South African Journal of Diabetes & Vascular Disease: Volume 27 Issue 1 by Clinics Cardive Publishing

JANUARY/FEBRUARY 2016 VOL 27 NO 1 A Lupin Group Company

Flexibility to ßeat hypertension www.cvja.co.za

CardioVascular Journal of Africa (official journal for PASCAR)

• Filamin C: a novel component of the KCNE2 interactome during hypoxia • Anatomical factors affect mortality rates after endovascular aneurysm repair • ECG abnormalities and dyslipidaemic syndrome in sickle cell anaemia • FTO rs9939609 and MC4R rs17782313: elevated nocturnal blood pressure • Left ventricular systolic function in Nigerian children infected with HIV/AIDS BISOPROLOL: • Is a highly selective ß-blocker • Oﬀers 24 hour BP reduction Up to

• Vascular rings: a radiological review of anatomical variations • Change in right ventricular systolic function according to revascularisation method

53% than the originator more aﬀordable

BISOPROLOL 2,5 mg / 5 mg / 10 mg HYDROCHLOROTHIAZIDE 6,25 mg

For further product information contact PHARMA DYNAMICS P O Box 30958 Tokai Cape Town 7966 Tel 021 707 7000 Fax 021 701 5898 Email info@pharmadynamics.co.za CUSTOMER CARE LINE 0860 PHARMA (742 762) www.pharmadynamics.co.za Bilocor 5. Each tablet contains 5 mg bisoprolol fumarate. Reg. No.: RSA S3 38/5.2/0053. NAM NS2 06/5.2/0061. BOT S2 BOT1101939. Bilocor 10. Each tablet contains 10 mg bisoprolol fumarate. Reg. No.: RSA S3 38/5.2/0051. NAM NS2 06/5.2/0062. BOT S2 BOT1101940. For full prescribing information, refer to the package insert approved by the Medicines Control Council, 23 July 2010. Bilocor Co 2,5/6,25. Each film coated tablet contains 2,5 mg bisoprolol fumarate and 6,25 mg hydrochlorothiazide. Reg No.: RSA S3 44/7.1.3/1010. NAM NS2 13/7.1.3/0260. Bilocor Co 5/6,25. Each film coated tablet contains 5 mg bisoprolol fumarate and 6,25 mg hydrochlorothiazide. Reg No.: RSA S3 44/7.1.3/1011. NAM NS2 13/7.1.3/0261. Bilocor Co 10/6,25.Each film coated tablet contains 10 mg bisoprolol fumarate and 6,25 mg hydrochlorothiazide. Reg No.: RSA S3 44/7.1.3/1012. NAM NS2 13/7.1.3/0262. For full prescribing information, refer to the package insert approved by the Medicines Control Council, 2 November 2012. 1) Department of Health website. http://www.mpr.gov.za – Accessed 19/10/2015. BRC150/01/2016.

Printed by Tandym Printers

BISOPROLOL 5 mg / 10 mg

Cardiovascular Journal of Africa . Vol 27, No 1, January/February 2016

PUBLISHED ONLINE: • Pericardial effusion mimicking anterior MI following coronary angiography

PACK!

FOR YOUR BUCK

s ’ 2

NOW EVEN

Now available in the ALL NEW

MORE BANG

A Lupin Group Company

From only R31,61 SEP excl. VAT per tablet.

Advise your patients about THE AFFORDABLE OPTION1 for Erectile Dysfunction

Active Ingredient: Sildenafil 50 mg 4’s pack SEP excl.VAT - R126,46 100 mg 4’s pack SEP excl.VAT - R173,44 50 mg 12’s pack SEP excl.VAT - R379,37 100 mg 12’s pack SEP excl.VAT - R520,32 For further product information contact PHARMA DYNAMICS P O Box 30958 Tokai Cape Town 7966 Tel 021 707 7000 Fax 021 701 5898 Email info@pharmadynamics.co.za CUSTOMER CARE LINE 0860 PHARMA (742 762) www.pharmadynamics.co.za Dynafil 50 mg. Each film-coated tablet contains sildenafil citrate equivalent to 50 mg sildenafil. Reg. No.: RSA S4 42/7.1.5/1071. NAM NS2 13/7.1.5/0086. Dynafil 100 mg. Each film-coated tablet contains sildenafil citrate equivalent to 100 mg sildenafil. Reg. No.: RSA S4 42/7.1.5/1072. NAM NS2 13/7.1.5/0087. For full prescribing information refer to the package insert approved by the Medicines Control Council, September 2012. 1) Department of Health Website. http://www.mpr.gov.za – Accessed 21/05/2015. DLD116/07/2015.

ISSN 1995-1892 (print) ISSN 1680-0745 (online)

Vol 27, No 1, JANUARY/FEBRUARY 2016

CONTENTS

Cardiovascular Journal of Africa 3

www.cvja.co.za

From the Editor’s Desk P Commerford

Cardiovascular Topics 4

Filamin C: a novel component of the KCNE2 interactome during hypoxia A Neethling • J Mouton • B Loos • V Corfield • C de Villiers • C Kinnear

12 The effect of anatomical factors on mortality rates after endovascular aneurysm repair D Ay • B Erdolu • G Yumun • A Demir • U Aydin • H Ozkan • K Erkoc • O Tiryakioglu 16 Electrocardiographic abnormalities and dyslipidaemic syndrome in children with sickle cell anaemia SA Adegoke • JAO Okeniyi • AA Akintunde 20

Combined effects of FTO rs9939609 and MC4R rs17782313 on elevated nocturnal blood pressure in the Chinese Han population Y Sun • J Sun • J Wu • M Yang

25 Left ventricular systolic function in Nigerian children infected with HIV/AIDS: a cross-sectional study I Arodiwe • A Ikefuna • E Obidike • E Arodiwe • B Anisuba • N Ibeziako • S Omokoidion • C Okoroma 30 Vascular rings: a radiological review of anatomical variations IS Ganie • K Amod • D Reddy 37 The change in right ventricular systolic function according to the revascularisation method used following acute ST-segment elevation myocardial infarction I Gul • M Zungur • AC Aykan • T Gokdeniz • MB Alkan • A Sayin • A Islamli • M Bilgin • E Kalaycioğlu • T Turan

INDEXED AT SCISEARCH (SCI), PUBMED, PUBMED CENTRAL AND SABINET

Editors

SUBJECT Editors

Editorial Board

Editor-in-Chief (South Africa) Prof Pat Commerford

Nuclear Medicine and Imaging DR MM SATHEKGE

prof PA Brink Experimental & Laboratory Cardiology

PROF A LOCHNER Biochemistry/Laboratory Science

PROF R DELPORT Chemical Pathology

PROF BM MAYOSI Chronic Rheumatic Heart Disease

Assistant Editor Prof JAMES KER (JUN) Regional Editor DR A Dzudie Regional Editor (Kenya) Dr F Bukachi Regional Editor (South Africa) PROF R DELPORT

Heart Failure Dr g visagie Paediatric dr s brown Paediatric Surgery Dr Darshan Reddy Renal Hypertension dr brian rayner Surgical dr f aziz Adult Surgery dr j rossouw Epidemiology and Preventionist dr ap kengne Pregnancy-associated Heart Disease Prof K Sliwa-hahnle

PROF MR ESSOP Haemodynamics, Heart Failure DR MT MPE Cardiomyopathy & Valvular Heart Disease DR OB FAMILONI Clinical Cardiology DR V GRIGOROV Invasive Cardiology & Heart Failure

International Advisory Board PROF DAVID CELEMAJER Australia (Clinical Cardiology) PROF KEITH COPELIN FERDINAND USA (General Cardiology) DR SAMUEL KINGUE Cameroon (General Cardiology)

PROF DP NAIDOO Echocardiography

DR GEORGE A MENSAH USA (General Cardiology)

PROF B RAYNER Hypertension/Society

PROF WILLIAM NELSON USA (Electrocardiology)

PROF MM SATHEKGE Nuclear Medicine/Society PROF J KER (SEN) Hypertension, Cardiomyopathy, PROF YK SEEDAT Cardiovascular Physiology Diabetes & Hypertension

DR ULRICH VON OPPEL Wales (Cardiovascular Surgery)

DR J LAWRENSON Paediatric Heart Disease

PROF ERNST VON SCHWARZ USA (Interventional Cardiology)

PROF H DU T THERON Invasive Cardiology

PROF PETER SCHWARTZ Italy (Dysrhythmias)

Case Reports 45 A rare case of heterotaxy and left ventricular non-compaction in an adult A Chacko • L Scholtz • S Vedajallam • C van Wyk

Vol 27, No 1, JANUARY/FEBRUARY 2016

CONTENTS

49 Intimomedial mucoid degeneration causing aortic and renal artery aneurysms in a young adult C Viljoen • P Szymanski • N Osman • KL Henning • P Scholtz • B Rayner • N Naidoo 53

First reported cases: renal denervation with second-generation multi-electrode catheter via brachial and radial access MJ Heradien • J Augustyn • A Saaiman • PA Brink

CARDIO NEWS

PUBLISHED ONLINE (Available on www.cvja.co.za and in Pubmed) Case Reports

e1 Localised pericardial effusion mimicking anterior myocardial infarction following coronary angiography Aynur Acibuca • Demet Menekse Gerede • Veysel Ozgur Baris • Mustafa Kilickap

financial & production co-ordinator ELSABÉ BURMEISTER Tel: 021 976 8129 Fax: 086 664 4202 Cell: 082 775 6808 e-mail: elsabe@clinicscardive.com

Production Editor

SHAUNA GERMISHUIZEN Tel: 021 785 7178 Cell: 083 460 8535 e-mail: shauna@clinicscardive.com

CONTENT MANAGER

Michael Meadon (Design Connection) Tel: 021 976 8129 Fax: 0866 557 149 e-mail: michael@clinicscardive.com

GAUTENG CONTRIBUTOR

PETER WAGENAAR Cell 082 413 9954 e-mail: skylark65@myconnection.co.za The Cardiovascular Journal of Africa, incorporating the Cardiovascular Journal of South Africa, is published 10 times a year, the publication date being the third week of the designated month.

All submissions to CVJA are to be made online via www.cvja.co.za

Subscriptions for 6 issues:

Electronic submission by means of an e-mail attachment may be considered under exceptional circumstances.

your postal address, e-mail

Postal address: PO Box 1013, Durbanville, RSA, 7551

Tel: 021 976 8129 Fax: 0866 644 202 Int.: +27 21 976 8129

Layout: Martingraphix

e-mail: info@clinicscardive.com

To subscribe to the journal or change elsabe@clinicscardive.com South Africa: R490 (incl VAT) Overseas: $135 Online subscription: R300 The views and opinions expressed in the articles and reviews published are those of the authors and do not necessarily

Printer: Durbanville Commercial Printers/ Tandym Print

Electronic abstracts available on Pubmed

reflect those of the editors of the Journal

Audited circulation

or its sponsors. In all clinical instances,

ONLINE publishing & coding SERVICES: Design Connection & Active-XML.com

Full text articles available on: www.cvja. co.za or via www.sabinet.co.za; for access codes contact elsabe@clinicscardive.com

medical practitioners are referred to the product insert documentation as approved by the relevant control authorities.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

From the Editor’s Desk It is interesting to one trained in the era that preceded the availability of new and sophisticated imaging modalities to see just how well the ‘old’ and often currently poorly regarded imaging techniques still serve. Ganie and colleagues (page 31) record how in seven of eight patients with vascular rings, the chest radiograph was abnormal, and they propose a diagnostic imaging algorithm for such patients, which includes chest radiographs. My own observations suggest that the chest radiograph is often neglected and may not be performed in current practice when patients are evaluated with symptoms or signs of cardiovascular disease, and are referred for echocardiography before a chest radiograph is performed. Echocardiography may fail to detect extra-cardiac abnormalities and mis-assess the severity of intracardiac abnormalities unless clinically directed. The authors are to be congratulated on pointing out how simple investigations, performed at low cost, may be valuable in evaluating patients with complex cardiovascular abnormalities. In exploring the genetic contribution to hypertension, Sun and colleagues (page 21) have identified genes that were risk factors for nocturnal hypertension in this Chinese Han population, and their combined effects played an important role in nocturnal hypertension. However, as the authors acknowledge, even if a gene were considered associated with hypertension in certain populations, to expand the conclusion to all human populations is unwise at this stage. In diseases such as hypertension, obesity or diabetes, not only genetic factors but many other factors, such as environment or geographic location, could be important. All these factors could have different effects on obesity or diabetes and they could impact on each other. Therefore whether or how single genes may be associated with nocturnal hypertension is complicated. Long-term population-based studies are needed to clarify the relationship. Arodiwe and co-authors (page 26) point out the paucity of information on the frequency of cardiac involvement in children with HIV/AIDS in sub-Saharan Africa, and the importance of such information given the extent of the epidemic. They conducted a descriptive cross-sectional echocardiographic study of HIV-infected children and uninfected controls at a Nigerian teaching hospital and showed left ventricular systolic dysfunction in 27% of HIV-infected children and 81% of those with AIDS. The systolic dysfunction was asymptomatic. This is important information and hopefully there will be further information forthcoming from the authors regarding follow up and prognosis of this particular group of patients, as well as the effects of anti-

Professor PJ Commerford

retroviral therapy. The impact of usual cardio-active medication for systolic dysfunction, such as angiotensin converting enzyme inhibitors and beta-blockers, should also be explored in this population. The clinical, laboratory and ECG profiles of 62 children with sickle cell anaemia (SCA) attending a paediatric haematology clinic in Nigeria and 40 age- and gender-matched haemoglobin AA controls were compared (page 16). Adegoke and colleagues found that ECG abnormalities were common in children with SCA, and in their discussion, speculate on the mechanisms and significance of the ECG abnormalities. Patrick Commerford Editor-in- Chief

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

AFRICA

Cardiovascular Topics Filamin C: a novel component of the KCNE2 interactome during hypoxia Annika Neethling, Jomien Mouton, Ben Loos, Valerie Corfield, Carin de Villiers, Craig Kinnear

Abstract Aim: KCNE2 encodes for the potassium voltage-gated channel, KCNE2. Mutations in KCNE2 have been associated with long-QT syndrome (LQTS). While KCNE2 has been extensively studied, the functions of its C-terminal domain remain inadequately described. Here, we aimed to elucidate the functions of this domain by identifying its protein interactors using yeast two-hybrid analysis. Methods: The C-terminal domain of KCNE2 was used as bait to screen a human cardiac cDNA library for putative interacting proteins. Co-localisation and co-immunoprecipitation analyses were used for verification. Results: Filamin C (FLNC) was identified as a putative interactor with KCNE2. FLNC and KCNE2 co-localised within the cell, however, a physical interaction was only observed under hypoxic conditions. Conclusion: The identification of FLNC as a novel KCNE2 ligand not only enhances current understanding of ion channel function and regulation, but also provides valuable information about possible pathways likely to be involved in LQTS pathogenesis.

Keywords: LQTS, KCNE2, filamin C (FLNC), hypoxia, arrhythmia Submitted 4/9/14, accepted 17/5/15 Cardiovasc J Afr 2016; 27: 4–11

www.cvja.co.za

DOI: 10.5830/CVJA-2015-049

DST/NRF Centre of Excellence in Biomedical Tuberculosis Research, SA MRC Centre for Tuberculosis Research, Division of Molecular Biology and Human Genetics, Department of Biomedical Sciences, Faculty of Medicine and Health Sciences, Stellenbosch University, South Africa Annika Neethling, MSc, aneethling@sun.ac.za Jomien Mouton, PhD Valerie Corfield, PhD Carin de Villiers, PhD Craig Kinnear, PhD

Department of Physiological Sciences, Faculty of Science, Stellenbosch University, Stellenbosch, South Africa Ben Loos, PhD

Long-QT syndrome (LQTS) is a cardiac repolarisation disorder with an estimated global prevalence of 1:2 000 to 1:7 000.1,2 It is characterised by a prolonged QT interval on a surface electrocardiogram (ECG), with symptoms including syncope, cardiac arrest and sudden death.1,3,4 Occasionally, sudden cardiac death may be the first and only manifestation of LQTS.5,6 To date, different types of LQTS (LQT1–LQT13), classified according to the primary disease causal gene, have been identified, with more than 700 mutations leading to disease pathogenesis.7,8 Yet a large number of patients with clinically diagnosed LQTS have no mutations within any of the known LQTS causal genes,9-11 and numerous patients, despite carrying the same disease-causing mutation, display variable phenotypic expression and disease penetrance.12 To complicate matters further, LQTS can also be acquired through the use of certain prescribed medications, such as antipsychotics, antidepressants and antibiotics,13,14 adding to the growing challenge of clinical management and treatment of affected individuals. The LQT type 6 (LQT6) causal gene, KCNE2 encoding for the potassium voltage-gated channel subfamily E member 2 (KCNE2) protein,15 has been implicated in the development of inherited, acquired and sporadic forms of LQTS.13,16-18 This protein consists of an extracellular N-terminal, a transmembrane and intracellular C-terminal domain. It comprises the beta(β) subunits of ion channel complexes and co-assembles with many different alpha- (α) subunits, including the frequently studied human Ether-à-go-go-related (HERG) channel protein encoded for by the potassium voltage-gated channel, subfamily H (eag-related), member 2 (KCNH2) gene.15,17,19 In combination with KCNE2, properties of the different ion channel currents are modulated,20 assisting in cardiac pacemaker activity and repolarisation to ensure adequate myocardial recharging and the maintenance of a regular rhythm.15,21-23 A unique quality of many cardiac ion channels, including those containing KCNE2 and HERG, is their ability to adapt to hypoxic conditions. Hypoxia, defined as the decrease in available oxygen, causes changes in the electrical characteristics of ion channels and has been reported to predispose individuals to fatal arrhythmias.24-27 Additionally, hypoxic conditions affect the expression, folding, maturation and trafficking of various channels.28-30 In a recent study, it was noted that the expression of genes from the KCNE family (including KCNE2) could be affected by hypoxia in the heart.31 It has been observed that acute ischaemic hearts of rats after myocardial infarction show increased expression of KCNE proteins, attributable to hypoxia.31 The intricacy of processes causing and modifying cardiac arrhythmias highlights the importance of identifying the protein

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

macromolecular complexes and pathways involved. Taking into consideration the relevance of KCNE2 in the context of ion channel regulation and LQTS, this study aimed to identify interactors with this β-subunit; specifically focusing on its cytoplasmic C-terminal domain, for which functional roles remain inadequately described. Using yeast two-hybrid analysis, we identified filamin C (FLNC) as a KCNE2-interacting protein. FLNC and its paralogs, filamin A (FLNA) and filamin B (FLNB), act as scaffolding proteins and have been implicated in a number of cellular stress responses,32-38 including several hypoxia-related effects.35–38 For this reason, co-localisation and co-immunoprecipitation (Co-IP) analyses for verification of this interaction were conducted both under normoxic and hypoxic conditions. Here, we show that, under normoxic and hypoxic conditions, FLNC and KCNE2c co-localised within the cell. However, FLNC and KCNE2 only co-immunoprecipitated under hypoxic conditions, suggesting that while these two proteins are located in close proximity to one another within the cell, it is only under conditions of cellular stress that a physical interaction between the two exists. The data presented here provide evidence to suggest that KCNE2 may play a role in hypoxia-induced arrhythmias.

Methods KCNE2 construct A fragment encoding the C-terminal of KCNE2 gene (amino acid 72-123) was amplified from human genomic DNA by means of polymerase chain reaction (PCR). The PCR reaction employed KCNE2 C-terminal-specific primers with two restriction enzyme sites (NdeI and EcoR1) (Table 1) for subsequent cloning into the CLONTECH yeast two-hybrid (Y2H) bait vector, pGBKT7 (pGBKT7-KCNE2), in-frame with the GAL4-DNA binding domain (GAL4BD). The integrity of the sequence and the conservation of the GAL4 domain reading frame of the resulting construct were verified via sequencing.

Yeast two-hybrid (Y2H) library screen The Saccharomyces cerevisiae strain, AH109 (BD Biosciences, Clontech, USA), was transformed with the pGBKT7-KCNE2 construct and mated with the S cerevisiae strain, Y187, which was pre-transformed with a MATCHMAKER human cardiac cDNA library (BD Biosciences, Clontech, USA). Subsequently, the library screen was conducted according to manufacturer’s recommendations. Table 1. Nucleotide sequences of primers used to amplify the C-terminal of KCNE2 Primer

Sequence (5’-3’)

Ta (°C)

KCNE2- 5’ - ACTGCAGAACATATGCTCAAATCCAAGAGAforwardNde1 CGG - 3’

KCNE2- 5’ - ACTGCAGAAGAATTCCTATCAGGGGAAreverseEcoR1 CATTTTGAAC - 3’

°C: degrees Celsius; Ta: annealing temperature; KCNE2: potassium voltagegated ion-channel subfamily E member 2. The bold text represents a tag, which facilitates restriction enzyme digestion, while the underlined sequences correspond to the Nde1 and EcoR1 restriction enzyme sites, respectively. The short italic sequence (CTA) symbolises the stop codon, and the remaining text represents the sequence of the primer, which will anneal to the DNA in the PCR amplification reaction.

The prey plasmids, from colonies expressing the three essential reporter genes (HIS3, ADE2 and MEL1), were isolated from the diploid yeast cells and were retransformed into S cerevisiae strain Y187 to analyse their ability to activate the reporter genes when mated with heterologous baits (Table 2). Prey peptides showing specific interaction with the KCNE2 C-terminal domain were sequenced and the in-frame open reading frame (ORF) sequences were analysed using BLASTN and BLASTP against public databases (http://ncbi.nlm.nih.gov/blast).

Cell culture The H9C2 rat-derived cardiac myoblasts (American Typer Culture Collection, USA) were grown in Dulbecco’s modified Eagle medium (DMEM, Lonza, CHE) containing 10% foetal bovine serum (FBS, Biochrom, GER) and 1% penicillin/ streptomycin (Pen/Strep, Biochrom, GER) until they reached 80% confluency. For co-localisation, 10 000 cells were seeded onto glass cover slips in each well of a six-well plate (8-cm2 culture dishes) and incubated until 80% confluency was reached, while for Co-IP, cells were grown in 175-cm2 flasks until they reached 80% confluency. Differentiation medium (DMEM containing 1% horse serum and 1% Pen/Strep) was subsequently added to each well of the six-well plate and the 175-cm2 flasks. Cells were differentiated for 10–14 days. For hypoxia induction, the differentiation medium was removed and replaced with Esumi buffer (138.6 mM NaCl, 12 mM KCl, 1 mM MgCl2, 1 mM CaCl2.H2O, and 4 mM Hepes, pH 6.2).39 Culture dishes and flasks were then placed in a chamber where a hypoxic environment was created by flushing the system with a 1% O2 gas mixture at a flow rate of 20 l/min, for approximately four minutes. The cells were then incubated in the hypoxic chamber at 37°C for two hours. For Co-IP experiments, 5 ml of pre-warmed trypsin was used to detach the cells from the growth surface of the flasks. The cells were then centrifuged at 4ºC for three minutes at 2 500 rpm. The supernatant was discarded and the pellet resuspended in 1 ml of phosphate-buffered saline (PBS) and re-pelleted at 9 000 rpm for two minutes. The PBS was removed and the cells were then lysed with ice-cold lysis buffer (50 mM Hepes, 5 M NaCl, 0.5 M EDTA, 1% Triton X-100, 1 M Na3VO4) containing protease inhibitor cocktail tablets [one tablet EDTA-free protease inhibitor cocktail tablet per 20 ml lysis buffer and 1 mM phenylmethylsulfonylfluoride (PMSF) (Sigma-Aldrich, USA)]. Approximately 0.5 ml of ZROB05 Ceria zirconium oxide beads (0.5 mm diameter) (Next Advance Inc, USA) was added to the suspension and it was placed in a Bullet blender® (Gentaur, GBR) for one minute. The blending step was repeated three times at five-minute intervals. The cells were then pelleted by centrifugation at 9 000 rpm for two minutes, after which the supernatant was collected. A Bradford assay was used for protein Table 2. S cerevisiae bait strains S cerevisiae bait strains AH109 pGBKT7-KCNE2 AH109 pGBKT7 AH109 pGBKT-53* AH109 pGBKT7-WFS1

Plasmid type Positive control plasmid Non-recombinant plasmid Control bait plasmid Negative control plasmid

*The pGBKT7 vector containing the human p53 gene. KCNE2: potassium voltage-gated ion-channel subfamily E member 2; WFS1: Wolfram syndrome 1.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

concentration determination,40 to ensure equivalent amounts of protein per sample were subjected to sodium dodecyl sulphatepolyacrylamide gel electrophoresis (SDS-PAGE) analysis.

Co-localisation For co-localisation experiments, the differentiation media and Esumi buffer was removed from the differentiated H9C2 rat-derived cardiomyocytes on the glass cover slips and the cells were rinsed with PBS. The cells were permeabilised with methanol for five minutes at –20°C and fixed with 4% paraformaldehyde for five minutes at room temperature. The cells were then washed three times with PBS for 10 minutes and blocked in 1% BSA for one hour at room temperature. Following the blocking step, the cells were again washed three times with PBS for 10 minutes and incubated at 4°C overnight with rabbit anti-KCNE2 (Abcam, Biocom Biotech, RSA, 1:50) and goat anti-FLNC (Santa Cruz Biotechnology Inc, USA, 1:50) primary antibodies diluted in 1% BSA. The cells were then washed three times with PBS for 10 minutes and stained with Alexa 488 donkey anti-rabbit (Jackson ImmunoResearch Laboratories Inc, USA, 1:500) and Cy3 donkey anti-goat (Jackson ImmunoResearch Laboratories Inc, USA, 1:500) secondary antibodies in PBS for 90 minutes in the dark at room temperature. Afterwards, the cells were washed three times with PBS for 10 minutes, and Hoechst H-33342 was added for nuclear staining [Sigma-Aldrich (Pty) Ltd, RSA, 1:200; 10 mg/ml], followed by a 10-minute incubation at room temperature. Subsequently, the cover slips with the stained cells were mounted onto glass slides using Mowiol (Jackson ImmunoResearch Laboratories Inc, USA) containing n-propylgallate as the anti-fade reagent and kept at 4°C in the dark until viewing. Samples were acquired using the Carl Zeiss Confocal LSM 780 Elyra S1, equipped with a LSM780 GaAsP detector, using a Plan Apochromat 63×/1.4 Oil DIC M27 or an alpha PlanApochromat 100×/1.46 oil DIC objective (Central analytical facility, Cell Imaging Unit, Stellenbosch University, RSA). The samples were excited with a 488-nm and 561-nm laser underutilisation of a MBS 488/561 beam splitter. Images were acquired through z-stacking with an increment of 0.3-µm step width, and projected as maximum-intensity projections using ZEN software (black edition, 2011). Thresholds were determined using appropriate control images acquired for cells individually stained (single-stain) for KCNE2 and FLNC, respectively. The background was adjusted for all acquired images using images of cells only stained with secondary control antibodies.

Co-immunoprecipitation Cells were harvested and the lysates were pre-cleared with protein G agarose beads (KPL Inc, USA) for 30 minutes at 4°C. The pre-cleared lysates (150 µg/total protein) were incubated with 1 µg of either rabbit polyclonal anti-KCNE2 (Santa Cruz Biotechnology Inc, USA) or goat polyclonal anti-FLNC (Santa Cruz Biotechnology Inc, USA) antibody rotating overnight at 4°C. To capture the protein complexes, 60 µl of protein G agarose beads were added to the lysate and incubated for an additional

AFRICA

hour rotating at 4°C. The complexes were then washed three times, each time removing the supernatant after centrifugation and adding fresh lysis buffer that contained protease inhibitors and PMSF. Proteins were eluted by addition of 1× SDS-PAGE sample buffer [95% Laemmli sample buffer (Bio-Rad Laboratories Inc, USA), 5% β-mercapto-ethanol], denatured for five minutes at 95°C and separated using 4–15% SDS-PAGE gels for Western blot analysis. Two negative controls, a non-relevant antibody control (HA-probe; Santa Cruz Biotechnology Inc, USA) and a protein G agarose control (without antibody) were included in all Co-IP experiments

Western blot analysis Following co-IP, proteins were separated on 4–15% SDS-PAGE gels and transferred to a polyvinylidene difluoride (PVDF) membrane (Thermo Scientific, USA) by means of the iBlot® system (Invitrogen, USA). Membranes were blocked with 5% fat-free powdered milk, supplemented with Tris-buffered saline Tween-20 (TBST, 0.01% Tween-20), for one hour at room temperature. Membranes were then incubated at 4°C overnight with the appropriate primary antibodies (Santa Cruz Biotechnology Inc, USA, 1:200 anti-KCNE2; 1:1 000 antiFLNC), diluted with 5% milk in TBST. Subsequently, the membranes were washed with TBST and incubated for one hour at room temperature with the corresponding horseradish peroxidase (HRP) conjugated secondary antibodies (Santa Cruz Biotechnology Inc, USA, 1:2 000 donkey anti-rabbit; 1:2 000 donkey anti-goat), diluted with 5% milk in TBST. Following incubation with the secondary antibody, the membranes were washed for 30 minutes at room temperature. The SuperSignal® West Pico chemiluminescence substrate kit (Thermo Scientific, USA) was then used according to the manufacturer’s instructions and the membranes were exposed for two minutes to CL-Xposure™ autoradiography film (Thermo Scientific, USA). The autoradiography film was developed using an Amersham hyperprocessor automatic autoradiography film processor (Amersham Pharmacia Biotech UK Ltd, UK) prior to final analyses.

Results FLNC as a novel interactor with KCNE2 under hypoxic conditions The Y2H screen identified FLNC (GenBank: NP_001449.3) as a KCNE2 (GenBank: NP_751951.1) interactor with the binding regions located between amino acids 2637–2725 of FLNC and amino acids 72–123 of KCNE2. These 88 amino acids of FLNC are positioned at the end of the C-terminal domain, shown to be involved in self-dimerisation.32 Imaging analysis revealed a strong co-localisation signal between KCNE2 and FLNC at the cell membrane, filamentous structures and the cytoplasm of differentiated H9C2 rat-derived cardiomyocytes under normoxic conditions (Fig. 1a–h), while the co-localisation of these two proteins was mainly restricted to the cytoplasm under conditions of hypoxia (Fig. 1i–p). When the cells were subjected to hypoxic stress, the pattern of co-localisation, relative to that during normoxia, changed considerably at the plasma membrane (Fig. 1i–p), where decreased co-localisation

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

FLNC

Overlay

Co-loc

Hypoxic

Normoxic

KCNE2

Fig. 1. F luorescent imaging and co-localisation analysis of KCNE2 and FLNC in differentiated H9C2 cardiomyocytes under normoxic and hypoxic conditions. (a–h) Co-localisation under normoxic conditions. (i–p) Co-localisation under hypoxic conditions. (a, e, i, m) KCNE2 labelled with the rabbit polyclonal anti-KCNE2 primary antibody and a donkey anti-rabbit Alexa 488 secondary antibody (green). (b, f, j, n) FLNC labelled with the goat polyclonal anti-Filamin C primary antibody and donkey anti-goat Cy3 secondary antibody (red). (c, g, k, o) Overlay images of a–b, e–f, i–j and m–n, respectively with Hoechst H-33342 nuclear staining (blue). (d, h, l, p) Co-localisation of KCNE2 and FLNC generated from merged images (white). Arrows in d and h indicate the ordered filamentous structure in the cardiomyocytes under normoxic conditions (blue). Arrows in l and p indicate the disordered filamentous structure in the cardiomyocytes under hypoxic conditions (blue). Micrographs are shown as maximum-intensity projections based on z-stack image frames. Co-loc: co-localisation; FLNC: filamin C; KCNE2: potassium voltage-gated ion-channel subfamily E member 2. Scale bar 10 µm.

of these proteins was observed. Following hypoxic stress, the internal cellular structure became disrupted and the filaments and cytoskeleton showed clear signs of disarray (Fig. 1i–p). The less well-defined signal appearance of co-localisation seen in Fig. 1l and p may be attributable to this disarray.

While co-localisation analysis provided convincing evidence that KNCE2 and FLNC are located in close proximity to one another within the cell, this does not necessarily mean that they physically interact. For this reason, Co-IP analysis was used to determine whether a physical interaction exists between the two.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

AFRICA

Hypoxic

Normoxic

Fig. 2. W estern blots of Co-IP of KCNE2 and putative interactor FLNC in differentiated H9C2 cardiomyocytes. Reciprocal Co-IP reactions were performed for each interaction. (a–b) Co-IP under normoxic conditions. (c–d) Co-IP under hypoxic conditions. FLNC: filamin C; IP: immunoprecipitate; KCNE2: potassium voltage-gated ion-channel subfamily E member 2; kDa: kilo Dalton; Neg: negative control; Prot G: protein G agarose control; WB: Western blot. Note: The Western blot revealed a larger-than-expected predicted molecular weight band for KCNE2 (50 kD versus 14–20 kDa) (c). This is likely due to previously described protein modifications and/or protein interactions of KCNE2.19,77-80

Under normoxic conditions, reciprocal Co-IP experiments failed to show any physical interaction between KCNE2 and FLNC (Fig. 2a, b). However, during hypoxia an interaction between KCNE2 and FLNC was observed (Fig. 2c, d). These findings suggest that the induction of stress is essential to the interaction and one could speculate that hypoxia-induced conformational changes of FLNC are necessary for the KCNE2–FLNC interaction.

Discussion This study identified a novel protein–protein interaction between the cytoplasmic C-terminal domain of KCNE2 and FLNC during conditions of acute hypoxia. To date, the intracellular C-terminal domain residues of KCNE2 have been implicated in modulating HERG current density,13,41 current deactivation rates,41 and phosphorylation-dependant channel degradation.19 However, studies elaborating on specific regulatory roles for this domain remain scarce, highlighting the importance of the current findings. The interactor identified in this study, FLNC, is located in the cytoplasm at the Z-line of the sarcomere and functions in the cytoskeleton, where it is involved in crosslinking actin filaments into networks and anchoring membrane proteins.32,42 This filamin and its main paralogs, FLNA and FLNB, act as scaffolding proteins and have been implicated in a number of cellular stress responses,32-34,43-46 including several hypoxia-related effects.33,34,45,46 FLNC specifically, is predominantly expressed in muscle tissue and is associated with cardiac abnormalities such as desminopathy, characterised by muscle weakness, conduction blocks, arrhythmias and chronic heart failure, frequently resulting in sudden cardiac death.35,36 Filamins also play an important part in cell signalling by disrupting existing interactions or by the introduction of novel interactions.32,37,38,47 Interestingly, there are several reports detailing interactions of filamin family members with ion channel subunits.48-50 Particularly noteworthy is a previously descibed association in neuronal tissue between FLNC and the potassium voltage-gated channel subfamily D member 2 (KCND2),48 the α-subunit of the Kv4.2 channel. That study proposed that FLNC mediates the direct link between KCND2 and the actin cytoskeleton and showed that this interaction is essential for the generation of appropriate current densities.48

Both neuronal and cardiac tissue contain voltage-gated ion channels responsible for controlling the excitability of neurons and cardiomyocytes. These channels allow for communication between cells in these tissues.51-53 Furthermore, a KCNE2– KCND2 interaction has been described, implicating KCNE2 in the regulation of the rapidly inactivating KCND2 α-subunit.54,55 A common theme in the observation of the ion channel interactions with filamin is the ability of filamin to influence membrane localisation.48-50 For FLNC, this process has also been shown to involve other actin-binding and auxiliary ion channel proteins.56 In the present study, the C-terminal of FLNC, specifically amino acids 2637–2725 (GenBank: NP_001449.3), bound to the cytoplasmic C-terminal domain of KCNE2, exclusively during conditions of hypoxic stress. This finding is consistent with a number of other studies, indicating that the C-terminal region of filamins is involved in protein interactions.57 The FLNC amino acid residues defined to interact with KCNE2 in this investigation correspond to a domain that is responsible for protein dimer formation and is important for actin filament bundling and cross-linking activities.58,59 The introduction of hypoxic stress is known to have profound effects on the cell.60 These include the disruption of ionic homeostasis, mitochondrial dysfunction resulting in impaired ATP production, induction of cell death by apoptosis or necrosis, and the generation of reactive oxygen species (ROS).61 Excess ROS leads to cardiac cell damage and post-ischaemic contractile dysfunction by attacking virtually all cellular components.62 This results in the degradation of intracellular proteins, rupture of cellular membranes (including the sarcolemma), as well as intracellular calcium ion overload,63 however, it has been show that cells remain viable even after extended periods of hypoxic stress.64 In addition to this, the actin cytoskeleton is also severely compromised and may therefore be a driving force for novel interactions. Additionally, Kesner et al. indicated that stressinduced conformational changes in filamins could have a direct effect on existing interactions or may influence the presence of novel interactions.47 Co-localisation analysis revealed that KCNE2 and FLNC co-localise under both normoxic and hypoxic conditions. However, no physical interaction could be confirmed between

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

these two proteins during normoxic conditions using Co-IP assays. Therefore, these findings suggest that the induction of stress is essential to the interaction. Given that hypoxic stress compromises the integrity of the cellular membranes and that FLNC has also been shown to interact with the actin cytoskeleton, it is tempting to speculate that during this time of cellular stress, the interaction between FLNC and KNCE2 may be an attempt by the cell to restore cellular membrane integrity, thereby promoting cellular survival during these conditions. If this is the case, one could further speculate that mutations in the genes encoding for KCNE2 or FLNC, or both, which weaken or abrogate their interaction could result in the cell being unable to restore membrane integrity, which could lead to acute myocardial ischaemic arrhythmogenesis. Furthermore, it may be that hypoxia-induced conformational changes of FLNC are necessary for the novel KCNE2–FLNC interaction. During hypoxia, the pattern of co-localisation changed and the differentiated H9C2 cardiomyocytes showed signs of internal structural disruption. Both KCNE2 and FLNC displayed reduced localisation at the surface membrane (Fig. 1i, j, m, n), while the intracellular co-localisation signal was intensified. Hypoxic conditions are known to initiate extensive variations in gene expression, alter protein sub-cellular localisation, and cause the attenuation of membrane protein translation.65-67 Furthermore, these findings are consistent with reports that the HERG α-subunit, known to bind KCNE2,16 showed reduced membrane localisation during hypoxia.30,68 The reason for the observed decrease of these proteins at the membrane requires further investigation; however, it is interesting to note that both KCNE2 and filamins have been implicated in processes involving the internalisation of membrane proteins.19,69,70 Additionally, given the evidence of filamins aiding channel localisation,69,70 and the increase in KCNE2 gene expression during hypoxia,31 it would be intriguing to investigate if this interaction serves a compensatory role to try to restore internally localised channels to the membrane. The role of cytoskeletal components, including actin-binding proteins, in ion channel function and regulatory processes is a rapidly expanding field of study. Evidence supports their significant contribution towards channel trafficking and activity at the plasma membrane itself.71-73 Furthermore, there are numerous studies linking the dysfunction of cytoskeletal proteins with conduction defects and arrhythmias.72,73 This study is the first to identify the cytoskeletal protein, FLNC, as a constituent of an ion channel macromolecular complex, specifically forming part of the KCNE2 interactome. This observation was only valid during conditions of hypoxia, although it remains to be seen if other stimuli can elicit the same association. Together, FLNC and KCNE2 most likely modulate KCNE2-containing channels, especially pertaining to their surface expression.

been shown in the cardiovascular system where lack of oxygen contributes to cardiac arrhythmia.75,76 This study identified and validated FLNC as an interactor with KCNE2 under conditions of hypoxia. This finding points towards new insight and understanding into the mechanisms in which KCNE2 functions, and could contribute to our understanding of the interactome in cardiovascular conditions such as LQTS. Through identification of novel KCNE2 interacting proteins, new genes can be included in searches for causal and modifying effects of novel arrhythmia disorders. These findings ultimately advocate intriguing possibilities that might lead to new therapeutic avenues being discovered. The KCNE2 Y2H screen was enabled by funding provided by the National Research Foundation grant FA2006040400017 (VAC). The authors thank Derick van Vuuren for his assistance with the hypoxic chamber (Division of Medical Physiology, Stellenbosch University).

References 1.

Schwartz PJ. Prevalence of the congenital long-QT syndrome. Circulation 2009; 120(18): 1761–1767.

Schulze Bahr E. Long QT syndromes: genetic basis. Card Electrophysiol Clin 2012; 4(1): 1–16.

Goldenberg I, Zareba W, Moss AJ. Long QT syndrome. Curr Probl Cardiol 2008; 33(11): 629–694.

Schwartz PJ, Crotti L, Insolia R. Long-QT syndrome from genetics to management. Circ Arrhythm Electrophysiol 2012; 5(4): 868–877.

Zipes DP, Wellens HJJ. Sudden cardiac death. Circulation 1998; 98(21): 2334–2351.

Bhuiyan MZA, Al-Shahrani S, Al-Aama J, Wilde A, Momenah TS. Congenital long QT syndrome: an update and present perspective in Saudi Arabia. Genet Disord 2013; 1: 39.

Hedley PL, Jørgensen P, Schlamowitz S, et al. The genetic basis of long QT and short QT syndromes: a mutation update. Hum Mutat 2009; 30(11): 1486–1511.

Schwartz PJ, Ackerman MJ, George AL Jr, Wilde AAM. Impact of genetics on the clinical management of channelopathies. J Am Coll Cardiol 2013; 62(3): 169–180.

Napolitano C. Genetic testing in the long QT syndrome: Development and validation of an efficient approach to genotyping in clinical practice. J Am Med Assoc Chic Ill. 2005; 294(23): 2975–2980.

10. Medeiros-Domingo A, Iturralde-Torres P, Ackerman MJ. Clinical and genetic characteristics of long QT syndrome. Rev Esp Cardiol Engl Ed 2007; 60(7): 739–752. 11. Newton-Cheh C, Eijgelsheim M, Rice KM, et al. Common variants at ten loci influence QT interval duration in the QTGEN Study. Nat Genet 2009; 41(4): 399–406. 12. Brink PA, Crotti L, Corfield V, et al. Phenotypic variability and unusual clinical severity of congenital long-QT syndrome in a founder population. Circulation 2005; 112(17): 2602–2610. 13. Sesti F, Abbott GW, Wei J, et al. A common polymorphism associated

Conclusion It has long been known that all cells have the ability to adapt and respond to hypoxic conditions in order to prevent the harmful effects of oxygen deprivation.74 In cardiac cells, potassium channels play a central role in this adaptation. However, inadequate adaptive responses may lead to serious cellular damage and cardiac arrhythmias. This has previously

with antibiotic-induced cardiac arrhythmia. Proc Natl Acad Sci 2000; 97(19): 10613–10618. 14. Sanguinetti MC, Mitcheson JS. Predicting drug–hERG channel interactions that cause acquired long QT syndrome. Trends Pharmacol Sci 2005; 26(3): 119–124. 15. Abbott GW, Sesti F, Splawski I, et al. MiRP1 forms IKr potassium channels with HERG and is associated with cardiac arrhythmia. Cell 1999; 97(2): 175–187.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

AFRICA

16. Splawski I, Shen J, Timothy KW, et al. Spectrum of mutations in

34. Nissou M-F, El Atifi M, Guttin A, et al. Hypoxia-induced expression of

long-QT syndrome genes : KVLQT1, HERG, SCN5A, KCNE1, and

VE-cadherin and filamin B in glioma cell cultures and pseudopalisade

KCNE2. Circulation 2000; 102(10): 1178–1185.

structures. J Neurooncol 2013; 113(2): 239–249.

17. Larsen LA, Andersen PS, Kanters J, et al. Screening for mutations and

35. Kley RA, Hellenbroich Y, van der Ven PFM, et al. Clinical and morpho-

polymorphisms in the genes KCNH2 and KCNE2 encoding the cardiac

logical phenotype of the filamin myopathy: a study of 31 German

HERG/MiRP1 ion channel: implications for acquired and congenital long Q-T syndrome. Clin Chem 2001; 47(8): 1390–1395. 18. Mazhari R, Greenstein JL, Winslow RL, Marbán E, Nuss HB.

patients. Brain 2007; 130(12): 3250–3264. 36. Goldfarb LG, Olivé M, Vicart P, Goebel HH. Intermediate filament diseases: desminopathy. Adv Exp Med Biol 2008; 642: 131–164.

Molecular interactions between two long-QT syndrome gene products,

37. Feng Y, Walsh CA. The many faces of filamin: a versatile molecular

HERG and KCNE2, rationalized by in vitro and in silico analysis. Circ

scaffold for cell motility and signalling. Nat Cell Biol 2004; 6(11):

Res 2001; 89(1): 33–38.

1034–1038.

19. Zhang M, Wang Y, Jiang M, et al. KCNE2 protein is more abundant

38. Ithychanda SS, Hsu D, Li H, et al. Identification and characterization

in ventricles than in atria and can accelerate hERG protein degradation

of multiple similar ligand-binding repeats in filamin implication on

in a phosphorylation-dependent manner. Am J Physiol – Heart Circ

filamin-mediated receptor clustering and cross-talk. J Biol Chem 2009;

Physiol 2012; 302(4): H910–922.

284(50): 35113–35121.

20. Tinel N. KCNE2 confers background current characteristics to the

39. Lecour S, Suleman N, Deuchar GA, et al. Pharmacological precondi-

cardiac KCNQ1 potassium channel. Eur Mole Biol Org J 2000; 19(23):

tioning with tumor necrosis factor-α activates signal transducer and

6326–6330.

activator of transcription-3 at reperfusion without involving classic

21. Towbin JA, Vatta M. Molecular biology and the prolonged QT syndromes. Am J Med 2001; 110(5): 385–398.

prosurvival kinases (Akt and extracellular signal-regulated kinase). Circulation 2005; 112(25): 3911–3918.

22. Chun KRJ, Koenen M, Katus HA, Zehelein J. Expression of the IKr

40. Bradford MM. A rapid and sensitive method for the quantitation of

components KCNH2 (rERG) and KCNE2 (rMiRP1) during late rat

microgram quantities of protein utilizing the principle of protein-dye

heart development. Exp Mol Med 2004; 36(4): 367–371.

binding. Anal Biochem 1976; 72: 248–254.

23. Kawakami K, Nagatomo T, Abe H, et al. Comparison of HERG

41. Abbott GW. Disease-associated mutations in KCNE potassium channel

channel blocking effects of various β-blockers – implication for clinical

subunits (MiRPs) reveal promiscuous disruption of multiple currents

strategy. Br J Pharmacol 2006; 147(6): 642–652.

and conservation of mechanism. Fed Am Soc Exp Biol J 2002; 16(3):

24. Clark RE, Christlieb I, Sanmarco M, Diaz-Perez R, Dammann JF,

390–400.

Zipser ME. Relationship of hypoxia to arrhythmia and cardiac conduc-

42. Fujita M, Mitsuhashi H, Isogai S, et al. Filamin C plays an essential role

tion hemorrhage: an experimental study. Circulation 1963; 27(4):

in the maintenance of the structural integrity of cardiac and skeletal

742–747.

muscles, revealed by the medaka mutant zacro. Dev Biol 2012; 361(1):

25. Ju YK, Saint DA, Gage PW. Hypoxia increases persistent sodium current in rat ventricular myocytes. J Physiol 1996; 497(Pt 2): 337–347. 26. Prandota J. Possible pathomechanisms of sudden infant death syndrome: key role of chronic hypoxia, infection/inflammation states, cytokine irregularities, and metabolic trauma in genetically predisposed infants. Am J Ther 2004; 11(6): 517–546.

79–89. 43. Nakagawa K, Sugahara M, Yamasaki T, et al. Filamin associates with stress signalling kinases MKK7 and MKK4 and regulates JNK activation. Biochem J 2010; 427(2): 237–245. 44. Razinia Z, Mäkelä T, Ylänne J, Calderwood DA. Filamins in mechanosensing and signaling. A Rev Biophys 2012; 41(1): 227–246.

27. Neary MT, Mohun TJ, Breckenridge RA. A mouse model to study

45. Boraldi F, Annovi G, Carraro F, et al. Hypoxia influences the cellular

the link between hypoxia, long QT interval and sudden infant death

cross-talk of human dermal fibroblasts. A proteomic approach. Biochim

syndrome. Dis Model Mech 2013; 6(2): 503–507.

Biophys Acta BBA – Proteins Proteomics 2007; 1774(11): 1402–1413.

28. Conforti L, Millhorn DE. Selective inhibition of a slow-inactivating

46. Hastie LE, Patton WF, Hechtman HB, Shepro D. H2O2-induced

voltage-dependent K+ channel in rat PC12 cells by hypoxia. J Physiol

filamin redistribution in endothelial cells is modulated by the cyclic

1997; 502(Pt 2): 293–305.

AMP-dependent protein kinase pathway. J Cell Physiol 1997; 172(3):

29. Wang J, Weigand L, Wang W, Sylvester JT, Shimoda LA. Chronic hypoxia inhibits Kv channel gene expression in rat distal pulmonary artery. Am J Physiol Lung Cell Mol Physiol 2005; 288(6): L1049–1058. 30. Nanduri J, Bergson P, Wang N, Ficker E, Prabhakar NR. Hypoxia

373–381. 47. Kesner BA, Ding F, Temple BR, Dokholyan NV. N-terminal strands of filamin Ig domains act as a conformational switch under biological forces. Proteins 2010; 78(1): 12–24.

inhibits maturation and trafficking of HERG K+ channel protein:

48. Petrecca K, Miller DM, Shrier A. Localization and enhanced current

Role of Hsp90 and ROS. Biochem Biophys Res Commun 2009; 388(2):

density of the Kv4.2 potassium channel by interaction with the actin-

212–216.

binding protein filamin. J Neurosci Off J Soc Neurosci 2000; 20(23):

31. Xia S, Wang Y, Zhang Y, et al. Dynamic changes in HCN2, HCN4,

8736–8744.

KCNE1, and KCNE2 expression in ventricular cells from acute myocar-

49. Sampson LJ, Leyland ML, Dart C. Direct interaction between the

dial infarction rat hearts. Biochem Biophys Res Commun 2010; 395(3):

actin-binding protein filamin-A and the inwardly rectifying potassium

330–335.

channel, Kir2.1. J Biol Chem 2003; 278(43): 41988–41997.

32. Van der Ven PF, Obermann WM, Lemke B, Gautel M, Weber K, Fürst

50. Kim EY, Ridgway LD, Dryer SE. Interactions with filamin A stimulate

DO. Characterization of muscle filamin isoforms suggests a possible role

surface expression of large-conductance Ca2+-activated K+ channels

of gamma-filamin/ABP-L in sarcomeric Z-disc formation. Cell Motil

in the absence of direct actin binding. Mol Pharmacol 2007; 72(3):

Cytoskeleton 2000; 45(2): 149–162.

622–630.

33. Cho K-O, Lee K-E, Youn D-Y, et al. Decreased vulnerability of

51. An WF, Bowlby MR, Betty M, et al. Modulation of A-type potas-

hippocampal neurons after neonatal hypoxia-ischemia in bis-deficient

sium channels by a family of calcium sensors. Nature 2000; 403(6769):

mice. Glia 2012; 60(12): 1915–1929.

553–556.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

52. Zaika O, Zhang J, Shapiro MS. Functional role of M-type (KCNQ) K+

decreases voltage-activated potassium channel expression and function

channels in adrenergic control of cardiomyocyte contraction rate by

in pulmonary artery myocytes. Am J Respir Cell Mol Biol 2004; 31(3):

sympathetic neurons. J Physiol 2011; 589(Pt 10): 2559–2568. 53. Kaczmarek LK. Slack, slick, and sodium-activated potassium channels. Int Sch Res Not 2013; 2013: e354262. 54. Zhang M, Jiang M, Tseng G-N. MinK-related peptide 1 associates with Kv4.2 and modulates its gating function: potential role as subunit of cardiac transient outward channel? Circ Res 2001; 88(10): 1012–1019. 55. Abbott GW. KCNE2 and the K channel: the tail wagging the dog. Channels 2012; 6(1). doi:10.4161/chan.6.1.19126. 56. Chan F-C, Cheng C-P, Wu K-H, et al. Intercalated disc-associated protein, mXin-alpha, influences surface expression of ITO currents in ventricular myocytes. Front Biosci Elite Ed 2011; 3: 1425–1442.

337–343. 67. Henke RM, Dastidar RG, Shah A, et al. Hypoxia elicits broad and systematic changes in protein subcellular localization. Am J Physiol – Cell Physiol 2011; 301(4): C913–928. 68. Nanduri J, Wang N, Bergson P, Yuan G, Ficker E, Prabhakar NR. Mitochondrial reactive oxygen species mediate hypoxic down-regulation of hERG channel protein. Biochem Biophys Res Commun 2008; 373(2): 309–314. 69. Minsaas L, Planagumà J, Madziva M, et al. Filamin A binds to CCR2B and regulates its internalization. PLoS ONE 2010; 5(8): e12212. 70. Noam Y, Ehrengruber MU, Koh A, et al. Filamin A promotes dynamin-

57. Van der Flier A, Sonnenberg A. Structural and functional aspects of

dependent internalization of hyperpolarization-activated cyclic nucleo-

filamins. Biochim Biophys Acta BBA – Mol Cell Res 2001; 1538(2–3):

tide-gated type 1 (HCN1) channels and restricts Ih in hippocampal

99–117.

neurons. J Biol Chem 2014; 289(9): 5889–5903.

58. Himmel M, Van der Ven PFM, Stöcklein W, Fürst DO. The limits of

71. Mazzochi C, Benos DJ, Smith PR. Interaction of epithelial ion channels

promiscuity: isoform-specific dimerization of filamins. Biochemistry

with the actin-based cytoskeleton. Am J Physiol Renal Physiol 2006;

(Mosc) 2003; 42(2): 430–439. 59. Vorgerd M, Van der Ven PFM, et al. A mutation in the dimerization domain of filamin c causes a novel type of autosomal dominant myofibrillar myopathy. Am J Hum Genet 2005; 77(2): 297–304. 60. Zieseniss A. Hypoxia and the modulation of the actin cytoskeleton – emerging interrelations. Hypoxia 2014; 11. 61. Kuznetsov AV, Javadov S, Sickinger S, Frotschnig S, Grimm M. H9c2 and HL-1 cells demonstrate distinct features of energy metabolism, mitochondrial function and sensitivity to hypoxia–reoxygenation. Biochim Biophys Acta 2015; 1853(2): 276–284. 62. Dhalla NS, Elmoselhi AB, Hata T, Makino N. Status of myocardial antioxidants in ischemia–reperfusion injury. Cardiovasc Res 2000; 47(3): 446–456. 63. Sanada S, Komuro I, Kitakaze M. Pathophysiology of myocardial

291(6): F1113–1122. 72. Vatta M, Faulkner G. Cytoskeletal basis of ion channel function in cardiac muscle. Future Cardiol 2006; 2(4): 467–476. 73. Steele DF, Fedida D. Cytoskeletal roles in cardiac ion channel expression. Biochim Biophys Acta 2014; 1838(2): 665–673. 74. López-López J, González C, Ureña J, López-Barneo J. Low pO2 selectively inhibits K channel activity in chemoreceptor cells of the mammalian carotid body. J Gen Physiol 1989; 93(5): 1001–1015. 75. Keating MT, Sanguinetti MC. Molecular and cellular mechanisms of cardiac arrhythmias. Cell 2001; 104(4): 569–580. 76. Sanguinetti MC. When the KChIPs are down. Nat Med 2002; 8(1): 18–19. 77. Um SY, McDonald TV. Differential association between HERG and KCNE1 or KCNE2. PLoS ONE 2007; 2(9): e933.

reperfusion injury: preconditioning, postconditioning, and translational

78. Jiang M, Zhang M, Tang DG, et al. KCNE2 protein is expressed in

aspects of protective measures. Am J Physiol - Heart Circ Physiol 2011;

ventricles of different species, and changes in its expression contribute

301(5): H1723–1741.

to electrical remodeling in diseased hearts. Circulation 2004; 109(14):

64. Bonavita F, Stefanelli C, Giordano E, et al. H9c2 cardiac myoblasts

1783–1788.

undergo apoptosis in a model of ischemia consisting of serum depriva-

79. Chandrasekhar KD, Bas T, Kobertz WR. KCNE1 subunits require

tion and hypoxia: inhibition by PMA. FEBS Lett 2003; 536(1–3): 85–91.

co-assembly with K+ channels for efficient trafficking and cell surface

65. Nakamura M, Wang NP, Zhao ZQ, et al. Preconditioning decreases Bax expression, PMN accumulation and apoptosis in reperfused rat heart. Cardiovasc Res 2000; 45(3): 661–670. 66. Hong Z, Weir EK, Nelson DP, Olschewski A. Subacute hypoxia

expression. J Biol Chem 2006; 281(52): 40015–40023. 80. Chandrasekhar KD, Lvov A, Terrenoire C, Gao GY, Kass RS, Kobertz WR. O-glycosylation of the cardiac I(Ks) complex. J Physiol 2011; 589(Pt 15): 3721–3730.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

AFRICA

The effect of anatomical factors on mortality rates after endovascular aneurysm repair Derih Ay, Burak Erdolu, Gunduz Yumun, Ahmet Demir, Ufuk Aydin, Hakan Ozkan, Kamuran Erkoc, Osman Tiryakioglu

Abstract Objective: The objective of this study was to investigate the effect of anatomical characteristics on mortality rates after endovascular aneurysm repair (EVAR). Methods: We investigated 56 EVAR procedures for infrarenal aortic aneurysms performed between January 2010 and December 2013, and the data were supplemented with a prospective review. The patients were divided into two groups according to the diameter of the aneurysm. Group I (n = 30): patients with aneurysm diameters less than 6 cm, group II (n = 26): patients with aneurysm diameters larger than 6 cm. The pre-operative anatomical data of the aneurysms were noted and the groups were compared with regard to postoperative results. Results: There were no correlations between diameter of aneurysm (p > 0.05), aneurysm neck angle (p > 0.05) and mortality rate. The long-term mortality rate was found to be high in patients in whom an endoleak occurred. Conclusion: We found that aneurysm diameter did not have an effect on postoperative mortality rates. An increased EuroSCORE value and the development of endoleaks had an effect on long-term mortality rates. Keywords: abdominal aortic aneurysm, EVAR, endoleak Submitted 16/4/15, accepted 2/7/15 Published online 14/7/15 Cardiovasc J Afr 2016; 27: 12–15

www.cvja.co.za

DOI: 10.5830/CVJA-2015-057

An aortic aneurysm is defined as a greater than 50% increase in the aortic diameter compared to the normal proximal aorta.1

Department of Cardiovascular Surgery, Bursa Yüksek İhtisas Education and Research Hospital, Bursa, Turkey Derih Ay, MD Burak Erdolu, MD Gunduz Yumun, MD Ufuk Aydin, MD

Department of Cardiovascular Surgery, Yalova State Hospital, Yalova, Turkey Ahmet Demir, MD

Department of Cardiovascular Surgery, Bahcesehir University Medical Faculty and Medical Park Bursa Hospital, Bursa, Turkey Hakan Ozkan, MD Osman Tiryakioglu, MD, tiryaki64@hotmail.com

Department of Cardiovascular Surgery, Medical Park Bursa Hospital, Bursa, Turkey Kamuran Erkoc, MD

Large aortic aneurysms tend to enlarge and rupture eventually. The annual risk of rupture of aneurysms with diameters larger than 6 cm is more than 25%.2 Generally, elective surgery or endovascular repair is recommended in aneurysms with diameters larger than 5.5 cm, whereas in those with smaller diameters, follow up with ultrasonography or computerised tomography (CT) is recommended.3 Endovascular repair compares favourably to open aneurysm repair, with a significant reduction in morbidity, reduced blood loss, shorter hospital stay, and earlier return to normal function.4 The size of the abdominal aortic aneurysm is the major determinant of risk of aneurysm rupture and long-term survival.5 The threshold value for differentiation of small and large aneurysms is generally 5.5 cm. Aneurysms whose diameter is smaller than 5.5 cm are evaluated as small aneurysms and when they are greater than 5.5 cm, they are regarded as large aneurysms. The treatment of AAA smaller than 5.5 cm with EVAR requires less recurring intervention compared with large aneurysms.6 Although early and long-term results in small aneurysms in which EVAR was performed were better when compared to large aneurysms, the relationship between size of the aneurysm and results after EVAR is unclear.7 The effect of EVAR on aneurysm morphology is changing. During or post-EVAR, it is possible that an angulated aneurysm neck can be straightened under the influence of the guidewire, the delivery system, and the stent-graft, and the aneurysm sac shrinks as a result.8 The aim of the current study was to determine the effect of pre-operative diameter and anatomical characteristics of the aneurysms on the outcome after EVAR. Therefore, patients with aneurysms larger than 5.5 cm were selected for the study and divided into two groups according to increased rupture risk (≤ 6 cm vs > 6 cm).

Methods A total of 56 patients underwent EVAR for a fusiform infrarenal AAA between January 2010 and December 2013 at Bursa Yuksek İhtisas Education and Research Hospital and Medical Park Bursa Hospital. Upon pre-operative evaluation, coronary artery disease was detected in 18 cases (32%), previous coronary artery bypass surgery was reported in eight (14%), and peripheral artery disease was found in eight cases (14%) (Table 1). The patients, all of whom were symptomatic, were divided into two groups according to the diameter of the aneurysm, measured with abdominal CT (at its largest site): group I included patients with an aneurysm diameter of 6 cm and below, and group II included patients with an aneurysm diameter larger than 6 cm. The patient data were prospectively collected. The primary end-point criteria of the study were determined

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Table 1. Pre-operative characteristics of the patients Aneurysm ≤ 6 cm Aneurysm > 6 cm (group I) (group II) p-value Number (%) 30 (53.5) (46.5) > 0.05 Age (years) 68.5 72.1 > 0.05 Gender (M/F) 24/6 23/3 > 0.05 COPD, n (%) 16 (53) 18 (69) 0.02* Smoking, n (%) 12 (40) 15 (58) > 0.05 DM, n (%) 8 (26.6) 11 (20) > 0.05 PAD, n (%) 2 (6.6) 6 (23) 0.001* CABG, n (%) 3 (10) 5 (19) 0.02* CAD, n (%) 10 (33) 8 (30.7) > 0.05 COPD: chronic obstructive pulmonary disease, DM: diabetes mellitus, PAD: peripheral artery disease, CABG: coronary artery bypass graft, CAD: coronary artery disease. *Statistically significant.

as EVAR-related morbidity, and death of the patient. Prior to the operation, we measured maximum aneurysm diameters and neck, as well as common femoral and iliac maximal diameters in all CT axial slices. In all patients, EVAR was performed via the main femoral artery route. In 11 (20%) cases, local anaesthesia, and in 34 (60%) cases, spinal and/or epidural anaesthesia were administered. General anaesthesia was administered in 11 cases (20%). In five of these cases the surgery began under local anaesthesia and then switched to general anaesthesia. The mean age of the patients in whom aneurysm repair was performed with endovascular graft was 70.4 years (52–82); nine patients were female and 47 were male. The following types of grafts were implanted: in 31 cases Medtronic Endurant, in 19 Vascutek Anaconda, in three Trivascular Ovation, in two Gore Excluder, and in one case Lombard Aorfix (Table 2). Thirty (53.5%) patients were in group I and 26 (46.5%) were in group II. The mean aneurysm diameter of patients in general was calculated as 6.6 cm (4.5–10.5 cm). The mean aneurysm diameter in group I was 5.8 cm (4.5–6.0 cm), and in group II it was 7.8 cm (6.1–10.5 cm) (Table 2). The number of the patients on whom urgent intervention was performed due to perforated aneurysm was four (9.09%) and the success rate of treatment was 100%.

Table 2. Anatomical features of aneurysms

Graft Endurant Anaconda Ovation Excluder Aorfix Mean diameter (cm) Neck angle (°) Neck length (cm) Right iliac angle (°) Left iliac angle (°) Endoleak, n (%) Femorofemoral cross-over bypass, n (%) Ruptured aneurysm, n (%) *Statistically significant.

Aneurysm ≤ 6 cm (group I) 14 12 3 1 – 5.8 63 1.7 87 95 4 (13.3) 1 (3.3)

Aneurysm > 6 cm (group II) 17 7 – 1 1 7.79 67 1.65 95 90 7 (27) 3 (11.5)

0 (0)

4 (9.09)

p-value > 0.05 0.01* 0.001* > 0.05 > 0.05 0.001* 0.04* > 0.05 > 0.05 > 0.05 0.02* 0.02* 0.001*

Statistical analysis All data were expressed as mean and standard deviation using the SPSS 15.0 statistical program. The correlations between aneurysm diameter and mortality rate, and between neck length and endoleak were compared using logistic regression, and the other correlations were compared using the chi-squared test; p < 0.05 was accepted as significant.

Results In four cases (7%), aorta–uni-iliac EVAR was performed and an additional femorofemoral extra anatomical bypass was carried out. In all other cases the EVAR graft was placed aorta–bi-iliac. In one case, renal stent implantation was performed in the same session. In one patient, surgery was performed after the procedure to control bleeding due to iliac perforation. In eleven cases (20%) an endoleak was detected during the procedure. Type I endoleak was detected in eight cases, seven of which were resolved after balloon application, and one was fixed with an aortic extension graft. In two cases, type II endoleak was detected; in one of these cases the causative vessel was occluded and in the other the leak was accepted as insignificant and followed up. Type IV endoleak was detected in one case and it disappeared during follow up. In two cases (4.54%) renal failure was observed in the early period after EVAR. One of the patients returned to normal after a six-month period of haemodialysis, whereas the other continues life dependent on haemodialysis. The mean duration of follow up of the patients included in the study was 48 months for group I and 55 months for group II. During the long-term follow up, two graft thromboses, one graft migration, three endoleaks and one case of mesenteric ischaemia were detected. Additional intervention was required in three patients. In-hospital deaths were observed in four patients and death occurred in a total of six patients (10.7%) (Table 3). The mean EuroSCORE of all the patients was calculated as 4 (1–9), and the mean EuroSCORE of the patients who died was 7 (4–9). In the statistical analysis, which was performed using the logistic regression method, no significant correlation was found between group I and group II in terms of aneurysm diameter and mortality rate. The increase in aneurysm diameter had no effect on mortality rate (p > 0.05) (Table 4). The mortality rate of the patients who had ruptured aneurysms was not different from the patients with non-ruptured aneurysms (p = 0.4). In 11 patients (19.6%), endoleaks were detected during the procedure but no correlation was found between neck length and endoleak development (R = 0.01, p = 0.83). In patients with an observed endoleak during the procedure, even if treated, there Table 3. Results during follow up Group I Group II p-value Mean duration of follow up (months) 48 55 > 0.05 Graft thrombosis (single leg) 2 – > 0.05 Graft migration – 1 > 0.05 Endoleak 1 2 > 0.05 Mesenteric ischaemia (n) – 1 > 0.05 Additional intervention 2 1 > 0.05 Mortality, n (%)* 3 (10) 3 (11.5) > 0.05 *Total mortality rate in hospital and during the follow up.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Table 4. Effects of anatomical data on mortality rate

Mean age (years) Aneurysm diameter (cm) Neck angle (°) Neck length (cm) Right iliac angle (°) Left iliac angle (°) Endoleak, n (%) EuroSCORE * Statistically significant.

Deaths (n = 6) 72.1 6.9 66 1.5 90 92 6 (100) 7

Survivals (n = 50) 69.5 6.7 65 1.69 92 90 5 (10) 4

p-value > 0.05 > 0.05 > 0.05 > 0.05 > 0.05 > 0.05 0.001* 0.02*

was a significant correlation with mortality rate (OR = 6.6) (95% CI: 1.03–42.23).

Discussion Pre-operative diagnostic studies of EVAR patients are important. Implantation of the graft in the correct manner is directly related to the anatomy of the patient. It is known that patients with aneurysms whose neck length is longer than 1.5 cm, without a surrounding thrombus, and with limited angulation, are ideal cases for implementation of EVAR. However, with recent increased surgical experience and the improvement in graft technology, difficult cases can now also be treated with EVAR.1,5-7 It is therefore possible that, in our study, the pre-operatively measured aneurysm diameter, neck length and neck angle were not found to have an effect on mortality rate. However, the mortality rate was observed to be higher in patients with detected endoleaks, even though they were treated (p = 0.001). We know that as the aneurysm diameter increases, the risk of rupture also increases. In their study, Brown et al.2 showed that the annual rate of rupture in aneurysms was 2.2%. The female gender, COPD, smoking and hypertension were indicated as risk factors for rupture.2 In the current study, urgent EVAR was performed due to aneurysm rupture in four of 56 patients and the success rate of treatment in these patients was 100%. All of the ruptured aneurysms were in group II and the correlation between the increase in aneurysm diameter and rupture was significant (p = 0.001). In recent studies, it has been found that in all patients, not only in those with a high surgical risk, EVAR should be the firstline treatment method in the presence of suitable anatomical conditions.1-7 Brewster et al. found that the most important fatal complication in endovascular treatment was aneurysm rupture, which was seen at a rate of 1% following repair. The mortality rate was found to be the same in the surgical group one year after the procedure.5,6 In a large, randomised study in the United Kingdom, it was found that the early mortality rate was lower with EVAR; however, with long-term follow up, the mortality rate was found to be similar to that with surgical repair. Additionally, in the EVAR group, further additional interventions were required and more graft complications were observed.9 In their five-year EVAR follow up, Zarins et al. stated that small aneurysms (5 cm) responded best to treatment, and they reported the survival rate at 99%. With large aneurysms, rupture, deaths and additional surgical requirements were reported to be higher.10

AFRICA

In their study, Peppelenbosch et al. found that aneurysms with large diameters caused increased early and long-term mortality rates and risk of rupture when compared to aneurysms with intermediate and small diameters. The mortality rate increased, particularly after the fourth year.11 In our study, no correlation was found between diameter of aneurysm and mortality rate in the early to intermediate period. In the study by Schanzer et al., endoleak, advanced age, increased aneurysm neck angle (> 60°), and diameter of the main iliac artery larger than 20 mm were found to be independent risk factors for increase in aneurysm diameter following the procedure.12 However, there are no data related to the treated endoleaks at the conclusion of these studies. Tsilimparis et al. showed that long-term survival of the AAA patients whose aortic diameter was less than 60 mm was superior to the ones whose aortic diameter was more than 60 mm.13 In our study, the diameter of the aneurysm had no effect on long-term survival. The factors affecting long-term survival were identified as high EuroSCORE values and endoleak formation during the procedure, even if it had been repaired. In a single-centre retrospective review, Wisniowski et al. described age, American Society of Anesthesiologists (ASA) score, and chronic obstructive pulmonary disease as predictive factors for mortality at three years; and age, ASA score, renal failure and serum creatinine level as predictive factors for mortality after five years of follow up.14 They did not include aneurysm size as a predictive factor in their study. Similarly, Wang et al. found no significant difference in outcome of EVAR with small versus large AAA.15 There are some limitations to this research study. The first is related to the selection of stent types. We carried out this study with heterogeneous stent types in order to get initial preliminary results, avoiding bias. These results could be improved with homogenous stent types in further studies. The second limitation is related to follow-up period. Long-term data have not yet been obtained.

Conclusion As a result of our study we observed that pre-operative anatomical characteristics of the aneurysms did not increase mortality rate at a mean period of 50 months of follow up after treatment with EVAR. However, the complications that developed during and after the procedure increased the mortality rate. Moreover, we believe that early intervention would be more helpful, as confirmed rupture is more frequently seen in large aneurysms.

References 1.

Johnston KW, Rutherford RB, Tilson MD, Shah DM, Hollier L, Stanley JC. Suggested standards for reporting on arterial aneurysms. Subcommittee on reporting standards for arterial aneurysms, ad hoc committee on reporting standards, Society for Vascular Surgery and North American Chapter, International Society for Cardiovascular Surgery. J Vasc Surg 1991; 13: 452–458.

Brown LC, Powell JT. UK Small Aneurysm Trial participants. Risk factors for aneurysm -rupture in patients kept under ultrasound surveillance. Ann Surg 1999; 230: 289–297.

Craig SR, Wilson RG, Walker AJ, Murie JA. Abdominal aortic aneurysm: still missing the message. Br J Surg 1993; 80: 450–452.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Zarins CK, White RA, Moll FL, Crabtree T, Bloch DA, Hodgson KJ, et

10. Zarins CK, Crabtree T, Bloch DA, Arko FR, Ouriel K, White RA.

al. The AneuRx stent graft: four-year results and worldwide experience

Endovascular aneurysm repair at 5 years: does aneurysm diameter

2000. J Vasc Surg 2001; 33(2 Suppl): S135–45. 5.

11. Peppelenbosch N, Buth J, Harris PL, van Marrewijk C, Fransen G.

WC, Matsumura JS. Guidelines for the treatment of abdominal aortic

Diameter of abdominal aortic aneurysm and outcome of endovascu-

aneurysms. Report of a subcommittee of the Joint Council of the

laraneurysm repair: does size matter? A report from EUROSTAR. J

Surgery. J Vasc Surg 2003; 37: 1106–1117.

MH, Goldberg RJ, et al. Predictors of abdominal aortic aneurysm

Aneurysm Trial: design, methods and progress. Eur J Vasc Endovasc

sac enlargement after endovascular repair. Circulation 2011; 123(24): 2848–2855.

Zarins CK, Siami S. Lifeline registry of EVAR publications committee.

13. Tsilimparis N, Mitakidou D, Hanack U, Deussing A, Yousefi S, Rückert

Lifeline registry of endovascular aneurysm repair: long-term primary

RI. Effect of preoperative aneurysm diameter on long-term survival

outcome measures. J Vasc Surg 2005; 42: 1–10.

after endovascular aortic aneurysm repair. Vasc Endovascular Surg 2012;

Van Keulen JW, Moll FL, Arts J, Vonken EJ, van Herwaarden JA. Aortic neck angulations decrease during and after endovascular aneu-

Vasc Surg 2004; 39: 288–297. 12. Schanzer A, Greenberg RK, Hevelone N, Robinson WP, Eslami

United Kingdom Small Aneurysm Trial participants. The UK Small Surg 1995; 9: 42–48.

predict outcome? J Vasc Surg 2006; 44: 920–929.

Brewster DC, Cronenwett JL, Hallett JW Jr, Johnston KW, Krupski

American Association for Vascular Surgery and Society for Vascular 6.

46(7): 530–535. 14. Wisniowski B, Barnes M, Jenkins J, Boyne N, Kruger A, Walker PJ.

rysm repair. J Endovasc Ther 2010; 17: 594–598.

Predictors of outcome after elective endovascular abdominal aortic

United Kingdom EVAR Trial investigators, Greenhalgh RM, Brown

aneurysm repair and external validation of a risk prediction model. J

LC, Powell JT,Thompson SG, Epstein D, Sculpher MJ. Endovascular versus open repair of abdominal aortic aneurysm. N Engl J Med 2010; 362(20): 1863–1871.

Vasc Surg 2011; 54(3): 644–653. 15. Wang GJ, Carpenter JP. EVAR in small versus large aneurysms: does size influence outcome? Vasc Endovasc Surg 2009; 43(3): 244–251.

CSI 2016 Catheter interventions in congenital, structural and valvular heart disease June 22–25 | Frankfurt | Germany New programme structure CSI Frankfurt 2016, the leading conference on congenital, structural and valvular heart interventions in children and adults will take place on June 22–25, in Frankfurt, Germany. We are preparing an exciting programme for you with lectures from leading experts in the field from all over the world, handson simulation training and an industry exhibition. We always strive to improve the conference and have made some radical changes to the programme structure this year in response to attendees’ comments and feedback. Our live-case sessions showing a wide range of cases from both the adult and paediatric fields will take centre stage in our programme. However, we will also introduce ‘focus live sessions’: sessions with lectures and a live case dedicated to a particular topic. This means we will have parallel sessions with live cases: the main sessions, which will give a general overview and the focus live sessions, which are aimed at those of you who want to gain more in-depth knowledge about a particular topic. The live sessions will alternate with lecture sessions in the main hall as well as smaller symposiums, allowing us to have fewer parallel sessions at lunch time and in the evenings. We feel that this new structure will give you, the attendee, more choice about what you will learn at CSI Frankfurt and a chance to customise your learning experience.

PICS-CSI ASIA

3–5 March 2016 | Dubai | UAE Focused on practice in the Asia–Pacific region, this meeting will give a comprehensive overview of major topics in catheter therapy of congenital, structural and valvular heart disease.

CSI Frankfurt

22–25 June 2016, | Frankfurt, | Germany Our flagship conference on catheter therapy of congenital, structural and valvular heart interventions aimed at adult and paediatric interventional cardiologists, cardiothoracic surgeons, anaesthesiologists, imaging specialists and any other specialty involved in these procedures.

D-HF

2–3 December 2016 | Paris | France Heart failure is the next frontier in cardiovascular interventions. We will be discussing new approaches to treating heart failure in the context of the 2016 ESC clinical practice guidelines.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

AFRICA

Electrocardiographic abnormalities and dyslipidaemic syndrome in children with sickle cell anaemia Samuel Ademola Adegoke, John Akintunde Oladotun Okeniyi, Adeseye Abiodun Akintunde

Abstract Background: Lipid and electrocardiographic (ECG) abnormalities have been reported in adults with sickle cell anaemia (SCA) and may reflect underlying structural and/ or functional damage. However, the relationship between ECG and lipid abnormalities among children with sickle cell disease is not fully understood. Objectives: To compare the steady-state lipid and ECG abnormalities in children with SCA to the controls and examine the hypothesis that lipid abnormalities are closely related to electrocardiographic abnormalities, and therefore are a reflection of cardiac damage among these children. Methods: Clinical, laboratory and ECG profiles of 62 children with SCA and 40 age- and gender-matched haemoglobin AA controls were compared. The influence of clinical characteristics, lipids profiles, markers of haemolysis, and renal and hepatic dysfunction on ECG pattern in children with SCA was then determined. Results: The patients had lower average diastolic and mean arterial blood pressure, total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels than the controls, (p = 0.001, 0.002, 0.000 and 0.000, respectively). The mean triglyceride level was significantly higher (p < 0.001), while high-density lipoprotein cholesterol (HDL-C) levels were comparable (p = 0.858). The cases were about six times more likely to have left ventricular hypertrophy than the controls (OR = 6.4, 95% CI = 2.7–15.6, p = 0.000). Haematocrit level had a negative correlation with QTC (r = –0.3, p = 0.016) and QT intervals (r = – 0.3, p = 0.044). Triglyceride levels had a positive correlation with the PR interval (r = 0.3, p = 0.012), while serum alanine transferase (ALT) concentrations had an inverse correlation with PR interval (r = –0.3, p = 0.015). There was no statistical difference in the sociodemographic and clinical characteristics of the SCA children with or without ECG abnormalities. However, the mean triglyceride and serum ALT levels in those with ECG abnormalities were significantly higher than those without (p = 0.007 and 0.045, respectively). Conclusion: Lipid and ECG abnormalities are common in children with SCA. Elevated triglyceride and serum ALT levels are possible biochemical markers of ECG abnormalities in these patients.

Paediatric Haematology Unit, Department of Paediatrics and Child Health, Obafemi Awolowo University, Ile-Ife, Nigeria Samuel Ademola Adegoke, MB ChB, MPH, FWACP (Paed), adegoke2samade@yahoo.com

Paediatric Cardiology Unit, Department of Paediatrics and Child Health, Obafemi Awolowo University, Ile-Ife, Nigeria John Akintunde Oladotun Okeniyi, BSc, MB ChB, FWACP (Paed)

Cardiology Division, Department of Medicine, Ladoke Akintola University of Technology, Ogbomoso, Nigeria Adeseye Abiodun Akintunde, MB ChB, FWACP, FMCP

Keywords: children, dyslipidaemia, electrocardiogram, sickle cell anaemia Submitted 12/2/15, accepted 15/7/15 Published online 6/8/15 Cardiovasc J Afr 2016; 27: 16–20

www.cvja.co.za

DOI: 10.5830/CVJA-2015-059

Several specific and non-specific electrocardiographic abnormalities have been reported in adult patients with sickle cell anaemia (SCA).1-3 Left ventricular hypertrophy (LVH), the most commonly reported ECG abnormality, has a prevalence ranging from 50 to 75% among different study populations.3 Also, significant prolongation of QRS duration, PR and QTC intervals, P wave, QRS and QTC dispersions, as well as T-wave inversion in the right precordial leads have been reported among Nigerian adults with SCA.1 Apart from the underlying pathologies, these high-voltage recordings have been attributed to reduced skin fat and thin chest wall in patients with sickle cell disease.4 Dyslipidaemic syndrome, characterised by hypocholesterolaemia, hypertriglyceridaemia and reduced plasma high-density lipoprotein cholesterol (HDL-C) levels, is a known metabolic disorder in adults and children with SCA.5-7 Low total cholesterol in SCA has been linked to chronic haemolysis and/or increased erythropoesis, with a subsequent increase in cholesterol utilisation.6 Plasma lipid levels have also been reported to correlate well with biomarkers of vascular haemolysis such as haematocrit level, haemoglobin concentration and lactate dehydrogenase levels in children with SCA.8 However, the influence of dyslipidaemic syndrome on the overall severity and development of electrocardiographic (ECG) abnormalities in children with sickle cell anaemia is not fully understood. ‘Nature’ and ‘nurture’ are known to influence SCA severity and the development of complications.9 Some of these factors include the patient’s environment; genetic modifiers, especially β-globin gene haplotype and foetal haemoglobin levels; and several other haematological and biochemical markers, including serum lipids and lipoproteins. These markers, in addition to determining the severity of SCA, also help to predict the possible complications a patient with SCA may develop.9 Therefore, a search for potential biomarkers of SCA disease severity would contribute positively to overall SCA management. In addition to comparing the steady-state lipid profiles of children with SCA with suitable controls and determining the prevalence of ECG abnormalities, this study examined the hypothesis that lipids are potential biochemical markers of ECG abnormalities in sickle cell disease. To achieve this, we related the clinical, haematological and biochemical profiles, including the steady-state lipid profiles, of children with SCA with their ECG pattern.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Methods This was a cross-sectional, case–control study of the cohort of children with sickle cell anaemia attending the paediatric haematology clinic of Wesley Guild Hospital, Ilesa Unit, Obafemi Awolowo University Teaching Hospital, Ile-Ife. Cases were consecutive children with SCA (confirmed by haemoglobin electrophoresis) aged two to 15 years in steady state. The age limits were set at 15 and two years, as the older children are managed in our hospital in the adult haematology clinic, and those younger than two would not be old enough to cooperate during electrocardiography. Steady state was defined as a period without any acute event such as pain, fever, infection or severe anaemia, and no transfusion in the four weeks preceding recruitment.10 Controls were age- and gender-matched apparently healthy haemoglobin AA children who attended the children’s welfare clinic of the hospital for pre-school-entry medical tests. Children with SCA on hydroxyurea, or those with known congenital or acquired heart disease, as well as controls with any acute illness in the previous two weeks were not incuded in the study. Also, none of the subjects were on medications known to prolong QTC interval, such as halofantrine and anti-histamine. Parents of all participants agreed to and signed written, informed consents before commencing the study. Data on sociodemographic characteristics (age, gender, socioeconomic class) and age at diagnosis were obtained by structured questionnaires. Socio-economic class was determined using the occupation of the father and the highest academic qualification of the mother, as described by Olusanya et al.11 Severity of SCD was assessed using frequency of significant painful episodes, blood transfusions and SCD-related hospitalisation in the previous 12 months, and history of complications. The children’s weights (kg) were measured using the SECA® electronic scale with an accuracy of 0.1 kg, with subjects standing upright, barefoot and wearing only light clothing. Heights (cm) were measured with a fixed stadiometer, Spirit Height®, with the children standing erect and barefoot. From the measured values of weight and height, the body mass index (BMI) was calculated (kg/m2).12 Liver and splenic enlargement were assessed clinically and documented as size (cm), palpable from the corresponding costal margins, vertically along the mid-clavicular line, using an inelastic tape measure.13 Blood pressures (BP) were taken supine using the Accuson® mercurial sphygmomanometer. The average of two readings was documented in mmHg. The systolic BP corresponded to the first Korotkoff sound while the diastolic BP corresponded to the fifth Korotkoff sound.14 The lipid profiles were determined using CardioMetabolic® Profile 1 test kits to obtain total cholesterol (TC), HDL-C and triglyceride (TG) levels. Low-density lipoprotein cholesterol (LDL-C) levels were calculated using the Friedwald equation.15 Haematocrit, platelet and total leucocyte counts, serum bilirubin, creatinine levels, total protein, albumin, aspartate transferase (AST), alanine transferase (ALT) and alkaline phosphatase assays were done for the cases using standard methods. All the participants were evaluated with 12-lead electrocardiography, which was performed using the Biocare® IE-12A model digital electrocardiography machine at a paper speed of 25 mm/s and standardised at 0.1 mV/mm. One of the authors (JAOO) performed and analysed all electrocardiograms.

Measurements of the heart rate, cardiac axis, PR interval, QRS duration and QTC interval were done in the standard fashion, as previously described.16,17 Electrocardiographic reference values for Nigerian children were used as cut-off values for the duration of electrocardiographic deflections and intervals.17 Sokolow and Lyon voltage criteria was used to determine LVH on ECG.18

Statistical analysis The clinical, laboratory and ECG profiles of cases and controls were summarised and presented as proportions and percentages for categorical data and means ± standard deviation (SD), and median and range for continuous data. Categorical variables were compared using the chi-squared or Fisher’s exact tests, while metric data were compared with the independent samples t-test, analysis of variance (ANOVA) or Pearson/Spearman correlation test as indicated; p-values < 0.05 were taken as statistically significant.

Results A total of 102 children, comprising 62 homozygous SS cases and 40 age- and gender-matched haemoglobin AA controls, were recruited for this study. The overall male:female ratio was 1.4:1. Their ages ranged from two to 15 years, with a mean ± SD of 7.76 ± 3.66 years. The sociodemographic characteristics and anthropometric measurements of the cases and controls were similar (Table 1). However, the cases had lower mean diastolic blood pressure and mean arterial pressure than the controls (p < 0.05) (Table 2). While the mean total cholesterol and LDL-C levels were significantly lower among the cases than the controls, the mean triglyceride level was significantly higher among the cases (p < 0.001). The mean HDL-C value was however comparable between the two groups (p = 0.858). Total cholesterol:HDL-C ratio was also lower among the cases (p = 0.029) (Table 1). Table 2 shows the comparison of age-dependent ECG indices between the cases and controls. The mean ECG-generated heart rate (HR), PR interval, QRS duration and corrected QT interval were higher among children with SCA than the controls (p < 0.05). The average RV5 voltage and combined RV5 and SV1 voltages were also higher among the cases (p < 0.05), however, the mean QRS axis was lower, while the mean QT intervals were comparable between the two groups. ECG abnormalities: left ventricular hypertrophy (71.0 vs 27.5%), first-degree atrio-ventricular block (19.4 vs 0%) and T-wave abnormalities consistent with lateral ischaemia (12.9 vs 0%) were significantly more prevalent among cases than controls (p = 0.000, 0.008 and 0.021, respectively). Also, children with SCA were about six times more likely to have LVH than ageand gender-matched haemoglobin AA children (OR = 6.4, 95% CI = 2.7–15.6). None of the study participants had left atrial enlargement or T-wave inversion. There was no statistical difference in the frequency of occurrence of tall T-wave abnormalities, sinus rhythm with ventricular premature complex, right atrial enlargement, right or biventricular hypertrophy, ST depression and conduction anormalies, such as right ventricular conduction delay and non-specific intraventricular conduction block between the two groups. On the other hand, abnormal left-axis deviation

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Table 1. Baseline characteristics of the cases and controls Cases Controls Baseline characteristics (n = 62) (n = 40) p-value 95% CI Male gender 39 (62.9) 21 (52.5) 0.297 0.7–3.4 0.974 1.4–1.5 Age (years), mean ± SD 7.77 ± 3.87 7.75 ± 3.35 Median age (range) 7.0 (2–16) 8.0 (2–14) Age 2–5 years, n (%) 18 (29.0) 13 (32.5) Age 6–10 years, n (%) 31 (50.0) 18 (45.0) 0.883 NA 13 (21.0) 9 (22.5) Age > 10 years, n (%) Upper class, n (%) 18 (29.0) 16 (40.0) Middle class, n (%) 19 (30.6) 11 (27.5) 0.507 NA Lower class, n (%) 25 (40.3) 13 (32.5) Weight (kg), mean ± SD 22.90 ± 7.76 26.36 ± 10.85 0.084 –7.4–0.5 0.313 –0.1–0.04 Height (m), mean ± SD 1.21 ± 0.20 1.26 ± 0.21 Pulse pressure (mmHg) 0.191 –1.6–1.3 35.97 ± 8.68 30.75 ± 7.56 Total cholesterol (mmol/l) 2.60 ± 0.42 0.000 0.3–0.8 3.11 ± 0.41 HDL-C (mmol/l) 0.858 0.1–0.6 0.96 ± 0.36 0.95 ± 0.35 Triglycerides (mmol/l) 0.000 1.4–1.9 1.59 ± 0.62 0.99 ± 0.45 LDL-C (mmol/l) 0.000 0.2–0.6 1.27 ± 0.60 1.69 ± 0.48 Total cholesterol:HDL-C 3.11 ± 1.44 0.029 1.3–1.7 3.80 ± 1.60 HDL-C = high-density lipoprotein cholesterol; LDL-C = low-density lipoprotein cholesterol; CI = confidence interval; NA = not applicable.

and ST-segment elevation were non-significantly less prevalent among children with SCA compared to the controls (Table 3). In all, only 13 (21.0%) of the cases against 22 (55.0%) of the controls had no identifiable ECG abnormalities (p = 0.000, OR = 4.6, 95% CI = 1.9–10.9). Those with identifiable abnormalities included about half; 30 (48.4%) with multiple abnormal ECG features and 19 (30.6%) with single abnormal ECG reports. There was no significant correlation between some ECG durations (heart rate, PR, QRS, QTC and QT intervals) and frequency of significant pain episodes, SCD-related hospitalisation or transfusion in the 12 months preceeding the study (p > 0.05) in each occasion. Haematocrit level had a negative correlation with QTC interval (r = –0.3, p = 0.016) and QT intervals (r = –0.3, p = 0.044). While liver enzyme AST levels had a moderate positive correlation with heart rate (r = 0.5, p = 0.025), ALT levels had a negative correlation with heart rate (r = –0.3, p = 0.000) and

AFRICA

Table 3. Prevalence of ECG abnormalities among children with SCA and age- and gender-matched haemoglobin AA controls Cases Controls Odds ratio ECG abnormalities n (%) n (%) p-value (95% CI) Sinus arrhythmia 5 (8.1) 4 (10.0) 0.737 0.8 (0.2–3.1) Sinus rhythm with ventricular 1 (1.6) 0 (0) 1.000 2.0 (0.1–47.9) premature complex Right atrial enlargement 3 (4.8) 0 (0) 0.417 1.7 (1.4–2.0) Left ventricular hypertrophy 44 (71.0) 11 (27.5) 0.000 6.4 (2.7–15.6) Right ventricular hypertrophy 5 (8.1) 1 (2.5) 0.462 3.4 (0.4–30.4) Biventricular hypertrophy 3 (4.8) 0 (0) 0.158 1.7 (1.4–2.0) ST-segment elevation 3 (4.8) 3 (7.5) 0.899 0.6 (0.1–3.2) ST depression 4 (6.5) 0 (0) 0.264 1.7 (1.4–2.0) Tall T-wave anomaly 1 (1.6) 0 (0) 1.000 1.9 (0.1–47.9) T-wave abnormality consistent 8 (12.9) 0 (0) 0.021 12.6 (1.7–21.7) with lateral ischaemia Non-specific T-wave 4 (6.5) 1 (2.5) 0.646 2.7 (0.3–24.3) abnormalities Right ventricular conduction 1 (1.6) 0 (0) 1.000 2.0 (0.1–47.9) delay Non-specific intraventricular 2 (3.2) 0 (0) 0.519 3.4 (0.2–69.1) conduction block Abnormal left-axis deviation 1 (1.6) 2 (5.0) 0.559 0.3 (0.1–3.5) First-degree atrio-ventricular 12 (19.4) 0 (0) 0.008 1.8 (1.5–2.2) block Presence of at least one 49 (79.0) 18 (45.0) 0.000 4.6 (1.9–10.9) abnormality on ECG findings

PR interval (r = –0.3, p = 0.015). Albumin values were positively correlated with QRS interval (r = 0.5, p = 0.013), and triglyceride levels positively correlated with PR interval (r = 0.3, p = 0.012). Leucocyte and platelet counts, serum total, direct and indirect bilirubin, alkaline phosphatase, total protein, total cholesterol, HDL-C and LDL-C levels had no significant correlation with heart rate, PR, QRS, QT and QTC intervals in children with SCA. There were no significant statistical differences in the sociodemographic and clinical characteristics of SCA children with or without ECG abnormalities (Table 4). However, the mean values of triglycerides and serum ALT of SCA children with ECG abnormalities were significantly higher than those with normal ECG patterns (p = 0.007 and 0.045, respectively) (Table 5).

Table 2. Comparison of age-dependent mean electrocardiographic indices and blood pressure parameters between cases and controls 2–5 years 6–10 years ECG and BP parameters Cases mean (SD) Controls mean (SD) Cases mean (SD) Controls mean (SD) HR (beats/min) 109.8 (9.0) 95.6 (13.1)b 95.0 (9.6) 90.4 (1.0)b PR interval (ms) 141.1 (8.1) 135.9 (1.2)b 156.4 (19.3) 142.7 (14.8)b QRS interval (ms) 77.2 (8.6) 72.1 (0.4)b 86.4 (16.9) 75.2 (5.9)b QT interval (ms) 333.2 (16.7) 334.4 (28.2)a 355.5 (18.9) 345.2 (20.5)a QTC interval (ms) 449.6 (13.4) 421.9 (32.5)b 445.4 (16.6) 415.4 (20.3)b P axis (°) 42.8 (12.3) 42.4 (19.4)a 34.2 (18.9) 41.4 (11.7)a QRS axis (°) 43.8 (17.3) 58.0 (22.1)a 38.8 (21.6) 54.7 (20.0)b T axis (°) 41.2 (13.4) 43.1 (16.7)a 38.9 (17.8) 47.7 (11.7)a RV5 voltage (mV) 3.1 (1.0) 2.1 (0.9)b 3.8 (0.8) 2.5 (0.6)b SV1 voltage (mV) 1.7 (0.7) 1.9 (0.6)a 1.8 (0.6) 1.4 (0.8)a RV5 + SV1 voltage (mV) 4.8 (1.3) 4.0 (0.2)b 5.6 (0.8) 3.9 (0.9)b SBP (mmHg) 76.4 (11.0) 82.3 (12.2)a 89.0 (10.0) 83.3 (13.5)a b DBP (mmHg) 43.6 (9.0) 54.2 (7.3) 46.3 (8.7) 55.8 (8.9)b MAP (mmHg) 54.5 (8.9) 63.6 (8.6)b 60.5 (0.3) 65.0 (1.9)b SBP = systolic blood pressure; DBP = diastolic blood pressure; MAP = mean arterial pressure; a No significant difference between cases and controls (p > 0.05); b Significant difference between cases and controls (p < 0.05).

11–15 years Cases mean (SD) Controls mean (SD) 85.4 (1.5) 80.1 (5.1)b 161.7 (30.9) 136.9 (15.7)b 89.5 (3.5) 81.9 (8.7)b 376.5 (31.2) 360.3 (13.5)a 451.9 (23.4) 415.7 (14.5)b 39.5 (22.0) 41.6 (13.2)a 47.9 (14.5) 53.3 (24.9)a 54.8 (50.5) 42.3 (16.5)a 3.7 (0.9) 2.8 (0.4)b 1.7 (0.4) 1.4 (0.3)a 5.4 (1.1) 3.9 (1.4)b 94.6 (9.9) 95.0 (7.1)a 52.6 (7.9) 60.0 (7.1)b 66.6 (1.7) 71.7 (6.7)b

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Table 5. Comparison of the baseline laboratory profiles of SCA children with and without ECG abnormalities

Table 4. Comparison of the sociodemographic and baseline clinical characteristics of SCA children with ECG abnormalities and those without abnormalities

Characteristics Number Males, n (%) Females, n (%) Mean age

Normal ECG pattern 13 9 (69.2) 4 (30.8) 7.2 ± 4.3 6 (46.2) 4 (30.8) 3 (23.1) 2 (15.4) 5 (38.5) 6 (46.2) 6 (46.2) 1 (7.7)

Multiple Single ECG ECG abnormality abnormalities p-value* 19 30 11 (57.9) 19 (63.3) 0.806 8 (42.1) 11 (36.7) 0.807 7.8 ± 3.9 8.0 ± 3.8 5 (26.3) 11 (57.9) 3 (15.8) 9 (47.4) 6 (31.6) 4 (21.1) 9 (47.4) 3 (15.8)

7 (23.3) 16 (53.3) 7 (23.3) 7 (23.3) 8 (26.7) 15 (50.0) 14 (46.7) 2 (6.7)

Age 2–5 years, n (%) Age 6–10 years, n (%) Age > 10 years, n (%) Upper class, n (%) Middle class, n (%) Lower class, n (%) ≥ 3 pain/12 months, n (%) ACS, n (%) SBP (mmHg)

84.7 ± 8.5 88.7 ± 12.1 86.0 ± 13.7

0.998 0.576 0.623

DBP (mmHg)

49.6 ± 8.5 54.2 ± 10.6 48.7 ± 9.4

0.141

MAP (mmHg)

61.3 ± 7.7 65.7 ± 10.4 61.1 ± 10.1

0.247

Pulse pressure (mmHg)

35.0 ± 7.6 34.5 ± 8.3

37.3 ± 9.4

0.487

Weight (kg)

22.4 ± 8.8 24.0 ± 7.7

22.4 ± 7.6

0.774

Height (m)

1.18 ± 0.20 1.24 ± 0.22 1.21 ± 0.20

0.509

0.165

0.774

*p-values when the three groups were compared; SBP = systolic blood pressure; DBP = diastolic blood pressure; MAP = mean arterial pressure; ACS = acute chest syndrome.

Discussion This study examined the ECG abnormalities and lipid profiles of children with SCA. These children had higher levels of triglycerides and lower levels of total cholesterol and LDL-C when compared to suitable age- and gender-matched controls. In addition to higher prevalence of LVH, they also had longer PR intervals, QRS duration, heart rate and corrected QT interval, with the majority (79%) having at least one identifiable ECG abnormality. Although these findings are not entirely novel for adults with SCA, the demonstration of a positive correlation between triglyceride level and PR interval, as well as higher mean triglyceride levels among SCA children with ECG abnormalities, have not been reported in children. Our finding also supports suggestions that (1) SCA children are at increased risk of developing cardiac abnormalities and, (2) specific dyslipidaemic syndrome, especially elevated levels of triglycerides, is a potential biochemical marker of ECG abnormalities in SCA. As described by Kato et al.,19 progressive haemolysis-induced vasculopathy, one of the two major subphenotypes associated with clinical and laboratory manifestations of SCA, has been linked to endothelial dysfunction and the subsequent development of reticulocytosis, leg ulcers, priapism, stroke, elevated pulmonary arterial pressure and cardiac abnormalities in sickle cell disease. The prevalence of ECG abnormalities in children with SCA in this study was 79%. This is comparable to some reported rates among adult Nigerians with SCA.20,21 Also, the finding of LVH as the ECG abnormality seen in 71% of SCA children is similar to many previous local reports.20,21 It has also beeen documented previously that Nigerian children with SCA have higher rates of arrhythmias than their counterparts without SCA.22 Abnormal loading conditions associated with chronic anaemia lead to chamber dilatation and myocardial remodelling, which progress to ventricular dysfunction.23 However, other factors such as

Characteristics Number Haematocrit (%)

Normal ECG pattern 13

Single ECG abnor- Multiple ECG mality abnormalities p-value* 19 30 0.263 24.4 ± 3.0 23.5 ± 3.8

25.5 ± 4.2 Leucocyte count (× 103/mm3) 9.27 ± 5.22 9.70 ± 3.69 Platelet count (× 105/ mm3) 2.24 ± 0.89 2.33 ± 1.09 Total bilirubin (µmol/l) 32.0 ± 15.3 50.5 ± 16.2 Direct bilirubin (µmol/l) Indirect bilirubin (µmol/l)

8.6 ± 4.5

6.9 ± 2.2

23.4 ± 11.7 43.6 ± 14.7

9.78 ± 6.24

0.964

2.02 ± 0.39

0.710

60.5 ± 67.1

0.545

16.1 ± 25.4

0.500

44.4 ± 42.7

0.421

Creatinine (mmol/l)

62.6 ± 17.7 66.8 ± 21.3

62.7 ± 21.8

0.858

AST (IU/l)

20.3 ± 17.3 23.8 ± 17.2

22.9 ± 14.6

0.938

ALT (IU/l) Alkaline phosphatase Total protein (g/dl)

0.045 5.0 ± 4.8 10.9 ± 7.1 17.3 ± 9.2 209.7 ± 7.0 236.0 ± 123.8 191.7 ± 131.1 0.815 0.472 66.8 ± 8.0 69.8 ± 10.6 73.4 ± 8.7

Albumin (g/dl)

31.8 ± 2.9

Total cholesterol (mmol/l)

2.62 ± 0.49 2.52 ± 0.30

36.5 ± 3.1

37.3 ± 8.7

0.334

2.64 ± 0.46

0.639

HDL-C (mmol/l)

0.94 ± 0.40 1.03 ± 0.35

0.93 ± 0.36

0.665

Triglyceride (mmol/l)

0.74 ± 0.28 0.76 ± 0.25

1.24 ± 0.78

0.007

LDL-C (mmol/l)

1.33 ± 0.41 1.24 ± 0.69

1.27 ± 0.63

0.914

Cholesterol:HDL-C ratio

3.40 ± 1.74 2.78 ± 1.44

3.18 ± 1.31

0.461

*p-values by ANOVA to compare means of the three groups; ALT = alanine transferase; AST = aspartate transferase; HDL-C = high-density lipoprotein cholesterol; LDL-C = low-density lipoprotein cholesterol.

genetic variations or polymorphisms are also thought to be involved in the dimensional and functional differences seen in LV dysfunction in SCA.23 The findings of T-wave abnormality consistent with lateral ischaemia in children with SCA (12.9 vs 0%, p = 0.021) have not been reported previously. This study also demonstrated that PR interval was significantly prolonged, and mean QTC interval was significantly longer in patients with SCA than in the controls. These are consistent with findings by Adebayo et al., Bode-Thomas et al. and Oguanobi et al.1,2,21 The prolongation of QTC interval, which implies abnormal repolarisation, can be explained by the fact that patients with SCA experience recurrent microscopic infarctions of the myocardium, especially with repeated vaso-occlusion.24 Bode-Thomas and co-workers have demonstrated that ECG changes consistent with myocardial ischaemia are common in children with SCA, especially during episodes of severe vasoocclusive crises, acute chest syndrome, and in those with elevated pulmonary arterial pressure.25,26 This may actually predispose them to increased risk of cardiovascular mortality from cardiac arrhythmias. Areas of micro-infarction are potential arrhthmogenic sites with the possibility of generating malignant arrhythmias such as ventricular and atrial tachyarrhthmias. In this study, haematocrit levels had a negative correlation with both QT and QTC intervals in children with SCA. Prolonged and shortened QTC on ECG are both known risk factors for sudden cardiac death.27,28 Although, the exact mechanism of prolonged QTC interval in sudden cardiac deaths in individuals with SCA is largely unknown, it is speculated that chronic anaemia and associated sub-acute cardiac ischaemia may be associated with ventricular repolarisation defects, which ultimately prolong QTC intervals.28 Specific dyslipidaemic subphenotype, especially elevated triglyceride levels, in addition to having a positive correlation with

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

PR interval, was significantly higher among SCA children with ECG abnormalities in this study. Studies have shown that elevated triglyceride levels independently predicted the development of coronary artery disease and myocardial infarction.23 Also, it was reported recently that an elevated level of triglycerides, which is already known to be linked with endothelial dysfunction, is an independent predictor of pulmonary hypertesion in patients with SCA.29 Raised triglyceride levels is an important cardiovascular risk factor for atherogenesis, as other abnormalities of the lipid profile are much more likely and are a readily available complement to atheromatous plaque formation and progression. Our study was limited by the small sample size, which may have affected proper data interpretation and the overall generalisability of the findings. Also, fasting samples for lipid estimations were not taken. However, non-fasting lipid levels have been significantly correlated with fasting triglyceride levels, and there is new evidence to show that triglyceride levels measured in the fasting or non-fasting state are important in determining the prognosis of cardiovascular diseases.

AFRICA

11. Olusanya O, Okpere E, Ezimokhai M. The importance of social class in voluntary fertility control in a developing country. West Afr J Med 1985; 4: 205–212. 12. Robinson TN, Dietz WH. Weight Gain: Overeating to Obesity. In: Rudolph CD, Rudolph AM, eds. Rudolph’s Paediatrics, 21st edn. New York: McGraw-Hill Medical, 2003: 476–481. 13. Swash M. The gastrointestinal system. In: Glynn M, Drake W, eds. Hutchison’s Clinical Methods: An Integrated Approach to Clinical Practice, 23rd edn. New York: Elsevier, 2012: 166–173. 14. Falkner B, Daniels SR. Summary of the fourth report on the diagnosis, evaluation, and treatment of high blood pressure in children and adolescents. AHA Hypertens 2004; 44: 387–388. 15. Frieldwald WT, Levy RI, Fredricson DS. Estimation of the concentration of low density lipoprotein cholesterol in plasma without use of prepreparative ultra centrifuge. Clin Chem 1972; 18: 499–502. PMID: 4337382. 16. Oguanobi NI, Ejim EC, Anisiuba BC, Onwubere BJC, Ike SO, Ibegbulam OG, et al. Clinical and electrocardiographic evaluation of sickle-sell anaemia patients with pulmonary hypertension. ISRN Hematol 2012; Art ID 768718, 6 pages. doi: 10.5402/2012/768718. 17. Kolawole AJ, Omokhodion SI. Normal limits for pediatric electrocardiogram in Ilorin, Nigeria. Nig J Cardiol 2014; 11: 112–123. DOI:

Conclusion This study showed that lipid and electrocardiographic abnormalities were common among the children with SCA attending the paediatric out-patient clinic of WGH, Ilesa, and they were closely related to the cardiovascular risk of these patients.

10.4103/0189-7969.142103. 18. Sokolow M, Lyon TP. The ventricular complex in left ventricular hypertrophy as obtained by unipolar leads. Am Heart J 1949; 37: 161–186. PMID: 18107386. 19. Kato GJ, Gladwin MT, Steinberg MH. Deconstructing sickle cell disease: reappraisal of the role of hemolysis in the development of clinical subphenotypes. Blood Rev 2007; 21: 37–47. PMID: 7084951

References 1.

PMC2048670. 20. Uzsoy NK. Cardiovascular findings in patients with sickle cell anaemia. Am J Cardiol 1964; 13: 320–328. PMID: 14128641.

Adebayo RA, Balogun MO, Akinola NO, Akintomide NO. The clinical, electrocardiographic and self-paced walking exercise features of

21. Oguanobi NI, Onwubere BJC, Ike SO, Anisiuba BC, Ejim EC,

Nigerians with sickle cell anaemia at OAUTHC, Ile-Ife. Nig J Med 2002;

Ibegbulam OG. Electrocardiographic findings in adult Nigerians with

11: 170–176. PMID: 12955994.

sickle cell anaemia. Afr Health Sci 2010; 10(3): 235–241. PMCID: PMC3035954.

Bode-Thomas F, Ogunkunle OO, Omotoso AB. The QT interval in Nigerian children with sickle cell anaemia. Trop Cardiol 2003; 29(113):

22. Bode-Thomas F, Ogunkunle OO, Omotoso ABO. Cardiac arrhythmias in children with sickle cell anaemia. Nig J Paediatr 2003; 30(1): 13–17.

9–12. 3.

Odia OJ. Electrocardiographic observations in patients with sickle cell

23. Voskaridou E, Christoulas D, Terpos E. Sickle cell disease and the heart: review of the current literatures. Br J Hematol 2012; 157(6): 664–673.

diseases. Trop Cardiol 1990; 16: 135–138. 4. 5.

doi: 10.1111/j.1365-2141.2012.09143.x

Araoye MA. Left ventricular hypertrophy by electrocardiography: A code system applicable to Negroes. Nig Postgrad Med J 1996; 3: 92–97.

24. Adegoke OA, Adegoke SA, Okeniyi JAO, Smith OO. Serum cardiac

Zorca S, Freeman L, Hildesheim M, Allen D, Remaley AT, Taylor JG, et

troponin T (cTnT) in Nigerian children with sickle cell anaemia: an

al. Lipid levels in sickle-cell disease associated with haemolytic severity,

index of myocardial injury? Int J Med Medical Sci 2013; 3(2): 376–380.

vascular dysfunction and pulmonary hypertension. Br J Haematol 2010;

25. Bode-Thomas F, Hyacinth HI, Ogunkunle O, Omotoso A.

149: 436–445. doi: 10.1111/j.1365-2141.2010.08109.x.

Myocardial ischaemia in sickle cell anaemia: evaluation using a

Van der Jagt DJ, Shores J, Okorodudu A, Okolo SN, Glew RH.

new scoring system. Ann Trop Paediatr 2011; 31(1): 67–74. doi: 10.1179/1465328110Y.0000000006.

Hypocholesterolemia in Nigerian children with sickle cell disease. J Trop Pediatr 2002; 48: 156–161. PMID: 12164599. 7.

26. Liem RI, Young LT, Thompson AA. Prolonged QTc interval in children and young adults with sickle cell disease at steady state. Pediatr Blood

Shores J, Peterson J, van der Jagt D, Gless RH. Reduced cholesterol

Cancer 2009; 52(7): 842–846. doi: 10.1002/pbc.21973.

levels in African-American adults with sickle cell disease. J Natl Med Assoc 2003; 95: 813–817. PMID: 14527048. PMC2594470. 8.

Seixas MO, Rocha LC, Carvalho MB, et al. Levels of high-density lipoprotein cholesterol (HDL-C) among children with steady-state sickle cell disease. Lipids Health Dis 2010; 9: 91. doi:10.1186/1476-511X-9-91. PMCID: PMC2940866.

Stuart MJ, Nagel RL. Sickle cell disease. Lancet 2004; 364: 1343–1360. doi: 10.1016/S0140-6736(04)17192-4.

27.

Berul CI. Congenital long-QT syndromes: who’s at risk for sudden cardiac death? Circulation 2008; 117: 2178–2180. doi: 10.1161/ CIRCULATIONAHA.108.772053.

28. Kolo PM, Sanya EO, Olanrewaju TO, Fawibe AE, Soladoye A. Cardiac autonomic dysfunction in sickle cell anaemia and its correlation with QT parameters. Nig Med J 2013; 54(6): 382–385. 29. Akinlade KS, Adewale CO, Rahamon SK, Fasola FA, Olaniyi JA,

10. Ballas S.K, Lieff S, Benjamin L.J, Dampier C.D, Heeney M.M, Hoppe

Atere AD. Defective lipid metabolism in sickle cell anaemia subjects in

C, et al. Definitions of the phenotypic manifestations of sickle cell

vaso-occlusive crisis. Nig Med J 2014; 55: 428–431. doi: 10.4103/0300-

disease. Am J Hematol 2010; 85: 6–13. doi: 10.1002/ajh.21550.

1652.140388.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Combined effects of FTO rs9939609 and MC4R rs17782313 on elevated nocturnal blood pressure in the Chinese Han population Yanlei Sun, Jiazhong Sun, Jun Wu, Mei Yang

Abstract Aim: In this study we investigated the association of FTO rs9939609 and MC4R rs17782313 with elevated blood pressure in the Chinese Han population, and analysed the relationship between the rs9939609 and rs17782313 variants. Methods: We tested the rs9939609 and rs17782313 variants with the sequence-retrieval method. Results: The increase in odds ratios of the A allele of rs9939609 and the C allele of rs17782313 for nocturnal blood pressure were 1.37 and 1.69. The nocturnal blood pressure of participants simultaneously carrying the A and C alleles was significantly higher than the blood pressure of those carrying neither FTO nor MC4R risk alleles (p < 0.05), and that of the controls carrying only the A or C alleles (p < 0.05). No association between the FTO or MC4R genes with daytime hypertension was found in this Chinese population (p > 0.05). Conclusion: Our data suggest that the rs9939609 and rs17782313 variants may be significantly associated with nocturnal but not daytime blood pressure levels and their combined effects were significant in this Chinese Han population. Keywords: gene polymorphism, daytime blood pressure, nocturnal blood pressure, Chinese Han population Submitted 6/9/14, accepted 11/8/15 Published online 31/8/15 Cardiovasc J Afr 2016; 27: 21–24

www.cvja.co.za

DOI: 10.5830/CVJA-2015-064

Elevated blood pressure increases the risk of experiencing cardiovascular events such as myocardial infarction and stroke. Current observational data suggest that body mass index (BMI) may have a causal role in the aetiology of hypertension, but this may be influenced by confounding and reverse causation.1 Genetic factors play an important role in the development of hypertension. Recent studies have revealed a strong association

between common variants in introductory studies on the FTO gene and obesity in children and adults.2-4 Frayling and co-workers found that each rs9939609 allele (chr16:52,378,028; dbSNP build 129) increased body weight by 1.2 kg in the general adult population and conferred a 31% higher risk of developing obesity.5 FTO protein is a key link between the central nervous system and energy balance. It was found to be ubiquitously expressed in the hypothalamus and is thought to mediate this effect through its influence on energy homeostasis. The hypothalamus, however, also regulates blood pressure.6 Masked (nocturnal) hypertension is common in patients with type 2 diabetes mellitus.6 Masked hypertension (normal blood pressure in the clinic but elevated levels when measured outside the clinic) is associated with an increased risk of cardiovascular disease. Therefore, we investigated whether the FTO risk variant may not be associated only with obesity and BMI, but also with elevated nocturnal blood pressure. The MC4R gene, encoding for the melanocortin 4 receptor, was the first locus at which mutations were associated with dominantly inherited morbid human obesity, and was the commonest genetic cause of human obesity.7 The rs17782313 C allele (chr18:56,002,077; dbSNP build 129), located 188 kb downstream of MC4R, was similarly associated with obesity [OR = 1.30 (1.20–1.41)] in populations of European origin.8 Cardiovascular risk factors such as type 2 diabetes mellitus,9,10 insulin resistance,11 and hypertension12 were associated with the risk allele A for FTO rs9939609 and the risk allele C for MC4R rs17782313, regardless of BMI.9,10 In Marcadenti and colleagues’ study, however, common genetic variants of FTO rs9939609 had a positive association with BMI and neck circumference, and MC4R rs17782313 in women, but a negative association with diastolic and mean blood pressure in hypertensive men in southern Brazil.13 In the present study, we investigated the association of FTO and MC4R gene polymorphisms with hypertension in the Chinese Han population and analysed the relationship between FTO rs9939609 and MC4R rs17782313 variants.

Methods Department of Endocrinology, the Third Hospital of Wuhan, Wuhan, China, 430060 Yanlei Sun, PhD, syleilei2008@qq.com Jun Wu, PhD

Department of Endocrinology, Zhongnan Hospital, Wuhan University, Wuhan, China, 430071 Jiazhong Sun, MD Mei Yang, PhD

The subjects were divided into two groups comprising a daytime hypertension group (575 patients) and a night-time hypertension group (583 patients). The number of control subjects was 1 200. We recruited by physical examination 2 358 non-related individuals, aged 50 to 70 years (1 175 men and 1 183 women), who all belong to the Han nationality from the Hubei province of China. The study was carried out in the examination centre at the ZhongNan Hospital of Wuhan University. Daytime

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

normotension was defined as daytime blood pressure < 135/85 mmHg.6 Night-time was defined as the time from when the patient went to bed until when the patient got out of bed the following morning. Nocturnal normotension was defined as night-time blood pressure < 120/70 mmHg.6 The individuals were selected for the daytime and nocturnal hypertension groups on the basis of having blood pressure levels ≥ 135/85 mmHg or ≥ 120/70 mmHg, respectively. The control group of 1 200 subjects had normal clinical and biochemical characteristics. A selection criterion was that these subjects were not on any hypotensive drugs or had stopped taking the drugs a week earlier. Additional selection criteria were the absence of (1) secondary hypertension, (2) diastolic blood pressure (DBP) 110 mmHg on blood pressure-lowering medication, (3) gross obesity (BMI > 35 kg/m2), (4) diabetes mellitus, (5) renal dysfunction (serum creatinine > 180 mmol/l), (6) liver disease, (7) severe physical or mental disease (for example, malignancy, terminal cancer or dementia), (8) pregnancy, and (9) substance abuse, including alcohol. Clinic normotension was defined as blood pressure < 130/80 mmHg with or without blood pressure-lowering medications. Clinic-measured blood pressure (clinic BP) was the average of three seated measurements taken one minute apart by specially trained nurses. Ambulatory BP measurement devices (Spacelab 90217, Spacelabs and Redmond, WA, USA) were set to measure the BP at 20-minute intervals for 24 hours. Each subject donated 5 ml of blood for genomic DNA extraction. For genotyping procedures in our study, refer to a previous report.14 The polymerase chain reaction (PCR) was performed on an automated DNA thermal cycler (Beijing Institute of Technology, China) with the primers of FTO rs9939609 (FP:5′-

Table 1. Characteristics of the study sample

Parameters

Daytime hypertension (n = 575)

Nocturnal hypertension (n = 583)

Age (years)

56.9 ± 12.8

57.70±13.7

56.7 ± 8.7

Clinic SBP (mmHg)

159.5 ± 4.5

130.9±4.4

126.8 ± 4.3

Controls (n = 1200)

Clinic DBP (mmHg)

93.8 ± 4.3

85.7 ± 4.6

77.9 ± 4.8

Nocturnal SBP (mmHg)

109.3 ± 9.8

130.4 ± 9.2

100.8 ± 6.5

Nocturnal DBP (mmHg)

61.7 ± 7.6

79.5 ± 7.5

59.5 ± 7.5

Daytime SBP (mmHg)

155.7 ± 5.0

129.1 ± 5.7

120.2 ± 6.4

Daytime DBP (mmHg)

96.9 ± 6.6

81.5 ± 4.2

75.6 ± 6.1

0.68 (0.52–0.75)

0.72 (0.67–0.80)

0.57 (0.49–0.65)

TC (mmol/l)

4.31 ± 1.20

4.32 ± 1.61

4.13 ± 1.65

TG (mmol/l)

2.15 ± 1.37

2.18 ± 1.51

2.20 ± 1.58

LDL cholesterol (mmol/l)

3.05 ± 1.98

3.03 ± 1.96

2.92 ± 1.93

hs-CRP (mg/l)

SBP: systolic blood pressure, DBP: diastolic blood pressure, hs-CRP: highsensitivity C-reactive protein, TC: total cholesterol, TG: triglycerides, LDL: low-density lipoprotein. Data are means ± SD, median (interquartile range) or percentages unless otherwise indicated.

AAGAGATGATCTCAAATCTACTTTATGAGATA-3′ and RP:5′-TTAGAGTAACAGAGACTATCCAAGTGCATCAT-3′, annealing temperature 54°C, 30 cycles and a 155 bp product).6 The primers of MC4R rs17782313 were designed using the primer 5 software (FP: 5′-AGGA AACAGCAGGGATAGGG-3′ and RP:5′-TGCTGAGACAGGTTCAT AAAAAG-3′, annealing temperature 56°C, 30 cycles and a 407 bp product). The MC4R rs17782313 and FTO rs9939609 variants were genotyped using sequence retrieval (SinoGenoMax Co, Ltd).

Statistical analysis Statistical analysis was performed using SPSS 11.5 for Windows. Genotype and allele frequencies were compared with the Hardy– Weinberg equilibrium model and then analysed using chi-squared testing and contingency tables, respectively. Allelic and genotypic associations of the FTO rs9939609 and MC4R rs17782313 variants that were found to be significant were evaluated by computing odds ratios and 95% confidence intervals (CI). All data were presented as means ± SD. The clinical and biochemical characteristics between these genotypes were compared by one-way ANOVA; p < 0.05 was considered significant. All analyses were adjusted for gender, age and geographical region.

Results The basic characteristics of the participants are shown in Table 1.

Effects of FTO and MC4R on daytime hypertension The effects of MC4R and FTO on daytime hypertension were first investigated independently of each other. All the genotype and allele frequencies of FTO rs9939609 and MC4R rs17782313 were in Hardy–Weinberg equilibrium (p > 0.05). The frequencies are presented in Table 2. The effects of FTO rs9939609 on daytime hypertension are shown in Table 2. All frequencies are presented in Table 2. We found no significant association between the FTO gene and the Chinese Han population with regard to daytime hypertension (p > 0.05). The A allele frequency and the AA frequencies were not obviously different between the daytime hypertension group of patients and the controls. The effects of MC4R rs17782313 on daytime hypertension are given in Table 2. No significant association was observed between MC4R and the Chinese Han population with regard to daytime hypertension (p > 0.05). The C allele frequency and the CC frequencies were not obviously different between the daytime hypertension group of patients and the controls.

Table 2. FTO rs9939609 and MC4R rs17782313 distributions in daytime hypertension and control groups FTO rs9939609 Genotypes, n (frequency)

MC4R rs17782313 Alleles, n (frequency)

Genotypes, n (frequency)

Alleles, n (frequency)

Groups

Daytime hypertension

575

96 (16.7)

258 (44.9)

221 (38.4)

450 (39.1)

700 (60.9)

49 (8.5)

230 (40.0)

296 (51.5)

328 (28.5)

822 (71.5)

1200

205 (17.1)

545 (45.4)

450 (37.5)

955 (39.8)

1445 (60.2)

116 (9.7)

476 (39.7)

608 (50.6)

708 (29.5)

1692 (70.5)

Controls

Data are means (SD) for genotypic classes in unrelated individuals. FTO rs9939309: with Pearson χ2 test, c omparison of genotypes: daytime hypertension vs controls, χ2 = 0.18, p > 0.05; comparison of alleles: daytime hypertension vs controls, χ2 = 0.03, p > 0.05; MC4R rs17782313: with Pearson χ2 test, c omparison of genotypes: daytime hypertension vs controls, χ2 = 0.90, p > 0.05; comparison of alleles: daytime hypertension vs controls, χ2 = 0. 41, p > 0.05.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Effects of FTO and MC4R on nocturnal hypertension

Discussion Obesity and BMI are known to be associated with hypertension. Increases in BMI lead to an increase in the burden of hypertension. However, Ernsberger and Haskew found increasing prevalence of obesity as well as average BMI levels were accompanied by significant decreases in blood pressure level and prevalence of hypertension.15 This has led to questions about the nature of the association between obesity and hypertension. Gregg et al. found both nocturnal and daytime systolic blood pressure predicted cardiovascular events independently of clinic systolic BP levels.16 In the general population, Ernsberger and Haskew found nocturnal BP was a better predictor of fatal cardiovascular events than daytime BP.15 Troiano and co-workers found the risk for cardiovascular death increased more steeply with increasing nocturnal BP levels than with increasing daytime BP levels.17

155

100 90

150 SBP (mmHg)

The effects of FTO rs9939609 on nocturnal hypertension are shown in Table 3. Interestingly, the distribution of the genotypes and the two alleles were significantly different between the nocturnal hypertension group of patients and the controls (χ2 = 18.54 and χ2 = 19.39, respectively; p < 0.05). The A allele frequency and the AA frequencies were significantly higher in the patients than in the controls, as seen in Table 3. The increase in odds ratio of the A allele for the nocturnal blood pressure group was 1.37 (95% CI: 1.19–1.58). The genotypic odds ratio for elevated nocturnal blood pressure was 1.82 (95% CI: 1.38–2.41) for the AA genotype, and 1.39 (95% CI: 1.10–1.75) for the AT genotype. The effects of MC4R rs17782313 on nocturnal hypertension is shown in Table 3. The distribution of the genotype and the two alleles were also significantly different between the nocturnal hypertension group and the controls (χ2 = 15.21 and χ2 = 12.88, respectively; p < 0.05). The C allele frequency and CC frequencies were significantly higher in the patients than in the controls, as seen in Table 3. The increase in odds ratio of the C allele for the nocturnal hypertension group was 1.69 (95% CI: 1.31–3.32). The genotypic odds ratio for nocturnal hypertension was 1.54 (95% CI: 1.39–4.13) for the CC genotype, and 1.28 (95% CI: 1.60–2.88) for the CT genotype. The combined effects of FTO rs9939609 and MC4R rs17782313 on nocturnal hypertension is shown in Fig. 1. In this study, we observed that the nocturnal blood pressure of the participants simultaneously carrying the A and C alleles was significantly higher than the BP of those carrying neither FTO nor MC4R risk allele (χ2 = 28.79, p < 0.05), and the BP of the controls carrying only the A or C alleles (χ2 = 25.74, p < 0.05) (Fig. 1).

145

140

DBP (mmHg)

AFRICA

50 135

130

30 20

125

120

0 0 (25%) 1 (38%) 2 (31%) 3–4 (6%) Number of risk alleles (% of samples) DBP (right)

SBP (left)

Fig. 1. Nocturnal blood pressure according to risk allele at rs9930609 and rs17782313. Nocturnal hypertension of participants carrying neither FTO nor MC4R risk allele (25% of the population) was 130.9 ± 4.9/71.4 ± 3.7 mmHg, those carrying one risk allele (38% of the population) was 135.9 ± 5.5/75.0 ± 3.8 mmHg, those carrying two risk alleles (31% of the population) was 142.2 ± 4.7/80.6 ± 2.3 mmHg and those carrying there or four risk alleles (6% of the population) was 151.3 ± 6.4/88.5 ± 5.1 mmHg.

In our study, the analysis demonstrated a significant association of the FTO and MC4R genes with nocturnal blood pressure in the Chinese Han population (p < 0.05). The combined effects of FTO and MC4R played an important role in nocturnal blood pressure levels in this population. Nocturnal blood pressure levels of the participants carrying three or four risk alleles were higher than those with neither FTO nor MC4R risk allele (p = 0.008), those with one risk allele (p = 0.025), and those with two risk alleles (p = 0.041). The mechanism may be related to the FTO protein, which is a key link between the central nervous system and energy balance. The FTO gene function is unknown but based on its predicted structure, the FTO gene encodes for a non-haeme (FeII) dioxygenase with a potential role in adaptation to hypoxia, lipolysis or DNA methylation.17,18 The FTO protein is expressed in almost all tissues; at the cellular level it has a nuclear localisation.17 The molecular mechanisms involved in the pathogenesis of obesity as well as the role of FTO gene in other complex disorders are unknown.

Table 3. FTO rs9939609 and MC4R rs17782313 distributions in nocturnal hypertension and control groups FTO rs9939609 Genotypes, n (frequency)

MC4R rs17782313 Alleles, n (frequency)

Genotypes, n (frequency)

Alleles, n (frequency)

Nocturnal hypertension

583

140 (24.0)

281 (48.2)

162 (27.8)

561 (48.1)

605 (51.9)

82 (14.1)

252 (43.2)

249 (42.7)

416 (35.7)

750 (64.3)

Controls

1200

205 (17.1)

545 (45.4)

450 (47.5)

955 (39.8)

1445 (60.2)

116 (9.7)

476 (39.7)

608 (50.6)

708 (29.5)

1692 (70.5)

Groups

Data are means (SD) for genotypic classes on unrelated individuals. FTO rs9939309: with Pearson χ2 test, c omparison of genotypes: nocturnal hypertension vs controls, χ2 = 18.54, p < 0.05; comparison of alleles: nocturnal hypertension vs controls, χ2 = 19.39, p < 0.05; MC4R rs17782313: with Pearson χ2 test, c omparison of genotypes: nocturnal hypertension vs controls, χ2 = 15.21, p < 0.05; comparison of alleles: nocturnal hypertension vs controls, χ2 = 12.88, p < 0.05.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Various studies have shown cardiovascular risk factors such as type 2 diabetes mellitus,9,10 insulin resistance,11 and hypertension12 were associated with the risk allele A for FTO rs9939609 and the risk allele C for MC4R rs17782313, regardless of BMI.9,10 But in Marcadenti and colleagues’ study, common genetic variants of FTO rs9939609 had positive associations with BMI and neck circumference and MC4R rs17782313 in women, but a negative association with diastolic and mean blood pressure in hypertensive men in southern Brazil.13 However, these associations need to be confirmed by further replication studies, particularly in other ethnic populations. Brazilians and Chinese are different in their environmental risk factors, medical profiles, body composition and genetic backgrounds. This study has some limitations that should be taken into account when interpreting the results. The analysis of genotype by gender was exploratory and it was underpowered to detect small differences. Therefore, some associations that achieved statistical significance in the overall analysis remained only as a trend towards that association. The association of gene variants with anthropometric indices should be confirmed in further studies with statistical power to carry out analysis by gender.

AFRICA

and obesity-associated (FTO) gene confers risk of obesity and modulates BMI in the Chinese population. Diabetes 2008; 57(8): 2245–2252. 3.

Villalobos-Comparán MM, Flores-Dorantes TM, Villarreal-Molina T. The FTO gene is associated with adulthood obesity in the Mexican population. Obesity 2008; 16: 2296–2301.

Seong WC, Sun MC, Kil SK. Replication of genetic effects of FTO polymorphisms on BMI in a Korean population. Obesity 2008; 16: 2187–2189.

Frayling TM, Timpson NJ, Weedon MN. A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. Science 2007; 316: 889–894.

Wijkman M, Länne T, Engvall J, Nystrom. Masked nocturnal hypertension – a novel marker of risk in type 2 diabetes. Diabetologia 2009; 52: 1258–1264.

Struan FA, Grant JP. Bradfield I, Haitao Z. Investigation of the locus near MC4R with childhood obesity in Americans of European and African ancestry. Obesity (Silver Spring) 2009; 17(7): 1461–1465.

Cauchi S, Stutzmann F, Cavalcanti-Proença C. Combined effects of MC4R and FTO common genetic variants on obesity in European general populations. J Mol Med 2009; 87: 537–546.

Li H, Kilpeläinen TO, Liu C. Association of genetic variation in FTO with risk of obesity and type 2 diabetes with data from 96,551 East and

Conclusion We found that the FTO and MC4R genes were risk factors for nocturnal hypertension in this Chinese Han population, and their combined effects played an important role in nocturnal hypertension. However, even if a gene were considered associated with hypertension in certain populations, to expand the conclusion to all human populations is arbitrary. Furthermore, in the investigation of hypertension, obesity or diabetes, not only genetic factors but other factors, such as environment or geographic location could play a role. All these factors could have different effects on obesity or diabetes and they could impact on each other. Therefore whether or how a single gene could be associated with nocturnal hypertension is a complicated question. To decipher this, one would need long-term studies with numerous patients. FTO is a new gene reported by Yi-Cheng and co-workers in 2007,2 and thus far we have not answered all the questions since there has been minimal research on this gene among the different nations. We need more studies, since from a population perspective, only the combined effect of the most potent genetic variants should be considered.

South Asians. Diabetologia 2012; 12: 981–995. 10. Qi L, Kraft P, Hunter DJ. The common obesity variant near MC4R gene is associated with higher intakes of total energy and dietary fat, weight change and diabetes risk in women. Hum Mol Genet 2008; 12: 3502–3508. 11. Tschritter O, Haupt A, Preissl H. An obesity risk SNP (rs17782313) near the MC4R gene is associated with cerebrocortical insulin resistance in humans. J Obes 2011; 12: 283–293. 12. Pausova Z, Syme C, Abrahamowicz M. A common variant of the FTO gene is associated with not only increased adiposity but also elevated blood pressure in French Canadians. Circ Cardiovasc Genet 2009; 12: 260–269. 13. Marcadenti A, Fuchs FD, Matte U. Effects of FTO RS9939906 and MC4R RS17782313 on obesity, type 2 diabetes mellitus and blood pressure in patients with hypertension. Cardiovascr Diabetol 2013; 12: 1186–2840. 14. Hubacek JA, Pitha J, Adamkova V. A common variant in the FTO gene is associated with body mass index in males and postmenopausal females but not in premenopausal females. Clin Chem Lab Med 2009; 47: 387–390. 15. Ernsberger P, Haskew P. Health implications of obesity: an alternative view. J Obes Weight Regul 1987; 6: 55–137.

This study was funded by the Hubei Provincial Bureau of Health Science Foundation for Young Scholars (grant QJX2008-29).

16. Gregg EW, Cheng YJ, Cadwell BL. Secular trends in cardiovascular disease risk factors according to body mass index in US adults. J Am Med Assoc 2005; 293: 1868–1874.

References 1.

Zacho J, Timpson, Nordestgaard BG. Does greater adiposity increase blood pressure and hypertension risk? Mendelian randomization using

17. Troiano RP, Frongillo EA Jr, Sobal J. The relationship between body weight and mortality: a quantitative analysis of combined information from existing studies. Int J Obes Relat Metab Disord 1996; 20: 63–75. 18. Sanchez-Pulido L, Andrade-Navarro MA. The FTO (fat mass and

the FTO/MC4R genotype. Hypertension 2009; 54: 84–131.

obesity associated) gene codes for a novel member of the non-heme

Yi-Cheng C, Pi-Hua L, Wei-Jei L. Common variation in the fat mass

dioxygenase superfamily. BMC Biochem 2007; 8: 8–23.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Left ventricular systolic function in Nigerian children infected with HIV/AIDS: a cross-sectional study Ijeoma Arodiwe, Anthony Ikefuna, Egbuna Obidike, Ejikeme Arodiwe, Bennedict Anisuba, Ngozi Ibeziako, Sunday Omokoidion, Christy Okoroma

Abstract Background: Cardiac complications contribute significantly to morbidity and mortality in children with HIV/AIDS. These rates have been under-reported in sub-Saharan African children. Methods: This was an observational, cross-sectional Doppler echocardiographic study of ventricular systolic function, performed at a tertiary clinic on children with HIV/AIDS. Results: Left ventricular systolic dysfunction was present in 27.0% of the children with HIV infection and 81.2% of those with AIDS. The mean fractional shortening in the AIDS group (31.6 ± 9.5%) was significantly lower than in the HIV-infected group (35.3 ± 10.5%, p = 0.001). A significant correlation was found with CD4+ cell count and age, and these were the best predictors of left ventricular systolic dysfunction in the stepwise multiple regression analysis (r = 0.396, p = 0.038; r = –0.212, p = 0.025, respectively). Conclusion: Left ventricular systolic dysfunction is common in Nigerian children with HIV/AIDS. Keywords: left ventricular systolic function, HIV/AIDS, children, echocardiography, Nigeria Submitted 11/4/15, accepted 25/8/15 Cardiovasc J Afr 2016; 27: 25–29

www.cvja.co.za

DOI: 10.5830/CVJA-2015-066

Human immune deficiency virus (HIV) infection and its effect, acquired immune deficiency syndrome (AIDS), is one of the most frightening emerging diseases and constitutes a global health burden with overwhelming social, economic and political Department of Paediatrics, University of Nigeria Teaching Hospital, Ituku-Ozalla, Enugu, Nigeria Ijeoma Arodiwe, MD, arodiwenephrol@yahoo.com Anthony Ikefuna, MD Egbuna Obidike, MD Ngozi Ibeziako, MD

Department of Medicine, College of Medicine, University of Nigeria, Enugu, Nigeria Ejikeme Arodiwe, MD Bennedict Anisuba, MD

Department of Paediatrics, University College Hospital, Ibadan, Nigeria Sunday Omokoidion, MD

Department of Paediatrics, College of Medicine, University of Lagos, Lagos, Nigeria Christy Okoroma, MD

repercussions.1 It is one of the challenges facing African countries today, as most countries in sub-Saharan Africa have generalised epidemics, defined as prevalence rate > 1%. It is a leading cause of death and shortened life expectancy in this region.2 This disease is characterised by a deficient cell-mediated immunity.3 The manifestation is usually protean, as shown by varied clinical features seen in different parts of the world.4 It results in a progressive dysfunction of multiple organ systems.5 In sub-Saharan Africa where the burden of the disease is very high, involvement of the heart in HIV has become a clinical problem over the last decade, but there are few published studies on it, especially in children.6-8 Left ventricular dysfunction is important in the clinical history and prognosis of HIV infection.9 It is most often clinically silent in HIV/AIDS patients and can progress to symptomatic left heart failure.10 Median survival to AIDS-related death is 101 days in patients with left ventricular dysfunction, and 472 days in patients with a normal heart, as shown by echocardiography at a similar infection rate.11 Reduced left ventricular fractional shortening and increased wall thickness were also predictive of survival after multivariate adjustment.11 With improved clinical surveillance and treatment, using highly active antiretroviral therapy (HAART), more patients are surviving potentially fatal opportunistic infections, only to succumb to neoplasm or end-organ damage. Heart muscle disease is one such end-organ damage.12 Our study evaluated left ventricular systolic function (LVSF) and factors affecting it in children with HIV and AIDS, compared with age- and gender-matched HIV-negative controls, using M-mode, two-dimensional and Doppler echocardiography.

Methods This was a descriptive, cross-sectional study of 90 paediatric HIV and AIDS patients, aged between 18 months and 14 years. Their age and gender matched the HIV-free controls. The cases were seen at the University of Nigeria Teaching Hospital (UNTH), Enugu, from February to December 2011. The study was carried out at the Paediatric retroviral clinic and in the paediatric wards. Those in the wards are already confirmed to be HIV positive or have AIDS. The controls were recruited from the children’s out-patient department, immunisation and adolescent clinic. The patients had a pre-echocardiography evaluation to identify those qualifying for the study. The inclusion criteria were children who were HIV 1 and/or 2 positive, confirmed by Western blot technique or DNA PCR, who were or were not on HAART. The exclusion criteria included children who were on medications with known cardiovascular effects, such as antiarrhythmic drugs, theophylline and adriamycin, children with pre-existing cardiac diseases, and children with other chronic diseases associated with demonstrable wasting or oedema.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Ninety patients who satisfied the study criteria were recruited after informed consent was obtained from their parents and other legal caregivers. Ethical approval was obtained from the ethics committee of the UNTH, Ituku-Ozalla, Enugu. Informed consent was obtained from parents or guardians of the children and older children, respectively. All the sera from potential control subjects were screened for HIV infection using the Retrocheck® HIV testing kit (Nicholas Biotech, Texas, USA). Only those who tested negative were recruited for the study. The investigator administered a standard pre-test questionnaire to obtain biodata, demographic data and clinical history, including medication history, HIV and AIDS category based on CDC classification system, and type and duration of HAART. All subjects and controls also underwent a thorough physical examination. The height and the weight were obtained using Hanson’s model H89 Orange® stadiometer and weighing scale respectively, according to standard procedures.11 Systolic and diastolic blood pressure measurements were taken on the right arm using an appropriately calibrated mercury sphygmomanometer with appropriate-sized cuff. The average of three readings was taken 10 minutes apart to represent the blood pressure estimate. Full blood counts (FBC) were obtained on the I-STAT autoanalyser, and counter for haemoglobin concentration, leukocyte count and differentials, and erythrocyte sedimentation rate (ESR). CD4+ cell counts were obtained by auto-separation. Echocardiography was done using the Hewlett-Packard SONO 2000 machine, which has a transducer with multifrequency in the range 5.5–12 MHz for children, a video recorder and a print-out processor. It has capabilities for M-mode, two-dimensional, pulsed wave and continuous-wave Doppler echocardiography. Echocardiography was performed on each child by two of the investigators and also interpreted to reduce intra-observer bias. These operators were blinded to the HIV and clinical status of the study subjects. For each examination, standard procedures and techniques were applied to windows.13 The younger subjects who were not cooperative in the presence of their caregiver or parents (usually those under two years) were pacified with toys or sedated with a mild short-acting sedative, chloral hydrate, as appropriate. Echocardiographic measurements were taken in centimetres (cm) using the American Society of Echocardiography (ASE) guidelines for leading-edge methodology.14 The mean of three measurements was recorded and normative values for the echocardiographic measures, according to body surface area (BSA), were based on the ASE reference, as there were no local data available in this age group known to the authors at the time of the study. Fractional shortening (FS) was calculated using the formula: (LVEDd–LVESd) × 100

___________________    FS (%) =      LVEDd  LVEDd = left ventricular end-diastolic dimension, LVESd = left ventricular end-systolic dimension. The normal range of FS is 28–41%, with a mean of 33 ± 5%.

stroke volume × 100

________________      Ejection fraction, EF (%) =      LVEDd

The normal range of EF is 45–90%, with a mean of 62 ± 10%. Stroke volume (SV) = LVEDV–LVESV.

AFRICA

Left ventricular end-diastolic volume (LVEDV) = LVEDd3 Left ventricular end-systolic volume (LVESV) = LVESd3 Depressed LV systolic function is a fractional shortening of ≤ 28%, or ejection fraction of less than 40% with normal left ventricular dimensions.14

Statistical analysis Statistical analysis was done using the Statistical Package for Social Sciences (SPSS) version 18.0. Descriptive statistics for baseline demographic data are presented as both mean and standard deviation (SD) for continuous variables, or percentages for discrete variables. The non-parametric chi-squared (χ2) test was used to test comparable categorical variables, while one-way ANOVA was used for continuous variables. A value of p < 0.05 was considered statistically significant. Pearson’s correlation and multiple linear regression analysis were used to assess the relationship between left ventricular systolic dysfunction (LVSD) and the variables affecting it.

Results Table 1 shows the clinical and laboratory characteristics of the study participants. There were 90 children with HIV and AIDS, and 90 normal children were used as controls. Of the 90 with HIV and AIDS, 16 had clinical AIDS. There was no significant gender difference (χ2 = 0.654, p = 0.06) or difference in mean age between the groups. However there were significant differences in the mean weight, height, body mass index (BMI), respiratory rate (RR), heart rate (HR), systolic blood pressure (SBP), diastolic blood pressure (DBP), total white blood cell count, erythrocyte sedimentation rate (ESR) and CD4+ cell count between the controls, HIV and AIDS groups. The controls had higher weight, height, BMI, haemoglobin levels and CD4+ cell counts than the HIV and AIDS groups. The mean RR, HR and ESR were significantly higher in the HIV and AIDS groups than in the controls (p < 0.001). The AIDS group had severely depressed CD4+ cell counts compared to the other groups (χ2 = 5.6, p = 0.01). Table 2 demonstrates the echocardiographic characteristics of the study participants with regard to systolic function of the heart. There was a significant difference in the mean left ventricular mass index (LVMI) of the HIV and AIDS groups compared with the controls. The LVMI was higher in the HIV and AIDS groups than in the controls. The mean FS and EF were significantly lower in the HIV and AIDS groups compared with the controls (p 0.001). The mean LVEDd and LVESd were significantly higher in the HIV and AIDS groups than in the controls. LVESd was highest in the AIDS group (Table 2). The prevalence of LVSD was highest in the AIDS group (81.2%), followed by the HIV-positive group (27%), and least (2.2%) in the controls. These differences were statistically significant (χ2 = 1.23, p = 0.03). Table 3 shows the correlation of important determinants of cardiac systolic function in the HIV and AIDS groups. Age, duration of treatment, CD4+ cell count (in the HIV group) and pulse rate correlated positively with systolic dysfunction, while duration of treatment, diastolic blood pressure, and CD4+ cell

AFRICA

Table 1. Demographic and clinical characteristics of patients and controls HIV infection (n = 74)

Variable

AIDS (n = 16)

Control (n = 90)

F/χ2

Table 3. Pearson’s correlation of independent variables with LV systolic dysfunction in HIV carriers and AIDS groups

p-value

HIV carriers

Gender Male

Female

8.15 ± 3.08

7.9 ± 2.07

8.3 ± 3.04

0.14

0.87

Mean weight (kg)

14.43 ± 9.67

10.22 ± 6.07

22.4 ± 9.42

21.30

< 0.001

Mean height (cm)

108.1 ± 20.9

95.7 ± 15.3

114.7 ± 21.8

6.28

0.002

Mean age (years)

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

0.654

0.06

Correlation coefficient (r)

Age (years)

0.32

BMI for age

Independent variable

Duration of treatment (years)

AIDS

p-value

Correlation coefficient (r)

p-value

0.03*

0.22

0.01*

0.19

0.31

0.20

0.22

–0.49

0.01*

–0.45

0.02*

SBP (mmHg)

–0.29

0.12

–0.30

0.45

DBP (mmHg)

–0.38

0.04*

–0.35

0.53

Haemoglobin conc (g/dl)

–0.20

0.30

–0.25

0.62

2–4 years (M) (F)

18.3 ± 2 18.8 ± 1

16.4 ± 2 16 ± 2

22 ± 3.1 22.5 ± 2.1

337.81 < 0.001

WBC (total)

–0.01

0.95

–0.05

0.12

16.7 ± 1 16.3 ± 1.2

15.8 ± 1.2 15.5 ± 1.5

23.2 ± 2.9 23.5 ± 2.4

240.08 < 0.001

ESR

–0.33

0.08

–0.35

0.24

5–9 years (M) (F)

CD4+ cell count

0.08

0.01*

–0.09

0.02*

10–14 years (M) (F)

17.5 ± 0.8 17.1 ± 0.9

16.3 ± 2 16.3 ± 0.5

21.5 ± 2 20.4 ± 3

Stage of disease

–0.05

0.32

–0.23

0.11

0.13

0.04*

0.15

0.03*

Mean BMI for age

94.11

< 0.001

Mean RR/min

29 ± 5

32 ± 6

26 ± 5

13.12

< 0.001

Mean HR/min

103 ± 18

120 ± 20

92 ± 13

25.05

< 0.001

Mean SBP (mmHg)

89 ± 8

81 ± 12

85 ± 12

5.14

0.007

Mean DBP (mmHg)

52 ± 8

60 ± 7

54 ± 7

7.76

0.001

9.8 ± 1.1

Mean Hb (g/dl)

31 ± 10.6

Mean ESR (mm/1st h) Mean CD4+ (cell/mm3)

8.6 ± 0.7

11.6 ± 0.7

6813 ± 2056.3 4059 ± 1838.2

Mean WBC (cells/µl)

5059 ± 1838.2

67 ± 12.4

1486.6 ± 158.6 504.6 ± 300.3

6.3 ± 2.4

127.93 < 0.001 23.02 < 0.001 486.40 < 0.001

1786.6 ± 1582.6

8.93

< 0.001

CD4+ (cell/mm3) ≤ 1499, n (%)

6 (8.1)

15 (93)

30 (3.3)

5.6

0.01

≥ 1500, n (%)

68 (92)

1.1 (6.9)

87 (96)

4.54

0.05

BMI: body mass index, RR: respiratory rate, HR: heart rate, SBP: systolic blood pressure, DBP: diastolic blood pressure, Hb: haemoglobin, WBC: white blood cells, ESR: erythrocyte sedimentation rate.

count (in the AIDS group) demonstrated a negative correlation. Multiple linear regression analysis of factors that correlated significantly with LVSD revealed that age and CD4+ cell count were the best predictors of LVSD in our children who were HIV positive and in those with AIDS (p = 0.025 and 0.038, respectively) (Table 4).

Discussion LVSD was more prevalent in the AIDS group (81.2%), than in the HIV group (27.0%) (p = 0.03). This is higher than the previous prevalences of 33.7% reported by Okoroma et al.8 in Lagos, Nigeria; 22% reported by Uwanuruochi15 in Enugu (in Table 2. Left ventricular echocardiography characteristics of the study participants

Variable

HIV infection (n = 74)

AIDS (n = 16)

Control (n = 90)

Mean LVMI (g/m2)

90.4 ± 25.3 89.4 ± 25.1 74.5 ± 23.2

Mean % FS

35.3 ± 10.5 31.6 ± 9.5

Mean % EF

53.3 ± 15.7 45.3 ± 12.7 68.1 ± 12.4

Mean LVEDd (cm)

6.8 ± 0.6

Mean LVESd (cm) Prevalence of LVSD, n (%)

39 ± 5.2

p-value

9.47

< 0.001

7.75

0.001

39.922

< 0.001

441.89

< 0.001

6 ± 0.6

3.8 ± 0.7

2.7 ± 0.2

3.8 ± 0.4

2.2 ± 0.2

375.62

< 0.001

20 (27)

13 (81.2)

2 (2.2)

χ2 = 1.23

0.03

LVMI: left ventricular mass index, FS: fractional shortening, EF: ejection fraction, LVEDd: left ventricular end-diastolic dimension, LVESd: left ventricular endsystolic dimension, LVSD: left ventricular systolic dysfunction.

Pulse rate

an adult population); and 29% reported by Lipshultz et al.16 in Boston. Other workers have reported wide-ranging figures for systolic dysfunction, such as the 6.5% prevalence noted by Cardoso et al.9 in Paris and 85.7% prevalence among adults reported by Longo-Mbenza1 in Kinshasa. These observed differences in prevalence may have been due to the use of different criteria for the definition of cardiac abnormality, or methodological differences, including study design, sample size, patient selection method, focus on a single echocardiographic parameter and bias in patient selection in terms of inadequate matching for age and gender.17 However, these observed differences may also show that there is some racial or genetic predisposition to this detectable cardiac abnormality.18 In a multicentre, prospective cohort study conducted in the USA, the significance of a high prevalence of systolic dysfunction related to its association with mortality.19 The prevalence of cardiac dysfunction is high in African children with HIV/AIDS but this has not attracted much attention.8 This is partly because the clinical picture of HIV/ AIDS is still dominated by chronic diarrhoea from opportunistic infections, and severe malnutrition.20 Cardiac dysfunction is rarely diagnosed in HIV-infected children in our setting and standard care does not include echocardiography.8 Echocardiography is a non-invasive and valuable means of characterising cardiac abnormalities. The mean weight and BMI in the AIDS group in our study was significantly lower than in the controls. This was expected as the loss of lean body mass, especially muscle protein, has been well documented in patients with HIV infection.21-23 Heart rate was significantly higher in the HIV and AIDS groups compared with the controls. Okeahialam et al. from Jos, Nigeria, noted this in 2000,24 and Coudray et al.25 reported similar findings in France.

Table 4. Stepwise multiple linear regressions of factors that correlated with LV systolic dysfunction in the subjects

Model

Unstandardised Standardised coefficients coefficients Std (r) B error Beta t-value p-value

95% CI for B B

Std error

0.714

1.851

Constant

1.282

277

4.627

0.000

Age (years)

0.005

0.051

–0.212

1.170

0.025*

–0.015

0.004

CD4+ cell counts

0.034

0.016

0.396

2.186

0.038*

0.002

0.066

CI: confidence interval, dependent variable: LV systolic dysfunction, *Significant.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

These findings may be as a result of ventricular dysfunction as well as autonomic dysfunction and the increased basal metabolic rate seen in HIV/AIDS patients.24 There were significant differences in the systolic and diastolic blood pressure of the HIV and AIDS groups in our study compared with the controls. Those with HIV or AIDS had higher blood pressure values than the controls. There are conflicting reports in the literature. Some workers found no differences in blood pressure,26-28 while others noted an increased frequency of systemic hypertension among patients with HIV/ AIDS.13,24 The compensatory mechanism of a normal or low blood pressure, seen in chronic malnutrition, which is prevalent in children with HIV/AIDS, may play a role.29 Haemoglobin level in the HIV/AIDS groups was significantly lower than in the controls. This was expected, due to chronic infection and malnutrition as a result of chronic diarrhoea. The HIV group had significantly higher mean left ventricular end-diastolic dimensions than the controls. Fractional shortening and ejection fraction, on the other hand were significantly lower in the HIV and AIDS groups than in the controls, being lowest in the AIDS group. This was similar to the findings of Hecht et al.30 and Nzuobontane et al.2 They noted that end-diastolic dimensions were significantly higher in HIV-positive patients, while fractional shortening was significantly lower in AIDS subjects. This suggests that ventricular dilatation occurs earlier in the course of the disease than impaired contractility. In identifying a possible link between certain variables and the presence of left ventricular systolic dysfunction, this study noted that BMI, blood pressure, except DBP (in the AIDS group), haemoglobin concentration, WBC, ESR and stage of the disease were not associated with the presence of systolic dysfunction (Table 3). Advanced stage of the disease, which is a known risk factor for cardiac involvement,1,31 was not significantly associated with the presence of LVSD in this study, even though the prevalence of LVSD was higher in the AIDS group. The reason for this was not obvious, however, it may be connected with the population studied, as racial or genetic differences had been noted.18 It is hoped that future studies will further investigate this finding. Lower CD4+ count and younger age were significantly associated with the development of LVSD in the logistic regression model. This agrees with the report of Herskowitz et al., who studied adults, and found a median CD4+ count of 30 cells/μl in HIV-infected patients with left ventricular dysfunction compared to a median count of 187 cells/ml in those without ventricular dysfunction.32 Lower CD4+ cell count is a marker of terminal disease associated with HIV cardiomyopathy, and younger children20 had been noted to have a rapid course of disease progression with end-organ effects. Increased pulse rate was found in our study to be associated with LVSD, however, this was not noted by other investigators.15,33 This may not be unconnected with the population studied and the high prevalence of ventricular dysfunction observed in this study. Multiple regression analysis showed that CD4+ cell count and age of the patients predicted the development of left ventricular systolic dysfunction, with CD4+ cell count being the best predictor (r = 0.396, CI = 0.002) (Table 4). This implies that significant decrease in CD4+ cell count was the highest risk factor for the development of LVSD in our subjects. This finding is at variance with Lipshultz et al.16 and Lobato et al.,34 who

AFRICA

noted the presence of HIV encephalopathy as a predictor of LV dysfunction in HIV infection. This difference may have been due to the inclusion criteria, as only perinatal acquired HIV infection was included. A limitation of the study is that the presence or absence of pre-existing cardiac abnormality prior to enrolment into the study was based on patients’ medical records or medical history. This did not completely exclude cardiac abnormality, as clinical evaluation alone is inadequate, as shown in the HIV-negative controls who had cardiac abnormalities.

Conclusion This study demonstrated a high prevalence of LVSD in children with HIV and AIDS, who apparently had no clinical evidence of heart failure. CD4+ cell count and age of the children were the best predictors of LVSD. The younger the age and the lower the CD4+ cell count, the higher the number of children with LVSD. Since LVSD was asymptomatic in these children, it is recommended that HIV and AIDS children should undergo baseline and periodic evaluation using echocardiography. Cardiac care providers should be incorporated in the management of children with HIV/AIDS in our environment to implement appropriate preventative and therapeutic measures. This will maximise survival and improve the quality of life of these children.

References 1.

Longo-Mbenza B, Tonduangu K, Kintonki VE. The effect of HIV infection on high incidence of heart disease in Kinshasa (Zaire). Echocardiographic study. Ann Cardio Angeiol (Paris) 1997; 46: 81–87.

Nzuobontane D, Blackett KN, Kuaban C. Cardiac involvement in HIV infected people in Yaounde, Cameroon. Postgr Med J 2002; 78: 678–681.

Grant AD, De Cock KM. HIV infection and AIDS in the developing world. Br Med J 2001; 322: 1475–1478.

Oruamabo R. Viral infection. In: Azubuike JC, Nkanginieme KEO, Eds. Paediatrics and Child health in a Tropical Region, 1st edn. Owerri: African Educational Services, 1999; 402–409.

Austran B, Gorin I, Leibowitch M. AIDS in a Haitian woman with cardiac Kaposi’s sarcoma and Whipple disease. Lancet 1983; 1: 767–768.

Longo-Mbenza B, Segher KV, Phuati M. Heart involvement and HIV infection in African patients: determinants of survival. Int J Cardiol 1998; 64: 63–73.

Lubega S, Zirembusi GW, Lwabi P. Heart Disease among children with HIV/AIDS attending the paediatric infectious disease clinic at Mulago Hospital. Afr Health Sci 2005; 5: 219–226.

Okoroma CAN, Ojo OO, Ogunkule OO. Cardiovascular dysfunction in HIV-infected children in a sub-Saharan African country: comparative cross-sectional observational study. J Trop Paediat 2011; downloaded from tropej.oxfordjournals.org on February 3, 2011.

Cardoso JS, Miranda AM, Moura B, Gomes MH, Oliveira P. Cardiac morbidity in the HIV infection. Rev Port Cardiol 1994; 13: 901–911.

10. Muralikrishna G, Archana B, Wissam IK, Alejandro B. Heart disease in patients with HIV/AIDS – an emerging clinical problem. Curr Cardiol Rev 2009; 5(2): 149–154. 11. Giuseppe B. Cardiovascular manifestations of HIV infection. Circulation 2002; 106: 1420–1425. 12. Roy VP, Prabhakar S, Pulvirenti J, Matthew J. Frequency and factors associated with cardiomyopathy in patients with HIV infection in an

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

inner city hospital. J Nat Med A 1999; 91: 502–504. 13. Asmi MH, Walsh MJ. A Practical Guide to Echocardiography. London: Chapman and Hall Medical, 1995: 174–186. 14. ACC/AHA/ASE 2003 guidelines update for the clinical application of

effects of anorexia nervosa and starvation. Arch Intern Med 1989; 149: 877–881. 24. Okeahialam BN, Nabashani MB. Infective endocarditis in acquired immune deficiency syndrome. Trop Card 2001; 27: 68–69.

echocardiography: a report of the American College of Cardiology/

25. Coudray N, de Zuttere D. Left ventricular diastolic function in asymp-

American Heart Association task force on practice guidelines.

tomatic and symptomatic HIV. An echocardiographic study. Eur Heart

Circulation 2003; 108–1146.

J 1995; 16: 61–67.

15. Uwanuruochi K. Evaluation of left ventricular function of HIV-infected

26. Obidike EO. Measurements. In: Obidike EO, ed. Essentials of Clinical

adults seen at UNTH Enugu. FMCP part II dissertation, National

Methods in Paediatrics. 1st edn. Institute For Development Studies,

Postgraduate Medical College of Nigeria 2008.

Enugu, 2004: 109–115.

16. Lipshultz S, Channock S, Sanders SP. Cardiac manifestations of human

27. Danbauchi SS, Sanni BG, Alhassan AM, Oyati AI. Echocardiographic

immunodeficiency virus infection in infants and children. Am J Cardiol

features of HIV/AIDS subjects on 1–2 years of ARV drugs in Nigeria.

1989: 63: 1489–1497.

Available at http://www2.umdng.edu/shindler/hiercho,html.

17. Lipshultz SE, Kirk AE, Orav EJ, et al. Left ventricular structure and

28. Sani MN. Electrocardiographic pattern of patients with AIDS in JUTH,

function in children infected with human immunodeficiency virus:

Jos FMCP Part 2. Dissertation, West African College of Physicians

the prospective P2C2 HIV multicentre study. Am J Cardiol 1998; 97: 1246–1250.

2002. 29. Herskowitz A, Wu TC, Willoughby SB. Myocarditis and cardiotropic

18. William RC, Tucker CR. Normal echocardiographic anatomy. In:

viral infection associated with severe left ventricular dysfunction in late

Nadas AS, ed. Echocardographic diagnosis of congenital heart disease

infection with human immunodeficiency virus. J Am Coll Cardiol 1994;

(2nd edn). Boston: Little, Brown and Co, 1977: 7–72. 19. Lipshultz SE, Easley KA, Orav EJ, et al. Cardiac dysfunction and mortality in HIV-infected children: the prospective P2 C2 HIV multicenter study. Circulation 2000; 102: 1542–1548. 20. Ram Y, Ellen GC. Acquired immunodeficiency syndrome (human

24: 1025–1032. 30. Hecht SR. Utility of Echocardiography in AIDS. Chest 1990; 98: 775. 31. Longo-Mbenza B, Seghers KV, Vita EK. Assessment of ventricular diastolic function in AIDS patients from Congo: a Doppler echocardiographic study. Heart 1998; 8: 184–189.

immunodeficiency virus). In: Behrman RE, Kliegman RM, Jenson HB,

32. Herskowitz A, Willoughby SB, Baughman KL, Schulman SP, Bartlett

eds. Nelson Textbook of Pediatrics, 17th edn. Philadelphia: Saunders,

JD. Cardiomyopathy associated with antiretroviral therapy in patients

2004: 1109–1120.

with HIV infection: a report of six cases. Ann Intern Med 1992; 116:

21. Miller TL, Orav EJ, Colan SD, Lipshultz SE. Nutritional status and cardiac mass and function in children infected with human immune deficiency virus. Am J Clin Nutr 1997; 66: 660–664. 22. Miller TL, Evans SJ, Orav EJ, Morris V, McIntosh K, Winters HS. Growth and body composition in children infected with the human immune deficiency virus-1. Am J Clin Nutr 1993; 57: 588–592. 23. Schocken DD, Holloway JD, Powers PS. Weight loss and the heart:

311–313. 33. Arshad A, Bansal A, Patel RC. Cardiac complications of human immunodeficiency virus infection: diagnostic and therapeutic considerations. Heart Dis 2000; 2: 133–145. 34. Lobato MN, Caldwell B, Ng P, Oxtoby MJ. Encephalopathy in children with perinatally acquired human immunodeficiency virus infection. J Paediat 1995; 126: 710-715.

CARDIOVASCULAR JOURNAL OF AFRICA â&#x20AC;˘ Volume 27, No 1, January/February 2016

AFRICA

Vascular rings: a radiological review of anatomical variations Iqbal Siddi Ganie, Khatija Amod, Darshan Reddy

Abstract Background: The imaging modalities used to diagnose vascular rings have evolved over time, from basic radiographic studies to advanced cross-sectional imaging. The goal of preoperative imaging is to provide the surgeon with an accurate representation of the ring configuration so that the surgical approach may be planned. Methods: We conducted a review of all patients with vascular rings who underwent surgery at Inkosi Albert Luthuli Central Hospital, Durban, South Africa from 1 July 2008 to 1 July 2013. Results: Eight patients were diagnosed with vascular rings. Seven patients had an abnormal plain chest radiograph (right aortic arch, tracheal narrowing, or abnormal mediastinal silhouette), while in six patients the contrast oesophagogram demonstrated a fixed extrinsic oesophageal indentation. Computed tomography angiography confirmed the pathology in all cases, with six double aortic arches and two right aortic arches with aberrant left subclavian artery and left ligamentum arteriosum. Conclusions: We advocate a diagnostic imaging algorithm consisting of plain chest radiography, contrast oesophagogram and computed tomography angiography prior to surgery. Magnetic resonance imaging may provide an alternative axial imaging modality depending on institutional preference. Keywords: vascular rings, aortic arch anomalies, double arch, aberrant subclavian artery, Kommerell diverticulum Submitted 16/5/14, accepted 3/10/15 Published online 2/12/15 Cardiovasc J Afr 2016; 27: 30â&#x20AC;&#x201C;36

www.cvja.co.za

DOI: 10.5830/CVJA-2015-076

Vascular rings generally present in infancy and early childhood, with symptoms relating to tracheal compression (cough, stridor or dyspnoea) or oesophageal compression (dysphagia, feeding difficulties). While diagnostic imaging algorithms vary between institutions, the main function of pre-operative imaging is

Department of Radiology, University of KwaZulu Natal, Durban, South Africa Iqbal Siddi Ganie, MB ChB, FC Rad D Khatija Amod, MB ChB, FC Rad D, MSc (Med) (SA)

Department of Cardiothoracic Surgery, University of KwaZulu Natal, Durban, South Africa Darshan Reddy, MB ChB, FC Cardio (SA), MMed (UKZN), darshan.reddy@ialch.co.za

to confirm the diagnosis, provide detailed definition of the ring configuration, and enable accurate surgical planning and treatment.

Methods We reviewed the electronic patient surgical records and archived imaging data of all patients diagnosed with complete vascular rings between July 2008 and July 2013 at Inkosi Albert Luthuli Central Hospital, Durban, South Africa. All patients were under the care of the cardiothoracic surgical service and underwent in-patient imaging prior to surgery. The imaging modalities available at our institution include plain chest radiography, oesophageal contrast studies, computed tomography angiography (CTA), magnetic resonance imaging (MRI), echocardiography, bronchoscopy and conventional catheter angiography. For the purpose of this study, all archived imaging underwent secondary review by an independent radiologist, as acknowledged. A Siemens Somatom Definition AS 128 slice 64 detector scanner was used for all our patients. Chloryl hydrate (10%) was used for sedation in all the cases at a dose of 0.5 ml/kg. Omnipaque 350 was used as iodinated contrast and the dose utilised was 4 ml/kg. ECG gating and breath holding were not applied. Axial, coronal and sagittal images were obtained and 3D reconstructions were employed for clear visualisation of the vascular anatomy.

Results Over the study period, eight patients were diagnosed with complete vascular rings (detailed patient characteristics are presented in Table 1). All patients presented between two and 24 months of age, with the commonest presenting symptoms relating to the upper aerodigestive tract (stridor, wheeze or dysphagia). In two patients the vascular ring was an incidental finding; the first presented with congestive cardiac failure as a result of a large ventricular septal defect (VSD); the second had persistent stridor following the extraction of an impacted coin in the oesophagus (Fig. 1). A plain chest radiograph (CXR) was undertaken in all patients, and was abnormal in seven of the eight patients (right aortic arch, widened mediastinal silhouette, tracheal narrowing). Contrast oesophagogram (CO) was undertaken in six patients. In all cases this study demonstrated a fixed extrinsic oesophageal indentation. Computed tomography angiography (CTA) was used to define the detailed anatomical configuration of the vascular ring in all eight patients, and was our primary imaging tool used to plan surgery. Six patients had double aortic arches, and two patients had a right aortic arch with an aberrant left subclavian artery and left ligamentum arteriosum.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA â&#x20AC;˘ Volume 27, No 1, January/February 2016

Table 1. Patient characteristics Patient Age/gender Date

Clinical features

Chest radiograph

Contrast oesophagogram

CT angiography

Echocardiogram

Surgery

Stridor

No tracheal stenosis

Not done

Double aortic arch

Double aortic arch seen

Right thoracotomy

2-monthold boy

2008

Normal posterior soft-tissue shadow

Trachea narrowing at T3 level

Division of right arch

Right aortic arch 2

9-monthold girl

2009

Stridor

Right aortic arch

Respiratory distress

Tracheal narrowing at T4 level

Posterior indentation Double aortic arch of mid-oesophagus at level of aortic arch Tracheal narrowing at and impression on T4 level right lateral wall

Double aortic arch seen

Not done

Right aortic arch seen

Left thoracotomy Division of posterior arch and ligamentum arteriosum

Normal posterior soft tissue shadow 3

24-monthold girl

2010

Oesophageal foreign body

Opacity right lower lobe

Double aortic arch

Tracheal narrowing at T4 level

Left thoracotomy Division of left aortic arch

Right aortic arch Normal posterior soft-tissue shadow 4

9-monthold boy

7-monthold boy

2011

Feeding difficulty

Widened superior mediastinu

Stridor

Tracheal narrowing at T4 level

Feeding difficulty

Right aortic arch

Respiratory distress

Tracheal narrowing at T4 level

Oblique indentation of mid-oesophagus at level of carina

Double aortic arch

Left aortic arch seen

Left thoracotomy

Tracheal narrowing at T4 level

Division of anterior aortic arch

Posterior indentation of mid-oesophagus at level of carina and impression laterally on the right

Right aortic arch, aberRight aortic arch rant left subclavian artery, seen left ligamentum

Left thoracotomy

Tracheal narrowing at T4 level

Division of ligamentum arteriosum

Bilateral dysplastic ribs 6

24-monthold boy

2012

Respiratory distress

Widened mediastinum Tracheal narrowing at T3/T4 level

22-monthold boy

2012

Congestive cardiac failure

Right aortic arch

Respiratory distress

Trachea normal

Posterior indentation Double aortic arch of mid-oesophagus at level of aortic arch Focal tracheal narrowing at T3 level

Double aortic arch seen

Left thoracotomy Division of left aortic arch and ligamentum arteriosum

Posterior indentation Right aortic arch, aberPMO VSD with left- Median sternotomy of mid-oesophagus rant left subclavian artery, to-right shunt at level of carina left ligamentum No tracheal narrowing

Right aortic arch seen

VSD closure and division of ligamentum arteriosum

Enlarged cardiac silhouette with plethoric lung fields 8

3-monthold girl

2012

Wheeze

Trachea normal

Chronic cough

Normal posterior soft-tissue shadow

Posterior indentation Double aortic arch Not done of mid-oesophagus Tracheal narrowing at T3/ at level of carina T4 level

Left thoracotomy Division of atretic aortic arch and ligamentum arteriosum

CT angiography: computed tomography angiography; PMO VSD: perimembranous outlet ventricular septal defect; T3: 3rd thoracic vertebra; T4: 4th thoracic vertebra.

After establishing the diagnosis of a vascular ring by CTA, echocardiography was used to exclude cardiac abnormalities. The echocardiographer was usually able to comment on the location and branching pattern of the aortic arch, but could not visualise the vascular ring with certainty in most cases. Bronchoscopy was not used routinely in the evaluation of patients with vascular rings, except in the child with the impacted coin, as is the usual practice at our institution when extracting oesophageal foreign bodies. All patients with complete rings were treated by surgical division of the vascular ring, with the surgical approach guided principally by the CTA. Factors determining the approach included exposure of the vascular ring component to be divided, the laterality of the ligamentum arteriosum and the patency and calibre of all vascular structures as well as the trachea. Left thoracotomy was used in six patients, right thoracotomy in one

patient and median sternotomy in one patient who underwent concomitant ventricular septal defect closure. The CTA provided an accurate representation of the findings noted at surgery, and vascular ring division was completed uneventfully in all cases. All eight patients demonstrated symptomatic improvement post-operatively.

Discussion Vascular rings account for approximately 1% of all congenital cardiac anomalies, with the Edwardâ&#x20AC;&#x2122;s classification being the first to outline the embryological basis for the various aortic arch anomalies resulting in a complete or partial vascular ring.1 A vascular ring may be composed of a combination of patent vessels, atretic vascular segments or ligamentous structures.

CARDIOVASCULAR JOURNAL OF AFRICA â&#x20AC;˘ Volume 27, No 1, January/February 2016

AFRICA

Fig. 1. R ed herrings. (A) The postero-anterior and (B) lateral plain chest radiographs illustrate the ingested coin in the oesophagus, superimposed on a widened superior mediastinal silhouette. The stridor persisted following extraction of the coin, prompting a computed tomography angiogram (CTA) that confirmed a double aortic arch.

Complete vascular rings may be divided into four major configurations, with double aortic arch being the most frequent variation encountered, followed by right aortic arch with aberrant left subclavian artery and left ligamentum.2 Innominate artery compression and pulmonary vascular slings are other configurations infrequently seen.2,3 Double aortic arches may present with earlier clinical symptoms than other configurations.2 In a symptomatic patient with a vascular ring, the plain chest radiograph will invariably demonstrate some abnormality.1 On the frontal film, the presence of a right aortic arch, right descending aorta or focal tracheal indentation should be noted, while the lateral chest radiograph may illustrate anterior tracheal bowing, increased retrotracheal soft tissue opacification, as well as focal tracheal narrowing.1,4 A high kV magnification technique may be used to exclude tracheal narrowing on the plain chest radiograph.4 The aortic arch may not be clearly visualised on frontal CXR in infants due to obscuration by the thymic shadow.3 Although useful to prompt further imaging, these signs are not useful to identify the specific type of vascular ring configuration. The frontal CXR mediastinal silhouette of any child with aerodigestive tract symptoms should always be carefully scrutinised despite an apparently obvious alternative aetiology, such as a foreign body.6 The contrast oesophagogram is useful to exclude the presence of a vascular ring, particularly in patients with persistent asthma or aspiration symptoms unresponsive to standard treatment.3 A persistent, extrinsic pulsatile indentation seen in multiple views during a contrast study of the oesophagus (generally laterally with double aortic arches and anteriorly with pulmonary artery sling) is highly suggestive of a vascular ring, while a normal study effectively excludes the diagnosis of a vascular ring.4 Occasionally an alternative diagnosis, such as aspiration or tracheo-oesophageal fistula, may be identified.3

CO is widely available, cheap and relatively non-invasive, all important characteristics in underdeveloped areas of South Africa, where access to advanced imaging may require referral to a tertiary centre a significant distance away. While CXR and CO may confirm the presence of a vascular ring, cross-sectional imaging is required to confirm the specific configuration of the ring and enable surgical planning, and to exclude another cause of a fixed extrinsic oesophageal indentation, such as a mediastinal foregut duplication cyst.5,6 Detailed cross-sectional imaging, in the form of computed tomography angiography or magnetic resonance imaging, is

Fig. 2. Double aortic arch. This axial CTA image illustrates the characteristic appearance of a double aortic arch, with both arches widely patent and contrast enhanced. The LA and RA encircle the oesophagus and trachea (asterisk) to form a complete vascular ring. LA: left arch; RA: right arch.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Fig. 3. D ouble aortic arch with both arches patent. (A) The plain chest radiograph demonstrates a widened superior mediastinal silhouette, with the presence of a right aortic arch in this child with stridor and dysphagia. (B) The reconstructed postero-anterior CTA image illustrates the double aortic arch, with the LA and RA patent and of similar calibre at the confluence with the DA. Clearly illustrated are the head and neck vessels, which arise individually from their respective aortic arches, hence the ‘four-vessel sign’ used to aid diagnosing a vascular ring radiologically. LA: left arch; RA: right arch; DA: descending aorta; LSA: left subclavian artery; LCA: left carotid artery; RSA: right subclavian artery; RCA: right carotid artery.

a crucial aspect of illustrating the detailed ring configuration and to facilitate surgical planning.3 Patent vascular channels are evident on CTA as contrast-enhancing segments, and are well visualised on reconstructed images (Figs 2, 3). Conversely, atretic vascular segments and ligaments are not evident on contrast-enhanced images (Figs 4, 5), but their presence can be inferred from traction on associated vascular structures or compression of the trachea.4 The ‘four-artery sign’ is a useful CTA radiographic sign which indicates an abnormal aortic branching pattern and is suggestive of a vascular ring.4 CTA allows multi-planar views to be obtained, with threedimensional reconstructions clearly illustrating vascular and tracheal relationships. CTA also allows detailed evaluation of the lung fields, particularly in patients with co-existing pulmonary disease.7 Inspiratory and expiratory CTA studies allow the dynamic evaluation of tracheal calibre for narrowing or traction, which is particularly important in patients with associated tracheo- or bronchomalacia.2,3,8 CTA is generally easily accessible and diagnostic interpretation relatively straightforward.2 CT scanning times are shorter than MRI and therefore sedation is usually not necessary, a significant advantage in a stridulous patient.2,4 The principle disadvantages of CTA are the need for intravenous contrast agents, and the potential late consequences of radiation-dose exposure.9 Vascular ring patients are only exposed to a single CTA, as serial imaging is not indicated before or after surgery. In the absence of basic investigations (CXR and CO) consistent with a vascular ring, CTA should not be used as a screening tool to exclude the diagnosis, except in a critically ill patient in whom the diagnosis is considered. Like CTA, MRI is a sensitive imaging tool for visualising vascular ring configuration. Advantages of MRI over CTA include the freedom from exposure to both radiation and intravenous contrast, as well as the ability to undertake haemodynamic studies in patients with intracardiac lesions. The limitations of MRI include the longer scanning time than CTA, the need for sedation in paediatric patients, and limited accessibility and reporting expertise in the developing world. Sedating patients with stridor resulting from a vascular ring requires rigorous monitoring to avoid potential airway obstruction, and is usually undertaken by specially trained nursing staff and in some instances senior MRI specialists.10 Endotracheal intubation is avoided to allow accurate tracheal cross-sectional evaluation.2 MRI demands more in terms of human resources, expertise and time. Despite its availability at our institution, CTA remains the favoured modality to obtain cross-sectional imaging of both the vascular ring and the trachea. Echocardiography is used principally to investigate intracardiac abnormalities that will be present in approximately 12.4% of vascular ring patients.2 However, echocardiography is a poor imaging tool to either establish or exclude the diagnosis of a vascular ring due to poor acoustic windows, ligamentous structures and hyperinflation of the lungs.2,8 In the past, conventional catheter angiography (CCA) was used, in conjunction with CXR and CO, to elucidate the exact configuration of a vascular ring and thus plan surgery. In the current era, non-invasive imaging modalities are preferred and CCA is reserved for the investigation of concomitant intracardiac lesions to obtain angiographic and haemodynamic data.4

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

AFRICA

Fig. 4. D ouble aortic arch with an atretic left aortic arch. (A) The plain chest radiograph suggests a right aortic arch, with a widened right paratracheal shadow. (B) and (C) The axial CTA images confirm the dominant RA, with the non-dominant LA consisting of a short patent segment near the DA and a longer atretic segment (between the yellow asterisks). The LA, together with the left ligamentum arteriosum, completes the vascular ring encircling the aerodigestive tract (red asterisk). (D), (E), (F) Postero-anterior oblique CTA reconstruction views illustrate the position of the atretic and thus ‘invisible’ left aortic arch (between the white asterisks), thereby completing the ring. RA: right arch; LA: left arch; S: superior vena cava; DA: descending aorta; AA: ascending aorta.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

* *

Fig. 5. R ight aortic arch with aberrant left subclavian artery and left ligamentum arteriosum. (A) The plain chest radiograph demonstrates an abnormal superior mediastinal silhouette, suggesting a right aortic arch. (B) Frontal contrast oesophagogram (CO) demonstrates the fixed, extrinsic indentation (asterisk) of the mid-thoracic oesophagus from the right aortic arch. (C) The oblique postero-anterior view on CO demonstrates a second indentation (asterisk) due to the aberrant left subclavian artery. (D) The reconstructed oblique postero-anterior CTA image illustrates the aberrant left subclavian artery arising from the proximal descending aorta and being tethered at the base (white asterisk) by the radiographically invisible ligamentum arteriosum, which completes the vascular ring in this case. (E) Abnormal enlargement at the base of the aberrant left subclavian artery (black asterisk) is termed a ‘Kommerell diverticulum’, which may become aneurysmal and require excision due to compressive effects. RA: right arch; DA: descending aorta; ALSA: aberrant left subclavian artery.

Bronchoscopy is useful for the airway evaluation of patients with vascular rings, particularly in patients with complete tracheal rings, tracheo- or bronchomalacia, or the identification of an aberrant subclavian artery.2 In patients with significant proximal bronchus narrowing, CTA is superior to bronchoscopy in evaluating the distal airways.7 Vascular rings are corrected surgically.8 Historically, surgical exploration was undertaken based on CXR, CO and

echocardiography alone, occasionally leading to incorrect thoracotomy placement (and associated morbidity) when the intra-operative anatomy was inconsistent with the pre-operative imaging. In the current era, pre-operative cross-sectional imaging in the form of CTA or MRI allows accurate surgical planning, and is considered mandatory.2,8 We found excellent correlation between CTA imaging and intra-operative findings. The goal of surgery is to divide all vascular or ligamentous

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

structures constricting the trachea and oesophagus. In double aortic arch, the non-dominant aortic arch (which may be patent or atretic) and the ligamentum arteriosum are divided. In the right aortic arch, aberrant left subclavian artery and left ligamentum arteriosum variant, the ligamentum alone is divided. Occasionally, a Kommerell diverticulum at the base of the aberrant subclavian artery requires excision in the primary operation, in order to avoid aneurysmal dilatation and recurrence of symptoms.2 Right thoracotomy is indicated in the unusual situation when a left aortic arch, aberrant right subclavian artery, right descending aorta and right ductus arteriosus is present.4,5 Median sternotomy is generally reserved for the correction of associated intracardiac anomalies, and the repair of pulmonary artery slings with or without sliding tracheoplasty. Following vascular ring division, there is usually an improvement in clinical symptoms over the ensuing weeks to months. No further imaging is indicated in asymptomatic patients following surgery.

AFRICA

This study was approved by the Biomedical Research Ethic Committee of the University of KwaZulu-Natal (BE143/13). The authors acknowledge the assistance of Dr JM Kalideen for his expert interpretation and independent review of the imaging. We have no conflicts of interest or funding declarations.

References 1.

Stewart JR, Kincaid OW, Edwards JE. An Atlas of Vascular Rings and Related Malformations of the Aortic Arch System. Springfield, IL: Charles C Thomas, 1964.

Backer CL, Mavroudis C, Rigsby CK, Holinger LD. Trends in vascular ring surgery. J Thorac Cardiovasc Surg 2005; 129: 1339–1347.

Hernanz-Schulman M. Vascular rings: a practical approach to imaging diagnosis. Pediatr Radiol 2005; 35: 961–979.

Lowe GM, Donaldson JS, Backer CL. Vascular Rings: 10-year review of imaging. Radiographics 1991; 11: 637–646.

Pickhardt PJ, Siegel MJ, Gutierrez FR. Vascular rings in symptomatic children: frequency of chest radiographic findings. Radiology 1997;

Conclusions The diagnostic imaging algorithm for vascular rings has evolved in tandem with the development of advanced non-invasive imaging modalities such as CTA or MRI, which have become the standard imaging techniques used to confirm the diagnosis and guide surgical management. The choice between CTA and MRI or vice versa remains an institutional preference, and is usually based on logistic issues such as accessibility to the imaging modality, the expertise required to undertake the study and the preference of the radiologist and surgeon interpreting the images. In our practice, CTA is the preferred cross-sectional imaging modality and provides excellent correlation with intraoperative findings.

203(2): 423–426. 6.

Roesler M, De Leval M, Chrispin A, Stark J. Surgical management of vascular rings. Ann Surg 1983; 197(2): 139–146.

Browne LP. What is the optimal imaging for vascular rings and slings? Pediatr Radiol 2009; 39: 191–195.

Van Son JA, Julsrud PR, Hagler DJ, Sim EK, Puga FJ, Schaff HV, et al. Imaging strategies for vascular rings. Ann Thorac Surg 1994; 57; 604–610.

Pearce MS, Salotti JA, Little MP, McHugh K, Lee C, Kim KP, et al. Radiation exposure from CT scans in childhood and subsequent risk of leukaemia and brain tumours: a retrospective cohort study. Lancet 2012; 380: 499–505.

10. Humphrey C, Duncan K, Fletcher S. Decade of experience with vascular rings at a single institution. Pediatrics 2006; 117: 903–908.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

The change in right ventricular systolic function according to the revascularisation method used, following acute ST-segment elevation myocardial infarction Ilker Gul, Mustafa Zungur, Ahmet Cagri Aykan, Tayyar Gokdeniz, Mustafa Beyazit Alkan, Ahmet Sayin, Aysel Islamli, Murat Bilgin, Ezgi Kalaycioğlu, Turhan Turan

Abstract Objective: The level of right ventricular (RV) systolic function has prognostic importance in right ventricular ST-segment elevation myocardial infarction (RV-STEMI). This study aimed to evaluate the changes in RV systolic function in patients with RV-STEMI according to the revascularisation method used for their management. Methods: The first group consisted of 132 patients who received primary percutaneous coronary intervention (PPCI). The 78 patients who had received thrombolytic therapy (TT) in external centres before referral to our centre for PCI within three to 12 hours of RV-STEMI were included in the second group. All patients were evaluated by conventional and twodimensional speckle-tracking echocardiography. Results: There were 172 male patients and their mean age was 63.7 ± 11.8 years. There were no significant differences between the two groups with regard to right ventricular systolic parameters at admission and at the one-month follow-up visit. The echocardiographic changes between admission and the one-month follow up were investigated for the patients included in the study groups. Mean values of

Department of Cardiology, Faculty of Medicine, Şifa University, Izmir, Turkey Ilker Gul, MD, drilkergul46@gmail.com Mustafa Zungur, MD Aysel Islamli, MD

Department of Cardiology, Ahi Evren Thoracic and Cardiovascular Surgery Training and Research Hospital, Trabzon, Turkey Ahmet Cagri Aykan, MD Ezgi Kalaycioğlu, MD Turhan Turan, MD

Department of Cardiology, Faculty of Medicine, Kafkas University, Kars, Turkey Tayyar Gokdeniz, MD

Department of Cardiology, Acıpayam State Hospital, Denizli, Turkey Mustafa Beyazit Alkan, MD

Department of Cardiology, Tepecik Education and Research Hospital, Izmir, Turkey Ahmet Sayin, MD

Department of Cardiology, Dışkapı Yıldırım Beyazıt Training and Research Hospital, Ankara, Turkey Murat Bilgin, MD

each parameter observed at the one-month follow up were significantly increased compared to those at admission within each group. Conclusion: Our study demonstrated that PCI within three to 12 hours following TT provided similar benefits on right ventricular systolic function compared to PPCI in patients with RV-STEMI.

Keywords: ST-elevation myocardial infarction (STEMI), primary percutaneous coronary intervention (PPCI), thrombolytic therapy (TT), right ventricular systolic function Submitted 19/5/15, accepted 3/10/15 Cardiovasc J Afr 2016; 27: 37–44

www.cvja.co.za

DOI: 10.5830/CVJA-2015-077

ST-elevation myocardial infarction (STEMI) is characterised by a loss of contractile tissue and a change in ventricle geometry that causes substantial impairment of the ventricular systolic and diastolic functions.1 In coronary artery disease (CAD), left ventricular (LV) function has been widely evaluated by means of echocardiographic methods. LV function has long been known to be among the most important determinants of morbidity and mortality.2,3 However, the right ventricle (RV) has been the subject of fewer studies compared to the left ventricle. RV-STEMI has been reported in 10 to 60% of patients with inferior STEMI.4-6 The co-existence of inferior STEMI and RV-STEMI has been shown to increase morbidity and mortality rates.7,8 The time lapse between the onset of symptoms and admission to hospital is known as the symptom-to-door time. Myocardial damage and cardiac complications are more likely to progress with prolonged periods without intervention after STEMI.9,10 Current guidelines emphasise the benefits of reperfusion within the first 12 hours after STEMI. Successful reperfusion within the first three hours is reported to provide improved prognosis. For this purpose, the selection of appropriate reperfusion strategy is an important discussion topic. Reperfusion strategies include fibrinolysis and primary percutaneous coronary intervention (PPCI) techniques. PPCI is preferable in a 24-hours-a-day, seven-days-a-week centre with an established coronary intervention facility. When the transfer time from centres without coronary intervention laboratories does not exceed 120 minutes and the door-to-balloon time does not exceed 90 minutes, PPCI is again

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

the preferred method for revascularisation. If these requirements are not met, fibrinolytic therapy may be performed for the patients. RV-STEMI requires immediate revascularisation in affected patients. Revascularisation can be achieved with methods such as percutaneous coronary intervention or thrombolytic therapy. Current guidelines recommend the appropriate treatment of coronary arteries after performing coronary angiography within three to 24 hours following TT. 11,12 This study aimed to evaluate the effects of coronary intervention on right ventricular systolic function by comparing PPCI with PCI performed within three to 12 hours of TT, as assessed by transthoracic echocardiography, in patients with RV-STEMI.

Methods This prospective, observational cohort study was carried out between January 2012 and February 2013. We interviewed 210 patients who met the criteria for admission and had had inferior myocardial infarction with right ventricular involvement (RV-STEMI) for the first time. RV-STEMI was defined as new ST-segment elevation ≥ 0.1 mV at the J-point in two contiguous inferior leads accompanied by new ST-segment elevation ≥ 0.1 mV in the right ventricular leads (V3R–V4R). Patients who had infection, heart muscle disease or chronic inflammatory disease were not included in the study. At hospital admission, the patients who had cardiogenic shock, chronic pulmonary disease or systolic pulmonary artery pressure > 35 mmHg, renal failure (creatinine > 2.5 mg/dl) or a history of cerebrovascular events were also excluded from the study. Since RV systolic function was evaluated in our study, those who had diseases such as pulmonary hypertension that could impair the RV systolic function were excluded from the study. As right heart catheterisation could not be applied during primary PCI, the patients with echocardiographically measured systolic pulmonary arterial pressure > 35 mmHg were not included in the study. Patients with unknown time of symptom onset or a StD time longer than 12 hours were also not included in the study. The patients were divided into two groups according to admission to hospital; 132 patients who underwent PPCI were identified as the first group. Seventy-eight patients who underwent PCI in our centre within three to 12 hours after receiving TT in other centres were included in the second group. Our centre is a tertiary hospital and coronary intervention facilities are available 24 hours a day, seven days a week. Patient records are kept on a regular basis, starting at admission to the emergency department. In addition to these data, the onset of symptoms was sought from the patients themselves or their relatives. The exact time of patient admission in the emergency department was identified as door-time. Symptom-to-door (StD) time was determined by calculating the difference between the two periods. The exact time the patient’s coronary balloon had been inflated was recorded in the angiography laboratory. The time lapse from the patient’s admission to the emergency department to inflating the balloon was calculated as doorto-balloon time (DtB). Symptom-to-balloon (StB) time was calculated in addition to StD and DtB. Symptom-to-needle (StN) time was calculated as the time from the initial onset of

AFRICA

symptoms to the start of thrombolytic drug administration. The time lapse from the patient’s admission to the emergency department to the start of thrombolytic drug administration was calculated as door-to-needle time (DtN). During the study, intervention was performed only for the culprit arteries responsible for the infarction. Elective interventions were performed for the other lesions. The invasive treatment methods applied during PCI, and balloon and stent diameters and lengths were recorded. The diameters of the vessels with lesions were calculated from the coronary angiography examinations. Traditional variables that have been used to assess response to TT were decrease in chest pain, ST-segment resolution and reperfusion arrhythmias. Patients who had < 50% ST-segment resulution were excluded from the study. Patients who required rescue PCI, patients scheduled for coronary artery bypass grafting (CABG) or those who underwent percutaneous intervention for all critical lesions due to haemodynamic instability were also excluded from the study. Patients with a DtB time longer than 30 minutes in the PPCI group, and those with a door-to-needle (DtN) time longer than 30 minutes in the TT group were not included in the study. All patients received dual antiplatelet therapy with acetylsalicylic acid and clopidogrel (300–600 mg) loading dose before coronary intervention. Peri-procedural anticoagulation consisted of intravenous unfractioned heparin (70 IU/kg) in all cases. Clopidogrel (75 mg per day) and acetylsalicylic acid (100 mg per day) were prescribed for at least one year. Blood samples were collected from each subject immediately after presenting at the emergency department. Cardiac enzymes, liver function tests, kidney function tests, complete blood count and thyroid function tests were performed on these samples.

Echocardiography A Vivid-S5 echocardiography device is readily available in the emergency department of our centre (General Electric Vingmed Ultrasound, Horten, Norway, with a 3.6-MHz transducer). Echocardiographic evaluation is performed rapidly in all patients presenting at the emergency room (ER) with acute coronary syndrome (ACS). Imaging is performed by the echocardiography operator simultaneously while patients with STEMI are prepared for coronary intervention. In our study, prolonged StD durations were avoided in order to assess echocardiographic parameters. Echocardiographic evaluation of the RV is more difficult than that of the LV. An appropriate imaging window may not be achieved due to restrictions caused by the sternum and other anatomical structures. Therefore, patients with inadequate echocardiographic imaging quality were excluded from the present study. American Society of Echocardiography (ASE) recommendations were followed for the evaluation of RV systolic function. RV end-systolic and end-diastolic diameters were measured from the left parasternal long-axis view. RV basal, mid and longitudinal diameters were measured from the apical four-chamber view. Endocardium margins were drawn from the tricuspid annulus to the RV apex and from there to the opposite side of the tricuspid annulus in the apical four-chamber view in order to calculate RV fractional area change (RV-FAC). End-systole and end-diastole areas were individually calculated

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

with this approach. RV-FAC was determined by means of the formula: end-diastole area – end-systole area

____________________________      RV-FAC =       end-diastole area

Tricuspid annular plane systolic excursion (TAPSE) was calculated by measuring the movement magnitude of the RV annular segment in the longitudinal plane using the M-mode method. This measurement was performed on the apical fourimaging window of the tricuspid lateral annulus. Right ventricle isovolumic acceleration (RV-IVA) was calculated by dividing the peak isovolumic myocardial velocity calculated at the time of isovolumic contraction by the time to peak velocity using tissue Doppler on the lateral tricuspid annulus. RV-S′ was calculated by measuring systolic velocity using tissue Doppler on the right ventricular lateral tricuspid annulus. Right ventricle myocardial performance index (RV-MPI) is one of the methods recommended for the evaluation of global RV function. It was calculated by dividing the sum of isovolumic contraction time (IVCT) and isovolumic relaxation time (IVRT) by the tricuspid ejection time: 13-17 IVRT + IVCT

____________ RV-MPI =        ET

Left ventricular ejection fraction (LVEF) was calculated from the four- and two-chamber views using the modified Simpson biplane method. LV wall-motion score index (LV-WMSI) was calculated according to the 16-segment model of the American Society of Echocardiography. In accordance with this model, normokinesis, mild-moderate hypokinesis, severe hypokinesis, akinesia and dyskinesia were evaluated with the scores 1, 2, 3, 4 and 5, respectively. The total value was divided into the evaluated segment number and WMSI was obtained.18 Echocardiographic examinations were performed by the same investigators, who were blinded to the patients’ data, at baseline and after the first month. All measurements were calculated from three consecutive cycles, and the average of the three measurements was recorded.

Speckle-tracking echocardiography Two-dimensional speckle-tracking echocardiography (2D STE) is a novel technique used for the measurement of cardiac mechanics. It assesses myocardial deformation and the myocardial deformation rate by tracking speckles in the myocardium on grayscale (B-mode) images, and can be used to evaluate both global and regional myocardial strain and strain rate.19,20 The investigations were performed with the patients in the left lateral decubitus position, in the parasternal and apical four-chamber views. Digital routine grayscale 2D ciné loops and tissue Doppler ciné loops were obtained from three consecutive beats with end-expiratory apnoea from standard apical fourand two-chamber views. Frame rates of 70–90 Hz were used for routine grayscale imaging in the speckle-tracking analysis. Sector width was optimised to allow for complete myocardial visualisation while maximising the frame rate. Gain settings were adjusted for routine clinical grayscale 2D imaging to optimise endocardial definition. Longitudinal deformation in the RV free wall was assessed

by 2D speckle-tracking longitudinal strain using a routine grayscale RV focused-view image, which was performed offline with dedicated software (EchoPAC 108.1.12, General ElectricVingmed Medical Systems, Horten, Norway) by one experienced cardiologist blinded to data about the patients’ status. Briefly, a region of interest (ROI) was traced with a pointand-click approach on the endocardium at end-diastole in the RV from the RV focused view. A second, larger ROI was then generated and manually adjusted near the epicardium. The RV was divided into six standard segments (at the basal, middle and apical levels), and six corresponding time–strain curves were generated. RV free-wall longitudinal speckle-tracking strain (RV-free-S) was calculated by averaging each of the three regional peak systolic strains along the entire RV free wall and RV free systolic strain rate (RV-free-SR), were calculated in the same manner. The patients were prospectively followed during the in-hospital period and first month after RV-STEMI. Informed consent was obtained from each subject, and the study was conducted in accordance with the Helsinki Declaration. The study protocol was approved by the ethics committee.

Variability analysis Intra- and inter-observer variability were assessed in the echocardiographic data obtained from a subgroup of 30 subjects. One month later, the first operator repeated the analysis to assess intra-observer variability. To assess inter-observer variability, the second operator who was unaware of the previous measurements, analysed the rotational parameters two days later. Agreement analysis for inter- and intra-observer variability of RV measurements revealed a high level of agreement, with a mean difference of 0.18 (95% limit of agreement –0.5, 0.96). For intra-observer variabilities, intraclass correlation coefficient of RV-free-ST and RV-free-STR-S were 0.907 (95% CI 0.840–0.943) and 0.954 (95% CI 0.823–0.967), respectively.

Statistical analysis SPSS 17 (SPSS Inc, Chicago, IL, USA) was used for statistical analysis. The Kolmogorov–Smirnov test was used to evaluate whether the numerical variables were normally distributed. For data showing an abnormal distribution, median and interquartile ranges were displayed. Continuous variables were presented as mean ± standard deviation, and categorical ones were presented as percentage (%). The two study groups were compared using the Student’s t-test or Mann–Whitney U- and chi-squared or Fisher’s exact tests, as appropriate. In each group, follow-up comparisons (early period and one month) were performed using the paired t-test and Wilcoxon rank test, as appropriate. Intraclass correlation coefficients and Bland–Altman analysis were used for echocardiographic measurements to assess intra- and interobserver reproducibility, respectively. A p-value < 0.05 was considered statistically significant.

Results There were 172 male patients in the study and the mean age was 63.7 ± 11.8 years. One-month clinical follow up was available

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

in all 172 patients (100.0%). There was no difference between the groups in terms of age, diabetes, hypertension and smoking status, and length of hospital stay. Average values were similar for heart rate, and systolic and diastolic blood pressure. Creatinine and troponin I values were higher in the TT group. No difference was found between the groups with regard to blood glucose and haemoglobin levels, and platelet count. The StD time from the onset of symptoms to admission to hospital was similar across the patients who had received similar medical treatment. Average DtB duration was 20.2 minutes for the PPCI group. DtN time was 23.2 minutes and StN time was 291.7 minutes in the TT group. Although the mortality rate in the first month was higher in the TT group, the difference was not statistically significant (p = 0.077). Re-MI and re-hospitalisation rates were similar between the groups during the first month. There were more ventricular tachycardia (p = 0.039) and ventricular fibrillation (p = 0.005) cases in the TT group. Rate of atrioventricular block of at least second degree, observed during the hospital stay, was similar. Table 1. General characteristics, cardiac complications and laboratory results of the patients according to the study groups Parameter

PPCI (n = 132)

TT + PCI (n = 78)

p-value

Age (years)

64.3 (± 12.1)

62.9 (±10.2)

0.128

Diabetes mellitus, n (%)

25 (18.9)

21 (26.9)

0.120

Hypertension, n (%)

73 (55.3)

41 (52.6)

0.404

Current smoking, n (%)

AFRICA

Rates of TIMI 0 and TIMI I–II flow following PCI were similar across the groups. The groups were similar in terms of SYNTAX score, one of the indicators of extent and complexity of coronary lesion (Table 1). There was no difference between the two groups regarding RV dimensions, volumes and function on admission to our hospital. There was no difference between the two groups with regard to the conventional RV systolic parameters, RV dimensions and volumes at the one-month follow up. There was no difference between the groups regarding the LVEF and LV-WMSI on admission to hospital and at the one-month follow up (Table 2). Echocardiographic changes between admission and one-month follow up were investigated for the patients included in the study groups. Mean values of each parameter were significantly increased at the one-month follow up compared to the early period within each individual group (Table 3). 2D-STE analysis of the RV revealed that the study groups had similar RV-free-S and RV-free-SR levels in the early period and at the one-month follow up (Tables 2, 3). According to these results, the strain/strain rates of the RV segments in both groups were significantly lower in the early period than those at the one-month follow up. In addition, changes in the RV mean strain/strain rates were significantly different (Table 3).

Table 2. Right and left ventricular echocardiographic parameters according to the groups First 12 hours (early period)

First month after RV-STEMI

64 (48.5)

47 (60.3)

0.066

Heart rate (beats/min)

61.8 (± 21.1)

63.9 (± 20.72)

0.480

Parameter

SBP (mmHg)

123.9 (± 29.5)

128.6 (± 34.12)

0.292

RV basal (mm) 37.3 (± 4.4) 37.9 (± 5.1)

0.325

34.3 (± 6.1) 33.8 (± 7.4)

0.128

DBP (mmHg)

75.1 (± 17.3)

78.4 (± 20.2)

0.206

RV mid (mm)

31.8 (± 2.4) 31.2 (± 3.5)

0.240

26.9 (± 3.6) 27.5 (± 2.8)

0.838

RV longitudinal (mm)

72.2 (± 5.4) 73.1 (± 2.4)

0.486

65.3 (± 2.4) 66.1 (± 2.4)

0.214

RV-eDV 64.3 (± 9.4) 63.2 (± 5.6) indexed (ml/m2)

0.082

56.9 (± 4.7) 57.1 (± 8.7)

0.762

RV-eSV 37.1 (± 4.3) 38.6 (± 3.9) indexed (ml/m2)

0.844

30.1 (± 2.9) 31.9 (± 3.0)

0.274 0.934

Creatinine (mg/dl)

0.98 (± 0.39)

1.16 (± 0.83)

0.048

Peak troponin I (ng/dl)

61.7 (41.2–105.3)

88.3 (48.3–166.8)

0.006

Blood glucose (mg/dl)

151.4 (87.5–245.3) 164.5 (92.7–261.3)

0.251

Haemoglobin (mg/dl)

PPCI

TT+PCI

p-value

PPCI

TT+PCI

p-value

13.5 (± 1.9)

13.6 (± 1.7)

0.521

245.9 (± 59.9)

253.1 (± 53.3)

0.465

Clopidogrel, n (%)

132 (100)

78 (100)

1.000

RVEF (%)

43.1 (± 8.3) 42.6 (± 8.8)

0.978

49.9 (± 7.2) 49.3 (± 7.2)

Acetylsalicylic acid, n (%)

132 (100)

78 (100)

1.000

RV-FAC (%)

29.9 (± 7.4) 29.4 (± 7.4)

0.458

33.3 (± 6.8) 34.2 (± 6.8)

0.110

Beta-blocker, n (%)

108 (81.8)

60 (76.9)

0.247

16.1 (± 4.0) 16.7 (± 4.2)

0.082

22.4 (± 3.8) 21.8 (± 3.9)

0.102

Statin, n (%)

131 (99.2)

77 (98.7)

0.983

RV-TAPSE (mm)

ACE/ARB, n (%)

118 (89.4)

66 (84.6)

0.131

RV-MPI

0.49 (± 0.09) 0.50 (± 0.12) 0.648 0.41 (± 0.12) 0.40 (± 0.14) 0.365

8 (6.1)

7(8.9)

0.557

RV-IVA (m/s2) 2.24 (± 0.64) 2.31 (± 0.52) 0.121 2.99 (± 0.63) 2.90 (± 0.55) 0.071

VT, n (%)

18 (13.6)

19 (24.4)

0.039

RV-S′ (cm/s)

9.1 (± 1.7)

VF, n (%)

3 (2.2)

9 (11.5)

0.005

RV apical strain (%)

–9.7 (± 1.8) –10.1 (± 1.5) 0.286 –16.6 (± 2.9) –15.9 (± 2.1) 0.293

RV mid strain (%)

–14.1 (± 2.3) –14.9 (± 1.9) 0.351 –22.6 (± 3.6) –21.2 (± 2.1) 0.102

Platelets (103/μl)

Total mortality, n (%)

High-degree AV block, n (%)

16 (12.1)

8 (10.2)

0.246

Post-PCI TIMI 0 flow rate, n (%)

3 (2.3)

1 (1.3)

0.618

Post-PCI TIMI I–II flow rate, n (%)

9 (6.8)

4 (5.1)

0.643

Pre-PCI SYNTAX score

22.1 (± 8.8)

21.2 (± 21.1)

0.511

Post-PCI SYNTAX score

8.4 (± 8.6)

9.1 (± 7.2)

0.568

Intensive care unit (days)

3.58 ± 1.19

3.85 ± 2.21

0.252

Duration of hospital stay (days)

6.48 ± 3.17

7.03 ± 4.71

0.322

9.5 (± 1.1)

0.212

11.3 (± 3.2) 10.9 (± 3.2)

0.094

RV basal strain –18.2 (± 4.7) –17.6 (± 2.0) 0.422 –24.8 (± 4.1) –24.2 (± 2.1) 0.434 (%) RV free strain (%)

–14.0 (± 2.7) –14.2 (± 1.7) 0.429 –21.3 (± 3.3) –20.4 (± 3.7) 0.102

RV apical –0.8 (± 0.4) –0.9 (± 0.3) strain rate (1/s)

0.424

–1.5 (± 0.5) –1.4 (± 2.1)

0.624

RV mid strain rate (1/s)

–1.1 (± 0.6) –1.0 (± 0.5)

0.435

–2.2 (± 0.4) –2.1 (± 2.1)

0.743

285.9 ± 135.1

268.5 ± 141.8

0.577

Mortality in hospital, n (%)

6 (4.6)

5 (6.4)

0.108

Mortality rate after discharge from hospital, n (%)

2 (1.5)

2 (2.5)

0.591

RV basal strain –1.7 (± 0.6) –1.6 (± 0.4) rate (1/s)

0.515

–2.3 (± 0.5) –2.2 (± 2.1)

0.802

Re-MI after discharge from hospital, n (%)

2 (1.5)

2 (2.5)

0.591

RV free strain rate (1/s)

–1.2 (± 0.4) –1.2 (± 0.5)

0.512

–2.0 (± 0.4) –1.9 (± 0.6)

0.292

Re-hospitalisation, n (%)

4 (3.0)

3 (3.8)

0.856

LVEF (%)

49.3 (± 8.3) 48.4 (± 7.6)

0.094

52.2 (± 6.6) 51.9 (± 8.3)

0.498

LV-WMSI

1.48 (± 0.27) 1.52 (± 0.34) 0.413 1.16 (± 0.25) 1.21 (± 0.31) 0.128

Symptom-to-door time (min)

ACE: angiotensin converting enzyme; ARB: angiotensin receptor blocker; AV: atrioventricular; DBP: diastolic blood pressure; MI: myocardial infarction; PCI: percutaneous coronary intervention; PPCI: primary percutaneous coronary intervention; SBP: systolic blood pressure; DBP: diastolic blood pressure; TT: thrombolytic therapy; VT: ventricular tachycardia; VF: ventricular fibrillation.

eDV: end-diastolic volume; EF: ejection fraction; eSV: end-systolic volume; FAC: fractional area change; IVA: isovolumic acceleration; LV: left ventricle; MPI: myocardial performance index; RV: right ventricle; S′: tissue Doppler systolic wave; TAPSE: tricuspid annulus planimetric systolic excursion; WMSI: wall motion score index.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Evaluation of the angiographic parameters in the PPCI and TT groups revealed a higher number of patients with singlevessel disease in the TT group. Triple-vessel disease was more common in the PPCI group. The groups were similar in terms of bifurcation lesion, left dominance, drug-eluting stent use, direct stenting, coronary ectasia, thrombus aspiration and tirofiban infusion. Similar balloons were used with regard to diameters and lengths. Increased stent diameters (p = 0.015) and lengths (0.005) were observed in the PPCI group (Table 4).

Discussion The results of this study demonstrated similar levels of improvement in RV function among patients managed with PCI within three to 12 hours from TT, and those managed with PPCI following RV-STEMI. There are several conventional methods of assessing RV systolic function that should be incorporated into a routine echocardiographic assessment. These are FAC, TAPSE, RV-S′, and MPI. It is strongly recommended that at least one of the above quantitative measures be incorporated into the routine echocardiographic examination. 2D-derived estimation of RV ejection fraction is not recommended because of the heterogeneity of methods and the numerous anatomical assumptions.13 Table 3. Right ventricular systolic parameters according to the echocardiographic evaluation periods PPCI Parameter

TT+PCI

Early period First month p-value Early period First month p-value

RV basal (mm) 37.3 (± 4.4) 34.3 (± 6.1)

0.042 37.9 (± 5.1) 33.8 (± 7.4)

0.018

RV mid (mm)

31.8 (± 2.4) 26.9 (± 3.6)

0.005 31.2 (± 3.5) 27.5 (± 2.8)

0.026

RV longitudinal (mm)

72.2 (± 5.4) 65.3 (± 2.4)

0.038 73.1 (± 2.4) 66.1 (± 2.4)

0.032

RV-eDV 64.3 (± 9.4) 56.9 (± 4.7) indexed (ml/m2)

0.006 63.2 (± 5.6) 57.1 (± 8.7)

0.012

RV-eSV 37.1 (± 4.3) 30.1 (± 2.9) indexed (ml/m2)

0.008 38.6 (± 3.9) 31.9 (± 3.0)

0.017

49.9 (±7.2) < 0.001 42.6 (± 8.8) 49.3 (± 7.2) < 0.001

RVEF (%)

43.1 (± 8.3)

RV-FAC (%)

29.9 (± 7.4) 33.3 (± 6.8)

RV-TAPSE (mm)

16.1 (± 4.0) 22.4 (± 3.8) < 0.001 16.7 (± 4.2) 21.8 (± 3.9) < 0.001

RV-MPI

0.49 (± 0.09) 0.41 (± 0.12) < 0.001 0.50 (± 0.12) 0.40 (± 0.14) < 0.001

0.011 29.4 (± 7.4) 34.2 (± 6.8)

0.006

RV-FAC is one of the parameters recommended for the assessment of systolic function. However, this technique is dependent on imaging and the operator’s skill. Normal values of RV-FAC are accepted as > 35%.13 RV-FAC has been shown to correlate with RVEF in studies performed using magnetic resonance imaging (MRI). Heart failure, sudden death, stroke and pulmonary embolism have also been shown to predict mortality.13,19 In the present study, there was no difference between the groups with regard to mean RV-FAC values obtained before PCI and at the one-month follow up. Mean RV-FAC values observed at the one-month follow up were significantly increased within each group compared to the pre-PCI period. Isovolumic acceleration (IVA) is considered a useful method to evaluate RV systolic function.20 However this method is not without disadvantages. It is angle-dependent and may be influenced by age and heart rate. The lower limit of pulse wave with tissue Doppler was accepted as 2.2 m/s2, as per the guideline recommendations.13 In our study, there was no difference between the groups in terms of pre-PCI RV-IVA. Although pre-PCI, RV-IVA levels were low in the two groups, mean levels were improved to normal at the one-month follow up in both groups. The difference between the early period and the one-month follow up was significant in each group. MPI may be used for the assessment of global heart function.21 It enables evaluation of both systolic and diastolic function. Reduced ventricular systolic function shortens the ejection time, leading to increased MPI. MPI > 0.4 with pulse Doppler and MPI > 0.55 with tissue Doppler are considered direct indicators of impaired RV function.13 A normal MPI value is 0.28 ± 0.04 for the RV, and 039 ± 0.05 for the LV.22 In a study by Karakurt et al., patients who were managed with PPCI following non-anterior STEMI were compared to those who received TT alone, and similar mean RV-MPIs were observed in both groups at 72 hours after the infarction.23 In our study, there was no difference between the groups in terms of mean RV-MPI values observed before percutaneous intervention and at the one-month follow up. However, the mean RV-MPI

RV-IVA (m/s2) 2.24 (± 0.64) 2.99 (± 0.63) < 0.001 2.31 (± 0.52) 2.90 (± 0.55) < 0.001 11.3 (± 3.0) < 0.001

9.1 (± 2.2)

–9.7 (± 1.8) –16.6 (± 2.9) < 0.001 –10.1 (± 1.5) –15.9 (± 2.1) < 0.001

RV mid strain (%)

–14.1 (± 2.3) –22.6 (± 3.6) < 0.001 –14.9 (± 1.9) –21.2 (± 2.1) < 0.001

RV basal strain –18.2 (± 4.7) –24.8 (± 4.1) (%) RV free strain (%)

9.5 (± 1.1)

10.9 (± 3.0)

0.003

RV-S′ (cm/s) RV apical strain (%)

0.006 –17.6 (± 2.0) –24.2 (± 2.1)

–14.0 (± 2.7) –21.6 (± 3.3) < 0.001 –14.2 (± 1.7) –21.1 (± 3.7) < 0.001

RV apical –0.8 (± 0.4) –1.5 (± 0.5) < 0.001 –0.9 (± 0.3) –1.4 (± 2.1) strain rate (1/s) RV mid strain rate (1/s)

0.003

0.004

–1.1 (± 0.6) –2.2 (± 0.4) < 0.001 –1.0 (± 0.5) –2.1 (± 2.1) < 0.001

RV basal strain –1.7 (± 0.6) –2.3 (± 0.5) rate (1/s)

0.002 –1.6 (± 0.4) –2.2 (± 2.1) < 0.001

RV free strain rate (1/s)

–1.22 (± 0.4) –2.11 (± 0.4) < 0.001 –1.29 (± 0.5) –1.96 (± 0.6) < 0.001

LVEF (%)

49.3 (± 8.3) 52.2 (± 6.6)

LV-WMSI

1.48 (± 0.27) 1.16 (± 0.25) < 0.001 1.52 (± 0.34) 1.21 (± 0.31) < 0.001

0.048 48.4 (± 7.6) 51.9 (± 8.3)

0.040

eDV: end diastolic volume; EF: ejection fraction ; eSV: end-systolic volume; FAC: fractional area change; IVA: isovolumic acceleration; LV: left ventricle; MPI: myocardial performance index; RV: right ventricle; S′: tissue Doppler systolic wave; TAPSE: tricuspid annulus planimetric systolic excursion; WMSI: wall motion score index.

Table 4. Angiographic findings and coronary intervention characteristics between the groups PPCI (n = 132)

TT+PCI (n = 78)

p-value

One-vessel coronary disease, n (%)

32 (24.2)

29 (37.2)

0.045

Two-vessel coronary disease, n (%)

52 (39.4)

31 (39.8)

0.820

Three-vessel coronary disease, n (%)

48 (36.4)

18 (23.1)

0.031

LMCA stenosis, n (%)

10 (7.5)

5 (6.4)

0.675

RCA proximal occlusion, n (%)

42 (31.8)

28 (35.9)

0.162

Thrombus aspiration, n (%)

13 (9.8)

6 (8.1)

0.443

Bifurcation lesion, n (%)

19 (14.4)

17 (23.0)

0.087

9 (6.8)

8 (10.8)

0.285

Drug-eluting stents, n (%)

22 (16.7)

14 (19.2)

0.236

Direct stent implantation, n (%)

24 (18.2)

14 (19.2)

0.500

Coronary ectasia, n (%)

6 (4.5)

5 (6.4)

0.387

Balloon diameter (mm)

2.46 ± 0.38

2.54 ± 0.49

0.681

Balloon length (mm)

18.1 ± 4.03

17.6 ± 3.56

0.130

Left dominance, n (%)

Stent diameter (mm)

3.18 (2.50–4.25) 2.96 (2.55–4.05)

0.015

Stent length (mm)

28.6 (14.5–38.5) 23.0 (15.3–34.8)

0.005

LMCA: left main coronary artery; PCI: percutaneous coronary intervention; PPCI: primary percutaneous coronary intervention; TT: thrombolytic therapy.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

values were significantly improved during the later period compared to the early period. TAPSE is easily obtainable and is a measure of RV longitudinal function.13 The preferred method to evaluate RV systolic function is often TAPSE, which is known to correlate with RVEF.24 TAPSE > 15 mm is reported to substantially decrease mortality rates.14,25 As Hayrapetyan et al. have shown, TAPSE < 14 during the 24 hours following RV-STEMI is associated with a poor prognosis.26 In our study, mean TAPSE values were improved at the one-month follow up in both groups. Mean TAPSE was similar between the groups in the early period and at the one-month follow up. RV-S′ is a very reliable and easily measured parameter in young adults. However, it may fail to fully reflect systolic function in the elderly. It can be measured from the tricuspid lateral annulus by means of tissue Doppler. RV-S′ < 10 cm is associated with RV systolic dysfunction.13,23,27 In our study there were no significant differences between the groups in the early period and at the one-month follow up according to mean RV-S′. It was significantly improved in the intra-group changes during these periods. Assessment of RV function using conventional echocardiography is challenging due to the complex geometry of the RV and the predominantly longitudinal orientation of its myofibrils.28,29 Therefore, we used a novel technique, 2D-STE, which is a sensitive, quantitative measure of contractility, emerging as a potent measure of RV function that can determine RV systolic dysfunction.30,31 Strain can be decreased even in the setting of normal contractility if regional or global stress such as afterload is elevated. This is even more pronounced in the setting of RV circulation, which is especially sensitive to afterload elevation and may be useful for evaluating subtle changes compared with other conventional echocardiographic techniques.13 Peak RV longitudinal strain, which quantifies the maximal shortening in the RV free wall from apex to base, is likely to be a good estimator of RV function because 80% of the stroke volume is generated by longitudinal shortening of the RV free wall.32 In our study RV-free-S and RV-free-SR means were similar in the early period. Mean regional and mean RV freewall strain/strain rates observed at the one-month follow up were significantly increased compared to the pre-PCI period within each individual group. According to conventional methods, sensitive changes in RV circulation can be detected earlier with 2D-STE.33 Since evaluation of the RV with conventional echocardiography after acute MI is not always possible, 2D-STE may be useful in this regard. RV dysfunction is an independent predictor of adverse prognosis after acute MI. The involvement of the RV during inferior acute MI has been defined as a strong predictor of morbidity and in-hospital mortality.7,8 Previous studies described proximal RCA occlusion compromising flow to the major RV branches as the most common anatomical substrate for RV dysfunction.34-36 However our study confirmed that the location of the proximal RCA lesion was similar between the study groups. In the study by Mehta et al., post-PCI, TIMI 0–2 flow rate was reported as 14.7%.37 Brosh et al. reported TIMI 0–1 flow rates as 6.7%.38 In the study by Henriques et al., however, no

AFRICA

reflow was 11%.39 Although initial TIMI 0, TIMI 1–2 and TIMI 0–2 flow rates were 1.9, 6.2 and 8.1%, respectively in our study, similar results to these studies are available. There was no statistical difference between the groups in terms of TIMI flow rates. In a recent study, ventricular tachycardia (VT) and fibrillation rates were higher in the TT group. Patients were monitored by event recorder monitors in the intensive care unit and service follow ups. Therefore, reperfusion arrhythmias such as accelerated idioventricular rhythm were excluded in the VT evaluation. The rates given in the tables were documented from the time of admission to hospital until discharge. However re-MI, re-hospitalisation and mortality rates were similar in both groups in hospital and at the one-month follow up. Patients should be revascularised as early as possible in order to minimise potential complications following RV-STEMI. RV function may recover within days or weeks, especially after successful reperfusion.40-43 The findings of our study demonstrated similar improvement in RV dimensions and volumes among patients treated with PPCI, or PCI within three to 12 hours after TT. This results from the rapid improvement in RV systolic function once revascularisation is achieved. Both the PPCI and TT groups exhibited near-normal values for the parameters at the one-month follow up compared to at admission.

Limitations of the study The main limitation of this study is its relatively small sample size. Our study included the in-hospital and one month after RV-STEMI periods only, and may therefore have failed to capture differences in relevant parameters. For this study, a group had been planned to include patients undergoing PCI within 12 to 24 hours of TT; however, the number of patients revascularised at our centre during this time period was insufficient for statistical analysis. Because the patients in the TT group had been referred from external centres, echocardiographic evaluation prior to thrombolytics was not possible. Therefore the RV systolic function determined in the TT group may have been overestimated. RV strain was assessed by 2D speckle-tracking echocardiography software, which has been developed mainly for LV strain. However, investigators demonstrated that the reproducibility of RV strain was acceptable using a speckletracking programme for LV strain. Moreover, RV septal and RV free wall were not separately evaluated during the RV strain analysis. However, previous studies suggested that RV septal strain showed no association with RV functional parameters. A possible explanation is that current speckle-tracking software cannot accurately separate LV septal from RV septal components, because the latter includes both RV and LV functional components. In our study, we could not evaluate 2D-derived estimation of RVEF because of the heterogeneity of methods and the numerous anatomical assumptions. We did not have 3D software during the study period.

Conclusions Our study included inferior STEMI with RV involvement alone. RV function, which evaluated conventional and RV strain/strain

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

rates, was similar between the two groups at admission and at the one-month follow up. In light of these results, we believe that revascularisation within three to 12 hours from TT may be as beneficial as PPCI for restoring RV systolic function. RV-STEMI diagnosis should be prompt and TT should be initiated in centres where PPCI cannot be performed. Patients should then immediately be referred to centres with coronary laboratories.

Society of Echocardiography endorsed by the European Association of Echocardiography, a registered branch of the European Society of Cardiology, and the Canadian Society of Echocardiography. J Am Soc Echocardiogr 2010; 23: 685–713. doi: 10.1016/j.echo.2010.05.010. 14. Kaul S, Tei C, Hopkins JM, Shah PM. Assessment of right ventricular function using two-dimensional echocardiography. Am Heart J 1984; 107: 526–531. doi:10.1016/0002-8703(84)90095-4. 15. Anavekar NS, Gerson D, Skali H, Kwong RY, Yucel EK, Solomon SD.

References 1.

Thygesen K, Alpert JS, White HD. Universal definition of myocardial ınfarction. J Am Coll Cardiol 2007; 50: 2173–2195, doi:10.1016/j.

et al. Feasibility and accuracy of a routine echocardiographic assessment of right ventricular function. Int J Cardiol 2007; 115: 86–89. DOI:

A, et al. Disagreement between tissue Doppler imaging and conven-

Risk stratification and survival after myocardial infarction. N Engl J

tional pulsed wave Doppler in the measurement of myocardial perfor-

Med 1983; 309: 331–336. DOI: 10.1056/NEJM198308113090602.

mance index. Eur J Echocardiogr 2006; 7: 356–364. DOI: http://dx.doi.

Goldstein JA. Right heart ischemia: pathophysiology, natural history,

Feigenbaum H, et al. Recommendations for quantitation of the left

Isner JM, Roberts WC. Right ventricular infarction complicating left

ventricle by two-dimensional echocardiography. American Society of

ventricular infarction secondary to coronary heart disease. Frequency,

Echocardiography committee on standards, subcommittee on quantita-

location, associated findings and significance from analysis of 236

tion of two-dimensional echocardiograms. J Am Soc Echocardiogr 1989;

necropsy patients with acute or healed myocardial infarction. Am J

2: 358–367.

et al. Usefulness of right ventricular fractional area change to predict

cy, size and topography in coronary heart disease: a prospective study

death, heart failure, and stroke following myocardial infarction (from

comprising 107 consecutive autopsies from a coronary care unit. J Am

the VALIANT ECHO study). Am J Cardiol 2008; 101: 607–612. doi: 10.1016/j.amjcard.2007.09.115.

Zornoff LA, Skali H, Pfeffer MA St John Sutton M, Rouleau JL,

20. Kukulski T, Hubbert L, Arnold M, et al. Normal regional right

Lamas GA. Right ventricular dysfunction and risk of heart failure

ventricular functionand its change with age: a Doppler myocardial

and mortality after myocardial infarction. J Am Coll Cardiol 2002; 39:

imaging study. J Am Soc Echocardiogr 2000; 13: 194–204. doi:10.1067/

1450–1455. doi: 10.1016/S0735-1097(02)01804-1.

mje.2000.103106.

O’Rourke RA, Dell’Italia LJ. Diagnosis and management of right

21. Tei C. New non-invasive index for combined systolic and diastolic

ventricular myocardial infarction.Curr Probl Cardiol 2004; 29: 1–47. doi:

ventricular function. J Cardiol 1995; 26: 135–136. doi:10.1016/0735-

http://dx.doi.org/10.1016/j.cpcardiol.2003.08.003. 9.

19. Anavekar NS, Skali H, Bourgoun M, Ghali JK, Kober L, Maggioni AP,

Andersen HR, Falk E, Nielsen D. Right ventricular infarction: frequen-

Coll Cardiol 1987; 10: 1223–1232. doi:10.1016/S0735-1097(87)80122-5. 7.

org/10.1016/j.euje.2005.08.004. 18. Schiller NB, Shah PM, Crawford M, DeMaria A, Devereux R,

http://dx.doi.org/10.1016/S0033-0620(98)80051-0.

Cardiology 1978; 42: 885–894. doi:10.1016/0002-9149(78)90672-0. 6.

http://dx.doi.org/10.1016/j.ijcard.2006.01.017. 17. Rojo EC, Rodrigo JL, Perez de Isla L, Almeria C, Gonzalo N, Aubele

10.1161/01.CIR.87.3.755.

and clinical management. Prog Cardiovasc Dis 1998; 40: 325–341. DOI: 5.

DOI: 10.1111/j.1540-8175.2007.00424.x. 16. Tamborini G, Pepi M, Galli CA, Maltagliati A, Celeste F, Muratori M,

Gaudron P, Eilles C, Kugler I, Ertl G. Progressive left ventricular mechanisms and early predictors. Circulation 1993; 87: 755–763. doi:

diographic-MRI correlative study. Echocardiography 2007; 24: 452–456.

jacc.2007.09.011. dysfunction and remodeling after myocardial infarction. Potential

Two-dimensional assessment of right ventricular function: an echocar-

1097(96)00202-1.

Sima AV, Stancu CS, Simionescu M. Vascular endothelium in athero-

22. Ueti OM, Camargo EE, Ueti Ade A, de Lima-Filho EC, Nogueira

sclerosis. Cell Tissue Res 2009; 335: 191–203. Doi: 10.1007/s00441-008-

EA. Assessment of right ventricular function with Doppler echocar-

0678-5.

diographic indices derived from tricuspid annular motion: comparison

10. Calabro P, Willerson JT, Yeh ET. Inflammatory cytokines stimulated C-reactive protein production by human coronary artery smooth muscle cells. Circulation 2003; 108: 1930–1932. Doi:10.1161/01. CIR.0000096055.62724.C5. 11. Antman EM, Morrow DA. ST-segment elevation myocardial infarc-

with radionuclide angiography. Heart 2002; 88: 244–248. doi:10.1136/ heart.88.3.244. 23. Karakurt O, Akdemir R. Right ventricular function in ST elevation myocardial infarction: effect of reperfusion. Clin Invest Med 2009; 32: 285–292.

tion management. In: Bonow RO, Mann DL, Zipes DP, Libby P (eds).

24. Miller D, Farah MG, Liner A, Fox K, Schluchter M, Hoit BD. The

Braunwald’s Heart Disease: A Textbook of Cardiovascular Medicine, 9th

relation between quantitative right ventricular ejection fraction and

edn. Elsevier-Saunders; Philedelphia, 2012: 1111–1128.

indices of tricuspid annular motion and myocardial performance. J Am

12. Windecker S, Kolh P, Alfonso F, Collet JP, Cremer J, Falk V, et al. 2014 ESC/EACTS Guidelines on myocardial revascularization: the task force

Soc Echocardiogr 2004; 17: 443–447. DOI: http://dx.doi.org/10.1016/j. echo.2004.01.010.

on myocardial revascularization of the European Society of Cardiology

25. Sade LE, Ozin B, Ulus T, Açikel S, Pirat B, Bilgi M, et al. Right ventricu-

(ESC) and the European Association for Cardio-Thoracic Surgery

lar contractile reserve in mitral stenosis: implications on hemodynamic

(EACTS) developed with the special contribution of the European

burden and clinical outcome. Int J Cardiol 2009; 135: 193–201. doi:

Association of Percutaneous Cardiovascular Interventions (EAPCI). Eur Heart J 2014; 35: 2541–2619. doi: http://dx.doi.org/10.1093/ eurheartj/ehu278.

10.1016/j.ijcard.2008.03.050. 26. Hayrapetyan HG, Adamyan KG, Arakelyan IA. Is combined myocardial performance index and tricuspid annular planesystolic excursion

13. Rudski LG, Lai WW, Afilalo J Hua L, Handschumacher MD,

a better predictive estimator than each of them alone in patients with

Chandrasekaran K, et al. Guidelines for the echocardiographic assess-

inferior ST-elevation myocardial infarction? Turk Kardiyol Dern Ars

ment of the right heart in adults: a report from the American

2014; 42: 131–138. doi: 10.5543/tkda.2014.81961.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

AFRICA

27. Nikitin NP, Witte KK, Thackray SD, de Silva R, Clark AL, Cleland JG,

al. Right ventricular ischemic injury in patients with acute ST-segment

et al. Longitudinal ventricular function: normal values of atrioventricu-

elevation myocardial infarction: Characterization with cardiovascular

lar annular and myocardial velocities measured with quantitative twodi-

magnetic resonance. Circulation 2010; 122: 1405–1412. doi: 10.1161/

mensional color Doppler tissue imaging. J Am SocEchocardiogr 2003; 16: 906–921. DOI: http://dx.doi.org/10.1016/S0894-7317(03)00279-7.

CIRCULATIONAHA.110.940254. 37. Mehta RH, Ou FS, Peterson ED, Shaw RE, Hillegass WB Jr, Rumsfeld

28. Davidson WR Jr, Fee EC. Influence of aging on pulmonary hemody-

JS, et al.; American College of Cardiology–National Cardiovascular

namics in a population free of coronary artery disease. Am J Cardiol

Database Registry investigators. Clinical significance of post-procedural

1990; 65: 1454–1458. doi:10.1016/0002-9149(90)91354-9.

TIMI flow in patients with cardiogenic shock undergoing primary

29. Petitjean C, Rougon N, Cluzel P. Assessment of myocardial function: a review of quantification methods and results using tagging MRI. J Cardiovasc Magn Reson 2005; 7: 501–506. DOI: 10.1081/JCMR200053610.

percutaneous coronary intervention. J Am Coll Cardiol Cardiovasc Interv 2009; 2: 56–64. Doi: 10.1016/J.JCİN.2008.10.006. 38. Brosh D, Assali AR, Mager A, Porter A, Hasdai D, Teplitsky I, et al. Effect of noreflow during primary percutaneous coronary intervention

30. Geyer H, Caracciolo G, Abe H, Wilansky S, Carerj S, Gentile F, et al.

for acute myocardial infarction on six-month mortality. Am J Cardiol

Assessment of myocardial mechanics using speckle tracking echocardi-

2007; 99: 442–445. Epub 2006 Dec 20. DOI: http://dx.doi.org/10.1016/j.

ography: fundamentals and clinical applications. J Am Soc Echocardiogr 2010; 23: 351–369. doi: 10.1016/j.echo.2010.02.015.

amjcard.2006.08.054. 39. Henriques JP, Zijlstra F, van ’t Hof AW, de Boer MJ, Dambrink JH, et

31. Altekin RE, Karakas MS, Yanikoglu A, Ozel D, Ozbudak O, Demir I,

al. Angiograpgic assesment of reperfusion in acute myocardial infarc-

et al. Determination of right ventricular dysfunction using the speckle

tion by myocardial blush grade. Circulation 2003; 107: 2115–2119. DOI:

tracking echocardiography method in patients with obstructive sleep apnea. Cardiol J 2012; 19: 130–139. doi: 10.5603/CJ.2012.0024.

10.1161/01.CIR.0000065221.06430.ED. 40. Popescu BA, Antonini-Canterin F, Temporelli PL, Giannuzzi P,

32. Carlsson M, Ugander M, Heiberg E, Arheden H. The quantitative

Bosimini E, Gentile F, et al. Right ventricular functional recovery after

relationship between longitudinal and radial function in left, right, and

acute myocardial infarction: relation with left ventricular function and

total heart pumping in humans. Am J Physiol Heart Circ Physiol 2007;

interventricular septum motion. GISSI-3 echo substudy. Heart 2005; 91:

293: 636–644. DOI: 10.1152/ajpheart.01376.2006.

484–488. doi:10.1136/hrt.2003.028050.

33. Fukuda Y, Tanaka H, Sugiyama D, Ryo K, Onishi T, Fukuya H, et al.

41. Shah PK, Maddahi J, Berman DS, Pichler M, Swan HJ. Scintigraphically

Utility of right ventricular free wall speckle-tracking strain for evalua-

detected predominant right ventricular dysfunction in acute myocar-

tion of right ventricular performance in patients with pulmonary hyper-

dial infarction: clinical and hemodynamic correlates and implications

tension. J Am Soc Echocardiogr 2011; 24:1101–1108. doi: 10.1016/j.

for therapy and prognosis. J Am Coll Cardiol 1985; 6: 1264–1272.

echo.2011.06.005.

doi:10.1016/S0735-1097(85)80212-6.

34. Bowers TR, O’Neill WW, Pica M, Goldstein JA. Patterns of coro-

42. Verani MS, Tortoledo FE, Batty JW, Raizner AE. Effect of coronary

nary compromise resulting in acute right ventricular ischemic

artery recanalization on right ventricular function in patients with

dysfunction. Circulation 2002; 106: 1104-1109. Doi:10.1161/01.

acute myocardial infarction. J Am Coll Cardiol 1985; 5: 1029–1035.

CIR.0000027566.51212.3F

doi:10.1016/S0735-1097(85)80002-4.

35. Grothoff M, Elpert C, Hoffmann J, Zachrau J, Lehmkuhl L, de Waha

43. Kidawa M, Chizynski K, Zielinska M, Kasprzak JD, Krzeminska-

S, et al. Right ventricular injury in st-elevation myocardial infarction:

Pakula M. Real-time 3D echocardiography and tissue Doppler echo-

Risk stratification by visualization of wall motion, edema, and delayed

cardiography in the assessment of right ventricle systolic function

enhancement cardiac magnetic resonance. Circ Cardiovasc Imaging

in patients with right ventricular myocardial infarction. Eur Heart J

2012; 5: 60–68. DOI: 10.1161/CIRCIMAGING.111.967810.

Cardiovasc Imaging 2013; 14: 1002–1009. doi: 10.1093/ehjci/jes321.

36. Masci PG, Francone M, Desmet W, Ganame J, Todiere G, Donato R, et

Epub 2013 Jan 23.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Case Reports A rare case of heterotaxy and left ventricular non-compaction in an adult A Chacko, L Scholtz, S Vedajallam, C van Wyk

Abstract Heterotaxy syndrome with left ventricular non-compaction is a rare co-existence of abnormalities with unknown cause. It can be isolated with no other associations, or associated with congenital heart diseases, or it can occur with multiple other congenital abnormalities. We describe the third reported case of heterotaxy syndrome with left ventricular non-compaction presenting in an adult. Keywords: heterotaxy, dextrocardia, left ventricular non-compaction, LVNC, polysplenia, situs ambiguous, left isomerism

congenital abnormalities. The entity characteristically exhibits prominent and excessive trabeculae in the left ventricular wall segment, with the deep inter-trabecular recesses being perfused from the cavity. Genetic causes associated with multiple gene mutations have been implicated in causing the arrest of normal embryogenesis within the endocardium and myocardium.1 Common clinical presentations include cardiac failure and tachyarrhythmia, as well as thromboembolic events. Associations with other cardiac and extra-cardiac abnormalities have been described. We describe the third reported case of dextrocardia with left ventricular non-compaction, situs ambiguous with an interrupted inferior vena cava, and polysplenia presenting in an adult.

Submitted 29/7/14, accepted 11/8/15 Published online 31/8/15 Cardiovasc J Afr 2016; 27: 45–48

www.cvja.co.za

DOI: 10.5830/CVJA-2015-063

Heterotaxy, also known as situs ambiguous, is defined as the abnormal and disorganised arrangement of organs and vessels within the abdominal cavity. This is in contrast to the orderly arrangement that occurs in situs inversus or situs solitus. The two major subcategories of situs ambiguous are situs ambiguous with polysplenia, and situs ambiguous with asplenia. Situs ambiguous with polysplenia, (which is also known as left isomerism or bilateral left-sidedness) is generally characterised by a midline position of the abdominal organs and multiple spleens/splenules. Left ventricular non-compaction is a rare congenital abnormality of the heart with unknown cause. It can be isolated with no other associations, or associated with congenital heart diseases, or it can occur in conjunction with multiple other Department of Radiology, Steve Biko Academic Hospital, University of Pretoria, Pretoria, South Africa A Chacko, MB BCh, FCRad (SA), anithchacko@gmail.com

Scholtz & Partners, Diagnostic Radiologists, Pretoria, South Africa L Scholtz, MB ChB, MMed (Rad Diag) (Pret)

Frere Hospital, East London, South Africa

Case report A 47-year-old male patient presented to the cardiologist with a history of chronic atrial fibrillation and known dextrocardia on chest radiography. The main presenting symptom was dyspnoea on exertion. The patient was a smoker and had a history of high alcohol intake. On examination he was noted to be normotensive and with a normal resting heart rate with atrial fibrillation. Lung function tests showed a mild obstructive airways disease pattern. Echocardiography confirmed the dextrocardia with hypertrophy, and possibly increased trabeculations were noted in the left ventricular wall. The ejection fraction was 50%, with a mildly enlarged left atrium and a normal-calibre left ventricular cavity. On abdominal ultrasound, the liver was observed to be midline with extension into the left hypochondrium, and the patient was noted to have polysplenia with multiple splenules located in the right hypochondrium. The ultrasound also confirmed an absent inferior vena cava. The patient’s blood work showed no abnormalities, with normal liver and renal function profile. Electrocardiography performed with a stress component showed no ischaemia and confirmed atrial fibrillation with no heart block. Cardiac magnetic resonance (CMR) imaging was performed to further evaluate cardiac and great vessel structure and function (Fig. 1). Dextrocardia, heterotaxy, left isomerism and left ventricular non-compaction were confirmed on the CMR and subsequent computed tomography (CT) (Figs 2, 3).

S Vedajallam, MB ChB, FCRad (SA)

Cardiologist in Private Practice, Zuid-Afrikaans Hospital, Pretoria, South Africa C van Wyk, MB ChB, MMed (Rad Diag) (Pret)

Discussion Dextrocardia is a cardiac positional anomaly in which the heart is located in the right hemithorax, with its base-to-apex axis

CARDIOVASCULAR JOURNAL OF AFRICA â&#x20AC;˘ Volume 27, No 1, January/February 2016

Fig. 1. C ardiac magnetic resonance imaging (T1 bright blood sequence) showing the dextrocardia with a midline liver. The white arrow indicates compacted portion of the left ventricular wall while the black arrow depicts the left ventricular non-compaction.

directed to the right and caudally. The malposition is intrinsic to the heart and not caused by extra-cardiac abnormalities such as right lung hypoplasia, right pneumonectomy or diaphragmatic hernia.2 Heterotaxy, also known as situs ambiguous, is defined as the abnormal and disorganised arrangement of organs and vessels within the abdominal cavity. This is in contrast to the orderly arrangement that occurs in situs inversus or situs solitus.

AFRICA

Patients with situs ambiguous and dextrocardia have associated congenital heart disease in 50 to 100% of cases, as opposed to patients with situs solitus or situs inversus and dextrocardia.3 The two major subcategories of situs ambiguous are situs ambiguous with polysplenia, and situs ambiguous with asplenia. Situs ambiguous with polysplenia (which is also known as left isomerism or bilateral left-sidedness) is generally characterised by a midline position of the abdominal organs and multiple spleens/splenules. Affected patients have a lower prevalence of congenital heart disease (50â&#x20AC;&#x201C;90%) and less severe defects than those with situs ambiguous with asplenia.4 When evaluating a patient with dextrocardia on CT or MRI, a systematic and sequential approach has been suggested in order to fully evaluate abnormalities of the heart and vascular structures. The approach favoured by Maldjian and Saric2 is analysis of the following in sequence: viscero-atrial situs, atrioventricular connections, ventricular morphology, ventricular situs, chamber positions, ventriculo-arterial connections, and relationship of the great arteries. Finally, any associated anomalies, such as septal defects or pulmonic stenosis, should be described. Situs of the viscera and atria is almost always concordant, and the atrial sinus is easily seen on cross-sectional imaging. On chest radiograph, this is also easily assessed by the location of the liver, spleen and stomach bubble. The morphology of the bronchial tree (usually best assessed on CT) is more accurate in determining atrial situs than the position of abdominal viscera. On chest radiographs in most patients, an enlarged azygous vein can be an indication of polysplenia, due to the high association with azygous or hemi-azygous continuation of the inferior vena cava.4 Evaluation of ventricular morphology, atrioventricular connections and relationships of the great arteries usually requires assessment by either CT angiography or MRI. The final step in analysis involves assessment of extra-cardiac abnormalities and possible syndromic associations. In patients who present as adults, the possible abnormalities are limited

Fig. 2. C omputed tomography angiogram (axial slices) showing the midline liver, absent inferior vena cava, azygous continuation (small white arrows), multiple splenules (accessory spleens), as well as the bilateral hypo-arterial bronchi (white double arrowheads).

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA â&#x20AC;˘ Volume 27, No 1, January/February 2016

Fig. 3. C omputed tomography angiogram (coronal slices) with lung window (A) and venous phases (B) and (C). Splenule (small black arrow), bilateral hypo-arterial bronchi (black double arrowheads), interruption of the inferior vena cava (larger white arrow) and azygous continuation of the inferior vena cava (small white arrows) are all part of the heterotaxy syndrome.

(other abnormalities generally presenting much earlier). Congenital heart and vascular defects that have been described include dextrocardia with situs inversus totalis (mirror image), situs solitus with normal relationship of great arteries (variation of dextroversion), situs solitus with levo- and/or dextrotransposition of the great arteries, and dextrocardia associated with polysplenia syndrome.2 Dextrocardia can also be associated with the heterotaxy syndromes of asplenia and polysplenia. Of the two syndromes, polysplenia is more likely to be associated with less severe cardiac malformations and therefore more likely to be encountered in adults. Up to 50% of cases of polysplenia syndrome can have dextrocardia. In polysplenia syndrome, there tends to be non-cyanotic congenital heart defects.2 Abnormalities associated with polysplenia syndrome are bilaterally symmetrical liver, bilateral bi-lobed lungs with bilateral hypo-arterial bronchi (left isomerism), bilateral superior vena cava, absence of the intrahepatic portion (interruption) of the inferior vena cava with azygous or hemi-azygous continuation, common atrium with complete absence of the atrial septum, endocardial cushion defect, hypoplasia or absence of one ventricle, valvular or subvalvular pulmonary stenosis, aortic stenosis or atresia, and double-outlet right ventricle. There is also an unexplained relationship between polysplenia and Kartagenerâ&#x20AC;&#x2122;s syndrome.2 Left ventricular non-compaction (LVNC) is a hereditary primary cardiomyopathy with characteristic features of prominent trabeculations and conspicuous inter-trabecular recesses that penetrate deeply into the left ventricular myocardium, with a thin, compacted ventricular free wall (mainly in the affected areas), and diffuse systolic dysfunction with hypokinesia.5 The majority of reported cases describe involvement of the left ventricle, but the right ventricle and septum can also be affected.6 Non-compaction of the ventricular myocardium was first described in 1932, in an autopsy on a newborn.7 Since then, due to increasing awareness and continuously improving technology, the rates of diagnosis of LVNC have been steadily increasing.

Imaging studies are the cornerstone of diagnosis of LVNC, with echocardiography being the main diagnostic tool. Computed tomography, angiography and magnetic resonance imaging (MRI) have been and can be used with equal success at diagnosis of the entity as well as for identification of associated abnormalities. In the normally developed heart, the left ventricle has up to three prominent trabeculations and is less trabeculated than the right ventricle. In LVNC the trabeculations are more numerous (left ventricle compared to right ventricle) and thicker with deep recesses between the trabeculae. Several diagnostic criteria have been proposed for LVNC, including a ratio of two for the wall thickness between the non-compacted trabeculated layer and the non-trabeculated compacted layer of the LVNC at end-systole, as measured along the parasternal short axis on echocardiography.8 Other criteria that can be used for diagnosis and possible classification include:8 (1) prominent and deep inter-trabecular recesses in the left ventricular lateral wall and apex, (2) direct blood flow from the ventricular cavity into the deep inter-trabecular recesses, as assessed by Doppler echocardiography, (3) two-layered structure of the ventricular wall, with an end-systolic ratio of non-compacted-to-compacted layer exceeding 1.4 (in infants), and (4) absence/presence of co-existing cardiac abnormalities. The clinical presentation can vary and initially most children and adults are asymptomatic. The left ventricular function then gradually deteriorates and other presenting events may also occur, such as cardiac failure and thromboembolic events. The prognosis is poor, with patients facing the possibility of sudden death (due to cardiac arrhythmias, ischaemic strokes, etc.) or eventual death due to heart failure.9 The systolic dysfunction is thought to occur due to a relative ischaemia of the myocardium with a mismatch of myocardial oxygen supply and demand.6 Restricted myocardial perfusion and decreased coronary flow reserve, which suggests a coronary microcirculatory dysfunction, has been demonstrated previously by Jenni et al. with positron emission tomography (PET) 10

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

AFRICA

The multiple prominent trabeculations cause a restriction in filling, an abnormal ventricular relaxation pattern and diastolic dysfunction, with a generally poor eventual outcome for patients. Other complications can include thrombus formation within the recesses between trabeculae and subsequent thromboembolic events. Delayed enhancement in the myocardium has been shown to increase under conditions of myocardial interstitial expansion or fibrosis.11 Previous histological studies have shown necrosis and fibrosis in patients with LVNC.12 These areas of fibrosis may serve as a focus or as foci for future lethal ventricular arrhythmias. Cardiac MRI has proven very useful in identifying these areas of fibrosis for characterisation and further management (evaluation for heart transplant).3 No such foci were found in our patient (Fig. 1). LVNC can be an isolated finding in the heart in the absence of other cardiac abnormalities. However, associations with other cardiac disorders, including coronary arterioventricular fistulae, ventricular septal defects, patent ductus arteriosus, atrial septal defects, a left coronary artery originating from the pulmonary artery, and dextrocardia have all been reported.3 Non-compaction of the myocardium can be either isolated or in conjunction with other congenital heart diseases. LVNC has been identified in relatively high association in patients with Ebstein’s anomaly with a reported figure of up to 18% of patients with Ebstein’s having non-compaction.13 Other associations previously reported include mitochondrial disorders, Barth syndrome, hypertrophic cardiomyopathy, muscular dystrophy type 1, 1p36 deletion, Turner syndrome, Ohtahara syndrome, distal 5q deletion, mosaic trisomy 22, trisomy 13, Di George syndrome, and 1q43 deletion with decreasing frequency, as well as Pierre-Robin syndrome.6 Malfunctioning of a rho-associated kinase has been implicated in the onset of the heterotaxy syndrome.14 Karyotyping and genetic testing have not been performed in our patient to date. CT angiography and/or MRI can be used in these patients to identify vasculature and other cardiac abnormalities, and associated congenital non-cardiac abnormalities.

References

Conclusion

13. Attenhofer Jost CH, Connolly HM, O’Leary PW, Warnes CA, Tajik AJ,

Ichida F, Tsubata S, Bowles KR, et al. Novel gene mutations in patients with left ventricular noncompaction or Barth syndrome. Circulation 2001; 103: 1256–1263. DOI: 10.1161/01.CIR.103.9.1256.

Maldjian PD, Saric M. Approach to dextrocardia in adults: review. Am J Roentgenol 2007; 188: S39–S49. DOI: 10.2214/AJR.06.1179

Cho YH, Jin SJ, Je HC, et al. A case of noncompaction of the ventricular myocardium combined with situs ambiguous with polysplenia. Yonsei Med J 2007; 48: 1052–1055.

Bartram U, Wirbelauer J, Speer CP. Heterotaxy syndrome: asplenia and polysplenia as indicators of visceral malposition and complex congenital heart disease. Biol Neonate 2005; 88: 278–290.

Ichida F, Hamamichi Y, Miyawaki T, et al. Clinical features of isolated noncompaction of the ventricular myocardium: Long-term clinical course, hemodynamic properties, and genetic background. J Am Coll Cardiol 1999; 34: 233–240.

Aypar E, Sert A, Gokmen Z, Aslan E, Odabas D. Isolated left ventricular noncompaction in a newborn with Pierre-Robin sequence. Pediatr Cardiol 2013; 34: 452–454.

Bellet S, Gouley BA. Congenital heart disease with multiple cardiac anomalies: report of a case showing aortic atresia, fibrous scar in myocardium and embryonal sinusoidal remains. Am J Med Sci 1932; 183: 458–465.

Jenni R, Oechslin E, Schneider J, Attenhofer Jost C, Kaufman PA. Echocardiographic and pathoanatomical characteristics of isolated left ventricular non-compaction: a step towards classification as a distinct cardiomyopathy. Heart 2001; 103: 1256–1263.

Wald R, Veldtman G, Golding F, et al. Determinants of outcome in isolated ventricular noncompaction in childhood. Am J Cardiol 2004; 94: 1581–1584.

10. Jenni R, Wyss CA, Oechslin EN, Kaufman PA. Isolated ventricular noncompaction is associated with coronary microcirculatory dysfunction. J Am Coll Cardiol 2002; 39: 450–454. 11. Moon JC, Mundy HR, Lee PJ, Mohiaddin RH, Pennell DJ. Images in cardiovascular medicine. Myocardial fibrosis in glycogen storage disease type III. Circulation 2003; 107: e47. 12. Oechslin EN, Attenhofer Jost CH, Rojas JR, Jaufman PA, Jenni R. Long-term follow up of 34 adults with isolated left ventricular noncompaction: a distinct cardiomyopathy with poor prognosis. J Am Coll Cardiol 2000; 36: 493–500.

We report on only the third known case of dextrocardia, situs ambiguous with polysplenia, and left ventricular non-compaction in an adult. All the characteristic morphological features could easily be identified on imaging studies including but not limited to echocardiography, CT angiography and MRI.

Seward JB. Left heart lesions in patients with Ebstein’s anomaly. Mayo Clin Proc 2005; 80: 361–368. 14. Egashira T, Yuassa S, Kimura M, et al. Coexistence of two distinct fascinating cardiovascular disorders: Heterotaxy syndrome with left ventricular non-compaction and vasopspastic angina. Int J Cardiol 2014; 174: e54–e56.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Intimomedial mucoid degeneration causing aortic and renal artery aneurysms in a young adult Charle Viljoen, Patryk Szymanski, Naeem Osman, Kristin Lorenc Henning, Paul Scholtz, Brian Rayner, Nadraj Naidoo

Abstract Intimomedial mucoid degeneration (IMMD) is characterised by aneurysm formation following mucin deposition in the intima and media, with elastic tissue degeneration of the arterial wall. We present a case of a young adult who developed a diffusely aneurysmal aorta and its major branches, which was histopathologically confirmed as intimomedial mucoid degeneration, and a review of the literature. This case report attempts to raise the awareness of the reader to this rare cause of aortic aneurysm and to the bleeding diathesis associated with IMMD that may complicate surgery. Keywords: intimomedial mucoid degeneration, aortic aneurysm, dissection Submitted 25/2/15, accepted 4/10/15 Cardiovasc J Afr 2016; 27: 49–52

www.cvja.co.za

DOI: 10.5830/CVJA-2015-079

Intimomedial mucoid degeneration (IMMD) is a rare vascular disorder characterised by the deposition of mucin in the intima and media, which leads to elastic tissue degeneration and aneurysm formation of the arterial wall.1-4 Although the condition was initially thought to involve only the aorta, subsequent publications have reported IMMD to affect the major branches of the aorta, as well as smaller vessels such as the coronary and brachial arteries.1,5,6-8 The aneurysms in IMMD usually have a saccular or fusiform morphology and cause symptoms related to the location of the aneurysm.6,8 Department of Medicine, Groote Schuur Hospital and University of Cape Town, South Africa Charle Viljoen, MB ChB, MMed, FCP (SA), charleviljoen@gmail.com Patryk Szymanksi, MB ChB

Division of Anatomical Pathology, National Health Laboratory Service, Groote Schuur Hospital and University of Cape Town, South Africa Naeem Osman, MB ChB, FC Path (SA) (Anat)

Division of Radiology, Groote Schuur Hospital and University of Cape Town, South Africa Kristin Lorenc Henning, MB ChB, DCH, FC Rad Diag (SA) Paul Scholtz, MB ChB, MMed, FC Rad Diag (SA)

Division of Nephrology and Hypertension, Groote Schuur Hospital and University of Cape Town, South Africa Brian Rayner, MB ChB, FCP, MMed, PhD

Division of Vascular Surgery, Groote Schuur Hospital and University of Cape Town Nadraj Naidoo, MB ChB, FCS (SA)

Surgery is often complicated by a bleeding diathesis distinct from disseminated intravascular coagulation (DIC), but which resolves after surgical treatment of the diseased vessel.2 Meticulous surgical technique is of paramount importance.2,6 Peri-operatively, the coagulation profile and platelet function should be carefully monitored and diligently corrected.

Case report A healthy 18-year-old male presented to the emergency unit with a two-week history of coughing with increasing dyspnoea and a feeling of ‘heaviness on the chest’. On examination, a blood pressure measurement of 177/105 mmHg was noted, with goodvolume regular pulses that were equal and present throughout, with no bruits. The jugular venous pressure was not elevated and the apex was undisplaced. Heart sounds were normal, but auscultation of the chest revealed crackles in the lung bases. A pulsatile mass was palpated in the epigastrium. The admission chest radiograph revealed pulmonary oedema and a widened mediastinum (Fig. 1), with the lateral film confirming dilatation of the descending thoracic aorta. Blood work returned with Na 142 mmol/l, K 4.7 mmol/l, urea 15.7 mmol/l and creatinine 306 μmol/l. The white blood cell count was 16.82 × 109 cells/l, haemoglobin 8.7 g/dl, mean cell volume 72.4 fl and platelets 338 109 cells/l. The C-reactive protein (CRP) was 210 mg/l and erythrocyte sedimentation rate (ESR) was 111 mm/h. HIV and syphilis serology returned negative. A computerised tomographic angiogram (CTA) showed that the descending thoracic aorta was aneurysmal throughout its course (maximum diameter 46 mm), with multiple complex dissection flaps (Fig. 2). The abdominal aorta was also aneurysmal with a large lobulated aneurysm below the level of the superior mesenteric artery (maximum diameter of 52 mm). The diseased aorta was diffusely thick walled with no calcification. Both renal arteries arose from the lobulated aneurysm and the left renal artery origin was noted to be aneurysmal (Fig. 3). There was poor contrast filling within both renal arteries proximally, likely related to dissection. Further aneurysms involved the right subclavian, left common carotid and right superficial femoral arteries. An echocardiogram showed mildly impaired left ventricular function, but normal valves. A DMSA scan indicated a differential glomerular filtration rate of 4 ml/min and 15 ml/min to the right and left kidney respectively. In spite of optimal blood pressure management, his renal function continued to decline. Haemodialysis was commenced prior to staged repair of a complex type 2 thoracoabdominal aneurysm. The first stage involved a left renal auto-transplantation. Histology of the left renal artery, as demonstrated in Figs 4, 5 and 6, showed mucin accumulation within the intimal and medial layers with disruption of the elastic

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Fig. 1. A dmission AP frontal chest radiograph demonstrating extensive pulmonary oedema as well as widening of the superior mediastinum.

laminae. There was no evidence of vasculitis or atherosclerosis. The overall features were in keeping with a diagnosis of intimomedial mucoid degeneration. The patient’s renal function and blood pressure improved postoperatively. However on the third day after admission his haemoglobin dropped and abdominal distension was

Fig. 2. O blique sagittal MIP reconstruction shows a diffusely aneurysmal descending thoracic aorta with complex multi-level dissection flaps.

AFRICA

Fig. 3. Volume-rendered CT reconstruction shows the aneurysmal abdominal aorta as well as aneurysmal origin of the left renal artery with focal stenosis.

noted. A repeat CTA indicated haemorrhage around the autotransplanted kidney with possible leakage of the abdominal aneurysm. The patient received an emergent hybrid repair of the extensive thoraco-abdominal aneurysm. The procedure involved debranching of the coeliac artery, superior mesenteric artery (SMA) and right renal artery, with extensive stent-graft repair using four overlapping aortic stent grafts. Prior to the stent-grafting, the coeliac artery and SMA were revascularised with a bifurcated prosthetic graft, using the

Fig. 4. Mild intimal thickening with disruption of the internal elastic lamina is shown on this haematoxylin and eosin stain (200× magnification).

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Fig. 5. Mucin pools within the intima and medial muscle layer are highlighted on Alcian blue stain (200× magnification).

Fig. 6. The Elastic von Gieson stain highlights fragmentation of the elastic fibres (400× magnification).

right common iliac artery as the donor vessel. Complex repair of the right renal artery followed, with subsequent right renal auto-transplantation onto the iliac vessels. Formal closure of the abdomen was performed three days later, at which point it was found that there was minimal thrombus in the abdominal aneurysm. The patient subsequently had an uneventful course. His creatinine level improved to 73 μmol/l (MDRD estimated glomerular filtration rate was 117 ml/min/1.73 m2) and his blood pressure normalised without additional antihypertensive medication. He was discharged in good health and was attending the vascular out-patient clinic regularly, with normal renal function.

in this case, patients with IMMD have a high prevalence of hypertension, which aggravates the elastic tissue breakdown, resulting in aneurysm formation.1,4,6,9,11 Patients with IMMD present with localised symptoms related to the position of the aneurysms.7,9 Presenting symptoms include abdominal and back pain, presence of a pulsatile mass, limb claudication and symptoms related to aneurysm rupture.6 This could be explained by the most common sites of involvement being the infra-renal aorta, followed by the thoracic aorta, subclavian, common carotid and common iliac arteries.6 Our patient did not present with abdominal or back pain, however, his chest discomfort could be explained by the local effects of the aneurysmal descending thoracic aorta. The morphological characteristics of the aneurysms found in patients with IMMD are usually of the fusiform or saccular types.8 Various imaging modalities, namely duplex ultrasound, CTA and/or magnetic resonance angiography, are used to determine the extent of disease, and whether or not there is an element of dissection.6,8 The principle histological features of IMMD include intimal and medial thickening resulting from accumulation of mucin pools, which in turn leads to fragmentation and aggregation of elastin fibres, as illustrated by our case.8,11 The weakened wall structure finally results in aneurysm formation.2,11 A striking feature on histological examination is the absence of any inflammatory reaction.1 The features are distinct from cystic medial necrosis, in which only the media is affected by the mucin accumulation.1,4 Cystic medial necrosis is also typically confined to the aorta, whereas IMMD has been found to involve extraaortic vessels.1,11 Extra-aortic disease in IMMD may also be found without any aortic involvement. 2,11 A distinctive feature of IMMD is the paucity of luminal thrombus in the aneurysm sac.7 Patients often suffer from bleeding intra-operatively.8 This bleeding diathesis is aggravated by surgical manipulation and is reversed once the aneurysm is repaired. It is therefore postulated that there is a primary fibrinolytic process that originates from the diseased aneurysm, which might explain why a thrombus is seldom found in IMMD, as was the case in our patient, and why occlusive disease is a rare finding, apart from a few reports in the literature.4-6,8

Discussion The condition was first described in South Africa, with the earliest cases dating back to a publication by Pepler in 1955.9 The term ‘intimomedial mucoid degeneration’ was first used in 1977 by Decker et al. from Johannesburg in their case series of nine patients with aortic aneurysms.1 Due to the lack of understanding of its aetiology, the condition was defined in pathological terms describing its histological features.1,10,11 In 1993 it became apparent that IMMD also had extraaortic manifestations, when Cooper et al. from Durban published a series of six cases in which the subclavian, common carotid, mesenteric and iliac arteries were found to have IMMD.11 In our case the right subclavian, left common carotid, right superficial femoral and left renal arteries were involved. Recent reports have also shown IMMD to affect smaller vessels, such as the coronary, brachial, dorsalis pedis and temporal arteries.5,7 Although early publications reported IMMD to be confined to predominantly female black South Africans, subsequent publications from India and Europe demonstrated that the disease is not limited to the African population.4,8,12 This is illustrated in our case as our patient was of mixed ancestry and male. Various studies have shown that aneurysms in IMMD affect a younger population group than what is found in conventional non-specific degenerative aneurysms.1,4,6 As

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

AFRICA

This fibrinolytic process in IMMD is distinct from DIC.2 Patients with IMMD are found to have decreased levels of platelets and fibrinogen, as well as factors V and VIII.2 This leads to accelerated fibrinolysis, often manifest as reduced euglobulin lysis time.2 In contrast to DIC, positive fibrin monomer and increased D-dimer levels are not seen in IMMD.2,6,8 The surgical team needs to be aware of the bleeding tendency of patients with IMMD.6 Also, the arterial wall often appears friable with a tendency to dissect easily during suture repair. Meticulous suture technique is therefore essential.6,8 The coagulation profile and platelet function should be carefully monitored peri-operatively and diligently corrected.8 A single case report by Katz et al. describes endovascular repair of a gluteal artery aneurysm secondary to IMMD.2 However, the standard of care in the treatment of IMMDrelated aneurysms is open surgical repair.6,8 At our institution, we have treated a few patients with IMMD-related thoracoabdominal aneurysms with hybrid procedures, comprising visceral debranching and revascularisation followed by extensive thoraco-abdominal stent grafting. The prognosis depends on the extent of disease and the time of presentation.8 Acute presentation with dissection has higher morbidity and mortality rates.8 Adverse outcomes are related to major blood loss requiring massive blood transfusions and the associated complications, as well as multi-organ failure secondary to shock.6 At the time of submission for publication, this case report possibly represents the first described case of IMMD affecting the renal artery.

The authors thanks Ms Monica van Schalkwyk for her help in obtaining the

Conclusion

10. Steiner I, Thomas J, Hutt M. Aortopathies in Ugandan Africans. J

Although IMMD is a rare vascular disorder, it forms part of the differential diagnoses in aortic aneurysm, especially in the younger population and in the absence of conventional risk factors associated with non-specific degenerative aneurysms. Clinicians managing patients with IMMD should be aware of the bleeding diathesis associated with this condition.

11. Cooper K. Extraaortic intimomedial mucoid degeneration : a clinico-

articles reviewed in this case report.

References 1.

Decker G, Samson I, Schmaman A. Abdominal aneurysm in South African Negroes due to intimomedial mucoid degeneration. Br J Surg 1977; 64: 513–516.

Katz JR, West DL, Bui JT, Knuttinen G, Chejfec G, Owens CA. Endovascular treatment of intimomedial mucoid degeneration. J Vasc Interv Radiol 2008; 19(12): 1765–1768.

Sandhyamani S. Mucoid vasculopathy of unknown etiology. Angiology 1991; 42: 48–51.

Raber MH, Meerwaldt R, Det RJ Van. A young man with intimomedial mucoid degeneration of the brachial artery. J Vasc Surg 2011; 53(3): 822–824.

Jessurun GAJ, Tio RA, Ribbed LSM, Willemse F, Boonstra PW, Crijns HJGM. Unusual cause of sudden cardiac death: basophilic degeneration of coronary arteries. Cathet Cardiovasc Diagn 1996; 39: 172–176.

Abdool-Carriem A, Robbs J, Kenoyer G, Cooper K. Aneurysms due to intimomedial mucoid degeneration. Eur J Vasc Endovasc Surg 1996; 11: 324–329.

Wali MA, Dewan M, Renno W, Ezzeddin M. Mucoid degeneration of the brachial artery: case report and a review of literature. J R Coll Surg Edinb 1999; 44: 126–130.

Gajjar H, Benningfield S, Naidoo N, Motala A. Multiple aneurysms due to intimomedial mucoid degeneration : a short presentation. S Afr J Radiol 2009: 98–101.

Pepler W. A study of some of the structural changes of the bantu aorta. S Afr J Lab ClinMed 1955; 1(4): 203–253. Pathol 1973; 109: 295–305. pathological study. Angiology 1993; 477–483.

12. Sandhyamani S. Mucoid vasculopathy: vascular lesions in an autopsy study. Mod Pathol 1993; 6(3): 333–341.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

First reported cases: renal denervation with secondgeneration multi-electrode catheter via brachial and radial access MJ Heradien, J Augustyn, A Saaiman, PA Brink

Abstract Renal denervation is a minimally invasive procedure that aims to reduce brain–kidney sympathetic cross-talk. Despite the negative results of the recent SYMPLICITY HTN-3 trial, the procedure is considered safe and has been associated with many beneficial effects, including the reversal of hypertensive heart disease substrate and the prevention of cardiac arrhythmia. The first-generation radiofrequency catheter system featured a monopolar catheter that required sequential singlepoint energy application, followed by rotation, partial withdrawal of the catheter and re-application of energy. The latest generation device features four electrodes configured in a helical arrangement that can simultaneously ablate in four quadrants of the vessel circumference. Renal denervation via brachial or radial arterial access with the second-generation system has not been described before.

Keywords: hypertension, renal denervation, atrial fibrillation Submitted 1/10/15, accepted 14/11/15 Cardiovasc J Afr 2016; 27: 53–55

www.cvja.co.za

DOI: 10.5830/CVJA-2015-089

Renal denervation (RD) is a minimally invasive procedure that aims to reduce brain–kidney sympathetic cross‐talk. Despite the negative results of the recent SYMPLICITY HTN‐3 trial,1 the procedure is considered safe and has been associated with many beneficial effects, including the reversal of hypertensive heart disease substrate and the prevention of cardiac arrhythmia.2 The first-generation radiofrequency (RF) catheter system featured a monopolar catheter that required sequential single-point energy application, followed by rotation, partial withdrawal of the catheter and re‐application of energy. The latest generation device features four electrodes configured in a helical arrangement that can simultaneously ablate in four quadrants of the vessel circumference (Fig. 1A). Although

the system is designed for femoral access, brachial or radial procedural access has possible advantages, including reduced risk of bleeding and easier access to the renal arteries due to the acute take-off angles of the renal artery from the abdominal aorta. As part of our ongoing trial aiming to determine whether sympathetic modulation with RD can prevent recurrence of atrial fibrillation (‘RDPAF’; clinicaltrials.gov identifier: NCT01990911), we report on two cases of RD with the next generation RD catheter system performed via brachial or radial access. The trial was approved by our local ethics committee, conformed to the Declaration of Helsinki, and the subjects provided written informed consent.

Case 1: renal denervation via brachial arterial access Our first case was a 62-year-old female patient (body mass index > 30 kg/m2) with a history of uncontrolled hypertension and type 2 diabetes mellitus, and paroxysmal atrial fibrillation managed with rivaroxaban, which was discontinued four days prior to the procedure. Baseline office blood pressure was 150/90 mmHg. Routine femoral access was achieved. However, catheter access to the right renal artery failed due to the acute anatomical takeoff of the vessel. Therefore, it was decided to attempt access via a brachial approach as an alternative. Percutaneous left brachial arterial access was achieved with a 6-Fr introducer sheath (Terumo), 6-Fr multipurpose guiding catheter (Medtronic) and a 190-cm, 0.014-inch gage BMWTM guide wire (Abbott Vascular). A Symplicity SpyralTM (Medtronic) catheter was then introduced over the guidewire, after removing the straightening tool, resulting in approximately 125 cm of catheter length (Fig. 1B). The diameter of the main renal artery was approximately 6.5 and 5.5 mm on the left and right side, respectively. Access to both arteries was readily attained, and 17 and 13 lesions were created in the right and left renal arteries, respectively (Fig. 2).

Department of Internal Medicine, Stellenbosch University, South Africa MJ Heradien, MB ChB, BSc Hons, MMed (Cert Cardiol) PA Brink, MB ChB, MMed, PhD

SA Endovascular, Netcare Kuilsriver Hospital, Cape Town, South Africa MJ Heradien, MB ChB, BSc Hons, MMed (Cert Cardiol) J Augustyn, MB ChB, MMed A Saaiman, MB ChB, MMed

Fig. 1A. Symplicity Spyral® renal ablation catheter is an over‐ the‐wire system that enables simultaneous quadripolar renal artery ablation.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Fig. 1B. S ymplicity Spyral® catheter threaded through the multipurpose guiding catheter with right brachial access point.

Case 2: renal denervation via radial arterial access The second case was performed on a 63-year-old male with a history of syncope, obstructive sleep apnoea, hypertension and baseline blood pressure of 160/100 mmHg. Percutaneous left radial arterial access was achieved with a 6-Fr introducer sheath (Terumo), 6-Fr multipurpose guiding catheter (Medtronic) and a 190-cm, 0.014-inch gage ThunderTM guide wire (Medtronic). The Spyral catheter was then introduced over the guidewire, after removing the straightening tool, resulting in approximately 125 cm of catheter length (Fig. 3). The diameter of the main renal artery was approximately 7 and 6 mm on the left and right side, respectively. Adequate catheter access to the renal arteries was attained and 24 and 20 lesions were performed in the right and left renal arteries, respectively. For both cases electrode temperature, impedance and impedance decreases were in the typical range for all lesions. Typical generator codes indicating sub‐optimal electrode contact

AFRICA

Fig. 3. Left radial access: note how much of the catheter is still outside the patient.

were occasionally observed and were addressed during the procedure by successful repeated energy delivery to the specific electrodes. No procedural complications occurred, and the arterial access site was managed post procedurally with routine manual compression. The patients were discharged the same day as the procedure, and no further complications have been reported to date. Both patients will continue to be monitored according to the clinical protocol (Table 1).

Discussion To our knowledge, these are the first reported cases of RD through brachial and left radial access, respectively, using the second-generation multi‐electrode RF generation system. Previous case reports have described successful RD via brachial access with the first-generation monopolar system.3,4 Compared to the traditional femoral approach, trans‐radial or brachial percutaneous procedures for coronary interventions generally have a lower risk of bleeding complications, fewer access site

Right renal artery Fig. 2. B ilateral renal artery denervation was successfully performed.

Left renal artery

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Table 1. Comparison: baseline versus follow up after renal denervation (RDN)

Patient 1: right brachial approach Office BP (mmHg) ABPM: mean BP (mmHg) BP meds (3 drugs) Patient 2: left radial approach Office BP (mmHg) ABPM: mean BP (mmHg) BP meds (4 drugs)

Before RDN (baseline) 05/02/2015: 159/94 137.1/78.1

Prexum Plus/ Bisocor 23/06/2015: 173/94

Follow up 12/06/2015: 137/77

Reduction 22/17 mmHg

130.2/74.9 6.9/3.2 mmHg (4 months after RDN) Prexum Plus/ no Bisocor 17/08/2015: 45/21 mmHg 128/73

155.5/85

133.2/82 22.3/3 mmHg (4 months after RDN) Co-Pritor/Biso- Co-Pritor/Bisono cor/Spiractin cor/Spiractin

complications and lower hospital costs, and are preferred by patients. Likewise, the unique geometric anatomy of the renal arteries relative to the abdominal aorta may make renal artery access easier from this superior approach. The Symplycity Spyral catheter measures 117 cm from spiral tip to shaft end, however, we found that removal of the attached ‘straightening sheath’, increased the usable length to 125 cm, which was adequate for these cases. Both cases had encouraging outcomes with no adverse events. During both procedures, we intentionally targeted the distal portion of the main vessel as well as the distal renal artery beyond the main bifurcation because the sympathetic nerves have been shown to be closer to the arterial lumen in these regions.5 Note that the patients described here did not have so called ‘treatment-resistant’ hypertension. However, these subjects received RD therapy as part of a separate clinical trial testing

the hypothesis that RD therapy may reduce recurrence of atrial fibrillation. Also, note that the system used in these cases was designed specifically for femoral procedural access and this is specified clearly in the product labelling. However, we chose to apply this device in an ‘off-label’ fashion in order to determine the potential to improve the procedural safety and outcome.

Conclusion We demonstrated that RD therapy is feasible with the currently approved multi-electrode RF system with either brachial or radial access, although larger prospective studies are required to determine the actual safety and efficacy of this alternative. Such an approach could perhaps reduce the rate of vascular complications associated with femoral access and also allows for same-day discharge. Finally, we suggest that future generations of RD catheter systems be designed with the goal to allow for brachial and radial arterial access.

References 1.

Bhatt DL, Kandzari DE, O’Neill WW, et al. A controlled trial of renal denervation for resistant hypertension. N Engl J Med 2014; 370: 1393–1401.

Böhm M, Linz D, Urban D, Mahfoud F, Ukena C. Renal sympathetic denervation: applications in hypertension and beyond. Nat Rev Cardiol 2013; 10: 465–476.

Bertog SC, Blessing E, Vaskelyte L, Hofmann I, Id D, Sievert H. Renal denervation: tips and tricks to perform a technically successful procedure. EuroIntervention 2013; 9: R83–88.

Zeller T, Rastan A, Macharzina R, Noory E. Challenging anatomy, how to treat or not to treat? EuroIntervention 2013; 9(Suppl R): R67–74.

Sakakura K, Ladich E, Cheng Q, et al. Anatomic assessment of sympathetic peri‐arterial renal nerves in man. J Am Coll Cardiol 2014; 64(7): 635–643.

Register now 5th Annual COngress of the faculty of consulting physicians of south africa 27 – 29 may 2016 Century city conference centre

www.physician.co.za

Faculty of

Consulting Physicians of South Africa

congress organisers: londocor email: leigh@londocor.co.za TEL: 011 954 5753

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

AFRICA

Cardio News Leadless pacing: an advance in cardiac pacing In March 2015, Groote Schuur Hospital (GSH) in Cape Town made history by becoming the first hospital in Africa, the Middle East, Central Asia and Turkey to implant the world’s smallest pacemaker: the Medtronic MicraTM transcatheter pacing system (TPS). Three patients in Cape Town had this device successfully implanted by the GSH team, led by Dr Ashley Chin, as part of Medtronic’s global pivotal clinical trial. After nearly one year of follow up, all three patients’ pacemakers are functioning well with no pacemaker-related complications. The MicraTM TPS is a leadless pacemaker that does not require the use of a lead to connect to the heart. It is one-tenth the size of a conventional transvenous pacemaker and is delivered directly into the heart through a catheter inserted in the femoral vein. Once positioned, the pacemaker is securely attached to the right ventricular wall and can be repositioned if needed. Attached to the heart via small tines, the pacemaker delivers electrical impulses that pace the heart through an

electrode at the end of the device. Leadless pacemakers were designed to avoid the need for a pacemaker pocket and transvenous lead, with the aim of avoiding lead complications (such as infection, fracture and displacement), which occur in a significant proportion of transvenous pacemakers. Other potential benefits include shorter procedure times, cosmetic appeal (no pacemaker scar), shorter recover times and fewer post-implant restrictions. The results of this landmark, multicentre, international study have recently been published in the New England Journal of Medicine.1 The device was successfully implanted in 719 of 725 patients (99.2% implant success rate). The primary efficacy endpoint (a pacing threshold at six months of < 2 V @ 0.24 msec) was achieved in 96% of patients. Patients with a leadless pacemaker had fewer complications compared to a historical cohort of patients with transvenous pacemakers. The most frequent complication included cardiac perforation or effusion (1.6% of cases), followed by vascular

access problems (0.7% of cases). The MicraTM TPS system has received FDA approval in the United States and obtained the CE mark in Europe, and is globally commercially available. The MicraTM TPS has some limitations. This leadless pacemaker currently can only pace the ventricle. This pacemaker is not ideal for patients who require atrial pacing (e.g. sick sinus syndrome) or for younger, active patients with heart block who require dual-chamber pacing. Cardiologists will also require training to implant the MicraTM TPS. The costs are expected to be significantly more expensive than a conventional pacemaker. Lastly, the long-term efficacy and safety of the device is still unknown. Nevertheless, leadless pacing is a major breakthrough in the field of cardiac pacing, which is now proven to be safe and effective in the short to medium term. 1. Reynolds D, Duray GZ, Omar R, Soejima K, et al. A leadless intracardiac transcatheter pacing system. N Engl J Med 2016; 374: 533–541.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA â&#x20AC;˘ Volume 27, No 1, January/February 2016

Case Report Localised pericardial effusion mimicking anterior myocardial infarction following coronary angiography Aynur Acibuca, Demet Menekse Gerede, Veysel Ozgur Baris, Mustafa Kilickap

Abstract The diagnosis of pericarditis is important, especially in patients assumed to have acute coronary syndrome. Distinguishing these two conditions is vital but not always easy. Accurate diagnosis is essential to provide appropriate treatment as soon as possible and to avoid inappropriate invasive procedures. By highlighting this distinction, we report a case of pericarditis that occurred after percutaneous coronary intervention and mimicked acute coronary syndrome. Keywords: regional pericarditis, myocardial infarction, acute stent thrombosis, located pericardial effusion Submitted 3/8/15, accepted 14/11/15 Cardiovasc J Afr 2016; 27: e1â&#x20AC;&#x201C;e3

www.cvja.co.za

DOI: 10.5830/CVJA-2015-086

Regional pericarditis has been described but remains a relatively unknown and under-diagnosed condition. There are no electrocardiography (ECG) criteria to diagnose regional pericarditis and only a few studies have investigated regional pericarditis. Although regional pericarditis is usually observed in patients following myocardial infarction (MI), it has also been reported in other conditions.1,2 We present a case of regional pericarditis with electrocardiographic features mimicking anterior MI.

Fig. 1. The right anterior oblique view shows stenosis in the circumflex and left anterior descending coronary artery.

Case report A 58-year-old male smoker presented with a one-month history of exercise chest pain. His exercise ECG was borderline normal, so coronary angiography (CAG) was performed. The CAG revealed severe stenosis in the circumflex and right coronary artery (RCA). Borderline severe stenosis was also detected in the left anterior descending (LAD) coronary artery (Figs 1, 2). The fractional flow reserve value was 0.92.

Department of Cardiology, Ankara University School of Medicine, Ankara, Turkey Aynur Acibuca, MD, aynuracibuca85@gmail.com Demet Menekse Gerede, MD Veysel Ozgur Baris, MD Mustafa Kilickap, MD

Fig. 2. The anteroposterior view shows stenosis in the circumflex and left anterior descending coronary artery.

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Fig. 3. A . ECG on hospital admission. B. Post-procedural ECG shows ST-segment elevation in leads V1–4, consistent with anteroseptal MI. C. Several days after the procedure, the ECG showed complete resolution of the ST-segment elevation, with no pathological Q wave.

Two stents were implanted in the RCA and circumflex artery, one after the other. Immediately after the procedure, the patient developed chest pain. An emergency CAG did not identify any culprit lesion. Half an hour after the second CAG, the patient complained of severe chest pain. An ECG revealed ST-segment elevation in leads V1–4, consistent with anteroseptal MI (Fig. 3B), which had not been there before (Fig. 3A). The patient was taken immediately to the catheterisation unit. There was no occlusion in the implanted stents but the stent in the RCA was under-expanded. Dilatation was performed, however, the patient continued to experience chest pain. Therefore, a stent was implanted for LAD stenosis. Initially, the chest pain decreased but then increased again. A second stent was deployed in the suspected dissection region in the LAD. Echocardiography confirmed a structurally normal heart with no obvious regional wall abnormality. An echocardiogram revealed a localised apical pericardial effusion (Fig. 4). The patient’s chest pain remained constant for several hours,

Fig. 4. T he echocardiogram displayed a localised pericardial effusion.

AFRICA

Fig. 5. The guide wire was advanced too far in the distal part of the right coronary artery during stent implantation.

without any recurrence of elevated cardiac enzymes. His chest pain was attributed to local pericardial irritation due to coronary perforation by the guide wire during implantation of the stent (Fig. 5). Several days after the procedure, the ECG showed complete resolution of the ST-segment elevation, with no pathological Q wave (Fig. 3C). Given the combination of symptoms, ECG changes and echocardiographic findings, a diagnosis of regional pericarditis was made, despite the absence of a pericardial rub, which is fleeting in nature.

Discussion It is important for the clinician to differentiate acute MI/acute stent thrombosis from pericarditis, which is a rare complication of percutaneous coronary intervention. It can be difficult to distinguish regional pericarditis from myocardial ischaemia with ECG. Echocardiography can be very useful in excluding regional wall motion abnormalities and identifying pericardial effusion, especially in atypical presentations of pericarditis. However, in the acute setting, prompt differentiation of pericarditis from myocardial injury by ECG remains of paramount importance to avoid a delay in reperfusion. Earlier reports confirm that it is frequently difficult to differentiate between acute pericarditis and coronary occlusion.3,4 The problem appears to be further confounded when pericarditis is regional, with electrocardiographic features nearly indistinguishable from localised MI, which could lead to the incorrect treatment.5 In this case, coronary perforation by the tip of the guide wire most likely caused injury to the local pericardium,6 as evidenced by the anterior injury pattern that developed on the patient’s ECG, mimicking MI. The complete resolution of the patient’s ECG abnormalities, the absence of wall motion abnormalities, and the lack of elevation of troponin I levels all support the diagnosis of regional pericarditis.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 27, No 1, January/February 2016

Conclusion Pericarditis is a common condition with clinical and electrocardiographic features that can mimic acute coronary syndromes. The subtle differences between the two conditions are often overlooked due to the fear of missing the more serious diagnosis of acute coronary syndrome and the window for timely reperfusion.

pericarditis: The role of two-dimensional echocardiogram. Clin Cardiol 1997; 20(4): 404–406. 3.

Bourne,WA. Acute pericarditis simulating cardiac infarction. Br Med J

Smith KJ, Theal M, Mulji A. Pericarditis presenting and treated as an

1949; 2(4627): 579–580. acute anteroseptal myocardial infarction. Can J Cardiol 2001; 17(7): 815–817. 5.

Youssef G, Khouzam S, Sprung J, Bourke DL. Regional pericarditis

Millaire A, De Groote P, Decoulx E, Leroy O, Ducloux G. Outcome after thrombolytic therapy of nine cases of myopericarditis misdiag-

References 1.

nosed as myocardial infarction. Eur Heart J 1995; 16(3): 333–338. 6.

Gungor B, Ucer E, Erdinler IC. Uncommon presentation of postcardiac

mimicking myocardial infarction. Anesthesiology 2001; 95(1): 261–264.

injury syndrome: acute pericarditis after percutaneous coronary inter-

Jain A. ‘‘Tombstone’’ anterior ST-segment elevations secondary to acute

vention. Int J Cardiol 2008; 128(1): e19–e21.

www.cvja.co.za

CardioVascular Journal of Africa (official journal for PASCAR)

Why you should publish with CVJA • Increased international exposure (indexed in Pubmed, Medline, Pubmed Central, Scopus, Embase and Thompson Reuters/ISI)

• Quick return on submissions • Changing patterns of heart disease in Africa get more exposure than in other journals

• Acceptance of diabetes studies as vascular studies in CVJA • African studies are given preference • Well-illustrated interventional studies are needed for CME in Africa (full website support capability)

• Instructions for authors on www.cvja.co.za • A PowerPoint presentation for new authors: 'How to write a scientific paper'

• Submit your manuscript online at www.cvja.co.za

PACK!

FOR YOUR BUCK

s ’ 2

NOW EVEN

Now available in the ALL NEW

MORE BANG

A Lupin Group Company

From only R31,61 SEP excl. VAT per tablet.

Advise your patients about THE AFFORDABLE OPTION1 for Erectile Dysfunction

JANUARY/FEBRUARY 2016 VOL 27 NO 1 A Lupin Group Company

Flexibility to ßeat hypertension www.cvja.co.za

CardioVascular Journal of Africa (official journal for PASCAR)

• Vascular rings: a radiological review of anatomical variations • Change in right ventricular systolic function according to revascularisation method

53% than the originator more aﬀordable

BISOPROLOL 2,5 mg / 5 mg / 10 mg HYDROCHLOROTHIAZIDE 6,25 mg

Printed by Tandym Printers

BISOPROLOL 5 mg / 10 mg

Cardiovascular Journal of Africa . Vol 27, No 1, January/February 2016

PUBLISHED ONLINE: • Pericardial effusion mimicking anterior MI following coronary angiography