chemotherapy. Table 2 shows response and survival results for each patient. Survival was measured by actual event times. Due to the small size of this study, the original intention to calculate median survival by the Kaplan-Meier method could not be done. Only one patient, (number 2), had a durable response to therapy that has lasted for nearly 21 months. All other patients had progression, including seven who progressed during chemotherapy treatment. The median time to progression was two months, median survival six months, and only two of the patients were still alive at the time the study was closed. One patient, (number 3), died at six months before follow-up imaging studies to document disease progression could be performed. All causes of death were due to disease progression. Additional therapy is also shown in Table 2. Accrual to the trial was suspended in September 2004 when information was released regarding adverse cardiovascular effects of rofecoxib, another COX-2 inhibitor.29, 30 By December 2004, questions were emerging regarding the safety of celecoxib at higher “cancer doses”, such as used in this trial.31 Therefore, the safety monitoring committee and principal investigator opted to close the trial, especially in the face of poor response and survival data. As noted in Table 1, one of the patients, (number 2), did have a myocardial infarction and developed hypertension requiring treatment, after having been on celecoxib for 16 months. Interestingly, this is the only patient who showed a durable survival.

III. Results From January 2003 until study closure in October 2004, 13 patients were enrolled in the trial and 12 were ultimately evaluable. One patient died due to respiratory failure less than a week after enrolling on the trial and before starting any therapy and was therefore excluded from analysis. All but one of the patients had stage IV disease. The first three patients were enrolled in the trial under the original plan of six cycles of therapy, while the remaining patients were treated under the revised protocol of four cycles. Treatment and toxicities are shown in Table 1. The “% dose” was based on the actual total dosage of chemotherapy, (not celecoxib), given divided by the intended dose if full doses for four complete cycles, (six cycles for the first three patients), were administered. Myelosuppression during chemotherapy administration was significant and led to treatment delays and/or dosage modifications in several patients. There were no dosage Table 1. Patient 1 2 3 4 5 6 7 8 9 10 11 12

Age/Sex 57F 66M 61M 66F 59F SOM 79M 74M 65M 71F 6SF 73F

Stage IV IV IV IV IV IV IV IV IV IV IV IIIB

PS 0 0 1 1 0 1 0 0 0 0 0 0

Cycles 3* 6* 3* 1 4 2 4 2 4 4 1 3

% dose 46% 100% 50% 25% 88% 32% 100% 50% 88% 100% 12.50% 83%

Grade 3/4 toxicity** NP NP, htn, MI*** NP, A NP, A, T, inc. ALT NP, T NP Staph bacteremia None None None None NP, A, T

*Patients 1,2,3 enrolled on protocol for 6 cycles, all others 4 cycles. **NP= neutropenia; A= anemia; T= thrombocytopenia; MI= nyocardial infarction; htn= hypertensbn; ALT=alanine aminotransferase ***MI occurred 16 months after chemotherapy but while still on celecoxib

Table 2. Patient 1 2 3

Response Progression Partial Stable*

TTP 3 mos ** ?

Survival 19 mos Alive (21 mos) 6 nos

Additional, Treatment Carbopletin-paclitaxel, vinorebine, topotecan, iressa No No 239

Mott et al: Phase II trial for first-line therapy in stage IIIB/IV NSCLC 4 5 6 7 8 9 10 11 12

Progression Stable Progression Progression Progression Stable Partial Progression Progression

1 mon 6 mos 2 mos 3 mos 2 mos 8 mos 6 mos 1 mon 2mos

I non 9 mos 12 mos 5 nos 3 mos Alive (9 mos) 7mos 2 nos 3mos

No Iressa Iressa No No Docetaxel No No No (THO-0059) (abstract 1270). Proc Am Soc Clin Oncol 21, 318a. Carmichael J, Allerheiligen S, Walling J (1996) a phase I study of gemcitabine and carboplatin in non-small-cell lung cancer. Semin Oncol 23 (5 Suppl 10), 55-9. Carrato A, Garcia-Gomez V, Alberola BJ, et al (1999) Carboplatin in combination with gemcitabine in advanced non-small cell lung cancer, comparison of two consecutive phase II trials using different schedules (abstract 1922). Proc Am Soc Clin Oncol 18, 498a. Cella DF (1995) The Functional Assessment of Cancer TherapyLung (FACT-L) quality of life instrument. In RJ Gralla & CM Moinpour (Eds), Assessing Quality of Life in Patients with Lung Cancer: A Guide for Clinicians. New York, NCM Publishers, Inc. Chang C, Cella D, Masters G, et al (2002) Real-time clinical application of quality-of-life assessment in advanced lung cancer. Clin Lung Cancer 4, 104-9. Choy H (2004) A phase II study of concurrent and adjuvant administration of a selective inhibitor of COX-2, celecoxib, in the treatment of stage I/II medically inoperable non-small cell lung cancer (NSCLC) with radiation. Protocol VCC THO-0216. Vanderbilt University Medical Center, Nashville, TN. Csiki I, Dang T, Gonzalez A, et al (2002) Cyclooxygenase-2 (COX-2) inhibition plus docetaxel (Txt) in recurrent nonsmall cell lung cancer (NSCLC), Preliminary results of a phase II trial (THO-0054) (abstract 1187). Proc Am Soc Clin Oncol 21, 297a, Dempke W, Rie C, Grothey A, et al (2001) Cyclooxygenase-2, a novel target for cancer chemotherapy. J Cancer Res Clin Oncol 127, 411-7. Edelman M, Gandara D, Lau D, et al (1998) Carboplatin/gemcitabine in NSCLC, interim analysis of a novel 21-day schedule. Paper presented at Perugia International cancer Conference VI, October 11-13, Perugia, Italy. FDA statement on the halting of a clinical trial of the COX-2 inhibitor Celebrex. FDA News Release (2004) Fosslien E (2000) Molecular Pathology of cyclo-oxygenase 2 in neoplasia. Ann Clin Lab Sci 30, 3-21. Gadgeel SM, Thatai L, Kraut A, et al (2003) Phase II study of celecoxib and docetaxel in non-small cell lung cancer (NSCLC) patients with progression after platinum-based therapy (abstract 2749). Proc Am Soc Clin Oncol 22, 684. Hida T, Yatabe Y, Achiwa H, et al (1998) Increased expression of cyclooxygenase 2 occurs frequently in human lung cancers, specifically in adenocarcinomas. Cancer Res 58, 3671-4. Hosomi Y, Yokose T, Hirose Y et al (2000) Increased cyclooxygenase 2 (COX-2) expression occurs frequently in precursor lesions of human adenocarcinoma of the lung. Lung Cancer 30, 73-81. Iaffaioli R, Tortoriello A, Facchini G, et al (1999) Phase I-II study of gemcitabine and carboplatin in stage IIIB-IV nonsmall-cell lung cancer. J Clin Oncol 17, 921-6.

Using the FACT-L questionnaire, administered at entry, midway, and the end of treatment; there was no significant impact, positive or negative, on quality of life with the study regimen. However, only six patients completed all of the questionnaires.

IV. Discussion Our initial study (Mott et al, 2003) of gemcitabine and carboplatin in which the carboplatin dose was administered on day eight demonstrated a combined partial response and stable disease rate of approximately 50%, with survival comparable to other regimens. With acceptable toxicity, it seemed like an ideal regimen to investigate in combination with a COX-2 inhibitor. Unfortunately, the majority of the patients treated on this trial progressed while on therapy and demonstrated a median survival that was not much better than expected with supportive care alone. However, due to the small study size, these endpoints need to be viewed cautiously. It is unknown why poor responses were seen in this trial. Some patients will have aggressive disease and do poorly, regardless of what type of therapy is given. It may be possible that a negative interaction exists between celecoxib and the carboplatin-gemcitabine combination; however, the number of patients in this study was too small to make any conclusions. Quality of life assessment, due to the number of patients surveyed, was not helpful and no conclusions regarding the impact of this regimen on QOL can be made. Toxicity was primarily myelosuppression, with anemia and neutropenia especially. This was a dose-limiting factor for several patients. Seven of twelve patients, (58%), experienced grade 3 or 4 neutropenia, compared with only 27% in our original trial (Mott et al, 2003). It is unclear whether this was due to the addition of celecoxib. Lastly, the COX-2 inhibitors, in general, came under scrutiny for adverse cardiovascular and cerebrovascular events in 2004, thus bringing their role in cancer therapy into question. Given this fact along with the poor response in our patient population, we were forced to close the study. Due to the small study size, we cannot recommend or refute the combination of carboplatin-gemcitabine with celecoxib as administered in this study protocol.

References Carbone D, Choy H, Csiki I, et al (2002) Serum/plasma VEGF level changes with cyclooxygenase-2 (COX-2) inhibition in combined modality therapy in stage III non-small cell lung cancer (NSCLC), Preliminary results of a phase II trial

240

Cancer Therapy Vol 3, page 241 Johnson DH, Csiki I, Gonzalez A, et al (2003) Cyclooxygenase-2 (COX-2) inhibition in non-small cell lung cancer (NSCLC), Preliminary results of a phase II trial (abstract 2575). Proc Am Soc Clin Oncol 22, 640. Jovtis S, Brocato N, Balbiani L et al (1999) First line therapy with gemcitabine and carboplatin in patients with advanced non-small-cell lung cancer, a phase II study (abstract). Proc Am Soc Clin Oncol 18, 510a. Juni P, Nartey L, Reichenbach S, et al (2004) Risk of cardiovascular events and rofecoxib, cumulative metaanalysis. Lancet 364, 2021-9. Masferrer JL, Leahy KM, Koki AT, et al (2000) Antiangiogenic and antitumor activities of cyclooxygenase-2 inhibitors. Cancer Res 60, 1306-11. Merck Press Release (2004) Merck announces voluntary worldwide withdrawal of VIOXX. FDA News Release, P0495 September 30. Mott FE, Cable CT, Sharma N (2003) Phase II study of an alternate carboplatin and gemcitabine dosing schedule in advanced non-small-cell lung cancer. Clinical Lung Cancer 5, 174-6. National Cancer Institute, Cancer Therapy evaluation Program. Common Criteria Toxicity Manual, version 2.0. Available at: http://ctep.cancer.gov. Ng EW, Sandler AB, Robinson L, Einhorn LH (1999) A phase II study of carboplatin plus gemcitabine in non-small-cell lung cancer (NSCLC): a Hoosier oncology group study. Am J Clin Oncol 22, 550-3 Ochiai M, Oguri T, Isobe T, et al (1999) Cyclooxygenase-2 (COX-2) mRNA expression levels in normal lung tissues and non-small cell lung cancers. Jpn J Cancer Res 90, 1338-43. Reddy BS, Hirose Y, Lubet R et al (2000) Chemoprevention of colon cancer by specific cyclooxygenase-2 inhibitor, celecoxib, administered during different stages of carcinogenesis. Cancer Res 60, 293-7. Sederholm C (1999) A phase II study of gemcitabine plus carboplatin in chemonaive patients with advanced non-smallcell lung cancer (NSCLC) (abstract 1889). Proc Am Soc Clin Oncol 18, 490a.

Shehadeh N, Alemkerian GP, Wozniak A, et al (2003) Preliminary results of a phase II study of celecoxib and weekly docetaxel in elderly (>70 years) or PS2 patients with advanced non-small cell lung cancer (NSCLC) (abstract 2758). Proc Am Soc Clin Oncol 22, 686. Socinski M, Baggstrom M, Hensing T (2003) Duration of therapy in advanced, metastatic non-small lung cancer. Clin Adv Hematol Oncol 1, 33-38. Soslow RA, Dannenberg AJ, Rush D, et al (2000) COX-2 is expressed in human pulmonary, colonic, and mammary tumors. Cancer 89, 2637-45. Steinbach G, Lynch PM, Phillips R, et al (2000) The effect of celecoxib, a cyclooxygenase-2 inhibitor, in familial adenomatous polyposis. N Engl J Med 342, 1946-52. Therasse P, Arbuck SG, Eisenhauer EA, et al (2000) New guidelines to evaluate the response to treatment in solid tumors, European Organisation for Research and Treatment of Cancer, National Cancer Institute of the United States, National cancer Institute of Canada. J Natl Cancer Inst 92, 205-16.

Frank E. Mott

241

Mott et al: Phase II trial for first-line therapy in stage IIIB/IV NSCLC

242

Cancer Therapy Vol 3, page 243 Cancer Therapy Vol 3, 243-248, 2005

Update on cervical cancer Review Article

Aaron C Han1,*, Maria Merzouk2, Richard Z Belch2 1

Department of Pathology, Department of Gynecologic Oncology, The Reading Hospital Regional Cancer Center

__________________________________________________________________________________ *Correspondence: Aaron C Han, The Reading Hospital Regional Cancer Center, 6th Avenue and Spruce Street, West Reading, PA 19612; Phone: 610-988-8088; Fax: 610-988-5185; Email: HanA@ReadingHospital.org Key words: cervical cancer, HPV biology, epidemiology and screening, Diagnosis Abbreviations: carcinoma in situ, (CIS); computed axial tomography, (CT); Human papillomavirus, (HPV); lymphovascular space involvement, (LVI); magnetic resonance imaging, (MRI); positron emission tomography-CT, (PET-CT); retinoblastoma, (Rb) Received: 31 March 2005; Revised: 11 April 2005 Accepted: 12 April 2005; electronically published: April 2005

Summary Cervical cancer is a significant cause of mortality worldwide in spite of recent advances with efficacious screening methods. The role of human papillomavirus as the causative agent of cervical cancer is well established. In this review, we examine the biology, epidemiology, diagnosis and treatment strategies for cervical cancer. We also outline potential avenues for worldwide prevention of this disease, and potential therapeutic targets.

risk for neoplastic transformation (Baseman and Koutsky, 2005). It is widely accepted that with persistant infection, and integration of the HPV genome into the host DNA is the background in which carcinogenesis occurs (Ferenczy and Franco, 2002). HPV proteins encoded by E6 and E7 genes interact with cellular proteins including p53 and Rb gene, respectively, which regulate cell cycle, and presumably this pathway is involved in cervical carcinogenesis (Munger et al, 1992; Giarre et al, 2001).

I. Introduction Cervical cancer continues to be a significant public health problem. It is the second leading gynecologic malignancy affecting women in the world (Platz and Benda, 1995; Rohan et al, 2003). Cervical cancers are predominately squamous cell carcinomas, with approximately 20% of the cases are accounted for by adenocarcinoma which appears to be increasing in frequency. Human papillomavirus (HPV) is acknowledged as the causative infectious agent in the vast majority of cases of cervical cancer (Stoler, 2003). HPV infections leads to precursor lesions, progressing to dysplasias and frank carcinoma over time. There is often an orderly progression to invasive cancer, and can occur asymptomatically over a course of 10-20 years.

III. Cervical cancer epidemiology and screening Cervical cancer screening using the Papanicolaou smear has effected marked impact on this disease, reducing both the incidence and mortality of cervical cancer (Foulks, 1998). In the United States for the period 1996 to 2000, the average annual age adjusted incidence rate for cervical cancer was 8.7 per 100,000 women. This incidence reaches a peak in white women at ages 45-49; while it continues to increase beyond that age in black women. Women older than 50 years of age have a higher incidence than those younger (6.7 versus 13.9 per 100,000), with mortality rates also increasing with age, being more than four fold higher in women over 50 years of age. The age adjusted mortality rate from cervix cancer in the United States was 3.0 per 100,000 women in the period between 1996 and 2000. This is a significant reduction compared to data from 1975 when mass

II. HPV biology HPV is a DNA virus which is the causative agent of cervical cancer (Stoler, 2003). This virus is sexually transmitted. More than 80 types of HPV have been identified. The majority of cervical cancers are associated with types 16, 18, 31, 33, and 35. These are often referred to as high risk HPV types, in contrast to others which are more associated with warts, condyloma and low grade cervical intraepithelial neoplasia (CIN). Of these HPV 16 is associated with about 50% of cases of cervical cancer. HPV can infect and cause a acute transient infection, but these frequently may clear and the patient would not be at 243

Han et al: Update on cervical cancer screening was first widely adopted, at which time the age adjusted incidence and mortality rate were 14.8 and 5.6 per 100,000 women respectively. Socioeconomic status impacts on incidence, and mortality in patients with cervical cancer (Singh et al, 2004; Wang et al, 2004). Lower social economic status confers a 1.6 fold increase risk for developing carcinoma in situ (CIS) when compared with those with higher socioeconomic status. A two fold increase risk for cancer was also correlated with limited accessibility to the healthcare system. Social and economic pressures can also indirectly affect the incidence of cervix cancer through lifestyle and cultural factors, such as sexual behavior, smoking and diet which are known risk factors. Parity, oral contraceptive use, smoking and other concomitant sexually transmitted disease appear to play a role in cervical carcinogenesis (Castellsague et al, 2002). Dietary factors as vitamin A, vitamin C, vitamin E, folic acid, as well as the immune status are also linked to the disease progression.

screening. Other presenting symptoms, such as urinary dysfunction, pelvic pressure or pain, sciatic pain in advanced disease may be present. Biopsies, whether colposcopically directed or a visible gross lesion will provide the tissue for histologic diagnosis. Endocervical curettage, cervical conization and endometrial biopsy may contribute to the diagnosis, especially in the absence of an obvious lesion. The extent of the disease at presentation remains the most important prognostic factor (Pecorelli and Odicino, 2003). Clinical staging as defined by the 1994 FIGO staging system for cervical carcinoma is useful (Table 1). Cervical cancer continues to be a clinically staged disease, as opposed to the surgical staging used in defining other gynecologic malignancies. Survival is related to stage, with 5-year survivals ranging from 99% (for early stage IA) to 15% stage IV disease. The earliest of stage I disease are based on histologic examination and microscopic measurements of the depth of tumor invasion. Other prognostic indicators used for treatment planning include radiologic findings from computed tomography (CT) and magnetic resonance imaging (MRI) (Chiang and Quek, 2003). Because clinical staging remains subjective, lesions may be understaged in up to 20-30% of cases, and these may correspond to nodal involvement or parametrial spread. On the other hand, overstaging can result from pelvic inflammatory disease

IV. Diagnosis Abnormal bleeding presenting as post-coital bleeding, intermenstrual or post-menopausal bleeding remains the most common presenting symptoms of cervical carcinoma (ACOG, 2002). Less than 10% of cases are asymptomatic when detected by cervical Table 1. The 1994 FIGO staging system for cervical carcinoma Stage 0 Stage I

Stage II

Stage III

Stage IV

Carcinoma in situ, cervical intraepithelial neoplasia grade III Carcinoma strictly confined to the cervix (extension to the corpus is disregarded) IA Invasive carcinoma that can be diagnosed only by microscopy. All macroscopically visible lesions â&#x20AC;&#x201C; even with superficial invasion â&#x20AC;&#x201C;are allotted to be stage IB carcinomas. Invasion is limited to a measured stromal invasion with a maximal depth of 5.0 mm and a horizontal extension of not more than 7.0 mm. Depth of invasion should be not more than 5.0 mm taken from the base of the epithelium of the original tissue-superficial or glandular. The involvement of vascular spacesvenous or lymphatic-should not change the stage allotment. IA1 Measured stromal invasion of not more than 3.0 mm in depth and extension of not more than 7.0 mm. IA2 Measured stromal invasion of greater than 3.0 mm and not more than 5.0 mm with an extension of not more than 7.0 mm. IB Clinically visible lesions limited to the cervix uteri or preclinical cancers greater than Stage IA IB1 Clinically visible lesions not more than 4.0 cm IB2 Clinically visible lesions greater than 4.0 cm Cervical carcinoma that invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina IIA No obvious parametrial involvement IIB Obvious parametrial involvement The carcinoma has extended to the pelvic wall. On rectal examination, there is no cancer-free space between the tumor and the pelvic wall. The tumor involves the lower third of the vagina. All cases with hydronephrosis or nonfunctioning kidney are included, unless they are known to be due to other causes. IIIA Tumor that involves the lower third of the vagina, with no extension to the pelvic wall IIIB Extension to the pelvic wall and/or hydronephrosis or nonfunctioning kidney The carcinoma has extended beyond the true pelvis, or biopsy proven involvement of the mucosa of the bladder or rectum. A bullous edema, as such, does not permit a case to be allotted to stage IV. IVA Spread of the growth to adjacent organs IVB Spread to distant organs

244

Cancer Therapy Vol 3, page 245 and other non-neoplastic pathology, which is estimated to be as high as 20% in stage IIIB disease. The use of positron emission tomography-CT (PET-CT) has been shown in some studies to have a high specificity and sensitivity in cervix cancer staging, approaching a positive predicted value of 100% and a negative predicted value of 96% in patients with early stage disease (Kumar and Alavi, 2004). This may be used more frequently in the future for accurate staging in cases with equivocal clinical findings especially in advanced disease to assess disease extension.

cure rates (Greven et al, 1999). Prospective randomized studies directly comparing surgery versus chemoradiation have not been forthcoming. Chemoradiation is utilized in conjunction with surgery for the treatment of bulky tumors (greater than 4 cm) Radiation is utilized after radical hysterectomy in high-risk patients with positive lymph nodes, positive surgical margins of resection, or tumor involving parametria (Kim et al, 2005). The role and benefit for adjuvant chemotherapy after hysterectomy is not yet defined. Locally advanced cervical carcinoma (stage IIBIVA) is treated with chemoradiation for the most part utilizing a platinum-based chemotherapy (Greven et al, 1999; ACOG 2002). External beam radiation and brachytherapy provide tumoricidal management for advanced cervical carcinoma. Neither surgery nor chemoradiation are without their inherent risk of a major complication. Perioperative complications associated with surgery are rare; and late complications possibly include lymphocyst formation, lymphedema, bowel and bladder dysfunction. Although the risk of major complications related to radiation therapy is low, the incidence increases with time, and include fistulization, involving either bowel or bladder, and small bowel obstruction. Thin body habitus, a history of smoking, pre-radiation surgery and pelvic infection are factors correlated with increased risk of major complications.

V. Treatment and management Superficially invasive cervix cancer carries an excellent prognosis. Both depth of tumor invasion, and degree of superficial tumor spread are related to the probability of nodal metastases. The presence of lymphovascular space involvement (LVI), although not in the FIGO staging schema, also appears to imparts a more significant risk of metastatic tumor spread (Graflun et al, 2004). In IA2 lesions, the risk of tumor recurrence is less than 1% if there is no LVI. This risk increases to 17% when LVI is noted by pathologic examination. Stromal response, histologic grade and tumor histology have been implicated as prognostic factors but the data pertaining to these remain weak. Microinvasive cervical carcinoma is often treated with a simple extrafascial hysterectomy (Mota, 2003). Early stage cancer, usually referring to stage IB1 (equal to or less than 4 cm) and early stage IIA cancers can potentially be cured with surgery (Lu and Burke, 2000). Traditionally, the treatment of choice has been radical hysterectomy or with radiation therapy, with comparable

VI. Pathology of cervical cancer The vast majority of cervical cancers are epithelial tumors with squamous cell carcinomas accounting for about 80% of the primary tumors in the cervix (Figure 1, Platz and Benda, 1999).

Figure 1. Invasive squamous carcinoma of the cervix with focal necrosis (H and E section).

245

Han et al: Update on cervical cancer Castellsague X, Bosch FX, Munoz N (2002) Environmental cofactors in HPV carcinogenesis. Virus Res 89, 191-199. Carico E, Atlante M, Bucci B, Nofroni I and Vecchione A (2001) E-cadherin and a-catenin expression during tumor progression of cervical carcinoma. Gynecol Oncol 80, 156161 Chiang SH and Quek ST (2003) Carcinoma of the cervix: role of MR imaging. Ann Acad Med Singapore 32, 550-556. Cronje HS (2004) Screening for cervical cancer in developing countries. Int J Gynaecol Obstet 84, 101-108 Finegan MM, Han AC, Edelson MI and Rosenblum NG (2004) p16 expression in squamous lesions of the female genital tract. J Molec Histol 35, 111-114 Ferenczy A, Franco E (2002) Persistent human papillomavirus infection and cervical neoplasia. Lancet Oncol 3, 11-16. Foulks MJ (1998) The Papanicolaou smear: its impact on the promotion of women's health. J Obstet Gynecol Neonatal Nurs 27, 367-373. Franco EL, Schlecht NF, Saslow D (2003) The epidemiology of cervical cancer. Cancer J 9, 348-359. Frazer IH (2004) Prevention of cervical cancer through papillomavirus vaccination. Nat Rev Immunol 4, 46-54. Giarre M, Caldeira S, Malanchi I, Ciccolini F, Leao MJ and Tommasino M (2001) Induction of pRb degradation by the human papillomavirus type 16 E7 protein is essential to efficiently overcome p16INK4A-imposed G1 cell cycle arrest. J Virol 75, 4705-4712 Graflund M, Sorbe B, Sigurdardottir S, Karlsson M (2004) HPVDNA, vascular space invasion and their impact on the clinical outcome in early-stage cervical carcinomas. Int J Gynecol Cancer 14, 896-902 Greven K, Petereit D, Vermorken JB, Lanciano R (1999) Current developments in the treatment of newly diagnosed cervical cancer. Hematol Oncol Clin North Am 13, 275-303 Han AC, Edelson MI, Peralta Soler A, Knudsen KA, LifschitzMercer B, Czernobilsky B, Rosenblum NG and Salazar H (2000) Cadherin expression in glandular tumors of the cervix. Aberrant P-cadherin expression as a possible marker of malignancy. Cancer 89, 20 Hirama T, Miller CW, Wilczynski SP and Koeffler HP (1996) p16 (CDKN2/cyclin-dependent kinase-4 inhibitor/multiple tumor suppressor-1) gene is not altered in uterine cervical carcinoma cell lines. Mod Pathol 9, 26-31 Keating JT, Ince T and Crum CP (2001) Surrogate biomarkers of HPV infection in cervical neoplasia screening and diagnosis. Adv Anat Pathol 8, 82-92 Kim JH, Kim HJ, Hong S, Wu HG, Ha SW (2005) Posthysterectomy radiotherapy in FIGO stage IB-IIB uterine cervical carcinoma. Gynecol Oncol 96, 407-414. Klaes R, Benner A, Friedrich T, Ridder R, Herrington S, Jenkins D, Kurman, RJ, Schmidt D, Stoler M and von Knebel Doeberitz MK (2002) p16INK4A immunohistochemistry improves interobserver agreement in the diagnosis of cervical intraepithelial neoplasia. Am J Surg Pathol 26, 1389-99. Klaes R, Friedrich T, Spitkovsky D, Ridder R, Rudy W, Petry U, Dallenbach-Hellweg G, Schmidt D and von Knebel Doeberitz M (2001) Overexpression of p16INK4A as a specific marker for dysplastic and neoplastic epithelial cells of the cervix uteri. Int J Cancer 92, 276-84. Kumar R, Alavi A (2004) PET imaging in gynecologic malignancies. Radiol Clin North Am 42, 1155-1167 Lee CM, Lee RJ, Hammond E, Tsodikov A, Dodson M, Zempolich K, Gaffney DK (2004) Expression of HER2neu (c-erbB-2) and epidermal growth factor receptor in cervical cancer: prognostic correlation with clinical characteristics, and comparison of manual and automated imaging analysis. Gynecol Oncol 93, 209-14.

Rarely tumors of glandular origin and small cell carcinomas are seen (Han et al, 2000; Zarka et al, 2003). Squamous carcinomas may have varying degrees of differentiation and amounts of keratin formation. In addition to HPV infection, cervical cancers frequently harbor other genetic alterations that herald other steps in oncogenesis (Carico 2001; Klaes et al, 2001) These most frequently include p16 and p53 (Keating et al, 2001; Finegan et al, 2004). p16 has been shown to be expressed in a large proportion of cervical squamous carcinomas (approximately 70% or more). The regulation of this tumor suppressor protein, presumably involves an HPV dependent pathway (Sano et al, 1998, 2002). Current studies are underway to examine the utility of p16 as an adjunctive marker for cervical cancer screening (Lin et al, 2000; Bibbo et al, 2002; Klaes et al, 2002). In addition our group has been interested in examining the role of adhesion protein expression in cancers of the cervix. We have seen the cell-cell adhesion marker P-cadherin as a good marker for glandular tumors of the cervix (Han et al, 2000), and often seen in increasing frequency in dysplastic to frankly neoplastic glandular tumors. In small cell cancers of the cervix, we have shown that the neural adhesion protein N-cadherin may be a tumor suppressor protein that is operative in the development of these tumors (Zarka et al, 2003) Recent studies on the oncogenetic profiles of cervical squamous carcinoma has uncovered tumor heterogeneity, suggesting that these tumors are not static, but undergo additional mutations and expression or loss of oncogenes, probably as a result of tumor clonal selection or tumor evolution (manuscript in preparation)

VII. Summary The last thirty years has seen dramatic change in the incidence and mortality of cervical cancer in the United States. This has been most dramatically affected by the effective screening program associated with the pap smear. Cervical cancer continues to be a significant disease worldwide, and we are understanding more and more of the tumor biology involved, and optimizing current treatment approaches to the disease. Future studies will hopefully uncover best practices for screening strategies for developed and developing countries, as well as preventative options (Lorincz, 1996; Cronje, 2004; Lee et al, 2004; Suba, 2004) Since HPV is the cause of cervical cancer in the majority of cases, research looking at eradicating HPV infection, specifically through vaccine trials is an area of significant interest, and holds much promise (Wolf et al, 2003; Sterlinko and Banks, 2004).

References American College of Obstetricians and Gynecologists (2002) ACOG practice bulletin. Diagnosis and treatment of cervical carcinomas. Int J Gynaecol Obstet 78, 79-91 Baseman JG, Koutsky LA (2005) The epidemiology of human papillomavirus infections. J Clin Virol 32 (Suppl), 16-24. Bibbo M, Klump WJ, DeCecco J and Kovatich AJ (2002) Procedure for immuno-cytochemical detection of p16INK4A Antigen in thin-layer liquidbased specimens. Acta Cytol 46, 25-29

246

Cancer Therapy Vol 3, page 247 Lin WM, Ashfaq R, Michalopulos EA, Maitra A, Gazdar AF and Muller CY (2000) Molecular Papanicolaou tests in the twenty-first century: Molecular analyses with fluid-based Papanicolaou technology. Am J Obstet Gynecol 183, 39-45 Lorincz AT (1996) Hybrid capture method for detection of human papillomavirus DNA in clinical specimens. J Obstet Gynaecol Res 22, 629-636 Lu KH and Burke TW (2000) Early cervical cancer. Curr Treat Options Oncol 1, 147-155 Mota F (2003) Microinvasive squamous carcinoma of the cervix: treatment modalities. Acta Obstet Gynecol Scand 82, 505509 Munger K, Scheffner M, Huibregtse JM, Howley PM (1992) Interactions of HPV E6 and E7 oncoproteins with tumour suppressor gene products. Cancer Surv 12, 197-217. Nakashima R, Fujita M, Enomoto T, Haba T, Yoshino K, Wada HKH, Sasaki M, Wakasa K, Inoue M, Buzard G and Murata Y (1999) Alteration of p16 and p15 genes in human uterine tumours. Br J Cancer 80, 458-467 Negri G, Egarter-Vigl E, Kasal A, Romano F, Haitel A and Mian C (2003) p16INK4A is a useful marker for the diagnosis of adenocarcinoma of the cervix uteri and its precursors. An immunohistochemical study with immunocytochemical correlations. Am J Surg Pathol 27, 187-93. Pecorelli S and Odicino F (2003) Cervical cancer staging. Cancer J 9, 390-394 Platz CE and Benda JA (1995) Female genital tract cancer. Cancer 75, 270-294 Rohan TE, Burk RD, Franco EL (2003) Toward a reduction of the global burden of cervical cancer. Am J Obstet Gynecol 189(4 Suppl), S37-9

Sano T, Oyama T, Kashiwabara K, Fukuda T and Nakajima T (1998) Expression status of p16 protein is associated with human papillomavirus oncogenic potential in cervical and genital lesions. Am J Pathol 153, 1741-1748 Sano T, Masuda N, Oyama T and Nakajima T (2002) Overexpression of p16 and p14ARF is associated with human papillomavirus infection in cervical squamous cell carcinoma and dysplasia. Pathol Int 52, 375-383 Singh GK, Miller BA, Hankey BF, Edwards BK (2004) Persistent area socioeconomic disparities in U.S. incidence of cervical cancer, mortality, stage and survival, 1975-2000. Cancer 101, 1051-7 Sterlinko GH and Banks L (2004) HPV proteins as targets for therapeutic intervention. Antivir Ther. 9, 665-678 Stoler MH (2003) The virology of cervical neoplasia: an HPVassociated malignancy. Cancer J 9, 360-367 Suba EJ (2004) Crossing the quality chasm: a requirement for successful cervical cancer prevention in developing countries. Clin Lab Med 24, 945-963 Wang SS, Sherman ME, Hildesheim A, Lacey JV Jr, Devesa S (2004) Cervical adenocarcinoma and squamous cell carcinoma incidence trends among white women and black women in the United States for 1976-2000. Cancer 100, 1035-1044 Wolf JK, Franco EL, Arbeit JM, Shroyer KR, Wu TC, Runowicz CD, Tortolero-Luna G, Herrero R, Crum CP (2003) Innovations in understanding the biology of cervical cancer. Cancer 98(9 Suppl), 2064-2069 Zarka TA, Han AC, Edelson MI and Rosenblum NG (2003) Expression of cadherins, p53 and BCL2 in small cell carcinomas of the cervix: Potential tumor suppressor role for N-cadherin. Int J Gynecol Cancer 13, 240-243.

From left to right: Aaron Han, Maria Merzouk, Richard Belch

247

Han et al: Update on cervical cancer

248

Cancer Therapy Vol 3, page 249 Cancer Therapy Vol 3, 249-266, 2005

The Oncofetal H19 RNA in human cancer, from the bench to the patient Review Article 1

Imad Matouk , Patricia Ohana , Suhail Ayesh , Ami Sidi2, Abraham Czerniak3, 1 1* Nathan de Groot , Abraham Hochberg 1

The Department of Biological Chemistry, Alexander Silberman Institute of Life Sciences,

Department of Urologic Surgery, The Wolfson Medical Center, Holon, and Sackler Faculty of Medicine Tel Aviv,University, Israel 3

Department of Surgery A, Wolfson Medical center, Holon, Israel

__________________________________________________________________________________ *Correspondence: Hochberg Abraham, Silberman Institute of Life Science, Hebrew University, P.O.Box 91904- Jerusalem-Israel; Tel: 972-2-6585456; Fax: 972-2-561-0250; -mail: hochberg@mail.ls.huji.ac.il Key words: H19 gene; imprinting; angiogenesis; migration; metastasis; oncofetal RNA; serum stress; hypoxia; diagnosis; prognosis; bladder cancer; H19 regulatory sequence; diphtheria toxin A; therapognostic Abbreviations: cellular Src (c-Src); desmoglein-2 (Dsg-2); differentially methylated domain (DMD); diphtheria toxin A (DT-A); fetal calf serum (FCS); heparin binding growth factor-like growth factor (HB-EGF); hepatocyte growth factor/Scatter factor (HGF/SF); in-situ hybridization (ISH); insulin-like growth factor 2, (IGF2); interleukin-6 (IL-6); intracellular adhesion molecule-1 (ICAM-1); Janus kinase-1 (Jak-1); loss of imprinting (LOI); luciferase, (luc); metalloproteinase 2, (MMP-2); N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN); nuclear factor !B (NF-!B); open reading frames (ORFs); thymidine kinase, (TK); transitional cell carcinoma (TCC); tumor necrosis factor " (TNF-"); Tyrosine kinase-2 (Tyk2); urokinase plasminogen activator receptor (uPAR); Received: 24 February 2005; Accepted: 8 March 2005; electronically published: April 2005

Summary H19 is an imprinted gene that demonstrates maternal monoallelic expression in fetal tissues and some cancers and very likely does not code for a protein. Studies of various tumors have demonstrated a re-expression or an overexpression of the H19 RNA when compared to healthy tissues. In cancers of different etiologies and lineages, aberrant expression in allelic pattern was observed in some cases, suggesting that H19 may play a role in tumorigenesis. Functional grouping of genes modulated by H19 RNA indicates trends towards cellular migration, angiogenesis and metastasis. H19 is a stress regulated oncofetal gene, with growth benefit in serum stress, and is up regulated in response to hypoxia and/or serum starvation. H19 is a useful diagnostic and prognostic aid because differential expression of H19 is found to have a clinically significant outcome in bladder cancer. We will present a pathway for a phase I clinical trial in bladder cancer using the H19 regulatory sequences and DT-A. Our study may be a platform for the design of extensive phase I and II clinical studies on a larger number of human patients, and may be a major breakthrough in the treatment of human bladder carcinoma. The promising outcomes of our animal experiments using this therapy, and absence of side effects in our limited human trial, all point to the value of a therapognostic strategy as part of the arsenal to win the war against cancer. Cancer has been a devastating disease throughout time. In 2004, more than half a million Americans died of cancer â&#x20AC;&#x201C; more than all those who fell in Americaâ&#x20AC;&#x2122;s wars throughout history. Although investments in research and drug developments soared in the last three decades, the mortality rate from cancer is still high. 30 years ago, 50% of cancer patients survived 5 years after diagnosis. Since then, minor progress increased that rate to 63%. This rise occurred due to change in personal habits, e.g. less smoking, and earlier detection of tumors.

I. Introduction Throughout time, the human race has striven for immortality. Testimonials are the creation of physical and mental monuments, such as pyramids, or E=mc2. A concept of life after death is a component of both Eastern and Western religions. In fact, immortality has been achieved: the simplest form of life, the cell, regularly achieves immortality. By transforming itself into a cancer cell, it will live on and on. However, its immortality may be deadly to higher organisms.

249

Matouk et al: The Oncofetal H19 RNA in human cancer Still, one out of two men and one out of three women may suffer from tumors during their life. This is a horrifying prediction which can be compared to a scenario where everyday two twin towers collapse. These data explain why people must devote resources to research. Cancer research has generated a rich and complex body of knowledge. Cancer now is known to involve dynamic changes in the genome. The foundation has been set for the discovery of mutations that produce oncogenes with dominant gain of function and tumor suppressor genes with recessive loss of function (Bishop and Weinberg, 1996). Several lines of evidence indicate that tumorogenesis in humans is a multi-step process. These steps reflect genetic alteration that drives the progressive transformation of normal human cells into highly malignant derivatives. The vast catalog of cancer cell genotypes is a manifestation of six essential alterations in cell physiology that collectively dictate malignant growth: self-sufficing-in-growth signals, insensitivity to growthinhibitory signals, evasion of programmed cell death (apoptosis), limitless replicative potential, sustained angiogenesis, and tissue invasion and metastasis (Hanahan and Weinberg, 2000). The genesis of cancer teaches us the complete lesson of evolution. In general, the pace of evolution, whether in malignant cells or a population of organisms, is dependent upon four factors: rate of mutation, rate of reproduction, number of individuals/cells and selective advantage gained by successful mutants (Glassman and Hochberg, 1997). Genetic instability is at the heart of malignancy, characterized by a high rate of mutations. This mutational cascade is shaped by natural selection to gain cellular autonomy. The results are a high rate of proliferation, invasion and conquest of a new habitat. Metastasis is the fatal event for patients and is particular evidence of a strong process of selection. To disseminate, tumor cells must loosen their adhesion to their neighbors, move through and escape their original tissue, cross through a vassal lamina and endothelium to reach the interior of a blood or lymphatic vessel, make an exit from the circulation and then survive in a new environment. Over billions of years of evolution, pressures remained to favor rapidly dividing cells. Thus the step between germ and somatic cells was a precipitous one. Somatic cells forsook their ability to vertically reproduce, in order to specialize. This enabled them to enhance circumstances for the germ cells, which would be responsible for the next generation. Genetic programs curbed the reproduction of the somatic cells. The loss of these control programs (tumor suppressor genes) and activation of proliferation (protoncogenes) are the essence of oncogenesis. In the late 1960s, several investigators suggested that the first genetic molecule on earth was RNA. They proposed the establishment of what is now called the RNA world â&#x20AC;&#x201C; a world in which RNA catalyzed all the reactions necessary for a precursor of lifeâ&#x20AC;&#x2122;s last common ancestor to survive and replicate.

During the last 10 years, a fair amount of evidence has lent credence to the idea that the hypothetical RNA world did exist and led to the advent of life based on DNA, RNA and protein. In 1983, Thomas R. Cech and Sidney Altman independently discovered the first known ribozymes, enzymes made of RNA. So far no RNA molecules that direct the replication of other RNA molecules have been identified. H19 was the first oncofetal RNA discovered. In this review, we will present the role of H19 in humans, its proposed mechanism of action and its use as a therapy against cancer. Finally, we would like to define the term therapognostic. We know now that cancer is a very complicated disease. The hallmark of cancer cells; mutability, natural selection, and change in biotope, bring about that the primary neoplasm is different from the metastatic one. Even more, each neogrowth in one patient might be different from the other. We have to adopt treatment tailored to the gene expression in each tissue of the patient. We have to develop a method where the diagnostic will be prerequisite of the treatment. We define this strategy therapognostic matching therapy and diagnosis.

II. Imprinting and regulation of the H19 gene A. H19 is an imprinted gene with no protein product In some animals including mammals, a number of genes have been found to be subject of genomic imprinting, a phenomenon of monoallelic expression depending on the parent of origin. The parental alleles of imprinted genes are marked during gametogenesis before fertilization, such that they are transcriptionally silenced at one of the parental alleles in the offspring, resulting in differential gene expression in a tissue specific way H19 was the first human imprinted non-coding gene to be identified showing expression of only the maternal allele (Rachmilewitz et al, 1992 B; Zhang and Tycko, 1992). It is also imprinted in mice (Bartolomei et al, 1991). Parentally methylated regions in germ line are present upstream of the H19 promoter. When a mutation in the methylation region of the maternal H19 gene locus occurs, the methylation imprinting pattern is identical to paternal wild type causing silencing of the H19 gene. On the other hand, loss of paternal-dependent silencing causes over-expression of the H19 gene (Cui et al, 2002). H19 was mapped on the short arm of chromosome 11, band 15.5, homologous to a region of murine chromosome 7 (Leibovitch et al, 1991). Imprinted genes including H19 are usually found organized as clusters harboring long range, cis-acting DNA sequences known as imprint control elements. Both physical and functional locations of H19 gene within the cluster are conserved between human and mice. 110-200Kb centromeric to H19 located insulin-like growth factor 2 (IGF2) gene (Zemel et al, 1992). IGF2 and H19 are reciprocally imprinted and have been found to show reciprocal regulation in a number of tissues. The

250

Cancer Therapy Vol 3, page 251 opposite pattern of imprinting and expression of H19 and IGF2 was initially explained by assuming a so called â&#x20AC;&#x153;enhancer competition modelâ&#x20AC;? (Zemel et al, 1992; Bartolomie et al, 1993). According to this model both H19 and IGF2 compete for a common set of enhancers. The maternal chromosome of H19 gene monopolizes the shared enhancers by virtue of its proximity and/or greater promoter strength. On the paternal chromosome, allele specific methylation of H19 would silence the gene and allow IGF2 access to the enhancers. However it was also shown that enhancer competition between H19 and IGF2 is not sufficient to explain their imprinting status (Schmidt et al, 1999). Another model called the boundary model was proposed (Bell and Felsenfeld, 2000). Transcription of these genes is controlled by a set of shared enhancers downstream of H19, and a differentially methylated domain (DMD) upstream of H19. The DMD can bind to a protein called (CTCF) through a binding site, and this protein can act as chromatin insulator. On the maternally inherited chromosome, CTCF binds to unmethylated DMD creating a chromatin insulator which prevents the IGF2 promoter from gaining access to downstream enhancers. On a paternally inherited allele, CTCF can't bind because DMD is methylated. This prevents the action of the insulator allowing the promoter of the paternal IGF2 allele to interact with the downstream enhancers (Bell and Felsenfeld, 2000; Hark et al, 2000). A detailed description of genomic imprinting of H19 and IGf2 genes lies beyond the scope of this review. The reader can refer to (Arney, 2003; Verona et al, 2003). Non-coding RNAs have increasingly been found associated with imprinted genes. H19 belongs to a group of genes that very likely does not code for a protein product (Brannan et al, 1990). Although H19 RNA undergoes all the classical properties of coding transcripts-it is transcribed by RNA-polymerase II, capped, spliced, polyadenylated and transported to the cytoplasm--it seems to function as an RNA and not as a protein. H19 was found associated with polyribosomes in different human cells indicating that it probably is a riboregulator, an RNA molecule with regulatory functions, such as (3' untranslated region of tropomysin mRNA for muscle cell differentiation and Xist for X-inactivation (Erdmann et al, 2001). The genes isolated from humans and mice consist of five exons separated by unusually short introns (80-96 nucleotides in humans). Both human and mice H19 RNAs have multiple open reading frames (ORFs), the largest of which can potentially code for 256 and 132 amino acid-long peptides. However, there is no similarity between the two amino acid sequences, although comparison between the human and mouse H19 gene revealed an overall 77% sequence identity (Brannan et al, 1990). The longest ORF of the human gene is preceded by four very short ORFs, which may be the reason for the complete repression of the main ORF translation in a cellfree translation system. Introduction of deletions and/or point mutations into the 5â&#x20AC;&#x2122;untranslated region of an ectopic H19 gene, upstream of the largest ORF, enabled

the production of the 26Kd protein, although this has not been detected in cells expressing an endogenous H19 gene (Joubel et al, 1996). We recently reported the identification of an alternative splice variant of H19 RNA that lacks part of exon 1. This variant was detected in human embryonic and placental tissues, but not in bladder or hepatocellular carcinomas. A very low level of this variant was also detected in colon carcinoma. The observed pattern of expression suggests that this splice variant is a developmentally regulated H19 gene transcript (Matouk et al, 2004). H19 gene was isolated by differential cDNA cloning from murine embryonic stem cells, which differentiate in vitro to embyoid bodies and as one of the genes (referred to as MyoH) involved in differentiation of myoblasts (Davis et al, 1987; Poirier et al, 1991). H19 was initially isolated as a raf-regulating gene, involved in expression of "-fetoprotein in the mouse liver (Pachnis et al, 1988). Its human counterpart was identified based on homology with the murine gene. We have cloned and isolated H19 by differential screening of cDNA libraries of in vitro cultured differentiated cytotrophoblasts (Rachmilevitz et al, 1992 A).

B. H19 upstream effectors and regulation Little is known today about the regulation of H19 gene expression. It was reported that H19 over-expression in breast adenocarcinoma was significantly correlated with the presence of steroid hormone receptors (Adriaenssens et al, 1998). Steroid hormones modulate H19 expression in the mammary glands and the uterus where H19 is up regulated by 17-#-estradoil and down regulated by progesterone (Adriaenssens et al, 1999). Very recently, it was shown that H19 expression was regulated by a peptidic and a male steroid hormone (Berteaux et al, 2004). H19 gene expression is up regulated by prolactin, but dihydrotestosterone counteracted prolactin mediated enhancement, and this effect is observed in human androgen-dependent cancer cells, but not in human androgen-independent prostate cancer cells. The up regulation of H19 by prolactin occurs by the JAK2-STAT5 transduction pathway. Moreover, the H19 TATA-less promoter is efficiently repressed by wild type p53, which may place the H19 gene within the core mechanism of cell cycle control and cell proliferation, especially at the transition from the G1 to S phase (Dugimont et al, 1998). H19 gene expression is also activated during adult liver regeneration (Pachnis et al, 1984), after liver hepatoctomy (Yamamoto et al, 2004), during the luteal phase of the female menstrual cycle (Ariel et al, 1997b) and in wound healing (Kim et al, 1994). Certain known carcinogens up regulate the expression of the H19 gene. In a study aimed to identify changes in gene expression patterns in the airway epithelium of disease-free smokers compared with a matched group of nonsmokers, a dramatic elevation of H19 RNA levels was detected in the airway epithelium of smokers without loss of imprinting (LOI) (Kaplan et al, 2003). BBN (a known carcinogen of the bladder also 251

Matouk et al: The Oncofetal H19 RNA in human cancer induces the expression of H19 gene in the rat model of bladder cancer (Elkin at al, 1998; Ariel et al, 2004). Moreover, Diethylnitrosamine (a known carcinogen of the liver) induces the expression of H19 in a mice model of hepatocellular carcinoma (Graveel et al, 2001). It was also reported that H19 gene expression is up regulated in vitro in differentiating cells. It was shown that expression of the H19 gene is dependent on the differentiation stage (Davis et al, 1987; Pachnis et al, 1988; Poirier et al, 1991; Rachmilewitz et al, 1992a; Kopf et al, 1998). In particular, we have shown that NT2 and NCCIT cells (derived from a human testicular germ cell tumor), do not express H19 gene. Retinoic acid, which plays an important role in the establishment of the differentiation pattern during embryogenesis, induces H19 expression in these cells, indicating the possibility that H19 RNA could mediate at least partly, the effect of retinoic acid on the differentiation of various tissues during embyogenesis (Kopf et al, 1998). It was also found that H19 expression level is positively correlated with the differentiation stage of placental cytotrophoblasts both in vivo and in vitro (Rachmilewitz et al, 1992a). Leibovitch et al, (1995) also reported that the over-expression of the c-mos protein increases H19 RNA expression in the C2C12 muscle cell line, suggesting an interrelationship between these two gene products during muscle differentiation. Additionally, no expression of H19 could be found in murine fertilized oocytes, the morula and early blastocyst. In the late blastocyst, however, H19 was found to be expressed in the trophectoderm (Poirier et al, 1991). H19 is therefore one of the earliest genes expressed during the first stages of embryonic differentiation. A number of growth factors and cytokines were also

reported to modulate the expression level of H19 RNA. Insulin, insulin-like growth factors (IGFI and II), epidermal growth factor, hepatocyte growth factor, tumor necrosis factor (TNF)-", transforming growth factor (TGF)-#1, interferon (IFN)-$, and activators and inhibitors of protein kinase A and C, all were reported to modulate H19 gene expression in different cell lines, vascular smooth muscle cells, fetal adrenal cells and cultured adrenal cells (Han and Liau, 1992; Han et al, 1996) (Figure 1). H19 gene was also shown to be regulated at the posttranscriptional levels. H19 gene is up regulated exclusively by stabilization of its RNA during muscle cell differentiation (Milligan et al, 2000). Turnover of primary transcripts is a major step in the regulation of mouse H19 gene expression (Milligan et al, 2002). Moreover, a link between IGF2 and H19 genes at post-transcriptional events during mammalian development has been suggested due to the ability of H19 RNA to bind four molecules of IGF2 mRNA binding proteins. This binding was sufficient to direct subcytoplasmic localization of H19 RNA to lamellipodia and perinuclear regions (Runge et al, 2000).

III. H19 and tumorigenesis The imprinted cluster on the chromosome 11p15.5 has been implicated in a variety of disorders and cancer predisposition of both pediatric and adult tumors. This initially places the H19 gene as a candidate gene that fulfills a role in tumorgenesis. Following intensive investigation, contradictory roles have been proposed; a tumor suppressive role and an oncofetal role. In this section, we will present both proposals.

Figure 1. Upstream effectors of the H19 gene. H19 gene expression is modulated when tissues undergo repair and differentiation, and are subjected to carcinogens, cytokines, growth factors and stress conditions. H19 gene expression is also modulated by p53 transcription factor and HGF/SF stromal factor.

252

Cancer Therapy Vol 3, page 253 involved like p57Kip2. Moreover, studies of various tumors have demonstrated a re-expression or an over-expression of the H19 gene when compared to healthy tissue. In cancers of different etiologies and lineages, aberrant expression in allelic pattern was observed in some cases, suggesting that H19 may play a role in tumorigenesis. While H19 shows mono-allelic expression in most tissues throughout development, with the exception of germ cells at certain stages of maturation, and in extra-villous trophoblasts (Adam et al, 1996), bi-allelic expression of this gene, referred as “relaxation of imprinting” or LOI, have been found in an increasing number of cancers. H19 expression was demonstrated for example in a complete hydatiform mole, placental tissue that carries the exclusively paternal genome and gives rise to a malignant trophoblastic tumor choriocarcinoma (Ariel et al, 1994). The kinds of tumors expressing H19, clearly demonstrated that LOI of H19 is not restricted to embryonal tumors. Moreover, some Wilms’ tumors and all neuroblastoma (embryonal tumors), retain mono-allelic expression of H19 (Wada et al, 1995). Bi-allelic expression of H19 was found for example in hepatocellular carcinoma (Kim et al, 1997), in liver neoplasms of albumin SV40 T antigen- transgenic rats (Manoharan et al, 2003), in lung adenocarcinoma (Kondo et al, 1995), in esophageal (Hibi et al, 1996), ovarian (Kim et al, 1998; Chen et al, 2000), rhabdomyosarcoma , cervical ( Douc-Rasy et al, 1996), bladder (Elkin et al, 1995), head and neck squamous cell carcinoma (el-naggar et al, 1999), colorectal (Cui et al, 2002), uterus (Hashimoto et al, 1997) and in testicular germ cell tumors (van Gurp et al, 1994;Verkerk et al, 1996). Further, LOI may or may not associate with overexpression. This indicates that LOI leading to bi-allelic expression of H19 seems not to be crucial in the pathogenesis of cancers. The significance of LOI to tumorigenesis is not fully understood. Moreover, it was shown that H19 over-expression of ectopic origin conferred a proliferative advantage for breast epithelial cells in a soft agar assay and in several combined immunodeficient (SCID) mice (Lottin et al, 2002a). In tumors formed by the injection of cells of a choriocarcinoma-derived cell line (JEG-3), and a bladder carcinoma cell line (T24P), the H19 level is very high when compared to the level of H19 in cells before injection (Elkin et al, 1995; Rachmilewitz et al, 1995; Lustig-Yariv et al, 1997). All of these observations and others contradict the proposal that H19 is a tumor suppressor gene. Herein, we provide a list of cancers (which is still growing), in which H19 gene expression was detected: A- Pediatric solid tumors 1. Wilms’ tumor. 2. Hepatoblastoma. 3. Embryonal rhabdomyosarcoma.

A. Tumor suppressor activity Genetic analysis of the chromosome 11p15.5 region revealed a frequent correlation between the loss of the maternally inherited 11p15.5 region and many cases of Wilms’ tumor and some embryonal rhabdomyosarcomas (Scrable et al, 1989; Moulten et al, 1994). Loss of imprinting of IGF2 and inactivation of H19 has been implicated in the pathogenesis of embryonal tumors and Beckwith-Wiedmann syndrome (Ogawa et al 1993; Steenman et al, 1994). These correlations and other experimental findings can be explained by assuming the existence of a paternally imprinted tumor suppressor gene in this chromosomal area (Rainier et al, 1993). In order to provide evidences for the proposal that H19 functions as a tumor suppressor gene, (Hao et al, 1993) introduced a construct expressing the H19 gene under the control of the metallothionein promoter into cells derived from a kidney tumor. Under the condition of high H19 expression, the cells, which showed prominent morphological changes, grew at a slower rate, had a much lower anchorage-independent growth rate in soft agar, and did not develop tumors when injected into nude mice, as did cells prior to their transfection with the H19 expression construct. Additional support for the proposed tumor suppressor role for H19 came from the study of the role of the H19 gene in Syrian hamster embryo cell tumorigenicity (Isfort et al, 1997). In this report, the author presented evidence that alternation in H19 gene expression may play an important role in the Syrian hamster embryo cell transformation process. 75% of morphologically transformed cells, as compared with non-transformed cells, have reduced expression of the H19 gene. Moreover, re-establishment of wild-type H19 expression in tumorigenic Syrian hamster embryo cells suppressed the tumorigenicity of the transformed cells, indicating that the reduction in H19 expression observed at the morphological transformation stage may be important in cell tumorigenicity (Isfort et al, 1997). Still more support for the possible tumor suppressor role of H19, has been postulated in the light of its possible role in controlling cellular differentiation. Thus by controlling differentiation H19 gene expression could result in differentiation of tumorigenic cells, thereby limiting their growth potential and tumorigenicity (Poirier et al, 1991; Davis et al, 1987; Pachnis et al, 1988; Kopf et al, 1998; Rachmilewitz et al, 1992 A). Moreover, the high frequency of inactivation of the H19 gene was found due to maternal allelic loss, by hyper-methylation of its promoter in sporadic hepatoblastoma (Fukuzawa et al, 1999), and in adrenocortical tumors (Goa et al, 2002).

B. H19 and human malignancies (Is H19 a tumor suppressor gene?) However, accumulating data do not support the idea of H19 being a tumor suppressor gene. (Reid et al, 1996) and using the same cell lines as (Hao et al, 1993) who proposed the tumor suppressor activity of H19, found that H19 expression itself is not correlated with suppression of malignancy. Earlier data had already proposed that another locus on the short arm of chromosome 11 might be

B- Germ cell tumors and trophoblastic tumors 1. Testicular germ cells tumors. 2. Immature teratoma of ovary. 3. Sacrococcygeal tumors.

253

Matouk et al: The Oncofetal H19 RNA in human cancer 4. Choriocarcinoma. 5. Placental site trophoblastic tumors. C- Epithelial adult tumors 1. Bladder carcinoma. 2. Hepatocellular carcinoma. 3. Ovarian carcinoma. 4. Cervical carcinoma. 5. Lung carcinoma. 6. Breast carcinoma. 7. Squamous cell carcinoma in head and neck. 8. Esophageal carcinoma. D- Neurogenic tumors 1. Astrocytoma. 2. Ganglioblastoma. 3. Neuroblastoma.

disease-free survival is significantly shorter, only 8.3 months, than in tumors expressing H19 in a smaller number of cells (38 and 51 months for less than 2/3 and less than 1/3 respectively). Therefore, in the group of patients with refractory superficial bladder cancer, the patients at higher risk of recurrent disease will be those who have more H19positive cells, and will benefit the most from DNA-based drug based on the transcriptional regulatory elements of H19 (as we will discuss later on). Moreover, it was reported that for all tumors of breast adenocarcinoma displaying a good prognosis (grade I), only the stromal component express H19, while H19 is expressed in both epithelial and stromal components of human invasive breast adenocarcinoma (Dugimont et al, 1995). One constraint with the use of H19 as a tumor marker relies on its nature of expression, being an untranslated RNA molecule, with no protein product to be detected in the blood or body fluids. However, it can be detected quite easily by in-situ hybridization (ISH) in malignant tissues (Ariel et al, 1997a, 1998). This technique is very sensitive. We were able to detect H19 RNA in a single cell. This could be a useful diagnostic aid because differential expression of H19 is found to have a clinically significant outcome.

IV. The H19 gene in diagnosis, prognosis and DNA-based therapy A. H19 as an Oncofetal RNA with both prognostic and diagnostic values It is now widely recognized that developmental processes in general and embryogenesis in particular, share many biologic and morphologic features with neoplasms. These include characteristics linked to reduced differentiation, rapid proliferation rate, and the ability to invade. It has become apparent that many of the genes that are expressed during embryogenesis, and down regulated with tissue maturation, are re-expressed in cancer. These include, for example carcinoembryonic antigen, " fetoprotein and the # subunit of chorionic gonadotropin. These genes have been designated as oncofetal or oncodevelopmental genes. The imprinted genes comprise a special group among embryonal genes. Imprinted genes play a pivotal role in embryogenesis and fetal growth and development (Tilghman, 1999; Ariel et al, 2000a). The H19 transcript is an abundant RNA in the developing mouse embryo, in human embryonic tissues and in human placenta, and is down regulated postnatal in most tissues (Pachnis et al, 1984; Lustig et al, 1994). Our group has shown that H19 RNA is re-expressed in tumors arising from tissues which express it in fetal life. This expression is linked to the stage of differentiation and led to the term oncofetal RNA for this mode of H19 expression (Ariel et al, 1997a). The term tumor marker is applied to all substances produced either by the tumor cells or by the host organism in response to a tumor. Its presence may be detected in the serum or other biological fluids or at the level of the tissue, indicating the presence of a neoplasm. An ideal tumor marker can be used for early detection, diagnosis, differential diagnosis, prognosis, and prediction of response to therapy and follow-up. The possibility of using H19 as a tumor marker was suggested by our group for hepatocellular, bladder, and ovarian carcinomas (Ariel et al, 1995, 1998; Tanos et al, 1999). More striking is the predictive value of H19 for tumor recurrence (Ariel et al, 2000b). We have found that in transitional cell carcinoma of the bladder with tumors that express H19 in most cells (more than 2/3), median

B. Setting the stage for a Phase I experiment in patients suffering from superficial bladder cancer using H19 regulatory sequences and DT-A Cancer is responsible for >20% of all deaths and will soon overtake heart disease as the main killer in the western world. The classical combined treatment of malignant diseases â&#x20AC;&#x201C; surgery, radiation therapy and chemotherapy and combinations thereof- often has to face tumors that are already resistant to it. Thus the development of new strategies for the cure of malignant diseases is an evolving field of research, with DNA-based therapeutic approaches being a promising area. One of the main goals for all cancer therapies is the selective targeting and killing of tumor cells, thus increasing the therapeutic ratio. Both chemotherapy and radiotherapy induce dose- limiting normal tissue toxicities, which reduce their clinical effectiveness. Cancer based DNA-drug carries the potential to avoid normal tissue toxicity. More importantly, the therapeutic transgene can target tumor cells, an outcome that conventional therapeutic approaches cannot always achieve. A DNA-based drug for cancer requires the development of delivery systems that allow gene therapy to be administrable to patients in vivo. This requirement demands that the vector itself have some capacity to discriminate between target and non-target cells at some level. If this is not satisfied, dangerous non-specific toxicity could result. One might avoid this problem by use of vectors that infect or transduce only target cells. However, there are few if any available gene delivery vehicles that allow efficient targeted transduction. Thus, while a relatively

254

Cancer Therapy Vol 3, page 255 high level of infectivity of viral- based vectors remains an attractive feature, there are multiple safety concerns and technical features which limit their application. Consequently, transcriptional targeting is alternative and may remain a required safety feature even in the events of development of reliable transductionally targeted vectors. Transcriptional targeting depends on specific regulatory sequences (promoters/enhancers) of genes that are identified as expressed or solely up regulated in cancer cells. The investigations of their transcriptional control provide genetic elements whose presence can be targeted in neoplastic cells, resulting in selective death (AbdulGhani et al, 2000; Ohana et al, 2002; Ayesh et al, 2003). Only targeted cells will be able to activate the transcriptional elements due to their processing of unique transcription factors, which drive the expression of the toxin gene. For such an approach to work the promoter elements need to be tumor specific and the regulatory elements of the promoters and enhancers need to be fully characterized. Ideally, tumor specific promoters should be highly active in tumor cells and have little or no activity in normal cells. The specificity of these strategies should provide improved targeting of metastatic tumors following systemic gene delivery. In the next section we will present a pathway for a phase I clinical trial in bladder cancer using the H19 regulatory sequences and "A" fragment of diphtheria toxin (DT-A). The potential of the toxic vectors driven by the H19 and the IGF2-P3 regulatory sequences have been tested in a metastatic model of rat CC531 colon carcinoma in liver. Preliminary results in treating a patient with hepatocellular carcinoma using H19 regulatory sequences were promising. Preliminary results in treating a patient with colon carcinoma that metastasize to the liver using H19 regulatory sequences and DT-A are promising.

tumors, which expresses H19 originating in the transitional epithelium of the urinary tract during fetal life. We have shown that H19 is significantly expressed in 84% of human bladder carcinomas and that the expression level is linked to the differentiation stage. In a N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN) induced bladder carcinoma mouse model, our group has correlated H19 expression, as demonstrated by (ISH), to the sequential stage of tumor progression (Elkin et al, 1998). The mouse model of BBN resulted in the development of invasive carcinoma preceded by pre-neoplastic mucosal changes. This resembles the solid invasive cancer in human. In this model, the initial expression of H19 was found to be concurrent with epithelial hyperplasia, which appeared as early as 5 weeks following carcinogen ingestion. The localization of H19 expression at this stage is the connective tissue of lamina propria underlying the basement membrane of the hyperplastic epithelium. At 11 weeks some expression was found in the epithelial cells, still in the pre-neoplastic state. Invasive tumors were first noted at the 20th week of BBN-treatment. H19 expression was evident at this stage in epithelial tumor cells, in the intervening stroma, and in the submucosa underlying the hyperplastic epithelium adjacent to the tumor. The stroma, the connective tissue that interposes between malignant cells, is an integral part of solid tumors. In contrast, the bladders of the control group that received normal tap water without the administration of BBN, did not express H19 in any of the tissular elements of bladder wall (Elkin et al, 1998). We have also injected cells from human bladder carcinoma cell lines, which did not express H19, into nude mice. The significant increase in H19 expression during the process of tumor formation in the mice raises the possibility that the H19 gene product fulfills a role in the process of tumor formation of the bladder (Elkin et al, 1995). Moreover, it was reported that LOI of H19 is linked to hypo-methylation of the paternal allele in human bladder cancer (Takai et al, 2001). Differential expression of H19 was found to have a clinically significant outcome in bladder cancers (Ariel et al, 2000 B).

C. H19 and bladder cancer Bladder cancer is the fourth most common cancer in men, accounting for about 10% of all cancer cases, and is the fifth most common cause of cancer death in men. In woman it is the eighth most common cancer (Silverberg et al, 1990). Most bladder tumors arise from epithelium lining the urinary system--the transitional epithelium--and are therefore, transitional cell carcinomas. Eighty percent are superficially limited to the bladder mucosa (Ta) or submucosa (T1). These tumors can be removed by transuretheral resection, but tend to recur in 50-70% of all patients. Attempts were made to decrease the high recurrence rate of superficial bladder tumors by adjuvant intravesical treatments such as intravesical chemotherapy and immunotherapy (BCG). However, a significant portion of patients develop recurrent tumors despite all these efforts, which are also associated with side effects. Human bladder carcinoma develops in the adult from bladder mucosa cells which have lost their ability to express the H19 gene. In recent years, we have studied the expression of the H19 gene in human bladder carcinoma (Elkin et al, 1995, 1998; Cooper et al, 1996; Ariel et al, 2000a). Human bladder carcinoma is a prototype of

D. Experimental models of bladder cancer "From the bench to the patient" 1. The use of a DNA- based therapy in vitro Early investigations in any modern anticancer therapy are done in vitro. For this purpose, our team characterized the human and mouse H19 regulatory sequences which can potentially be applied to control the expression of a toxin gene, in constructs to be used in bladder cancer gene therapy trials in mice and humans (Banet et al, 2000). Cloning of different fragments of the human H19 promoter enabled the examination of their transcriptional activity in a variety of cancer cell lines. The regions between -85bp and -61bp is rich in CpGs, and was found to play a significant role in the regulation of H19 transcription. This region contains transcription factor binding sites, including the CCATT box, which binds transcription factors from the C/EBP family. 255

Matouk et al: The Oncofetal H19 RNA in human cancer We have constructed expression vectors carrying â&#x20AC;&#x153;cytotoxic genesâ&#x20AC;?, such as the gene for the DT-A or the gene of herpes simplex virus thymidine kinase (TK), under the control of an 814 bp 5â&#x20AC;&#x2122; flanking region of the H19 promoter sequence. This region was verified to be highly active in both human and murine cell lines. We also presented evidence that the constructs expressing either the toxin or the suicide gene driven by the H19 regulatory sequence could selectively exert their cytotoxic effects in H19-positive cells (Ohana et al, 2002). The killing capacity of these constructs was in accordance with the relative activity of the H19 regulatory sequences in the transfected cells. These studies demonstrate that the transcriptional regulatory sequence of the H19 gene can be exploited to achieve high cell-specific expression of exogenous toxin in vitro. The usage of the gene only encoding the diphtheria toxin-A chain prevents any bystander effect because the B chain is responsible for cell penetration. This might be desirable in many cases since it prevents harmful effects to surrounding normal cells. The potent activity of the toxin can be attenuated by using a mutated DT-A chain gene. Using a plasmid with an expression cassette of the toxin, no immune response will be encountered; moreover, the whole western population is immunized against the toxin. Further, our system will not be affected by a multi-drug resistance effect, a major problem in chemotherapy. In a second stage of our studies, DT-A toxin expression was evaluated in animal models of bladder cancer. One advantage associated with bladder cancer is its easy accessibility and relative isolation from other areas of the body.

therapeutic vector, or the luciferase (luc) gene as a control. Additional controls mice had tumors without any treatment. The results of these experiments showed that the mean weight of the tumors from mice given three treatments of the toxin plasmid was 40% lower than the mean tumor weight of the mice treated with a similar construct expressing the (luc) gene (Ohana et al, 2002). ii. Heterotopic nude mice model This model shares the advantages and disadvantages of the syngeneic mouse model. However another advantage of this model is that it can be used to assess the therapeutic potential of our plasmids on tumors formed by cell lines of human origin. We have previously shown that the regulatory sequences of H19 are highly transcriptionally-active in a human bladder carcinoma cell line (RT-112) (Ohana et al, 1999, 2002). Confluent (RT-112) and (UM-UC3) human bladder carcinoma cells were subcutaneously injected into the back of CD1 nude mice females, 6-8 weeks old. 14 days after cell inoculation the developing tumors were measured in two dimensions and randomized to different treatments. Two injections of DTA-H19 were able to inhibit any further tumor growth as compared to the control luc-H19 treatment (Ohana et al, 2004a). While the average tumor size of the toxin treated tumors did not change, the control treated tumors continued to increase their volume 2.5 fold during the 7 days after the start of the treatments. The growth rates of treated tumors according to tumor volume measured in vivo were significantly reduced, with relatively large necrotic areas compared to the control. Moreover, signs of toxicity were not observed. Liver and renal function tests were identical to values obtained from untreated animals. No traces of the plasmid H19DTA were found in the blood analyzed by PCR after the mice were sacrificed, nor was weight loss of the treated animals observed (Ohana et al, 2004a).

2. Animal models for in vivo DNA-based therapy for bladder cancer The goal of all laboratory models of cancer is to simulate the human disease. When promising in vitro results are obtained, the next step is animal studies. Most of the animal experimental work in the field of bladder cancer is done on rodents. The road from in vitro experiments to a Phase I clinical study is illustrated, below, using different animal models of bladder cancer.

iii. The orthotopic syngeneic models in the mouse and rat An intravesical tumor is produced by injection of malignant cells (syngeneic cells for immuno-competent animals and human-derived cells for immuno-deficient animals) into the bladder of the rodent. The bladder is rather resistant to implantation of cells, and it is necessary to create abrasions in the bladder mucosa of the anesthetized rodent either by acid, by trypsin installation, or by induction of thermal burns with surgical diathermy, in order to increase "tumor take". The advantages of this model are its speed, 7-10 days for production of a tumor, and the ability to treat bladder tumors inside the bladder. The disadvantages are the need for anesthesia, and the difficulty in assessing tumor burden. These tumors resemble human bladder tumors but not as much as carcinogen-induced bladder tumors. Accordingly, a rat model for bladder cancer was developed by intravesical instillation of (NBT-II) rat bladder carcinoma cells onto the wall of rat bladder in vivo. To evaluate the potential use of H19 regulatory sequences for the therapy of this rat bladder carcinoma

i. The heterotopic syngeneic mouse model In this model, malignant cells are injected into the back of the mouse. In an immuno-competent animal a syngeneic cell line is used. The advantages of this model are its rapidity, reproducibility, and visibility of tumors. The disadvantage is the poor correlation in histology and clinical course between this model and the clinical disease. Novel therapies can be tested using this model and it is possible to obtain quick initial results, and use them as a guide for further research. In this model, syngeneic (MBT-2-t50) bladder carcinoma cells were injected subcutaneously (s.c.) into the dorsa of 6-7-week-old C3H/He female mice. Measurable tumors appeared after 10 days, and treatment began 14 days after inoculation. An H19 gene promoter was used to drive the expression of either the (DT-A) toxin or (TK), followed by ganciclovir treatment, as the 256

Cancer Therapy Vol 3, page 257 model, we determined the levels of H19 RNA by PCR, from samples of the developed tumors in vivo 7 days after instillation. It is interesting that the level of H19 RNA was even higher than the original (NBT-II) cells used to establish this model. H19 RNA is undetectable in normal rat bladder tissue, the DTA-H19 construct was shown to be highly active in (NBT-II) cells in vitro. Hence, the validity of using this animal model was shown (Ohana et al, 2004a). Rats were treated with either the DTA-H19 construct or luc-H19 control four days after (NBT-II) instillation using polycation PEI. Treatment was repeated four days later and rats were sacrificed 11 days after the first treatment. The mean weight of bladders of DTA-H19 treated rats was significantly lower. The average size of DTA-H19 treated tumors was 95% smaller than the luctreated ones. The group treated with the reporter vector showed more than one large transitional cell carcinoma (TCC) lesion, with different grades of invasion. In contrast, only smaller papillary tumors were detected in the DTA-H19 treated bladders. No traces of toxicity was seen by blood, urine and weight gain analyses. In vivo evidence of DT-A expression was tested by PCR analysis. There was expression in the tumor, but not in the liver and marginally in the kidney (Ohana et al, 2004a).

on human patients were promising and supplied plenty of important information. The most prominent points are: 1- Intravesical instillation of DTA-H19 construct in complex with PEI is safe up to a dose of 5mg in a single treatment. No adverse side effects related to the constructs occurred during 30 treatment sessions in the two patients (20 treatments to the first patient, and 10 to the second). 2- The DTA-H19 construct is not absorbed into the blood stream. This was supported by the results showing no trace of DTA-H19 plasmid in the blood even after extensive PCR cycling analysis done on blood samples regularly taken during the course of treatment before and 2 hours after plasmid instillation of plasmid administration. 3- Evidence for biological activity of the transgene was strongly demonstrated by video-cystoscopy. The treatment with the DTA-H19 construct has an ablative power on bladder tumors with > 75% decrease in tumor volume, as compared to the video-cystoscopy before treatment, and was coupled with macroscopic signs of tumor necrosis. 4- The DTA-H19 plasmid is excreted in the urine up to one week after instillation as determined by PCR analysis. Although clearance of the plasmid was observed with time, the presence of the plasmid in the urine for a prolonged period is a great advantage, because the plasmid may be continuously available to transfect deep layers of tumor once the superficial layers of the tumor have been transfected and pilled off. 5- The source of the DTA-H19 plasmid excreted in the urine after the instillation comes both from exfoliated cells and from the supernatant (probably plasmid loosely adherent to outer cell surface). The plasmid DTA-H19 probably enters the nucleus since the plasmid presents in the extract of genomic DNA from the cells pelleted from the urine. 6- In the first patient, no recurrence of TCC occurred even 17 months after the first DTA-H19 plasmid treatment, while no recurrence occurred even after 14 months in the second patient. In conclusion, these points show that bladder tumors may be successfully treated by a DNA-based drug approach based on transcriptional targeting using the H19 gene regulatory sequence. This treatment seems safe, very efficient, promising, and above all can increase the quality of life of many patients. Our study may be a platform for the design of extensive phase I and II studies on a larger number of human patients, and may be a major turning point in the treatment of human bladder carcinoma (Ohana et al, 2004a).

iv. Carcinogen-induced bladder cancer in mice and rats In this model, the rodent is given a carcinogen, most commonly through drinking water. BBN is a carcinogen given in a concentration of 0.05% and it induces bladder tumors in 95% of the rodents after 25 weeks. The tumors produced by the carcinogen resemble human bladder cancer in histology, etiology, and in kinetics (25 rat weeks equal 10 human years- the expected incubation period of human bladder cancer). Treatment with DTA-H19 constructs resulted in about 50% reduction of tumor area and large necrotic areas as detected by histological examination, while no significant reduction of the weight of the bladders was noted between DTA-H19 and Luc- H19 constructs. (Unpublished results). v. Treatment of two human patients with the therapeutic vector DTA-H19 These patients suffered from refractory superficial bladder cancer. They developed recurrent bladder tumors and failed to respond to all acceptable treatments known to inhibit the development of recurrent tumors. They were also candidates for cystectomy. Samples of bladder tumors from both patients were removed by transuretheral surgery. The samples were submitted for histological and molecular diagnosis. In-situ hybridization studies showed high expression of H19 in their bladder tumors. Hence, they were appropriate candidates for the treatment with the toxin construct DTAH19 (Ohana et al, 2004a). Taking advantage of the anatomy of the bladder, we evaluated the feasibility and safety of intravesical vector instillation using a transurethral catheter. The experiments

vi. Regulatory sequences of H19 and IGF2 genes in DNA-based therapy of colorectal rat liver metastasis We extended the described approach to colorectal rat liver metastases. The therapeutic potential of the toxin vectors driven by the human H19 and IGF2-P3 regulatory sequences was tested in a metastatic model of rat (CC531) colon carcinoma in liver (Ohana et al, 2004b). We have already characterized the expression profile of H19 in human liver metastasis originating from colorectal, pancreatic, ovarian, breast and gastric cancers. H19 is highly expressed in various human liver metastases

257

Matouk et al: The Oncofetal H19 RNA in human cancer as detected using quantitative (ISH) analysis (accepted results for publication). Moreover, we have previously described the construction of expression vectors carrying the diphtheria-toxin A-chain gene under the control of IGF2-P3 and P4 promoters, and showed that these constructs selectively kill tumor cells and inhibit tumor growth in vitro and in vivo (Ayesh et al, 2003). In order to determine the validity of this approach for therapy of rat colon tumors in the liver, the level of H19 transcript in normal rat and tumor livers induced by subcapsular injection of CC531 cells was detected , results showed high levels of H19 RNA in liver metastasis, in contrast, H19 RNA levels in normal liver or liver parenchyma that was not involved in metastasis were marginal. Moreover, high levels of P2 transcripts were also detected in the metastatic tissue where no or very low expression levels were detected in the adjacent host liver tissues by using (ISH) technique (Ohana et al, 2004b). The pattern of rat igf2-P2 expression in the rat liver resembles that of the human IGF2-P3 expression (Kawamoto et al, 1999). We previously reported that the human H19 and IGF2-P3 regulatory sequences are also active in murine cells (Ohana et al, 2001; Ayesh et al, 2003). We also showed that human H19 and IGF2-P3 regulatory sequences were able to drive the DTA expression in orthotopic rat colon carcinoma (CC531) cells. Intratumoral injection of the toxin vectors induced a 90% and 50% reduction in the medium tumor volume for H19 and IGF2-P3 therapeutic vectors respectively, as compared with the control groups that were treated with the correspondent reporter vectors. The therapeutic effect was accompanied by an increase of necrosis of the tumor. No signs of toxicity were detected in healthy animals after their treatment by the toxin expressing vectors. Although liver metastases were not totally ablated, the treatment with the toxin vectors almost stopped the further growth of the metastasis (Ohana et al, 2004b). The inhibition in tumor growth was also demonstrated in a group of rats treated with H19-DTA, compared with a control group, in a long-term experiment. The decrease in medium tumor volume in this experiment, 43%, was smaller than that obtained in a short-term experiment. The reduced efficiency of the long term experiment may be due to the longer time intervals between treatments with the plasmids (7 days compared with 4 days, to avoid complications due to surgical procedures). Based on the findings presented here, we propose a patient-oriented approach to treat colon metastases in the liver. Given the clinical and genetic diversity of liver metastases, it may prove difficult to find a one-for-all promoter sequence to be used as a therapy. Instead we propose tailored transcriptional regulatory sequence selection for DNA-based therapy of liver metastases, according to an individual patient-specific gene expression profile. According to this approach, the patient may be simultaneously treated with a combination of toxin-expressing plasmids, some of which are under the control of the H19 and IGF2 regulatory sequences, and

others depending on differentially expressed gene profiling. We recently used regulatory sequences of H19 to drive the expression of DT-A in treating a patient with colon carcinoma that metastasizes to the liver. Preliminary results are promising.

V. Proposed mechanism of action of H19 RNA The goal of uncovering the H19 gene function has led to many investigations. Early attempts worked with models of H19 over-expression and knockout in mice. When extra copies of the H19 gene were introduced into mouse embryos, no transgenic progeny were obtained which expressed the transgene, and fetal death occurred at midgestation. However, in the developing embryo before death, the transgene was expressed in several tissues including those in which the endogenous gene is normally not expressed (brain tissue) (Brunkow and Tilghman, 1991). When H19 was knocked out creating a null mutation for the H19 gene, leaving the 5' enhancer region intact, the paternal transmission of the mutation neither exhibited any obvious phenotype nor aberrant H19 expression (Leighton et al, 1995). This was consistent with the inactivation of the paternal allele under physiological conditions. However, the maternal transmission of the mutation showed a 28% increase in the body size that could be attributed to the higher levels of IGF2. Despite much evidence, uncovering the H19 gene function remains elusive. We have made contributions that could lay the foundation for understanding more about this gene. H19 is a stress regulated oncofetal RNA. H19 seems not to contribute to the onset stages of tumor development, but can be added to the list of genes that dictate a tumor's deadly signature (Ayesh et al, 2002, 2004).

A. Functional grouping of genes modulated by H19 RNA: trends to cellular migration, angiogenesis and metastasis An important step towards understanding the role of H19 RNA is defining gene expression profile; comparing patterns of gene expression in two homogeneous cell populations that only differ in the presence or absence of H19 RNA. This approach for analyzing the expression of multiple genes simultaneously using the cDNA expression array, has widely opened the way to unmasking the function of this gene. Plenty of downstream effectors of H19 RNA have been identified and among these are group of genes that were previously reported to play crucial roles in some aspects of the tumorigenic process. H19 RNA presence could enhance the invasive, migratory and angiogenic capacity of the cell by up regulating genes that function in those ways, and could thus contribute at least to the initial steps of metastatic cascade (Jiang et al, 1995; Abramovitch et al, 1998; Arkonac et al, 1998; Kacimi et al, 1998; Giroux et al, 1999; Sebolt-leopold et al, 1999; Huang et al, 2000; Schlessinger et al, 2000; Wang, 2001) (Figure 2). 258

Cancer Therapy Vol 3, page 259

Figure 2. Modulation of gene expression linked to invasion and angiogenesis by H19 RNA. A reduced expression of adhesion molecules responsible for cell-cell and cell-matrix interactions together with the up regulation of genes required for extracellular-matrix metabolism, motility, and angiogenesis put H19 gene function in the core of at least the initial steps of metastatic cascade.

Previous observations made by us and others are in accordance with this proposal. First, it was demonstrated that halofuginone, a low molecular weight alkaloid compound known to inhibit collagen type "-1 and MMP-2 gene expression, effectively suppresses the progression of primary tumors in both transplantable and chemically induced models of bladder cancer. It abrogated BBNinduced tumor in the mouse bladder, and its progression towards highly invasive carcinoma. Moreover, a significant reduction in vascular density was revealed by histological examination of tumors derived from halofuginone-treated mice (Elkin et al, 1999). All these observations are coupled with the absence of H19 gene expression in halofuginone-treated mice as compared with its high level in BBN-induced bladder tumors in mice that did not received halofuginone. ISH revealed a high level of H19 expression in both epithelial and stromal compartments of bladder tumors induced by BBN. After halofuginone treatments, H19 expression was not detected in any tissue element of the bladder wall (Elkin et al, 1999). Taking into consideration that the course of H19 expression in BBN-induced bladder cancer in mice is essentially the same as in humans (Elkin et al, 1998), lack of H19 transcripts in halofuginonetreated bladders could be related to the observed antiinvasive and anti-angiogenic effect of halofuginone. However, the direct effect of halofuginone on H19 expression needs to be elucidated.

Second, it is well established that epithelialmesenchymal transitions are vital for morphogenesis during embryonic development and are also implicated in the conversion of early stage tumors into invasive malignancies. (Adriaenssens et al, 2002) showed that cross-talk between mesenchyme and epithelium increases H19 gene expression during scattering and morphogenesis of epithelial cells. The mesenchymal factor hepatocyte growth factor also known as scatter factor (HGF/SF), was capable of inducing H19 expression and cell morphogenesis. This finding places H19 as a target gene for HGF/SF, and suggests that up regulation of H19 may be implicated in morphogenesis and/or migration of epithelial cells (Adriaenssens et al, 2002). Moreover, it was shown that the H19 promoter region is responsive to HGF/SF in a transient transfection assay. However using pharmacological inhibition of ERK/MAPK prevented the activation of H19 promoter in response to HGF/SF. This study highlights H19â&#x20AC;&#x2122;s potential role in promoting cancer progression and tumor metastasis by being a responsive gene to HGF/SF. The study also showed that H19 is often overexpressed in stromal cells and preferentially located at the epithelium/stroma boundary; in some cases of breast adenocarcinoma with poor prognosis, H19 is overexpressed in epithelial cells. Moreover, regulation and general expression patterns of H19 in the mammary gland 259

Matouk et al: The Oncofetal H19 RNA in human cancer during fetal or postnatal life may argue in favor of the H19 being involved in epithelial cell migration. Indeed in puberty and pregnancy, H19 is strongly expressed in mammary terminal buds extending into the fat pad and the mesenchymal components (Adriaenssens et al, 1999). It was shown that the well-differentiated breast carcinoma cell line MCF-7 does not express the c-Met protein (the receptor of HGF/SF). Therefore it does not demonstrate a motile or invasive phenotype; nor is H19 induced by HGF/SF in this cell line. In contrast, poorly differentiated cell lines (MDA-MB-23, and HBL-100), that are sensitive to HGF/SF, exhibit a high level of H19 gene expression. This is concordant with a fully developed invasive phenotype (Adriaenssens et al, 2002). In a related way, it was very recently reported that the level of H19 expression is strongly correlated with tumor invasion and myometrium invasion of the female genital organs (Lottin et al, 2005). Relevant to the physiological role played by H19 RNA, many features of H19 expression during embryogenesis and adult life are in accordance with our proposed function of H19 RNA. It is very interesting to note that while H19 expression is down regulated after birth, the endometrium and the ovary of the human female are two of the very few tissues which retain the ability to express the H19 gene in adult life (Ariel et al, 1997b). H19 has been shown to be present in the secretory endometrium of the female menstrual cycle, which is characterized by increased vasculature. It is also known that physiological angiogenesis rarely occurs in adults, but does occur during menstruation for repair of the vascular bed. Furthermore, H19 was found to be expressed at high levels during embryogenesis, and the above-proposed activity of H19 can explain the role of H19 in placental and embryonic development. H19 is reported to be highly expressed in extra-villous trophoblasts cells, which are responsible for the invasive properties of the placenta during implantation (Ariel et al, 1994). Moreover, H19 expression increases in the carotid artery after injury suggesting a role during wound healing (Kim et al, 1994), where angiogenesis is fundamental to restoring or creating a blood supply to growing tissue.

serum stressed media (0.1%FCS) for 72 hours (Ayesh et al, 2002). This observation was coupled with the inability of the H19 expressing cells to induce the cdk inhibitor p57Kip2 in response to serum stress. This observation conditionally (absence of serum factors) places H19 gene in the core mechanism of cell cycle control and cell proliferation, especially at the transition from G1 to S phase and thus could indicate the importance of H19 gene expression to the tumor under stress conditions, like when the growth factors availability is strict (Ayesh et al, 2002). Taking a look at the set of genes modulated by the presence of H19 RNA, we found that uPAR and ERK1/2 is up regulated. The growth advantage of H19 expressing cells under serum starvation could be related to the up regulation of those genes. Recently we showed that H19 is a responsive gene to hypoxia with or without serum starvation, depending on the cell line under investigation. Plenty of downstream effectors of H19 under hypoxic conditions and/or serum starvation have been identified, which further indicates a role of the H19 gene in the initial steps of metastatic cascade (Ayesh et al, 2004). All of these observations can place the H19 RNA into the category of biotic and abiotic stress response RNA. We thus hypothesize the possible role played by H19 RNA in tumorigenicity. During tumor development, an evolution-like process occurs in which cells with highly advantageous properties are selected. In this regard, the microenvironment of the tumor is the factor that imposes the selective pressure on the malignant cells. The ability of the cells to withstand harsh conditions due to the lack of adequate blood supply is of great advantage for tumor progression. Populations of cells may be forced into a state of dormancy, rendering themselves non-proliferative, and hence lowering down their needs for oxygen and metabolites. In contrast, any genomic alternation, in our case increased in H19 expression, occurring in a malignant cell which enhances its ability to proliferate under harsh condition, will give that cell a selective advantage. The progeny of the H19 expressing cells will increase in number at a higher rate than the neighboring cells and hence gradually increase their relative contribution to the tumor volume. Phenotypic traits beneficial for cell proliferation also seem to favor invasive growth and metastasis. Less sensitive cells in a harsh and stressed condition will indeed contribute greatly to the generation of a pathophysiological microenvironment with harsher low extracellular pH (more acidic) and low oxygen tensions (hypoxia). Experimental studies have shown that hypoxic tumors may also be the most pro-angiogenic, and prometastatic. Hypoxic conditions in tumors induce the release of cytokins that promote vascularization and thereby enhance tumor growth and metastasis (Brahimihorn et al, 2001; Harris, 2002; Choi et al, 2003). Since we provide evidence that H19 RNA enables the cells to continue proliferating in a serum starved condition (one of the consequences of a poorly vascularized tumor), it is logic to assume that the relative

B. H19 is a stress regulated gene, with growth benefit in serum stress, and is up regulated in response to hypoxia and/or serum starvation The involvement of H19 in cell cycle control was previously predicted by the involvement of the tumor suppressor gene p53 in the down regulation and promoter activity of H19 expression, which lacks a p53 consensus site and a TATA box (Dugimont et al, 1998). We previously provided experimental evidence for a role played by H19 in enabling the cells to overcome the stress caused by serum starvation. We indicated that while H19 does not confer any growth advantage on cells cultured in 10% fetal calf serum (FCS), it does enable them to continue proliferating when the cells are cultured in a

260

Cancer Therapy Vol 3, page 261 contribution of H19 expressing cells towards the creation of the pathological microenvironment is great, which will promote for tumor angiogenesis, invasion and metastasis. Here, it seems that H19 have dual effects on the accelerated creation of the pathological environment, and the modulation of some of the genes that are required for hypoxic response needed for angiogenesis and metastasis (Figure 3). This proposal is supported by many observations: 1. It was previously shown by us that while H19 RNA is either not or weakly expressed in certain bladder carcinoma cell lines in normal culture conditions, H19 is strongly expressed when tumors are grown by injecting these cell lines into nude mice (Elkin et al, 1995).

Although we canâ&#x20AC;&#x2122;t rule out any other possibility, it seems that enhanced H19 expression observed in these tumors has to do with selection and clonal expansion of H19 expressing cells, under the severe and harsh condition of a rapidly growing tumor in vivo. This explanation is strengthened by our observation that these cells have lost H19 expression upon the third passage when re-cultured in vitro and provided with essential nutrients and serum factors and oxygen. 2. The patients with the most hypoxic tumors had worse disease-free and overall survival probabilities than those with the least hypoxic tumors, irrespective of whether the treatment was a surgery or radiation therapy. Moreover, recurrent tumors were found to show

Figure 3. Proposed mechanism of action of H19 RNA. Cancer progression springs from the combined forces of both genetic and epigenetic events. The presence of activated oncogenes and/or inactivated tumor suppressor genes represents the onset of multistage tumor development. At advanced stages, however, uncontrolled tumor growth due to genetic instability and clonal expansion, and the consequent development of a stress microenvironment, allow a gradual process of microevolution to occur, in which sub-clones with a survival or growth advantage come to predominate the tumor. Competition for space, and ability to recruit neo-vasculature and detach from neighboring cells, may all represent early selective pressure. The H19 gene may contribute to malignant spread by conferring growth advantage as a response to a pathological microenvironment (self-sufficiency-in-growth signal), and by inducing angiogenesis and metastasis.

261

Matouk et al: The Oncofetal H19 RNA in human cancer significantly lower median pO2 values than primary tumors of comparable size, as has been reported for uterine cervix (Hockel et al, 1993). Consistent with this, our group showed that H19 gene expression is a marker of early recurrence in human bladder carcinoma. Moreover, we have found that in the group of patients with refractory superficial bladder cancer, those that have more H19 positive cells are at higher risk of recurrent disease, and significantly shorter median disease-free survival (Ariel et al, 2000b). A proteomic approach has revealed that H19 over expression in human cancerous mammary epithelial cells stably transfected with genomic DNA containing the entire H19 gene, is responsible for positively regulating the thioredoxin gene at post-tramscriptional level, thioredoxin being a key protein of the oxidative stress response and deoxynucleotide biosynthesis (Lottin et al, 2002b). 3. Many processes that involve cellular invasion, including blastocyst implantation, and placental development occur in reduced oxygen environments (Rodesch et al, 1992). These two physiological processes show intensive up regulation of H19 expression (Ariel et al, 1994). 4. Comparison of the tumorigenic potential of the human epidermoid carcinoma cell (HEp3) which expresses uPAR, and its variant in which uPAR expression was reduced by an antisence strategy, reveals that reduction of uPAR expression forces malignant cells into a protracted state of dormancy. The uPAR-expressing clones produced rapidly growing, highly metastatic tumors within two weeks of inoculation on the chorioallantoic membranes (CAMs) of chick embryo. In contrast, each of the clones with low surface uPAR, whose proliferation rate in culture was indistinguishable from controls, remained dormant for up to 5 months when inoculated on CAMs. Calculating the percent of apoptotic cells and Sphase cells in vivo showed that the mechanism responsible for the dormancy was diminished proliferation (Yu et al, 1997). It was speculated that reduced uPAR might diminish responses mediated via this receptor, such as migration, mitogenicity, and induction of neovascularization leading to tumor dormancy. As we stated above, uPAR expression is up regulated by H19 RNA. 5. It is very interesting to note that several genes up regulated in the presence of H19 RNA are also known to be induced by hypoxia. For example, it was reported that hypoxia increased in vitro invasiveness of trophoblasts and breast carcinoma cells through the increase in uPAR expression, and decreased adhesion of the cells to fibronectin through reduced expression of "-5 Integrin (Lash et al, 2001). Those observations are similar to what we observe in the presence of H19, where uPAR expression is induced and Integrin "-5 is reduced. Moreover, the transcription factor NF-!B, as well as members of the mitogen-activated protein kinase (MAPK) superfamily, consisting of (ERK)1/2, c-Jun, NH2-terminal kinase (JNK1/2), all induced by the presence of H19, have been reported to be activated by hypoxia (Laderoute et al, 1999; Kroon et al, 2001). TNF-", IL-6, ICAM-1 (Kacimi et al, 1998), c-Src (O'toole et al, 1997), Ezrin

(Mukhopadhyay et al, 1995), HB-EGF (Sakai et al, 2001) and Transferrin receptor (Tacchini et al, 1999) are also induced by hypoxia and are up regulated by H19. We recently provided evidence that H19 itself is a hypoxia responsive gene (Ayesh et al, 2004). 6. H19 RNA has been detected in rheumatoid arthritis synovial tissue (Stuhlmuller et al, 2003). Although this provides one of the first cases of H19 expression in chronic, non-tumoral disease, the hyperplastic synovial tissue in rheumatoid arthritis displays several features of a semi-transformed tissue, such as invasive growth into cartilage and bone. Moreover, the presence of extensive angiogenesis is usually associated with rheumatoid arthritis due to hypoxic and oxidative stress, partly due to the metabolic activity of increased inflammatory cell exudates in the affected area. This could explain why H19 was detected in rheumatoid arthritis synovial tissue. What is common to serum starvation and hypoxia? Hypoxia and serum starvation are both the consequence of a poorly vascularized tumor, which is considered a normal stage during tumor development. The realization that a lot of us carry in situ tumors, but do not develop the disease, suggests that these microscopic tumors are mostly dormant and need additional signal to grow and become lethal tumor (Folkman and Kalluri, 2004). In the absence of blood supply in situ tumor can remains dormant indefinitely. Our findings could mean that H19 expression not only confers a growth advantage on cells under a stress condition (serum starvation), but also up regulates the expression of genes that could contribute to the promotion of cancer progression and metastasis, and thus could be one of those signals that dictate tumors deadly signature. In conclusion, the oncofetal H19 RNA is a unique gene that can be used for cancer diagnosis as well as therapy. The 33 types of human cancers that express H19, the simplicity of the H19 construct therapy, the promising outcomes of our animal experiments using this therapy, and the promising outcomes and absence of side effects in our limited human trial using this therapy, all point to the value of a therapognostic strategy as part of the arsenal to win the war against cancer.

Acknowledgements We thank Avi Barak president and C.E.O of Yissum technology transfer company of the Hebrew university of Jerusalem for his kind support and to Dr. Rachel Hochberg for her critical reviewing and to the Israeli ministry of science through its National Knowledge Center in Gene Therapy at the Hadassah-Hebrew University in Jerusalem as well as by grants from the Grinspoon, Blum and the Horwitz Foundations for financial support.

References Abdul-Ghani R, Ohana P, Matouk I, Ayesh S, Ayesh B, Laster M, Bibi O, Giladi H, Molnar-Kimber K, Sughayer MA, de groot N and Hochberg A (2000) Use of the transcriptional regulatory sequences of telomerase (hTER and hTERT) for selective killing of cancer cells. Mol Ther 2, 539-544. Abramovitch R, Neeman M, Reich R, Stein I, Keshet E, Abraham J, Solomon A and Marikovsky M (1998)

262

Cancer Therapy Vol 3, page 263 Intercellular communication between vascular smooth muscle and endothelial cells mediated by heparin-binding epidermal growth factor-like growth factor and vascular endothelial growth factor. FEBS Lett 425, 441-447. Adam GI, Cui H, Miller SJ, Flam F and Ohlsson R (1996) Allele-specific in situ hybridization (ASISH) analysis: a novel technique which resolves differential allelic usage of H19 within the same cell lineage during human placental development. Development 122, 839-847. Adriaenssens E, Dumont L, Lottin S, Bolle D, Lepretre A, Delobelle A, Bouali F, Dugimont T, Coll J and Curgy JJ (1998) H19 overexpression in breast adenocarcinoma stromal cells is associated with tumor values and steroid receptor status but independent of p53 and Ki-67 expression. Am J Pathol 153, 1597-1607. Adriaenssens E, Lottin S, Berteaux N, Hornez L, Fauquette W, Fafeur V, Peyrat JP, Le Bourhis X, Hondermarck H, Coll J, Dugimont T and Curgy JJ (2002) Cross-talk between mesenchyme and epithelium increases H19 gene expression during scattering and morphogenesis of epithelial cells. Exp Cell Res 275, 215-229. Adriaenssens E, Lottin S, Dugimont T, Fauquette W, Coll J, Dupouy JP, Boilly B and Curgy JJ (1999) Steroid hormones modulate H19 gene expression in both mammary gland and uterus. Oncogene 18, 4460-4473. Ariel I, Ayesh S, Gofrit O, Ayesh B, Abdul-Ghani R, Pizov G, Smith Y, Sidi A, Birman T, Schneider T, de-Groot N and Hochberg A (2004) Gene expression in the bladder carcinoma rat model. Mol Carcinog 41, 69-76. Ariel I, Ayesh S, Perlman EJ, Pizov G, Tanos V, Schneider T, Erdmann VA, Podeh D, Komitowski D, Quasem AS, de Groot N and Hochberg A (1997a) The product of the imprinted H19 gene is an oncofetal RNA. Mol Pathol 50, 34-44. Ariel I, de Groot N and Hochberg A (2000a) Imprinted H19 gene expression in embryogenesis and human cancer: the oncofetal connection. Am J Med Genet 91, 46-50. Ariel I, Lustig O, Oyer CE, Elkim M, Gonik B, Rachmilewitz J, Biran H, Goshen R, de Groot N and Hochberg A (1994) Relaxation of imprinting in trophoblastic disease. Gynecol Oncol 53, 212-219. Ariel I, Lustig O, Schneider T, Pizov G, Sappir M, de Groot N and Hochberg A (1995) The imprinted H19 gene as a tumor marker in bladder carcinoma. Urology 45, 335-338. Ariel I, Miao H.Q, Ji XR, Schneider T, Roll D, de Groot N, Hochberg A and Ayesh S (1998) Imprinted H19 oncofetal RNA is a candidate tumor marker for hepatocellular carcinoma. Mol Pathol 51, 21-25. Ariel I, Sughayer M, Fellig Y, Pizo G, Ayesh S, Podeh D, Libdeh BA, Levy C, Birman T, Tykocinski ML, de Groot N and Hochberg A (2000b) The imprinted H19 gene is a marker of early recurrence in human bladder carcinoma. Mol Pathol 53, 320-323. Ariel I, Weinstein D, Voutilainen R, Schneider T, Lustig-Yariv O, de Groot N and Hochberg A (1997b) Genomic imprinting and the endometrial cycle. The expression of the imprinted gene H19 in the human female reproductive organs. Diagn Mol pathol 6, 17-25. Arkonac BM, Foster LC, Sibinga NE, Patterson C, Lai K, Tsai JC, Lee ME, Perrella MA and Haber E (1998) Vascular endothelial growth factor induces heparin-binding epidermal growth factor-like growth factor in vascular endothelial cells. J Biol Chem 273, 4400-4445. Arney KL (2003) H19 and Igf2-- enhancing the confusion? Trends Genet 19, 17-23. Ayesh B, Matouk I, Ohana P, Sughayer MA, Birman T, Ayesh S, Schneider T, de Groot N and Hochberg A (2003) Inhibition

of tumor growth by DT-A expressed under the control of IGF2 P3 and P4 promoter sequences. Mol Ther 7, 535-541. Ayesh S, Farrah I, Schneider T, de-Groot N and Hochberg A (2004) The involvement of H19 non-coding RNA in stress: Implications in cancer development and prognosis.Gene Ther Mol Biol 8, 403-412. Ayesh S, Matouk I, Schneider T, Ohana P, Laster M, Al-Sharef W, de-Groot N and Hochberg A (2002) Possible physiological role of H19 RNA. Mol Carcinog 35, 63-74. Banet G, Bibi O, Matouk I, Ayesh S, Laster M, Kimber KM, Tykocinski M, de-Groot N and Hochberg A (2000) Characterization of human and mouse H19 regulatory sequences. Mol Biol Rep 27, 157-165. Bartolomei MS, Webber AL, Brunkow ME and Tilghman SM (1993) Epigenetic mechanisms underlying the imprinting of the mouse H19 gene. Genes Dev 9, 2079-2089. Bartolomei MS, Zemel S and Tilghman SM (1991) Parental imprinting of the mouse H19 gene. Nature 351, 153-155. Bell AC and Felsenfeld G (2000) Methylation of a CTCFdependent boundary controls imprinted expression of the Igf2 gene. Nature 405, 482-485. Berteaux N, Lottin S, Adriaenssens E, Van Coppennolle F, Leroy X, Coll J, Dugimont T and Curgy JJ (2004) Hormonal regulation of H19 gene expression in prostate epithelial cells. J Endocrinol 183, 69-78. Bishop JM and Weinberg RA, eds (1996) Molecular oncology (New York: Sceintific American, Inc.). Brahimi-Horn C, Berra E and Pouyssegur J (2001) Hypoxia: the tumor's gateway to progression along the angiogenic pathway. Trends Cell Biol 11, S32-S36. Brannan CI, Dees EC, Ingram RS and Tilghman SM (1990) The product of the H19 gene may function as an RNA. Mol Cell biol 10, 28-36. Brunkow ME and Tilghman SM (1991) Ectopic expression of the H19 gene in mice causes prenatal lethality. Genes Dev 5, 1092-1101. Chen CL, Ip SM, Cheng D, Wong LC and Ngan HY (2000) Loss of imprinting of the IGF-II and H19 genes in epithelial ovarian cancer. Clin Cancer Res 6, 474-479. Choi KS, Bae MK, Jeong JW, Moon HE and Kim KW (2003) Hypoxia-induced angiogenesis during carcinogenesis. J Biochem Mol Biol 36, 120-126. Cooper MJ, Fischer M, Komitowski D, Shevelev A, Schulze E, Ariel I, Tykocinski ML, Miron S, Ilan J, de Groot N and Hochberg A (1996) Developmentally imprinted genes as markers for bladder tumor progression. J Urol 155, 21202127. Cui H, Onyango P, Brandenburg S, Wu Y, Hsieh CL and Feinberg AP (2002) Loss of imprinting in colorectal cancer linked to hypomethylation of H19 and IGF2. Cancer Res 62, 6442-6446. Davis RL, Weintraub H and Lassar AB (1987) Expression of a single transfection cDNA converts fibroblast to myoblast. Cell 51, 987-1000. Douc-Rasy S, Barrois M, Fogel S, Ahomadegbe JC, Stehelin D, Coll J and Riou G (1996) High incidence of loss of heterozygosity and abnormal imprinting of H19 and IGF2 genes in invasive cervical carcinomas. Uncoupling of H19 and IGF2 expression and biallelic hypomethylation of H19. Oncogene 12, 423-430. Dugimont T, Curgy JJ, Wernert N, Delobelle A, Raes MB, Joubel A, Stehelin D and Coll J (1995) The H19 gene is expressed within both epithelial and stromal components of human invasive adenocarcinomas. Biol cell 85, 117-124. Dugimont T, Montpellier C, Adriaenssens E, Lottin S, Dumont L, Lotsova V, Lagrou C, Stehelin D, Coll J and Curgy JJ (1998) The H19 TATA-less promoter is efficiently repressed

263

Matouk et al: The Oncofetal H19 RNA in human cancer by the wild- type tumor suppressor gene product p53. Oncogene 16, 2395-2401. Elkin M, Ariel I, Miao HQ, Nagler A, Pines M, de-Groot N, Hochberg A and Vlodavsky I (1999) Inhibition of bladder carcinoma angiogenesis, stromal support, and tumor growth by halofuginone. Cancer Res 59, 4111-4118. Elkin M, Ayesh S, Schneider T, de Groot N, Hochberg A and Ariel I (1998) The dynamics of the imprinted H19 gene expression in the mouse model of bladder carcinoma induced by N-Butyl-N-(4-hydroxybutyl)nitrosamine. Carcinogenesis 19, 2095-2099. Elkin M, Shevelev A, Schulze E, Tyckocinsky M, Cooper M, Ariel I, Pode D, Kopf N, de Groot N and Hochberg A (1995) The expression of the H19 and IGF-2 genes in human bladder carcinoma. FEBS Lett 374, 57-61. el-Naggar AK, Lai S, Tucker SA, Clayman GL, Goepfert H, Hong WK and Huff V (1999) Frequent loss of imprinting at the IGF2 and H19 genes in head and neck squamous carcinoma. Oncogene 18, 7063-7069. Erdmann VA, Barciszewska MZ, Szymanski M, Hochberg A, de Groot N and Barciszewski J (2001) The non-coding RNAs as riboregulators. Nucleic Acids Res 29, 189-193. Folkman J and Kalluri R (2004) cancer without disease. Nature 427, 787. Fukuzawa R, Umezawa A, Ochi K, Urano F, Ikeda H and Hata J (1999) High frequency of inactivation of the imprinted H19 gene in sporadic hepatoblastoma. Int J Cancer 82, 490-497. Gao ZH, Suppola S, Liu J, Heikkila P, Janne J and Voutilainen R (2002) Association of H19 promoter methylation with the expression of H19 and IGF-II genes in adrenocortical tumors. J Clin Endocrinol Metab 87, 1170-1176. Giroux S, Tremblay M, Bernard D, Cardin-Girard JF, Aubry S, Larouche L, Rousseau S, Huot J, Landry J, Jeannotte L and Charron L (1999) Embryonic death of Mek1-deficient mice reveals a role for this kinase in angiogenesis in the labyrinthine region of the placenta. Curr Biol 9, 369-372. Glassman ML and Hochberg A (1997) Time reversal in biological systems. Med Hypotheses 49, 505-508. Graveel CR, Jatkoe T, Madore SJ, Holt AL and Farnham PJ (2001) Expression profiling and identification of novel genes in hepatocellular carcinomas. Oncogene 20, 2704-2712. Han DK and Liau G (1992) Identification and characterization of developmentally regulated genes in vascular smooth muscle cells. Circ Res 71, 711-719. Han DK, Khaing ZZ, Pollock RA, Haudenschild CC and Liau G (1996) H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by insulin family of growth factors in cultured rabbit smooth muscle cells. J Clin Invest 97, 1276-1285. Hanahan D and Weinberg RA (2000) The hallmarks of cancer. Cell 100, 57-70. Hao Y, Crenshaw T, Moulton T, Newcomb E and Tycko B (1993) Tumor-suppressor activity of H19 RNA. Nature 365, 764-767. Hark AT, Schoenherr CJ, Katz DJ, Ingram RS, Levorse JM, Tilghman SM (2000) CTCF mediates methylation-sensetive enhancer-blocking activity at the H19/Igf2 locus. Nature 405, 486-489. Harris AL (2002) Hypoxia--a key regulatory factor in tumour growth. Nat Rev Cancer 2, 38-47. Hashimoto K, Azuma C, Tokugawa Y, Nobunaga T, Aki TA, Matsui Y, Yanagida T, Izumi H, Saji F and Murata Y (1997) Loss of H19 imprinting and up-regulation of H19 and SNRPN in a case with malignant mixed Mullerian tumor of the uterus. Hum Pathol 28, 862-865. Hibi K, Nakamura H, Hirai A, Fujikake Y, Kasai Y, Akiyama S, Ito K and Takagi H (1996) Loss of H19 imprinting in esophageal cancer. Cancer Res 65, 480-482.

Hockel M, Knoop C, Schlenger K, Vorndran B, Baussmann E, Mitze M, Knapstein PG and Vaupel P (1993) Intratumoral pO2 predicts survival in advanced cancer of the uterine cervix. Radiother Oncol 26, 45-50. Huang S, Robinson JB, Deguzman A, Bucana CD and Fidler IJ (2000) Blockade of nuclear factor-!B signaling inhibits angiogenesis and tumorigenicity of human ovarian cancer cells by suppressing expression of vascular endothelial growth factor and interleukin 8. Cancer Res 60, 5334-5339. Isfort RJ,Cody DB Kerchaert GA, Tycko B and LeBoeuf RA (1997) Role of the H19 gene in Syrian hamster embryo cell tumorigenicity. Mol Carcinog 20, 189-193. Jiang WG, Hiscox S, Singhrao SK, Puntis MC, Nakamura T, Mansel RE and Hallett MB (1995) Induction of tyrosine phosphorylation and translocation of ezrin by hepatocyte growth factor/scatter factor. Biochem Biophys Res Commun 217, 1062-1069. Joubel A, Curgy JJ, Pelczar H, Begue A, Lagrou C, Stehelin D and Coll J (1996) The 5' part of the human H19 RNA contains cis-acting elements hampering its translatability. Cell Mol Boil 42, 1159-1172. Kacimi R, Karliner JS, Koudssi F and Long CS (1998) Expression and regulation of adhesion molecules in cardiac cells by cytokines: response to acute hypoxia. Circ Res 82, 576-586. Kaplan R, Luettich K, Heguy A, Hackett NR, Harvey BG and Crystal RG (2003) Monoallelic up-regulation of the imprinted H19 gene in airway epithelium of phenotypically normal cigarette smokers. Cancer Res 63, 1475-1482. Kim D, Zhang L, Dzau VJ and Pratt RE (1994) H19, a developmentally regulated gene, is reexpressed in rat vascular smooth muscle cells after injury. J Clin Invest 93, 355-360. Kim HT, Choi BH, Niikawa N, Lee TS and Chang SI (1998) Frequent loss of imprinting of the H19 and IGF-II genes in ovarian tumors. Am J Med Genet 80, 391-395. Kim KS and Lee YI (1997) Biallelic expression of the H19 and IGF2 genes in hepatocellular carcinoma. Cancer Lett 119, 143-148. Kondo M, Suzuki H, Ueda R, Osada H, Takagi K and Takahashi T (1995) Frequent loss of imprinting of the H19 gene is often associated with its overexpression in human lung cancers. Oncogene 10, 1193-1198. Kopf E, Bibi O, Ayesh S, Tykocinski M, Vitner K, Looijenga LH, de Groot N and Hochberg A (1998) The effect of retinoic acid on the activation of the human H19 promoter by a 3' downstream region. FEBS Lett 432, 123-127. Kroon ME, Koolwijk P, van der Vecht B and van Hinsbergh VW (2001) Hypoxia in combination with FGF-2 induces tube formation by human microvascular endothelial cells in a fibrin matrix: involvement of at least two signal transduction pathways. J Cell Sci 114, 825-833. Laderoute KR, Mendonca HL, Calaoagan JM, Knapp AM, Giaccia AJ and Stork PJ (1999) Mitogen-activated protein kinase phosphatase-1 (MKP-1) expression is induced by low oxygen conditions found in solid tumor microenvironments. A candidate MKP for the inactivation of hypoxia-inducible stress-activated protein kinase/c-Jun N-terminal protein kinase activity. J Biol Chem 274, 12890-12897. Lash GE, Fitzpatrick TE and Graham CH (2001) Effect of hypoxia on cellular adhesion to vitronectin and fibronectin. Biochem Biophys Res Commun 287, 622-629. Leibovitch MP, Nguyen VC, Gross MS, Solhonne B, Leibovitch SA and Bernheim A (1991) The human ASM (adult skeletal muscle) gene: expression and chromosomal assignment to 11p15. Biochem Biophys Res Commun 180, 1241-1250. Leibovitch MP, Solhonne B, Guillier M, Verrelle P and Leibovitch SA (1995) Direct relationship between the

264

Cancer Therapy Vol 3, page 265 expression of tumor suppressor H19 mRNA and c-mos proto-oncogene during myogenesis. Oncogene 10, 251-260. Leighton PA, Saam JR, Ingram RS, Stewart CL and Tilghman SM (1995) An enhancer deletion affects both h19 and Igf2 expression. Genes Dev 9, 2079-2089. Lottin S, Adriaenssens E, Berteaux N, Lepretre A, Vilain MO, Denhez E, Coll J, Dugimont T and Curgy JJ (2005) The human H19 gene is frequently overexpressed in myometrium and stroma during pathological endometrial proliferative events. Eur J Cancer 41, 168-177. Lottin S, Adriaenssens E, Dupressoir T, Berteaux N, Montpellier C, Coll J, Dugimont T and Curgy JJ (2002a) Overexpression of an ectopic H19 gene enhances the tumorigenic properties of breast cancer cells. Carcinogesis 23, 1885-1895. Lottin S, Vercoutter-Edouart AS, Adriaenssens E, Czeszak X, Lemoine J, Roudbaraki M, Coll J, Hondermarck H, Dugimont T and Curgy JJ (2002b) Thioredoxin posttranscriptional regulation by H19 provides a new function to mRNA-like non-coding RNA. Oncogene 21, 1625-1631. Lustig O, Ariel , Ilan J, Lev-Lehman E, de Groot N and Hochberg A (1994) Expression of the imprinted gene H19 in the human fetus. Mol Reprod Dev 38, 239-264. Lustig-Yariv O, Schulze E, Komitowski D, Erdmann V, Schneider T, de Groot N and Hochberg A (1997) The expression of the imprinted genes H19 and IGF-2 in choriocarcinoma cell lines. Is H19 a tumor suppressor gene? Oncogene 15, 169-177. Manoharan H, Babcock K, Willi J and Pitot HC (2003) Biallelic expression of the H19 gene during spontaneous hepatocarcinogenesis in the albumin SV40 T antigen transgenic rat. Mol Carcinog 38, 40-47. Matouk I, Ayesh B, Schneider T, Ayesh S, Ohana P, de-Groot N, Hochberg A and Galun E (2004) Oncofetal splice pattern the human H19 gene. Biochem Biophys Res Commun 318, 916-919. Milligan L, Antoine E, Bisbal C, Weber M, Brunal C, Forne T and Cathala G (2000) H19 gene expression is upregulated exclusively by stabilization of the RNA during muscle cell differentiation. Oncogene 19, 5810-5816. Milligan L, Forne T, Antoine E, Weber M, Hemonnot B, Dandolo L, Brunel C and Cathala G (2002) Turnover of primary transcripts is a major step in the regulation of mouse H19 gene expression. EMBO Rep 8, 774-779. Moulton T, Crenshaw T, Hao Y, Moosikasuwan J, Lin N, Dembitzer F, Hensle T, Weiss L, McMorrow L, Loew T et al (1994) Epigenetic lesions at the H19 locus in Wilms' tumor patients. Nat Genet 7, 440-447. Mukhopadhyay D, Tsiokas L, Zhou XM, Foster D, Brugge JS and Sukhatme VP (1995) Hypoxic induction of human vascular endothelial growth factor expression through c-Src activation. Nature 375, 577-581. Ogawa O, Eccles MR, Szeto J, McNoe LA, Yun K, Maw MA, Smith PJ and Reeve AE (1993) Relaxation of insulin-like growth factor II gene imprinting implicated in Wilms' tumour. Nature 362, 749-751. Ohana P, Bibi O, Matouk I, Levy C, Birman T, Ariel I, Schneider T, Ayesh S, Giladi H, Laster M, de Groot N and Hochberg A (2002) Use of H19 regulatory sequences for targeted gene therapy in cancer. Int J Cancer 98, 645-650. Ohana P, Gofrit O, Ayesh S, Al-sharef W, Mizrahi A, Birman T, Schneider T, Matouk I, de-Groot N, Tavdy E, Sidi AA and Hochberg A (2004a) Regulatory sequences of the H19 gene in DNA based therapy of bladder cancer. Gene Ther Mol Biol 8, 181-192. Ohana P, Kopf E, Bibi O, Ayesh S, Schneider T, Laster M, Tykocinski M, de Groot N and Hochberg A (1999) The expression of the H19 gene and its function in human bladder carcinoma cell lines. FEBS Lett 454, 81-84.

Ohana P, Schachter P, Ayesh B, Mizrahi A, Birman T, Schneider T, Matouk I, Ayesh S, Kuppen PJ, de Groot N, Czerniak A and Hochberg A (2004b) Regulatory sequences of H19 and IGF2 genes in DNA-based therapy of colorectal rat liver metastases. J Gene Med, in press O'Toole EA, Marinkovich MP, Peavey CL, Amieva MR, Furthmayr H, Mustoe TA and Woodley DT (1997) Hypoxia increases human keratinocyte motility on connective tissue. J Clin Invest 100, 2881-2891. Pachnis V, Belayew A and Tilghman SM (1984) Locus unlinked to "-fetoprotein under the control of the murine raf and Rif genes. Proc Natl Acad Sci USA 81, 5523-5527. Pachnis V, Brannan CL and Tilghman SM (1988) The structure and expression of a novel gene activated in early mouse embryogenesis. EMBO J 7, 673-681. Poirier F, Chan CT, Timmons PM, Robertson EJ, Evans MJ and Rigby PW (1991) The murine H19 gene is activated during embryonic stem cell differentiation in vitro at the time of implantation in the developing embryo. Development 113, 1105-1114. Rachmilevitz J, Gileadi O, Eldar-Geva T, Schneider T, de Groot N and Hochberg A (1992a) Transcription of the H19 gene in differentiating cytotrophoblasts from human placenta. Mol Reprod Dev 32, 196-202. Rachmilewitz J, Elkim M, Rosensaft J, Gelman-Kohan Z, Ariel I, Lustig O, Schneider T, Goshen R, Biran H, de Groot N and Hochberg A (1995) H19 expression and tumorigenicity of choriocarcinoma derived cell lines. Oncogene 11, 863-870. Rachmilewitz J, Goshen R, Ariel I, Schneider T, de Groot N and Hochberg A (1992b) Parental imprinting of the human H19 gene. FEBS Lett 309, 25-28. Rainier S, Johnson LA, Dobry CJ, Ping AJ, Grundy PE and Feinberg AP (1993) Relaxation of imprinted genes in human cancer. Nature 362, 747-749. Reid LH, West A, Gioeli DG, Phillips KK, Kelleher KF, Araujo D, Stanbridge EJ, Dowdy SF, Gerhard DS and Weissman BE (1996) Localization of a tumor suppressor gene in 11p15.5 using the G401 Wilms' tumor assay. Hum Mol Genet. 5, 239-247. Rodesch F, Simon P, Donner C and Jauniaux E (1991) Oxygen measurements in endometrial and trophoblastic tissues during early pregnancy. Obstet Gynecol 80, 283-285. Runge S, Nielsen FC, Nielsen J, Lykke-Andersen J, Wewer UM and Christiansen J (2000) H19 RNA binds four molecules of insuline-like growth factor II mRNA-binding protein. J Biol Chem 275, 29562-29569. Sakai M, Tsukada T and Harris RC (2001) Oxidant stress activates AP-1 and heparin-binding epidermal growth factorlike growth factor transcription in renal epithelial cells. Exp Nephrol 9, 28-39. Schlessinger J (2000) Cell signaling by receptor tyrosine kinases. Cell 103, 211-225. Schmidt JV, Levorse JM and Tilghman SM (1999) Enhancer competition between H19 and Igf2 does not mediate their imprinting. Proc Natl Acad Sci USA 96, 9733-9738. Scrable H, Cavenee W, Ghavimi F, Lovell M, Morgan K and Sapienza C (1989) A model for embryonal rhabdomyosarcoma tumorigenesis that involves genome imprinting. Proc Natl Acad Sci USA 86, 7480-7484. Sebolt-Leopold JS, Dudley DT, Herrera R, Van Becelaere K, Wiland A, Gowan RC,Tecle H, Barrett SD, Bridges A, Przybranowski S, Leopold WR and Saltiel AR (1999) Blockade of the MAP kinase pathway suppresses growth of colon tumors in vivo. Nat Med 5, 810-816. Silverberg E, Boring CC and Squires TS (1990) Cancer statistics, 1990. CA Cancer J Clin. 40, 9-26. Steenman MJ, Rainier S, Dobry CJ, Grundy P, Horon IL and Feinberg AP (1994) Loss of imprinting of IGF2 is linked to

265

Matouk et al: The Oncofetal H19 RNA in human cancer reduced expression and abnormal methylation of H19 in Wilms' tumour. Nat Genet 7, 433-439. Stuhlmuller B, Kunisch E, Franz J, Martinez-Gamboa L, Hernandez MM, Pruss A, Ulbrish N, Erdmann VA, Burmester GR and Kinne RW (2003) Detection of oncofetal h19 RNA in rheumatoid arthritis synovial tissue. Am J Pathol 163, 901-911. Tacchini L, Bianchi L, Bernelli-Zazzera A and Cairo G (1999) Transferrin receptor induction by hypoxia. HIF-1-mediated transcriptional activation and cell-specific posttranscriptional regulation. J Biol Chem 274, 24142-24146. Takai D, Gonzales FA, Tsai YC, Thayer MJ and Jones PA (2001) Large scale mapping of methylcytosines in CTCFbinding sites in the human H19 promoter and aberrant hypomethylation in human bladder cancer. Hum Mol Genet 10, 2619-2626. Tanos V, Prus D, Ayesh S, Weinstein D, Tykocinski ML, de Groot N, Hochberg A and Ariel I (1999) Expression of the imprinted H19 oncofetal RNA in epithelial ovarian cancer. Eur J Obstet Gynecol Reprod Biol 85, 7-11. Tilghman SM (1999) The sins of the fathers and mothers: genomic imprinting in mammalian development. Cell 96, 185-193. Van Gurp RJ, Oosterhuis JW, Kalscheure V, Mariman EC and Looijenga LH (1994) Biallelic expression of the H19 and IGF2 genes in human testicular germ cell tumors. J Natl Cancer Inst 86, 1070-1075. Verkerk AJ, Ariel I, Dekker MC, Schneider T, van Grup RJ, de Groot N, Gillis AJ, Oosterhuis JW, Hochberg AA and Looijenga LH (1997) Unique expression patterns of H19 in human testicular cancers of different etiology. Oncogene 14, 95-107. Verona RI, Mann MR and Bartolomei MS (2003) Genomic imprinting: intricacies of epigenetic regulation in clusters. Annu Rev Cell Dev Bio 19, 237-259. Wada M, Seeger RC, Mizoguchi H, and Koeffler HP (1995) Maintenance of normal imprinting of H19 and IGF2 genes in neuroblastoma. Cancer Res 55, 3386-3388.

Wang Y (2001) The role and regulation of urokinase-type plasminogen activator receptor gene expression in cancer invasion and metastasis. Med Res Rev 21, 146-170. Wilkim F, paquette J, Ledru E, Mamelin C, Pollak M and Deal CL (2000) H19 sense and antisense transgenes modify insulin-like growth factor-II mRNA levels. Eur J Biochem 267, 4020-4027. Yamamoto Y, Nishikawa Y, Tokairin T, Omori Y and Enomoto K (2004) Increased expression of H19 non-coding mRNA follows hepatocyte proliferation in the rat and mouse. J Hepatol 40, 808-814. Yu W, Kim J and Ossowski L (1997) Reduction in surface urokinase receptor forces malignant cells into a protracted state of dormancy. J Cell Biol 137, 767-777. Zemel S, Bartolomei MS and Tilghman SM (1992) physical linkage of two mammalian imprinted genes, H19 and insulinlike growth factor 2. Nat Genet 2, 61-65. Zhang Y and Tycko B (1992) Monoallelic expression of the human H19 gene. Nat Genet 1, 40-44.

Imad Matouk

266

Abraham Hochberg

Cancer Therapy Vol 3, page 267 Cancer Therapy Vol 3, 267-284, 2005

Adenoviral vectors for prostate cancer gene therapy Review Article

Shawn E. Lupold* and Ronald Rodriguez The James Buchanan Brady Urological Institute, Johns Hopkins University School of Medicine, Marburg 105A, 600 N Wolfe St, Baltimore, MD 21287-2101

__________________________________________________________________________________ *Correspondence: Shawn E. Lupold, The James Buchanan Brady Urological Institute, Johns Hopkins University School of Medicine, Marburg 105A, 600 N Wolfe St., Baltimore, MD 21287-2101; Phone: 410-955-2516; FAX: 410-502-9336; E-mail: slupold@jhmi.edu Key words: Prostate Cancer, Adenovirus, Gene Therapy, Review Abbreviations: American Association of Gene Therapy, (ASGT); American Society of Clinical Oncology, (ASCO); Conditionally replicating adenovirus, (CRADs); Coxsackie and Adenovirus Receptor, (CAR); cytosine deaminase, (CD); digital rectal exam, (DRE); diphtheria toxin, (DT); double stranded DNA, (dsDNA); gancyclovir, (GCV); herpes simplex virus Thymidine Kinase, (HSV-TK); Infectious Units, (IU); Interleukin-12, (IL-12); intravenously, (i.v.); Major Late Transcriptional Unit, (MLTU); natural killer, (NK); prostate cancer, (PCa); prostate specific antigen enhancer, (PSE); prostate specific antigen, (PSA); PSA doubling time, (PSADT); Topoisomerase I, (Topo I)

This study was supported in part by grants from the NIH Prostate SPORE, the Robert & Donna Tompkins Foundation, and the Department of Defense Prostate Cancer Research Program, which is managed by the U.S. Army Medical Research and Material Command. Received: 16 March 2005; Accepted: 30 March 2005; electronically published: April 2005

Summary There is a great need for advances in the treatment of hormone resistant metastatic prostate cancer. The unique character of prostate cells provides opportunities to generate highly specific therapies, such as viral gene therapy, to elicit a tissue specific response. Adenovirus have been an accepted choice for such approaches, and several have been applied to localized prostate cancer, via intraprostatic injection, in phase I and II clinical trials. However, only a single clinical trial has investigated the systemic application of an adenoviral gene therapy vector (as a single agent) for advanced hormone resistant prostate cancer. Preliminary results from this trial suggest that the virus reached metastatic tumors and elicited a biological response detectable by decreases in serum PSA. While these clinical data have been accumulating, many advances in viral re-targeting have been discovered in the laboratory. It is our feeling that major advances in prostate cancer gene therapy will be reached in the next several years when the combination of prostate specific transductional targeting and transcriptional targeting reach clinical trials. Below we review adenoviral vectors and their application to prostate cancer gene therapy.

of efficacy. Directly injected adenovirus is now being combined with radiation therapy and appears to increase therapeutic effects without altering safety. The field is also undertaking the most difficult challenge, the translation from intraprostatic administration to systemic therapy for the treatment of metastatic disease. Early results from such clinical trials are promising, but suggest a need for improvements in viral tropism. In other words, response may be improved if viral infection favored tumor cell infection over non-target cell infection, such as the liver. However, it is unclear what degree of de-targeting and retargeting will be required for an effective therapy. Herein we review adenoviral prostate cancer gene therapy and predict that small improvements in viral re-targeting may result in a significantly enhanced therapeutic result.

I. Introduction In the United States prostate cancer (PCa) is the most commonly diagnosed non-skin malignancy, and the second leading cause of male cancer death (Jemal et al, 2005). Despite notable progress in early detection, chemotherapeutic, surgical, and radiation-based approaches, there is no curative therapy for hormone refractory metastatic disease. In principle, adenoviral gene therapies can be tailored to the unique biology of prostate cancers and hence represent an active area of research as a potential adjuvant to standard prostate cancer treatments. Early clinical studies of adenoviral vectors, administered directly into the prostate of men with prostate cancers, have provided clear evidence of safety and have demonstrated early signs 267

Lupold and Rodriguez: Prostate cancer gene therapy Once in the nucleus, the adenovirus genome remains episomal and viral gene expression begins. Adenoviral gene expression is sequential, starting with the early genes, E1 to E4, and finishing with the late genes, L1 to L5, which are organized into a single large transcript known as the Major Late Transcriptional Unit (MLTU) (Figure 1B). Early gene transcription drives both quiescent and dividing cells into S-phase to facilitate viral replication. Viruses lacking the earliest gene, E1A, do not progress past the immediate early phase and do not replicate in normal cells. These E1 deleted, replication attenuated virus served as the first vectors for adenoviral gene therapy.

A. Adenovirus Adenoviruses were first discovered in the 1950’s as the infectious agents responsible for outbreaks of acute respiratory infections (See Shenk, 2001 for review). The earliest studies of the virus were completed in cell cultures from human adenoid tissue, hence the name adenovirus (Rowe et al, 1953; Enders et al, 1956). Adenoviruses are approximately 100 nm sized icosahedral particles consisting almost exclusively of protein and DNA. The outer capsid shell is composed of three major coat proteins, hexon, penton, and fiber, and several smaller proteins that aid in assembly and maintenance of capsid structure (Figure 1A). The genome is linear double stranded DNA (dsDNA) of approximately 36,000 nucleotides, with two flanking terminal repeats, and multiple open reading frames on each strand (Figure 1B). Adenoviral infection is a stepwise process, initiated by binding of the adenoviral fiber protein to its receptor, CAR (Coxsackie and Adenovirus Receptor) (Bergelson et al, 1997; Tomko et al, 1997), followed by internalization, which is triggered by viral penton base interaction with cellular integrins (Wick ham et al, 1993). CAR is expressed in multiple tissues, which accounts the broad tropism of adenovirus, a characteristic that was initially appealing for development as a general purpose gene therapy vector.

B. Adenoviral vectors The so called “first generation” adenoviral vectors replaced the E1 region with fusions of foreign promoters and genes to elicit a therapeutic effect (Van Doren et al, 1984). Often, the non-essential E3 region was also deleted to allow for larger transgene inserts (Figure 2) (GhoshChoudhury et al, 1986). Specialized cell lines, referred to as “packaging lines”, contain stably integrated portions of the early viral genome to provide the E1 gene products in trans and drive viral replication and packaging (Graham et al, 1977; Fallaux et al, 1996; Louis et al, 1997).

Figure 1 Adenoviral capsid and genomic structure. (A) The adenoviral capsid consists of three major capsid proteins, Hexon, Penton, and Fiber. Parentheses contain the number of capsid proteins per virion. The fiber protein, which is responsible for initial cell binding events, contains a shaft and knob domain. The knob domain contains all residues required to bind the cellular receptor. (B) The organization of the dsDNA linear viral genome, containing coding regions on both strands, with many genes alternatively spliced into multiple forms. The late genes (L1-L5), which contain the major capsid proteins, are processed as a single transcript, known as the Major Late Transcriptional Unit, which is then spliced for production of individual genes.

268

Cancer Therapy Vol 3, page 269

Figure 2. Adenoviral vector design. First generation adenoviral gene therapy vectors lack the E1A gene, rendering the virus replication incompetent, and contain a therapeutic transgene (shaded region). Additional deletion of the E3 gene allows for larger transgene insertion while still allowing propagation in traditional packaging cells. Second generation vectors delete additional genes, such as E2, E4, or more (high capacity vectors) to allow for larger transgene inserts and to minimize viral protein mediated immune responses.

Limitations of packageable transgene size and host immune response to viral proteins quickly led to the deletion of additional viral genes in future vectors. These so-called “second generation” vectors often have adenoviral genes E2 and E4 deleted, which then require further complementation from packaging cell lines for production. Such strategies have been taken to extremes in the generation of “gutless” vectors that lack all virally encoded genes. These second generation vectors are generally applied to corrective gene therapies, where longterm expression of a transgene is required, rather than cytotoxic gene therapy. The majority of cancer gene therapy vectors are first generation; therefore, second generation vectors will not be further discussed. For additional review of high capacity adenovirus vectors, please see Konchanek et al, (2001).

prostate cancer, serum PSA has also become a valuable tool for detecting recurrence, estimating tumor growth rate, and as a surrogate marker of therapeutic response. Prostate cancers progress as most solid tumors, initiating as organ confined disease and progressing to locally advanced or metastatic disease either through lymphatic or hematogenous spread to distant sites such as the bone. Prostate cancer growth is unusually slow when compared to other tissues (Schmid et al, 1993). It has been estimated that 5% or less of prostatic tumor cells are in Sphase (Kallioniemi et al, 1991; Visakorpi et al, 1991). It is likely that this slow growth is responsible in part for the poor response of these tumors to chemotherapeutics. This has become a strong argument for the use of adenovirus in the treatment of prostate cancer as they equally affect quiescent or dividing cells. The anatomical location of the prostate is ideal for direct injection of therapeutic virus, which avoids many of the problems associated with adenoviral gene therapy such as broad tropism, hepatic clearance, and immunological response. Additionally, the prostate is an accessory gland and therefore there is not a pressing need to differentiate between normal and cancerous cells when designing a therapeutic. Both normal prostate and prostate cancer cells are known to express sufficient levels of CAR for adenoviral infection (Kirkman et al, 2001; Rauen et al, 2002). These promising features facilitated the numerous

C. Prostate cancer as a target for gene therapy The prostate is a small, walnut sized gland located at the base of the bladder and adjacent to the rectum. Cancers of the prostate are generally multifocal and originate in the peripheral zone of the gland. The highly sensitive serum prostate specific antigen (PSA) screen, along with digital rectal exam (DRE), provide one of the earliest means of cancer detection available. After definitive treatment of

269

Lupold and Rodriguez: Prostate cancer gene therapy in situ delivered clinical trials for locally-recurrent and advanced local prostate cancers (Table 1). The most valuable attribute of prostate cancer as a target for gene therapy is the unique quality of prostate cells. It has been estimated that there are over two hundred prostate specific genes, many of them regulated by androgens (Xu et al, 2001). Several groups have taken advantage of this in “transcriptional targeting” where prostate specific gene promoters limit therapeutic effects to only target tissue (Gotoh et al, 1998; Rodriguez et al, 1997; Koeneman et al, 2000; Xie et al, 2001). Prostate specific cell membrane proteins also offer potential targets for “transductional targeting”, where virus are re-directed to bind and infect through alternative receptors (Kraaij et al, 2005). Adenoviral vectors exploiting multiple prostate specific mechanisms will likely improve safety and efficacy in systemically applied clinical trial.

back into the realm of cancer therapeutics in the early 1990’s. There are four approaches one can take to apply viral vectors to cancer: corrective, cytotoxic, immunotherapeutic, and oncolytic (Table 2). Corrective therapies generally aim to repair or overcome genetic defects by either long-term expression of a gene or by induction of apoptosis through restoration of a mutant repair or apoptotic pathway. For example, treating a mutant p53 cell with an adenovirus expressing wild type p53 (Yang et al, 1995). Cytotoxic gene therapies aim to destroy cancer cells by expressing a toxic gene, such as diphtheria toxin (DT) (Li et al, 2002), or a prodrug catalyst, such as the herpes simplex virus Thymidine Kinase (HSV-TK) (Eastham et al, 1996). Immunotherapeutic strategies employ the adenovirus to express tumor antigens or immune stimulatory genes to enhance the immune response against cancer cells (Nasu et al, 1999; Elzey et al, 2001). Oncolytic gene therapy applies tissue specific promoters, such as the PSA promoter, to drive viral genes responsible for viral replication (Rodriguez et al, 1997). Alternatively, oncolytic virus have been developed by deleting viral genes, such as p53 or Rb, resulting in selective replication in cancer cells (Bischoff et al, 1996; Heise et al, 2000). To date, there have been over eighty described adenoviral gene therapy vectors for the treatment of prostate cancer. Below we highlight a few examples.

II. Strategies for prostate cancer gene therapy Adenoviruses were considered for cancer therapy as early as 1956, but were temporarily abandoned due to the early success of chemotherapy (Smith et al, 1956). A combination of the appreciation of chemotherapy and hormone resistance, the development of attenuated adenoviral gene therapy vectors, and a better understanding of tumor biology have brought adenovirus

Table 1. Adenoviral gene therapy clinical trials for prostate cancer NIH No. 9601-144 9705-187 9706-192 9710-217 9801-229 9802-236 9812-276 9906-321 9906-324 9909-338 9910-344 9910-345 0010-418 0010-426 0010-428 0101-449 0101-450 0101-451 0104-464 0111-509 0203-517 0204-533 0302-572 0307-590 0307-597 0309-601 0309-603

Therapeutic HSV-TK HSV-TK p53 p53 HSV-TK Replication (E1A) HSV-TK Replication (!E1B) + CD/HSV-TK HSV-TK CDKN2A Replication (E1A) Replication (E1A) p53 Replication (E1A) Replication (!E1B) + CD/HSV-TK mIL-12 Replication (E1A) Replication (E1A) Replication (!E1B) + CD/HSV-TK Replication (E1A) IFN-" NIS Replication (E1A) Replication (!E1B) + CD/HSV-TK Replication (!E1B) + CD/HSV-TK mIL-12 TRAIL

Promoter RSV RSV CMV CMV RSV PSA/PSE Osteocalcin CMV RSV RSV Probasin/PSA Probasin/PSA CMV Osteocalcin CMV CMV Probasin/PSA Probasin/PSA CMV PSA/PSE CMV CMV PSA/PSE CMV CMV RSV CMV

270

Additional Rx Radiation Radiation Radiation Docetaxel Radiation Radiation Radiation Radiation Radiation -

Route intraprostatic intraprostatic intraprostatic intraprostatic intraprostatic intraprostatic intraprostatic intraprostatic intraprostatic intraprostatic intraprostatic intravenous intraprostatic intraprostatic intraprostatic intraprostatic intraprostatic intravenous intraprostatic intraprostatic intraprostatic intraprostatic intraprostatic intraprostatic intraprostatic intraprostatic intraprostatic

Cancer Therapy Vol 3, page 271 Table 2. Adenoviral gene therapy strategies for prostate cancer. Corrective Virus Ad-C-CAM1 AdCMV.p53 Ad5CMV-p21 Ad21 Ad-PML Ad-CD66a AdRSVp16 AdRSVpHyde AdGnRH-R Ad-c-Met Ad-Cx26 AdIIIcR1 AdVEGF-sKDR

Transgene C-CAM1 p53 p21 Intracellular Anti-erB-2 sFV promyelocytic leukemia gene CD66a p16 pHyde GnRH-R Anti-c-Met Ribozyme Connexin 26 soluble FGFR1 soluble KDR

Reference Kleinerman et al, Cancer Res 1995 Jul 1; 55(13):2831-6 Yang et al, Cancer Res 1995 0ct 1; 55(19):4210-3 Eastham et al, Cancer Res 1995 Nov 15; 55(22):5151-5 Kim et al, Hum Gene Ther 1997 Jan20; 8(2):157-70 He et al, Cancer Res 1997 May 15; 57(10):1868-72 Luo et al, Cancer Gene Ther 1999 Jul-Aug; 6(4):313-21 Steiner et al, Cancer Gene Ther 2000 Mar; 7(3):360-72 Steiner et al, Cancer Res 2000 Aug 15; 60(16):4419-25 Franklin et al, J Endocrinol 2003 Feb; 176(2):275-84, Becker et al, Cancer Biol Ther 2002 Sep-Oct; 1(5):548-53 Tanaka and Grossman, Oncol Rep 2004 Feb; 11(2):537-41 Gowardhan et al, Prostate 2004 Sep 15; 61(1):50-9 Kaliberov et al, Gene Ther 2005 Mar; 12(15) 407-17

Transgene mIL-12 mIL-12 + B7-1 IFN-" PSA IL-2 IL-24 (Mda-7) mIL-3

Reference Nasu et al, Gene Ther 1999 Mar; 6(3):338-49 Hull et al, Clin Cancer Res 2000 Oct; 6(10):4101-9 Cao et al, Cancer Gene Ther 2001 Jul; 8(7)497-505 Elzey et al, Int J Cancer 2001 Dec 15; 94(6):842-9, Trudel et al, Cancer Gene Ther 2003 Oct; 10(10):755-63 Lebedeva et al, Cancer Res 2003 Dec 1; 63(23):8138-44 Oh et al, Int J Radial Oncol Biol Phys 2004 Jun l; 59(2):579583

Virus ADV/RSV-tk Ad5/PSA/PNP

Transgene HSV-TK HSP70p-CD/HSV-TK PSA-PNP

Av-C7 Ad-mFasL Ad-PSA(EEP)-NR AdNIS Ad.CD Ad/GT-Bax Ad5-TRAIL Ad5PSE-DT-A

Caspase-7 Fas Ligand PSAp-Nitroreductase rNIS CD Bax TRAIL PSEp-DT-A

Reference Eastham et al, Gene Ther 1996 Mar 1; 7(4):515-23 Blackburn et al, Cancer Res 1998 Apr 1; 58(7):1358-62 Martiniello -Wilks et al, Gene Ther 1998 Jul 20; 9(11):16l726 Marcelli et al, Cancer Res 1999 Jan 15;59(2):382-90 Hedlund et al, Cell Death Differ 1999 Feb; 6(2):175-82 Latham et al, Cancer Res 2000 Jan 15; 60(2):334-41 Boland et al, Cancer Res 2000 Jul 1; 60(13):3484-92 Anello et al, J Urol 2000 Dec; 164(6):2173-7 Li et al, Cancer Res 2001 Jan 1; 61(1):186-91 Griffith and Broghammer, Mol Ther 2001 Sep; 4(3):257-66 Li et al, Cancer Res 2002 May l; 62(9)2576-82

Immunologic Virus AdmIL-12 AdmIL12/B7 AdIFN-" Ad5-PSA AdCAIL-2 Ad-mda7 Ad-mIL-3 Cytotoxic

Oncolytic Virus CG7060 CV764 CG7870 Ad-OC-E1a Ad-hOC-E1 Ad.!55.HRE Oncolytic + Cytotoxic Virus Ad5-CD/Tkrep Ad.E1A(+)HS-CDTK

Transgene PSA/PSEp - E1A PSA/PSEp -E1A; HK2p - E1B Probasin(p) - E1A; PSA/PSE - E1B OCp - E1A OCp - E1A; OCp - E1B HREp - E1A

Reference Rodriguez et al, Cancer Res 1997 Ju1 1; 57(13):2559-63 Yu et al, Cancer Res 1999 Apr 1; 59(7):1498-504 Yu et al, Cancer Res 1999 Sep 1; 59(17):4200-3 Matsubara et al, Cancer Res 2001 Aug 15; 61(16)6012-9 Hsieh et al, Cancer Res 2002 Jun 1; 62(11):3084-92 Cho et al, Mol Ther 2004 Nov; 10(5):938-49

Transgene !E1B-55K + CD/HSV-TK !E1B-55K + CD/HSV-TK

Reference Freytag et al, Hum Gene Ther 1998 Jun 1; 9(9):1323-33 Lee et al, Cancer Gene Ther 2001 Jun; 8(6):397-404

271

Lupold and Rodriguez: Prostate cancer gene therapy temporarily present in the urine of those patients treated at the highest level (1011 Infectious Units (IU)). The results of these pioneering studies have been invaluable in paving the way for clinical trials of in situ gene therapy for prostate cancer (Table 1). While the results with this virus are encouraging for local recurrence or as a neoadjuvant to radiation therapy for primary treatment, the need to convert these types of vectors to systemic therapy has been omnipresent. Several transcriptionally targeted HSV-TK vectors have been developed for this purpose (Blackburn et al, 1998; Gotoh et al, 1998; Koeneman et al, 2000; Pramudji et al, 2001; Furuhata et al, 2003); however, to date, only one of these has been translated into a clinical trial (Kubo et al, 2003).

A. Cytotoxic: Ad5PSE-DT-A/tox176 and Ad5/RSV-TK There are several gene-encoded cytotoxins, such as ricin and diphtheria toxin, that can be specifically expressed in a tissue of interest under the control of gene specific promoters. Prior to development of a viral vector, a series of eight recombinant toxins were evaluated for cytotoxicity against prostate cancer cells (Rodriguez et al, 1998). Only diphtheria toxin (DT) and ricin were capable of killing all prostate cancer cell lines tested, regardless of p53 status, by both apoptotic and non-apoptotic pathways. Following these analyses, the catalytic A-chain of diphtheria toxin was placed under the control of the prostate specific antigen promoter and enhancer (PSE) in a non-replication competent adenoviral vector, Ad5PSEDT-A (Li et al, 2002). A second vector with a less toxic DT version, tox176, was also generated (van der Poel et al, 2001). Results of xenograft models treated with Ad5PSEDT-A were promising, with long term survival of over one year in 80% of animals treated by intratumoral injection. However, due to production and toxicity issues, these viruses have not yet been pursued for clinical translation. The first adenoviral gene therapeutic applied clinically for prostate cancer was ADV/RSV-TK, followed by treatment with gancyclovir (GCV), for patients with local recurrence following radiation therapy (Herman et al, 1999). This virus expresses the HSV-TK gene by the non tissue-specific, constitutively active Rouse Sarcoma Virus (RSV) long terminal repeat promoter (Chen et al, 1994). Preclinical animal models demonstrated decreased tumor volume and metastasis when Ad5/RSV-TK was administered intratumorally (Eastham et al, 1996; Hall et al, 1997), with additive benefits when combined with hormone ablation or radiation therapies (Atkinson and Hall, 1999, Chhikara et al, 2001, Hall et al, 1999). The HSV-TK strategy is especially appealing due to the â&#x20AC;&#x153;bystander effectâ&#x20AC;? where neighboring non-infected cells are also susceptible to cell death (Freeman et al, 1993, Mesnil et al, 1996). The virus was also tested as an adjuvant therapy in mouse models, where it was applied to the tumor bed following surgery, and was not found to significantly delay recurrence (Sukin et al, 2001). Clinical studies with Ad5/RSV-TK taught much about the safety, efficacy, pharmacokinetics, and immune response (with both single and repeated intraprostatic injections) for in situ PCa gene therapy (Herman et al, 1999; Shalev et al, 2000). Most reactions to viral injection were mild, and all were resolved completely once the therapy was completed. Therapeutic response was apparent in several patients by evidence of decreases in serum PSA over extended periods and prolongation of the PSA doubling time (PSADT). Increased levels of CD8+ T cells in peripheral blood and prostate needle biopsies, which also correlated with prostatic apoptosis, indicated that an immune response may aid in the effect of the therapy (Miles et al, 2001). This effect was enhanced when combined with radiation (Satoh et al, 2004). The initial study found no evidence of aberrant viral replication and demonstrated that no virus shed to the serum or nasal passages, negating the need to perform these type evaluations in future trials. Viral DNA was

B. Corrective: INGN 201 and SCH58500 The p53 tumor suppressor gene is considered to be one of the most frequently mutated genes in human cancer (Hollstein et al, 1994). In prostate cancer, p53 mutation correlates with disease stage, where mutation is a rare event for primary tumors and is more frequently associated with advanced and metastatic disease (Bookstein et al, 1993; Navone et al, 1993; Eastham et al, 1995; Brooks et al, 1996). p53 based corrective gene therapy was originally developed and evaluated for head and neck squamous cell carcinoma and non-small cell lung cancer (Clayman et al, 1998; Roth et al, 1998). Local recurrent and advanced local prostate cancer was an ideal model for these viruses as they could be directly injected into the prostate and therapeutic response monitored by serum PSA levels (Sweeney and Pisters, 2000). Transfection of wild type p53 into p53 mutant prostate cancer cells had previously been shown to result in growth suppression (Isaacs et al, 1991). Additionally, adenoviral p53 transduction has been shown to result in a high percentage of apoptotic death (Yang et al, 1995). Several independent groups have confirmed the efficacy of p53 expressing adenoviral gene therapy in multiple prostate cancer animal models. While every cell wonâ&#x20AC;&#x2122;t be transduced in a tumor environment, an anti-angiogenic bystander effect has been demonstrated (Bouvet et al, 1998; Nishizaki et al, 1999). Additionally, p53 expression has been shown to sensitize tumor cells to chemotherapy and radiation (Badie et al, 1998; Blagosklonny and ElDeiry, 1998; Nielsen et al, 1998). These pre-clinical results have led to the translation of two p53 expressing adenovirus, INGN 201 and SCH58500, into phase I and II clinical trials for locally advanced or locally recurrent prostate cancer. Results of these trials have not yet been reported in the literature.

C. Immunologic: AdmIL-12 Interleukin-12 (IL-12) is a heterodimer composed of a disulfide linked heavy (40 kD) and light (35 kD) chain (Rodolfo and Colombo, 1999). IL-12 induces a multitude of immuno-stimulatory effects including the differentiation of CD4 and CD8 type 1 cells, stimulation of antigen presenting cells, enhanced natural killer (NK) cell activity, a switch from Ig to IgG2a, and induction of several pro-inflammatory cytokines. When compared to

272

Cancer Therapy Vol 3, page 273 other cytokines, IL-12 was found to be the most efficient in curing mice with established syngeneic mammary tumors (Cavallo et al, 1997). However, systemic administration of IL-12 can be toxic to humans and has led patient deaths (Cohen, 1995; Golab and Zagozdzon, 1999). Therefore, local administration or gene therapeutic expression of IL-12 is now being evaluated. The adenovirus AdmIL-12, expressing both p40 and p35 cDNA of mouse IL-12, was originally designed and tested in a breast tumor model (Bramson et al, 1996). This virus performed well in an intralesionally injected orthotopic mouse prostate cancer model, suppressing growth of established tumors and metastases, which resulted in increased survival (Nasu et al, 1999, Sanford et al, 2001). Tumors demonstrated NK cell activity and infiltration of CD4+ and CD8+ T cells. These responses were enhanced with co-expression of B7-1 in a single construct, AdmIL-12/B7, resulting in some long term cures (Hull et al, 2000). Similar results were found with an ex vivo strategy, where macrophage or dendritic cells were harvested, infected with AdmIL-12, and then directly injected into tumors, which gives the potential of tumor antigen presentation in draining lymph nodes for a greater systemic effect (Satoh et al, 2003; Saika et al, 2004). There are currently two phase I clinical trials investigating in situ administration of IL-12 expressing adenoviral vectors for post-radiation locally recurrent disease. The results of these trials have yet to be published.

region that is often deleted in first generation vectors. E3 is not required for viral replication, but aids in immune evasion and viral release (Lichtenstein et al, 2004). This new version was capable of eliminating established tumors when administered i. v. through the mouse tail vein, a task the original CG7060 virus was unable to complete (Yu et al, 1999). CG7870 initially entered the clinic in a similar manner to CG7060, as an intra-prostatic applied gene therapy for local recurrent disease. CG7870 has further been applied in combination trials with external beam radiation therapy (the benefits of combination therapy are discussed below). Most importantly, CG7870 is the first adenoviral gene therapy vector to enter PCa clinical trials as a single intravenously administered agent, and also in combination with docetaxel. The results of these studies have not yet been thoroughly described; however, promising results from both the national meetings of the American Association of Gene Therapy (ASGT) and the American Society of Clinical Oncology (ASCO) suggest that CG7870, as a single i. v. administered agent, is capable of eliciting reductions in serum PSA of patients with hormone refractory metastatic cancer (Wilding et al, 2004). These results, although modest and preliminary, implicate the ability of the virus to reach metastatic sites and elicit a biologic response. This is promising as immunologic clearance, hepatic clearance, and significant depletion by non-target CAR positive cells has been predicted to severely limit i. v. applied therapies (see detargeting section below). We do not wish to overstate these results; however, we are enthusiastic that if nontargeted vectors can provide therapeutic some response, then even small improvements in viral targeting may be enough to cause a more meaningful outcome for metastatic disease, especially if combined with other therapies.

D. Conditionally replicating adenovirus (CRADs): CG7060 and CG7870 The first tissue specific conditionally replicative adenovirus was developed for the treatment of prostate cancer (Rodriguez et al, 1997). By placing the viral E1A gene under the control of the PSA promoter and enhancer (PSE), viral replication was limited to prostate cells. This strategy offers the promising attributes of tissue specificity and local amplification, which should be valuable for the future goal of systemic treatment. The virus, CG7060 (previously known as CN706 and CV706), was quickly translated into clinical trials as an intra-prostatically injected agent for patients with local recurrence following radiation therapy. This initial phase I trial injected between 1011-1013 viral particles at between 20 to 80 sites, as determined by a â&#x20AC;&#x153;viral dosimetricâ&#x20AC;? algorithm based on a potential killing zone of 1 cc per injection site (DeWeese et al, 2001; Li et al, 2003). Safety was clearly established and the maximum tolerable dose was not reached. Prostatic replication was evident both by examination of post treatment biopsies, where nuclear adenovirus was visible by electron microscopy, and also by a second burst of virus detected in the serum at 2-8 days post infection. Therapeutic response was evident by a greater than 50% drop in serum PSA in patients treated with the highest viral doses. These promising results led to further improvements of CN706 and further clinical trials. The second virus, CG7870 (previously CV787), was developed using two prostate specific promoters, the rat probasin promoter and the human PSE driving viral E1A and E1B genes, respectively (Yu et al, 1999). Additionally, CG7870 contained the viral E3 region, a

E. Oncolytic CD/TKrep

and

cytotoxic:

Ad5-

The first tumor oncolytic adenovirus, ONYX-015, was designed for conditional replication in p53 mutant tumor cells (Bischoff et al, 1996). The viral design was based on the hypothesis that the E1B-55K gene, known to be responsible for binding and inactivation of p53, would not be required for viral replication in tumor cells harboring p53 mutations. ONYX-015 demonstrated tumor selective replication and has since been clinically tested in multiple malignancies (McCormick, 2003). However, several groups later found that ONYX-015 could replicate in cells with wild type p53 and p19ARF (Edwards et al, 2002, Rothmann et al, 1998). The true mechanism behind ONYX-015 tumor selective replication has been controversial. However, the original group has now provided new evidence that tumor selective replication reflects a differential late viral gene export mechanism and not p53 or p19ARF status (O'Shea et al, 2004). Regardless of mechanism, ONYX-015 appears to have a selective replication advantage in tumor cells when compared to non-tumor cells. In 1998, Freytag and colleagues generated a similar conditionally replicating adenovirus, Ad5-CD/TKrep, by 273

Lupold and Rodriguez: Prostate cancer gene therapy generating two early stop codons in the E1B-55K gene (Freytag et al, 1998). Ad5-CD/TKrep also contains a cytotoxic fusion gene of both cytosine deaminase (CD) and HSV-TK with the aim of combining viral replication, prodrug therapy, and radiotherapy for cancer treatment. Ad5-CD/TK demonstrated a similar replication profile to ONYX-015, produced concentration depended cell killing with 5-fluorocytosine (5-FC) and/or GVC, and dose dependently sensitized cells and xenograft tumors to radiation in combination with pro-drug therapy (Freytag et al, 1998, 2002; Rogulski et al, 2000). Pre-clinical PCa mouse models of biodistribution and toxicity demonstrated that intra-prostatically administered Ad5-CD/TKrep was capable of spreading and replicating to numerous urologic tissues, including the bladder, seminal vesicles, and testes, with no vertical germ-line transmission of the virus in offspring (Paielli et al, 2000). In clinical trials, a single intraprostatic dose of Ad5CD/TKrep followed by combined 5-FC/GVC therapy demonstrated safety and evidence of therapeutic response by short term decreases in serum PSA of several patients with local recurrent prostate cancer. The original threepronged approach of Ad5-CD/TKrep, 5-FC/GVC, and external beam radiation was later taken into phase I trials and also demonstrated safety and similarly described decreases in serum PSA of several patients, especially for those receiving longer term pro-drug treatments (Freytag et al, 2003). Intraprostatic transgene expression lasted up to three weeks following administration. Clinical trials combining Ad5-CD/TKrep and radiation are still on-going in phase I/II format and should further define safety and efficacy profiles. While ONYX-015 has been clinically tested for intravenous administration (Nemunaitis et al, 2001), to date Ad5-CD/TKrep has only been tested as an intraprostatic agent.

and concatamerization initiated by DNA-PK. Two viral proteins, E4orf3 and E4orf6, bind to and inhibit the DNAPK complex (Boyer et al, 1999). Additionally, the viral gene products of E4orf3/6 and E1B-55K cooperate to inhibit the action of the MRE-11 complex, which is known to play an important role in NHEJ repair (Stracker et al, 2002). The inhibition of dsDNA break repair in combination with radiation therapy can lead to cell death by apoptosis or reproductive cell death (Taccioli, 1998 and Chernikova, 1999), thus leading to additive or synergistic therapeutic effects. It is unclear what combination of viral genes best enhances radiation therapy. For example, E40rf6 alone does not appear to sensitize tumors to radiation (Collis et al, 2003). Some conditionally replicating viruses, such as CG7060 and CG7870, express E1A and therefore also express E4orf3/6 and E1B-55K. These viruses demonstrate a synergistic response when combined with radiation (Chen et al, 2001). Ad5-CD/TKrep expresses E1A and therefore should also express E4orf3/6, but does not express E1B-55K. The additive effects E4orf3/6 +/E1B-55K and radiation have not yet been evaluated. CG7060, CG7870, and Ad5-CD/TKrep have all entered phase I and II clinical trials in combination with radiation therapy for the treatment of local recurrent and high risk local disease. Since the addition of the adenoviral gene therapy does not appear to add significantly to the toxicity of radiation therapy, acceptance of this combination is likely to meet with little resistance if efficacy can be truly demonstrated. The tumor suppressor gene p53 has been referred to as the guardian of the genome for its involvement in selecting cell cycle arrest or apoptosis when faced with cellular stress, such as ionizing radiation. Thus, several groups have found additional tumor suppression and apoptosis when combining p53-based gene therapy and radiation (Colletier et al, 2000; Cowen et al, 2000; Sasaki et al, 2001). This is in contrast to some in vitro studies which suggest that intact cell cycle checkpoints are not required for efficient radiation therapy (Waldman et al, 1997; DeWeese et al, 1998). The combination of the constitutively expressing p53 adenovirus, INGN 201, and radioactive seeds is in clinical trials. Results should provide some clarity to the value of such combination therapies. The combination of adenoviral cytotoxic strategies and radiation therapy is also logical. For example, DNA damaging agents, such as 5-FU, have previously been shown to sensitize cells to radiation (Smalley et al, 1991). The combination of radiation with GCV has also been effective. As described briefly above, combination of the ADV/RSV-TK + GCV with radiation resulted in significantly decreased tumor volume and growth of lung metastases (Chhikara et al, 2001). Also, the dual suicide gene therapy vector Ad5-CD/Tkrep + 5-FC and/or GCV has demonstrated additional therapeutic effects with radiation in animal models (Freytag et al, 2002). Both HSV-TK and replicating double suicide adenoviral gene therapy vectors are being combined with radiation therapy in phase I and II clinical trials for local prostate cancer (Teh et al, 2001, 2002, 2004).

III. Combination of adenoviral gene therapy and radiation Local radiation, either in the form of external beam radiation or by the intraprostatic placement of radioactive “seeds”, is an effective means of both treating low risk local prostate cancer and also of managing or “debulking” high risk local disease. The combination of adenoviral gene therapy and radiation therapy has been approached on a number of levels, including corrective, cytotoxic, and oncolytic adenoviral gene therapies. It appears that pretreatment of cells with radiation results in increased transgene expression, a technique applicable to all strategies (Zeng et al, 1997). Additionally, radiationinducible promoters have been developed (Marples et al, 2000). Collis et al. have recently reviewed the combination of radiation therapy and gene therapy in prostate cancer (Collis et al, 2003). Therefore, we will only briefly review a few applications. Ionizing radiation induces double stranded breaks, which are repaired by either homologous recombination or Non-Homologous End Joining (NHEJ), both of which are initiated by the DNA-PK complex (Collis et al, 2005). As a linear double-stranded DNA (dsDNA) genome, the adenovirus must take specific actions to avoid recognition

274

Cancer Therapy Vol 3, page 275 tissues, especially the liver. This sequestration is significant, with approximately 70-75% of the viral dose residing in the liver of mice intravenously injected with type 5 virus (Fechner et al, 1999; Wood et al, 1999; Leissner et al, 2001). Route of administration can alter biodistribution to certain tissues (Kass-Eisler et al, 1994; Huard et al, 1995); however, a significant enough portion of the therapeutic pool is still sequestered to non-target tissues, likely resulting in a reduced therapeutic response when compared to direct injection. The biodistribution also presents potential toxicity problems for systemic administration of non-transcriptionally targeted cytotoxic virus. Therefore, there has been much effort to de-target viral infection away from natural tropism, especially to the liver, and to re-target infection to specific tissue types. There are several mechanisms to achieve this, as shown in Figure 3. Below we briefly focus on mechanisms to retarget viral infection.

IV. Combination of adenoviral gene therapy and chemotherapy The combination of chemotherapy and adenoviral gene therapy is successful for many of the same reasons described above with radiation. Replication competent virus drive cells into S-phase, potentially making them more sensitive to chemotherapeutic agents. For example, the E1A gene itself is capable of enhancing chemotherapeutic toxicity (Sanchez-Prieto et al, 1996). This co-insult of S-phase progression and viral replication with DNA damaging agents is clearly additive and may be synergistic (Heise et al, 2000; You et al, 2000). The combination of CG7870 with microtubule stabilizing agents paclitaxel and docetaxel has also shown synergy in animal models (Yu et al, 2001). Combined intravenously administered CG7870 and docetaxel are currently in phase II clinical trials for advanced metastatic prostate cancer. As would be expected, corrective gene therapy strategies are also enhanced when combined with chemotherapeutics. Adenoviral mediated expression of p53 has been shown to chemo- sensitize several different cancers to cisplatin therapy (Fujiwara et al, 1994; Song et al, 1997). This effect was consistent with multiple DNA damaging chemotherapeutics in many cell line backgrounds, where microtubule targeting agents were only enhanced by p53 in a few cell lines (Blagosklonny and El-Deiry, 1998). In contrast, other groups have found improved responses with p53 expression and paclitaxel in multiple tumor types (Nielsen et al, 1998). This enhancement may come through advanced transduction efficiency, which can occur with low dose paclitaxel (Nielsen et al, 1998; Li et al, 2002). Further evaluation of p53 and microtubule targeted agents will likely provide clarity to the benefit for prostate cancer. Pro-drug therapies such as HSV-TK + GVC and CD + 5-FC induce DNA damage and therefore induce DNA repair machinery. Topoisomerase I (Topo I) plays a role in DNA replication and repair by relaxing supercoiled DNA with single strand breaks, in a mechanism where the enzyme is covalently linked to the 3â&#x20AC;&#x2122;-end of the strand break. The topoisomerase inhibitor, topotecan, stabilizes the covalently linked DNA/Topo I complex and inhibits the pending ligation reaction (Rothenberg, 1997). The combination of HSV-TK gene therapy with topotecan demonstrates enhanced cell killing and animal survival in colon cancer models (Wildner et al, 1999). Such studies have not been completed in prostate cancer models; however, topotecan alone has not been found to be an effective agent in treating prostate cancer (Klein et al, 2002).

A. De-targeting adenoviral tropism The term â&#x20AC;&#x153;de-targetingâ&#x20AC;? describes viral vectors that have been altered so that they no longer bind and infect cells through their natural mechanism. The molecular interactions of adenoviral cell binding through fiber/CAR have been well characterized. Specifically, the C-terminal knob portion of fiber mediates viral binding to cells via CAR (Figure 1A) (Henry et al, 1994; Louis et al, 1994). The knob structure is composed of two sheets of "-strands, the R-sheet (containing "-strands G, H, I, and D), which interacts directly with the receptor, and the S-sheet (containing "-strands C, B, A, and J), which faces the inward portion of the knob trimer (Xia et al, 1994; Bewley et al, 1999). A series of papers have described the required CAR interacting domains of fiber knob through competition assays with soluble knobs, fiber pseudotyping, and genetic mutation of the fiber gene in the viral genome (Jakubczak et al, 2001, Kirby et al, 1999, Kirby et al, 2000, Roelvink et al, 1999, Santis et al, 1999). These results have clearly demonstrated that adenovirus can be de-targeted from CAR mediated infection in vitro. However, it is becoming clear that knob mutations alone are not sufficient enough for de-targeting adenoviral tropism to the liver (Alemany and Curiel, 2001; Leissner et al, 2001; Mizuguchi et al, 2002; Smith et al, 2003). Additional mutations of the viral penton base RGD sequence, which is known to interact with cellular integrins to invoke viral internalization (Wickham et al, 1993), have been combined with fiber mutation; however, the effects on in vivo tropism are unclear. Some studies have described little to no change in hepatic infection with both Fiber and Penton de-targeting (Martin et al, 2003, Smith et al, 2003), where others have demonstrated significant liver de-targeting with this combination (Einfeld et al, 2001; Koizumi et al, 2003; Akiyama et al, 2004). Heparin sulfate proteoglycans (HSG) have also been described to play a role in hepatic infection via a putative HSG binding domain on the fiber shaft (Dechecchi et al, 2000, 2001). Mutations of this domain have been shown to decrease CAR mediated viral infection in vitro, and to significantly decrease liver

V. Adenoviral biodistribution: the need for transduction targeting While direct tumor injection has been an effective means for evaluating safety and efficacy of adenoviral gene therapy for prostate cancer, the long-term goal of cancer gene therapy is to exploit the targeting and delivery capabilities of the virus for systemic therapy of metastatic disease. However, the broad tropism of the virus leads to sequestration of the administered viral dose to non-target 275

Lupold and Rodriguez: Prostate cancer gene therapy

Figure 3. Adenoviral Re-Targeting. Initial viral re-targeting strategies applied bi-functional targeting agents, which served the dual purpose of de-targeting by blocking Fiber-CAR interactions, and re-targeting by providing a re-targeting peptide or protein (triangle). Pseudotyping involves propagating Fiber deleted adenovirus (gray shaded) in a cell line that expresses a modified fiber gene. Fiber detargeting (square) involves mutating regions of fiber involved in CAR recognition, and re-targeting is accomplished by inserting a peptide in the HI-loop or carboxy-terminus of fiber. Fiber genes from other serotypes may also achieve these goals (Fiber Swapping). Importantly, replicating pseudotyped viruses do not continue to maintain re-targeting after the first round of infection. Genetically retargeted viruses have the viral genome altered to express the re-targeted fiber gene.

tropism in vivo when combined with Fiber and Penton base mutations (Smith et al, 2003).Ad discussed below, fibers from alternative adenoviral serotypes may also aid in de-targeting. Route of administration combined with de-targeting has also been shown to effect liver transduction. Akiyama and colleagues have shown that the natural tropism of intraperitoneally (i. p.) administered adenovirus is to the mesothelium of abdominal tissues (Akiyama et al, 2004). The combination of CAR ablation and i. p. administration inhibits viral infection to the mesothelium, leading to viral entry to the bloodstream, followed by infection of the liver parenchyma. Interestingly, i. p. injection of vectors abated for both CAR and integrin binding resulted in bloodstream entry and long term viral persistence without liver parenchyma infection. The efficiency to escape to the bloodstream was dependant upon the initial viral dose, but occurred in a non-linear manner suggesting a saturable process. Further investigations of the effects of detargeting and route of administration in animal models should aid in the ability to alter viral biodistribution in favor of tumor infection.

reviewed in detail by several groups (Wickham, 2003; Everts and Curiel, 2004; Glasgow et al, 2004). Re-targeted vectors are defined as those that have been modified to bind and infect via additional receptors beyond the natural tropism patterns. Initial studies in re-targeting involved swapping fiber genes or knobs from various serotypes to demonstrate broad changes in infection profiles (Gall et al, 1996; Krasnykh et al, 1996). These types of fiber swap vectors simultaneously de-target and re-target to a whole different class of cells and tissues. For example, the fiber protein of subgroup B adenoviruses uses CD46 rather than CAR as a cellular receptor (Gaggar et al, 2003). Chimeric serotype 5 adenovirus displaying the subgroup B serotype 35 fiber have been shown to decrease liver (and other nontarget tissue) infection when compared to serotype 5 fiber, and to show increased ability to transduce some hematopoietic and malignant cells (Bernt et al, 2003; Sakurai et al, 2003; Nilsson et al, 2004). Much effort has also been placed in designing bifunctional targeting agents, such as bi-functional antibodies, where one half binds the virus and the other half to a cellular receptor (Douglas et al, 1996; Wickham et al, 1996; Watkins et al, 1997; Dmitriev et al, 2000). Bifunctional targeting strategies can have the advantage of both viral de-targeting, by binding to and blocking Fiber CAR interaction domains, and re-targeting. However, difficulties associated with production and clinical

B. Re-targeting adenoviral tropism Adenoviral re-targeting has been a major focus of the gene therapy field for the last decade and has been

276

Cancer Therapy Vol 3, page 277 translation of bi-functional agents has driven the field toward genetically based re-targeting. Re-targeting peptides can be genetically incorporated and displayed on either the carboxy-terminus (Wickham et al, 1996, 1997) or the HI-loop of the fiber gene (Dmitriev et al, 1998; Krasnykh et al, 1998; Einfeld et al, 1999) to increase tropism beyond CAR expressing cells. Additional sites for peptide insertion have been identified in the Penton base (Wickham et al, 1996), Hexon (Vigne et al, 1999; Wu et al, 2003), and Protein IX (Dmitriev et al, 2002). Most of the initial fiber targeting strategies applied broad tropism targeting motifs, such as poly-lysine, RGD, or fiber knobs from alternative serotypes. Such strategies will be easily translated to tissues known to lose CAR expression during carcinogenesis, such as bladder cancer (Sachs et al, 2002; van der Poel et al, 2002). However, there are additional pharmaceutical options for these tissue types, such as histone deacetylase inhibitors, which upregulate CAR expression (Kitazono et al, 2001; Sachs et al, 2004). Prostate cancer, on the other hand, has been shown to retain CAR expression and therefore would likely not benefit from broad tropic targeting strategies (Rauen et al, 2002). The combination of de-targeting and more specific re-targeting may be required for prostate cancer. Such cell-specific targeting has been demonstrated for endothelial cells by first identifying cell binding peptides through phage display, and then incorporating them into the fiber HI-loop (Nicklin et al, 2001, Nicklin et al, 2000). However, to date, no such transductionally targeted adenovirus has been designed for prostate. We have recently applied phage display to identify two peptides that bind to the extracellular portion of the Prostate Specific Membrane Antigen (PSMA) (Lupold and Rodriguez, 2004), a protein highly expressed on the surface of advanced prostate cancer cells (see Ghosh and Heston for Review (Ghosh and Heston, 2004)). We are currently in the process of developing genetically retargeted vectors with these peptides. The concept of PSMA targeted adenovirus was recently confirmed using bifunctional antibodies (Henning et al, 2005, Kraaij et al, 2005), so we are therefore optimistic that a genetically based re-targeting mechanism could be successful.

demonstrate the benefits of combining transcriptional and transductional targeting. For example, the combination of ovarian specific transcriptional targeting and transductional targeting (via a bi-specific fusion protein) decreased liver and spleen transgene expression by 47% and 68%, respectively, while increasing tumor transgene expression by 30% (Barker et al, 2003). Other groups have reported similar increases in specificity and efficacy in other tissue models, both in vitro and in vivo (Barnett et al, 2002; Work et al, 2004). While there have been no dualtargeted prostate-specific vectors reported to date, it is likely that some will soon be described. The combination of current transductional targeting advances, existing transcriptionally targeting vectors, and chemotherapy will likely increase responses in metastatic disease trials.

VI. Conclusions Adenoviral vectors have been widely studied as cancer gene therapeutics. Their safety and efficacy profiles have shown much promise as in situ administered gene therapy agents in prostate cancer clinical trials. Additional laboratory studies have determined efficient means to retarget adenoviral transduction to improve bio-distribution, which should result in improved toxicity profiles and therapeutic responses. The promise of combining both prostate specific transductional targeting and prostate specific therapeutic effect is clear for advanced metastatic disease.

References Akiyama M, Thorne S, Kirn D, Roelvink PW, Einfeld DA, King CR and Wickham TJ (2004) Ablating CAR and integrin binding in adenovirus vectors reduces nontarget organ transduction and permits sustained bloodstream persistence following intraperitoneal administration. Mol Ther 9, 21830. Alemany R and Curiel DT (2001) CAR-binding ablation does not change biodistribution and toxicity of adenoviral vectors. Gene Ther 8, 1347-53. Anello R, Cohen S, Atkinson G and Hall SJ (2000) Adenovirus mediated cytosine deaminase gene transduction and 5fluorocytosine therapy sensitizes mouse prostate cancer cells to irradiation. J Urol 164, 2173-7. Atkinson G and Hall SJ (1999) Prodrug activation Gene Therapy and external beam irradiation in the treatment of prostate cancer. Urology 54, 1098-104. Badie B, Kramar MH, Lau R, Boothman DA, Economou JS and Black KL (1998) Adenovirus-mediated p53 gene delivery potentiates the radiation-induced growth inhibition of experimental brain tumors. J Neurooncol, 37, 217-22. Barker SD, Dmitriev IP, Nettelbeck DM, Liu B, Rivera AA, Alvarez RD, Curiel DT and Hemminki A (2003) Combined transcriptional and transductional targeting improves the specificity and efficacy of adenoviral gene delivery to ovarian carcinoma. Gene Ther 10, 1198-204. Barnett BG, Tillman BW, Curiel DT and Douglas JT (2002) Dual targeting of adenoviral vectors at the levels of transduction and transcription enhances the specificity of gene expression in cancer cells. Mol Ther 6, 377-85. Becker CM, Farnebo FA, Iordanescu I, Behonick DJ, Shih MC, Dunning P, Christofferson R, Mulligan RC, Taylor GA, Kuo CJ and Zetter BR (2002) Gene Therapy of prostate cancer

VI. Combining transcriptional and transductional targeting The most pressing need of adenoviral gene therapy is in metastatic disease. These types of studies are in their infancy, and to date only a single i. v. administered, transcriptionally targeted, adenoviral vector has been tested in clinical trials for prostate cancer. As described above, preliminary reports from CG7870 suggest that enough virus can avoid liver and blood clearance to reach the tumor and elicit a therapeutic response (Wilding et al, 2004). Although these results are preliminary, they suggest that drastic improvements in de-targeting may not be required to significantly improve therapeutic effect. The application of some of the above discussed de-targeting and re-targeting advances would likely improve the responses elicited by this vector. Pre-clinical results from non-prostatically targeted vectors have already begun to

277

Lupold and Rodriguez: Prostate cancer gene therapy with the soluble vascular endothelial growth factor receptor Flk1. Cancer Biol Ther 1, 548-53. Bergelson JM, Cunningham JA, Droguett G, Kurt-Jones EA, Krithivas A, Hong JS, Horwitz MS, Crowell RL and Finberg RW (1997) Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-3. Bernt KM, Ni S, Gaggar A, Li ZY, Shayakhmetov DM and Lieber A (2003) The effect of sequestration by nontarget tissues on anti-tumor efficacy of systemically applied, conditionally replicating adenovirus vectors. Mol Ther 8, 746-55. Bewley MC, Springer K, Zhang YB, Freimuth P and Flanagan JM (1999) Structural analysis of the mechanism of adenovirus binding to its human cellular receptor, CAR. Science 286, 1579-83. Bischoff JR, Kirn DH, Williams A, Heise C, Horn S, Muna M, Ng L, Nye JA, Sampson-Johannes A, Fattaey A and McCormick F (1996) An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science 274, 373-6. Blackburn RV, Galoforo SS, Corry PM and Lee YJ (1998) Adenoviral-mediated transfer of a heat-inducible double suicide gene into prostate carcinoma cells. Cancer Res 58, 1358-62. Blagosklonny MV and El-Deiry WS (1998) Acute overexpression of wt p53 facilitates anticancer drug-induced death of cancer and normal cells. Int J Cancer 75, 933-40. Bookstein R, MacGrogan D, Hilsenbeck SG, Sharkey F and Allred DC (1993) p53 is mutated in a subset of advancedstage prostate cancers. Cancer Res 53, 3369-73. Bouvet M, Ellis LM, Nishizaki M, Fujiwara T, Liu W, Bucana CD, Fang B, Lee JJ and Roth JA (1998) Adenovirusmediated wild-type p53 gene transfer down-regulates vascular endothelial growth factor expression and inhibits angiogenesis in human colon cancer. Cancer Res , 2288-92. Boyer J, Rohleder K and Ketner G (1999) Adenovirus E4 34k and E4 11k inhibit double strand break repair and are physically associated with the cellular DNA-dependent protein kinase. Virology 263, 307-12. Bramson J, Hitt M, Gallichan WS, Rosenthal KL, Gauldie J and Graham FL (1996) Construction of a double recombinant adenovirus vector expressing a heterodimeric cytokine: in vitro and in vivo production of biologically active interleukin-12. Hum Gene Ther 7, 333-42. Brooks JD, Bova GS, Ewing CM, Piantadosi S, Carter BS, Robinson JC, Epstein JI and Isaacs WB (1996) An uncertain role for p53 gene alterations in human prostate cancers. Cancer Res 56, 3814-22. Cao G, Su J, Lu W, Zhang F, Zhao G, Marteralli D and Dong Z (2001) Adenovirus-mediated interferon-" Gene Therapy suppresses growth and metastasis of human prostate cancer in nude mice. Cancer Gene Ther 8, 497-505. Cavallo F, Signorelli P, Giovarelli M, Musiani P, Modesti A, Brunda MJ, Colombo MP and Forni G (1997) Antitumor efficacy of adenocarcinoma cells engineered to produce interleukin 12 (IL-12) or other cytokines compared with exogenous IL-12. J Natl Cancer Inst 89, 1049-58. Chen SH, Shine HD, Goodman JC, Grossman RG and Woo SL (1994) Gene Therapy for brain tumors: regression of experimental gliomas by adenovirus-mediated gene transfer in vivo. Proc Natl Acad Sci USA 91, 3054-7. Chen Y, DeWeese T, Dilley J, Zhang Y, Li Y, Ramesh N, Lee J, Pennathur-Das R, Radzyminski J, Wypych J, Brignetti D, Scott S, Stephens J, Karpf DB, Henderson DR and Yu DC (2001) CV706, a prostate cancer-specific adenovirus variant, in combination with radiotherapy produces synergistic antitumor efficacy without increasing toxicity. Cancer Res 61, 5453-60.

Chhikara M, Huang H, Vlachaki MT, Zhu X, Teh B, Chiu KJ, Woo S, Berner B, Smith EO, Oberg KC, Aguilar LK, Thompson TC, Butler EB and Aguilar-Cordova E (2001) Enhanced therapeutic effect of HSV-tk+GCV Gene Therapy and ionizing radiation for prostate cancer. Mol Ther 3, 53642. Cho WK, Seong YR, Lee YH, Kim MJ, Hwang KS, Yoo J, Choi S, Jung CR and Im DS (2004) Oncolytic effects of adenovirus mutant capable of replicating in hypoxic and normoxic regions of solid tumor. Mol Ther 10, 938-49. Clayman GL, el-Naggar AK, Lippman SM, Henderson YC, Frederick M, Merritt JA, Zumstein LA, Timmons TM, Liu TJ, Ginsberg L, Roth JA, Hong WK, Bruso P and Goepfert H (1998) Adenovirus-mediated p53 gene transfer in patients with advanced recurrent head and neck squamous cell carcinoma. J Clin Oncol 16, 2221-32. Cohen J (1995) IL-12 deaths: explanation and a puzzle. Science 270, 908. Colletier PJ, Ashoori F, Cowen D, Meyn RE, Tofilon P, Meistrich ME and Pollack A (2000) Adenoviral-mediated p53 transgene expression sensitizes both wild-type and null p53 prostate cancer cells in vitro to radiation. Int J Radiat Oncol Biol Phys 48, 1507-12. Collis SJ, DeWeese TL, Jeggo PA and Parker AR (2005) The life and death of DNA-PK. Oncogene 24, 949-61. Collis SJ, Ketner GW, Hicks JL, Nelson WG, Demarzo AM and Deweese TL (2003) Expression of the DNA-PK binding protein E4-34K fails to confer radiation sensitivity to mammalian cells. Int J Radiat Biol 79, 53-60. Collis SJ, Khater K and DeWeese TL (2003) Novel therapeutic strategies in prostate cancer management using Gene Therapy in combination with radiation therapy. World J Urol 21, 275-89. Cowen D, Salem N, Ashoori F, Meyn R, Meistrich ML, Roth JA and Pollack A (2000) Prostate cancer radiosensitization in vivo with adenovirus-mediated p53 Gene Therapy. Clin Cancer Res 6, 4402-8. Dechecchi MC, Melotti P, Bonizzato A, Santacatterina M, Chilosi M and Cabrini G (2001) Heparan sulfate glycosaminoglycans are receptors sufficient to mediate the initial binding of adenovirus types 2 and 5. J Virol 75, 877280. Dechecchi MC, Tamanini A, Bonizzato A and Cabrini G (2000) Heparan sulfate glycosaminoglycans are involved in adenovirus type 5 and 2-host cell interactions. Virology 268, 382-90. DeWeese TL, Shipman JM, Dillehay LE and Nelson WG (1998) Sensitivity of human prostatic carcinoma cell lines to low dose rate radiation exposure. J Urol 159, 591-8. DeWeese TL, van der Poel H, Li S, Mikhak B, Drew R, Goemann M, Hamper U, DeJong R, Detorie N, Rodriguez R, Haulk T, DeMarzo AM, Piantadosi S, Yu DC, Chen Y, Henderson DR, Carducci MA, Nelson WG and Simons JW (2001) A phase I trial of CV706, a replication-competent, PSA selective oncolytic adenovirus, for the treatment of locally recurrent prostate cancer following radiation therapy. Cancer Res 61, 7464-72. Dmitriev I, Kashentseva E, Rogers BE, Krasnykh V and Curiel DT (2000) Ectodomain of coxsackievirus and adenovirus receptor genetically fused to epidermal growth factor mediates adenovirus targeting to epidermal growth factor receptor-positive cells. J Virol 74, 6875-84. Dmitriev I, Krasnykh V, Miller CR, Wang M, Kashentseva E, Mikheeva G, Belousova N and Curiel DT (1998) An adenovirus vector with genetically modified fibers demonstrates expanded tropism via utilization of a coxsackievirus and adenovirus receptor-independent cell entry mechanism. J Virol 72, 9706-13.

278

Cancer Therapy Vol 3, page 279 Dmitriev IP, Kashentseva EA and Curiel DT (2002) Engineering of adenovirus vectors containing heterologous peptide sequences in the C terminus of capsid protein IX. J Virol 76, 6893-9. Douglas JT, Rogers BE, Rosenfeld ME, Michael SI, Feng M and Curiel DT (1996) Targeted gene delivery by tropismmodified adenoviral vectors. Nat Biotechnol, 14, 1574-8. Eastham JA, Chen SH, Sehgal I, Yang G, Timme TL, Hall SJ, Woo SL and Thompson TC (1996) Prostate cancer Gene Therapy: herpes simplex virus thymidine kinase gene transduction followed by ganciclovir in mouse and human prostate cancer models. Hum Gene Ther 4, 515-23. Eastham JA, Hall SJ, Sehgal I, Wang J, Timme TL, Yang G, Connell-Crowley L, Elledge SJ, Zhang WW, Harper JW and et al (1995) In vivo Gene Therapy with p53 or p21 adenovirus for prostate cancer. Cancer Res 55, 5151-5. Eastham JA, Stapleton AM, Gousse AE, Timme TL, Yang G, Slawin KM, Wheeler TM, Scardino PT and Thompson TC (1995) Association of p53 mutations with metastatic prostate cancer. Clin Cancer Res 1, 1111-8. Edwards SJ, Dix BR, Myers CJ, Dobson-Le D, Huschtscha L, Hibma M, Royds J and Braithwaite AW (2002) Evidence that replication of the antitumor adenovirus ONYX-015 is not controlled by the p53 and p14 (ARF) tumor suppressor genes. J Virol 76, 12483-90. Einfeld DA, Brough DE, Roelvink PW, Kovesdi I and Wickham TJ (1999) Construction of a pseudoreceptor that mediates transduction by adenoviruses expressing a ligand in fiber or penton base. J Virol 73, 9130-6. Einfeld DA, Schroeder R, Roelvink PW, Lizonova A, King CR, Kovesdi I and Wickham TJ (2001) Reducing the native tropism of adenovirus vectors requires removal of both CAR and integrin interactions. J Virol 75, 11284-91. Elzey BD, Siemens DR, Ratliff TL and Lubaroff DM (2001) Immunization with type 5 adenovirus recombinant for a tumor antigen in combination with recombinant canarypox virus (ALVAC) cytokine gene delivery induces destruction of established prostate tumors. Int J Cancer 94, 842-9. Enders J, Bell J, JH D, Jr FT, MR H, RJ H and AM P (1956) Adenoviruses: group name proposed for new respiratorytract viruses. Science 124, 119-120. Everts M and Curiel DT (2004) Transductional targeting of adenoviral cancer Gene Therapy. Curr Gene Ther 4, 33746. Fallaux FJ, Kranenburg O, Cramer SJ, Houweling A, Van Ormondt H, Hoeben RC and Van Der Eb AJ (1996) Characterization of 911: a new helper cell line for the titration and propagation of early region 1-deleted adenoviral vectors. Hum Gene Ther 7, 215-22. Fechner H, Haack A, Wang H, Wang X, Eizema K, Pauschinger M, Schoemaker R, Veghel R, Houtsmuller A, Schultheiss HP, Lamers J and Poller W (1999) Expression of coxsackie adenovirus receptor and #v-integrin does not correlate with adenovector targeting in vivo indicating anatomical vector barriers. Gene Ther 6, 1520-35. Franklin J, Hislop J, Flynn A and McArdle CA (2003) Signalling and anti-proliferative effects mediated by gonadotrophinreleasing hormone receptors after expression in prostate cancer cells using recombinant adenovirus. J Endocrinol, 176, 275-84. Freeman SM, Abboud CN, Whartenby KA, Packman CH, Koeplin DS, Moolten FL and Abraham GN (1993) The "bystander effect": tumor regression when a fraction of the tumor mass is genetically modified. Cancer Res 53, 527483. Freytag SO, Paielli D, Wing M, Rogulski K, Brown S, Kolozsvary A, Seely J, Barton K, Dragovic A and Kim JH (2002) Efficacy and toxicity of replication-competent

adenovirus-mediated double suicide Gene Therapy in combination with radiation therapy in an orthotopic mouse prostate cancer model. Int J Radiat Oncol Biol Phys, 54, 873-85. Freytag SO, Rogulski KR, Paielli DL, Gilbert JD and Kim JH (1998) A novel three-pronged approach to kill cancer cells selectively: concomitant viral, double suicide gene, and radiotherapy. Hum Gene Ther 9, 1323-33. Freytag SO, Stricker H, Pegg J, Paielli D, Pradhan DG, Peabody J, DePeralta-Venturina M, Xia X, Brown S, Lu M and Kim JH (2003) Phase I study of replication-competent adenovirus-mediated double-suicide Gene Therapy in combination with conventional-dose three-dimensional conformal radiation therapy for the treatment of newly diagnosed, intermediate- to high-risk prostate cancer. Cancer Res 63, 7497-506. Fujiwara T, Grimm EA, Mukhopadhyay T, Zhang WW, OwenSchaub LB and Roth JA (1994) Induction of chemosensitivity in human lung cancer cells in vivo by adenovirus-mediated transfer of the wild-type p53 gene. Cancer Res 54, 2287-91. Furuhata S, Ide H, Miura Y, Yoshida T and Aoki K (2003) Development of a prostate-specific promoter for Gene Therapy against androgen-independent prostate cancer. Mol Ther 7, 366-74. Gaggar A, Shayakhmetov DM and Lieber A (2003) CD46 is a cellular receptor for group B adenoviruses. Nat Med 9, 1408-12. Gall J, Kass-Eisler A, Leinw and L and Falck-Pedersen E (1996) Adenovirus type 5 and 7 capsid chimera: fiber replacement alters receptor tropism without affecting primary immune neutralization epitopes. J Virol 70, 2116-23. Ghosh-Choudhury G, Haj-Ahmad Y, Brinkley P, Rudy J and Graham FL ( 1986) Human adenovirus cloning vectors based on infectious bacterial plasmids. Gene, 50, 161-71. Ghosh A and Heston WD (2004) Tumor target prostate specific membrane antigen (PSMA) and its regulation in prostate cancer. J Cell Biochem, 91, 528-39. Glasgow JN, Bauerschmitz GJ, Curiel DT and Hemminki A (2004) Transductional and transcriptional targeting of adenovirus for clinical applications. Curr Gene Ther 4, 114. Golab J and Zagozdzon R (1999) Antitumor effects of interleukin-12 in pre-clinical and early clinical studies (Review). Int J Mol Med 3, 537-44. Gotoh A, Ko SC, Shirakawa T, Cheon J, Kao C, Miyamoto T, Gardner TA, Ho LJ, Cleutjens CB, Trapman J, Graham FL and Chung LW (1998) Development of prostate-specific antigen promoter-based Gene Therapy for androgenindependent human prostate cancer. J Urol 160, 220-9. Gowardhan B, West AF, Robson CN and Leung HY (2004) Adenovirus-mediated expression of a soluble fibroblast growth factor receptor inhibits in vitro growth of prostate DU145 cells. Prostate, 61, 50-9. Graham FL, Smiley J, Russell WC and Nairn R (1977) Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol 36, 59-74. Griffith TS and Broghammer EL (2001) Suppression of tumor growth following intralesional therapy with TRAIL recombinant adenovirus. Mol Ther 4, 257-66. Hall SJ, Mutchnik SE, Chen SH, Woo SL and Thompson TC (1997) Adenovirus-mediated herpes simplex virus thymidine kinase gene and ganciclovir therapy leads to systemic activity against spontaneous and induced metastasis in an orthotopic mouse model of prostate cancer. Int J Cancer 70, 183-7. Hall SJ, Mutchnik SE, Yang G, Timme TL, Nasu Y, Bangma CH, Woo SL, Shaker M and Thompson TC (1999)

279

Lupold and Rodriguez: Prostate cancer gene therapy Cooperative therapeutic effects of androgen ablation and adenovirus-mediated herpes simplex virus thymidine kinase gene and ganciclovir therapy in experimental prostate cancer. Cancer Gene Ther 6, 54-63. He D, Mu ZM, Le X, Hsieh JT, Pong RC, Chung LW and Chang KS (1997) Adenovirus-mediated expression of PML suppresses growth and tumorigenicity of prostate cancer cells. Cancer Res 57, 1868-72. Hedlund TE, Meech SJ, Srikanth S, Kraft AS, Miller GJ, Schaack JB and Duke RC (1999) Adenovirus-mediated expression of Fas ligand induces apoptosis of human prostate cancer cells. Cell Death Differ, 6, 175-82. Heise C, Hermiston T, Johnson L, Brooks G, Sampson-Johannes A, Williams A, Hawkins L and Kirn D (2000) An adenovirus E1A mutant that demonstrates potent and selective systemic anti-tumoral efficacy. Nat Med 6, 1134-9. Heise C, Lemmon M and Kirn D (2000) Efficacy with a replication-selective adenovirus plus cisplatin-based chemotherapy: dependence on sequencing but not p53 functional status or route of administration. Clin Cancer Res 6, 4908-14. Henning P, andersson KM, Frykholm K, Ali A, Magnusson MK, Nygren PA, Granio O, Hong SS, Boulanger P and Lindholm L (2005) Tumor cell targeted gene delivery by adenovirus 5 vectors carrying knobless fibers with antibody-binding domains. Gene Ther 12, 211-24. Henry LJ, Xia D, Wilke ME, Deisenhofer J and Gerard RD (1994) Characterization of the knob domain of the adenovirus type 5 fiber protein expressed in Escherichia coli. J Virol 68, 5239-46. Herman JR, Adler HL, Aguilar-Cordova E, Rojas-Martinez A, Woo S, Timme TL, Wheeler TM, Thompson TC and Scardino PT (1999) In situ Gene Therapy for adenocarcinoma of the prostate: a phase I clinical trial. Hum Gene Ther 10, 1239-49. Hollstein M, Rice K, Greenblatt MS, Soussi T, Fuchs R, Sorlie T, Hovig E, Smith-Sorensen B, Montesano R and Harris CC (1994) Database of p53 gene somatic mutations in human tumors and cell lines. Nucleic Acids Res 22, 3551-5. Hsieh CL, Yang L, Miao L, Yeung F, Kao C, Yang H, Zhau HE and Chung LW (2002) A novel targeting modality to enhance adenoviral replication by vitamin D(3) in androgenindependent human prostate cancer cells and tumors. Cancer Res 62, 3084-92. Huard J, Lochmuller H, Acsadi G, Jani A, Massie B and Karpati G (1995) The route of administration is a major determinant of the transduction efficiency of rat tissues by adenoviral recombinants. Gene Ther 2, 107-15. Hull GW, McCurdy MA, Nasu Y, Bangma CH, Yang G, Shimura S, Lee HM, Wang J, Albani J, Ebara S, Sato T, Timme TL and Thompson TC (2000) Prostate cancer Gene Therapy: comparison of adenovirus-mediated expression of interleukin 12 with interleukin 12 plus B7-1 for in situ Gene Therapy and gene-modified, cell-based vaccines. Clin Cancer Res 6, 4101-9. Isaacs WB, Carter BS and Ewing CM (1991) Wild-type p53 suppresses growth of human prostate cancer cells containing mutant p53 alleles. Cancer Res 51, 4716-20. Jakubczak JL, Rollence ML, Stewart DA, Jafari JD, Von Seggern DJ, Nemerow GR, Stevenson SC and Hallenbeck PL (2001) Adenovirus type 5 viral particles pseudotyped with mutagenized fiber proteins show diminished infectivity of coxsackie B-adenovirus receptor-bearing cells. J Virol 75, 2972-81. Jemal A, Murray T, Ward E, Samuels A, Tiwari RC, Ghafoor A, Feuer EJ and Thun MJ (2005) Cancer statistics, 2005. CA Cancer J Clin, 55, 10-30.

Kaliberov SA, Kaliberova LN and Buchsbaum DJ (2005) Combined ionizing radiation and sKDR gene delivery for treatment of prostate carcinomas. Gene Ther 12, 407-17. Kallioniemi OP, Visakorpi T, Holli K, Heikkinen A, Isola J and Koivula T (1991) Improved prognostic impact of S-phase values from paraffin-embedded breast and prostate carcinomas after correcting for nuclear slicing. Cytometry, 12, 413-21. Kass-Eisler A, Falck-Pedersen E, Elfenbein DH, Alvira M, Buttrick PM and Leinw and LA (1994) The impact of developmental stage, route of administration and the immune system on adenovirus-mediated gene transfer. Gene Ther 1, 395-402. Kim M, Wright M, Deshane J, Accavitti MA, Tilden A, Saleh M, Vaughan WP, Carabasi MH, Rogers MD, Hockett RD, Jr, Grizzle WE and Curiel DT (1997) A novel Gene Therapy strategy for elimination of prostate carcinoma cells from human bone marrow. Hum Gene Ther 8, 157-70. Kirby I, Davison E, Beavil AJ, Soh CP, Wickham TJ, Roelvink PW, Kovesdi I, Sutton BJ and Santis G (1999) Mutations in the DG loop of adenovirus type 5 fiber knob protein abolish high-affinity binding to its cellular receptor CAR. J Virol 73, 9508-14. Kirby I, Davison E, Beavil AJ, Soh CP, Wickham TJ, Roelvink PW, Kovesdi I, Sutton BJ and Santis G (2000) Identification of contact residues and definition of the CAR-binding site of adenovirus type 5 fiber protein. J Virol 74, 2804-13. Kirkman W, 3rd Chen P, Schroeder R, Feneley MR, Rodriguez R, Wickham TJ, King CR and Bruder JT (2001) Transduction and apoptosis induction in the rat prostate, using adenovirus vectors. Hum Gene Ther 12, 1499-512. Kitazono M, Goldsmith ME, Aikou T, Bates S and Fojo T (2001) Enhanced adenovirus transgene expression in malignant cells treated with the histone deacetylase inhibitor FR901228. Cancer Res 61, 6328-30. Klein CE, Tangen CM, Braun TJ, Hussain MH, Peereboom DM, Nichols CR, Rivkin SE, Dakhil SR and Crawford ED (2002) SWOG-9510: evaluation of topotecan in hormone refractory prostate cancer: a Southwest Oncology Group study. Prostate, 52, 264-8. Kleinerman DI, Zhang WW, Lin SH, Nguyen TV, von Eschenbach AC and Hsieh JT (1995) Application of a tumor suppressor (C-CAM1)-expressing recombinant adenovirus in androgen-independent human prostate cancer therapy: a preclinical study. Cancer Res 55, 2831-6. Kochanek S, Schiedner G and Volpers C (2001) High-capacity 'gutless' adenoviral vectors. Curr Opin Mol Ther 3, 454-63. Koeneman KS, Kao C, Ko SC, Yang L, Wada Y, Kallmes DF, Gillenwater JY, Zhau HE, Chung LW and Gardner TA (2000) Osteocalcin-directed Gene Therapy for prostatecancer bone metastasis. World J Urol 18, 102-10. Koizumi N, Mizuguchi H, Sakurai F, Yamaguchi T, Watanabe Y and Hayakawa T (2003) Reduction of natural adenovirus tropism to mouse liver by fiber-shaft exchange in combination with both CAR- and #v integrin-binding ablation. J Virol 77, 13062-72. Kraaij R, Van Rijswijk AL, Oomen MH, Haisma HJ and Bangma CH (2005) Prostate specific membrane antigen (PSMA) is a tissue-specific target for adenoviral transduction of prostate cancer in vitro. Prostate, 62, 253-9. Krasnykh V, Dmitriev I, Mikheeva G, Miller CR, Belousova N and Curiel DT (1998) Characterization of an adenovirus vector containing a heterologous peptide epitope in the HI loop of the fiber knob. J Virol 72, 1844-52. Krasnykh VN, Mikheeva GV, Douglas JT and Curiel DT (1996) Generation of recombinant adenovirus vectors with modified fibers for altering viral tropism. J Virol 70, 6839-46.

280

Cancer Therapy Vol 3, page 281 Kubo H, Gardner TA, Wada Y, Koeneman KS, Gotoh A, Yang L, Kao C, Lim SD, Amin MB, Yang H, Black ME, Matsubara S, Nakagawa M, Gillenwater JY, Zhau HE and Chung LW (2003) Phase I dose escalation clinical trial of adenovirus vector carrying osteocalcin promoter-driven herpes simplex virus thymidine kinase in localized and metastatic hormone-refractory prostate cancer. Hum Gene Ther 14, 227-41. Latham JP, Searle PF, Mautner V and James ND (2000) Prostatespecific antigen promoter/enhancer driven Gene Therapy for prostate cancer: construction and testing of a tissue-specific adenovirus vector. Cancer Res 60, 334-41. Lebedeva IV, Su ZZ, Sarkar D, Kitada S, Dent P, Waxman S, Reed JC and Fisher PB (2003) Melanoma differentiation associated gene-7, mda-7/interleukin-24, induces apoptosis in prostate cancer cells by promoting mitochondrial dysfunction and inducing reactive oxygen species. Cancer Res 63, 8138-44. Lee YJ, Galoforo SS, Battle P, Lee H, Corry PM and Jessup JM (2001) Replicating adenoviral vector-mediated transfer of a heat-inducible double suicide gene for Gene Therapy. Cancer Gene Ther 8, 397-404. Leissner P, Legr and V, Schlesinger Y, Hadji DA, van Raaij M, Cusack S, Pavirani A and Mehtali M (2001) Influence of adenoviral fiber mutations on viral encapsidation, infectivity and in vivo tropism. Gene Ther 8, 49-57. Li S, Simons J, Detorie N, O'Rourke B, Hamper U and DeWeese TL (2003) Dosimetric and technical considerations for interstitial adenoviral Gene Therapy as applied to prostate cancer. Int J Radiat Oncol Biol Phys, 55, 204-14. Li X, Marani M, Yu J, Nan B, Roth JA, Kagawa S, Fang B, Denner L and Marcelli M (2001) Adenovirus-mediated Bax overexpression for the induction of therapeutic apoptosis in prostate cancer. Cancer Res 61, 186-91. Li Y, McCadden J, Ferrer F, Kruszewski M, Carducci M, Simons J and Rodriguez R (2002) Prostate-specific expression of the diphtheria toxin A chain (DT-A): studies of inducibility and specificity of expression of prostate-specific antigen promoter-driven DT-A adenoviral-mediated gene transfer. Cancer Res 62, 2576-82. Li Y, Okegawa T, Lombardi DP, Frenkel EP and Hsieh JT (2002) Enhanced transgene expression in androgen independent prostate cancer Gene Therapy by taxane chemotherapeutic agents. J Urol 167, 339-46. Lichtenstein DL, Toth K, Doronin K, Tollefson AE and Wold WS (2004) Functions and mechanisms of action of the adenovirus E3 proteins. Int Rev Immunol, 23, 75-111. Louis N, Evelegh C and Graham FL (1997) Cloning and sequencing of the cellular-viral junctions from the human adenovirus type 5 transformed 293 cell line. Virology 233, 423-9. Louis N, Fender P, Barge A, Kitts P and Chroboczek J (1994) Cell-binding domain of adenovirus serotype 2 fiber. J Virol 68, 4104-6. Luo W, Tapolsky M, Earley K, Wood CG, Wilson DR, Logothetis CJ and Lin SH (1999) Tumor-suppressive activity of CD66a in prostate cancer. Cancer Gene Ther 6, 313-21. Lupold SE and Rodriguez R (2004) Disulfide-constrained peptides that bind to the extracellular portion of the prostatespecific membrane antigen. Mol Cancer Ther 3, 597-603. Marcelli M, Cunningham GR, Walkup M, He Z, Sturgis L, Kagan C, Mannucci R, Nicoletti I, Teng B and Denner L (1999) Signaling pathway activated during apoptosis of the prostate cancer cell line LNCaP: overexpression of caspase-7 as a new Gene Therapy strategy for prostate cancer. Cancer Res 59, 382-90.

Marples B, Scott SD, Hendry JH, Embleton MJ, Lashford LS and Margison GP (2000) Development of synthetic promoters for radiation-mediated Gene Therapy. Gene Ther 7, 511-7. Martin K, Brie A, Saulnier P, Perricaudet M, Yeh P and Vigne E (2003) Simultaneous CAR- and # V integrin-binding ablation fails to reduce Ad5 liver tropism. Mol Ther 8, 48594. Martiniello-Wilks R, Garcia-Aragon J, Daja MM, Russell P, Both GW, Molloy PL, Lockett LJ and Russell PJ (1998) In vivo Gene Therapy for prostate cancer: preclinical evaluation of two different enzyme-directed prodrug therapy systems delivered by identical adenovirus vectors. Hum Gene Ther 9, 1617-26. Matsubara S, Wada Y, Gardner TA, Egawa M, Park MS, Hsieh CL, Zhau HE, Kao C, Kamidono S, Gillenwater JY and Chung LW (2001) A conditional replication-competent adenoviral vector, Ad-OC-E1a, to cotarget prostate cancer and bone stroma in an experimental model of androgenindependent prostate cancer bone metastasis. Cancer Res 61, 6012-9. McCormick F (2003) Cancer-specific viruses and the development of ONYX-015. Cancer Biol Ther 2, S157-60. Mesnil M, Piccoli C, Tiraby G, Willecke K and Yamasaki H (1996) Bystander killing of cancer cells by herpes simplex virus thymidine kinase gene is mediated by connexins. Proc Natl Acad Sci U S A, 93, 1831-5. Miles BJ, Shalev M, Aguilar-Cordova E, Timme TL, Lee HM, Yang G, Adler HL, Kernen K, Pramudji CK, Satoh T, Gdor Y, Ren C, Ayala G, Wheeler TM, Butler EB, Kadmon D and Thompson TC (2001) Prostate-specific antigen response and systemic T cell activation after in situ Gene Therapy in prostate cancer patients failing radiotherapy. Hum Gene Ther 12, 1955-67. Mizuguchi H, Koizumi N, Hosono T, Ishii-Watabe A, Uchida E, Utoguchi N, Watanabe Y and Hayakawa T (2002) CAR- or #v integrin-binding ablated adenovirus vectors, but not fibermodified vectors containing RGD peptide, do not change the systemic gene transfer properties in mice. Gene Ther 9, 76976. Nasu Y, Bangma CH, Hull GW, Lee HM, Hu J, Wang J, McCurdy MA, Shimura S, Yang G, Timme TL and Thompson TC (1999) Adenovirus-mediated interleukin-12 Gene Therapy for prostate cancer: suppression of orthotopic tumor growth and pre-established lung metastases in an orthotopic model. Gene Ther 6, 338-49. Navone NM, Troncoso P, Pisters LL, Goodrow TL, Palmer JL, Nichols WW, von Eschenbach AC and Conti CJ (1993) p53 protein accumulation and gene mutation in the progression of human prostate carcinoma. J Natl Cancer Inst, 85, 1657-69. Nemunaitis J, Cunningham C, Buchanan A, Blackburn A, Edelman G, Maples P, Netto G, Tong A, R andlev B, Olson S and Kirn D (2001) Intravenous infusion of a replicationselective adenovirus (ONYX-015) in cancer patients: safety, feasibility and biological activity. Gene Ther 8, 746-59. Nicklin SA, Von Seggern DJ, Work LM, Pek DC, Dominiczak AF, Nemerow GR and Baker AH (2001) Ablating adenovirus type 5 fiber-CAR binding and HI loop insertion of the SIGYPLP peptide generate an endothelial cellselective adenovirus. Mol Ther 4, 534-42. Nicklin SA, White SJ, Watkins SJ, Hawkins RE and Baker AH (2000) Selective targeting of gene transfer to vascular endothelial cells by use of peptides isolated by phage display. Circulation, 102, 231-7. Nielsen LL, Lipari P, Dell J, Gurnani M and Hajian G (1998) Adenovirus-mediated p53 Gene Therapy and paclitaxel have synergistic efficacy in models of human head and neck, ovarian, prostate, and breast cancer. Clin Cancer Res 4, 835-46.

281

Lupold and Rodriguez: Prostate cancer gene therapy Nilsson M, Ljungberg J, Richter J, Kiefer T, Magnusson M, Lieber A, Widegren B, Karlsson S and Fan X (2004) Development of an adenoviral vector system with adenovirus serotype 35 tropism; efficient transient gene transfer into primary malignant hematopoietic cells. J Gene Med 6, 63141. Nishizaki M, Fujiwara T, Tanida T, Hizuta A, Nishimori H, Tokino T, Nakamura Y, Bouvet M, Roth JA and Tanaka N (1999) Recombinant adenovirus expressing wild-type p53 is antiangiogenic: a proposed mechanism for bystander effect. Clin Cancer Res 5, 1015-23. O'Shea CC, Johnson L, Bagus B, Choi S, Nicholas C, Shen A, Boyle L, P andey K, Soria C, Kunich J, Shen Y, Habets G, Ginzinger D and McCormick F (2004) Late viral RNA export, rather than p53 inactivation, determines ONYX-015 tumor selectivity. Cancer Cell, 6, 611-23. Oh YT, Chen DW, Dougherty GJ and McBride WH (2004) Adenoviral interleukin-3 gene-radiation therapy for prostate cancer in mouse model. Int J Radiat Oncol Biol Phys, 59, 579-83. Paielli DL, Wing MS, Rogulski KR, Gilbert JD, Kolozsvary A, Kim JH, Hughes J, Schnell M, Thompson T and Freytag SO (2000) Evaluation of the biodistribution, persistence, toxicity, and potential of germ-line transmission of a replication-competent human adenovirus following intraprostatic administration in the mouse. Mol Ther 1, 26374. Pramudji C, Shimura S, Ebara S, Yang G, Wang J, Ren C, Yuan Y, Tahir SA, Timme TL and Thompson TC (2001) In situ prostate cancer Gene Therapy using a novel adenoviral vector regulated by the caveolin-1 promoter. Clin Cancer Res 7, 4272-9. Rauen KA, Sudilovsky D, Le JL, Chew KL, Hann B, Weinberg V, Schmitt LD and McCormick F (2002) Expression of the coxsackie adenovirus receptor in normal prostate and in primary and metastatic prostate carcinoma: potential relevance to Gene Therapy. Cancer Res 62, 3812-8. Rodolfo M and Colombo MP (1999) Interleukin-12 as an adjuvant for cancer immunotherapy. Methods, 19, 114-20. Rodriguez R, Lim HY, Bartkowski LM and Simons JW (1998) Identification of diphtheria toxin via screening as a potent cell cycle and p53-independent cytotoxin for human prostate cancer therapeutics. Prostate, 34, 259-69. Rodriguez R, Schuur ER, Lim HY, Henderson GA, Simons JW and Henderson DR (1997) Prostate attenuated replication competent adenovirus (ARCA) CN706: a selective cytotoxic for prostate-specific antigen-positive prostate cancer cells. Cancer Res 57, 2559-63. Roelvink PW, Mi Lee G, Einfeld DA, Kovesdi I and Wickham TJ (1999) Identification of a conserved receptor-binding site on the fiber proteins of CAR-recognizing adenoviridae. Science 286, 1568-71. Rogulski KR, Wing MS, Paielli DL, Gilbert JD, Kim JH and Freytag SO (2000) Double suicide Gene Therapy augments the antitumor activity of a replication-competent lytic adenovirus through enhanced cytotoxicity and radiosensitization. Hum Gene Ther 11, 67-76. Roth JA, Swisher SG, Merritt JA, Lawrence DD, Kemp BL, Carrasco CH, El-Naggar AK, Fossella FV, Glisson BS, Hong WK, Khurl FR, Kurie JM, Nesbitt JC, Pisters K, Putnam JB, Schrump DS, Shin DM and Walsh GL (1998) Gene Therapy for non-small cell lung cancer: a preliminary report of a phase I trial of adenoviral p53 gene replacement. Semin Oncol, 25, 33-7. Rothenberg ML (1997) Topoisomerase I inhibitors: review and update. Ann Oncol, 8, 837-55. Rothmann T, Hengstermann A, Whitaker NJ, Scheffner M and zur Hausen H (1998) Replication of ONYX-015, a potential

anticancer adenovirus, is independent of p53 status in tumor cells. J Virol 72, 9470-8. Rowe WP, Huebner RJ, Gilmore LK, Parrott RH and Ward TG (1953) Isolation of a cytopathogenic agent from human adenoids undergoing spontaneous degeneration in tissue culture. Proc Soc Exp Biol Med 84, 570-3. Sachs MD, Ramamurthy M, Poel H, Wickham TJ, Lamfers M, Gerritsen W, Chowdhury W, Li Y, Schoenberg MP and Rodriguez R (2004) Histone deacetylase inhibitors upregulate expression of the coxsackie adenovirus receptor (CAR) preferentially in bladder cancer cells. Cancer Gene Ther 11, 477-86. Sachs MD, Rauen KA, Ramamurthy M, Dodson JL, De Marzo AM, Putzi MJ, Schoenberg MP and Rodriguez R (2002) Integrin #(v) and coxsackie adenovirus receptor expression in clinical bladder cancer. Urology 60, 531-6. Saika T, Satoh T, Kusaka N, Ebara S, Mouraviev VB, Timme TL and Thompson TC (2004) Route of administration influences the antitumor effects of bone marrow-derived dendritic cells engineered to produce interleukin-12 in a metastatic mouse prostate cancer model. Cancer Gene Ther 11, 317-24. Sakurai F, Mizuguchi H, Yamaguchi T and Hayakawa T (2003) Characterization of in vitro and in vivo gene transfer properties of adenovirus serotype 35 vector. Mol Ther 8, 813-21. Sanchez-Prieto R, Quintanilla M, Cano A, Leonart ML, Martin P, Anaya A and Ramon y Cajal S (1996) Carcinoma cell lines become sensitive to DNA-damaging agents by the expression of the adenovirus E1A gene. Oncogene, 13, 1083-92. Sanford MA, Yan Y, Canfield SE, Hassan W, Selleck WA, Atkinson G, Chen SH and Hall SJ (2001) Independent contributions of GR-1+ leukocytes and Fas/FasL interactions to induce apoptosis following interleukin-12 Gene Therapy in a metastatic model of prostate cancer. Hum Gene Ther 12, 1485-98. Santis G, Legrand V, Hong SS, Davison E, Kirby I, Imler JL, Finberg RW, Bergelson JM, Mehtali M and Boulanger P (1999) Molecular determinants of adenovirus serotype 5 fibre binding to its cellular receptor CAR. J Gen Virol 80 (Pt 6), 1519-27. Sasaki R, Shirakawa T, Zhang ZJ, Tamekane A, Matsumoto A, Sugimura K, Matsuo M, Kamidono S and Gotoh A (2001) Additional Gene Therapy with Ad5CMV-p53 enhanced the efficacy of radiotherapy in human prostate cancer cells. Int J Radiat Oncol Biol Phys, 51, 1336-45. Satoh T, Saika T, Ebara S, Kusaka N, Timme TL, Yang G, Wang J, Mouraviev V, Cao G, Fattah el MA and Thompson TC (2003) Macrophages transduced with an adenoviral vector expressing interleukin 12 suppress tumor growth and metastasis in a preclinical metastatic prostate cancer model. Cancer Res 63, 7853-60. Satoh T, Teh BS, Timme TL, Mai WY, Gdor Y, Kusaka N, Fujita T, Pramudji CK, Vlachaki MT, Ayala G, Wheeler T, Amato R, Miles BJ, Kadmon D, Butler EB and Thompson TC ( 2004) Enhanced systemic T-cell activation after in situ Gene Therapy with radiotherapy in prostate cancer patients. Int J Radiat Oncol Biol Phys, 59, 562-71. Schmid HP, McNeal JE and Stamey TA (1993) Clinical observations on the doubling time of prostate cancer. Eur Urol 23 Suppl 2, 60-3. Shalev M, Kadmon D, Teh BS, Butler EB, Aguilar-Cordova E, Thompson TC, Herman JR, Adler HL, Scardino PT and Miles BJ (2000) Suicide Gene Therapy toxicity after multiple and repeat injections in patients with localized prostate cancer. J Urol 163, 1747-50. Shenk TE (2001) Adenoviridae: The Viruses and their Replication, in Fields Virology B, F., P, H. and D, K.,

282

Cancer Therapy Vol 3, page 283 Editors. Lippincott Williams and Wilkens New York, 22652300. Smalley SR, Kimler BF and Evans RG (1991) 5-Fluorouracil modulation of radiosensitivity in cultured human carcinoma cells. Int J Radiat Oncol Biol Phys, 20, 207-11. Smith R, Huebner R, Rowe W, Schatten W and Thomas L (1956) Studies on the use of viruses in the treatment of carcinoma of the cervix. Cancer 9, 1211-1218. Smith TA, Idamakanti N, Marshall-Neff J, Rollence ML, Wright P, Kaloss M, King L, Mech C, Dinges L, Iverson WO, Sherer AD, Markovits JE, Lyons RM, Kaleko M and Stevenson SC (2003) Receptor interactions involved in adenoviral-mediated gene delivery after systemic administration in non-human primates. Hum Gene Ther 14, 1595-604. Song K, Li Z, Seth P, Cowan KH and Sinha BK (1997) Sensitization of cis-platinum by a recombinant adenovirus vector expressing wild-type p53 gene in human ovarian carcinomas. Oncol Res 9, 603-9. Steiner MS, Zhang X, Wang Y and Lu Y (2000) Growth inhibition of prostate cancer by an adenovirus expressing a novel tumor suppressor gene, pHyde. Cancer Res 60, 441925. Steiner MS, Zhang Y, Farooq F, Lerner J, Wang Y and Lu Y (2000) Adenoviral vector containing wild-type p16 suppresses prostate cancer growth and prolongs survival by inducing cell senescence. Cancer Gene Ther 7, 360-72. Stracker TH, Carson CT and Weitzman MD (2002) Adenovirus oncoproteins inactivate the Mre11-Rad50-NBS1 DNA repair complex. Nature, 418, 348-52. Sukin SW, Chhikara M, Zhu X, Ayala G, Aguilar LK, O'Brian Smith E, Miles BJ, Thompson TC, Kadmon D and AguilarCordova E (2001) In vivo surgical resection plus adjuvant Gene Therapy in the treatment of mammary and prostate cancer. Mol Ther 3, 500-6. Sweeney P and Pisters LL (2000) Ad5CMVp53 Gene Therapy for locally advanced prostate cancer--where do we stand? World J Urol 18, 121-4. Tanaka M and Grossman HB (2004) Connexin 26 induces growth suppression, apoptosis and increased efficacy of doxorubicin in prostate cancer cells. Oncol Rep, 11, 537-41. Teh BS, Aguilar-Cordova E, Kernen K, Chou CC, Shalev M, Vlachaki MT, Miles B, Kadmon D, Mai WY, Caillouet J, Davis M, Ayala G, Wheeler T, Brady J, Carpenter LS, Lu HH, Chiu JK, Woo SY, Thompson T and Butler EB (2001) Phase I/II trial evaluating combined radiotherapy and in situ Gene Therapy with or without hormonal therapy in the treatment of prostate cancer--a preliminary report. Int J Radiat Oncol Biol Phys, 51, 605-13. Teh BS, Aguilar-Cordova E, Vlachaki MT, Aguilar L, Mai WY, Caillouet J, Davis M, Miles B, Kadmon D, Ayala G, Lu HH, Chiu JK, Carpenter LS, Woo SY, Grant WH, 3rd Wheeler T, Thompson TC and Butler EB (2002) Combining radiotherapy with Gene Therapy (from the bench to the bedside): a novel treatment strategy for prostate cancer. Oncologist, 7, 458-66. Teh BS, Ayala G, Aguilar L, Mai WY, Timme TL, Vlachaki MT, Miles B, Kadmon D, Wheeler T, Caillouet J, Davis M, Carpenter LS, Lu HH, Chiu JK, Woo SY, Thompson T, Aguilar-Cordova E and Butler EB (2004) Phase I-II trial evaluating combined intensity-modulated radiotherapy and in situ Gene Therapy with or without hormonal therapy in treatment of prostate cancer-interim report on PSA response and biopsy data. Int J Radiat Oncol Biol Phys, 58, 1520-9. Tomko RP, Xu R and Philipson L (1997) HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proc Natl Acad Sci U S A, 94, 3352-6.

Trudel S, Trachtenberg J, Toi A, Sweet J, Li ZH, Jewett M, Tshilias J, Zhuang LH, Hitt M, Wan Y, Gauldie J, Graham FL, Dancey J and Stewart AK (2003) A phase I trial of adenovector-mediated delivery of interleukin-2 (AdIL-2) in high-risk localized prostate cancer. Cancer Gene Ther 10, 755-63. van der Poel HG, McCadden J, Verhaegh GW, Kruszewski M, Ferrer F, Schalken JA, Carducci M and Rodriguez R (2001) A novel method for the determination of basal gene expression of tissue-specific promoters: an analysis of prostate-specific promoters. Cancer Gene Ther 8, 927-35. van der Poel HG, Molenaar B, van Beusechem VW, Haisma HJ, Rodriguez R, Curiel DT and Gerritsen WR (2002) Epidermal growth factor receptor targeting of replication competent adenovirus enhances cytotoxicity in bladder cancer. J Urol 168, 266-72. Van Doren K, Hanahan D and Gluzman Y (1984) Infection of eucaryotic cells by helper-independent recombinant adenoviruses: early region 1 is not obligatory for integration of viral DNA. J Virol 50, 606-14. Vigne E, Mahfouz I, Dedieu JF, Brie A, Perricaudet M and Yeh P (1999) RGD inclusion in the hexon monomer provides adenovirus type 5-based vectors with a fiber knobindependent pathway for infection. J Virol 73, 5156-61. Visakorpi T, Kallioniemi OP, Paronen IY, Isola JJ, Heikkinen AI and Koivula TA (1991) Flow cytometric analysis of DNA ploidy and S-phase fraction from prostatic carcinomas: implications for prognosis and response to endocrine therapy. Br J Cancer 64, 578-82. Waldman T, Zhang Y, Dillehay L, Yu J, Kinzler K, Vogelstein B and Williams J (1997) Cell-cycle arrest versus cell death in cancer therapy. Nat Med 3, 1034-6. Watkins SJ, Mesyanzhinov VV, Kurochkina LP and Hawkins RE (1997) The 'adenobody' approach to viral targeting: specific and enhanced adenoviral gene delivery. Gene Ther 4, 100412. Wickham TJ (2003) Ligand-directed targeting of genes to the site of disease. Nat Med 9, 135-9. Wickham TJ, Mathias P, Cheresh DA and Nemerow GR (1993) Integrins # v "3 and #v "5 promote adenovirus internalization but not virus attachment. Cell, 73, 309-19. Wickham TJ, Roelvink PW, Brough DE and Kovesdi I (1996) Adenovirus targeted to heparan-containing receptors increases its gene delivery efficiency to multiple cell types. Nat Biotechnol, 14, 1570-3. Wickham TJ, Segal DM, Roelvink PW, Carrion ME, Lizonova A, Lee GM and Kovesdi I (1996) Targeted adenovirus gene transfer to endothelial and smooth muscle cells by using bispecific antibodies. J Virol 70, 6831-8. Wickham TJ, Tzeng E, Shears LL, 2nd Roelvink PW, Li Y, Lee GM, Brough DE, Lizonova A and Kovesdi I (1997) Increased in vitro and in vivo gene transfer by adenovirus vectors containing chimeric fiber proteins. J Virol 71, 82219. Wilding G, Carducci M, Yu D, Burke J, Borellini F, Aimi J, Working P, Ando D, Kirn D and Small E (2004) A Phase I/II trial of IV CG7870, a replication-selective, PSA-targeted oncolytic adenovirus (OAV), for the treatment of hormonerefractory, metastatic prostate cancer. J Clin Oncol 2004 ASCO Annual Meeting Proceedings, 22, 3036. Wildner O, Blaese RM and Morris JC (1999) Synergy between the herpes simplex virus tk/ganciclovir prodrug suicide system and the topoisomerase I inhibitor topotecan. Hum Gene Ther 10, 2679-87. Wood M, Perrotte P, Onishi E, Harper ME, Dinney C, Pagliaro L and Wilson DR (1999) Biodistribution of an adenoviral vector carrying the luciferase reporter gene following

283

Lupold and Rodriguez: Prostate cancer gene therapy intravesical or intravenous administration to a mouse. Cancer Gene Ther 6, 367-72. Work LM, Ritchie N, Nicklin SA, Reynolds PN and Baker AH (2004) Dual targeting of gene delivery by genetic modification of adenovirus serotype 5 fibers and cellselective transcriptional control. Gene Ther 11, 1296-300. Wu E, Pache L, Von Seggern DJ, Mullen TM, Mikyas Y, Stewart PL and Nemerow GR (2003) Flexibility of the adenovirus fiber is required for efficient receptor interaction. J Virol 77, 7225-35. Xia D, Henry LJ, Gerard RD and Deisenhofer J (1994) Crystal structure of the receptor-binding domain of adenovirus type 5 fiber protein at 1.7 A resolution. Structure 2, 1259-70. Xie X, Zhao X, Liu Y, Zhang J, Matusik RJ, Slawin KM and Spencer DM (2001) Adenovirus-mediated tissue-targeted expression of a caspase-9-based artificial death switch for the treatment of prostate cancer. Cancer Res 61, 6795-804. Xu LL, Su YP, Labiche R, Segawa T, Shanmugam N, McLeod DG, Moul JW and Srivastava S (2001) Quantitative expression profile of androgen-regulated genes in prostate cancer cells and identification of prostate-specific genes. Int J Cancer 92, 322-8. Yang C, Cirielli C, Capogrossi MC and Passaniti A (1995) Adenovirus-mediated wild-type p53 expression induces

apoptosis and suppresses tumorigenesis of prostatic tumor cells. Cancer Res 55, 4210-3. You L, Yang CT and Jablons DM (2000) ONYX-015 works synergistically with chemotherapy in lung cancer cell lines and primary cultures freshly made from lung cancer patients. Cancer Res 60, 1009-13. Yu DC, Chen Y, Dilley J, Li Y, Embry M, Zhang H, Nguyen N, Amin P, Oh J and Henderson DR (2001) Antitumor synergy of CV787, a prostate cancer-specific adenovirus, and paclitaxel and docetaxel. Cancer Res 61, 517-25. Yu DC, Chen Y, Seng M, Dilley J and Henderson DR (1999) The addition of adenovirus type 5 region E3 enables calydon virus 787 to eliminate distant prostate tumor xenografts. Cancer Res 59, 4200-3. Yu DC, Sakamoto GT and Henderson DR (1999) Identification of the transcriptional regulatory sequences of human kallikrein 2 and their use in the construction of calydon virus 764, an attenuated replication competent adenovirus for prostate cancer therapy. Cancer Res 59, 1498-504. Zeng M, Cerniglia GJ, Eck SL and Stevens CW (1997) Highefficiency stable gene transfer of adenovirus into mammalian cells using ionizing radiation. Hum Gene Ther 8, 1025-32.

Shawn E. Lupold

Ronald Rodriguez

284

Cancer Therapy Vol 3, page 285 Cancer Therapy Vol 3, 285-292, 2005

AML1-MTG16 gene rearrangement in a pediatric therapy related AML after Ewing sarcoma: a case discussion and review of literature Case Report

Emanuela Frascella1, Claudia Zampieron1, Laura Sainati1, Letizia Casula2, Francesco Pasquali3, Rossella Mura2, Emanuela Maserati3, Martina Pigazzi1, Monica Spinelli1, Silvia DisarĂ˛1, Pier Francesco Biddau2, Giuseppe Basso1 1

Pediatric Hematology-Oncology Unit, University of Padova; Microcitemie Hospital Cagliari; 3 Biologia e Genetica, DSBSC, University of Insubria, Varese. 2

__________________________________________________________________________________ *Correspondence: Emanuela Frascella, MD, PhD, Pediatric Hematology-Oncology Unit, Department of Pediatrics, University of Padova, via Giustiniani 3, 35128 Padova, Italy; Tel: +39-0498211455; Fax: +39-0498211462; e-mail: emanuela.frascella@unipd.it Key words: AML1-MTG16 gene, AML, pediatric therapy, Ewing sarcoma, Morphological evaluation, Immunophenotypic analyses, Cytogenetic analysis, FISH analysis, RT-PCR assay, Sequencing and Genescan Abbreviations: Bone marrow, (BM); complete remission, (CR); monoclonal antibodies, (MoAbs); peripheral blood (PB); radiotherapy, (RT); Therapy-related Acute Myelogenous Leukaemia, (t-AML) Received: 1 April 2005; Accepted: 08 April 2005; electronically published: April 2005

Summary Therapy-related Acute Myelogenous Leukaemia (t-AML) carrying a 21q22 rearrangement accounts for about 15% among t-AML with balanced chromosome translocation. In this group t(16;21)(q24;q22) is very rare and even more so in children. In fact, review of the literature shows few reports of t-AML with t(16;21)(q24;q22) and until now only one pediatric case occurring after acute promyelocytic leukaemia has been reported. Here we report the second case of pediatric t-AML with AML1-MTG16 gene rearrangement in a 14-year-old boy after treatment for a Ewingâ&#x20AC;&#x2122;s sarcoma with cyclophosphamide, doxorubicin, etoposide, vincristine, ifosfamide, and radiotherapy. To treat t-AML the patient received a modified BFM-98 protocol due to a concomitant cardiomyopaty. Morphological complete remission (CR) was achieved after induction therapy. Due to a fungal infection chemotherapy was reduced and then discontinued. The child, in complete remission for both cancers, died 14 months after AML diagnosis from multi-organ-failure. The clinical, biological and molecular features of the 11 known cases of t(16;21) positive AML are discussed. of the long arm of chromosome 5 and 7 (PedersenBjergaard et al, 2002; Rowley and Olney 2002). In the second group, t-AML occurrs after therapy with topoisomerase II inhibitors: these may be differentiated from other t-AML by some typical features such as balanced translocations involving the MLL or AML1 genes, a short latency period and lack of a myelodysplastic phase (Andersen et al, 1998; Pui and Relling, 2000; Felix, 2001; Slovak et al, 2002). Most patients receive multidrug regimens frequently including radiotherapy (RT) and although it is difficult to correlate specific chromosome aberrations with specific prior therapy, there are data suggesting that MLL gene rearrangements predominate in patients treated with epipodophyllotoxins, while balanced translocations involving chromosome band 21q22 are

I. Introduction The estimated risk of developing leukaemia in survivors of childhood Ewing sarcoma is about 2%. AML is the most common secondary malignancy, but also acute lymphoblastic leukaemia and chronic myelogenous leukaemia have been reported (Snyder et al, 2005; Numata et al 2002). Therapy-related Acute Myelogenous Leukaemia (t-AML), constitute approximately 5-10% of all AML and is the most serious, long term complication of cancer chemotherapy, especially in children (Leone et al, 1999). Two main groups of t-AML can be distinguished. The first includes t-AML arising after therapy with alkylating agents that characteristically present a preleukemic phase with trilineage dysplasia and cytogenetic abnormalities involving the loss of all or part 285

Frascella et al: AML1-MTG16 translocation in pediatric t-AML according to the International System of Human Cytogenetic Nomenclature.

related to therapy with anthracyclines (Quesnel et al, 1993; Andersen et al, 1998; Pui and Relling, 2000; Felix, 2001; Slovak et al, 2002). In this latter group t(16;21)(q24;q22) is one of the most common translocations observed (Quesnel et al, 1993; Sakugawa, 2001; Slovak et al, 2002). In this translocation AML1 is juxtaposed to MTG16, a gene that shows high homology with ETO, and the AML1-MTG16 fusion transcript shares several common structural features with AML1-ETO, including the presence of the AML1 DNA binding domain and the four conserved motifs of dimerization and corepressor recruiment of MTG genes (Gamou et al, 1998; Hoogeveen et al, 2002). Here we report one case of pediatric t-AML with AML1-MTG16 gene rearrangement and a review of the literature.

E. FISH analysis FISH analysis was performed with libraries for the whole painting of chromosomes 8, 16, and 21 (Cambio, Cambridge, UK), according to standard procedures and to the manufacturer's instructions.

F. RT-PCR assay Total RNA was isolated using the RNAzol-B reagent (TEL-TEST INC, Duotech, Milan, Italy) and 2 Âľg of total RNA were reverse transcribed using the Superscript reverse transcriptase (Invitrogen, Milan, Italy) and random hexamers. PCR amplification to identify AML1-ETO and CBF"MYH11 chimeric transcripts was performed using Amplitaq polymerase (Applied Biosystem, Monza, Italy) according to the BIOMED-1 protocol (van Dongen et al, 1999). RT-PCR to identify FLT3 aberration was performed as previously described (Nakao et al, 1996). We set-up an RT-PCR assay with specific MTG16 primers to identify the AML1-MTG16 transcript in order to monitor the minimal residual disease during treatment. Reverse primers MTG16-B (GGCCATTGCTGAAGCCGTT) and MTG16-D (GGTGCACCATTGATGGCTGTT), located between nt.594-612 and nt.563-583 of the published MTG16 germline sequence AB010419, respectively, were used with AML1-A and AML1-C primers in the first and second round of PCR analysis, respectively, according to the BIOMED-1 protocol. Sensitivity of reactions was 10-3/10-5 for single step analysis and 10-4/10-5 for nested PCR A positive control, a negative control and a sample without nucleic acid were included in each assay to verify analysis quality and absence of cross contamination. The expression of the housekeeping gene, ABL, was assessed to determine the presence of amplifiable RNA and the efficacy of reverse transcription. PCR reaction products were electrophoresed by 2% agarose gel and stained with ethidium bromide.

II. Materials and Methods A. Samples Bone marrow (BM) and peripheral blood (PB) samples, obtained after informed consent, were centralized at diagnosis and during treatment phase in the reference laboratory at the University of Padua. Nucleated cells were isolated by the FicollHypaque technique.

B. Morphological evaluation Morphological evaluation was performed on bone marrow smears after painting with Wright-Giemsa, Peroxidase and !naphtyl-acetate-esterase (Figure 1).

C. Immunophenotypic analyses Immunophenotypic analyses was made by flow-cytometry using a direct immunofluorescence technique with four-color combinations of monoclonal antibodies (MoAbs) (Basso et al, 2001). The MoAbs used were: CD45, CD13, CD33, HLA-DR, CD34, CD56, CD117, CD19, CD2, CD7, CD10, CD20.

G. Sequencing and Genescan

D. Cytogenetic analysis

PCR products was directly sequenced by thermal cycling with BigDye# Terminator mix (Applied Biosystem), using

BM samples were processed by standard methods. Cytogenetic analysis was performed using a QFQ banding technique and 24 mitoses were scored (400 band level resolution). Chromosomal abnormalities were described

Figure 1. Left panel: bone marrow aspirate, Wright-Giemsa, x 1,000. Blast cells with monocytoid differentiation: cells are large sized with irregular nuclei and greyish cytoplasm mostly devoid of granules. Right panel: bone marrow aspirate, !-naphtyl-acetate-esterase, x 1,000. Blast cells show positive reaction after !-naphtyl-acetate-esterase staining.

286

Cancer Therapy Vol 3, page 287 manufacturer’s instructions. Sequencing products reactions were analyzed by automated sequencer ABI Prism 310 Genetic Analyzer (Applied Biosystems).

of M5a FAB-subtype with associated dysplasia was made. On flow cytometric analysis blasts presented atypical expression of CD45 and intermediate side scatter expression of CD34, CD13, CD33, HLA-DR, weak expression of CD19. A complex karyotype was found by standard cytogenetic examination in 23/24 cells scored, while trisomy 8 was present in one: 47, XY, add(4)(q35), +8, add(16)(q24)[23]/ 47,XY, +8[1]. FISH was used to better define the anomalies found: a whole chromosome painting (wcp) for chromosome 8 confirmed the trisomy and showed that no material of chromosome 8 was transposed elsewhere, while wcp for chromosome 16 failed to reveal material of chromosome 16 translocated elsewhere, but showed that material of another chromosome was present in the add(16). The presence of this complex karyotype, in which no recurrent change was evident and the long arms of chromosome 16 were involved, prompted a molecular analysis o identify the rearrangement at gene level. RT-PCR to identify AML1ETO and CBF"-MYH11 chimeric transcripts and FLT3 aberration was performed as previously described (Nakao et al, 1996; van Dongen et al, 1999). Molecular study of FLT3 showed both lack of internal tandem duplication and point mutation, while a product of 256 bp, smaller than expected, was found after the reaction with primers A and B to identify the AML1-ETO chimeric transcript (Figure 2). Nucleotide sequence analysis of PCR products by ABIprism 3700 allowed recognition of an AML1-MTG16 type-1 chimeric transcript (Figure 3). Wcp for chromosome 21 was then performed and the material transposed to the abnormal chromosome 16 was confirmed to be from chromosome 21. Subsequently we set-up an RT-PCR assay with specific MTG16 primers to identify the AML1-MTG16 transcript in order to monitor the minimal residual disease during treatment. The molecular study was performed on bone marrow at 2, 7, 9, and 13 months after diagnosis by a semiquantitative method and demonstrated a progressive decrease of the transcript with molecular remission achieved 1 year after diagnosis (Figure 4). Peripheral blood study was performed at 7, 8,

III. Case report and discussion A 10-year-old male was admitted in April 1998 for swelling of the 6th left rib. Histology revealed small undifferentiated cells of a Ewing’s sarcoma. The patient was classified as high risk due to tumor volume of more than 100 milliliter and thoracic neoplastic effusion. The child was treated by multiagent chemotherapy and, after the first course, he received surgical resection of the bone residual mass, but residual tumor tissue remained on pericardium. Pathologic examination demonstrated partial necrosis of the excised cancer. The child received radiotherapy on his left hemithorax (46 Gy plus a boost of 9.2 Gy on the tumor site) plus chemotherapy achieving complete remission. He stopped therapy one year after diagnosis. Cumulative doses of chemotherapy delivered were cyclophosphamide 16,000 mg/m2, doxorubicin 420 mg/m2, etoposide 2,700 mg/m2, vincristine 8.5 mg/m2, and ifosfamide 27,000 mg/m2. Two years later he developed a secondary cardiomyopathy. Four years after the first neoplasm, a pancytopenia was found and t-AML was diagnosed. Due to the cardiomyopathy, the patient received a modified BFM-98 protocol using liposomial Daunorubicin, instead of Idarubicin, and with reduced doses of AraC and Mitoxantrone. Morphological CR was achieved after the induction therapy. Due to a fungal infection, therapy was reduced and then discontinued. The child, in complete remission for both cancers, died 14 months after AML diagnosis from multi-organ-failure. Cells at diagnosis were collected from bone marrow and peripheral blood and studied by morphology, flowcytometry, conventional cytogenetics, and molecular genetics. Bone marrow aspirate smears revealed the presence of 80% blasts cell myeloperoxidase and !naphtyl-esterase positive. Residual normal myeloid and erythroid precursors showed dysplastic features. Based on morphological and cytochemical evaluations, a diagnosis

Figure 2. RT-PCR to detect AML1-ETO fusion transcript using BIOMED-1 protocol. Panel A. Primers: forward AML1-A, reverse ETO-B; lane 1 positive control, lane 2 negative control, lane 3 sample, lane 4 H2O. Panel B. Primers: forward AML1-E5’, reverse ETOD; lane 1 positive control, lane 2 sample. Panel C. primers: forward AML1-E5’, reverse ETO-B; lane 1 sample, lane 2 positive control. Homology between ETO and MTG16 sequence in the region in which ETO-B reverse primer is located is shown. Nucleotide without homology are marked in bold. Gene bank accession number is in bracket.

287

Frascella et al: AML1-MTG16 translocation in pediatric t-AML

Figure 3. Sequence of PCR products obtained after amplification with primer forward AML1-A and reverse ETO-B (Figure 1, lane 3). Data base reference per gene: AML1 accession number D43969; MTG16 accession number AB010419. MTG16 nucleotides are in bold.

Figure 4. Minimal residual disease study by RT-PCR on bone marrow sample. To evaluate sensitivity of the assay we used the diagnostic bone marrow patient sample diluted with RNA from a negative sample. In the upper panel the graph shows the progressive clearance of blast cell in bone marrow samples during therapy. In the lower panel the result of a RT-PCR assay is shown.

9, 10, 11 and 13 months and was always negative. Secondary acute leukaemia carrying a 21q22 translocation accounts for about 15% among t-AML with balanced translocations. About half of primary neoplasms are solid tumours, breast cancer being the most frequent. The median latency from the time of first diagnosis is intermediate compared with other subgroups, but significantly longer than that of t-AML carrying 11q23

rearrangements. The most common translocations observed are t(8;21)(q22;q22), t(3;21)(q26.2;q22) and t(16;21)(q24;q22), observed in 56%, 20% and 5% of case, respectively, although many other chromosomes may be involved (Quesnel et al, 1993; Sakugawa et al, 2001; Slovak et al, 2002). The translocation t(16;21)(q24;q22) is rare in children and our case is the second reporting childhood t-AML carrying AML1-MTG16 gene 288

Cancer Therapy Vol 3, page 289 rearrangement. Until now, 10 cases of t(16;21)(q24;q22) positive AML with AML1-MTG16 rearrangement have been reported and only 2 of these were de novo AML (Raimondi et al, 1989; Berger et al, 1996; Shimada et al, 1997; Takeda et al, 1998; Salomon-Nguyen et al, 2000; La

Starza et al, 2001). Table 1 summarizes the clinical and biological features of the 11 available patients, including the present one. Females are 8 of 11 cases, the median age was 42 years and children were 3 out of 11. Nine patients had secondary leukaemia: primary disease was more

Table 1. Patientâ&#x20AC;&#x2122;s clinical-biological features Sex Age F

<15

First Cancer

therapy

latency

Diagn.

Phenotype

MDS M1

MDS M2

Lung ca.

VP16/Car bo

Carbo/T/ Oviduct Doxo/CP al ca. M

VP16/M/ T-NLH CPM

Breast ca.

RT/M/CP M/ 5F/VCR RT/CPM/ M/ TAM/5F/ VCR

Breast ca.

T-NLH

Breast ca.

APL

Ewing M

sarcom a

CHOP/ RT RT/ Mtx/ My/ M/5F/VP 16/ Cis/CPM ATRA/A raC/DNR /M/P/ VP16/Bu/ Mel CPM, /Doxo/ VP16/VC R/IFO RT

MDS-M2

Karyotipe/ type of transcript by RT-PCR t(16;21)(q24;q22) RT-PCR not done

Response to therapy/Outcome

CD13, CD34, HLADR pos. CD14, CD33 and lymphoid marker neg,

46, XY, t(16;21)(q24;q22) Type 2

Dead 12 months after for mycotic pneumonia

47, XX, +8, t(16;21)(q24;q22) Type 1

Non-responder Dead 8 months after for leukaemia

CD13, HLA-DR pos.

CD13, CD33, HLADR pos.

46, XX, add(7)(q3 ?), t(16;21)(q24;q22)/46, XX, idem, del(13)(q ?)/46, XX, idem, del(1)(q?) Type 1 46, XX, del(7)(q22), t(16;21)(q24;q22) [12]/ 46, XX, del(7)(q3?2), t(16;21)(q24;q22) [12]/ Type 1

CR/ AML relapse. Dead 12 months after for pneumonia

Raimon di et al, 1989 Shimad a, 1997; Gamou, 1998 Shimad a, 1997; Gamou, 1998 Shimad a, 1997; Gamou, 1998

CR/ Alive in CR 12 months +

Takeda, 1998; Gamou, 1998

CR / Alive in CR (ABMT) 30 months +

Salomo nNguyen , 2000

CD34, CD56 pos. lymphoid markers neg.

MDS M2

CD13, CD117 pos. Lymphoid markers neg.

1, 8 y

MDS M2

CD19, CD13, CD34, HLA-DR pos. CD2, CD33 neg.

46, XY, add(12)(p13), t(16;21)(q24;q22) Type 1

CR / AML Relapse, Kondoh ABMT and CR for , 2002 20 months

CD13, CD34, CD33, HLA-DR pos., CD19 weakly pos., CD117, CD56, lymphoid markers neg.

47, XY, add(4)(q35)+8, add(16)(q24)[23]/ 47, XY, +8 [1] Type 1

CR / Died in CR 14 months after for multiorgan failure

47, XX, +8, t(16;21)(q24;q22) Type 1

Ref

CR for AML / Salomo Uterine adenoc. 18 nmonths after AML. Nguyen Dead from breast , 2000 cancer metastases. 47, XX, +8, del(21)q(22) Induction death Berger, RT-PCR not done (sepsis) 1996 46, XX, t(16;21)(q24;q22)/ Dead 1 month after La AML (no Starza, 47, XX, +8, t(16;21)(q24;q22) treatment) 2001 RT-PCR not done 47, XX, +8, t(16;21)(q24;q22) Type 1

Present

AraC=Cytarabine, ATRA, = Trans-retinoic Acid, Bu=Busulfan, Carbo=carboplatin, Cis=cisplatin, CHOP=Cyclophosphamide + Doxorubicin +VCR + PND, CPM=Cyclophosphamide, DNR=Daunorubicin, Doxo=Doxorubicin, 5F=5-Fluorouracil, M=Mitoxantrone, Mel=Melphalan, Mtx=Metotrexate, My=Mytomicin, P=Pirarubicin, PND=Prednisone, RT=Radiotherapy, T=Togafur, TAM=Tamoxifen, VCR=Vincristine, VP16=Etoposide

frequently a solid tumour, especially breast cancer (3 cases), and the median interval between first cancer

diagnosis and t-AML was 3 years (range 1-9), as in other 21q22 rearranged t-AML. All patients received 289

Frascella et al: AML1-MTG16 translocation in pediatric t-AML topoisomerase II inhibitors, more often anthracyclines than epipodophyllotoxins (8 out of 9 and 5 out of 9, respectively) and, frequently, both of them. Nevertheless, they were also treated with multiagent regimens, including alkylating agents and platinum compounds, that can produce cumulative DNA damage and potentiate the leukemogenic effects of both anthracyclines and epipodophyllotoxins. All previous published cases were morphologically classified as FAB M1 or M2 while the present case was classified as M5a and monocytic lineage of blast cell was confirmed by morphological evaluation and immunohistochemical !-naphtyl-acetate reactivity. The FAB-M2 subtype accounts for 7 out 11 cases; however, these cases did not show the morphological features that characterize AML1-ETO positive AML (Kondoh et al, 2002). A myelodysplastic phase was observed in about a half of the cases (5/11). The immunophenotype showed a frequent expression of CD13, CD34 and HLA-DR, similar to AML1-ETO positive AML, inconstant positivity for CD33, occasional positivity for CD117. It is worth noting that CD56 and CD19, which characterize AML1-ETO positive AML, were only sporadically positive. A karyotype with also additional chromosome anomalies characterized t(16;21) t-AML, but not de novo cases. The most common of these changes was trisomy 8, while, unlike t(8;21) AML, the loss of a sex chromosome was never observed (Slovak et al, 2002). Chromosome 7 abnormalities were found in 2 cases who had also received alkylating agents. In all the cases studied at a molecular level, AML1 breakpoint always occurred between exons 5 and 6, as in AML1-ETO gene rearrangement, while, with regard to MTG16, it is noteworthy that all t-AML had breaks between exons 3 and 4, while the breakpoint in de novo AML cases was mapped between exons 1 and 2. All the cases from the literature were identified by cytogenetic examination, while our case, with a complex karyotype, was fully recognized only using a molecular analysis. Therefore, we can not rule out that, in a proportion of cases, this gene rearrangement may be cryptic and undetectable using conventional cytogenetic techniques. Thus, a screening by specific RT-PCR assay to detect AML1-MTG16 fusion gene, could be useful to evaluate the true incidence of this gene rearrangement among secondary AML and MDS. Information concerning FLT3 were available only in our case, who did not show any alteration. However, FLT3 internal tandem duplication and mutation are uncommon in t-AML and, among de novo AML, are unusual in 21q22 rearranged de novo AML (Arber et al, 2002). In summary, t(16;21) positive cases showed some peculiar features among t-AML with 21q22 rearrangements: there is a prevalence of females; blast cells do not show cytological features typical of de novo t(8;21) AML; all cases show a complex karyotype: trisomy 8 is the most common associated abnormality, while loss of a sex chromosome was never reported. On the contrary, some features, such as latency between first and second cancer, AML1 breakpoint, morphological features of dysplasia in residual normal cells and solid tumours, especially breast cancer, as first neoplasm, are

similar to t(8;21) t-AML. Finally, it is well known that secondary leukaemia is difficult to cure and, in general, the prognosis of t-AML occurring after topoisomerase II inhibitor treatment is poor. A large amount of data suggests that cytogenetics is an important prognostic factor also in t-AML and the subgroup carrying 21q22 balanced translocations seems to have a better outcome than t-AML with MLL rearrangement. Indeed, although remission induction response is about 80% in both groups, remission in t-AML with 11q23 abnormalities is usually of short duration. Among t-AML with 21q22 rearrangement, treatment response and survival seems to depend on the translocation partner and t(8;21) cases have the most favourable prognosis (Slovak et al, 2002; Kern et al, 2004; Schoch et al, 2004; Side et al, 2004). Due to the similarity of structure and sequence between AML1-MTG16 and AML1-ETO chimeric transcript, it would be possible to speculate that AML1-MTG16 positive AML could be sensitive to chemotherapy as well. In the series of t(16;21) t-AML available, 8 patients received chemotherapy: one died during induction, one had resistant disease and 6 (75% of cases) achieved CR. Among these 6 patients 2 relapsed, 2 were alive in first CR when were reported, and 2 died during CR for other causes. So, these patients seems to have a good and durable response to therapy, but toxicity is an important cause of death, hence a less aggressive therapeutic approach could be suggested. Furthermore, as intensive chemotherapy can not be delivered in many pre-treated patients, an evaluation of the response to treatment is particularly desirable in these patients and our RT-PCR assay could represent a useful tool to study the minimal residual disease in order to better modulate the therapy and to avoid unnecessary toxicity.

Acknowledgments We thank Dr C. Case for linguistic consultancy. This research was supported by Fondazione CittĂ della Speranza.

References Andersen MK, Johansson B, Larsen SO, Pedersen-Bjergaard J (1998) Chromosomal abnormalities in secondary MDS and AML. Relationship to drugs and radiation with specific emphasis on the balanced rearrangements. Haematologica 83, 483-488. Arber DA, Slovak ML, Popplewell L, Bedell V, Ikle D, Rowley JD (2002) International Workshop on Leukemia Karyotype and Prior Therapy. Therapy-related acute myeloid leukemia/myelodysplasia with balanced 21q22 translocations. Am J Clin Pathol 117, 306-313. Basso G, Buldini B, De Zen L, Orfao A (2001) New methodological approaches for immunophenotyping acute leukemias. Haematologica 86, 675-692 Berger R, Le Coniat M, Romana SP, Jonveaux P (1996) Secondary acute myeloblastic leukemia with t(16;21)(q24;q22). involving the AML1 gene. Hematol Cell Ther 38, 183-186. Felix CA (2001) Leukemias related to treatment with DNA topoisomerase II inhibitors. Med Pediatr Oncol 36, 525535.

290

Cancer Therapy Vol 3, page 291 Gamou T, Kitamura E, Hosoda F, Shimizu K, Shinohara K, Hayashi Y, Nagase T, Yokoyama Y, Ohki M (1998) The partner gene of AML1 in t(16;21) myeloid malignancies is a novel member of the MTG8(ETO) family. Blood 91, 40284037. Hoogeveen AT, Rossetti S, Stoyanova V, Schonkeren J, Fenaroli A, Schiaffonati L, van Unen L, Sacchi N (2002) The transcriptional corepressor MTG16a contains a novel nucleolar targeting sequence deranged in t (16;21)-positive myeloid malignancies. Oncogene 21, 6703-6712. Kern W, Haferlach T, Schnittger S, Hiddemann W, Schoch C (2004) Prognosis in therapy-related acute myeloid leukemia and impact of karyotype. J Clin Oncol. 22, 2510-2511. Kondoh K, Nakata Y, Furuta T, Hosoda F, Gamou T, Kurosawa Y, Kinoshita A, Ohki M, Tomita Y, Mori T (2002) A pediatric case of secondary leukemia associated with t(16;21)(q24;q22) exhibiting the chimeric AML1-MTG16 gene. Leuk Lymphoma 43, 415-420. La Starza R, Sambani C, Crescenzi B, Matteucci C, Martelli MF, Mecucci C (2001) AML1/MTG16 fusion gene from a t(16;21)(q24;q22) translocation in treatment-induced leukemia after breast cancer. Haematologica 86, 212-213. Leone G Mele L, Pulsoni A, Equitani F, Pagano L (1999) The incidence of secondary leukemias. Haematologica 84, 937945. Nakao M, Yokota S, Iwai T, Kaneko H, Horiike S, Kashima K, Sonoda Y, Fujimoto T, Misawa S (1996) Internal tandem duplication of the flt3 gene found in acute myeloid leukemia. Leukemia 10, 1911-1918. Numata A, Shimoda K, Gondo H, Kato K, Aoki K, Ito Y, Takase K, Asano Y, Okamura T, Niho Y, Harada M (2002) Therapyrelated chronic myelogenous lekaemia folloiwng autologous stem cell transplatation for Ewing's sarcoma. Br J Heameatol 117, 613-616 Pedersen-Bjergaard J, Christiansen DH, Nerlov C (2002) Genetic pathways in therapy-related myelodysplasia and acute myeloid leukemia. Blood 99, 1909-1912. Pui CH, Relling MV (2000) Topoisomerase II inhibitor-related acute myeloid leukaemia. Br J Haematol 109, 13-23. Quesnel B, Kantarjian H, Bjergaard JP, Brault P, Estey E, Lai JL, Tilly H, Stoppa AM, Archimbaud E, Harousseau JL, et al, (1993) Therapy-related acute myeloid leukemia with t(8;21), inv(16), and t(8;16): a report on 25 cases and review of the literature. J Clin Oncol 11, 2370-2379. Raimondi SC, Kalwinsky DK, Hayashi Y, Behm FG, Mirro J Jr, Williams DL (1989) Cytogenetics of childhood acute nonlymphocytic leukemia. Cancer Genet Cytogenet 40, 1327. Rowley JD, Olney HJ (2002) International workshop on the relationship of prior therapy to balanced chromosome aberrations in therapy-related myelodysplastic syndromes

and acute leukemia: overview report. Genes Chromosomes Cancer 33, 331-345. Sakugawa M Kojima K, Kaneda K, Masuda K, Dansako H, Shinagawa K, Ishimaru F, Ikeda K, Niiya K, Harada M, Tanimoto M (2001) Therapy-related myelodysplastic syndrome/acute myeloid leukemia M2 and translocation t(8;21). Ann Hematol 80, 763-766. Salomon-Nguyen F, Busson-Le Coniat M, Lafage Pochitaloff M, Mozziconacci J, Berger R, Bernard OA (2000) AML1MTG16 fusion gene in therapy-related acute leukemia with t(16;21)(q24;q22): two new cases. Leukemia 14, 1704-1705. Schoch C, Kern W, Schnittger S, Hiddemann W, Haferlach T (2004) Karyotype is an independent prognostic parameter in therapy-related acute myeloid leukemia (t-AML): an analysis of 93 patients with t-AML in comparison to 1091 patients with de novo AML. Leukemia. 18, 120-125. Shimada M, Ohtsuka E, Shimizu T, Matsumoto T, Matsushita K, Tanimoto F, Kajii T (1997) A recurrent translocation, t(16;21)(q24;q22), associated with acute myelogenous leukemia: identification by fluorescence in situ hybridization. Cancer Genet Cytogenet 96, 102-105. Side LE, Curtiss NP, Teel K, Kratz C, Wang PW, Larson RA, Le Beau MM, Shannon KM (2004) RAS, FLT3, and TP53 mutations in therapy-related myeloid malignancies with abnormalities of chromosomes 5 and 7. Genes Chromosomes Cancer. 39, 217-223. Slovak ML, Bedell V, Popplewell L, Arber DA, Schoch C, Slater R (2002) 21q22 balanced chromosome aberrations in therapy-related hematopoietic disorders: report from an international workshop. Genes Chromosomes Cancer 33, 379-394. Snyder DS, Stein AS, O'Donnell MR, Gaal K, Slovak ML, Forman SJ (2005) Philadelphia chromosome-positive acute lymphoblastic leukemia secondary to chemoradiotherapy for Ewing sarcoma. Report of two cases and concise review of the literature. Am J Hematol 78, 74-8. Takeda K, Shinohara K, Kameda N, Ariyoshi K (1998) A case of therapy-related acute myeloblastic leukemia with t(16;21)(q24;q22) after chemotherapy with DNAtopoisomerase II inhibitors, etoposide and mitoxantrone, and the alkylating agent, cyclophosphamide. Int J Hematol 67, 179-186. van Dongen JJ, Macintyre EA, Gabert JA, Delabesse E, Rossi V, Saglio G, Gottardi E, Rambaldi A, Dotti G, Griesinger F, Parreira A, Gameiro P, Diaz MG, Malec M, Langerak AW, San Miguel JF, Biondi A (1999) Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia 13, 1901-1928.

291

Frascella et al: AML1-MTG16 translocation in pediatric t-AML

Top row from left to right: Emanuela Frascella, Laura Sainati, Giuseppe Basso, Claudia Zampieron. Lower row from left to right: Francesco Pasquali, Monica Spinelli, Emanuela Maserati, Martina Pigazzi

292

Cancer Therapy Vol 3, page 293 Cancer Therapy Vol 3, 293-298, 2005

Placental site trophoblastic tumor Review Article

Nadereh Behtash*, Malihe Hasanzadeh Gynecology Oncology Department, Vali â&#x20AC;&#x201C;Asr Hospital, Tehran University of Medical Sciences, Keshavarz Blvd., Tehran 14194,Iran

__________________________________________________________________________________ *Correspondence: Nadereh Behtash, Associate Professor, Gynecologist Oncologist, Tehran University of Medical Sciences. Gynecology Oncology Department, Vali-e-Asr Hospital, Imam Khomeini Hospital Complex, Keshavarz Blvd., Tehran 14194, Iran. Phone: #98-21-6939320, Fax: #98-21-6937321, E-mail: valrec2@yahoo.com, nadbehtash@yahoo.com Key words: Placental site trophoblastic tumor, Tumor genesis, Pathology, Differential diagnosis, Imaging, Clinical features, prognostic factors Abbreviations: Epidermal growth factor receptor, (EGF-R); human chorionic gonadotropin, (HCG); human placental lactogen, (HPL); Placental site trophoblastic tumor, (PSTT); Pregnancy-associated major basic protein, (pMBP) Received: 24 January 2005; Revised: 1 March 2005 Accepted: 4 March 2005; electronically published: May 2005

Summary Placental site trophoblastic tumor (PSTT) is a rare neoplasm that arises from intermediate trophoblasts and shows diversity of biological behaviors, resulting in the absence of consistency in treatment modality. PSTT can occur after a normal pregnancy, spontaneous abortion, termination of pregnancy, ectopic or molar pregnancy. There is a wide clinical spectrum of presentation and behavior ranging from a benign condition to an aggressive disease with fatal outcome. The etiology, epidemiology and risk factors for the development of PSTT are not well understood. Surgery is the cornerstone of treatment. Chemotherapeutic regimen should be EMA/CO for first-line chemotherapy, EMA/EP should be used in EMA/CO refractory cases. This article reviews the literatures on this rare but fatal disease. Karyotype of PSTT is diploid, but few cases of tetraploidy have been reported (Xue et al, 2002). Genetic analysis showed an XX genomic composition in 89% of PSTT. Most of PSTT were derived from the antecedent female conceptus and were likely to have possessed a functional paternal X chromosome. Sex chromosome analysis of patients with PSTT suggests a unique genetic basis for the development of PSTT that involves the paternal X chromosome (Hui et al, 2000). Inactivation or dysregulation of p53 gene and upregulation of epidermal growth factor receptor (EGF-R) and MIB-1 (Ki67, a proliferation- associated antigen) are suggested to have a role in the tumor genesis and propagation of PSTT (Muller-Hocker et al, 1997).

I. Introduction Placental site trophoblastic tumor is a rare form of gestational trophoblastic neoplasia composed predominantly of intermediate trophoblast. It constitutes about 1-2% of trophoblastic tumor (Ajithkumar et al, 2003). While Marchand in 1895 used the term of atypical choriocarcinoma, todayâ&#x20AC;&#x2122;s terminology comes from Kurman who described 12 patients with a distinct form of trophoblastic disease (Kurman et al, 1976) and regarded it as an exaggerated form of reaction of the placental bed (Larsen et al, 1991). Following the report by Twiggs et al of a woman who died of this disease (Twiggs et al, 1981). Scully and Young, 1981 coined the name PSTT to describe the malignant potential of this tumor. Since then, approximately 150 cases have been reported in the literature (Guvendag et al, 2004). The etiology, epidemiology and risk factors for the development of PSTT are not well understood (Ajithkumar et al, 2003).

III. Pathology PSTTs are slow growing malignant tumors of intermediate trophoblast that form a nodule in the endometrium and myometrium (Begent, 1995). The gross appearance is gray or yellow with a circumscribed border and little hemorrhage (Ajithkumar et al, 2003). PSTT is composed almost exclusively of intermediate trophoblasts that proliferate to form a tumor mass. These cells constitute a transitional form between cytotrophoblasts

II. Tumor genesis Genetic studies show that PSTT can originate from either a normal conceptus or from hydatidiform mole. 293

Behtash and Hasanzadeh: Placental site trophoblastic tumor and syncytiotrophoblasts. Their physiologic role is to form placental bed, which is why they are also called extra villous trophoblasts (Arato et al, 2000). The intermediate trophoblasts are variable in appearance but tend to form sheets or nests of cells that invade in uterus by splaying apart individual myometrial fibers. The tumor cells can also extensively invade blood vessels, reminiscent of their role in normal implantation. The intermediate trophoblasts range from completely bland and monotonous cells to enlarged, hyperchromatic cells with marked nuclear atypia. The cytoplasm is generally ample and can be clear, amphophilic or eosinophilic. Some tumor cells may be spindled. Most tumor cells are mononuclear but occasionally they coalescence into multinucleated giant cells. The mitotic rate is variable from less than 1 to greater than 30 mitoses per 10 HPF (Moore-Maxwell and Robboy, 2004). Syncytiotrophoblasts can sometimes be identified, but only sparingly (Lage, 2002). The occasional observation of fibrinoid deposition is a typical feature of this tumor (Ishi et al, 1995). The endometrium adjacent to the neoplastic cells may show a pseudodecidual change (Fox, 1995). With immunohistochemical staining, 50-100% of intermediate trophoblasts show positivity for human placental lactogen (HPL) and fewer than 10% of tumor cells stain for human chorionic gonadotropin (HCG) (Kurman et al, 1984; Kurman, 1991). This can be valuable in diagnosis and in discriminating PSTT from carcinoma or sarcoma. More PSTT cells stain with specific monoclonal antibodies for b core segment and for HPL than for intact HCG (Eckstein et al, 1982). Pregnancy-associated major basic protein (pMBP), a marker of intermediate trophoblast, is useful in distinguishing PSTT from other forms of throphoblatic tumor immunohistochemically. It presents in 78% of cases (Rhoton-Vlasak et al, 1998). Recently Shih and Kurman have described a doublestaining technique using MIB-1 antibody to determine the Ki67 proliferative index in Mel- CAM (also Known as CD 146 and MUC 18) defined intermediate trophoblast (Shih and Kurman, 1998). The proliferation rate of PSTT as measured by Ki67 labeling in approximately 14%, which helps to distinguish it from exaggerated placental site reaction that demonstrates no proliferation. Inhibin staining of tissue samples is useful in distinguishing PSTT from uterine sarcoma and carcinoma (Guvendag et al, 2004). Immunohistochemical staining for p53 reveales intense nuclear labeling (Iwamoto et al, 2003).

are usually seen after delivery or abortion. The dominating signs of the clinical picture are vaginal bleeding (79%) and enlargement of the uterus (Fukunaga and Ushigome, 1993). Vaginal bleeding or amenorrhea is the usual mode of presentation. Nephrotic syndrome or hematuria appears to be related to glomerular membrane deposition of immunoglobulin and fibrin may occur in 10% of patients. It resolves after removal of the tumor (Young et al, 1985). Virilization due to raised testosterone levels, secondary to an ovarian response to gonadotropin derived from the tumor, is also reported (Nagelberg and Rosen, 1985). PSTT is staged according to the FIGO staging of gestational trophoblastic disease. The WHO scoring system for GTD couldnâ&#x20AC;&#x2122;t be used for PSTT (Goldstein et al, 1998). Sepsis, erythrocytosis and pneumothorax, anorexic syndrome may be the presenting symptoms (Brewer et al, 1992).

V. Differential diagnosis Differential diagnosis includes choriocarcinoma, exaggerated placental site, placental site nodule and epithelioid type of leiomyosarcoma. In PSTT, mean Ki 67 staining is 14% of total specimen area, when compared with 69% of total specimen area in choriocarcinoma. However, there can be overlap area in staining mitotic index will be useful in differential diagnosis in that situation (Guvendag et al, 2004). In choriocarcinoma, !-HCG titer is high but in PSTT, it is low. Placental site nodule is a focal, usually superficial, well-circumscribed nodule with a pauci cellular center surrounded by radiating intermediate trophoblasts enmeshed in fibrin. This residue may cause menorrhagia after delivery or abortion, and may cicatrize. The other benign anomaly is the so-called exaggerated placental site reaction (Arato et al, 2000). By its size and its morphology, it may be similar to PSTT, can be the cause of bleeding disorders but can be treated with endometrial ablation. Ki67 labeling is negative. On the other hand, PSTT is a real tumor of the intermediate trophoblast cells. Epithelioid trophoblastic tumor is composed of chorionic type intermediate trophoblast, behavior is similar to PSTT. It is generally benign, metastasis and death is 25% and 10%. Another differential diagnosis is epithelioid type of leiomyosarcoma.

VI. Investigation

IV. Clinical features and diagnosis

The variable and often low level of HCG detected in these tumors reflects the lack of syncytiotrophoblast. In bulky PSTT, the level of !-HCG is in the range of only 102-103 IU/lt (Bagshawe and Rustin, 1995). Hence, the level of HCG are not an accurate indication of tumor burden and can not be used as a reliable tumor marker. Unlike choriocarcinoma, the level of serum HCG in PSTT correlate neither with tumor burden, nor with the malignant behavior. Thus !HCG appear to have no

PSTT shows widely variable characteristic, from a comparatively benign type confined within the uterus to a highly malignant type causing widespread metastasis. PSTT presents with metastases in about 10% of cases and metastases develop in an additional 10% of patients during follow up (Disaia and Creasman, 2002). Symptoms may present weeks to years after the preceding pregnancy. The first symptoms of the disease

294

Cancer Therapy Vol 3, page 295 predictive value and disease may still progress even if levels are not raised (Felmate et al, 2001). The range of serum !HCG concentration at diagnosis in 79% is below 1000 IU/lt and in 58% lower than 500 IU/lt (Papadopoulos et al, 2002). Human placental lactogen, a late trophoblastic product, is contained in most of the cells of PSTT and measurement of HPL may be useful in identification and monitoring of PSTT (Driscoll, 1984).

bundles, where as the metastatic tumor was mostly composed of tumor cells. Although the ratio of mitotic tumor cells to all tumor cells in these sections was similar, the smooth muscle bundles diluted the mitotic count over a fixed observation area. Hence, the mitotic count per 10 HPF in a tumor is also inversely related to the proportion of stromal cells in that tumor and does not completely reflect the proliferation activity of the tumor (Chang et al, 1999). How et al. found that prognosis is poor if tumor specimens show a mitotic count of more than five mitoses per 10 HPF (How et al, 1995). Chang reported FIGO stage is the most important prognostic factor in PSTT. Patients with disease confined to genital tract (FIGO I and II) had 93.5% survival which was higher than that (33.3%) of those with disease extended outside genital tract (FIGO III and IV) (p < 0.0001) (Chang et al, 1999). Extra uterine spread of the disease appears to be the most useful prognostic factor for progression. Other reported poor prognostic factors are higher gravity and term deliveries with female fetuses (Lathrop et al, 1988). Length of time from antecedent pregnancy of two or more years appears to be a major prognostic variable in PSTT (Newslands et al, 2000). According to multivariate analysis, the risk for unfavorable behavior of the disease increases considerably with the length of this interval (Kim, 2003). Diagnosis less than 2 years from the antecedent pregnancy, and the disease localized to the uterus are associated with better outcome (Papadopoulos et al, 2002; Kim, 2003). In the report of Charring Cross Hospital all seven deaths had lung metastases and presented more than 4 years since the last pregnancy (Papadopoulos et al, 2002). In Change review, it is noticed that patients with PSTT extended outside the uterus at presentation were an average of 3 years older in age and had longer intervals between their antecedent pregnancy and the diagnosis of PSTT when compared to those whose diseases were confined to the uterus. They also had a higher incidence of term delivery as their antecedent pregnancy (Chang et al, 1999). Vascular space involvement, endomyometrial invasion are adverse prognostic factors. The occurrence of brain metastasis is also a poor prognostic factor. PSTT previously complicated by hydatidiform mole has a poor prognosis and high risk of brain metastasis. The WHO scoring system for GTD did not correlate with this outcome (Lathrop et al, 1988).

VII. Imaging Ultrasonography shows an echogenic mass that can involve endometrium and myometrium. Both solid intramural masses and cystic lesions are described. PSTT divided into two types, a hypervascular type and a relatively hypovascular type. In the hypervascular type, massive bleeding following dilatation and curettage have been reported. When prominent vascularity of the tumor is indicated by imaging findings, dilatation and curettage should be avoided. On the other hand, uterine conservative surgery may be possible in patients with the localized hypovascular type. The main role of imaging diagnosis of PSTT is to clearify the vascularity of the tumor (Sumi et al, 1999). CT scan may also delineate uterine mass. In MRI, PSTT presented as myometrial masses that are isodense to healthy myometrium. To perform an open uterine surgery with an aim at preservative fertility, it is important to precisely determine the size and location of the tumor and execute an effective resection procedure. In these cases, the operation was aided by combined use of MRI, PET scan, sonohysterography, high- resolution digital hysteroscopy (Tsuji et al, 2002).

VIII. Clinical behavior and prognostic factors The majority of PSTT behave in a benign fashion, approximately 10-15% are clinically malignant. It is usually confined to the uterus at the time of initial diagnosis. PSTT can metastasize and usually resistant to chemotherapy. The most common site of metastasis is the lung, but metastasis to the scalp, brain, stomach, liver, spleen, bowel, pancreas, kidney, adjacent pelvic organs also has been reported. The most common site of metastasis are the lung and vagina (Guvendag et al, 2004). PSTT occurring simultaneously in mother and infant have been reported (Monclair et al, 2002). Prediction of metastatic potential is difficult. Mitotic counts have not proved to be reliable because tumors with low mitotic counts can do metastasize. In addition, mitotic counts in the curettage specimen may differ from those in the hysterectomy specimen and from those in the resected metastases. Differences between the mitotic counts of the endometrial curettage and the corresponding hysterectomy specimens were also noticed in some patients. Uterine tumor was intermixed with abundant smooth muscle

IX. Treatment Surgery remains the cornerstone of therapy. With primary hysterectomy being the optimal therapy once the diagnosis of PSTT is established (Bower et al, 1996). The ovaries may be preserved if they appear macroscopically normal. Role of pelvic and paraaortic lymphadenectomy in early stage disease is unclear, but isolated metastasis in lymph node reported. Consequently surgery is the mainstay of treatment of non metastatic PSTT (Behtash et al, 2004). However, in locally advanced and metastatic

295

Behtash and Hasanzadeh: Placental site trophoblastic tumor disease, all extra pelvic tumors should be resected if technically feasible. Only in cases which preservation of fertility desired, conservative surgery (D and C or local resection) could be justified (Hopkins et al, 1985). In most series more than one treatment modalities have been used. Local uterine resection may be considered if a patient is resistant to chemotherapy and wants to retain fertility. When local resection is considered, ultrasound, MRI, and /or PET scan may identify the site of resistant tumor (Behtash et al, 2004). Conservative surgery recommended when the lesion is confined to the uterus, mitotic count is low, there is no uterine enlargement and close follow up (including serial HCG estimation with periodic pelvic examination and ultrasonography) is possible (Lathrop et al, 1988; Kurman, 1991). However in the absence of reliable prognostic indicators, conservative therapy in the form of curettage alone should be used with caution (Ajithkumar et al, 2003). PSTT is resistant to chemotherapeutic agents commonly used for chorionic tumor, such as Methotrexate and Actinomycin D, but combination chemotheraphy, such as EP/EM or EMA /CO utilizing Etoposide, Cisplatin, Methotrexte, Actinomycin D, Cyclophosphamide and Vincristine, has been reported to be higly effective (Monclair et al, 2002). The best choice of chemotherapy for PSTT is uncertain, clinical impression is that EMA/ EP is more potent than the EMA/CO schedule of chemotherapy (Fisher et al, 1992). The complete response rate for metastatic PSTT managed with EMA/CO chemotherapy is only 28% (Swisher and Drescher, 1998). Chemotherapeutic regimen should be EMA/CO for first line chemotherapy. EMA/ EP should be used in EMA/CO refractory cases. Taxol is added to the regimen for cisplatin- refractory cases (Taxol / Cisplatin- Taxol /Etoposide regimen) (Newslands et al, 2000). The most recent data from the Charing Cross Hospital and other centers suggest the EMA/ EP is the most effective treatment for metastatic or recurrent PSTT (Newlands et al, 1998). Alternative second- line treatments for recurrent or progressive PSTT are BEP (Bleomycin, Etoposide, Cisplatin) and VIP (Etoposide, Ifosfamide, Cisplatin) protocols (Ajithkumar et al, 2003). Chemotherapy should be used in patients with advanced PSTT and may be considered in patients with FIGO stage I disease with length of time from antecedent pregnancy >2 years or high mitotic count per 10 HPF in histopathology (Hoekstra et al, 2004). Radiation is reported to be useful in the setting localized and isolated recurrence or setting palliative therapy (Lathrop et al, 1988). Radiotherapy have been used in 6 cases with varying success. In 2 reported cases, pelvic external beam radiotherapy contributed to remission of the disease. Irradiation combined with surgery and chemotherapy might be more helpful in cases with pelvic residual disease (Newslands et al, 2000). However, use of radiation should be based on individual basis and no generalized conclusions can be drawn regarding its use. In cases of unresectable progressive PSTT, salvage chemotherapy is based on the initial treatment. Patients

who had initial treatment with EMA/CO regimen can be salvaged with EMA-EP (Kandall et al, 2000).

X. Conclusion PSTT is a well recognized, but uncommon form of gestational trophoblastic disease with a highly variable clinical behavior. Most of the tumors in the uterus are well circumscribed and localized. Hysterectomy seems to be sufficient treatment of patients whose disease is limited to the uterus. Patients with extensive or metastatic disease are candidates for cytoreductive surgery and chemotherapy. Although the clinical outcome is largely unpredictable.

References Ajithkumar TV, Abraham EK, Rejnishkumar R, Minimole AL (2003) Placental site trophoblastic tumor. Obstet Gynecol Surv 58, 484-488. Arato G, Fulop V, Degrell P, Szigetvari I (2000) Placental site trophoblastic tumor. Pathol oncol Res 6, 292-294. Bagshawe KD, Rustin GJS (1995) In, Peckham M, Pinedo H, Veronesi U, eds. Oxford Textbook of oncology, vol 1, Oxford, Oxford university press, 412-420. Begent RHJ (1995) Gestational trophoblastic tumors. In, Peckham M, Pinedo H, Veronesi U, eds. Oxford Textbook of oncology Vol 2. Oxford, Oxford university press, 1363-1378. Behtash N, Ghaemmaghami F, Hasanzadeh M, Modares M, Mosavi A (2004) Longterm remission of metastatic placental site trophoblastic tumor, case report and review of literature. World J Surg Oncol, In press. Bower M, Paradinas FJ, Fisher RA, et al (1996) Placental site trophoblastic tumor, molecular analysis and clinical experience. Clin Cancer Res 2, 897-902. Brewer CA, Adelson MD, Elder RC (1992) Erythrocytosis associated with a PSTT. Obstet Gynecol 79, 846. Chang YL, Chang TC, Hsueh S, Huang KG et al (1999) Prognostic factors and treatment for placental site trophoblastic tumor, Report of 3 cases and analysis of 88 cases. Gynecol Oncol 73, 216-222. Disaia PJ, Creasman WT (2002) Gestational trophoblastic disease, in Disaia PJ, Creasman WT, editors. Clin Gynecol Oncol. 6th ed. St. Louis, Mosby year book, 185-206. Driscoll EG (1984) Placental site chorioma, the neoplasm of the implantation site trophoblast. J Reprod Med 29, 821-825. Eckstein RP, Paradinas FJ, Bagshawe KD (1982) Placental site trophoblastic tumor, A study of four cases requiring hysterectomy including one fatal case. Histopathol 6, 211226. Felmate CM, Genest DR, Wise L, et al (2001) Placental site trophoblastic tumor, A 17 year experience at the New England Trophoblastic Disease center. Gynecol Oncol 82, 415-419. Fisher RA,, Paradinas FJ, Newlands ES, et al (1992) Genetic evidence that placental site trophoblastic tumor can originate from hydatiform mole or a normal conceptus. Br J Cancer 65, 355-358. Fox H (1995) Tumors of Endometrium. In, Fletcher CDM. Diagnostic histopathology of tumors, Vol 1. Edinburgh, Churchill Livingstone, 456-496. Fukunaga M, Ushigome S (1993) Malignant trophoblastic tumor. Hum Pathol 24, 1098-1106. Goldstein DP, Zanten P, IV, Bernstein MR, et al (1998) Revised FIGO staging for gestational trophoblastic tumors. Recommendations regarding therapy. J Reprod Med 43, 3743.

296

Cancer Therapy Vol 3, page 297 Guvendag Guven ES, Guven S, Esinler I, Ayhan A, Kucukali T, Usubutun A (2004) Placental site trophoblastic tumor in a patient with brain and lung metastases. Int J Gynecol Cancer 14, 558. Hoekstra AV, Keh P, Lurain JR (2004) PSTT, a review of 7 cases and their implications for prognosis and treatment. J Reprod Med 49, 447-52. Hopkins M, Neunez C, Murphy JR, Wentz WB (1985) Malignant placental site trophoblastic tumor. Obstet Gynecol 66, 9551005. How J, Scurry J, Grant P, Sapountzis K, Ostar A, Fortune D, Armes J (1995) Placental site trophoblastic tumor, Report of three cases and review of the literature. Int J Gynecol Cancer 5, 241-9. Hui P, Parkash V, Perkins AS, Carcangiu ML (2000) Pathogenesis of placental site trophoblastic tumor may require the presence of a paternally derived X chromosome. Lab Invest 80, 965-72. Ishi K, Suzuki F, Saito A, et al (1995) Cytodiagnosis of placental site trophoblastic tumor, A report of two cases. Acta Cytol 1998 42, 745-750. Iwamoto H, Nara M, Minai M, Hirata S, Hoshi K (2003) Placental site trophoblastic tumor, P53 gene analysis. Eur J Gynaecol Oncol 24, 25-9. Kandall TC, Coukos G, Wheeler JE (2000) Prolonged remission of recurrent metastatic placental site trophoblastic tumor after chemotherapy. Gynecol Oncol 76, 115-117. Kim SJ (2003) Placental site trophoblastic tumor. Best Pract Res Clin Obstet Gynaecol 17, 969-984. Kurman RJ (1991) The morphology, biology and pathology of intermediate trophoblast, A look back into the present. Hum Pathol 22, 847-855. Kurman RJ, Main CS, Chen HC (1984) Intermediate trophoblasts, A distinctive form of trophoblast with specific morphological, biochemical and functional features. Placenta 5, 349-370. Kurman RJ, Scully RE, Norris HJ (1976) Trophoblastic pseudotumor of the uterus, an exaggerated form of “ syncytial endometritis” simulating a malignant tumor. Cancer 38, 1214-1226. Lage J (2002) Gestational trophoblastic disease. In, Robboy SJ, Anderson M, Russell P, editors. Pathology of the female reproductive tract. London, Churchill Livingstone, 771-73. Larsen LG, Theilade K, Skibsted L, et al (1991) Malignant placental site trophoblastic tumor. A case report and review of the literature. APMIS suppl 23, 138-145. Lathrop FC, Lauchlan S, Ramakrishna N, et al (1988) Clinical characteristics of placental site trophoblastic tumor (PSTT). Gynecol Oncol 31, 32-42. Marchand F (1895) Uber die sogenannten “ decidualen” geschwulste im Anschloss an normale Gebart, Abort, Blasenmole, und Extauterin Schwangerchaft. Monatsschr Geburtshilfe Gynaekol 1, 419. Monclair T, Abeler VM, Kaern J, Walaas L, Zeller B, Hilstrom C (2002) PSTT in mother and child, firt report of PSTT in infancy. Med Pediatr Oncol 38, 187-91.

Moore-Maxwell CA, Robboy SJ (2004) Placental site trophoblastic tumor arising from antecedent molar pregnancy. Gynecol Oncol 92, 708-712. Muller-Hocker J, Obernitz N, Johannes A, et al (1997) p53 gene product and EGF receptors are highly expressed in placental site trophoblastic tumor. Hum Pathol 28, 1302-1306. Nagelberg SB, Rosen SW (1985) Clinical and laboratory investigation of a virilized woman with placental site trophoblastic tumor. Obstet Gynaecol 65, 527-534. Newlands ES, Bower M, Fisher RA, Paradinas FJ (1998) Management of PSTT. J Reprod Med 43, 53-9. Newslands ES, Mulholland PJ, Holden L, Seckl MJ, Rustin GJS (2000) Etoposide and Cisplatin/ Etoposide, Methotrexate and Actinomycin D (EMA) chemotherapy for patients with highrisk gestational trophoblastic tumors refractory to EMA/ Cyclophosphamide and Vincristine chemotherapy and patients with metastatic PSTT. J Clin Oncol 18, 854-9. Papadopoulos AJ, Foskett M, Seckl MJ, MC Neish I, et al (2002) Twenty-five years clinical experience with placental site trophoblastic tumors. J Reprod Med 47, 460-4. Rhoton-Vlasak A, Wagner JM, Rutgers JL, et al (1998) Placental site trophoblastic tumor, HPL and pregnancy associated major basic protein as immunohistologic markers. Hum Pathol 29, 280-288. Scully RE, Yong RH (1981) Trophoblastic pseudotumor, a reppraisal. Am J surg Pathol 5, 75-76. Shih IM, Kurman RJ (1998) Ki67 labeling index in the differential diagnosis of exaggerated placental site, placental site trphoblastic tumor and choriocarcinoma, A double immunohistochemical staining technique using Ki67 and Mel-CAM antibodies. Hum Pathol 29, 27-33. Sumi Y, Ozaki Y, Shindoh N, Katayama H (1999) Placental site trophoblastic tumor, imaging findings. Radiat Med 17, 42730. Swisher E, Drescher CW (1998) Metastatic placental site trophoblastic tumor, long term remission a patient treated with EMA/ CO chemotherapy. Gynecol Oncol 68, 62-5. Tsuji Y, Tsubamoto H, Hori M, Ogasawara T, Koyama K (2002) Case of placental site trophoblastic tumor treated with chemotherapy followed by open uterine tumor resection to preserve fertility. Gynecol Oncol 87, 303-307. Twiggs LB, Okagaki T, Phillips GL, Stroemer JR, Adcock LL (1981) Trophoblastic pseudotumor –evidence of malignant disease potential. Gynecol Oncol 12, 238-248. Xue WC, Guan XY, Ngan HY, shen DH, Khoo US, Cheung AN (2002) Malignant placental site trophoblastic tumor, a cytogenetic study using comparative genomic hybridization and chromosome in situ hybridization. Cancer 94, 2288-94. Young RH, Scully RE, Mecluskey RT (1985) A distinctive glomerular lesion complication (PSTT), Report or two cases. Human Pathol 16, 35-42.

297

Behtash and Hasanzadeh: Placental site trophoblastic tumor

298

Cancer Therapy Vol 3, page 299 Cancer Therapy Vol 3, 299-320, 2005

Management of peritoneal carcinomatosis from colon cancer, gastric cancer and appendix malignancy Review Article

Paulo Goldstein1, Rodrigo Gomes da Silva2, Jacobo Cabanas3, Paul H. Sugarbaker4 1

Hospital das Clinicas da Faculdade de Medicina da Universidade de Sao Paulo, Sao Paulo (Brasil) Faculdade da Medicina da Minas Gerais Federal University, Belo Horizonte (Brasil) 3 Hospital Universitario Ram贸n y Cajal, Madrid (Spain) 4 Program in Peritoneal Surface Malignancy, Washington Cancer Institute, Washington DC (USA) 2

__________________________________________________________________________________ *Correspondence: Paul H. Sugarbaker, M.D., Washington Cancer Institute, 106 Irving Street, NW, Suite 3900, Washington, DC 20010, USA; Phone: (202) 877-3908; Fax: (202) 877-8602; e-mail: Paul.Sugarbaker@medstar.net Key words: Intraperitoneal chemotherapy, cytoreductive surgery, peritonectomy, appendiceal cancer, colon cancer, gastric cancer, peritoneal surface malignancy Abbreviations: Completeness of cytoreduction score, (CCS); cytoreduction score, (CC); diffuse peritoneal adenomucinosis, (DPAM); early postoperative intraperitoneal chemotherapy, (EPIC); hyperthermia, (HIIC); long-term intraperitoneal chemotherapy, (LTIC); peritoneal cancer index, (PCI); peritoneal mucinous adenocarcinomas, (PMCA); Prior surgical score, (PSS) Received: 25 March 2005; Accepted: 18 April 2005; electronically published: May 2005

Summary Peritoneal dissemination from gastrointestinal malignancies can occur either as a result of direct seeding during the growth process of the primary tumor or after cell spillage caused by surgical manipulation. Until recently this condition was treated only with palliative intent and resulted in a cancer death associated with a period of poor quality of life. However, new concepts regarding the pathobiology of peritoneal seeding and new treatment options supported a rationale for a major revision of management strategies. Peritonectomy procedures are now used to remove macroscopic tumor nodules. Perioperative chemotherapy delivered by an intraperitoneal route allows high local-regional exposure of peritoneal surface associated with minimal systemic toxicity. This combined treatment has been used in the management of several gastrointestinal malignancies. Mucinous appendiceal tumors are the paradigm of this new approach with 80% 5-year survival. Colon cancer has been successfully treated in approximately 30% of patients and in selected patients with gastric cancer approximately 10% have reached 5-year survival. In this review the natural history of peritoneal carcinomatosis is presented, the results of phase II and III trials are evaluated and morbidity, mortality and quality of life with this definitive approach assessed.

A. Colorectal carcinomatosis

I. Introduction

Despite advances for early diagnosis of colorectal cancer, peritoneal carcinomatosis persists as a major problem. Peritoneal implants are present in 10% of patients with colorectal cancer at the time of diagnosis and are the second cause of death after liver metastasis (Sugarbaker, 1990). In contrast to the other two main sites of colorectal cancer metastasis, liver and lymph nodes, peritoneal seeding is considered a condition uniformly lethal with no perspective of cure. From a database of 3019 colorectal cancer patients, Jayne and colleagues identified 349 patients with peritoneal carcinomatosis (Jayne et al, 2002). The median survival of this group was 7 months. Unfortunately this recent data showed no

Peritoneal carcinomatosis represents a significant adverse step in the natural history of any gastrointestinal cancer using conventional management. It eliminates any hope of cure and with disease progression leads to poor quality of life. Patients who relapse through peritoneal seeding will experience a succession of complications secondary to the progressive carcinomatosis. Those patients who present with peritoneal implants with the primary cancer in place may suffer not only from progressive carcinomatosis but also from the complications of the primary tumor, most commonly obstruction, bleeding and perforation.

299

Goldstein et al: Management of peritoneal carcinomatosis improvement in the survival of these patients if compared with the first study of the natural history of peritoneal carcinomatosis published 13 years before (Chu et al, 1989). Also, a European multicenter trial (EVOCAPE 1) evaluated prospectively 118 patients with peritoneal carcinomatosis arising from colorectal cancer. The mean survival of those patients was 6.9 months (Sadeghi et al, 2000).

carcinomatosis patients. Recognition of the peritoneal layer as the first defense barrier to tumor progression allows one to assume that cure might be possible if tumor nodules were eradicated from all peritoneal surfaces (Sugarbaker, 1990). Also in 1984, Flessner and colleagues showed in pharmacokinetics experiments that the clearance of a drug from the peritoneal cavity is inversely proportional to its molecular weight (Flessner et al, 1984). This new pharmacologic concept, known as PeritonealPlasma Barrier, represents the basis of intraperitoneal use of chemotherapeutic agents. In 1995, Sugarbaker published new surgical strategies collectively referred to as peritonectomy procedures (Sugarbaker, 1995). These surgical techniques allow the resection of all parietal peritoneum involved by peritoneal seeding. Visceral peritoneum invaded by tumor may require organ resection. When the concept of peritonectomy is combined with new pharmacokinetics studies, strategies for the effective management of peritoneal surface malignancies can be formulated for a significant proportion of patients. Accumulated experience shows that success against carcinomatosis from gastrointestinal tumors depends on a coordinated and dose intensive effort. That means maximal surgical cytoreduction plus maximal chemotherapy delivered directly into the abdominal and pelvic cavity during the perioperative period. Unless both strategies are used as a planned part of the surgical intervention little success can be expected. The most direct test of this new concept of the peritoneum as the first line of defense against peritoneal dissemination is pseudomyxoma peritonei arising from an appendiceal adenoma. It represents a paradigm of this new approach to peritoneal surface malignancies with approximately 85% 5-year survival (Sugarbaker et al, 1999). No other treatments for this group of patients have been shown to be curative. From the remarkable results achieved in appendiceal mucinous tumors using this new combined treatment a rationale for the treatment of peritoneal carcinomatosis from colorectal cancer and gastric cancer emerges. The treatment modalities are further described, selection criteria discussed, results of clinical studies presented and morbidity, mortality and quality of life among treated patients evaluated.

B. Gastric carcinomatosis In the United States 20 to 30% of patients with gastric cancer being explored for potentially curative resection will be found to have peritoneal seeding at the time of surgical exploration (Sugarbaker, 2003 or 2004). Current standard treatment is systemic chemotherapy which may delay onset of symptoms but is not curative. The median survival of these patients is 5 months with virtually no long-term survivors (Sadeghi et al, 2000). Yoo and colleagues reviewed 2328 patients with gastric cancer who underwent curative resection with at least 5-years follow-up (Yoo et al, 2000). Documented evidence of relapse of the disease was found in 508 patients. Isolated peritoneal recurrence was noted in 34% of patients who relapsed. Hematogenous recurrence occurred in 26% and local-regional persistence of the tumor was seen in 19%. Two or more sites of recurrence were documented in the remaining patients. Serosal invasion and lymph node metastasis were risk factors of relapse in all patterns of recurrence. This high incidence of peritoneal carcinomatosis following curative resections is shared by others, with an average incidence between 20% and 50% (Gunderson and Sosin, 1982; Koga et al, 1984; Wisbeck et al, 1986; Landry et al, 1990). These data show that in an impressive number of patients the recurrence is isolated within the peritoneal cavity. It also suggests that if an effective treatment could be targeted toward peritoneal dissemination, at least a third of the patients with advanced gastric cancer could experience a better outcome. Systemic chemotherapy for gastric patients presenting with peritoneal seeding at the time of abdominal exploration or as a manifestation of disease recurrence after a curative surgery is uniformly disappointing. Preusser and colleagues published a response rate for advanced gastric cancer of 50%; nevertheless patients with peritoneal dissemination obtained the worst response (Preusser et al, 1989). Ajani and colleagues, treated patients prior to gastrectomy (Ajani et al, 1991). At exploration, peritoneal carcinomatosis was the most common cause of failure of intensive neoadjuvant chemotherapeutic treatment. Also, radiation showed limited results in this situation and is expected to cause significant morbidity when applied to such a large field.

C. Rationale for malignancy treatments

peritoneal

II. Peritonectomy procedures Until recently any patient with peritoneal seeding from a gastrointestinal primary had no surgical option with intent to cure. This was based on the assumption that even if the peritoneal nodules were the only anatomical sites of advanced disease, they were untreatable by conventional surgical techniques. However, the study of the pathobiology of the peritoneal surface component of cancer and also of the patterns of this dissemination allowed the evolution of six surgical procedures for the treatment of macroscopic disease spread on peritoneal surfaces (Sugarbaker, 1995). An important concept regarding tumor behavior derives from the studies of Weiss. He showed that even though a large number of malignant cells reached the liver through the blood stream only a few adhere to the endothelium and develop into true metastasis. This

surface

However, during the last two decades new concepts have arisen with the intent to develop treatment options for

300

Cancer Therapy Vol 3, page 301 phenomenon known as “metastatic inefficiency” characterizes hematogenous dissemination of disease (Weiss, 1986). In contrast, free cancer cells in the peritoneal cavity implant and grow with great efficiency. Schott and colleagues evaluated the prognostic significance of isolated tumor cells detected in the bone marrow and in the peritoneal lavage of 84 patients with gastric cancer and in 109 patients with colorectal cancer (Schott et al, 1998). Although cancer cells identified in the bone marrow showed little prognostic significance, free cancer cells in the peritoneal cavity were highly correlated with limited long-term survival. From observations collected from reoperative surgical procedures, Sugarbaker, (1996) described four patterns of intracoelomic cancer dissemination. In the absence of peritoneal fluid aggressive tumors tend to spread randomly to the peritoneum surrounding the primary tumor. However, tumors that are mucus producing or those that lead to ascitic fluid accumulation, present a characteristic redistributed pattern. The tumor cells tend to adhere at the peritoneal resorption sites in the greater omentum and beneath the diaphragm. Also, gravity is a determinant in tumor distribution since the peritoneal fluid accumulates in the pelvis creating a fluid rich in tumor contamination. Thus, these malignant cells have the opportunity to implant and progress on pelvic peritoneal surfaces. The third pattern of intracoelomic cancer dissemination was described by Carmignani and colleagues (2003). They documented the influence that peritoneal motion has on tumor distribution. Many structures in the abdomen are stationary, whereas others such as the jejunum and ileum are in continuous peristalsis. When cancer cells are present within the peritoneal space, especially when ascitic or mucoid fluid is present, the malignant cells tend to deposit within nonmobile anatomic sites such as the rectosigmoid junction, around the cecum and the appendix, over the liver and in the subpyloric space. In contrast, the surfaces of the small bowel and its mesentery may remain almost free of disease. This is one of the observations that led to a rationale for peritonectomy procedures and a curative approach to peritoneal surface malignancies. A fourth mechanism influencing tumor distribution into the abdominopelvic cavity occurs as a result of surgical manipulation and is called “tumor cell entrapment.” The malignant cells present in the peritoneal cavity at the time of the first surgery have a tendency to implant on wounded surfaces such as the laparotomy scar, along the bed of the resected primary tumor, or in suture lines. These cells become entrapped by fibrin and are stimulated by inflammatory growth factors released during the healing process. The concept that tumor cell entrapment and enhancement can result from surgical procedures should profoundly affect the practice of cancer surgery (Sugarbaker, 1990). Considering that a significant proportion of patients with carcinomatosis arising from gastrointestinal cancer have a preponderance of spread on parietal peritoneum and have limited disease over their small bowel surfaces, Sugarbaker described the peritonectomy procedures with

the intent to reduce peritoneal surface dissemination to a microscopic level (Sugarbaker, 1995). These procedures are used for resection of peritoneum involved by cancer. On the small bowel surface tumor nodules are electroevaporated and normal peritoneum is spared in order to preserve gastrointestinal function. These techniques are summarized as follows: • Epigastric peritonectomy: includes any prior midline scar in continuity with preperitoneal epigastric fat pad, the xiphoid process and the round and falciform ligaments of the liver. • Anterolateral peritonectomy: removes the greater omentum with the anterior layer of the peritoneum from the transverse mesocolon. If the spleen is involved it is resected. The peritoneum of the right paracolic gutter along with the appendix, the spleen and in some patients, the peritoneum covering the left paracolic gutter must be stripped. • Subphrenic peritonectomy: the peritoneum underneath the right and left portions of the diaphragm is removed along with the left triangular ligament of the liver; this includes the peritoneum lining the retrohepatic space. Glisson’s capsule is removed in part or completely as required by cancer implants. • Omental bursa peritonectomy and lesser omentectomy: begins with the cholecystectomy and is followed by removal of the peritoneum of the porta hepatis, anterior and posterior aspects of the hepatoduodenal ligament, hepatogastric ligament and the peritoneal floor of the omental bursa, including the peritoneum overlying the pancreas. • Pelvic peritonectomy: removes the peritoneum from the rectovesical or rectouterine space (pouch of Douglas) and usually the rectosigmoid colon must be resected. In women, both ovaries and the uterus are also removed. • Partial/total gastrectomy: if the subpyloric space is involved an antrectomy may be enough to eliminate the disease. However, especially in mucinous tumors, the entire lesser curvature of the stomach may be encased by tumor and only a total gastrectomy allows complete removal of disease.

III. Intraperitoneal chemotherapy A. Rationale Cytoreductive surgery alone can treat gross and macroscopic disease. However, it leaves behind microscopic disease which will progress not only on the peritoneal surfaces, but also within the scar tissues. Residual disease will be stimulated by growth factors released during the healing process (Sugarbaker, 1990). This iatrogenic mechanism for tumor dissemination (tumor cell entrapment and enhancement) is a major cause for both systemic and intraperitoneal chemotherapy failure. Intraperitoneal chemotherapy was designed to treat the entire abdominal and pelvic cavity using high drug concentrations locally with reduced systemic toxicities. As would be expected, the results of intraperitoneal chemotherapy administered alone for the treatment of

301

Goldstein et al: Management of peritoneal carcinomatosis established peritoneal metastasis are disappointing. This failure occurs as a result of the very limited penetration of the drugs into tumor nodules. Experimental studies show that only the outer layers of the cancer implants will achieve cytotoxic concentrations of the chemotherapeutic agent (Ozols et al, 1979; Los and McVie JG, 1990). The most optimistic studies suggest a maximum of 3 mm depth of penetration by the cytotoxic drugs (van de Vaart, 1998). These data establish that intraperitoneal chemotherapy should be used only after complete cytoreduction. Another important limitation for the use of intraperitoneal chemotherapy alone for the treatment of peritoneal surface malignancies is the non-uniform distribution of the drug inside the abdominal and pelvic cavity. The tumor itself may cause extensive adhesions; also, a significant number of these patients have had prior surgical interventions leading to scar formation. Thus, unless all adhesions are taken down one cannot expect a uniform distribution to all peritoneal surfaces (Elias et al, 2000).

Preoperative intraperitoneal chemotherapy has been used by Yonemura (Japan), for the treatment of gastric cancer presenting with established peritoneal metastasis. This group also utilizes HIIC and EPIC in the same patients trying to improve the results in this poor prognosis clinical entity (Yonemura et al, 2003). The use of intraperitoneal chemotherapy just after the cytoreduction, but before the construction of the anastomosis; HIIC, is the most widely used method (Glehen et al, 2004). In addition to the advantages of the route of administration of the chemotherapeutic agent (intraperitoneal) and the association of hyperthermia, all adhesions are eliminated at this point in the surgery allowing the distribution of the fluid to the whole peritoneal cavity. Another major benefit of HIIC utilized after maximal cancer resection with peritonectomy is related to the reduction of tumor burden to a microscopic level. The cytotoxic drugs can eliminate free cancer cells before they implant deep in scar tissue and away from the effects of both systemic and intraperitoneal chemotherapy. There are four techniques by which to perform the HIIC: closed, partially closed, open and by a peritoneal expander. In the closed technique the intestinal anastomoses, the fascia and skin of the abdominal wall are closed prior to the HIIC. In the partially closed technique the skin of the abdominal wall is closed with a running suture. After the chemotherapy treatment the abdominal skin is reopened and intestinal anastomoses performed. However, these methods do not guarantee a uniform drug and heat distribution as shown through radiological exams and dye studies (Hughes et al, 1992; Elias et al, 2000). The open technique or “Coliseum technique” (Figure 1) was described by Sugarbaker and is performed by elevating the skin edges of the midline abdominal incision on a selfretaining retractor (Sugarbaker, 1999). This method, in spite of greater heat-loss and the theoretical problem of environmental chemotherapy contamination, has the advantage of allowing the surgeon to manipulate the fluid inside the abdominal cavity in order to optimize heat and drug distribution. Yonemura et al. also described an open technique with the help of a peritoneal expander which, as the coliseum method, permits the surgeon to distribute the fluid (Yonemura, 2003). The peritoneal expander technique is performed through the closure of the proximal and distal portions of the abdominal incision, leaving a central gap for a plastic cylinder. Through this opening the surgeon’s hand can manipulate the abdominal contents. The peritoneal expander is attached to a self-retaining retractor. This method was designed to accelerate the heating process inside the abdomen and diminish the heat loss (De Simone et al, 2003). Some groups use HIIC and also EPIC in the same patient; only a few groups utilize EPIC alone as a preferential route of drug administration (Glehen et al, 2004). HIIC plus EPIC may have some disadvantages when compared with EPIC alone: • Hyperthermia is usually not used in EPIC; • Drug distribution depends on gravity; • This technique is more associated with a greater incidence of wound healing complications.

B. Hyperthermia Hyperthermia alone already has some cytotoxic properties that can be summarized as follows: inhibition of angiogenesis, induction of apoptosis, denaturation of essential proteins, impaired DNA repair and induction of heat-shock proteins which can be receptors for naturalkiller cells (Christophi et al, 1999; Dahl et al, 1999). Perhaps more important, chemotherapy has been shown to be potentiated by hyperthermia. The ideal temperature for specific chemotherapy agents have not been precisely determined, but it is between 41oC and 44oC. Above this temperature the heat will be cytotoxic to non-cancerous cells and cause destruction of the chemotherapy agents (Shimizu et al, 1991). Hyperthermia decreases interstitial pressure of the tumor nodules to a level expected for normal tissues. It also increases cell membrane permeability allowing a higher drug concentration inside tumor nodules (Storm, 1989; Leunig et al, 1992; Jacquet et al, 1998). Although hyperthermic enhancement of penetration deep into the cancer nodule has only been demonstrated for cisplatin and doxorubicin, it should occur also with other cytotoxic drugs (van der Vaart et al, 1998). Another benefit of higher temperatures is heat augmentation with selected drugs such as mitomycin C, cisplatin and doxorubicin (Storm, 1989). Some chemotherapy agents such as melphalan, cyclophosphamide and ifosfamide are synergized by heat to a great extent (Urano et al, 1999, 2002; Mohamed et al, 2003; Glehen et al, 2004).

C. Technique The timing of drug delivery can be classified as preoperative intraperitoneal chemotherapy; intraoperative intraperitoneal chemotherapy, usually associated with hyperthermia (HIIC); early postoperative intraperitoneal chemotherapy (EPIC); and long-term intraperitoneal chemotherapy (LTIC).

302

Cancer Therapy Vol 3, page 303

Figure 1. The â&#x20AC;&#x153;Coliseum techniqueâ&#x20AC;? for heated intraoperative intraperitoneal chemotherapy.

The delayed delivery of intraperitoneal chemotherapy produces the worst results (Sautner et al, 1994). In addition to the disadvantages presented by the closed technique, in this method the drugs are delivered after adhesion formation. This not only prevents treatment of the entire abdominal and pelvic cavity, but also allows viable tumor cells to become imbedded inside the scar of healing tissue. Trapped in scar tissue and under the stimulus of growth factors released by inflammatory cells, these cancer cells are in a sanctuary site and cannot be reached by chemotherapeutic drugs (Sugarbaker, 1990; Sugarbaker, 1996). The duration of the peritoneal washing with chemotherapy solution varies greatly. In the HIIC techniques, this period varies between 60 to 90 minutes. The volume and flow employed are also differences encountered among the groups; 3 liters of fluid, with a flow of 2L/minute can be considered an average (Glehen et al, 2004). In the EPIC technique the drug is administered as fast as possible and remains within the peritoneal cavity for 23 hours. An additional chemotherapy instillation occurs the next day. The EPIC usually is performed during the first five post-operative days. Changes in patient position facilitate drug distribution.

with complete healing of the abdomen and scar tissue accumulation after peritonectomy procedures (Sugarbaker et al, 1990). The peritoneal-plasma barrier has an important practical utility since it maintains a high concentration of the drug inside the peritoneal cavity with a lower plasma concentration. This diminishes the systemic toxicities that accompanies cancer chemotherapy treatment. From this data the ideal drug to be used should have the following characteristics: high molecular weight, fast systemic clearance and water solubility. For use as HIIC augmentation by hyperthermia and non-cell cycle specific cytotoxicity is desired. A large number of chemotherapeutic agents have been used for the treatment of peritoneal surface malignancies arising from gastrointestinal tumors. Mitomycin C is the most frequently used agent. The synergism between hyperthermia and mitomycin C has been demonstrated in the laboratory. Clinically, it has been found to be effective in the control of cancer lines with low growth rates and high chemotherapy resistance such as the mucinous appendiceal adenocarcinomas (Sugarbaker et al, 1999). Five-fluorouracil is an ideal agent to be used in EPIC, but not in HIIC, since the 5-fluorouracil does not show augmentation with hyperthermia and its cytotoxicity is cell-cycle related (Storm, 1989). Doxorubicin has proven to be an excellent drug to be used in HIIC. In a rat model, when used at 43oC, this drug showed a marked deep penetration without increasing plasma concentrations (Jacquet et al, 1998). These positive characteristics make this drug an appropriate choice in many tumors. At high doses and repeated treatments, peritoneal sclerosis is a limiting factor in dose escalation. Synergism between cisplatin and hyperthermia has been shown in several clinical trials. In animal models this finding was considered to be a consequence of higher and selective uptake of the drug by the cancer cells (Los et al, 1993). Thus, cisplatin clearly deserves special attention from investigators for use in HIIC.

D. Drugs The pharmacokinetics characteristics of intraperitoneal administration of chemotherapeutic agents are of great importance in the choice of drugs. Selected chemotherapy agents have a prolonged retention within the peritoneal cavity. In 1978 Dedrick and colleagues demonstrated that the peritoneal clearance of a drug is inversely proportional to its molecular weight. Further investigation confirmed that certain agents delivered into the peritoneal cavity will maintain higher levels inside the abdomen compared to the plasma levels. This finding is known as the peritoneal-plasma barrier. This is an inaccurate nomenclature; even after extensive stripping of the peritoneal surfaces there are no large changes in the clearance of the drugs. There is an increase in the barrier 303

Goldstein et al: Management of peritoneal carcinomatosis Oxaliplatin, used for several years in Europe, but only recently approved in the United States, was the subject of a pharmacokinetics study by Elias and colleagues (Elias et al, 2002). Their report showed that this agent achieved high tumor and intraperitoneal concentrations without toxic plasma levels. Since this drug has shown an impact in the systemic treatment of advanced colorectal cancer, it must be explored in the treatment of carcinomatosis secondary to colorectal tumors.

appendiceal adenoma. These tumors may have extensive intraperitoneal accumulation without local invasion, lymphatic infiltration or hematogenous dissemination. Thus, the use of peritonectomy procedures, even in bulky tumors, can eradicate all macroscopic disease and when combined with perioperative intraperitoneal chemotherapy leads to long-term survival.

B. Prior surgery score The occurrence of prior abdominal surgeries greatly influences the likelihood of complete cytoreduction. During surgery, cancer cells free in the peritoneal space have a tendency to adhere to raw surfaces such as sites of surgical dissection. These entrapped tumor cells may now grow along retroperitoneal structures such as the ureters and the vena cava. Abraided and surgically traumatized small bowel surfaces also are favored sites for cancer cells to implant. This deeper non-anatomical cancerous dissemination caused by prior abdominal surgery represents a major cause of incomplete cytoreduction and thus of limited survival. The â&#x20AC;&#x153;Prior Surgical Scoreâ&#x20AC;? (Table 1) was developed to quantitate the previous surgical trauma and to estimate the likelihood of a complete resection (Jacquet and Sugarbaker, 1996). This scoring system has proved to have a good correlation with prognosis in patients with mesothelioma (Sebbag et al, 2000) and pseudomyxoma peritonei (Sugarbaker and Chang, 1999) treated by cytoreductive surgery and intraperitoneal chemotherapy. Also, primary colon cancer with carcinomatosis may have a better prognosis that carcinomatosis with recurrent disease (Pestieau et al, 2000). Recommendations regarding primary gastrointestinal cancer operations need to change in order to minimize the prior surgical score. One must conclude that if unexpected carcinomatosis is found, modification of the first surgical intervention is required. For example, if mucinous carcinomatosis arising from a ruptured appendiceal neoplasm is observed in a patient thought to have appendicitis, a minimal dissection should be undertaken. Beyond appendectomy, the surgeon is advised to aspirate the free mucoid fluid and to perform generous biopsies to plan a future definitive combined treatment (Gonzalez and Sugarbaker, 2004). A right colectomy should not be performed to avoid deep entrapment of tumor cells in the groove between the psoas muscle and vena cava. A more common situation is patients presenting with obstructing colonic malignancies with peritoneal seeding. If the patient has a good performance status, the only procedures indicated are a decompressing ostomy and biopsies.

IV. Quantitative prognostic indicators When confronted in the operating room with peritoneal seeding from gastrointestinal cancer, the surgeon must make a decision regarding the possible risks and benefits of a definitive treatment versus supportive care. Although this combined treatment has proven to be the only possibility of cure for patients presenting with peritoneal carcinomatosis, one cannot forget the morbidity, mortality and cost that accompany the combined treatment. With the combined treatment strategy a proportion of patients will be free of disease and a second group will experience a better outcome with longer survival. However, as in most gastrointestinal cancer treatments, there will be a group of patients that will be treated with minimal benefit. The disease will continue to progress despite the treatment provided; sometimes these patients will have a worse clinical course due to the inappropriately excessive treatment. In an attempt to offer a suitable treatment for individual patients quantitative prognostic indicators have been developed. The peritoneal surface malignancy literature supports three pre-operative quantitative prognostic indicators: tumor histopathology, radiological features and prior surgical score. In the operating room after complete exploration of the abdomen and pelvis, the surgeon has another prognostic indicator that is an index to measure the tumor burden within the peritoneal surfaces. This is called the peritoneal cancer index (PCI). Unfortunately, the most reliable prognostic indicator to date can be assessed only after the surgical procedure. The completeness of cytoreduction score indicates the amount of tumor that could not be surgically resected.

A. Tumor histopathology The biologic behavior of the peritoneal surface malignancy is a major determinant of prognosis in these patients. Pancreatic adenocarcinomas with peritoneal seeding exemplify one clinical situation in which combined treatment is of no known value due the extremely aggressive behavior of this neoplasm. Gastric cancer patients represent another major challenge to the combined treatment since only those presenting small volume of peritoneal surface disease seems to have an improved life expectancy. Colon cancer patients are in an intermediate position. Even though these patients have a moderate amount of disease, if a complete cytoreduction is achieved, improvement in life expectancy may be observed. On the other hand there are the non-invasive tumors such as pseudomyxoma peritonei arising from an

Table 1. Prior surgical score (PSS) PSS-0 (none) PSS-1 (minimal) PSS-2 (moderate) PSS-3 (heavy)

304

Biopsy only Exploratory laparotomy, one region dissected Exploratory laparotomy, two to five regions dissected Extensive prior cytoreduction, more than five regions dissected

Cancer Therapy Vol 3, page 305 Only the debilitated patient that will not be a candidate for the combined approach should undergo definitive resection.

complete cytoreduction. Masses along the terminal ileum are common findings and can be resected with the cecum. These poor prognosis findings suggest a more advanced disease with an invasive component. Also, the nodules associated with the small bowel surfaces reflect the failure of the redistribution phenomenon, usually a result of previous surgical trauma or from end-stage of the disease.

C. Radiological features Pre-operative CT of chest, abdomen and pelvis are performed in invasive tumors such as gastric and colorectal cancer patients to exclude systemic disease. Unfortunately, there is no reliable radiological examination able to predict the intraperitoneal tumor burden or its distribution in invasive tumors. This lack of accuracy occurs as a result of the pattern of the cancerous growth in the peritoneal cavity. In contrast with solid organs such as the liver in which metastasis grow as nodules, aggressive cancerous implants spread along the contours of the peritoneal surfaces. This means that a negative pre-operative CT may have little value in quantitating carcinomatosis in invasive tumors (Jacquet et al, 1993). In contrast there are non-invasive malignancies for which CT represents a reliable tool to predict the success of a complete cytoreduction. In a retrospective analyses Jacquet et al, (1995) compared patients with mucinous tumors with complete and incomplete cytoreduction. The authors identified two radiological findings that were correlated with incomplete resection: • Signs of segmental small bowel obstruction • Tumor masses of 5 cm or greater diameter associated with the jejunum or the upper ileum or their mesentery. The association of both findings in the same patient indicated a likelihood of less than 5% to achieve a

D. Peritoneal cancer index The extent of carcinomatosis has proven to be directly related to the likelihood of a complete cytoreduction and thus with survival. With the intent to quantitate the extent of intraperitoneal disease Jacquet and Sugarbaker described the PCI. The PCI (Figure 2) is a score obtained in the operating room with surgical exploration after the release of adhesions (Jacquet and Sugarbaker, 1996). The peritoneal space is divided into 13 abdominopelvic regions as seen in Table 2. Then, the largest tumor nodule within each anatomical location is measured. A value that goes from 0 to 3 is given to each of the 13 regions according to the size of the largest nodule found in the region. The number of nodules in each area is not counted but only the size of the largest nodule is registered. Then the PCI is calculated by the sum of the 13 values recorded; the PCI will range from 0 to 39 (13x3). The PCI has two distinct roles. First, it provides an objective parameter for the surgeon that can be used in the decision-making process regarding the choice of the most suitable treatment for an individual patient. Second, the

Figure 2. The “Peritoneal Cancer Index” for staging peritoneal malignancies.

305

Goldstein et al: Management of peritoneal carcinomatosis Table 2. Description of the anatomic structures included in each of the 13 abdominopelvic regions used to calculate the Peritoneal Cancer Index (PCI). Regions 0 Central 1 Right upper 2 Epigastrium 3 Left upper 4 Left flank 5 Left lower 6 Pelvis 7 Right lower 8 Right flank 9 Upper jejunum 10 Lower jejunum 11 Upper ileum 12 Lower ileum

Anatomic structures Midline abdominal incision – entire great omentum – transverse colon Superior surface of the right lobe of the liver – undersurface of the right hemidiaphragm – right retrohepatic space Epigastric fat pad – left lobe of the liver – lesser omentum – falciform ligament Undersurface of the left hemidiaphragm – spleen – tail of pancreas – anterior and posterior surfaces of stomach Descending colon – left abdominal gutter Pelvic sidewall lateral to the sigmoid colon – sigmoid colon Female internal genitalia with ovaries, tubes and uterus – bladder – Douglas pouch – rectosigmoid colon Right pelvic sidewall – cecum – appendix Ascending colon – right abdominal gutter Including both bowel and its mesentery Including both bowel and its mesentery Including both bowel and its mesentery Including both bowel and its mesentery

PCI is a tool that facilitates standardization of patients among researches at different institutions for better communication and evaluation of the results obtained with the combined treatment. Despite the detailed information provided by the PCI, two important caveats are necessary. There are some patients with low PCI but with very guarded prognosis. This usually occurs in aggressive tumors with spread restricted to vital and unresectable anatomic sites such as the porta hepatis, the ureters, or the small bowel. A second caveat regarding PCI concerns patients with non-invasive tumors that even in the presence of high PCI score can achieve a complete cytoreduction. Pseudomyxoma peritonei patients may have a large PCI but should still have definitive treatment. This finding can be explained in part due to the redistribution phenomenon and small bowel sparing that occurs in non-invasive mucus-producing tumors such as pseudomyxoma peritonei. With these exceptions in mind, the PCI has prognostic implications in the survival in patients with colorectal, gastric and non-mucinous appendiceal tumors submitted to the combined treatment (Pestieau and Sugarbaker, 2000; Yonemura et al, 2003; Mahteme and Sugarbaker, 2004). Other scores have been described such as the Gilly peritoneal carcinomatosis staging (Gilly et al, 1994), the carcinomatosis staging of the Japanese Research Society for Gastric Cancer (Fujimoto et al, 1997) or the Dutch simplified peritoneal carcinomatosis assessment (van der Vange et al, 2000). These scoring systems may be simpler but lack the precision when compared with the PCI.

As described by experimental studies and confirmed in clinical trials, when there are large residual nodules intraperitoneal chemotherapy is unable to eradicate peritoneal surface disease. Some treatment centers suggest that residual large nodules present within the peritoneal cavity indicate that intraperitoneal chemotherapy should be avoided (Katz and Barone, 2003). However, minute nodules may be successfully treated by intraperitoneal chemotherapy. This concept raises the question of what would be a complete cytoreduction. Sugarbaker described the completeness of cytoreduction score (CCS) to measure the amount of disease left behind (Sugarbaker and Jablonsky, 1995). The important information for the CCS is not the number of nodules remaining, but the size of the largest nodules. The cutoff value used in this score to separate complete from incomplete cytoreductions is dependent on the penetration achieved by the chemotherapy into the cancer nodules. Considering these concepts and the pharmacokinetics studies Sugarbaker describes the CCS for mucinous appendiceal malignancy as follows (Figure 3): • CC-0: no visible tumor • CC-1: no nodule larger than 0.25 cm • CC-2: nodules between 0.25 cm and 2.5 cm • CC-3: nodules larger than 2.5 cm or a layering of cancer at any site. Patients with no tumor greater than 0.25 cm (CC-0 and CC-1) after surgery are in the group considered as complete cytoreduction since chemotherapy can penetrate these small nodules. However, clinical trials have shown that patients with CC-2 or CC-3 score have a uniformly poor prognosis (Sugarbaker and Chang, 1999; Loggie et al, 2000; Pestieau and Sugarbaker, 2000). The CCS has proven to be the strongest quantitative prognostic indicator in gastrointestinal cancer patients with peritoneal seeding that were treated with the use of this combined approach independent of the site of origin. This result has been demonstrated by several

E. Completeness of cytoreduction score (CCS) A profound determinant of survival is the volume of tumor remaining after cytoreductive surgery that will be treated with perioperative intraperitoneal chemotherapy.

306

Cancer Therapy Vol 3, page 307

Figure 3. Completeness of cytoreduction score (CC score) after cytoreductive surgery.

groups involved in the management of peritoneal surface malignancies in appendiceal, colorectal and gastric malignancy (Loggie et al, 2000; Pestieau and Sugarbaker, 2000; Elias et al, 2001; Yonemura et al, 2003; Pilati et al, 2003; Glehen et al, 2004). One must consider that the CCS should be individualized according to the site of origin of the primary cancer, considering that the penetration of the chemotherapy inside of a tumor nodule is dependent on the intrinsic interstitial pressure of each malignancy. Thus, for more aggressive neoplasms such as gastric cancer that produce hard peritoneal surface nodules, the cutoff value may be 1 mm or less. More studies are needed to establish precise CCS for the different gastrointestinal cancer sites.

regimens evolved during the 22 years of the study. Seven patients treated early in this experience received only EPIC, while thirteen patients received HIIC mitomycin C at the end of the surgical procedure plus EPIC (5fluorouracil). Carcinoid syndrome was noted in only one patient. Survival rates at 2 and 5 years were 39% and 25% respectively. The PCI and CCS were significant determinants of survival, but the extent of previous surgery was not (Mahteme and Sugarbaker, 2004). The epithelial tumors of the appendix can be divided into mucus-producing neoplasms and intestinal adenocarcinomas. The last subtype represents approximately 10% of the appendiceal malignancies. Its biologic behavior is similar to colorectal tumors and carcinomatosis from this non-mucinous tumor should be treated as a colonic adenocarcinoma. The carcinomatosis arising from mucus-producing appendiceal neoplasms are collectively grouped under the term “Pseudomyxoma peritonei” due to the characteristic mucoid ascites. However, these neoplasms do not have a uniform prognosis. Ronnett and colleagues after their study of 109 patients with pseudomyxoma peritonei treated by cytoreductive surgery and intraperitoneal chemotherapy developed a classification with clear prognostic value. According to this classification a minimally invasive and histologically bland pseudomyxoma peritonei occurs in patients with mucoid ascites as a result of ruptured appendiceal adenomas. This type of peritoneal surface malignancy is referred to as diffuse peritoneal adenomucinosis (DPAM). This group of patients presents an excellent prognosis since it is a disease that is restricted to the peritoneal cavity and thus if combined treatment is successfully completed it will lead to cure in 85% of patients. These authors showed, in contrast, an aggressive behavior of the mucus-producing adenocarcinomas referred to as peritoneal mucinous adenocarcinomas (PMCA). There is also a third subtype that is similar to DPAM but with isolated foci of PMCA, the “hybrid type” (Ronnett et al, 1995). Sugarbaker et al, (1999) reported on the treatment of 385 patients with appendiceal mucinous malignancies with a mean follow-up of 37.6 months. A complete cytoreduction (CC-0 and CC-1) was obtained in 250 patients. They showed approximately 80% 5-year survival, while patients with CC-2 or CC-3 cytoreductions reached

V. Results of clinical trials A. Appendiceal tumors Appendiceal malignancies correspond to approximately 1% of all tumors arising from the large bowel. Three distinct histopathologic tumors have been described as primary neoplasms from the appendix: carcinoid, adenocarcinoma and tumors with features from both, designated adenocarcinoid tumors. Carcinoid tumors account for approximately two-thirds of all appendiceal malignancies, however carcinomatosis from this primary site is exceptional with only one case reported in the literature (Vasseur et al, 1996). A small percentage of carcinoid tumors have mucus producing epithelial cells associated. This uncommon combined feature is known as adenocarcinoid and represents less than 5% of all appendiceal tumors. Adenocarcinoid tumors of the appendix spread frequently to the peritoneum (Aizawa et al, 2003; Mahteme and Sugarbaker, 2004). Carcinoid syndrome in these patients is usually not seen. The limited survival observed in these patients show that their prognosis is more dependent on the progression of malignant epithelial cells than on the carcinoid component. A recent study in the literature regarding the use of this combined approach for the treatment of patients with peritoneal carcinomatosis arising from adenocarcinoid tumors was reported by Mahteme and Sugarbaker. From 810 patients with peritoneal malignancy of appendiceal origin treated by cytoreductive surgery and intraperitoneal chemotherapy, 22 patients (2.7%) had adenocarcinoid. The treatment 307

Goldstein et al: Management of peritoneal carcinomatosis only a 20% 5-year survival (Figure 4). As expected, patients with DPAM did better than patients with PMCA or the hybrid subtype. The prior surgical score also showed to be an important statistically significant prognostic indicator. These favorable results are shared by other groups experienced in the use of the combined treatment (Table 3). Appendiceal malignancies with peritoneal seeding are considered the paradigm for success of the combined treatment. This good outcome occurs as a result of four features that are unique for appendiceal tumors (Sugarbaker and Chang, 1999). First, these tumors demonstrate a wide spectrum of invasion, with the

majority exhibiting a noninvasive histology. Second, the appendix has a tiny lumen that is obstructed early in the development of these tumors leading to perforation and release of epithelial cells into the peritoneal cavity early in the natural history of the disease. Symptomatic carcinomatosis will result in treatment prior to lymph node or hematogenous metastasis. Third, the texture of mucinous tumors is compatible with a deep penetration by the chemotherapeutic agent. Fourth, since these neoplasms are restricted to the peritoneal cavity, if the residual microscopic disease is sensitive to the intraperitoneal chemotherapy all the cancer may be eradicated and the patient will survive long term.

Figure 4. Influence of complete cytoreduction (CC-0 or CC-1) in the prognosis of patients with pseudomyxoma peritonei from appendiceal origin treated by peritonectomy procedures and perioperative intraperitoneal chemotherapy. Reproduced from Sugarbaker and Chang, 1999 with kind permission from Annals Surgical Oncology.

Table 3. Literature review of cytoreductive surgery and perioperative intraperitoneal chemotherapy as a treatment for mucinous appendiceal tumors with peritoneal dissemination Author

Year

Institution

Sugarbaker

1999

Witkamp Piso Shen

2001 2001 2003

Deraco Guner

2004 2004

Washington DC Amsterdam Regensburg WinstonSalem Milan Hanover

Loungnarath

2005

Lyon

No. of Patients 385

Method

5 year

Morbidity

Mortality

MMC

3 year survival 74%

63%

27%

2.7%

46 17 23

MMC Cisplatin MMC

81% 75% 61%

NA NA NA

39% 63% NA

8% 11% NA

33 28

Cisplatin/MMC Cisplatin/MMC/ 5FU Cisplatin/MMC

NA NA

96% 75%

33% 36%

3% 7%

80%

50%

44%

308

Cancer Therapy Vol 3, page 309 Esquivel and Sugarbaker showed, (2001) that patients with relapse of mucinous appendiceal malignancies should be treated again by the combined approach. If a complete cytoreduction is achieved at reoperation then the chance of long-term survival will be similar to the first intervention. Even a third or fourth reoperation may have palliative benefit in selected patients and prolong survival (Mohamed et al, 2003). The pattern of recurrence after combined treatment using cytoreductive surgery plus EPIC was described (Zoetmulder and Sugarbaker, 1996). From 118 consecutive patients evaluated, only three exhibited metastatic disease. Nine patients developed pleural disease; however, in all of them the pleural cavity had been entered by dissection of the hemidiaphragm in the previous surgery. Two anatomic sites were the most common places for recurrence: small bowel surface and left sub-hepatic space along the lesser curvature of the stomach. Also it was noted that in 52% of the patients that recurred, disease was present within their abdominal scar. Of great importance was to the finding that 60% of all recurrences occurred within suture lines. These data reinforced the need to perform the intraperitoneal chemotherapy prior to the intestinal reconstruction and prior to abdominal closure (Zoetmulder and Sugarbaker, 1996).

decade of time suggest these studies a reliable historical control group. Several phase II studies have demonstrated long-term survival in peritoneal carcinomatosis secondary to colorectal cancer when the combined treatment modality is used (Table 4). In 2004, a retrospective multicenter study reported the experience of 28 institutions used cytoreductive surgery and perioperative intraperitoneal chemotherapy (Glehen et al, 2004). The evaluation of 506 patients treated by the combined approach revealed an overall median survival of 32.4 months when complete cytoreduction was obtained. Despite differences in the protocols of the participating centers, the median survival achieved in this retrospective study was approximately 3 times higher than the historical controls. The majority of the researchers combine cytoreductive surgery with hyperthermic intraoperative intraperitoneal chemotherapy alone. In this study two hundred seventy-one patients underwent HIIC alone (53.5%), 123 underwent EPIC alone (24.3%) and 112 (22.2%) were submitted to both HIIC and EPIC treatments. The chemotherapeutic agents used were not similar among the centers and neither were the doses of the drugs employed. In addition, both open technique and the closed system were used to perform the intraperitoneal chemotherapy washing. Even though a better outcome (never seen before in this group of patients) has been demonstrated by phase II studies, one could suggest that selection bias would be responsible for these good results. Only through phase III studies would this method be definitely validated as standard of care for these patients. In 2003, Verwaal and colleagues published the first prospective randomized trial regarding the combined approach for patients with carcinomatosis from colorectal cancer (Verwaal et al, 2003). In this study, 105 patients were randomly assigned to receive systemic chemotherapy (control group) or cytoreductive surgery plus HIIC followed by the same systemic chemotherapy employed in the control group. After a median follow-up of 21.6 months, the median survival was 12.6 months in the control group and 22.3 months in the experimental group (p=0.032). The mortality in the experimental group was 8%. This first clinical trial established the beneficial effect that the combined treatment might have in peritoneal carcinomatosis arising from colorectal cancer as compared to the standard of care.

B. Colorectal cancer The natural history of peritoneal carcinomatosis arising from colorectal tumors is well known and marked by the lack of improvement with any treatment used. In 1989, Chu and colleagues evaluated 45 colorectal patients with peritoneal carcinomatosis and found a median survival of 6 months (Chu et al, 1989). The EVOCAPE-1 study reported a median survival of 6.9 months for these patients (Sadeghi et al, 2000). More recently, Jayne et al, (2002) from Singapore related a median survival of 7 months in patients with peritoneal carcinomatosis of colorectal origin. In these three studies, the 5-year survival was 0%. In general, the authors of phase II studies that employ the combined aggressive approach for the treatment of peritoneal seeding arising from colorectal malignancies, use these historical controls to evaluate their results. The similar median survival seen in these three studies, ranging from 6 to 7 months, the uniform absence of long-term survivors and consistent survival data over a

Table 4. Results of phase II trials that combined aggressive cytoreduction with perioperative intraperitoneal chemotherapy for the treatment of patients with carcinomatosis of colorectal origin Author Mahteme Glehen Shen Pilati Glehen Elias Pestieau Verwaal

Journal Br J Cancer Br J Surg Ann Surg Oncol Ann Surg Oncol J Clin Oncol Cancer Dis Colon Rectum Br J Surg

Year 2004 2004 2004 2003 2004 2001 2000 2004

309

Median survival 32 32.9 28 18 32.4 35.9 24 21.6

Goldstein et al: Management of peritoneal carcinomatosis However, many oncologists desire to have a second randomized trial. Unfortunately, previous experience has shown that the randomization of patients into this kind of study can be very difficult. In 1995, Elias designed a prospective randomized trial involving patients with colorectal peritoneal carcinomatosis. Systemic chemotherapy would be used in the control group to be compared to maximal cytoreduction plus EPIC. He reports that this trial was rapidly abandoned due to the great dissatisfaction with inclusion criteria in six of the first seven eligible patients; the patients were fully aware of the futility of the control arm of the study. Then, the design of the trial was modified. The control group would now receive maximal cytoreductive surgery and systemic chemotherapy while the experimental arm would be treated by cytoreductive surgery and EPIC plus similar systemic chemotherapy. However, during the 4 years of study only 35 patients were enrolled in this phase III randomized study in spite of the 90 patients that were necessary. There were enough eligible patients, but most of them refused to be randomized in the trial. They asked to be enrolled in the phase I-II trials involving HIIC (Elias and Pocard, 2003; Elias et al, 2004). The experience of this French group reflects a changing proactive behavior of patients who refuse to be randomized in a control group with well-known established poor prognosis. Future trials will probably be designed to standardize the most effective features of the combined approach instead of denying an effective treatment for the control group. However, one should not assume that this combined treatment is suitable for all patients with peritoneal carcinomatosis arising from colorectal cancer. As in all surgical treatments for cancer it is important to exercise proper patient selection. Several quantitative prognostic indicators have been identified. For colorectal tumors there are two prognostic indicators that have shown to be reliable; the PCI and the CCS. In patients with colorectal carcinomatosis, Pestieau and Sugarbaker reported that a PCI of 10 or less was associated with a five-year survival rate of 50%; a PCI between 10 and 20 carried a 5-year survival of 15%; a PCI greater than 20 resulted in no 5-year survivals (Pestieau and Sugarbaker, 2000). Elias in 2001, also using mitomycin C as the intraperitoneal chemotherapy agent, reported an improved prognosis when the PCI was lower than 16. Patients with PCI below 16 had a 3-year survival rate of 60.3% versus 32.5% in patients with PCI above this cutoff (Elias et al, 2001). More recently, the same French group using intraperitoneal oxaliplatin combined with systemic 5-fluorouracil and leucovorin used a PCI of 24 to separate patients with good prognosis from those with restricted long-term survival (Elias et al, 2002). These studies demonstrate that the PCI be used to separate patients who are likely to benefit from this aggressive combined treatment from those patients who should be treated with palliative intent. The numerical value for this PCI cutoff must be determined for a particular treatment regimen in a specific carcinomatosis disease state. In other words the critical PCI for colorectal cancer, gastric cancer and appendiceal cancer will all be different. Most likely,

the more aggressive the cancer and the more heavily pretreated the patient, the lower the PCI that will be associated with long-term survivors. The second quantitative prognostic indicator of predictive value in colorectal carcinomatosis in CCS. In the multicentric analysis performed by Glehen, the actuarial survival rate at 1-year, 3-years and 5-years for patients classified as CC-0 or CC-1 were 87%, 47% and 31%, respectively (Glehen et al, 2004). Shen and colleagues reported on 77 colorectal cancer patients treated by the combined approach. The 5-year survival rate for complete resection of all visible disease was 34% with a median survival of 28 months (Shen et al, 2004). In 2000, Sugarbaker reported the results of 104 patients with peritoneal seeding from colorectal cancer. The median overall survival for patients with complete cytoreduction was 24 months with a 30% 5-year survival, whereas patients with incomplete cytoreduction had a median survival of 12 months and 0% 5-year survival (Pestieau and Sugarbaker, 2000). Other prognostic factors to be recognized in colorectal carcinomatosis patients were the use of neoadjuvant chemotherapy, lymph node involvement, presence of liver metastasis, poor histological differentiation, presence of signet ring cell type and location of the primary tumor in the rectum. The presence of these clinical features has been associated with poor prognosis (Gomez-Portilla et al, 1999; Marcus et al, 1999; Elias et al, 2001; Carmignani et al, 2004; Glehen et al, 2004; Knorr et al, 2004). Gomez-Portilla et al, (1999) evaluated 86 patients with peritoneal carcinomatosis from colorectal origin with a median follow-up of 36.2 months. These authors showed that second-look operations were more likely to be successful if patients had a complete cytoreduction at the time of first surgery. They concluded that second-look surgery should be considered a treatment option in patients who could fulfill two criteria: First, they had a complete initial cytoreduction and second, a new complete resection was judged possible (Gomez-Portilla et al, 1999). Similar findings were reported by Verwaal et al, (2004).

C. Gastric cancer 1. Background and rationale Among gastrointestinal cancers discussed in this paper, gastric cancer with peritoneal seeding deserves special attention because of its aggressive behavior and short median survival. In most gastric carcinomatosis patients this new combined treatment should first of all be considered a good palliation; in a small percentage of patients hope for cure may be realistic. A review of multiple journal articles over the last 20 years supports palliative resections, even total gastrectomy if necessary, as the treatment of choice in selected patients with stage IV gastric cancer (Table 5). Complete removal of the primary cancer has a statistically significant improvement not only in survival, but also a better quality of life for these patients. The rationale for palliative resection of the primary gastric cancer is to eliminate the serious complications that can result from the primary malignancy. These are most 310

Cancer Therapy Vol 3, page 311 Table 5. Journal articles since 1980 from English literature supporting palliative gastrectomy Reference Ekbom and Gleysteen a

Location Milwaukee, WI

GITSG

Washington, DC

Meijer et al. a

Amsterdam, Netherlands

Boddie et al. b

Houston, TX

Bozzetti et al.

Milan, Italy

Hallissey et al.

Birmingham, UK

Butler et al. a Haugstvedt et al b Monson et al. a

Torrance, CA Norway Rochester, NY

Ouchi et al. a

Natori, Japan

Kikuchi et al.

Kanagawa, Japan

a b

Treatment and no. No resection, 20 Palliative gastrectomy, 147 No resection, 53 Palliative gastrectomy, 147 No resection, 25 Palliative gastrectomy, 26 No resection, 21 Palliative gastrectomy, 45 No resection, 185 Palliative gastrectomy, 61 No resection, 9,597 Palliative gastrectomy, 884 Palliative total gastrectomy, 27 No resection, 311 No resection, 226 Palliative gastrectomy, 53 No resection, 31 Palliative gastrectomy,64 No resection, 59 Palliative gastrectomy,63

Survival 0% (2 year minimum) 16% (2 year minimum) P < 0.05 4.2 m (median) 9.6 m 3.6 m (median) 10.4 m 3.0 m 8.0 m P < 0.001 15.0 m 4.0 m (median) 3.5 m (median) 19.0 m 6.0 m P < 0.01 12.0 m 5.5 m P < 0.0001 12.2 m

Marked symptom relief documented Marked patients for symptoms and stage

commonly obstruction, perforation and bleeding. Another rationale for the resection of the primary tumor is more theoretical. By Skipperâ&#x20AC;&#x2122;s log-kill hypothesis, if a significant proportion of the tumor burden is removed, then both systemic and intraperitoneal chemotherapy are expected to show a greater response (Skipper et al, 1952). This may have a particular importance in gastric cancer because it is a chemotherapy-resistant tumor. In the absence of liver or systemic metastases, the primary gastric tumor should not be considered unresectable prior to laparotomy. As long as the primary lesion and the organs it invades can be removed without significant morbidity, an attempt should be made to resect regardless of size. Leaving the gastric mass behind not only allows obstruction, bleeding and perforation during the chemotherapy treatment, but also diminishes the likelihood of a meaningful response from the chemotherapeutic drugs. Peritonectomy can be used to further reduce and, in some patients, even eliminate all visible carcinomatosis. In this situation, the response to subsequent intraperitoneal and systemic chemotherapy should be maximized. Sugarbaker reported, (1995) the use of five different peritonectomy procedures for carcinomatosis from gastric cancer. The goal of these procedures is to reduce the intraperitoneal burden of tumor to a microscopic level, which can then be knowledgeably treated by both intraperitoneal and systemic chemotherapy. The peritonectomy procedures utilized for gastric cancer patients have been described previously. In discussing the peritonectomy procedures for gastric cancer it needs to be emphasized that these resections are performed selectively; rarely are all procedures performed in a single patient. Peritoneum that

is involved by carcinomatosis is removed but normal peritoneum is spared. Unfortunately, peritoneum on the small bowel surface invaded by cancer nodules often cannot be removed. Yonemura et al, (1999) expanded the visceral peritonectomy in gastric cancer with peritoneal dissemination. Beyond a subtotal or total gastrectomy, the peritonectomy may involve a total colectomy if it proves to be necessary for removal of gastric cancer implants. This combination of procedures allows the surgeon to perform a total parietal peritonectomy and a very extensive visceral peritonectomy which is limited most of times by the risk of short bowel syndrome. Intraperitoneal chemotherapy has as its objective the eradication of the microscopic residual disease and tiny tumor nodules that the surgeon cannot see or cannot remove because of a diffuse involvement of small bowel peritoneum. Conceptually, the peritoneal cavity may qualify as a â&#x20AC;&#x153;pharmacologic sanctuaryâ&#x20AC;? because intravenously injected drugs penetrate poorly at this site (Dedrick et al, 1978). This limited access to peritoneal implants may be one reason why patients with gastric cancer presenting with peritoneal seeding respond so poorly to systemic chemotherapy.

2. Gastrectomy chemotherapy

plus

intraperitoneal

In 1988 Fujimoto and colleagues from Chiba, Japan presented their initial experience in patients with gastric cancer and peritoneal seeding treated with gastrectomy and intraperitoneal hyperthermic perfusion with mitomycin C and misonidazole. All 15 of their patients tolerated the procedure well. They maintained the

311

Goldstein et al: Management of peritoneal carcinomatosis temperature inside of the peritoneal cavity at 43oC to 44.5oC (Fujimoto et al, 1988). One year later the same authors reported on 59 patients that received gastrectomy combined with intraperitoneal hyperthermic perfusion with mitomycin C (Fujimoto et al, 1989). Compared with historical controls, the patients of the protocol showed a statistically significant improvement in survival (p=0.001). The results were most impressive in patients who had demonstrated peritoneal seeding. Median survival of the untreated group was approximately 6 months. Median survival of the patients treated with intraperitoneal chemohyperthermia was approximately 18 months (p=0.001). In 1990 Fujimura and colleagues from Kanazawa, Japan reported on continuous hyperthermic peritoneal perfusion for the treatment of peritoneal dissemination of gastric cancer. Thirty-one patients with gastric cancer and peritoneal dissemination received cisplatin and mitomycin C. All but one of these patients had peritoneal dissemination assessed as P3. The peritoneal fluid was heated between 41 oC and 43 oC. A special peritoneal cavity expander was used in an attempt to improve distribution of chemotherapy and heat so that the surgeon could manipulate the small bowel with his hand during the chemotherapy treatments. Two of their patients survived more than 2 years (6%). Noh et al from Seoul, Korea reported on 23 patients who had gastric resection plus intraoperative intraperitoneal chemotherapy and early postoperative intraperitoneal chemotherapy. These patients were compared to 17 who had no resection and systemic chemotherapy. Two patients died after resection. The mean survival in the resection group was 7 months as compared to 5 months in the non-resection group. These authors suggested that cytoreductive surgery plus intraoperative and early postoperative intraperitoneal chemotherapy appears to be relatively safe and provides an improved outcome (Noh et al, 1995). Yu et al from Taegu, Korea reported on the treatment of 64 patients with resectable stage IV gastric cancer (Yu et al, 1998). Half of these patients had gastrectomy only and half underwent gastrectomy plus early postoperative intraperitoneal chemotherapy with mitomycin C and 5fluorouracil. The median survival was 4.9 versus 27.8 months (p=0.0098). These reports demonstrate the benefit in gastric cancer of treating patients with established peritoneal implants with gastrectomy plus intraperitoneal chemotherapy. However new data has supported the use of peritonectomy procedures in selected patients at the time of resection of the primary gastric cancer.

3. Gastrectomy procedures combined chemotherapy

plus with

with hyperthermic intraperitoneal chemotherapy for the treatment of gastric cancer with peritoneal dissemination. In 1991, these authors published results on 41 patients with peritoneal dissemination of gastric cancer in the absence of liver metastasis. The overall median survival was 14.6 months with a 3-year survival in 4 patients (9.8%). The procedure also had a favorable impact on the relief of symptoms. In 7 of 9 patients who had ascites, the ascites disappeared after continuous hyperthermic peritoneal perfusion. These authors suggest that continuous hyperthermic peritoneal perfusion with mitomycin C and cisplatin is of benefit in the treatment of gastric cancer patients with peritoneal dissemination (Yonemura et al, 1991). Yonemura and colleagues updated their experience in 1995. They reported on 43 patients who had peritonectomy in addition to continuous hyperthermic peritoneal perfusion with mitomycin C, cisplatin and etoposide. Patients who had a complete cytoreduction had a mean survival of 419 days, a 1-year survival of 61% and a 5-year survival of 17%. Patients who had residual disease had a mean survival of 205 days, a 1-year survival of 30% and a 5-year survival of 2%. The survival of patients with complete cytoreduction (n=28) as compared to patients with residual disease (n=55) was significantly different (p=0.034). Twenty-eight patients underwent a second-look surgery. In 8 patients who had a complete response recorded at the time of the second-look operation, there was a 47% five-year survival. These authors concluded that chemotherapy was most effective in those patients who had a small tumor burden as a result of cytoreductive surgery because this is the clinical situation in which there is a maximal response to chemotherapy. They suggested that cytoreductive surgery and continuous hyperthermic peritoneal perfusion are an effective treatment strategy for peritoneal dissemination of gastric cancer (Yonemura et al, 1995). The findings of this study also show that the results of treatment are greatly affected by proper patient selection. In 1995 these authors updated this information reporting on the effects of this treatment in 83 patients (Yonemura et al, 1995). The overall one-year survival was 43% and 5-year survival was 11%. Again, patients who underwent a complete cytoreduction survived significantly longer than those with residual disease and those with a complete response to chemotherapy as observed at the time of the second-look operation survived longer than those with a partial response or no response. Hirose et al, (1999) from Fukui, Japan, reported on hyperthermic peritoneal perfusion to treat gastric cancer with peritoneal metastasis in 17 patients. Patients given the combined treatment had a significantly better survival than 20 control patients. There was an 11-month versus 6month median survival time and a one-year survival rate of 44% versus 15% (p=0.00479). All 5 patients who had a complete cytoreduction prior to continuous hyperthermic peritoneal perfusion survived more than 14 months. A Cox multivariate regression analysis showed that complete resection of localized peritoneal metastasis was an independent prognostic factor (p=0.0062). In these patients, continuous hyperthermic peritoneal perfusion

peritonectomy intraperitoneal

In theory and in practice, the more complete the surgical eradication of gastric cancer prior to initiation of chemotherapy, the greater the likelihood of cancer eradication. Yonemura and colleagues are the pioneers in the combination of gastrectomy plus cytoreductive surgery 312

Cancer Therapy Vol 3, page 313 was not a statistically independent prognostic variable (Hirose et al, 1999). Yoo and colleagues reported the effectiveness of early postoperative intraperitoneal chemotherapy on 91 patients with stage IV gastric cancer. Additional cycles of intraperitoneal chemotherapy were administered on a monthly basis for four cycles. The results were compared with those from 140 historical controls who had surgery only. The overall 3-year survival in the group treated with chemotherapy was 17.5% and in the surgery alone group it was 11.4% (Yoo et al, 1999).

advantage was not seen in three studies, but the trend with small number of patients was for benefit with adjuvant intraperitoneal chemotherapy. Moreover, peritoneal recurrence was shown to be lower in two study groups treated with perioperative intraperitoneal chemotherapy (Hamazoe et al, p=0.0854; Fujimoto, p<0.0001). Taken together, these reports strongly suggest improved overall survival in the adjuvant-treatment group, which received chemotherapy given intraoperatively or immediately following surgery, as compared with patients who underwent gastrectomy alone. Of interest is a report by Sautner and colleagues who randomized patients to receive or not receive intraperitoneal cisplatin between postoperative days 10 and 28 after gastrectomy. No improvement in survival was seen (Sautner et al, 1994). It has been suggested that both the route (intraperitoneal vs systemic) and the timing (perioperative vs delayed) of this surgically directed chemotherapy were crucial factors in the benefits observed in adjuvant gastric cancer trials (Sugarbaker et al, 1990). The negative results of the Sautner study supports the tumor cell entrapment hypothesis as an important factor of failure in the treatment of peritoneal seeding. This study was not included in Table 6 or in the meta-analysis since it did not adhere to the principles required for the adequate treatment of peritoneal surface malignancies. Certain groups of randomized patients benefited more from perioperative intraperitoneal chemotherapy than other groups. A study by Ikeguchi and colleagues did not show statistically significant benefits for all patients of the trial. However, in 72 patients who had 1-9 positive nodes, the survival rate was 44% in the control group and 66% in patients treated by intraperitoneal chemotherapy (Ikeguchi et al, 1995). In the study by Yu et al, (1998) patients with N2-positive lymph nodes had 5-year survival rate of 15% in the control group and 44% in patients treated by intraperitoneal chemotherapy (p=0.03). Patients with lymph nodes positive for gastric cancer may be at special risk for local-regional cancer dissemination, which perioperative intraperitoneal chemotherapy can eradicate. Investigators must use some caution when interpreting the results of these randomized studies of adjuvant perioperative intraperitoneal chemotherapy. Because of the difficulty of accurately staging patients prior to treatment, some patients with resectable stage IV cancer were included in the randomization. Therefore, true adjuvant results are combined with the use of intraperitoneal chemotherapy in patients with stage IV cancer who were able to have a gastrectomy. These eight prospective randomized trials for the adjuvant treatment of gastric cancer may be suitable for metaanalysis. They involved only patients with a well-defined clinical entity: resectable gastric cancer without visible peritoneal seeding. They represent all randomized clinical trials that have been presented to date, with no exclusions. Also, the trials were sufficiently similar in terms of treatment to make the calculation of average effects medically meaningful. The average treatment effect has a hazard ratio of 1.75. In other words, a patient with resectable gastric cancer treated by gastrectomy plus perioperative intraperitoneal chemotherapy was almost 2

4. Prevention of peritoneal carcinomatosis in patients with gastric cancer treated with intent to cure Analyses of recurrence patterns after potentially curative resections of primary gastric cancer have shown that local and intra-abdominal sites of progressive disease have an impact on survival. They are the only site of first recurrence in approximately 50% of patients. Even at death, the tumor often remains confined to the abdomen (Gunderson and Sosin, 1982; Wisbeck et al, 1986; Landry et al, 1990). The anatomic sites of treatment failure with postoperative systemic adjuvant chemotherapy treatments or neoadjuvant chemotherapy are essentially the same as those observed after surgery alone (Bruckner and Stablein, 1983; Wils, Meyer and Wilke, 1994). After extended lymphadenectomy, the peritoneal surfaces and the liver remain the major sites of recurrence; the rate of localregional relapse is considerably lower when compared to recurrence patterns with more limited surgery (Maruyama et al, 1987; Kaibara et al, 1990; Korenaga et al, 1992). From this analysis of the clinical data on surgical treatment failure, perioperative intraperitoneal chemotherapy as an adjuvant to surgery may be considered a rational therapeutic modality. There is a strong theoretical basis for the use of perioperative intraperitoneal chemotherapy as a planned part of primary gastric cancer surgery. The tumor cell entrapment hypothesis suggests that surgical manipulation of the cancerous stomach, transection of lymphatic channels and blood loss from the cancer specimen result in free intraperitoneal cancer cells. These cells become fixed in fibrin and tumor progression is enhanced by the woundhealing process. All available data indicate that gastric cancer cells present in the peritoneal cavity are always lethal (Boku et al, 1990; Fujimura et al, 1997; Bando et al, 1999; Kodera et al, 1999). Eight studies were identified reviewing publications over the last 20 years in the English language that reported on the use of perioperative intraperitoneal chemotherapy in patients who had potentially curative resection of their primary gastric cancer. Perioperative chemotherapy was used during the surgical procedures in seven studies and immediately after surgery in one trial. All eight studies were prospective and randomized. Table 6 shows statistically significant data for a 3year survival rate (p=0.01) in one study (Fujimura et al, 1994) and a 5-year survival rate in the three other studies (Hamazoe et al, p=0.02; Yu et al, p=0.0278; and Fujimoto et al, p=0.0362). A statistically significant survival 313

Goldstein et al: Management of peritoneal carcinomatosis Table 6. Eight reports of adjuvant treatment with perioperative intraperitoneal chemotherapy in gastric cancer having an R0 resection*. Reference

Location

Koga et. al.

Yonago

No. of patients study/ control 26/21

Hamazoe et al.

Yonago

42/40

Fujimura et al.

Kanazawa

22/18

Yonemura et al. Ikeguchi et al.

Kanazawa

79/81

Yonago

78/96

Yu et al.

Taegu

125/123

Fujimoto et al.

Chiba

71/70

Kim et al.

Seoul

52/51

Survival rates % study/ control

Study/ control morbidity % 3.1/7.1

Study/ control mortality % NA

2.5-year 83/67.3 5-year 61.3/52.5 3-year 68/23 3-year 55/38 5-year 51/46 5-year 54.1/38.1 5-year 69/55 5-year 34.6/31.4

0.02

4.8/7.50

0.01

36/NA

0.05 2 NS

3/2.5

1.2/2.08

28.8/20.3

6.4/1.6

2.81/2.85

0.02 78 0.03 62 NS

* Negative margins of excision and absence of disseminated disease. NA, not available; NS, not significant

more times more likely to survive 5 years than a patient treated by gastrectomy alone. According to these survival data, cure after resection of gastric cancer increased significantly in five of eight trials and showed a trend toward improvement in the other three when adjuvant perioperative intraperitoneal chemotherapy was used. This is in sharp contrast with a previously published meta-analysis of adjuvant systemic chemotherapy randomized trials (Hermans et al, 1993). The advantages of adjuvant intraperitoneal chemotherapy were especially evident in patients with stage III gastric cancer. Regional chemotherapy used in such a manner can not be expected to effectively eradicate disease left behind in lymph nodes. It is likely that extended lymph node dissection is necessary to obtain the beneficial effects of perioperative intraperitoneal chemotherapy. This treatment is designed to eradicate microscopic residual disease present in peritoneal cavity after cancer resection. From a conceptual perspective and from clinical trials data, perioperative intraperitoneal chemotherapy alters the pattern of dissemination after potentially curative gastric cancer surgery, but is not a treatment for residual disease in lymph nodes or systemic metastasis.

Selection of patients needs to involve not only quantitative prognostic indicators of carcinomatosis but also the performance status of the patient. Acceptable nutritional status and renal, hepatic, pulmonary and myocardial function must be present. The clinical judgment and experience of the surgeon is subjective, but extremely important. As might be expected the rates of morbidity range from 10% to 54%. Mortality rates vary from 1.5% in series with large number of patients to above 10% in small series. A long and steep learning curve exists in this group of patients (Table 7). Two large studies conducted in specialized centers involved in the treatment of peritoneal carcinomatosis reported their morbidity and mortality secondary to the combined procedure. Stephens and colleagues, in 1999, reviewed 200 consecutive patients with peritoneal carcinomatosis from a variety of origins treated at the Washington Cancer Institute. The authors reported a combined grade III/IV morbidity rate of 27%. Peripancreatitis, intestinal fistula, postoperative bleeding and hematological toxicity were the most common serious complications. The mortality rate was 1.5% (Stephens et al, 1999). In another extensive study, Glehen and colleagues studied 216 consecutive patients who underwent cytoreductive surgery combined with closed abdominal hyperthermic perfusion. The postoperative morbidity and mortality were 24.5% and 3.2%, respectively. Intestinal fistulas (6.5%) and hematological toxicity (4.6%) were the principal causes of serious complications (Glehen et al, 2003). Both of these studies identify the extent of the surgical procedure as the most important variable associated with morbidity and mortality. Duration of surgery, number of peritonectomy procedures and

VI. Morbidity and mortality Intuitively, one would expect that the morbidity and mortality would correlate with the magnitude of the surgery. Considering that cytoreductive surgery is a prolonged series of surgical dissections and extensive reconstructions one should expect a high rate of complications. Two other variables may contribute to increase the incidence of complications: retarded wound healing associated with perioperative intraperitoneal chemotherapy and the hyperthermia. 314

Cancer Therapy Vol 3, page 315 Table 7. Morbidity and mortality after cytoreductive surgery and intraperitoneal perioperative chemotherapy Author Stephens Beaujard Elias Witkamp Butterworth Verwaal Glehen Elias Pilati Glehen Glehen Guner Zanon Deraco Glehen Shen

Journal, year Ann Surg Oncol, 1999 Cancer, 2000 Cancer, 2001 Br J Surg, 2001 Am J Surg, 2002 J Clin Oncol, 2003 J Clin Oncol, 2003 Gastroenteral Clin Biol, 2003 Ann Surg Oncol, 2003 Ann Surg Oncol, 2003 J Clin Oncol, 2004 Int J Colorectal Dis, 2004 World J Surg, 2004 Ann Surg Oncol, 2004 Br J Surg, 2004 Ann Surg Oncol, 2004

N 200

Morbidity (%) 27

Mortality (%) 1.5

83 64 46 11 48 56 36

9.6 54.6 39.1 56 66 28.6 44

3.6 9.3 8.7 9 8 1.8 13.8

216

24.5

3.2

506 28

22.9 36

4 2/28

30 33

16.7 18

3.3 3

53 77

23 30

4 12

resections, number of sutures lines and carcinomatosis stage were variables associated with major complications. In another study, Elias and colleagues reported that the rate of complication was directly correlated with the PCI. In this series, the rate of reoperations was 28.8%. The more extensive the disease as estimated by the PCI, the higher was the rate of complications (Elias et al, 2001). In the multicentric study of patients with peritoneal seeding from colorectal cancer, Glehen showed association between EPIC and major complications (Glehen et al, 2004). Experimental studies showed that the 5-fluoruracil diminished the strength of suture lines (Fumagalli et al, 1991; Graf et al, 1992; van der Kolk et al, 1999; Haciyanli et al, 2001). Recently, Haciyanli and colleagues reported that the administration of 5-fluoruracil for 5 days after the surgery in rats results in higher rates of anastomotic complications, reductions in anastomostic breaking strength and hydroxyproline content when compared with rats without infusion of intraperitoneal 5-FU (Haciyanli et al, 2001). In another study, Fumagalli et al, (1991) studied the role of mitomycin C on healing of intestinal anastomosis in rats. After 7 days of surgery the animals were killed. The rate of anastomotic fistula was 52.8% in the intraperitoneal group, 20% in the intravenous-group and none in the control group (Fumagalli et al, 1991). These studies and the data of clinical trials support the recommendation to avoid multiple anastomoses whenever possible and avoid anastomoses altogether in high risk groups. In addition to anastomotic fistula, postoperative perforation of traumatized small bowel is a condition to be actively prevented. During the cytoreductive surgery the

small bowel may require extensive manipulation to divide intestinal adhesions and multiple resections of cancer implants on its serosal surface. The seromuscular layer of the small bowel may be weakened by electrosurgical dissection; the systemic effects of chemotherapy damage the submucosa and mucosa layers of the small bowel. These combined surgical and chemotherapy-induced injuries may at least in part explain the high level of bowel perforations described in the clinical studies. In 1994 Fernandez-Trigo and Sugarbaker studied 33 gastrointestinal fistulas in patients who had extensive gastrointestinal surgery and EPIC. There were 11 (35%) anastomotic leaks and 22 (65%) sidewall bowel perforations. The definitive diagnosis of a fistula was made on average at day 14 postoperatively. The most common site of fistula was the ileum or colorectal anastomosis. The perforations occurred with more frequency in the small bowel than in stomach or large bowel. From the patients presented in this study 84% required further surgical procedures for sepsis control (Fernandez-Trigo and Sugarbaker, 1994). In another study, Murio and Sugarbaker, (1993) identified prior bowel obstruction and prior intraabdominal chemotherapy as significant risk factors for fistula development after the cytoreductive surgery. The retrospective multicenter study reported that intestinal fistula was the main complication among 509 patients treated by the combined approach with a rate of 8.3% (Glehen et al, 2004). Also, this complication was present in seven of the twenty postoperative deaths reported. Intestinal fistula rates varied from 1.3% to 22.2% (Table 8).

315

Goldstein et al: Management of peritoneal carcinomatosis Table 8. Incidence of intestinal fistula and hematological toxicity associated with cytoreductive surgery and intraperitoneal intraoperative chemotherapy. Complication Author Stephens, 1999 Beujard, 2000 Witkamp, 2001 Elias, 2001 Butterworth, 2002 Verwaal, 2003 Glehen, 2003 Pilati, 2003 Elias, 2003 Glehen, 2003 Guner, 2004 Zanon, 2004 Deraco, 2004 Ghehen, 2004 Shen, 2004

Intestinal fistula n (%) 9/200 (4.5) 2/83 (2.4) 6/46 (13) 12/64 (18.7)

Hematologic toxicity n (%) 8/200 (4.0) 3/83(3.6) 22/46 (47.8) 2/64 (3.1) 2/11 (18.1) 19% 2/56 (3.6) 4/46 7/36 (19.4) 10/216 (4.6) 2/28 (7.1) 1/30 (3.3) 7/ 12/506 (2.4) 15/77 (19)

7/48 (15) 7/56 (12.5) 2/46 8/36 (22.2) 14/216 (6.5) 3/28 (10.7) 1/30 (3.3) 2/33 (6) 42/506 (8.3) 1/77 (1.3)

In the prospective protocol used by Verwaal and colleagues the administration of a high dose of mitomycin C (35 mg/m2) was required. This may explain in part the 15% incidence of intestinal fistula (Verwaal et al, 2003). In another study with high rate of intestinal fistula (22.2%), oxaliplatin was the drug used (Elias et al, 2002). The high dosage or the type of intraperitoneal chemotherapy may contribute to an unexpected high incidence of anastomotic dehiscence and fistula. The role of the type of irrigation technique (open versus closed) on the rate of anastomotic fistulas is controversial. The open technique has the theoretical advantage to distribute the heated chemotherapy solution more uniformly (Sarnaik et al, 2003). Stephens reported a rate of 4.5% of intestinal complications with the open â&#x20AC;&#x153;Coliseum Techniqueâ&#x20AC;? (Stephens et al, 1999). However, possible disadvantages of a non-uniform heated irrigation on the anastomosis was not observed in the Glehen study which showed similar rate of intestinal fistula (6.5%) using the closed technique (Glehen et al, 2003). The timing of development of intestinal fistulas in patients who underwent intraperitoneal chemotherapy can be later than usual in other operations on the gastrointestinal tract. In the study of Glehen et al, (2003) the mean time of occurrence of these fistulas was the sixteenth postoperative day. Another major concern regarding combined treatment relates to the hematologic toxicity of intraperitoneal chemotherapy. The rate of hematological toxicity varies considerably between series. It depends on the chemotherapy dosage used and the extent of stem cell damage from prior systemic chemotherapy treatment (Schnake et al, 1999). The higher the dosage, the higher the rates of toxicity. Postoperative hematological toxicity rates varied among these studies from 3.1% to 47.8%. It is important to note that the toxicity due to chemotherapeutic agents may occur early in the postoperative course. In the study of Shen and colleagues, the two patients that died as a consequence of bone marrow suppression developed this

Dosage/drug 10/12.5 mg/m2/MMC 10 mg/L/MMC 35mg/m2/MMC 10 mg/m2/MMC Max 70 mg/MMC Max 60 mg/MMC 26.2 mg (median)/MMC 460 mg/m2/oxaliplatin Max 60 mg/MMC 12.5 mg/m2 Cisplatin 30-40 mg/m2/MMC

complication within 72 hours chemotherapy (Shen et al, 2004).

after

intraperitoneal

VII. Quality of life The quality of life after cytoreductive surgery plus perioperative intraperitoneal chemotherapy has been evaluated in only a few studies. Although this combined approach may confer long term survival for a proportion of patients suffering from peritoneal carcinomatosis secondary to invasive cancers, in a large percentage of patients it will be a palliative procedure. Especially in patients treated with palliative intent the quality of life is an important consideration. McQuellon and colleagues reported on quality of life data prospectively obtained from 64 consecutive patients treated by the combined approach for peritoneal carcinomatosis. Within 3 to 6 months after the surgery, the quality of life, measured by questionnaires, returned to baseline (McQuellon et al, 2001). From the same group of patients, McQuellon focused on 17 patients who had survived more than 3 years after the cytoreductive surgery and hyperthermic intraperitoneal chemotherapy. Ten patients (65.5%) described their health as excellent or very good; 4 (25%) as good; and 2 (13%) as fair. In 94% of cases, no limitations on moderate activity were reported. When the authors analyzed the life satisfaction of the patients since their treatment, 76% indicated that everything was different, but better after the treatment (McQuellon et al, 2003). Schmidt and colleagues, (2005) assessed the quality of life in 25 patients who were alive following treatment by cytoreductive surgery and heated intraperitoneal chemotherapy. The mean duration for these assessments following surgery was 4 years. The global health status score was 62.6% in the study group and 75.3% in the general population. The differences were not significant (p=0.07). However, there was a definite trend towards reduced quality of life in treated patients. Symptoms of nausea and diarrhea were significantly more frequent in 316

Cancer Therapy Vol 3, page 317 M (2002) Heated intra-operative intraperitoneal oxaliplatin after complete resection of peritoneal carcinomatosis: pharmacokinetics and tissue distribution. Ann Oncol 13, 267-272. Elias D, Delperro JR, Sideris L, Benhamou E, Pocard M, Baton O, Giovanninni M and Lasser P (2004) Treatment of peritoneal carcinomatosis from colorectal cancer: impact of complete cytoreduction surgery and difficulties in conducting randomized trials. Ann Surg Oncol 11,518-521. Esquivel J and Sugarbaker PH (2001) Second-look surgery in patients with peritoneal dissemination from appendiceal malignancy: analysis of prognostic factors in 98 patients. Ann Surg 234, 198-205. Fernadez-Trigo V and Sugarbaker PH (1994) Diagnosis and management of postoperative gastrointestinal fistulas: a kinetic analysis. J Exp Clin Cancer Res 13, 233-241. Flessner MF, Dedrick RL and Schultz JS (1984) A distributable model of peritoneal plasma transport: Theoretical considerations. Am J Physiol 246, 597-607. Fujimoto S, Shrestha RD, Kokubun M, Kobayashi K, Kiuchi S, Konno C, Ohta M, Takahashi M, Kitsukawa Y, Mizutani M and et al (1990) Positive results of combined therapy of surgery and intraperitoneal hyperthermic perfusion for faradvanced gastric cancer. Ann Surg 212, 592-596. Fujimoto S, Shrestha RD, Kokubun M, Ohta M, Takahashi M, Kobayashi K, Kiuchi S, Okui K, Miyoshi T, Arimizu N and et al (1988) Intraperitoneal hyperthermic perfusion combined with surgery effective for gastric cancer patients with peritoneal seeding. Ann Surg 208, 36-41. Fujimoto S, Takahashi M, Mutou T, Kobayashi K and Toyosawa T (1999) Successful intraperitoneal hyperthermic chemoperfusion for the prevention of postoperative peritoneal recurrence in patients with advanced gastric cancer. Cancer 85, 529-534. Fujimoto S, Takahashi M, Mutou T, Kobayashi K, Toyosawa T, Isawa E and et al (1997) Improved mortality rate of gastric carcinoma patients with peritoneal carcinomatosis treated with intraperitoneal hyperthermic chemoperfusion combined with surgery. Cancer 79, 884-891 Fujimura T, Yonemura Y, Fushida S, Urade M, Takegawa S, Kamata T and et al (1990) Continuous hyperthermic peritoneal perfusion for the treatment of peritoneal dissemination in gastric cancers and subsequent second-look operation. Cancer 65, 65-71. Fujimura T, Yonemura Y, Ninomiya I, â&#x20AC;Ś(1997) Early detection of peritoneal dissemination of gastrointestinal cancers by reverse-transcriptase polymerase chain reaction. Oncol Rep 4, 1015-1019. Fumagalli U, Trabucchi E, Soligo M, Rosati R, Rebuffat C, Tonelli C and Montorsi M (1991) Effects of intraperitoneal chemotherapy on anastomotic healing in the rat. J Surg Res 50, 82-87. Gilly FN, Carry PY, Sayag AC, Brachet A, Panteix G, Salle B and et al (1994) Regional chemotherapy and intraoperative hyperthermia for digestive cancers with peritoneal carcinomatosis. Hepatogastroenterology 41, 124-129. Glehen O, Cotte E, Schreiber V, Sayag-Beaujard A, Vignal J and Gilly FN (2004) Intraperitoneal chemohyperthermia and attempted cytoreductive surgery in patients with peritoneal carcinomatosis of colorectal origin. Br J Surg 91, 747-754. Glehen O, Kwiatkowski F, Sugarbaker PH, Elias D, Levine EA, De Simone M, Barone R, Yonemura Y, Cavaliere F, Quenet F, Gutman M, Tentes AA, Lorimier G, Bernard JL, Bereder JM, Porcheron J, Gomez-Portilla A, Shen P, Deraco M and Rat P (2004) Cytoreductive surgery combined with perioperative intraperitoneal chemotherapy for the management of peritoneal carcinomatosis from colorectal

operated patients. The data in patients undergoing cytoreductive surgery and heated intraperitoneal chemotherapy were far superior to those patients treated with Whipple procedure where the score was 40.

References Aizawa M, Watanabe O, Naritaka Y, Katsube T, Imamura H, Kinoshita J, Shimakawa T, Kobayashi S, Asaka S, Haga S, Ogawa K, Aiba M, Kajiwara T (2003) Adenocarcinoid of the appendix: report of two cases. Surg Today 33, 375-378. Ajani JA, Ota DM, Jessup JM, Ames FC, McBride C, Boddie A, Levin B, Jackson DE, Roh M and Hohn D (1991) Resectable gastric carcinoma. An evaluation of preoperative and postoperative chemotherapy. Cancer 68, 1501-1506. Bando E, Yonemura Y, Takeshita Y, Taniguchi K, Yasui T, Yoshimitsu Y, Fushida S, Fujimura T, Nishimura G and Miwa K (1999) Intraoperative lavage for cytological examination in 1,297 patients with gastric carcinoma. Am J Surg 178, 256-262. Boku T, Nakane Y, Minoura T, Takada H, Yamamura M, Hioki K and Yamamoto M (1990) Prognostic significance of serosal invasion and free intraperitoneal cancer cells in gastric cancer. Br J Surg 77, 436-439. Bruckner HW and Stablein DM ( 1982) Sites of treatment failure: gastrointestinal tumor study group analysis of gastric, pancreatic and colorectal trials. Cancer Treat Symp 2, 199210. Carmignani CP, Ortega-Perez G and Sugarbaker PH (2004) The management of synchronous peritoneal carcinomatosis and haematogenous metastasis from colorectal cancer. Eur J Surg Oncol 30, 391-398. Carmignani CP, Sugarbaker T, Bromley CM and Sugarbaker PH (2003) Intraperitoneal cancer dissemination: Mechanisms of the patterns of spread. Cancer Metastasis Rev 22, 465-472. Christophi C, Winkworth A, Muralihdaran V and Evans P (1998) The treatment of malignancy by hyperthermia. Surg Oncol 7, 83-90. Chu DZ, Lang NP, Thompson C, Osteen PK and Westbrook KC (1989) Peritoneal carcinomatosis in nongynecologic malignancy. A prospective study of prognostic factor. Cancer 63, 364-367. Dahl O, Dalene R, Schen BC and Mella O (1999) Status of clinical hyperthermia. Acta Oncol 38, 863-873. De Simone M, Barone R, Vaira M, Aghemo B, Mioli P, Franco C, Scuderi S, Costamagna D and Dei Poli M (2003) Semiclosed hyperthermic-antiblastic peritoneal perfusion (HAPP) in the treatment of peritoneal carcinosis. J Surg Oncol 82, 138-140. Dedrick RL, Myers CE, Bungay PM and DeVita VT Jr (1978) Pharmacokinetic rationale for peritoneal drug administration in the treatment of ovarian cancer. Cancer Treat Rep 62, 111. Elias D and Pocard M (2003) Treatment and prevention of peritoneal carcinomatosis from colorectal cancer. Surg Oncol Clin N Am 12, 543-559. Elias D, Antoun S, Goharin A, Otmany AE, Puizillout JM and Lasser P (2000) Research on the best chemohyperthermia technique of treatment of peritoneal carcinomatosis after complete resection. Int J Surg Investig 1, 431-439. Elias D, Blot F, El Otmany A, Antoun S, Lasser P, Boige V, Rougier P and Ducreux M (2001) Curative treatment of peritoneal carcinomatosis arising from colorectal cancer by complete resection and intraperitoneal chemotherapy. Cancer 92, 71-76. Elias D, Bonnay M, Puizillou JM, Antoun S, Demirdjian S, El OA, Pignon JP, Drouard-Troalen L, Ouellet JF and Ducreux

317

Goldstein et al: Management of peritoneal carcinomatosis cancer: a multi-institutional study. J Clin Oncol 22, 32843292. Glehen O, Osinsky D, Cotte E, Kwiatkowski F, Freyer G, Isaac S, Trillet-Lenoir V, Sayag-Beaujard C, Francois Y, Vignal J and Gilly FN (2003) Intraperitoneal chemohyperthermia using a closed abdominal procedure and cytoreductive surgery for the treatment of peritoneal carcinomatosis: morbidity and mortality analysis of 216 consecutive procedures. Ann Surg Oncol 10, 863-869 Glehen O, Stuart OA, Mohamed F and Sugarbaker PH (2004) Hyperthermia modifies pharmacokinetics and tissue distribution of intraperitoneal melphalan in a rat model. Cancer Chemother Pharmacol 54, 79-84. Gomez-Portilla A, Sugarbaker PH and Chang D (1999) Secondlook surgery after cytoreductive and intraperitoneal chemotherapy for peritoneal carcinomatosis from colorectal cancer: analysis of prognostic features. World J Surg 23, 23-29. Gonzalez-Moreno S and Sugarbaker PH (2004) Right hemicolectomy does not confer a survival advantage in patients with mucinous carcinoma of the appendix and peritoneal seeding. Br J Surg 91, 304-311. Graf W, Weiber S, Glimelius B, Jiborn H, Pahlman L and Zederfeldt B (1992) Influence of 5-fluorouracil and folinic acid colonic healing: an experimental study in the rat. Br J Surg 79:825-828. Gunderson LL and Sosin H (1982) Adenocarcinoma of the stomach: Areas of failure in a reoperation series (second or symptomatic look), clinico-pathologic correlation and implications for adjuvant therapy. Int J Radiat Biol Phys 8, 1-11. Haciyanli M, Fuzun M, Unek T and Tokgoz Z (2001) Does the administration route of leucovorin have any influence on the impairment of colonic healing caused by intraperitoneal 5fluorouracil treatment? Eur Surg Res 33, 80-85. Hamazoe R, Maeta M and Kaibara N (1994) Intraperitoneal termochemotherapy for prevention of peritoneal recurrence of gastric cancer. Cancer 73, 2048-2052. Hermans J, Bonenkamp JJ, Boon MC, Bunt AM, Ohyama S, Sasako M and Van de Velde CJ (1993) Adjuvant therapy after curative resection for gastric cancer: meta analysis of randomized trials. J Clin Oncol 11, 1441-1447. Hirose K, Katayama K, Iida A, Yamaguchi A, Nakagawara G, Umeda S and Kusaka Y (1999) Efficacy of continuous hyperthermic peritoneal perfusion for the prophylaxis and treatment of peritoneal metastasis of advanced gastric cancer: evaluation by multivariate regression analysis. Oncology 57, 106-114. Hughes PM, Zammit-Maempel I and Murphy D (1992) Computed tomographic assessment of intraperitoneal fluid distribution prior to intraperitoneal chemotherapy for ovarian cancer. Br J Radiol 65, 295-297. Ikeguchi M, Kondou A, Oka A, Tsujitani S, Maeta M and Kaibara N (1995) Effects of continuous hyperthermic peritoneal perfusion on prognosis of gastric cancer with serosal invasion. Eur J Surg 161, 581-586. Jacquet P and Sugarbaker PH (1995) Influence of wound healing on gastrointestinal cancer recurrence. Wounds 7, 40-47. Jacquet P and Sugarbaker PH (1996) Clinical research methodologies in diagnosis and staging of patients with peritoneal carcinomatosis. (In) Sugarbaker PH (Ed). Peritoneal Carcinomatosis: Principles of Management. Boston, Kluwer Academic publishers, p. 359-374. Jacquet P, Averbach A, Stuart OA, Chang D and Sugarbaker PH (1998) Hyperthermic intraperitoneal doxorubicin: pharmacokinetics, metabolism and tissue distribution in a rat model. Cancer Chemother Pharmacol 41, 147-154.

Jacquet P, Jelinek JS, Chang D, Koslowe P and Sugarbaker PH (1995) Abdominal computed tomography scan in the selection of patients with mucinous peritoneal carcinomatosis for cytoreductive surgery. J Am Coll Surg 181, 530-538. Jacquet P, Jelinek JS, Steves MA and Sugarbaker PH (1993) Evaluation of computer tomography in patients with peritoneal carcinomatosis. Cancer 72, 1631-1636. Jayne DG, Fook S, Loi C and Seow-Choen F (2002) Peritoneal carcinomatosis from colorectal cancer. Br J Surg 89, 15451550. Kaibara N, Sumi K, Yonekawa M, Ohta M, Makino M, Kimura O, Nishidoi H and Koga S (1990) Does extensive dissection of lymph nodes improves the results of surgical treatment of gastric cancer? Am J Surg 159, 218-221. Kaibara N, Sumi K, Yonekawa M, Ohta M, Makino M, Kimura O, Nishidoi H and Koga S (1999) Peritoneal washing cytology: prognostic value of positive findings in patients with gastric carcinoma undergoing a potentially curative resection. J Surg Oncol 72, 60-65. Katz MH and Barone RM (2003) The rationale of perioperative intraperitoneal chemotherapy in the treatment of peritoneal surface malignancies. Surg Oncol Clin N Am 12, 673-688. Knorr C, Reingruber B, Meyer T, Hohenberger W and Stremmel C (2004) Peritoneal carcinomatosis of colorectal cancer: incidence, prognosis and treatment modalities. Int J Colorectal Dis 19, 181-187. Koga S, Hamazoe R, Maeta M, Shimizu N, Murakami A and Wakatsuki T (1988) Prophylactic therapy for peritoneal recurrence of gastric cancer by continuous hyperthermic peritoneal perfusion with mitomycin C. Cancer 61, 232-237. Korenaga D, Moriguchi S, Orita H, Kakeji Y, Haraguchi M, Maehara Y and Sugimachi K (1992) Trends in survival rates in Japanese patients with advanced carcinoma of the stomach. Surg Gynecol Obstet 174, 387-393. Landry J, Tepper JE, Wood WC, Moulton EO, Koerner F and Sullinger J (1990) Patterns of failure following curative resection of gastric carcinoma. Int J Radiat Biol Phys 19, 1357-1362. Leunig M, Goetz AE, Dellian M, Zetterer G, Gamarra F, Jain RK and Messmer K (1992) Interstitial fluid pressure in solid tumors following hyperthermia: possible correlation with therapeutic response. Cancer Res 52, 487-492. Loggie BW, Fleming RA, McQuellon RP, Russel GB and Geisinger KR (2000) Cytoreductive Surgery with intraperitoneal hyperthermic chemotherapy for disseminated peritoneal cancer of gastrointestinal origin. Am Surg 66, 561-568. Los G and McVie JG (1990) Experimental and clinical status of intraperitoneal chemotherapy. Eur J Cancer 26, 755-762. Los G, van Vugt MJH, den Engelse and Pinedo HM (1993) Effects of the temperature on the interaction of cisplatin and carboplatin with cellular DNA. Biochem Pharmacol 46, 1229-1237. Mahteme H, Sugarbaker PH (2004) Treatment of peritoneal carcinomatosis from adenocarcinoid of appendiceal origin. Br J Surg 91, 1168-1173. Marcus E, Weber TK, Rodrigues-Bigas MA, Driscoll D, Meropol NJ and Petrelli NJ (1999) Prognostic factors affecting survival in patients with colorectal carcinomatosis. Cancer Invest 17, 249-252. Maruyama K, Okabayashi K, Kinoshita T (1987) Progress in gastric cancer surgery in Japan and its limits of radicality. World J Surg 11, 418-425. McQuellon RP, Loggie BW, Fleming RA, Russell GB, Lehman AB, Rambo TD. Quality of life after intraperitoneal hyperthermic chemotherapy (IPHC) for peritoneal carcinomatosis. Eur J Surg Oncol 2001;27:65-73.

318

Cancer Therapy Vol 3, page 319 McQuellon RP, Loggie BW, Lehman AB, Russell GB, Fleming RA, Shen P and Levine EA (2003) Long-term survivorship and quality of life after cytoreductive surgery plus intraperitoneal hyperthermic chemotherapy for peritoneal carcinomatosis. Ann Surg Oncol 10,155-162. Mohamed F, Chang D and Sugarbaker PH (2003) Third look surgery and beyond for appendiceal malignancy with peritoneal dissemination. J Surg Oncol 83, 5-13. Mohamed F, Marchettini P, Stuart OA, Urano M and Sugarbaker PH (2003) Thermal enhancement of new chemotherapeutic agents at moderate hyperthermia. Ann Surg Oncol 10, 463468. Murio JE and Sugarbaker PH. Gastrointestinal fistula following cytoreductive procedures for peritoneal carcinomatosis: incidence and outcome. J Exp Clin Cancer Res 1993;12:1538. Noh SH, Son BH and Min JS (1995) Treatment of gastric cancer with peritoneal metastasis. J Korean Surg Soc 49, 77-83. Ozols RF, Locker GY and Doroshow JH (1979) Pharmacokinetics of adriamycin and tissue penetration in murine ovarian carcinoma. Cancer Res 39, 3209-3213. Pestieau SR and Sugarbaker PH (2000) Treatment of primary colon cancer with peritoneal carcinomatosis: comparison of concomitant versus delayed management. Dis Colon Rectum 43, 1341-1346. Pilati P, Mocellin S, Rossi CR, Foletto M, Campana L, Nitti D and Lise M (2003) Cytoreductive surgery combined with hyperthermic intraperitoneal intraoperative chemotherapy of peritoneal carcinomatosis arising from colon adenocarcinoma. Ann Surg Oncol 10, 508-513. Piso P, Bektas H, Werner Vet, et al. Improved prognosis following peritonectomy procedures and hyperthermic intraperitoneal chemotherapy for peritoneal carcinomatosis from appendiceal carcinoma. Eur J of Surg Oncol 2001; 27:286-290. Preusser P, Wilke H, Achterrath W, Fink U, Lenaz L, Heinicke A, Meyer J, Meyer HJ and Buente H (1989) Phase II study with the combination of etoposide, doxorubicin and cisplatin in advanced measurable gastric cancer. J Clin Oncol 7, 1310-1317. Ronnett BM, Zahn CM, Kurman RJ, Kass ME, Sugarbaker PH and Shmookler BM (1995) Disseminated peritoneal adenomucinosis and peritoneal mucinous carcinomatosis. A clinicopathologic analysis of 109 cases with emphasis on distinguishing pathologic features, site of origin, prognosis and relationship to "pseudomyxoma peritonei". Am J Surg Pathol 19, 1390-1408 Sadeghi B, Arvieux C, Glehen O, Beaujard AC, Rivoire M, Baulieux J, Fontaumard E, Brachet A, Caillot JL, Faure JL, Porcheron J, Peix JL, Francois Y, Vignal J and Gilly FN (2000) Peritoneal carcinomatosis from non-gynecologic malignancies: results of the EVOCAPE 1 multicentric prospective study. Cancer 88, 358-363. Sarnaik AA, Sussman JJ, Ahmad SA and Lowy AM (2003) Technology of intraperitoneal chemotherapy administration: a survey of techniques with a review of morbidity and mortality. Surg Oncol Clin N Am 12, 849-863. Sautner T, Hofbauer F and Depisch D (1994) Adjuvant intraperitoneal cisplatin chemotherapy does not improve long-term survival after surgery for advanced gastric cancer. J Clin Oncol 12, 970-974. Schmidt U, Dahlke MH, Klempnauer J, Schlitt HJ and Piso (2005) Perioperative morbidity and quality of life in longterm survivors following cytoreductive surgery and hyperthermic intraperitoneal chemotherapy. Eur J Surg Oncol 31, 53-58.

Schnake KJ, Sugarbaker PH and Yoo D (1999) Neutropenia following perioperative intraperitoneal chemotherapy. Tumori 85, 41-46. Schott A, Vogel I, Krueger U, Kalthoff H, Schreiber HW, Schmiegel W, Henne-Bruns D, Kremer B and Juhl H (1998) Isolated tumor cells are frequently detectable in the peritoneal cavity of gastric and colorectal cancer patients and serve as a new prognostic marker. Ann Surg 227, 372-379. Sebbag G, Yan H, Shmookler BM, Chang D and Sugarbaker PH (2000) Results of treatment of 33 patients with peritoneal mesothelioma. Br J Surg 87, 1587-1593. Shen P, Hawksworth J, Lovato J, Loggie BW, Geisinger KR, Fleming RA and Levine EA (2004) Cytoreductive surgery and intraperitoneal hyperthermic chemotherapy with mitomycin C for peritoneal carcinomatosis from nonappendiceal colorectal carcinoma. Ann Surg Oncol 11, 178-186. Shen P, Levine EA, Hall J, Case D, Russell G, Fleming R, McQuellon R, Geisinger KR and Loggie BW (2003) Factors predicting survival after intraperitoneal hyperthermic chemotherapy with mitomycin C after cytoreductive surgery for patients with peritoneal carcinomatosis. Arch Surg 138, 26-33. Shimizu T, Maeta M and Koga S (1991) Influence of local hyperthermia of healing of small intestine anastomosis in the rat. Br J Surg 78, 57-59. Skipper HC, Chapman JB and Bell M (1952) The anti-leukemic action of combinations of certain known anti-leukemic agents. Cancer Res 11, 109-114. Stephens AD, Alderman R, Chang D, Edwards GD, Esquivel J, Sebbag G, Steves MA and Sugarbaker PH (1999) Morbidity and mortality analysis of 200 treatments with cytoreductive surgery and hyperthermic intraoperative intraperitoneal chemotherapy using the coliseum technique. Ann Surg Oncol 6, 790-796. Storm FK (1989) Clinical hyperthermia and chemotherapy. Radiol Clin N America 27, 621-627. Sugarbaker PH (1995) Peritonectomy procedures. Ann Surg 221, 29-42. Sugarbaker PH (1996) Observations concerning cancer spread within the peritoneal cavity and concepts supporting an ordered pathophysiology. (In) Sugarbaker PH (Ed). Peritoneal Carcinomatosis: Principles of Management. Boston, Kluwer Academic Publishers, pp. 79-100. Sugarbaker PH (1999) Management of Peritoneal Surface Malignancy Using Intraperitoneal Chemotherapy and Cytoreductive Surgery: A Manual for Physicians and Nurses. 3rd ed. Grand Rapids, MI: The Ludann Company. Sugarbaker PH (2002) Respect for the peritoneum as the first line of defense against carcinomatosis and sarcomatosis. (In) Colucci G, Iaffaioli RV, Carteni G (Eds). Dalla Biologica Moleculare All Accreditamento Di Eccellenza, Volume degli atti GIOM, Napoli. Sugarbaker PH (2004) Carcinomatosis from gastrointestinal cancer. Ann Med 36, 9-22. Sugarbaker PH and Chang D (1999) Results of treatment of 385 patients with peritoneal surface spread of appendiceal malignancy. Ann Surg Oncol 6, 727-731. Sugarbaker PH and Jablonsky KA (1995) Prognostic features of 51 colorectal and 130 appendiceal cancer patients with peritoneal carcinomatosis treated by cytoreductive surgery and intraperitoneal chemotherapy. Ann Surg 221, 124-132. Sugarbaker PH, Graves T, DeBruijn EA, Cunliffe WJ, Mullins RE, Hull WE, Oliff L and Schlag P (1990) Early postoperative intraperitoneal chemotherapy as an adjuvant therapy to surgery for peritoneal carcinomatosis from gastrointestinal cancer: pharmacological studies. Cancer Res 50, 5790-5794.

319

Goldstein et al: Management of peritoneal carcinomatosis Sugarbaker PH, Yu W and Yonemura Y (2003) Gastrectomy, peritonectomy and perioperative intraperitoneal chemotherapy: the evolution of treatment strategies for advanced gastric cancer. Semin Surg Oncol 21, 233-248. Urano M and Ling CC (2002) Thermal enhancement of melphalan and oxaliplatin cytotoxicity in vitro. Int J Hyperthermia 18, 307-315. Urano M, Kuroda M, Nishimura Y (1999) For the clinical application of thermochemotherapy given at mild temperatures. Int J Hyperthermia 15, 79-107. van de Vaart PJ, van der Vange N, Zoetmulder FA, van Goethem AR, van Tellingen O, ten Bokkel Huinink WW, Beijnen JH, Bartelink H and Begg AC (1998) Intraperitoneal cisplatin with regional hyperthermia in advanced ovarian cancer: pharmacokinetics and cisplatin-DNA adduct formation in patients and ovarian cancer cell lines. Eur J Cancer 34, 148154. van der Kolk BM, de Man BM, Wobbes T and Hendriks T (1999) Is early post-operative treatment with 5-fluorouracil possible without affecting anastomotic strength in the intestine? Br J Cancer 79, 545-550. van der Vange N, van Goethem AR, Zoetmulder FA, Kaag MM, van de Vaart PJ, ten Bokkel Huinink WW and Beijnen JH (2000) Extensive cytoreductive surgery combined with intraoperative intraperitoneal perfusion with cisplatin under hyperthermic conditions (OVHIPEC) in patients with recurrent ovarian cancer: a feasibility pilot. Eur J Surg Oncol 26, 663-668. Vasseur B, Cadiot G, Zins M, Flejou JF, Belghiti J, Marmuse JP, Vilgrain V, Bernades P, Mignon M and Ruszniewski P (1996) Peritoneal carcinomatosis in patients with digestive endocrine tumors. Cancer 78, 1686-1692. Verwaal VJ, van Tinteren H, van Ruth S and Zoetmulder FA (2004) Predicting the survival of patients with peritoneal carcinomatosis of colorectal origin treated by aggressive cytoreduction and hyperthermic intraperitoneal chemotherapy. Br J Surg 91, 739-746. Verwall V, van Ruth S, de Bree E, van Slooten GW, van Tinteren H, Boot H and Zoetmulder FAN (2003) Randomized trial of cytoreduction and hyperthermic intraperitoneal chemotherapy versus systemic chemotherapy and palliative surgery in patients with peritoneal carcinomatosis of colorectal cancer. J Clin Oncol 21, 37373743. Weiss L (1986) Metastatic inefficiency: cause and consequences. Cancer Rev 3, 1-24. Wils J, Meyer HJ and Wilke H (1994) Current status and future directions in the treatment of localized gastric cancer. Oncology 5, 69-72. Wisbeck WM, Beecher EM and Russell AH (1986) Adenocarcinoma of the stomach: Autopsy observations with therapeutic implications for the radiation oncologist. Radiother Oncol 7, 13-18. Yonemura Y, Bandou E, Kinoshita K, Kawamura T, Takahashi S, Endou Y and Sasaki T (2003) Effective therapy for peritoneal dissemination in gastric cancer. Surg Oncol Clin N Am 12, 635-648. Yonemura Y, Fujimura T, Fushida S, et al (1995) A novel treatment for the peritoneal dissemination of gastric cancer. Peritonectomy and hyperthermo-chemotherapy. (In) Nishi

M, Sugano H, Takahashi T (eds). Proceedings of the International Gastric Cancer Congress, Munich, Germany. Bologna: Monduzzi, pp 1673-1676. Yonemura Y, Fujimura T, Fushida S, Fujita H, Bando E, Nishimura G, et al (1999) A new surgical approach (peritonectomy) for the treatment of peritoneal dissemination. Hepatogastroenterology 46, 601-609. Yonemura Y, Fujimura T, Fushida S, Takegawa S, Kamata T, Katayama K, Kosaka T, Yamaguchi A, Miwa K and Miyazaki I (1991) Hyperthermo-chemotherapy combined with cytoreductive surgery for the treatment of gastric cancer with peritoneal dissemination. World J Surg 15, 530-536. Yonemura Y, Ninomiya I, Kaji M, Sugiyama K, Fujimura K, Sawa T, Katayama K, Tanaka S, Hirono Y, Miwa K and et al (1995) Prophylaxis with intraoperative chemohyperthermia against peritoneal recurrence of serosal invasion-positive gastric cancer. World J Surg 19, 450-455. Yoo CH, Noh SH, Shin DW, Choi SH and Min JS (2000) Recurrence following curative resection for gastric carcinoma. Br J Surg 87, 236-242. Yoo CH, Noh SH, Shin DW, Chung HC, Kim JH, Roh JK and Min JS (1999) Early postoperative intraperitoneal chemotherapy (EPIC) for advanced gastric cancer. (In) Kim JP, Min JS, Mok YJ (eds). Proceedings of the International Gastric Cancer Congress, Seoul, Korea. Bologna: Monduzzi, pp. 103. Yu W, Whang I, Suh I, Averbach A, Chang D and Sugarbaker PH (1998) Prospective randomized trial of early postoperative intraperitoneal chemotherapy as an adjuvant to respectable gastric cancer. Ann Surg 228, 347-354. Zoetmulder FA and Sugarbaker PH (1996) Patterns of failure following treatment of pseudomyxoma peritonei of appendiceal origin. Eur J Cancer 32A, 1727-1733.

Paul H. Sugarbaker, M.D.,

320

Cancer Therapy Vol 3, page 321 Cancer Therapy Vol 3, 321-324, 2005

Photodynamic therapy for nasopharyngeal cancer Review Article

Viroj Wiwanitkit Department of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok Thailand 10330

__________________________________________________________________________________ *Correspondence: Viroj Wiwanitkit, M.D., Department of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand 10330; Tel: 662 256 4136; Fax: 662 218 3640; e-mail: Viroj.W@Chula.ac.th Key words: photodynamic therapy, nasopharyngeal carcinoma Abbreviations: cyclooxygenase-2, (COX-2); Glutathione S-transferase, (GST); Intensity modulation radiotherapy, (IMRT); Interleukin, (IL); Matrix metalloproteinase-1, (MMP-1); merocyanine 540, (MC540); nasopharyngeal carcinoma, (NPC); nitric oxide synthase, (NOS; Photodynamic therapy, (PDT); protoporphyrin IX dimethyl ester, (PME); protoporphyrin IX, (PPIX); reverse transcriptionpolymerase chain reaction, (RT-PCR); soluble interleukin-2 receptor, (SIL-2R); Temoporfin (meta-tetra-hydroxyl-phenyl-chlorin), (mTHPC) Received: 22 February 2005; Revised: 2 March 2005 Accepted: 4 March 2005; electronically published: May 2005

Summary Photodynamic therapy (PDT) is a medical therapy making used of a non-toxic dye termed a photosensitizer (PS) together with low intensity visible light, which, in the presence of oxygen, produce cytotoxic species. It is an approved treatment for several types of tumors and certain benign diseases. In this article a summary on using of PDT as an integrative cancer therapy in cancer of nasopharynx is presented. However, adequate or effective treatments are not always available for most recurrent or residual nasopharyngeal cancers (Kulapaditharom and Boonkitticharoen, 1999). In those cases, photodynamic therapy (PDT) is a new alternative. PDT is a medical therapy making used of a non-toxic dye termed a photosensitizer together with low intensity visible light, which, in the presence of oxygen, produce cytotoxic species (Demidova and Hamblin, 2004). PS can be targeted to its destination cell or tissue and, in addition, the irradiation can be spatially confined to the lesion giving PDT the advantage of dual selectivity (Demidova and Hamblin, 2004). In therapy, PDT leads to photochemical tissue destruction or immunomodulation (Dragieva et al, 2004). Considering the mechanism of PDT, light-activation of the photosensitizer in the presence of molecular oxygen, which accumulates in cancer tissues, leads to the local production of reactive oxygen species that kill the tumor cells (Agostinis et al, 2004). Hendrickx et al, (2003) reported that hypericin-mediated PDT of human cancer cells led to up-regulation of the inducible cyclooxygenase-2 (COX-2) enzyme and the subsequent release of PGE2. They noted that the combination of PDT with pyridinyl imidazole inhibitors of p38 MAPK might improve the therapeutic efficacy of PDT by blocking COX-2 up-regulation, which contributed to tumor growth by the release of growth- and pro-angiogenic factors, as well as by sensitizing cancer cells to apoptosis (Hendrickx

I. Introduction to photodynamic therapy and mechanism of action in nasopharyngeal cancer cell Nasopharyngeal carcinoma is an endemic tumor in southern China and Southeast Asia (Chan et al, 2004). Three main etiologic factors include genetic susceptibility, chemical carcinogens, and association with Epstein-Barr virus (EBV) infection (Chan et al, 2004). Generally, this carcinoma is highly radiosensitive and chemosensitive (Chan et al, 2004). Attempts have been made to improve treatment results by integrating radiotherapy with some form of chemotherapy (Chan et al, 2004). Presently, radiotherapy remains a common treatment for early disease, while concurrent chemoradiotherapy is being increasingly accepted as the standard treatment for advanced disease (Chang et al, 2004). Intensity modulation radiotherapy (IMRT) delivers a more conformal radiation dose to the target area and may spare normal organs such as the parotid gland for patients with early stage disease (Chang et al, 2004). IMRT in conjunction with concurrent chemotherapy offers excellent tumor control with fewer complications (Chang et al, 2004). The outcome of nasopharyngeal carcinoma treatment has greatly improved as advances in imaging techniques increase the accuracy of tumor mapping (Chang et al, 2004).

321

Wiwanitkit: Photodynamic therapy for nasopharyngeal cancer et al, 2003). Agostinis et al, (2004) noted that mitochondria were central coordinators of the mechanisms by which PDT induces apoptosis in the target cells. They proposed that signaling pathways regulated by members of mitogen activated protein kinases and their downstream targets, such as cyclooxygenase-2, appeared to critically modulate cancer cell sensitivity to PDT (Agostinis et al, 2004). Almeida et al (2004) proposed that activation of phospholipases, changes in ceramide metabolism, a rise in the cytosolic free Ca2+ concentration, stimulation of nitric oxide synthase (NOS), changes in protein phosphorylation and alterations in the activity of transcription factors and levels of gene expression had all been observed in PDTtreated cells (Almeida et al, 2004). Ali et al, (2002) also noted that an important role of PDT in cancer therapy is induction of cellular apoptosis. PDT has been used as an integrative therapy for many cancers including nasopharyngeal carcinoma (Zhao et al, 1988). Concerning the mechanism of tumor therapy, the general principle of induction of cellular apoptosis is mentioned in PDT for nasopharyngeal cancer (Zhao et al, 1988). In 2001, Lai et al, performed a study to investigate the effect of PDT on expression of the pro-apoptotic gene Bak in nasopharyngeal carcinoma (NPC). In this study, apoptosis and expression of the pro-apoptotic gene Bak on the tumor tissues from both pre- and post-PDT were determined using the in situ end labeling (ISEL), standard immunohistochemistry technique and western blot, respectively, in 24 patients with either persistent or recurrent NPC after radiotherapy (Lai et al, 2001). According to this study, immunohistochemical assay indicated that 75% of the patients had an upgrade of the expression of Bak protein in their tumor tissues after PDT and increases in expression of Bak from PDT were also confirmed by western blot analysis (Lai et al, 2001). Lai et al, 2001 concluded that PDT probably caused NPC cell apoptosis through an upregulation of the pro-apoptotic protein Bak expression. In 2001, Ali et al examined the photodynamic effects of hypocrellin A and B compounds in poorly differentiated (CNE2) and moderately differentiated (TW0-1) human nasopharyngeal carcinoma cells. According to this study, a loss of membrane phospholipid asymmetry associated with apoptosis was induced by both tumor cell lines as evidenced by the externalization of phosphatidylserine and a dosedependent increase in caspases-3 protease activity inhibitable by the tetrapeptide inhibitor DEVD-CHO was also observed in both cell lines (Ali et al, 2001). Ali et al, (2001) noted that tumor cell death induced by Hypocrellin A and B was mediated by caspase proteases. Ali et al, (2001) proposed that both hypocrellins (A and B) were potent and promising photosensitizers for the treatment of nasopharyngeal carcinoma. In 2002, Du et al, investigated the endogenous production of interleukin (IL)-8 and IL-10 in vitro by two EBV-positive nasopharyngeal carcinoma cell lines, HK1 and CNE-2. According to this study, Du et al noted that PDT which was known to upregulate IL-8 transcription via reactive oxygen species and activate the IL-10 promoter did not alter IL-8 levels in either of the NPC cell lines nor induced the production of IL-10 (Du et al, 2002).

In 2003, Du et al showed by electron microscopy that subcutaneously implanted HK1 NPC cells from Balb/c nude mice perished by cell necrosis with hypericin-PDT treatment. They said that there was evidence of cytoplasmic swelling accompanied by loss of cell membrane integrity and autophagic vacuolization of cytoplasm but no nuclear changes and there was also no significant difference in the apoptotic index of control and PDT-treated tumors, when analyzed by in situ end labeling of DNA strand breakage to detect apoptosis (Du et al, 2003b). Du et al (2003b) said that these further finding supported the observation that cell death in PDT-treated nasopharyngeal cell /HK1 tumors was by necrosis. They noted that lipid peroxidative stress analyzed by the malondialdehyde assay was significantly elevated in PDTtreated cells, however, PDT had no effect on the activity of superoxide dismutase, an intracellular antioxidant enzyme (Du et al, 2003b). Finally, they concluded that hypericin-PDT of nasopharyngeal tumors in vivo induced tumor necrosis with accompanying lipid peroxidation (Du et al, 2003b). In 2003, Du et al also investigated the effect of hypericin-mediated PDT on subcutaneously implanted NPC/HK1 tumor cells and the relationship between the biodistribution of hypercin and photodynamic effects (Du et al, 2003a). They concluded that hypericin-mediated PDT induces both vascular damage and direct tumor cell killing, thereby bringing about tumor necrosis and shrinkage (Du et al, 2003a). In 2004, Du et al analyzed the effect of hypericin-based PDT on matrix metalloproteinase-1 (MMP-1) expression in two NPC cell lines and an animal tumor model. MMP-1 protein. In addition, mRNA expression were evaluated by Western blot analysis and quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) respectively (Du et al, 2004a). According to this study, photoactivation of hypericin, a polycyclic phenanthroperylenedione, elicited an increase in MMP-1 protein and mRNA expression in well differentiated HK1 and poorly differentiated CNE-2 nasopharyngeal cell cells in vitro and there was similar up-regulation of MMP1 mRNA expression in hypericin-PDT-treated nasopharyngeal cell /HK1-tumors (Du et al, 2004a). Du et al proposed that this was the first time that modulation of MMP-1 expression had been demonstrated as a photodynamic effect of hypericin in nasopharyngeal carcinoma cells (Du et al, 2004a). In 2004, they observed that photoactivated hypericin induced the generation of reactive oxygen intermediates in nasopharyngeal cancer cells in vitro (Du et al, 2004a). They noted that there was also significant reduction of glutathione S-transferase (GST) activity in HK1 and CNE-2 NPC cells and in tumor tissues from the nasopharyngeal cell/HK1 murine tumor model by hypericin-mediated PDT (Du et al, 2004b). Du et al (2004b) concluded that down-regulation of GST activity would potentiate the efficacy of hypericin-PDT treatment as antioxidants protect cells against phototoxicity.

322

Cancer Therapy Vol 3, page 323 al, 1995). According to this study, all patients survived at 5-years, indicating good outcome of treatment (Lofgren et al, 1995). Lofgren et al, (1995) found that long-term tumor control could be achieved by photodynamic therapy in cases where very high doses of ionizing radiation have failed. They proposed that the entire treatment could be accomplished in 30 minutes under topical anesthesia and the technique carried no serious side effects (Lofgren et al, 1995). In 1999, Kulapaditharom and Boonkitticharoen evaluated the PDT using hematoporphyrin derivative for its effectiveness in treating patients with recurrent nasopharyngeal carcinoma, who failed conventional therapy, with curative or palliative intent in 13 patients. They demonstrated that hematoporphyrin derivative -PDT could effectively control locally recurrent or residual NPC at T1-T2 stages and offered good palliation for more advanced diseases (Kulapaditharom and Boonkitticharoen, 1999). They also proposed that combined PDT and chemotherapy seemed to prolong survival time for a period longer than 2 years in T3-T4 tumors.

II. Summary on previous reports of photodynamic therapy for nasopharyngeal carcinoma A. General reports on photodynamic therapy for nasopharyngeal cancer As previously mentioned, PDT can be applied in nasopharyngeal carcinoma. In 1990, Sun reported a case series, consisting of 57 nasopharyngeal carcinoma cases treated with PDT with hematoporphyrin derivative in China (Sun, 1990). In this report, 25 (43.9%) achieved complete response, 25 (43.9%) marked response and 7 (12.2%) mild response (Sun, 1990). In 1992, Sun et al, (1992) reported another case series of 137 cases of nasopharyngeal carcinoma treated by PDT with hematoporphyrin derivative. In this report, the results were: complete response 76 cases (55.47%) and marked response 47 cases (34.31%), with an over-all marked response rate of 89.78% (123/137) (Sun, 1992). In 1997, Lai et al studied the effect of PDT on selected laboratory values of patients with nasopharyngeal carcinoma. According to this study, the results showed that the postPDT serum level of soluble interleukin-2 receptor (SIL2R) had significantly declined, while that of IL-2 and the NK cell activity had significantly increased, compared with pre-PDT values, suggesting an immunoenhancing (Lai et al, 1997). The apparent benefit of PDT in nasopharyngeal carcinoma on survival and quality of life must be confirmed. Here, the reports on these outcomes of PDT in nasopharyngeal carcinoma are summarized and present.

C. Reports on photodynamic therapy for nasopharyngeal cancer with different photosensitizers In additional to general photosensitizer, hematoporphyrin derivative, there are also some reports on PDT for nasopharyngeal cancer with other photosensitizers. Yee et al found that protoporphyrin IX dimethyl ester (PME), a dimethyl esterification of protoporphyrin IX (PPIX), exhibited higher intracellular uptake into NPC/CNE2 cells, a poorly differentiated human nasopharyngeal carcinoma, than did PPIX (Yee et al, 2002). They noted that phototoxicity studies revealed PME to be a more potent photosensitizer than was PPIX, at the early and late incubation time points (Yee et al, 2002). According to this study, correlating phototoxicity with subcellular localization indicated that PME was a more potent photosensitizer when its primary target of photodamage was mitochondria (Yee et al, 2002). In 2002, Betz et al investigated the potential use of 5aminolevulinic acid (5-ALA, 5-amino-4-oxovaleric acid) induced PPIX for PDT of nasopharyngeal carcinoma and its related mechanisms of inducing cell death. PPIX biosynthesis via fluorescence analysis (Betz et al, 2002). In this study, mechanisms of PDT-induced cell death were investigated via anncxin-V/propidium iodide staining and DNA electrophoresis (Betz et al, 2002). According to this study, more than 80% of induced cell deaths thereby occurred via apoptosis within the first 12 h following irradiation; necrosis was accountable for less than 20% and high level induction of apoptosis by 5-ALA-PDT was confirmed by DNA electrophoresis (Betz et al, 2002). Betz et al reported that their investigations showed promising results of 5-ALA based PDT of nasopharyngeal carcinoma in vitro (Betz et al, 2002). In 2003, Mak et al studied two sulfonamide derivatives of porphycene, namely PS6 and PS6A, were synthesized, and their photodynamic efficacies on the nasopharyngeal carcinoma cell line NPC/CNE-2. They found that over 99% of CNE-2 cells were sensitized by

B. Reports on photodynamic therapy for recurrent nasopharyngeal cancer There are some reports on PDT for recurrent nasopharyngeal cancer. In 1996, Tong et al reported their initial experience in using PDT for 12 patients with recurrent nasopharyngeal carcinoma. In this report, all patients were treated with an infusion of hematoporphyrin derivative (5 mg/kg) 48-72 h before exposure to 200 J/cm2 light (wavelength, 630 nm) delivered from a gold vapor laser (Tong et al, 1996). According to this study, all 12 patients showed a dramatic response as judged by computed tomography or magnetic resonance imaging at 6 months post-PDT (Tong et al, 1996). Concerning the sideeffects of therapy, skin hypersensitivity occurred in two patients and was the only significant complication encountered (Tong et al, 1996). Tong et al concluded that PDT could be an encouraging palliative or definitive management for recurrent superficial nasopharyngeal carcinoma (Tong et al, 1996). In 1995, Lofgren et al performed another similar pilot study to determine if PDT could be a safe and efficacious treatment for recurrent or persistent nasopharyngeal cancer (Lofgren et al, 1995). In this study, 4 patients were injected intravenously with hematoporphyrin derivative (2.5 mg/kg) and one patient with porfimer sodium (2 mg/kg) 48 hours before treatment by a 630-nm laser light passed down a 1-mm core quartz fiber to a miniaturized convex mirror positioned in the nasopharynx via the contralateral nasal cavity (Lofgren et

323

Wiwanitkit: Photodynamic therapy for nasopharyngeal cancer nasopharyngeal carcinoma cells and the effect of photodynamic therapy. Int J Mol Med 10, 73-6. Du HY, Bay BH, Olivo M (2003a) Biodistribution and photodynamic therapy with hypericin in a human NPC murine tumor model. Int J Oncol 22, 1019-24. Du HY, Olivo M, Tan BK, Bay BH (2003b) Hypericin-mediated photodynamic therapy induces lipid peroxidation and necrosis in nasopharyngeal cancer. Int J Oncol 23, 1401-5. Du HY, Olivo M, Tan BK, Bay BH (2004b) Photoactivation of hypericin down-regulates glutathione S-transferase activity in nasopharyngeal cancer cells. Cancer Lett 207, 175-81. Hendrickx N, Volanti C, Moens U, Seternes OM, de Witte P, Vandenheede JR, Piette J, Agostinis P (2003) Up-regulation of cyclooxygenase-2 and apoptosis resistance by p38 MAPK in hypericin-mediated photodynamic therapy of human cancer cells. J Biol Chem 278, 52231-9. Kulapaditharom B, Boonkitticharoen V (1999) Photodynamic therapy for residual or recurrent cancer of the nasopharynx. J Med Assoc Thai 82, 1111-7. Lai J, Tao Z, Xiao J, Yan Y, Wang X, Wang C, Zhou S, Tian Y (2001) Effect of photodynamic therapy (PDT) on the expression of pro-apoptotic protein Bak in nasopharyngeal carcinoma (NPC). Lasers Surg Med 29, 27-32. Lai JP, Tao ZD, Xiao JY, Zhao SP, Tian YQ (1997) Effect of photodynamic therapy on selected laboratory values of patients with nasopharyngeal carcinoma. Ann Otol Rhinol Laryngol 106, 680-2. Lofgren LA, Hallgren S, Nilsson E, Westerborn A, Nilsson C, Reizenstein J (1995) Photodynamic therapy for recurrent nasopharyngeal cancer. Arch Otolaryngol Head Neck Surg 121, 997-1002. Mak NK, Kok TW, Wong RN, Lam SW, Lau YK, Leung WN, Cheung NH, Huang DP, Yeung LL, Chang CK (2003) Photodynamic activities of sulfonamide derivatives of porphycene on nasopharyngeal carcinoma cells. J Biomed Sci 10, 418-29. Sun ZQ (1990) Hematoporphyrin derivative (HPD) plus laser photodynamic therapy for nasopharyngeal carcinoma-analysis of 57 cases. Zhonghua Zhong Liu Za Zhi 12, 1202. Sun ZQ (1992) Photodynamic therapy of nasopharyngeal carcinoma by argon or dye laser--an analysis of 137 cases. Zhonghua Zhong Liu Za Zhi 14, 290-2. Tong MC, van Hasselt CA, Woo JK (1996) Preliminary results of photodynamic therapy for recurrent nasopharyngeal carcinoma. Eur Arch Otorhinolaryngol 253, 189-92. Yee KK, Soo KC, Bay BH, Olivo M (2002) A comparison of protoporphyrin IX and protoporphyrin IX dimethyl ester as a photosensitizer in poorly differentiated human nasopharyngeal carcinoma cells. Photochem Photobiol 76, 678-82. Yow CM, Mak NK, Szeto S, Chen JY, Lee YL, Cheung NH, Huang DP, Leung AW (2000) Photocytotoxic and DNA damaging effect of temoporfin (mTHPC) and merocyanine 540 (MC540) on nasopharyngeal carcinoma cell. Toxicol Lett 115, 53-61. Zhao SP, Tao ZD, Xiao JY, Peng YY, Yang YH, Zeng QS, Liu ZW (1988) Clinical use of hematoporphyrin derivative and photoradiation therapy in nasopharyngeal carcinoma. Chin Med J (Engl) 101, 86-91.

PS6A 24 h after drug treatment and collapse of the mitochondrial membrane potential was also observed in PS6A PDT-treated CNE-2 cells 1.5 h after PDT (Mak et al, 2003). In addition, confocal microscopy revealed that PS6A was predominantly localized in the mitochondria, lysosomes and Golgi bodies of NPC cells. Significant genotoxicity was not observed in CNE-2 cells (Mak et al, 2003). Mak et al concluded that PS6A mediated both in vitro antitumor and antiangiogenic activities and PS6A might be a candidate for photodynamic treatment of nasopharyngeal carcinoma (Mak et al, 2003). In 2000, Yow et al studied two clinical photosensitizers, Temoporfin (meta-tetra-hydroxyl-phenyl-chlorin; mTHPC) and merocyanine 540 (MC540) for their photocytotoxic and genotoxic effects on nasopharyngeal carcinoma cells (Yow et al, 2000). According to this study, mTHPC-mediated PDT exerted a more potent effect than MC540-mediated PDT, even though the molar extinction coefficient of the main absorption peak for MC540 was much higher than that of mTHPC (Yow et al, 2000). In addition, confocal laser scanning microscopy showed that mTHPC and MC540 localized in the cytoplasm but not in the nucleus of the tumor cells, which provided evidence for undetectable DNA damage under dark and low photodynamic dose (Yow et al, 2000).

References Agostinis P, Buytaert E, Breyssens H, Hendrickx N (2004) Regulatory pathways in photodynamic therapy induced apoptosis. Photochem Photobiol Sci 3, 721-9. Ali SM, Chee SK, Yuen GY, Olivo M (2002) Photodynamic therapy induced Fas-mediated apoptosis in human carcinoma cells. Int J Mol Med 9, 257-70. Ali SM, Olivo M, Yuen GY, Chee SK (2001) Photodynamicinduced apoptosis of human nasopharyngeal carcinoma cells using Hypocrellins. Int J Oncol 19, 633-43. Almeida RD, Manadas BJ, Carvalho AP, Duarte CB (2004) Intracellular signaling mechanisms in photodynamic therapy. Biochim Biophys Acta 1704, 59-86. Betz CS, Lai JP, Xiang W, Janda P, Heinrich P, Stepp H, Baumgartner R, Leunig A (2002) In vitro photodynamic therapy of nasopharyngeal carcinoma using 5-aminolevulinic acid. Photochem Photobiol Sci 1, 315-9. Chan AT, Teo PM, Huang DP (2004) Pathogenesis and treatment of nasopharyngeal carcinoma. Semin Oncol 31, 794-801. Chang JT, Ko JY, Hong RL (2004) Recent advances in the treatment of nasopharyngeal carcinoma. J Formos Med Assoc 103, 496-510. Demidova TN, Hamblin MR (2004) Photodynamic therapy targeted to pathogens. Int J Immunopathol Pharmacol 17, 245-54. Dragieva G, Scharer L, Dummer R, Kempf W (2004) Photodynamic therapy--a new treatment option for epithelial malignancies of the skin. Onkologie 27, 407-11. Du H, Olivo M, Mahendran R, Bay BH (2004a) Modulation of Matrix metalloproteinase-1 in nasopharyngeal cancer cells by photoactivation of hypericin. Int J Oncol 24, 657-62. Du HY, Bay BH, Mahendran R, Olivo M (2002) Endogenous expression of interleukin-8 and interleukin-10 in

324

Cancer Therapy Vol 3, page 327 hydroxybenzotriazole in N-methylpyrrolidinone were used as activation reagents for peptide bond formation. The reactions were carried out in the presence of 2 equivalents of N,Ndiisopropylethylamine. For the more hindered coupling to the secondary amino group in tetrahydroisoquinoline carboxylic acid (Tic), 2-(7-Aza-1H-benzotriazole-1-yl)-1,1,3,3tetramethyluronium hexafluorophosphate (HATU) was utilized. The sensitive amino acid cysteine was coupled using a combination of DIC and 0.5 M 1-hydroxybenzotriazole (HOBt)solution without any base to minimize the risk of racemization. The side chain protecting groups were the trityl group for cysteine, the tert-butyl group for aspartic acid and threonine and 2,2,4,6,7-pentamethyldihydrobenzofuran-5-sulfonyl (Pbf) for arginine. Cleavage of the peptides from resin and simultaneous deprotection of all side chain protecting groups were accomplished by treatment with a trifluoroacetic acid cocktail, which contains triisopropylsilane, phenol and water as scavengers. Disulfide bond formation was completed by air oxidation in aqueous solution. Peptide purification was performed by preparative reverse phase-high performance liquid chromatography (RP-HPLC) on a Vydac C18 column (WR Grace & Co.-Conn, Columbia, MD) using a gradient of acetonitrile in water with 0.1% trifluoroacetic acid.

E. Stability of RGD peptide in rat brain cell lysates suspended in artificial cerebrospinal fluid (aCSF) The peptides were tested for stability in rat brain homogenate suspended in aCSF (Grosshans et al, 2002). The rat brains were removed from the skull of sacrificed animals and kept frozen. The aCSF was prepared by dissolving 8.6 g of sodium chloride, 0.224 g of potassium chloride, 0.206 g of calcium chloride dihyrate and 0.163 g of magnesium chloride hexahydrate in 500 ml of sterile water and combining that solution at a ratio of 1:1 with a solution of 0.214 g of sodium hydrogen phosphate heptahydrate and 0.027 g sodium phosphate monohydrate in 500 ml of sterile water. The pH was adjusted to 7.45. A 350 mg portion of rat brain was homogenized in 3.1 ml of aCSF in a glass tissue homogenizer. Then 400 µl of RGD peptide was dissolved in aCSF to a final concentration of 3.5 mg/ml and that solution added to the homogenate. Samples were agitated gently at 37oC and aliquots were taken after 5, 15, 30, 45, 60, 90 and 1200 min, filtered and analyzed by RP-HPLC. The RP-HPLC method involved a determination of the RGD peptide peak area (in millions) present at various times.

F. Effects of RGD peptide on glioma cell proliferation

D. Binding affinity assay

A quantitative in vitro colorimetric cell proliferation assay was performed with glioma cells seeded into triplicate wells (3 x 103 cells/well) of a 96-well tissue culture plate. The cells were allowed to attach overnight. The medium was gently aspirated, rinsed once with PBS and replaced with 300 µl of fresh complete medium or that containing 0.001 M of a scrambled non-RGD peptide analog (Ac-[(Pen)RY(Me)AGND(Tic)C]-NH2) or experimental RGD peptide. Cells were incubated at 37°C in a humidified atmosphere at 5% CO2 and the colorimetric assay was performed at 1, 3, 6 or 8 days. On the day of assay, the relative metabolic activity was estimated from triplicate wells using a CellTiter 96 AQ kit (Promega, Madison, WI) according to the manufacturer's instructions. Absorbance at 562 nm was plotted with SigmaPlot (SPSS Inc., Chicago, IL) and was a reflection of the relative metabolic activity as measured by viable cell dehydrogenase activity.

Each well of a microtiter plate (Nunc MaxiSorp, Naperville, IL) was coated with 120 µl of purified receptor (0.5 µg/ml in assay buffer composed of 2 mM CaCl2, 1 mM MgCl2, 50 mM TRIS, 150 mM NaCl at pH 7.4) with 4 mM octyl glucoside overnight at room temperature with shaking. The receptor solution was removed and each well was washed with 200 µl of 0.5% bovine serum albumin in assay buffer for ten minutes. This step was repeated for a total of three washes. Fifty microliters of ten-fold dilutions (from 0.0002 to 200 µg/ml) of the inhibitory compounds in assay buffer was added to the wells. Fifty µl of biotinylated ligand (fibrinogen for !IIb"3, fibronectin for !5"1 and vitronectin for !v"3 and !v"5) in assay buffer was added to the wells. The plates were sealed and incubated overnight at room temperature with shaking. The ligand/competitor solution was removed, then each well was washed with 250 µl wash buffer (0.05 % Tween 20, 50 mM TRIS, 150 mM NaCl 2, pH 7.4) for 5 min. This step was repeated for a total of three washes. One hundred microliters of an avidin biotin peroxidase complex (Pierce Chemical ABC kit 32050, Urbana, IL) in wash buffer was added to each well. The plates were incubated for 30 min at room temperature with shaking. The ABC solution was removed, then each well was washed with 250 µl wash buffer for 5 min. This step was repeated for a total of three washes. One hundred microliters of a peroxidase substrate (3, 3', 5, 5' tetramethylbenzidine, Pierce Chemical TMB substrate kit 34021) was added to each well. The conversion of the substrate was monitored kinetically in a microtiter plate reader (Molecular Devices, S u n n y v a l e C A) at 650 nm. Optical density readings were made of each well at 12 sec intervals for 10 min. The software for the plate reader was used to calculate the concentration at which 50% of the binding of the ligand to the receptor was inhibited (IC50). The maximal velocity of the enzymatic conversion (Vmax) was calculated for each well and expressed in milli-optical density units per min (mOD/min). The Vmax values were plotted as a function of inhibitor concentration and a four parameter logistic curve was fitted to the data. The inflection point of this curve was the IC50.

G. Effects of RGD peptide on glioma cell adhesion to extracellular matrix (ECM) proteins Culture plates coated with glioma-derived ECM proteins were produced by plating 5 x 103 glioma cells/well in 96 well tissue culture plates and grown in complete medium until confluent (Berens and Giese 1996). Medium was carefully removed and the monolayers were rinsed once with PBS. Cells were then lysed with 100 µl of 0.5% Triton X-100 and placing the plates at 120 rpm on a horizontal rotator for 30 min. This was followed by incubation with 0.1 M NH4OH for 3 min. Plates then were rinsed three times with PBS. The wells were covered with 200 µl PBS and stored at 4°C until use in the adhesion assays. Relevant ECM proteins such as collagen type IV, fibronectin, tenascin, laminin, and vitronectin are produced by glioma cells, although the specific types and ratios may vary from one to another (Berens and Giese, 1996). The scrambled non-RGD and experimental RGD peptides were tested for their ability to reverse the adhesion of attached glioma cells plated onto ECM-coated plates or to interfere with adhesion of recently passaged glioma cells (Berens and Giese 1996). In the first set of experiments, glioma cells were harvested from monolayer cultures and placed into 96-well flat bottom plates coated with autologous ECM (i.e., the ECM used for analysis of adhesion of the individual glioma cells were derived from the same cells to be tested) at a concentration of 5 x 105

327

Mattern et al: Glioma cell integrin expression and their interactions with integrin antagonists cells/ml (50,000 cells/well) and incubated overnight. Medium was removed and replaced with 200 µl of fresh medium, or that containing scrambled peptide or the experimental RGD peptide (0.001 M). After 4 hr incubation at 37°C, the plates were subjected to 350 rpm agitation on a horizontal rotator for 6 min. The medium containing nonattached cells was removed and the wells were rinsed with PBS. Attached cells were fixed in 1% glutaraldehyde for 10 min before staining with crystal violet (0.1% in H2O). Spectrophotometric absorbance of the stained nuclei was quantified at 595 nm. In the second set of experiments, similar assays were performed with nonattached glioma cells. 5 x 104 cells/well were seeded in 96 well ECMcoated plates with medium or that containing the scrambled or RGD peptides. Plates were incubated 30 min on ice and then at 37°C for 60 min to allow adhesion. The wells were rinsed, fixed, stained and adhesion quantified as previously described (Berens and Giese 1996).

I. Instillation of cannulas and infusion of peptides into normal and tumor-bearing rat brain 1. Surgical implantation of cannulas Anesthetized F344 rats (190-210 g, Harlan, Indianapolis, IN) underwent one surgical procedure for the permanent implantation of a stainless steel cannula into the right frontal brain (3 mm lateral to midline, 2 mm anterior to bregma, 4 mm depth) as described (Fleshner et al, 1992; Kruse et al, 1994b). A sterile stylet inserted into the cannula maintained patency. The rats were allowed to recover from surgery for one week before being further manipulated. Intracranial infusions (RGD peptide, scrambled peptide, saline, CNS-1 or 9L tumor cells) never exceeded a 10 µl volume and were given to rats in the awake state. Tumor was allowed to establish for one week before starting treatment. Intraperitoneal injections (RGD peptide or scrambled peptide at 0.01 M) never exceeded a 100 µl volume.

H. Effects of RGD peptide on glioma cell injury by a quantitative morphologic assay and by a 7AAD flow cytometric assay

2. In vivo toxicity assessments To establish the highest tolerable dose, in vivo dosing assays were conducted. Cannulated F344 rats were randomized into groups (n = 4 rats/group) that received either three or six 10 µl intracranial infusions of either 0.0, 0.1, 0.5, 0.75, 1.0, 2.0, or 10 mg/ml of RGD peptide every other day. Animals were euthanized at 1, 2, 7, or 14 days after the last infusion and the brains were removed for histopathologic examination. Animal group weights were monitored and plotted every 2-3 days during and after treatment, as we previously established that weight loss (>20%) is evidence of toxicity in non-tumor bearing rats (Kruse et al, 1993). As well, animals were observed daily for gross neurological abnormalities (tremors and ataxic gait) and general reflex behavior (placing/stepping and righting reflexes) as described (Heimberger et al, 2000). In a second toxicity screen, cannulated rats received three 10 µl (0.001 M or 0.114 mg/ml) intracranial infusions every other day. Some animals also received scrambled peptide at the same dose, or saline. They were sacrificed at 1, 7 and 14 days after the last infusion and brains collected for histopathologic evaluation.

1. Apoptosis assessment by a quantitative in vitro morphologic assay Cell morphology studies were performed to discern apoptotic figures in hematoxylin and eosin (H&E) stained glioma cells (10-08-MG, 04-11-MG, U-251MG, U-373MG) after a 18 hr coincubation with either scrambled or RGD peptide. The glioma cells (4 x 104) were plated onto sterile Lab-Tek 4 well glass chamber slides (Nalge Nunc International, Naperville, IL) for 48 hr. Then medium was gently aspirated from the wells and replaced with fresh medium, or that containing scrambled or RGD peptides (0.001 M). The mixtures were incubated at 5% CO2 in a 37°C humidified chamber for 18 hr. The medium was removed, the chambers gently rinsed with HBSS (Life Technologies) and fresh medium added to the wells. The adherent cells were incubated for another 24 hr before fixation in 10% phosphate buffered formalin for 30 min. The cells were stained with H&E. Glioma cell nuclear morphology was examined by light microscopy using a 60X objective (Olympus BX40, Melville, NY). Results are expressed as the percentage of adherent cells identified as live or apoptotic, obtained from an approximate 250-300 total cell count (Gomez et al, 2004).

3. In vivo efficacy assessments To obtain preliminary efficacy testing in Fischer or Lewis tumor-bearing rats (n = 4-7 rats/group), 9L (5 x 103/10 µl PBS) or CNS-1 (1 x 104/10 µl PBS) cells, respectively, were infused one week post-surgery into conscious cannulated rats over a 5 min period (Fleshner et al, 1992). These doses were previously determined to give an approximate 1 month survival for sham treated animals (Kruse et al, 1994a). The tumor was allowed to establish for 1 week after which scrambled peptide or RGD peptide (10 µl at 0.001 M) were intracranially infused six times through the cannula every other day. Some groups of rats received daily intraperitoneal injections (0.1 ml at 0.01 M) of scrambled and RGD peptides for 12 days. Systemic administration of RGD peptides had been tested in rodents and ten-fold higher concentrations were safe (data not shown). Other groups of rats received 6 intracranial infusions every other day along with 12 daily intraperitoneal injections. Rats were sacrificed 2 days following the last infusion and the brains were collected for histopathologic analyses and calculation of tumor and necrotic areas at the instillation site. For statistics, an unpaired t test with Welch correction was performed because of the variance in the SD. The p values were considered significant if #0.05.

2. Cell injury assessment by a flow cytometric 7AAD assay Glioma cells (13-06-MG, 04-11-MG, 10-08-MG and 1407-MG) were plated into sterile 6 well plates for 24 hr. RGD peptide or scrambled peptide (0.001 M), or fresh culture medium alone were then added to the wells. Coincubation for 4 or 18 hr at 37oC in a humidified 5% CO2 chamber was followed by collection of both the cells in suspension and the adherent cells, which were harvested with 1 mM EDTA and 1% bovine serum albumin in PBS. The combined adherent and non-adherent cells were centrifuged and the supernatants decanted. A 50 µl volume of 7AAD (20 µg/ml in PBS) was added to the resuspended pellet. After staining for 20 min at 4oC, cells were rinsed once and resuspended in 400 µl of PBS. Samples were analyzed by flow cytometry within 30 min at the University of Colorado Flow Cytometry Core facility. Scattergrams were generated by 7AAD fluorescence of the labeled glioma population. Regions were drawn around clear-cut populations having negative (live cells), bright (late apoptotic/dead cells) and dim (apoptotic) fluorescence (Schmid et al, 1994; Philpott et al, 1996). The percentages of glioma cells within the segregated live, apoptotic and late apoptotic/necrotic populations were determined (Gomez et al, 2004).

4. Histopathological assessments Brain tissue specimens were fixed in 10% buffered formalin. Brains were placed into a Jacobowitz rat brain slicer (Zivic Miller, Allison Park, PA) and a coronal slice made at the

328

Cancer Therapy Vol 3, page 329 instillation site and at 4 mm posterior and anterior to that site. The two brain sections were placed face down in a tissue cassette and paraffin-embedded. Five µm coronal brain sections were taken at the instillation site and at 50 µm intervals out to 250 µm to assure that we appropriately analyzed the instillation site. Paraffin sections were dewaxed by placing the slides in a 60°C incubator overnight. After rinsing the slides with saline solution, they were stained with Harris H&E for histopathologic analysis and photomicroscopy. Stained sections were digitally imaged using a Sprint Scan 35 digital scanner (Polaroid, Cambridge, MA) adapted with a Path Scan Enabler (Meyer Instruments, Houston, TX) adapted to image microscope slides (Kruse et al, 2000). Digital images were analyzed using SigmaScan software (SPSS Inc., Chicago, IL). Tumor area was traced and expressed as a percentage of total tissue area using the tissue section at or nearest the cannulation site (Owens et al, 1998). Necrotic area was traced and expressed as a percentage of total tumor area.

complex to form !5"1 (the fibronectin receptor). The VLA"1 was even more intensely expressed (mean MFI 17.8) by higher percentages (mean 87%) of the glioma cells, whereas, they exhibited slightly lower positivity at moderate levels for the VLA5! chain (mean 41.7% with mean MFI 4.7). Overall, the findings indicate that the !v"5 and !5"1 integrins are expressed at consistently higher levels than !$"3 by human glioma cells. Additionally, we screened the rat 9L and CNS-1 cells with the anti-human antibodies to !$"3 and !$"5. The 9L and CNS-1 cells were negative for !$"3, however, 9L was 88.5% positive and CNS-1 was 28.5% positive for !$"5. A limitation of the latter analyses is the unknown cross reactivities of the two antibodies; as such, the negative results obtained for !$"3 can not be reliably interpreted.

B. Binding affinities of RGD-containing peptides to integrin receptors

III. Results A. Expression of integrins by human glioma cells

Six different cyclic RGD-containing peptides were synthesized and characterized for their ability to bind to purified integrins. The sequences as well as the binding affinities of the synthesized peptides to isolated integrin receptors are given (Table 2). The data shown are the IC50 (nM) concentration at which 50% inhibition of binding by the peptide to the receptor occurred. The specificities (bolded numbers) were indicated if lower concentrations provided the inhibition. Compounds 1 and 2 have individual specificity for !$"3, whereas compound 3 has specificity for !$"5 receptors. Compound 4 is a potent and selective antagonist for !5"1. Compound 6 displayed a broader selectivity to !$"3 and !$"5 receptors. However, peptide 5, Ac-c[(Pen)-Tyr(Me)-Ala-Arg-Gly-Asp-AsnTic-Cys]NH2, which we will subsequently refer to as RGD peptide, was selected for further study based on the fact that 1) it exhibited not only potent binding to the !$"3 and !$"5 receptors but also to the !5"1 fibronectin receptor and 2) our screen for integrin expression demonstrated that

The expression of integrins on the surfaces of human glioma cell explants was analyzed using 4 separate monoclonal antibodies to integrins !v"3, !v"5, the VLA"1 chain and the VLA5! chain of the !5"1 receptor (Table 1). Low passage cell explants were used since they were considered to be more reflective of the integrin expression found on tissues in situ (Zhang et al, 1997). Previously, Chatterjee and colleagues used the U-373MG and U251MG glioma cell lines as positive and negative controls for !v"3 expression, respectively (Chatterjee et al, 2000). We included these two cell lines in our analyses and our data confirm their findings with 73% of the U-373MG cells being positive compared to only 0.9% of the U251MG cells. A low percentage of the glioma cells displayed a fair to moderate expression of the vitronectin receptor, !v"3 (mean % positive= 20.8, MFI=4.3), whereas the !v"5 integrin was expressed by a majority of the glioma cells (mean 72.7%) more intensely (mean MFI 6.2). The VLA"1 (CD29) and VLA5! (CD49e) chains Table 1. Integrin expression by human glioma cell explants* !$"3 Cell explant

VLA"1

!$"5

% Positive (MFI)

VLA5

% Positive (MFI)

13-06-MG

28.2

(4.1)

75.7

(6.2)

90.4

(24.1)

46.3

(4.8)

10-08-MG

14.6

(4.2)

72.2

(6.2)

89.2

(15.6)

36.7

(4.3)

04-11-MG

20.8

(4.5)

70.9

(5.9)

81.2

(14.2)

52.4

(4.9)

14-07-MG

19.6

(4.5)

71.8

(6.6)

87.1

(17.4)

31.5

(4.8)

Mean % + & MFI Cell line U-373MG** U-251MG***

20.8

(4.3)

72.7

(6.2)

87.0

(17.8)

41.7

(4.7)

73.0 0.9

(5.5) (4.0)

68.7 45.9

(4.6) (4.3)

98.7 97.9

(13.4) (10.5)

25.3 3.4

(3.0) (3.6)

*Flow cytometry was used to determine the percentage of positive cells and the relative antigen density, which was expressed as the mean fluorescence intensity (MFI) of the integrin. **The U-373MG glioma cell line was used as a positive control for !$"3 (Chatterjee et al, J. Neurooncol. 46:135-144, 2000). ***The U-251MG glioma cell line was used as a negative control for !$"3 (Chatterjee et al, ibid).

329

Mattern et al: Glioma cell integrin expression and their interactions with integrin antagonists Table 2. Binding affinities of RGD-containing peptides to integrin receptors determined from the IC50* R GD -c o nt ai n in g p e p ti d e / s e que nc e **

!$ "3

!v"5

!5"1

! I I b" 3

1 2 3 4 5 6

3 20 2 70 0 52 2 14

20 2 10 46 3 30 6 8

42 3 90 1 80 0 2 5 2 60

2 40 70 3 40 0 30 1 90 1 25 0

c [ R G D D( t- B uG )( M am b) ] c [ (M p a) R G D D( t- B uG )C ]-N H2 G- c [ ( Pe n) F R G DS F C ] -A G- c [ ( Pe n) R AR GD N PC ]- A Ac -c [(P e n )Y( M e )AR GD N (T ic )C ] -N H2 * ** A cF -c [C R GD TFC ]- N H2

* I C5 0 is t h e c o n c e n t r a t io n ( n M) a t w h i c h 5 0 % o f t h e b i n d in g o f l ig a n d t o i n t e g r in r e c e p t o r is in h i b it e d . * * A b b r e v ia t io n s : A c , A c e t y l; t - B u G , t e r t- Bu ty l g l y c i n e ; M a m b , m - a mi n o m e t h y l b e n z o ic a c id ; M p a , 3 - M e r c a p to p r o p i o n i c a c i d ; Pe n , P e n ic i ll a m i n e ; T ic , T e t r a h y d r o i so q u i n o li n e - 3 - c a r b o x y l ic a c id ; Y ( M e ) , O - M e t h y l ty r o s in e ; A c F , a c e ty l p h e n y la la n in e ***M o l e c u la r s tr u c t u r e s o f A c - c [ ( Pe n ) Y ( M e ) A RG D N ( T i c ) C ] - N H2 ( le f t ) a n d its scrambled analog Ac[(Pen)RY(Me)AGND(Tic)C]-NH2 (right) are:

all three receptors, especially the latter two, were commonly displayed by our human glioma cell explants. Thus, we would be able to test whether an RGD peptide with broader specificity may have more potent effects on glioma cell growth, adhesion, migration and induction of apoptosis. The structures of the RGD peptide and a control scrambled peptide, synthesized with the same amino acids in a non-RGD sequence, are shown in the footnote of Table 2.

D. RGD peptide effects on human and rat glioma cell proliferation The relative metabolic activity, a measure of cell proliferation, was monitored over time with a panel of human and rat glioma cells when they were untreated, or treated with scrambled non-RGD peptide or RGD peptide (Figure 1). Although not apparent on days 1 and 3, all of the gliomas treated with RGD peptide exhibited a decrease in growth rate by days 6 and 8 when compared to the growth rates of glioma cells treated with scrambled peptide or when placed into medium alone. Thus, the RGD peptide significantly inhibited the proliferation of the entire panel of human glioma cells and the rat CNS-1 glioma cells.

C. In vitro stability of the RGD peptide To analyze whether the RGD peptide might have appropriate pharmacokinetic properties for in vivo use, an HPLC method was selected for testing the stability of the RGD peptide at 37oC in rat brain homogenate suspended in artificial cerebrospinal fluid. The testing was performed at multiple earlier time points between 5 and 90 min (a range likely to be physiologically-relevant in vivo ) and at one later time point at 20 hr (data not shown). At 90 min or less the RGD peptide exhibited good stability and no significant differences existed between the peak areas. At 20 hr, the peptide concentration in the sample was approximately 50% of the initial concentration, i.e., one half-life. These in vitro data suggest that the half life of the RGD peptide will be quite good if placed into the microenvironment of the brain.

E. RGD peptide effects on glioma cell adhesion to glioma ECM protein-coated plates. To determine the effect of RGD peptide on glioma cell adhesion to glioma cell-derived ECM, two assays were performed. In the first assay, scrambled peptide or RGD peptide was added to cells pre-plated on ECM protein-coated plates. The spectrophotometric absorbances obtained from the wells with crystal violet stained cells revealed that the RGD peptide successfully competed for and reversed the adhesion of attached glioma cells bound to ECM-coated plates (Figure 2). 330

Cancer Therapy Vol 3, page 325 Cancer Therapy Vol 3, 325-340, 2005

Glioma cell integrin expression and their interactions with integrin antagonists Research Article

Ralph-Heiko Mattern1,ยง, Susana B. Read2,ยง, Michael D. Pierschbacher1, Chun-I Sze2, Brian P. Eliceiri3, Carol A. Kruse2,3,ยง,* 1

Integra Neurosciences, San Diego, CA 92121, University of Colorado Health Sciences Center, Denver, CO 80262 3 The La Jolla Institute for Molecular Medicine, San Diego, CA 92121 2

__________________________________________________________________________________ *Correspondence: Carol A. Kruse, Ph.D, Professor of Cancer Biology, The La Jolla Institute for Molecular Medicine, 4570 Executive Drive, Suite 100, San Diego, CA 92121; Tel: 858-587-8788 ext 142; Fax: 858-587-6742; e-mail: ckruse@ljimm.org Key words: RGD peptides; brain tumors; apoptosis; adhesion; motility; proliferation Abbreviations: 7-amino actinomycin D, (7AAD); 9-fluorenylmethoxycarbonyl-, (Fmoc); Ac-c[(Pen)-Tyr(Me)-Ala-Arg-Gly-Asp-AsnTic-Cys]NH2, (RGD peptide); artificial cerebrospinal fluid, (aCSF); diisopropylcarbodiimide, (DIC); extracellular matrix, (ECM) fetal bovine serum, (FBS); fibrotic wall, (Fb); hematoxylin and eosin, (H&E); hexafluorophosphate, (HATU); hydroxybenzotriazole, (HOBt); mean fluorescence intensities, (MFI); methylbenzhydrylamine, (MBHA); milli-optical density units per min, (mOD/min); necrotic center, (Nc); normal brain, (NB); phosphate buffered saline, (PBS); reverse phase-high performance liquid chromatography, (RPHPLC); scrambled, (Scr); tetrahydroisoquinoline carboxylic acid, (Tic) ยง

The first two authors contributed equally to the work Received: 27 April 2005; Revised: 19 May 2005 Accepted: 23 May 2005; electronically published: May 2005

Summary A panel of human glioma cell explants was screened for integrin expression by flow cytometry using !$"-specific antibodies. A lower percentage of the glioma cells were positive for the !$"3 (mean % positive = 20.8%) integrin, whereas higher percentages were positive for the !$"5 (mean % positive = 72.7%), VLA5! (mean % positive = 87%) and VLA"1 (mean % positive = 41.7%) integrins. A series of RGD peptides was designed, synthesized and tested for binding to integrin receptors. Based on the results of the binding to the isolated integrin receptors and the expression of integrins on glioma cell lines, a peptide that binds potently to the !$"3, !$"5 and !5"1 was selected for further investigations with regards to its effect on glioma cells. The peptide, Ac-c[(Pen)-Tyr(Me)-Ala-Arg-Gly-AspAsn-Tic-Cys]NH2 (RGD peptide), exhibited high potential for use in clinical intracranial administration since it had good stability in rat brain cell homogenates placed into artificial cerebrospinal fluid. Using an HPLC method for quantification of peptides in rat brain cell homogenates, we could demonstrate the half-life of the RGD peptide approximated 20 hr. Relative to a scrambled peptide control (non-RGD sequence, same amino acids), the experimental RGD peptide significantly decreased glioma cell proliferation of the entire panel of rat and human glioma cells tested. Adhesion of recently passaged glioma cells to glioma-derived extracellular matrix protein-coated plates was inhibited significantly by the RGD peptide. The peptide also reversed attachment of plated glioma cells. The RGD peptide caused some, but not substantial, glioma cell injury, as evidenced by a quantitative in vitro nuclear DNA morphologic assay and by a flow cytometric assay employing 7-amino actinomycin D (7AAD). We histologically monitored for toxicity caused by various doses of the RGD peptide infused repeatedly into normal cannulated rat brain. At safe doses, the experimental RGD peptide-treated brains did not show significant differences from those infused with scrambled peptide or buffer-treated controls. In tumor-bearing brains, slightly smaller tumor areas were measured with a higher necrotic-to-tumor index in the RGD peptide treated relative to the scrambled peptide-treated controls. This was obtained with intracranial peptide administrations or combined intracranial and intraperitoneal injections. From this in vitro work, we conclude that the anti-glioma effects of the RGD peptide tested resulted from lowered glioma proliferation and adhesion/mobility, rather than from significant glioma cell injury in the timeframe analyzed. Although other mechanisms not discerned from our limited 325

Mattern et al: Glioma cell integrin expression and their interactions with integrin antagonists histopathological observations may be operational, from our in vivo work, we conclude that repeated administration of RGD peptide into brain is safe but that better delivery of the peptides to infiltrating tumor cells is necessary.

II. Materials and Methods

I. Introduction

A. Cells and cell culture

Glial neoplasms are the most common primary tumors of the central nervous system. The prognosis for patients with nervous system tumors is discouraging (CBTRUS 2002). They remain a significant cause of death in young adults and in children (Prados et al, 1998). The dismal outlook for malignant brain tumor patients is due to the inability of conventional therapies (surgery, radiation and chemotherapy) to completely eliminate gliomas. Several factors contribute to the inefficacy of these treatments including the precarious locations of the tumors within the brain and the infiltrative nature of malignant gliomas. As such, there is a necessity to explore alternative experimental therapies. Concentrated efforts in the area of angiogenesis research are leading to the discovery of a number of antiangiogenic substances for treatment of angiogenic disorders and cancer. The involvement of integrins as regulators of angiogenic and apoptotic processes and in brain tumor cell and astrocyte recognition, adhesion and migration on extracellular matrix (ECM) are documented (Ruoslahti and Reed 1999; MacDonald et al, 2001; Ding et al, 2002; Hynes 2002; Milner and Campbell 2002). Many integrin receptors on cells are known to bind to the tripeptide Arg-Gly-Asp (RGD) sequences present in various ECM components such as fibronectin, vitronectin, collagen and fibrinogen. Due to the lack of existing effective treatments for gliomas and other brain cancers, integrin antagonists were explored as an alternative treatment for gliomas. RGD-containing peptides were found to be efficacious in in vitro studies with glioma cells and in animal brain tumor models (Chatterjee et al, 2000; MacDonald and Ladisch 2001; MacDonald et al, 2001; Taga et al, 2002). The studies by Chatterjee and colleagues focused on the cyclic RGDfV integrin antagonist and its linear homolog, the cyclic form of which was known to bind to the !$_ integrins (Chatterjee et al, 2000). The accumulation of preclinical data has led to several clinical trials testing systemic administration of integrin antagonists for patients with gliomas or with advanced solid tumors (Eskens et al, 2003; Phuphanich et al, 2004). In this investigation, a broader screen of the integrin expression by a panel of gliomas was conducted. After synthesizing a variety of RGD-containing peptides, the binding affinities to integrin receptors were screened. Stability of one RGD peptide displaying broad specificity was obtained upon its in vitro exposure to rat brain cell homogenates in artificial cerebrospinal fluid. We then noted effects of the RGD peptide on glioma cells by a number of in vitro assays, including proliferation, adhesion and apoptosis induction. Finally, in pilot studies we explored their toxicity when introduced intracranially into normal cannulated rat brain and into tumor-bearing rat brain.

Early passage (#P10) human glioma cell explants used in these experiments, 13-06-MG, 04-11-MG, 10-08-MG and 14-07MG, were obtained according to Institutional Regulatory Body guidelines and practices. The similarities of cell explants to those of primary tissues have been validated by gene array patterns (Zhang et al, 1997). Minced and enzymatically digested tissue cells were placed into culture as described (Gomez and Kruse 2003). Some of the cell explants at higher passage number received partial characterization (Kruse et al, 1998; Kleinschmidt-DeMasters et al, 1999; Read et al, 2003). Other human glioma cell lines, U-373MG, U-87MG and U-251MG, were graciously supplied by Drs. D. Bigner (Duke University, Durham, NC) or M. Jadus (Veterans Medical Center, Long Beach, CA). The cells were maintained in F12/DMEM medium (1:1 v/v, InVitrogen Life Technologies, Carlsbad, CA) or RPMI 1640 medium supplemented with 10% heat inactivated fetal bovine serum (FBS, Gibco, Grand Island, NY), all at a pH of 7.2. The cells were incubated at 37°C in a humidified 5% CO2 atmosphere. The cells that attached to the plastic were passaged when confluent with 0.025% trypsin in phosphate buffered saline (PBS) containing 1 mM EDTA and placed into culture medium containing 20% conditioned medium from their previous passage. Fischer rat 9L gliosarcoma cells and Lewis rat CNS-1 glioma cells were maintained in RPMI-1640 and Dulbecco’s Modified Eagle’s Medium (2:1 v/v) supplemented with 10% FBS (Gibco), 2 mM L-glutamine, 100 U/ml penicillin and 0.1 mg/ml streptomycin.

B. Integrin expression by glioma cells Cell cultures at ~80% confluency were disaggregated with 1 mM EDTA and 1% bovine serum albumin in PBS. Cell clumps were further dissociated by tituration. Five x 105 cells were pelleted at 200 x g for 5 min and the supernatants decanted. After washing, cells were then incubated on ice for 45 min with monoclonal antibodies to identify integrin expression. FITCconjugated antibodies were as follows: mouse anti-human integrin !v"5 (MAB 1961F, Chemicon International, Temecula, CA), mouse anti-human integrin !v"3 (MAB 1976F, Chemicon International), mouse anti-human antibody was used for VLA"1 chain expression or CD29 (CBL 481F, Cymbus Biotechnology LTD), along with their isotype control, mouse IgG1 (CBL 600F, Cymbus Biotechnology LTD, Hants, UK). Additionally, a FITCconjugated mouse anti-human VLA5! chain or CD49e (CBL 497F Cymbus Biotechnology LTD, Hants, UK) was used along with its isotype control, a mouse IgG2b (PharMingen, San Diego, CA). The cells were washed with PBS containing 1% FBS and pelleted at 200 x g for 5 min. The stained cells were then fixed with 1% paraformaldehyde (Sigma, St. Louis, MO) in PBS and kept refrigerated until analysis on an EPICS XL-MCL flow cytometer. The percentage of positive cells as well as the mean fluorescence intensities (MFI) were obtained, the latter of which is an expression of the relative antigen density.

C. Synthesis of peptides The peptides were synthesized by stepwise coupling of 9fluorenylmethoxycarbonyl- (Fmoc)-amino acid derivatives on solid-phase Rink amide methylbenzhydrylamine (MBHA) resin (Novabiochem, San Diego, CA) using standard coupling procedures. Usually, diisopropylcarbodiimide (DIC) and

326

Cancer Therapy Vol 3, page 331

Figure 1. RGD peptide effects on glioma cell proliferation. A panel of glioma cells were assayed when incubated with fresh medium, or that containing scrambled non-RGD peptide (Scr) or RGD peptide. The relative metabolic activity was determined by an in vitro colorimetric method. The mean of the absorbances obtained at 562 nm from supernates harvested from triplicate wells Âą SE is shown at 1, 3, 6 and 8 days.

331

Mattern et al: Glioma cell integrin expression and their interactions with integrin antagonists

Figure 2. RGD peptide effects on adhesion of glioma cells to autologous glioma cell extracts of extracellular matrix proteins. The mean absorbance values Âą SE obtained at 595 nm were from triplicate wells containing crystal violet stained cells. Cells were incubated for 4 hr with fresh medium (!) or that containing scrambled peptide ( ) or RGD peptide (!).

The scrambled peptide did not significantly alter the adhesion of glioma cells compared to the medium control. As examples, representative wells from 14-07-MG and U373MG glioma cells show few crystal-violet stained cells left on the plate after exposure to the RGD peptide compared to the glioma cells incubated with scrambled peptide or in medium alone (Figure 3). The second assay entailed a determination of whether RGD peptide, when added to glioma cells in suspension, would interfere with their subsequent attachment to ECM protein-coated plates. Similar findings were obtained (data not shown). The RGD peptide interfered with the adhesion of recently passaged glioma cells in suspension to ECM-coated plates.

Thus, RGD peptide can interfere with glioma cell adhesion or reverse the adhesion of plated glioma cells.

F. Influence of RGD peptide on apoptosis induction in glioma cells A quantitative morphologic assay was conducted to determine the apoptotic effects of RGD peptide on human and rat glioma cell populations. The numbers of apoptotic and live glioma cells were obtained, as determined by counting high power fields of H&E-stained adherent cells by light microscopy (Figure 4). Representative light microscopic photographs of human 10-08-MG glioma cells and rat 9L gliosarcoma cells exposed to RGD peptide

Figure 3. Crystal violet stained 14-07-MG and U-373MG glioma cells adhered to ECM protein-coated wells after 4 hr incubation in fresh medium, in medium containing scrambled peptide, or RGD peptide.

332

Cancer Therapy Vol 3, page 333 for 18 hr (Figures 4a and 4c, respectively) show cells with nuclear changes consistent with apoptosis, as opposed to the control cell monolayers (Figures 4b and 4d, respectively). With a panel of four human glioma cells, quantitative data from the morphologic assay were collected, which showed a 4-6 fold increase in apoptotic cell percentages in two of the four glioma cell populations tested (U-251MG and U-373MG), although the degree of cell injury was not exceptionally high, i.e., only 11-12%. In the other two cases, 10-08-MG and 04-11-MG, few cells remained attached to the slides for counting, thus we were unable to accurately determine the degree of cell injury from a high number of total cell counts. Since we were unable by this method to determine whether the cells that had lifted were viable, or were permanently versus reversibly injured in the 24 hr following 18 hr RGD exposure, we used an alternative flow cytometric technique with 7AAD to examine glioma cell injury in combined adherent/nonadherent cells (Table 3). Early (4 hr) and later (18 hr) time points after glioma cell exposure to RGD peptide were examined. In the assay, another set of four human glioma cell populations were incubated with medium, or with medium containing scrambled or RGD peptide. Again, the percentages of apoptotic cells only reached 18% for two of the four human glioma cell populations by 18 hr. The cell damage observed was not

significantly enhanced relative to the cells exposed to the scrambled peptide controls. Scattergrams from a 7AAD flow cytometric assay, which show live, apoptotic and dead (necrotic/late apoptotic) cell percentages after a 3 hr treatment of rat 9L gliosarcoma cells with scrambled peptide and RGD peptide is shown in Figure 5. An approximate 2-fold increase in injured 9L gliosarcoma cells was observed when they were incubated with RGD peptide (20.9%) compared to the scrambled counterpart (10.1%). The damaged cell population in the medium control was 6.0% (data not shown). Thus, at this early time point apoptosis was slightly induced upon incubation of the 9L rat gliosarcoma cells with RGD peptide, as it was with the human glioma cells.

G. In vivo toxicology and efficacy of the RGD peptide Based upon in vitro testing that showed the high levels of !$"5 integrin expression by the rat 9L and CNS-1 cells and the decreased proliferation of CNS-1 cells and apoptosis induction in 9L cells upon their exposure to the RGD peptide, we proceeded with in vivo toxicity and pilot efficacy assessments with RGD peptide in the rat brain tumor models. For such testing, RGD peptide was

Figure 4. Quantitative morphologic assay showing H&E stained brain tumor cell monolayers that were or were not exposed to RGD peptide (a) human 10-08-MG glioma cells after 18 hr coincubation with RGD peptide demonstrate fewer attached cells and rounded shapes. Some of the cells exhibit typical apoptotic morphological changes such as those with condensed nuclei (black arrow) and fragmented DNA (white arrow) (b) 10-08-MG glioma cells not exposed to RGD peptide exhibited fewer apoptotic cells. The cells were larger with oval nuclei and abundant cytoplasm (c) rat 9L gliosarcoma cells after 4 hr coincubation with RGD peptide. Apoptotic cells with condensed nuclei (black arrows) are visible in the monolayer (d) 9L gliosarcoma cells in monolayer and not exposed to peptide. The healthy cells are well attached to the surface and mitotic figures are readily apparent.

333

Mattern et al: Glioma cell integrin expression and their interactions with integrin antagonists Table 3. RGD effects on glioma cell apoptosis as assessed by a quantitative in vitro morphologic assay on adherent cells (Experiment 1) or by a 7AAD assay where nonadherent and adherent cells were analyzed (Experiment 2). Tumor Additive to Medium none Scrambled RGD peptide

10-08-MG

04-11-MG

13-06-MG

14-07-MG

Incubation time (hr) 4

Apoptotic %

1.1

1.6

2.8

3.6

7.5

0.8

3.3

0.4

4.7

0.8

4.9

8.3

13.6

0.6

4.8

12.0

8.4

2.1

4.2

15.8

18.7

3.0

7.2

17.8

**Glioma cells were plated into 6 well plates for 24 hr. RGD peptide or scrambled peptide (0.001 M), or fresh culture medium were then added to the wells. Coincubation for 4 or 18 hr at 37oC in a humidified 5% CO 2 chamber was followed by collection of the adherent and nonadherent cells. Cells were incubated with 7AAD (20 µg/ml in PBS) for 20 min at 4 oC, rinsed once and resuspended in 400 µlof PBS. Samples were analyzed by flow cytometry. The percentages of glioma cells within the segregated live, apoptotic, and late apoptotic/necrotic populations were determined.

repeatedly introduced intracranially into normal cannulated rat brain and into tumor-bearing cannulated rat brain. To establish appropriate doses for repeated intracranial administrations of RGD peptide, seven different doses (0.1, 0.5, 0.75, 1.0, 1.5, 2.0 and 10 mg/ml), as well as saline controls, were evaluated in cannulated F344 rat brains. Six infusions (10 µl) were given every other day. Groups of rats at the different dose levels (n=4) were evaluated for side effects that included weight loss and symptoms for neurotoxicity. Half or more animals in the groups at the five highest peptide doses exhibited an immediate onset of abnormal motor function, including ataxic gait and some tremor. The animals given the highest intracranial dose displayed the most severe and longlasting (>3 hr) symptoms. We discontinued testing of the

10 mg/ml dose after the first two doses. No disturbances in behavior were monitored at the lowest dose (0.1 mg/ml) and transient but tolerable effects were seen in several animals at the 0.5 mg/ml dose. As a gross estimate of long term toxicity due to repeated administration of treatment agent, mean group weights were monitored during and after treatment. The mean group weights of the animals were maintained or increased over time, indicating their ability to thrive upon exposure to multiple intracranial infusions. The histopathological evaluation of normal brain that received higher doses of the RGD peptide (% 1.0 mg/ml) showed a degree of stress to the brain as evidenced by the presence of congested blood vessels (black arrows) and capillaries (white arrows) (Figure 6a). Some neurons stained pink with eosin, possibly an indication of apoptosis induction and where neuronal dropout would eventually

Figure 5. Scattergrams from a 7AAD flow cytometric assay, which give live, apoptotic and dead (necrotic/late apoptotic) cell percentages after a short 3 hr treatment of rat 9L gliosarcoma cells with (a) scrambled non-RGD peptide and (b) RGD peptide. An approximate 2-fold increase in injured 9L gliosarcoma cells is seen when incubated with RGD peptide compared to the scrambled counterpart. Forward scatter (abscissa) is plotted versus 7AAD intensity (ordinate).

334

Cancer Therapy Vol 3, page 335

Figure 6. Photomicrographs of RGD or scrambled peptide repeatedly introduced intracranially into cannulated normal rat brain (a-c) or 9L tumor-bearing rat brain (d-i). At 24 hr following the last infusion: (a) Rat brains administered RGD peptide at high doses show signs of stress including congested vessels (black arrows) and capillaries (white arrow). (b) At higher power, brains given RGD peptide at higher doses also showed infiltration of mononuclear cells and polymorphonuclear cells (black arrows), indicative of an acute inflammatory reaction. At 7 or 14 days following the last infusion: (c) Small focal sterile granulomas often formed in cannulated rat brain, whether treated with saline or peptide, as visualized by a necrotic center (Nc) surrounded by a fibrotic wall (Fb). Normal brain (NB) was immediately adjacent to the granuloma. (d) At low power, a representative sized area of necrosis characteristic of scrambled peptide treated brains is shown next to (e) a representative larger sized area of necrosis characteristic of RGD peptide treated brains. The (f) saline-treated tumor has viable cells showing a number of mitotic figures (black arrows) and (g) tumor cells at the periphery of the solid tumor mass are infiltrating into perivascular spaces within normal brain. The (h) RGD peptide treated brain sections show many cells with pyknotic nuclei interspersed within the solid tumor mass adjacent to the instillation site (i) often the palisading areas of growth better show the pyknotic cells that are assumed undergoing apoptosis. Healthy tumor cells are also shown growing in perivascular spaces of the RGD peptide treated brains, however, similar to that shown in g. Magnifications are: d,e = 40X, a,c = 100X, h,i = 200X, f,g = 400X, b = 600X

occur. In the brains treated with more dilute doses of RGD peptide (#0.5 mg/ml), at 24 hr following the last infusion, some brains showed an influx of polymorphonuclear leukocytes (black arrows) near the instillation site (Figure 6b), suggestive of an acute inflammatory response. Scattered mononuclear cells also were evident in the brains treated with the RGD peptide (Figure 6b). Although not shown in this particular photomicrograph, some of the cells presented with morphology characteristic of plasma cells. At 7 or 14 days following the last infusion, some brains revealed formation of small focal sterile granulomas (Figure 6c) at the instillation site. A necrotic center (Nc) was surrounded by a fibrotic wall (Fb) composed of fibroblasts, histiocytes and neutrophils; that was immediately adjacent to normal brain (NB). Granulomas may have formed as a result of the cannulation procedure itself, as some were also seen in animals administered saline through the cannulas. Overall,

the areas of damage were small and well contained. The histological differences between the brains given low doses of RGD and scrambled peptides or saline treated were relatively insignificant. In the efficacy studies, 9L tumors were visually discernible in the right frontal quadrants upon gross examination of the brains regardless of whether they were treated with saline, the scrambled non-RGD peptide, or the experimental RGD peptide. Microscopically, at low power, the 9L-tumor bearing brains treated with scrambled peptide had smaller areas of necrosis at the instillation site (Figure 6d), as opposed to those treated with RGD peptide (Figure 6e). Shown at higher power and immediately adjacent to the instillation site, the scrambled peptide or saline treated 9L tumor cells were highly viable and presented in pseudopalisade formation; denoting rapid growth, there were many mitotic figures per microscopic field (black arrows, Figure 6f). Analysis at the periphery

335

Mattern et al: Glioma cell integrin expression and their interactions with integrin antagonists of the solid tumor growth revealed perivascular extension of the tumor cells into normal brain (Figure 6g). Characteristic of the RGD peptide treated brains and within the solid tumor growth adjacent to the instillation site, large numbers of cells appeared with pyknotic nuclei, a characteristic of cells undergoing apoptosis (Figure 6h). Damaged cells were perhaps more readily apparent in areas of pseudopalisading tumor growth (Figure 6i). In the RGD peptide treated brains, however, healthy and viable tumor cells appeared in perivascular spaces as they did in control treated groups. Since tumor cells visible at the periphery of the areas of solid tumor growth would have eventually resulted in the demise of the animals in all treatment groups, including those given the experimental RGD peptide, we performed several pilot experiments to compare delivery of the RGD peptide by intracranial, intraperitoneal, or both administration routes in animals bearing 9L or CNS-1 tumors. Rats with 1 week established CNS-1 tumors were either treated with six infusions, given every other day, of intracranially administered RGD or scrambled peptide (10 µl of 0.001 M), or twelve daily intraperitoneal injections of both types of peptide (100 µl of 0.01 M), or the treatments were combined. At 48 hr following the last treatment, brains were collected and multiple H&E-stained sections were examined; sections were chosen for area analysis that corresponded to at or near the instillation site, where tumor growth would be expected to be the largest. We also assessed the necrotic areas within the tumor mass. As examples, Figure 7a shows a gross section of brain where the majority of the hemisphere contains a tumor with centralized necrosis, whereas Figure 7b shows a tumor without necrosis. Figure 8a shows the mean tumor area for each treated group as a percentage ± SD of the total brain area on the sections. Figure 8b shows the mean necrotic area as a percentage ± SD of the total tumor area on the sections. The trend was that smaller tumor areas with higher necrotic indices were present in the RGD

treated brain slices compared to the scrambled peptide treated controls when peptides were administered by intracranial or intracranial/intraperitoneal combined routes. There were no differences in tumor areas of groups given RGD or scrambled peptide by the intraperitoneal route. Combining intracranial with intraperitoneal administrations did not result in greater anti-tumor effect than the intracranial administrations. Interestingly, none of the animal tumors given intraperitoneally-administered peptides had necrotic areas (data not shown), perhaps implying that the RGD peptide was not delivered across the blood-brain-barrier.

IV. Discussion Previous studies have shown that anti-integrin antagonists (i.e. cyclic RGD peptides) block glioma tumor growth, however, analysis of them in various tumor models, integrin knockout mouse models and established glioma cell lines indicates that further characterization of the role of !v integrins in glioma biology is necessary. In this study we have focused on the characterization of integrin expression by a panel of low passage glioma cells and identified significant differences in the ratio of integrin !v"3 and !v"5 expression in these cells. We propose that the analysis of integrin expression in these low passage and infiltrative glioma cells will be an important consideration in the design of specific integrin antagonists. In these studies we show that although integrin !v"3 is expressed in these low passage glioma cells, consistent with previous observations (Gladson and Cheresh 1991), we also observed a significantly higher level of integrins !v"5 receptor and "1-containing integrins. Using various cyclic RGD integrin antagonists we suggest that targeting integrins !v"5 and !5"1_ may be more important to glioma cell biology than those inhibitors that are primarily restricted to !v"3.

Figure 7. H&E stained sections macroscopically showing tumor filling the majority of the upper part of the hemispheres. Panel (a) shows a tumor containing a substantial degree of necrosis derived from an animal that was treated with IC, IP RGD peptide. Panel (b) shows a tumor not displaying necrosis that was derived from an animal that was treated with IC, IP scrambled peptide. Magnifications are 4X

336

Cancer Therapy Vol 3, page 337

Figure 8. Tumor areas as percentages of total brain areas at the instillation site and necrotic areas as percentages of the total tumor areas, evaluated in groups of RGD and scrambled (Scr) peptide treated rat brains. The peptides were infused 6 times over a two week period. Sacrifice was at 48 hr following the last infusion. (a) The CNS-1 tumor areas are given as percentages of total brain area when administration of RGD or scrambled peptides was by intracranial (IC) or intraperitoneal (IP) routes, or both (IP + IC). (b) Necrotic areas as percentages of the tumor areas at the instillation site when administered by IC or IP + IC routes. The tumors given peptides by the IP route were not necrotic (data not shown). * By unpaired t test with Welch correction, comparing RGD vs Scr given IC the p value was significant at 0.0263. Also, comparing RGD given IP vs IP+IC was not considered quite significant with p=0.0547.

We synthesized a number of RGD-containing peptides and continued study with one that could potently bind to !v"3, !v"5 and !5"1 integrins. It suppressed glioma cell growth, inhibited adhesion of glioma cells to glioma-derived ECM, and induced a small degree of apoptosis in glioma cells in vitro. The findings that the RGD peptide induced reductions of both cell growth and adhesion may be surprising given the direct association of adhesion with migration, and extrapolation of cell migration occurring at the expense of proliferation as put forth in the â&#x20AC;&#x153;go or grow conceptâ&#x20AC;? (Berens and Giese, 1996). Also, it was surprising that the degree of apoptosis induction was relatively low at the few time points we assayed in vitro. The only reason the apoptosis percentages might be higher than assayed is if the cells had already lysed (i.e., not able to adhere in the in vitro morphologic assay or unrecoverable by centrifugation in the 7AAD flow cytometric assay). Of course, the percentages of injured cells might vary if other times after glioma cell exposure to RGD peptide are examined in vitro, or if the assay is performed with ECM substrate. Indeed, Taga and colleagues showed that the !v integrin antagonist EMD12197, which is a cyclic RGDpentapeptide, induced apoptosis in human and pediatric brain tumor cells by detaching them from vitronectin and tenascin (Taga et al, 2002). One group reported that synthetic peptides containing the RGD sequence directly induced apoptosis by entering the cells and inducing autoprocessing and enzymatic activity of pre-caspase 3 (Buckley et al, 1999). Chatterjee and collaborators studied the effects of linear and cyclic RGD peptides on gliomas (Chatterjee et al, 2000). They found that conformation of the peptide was important, as the linear peptide had little killing effect. Furthermore, their cyclic RGD peptide was capable of killing glioma cell lines expressing !v"3 receptors on their cellular membranes, like U-373MG or

U-87MG, whereas it had relatively little effect on the U251MG cell line that did not express the !v"3 __receptors. We assume the reason that the RGD peptide we tested was able to induce a similar level of apoptosis in U-373MG and U-251MG cells was because of its broader specificity. All of the published data are in correlation with the findings by MacDonald and Ladisch, where antisense oligonucleotides to the !v integrin inhibited growth and induced apoptosis of medulloblastoma cells (MacDonald and Ladisch 2001). Thus, our experimental findings conform with those from a number of studies with RGD peptide integrin antagonists that demonstrate similar antitumor actions on brain tumor cells. The in vitro stability of the RGD peptide was very good in rat brain homogenates suspended in aCSF. We believe these data should be indicative of the stability of peptide if administered intracranially. Our data also showed that the RGD peptides displayed a consistent, high stability in plasma upon subcutaneous bolus injection (half life between 3-4 hours, data not shown). Therefore, the pharmacokinetic data demonstrate that they have useful half-lives when administered by these routes. In animal studies, Taga and colleagues showed that the daily systemic administration of the RGD peptide inhibited the growth of orthotopically implanted brain tumors in athymic mice (Taga et al, 2002). The Chatterjee group also intratumorally treated brain tumors with RGD peptide and found anti-tumor effects (Chatterjee et al, 2000). Our animal studies incorporated testing of intracranial or systemic administration of RGD peptide, or a combination of these two administration routes. The tumor areas traced in the groups of animals given RGD peptide intracranially or by combined intracranial and intraperitoneal administration were distinguishably smaller than the groups given scrambled peptide. The RGD peptide treated groups also had a higher necrotic index. The 337

Mattern et al: Glioma cell integrin expression and their interactions with integrin antagonists Chatterjee S, Matsumura A, Schradermeier J and Gillespie GY (2000) Human malignant glioma therapy using anti-!(v)"3 integrin agents. J Neurooncol 46, 135-44. Chen MY, Lonser RR, Morrison PF, Governale LS and Oldfield EH (1999) Variables affecting convection-enhanced delivery to the striatum: a systematic examination of rate of infusion, cannula size, infusate concentration and tissue-cannula sealing time. J Neurosurg 90, 315-20. Ding Q, Stewart J, Jr., Prince CW, Chang PL, Trikha M, Han X, Grammer JR and Gladson CL (2002) Promotion of malignant astrocytoma cell migration by osteopontin expressed in the normal brain: differences in integrin signaling during cell adhesion to osteopontin versus vitronectin. Cancer Res 62, 5336-43. Eskens FA, Dumez H, Hoekstra R, Perschl A, Brindley C, Bottcher S, Wynendaele W, Drevs J, Verweij J and van Oosterom AT (2003) Phase I and pharmacokinetic study of continuous twice weekly intravenous administration of Cilengitide (EMD 121974), a novel inhibitor of the integrins !v"3 and !v"5 in patients with advanced solid tumours. Eur J Cancer 39, 917-26. Fleshner M, Watkins LR, Redd JM, Kruse CA and Bellgrau D (1992) A 9L gliosarcoma transplantation model for studying adoptive immunotherapy into the brains of conscious rats. Cell Transplant 1, 307-12. Gladson CL and Cheresh DA (1991) Glioblastoma expression of vitronectin and the avB3 integrin: adhesion mechanism for transformed glial cells. J Clin Invest 88, 1924-32. Gomez GG and Kruse CA (2003) The isolation and culture of human brain tumor cells. In Methods in Molecular Medicine, Cancer Cell Culture: Methods and Protocols, S. Langdon, (ed) Vol 88, Humana, Totowa, NJ, pp. 101-109. Gomez GG, Read SB, Gerschenson LE, Santoli D, Zweifach A and Kruse CA (2004) Interactions of the allogeneic effector leukemic T cell line, TALL-104, with human malignant brain tumors. Neurooncol 6, 83-95. Grosshans DR, Clayton DA, Coultrap SJ and Browning MD (2002) Analysis of glutamate receptor surface expression in acute hippocampal slices. In: Science's STKE, www.stke.org/cgi/content/full/sigtrans;2002/137/pI8. Heimberger AB, Archer GE, McLendon RE, Hulette C, Friedman AH, Friedman HS, Bigner DD and Sampson JH (2000) Temozolomide delivered by intracerebral microinfusion is safe and efficacious against malignant gliomas in rats. Clin Cancer Res 6, 4148-53. Hynes RO (2002) A reevaluation of integrins as regulators of angiogenesis. Nat Med 8, 918-21. Kleinschmidt-DeMasters BK, Orr EA, Savelieva E, Owens GC and Kruse CA (1999) Paucity of retinoic acid receptor ! (RAR !) nuclear immunostaining in gliomas and inability of retinoic acid to influence neural cell adhesion molecule (NCAM) expression. J Neurooncol 41, 31-42. Kroll RA and Neuwelt EA (1998) Outwitting the blood-brain barrier for therapeutic purposes: osmotic opening and other means. Neurosurg 42, 1083-99; discussion 99-100. Kruse CA, Lamb C, Hogan S, Smiley WR, KleinschmidtDemasters BK and Burrows FJ (2000) Purified herpes simplex thymidine kinase retroviral particles. II. Influence of clinical parameters and bystander killing mechanisms. Cancer Gene Ther 7, 118-27. Kruse CA, Mitchell DH, Kleinschmidt-DeMasters BK, Bellgrau D, Eule JM, Parra JR, Kong Q and Lillehei KO (1993) Systemic chemotherapy combined with local adoptive immunotherapy cures rats bearing 9L gliosarcoma. J Neurooncol 15, 97-112. Kruse CA, Molleston MC, Parks EP, Schiltz PM, KleinschmidtDeMasters BK and Hickey WF (1994a) A rat glioma model, CNS-1, with invasive characteristics similar to those of

histopathological findings were from animal brains collected at 48 hr following the last administration of RGD peptide. Based upon the number of cells with pyknotic nuclei seen dispersed through the tumor, the necrotic index analyzed at later times might have been even higher. Interestingly, none of the animal tumors given intraperitoneally-administered peptides had necrotic areas, indicating delivery of the peptide to the tumor may have been compromised by the blood-brain-barrier. Since the animal study findings are a reflection of one early time point following the last RGD administration, a time course would be warranted before firm conclusions could be reached regarding the toxicity/efficacy of RGD peptide for brain tumor treatment. Nonetheless, the experimental peptide did have some in vitro and in vivo anti-glioma effects that cumulatively appeared to provide limited benefit in vivo. The treatment would need to be experimentally optimized, as healthy tumor cells existing in perivascular spaces would eventually cause the demise of the animals. Delivery of the RGD peptide appeared to be part of the problem. RGD peptide deposited at the instillation site was capable of reducing the tumor burden centrally. However, infiltrating glioma cells escaped the local intracranial delivery and systemic administration appeared to have little effect at the tumor periphery when combined with the intracranial administration. For a significant improvement in survival to occur, it is likely an improvement to delivery of the peptide, such as by convection enhanced delivery and/or transient opening of the blood-brain-barrier would be necessary (Neuwelt and Rapoport 1984; Bartus et al, 1996; Kroll and Neuwelt 1998; Chen et al, 1999). Further testing is warranted.

Acknowledgements We thank Dr. Ron Ingram for helpful discussions regarding the peptide specificities. University of Colorado Cancer Summer Student Fellows, Ms. Esperanza Salazar and Stacy Muffly provided technical assistance associated with the animal studies. CAK was a member of the University of Colorado Cancer Center at the initiation of this project. We gratefully acknowledge financial support from the National Institutes of Health (DK51938-03 and NS046463). This work also was partially supported by Integra Neurosciences, the R. Herbert and Alma S. Manweiler Memorial Fund and the La Jolla Foundation for Molecular Medicine.

References Bartus RT, Elliott PJ, Dean RL, Hayward NJ, Nagle TL, Huff MR, Snodgrass PA and Blunt DG (1996) Controlled modulation of BBB permeability using the bradykinin agonist, RMP-7. Exp Neurol 142, 14-28. Berens ME and Giese A (1996) What's malignant about astrocytomas? Studies of brain tumor proliferation and migration. Barrows Neurol Inst Quarterly 12, 15-22. Buckley CD, Pilling D, Henriquez NV, Parsonage G, Threlfall K, Scheel-Toellner D, Simmons DL, Akbar AN, Lord JM and Salmon M (1999) RGD peptides induce apoptosis by direct caspase-3 activation. Nature 397, 534-9. CBTRUS (2002) CBTRUS: Statistical Report: Primary Brain Tumors in the United States, 1995-1999. Central Brain Tumor Registry of the United States.

338

Cancer Therapy Vol 3, page 339 human gliomas: a comparison to 9L gliosarcoma. J Neurooncol 22, 191-200. Kruse CA, Schiltz PM, Bellgrau D, Kong Q and KleinschmidtDeMasters BK (1994b) Intracranial administrations of single or multiple source allogeneic cytotoxic T lymphocytes: chronic therapy for primary brain tumors. J Neurooncol 19, 161-8. Kruse CA, Varella-Garcia M, Kleinschmidt-Demasters BK, Owens GC, Spector EB, Fakhrai H, Savelieva E and Liang BC (1998) Receptor expression, cytogenetic and molecular analysis of six continuous human glioma cell lines. In Vitro Cell Dev Biol Anim 34, 455-62. MacDonald TJ and Ladisch S (2001) Antisense to integrin !v inhibits growth and induces apoptosis in medulloblastoma cells. Anticancer Res 21, 3785-91. MacDonald TJ, Taga T, Shimada H, Tabrizi P, Zlokovic BV, Cheresh DA and Laug WE (2001) Preferential susceptibility of brain tumors to the antiangiogenic effects of an !(v) integrin antagonist. Neurosurg 48, 151-7. Milner R and Campbell IL (2002) The integrin family of cell adhesion molecules has multiple functions with the CNS. J Neurosci Res 69, 286-91. Neuwelt EA and Rapoport SI (1984) Modification of the bloodbrain barrier in the chemotherapy of malignant brain tumors. Fed Proc 43, 214-9. Owens GC, Orr EA, DeMasters BK, Muschel RJ, Berens ME and Kruse CA (1998) Overexpression of a transmembrane isoform of neural cell adhesion molecule alters the invasiveness of rat CNS-1 glioma. Cancer Res 58, 2020-8. Philpott NJ, Turner AJ, Scopes J, Westby M, Marsh JC, GordonSmith EC, Dalgleish AG and Gibson FM (1996) The use of 7-amino actinomycin D in identifying apoptosis: simplicity of use and broad spectrum of application compared with other techniques. Blood 87, 2244-51. Phuphanich S, Brat DJ and Olson JJ (2004) Delivery systems and molecular targets of mechanism-based therapies for GBM. Expert Rev Neurotherapeutics 4, 649-63. Prados MD, Berger MS and Wilson CB (1998) Primary central nervous system tumors: advances in knowledge and treatment. CA: Cancer J Clin 48, 331-60, 21. Read SB, Kulprathipanja NV, Gomez GG, Paul DB, Winston KR, Robbins JM and Kruse CA (2003) Human alloreactive

CTL interactions with gliomas and with those having upregulated HLA expression from exogenous IFN-& or IFN-& gene modification. J Int Cyt Res 23, 379-93. Ruoslahti E and Reed J (1999) New way to activate caspases. Nature 397, 479-80. Schmid I, Uittenbogaart CH, Keld B and Giorgi JV (1994) A rapid method for measuring apoptosis and dual-color immunofluorescence by single laser flow cytometry. J Immunol Methods 170, 145-57. Taga T, Suzuki A, Gonzalez-Gomez I, Gilles FH, Stins M, Shimada H, Barsky L, Weinberg KI and Laug WE (2002) !v-Integrin antagonist EMD 121974 induces apoptosis in brain tumor cells growing on vitronectin and tenascin. Int J Cancer 98, 690-7. Zhang L, Zhou W, Velculescu VE, Kern SE, Hruban RH, Hamilton SR, Vogelstein B and Kinzler KW (1997) Gene expression profiles in normal and cancer cells. Science 276, 1268-72.

Carol A. Kruse

339

Mattern et al: Glioma cell integrin expression and their interactions with integrin antagonists

340

Cancer Therapy Vol 3, page 341 Cancer Therapy Vol 3, 341-346, 2005

Radiation esophagitis, treatment strategies and prevention Review Article

Gorkem Aksu1, Hakan Bakkal 2, Merdan Fayda 3,Binnaz Celebioglu Sarper1 1

Kocaeli University Faculty of Medicine, Radiotherapy Department Ankara Oncology Hospital, Radiotherapy Department 3 Istanbul University Oncology Institute, Radiotherapy Department 2

__________________________________________________________________________________ *Correspondence: Dr. Gorkem Aksu Yahyakaptan Mahallesi, F29 Blok Da: 12, Kocaeli, Turkey; Tel: 0 555 3750805; E-mail: aksugorkem@yahoo.com Key words: Radiation esophagitis, chemoradiotherapy, Prevention, amifostine Abbreviations: cyclophosphamide, doxorubicin, adriamycin and cisplatin, (CAP); European Organization for Research and Treatment of Cancer, (EORTC); gross tumor volume, (GTV); intensity modulated radiotherapy, (IMRT); National Cancer Institute, (NCI); NCI Common Toxicity Criteria, (NCI-CTC); non-small cell lung cancer, (NSCLC); Radiation Therapy Oncology Group, (RTOG); radiation therapy oncology group, (RTOG); three-dimensional, (3-D) Received: 3 May 2005; Revised: 19 May 2005 Accepted: 24 May 2005; electronically published: May 2005

Summary The most important dose-limiting acute toxicity during radiotherapy for thoracic malignancies is radiation esophagitis. The combined modality treatmentâ&#x20AC;&#x2122;s (chemoradiotherapy) becoming a standard treatment approach for these malignancies has also increased the rate of esophagitis. Generally the first symptoms of radiation esophagitis that are dysphagia and odynophagia are seen 2-3 weeks after the beginning of radiotherapy and the incidence of severe acute esophagitis > or = grade 3 in patients treated with once-daily radiotherapy alone is 1.3%, increasing to 14% to 25% with the addition of concurrent chemotherapy, and 24% to 34% for the combination of hyperfractionated radiotherapy plus concomitant chemotherapy. In order to minimize this complication that can lead to treatment interruptions, three-dimensional (3-D) conformal radiotherapy, varying treatment schedules and doses of chemotherapeutics, radiosensitizers and radioprotectors are tested in several trials. In this review predictive factors and treatment strategies for radiation esophagitis are discussed.

II. Radiation esophagitis in patients treated with chemoradiotherapy

I. Introduction The most important dose-limiting acute toxicity during radiotherapy for thoracic malignancies is radiation esophagitis. The combined modality treatmentâ&#x20AC;&#x2122;s (chemoradiotherapy) becoming a standard treatment approach for these malignancies has also increased the rate of esophagitis. The toxicity related to radiation injury is categorized as acute toxicity (occurring during or just after the completion of chemoradiotherapy and resolving within 4-6 weeks) or late toxicity (occurring months after the completion of the treatment). In order to minimize this complication that can lead to treatment interruptions, three-dimensional (3-D) conformal radiotherapy, varying treatment schedules and doses of chemotherapeutics, radiosensitizers and radioprotectors are tested in several trials. In this review predictive factors and treatment strategies for radiation esophagitis are discussed.

Generally the first symptoms of radiation esophagitis that are dysphagia and odynophagia are seen 2-3 weeks after the beginning of radiotherapy. Table 1 and 2 defines the NCI Common Toxicity Criteria Version 2.0- Acute Dysphagia-Esophageal Grading Criteria and the Radiation Therapy Oncology Group (RTOG)/ European Organization for Research and Treatment of Cancer (EORTC) Late Esophagitis Morbidity Grading Criteria. The reactions are generally graded as I and II in most of the patients according to the National Cancer Institute (NCI) Acute Dysphagia- Esophageal Grading Criteria that means the patients can eat pureed, soft or liquid diet (Table 1). However in some patients especially who are treated with concurrent chemoradiotherapy these reactions can be severe and dysphagia requiring feeding tube or intravenous hydration or rarely complete obstruction can

341

Aksu et al: Radiation esophagitis, treatment strategies and prevention develop. In such cases weight loss and dehydration can threat the patient’s life and treatment shall be interrupted. The late reactions include mild to severe fibrosis causing strictures that may require dilation, necrosis, fistulas or perforation.

As seen in these trials, induction chemotherapy does not significantly increase the incidence of radiation esophagitis. However, today concurrent chemoradiotherapy is the standard treatment for patients with non-small cell lung cancer and good performance status and unfortunately acute esophagitis is a frequent toxicity in such cases. Generally, the incidence of severe acute esophagitis > or = grade 3 in patients treated with once-daily radiotherapy alone is 1.3%, increasing to 14% to 25% with the addition of concurrent chemotherapy, and 24% to 34% for the combination of hyperfractionated radiotherapy plus concomitant chemotherapy (Boal et al, 1979; Umsawasdi et al, 1985; Byhardt et al, 1998; Choy et al, 1998; Hirota et al, 2001; Singh et al, 2003). Umsawasdi et al. analyzed esophageal complications from combined chemoradiotherapy consisting of chemotherapy (cyclophosphamide, doxorubicin, adriamycin and cisplatin = CAP) and 50 Gy radiotherapy in 55 patients with limited non-small cell lung cancer (NSCLC). Group I consisted of 45 patients receiving two courses of CAP, followed by five weekly courses of low dose CAP and radiotherapy followed by additional CAP chemotherapy. In group II, 10 patients received concomitant chemoradiotherapy from the onset of treatment. Esophagitis occurred in 80% of all patients. Severe esophagitis occurred in 27% of patients of Group 1 and 40% of patients of Group 2. Esophageal stricture or fistula rates were also higher in concurrent treatment arm (in 1 of 45 (2%) patients in Group 1 and 3 of 10 (30%) patients in Group 2; p<0.025). The authors concluded that concurrent chemoradiotherapy significantly increased esophageal complications (Umsawasdi et al, 1985). Boal et al. also showed that the addition of concurrent doxorubicin to RT increases the incidence and severity of esophagitis even at well-tolerated dose/fractionation schedules (<60 Gy in 1.8–2-Gy fractions daily) (Boal et al, 1979).

Seaman et al. was the first to determine esophagitis in patients with lung cancer who were treated with 24 MEV photons. They reported that the narrowing of the esophageal lumen was the most common complication and suggested that the tolerance of the esophagus was 60 Gy / 200 cGy per fraction (Seaman and Ackerman, 1957). Emami et al.’s findings in 1991 also supported their suggestions (Bradley and Movsas, 2004). Following Seaman’s findings several trials evaluated the rate of esophagitis after thoracic irradiation. Lepkee and Libshitz reported that among 63 of 250 patients who were treated with thoracic radiotherapy alone only 1 patient (1.6%) had esophageal abnormality while 10 of 132 patients (7.7%) who were treated with chemoradiotherapy had esophagitis in differentiating degrees. Abnormalities included abnormal motility with and without mucosal edema, stricture, ulceration, pseudodiverticulum and fistula. Abnormal motility occurred 4 to 12 weeks following radiotherapy alone and as early as 1 week after therapy when concomitant chemotherapy had been given. Strictures developed 4 to 8 months following completion of radiotherapy. Ulceration, pseudodiverticulum, and fistula formation did not develop in a uniform time frame (Lepke and Kibshitz, 1993). In a randomized trial by Dillman et al. that compared induction chemotherapy and 60 Gy radiotherapy or 60 Gy radiotherapy alone in patients with lung cancer the incidence of esophageal toxicity was < 1% and similar in both groups (Dillman et al, 1990). Supporting these findings, in RTOG 8808 trial, the incidence of esophageal toxicity was also similar in patients who were treated with chemoradiotherapy or radiotherapy alone (Sause et al, 2000).

Table 1. NCI CTC (Common Toxicity Criteria) (Version 2.0) Acute Dysphagia-Esophageal (related to radiation) grading criteria GRADE 0 1 2 3 4

DESCRIPTION None Mild dysphagia but can eat regular diet Dysphagia, requiring predominantly pureed, soft or liquid diet Dysphagia, requiring feeding tube IV hydration or hyperalimentation Complete obstruction (can not swallow saliva), ulceration with bleeding not induced by minor trauma or abrasion or perforation

Table 2. RTOG/EORTC late esophagitis morbidity grading criteria GRADE 0 1 2 3 4

DESCRIPTION No change over baseline Mild fibrosis; slight difficulty in swallowing solids; no pain on swallowing Unable to take solid food normally; swallowing semisolid food; dilatation may be indicated Severe fibrosis; able to swallow only liquids; may have pain on swallowing; dilatation required Necrosis/perforation, fistula

342

Cancer Therapy Vol 3, page 343 Choy et al, reported a 46% incidence of acute Grade 3-4 esophagitis during treatment with 66 Gy of RT (2-Gy daily fractions) and concurrent weekly paclitaxel and carboplatin (Choy et al, 1998). In 1998 Byhardt et al. analyzed the results of five radiation therapy oncology group (RTOG) trials of sequential and/or concurrent chemotherapy and radiotherapy for locally advanced non–small-cell carcinoma of the lung according to response, toxicity, failure patterns and survival. Totally 461 patients were divided into three groups. In group I patients were treated with sequential chemotherapy followed by standard RT (60 Gy in 6 weeks). Group II consisted of patients who received combined sequential and concurrent chemotherapy and standard RT (60 Gy in 6 weeks). In group III patients received concurrent chemotherapy and hyperfractionated RT (69.6 Gy in 6 weeks). Acute toxicity was defined as that occurring within 90 days from the start of RT and late toxicity was defined as that occurring after 90 days from the start of RT. Acute or late toxicity ! grade 3 was defined as severe. Group 3 (concurrent chemotherapy and hyperfractionated RT arm) had a significantly more severe acute esophagitis rate of 34% compared with Group 1 (1.3%) and Group 2 (6%) (p< 0.0001). Late esophagitis rate was also significantly greater in group 3 (8% vs. 2% and 4%; p=0.077). The authors concluded that concurrent chemotherapy and hyperfractionated RT had a significantly higher incidence of severe acute esophageal toxicity (Byhardt et al, 1998). Singh et al, (2003) evaluated 207 patients with NSCLC who were treated with high-dose, definitive 3Dconformal radiotherapy and/or sequential or concurrent chemotherapy for investigating the predictors of radiation esophagitis. The mean dose to the entire esophagus, maximal point dose to the esophagus, and percentage of volume of esophagus receiving >55 Gy were analyzed. The median dose was 70 Gy (range 60–74) delivered in 2Gy daily fractions/once daily. Of 207 patients, 16 patients (8%) developed acute Grade 3–5 esophageal toxicity. Late Grade 3–5 esophageal toxicity was present in 7 patients (3%) and 1 patient died (Grade 5 esophageal toxicity) of late esophageal perforation. In univariate analysis concurrent chemotherapy, maximal point dose to the esophagus >58 Gy, and a mean dose to the entire esophagus >34 Gy were significantly associated with a risk of Grade 3–5 esophageal toxicity. In multivariate analysis concurrent chemotherapy and maximal point dose to the esophagus >58 Gy was significant. An important point was that 14 (88%) of the 16 patients who developed Grade 3–5 esophageal toxicity had received concurrent chemotherapy (p= 0.0001). Only 2 patients developed Grade 3–5 esophageal toxicity in the absence of concurrent chemotherapy that was explained by both’s receiving a maximal esophageal point dose >69 Gy. In conclusion concurrent chemotherapy and the maximal esophageal point dose were found as significantly adverse risk factors for Grade 3–5 esophageal toxicity in patients with NSCLC treated with high-dose 3D-CRT (Singh et al, 2003). Hirota et al. endoscopically investigated the patients who received chemoradiotherapy or thoracic radiotherapy

alone for esophagitis and found out that endoscopic grade 3 esophagitis did not occur in any of the patients who received radiotherapy alone while 27% of patients receiving chemoradiotherapy had grade 3 esophagitis (Hirota et al, 2001). The results of these trials confirm that concomitant chemoradiotherapy is associated with the elevated risk of radiation esophagitis and preventive strategies are necessary to minimize the toxicity.

III. Prevention esophagitis

radiation

In order to reduce the amount of esophagitis several strategies including the use of 3-D conformal radiotherapy, medical management and radioprotectors are developed. The use of conformal radiotherapy is effective in minimizing the irradiated volume of normal tissues as well as esophagus. Medical management includes analgesics and nutritional supplements but most of the patients require further therapies since late reactions may be severe although they are rare. In such cases the use of sucralfate may prevent radiation-induced esophagitis as shown in some trials. Sur et al. analyzed 80 patients with esophageal carcinoma who had acute radiation esophagitis following external beam and intracavitary radiotherapy. The patients were divided into two different treatment arms. Group 1 (n = 40) received an antacid containing sodium alginate and Group 2 (n = 40) received a 10% sucralfate suspension during 4 weeks. In sucralfate group, 32 of 40 patients (80%) had a significant relief of symptoms within 7 days of treatment and it was detected endoscopically that most ulcers had healed by 12 days of treatment. Patients receiving sodium alginate showed little improvement of symptoms and had persistent ulcers even after 4 weeks of therapy. The authors concluded that the use of oral sucralfate was useful in the management of acute radiation esophagitis (Sur et al, 1994). There are also trials showing that sucralfate has a limited effect in the treatment of radiation esophagitis radiation induced odynophagia. In one of these trials, Taal et al, (1995) administered sucralfate labeled with TC99m to 26 patients with esophageal carcinoma and endoscopically proven radiation esophagitis. The degree of coating was evaluated according to persistence of the radionuclide in the affected esophageal segment. Although scans were positive for radioactivity in 24 of 26 (92%) patients, only 8 (31%) of these represented selective binding of sucralfate to tissue. In the other 16 cases, scans were positive for sucralfate and albumin, indicating nonspecific retention most likely caused by concomitant esophageal stenosis. Residual radioactivity was observed for 30 minutes or more in 11 (42%) patients, but scans were positive for radioactivity after 1 to 2 hours in only 4 (15%). These findings suggested that the inability of sucralfate in alleviating radiation-related odynophagia might be related to insufficient duration of adherence of sucralfate to the damaged esophageal mucosa (Taal et al, 1995). 343

Aksu et al: Radiation esophagitis, treatment strategies and prevention In a different randomized study by McGinnis et al, (1997) that included 97 patients the preventive effect of sucralfate was evaluated among patients who received thoracic radiotherapy. The patients received sucralfate or placebo during radiotherapy. Surprisingly although only 2 placebo patients (4%) stopped their study medication during the first 2 weeks, in sucralfate group this number reached up to 20 patients (40%) that was thought to be related with the increased incidence of gastrointestinal toxicity (58% of sucralfate patients vs. 14% of placebo patients; p < 0.0001). The authors also reported that there was no substantial benefit of sucralfate in esophagitis scores and concluded that oral sucralfate solution did not appear to inhibit radiation-induced esophagitis and was associated with disagreeable gastrointestinal side effects in this patient population (McGinnis et al, 1997). As seen, sucralfate at least has a limited effect on the prevention of radiation esophagitis and the most important point is the continuation of nutrition by endoscopic dilatation, stent-implantation or endoscopic percutaneous gastrostomy. There is still no effective prophylactic measure and local injection of steroids may be used to avoid an early restenosis. Topical or systemic analgesics can also be useful and calcium antagonists may be used in cases with esophageal spasm. If the symptoms are complicated with the presence of gastro-esophageal reflux, proton pump inhibitors shall also be used (Zimmermann et al, 1998).

esophagitis occurring in 14-25% of patients (Albain et al, 1995; Ardizzoni et al, 1999; Lopez-Picazo et al, 1999; Tan et al, 1999; Uittterhoeve et al, 2000). For chemoradiotherapy regimens that use paclitaxel, esophagitis rates are higher (37-70%) (Senzer, 2002), (Leong et al, 2003). Leong et al. tested concurrent weekly paclitaxel (60 mg/m2) and 64 Gy radiotherapy with or without amifostine in patients with stage III lung cancer. The incidence of grade 2-3 esophagitis was %43 in patients who received amifostine while patients who did not receive amifostine had an esophagitis rate of 70% but the difference did not reach a significance (Leong et al, 2003). In a different phase III study Senzer et al. tested the radioprotective efficacy of amifostine among 100 patients with NSCLC who received concurrent hyperfractionated radiotherapy (64.8 Gy) with weekly paclitaxel and carboplatin followed by gemcitabine and carboplatin. The preliminary results demonstrated no cytoprotective benefit of amifostine (Senzer, 2002). Following these studies RTOG conducted a large trial to test the role of amifostine, RTOG 9801 that included 243 patients with stage II or III NSCLC. The importance of this trial was that it was the only trial that prospectively analyzed quality of life. The patients received induction chemotherapy consisting of paclitaxel and carboplatin followed by concurrent weekly paclitaxel and carboplatin and hyperfractionated RT (69.6 Gy-1.2 Gy/fraction/twice a day). They were randomized to with or without intravenous 500 mg amifostine arms at the beginning of the radiotherapy and esophageal toxicities were analyzed with NCI Common Toxicity Criteria (NCICTC) and RTOG/EORTC Late Esophagitis Morbidity Grading Criteria. Totally 122 of 245 patients (49%) received amifostine. Grade 3 or greater esophagitis rates were 30% and 34% respectively showing no significant difference between two arms (p=0.9). Although overall quality of life was not significantly different between two arms the only advantage of amifostine was the significant improvement in pain and less deterioration at 6 weeks of follow-up on the amifostine arm (p= 0.003). Another finding of this trial was that there was a significant increase in nausea and vomiting, cardiovascular toxicity (transient hypotension in most of the patients) and febrile neutropenia in amifostine arm. Amifostine also had no benefit on survival and the median survivals were similar in both groups (15.5 months in amifostine arm and 15.6 months in no amifostine arm) (Movsas et al, 2003). Although the results of RTOG trial did not support that amifostine has an effect on reducing esophagitis in patients who receive concurrent chemoradiotherapy recent trials investigated its possible advantages with alternative radiation and chemotherapy schedules. Recently Werner-Wasik et al. conducted a randomized phase II study of amifostine for patients with inoperable stage II-IIIA/B or stage IV non-small cell lung cancer with oligometastases receiving concurrent radiochemotherapy with carboplatin and paclitaxel followed by optional consolidative chemotherapy as a follow-up study after RTOG 98-01 and the results are awaited (Werner-Wasik et al, 2004).

IV. The role of amifostine in radiation esophagitis After the demonstration of the efficacy of amifostine (WR-2721) as a radioprotector in reducing the severity of acute and late xerostomia without compromising the efficacy of radiotherapy in patients with head and neck cancer (Sauer et al, 1999) several randomized trials tested the role of amifostine in reducing radiation esophagitis and radiation-related pneumonitis. Antonadou et al. reported the results of a phase III randomized trial that tested intravenous amifostine and thoracic radiotherapy in 146 patients with lung cancer and showed that amifostine significantly reduced the incidence of esophagitis and pneumonitis (p< 0.001) (Antonadou et al, 2001). Koukourakis et al. investigated the efficacy of subcutaneous administration of amifostine in 60 patients with thoracic malignancies and the results showed that subcutaneous administration was well tolerated end effectively reduced radiation esophagitis (p<0.04) (Koukourakis et al, 2000). In 2003 Antonadou et al. reported the results of a different randomized trial that included 73 patients with previously untreated Stage IIIA and IIIB NSCLC. Group I received radiotherapy alone while the patients in group II received radiotherapy and 300 mg/m2 intravenous amifostine. The incidence of Grade >= 3 esophagitis was significantly lower in patients that received amifostine (38.9% vs. 84.4%; p<0.0001) (Antonadou et al, 2003). Cisplatin-based chemotherapy regimens are associated with a lower incidence of esophagitis given concurrently with radiotherapy, with significant 344

Cancer Therapy Vol 3, page 345 Fractioanated Radiotherapy, A randomized Phase II Study. J Clin Oncol 18, 2226-2233. Leong SS, Tan EH, Fong KW, Wilder-Smith E, Ong YK, Tai BC, Chew L, Lim SH, Wee J, Lee KM, Foo KF, Ang P, Ang PT (2003) Randomized double-blind trial of combined modality treatment with or without amifostine in unresectable stage III non-small-cell lung cancer. J Clin Oncol 21, 1767-74. Lepke RA, Kibshitz HI (1993) Radiation-induced injury of the esophagus. Radiology 148, 375-378. Lopez-Picazo JM, Azinovic I, Aristu JJ, et al (1999) Induction platinum-based chemotherapy followed by radical hyperfractionated radiotherapy with concurrent chemotherapy in the treatment of locally advanced nonsmall-cell carcinoma of the lung. Am J Clin Oncol 22, 203208. McGinnis WL, Loprinzi CL, Buskirk SJ, Sloan JA, Drummond RG, Frank AR, Shanahan TG, Kahanic SP, Moore RL, Schild SE, Humphrey SL (1997) Placebo-controlled trial of sucralfate for inhibiting radiation-induced esophagitis. J Clin Oncol 15, 1239-4. Movsas B, Scott C, Langer C, et al (2003) Phase III study of amifostine in patients with locally advanced non-small cell lung cancer (NSCLC) receiving chemotherapy plus hyperfractionated radiation (Chemo/HFxRT), Radiation Therapy Oncology Group (RTOG) 98-01 (abstract 2599). Proc Am Soc Clin Oncol 22, 636. Sauer R, Wannenmacher M, Waserman T et al (1999) A randomized phase III trial of radiation +- amifostine in patients with head and neck cancer (abstr 1516). Proc Am Soc Clin Oncol 18, 392a. Sause W, Kolesar P, Taylor SI, et al (2000) Final results of phase III trial in regionally advanced unresectable non-small cell lung cancer, Radiation Therapy Oncology Group, Eastern Cooperative Oncology Group, and Southwest Oncology Group. Chest 117, 358-364. Seaman WB, Ackerman LV (1957) The effect of radiation on the esophagus: A clinical and histologic study of the effects produced by the betatron. Radiology 68, 534-541. Senzer N (2002) Rationale for a phase III study of erythropoietin as a neurocognitive protectant in patients with lung cancer receiving prophylactic cranial irradiation. Semin Oncol 29, 47-52. Singh AK, Lockett MA, Bradley JD (2003) Predictors of radiation-induced esophageal toxicity in patients non-small cell lung cancer treated with three-dimensional conformal radiation therapy. Int J Radiat Oncol Biol Phys 55, 337341. Sur RK, Kochhar R, Singh DP (1994) Oral sucralfate in acute radiation oesophagitis. Acta Oncol 33, 61-3. Taal BG, Vales Olmos RA, Boot H, Hoefnagel CA (1995) Assessment of sucralfate coating by sequential scintigraphic imaging in radiation-induced esophageal lesions. Gastrointest Endosc 41, 109-14. Tan EH, Wee J, Ang PT, et al (1999) Induction chemotherapy followed by concurrent chemoradiotherapy in stage III unresectable non-small cell lung cancer. Acta Oncol 38, 1005-1009. Uittterhoeve AL, Belderbos JS, Koolen MG et al (2000) Toxicity of high dose radiotherapy combined with daily cisplatin in non-small cell lung cancer, Results of the EORTC 08912 phase I/II study â&#x20AC;&#x201C; European Organization for Research and Treatment of Cancer. Eur J Cancer 36, 592-600. Umsawasdi T, Valdivieso M, Barkley HT Jr, Booser DJ, Chiuten DF, Murphy WK, Dhingra HM, Dixon CL, Farha P, Spitzer G, et al (1985) Esophageal complications from combined chemoradiotherapy (cyclophosphamide + Adriamycin +

In a recent review by Gopal, it was reported that evidences in the literature suggested that the protective effect of amifostine appeared to be the result of a reduction in the accumulation of macrophages and a decrease in plasma and tissue transforming growth factorbeta levels in radiation-related pneumonitis (Gopal, 2004).

V. Conclusion As seen above a standard treatment in order to reduce esophageal toxicity during chemoradiotherapy is yet to be identified and much additional work investigating new biological modifiers as radioprotectors shall be performed. Although the effect of amifostine in reducing radiation esophagitis is not clear, with some encouraging results it shall be tested in new trials combined with intensity modulated radiotherapy (IMRT) and new biologic modifiers.

References Albain KS, Rusch VW, Crowley JJ, et al (1995) Concurrent cisplatin/etoposide plus chest radiotherapy followed by surgery for stages IIIA(N2) and IIIB non-small-cell lung cancer, Mature results of Southwest Oncology Group phase II study 8805. J Clin Oncol 13, 1880-1892. Antonadou D, Coliarakis N, Synodinou M, et al (2001) Randomized phase III trial of radiation treatment +/amifostine in patients with advanced-stage lung cancer. Int J Radiat Oncol Biol Phys 51, 915-922. Antonadou D, Throuvalas N, Petridis A, et al (2003) Effect of amifostine on toxicities associated with radiochemotherapy in patients with locally advanced non-small cell lung cancer. Int J Radiat Oncol Biol Phys 57, 402-408. Ardizzoni A, Grossi F, Scolaro T, et al (1999) Induction chemotherapy followed by concurrent standard radiotherapy and daily low-dose cisplatin in locally advanced non-smallcell lung cancer. Br J Cancer 81, 310-315. Boal DKB, Newburger PE, Teele RL (1979) Esophagitis induced by combined radiation and adriamycin. Am J Radiol 137, 567-570. Bradley J, Movsas B (2004) Radiation esophagitis, Predictive factors and preventive strategies. Semin Radiat Oncol 14, 280-286. Byhardt RW, Scott C, Sause WT, et al (1998) Response, toxicity, failure patterns and survival in five RTOG trials of sequential and/or concurrent chemotherapy and radiotherapy for locally advanced non-small cell lung carcinoma of the lung. Int J Radiat Oncol Biol Phys 42, 469-478. Choy H, Akerley W, Graziano S (1998) Multiinstitutional phase II trial of paclitaxel, carboplatin, and concurrent radiation therapy for locally advanced non-small-cell lung cancer. J Clin Oncol 16, 3316â&#x20AC;&#x201C;3322. Dillman RO, Seagren SL, Propert KJ, et al (1990) A randomized trial of induction chemotherapy plus high-dose radiation versus radiation alone in stage III non-small cell lung cancer. N Engl J Med 323, 940-945. Gopal R (2004) Non-small cell lung cancer, the role of cytoprotection in treating therapy-related toxicity. J Support Oncol 2, 6 Suppl 3, 13-7. Hirota S, Tsujino K, Endo M, et al (2001) Dosimetric predictors of radiation esophagitis in patients treated for non-small cell lung cancer with carboplatin/paclitaxel/radiotherapy. Int J Radiat Oncol Biol Phys 51, 291-295. Koukourakis MI, Kyrias G, Kakolyris S et al (2000) Subcutaneous Administration of Amifostine During

345

Aksu et al: Radiation esophagitis, treatment strategies and prevention cisplatin + XRT) in the treatment of non-small cell lung cancer. Int J Radiat Oncol Biol Phys 11, 511-9. Werner-Wasik M, Langer C, Movsas B (2004) Randomized phase II study of amifostine mucosal protection by either subcutaneous injection or rapid IV bolus for patients with inoperable stage II-IIIA/B or stage IV non-small cell lung cancer with oligometastases receiving concurrent radiochemotherapy with carboplatin and paclitaxel followed by optional consolidative chemotherapy, a follow-up study after RTOG 98-01. Semin Oncol. 31, 6 Suppl 18, 47-51. Zimmermann FB, Geinitz H, Feldmann HJ (1998) Therapy and prophylaxis of acute and late radiation-induced sequelae of the esophagus. Strahlenther Onkol 174 Suppl 3, 78-81.

Gorkem Aksu

346

Cancer Therapy Vol 3, page 347 Cancer Therapy Vol 3, 347-356, 2005

Association between MUC1mucin, E-cadherin and nm23-H1expression and clinicopathological features in patients with invasive carcinoma of the cervix Research Article

Veronica S. Jeyadoss1,5, Chetlur Srinivasan! Vijayalakshmi2, Balaraman Nair M3, Halagowder Devaraj1, Niranjali Devaraj4, Prabha Balaram5,* 1

Unit of Biochemistry, Dept. of Zoology, University of Madras, Chennai Department of Pathology, Royapettah Govt. Hospital, Chennai 3 Chief Pathologist, Doctor’s Diagnostic Research Centre, Trivandrum 4 Department of Biochemistry and Molecular Biology, University of Madras, Chennai 5 Division of Cancer Research, Regional Cancer Centre, Trivandrum 2

__________________________________________________________________________________ *Correspondence: Prabha Balaram, Professor and Head, Division of Cancer Research, Regional Cancer Centre, Trivandrum, Kerala, India – 695011; Tel: 91-471-2522203; Fax: 91-471-2447454; E-mail: prabhabalaram@yahoo.co.in Key words: Mucin-1, E-cadherin, NM23-H1, Uterine cervical carcinoma, Immunohistochemistry, Cancer Invasion, Metastasis Abbreviations: amino ethyl carbazole, (AEC); avidin-biotin peroxidase complex, (ABC); Bovine Serum Albumin, (BSA); E-cadherin, (Ecad); International Federation of Gynaecology and Obstetrics, (FIGO); Moderately Differentiated Squamous Cell Carcinoma, (MDSCC); Mucin1, (MUC1); nm23 gene, (NME1); Well Differentiated Squamous Cell Carcinoma, (WDSCC) Received: 9 March 2005; Revised: 26 May 2005 Accepted: 27 May 2005; electronically published: June 2005

Summary The expression of MUC1 mucin, E-cadherin and nm23-H1 proteins has been evaluated immunohistochemically in lesions of uterine cervix in order to delineate the role of their expression in relation to metastasis. The results show significant over expression (p 0.003) and translocation of MUC1 to the cytoplasm in cancer lesions and strong association with node positivity. Down regulation of nm23-H1 and E-cadherin protein expression was observed with many lesions being totally negative with no association with node positivity with regard to staining intensity. However, the nm23-H1 negative tumors were mostly node positive (86%, p 0.02). The risk for node positivity was higher in lesions with intense MUC1 positive-nm23-H1 negative tumors. The results thus show that i. malignant transformation is associated with a translocation of MUC1 and E-cadherin to the cytoplasm suggesting changes in its function and ii. lesions positive for MUC1 and negative for nm23-H1 expression have high risk of lymph node metastasis and can be used as markers of invasion and metastasis in cancer of the uterine cervix.

value, they are not very precise and their informative value appears to be limited. Recent studies have therefore focused on identifying molecular markers that might accurately reflect biological aggressiveness of cervical cancers. In this regard, cell adhesion molecules Mucin1 (MUC1), E-cadherin (E-cad) and the anti-metastatic protein nm23-H1 deserve particular attention among the several interesting metastatic-specific marker genes. Mucins are high molecular weight glycoproteins that contain oligosaccharides and have the unique function of protecting and lubricating epithelial surfaces. But in recent

I. Introduction Cervical neoplasia continues to be a significant disease worldwide in terms of prevalence, morbidity and mortality (Greenlee et al, 2000). Despite the introduction of many screening programmes, nearly half a million patient’s die of metastatic disease and this loss may be partly due to the difficulty in predicting the biologic potential of this disease. Identifying patients likely to develop metastatic spread at an early stage in disease progression may have important clinical implications. Although clinical and pathologic parameters such as tumor size, the histological type and grade have some predictive

347

Jeyadoss et al: Altered expression of invasion/metastasis related proteins in carcinoma of uterine cervix formalin and were embedded in paraffin for routine histologic procedures. The patients with cervical carcinoma were clinically staged according to the criteria of the International Federation of Gynaecology and Obstetrics (FIGO) based on clinical findings. Histologic grouping of biopsies was assigned according to the WHO classification. The benign biopsies revealed Erosion cervix, Basal cell hyperplasia, and chronic cervicitis. The carcinoma biopsies were classified as Well Differentiated Squamous Cell Carcinoma (WDSCC) and Moderately Differentiated Squamous Cell Carcinoma (MDSCC) and Adenocarcinoma tumors. The sample contained no Poorly Differentiated Squamous Cell Carcinoma. Patients displaying positive and negative lymph node metastases were also compared in this study. Patients had their lymph nodes removed either by radical hysterectomy or by a laparoscopic approach. Accordingly, the samples included Erosion cervix-3, Basal cell hyperplasia-4, Chronic cervicitis-3, WDSCC18, MDSCC-29 and Adenocarcinoma- 8.

years they have also been implicated in additional diverse roles such as growth, fetal development, epithelial renewal and differentiation, epithelial carcinogenesis and metastasis (Kim et al, 1996). Among the fourteen mucin genes identified, the human DF3/MUC1 is one of the best known transmembrane glycoprotein with a large extracellular domain and a cytoplasmic domain. While the exact function of MUC1 mucin in the normal cell is still a matter of debate, they have had considerable impact as markers in many human carcinomas (Gendler et al, 1990). E-cadherin, an important member of the cadherin family is reported to act as a master molecule in maintaining the architecture and in differentiation of normal epithelium (Birchimer et al, 1993). They are transmembrane glycoproteins localized in the plasma membrane of cells and mediate calcium-dependent cell-cell adhesion, predominantly through homophilic interaction of their extracellular domains (Birchmeier and Beherens, 1994). The nm23 gene (NME1), localized on chromosome 17q21.3 was first isolated by differential screening of cDNA library from low and high metastatic clones of a murine melanoma cell line (Steeg et al, 1988). Presently, a total of five nm23 family members have been identified (nm23-H1H5) (Munier et al, 1998). Taken together, the gene products of this family are thought to function in the growth, development, differentiation and apoptosis of normal tissue. The clinical relevance of nm23-H1 as a metastasis suppressor for human cancers remains enigmatic. The significance of nm23-H1 expression in human cancer seems to differ among the diverse tumour types, leading to contradictory conclusions regarding the biological properties of the nm23-H1 gene product. Although MUC1, E-cadherin and nm23-H1 protein expression are associated most consistently with epithelial tissues, no detailed study concerning the consequences of their interactions and their relationship with invasive and metastatic nature of the lesions of carcinoma of the cervix has been reported till date. The current study is the first, to our knowledge, to examine the expression pattern of MUC1, E-cadherin and nm23-H1 proteins in uterine cervical cancer and their relationship with the clinico-pathological factors using immunohistochemistry.

C. Antibodies used Mouse monoclonal antibody DF3 (Dako, Denmark) specific for MUC1, Goat polyclonal antibody CDH1 (Santa Cruz, California) specific for E-cadherin, and Rabbit polyclonal antibody NME1 (Santa Cruz, California) specific for NM23-H1 were used at 1/50, 1/30 and 1/100 dilutions respectively. All the dilutions were done in 1X (PBS) phosphate buffered saline buffer (pH=7).

D. Immunohistochemical study The avidin-biotin peroxidase complex (ABC) method was used for immunostaining. 4Âľ sections cut from paraffin blocks, and mounted on silane (3-aminopropyl triethoxy silane; Sigma, St Louis, USA) coated glass slides were deparaffinised using xylene and hydrated using decreasing gradients of alcohol. The sections were washed in PBS buffer and antigen unmasking was performed by microwave treatment (three sequential steps of 3 min each in 10mM citrate buffer (pH=6). To block endogenous peroxidase activity, the specimens were treated with 0.3% hydrogen peroxide in 70% methanol for 30 minutes. The sections were incubated in 3% Bovine Serum Albumin (BSA) for 30 minutes to block nonspecific binding. Then the sections were incubated overnight with primary antibody and immunostained with MUC1 Mucin specific monoclonal antibody DF3 or E-cadherin specific polyclonal antibody CDH1 or nm23-H1 specific polyclonal antibody NME-1 at 40C, washed and incubated with a biotinylated secondary antibody (30 minutes), washed and incubated again with avidinHRP conjugated tertiary antibody (30 minutes). The peroxidase reaction was visualised by incubating with amino ethyl carbazole (AEC) for 10 minutes in the dark and counterstained with haematoxylin. All washings were done in 1X PBS buffer. As positive controls, poorly differentiated breast cancer tissues were used for MUC1, and well differentiated breast cancer tissue was used for E-cadherin and Nm23-H1 proteins. To ensure antibody specificity, control sections were incubated with isotype control immunoglobulin instead of the primary antibody with each set of immunohistochemical analysis.

II. Materials and methods A. Patient selection The patient population for this study consisted of total 65 samples of which 55 individuals were presented with cervical carcinoma at the Institute of Obstetrics and Gynaecology, Madras Medical College, Egmore, Chennai, India. In addition to this, 10 benign cervical tissues were obtained from patients undergoing hysterectomy for benign diseases of the corpus uteri with normal cervical cytology. Informed consent regarding the use of tissue specimens for research purpose was obtained from all patients. The clinical details of the patients were collected from the medical records maintained in the hospital and also by personal interview.

E. Evaluation of immunostaining Sections were examined under light microscope and tumor cells were examined microscopically for positive staining and the intensity of staining was evaluated. The staining pattern was assessed without the prior knowledge of histopathological diagnosis. Semi-quantitative four-point scale score was used, based on the intensity as follows: negative - 1; mild positive - 2; moderate positive - 3; and intense positive - 4 respectively. The staining pattern was evaluated by an independent investigator and confirmed in consultation with the two pathologists (C.S.V and B N) who were

B. Sample collection Since most of the patients were treated by radiotherapy, single punch biopsy from the tumor was taken from all patients for analysis before treatment. Carcinoma specimens were also collected by surgical excision from 30 untreated patients with invasive carcinoma. All tissue samples were fixed in 10% neutral buffered

348

Cancer Therapy Vol 3, page 349 unaware of the final diagnosis and reviewed the biopsies independently.

1F). However, the mean staining score showed a significant increase in invasive lesions (3.93 ±0.25), when compared to non-invasive lesions (3.24± 1.20) (P 0.005) (Table 2). The odds ratio of a lesion showing intense MUC1 positivity to be lymph node positivity was ¯2: 7.87, P 0.015, CI: 1.51-41.03.

F. Statistical analysis For histological type comparisons of the staining intensities of the three respective antibodies, the mean staining score was calculated using Student’‘t’– test. The frequency of the positivity/negativity of the protein expression was analysed by ¯2 test. Expression of the various proteins was analysed between the different histological groups using non-parametric MannWhitney U Test and P value < 0.05 was considered significant. Spearman Bivariate Correlation Analysis was performed for analysing the correlation between the various parameters studied using histological types and metastases.

B. E-cadherin expression The expression of E-cadherin protein showed difference in the different groups of benign lesions. In hyperplastic squamous epithelium, the specific E-cadherin expression was moderate to intense and membranous. The expression was observed both in the superficial and basal layers (Figure 2A). However, a striking alteration of the E-cadherin expression pattern was apparent in chronic cervicitis lesions where they showed intense cytoplasmic expression (Figure 2B), while a heterogenous distribution of staining of both membranous and cytoplasmic nature was noticed in the epithelial tumor lesions (Table 1). The immunostaining appeared to be less intense wherever cellcell contact appeared loose. In the E-cadherin positive cancer cases, cytoplasmic immunostaining was very mild and distributed throughout the carcinoma cell nests (Figure 2C and 2D). E-cadherin expression did not show any relation with the invasive status and was mild both in the invasive and non-invasive carcinoma tissues. E-cadherin expression in cancerous cases, when analyzed in relation to benign cases showed a marked down regulation and this difference was found to be highly significant (P 0.009). The down regulation was more marked in the advanced stages of the disease (Table 2). All the adenocarcinoma cases were positive for the expression of E-cadherin while 38% of the SCC cases were negative for this protein. The negativity for this protein was higher in the WDSCC cases (50% in WDSCC Vs 31% in MDSCC), (P 0.013). No significant correlation of this protein was noticed with lymph node positivity (P 0.616) or MUC1 expression (r:-0.095 p 0.452) whereas a positive correlation was noticed with nm23H1 expression (r: 0.641 p 0.009) in ¯2 analysis.

III. Results A. Muc1/Mucin expression Labelling of MUC1 protein in benign lesions was mostly restricted to membrane of basal, parabasal and suprabasal cells with moderate intensity in the hyperplastic lesions. (Figure 1A). The glandular cells showed apical expression in all cases. Chronic cervicitis formed a separate entity among the benign lesions that MUC1 expression was mild and seen in the cytoplasm (Figure 1B) The malignant lesions were characterized by a translocation of the protein to the cytoplasm in majority of cases. In a few cases, concomitant membrane and cytoplasmic positivity was observed (Table 1). 91% of the malignant lesions were positive for MUC1 expression wherein the staining was of intense nature (80%).91% of the malignant lesions were positive for MUC1 expression wherein the staining was of intense nature (80%). The squamous cell carcinoma cases showed a higher frequency (94%) of moderate to intense staining when compared to adenocarcinoma cases (75%). Among the SCC groups, a higher percentage of intense positivity was observed in the lesions with lower differentiation (MDSCC 86% Vs 72% in WDSCC) and in an advanced stage of the disease P 0.003 (Figure 1C and 1D) (Table 2). Cytoplasmic expression of high intensity was noticed both in the invasive lesions and non-invasive lesions (Figure 1E and

Table 1. Expression of MUCIN-1, E-CADHERIN and NM23-H1 proteins in relation to their cellular localization PROTEINS

MUC 1 Benign (10) SCC (47) Adeno (8) E-cadherin Benign (10) SCC (47) Adeno (8) NM23-H1 Benign (10) SCC (47) Adeno (8)

Negative No. cases(%)

0(0%) 3(6.38%) 2(25%)

Apical No. cases(%) 4(40%) 0(0%) 0(0%)

Memb. No. cases (%)

Cyto + Memb. No. cases (%)

Cytoplasm No. cases(%)

3(30%) 0(0%) 0(0%)

0(0%) 23(48.9%) 3(37.5%)

3(30%) 21(44.6%) 3 (37.5%)

0(0%) 18(38.2%) 0(0%)

7(70%) 0(0%) 0(0%)

3(30%) 29(61.7%) 8(100%)

0 (0%) 13(27.6%) 1(12.5%)

10(100%) 34(72.3%) 7 (87.5%)

349

Jeyadoss et al: Altered expression of invasion/metastasis related proteins in carcinoma of uterine cervix

Figure 1. (A) Membrane immunoreactivity of MUC1 in hyperplastic squamous epithelium (X 25) (B) Cytoplasmic immunoreactivity of MUC1 in lesions of Chronic cervicitis (X25). (C) Cytoplasmic immunoreactivity of MUC1 in lesions of Well differentiated Squamous Cell Carcinoma lesion (X 40) (D) Cytoplasmic immunoreactivity of MUC1 in lesions of Moderately Differentiated Squamous Cell Carcinoma lesion (X 40) (E) Cytoplasmic immunoreactivity of MUC1 in invasive lesion (X40) (F) Cytoplasmic immunoreactivity of MUC1 in Non-invasive lesion (X40).

positivity in cancer lesions. In cancer cases, a loss of nm23-H1 expression was noticed in majority of less differentiated and more advanced tumors (Table 2). In cancer lesions, no statistical difference was noticed between the histological groups in terms of intensity of staining. None of the benign lesions were negative for

C. Nm23-H1 expression The nm23-H1 protein showed cytoplasmic localization in both benign and cancer cases (Table 1). The intensity of expression was generally moderate to intense and localized to the glandular and squamous epithelium in the benign lesions when compared to mild to moderate 350

Cancer Therapy Vol 3, page 351 Table 2. Relationship of MUCIN-1, E-CADHERIN and NM23-H1 with clinicopathological characters

Benign (10)

10 (100)

Expression Mean value 3.10 ±0.88

Erosion (4) Hyperplasia(3) Chr.cervicitis(3) Cancer (55) Histology WDSCC (18) MDSCC (29) Adeno (8) Stage IA & IB (10) IIA & IIB (13) IIIA & IIIB(32) Nodal status Negative (25) Positive (30)

4(100) 3(100) 3(100) 50(90.9)

4.00±0.00 3.00±0.00 2.00±0.00 3.62 ±0.89 *

4(100) 3(100) 3(100) 37(67.2)

3.00±0.00 2.33±0.33 2.66±0.33 1.67±0.47*

4(100) 3(100) 3(100) 41(74.5)

4.00±0.00 3.00±0.00 4.00±0.00 2.07±0.76*

17(94.4) 27(93.1) 6 (75)

3.61±0.78 3.72 ±0.80* 3.25 ± 1.39

9 (50) 20(68.9) 8 (100)

1.50±0.51* 1.68±0.47* 2.00±0.00*

12(66.6) 22(75.8) 7 (87.5)

2.11±0.90* 2.00±0.70* 2.25±0.70*

8 (80) 10 (76.9) 32 (100)

3.30 ±1.25 3.31 ±1.32 3.84±0.3*

8 (80) 6 (46.1) 23(71.8)

1.80±0.42* 1.46±0.51* 1.71±0.45*

9 (90) 7 (53.8) 25(78.1)

2.40±0.69* 1.5±0.51* 2.1±0.78*

20 (80) 30 (100)

3.24±1.20** 3.93±0.25**

19 (76) 18 (60)

1.76 ±0.43 1.60 ±0.49

23 (92) 18 (60)

2.28±0.61 1.90 ±0.84

Variables

MUC 1 %Positive

E-cadherin %Positive

NM23-H1 %Positive

10 (100)

Expression Mean value 2.70±0.48

10 (100)

Expression Mean value 3.70±0.48

*Significant ( p <0.05) in comparison with benign lesions ** Significant ( p<0.05%) in comparison between positive and negative lesions.

Figure 2 . (A) Membranous immunostaining for E-cadherin in Hyperplastic squamous lesion of the uterine cervix (X 25) (B) Intense cytoplasmic immunostaining for E-cadherin in Chronic cervicitis lesion of the uterine cervix (X40) (C) Mild cytoplasmic immunostaining for E-cadherin in Well Differentiated Squamous Cell Carcinoma lesion (X40) (D) Mild cytoplasmic immunostaining for E-cadherin in Moderately Differentiated Squamous Cell Carcinoma lesion (X40).

351

Jeyadoss et al: Altered expression of invasion/metastasis related proteins in carcinoma of uterine cervix

Figure 3. (A) Moderate cytoplasmic immunostaining for nm23-H1 in Invasive lesion of the uterine cervix (X40) (B) Negative immunostaining for nm23-H1 in Non-invasive lesion (X40)

nm23-H1 expression while 27.6% (13/47) of the SCC lesions and 12.5% (1/8) of the adenocarcinoma cases were totally negative for nm23-H1 expression. Node positivity was higher in the nm23-H1 negative tumors when compared to nm23-H1 positive tumors (ÂŻ2- OR: 1.95, p=0.011, CI 1.32-2.93) (Figure 3A and 3B). An inverse relation in expression of MUC1(r: -0.247 p0.04) and a direct relation with E cadherin expression were observed in these lesions. Among the nm23-H1 negative lesions, 93% were intensely positive for MUC 1 expression while among the nm23-H1 positive lesions, 68% were positive for MUC1 expression.

significant up-regulation of MUC1 protein in lesions of high pathologic grade (MDSCC, NKLC), advanced stage tumors (Stage IIIA/B) and in cases with positive lymph node metastasis. The risk of intense MUC1 positive lesions being node positive is OR: 7.87, P 0.015, CI: 1.51- 41.03. Similar observations have been made in other cancers (Nakamori et al, 1994; Nitta et al, 2000; Reithdorf et al, 2000; Leroy et al, 2002; Zhao et al, 2003). The normal squamous cells of uterine cervix exhibit MUC1 in the entire cell membrane and on the apical side of the cells in glandular epithelial cells. In most cancer cells, this polarization is lost and even though MUC1 is synthesized as a membrane protein, it is translocated to the cytoplasm and may therefore be an important co-factor in the transition from normal to malignant condition. In this study, all the lymph node positive lesions showed cytoplasmic localization of MUC1 (r: 0.434, p0.009). This phenomenon was also noticed by others, who suggested that the cytoplasmic localization to reflect inactivation of the protein and correlated with tumor progression, invasion and metastasis (Nakamori et al, 1994; Nitta et al, 2000; Reithdorf et al, 2000; Leroy et al, 2002; Zhao et al, 2003). E-cadherin is one of the major cell adhesion molecules defining the architecture and differentiation of keratinocytes (Hodivala and Watt, 1994; Wilding et al, 1996). E-cadherin loss has further been shown to be responsible for the disruption of cell-cell adhesion and is important in tumor spread (Takeichi, 1993). In cervical carcinomas, a decrease in expression of E-cadherin has been reported (Inoue et al, 1992; Sun et al, 2000; Carico et al, 2001; Chen et al, 2003; Moon et al, 2003) but others describe a decreased expression in metastasis but not in primary tumor (Vessey et al, 1995; Fujimoto et al, 1997). Hypermethylation has been proposed as an explanation for the decreased protein expression (Dong et al, 2001; Chen et al, 2003). The absence of significant correlation in relation to nodal invasion and down regulation in MDSCC observed in this study suggests that E-cadherin plays a more important role in the differentiation and

IV. Discussion The hallmark characteristics of a malignant tumor include alteration of adhesive interactions mediated by several adhesion molecules involved in cell-cell and cellextracellular matrix interactions (Hart and Saini, 1992). It is accepted generally that the structure and distribution of cell surface glycoconjugates changes during malignant transformation and tumor progression, thereby heavily influencing the biological behaviour of carcinoma cells. The uterine cervix represents an in vivo model for the neoplastic progression of squamous epithelia. The epithelial mucin is expressed in most normal glandular and squamous epithelial cells, and the expression is dramatically increased when the cells become malignant (Guillem et al, 2000; Hirasawa et al, 2000; Baldus et al, 2001; Croce et al, 2001). In cervical disorders, reports show that the expression of both secreted and membranous mucins is altered in benign and malignant glandular cervical lesions (Reithdorf et al, 2000; Zhao et al, 2003). In cancers, MUC1 has been shown to be of importance, especially in relation to invasion and metastasis. However, the biological role of MUC1 mucin in Squamous cell carcinoma of the uterine cervix remains vague and no reports are available in literature. In the current study, we observed an increased cytoplasmic expression and

352

Cancer Therapy Vol 3, page 353 aggressiveness of the tumor than in its invasion. We have consistently noticed a loss of membrane expression and a translocation to the cytoplasm. The loss of membranous staining pattern in some of our samples could mean the presence of a non-functional E-cadherin as suggested by Gagliardi et al, 1995. In addition to this, various studies have pointed out that the cytoplasmic accumulation of Ecadherin may reflect abnormal transport to the cell surface or abnormal re-uptake of the molecule from the cell surface back into the cytoplasm (Gabbert et al, 1996; Handschuh et al, 1999; Ascano et al, 2001). Since the majority of our samples showed a decrease in membrane expression and due to the lack of significance with invasion, it would seem that E-cadherin changes are a rather early event in the carcinogenesis of cervical carcinoma. The reports on E-cadherin expression in various cancers are contradictory. Some groups describe its preservation (Shimoyama and Hirohashi, 1991) while others have reported a down regulation in invasive and aggressive tumors (Bringuier et al, 1993; Oka et al, 1993; Shun et al, 1998). An inverse relation in the pattern of MUC1 and Ecadherin expression has been noticed in this study. This observation supports the reports of anti-adhesive property of MUC1 wherein mucin is reported to accelerate tumor invasion via impairment of the cell-cell adhesion molecule, E-cadherin (Ligtenberg et al, 1992; Makiguchi et al, 1996). Therefore, the findings of the current study suggest that MUC1 and E-cadherin have important roles in differentiation, invasion and metastasis of cervical neoplasia. The dissemination of a tumor is regulated at the molecular level involving several genes among which the anti-metastatic gene, nm23-H1 is thought to play a critical role. Down-regulation of its expression during tumor progression has been reported in several in vitro and in vivo studies (Steeg et al, 1988; Florenes et al, 1992; Luo et al, 1993; Kodera et al, 1994; Jensen et al, 1996; Srinivas et al, 2002). Little is known about the role of nm23-H1 protein expression in cervical carcinoma with respect to tumor progression. The results of this study show a down regulation of nm23-H1expression and support the reports in other cancers (Florenes et al, 1992; Yamaguchi et al, 1994). A role for nm23-H1 in metastasis is also reported (Florenes et al, 1992) even though, earlier reports from this lab and other investigators has failed to show such a relation in other cancers (Luo et al, 1993; Kodera et al, 1994; Jensen et al, 1996; Srinivas et al, 2002). The results of this study also show no significant relation to invasion in terms of intensity of expression. However, some of the tumors (22%) were totally negative for nm23-H1 expression suggesting its absence due to either gene deletion or epigenetic mechanisms affecting nm23-H1. The odds ratio of nm23-H1 negative lesion being node positive was 1.95, p=0.011, CI 1.32-2.93. Nm23-H1 expression abnormalities have been observed to be frequent events related to lymph node metastasis in various cancers (Yi et al, 2003). Hence, it appears that nm23-H1 protein is associated with malignant transformation and its complete absence is a contributing factor for metastasis.

The results also showed an inverse relation in the pattern of expression between MUC1 and nm23-H1 protein. Majority of MUC1 positive cases were negative or mildly positive for nm23-H1 and had a very high risk for lymph node metastasis. These results suggest that reduced nm23H1 expression may promote the metastatic properties of cancer cells in concert with increased MUC1 expression. The observation of a significant direct correlation between E-cadherin and nm23-H1 protein expression (r: 0.641, P 0.009) was interesting. Both these proteins were found to be down regulated in carcinoma cases when compared with those in benign lesions. In summary, the results suggest that increase in MUC1 levels concomitant with decreased levels and impaired localisation of E-cadherin and nm23-H1 may lead to a disordered state favouring aberrant development or cancer progression. The lesions intensively positive for MUC1 and negative for nm23-H1 are at high risk for lymph node metastasis. It also appears that MUC1 and nm23-H1 are related to invasion in addition to tumor differentiation and progression while E-cadherin has no distinct role in invasion. The results thus indicate that numerous phenotypic changes in tumor metastasis may result from alterations in the expression of relatively few genes. It is therefore likely that each of these biomarkers regulates important steps in the malignant cascade and that the metastatic potential is controlled by multiple independent regulatory events. In conclusion, the results suggest that the adhesion proteins MUC1, E-cadherin and the anti-metastatic protein, nm23-H1 might be inter-related in their function resulting in a lower differentiation and higher aggressiveness and metastasis of the tumor.

References Ascano JJ, Frierson H Jr, Moskaluk CA, Harper JC, Roviello F, Jackson CE, El-Rifai W, Vindigni C, Tosi P, Powell SM (2001) Inactivation of the E-cadherin gene in sporadic diffuseâ&#x20AC;&#x201C;type gastric cancer. Mod Pathol 14, 942-949. Baldus SE, Zirbes TK, Glossmann J, Fromm S, Hanisch FG, Monig SP, Schroder W, Schneider PM, Flucke U, Karsten U, Thiele J, Holscher AH, Dienes HP (2001) Immunoreactivity of monoclonal antibody BW835 represents a marker of progression and prognosis in early gastric cancer. Oncology 61, 147-155. Birchimer KW, Weidner KM, Behrens J (1993) Molecular mechanisms leading to loss of differentiation and gain of invasiveness in epithelial cells. J Cell Sci 17, 159-164. Birchmeier W, Beherens J (1994) Cadherin expression in carcinomas: role in the formation of cell junctions and the prevention of invasiveness. Biochim Biophys Acta 1198, 1126. Bringuier PP, Umbas R, Schaafsma HE, Karthaus HF, Debruyne FM, Schalken JA (1993) Decreased E-cadherin immunoreactivity correlates with poor survival in patients with bladder tumors. Cancer Res 53, 3241-3245. Carico E, Atlante M, Bucci B, Nofroni I, Vecchione A (2001) Ecadherin and alpha-catenin expression during tumor progression of cervical carcinoma. Gynecol Oncol 80, 156â&#x20AC;&#x201C;161. Chen CL, Liu SS, Ip SM, Wong LC, Ng TY, Ngan HY (2003) Ecadherin expression is silenced by DNA methylation in

353

Jeyadoss et al: Altered expression of invasion/metastasis related proteins in carcinoma of uterine cervix cervical cancer cell lines and tumours. Eur J Cancer 39, 517–523. Croce MV, Rabassa ME, Price MR, Segal-Eiras A (2001) MUC1 mucin and carbohydrate associated antigens as tumor markers in head and neck squamous cell carcinoma. Pathol Oncol Res 7, 284-291. Dong SM, Kim HS, Rha SH, Sidransky D (2001) Promoter hypermethylation of multiple genes in carcinoma of the uterine cervix. Clin Cancer Res 7, 1982–1986. Florenes VA, Aamdal S, Myklebost O, Maelandsmo GM, Bruland OS, Fodstad O (1992) Level of nm23 messenger RNA in metastatic malignant melanoma: inverse correlation to disease progression. Cancer Res 52, 6088-6091. Fujimoto J, Ichigo S, Hirose R, Sakaguchi H, Tamaya T (1997) Expression of E-cadherin and alpha- and beta-catenin mRNAs in uterine cervical cancers. Tumour Biol 18(4), 206– 212. Gabbert HE, Mueller W, Schneiders A, Meier S, Moll R, Birchmeier W, Hommel G. (1996) Prognostic value of Ecadherin expression in 413 gastric carcinomas. Int J Cancer 69, 184-189. Gagliardi G, Kandemir O, Liu D, Guida M, Benvestito S, Ruers TG, Benjamin IS, Northover JM, Stamp GW, Talbot IC (1995) Changes in E-cadherin immunoreactivity in the adenoma-carcinoma sequence of the large bowl. Virchows Archiv 426, 149-154. Gendler SJ, Lancaster CA, Taylor-Papadimitriou J, Duhig T, Peat N, Burchell J, Pemberton L, Lalani EN, Wilson D (1990) Molecular cloning and expression of human tumor–associated polymorphic epithelial mucin. J Biol chem 265, 15286-15293. Greenlee RT, Murray T, Bolden S, Wingo PA (2000) Cancer statistics. CA Cancer J Clin 50, 7-33. Guillem P, Billeret V, Buisine MP, Flejou JF, Lecomte-Houcke M, Degand P, Aubert JP, Triboulet JP, Porchet N (2000) Mucin gene expression and cell differentiation in human normal, premalignant and malignant esophagus. Int J Cancer 88, 856-861. Handschuh G, Candidus S, Luber B, Reich U, Schott C, Oswald S, Becke H, Hutzler P, Birchmeier W, Hofler H, Becker KF (1999) Tumor-associated E-cadherin mutations and cellular morphology decrease cellular adhesion and increase cellular motility. Oncogene 18, 4301-4312. Hart IR, Saini A (1992) Biology of tumour metastasis. Lancet 339, 1453-1457. Hirasawa Y, Kohno N, Yokoyama A, Kondo K, Hiwada K, Miyake M (2000) Natural autoantibody to MUC1 is a prognostic indicator for non-small cell lung cancer. Am J Respir Crit Care Med 161, 589-594. Hodivala KJ, Watt FM (1994) Evidence that cadherins play a role in the down regulation of integrin expression that occurs during keratinocyte terminal differentiation. J Cell Biol 124, 589 - 600. Inoue M, Ogawa H, Miyata M, Shiozaki H, Tanizawa O (1992) Expression of E-cadherin in normal, benign, and malignant tissues of female genital organs. Am J Clin Pathol 98, 76– 80. Jensen SL, Wood DP Jr, Banks ER, Veron M, Lascu I, McRoberts JW, Rangnekar VM (1996) Increased levels of nm23-H1/nucleoside diphosphate kinaseA mRNA is associated with adenocarcinoma of the prostate. World J Urol Suppl 1,S21-25. Kim YS, Gum JJr, Brockhausen I (1996) Mucin glycoproteins in neoplasia. Glycoconju J 13, 693-707. Kodera Y, Isobe K, Yamauchi M, Kondoh K, Kimura N, Akiyama S, Itoh K, Nakashima I, Takagi H (1994)

Expression of nm23-H1 RNA levels in human gastric cancer tissues: a negative correlation with nodal metastasis. Cancer 73, 259- 265. Leroy X, Zerimech F, Zini L, Copin MC, Buisine MP, Gosselin B, Aubert JP, Porchet N (2002) MUC1 expression is correlated with nuclear grade and tumor progression in PT1 renal clear cell carcinoma. Am J Clin Pathol 118, 47 - 51. Ligtenberg, MJL, Vos BHL, Hilkens J (1992) Suppression of cellular aggregation by high levels of episialin. Cancer Res 52, 2318-2324. Luo W, Matsuo K, Nagayama Y, Urano T, Furukawa K, Takeshita A, Nakayama T, Yokoyama N, Yamashita S, Izumi M (1993) Immunohistochemical analysis of expression of nm23-H1/nucleosidediphosphate kinase in human thyroid carcinomas:lack of correlation between its expression and lymph node metastasis. Thyroid 3, 105-109. Makiguchi Y, Hinoda Y, Imai K (1996) Effect of MUC1 mucin and anti-adhesion molecule on tumor cell growth. Jpn J Cancer Res 87, 505-511. Moon HS, Park WI, Choi EA, Chung HW, Kim SC (2003) The expression and tyrosine phosphorylation of Ecadherin/catenin adhesion complex, and focal adhesion kinase in invasive cervical carcinomas. Int J Gynecol Cancer 13, 640 –646. Munier A, Feral C, Milon L, Pinon VP, Gyapay G, Capeau J, Guellaen G, Lacombe ML (1998) A new nm23 homologue (nm23-H5) specifically expressed in testis germinal cells. FEBS Lett 434, 289-294. Nakamori S, Ota DM, Cleary KR, Shirotani K, Irimura T (1994) MUC-1 mucin expression as a maker of progression and metastasis of human colorectal carcinoma. Gastroenterology 106, 353-361. Nitta T, Sugihara K, Tsuyama S, Murata F (2000) Immunohistochemical study of MUC1 mucin in pre-malignant oral lesions and squamous cell carcinoma. Cancer 88, 245 254. Oka H, Shiozaki H, Kobayashi K, Inoue M, Tahara H, Kobayashi T, Takatsuka Y, Matsuyoshi N, Hirano S, Takeichi M (1993) Expression of the E-cadherin cell adhesion molecules in human breast cancer tissues and its relationship to metastasis. Cancer Res 53, 1696 - 1701. Riethdorf L, O'Connell JT, Riethdorf S, Cviko A, Crum CP (2000) Differential expression of MUC2 and MU5AC in benign and malignant glandular lesions of the cervix uteri. Virchows Arch 437, 365-371. Shimoyama Y, Hirohashi S (1991) Expression of E and P-cadherin in gastric carcinoma. Cancer Res 51, 2185-2192. Shun CT, Wu MS, Lin JT, Wang HP, Houng RL, Lee WJ, Wang TH, Chuang SM (1998) An immunohistochemical study of Ecadherin expression with correlations to clinicopathological features in gastric cancer. Hepatogastroenterology 45, 944949. Srinivas P, Madhavan M, Ahamed I, Abraham E, Vijayalakshmy NR, Balaram P (2002) NM23-H1 and p53 proteins are differentially correlated to metastasis in breast carcinoma. Neoplasma 49, 225-230. Steeg PS, Bevilacqua G, Kopper L, Thorgeirsson UP, Talmadge JE, Liotta LA, Sobel ME (1988) Evidence for a novel gene associated with lower metastatic potential. J Natl Cancer Inst 80, 200-204. Steeg PS, Bevilacqua G, Pozzatti R, Liotta LA, Sobel ME (1988) Altered expression of NM23, a gene associated with low tumor metastatic potential, during adenovirus 2 Ela inhibition of experimental metastasis.Cancer Res 48, 6550-6554.

354

Cancer Therapy Vol 3, page 355 Sun H, Liu X, Li M (2000) E-cadherin expression and its clinical significance in cervical cancer. Zhonghua Zhong Liu Za Zhi 22, 496-498. Takeichi M (1993) Cadherins in cancer:implications for invasion and metastasis. Curr Opin Cell Biol 5, 806-811. Vessey CJ, Wilding J, Folarin N, Hirano S, Takeichi M, Soutter P, Stamp GW, Pignatelli M (1995) Altered expression and function of E-cadherin in cervical intraepithelial neoplasia and invasive squamous cell carcinoma. J Pathol 176, 151â&#x20AC;&#x201C;159. Wilding J, Vousden KH, Soutter WP, McCrea PD, Del Buono R, Pignatelli M (1996) E-cadherin transfection down-regulates the epidermal growth factor receptor and reverses the invasive

phenotype of human papillomavirus-transfected keratinocytes. Cancer Res 56, 5285-5292. Yamaguchi A, Urano T, Goi T, Takeuchi K, Niimoto S, Nakagawara G, Furukawa K, Shiku H (1994) Expression of human nm23-H1 and nm23-H2 proteins in hepatocellular carcinoma. Cancer 73, 2280-2284. Yi S, Guangqi H, Guoli H (2003) The association of the expression of MTA1, nm23H1 with the invasion, metastasis of ovarian carcinoma. Chin Med Sci J 18, 87-92. Zhao S, Hayasaka T, Osakabe M, Kato N, Nakahara K, Kurachi H, Fukase M, Katayama Y, Yaegashi N, Motoyama T (2003) Mucin expression in non neoplastic and neoplastic glandular epithelia of the uterine cervix. Int J Gynecol Pathol 22, 393397.

355

Jeyadoss et al: Altered expression of invasion/metastasis related proteins in carcinoma of uterine cervix

356

Cancer Therapy Vol 3, page 357 Cancer Therapy Vol 3, 357-358, 2005

Improper simple hysterectomy in invasive cervical cancer Case report

Fatemeh Ghaemmaghami* and Malihe Hasanzadeh Gynecology and Reproductive Medicine, Tehran University of Medical Sciences

__________________________________________________________________________________ *Correspondence: Fatemeh Ghaemmaghami, Associate Professor, Gynecologist Oncologist, Tehran University of Medical Sciences. 2nd Floor, Department of Gynecology Oncology, Vali-e-Asr Hospital, Keshavarz Blvd.,Tehran 14194, Iran; Phone: 0098-21-6937766; Fax: 0098-21-6937321; E-mail: valrec2@yahoo.com, ftghaemmagh@yahoo.com Key words: cervical cancer, simple hysterectomy, improper surgery, invasive cervical cancer, subtotal hysterectomy Received: 31 January 2005; Revised: 30 May 2005 Accepted: 31 May 2005; electronically published: June 2005

Summary Invasive cervical cancer discovered after a simple hysterectomy remains a problem. Approximately 4-15% of invasive cervical cancers are found after an inappropriate simple hysterectomy is performed. There are several reasons for this suboptimal treatment of invasive cervical cancer. A 53-year old patient is reported with histologically confirmed cervical cancer who was undergone a subtotal hysterectomy and bilateral salpingooophorectomy inadvertendly at another hospital. She had done dilatation curettage due to abnormal vaginal bleeding 3 months prior of hysterectomy. A histological examination of specimen from curettage suggested adenocarcinoma. So she scheduled for total abdominal hysterectomy and bilateral salpingo-oophorectomy with concept of endometrial cancer inadvertently. Exploration and palpation via laparotomy indicated that the gross lesion with involved parametrium and impossibility doing total hysterectomy. After the patient was referred to the Gynecology Oncology Department at Vali-e-Asr Hospital, a vaginal examination showed a 4-cm exophytic, necrotic cervical lesion. The patient was diagnosed with stage IIB cervical cancer. Therefore, the patient was scheduled to receive chemoradiation therapy and brachytherapy. A preoperative Pap smear and a careful evaluation of the cervix are necessary before performing gynecologic surgery for the management of benign or malignant gynecologic disease. survival rate than patients who are treated with primary irradiation (Behtash et al, 2003). We report the case of a patient referred for the management of cervical cancer following subtotal hysterectomy to point out the problems encountered in such patients.

I. Introduction Cancer of the cervix is one of the most common gynecological cancers and is one of the leading causes of cancer death worldwide. It is widely agreed that very early stage disease (FIGO stage IA) can be treated by a simple hysterectomy. However, patients with stage IB or IIA disease should either have radical surgery or should be treated with radiotherapy or chemoradiation therapy (Munstedt et al, 2004). Despite the increasing effort to promote cervical cancer screening and make it widely available, the number of patients referred because of cervical cancer following inappropriate hysterectomy is not decreasing. Indeed, approximately 4-15% of invasive cervical cancers are found during an inappropriate hysterectomy (Munstedt et al, 2002, 2004). The prognosis for patients with residual disease after a simple hysterectomy is poor. Such patients have a lower

II. Case Report A 53-year-old gravida 6, para 6 patients with histologically confirmed cervical cancer was referred to the Gynecology Oncology Department of Vali-e-Asr Hospital. She had undergone a subtotal hysterectomy inadvertently at another hospital. Three months prior to the hysterectomy, the patient had experienced abnormal vaginal bleeding for which she has been undergone dilatation and curettage (D&C). A histological examination suggested malignancy and probability of adenocarcinoma. So she scheduled for total abdominal hysterectomy and bilateral salpingo-oophorectomy with 357

Ghaemmaghami and Hasanzadeh: Improper simple hysterectomyin invasive cervical cancer concept of endometrial cancer inadvertently. Exploration and palpation via laparatomy indicated that the gross lesion also involved parametrium and impossibility doing total hysterectomy. Histologic examinations of the specimen from the subtotal hysterectomy revealed a large non-keratinized squamous cell carcinoma of the cervix with involvement of the lower segment of the uterus (2/3 inferior). A cytological examination of the tumor after a laparotomy lavage was positive for malignancy. After being referred to the Gynecology Oncology Department at our hospital, the patient underwent a vaginal examination which showed a 4-cm exophytic, necrotic cervical lesion. Parametrial involvement was confirmed by rectovaginal examination. The patient was diagnosed with stage IIB cancer. The patient was then managed with chemoradiation therapy and brachytherapy.

were the main causes leading to an simple hysterectomy. Review of data (Behtash et al.2003) suggests that most cases are avoidable if one adheres to well-established guidelines for cervical cancer detection and management yearly Pap smear, evaluation of abnormal Pap smear by performing colposcopy and cervical biopsy or endocervical sampling and conization and fractional dilatation and curettage when indicated. However, gynecologists must decide what the best subsequent management should be. There are two options: (1) postoperative radiotherapy or (2) further surgery with radical parametrectomy, upper vaginectomy and pelvic lymphadenectomy (Choi et al, 1997). A study of the historical controls (covered more than 50 years) who had not undergone subsequent therapy showed 5-year survival rates of 42-60%, but survival rates fell to 16% in patients with surgical margins infiltrated by tumor (Schmidt, 1951). As in this patientâ&#x20AC;&#x2122;s case, hysterectomies can be inadequate for the following reasons: first, the lack of a preoperative Pap smear; second, the misreading of pathology results; and third, failure to carefully examine the cervix and take a biopsy specimen of the gross cervical lesion at the time of the D and C. We conclude that a preoperative Pap smear and careful evaluation of the cervix are necessary before performing gynecologic surgery for the treatment of benign or malignant gynecologic disease.

III. Discussion Invasive cervical cancer that is discovered during a simple hysterectomy remains a problem. Many studies have indicated that management is suboptimal for the following reasons: - Inadequate evaluation of an abnormal Pap smear of cervical biopsy; 7-21% - Failure to perform a cone biopsy when necessary, 3-12% - Failure to perform endocervical curettage after a cone biopsy, 10% - Deliberate hysterectomy for grossly invasive cancer, 11-25% - Lack of preoperative Pap smears, 7-29% - Positive cone biopsy margins or unevaluated cone biopsy margins, 7-21% - Misreading of pathology results, 5% - Errors during colposcopic examination, 4% - Emergency operation because of bleeding or perforation, 2-8% - Failure to check cytology results before surgery, 2% - Failure to take a biopsy sample of a gross cervical lesion, 2% - Negative cytology findings and no clinical evidence of cancer, 19-31% It is widely agreed that adherence to screen guidelines and careful patient management may help to minimize the number of suboptimal, simple hysterectomies performed, where primary treatment has been inadequate. The most common preoperative diagnosis in a study (Roman et al. 1992) of 145 cases was cervical dysplasia and the greatest proportion of cases (40%) resulted from inappropriate management of preinvasive diseases. Also it is shown (Rodolkis et al. 1992) that the absence of preoperative cytology and inadequate evaluation of abnormal pap smear

References Behtash N, Mousavi A, Mohit M, et al (2003) Simple hysterectomy in the presence of invasive cervical cancer in Iran. Int J Gynecol Cancer 13, 177-81. Choi DH, Huh SJ, Nam KH (1997) Radiation therapy results for patients undergoing inappropriate surgery in the presence of invasive cervical carcinoma. Gynecol Oncol 65, 506-11. Munstedt K, Von Georgi R, Zygmunt M, et al (2002) Shortcmoings and deficits in surgical treatment of gynecological cancers: a German problem only? Gynecol Oncol 86, 337-43. Munstedt K, Johnson P, et al (2004) Consequences of inadvertent, suboptimal primary surgery in carcinoma of the uterine cervix. Gynecol Oncol 94, 515-520. Rodolakis A, Diakomanolis E, Haidoloulos D,Voulgaris Z. (1999) How to avoid suboptimal management of cervical carcinoma by simple hysterectomy. Eur I Gynecol Oncol 20:418-22 Roman LD, Morris M, Eifel PJ, Burke TW, Gershenson DM (1992)Reasons for inappropriate simple hysterectomy in the presenceof invasive cancer of the cervix. Obstet Gynecol 79;485-9 Schmidt RTF (1951) Pan hysterectomy in the treatment of carcinoma of the uterine cervix: evaluation of results. J Am Med Assoc 146, 1310-1314.

358

Cancer Therapy Vol 3, page 359 Cancer Therapy Vol 3, 359-364, 2005

Selective tumor cell growth on tissue culture polystyrene and PrimariaTM: a preliminary study Research Article

Shamim A. Faruqi1,*, Okeychukwu A. Ibeanu1, Tariq Ali1, Harvey B. Spector2, Joel S. Noumoff1 1

Department of OB/GYN Department of Histopathology, Crozer-Chester Medical Center, One Medical Center Boulevard, Upland, PA 19013.

__________________________________________________________________________________ *Correspondence: Shamim A. Faruqi, Ph.D., Gynecologic Oncology Research Laboratory, Department of OB/GYN, Crozer-Chester Medical Center, Upland, PA 19013, USA; Tel: 610-447-2775; Fax: 610-447-2939; e-mail: gynoncob@aol.com Key words: tumor cell growth, polystyrene and PrimariaTM, tissue culture Abbreviations: normal tissue culture plastic, (NTCP) Received: 15 March 2005; Revised: 10 June 2005 Accepted: 10 June 2005; electronically published: June 2005

Summary We have grown endometrial and ovarian tumors of different grades separately, either on normal tissue culture plastic (NTCP) or PrimariaTM and compared their growth characteristics. These preliminary results have shown that well differentiated and moderately differentiated tumors of both ovarian and endometrial origins grow better on PrimariaTM than NTCP when compared to poorly differentiated tumors. These results may have relevance to prognosis, treatment planning and an understanding towards in-vivo behavior of tumor cells. Because low-grade tumors have a strong growth preferential for PrimariaTM, it would be interesting to see the final outcome of those tumors which are medium- or high-grade and grow favorably on it. other, increasing the rate of positive tumor culture (Deger et al, 1997). In the present report, we point out a relationship between successful cell culture in each of the tumor grades and the two substrates separately, both in endometrial and ovarian malignancies.

I. Introduction In-vitro culture and growth of tumor cells usually employs normal tissue culture plastic (NTCP), which is essentially polystyrene impregnated with oxygen containing molecules. The high oxygen content makes this substrate more hydrophilic and hence is thought to enhance cell adhesion capacity. PrimariaTM (Beckton Dickinson Labware, Franklin Lakes, NJ, USA), a modified polystyrene tissue culture plastic containing almost equal amounts of nitrogen and oxygen, is contended by the manufacturerâ&#x20AC;&#x2122;s unpublished data to have a superior cell adhesion quality than NTCP. Earlier, one of the current authors (Fuscaldo et al, 1989; Faruqi and Krueger 2004) cultured lung cancer cells both on NTCP and PrimariaTM and discovered that tumor clones had a significant growth differential with regard to these two substrates. Certain clones which were absent on one substrate were present in the other (and vice versa). Similarly, genomic differences were also discovered in the ovarian and endometrial tumor cell cultures between these two substrates (Faruqi et al, 2003). From this laboratory, we further reported data on 35 ovarian tumors of different grades and noted that when a certain tumor failed to grow on one substrate, it successfully grew on the

II. Materials and Methods This study included twenty-one epithelial endometrial and twenty-five epithelial ovarian primary tumors, classified as either well, moderately, or poorly differentiated. After accession by the histopathologist, the material was brought to the laboratory in serum-free RPMI-1640. Material was processed and plated as described earlier, through the creation and separation of cell slurries in RPMI and 10% fetal bovine serum (FBS) supplemented with 2% penicillin and streptomycin, with 2mM glutamine (Deger et al., 1997). Two mL of a cell culture containing 5*104 cells/mL were plated (for a plate total of 1*105 cells/plate) and cultured in 60 mm of either NTCP or PrimariaTM Petri-plates at 37oC with 5% CO2 at 98% humidity. Three replicates of each cellular sample were made. For in-situ harvest, cells were first exposed to a hypotonic solution (a 1:1 mixture of 0.4% each sodium citrate and potassium chloride) and incubated at 37oC for 35min. Twenty drops of Carnoyâ&#x20AC;&#x2122;s fixative were added to the hypotonic solution as a pre-fixative and the plates

359

Faruqi et al: Selective tumor cell growth on tissue culture polystyrene and PrimariaTM were incubated at room temperature for 10 min. The solution was then exchanged for fresh fixative two times for 20 min each, and after a final change of fixative, incubated for 10 min. For harvest, Petri-plates were washed twice in fresh fixative and placed to dry under a slow fan in an atmosphere of 78oC temperature and 36% humidity. Chromosomes were banded after a pretreatment with a highly purified trypsin solution (Enzar-TTM, 0.5mL in 75mL Hanksâ&#x20AC;&#x2122; Balanced Salt Solution 1X, pH adjusted to 7.2 through NaHSO4), and stained with either Geimsa or Leishman stains. The rims of the Petri-plates were then removed using a pair of pliers. The remaining discs, containing the stained cells, were cut into halves with a hot knife and each half disc was mounted on a glass slide. Entire slides were scanned under a high power compound microscope and all dividing cells were scored. Bar graphs were made from the average score of the three replicate Petri plates.

IV. Discussion In this pilot study, we examined the in vitro behavior of endometrial and ovarian tumor cells of different grades to determine if there is a relationship in each tumor type between tumor grades and growth pattern on either PrimariaTM or NTCP. Furthermore, we sought to determine if the growth pattern in endometrial tumors is any different than of those that are ovarian in origin. Our results show that well- and moderately differentiated epithelial tumors of both ovarian and endometrial origin grow better on PrimariaTM than NTCP. We realize that our data is not sufficient to draw any firm conclusions, and the lack of a consistent pattern with regard to cell counts is surprising. The results from low-grade tumor lines however provided a strong indication that PrimariaTM is favored uniformly (Figures 1A, 2A). Without specific genetic analysis to determine metabolic variation in each advanced, highgrade tumor line, we are unable to determine if there is a genetic or metabolic cause for the varied results we recorded in said tumor cells. However, we feel that those tumors which were of medium- or high-grade and selective for growth on PrimariaTM may have future implications with regard to either treatment or prognostic determinations if their final outcomes were tracked and compared to those of the individuals with low-grade tumor pathologies. It should be noted here that earlier, one of us demonstrated that in variant small cell lung cancer (vSCLC) the culture in the two plastics separated the tumor types where the cells were different not only with respect to their genomes but also in biology, when they were tested with a panel of eight antibodies (Faruqi and Krueger, 2004). v-SCLC tumor of the lung evolves from small cell to non-small cell lung cancer. Its culture in two plastics separated the tumor into two distinct groups, one growing in one plastic demonstrated highly positive reaction to monoclonal antibodies specific to small lung cancer and the other cell population growing in the other plastic showed a clear negative reaction to the monoclonals (Faruqi and Krueger 2004). This being a preliminary study our results may be hiding other trends or tendencies that we can not yet ascertain. Because all of the tumor cells used in this study were in vitro in origin, we would have to rely on enzymatic assays to determine whether or not tumor cell metabolism would have been a complicating factor. Although histopathology is the gold standard in tumor evaluation and prognosis, in certain cases it fails to identify the true genetic potential of a tumor. For example, the portion of a dermoid cyst which was regarded as benign and mature in histopathological evaluation, possessed scores of structurally and numerically altered chromosomes common to the portion which degenerated into malignant immature tumor (Faruqi et al, 1999; Noumoff et al, 2001). By the same token, an immature ovarian teratoma which matured after chemotherapy possessed the same genomic anomalies which were present initially in the immature tumor (Gibas et al, 1993). This culture method has the possibility of adding another dimension to our methods of tumor evaluation.

III. Results A total of 46 gynecological tumors were cultured, of which 21 were endometrial in origin while 25 came from the ovarian sites. Among the endometrial tumors, 3 were well differentiated (low grade tumors), 6 were moderately differentiated and 12 were poorly differentiated (high grade tumors). Of the ovarian tumors, 10 were well differentiated while 15 were poorly differentiated. There were no moderately differentiated ovarian tumors. Results were analyzed and presented separately according to the primary tumor site and grade (Figures 1, 2).

A. The endometrial tumors The three well differentiated tumors grew well in PrimariaTM dishes while tumors from patients 2 and 3 displayed no growth on NTCP plates (Figure 1A). In the moderately differentiated tumors, out of six samples three showed more growth on PrimariaTM than on NTCP while one grew exclusively on PrimariaTM and similarly one on NTCP. Only in a single case there was more growth on NTCP than on PrimariaTM in this tumor category (Figure 1B). Of the poorly differentiated tumors, two failed to grow on either of the plastics and one (line 3) grew equally well on both PrimariaTM and NTCP. Of the remaining 9 tumors, five grew selectively or exclusively for NTCP, while four grew exclusively or selectively for PrimariaTM. (Figure 1C).

B. The ovarian tumors Out of the 10 well differentiated tumors, eight showed growth on PrimariaTM, while four showed growth on NTCP (Figure 2A). Cell lines 1 and 6 did not have growth on either substrate. Four lines grew on PrimariaTM alone and one line showed preferential growth towards PrimariaTM. Two lines had a weak preference for NTCP, and one line produced nearly identical growth between both substrates. Among the 15 poorly-differentiated tumors, lines 8 and 9 showed no growth in either substrate, lines 2, 13 and 14 grew solely in PrimariaTM, and lines 5 and 6 grew solely in NTCP. For those where growth was recorded in both substrates, two lines (1 and 10) were differential for PrimariaTM, three lines (4, 7, and 12) were differential for NTCP, and three lines (3, 7, and 11) showed no preference for either substrate.

360

Cancer Therapy Vol 3, page 361

Figure 1. Endometrial tumor grades showing differential cell growth in normal tissue culture plastic and PrimariaTM. Dividing cell counts are shown along the y-axis of each graph. (A) Low grade endometrial carcinoma cases showing almost exclusive growth in PrimariaTM plastic and very feeble growth in NTCP in one of the three tumors. (B) Moderately differentiated endometrial carcinoma showing more cases with better growth on PimariaTM than NTCP. (C) Twelve high grade endometrial carcinoma cases showing two cases without growth on either medium, one case with equivalent growth, four cases preferential (exclusively or selectively) for

PrimariaTM and five cases preferential to NTCP.

361

Faruqi et al: Selective tumor cell growth on tissue culture polystyrene and PrimariaTM

Figure 2. Ovarian tumor grades showing differential cell growth in normal tissue culture plastic and PrimariaTM. Dividing cell counts are shown along the y-axis of each graph. (A) Low grade ovarian tumors with one showing better while four growing exclusively in Primaria and two grew in neither of the two plastics. (B) Fifteen cases of high grade ovarian tumors grown in PrimariaTM and NTCP show no growth preference for either of the two plastics.

Special note should be made regarding the modified method of culture utilized in this study. Culturing, harvesting and examining the cells on the same plates minimized sampling error by eliminating the process of sampling for cell count. Thus, every dividing cell was visualized and counted. Use of replicate dishes also reduced the inter-plate variation. Total count of dividing cells should be better than taking samples and counting them manually as it is done in almost all the laboratories with the exception of the currently used automated cell counters (Ionnides, 2003). Since the only variable evaluated was the grade of the tumor, future studies would obviously require analysis

by a variety of factors. The importance of this data is that of the question raised regarding the variability in cell growth; if indeed it is related to selection of specific tumor clones as demonstrated also earlier in v-SCLC (Faruqi and Krueger, 2004).

References Deger RB, Faruqi, SA, Noumoff JS (1997) Karyotypic analysis of 32 malignant epithelial ovarian tumors. Cancer Genet Cytogenet 96, 166-173. Faruqi SA, Ali T, Noumoff JS (2003) Substrate and media dependent genomic heterogeneity in gynecologic cancers.

362

Cancer Therapy Vol 3, page 363 XIX Internat Congr Genet Melbourne, Austr. E-publ.#5. ,B.0792. Faruqi SA, Deger RB, Javid H, Noumoff JS (1999) Genomic differences within cystic and squamous component of an ovarian teratoma when grown in Primaria plastic and normal tissue culture plastic with RPMI and LHC-9 media. Amer J Hum Genet 65, A126, Abstr # 669. Faruqi SA and Krueger L (2004) Substrate dependent genomic heterogeneity in cancers of the lung. Cancer Therapy 2, 5560. Fuscaldo KE, Faruqi SA, Scavicchio K, Pequignot E, Krueger LJ (1989) Chromosomal differences in primary human tumor biopsies grown on tumor culture plastic or PrimariaTM, 3rd

International Workshop on Chromosomes in Solid Tumors 54, A39. Gibas Z, Talerman A, Faruqi S, Carlson J, Noumoff J (1993) Cytogenetic analysis of an immature teratoma of the ovary and its metastasis after chemotherapy-induced maturation. Int J Gynecol Path 12, 276-80. Ioannides C (2003) Improving the accuracy and speed of mammalian cell counting. Biotech Lab 21, 10-12. Noumoff JS, LiVolsi VA, Deger RB, Montone KT, Faruqi SA (2001) Chromosome analysis and comparison of the benign cystic and malignant squamous component of an ovarian teratoma. Cancer Genet Cytogenet 125, 59-62.

363

Faruqi et al: Selective tumor cell growth on tissue culture polystyrene and PrimariaTM

364