TEST BANK For Introductory Chemistry Atoms First, 5th Edition By Steve Russo, Michael Silver by digitaldownload87

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 1 What Is Chemistry? 1.1 Multiple-Choice Questions 1) Which of the following can be classified as matter? A) ice B) sugar C) graphite D) All of the above are matter. Answer: D Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) Which of the following cannot be classified as matter? A) air B) temperature C) fog D) oxygen molecule Answer: B Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Which of the following may not be classified as matter? A) tooth filling B) sand C) heat D) seawater Answer: C Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) Which of the following is a pure, elemental substance? A) Br2(l) B) SO2(g) C) H2O(l) D) air Answer: A Section: Section 1.2 Learning Outcome: 1.3 Describe how an elemental substance differs from a compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

5) Which of the following is a pure substance? A) blood B) block of aluminum C) air D) orange juice Answer: B Section: Section 1.2 Learning Outcome: 1.3 Describe how an elemental substance differs from a compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) Which of the following is an example of a homogeneous mixture? A) sand B) copper C) air D) sugar Answer: C Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) What is another name for a homogeneous mixture? A) pure substance B) compound C) solution D) element Answer: C Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) Dirt is an example of a(n) ________. A) homogeneous mixture B) heterogeneous mixture C) compound D) element Answer: B Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

9) Which of the following is an example of a heterogeneous mixture? A) seawater B) steel C) milk D) chicken noodle soup Answer: D Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) What is the name given to the element with the symbol "P"? A) polonium B) protactinium C) phosphorus D) palladium Answer: C Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) What is the name of the element whose symbol is "Co"? A) carbon B) chromium C) coal D) cobalt Answer: D Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) What is the name given to the element with the symbol "K"? A) kallium B) potassium C) phosphorus D) krypton Answer: B Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) What is the name given to the element with the symbol "As"? A) silver B) argon C) antimony D) arsenic E) astatine Answer: D Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3 Copyright © 2015 Pearson Education, Inc.

14) By what chemical symbol do we know the element chromium? A) Cr B) Co C) C D) Cs Answer: A Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) What chemical symbol has been given to the element sodium? A) S B) K C) Na D) Sr Answer: C Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) By what chemical symbol do we know the element magnesium? A) Mn B) Ma C) M D) Mg Answer: D Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) Which element pair is incorrect? A) Au - gold B) Pb - iron C) Ag - silver D) Hg - mercury E) Mg - magnesium Answer: B Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) What is the correct statement about an atom? A) It is always pure. B) It is the smallest particle of an element. C) It is the smallest particle of a molecule. D) All atoms have protons, electrons, and neutrons. Answer: B Section: Section 1.2 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

19) Which of the following is a compound? A) F2(g) B) O2(g) C) Na(s) D) H2O2(l) Answer: D Section: Section 1.2 Learning Outcome: 1.3 Describe how an elemental substance differs from a compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) Which of the following represents a physical property? A) Sodium metal is extremely reactive with chlorine gas. B) Mercury is a shiny liquid at room temperature. C) The tendency of aluminum to "oxidize" D) The flammability of butane fuel. E) The unreactive nature of argon gas Answer: B Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) Which of the following represents a physical change only? A) steel turning to rust in salt air B) liquid water freezing into ice cubes C) milk turning "sour" D) wood burning to form ashes Answer: B Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 22) Which of the following represents a physical change only? A) barbecuing a steak B) adding electricity to water to produce hydrogen and oxygen gas C) condensing of steam D) burning a propane camping stove Answer: C Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

23) The "disappearance" of mothballs is an example of ________. A) melting B) vaporization C) condensation D) sublimation Answer: D Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) The term used to describe the conversion from a gaseous state to a liquid state is ________. A) melting B) vaporization C) condensation D) sublimation Answer: C Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 25) The term used to describe the conversion from a liquid state to a gaseous state is ________. A) melting B) vaporization C) condensation D) sublimation Answer: B Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 26) Which of the following represents a chemical change? A) sugar dissolving into hot coffee B) ice melting to form liquid water C) water boiling to form steam D) steel turning to rust in salt air Answer: D Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

27) Which of the following represents a chemical change? A) sublimation of dry ice B) molding solid silver C) frying an egg D) breaking a piece of glass Answer: C Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 28) Which of the following represents a chemical property of a specific metal? A) It has magnetic properties. B) It melts at 800 °C. C) Its density is higher than that of water. D) When in contact with air it corrodes. Answer: D Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 29) Which of the following is not a chemical property of carbon dioxide? A) It is a critical component in photosynthesis. B) It is used in fire extinguishers because it does not support combustion. C) It is used to pump up bicycle tires. D) It is reacts with water to form carbonic acid. Answer: C Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 30) The only way one can change an element to another is via ________. A) a chemical change B) a physical reaction C) a nuclear transformation D) applying heat Answer: C Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

31) Which term best completes this definition? An attempt to explain why a law exists is a(n) ________. A) experiment B) law C) theory D) model Answer: C Section: Section 1.5 Learning Outcome: 1.7 Describe the parts of the Scientific Method and how they are related to each other. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 1.2 True/False Questions 1) Iced tea, with sugar completely dissolved in it, is an example of a homogeneous mixture. Answer: TRUE Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 2) Air is a homogeneous mixture of nitrogen, oxygen and hydrogen. Answer: FALSE Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Tap water is a homogeneous mixture, while freshly distilled water is a compound. Answer: TRUE Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 4) The earth, taken together as a unit, may be considered one very large piece of heterogeneous matter. Answer: TRUE Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

5) Water is heterogeneous matter because it is made from twice as much hydrogen as oxygen (H2O). Answer: FALSE Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) A compound is a pure substance made from atoms of two or more different elements. Answer: TRUE Section: Section 1.2 Learning Outcome: 1.3 Describe how an elemental substance differs from a compound. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 7) The smallest possible piece of gold which still retains all the properties of gold is a cube shape containing eight gold atoms. Answer: FALSE Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) The chemical compounds CO and CO2 have exactly the same properties, because both are made from carbon and oxygen. Answer: FALSE Section: Section 1.2 Learning Outcome: 1.4 Explain what a chemical formula is (what it tells you). Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) If 1 gram of ice needs a certain amount of heat to melt, the same amount of energy must be removed to convert it back to ice at its melting point. Answer: TRUE Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) Evaporated ethanol can be isolated by cooling, without changing its disinfectant properties. Answer: TRUE Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) When milk goes "sour," only a physical change has occurred. Answer: FALSE Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 9 Copyright © 2015 Pearson Education, Inc.

12) Cooking vegetables with steam is a chemical process. Answer: TRUE Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 13) It is scientifically proper to construct a theory without then doing any experiments to test it. Answer: FALSE Section: Section 1.5 Learning Outcome: 1.7 Describe the parts of the Scientific Method and how they are related to each other. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) A theory summarizes facts. Answer: FALSE Section: Section 1.5 Learning Outcome: 1.7 Describe the parts of the Scientific Method and how they are related to each other. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) A physical picture used to illustrate a theory is a model. Answer: TRUE Section: Section 1.5 Learning Outcome: 1.7 Describe the parts of the Scientific Method and how they are related to each other. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

1.3 Matching Questions Match the substances in the left column with their classification in the right column. A) heterogeneous mixture B) element C) homogeneous mixture D) compound 1) Lemonade (without pulp) Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 2) Oil-vinegar salad dressing Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 3) Diamond Section: Section 1.2 Learning Outcome: 1.3 Describe how an elemental substance differs from a compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 4) Distilled water Section: Section 1.2 Learning Outcome: 1.3 Describe how an elemental substance differs from a compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 5) Table salt Section: Section 1.2 Learning Outcome: 1.3 Describe how an elemental substance differs from a compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 6) Intravenous liquid Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

7) Breakfast cereal with milk Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 8) Chlorine gas Section: Section 1.2 Learning Outcome: 1.3 Describe how an elemental substance differs from a compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 9) Brass Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 10) Golden nugget Section: Section 1.2 Learning Outcome: 1.3 Describe how an elemental substance differs from a compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 11) sugar Section: Section 1.2 Learning Outcome: 1.3 Describe how an elemental substance differs from a compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 12) sand and salt Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 13) Gasoline Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 14) chocolate chip cookies Section: Section 1.2 Learning Outcome: 1.2 Define the types of mixtures in terms of the types of matter. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 12 Copyright © 2015 Pearson Education, Inc.

15) mercury Section: Section 1.2 Learning Outcome: 1.3 Describe how an elemental substance differs from a compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 16) Vitamin C Section: Section 1.2 Learning Outcome: 1.3 Describe how an elemental substance differs from a compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. Answers: 1) C 2) A 3) B 4) D 5) D 6) C 7) A 8) B 9) C 10) B 11) D 12) A 13) C 14) A 15) B 16) D

Match the element in the first column with the symbol on the right. A) Po B) Pd C) Pt D) K E) Pu F) Pa G) P 17) Potassium Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Polonium Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) Phosphorus Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) Plutonium Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) Platinum Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) Palladium Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) Protactinium Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 17) D 18) A 19) G 20) E 21) C 22) B 23) F

Match the element in the first column with the symbol on the right. A) N B) Ne C) Nd D) Ni E) No 24) Nitrogen Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) Neodymium Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) Nobelium Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) Neon Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) Nickel Section: Section 1.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 24) A 25) C 26) E 27) B 28) D

Match the event in the left column with the name of the process in the right column. A) vaporization B) melting C) condensation D) freezing E) sublimation 29) The pond ices in winter. Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 30) Mothballs disappear when placed between clothes. Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 31) Water droplets form on the mirror of the medicine cabinet while taking a shower. Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 32) While heating water in a tea kettle, part of it disappears. Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 33) Ice cream liquefies on a hot day. Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 34) The block of dry ice in an ice cream parlor starts smoking once the store attendant opens the ice cream freezer. Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

35) Margarine is transformed into a liquid while frying an egg. Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 36) Water is collected in the gas tank of a car in a humid day. Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 37) Water changes to ice in the freezer. Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 38) Liquid nitrogen is transformed into a colorless gas. Section: Section 1.3 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. Answers: 29) D 30) E 31) C 32) A 33) B 34) E 35) B 36) C 37) D 38) A

Match the definition in the first column with the term in the second column. A) model B) law C) hypothesis D) experiment E) chemical change F) bias G) scientific method H) physical change I) theory 39) Baking bread Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 40) Iron rusting Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 41) Paper burning Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 42) Mixing ammonia and bleach Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 43) Mothballs subliming Section: Section 1.4 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

44) Cooking of an egg Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 45) Molding iron Section: Section 1.4 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 46) Digesting a sandwich Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 47) Water boiling Section: Section 1.4 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 48) Gasoline combusting in an engine. Section: Section 1.4 Learning Outcome: 1.6 Explain what happens to a substance or substances after they undergo a chemical change. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 49) Formation of snow Section: Section 1.4 Learning Outcome: 1.5 Name the states of matter and the types of physical transformation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 50) A procedure that scientists carry out to study phenomenon Section: Section 1.5 Learning Outcome: 1.7 Describe the parts of the Scientific Method and how they are related to each other. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

51) A generalization that concisely summarizes the outcome of a series of experiments Section: Section 1.5 Learning Outcome: 1.7 Describe the parts of the Scientific Method and how they are related to each other. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 52) A strong preference or inclination that inhibits impartial judgement Section: Section 1.5 Learning Outcome: 1.7 Describe the parts of the Scientific Method and how they are related to each other. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 53) An attempt to explain why a law exists Section: Section 1.5 Learning Outcome: 1.7 Describe the parts of the Scientific Method and how they are related to each other. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 54) The first time a theory is postulated Section: Section 1.5 Learning Outcome: 1.7 Describe the parts of the Scientific Method and how they are related to each other. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 55) Some kind of physical picture or mathematical expression of a theory. Section: Section 1.5 Learning Outcome: 1.7 Describe the parts of the Scientific Method and how they are related to each other. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 56) A cyclical process in which scientists continuously uncover new information, postulate new laws, and either modify or discard old ones. Section: Section 1.5 Learning Outcome: 1.7 Describe the parts of the Scientific Method and how they are related to each other. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. Answers: 39) E 40) E 41) E 42) E 43) H 44) E 45) H 46) E 47) H 48) E 49) H 50) D 51) B 52) F 53) I 54) C 55) A 56) G

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 2 The Numerical Side of Chemistry 2.1 Multiple-Choice Questions 1) Identify the exact number. A) a number of coins B) the diameter of a coin C) the radius of a coin D) the mass of a coin Answer: A Section: Section 2.1 Learning Outcome: 2.1 Explain what an exact number is and what a measured number is. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) Identify the piece of glassware that provides the least precise volume measurement of a liquid. A) beaker B) graduated cylinder C) buret D) pipette Answer: A Section: Section 2.1 Learning Outcome: 2.3 Explain why measured numbers always have uncertainty associated with them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Which of the following represents an estimated measurement? A) A calendar week has 7 days. B) The U.S. national debt is 6 trillion dollars. C) There are 50 states in the United States of America. D) My bank account contains 19 dollars and 26 cents. Answer: B Section: Section 2.1 Learning Outcome: 2.1 Explain what an exact number is and what a measured number is. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) For the measured value 6.73 pounds, what is the degree of uncertainty? A) +/- 10 pounds B) +/- 1 pound C) +/- 0.1 pound D) +/- 0.01 pound Answer: D Section: Section 2.2 Learning Outcome: 2.7 Identify the degree of uncertainty in a number written in scientific notation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 1 Copyright © 2015 Pearson Education, Inc.

5) How many significant figures are in 43.8001? A) 2 B) 3 C) 4 D) 6 Answer: D Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) Which one of the following numbers does not have four significant figures? A) 1.007 g B) 0.0007 g C) 1.070 g D) 1700. g E) 1.700 g Answer: B Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) Round off 907,506 to four significant figures. A) 9.075 × 10-5 B) 9.075 × 105 C) 9,075 D) 90,751 E) 908,000 Answer: B Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) How many significant digits are present n the number 6046.2? A) 4 B) 3 C) 5 D) 1 Answer: C Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

9) How many significant digits are present in the number 0.02560? A) 3 B) 4 C) 5 D) 6 Answer: B Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) How many significant figures are present in 0.00123, 7000, and 1.519 × 10-2? A) 6, 4, 4 B) 4, 1, 1 C) 7, 1, 4 D) 3, 1, 4 Answer: D Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) The number 0.0040600 has ________ trailing zeros. A) 0 B) 1 C) 2 D) 6 Answer: C Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) The correct scientific notation for 147.8 × 10 -3 is ________. A) 1.478 B) 1478 × 10-4 C) 1.478 × 10-1 D) 1.478 × 10-5 Answer: C Section: Section 2.4 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

13) Convert 0.000001546 mi to scientific notation. A) 1.546 × 106 mi B) 1.546 × 105 mi C) 1.546 × 10-5 mi D) 1.546 × 10-6 mi Answer: D Section: Section 2.4 Learning Outcome: 2.6 Convert a number from standard to scientific notation and vice versa. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) The number 0.0247 expressed in scientific notation is ________. A) 2.47 × 10-4 B) 2.47 × 10-2 C) 2.47 × 10-1 D) 24.7 Answer: B Section: Section 2.4 Learning Outcome: 2.6 Convert a number from standard to scientific notation and vice versa. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) The number 0.00003007 expressed in scientific notation is ________. A) 3.007 × 10-5 B) 3.007 × 105 C) 3.007 D) 3.007 × 104 E) 3.7 × 10-5 Answer: A Section: Section 2.4 Learning Outcome: 2.6 Convert a number from standard to scientific notation and vice versa. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Express the number 1.06 × 10-4 in standard notation. A) 10,600 B) 106 C) 0.0106 D) 0.000106 Answer: D Section: Section 2.4 Learning Outcome: 2.6 Convert a number from standard to scientific notation and vice versa. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

17) The United States has the unit of currency dollars (unit symbol: $). Which of the following is a proper expression of the value seventy seven hundred dollars +/- 1 dollar? A) $ 7.7 × 10+4 B) $ 7.7 × 10+3 C) $ 7700 D) $ 7.700 × 10+3 Answer: D Section: Section 2.4 Learning Outcome: 2.5 Identify the amount of uncertainty in a written measured quantity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) By how many places must the decimal point of the number 0.0000814 be moved in order to express this same number in a standard scientific notation? A) 4 B) 5 C) 6 D) 7 Answer: B Section: Section 2.4 Learning Outcome: 2.5 Identify the amount of uncertainty in a written measured quantity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) For the final sum of 544.36 + 455.64, the number of significant figures is ________. A) 6 B) 5 C) 4 D) 2 E) 1 Answer: A Section: Section 2.5 Learning Outcome: 2.8 Correctly add or subtract numbers according to the rules of significant figures. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 20) The correct answer for the operation (5.61 + 7.891 ) / 9.1 is ________. A) 4.86 B) 4.8646714 C) 1.5 D) 5.0 Answer: C Section: Section 2.5 Learning Outcome: 2.8 Correctly add or subtract numbers according to the rules of significant figures and 2.9 Correctly multiply or divide numbers according to the rules of significant figures. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

21) Using the rules of significant figures, calculate the following: 14.8903 - 2.14 = A) 12.750 B) 12.75 C) 13 D) 12.7503 E) 12 Answer: B Section: Section 2.5 Learning Outcome: 2.8 Correctly add or subtract numbers according to the rules of significant figures. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 22) The sum for the operation 1.2315 + 0.116 + 15.10 is ________. A) 16 B) 16.4 C) 16.45 D) 16.4475 Answer: C Section: Section 2.5 Learning Outcome: 2.8 Correctly add or subtract numbers according to the rules of significant figures. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 23) Which of the following operations will give an answer of 50.1? A) 29.75 + 20.3 B) 58.23 - 8.1 C) 26.255 × 1.91 D) all of the above Answer: D Section: Section 2.5 Learning Outcome: 2.8 Correctly add or subtract numbers according to the rules of significant figures and 2.9 Correctly multiply or divide numbers according to the rules of significant figures. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 24) Which of the following operations will not give an answer of 73.3? A) 63.75 × 1.15 B) 90.0 - 16.67 C) 60.15 + 13.26 D) 12.161 × 6.03 Answer: C Section: Section 2.5 Learning Outcome: 2.8 Correctly add or subtract numbers according to the rules of significant figures and 2.9 Correctly multiply or divide numbers according to the rules of significant figures. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6 Copyright © 2015 Pearson Education, Inc.

25) The correct answer in the operation below is ________. (30.004 cm × 14.01 g) / 6.08 cm2 A) 69.1375 g/cm B) 69.14 g/cm C) 69.1 g/cm D) 69.138 g/cm Answer: C Section: Section 2.5 Learning Outcome: 2.9 Correctly multiply or divide numbers according to the rules of significant figures. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 26) Which of the following is defined as the quantity of matter in a sample that is independent of where it is measured? A) weight B) mass C) volume D) both A and B Answer: B Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) Which of the following is not an SI unit that is used in chemistry? A) s B) K C) kg D) quart Answer: D Section: Section 2.6 Learning Outcome: 2.10a Identify the common SI units used by science. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) Which is the SI unit for mass? A) kilogram B) pound C) gram D) ounce Answer: A Section: Section 2.6 Learning Outcome: 2.10a Identify the common SI units used by science. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

29) Which is the SI unit for temperature? A) Fahrenheit B) Celsius C) Kelvin D) either A or C Answer: C Section: Section 2.6 Learning Outcome: 2.10a Identify the common SI units used by science. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) Which is the SI unit for length? A) meter B) inch C) kilometer D) mile Answer: A Section: Section 2.6 Learning Outcome: 2.10a Identify the common SI units used by science. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) Which is the SI unit for time? A) year B) day C) minute D) second Answer: D Section: Section 2.6 Learning Outcome: 2.10a Identify the common SI units used by science. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) Which is a derived SI unit? A) J B) m C) K D) s Answer: A Section: Section 2.6 Learning Outcome: 2.10a Identify the common SI units used by science. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

33) Which is not a derived SI unit? A) Pa B) J C) C D) s Answer: D Section: Section 2.6 Learning Outcome: 2.10a Identify the common SI units used by science. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) The prefix used to indicate 10-12 is ________. A) microB) nanoC) picoD) gigaAnswer: C Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 35) What is the prefix for the multiplier 1 × 106? A) microB) nanoC) megaD) kiloAnswer: C Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) What is the prefix for the multiplier 1 × 10-6? A) microB) nanoC) megaD) kiloAnswer: A Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

37) 10 millimeters are equal to ________ nanometers. A) 107 B) 10-7 C) 103 D) 10-3 Answer: A Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) How many kilograms are in 452 mg? A) 4.52 × 10-7 kg B) 4.52 × 10-4 kg C) 0.452 kg D) 4.52 × 108 kg Answer: B Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 39) 465.000 g is equivalent to ________. A) 0.0465 kg B) 465,000 mg C) 4.65 kg D) 465,000 ng Answer: B Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 40) Which of the following numbers expresses the value 2600. calories with both the correct units and proper scientific notation? A) 2.6 × 104 kcal B) 2.600 × 103 cal C) 2.60 × 103 mcal D) 26 × 102 dcal Answer: B Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

41) In order to convert 121 dm to mm one needs to multiply by ________. A) 107 B) 102 C) 10-2 D) 10-5 Answer: B Section: Section 2.6 Learning Outcome: 2.6 Convert a number from standard to scientific notation and vice versa. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 42) Which of the following does not measure temperature? A) °C B) °F C) K D) J Answer: D Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) 68 °F is equal to ________. A) 37 °C B) 32 °C C) 25 °C D) 20. °C Answer: D Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 44) 40. °C is equal to ________ K. A) 313 B) 293 C) 263 D) 233 Answer: A Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

45) A liquid boils at 68 °F at one atmosphere pressure. This is equal to ________ K. A) 341 B) 205 C) 253 D) 293 Answer: D Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 46) Which is the lowest temperature? A) 40 °C B) 104 °F C) 313 K D) All of them are about the same. Answer: D Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 47) Which of the following is the hottest temperature? A) 90 °C B) 104 °F C) 353 K D) All of the above are the same. Answer: A Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 48) Which of the following is coldest temperature? A) -40 °C B) -40 °F C) 210 K D) All of the above are the same. Answer: C Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

49) The correct order of decreasing temperatures in the set below is ________. A) 18 °C > 80 °F > 280 K B) 280 K > 18 °C > 80 °F C) 80 °F > 18 °C > 280 K D) 80 °F > 280 K > 18 °C Answer: C Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 50) Which of the following temperatures are not possible? A) 2000 °C B) -425 °F C) -425 °C D) 5 K Answer: C Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 51) The units of density for a liquid are usually expressed as ________. A) g/mL B) g/L C) mg/mL D) mg/L Answer: A Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 52) What is the density of a piece of wood that weighs 62 grams and displaces 0.525 L of water? A) 120 g/mL B) 0.12 g/mL C) 0.0080 g/mL D) 8.5 g/mL Answer: B Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

53) If the density of aluminum is 2.70 g/ cm3, the mass of 10.0 cm3 of this material is ________. A) 27.0 g B) 2.70 g C) 3.70 g D) 0.270 g Answer: A Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 54) The density of a 4.0 cm3 sample of a metal is 11.3 g/cm3. What is the density of 8.0 cm3 sample of the same metal? A) 11.3 g/ mL B) 22.6 g/ mL C) 5.65 g/ mL D) 2.0 g/ mL Answer: A Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 55) A popular science demonstration is to take several liquids that will not mix together and "stack" these liquids in a tall glass cylinder. Suppose the following three liquids were placed in the same tall, narrow glass cylinder: SUBSTANCE vinegar motor oil corn syrup

DENSITY g/mL 1.01 0.87 1.36

The substance that should be placed first in the cylinder so that it is on the bottom is ________. A) vinegar B) motor oil C) corn syrup D) cannot be determined Answer: C Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

56) The density of copper is about 8.96 g/mL. This means that a certain mass of copper will ________. A) occupy the same volume as the same mass of water B) occupy a volume 8.96 times larger than the volume occupied by the same mass of water C) occupy a volume that is 8.96 times smaller than the volume occupied by the same mass of water D) always occupy a volume of 8.96 mL Answer: C Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 57) Ethanol has a density of 0.789 g/mL. This means that a certain volume of ethanol will ________. A) weigh more than an equal volume of water B) weigh less than an equal volume of water C) weigh exactly the same as an equal volume of water D) always weigh 0.8 g Answer: B Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 58) An 80.0 g sample of metal A displaces 20.0 mL of water, while a 56.0 g sample of metal B displaces 14.0 mL of water. The conclusion one may draw from this information is that ________. A) A and B are the same metal B) A and B are not the same metal C) A and B may be the same metal, but more studies are needed to decide if they are the same D) The above results tell us nothing about the nature of A and B. Answer: C Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 59) 164.0 g of a substance occupy a volume of 120.0 mL. In relation to water, which statement is true? A) The substance will float in water. B) The substance will sink in water. C) The substance will react with water. D) The substance is a metal. Answer: B Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

60) 20.5 g of a liquid has a volume of 15 mL. What is the density? A) 1 g/mL B) 1.3 g/mL C) 1.4 g/mL D) 1.36 g/mL Answer: C Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 61) Which statement is true? A) 1 mm = 0.0394 in. B) 1 cm3 = 1 mL C) 1 g = 0.0022 lb D) All of the above are true. Answer: D Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 62) 5 gallons is equal to ________ quarts. A) 5 B) 10 C) 20 D) 40 Answer: C Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 63) The closest number of grams that is equivalent to 0.745 lb is ________. A) 338 B) 3.379 C) 0.338 D) 1.64 × 10-3 Answer: A Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

64) One thousand yards are equivalent to ________. A) 9.14 × 10-2 mm B) 9.14 × 102 m C) 12,000 in D) 1,094 m Answer: B Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 65) How many moles of copper are present in 128 grams of copper (for copper, 1 mole = 63.546 grams)? A) 0.496 moles B) 8134 moles C) 8.13 × 10-3 moles D) 2.01 moles Answer: D Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 66) If the speed limit is 60. mi/hr, its equivalent in km/hr is ________. A) 38 B) 97 C) 27 D) 123 Answer: B Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 67) If the speed limit is 120 km/hr, its equivalent in mi/hr is ________. A) 75 B) 192 C) 133 D) 210 Answer: A Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

68) A person is 6 ft 10 in tall. This is equivalent to ________ m. A) 2.08 m B) 2.69 m C) 3.22 m D) 1.68 m Answer: A Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 69) The density of aluminum is 2.7 g/mL. This is equivalent to ________ kg/m3. A) 2.7 × 104 B) 2.7 C) 0.27 D) 2.7 × 103 Answer: D Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 70) How many cm2 are there in 5.20 in2? A) 33.5 B) 13.2 C) 2.05 D) 0.806 Answer: A Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 71) The distance of the 220-yard race is equivalent to ________ ft. A) 660 B) 2,640 C) 7.92 × 103 D) 73.3 Answer: A Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

72) The world record for the 100-meter dash is 9.8 s. If the world record holding runner could maintain the same pace when running five kilometers, he would cover the distance in ________. A) 9.8 min B) 8.2 min C) 1.6 min D) 5.1 min Answer: B Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 73) Which of the following is the shortest? A) 18 inches B) 0.58 m C) 580 mm D) 1.9 ft Answer: A Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 74) Which of the following has the greatest mass? A) 4.4 lb B) 2.0 kg C) 165 oz D) 2.0 × 103 g Answer: C Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 75) The dietary energy requirement for an adult is 2000 kcal per day. This is equivalent to ________. A) 478 J B) 8.37 J C) 47.8 kJ D) 8.37 × 103 kJ Answer: D Section: Section 2.10 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

76) 20.9 kJ is equal to ________ kcal. A) 5,000 B) 5.00 C) 873.6 D) 20 Answer: B Section: Section 2.10 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 77) Convert 250.0 kcal to Joules. A) 250.0 J B) 5.975 × 104 J C) 1.046 × 106 J D) 1.046 × 103 J Answer: C Section: Section 2.10 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 78) 500 cal are added to 10 g of water (specific heat of 1.000 cal/g °C) originally at 20 °C. The final temperature is ________. A) 70 °C B) 50 °C C) 25 °C D) 22.5 °C Answer: A Section: Section 2.10 Learning Outcome: 2.14e Calculate the amount of heat energy using specific heat. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 79) 10. g of a certain metal absorb 40. cal of heat and the temperature is observed to rise from 20. °C to 60. °C. The specific heat of this metal is ________ cal/g °C. A) 0.050 B) 0.10 C) 0.16 D) 0.40 Answer: B Section: Section 2.10 Learning Outcome: 2.14e Calculate the amount of heat energy using specific heat. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

80) 100. cal of heat are added to 10 g of ethanol (0.581 cal/g °C) originally at 15 °C. The final temperature is ________. A) 17 °C B) 27 °C C) 32 °C D) 38 °C Answer: C Section: Section 2.10 Learning Outcome: 2.14e Calculate the amount of heat energy using specific heat. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 81) How many Joules of heat are required to raise the temperature of 35 mL of water from 25 °C to 100 °C? A) 630 J B) 2.6 × 103 J C) 1.1 × 104 J D) 1.0 × 103 J Answer: C Section: Section 2.10 Learning Outcome: 2.14e Calculate the amount of heat energy using specific heat. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 82) Which of the following statements about energy is correct? A) Energy is the ability to do work. B) When energy is absorbed by a system, its temperature increases. C) Heat energy may be converted to work. D) All of the above are correct. Answer: D Section: Section 2.10 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 83) The specific heat of water is higher than that of iron. Which of the following statements is correct? A) The energy needed to heat iron to a certain temperature is less than the energy needed to raise the water temperature to the same level. B) If the same quantity of energy is applied to both water and iron, iron's temperature will be much higher. C) Iron is a better heat conductor. D) All of the above statements are correct. Answer: D Section: Section 2.10 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

84) Which of the following is not a conversion factor? A) speed B) density C) energy D) specific heat Answer: C Section: Section 2.10 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 85) Which of the following is a conversion factor? A) mass B) density C) volume D) time Answer: B Section: Section 2.10 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2.2 True/False Questions 1) Precision refers to how close the measured result is to the true value. Answer: FALSE Section: Section 2.1 Learning Outcome: 2.2 Describe the difference between precision and accuracy. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) The measured value 12.011 can be assumed to be accurate to +/- 0.001. Answer: TRUE Section: Section 2.2 Learning Outcome: 2.3 Explain why measured numbers always have uncertainty associated with them. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 3) The commonly quoted distance from the earth to the sun (93,000,000 miles) is accurate to only miles. Answer: TRUE Section: Section 2.2 Learning Outcome: 2.3 Explain why measured numbers always have uncertainty associated with them. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry and G5 Demonstrate an understanding of the impact of science on society. 4) Leading zeros are all the zeros that follow the first non-zero digit. Answer: FALSE Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 22 Copyright © 2015 Pearson Education, Inc.

5) When determining the number of significant figures in a number, leading zeros are not significant. Answer: TRUE Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 6) When determining the number of significant figures in a number, trailing zeros are not significant. Answer: FALSE Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 7) Trailing zeros are also called place-holding zeros. Answer: FALSE Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 8) When adding or subtracting measured numbers, the answer contains no more significant figures than the number with the least number of significant figures being added or subtracted. Answer: TRUE Section: Section 2.5 Learning Outcome: 2.8 Correctly add or subtract numbers according to the rules of significant figures. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 9) The correct answer for the product (2.150 × 12.2) is 26.23. Answer: FALSE Section: Section 2.5 Learning Outcome: 2.8 Correctly add or subtract numbers according to the rules of significant figures. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) Coulomb is the derived SI unit that measures electrical charge. Answer: TRUE Section: Section 2.6 Learning Outcome: 2.10a Identify the common SI units used by science. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) Joule is the derived SI unit that measures energy. Answer: TRUE Section: Section 2.6 Learning Outcome: 2.10a Identify the common SI units used by science. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23 Copyright © 2015 Pearson Education, Inc.

12) The derived SI unit for pressure is cubic inches. Answer: FALSE Section: Section 2.6 Learning Outcome: 2.10a Identify the common SI units used by science. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) 1 kilowatt is equal to 10,000 watts. Answer: FALSE Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 14) 2 × 10-3 meters is equal to 2 kilometers. Answer: FALSE Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 15) One meter is equal to 1 million micrometers. Answer: TRUE Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 16) The prefix micro- indicates one millionth. Answer: TRUE Section: Section 2.6 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 17) The prefix pico- indicates one billionth. Answer: FALSE Section: Section 2.6 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 18) One mL is equal to 1 cc. Answer: TRUE Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

19) A pound of feathers really does not weigh more than a pound of gold. Answer: TRUE Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 20) 0 K is equal to -273.15 °C. Answer: TRUE Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 21) -40 °C is equivalent to -40 °F. Answer: TRUE Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 22) 40 °C is equivalent to 40 °F. Answer: FALSE Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 23) There has never been recorded a negative Kelvin temperature. Answer: TRUE Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) The Kelvin temperature is not always higher than the equivalent Celsius temperature. Answer: FALSE Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

25) The Fahrenheit temperature is always numerically higher than the equivalent Celsius temperature. Answer: FALSE Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) Density is an extensive property of matter the more of a given substance you have, the more dense it becomes. Answer: FALSE Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 27) Oil "floats" on water because oil weighs less than water. Answer: FALSE Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 28) Oil "floats" on water because oil is less dense than water. Answer: TRUE Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 29) Density units may be in lb/ gallon. Answer: TRUE Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) The fact that ice has a lower density than liquid water is advantageous to marine life. Answer: TRUE Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

31) Salt water has a density that is less than 1 g/mL. Answer: FALSE Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 32) Ice always occupies a smaller volume than water. Answer: FALSE Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 33) Density is a conversion factor. Answer: TRUE Section: Section 2.8 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) One week contains 604,800 seconds. Answer: TRUE Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry and G5 Demonstrate an understanding of the impact of science on society. 35) There are 4 pints in a gallon. Answer: FALSE Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry and G5 Demonstrate an understanding of the impact of science on society. 36) Specific heat may be measured as cal. g/°C. Answer: FALSE Section: Section 2.10 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 37) A substance that may be a good heat conductor usually has a low value for specific heat. Answer: TRUE Section: Section 2.10 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

38) Water is a good heat conductor. Answer: FALSE Section: Section 2.10 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 39) When heat is absorbed the temperature of the system increases. Answer: TRUE Section: Section 2.10 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 40) Temperature changes that may be used for energy difference calculations are measured through a bomb calorimeter. Answer: TRUE Section: Section 2.10 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 41) One Cal of energy used by dieticians and the food industry is equal to 4.184 joules. Answer: FALSE Section: Section 2.10 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) One Cal is equal to 1 kcal. Answer: TRUE Section: Section 2.10 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2.3 Short Answer Questions 1) How many significant digits are there in the number 740.2? Answer: 4 Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) How many significant digits are there in the number 0.0038040? Answer: 5 Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) What is the Greek prefix and abbreviation which signifies one thousand? Answer: k, for kilo Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

4) Convert 16.8 meters to: a) millimeters, b) centimeters, c) kilometers. Answer: a) 16,800 mm b) 1,680 cm c) 0.0168 km Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) Convert 65 °F, a cool summer's daytime temperature, to: a) degrees Celsius. b) absolute temperature (Kelvin). Answer: a) 18 °C b) 291 K Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) What is the density, in g/mL, of a piece of metal that weighs 0.408 kg and displaces 0.0297 L of water? Answer: d = 13.7 g/mL Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) Convert 302 cubic inches to liters (1 inch = 2.54 centimeters). Show the math. Answer: (302 in3) × (2.54 cm/1 in)3 × (1 mL/1 cm3) × (1 L/1000 mL) = 4.95 L Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 8) Convert 15.0 ft 3 to m3. Show the math. Answer: (15.0 ft 3) × (12 in/1 ft)3 × (2.54 cm/1 in) 3 × (1 m/100 cm)3 = 0.425 m3 Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

9) It is 1148 miles from Grand Rapids, Michigan, to Starkville, Mississippi. What is the same distance in kilometers (1 mile = 1.61 kilometers)? Answer: 1850 kilometers (although it seems much longer by car) Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) Calculate the approximate distance (in km) between earth and sun, given that the speed of light is about and that it takes about 8.5 minutes for sunlight to reach earth. Answer: (3 × 1010 cm/s) × (60 s/min) × (8.5 min) × (1 m/100 cm) × (1 km/1,000 m) = 1.5 × 108 km Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) Solve the equation 4x + 3y = 246 for the x-variable, and report the value for x when y = 2.36. Answer: (246 - 3y)/4 = x; when y = 2.36, x = 59.7 Section: Section 2.9 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 12) Solve the equation PV = nRT for the n-variable. Answer: n = (PV)/(RT) Section: Section 2.9 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 13) Calculate the amount of energy needed to raise the temperature of 25 mL ethanol (density = 0.80 g/mL) from 10.0 °C to 20.0 °C (c = 0.581 cal/g°C) both in cal and joules. Answer: Density = mass/ volume; mass of ethanol = 0.80 × 25 = 20. g; Heat = mass × specific heat × difference in temperature = 20. × 0.581 × 10 = 120 cal = 490 joules Section: Section 2.10 Learning Outcome: 2.14e Calculate the amount of heat energy using specific heat. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

2.4 Matching Questions Match the correct number of significant figures from the second column with each of the numbers in the first column. A) 7 B) 3 C) 2 D) 6 E) 5 F) 4 G) 1 1) 2.456 × 10-3 Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) 0.00201 Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) 34.3004 Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) 0.40001 Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) 4.0 Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) 0.7 Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) 0.02 Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31 Copyright © 2015 Pearson Education, Inc.

8) 5.2406 Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) 8.901070 Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) 0.002003 Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) 5000 Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) 5000. Section: Section 2.3 Learning Outcome: 2.4 Identify leading zeros and trailing zeros in a measured number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 1) F 2) B 3) D 4) E 5) C 6) G 7) G 8) E 9) A 10) F 11) G 12) F

Match the correct scientific notation from column 2 with the standard notation provided in column 1. A) 1.570 x 100 B) 1.570 x 101 C) 1.570 x 10-3 D) 1.570 x 10-2 13) 15.70 Section: Learning Outcome: Section 2.4 2.6 Convert a number from standard to scientific notation and vice versa. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) 1.570 Section: Section 2.4 Learning Outcome: 2.6 Convert a number from standard to scientific notation and vice versa. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) 0.001570 Section: Section 2.4 Learning Outcome: 2.6 Convert a number from standard to scientific notation and vice versa. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) 0.01570 Section: Section 2.4 Learning Outcome: 2.6 Convert a number from standard to scientific notation and vice versa. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 13) B 14) A 15) C 16) D

Match each temperature in column 1 with the equivalent different scale temperature in column 2. A) 0. °C B) 280 K C) 68 °F D) 100. °C E) -40 °F F) 32 °F G) 98.6 °F H) -273 °C I) -17.8 °C 17) 20. °C Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 18) 273 K Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 19) 40. °F Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 20) 0.00 °F Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 21) 0 °C Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 22) 310 K Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 34 Copyright © 2015 Pearson Education, Inc.

23) -40 °C Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 24) 212 °F Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 25) 0 K Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 17) C 18) A 19) B 20) I 21) F 22) G 23) E 24) D 25) H

Match a unit from the first column with a measurement from the second column. A) time B) energy C) electrical charge D) mass E) length F) volume G) temperature H) density 26) mg Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) s Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) ft Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 29) km Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) qt Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) mL Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) lb Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) gallon Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) m3 Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36 Copyright © 2015 Pearson Education, Inc.

35) in Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) K Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 37) °F Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) °C Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 39) Joule Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 40) C Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 41) g/L Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) lb/qt Section: Section 2.7 Learning Outcome: 2.11b Define density and use it to do calculations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) Cal Section: Section 2.10 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 26) D 27) A 28) E 29) E 30) F 31) F 32) D 33) F 34) F 35) E 36) G 37) G 38) G 39) B 40) C 41) H 42) H 43) B

Match an exponential from the right column with each prefix in the left column. A) 10+3 B) 10-1 C) 10+9 D) 10-12 E) 10-3 F) 10+6 G) 10-6 H) 10-9 I) 10-2 44) gigaSection: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 45) nanoSection: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 46) centiSection: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 47) milliSection: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 48) microSection: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 49) kiloSection: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 50) picoSection: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 51) deciSection: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

52) megaSection: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 44) C 45) H 46) I 47) E 48) G 49) A 50) D 51) B 52) F

Match each unit in the left column with another unit of the same physical measurement that appears in the right column. A) joule B) lb/qt C) °C D) gallon E) km F) lb 53) g Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 54) ton Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 55) quart Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 56) cal Section: Section 2.10 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 57) K Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 58) g/mL Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 59) mile Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 60) cup Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 61) oF Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

62) yd Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 63) cm3 Section: Section 2.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 53) F 54) F 55) D 56) A 57) C 58) B 59) E 60) D 61) C 62) E 63) D

Choose the number in the second column that correctly fills the blank in each item in the first column. A) 36 B) 0.556 C) 454 D) 8 E) 1,000,000 F) 1,000 G) 1 H) 2.54 I) 4.184 J) 16 64) One kg is equal to ________ g. Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 65) One degree Fahrenheit is equal to _____°C. Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 66) One Kelvin is equal to _____°C. Section: Section 2.6 Learning Outcome: 2.13d Algebraically rearrange a mathematical equation to solve it for a desired variable. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 67) One kilometer is equal to ________ mm. Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 68) One pound is equal to ________ g. Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

69) One gallon is equal to ________ pints. Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 70) One yard is equal to ________ inches. Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 71) One inch is equal to ________ cm. Section: Section 2.8 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 72) One pound is equal to ________ oz. Section: Section 2.6 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 73) One cal is equal to ________ J. Section: Section 2.10 Learning Outcome: 2.12c Convert the units of a measured quantity to some other units using Unit Analysis. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 64) F 65) B 66) G 67) E 68) C 69) D 70) A 71) H 72) J 73) I

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 3 The Evolution of Atomic Theory 3.1 Multiple-Choice Questions 1) Calcium carbonate (CaCO3) is 34.5% Ca by mass. In a 418 g sample of CaCO3, how many grams of calcium are present? A) 144 g B) 40.08 g C) 235.1 g D) 83.6 g Answer: A Section: Section 3.1 Learning Outcome: 3.1 Calculate the percent composition of each element in a compound. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 2) 24.3 g of magnesium yield 40.3 g MgO upon combustion with oxygen. How much magnesium needs to be burned to yield 12.1 g MgO? A) 4.30 g B) 6.10 g C) 7.30 g D) 8.40 g Answer: C Section: Section 3.1 Learning Outcome: 3.1 Calculate the percent composition of each element in a compound. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 3) What is the mass of the single product that is formed from the complete reaction of 2.5 g hydrogen with 7.5 g oxygen? A) 5.0 g B) 7.5 g C) 9.5 g D) 10.0 g Answer: D Section: Section 3.1 Learning Outcome: 3.1 Calculate the percent composition of each element in a compound. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

4) A 3.45 gram sample of hematite (Fe2O3) that contains 2.41 grams of Fe has what percentage Fe by mass? A) 41.0% B) 31.1% C) 69.9% D) 59.9% Answer: C Section: Section 3.1 Learning Outcome: 3.1 Calculate the percent composition of each element in a compound. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) A compound is produced when 6.08 g of nitrogen combine with 13.92 g oxygen. What is the empirical formula of this compound? A) NO B) NO2 C) N2O3 D) N2O5 Answer: B Section: Section 3.1 Learning Outcome: 3.1 Calculate the percent composition of each element in a compound. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) According to the experiments of Ernest Rutherford, where can a majority of a given atom's mass be found? A) scattered randomly throughout an approximately cube-shaped atom B) at the center of an approximately spherical atom C) in concentric layers of spherical shape D) as small pieces orbiting a common center in circular paths Answer: B Section: Section 3.3 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) The structure of individual atoms can roughly be described as ________. A) positively charged center and mostly empty space B) an even mixture of mass and charge scattered throughout a spherical shape C) positively charged, low-mass pieces in orbit around a massive, negatively charged center D) positively charged pieces in orbit around a low-mass, negatively charged center Answer: A Section: Section 3.3 Learning Outcome: 3.3 Name and describe the subatomic particles in an atom. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

8) What is the relative charge on a neutron, proton, and electron? A) 0, -1, +1 B) 0, 0, -1 C) 0, +1, -1 D) -1, +1, -1 Answer: C Section: Section 3.4 Learning Outcome: 3.3 Name and describe the subatomic particles in an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) How is the term "atomic number" defined for a given atom? A) as the mass of one mole of that element or isotope B) as the sum of the number of protons, neutrons, and electrons C) as the sum of the number of protons and neutrons in the nucleus D) as the number of protons in the nucleus Answer: D Section: Section 3.4 Learning Outcome: 3.6 Explain the meaning of an atom's atomic mass and mass number. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 10) How is the term "mass number" defined for a given atom or isotope? A) as the mass of one mole of that element or isotope B) as the sum of the number of protons, neutrons, and electrons C) as the sum of the number of protons and neutrons in the nucleus D) as the number of protons in the nucleus Answer: C Section: Section 3.4 Learning Outcome: 3.6 Explain the meaning of an atom's atomic mass and mass number. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 11) A neutral atom's atomic number is equal to ________. A) the number of nucleons B) the sum of the number of protons and neutrons C) the number of electrons D) the number of neutrons Answer: C Section: Section 3.4 Learning Outcome: 3.6 Explain the meaning of an atom's atomic mass and mass number. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

12) An atomic mass unit, also known as amu, is equal to ________ the mass of a 12C atom. A) 1/2 B) 1/12 C) 1/6 D) 1/1840 Answer: B Section: Section 3.4 Learning Outcome: 3.6 Explain the meaning of an atom's atomic mass and mass number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) Which of the following is the correct symbolic representation of the lead-209 isotope? A)

Answer: D Section: Section 3.4 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) How many neutrons does the nucleus of the phosphorus-32 isotope have? A) 15 B) 16 C) 17 D) 32 Answer: C Section: Section 3.4 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) What is the atomic number of uranium-235? A) 235 B) 238 C) 92 D) 143 Answer: C Section: Section 3.4 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4 Copyright © 2015 Pearson Education, Inc.

16) How many protons does the nucleus of the sulfur-35 isotope have? A) 16 B) 19 C) 32 D) 35 Answer: A Section: Section 3.4 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) Identify X in the expression

A) zinc B) iron C) iridium D) cesium E) manganese Answer: E Section: Section 3.4 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Identify X in the expression

A) selenium B) copper C) cobalt D) cesium E) manganese Answer: B Section: Section 3.4 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

19) Identify X in the expression

A) silver B) gold C) bohrium D) cobalt E) neodymium Answer: A Section: Section 3.4 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) The breakthrough Dmitri Mendeleev had when constructing the periodic table occurred ________. A) when J. J. Thomson discovered the electron B) when Sir James Chadwick discovered the neutron C) when Thomson and E. Goldstein discovered the proton D) when Mendeleev placed the elements in a sequence of increasing atomic mass Answer: D Section: Section 3.5 Learning Outcome: 3.8 Explain Mendeleev's discovery. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) Which of the following terms applies to the vertical columns found on a periodic table? A) arrangement B) group C) period D) isotope Answer: B Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 22) Which of the following terms applies to the horizontal rows found on a periodic table? A) arrangement B) group C) period D) isotope Answer: C Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

23) What name is commonly given to the elements of Group IA of the periodic table? A) alkaline earth metals B) transition metals C) platinum metals D) alkali metals Answer: D Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 24) What name is commonly given to the elements of Group IIA of the periodic table? A) alkaline earth metals B) transition metals C) platinum metals D) alkali metals Answer: A Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 25) Which is expected to be the most chemically similar element to phosphorus? A) S B) As C) Se D) O Answer: B Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) Which element would have a similar chemical reactivity in water as K? A) Ca B) Ar C) Rb D) H Answer: C Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

27) Which of the following is not a metal? A) Ca B) Pt C) Kr D) Mg Answer: C Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) Which of the following is a metal? A) Xe B) C C) As D) W Answer: D Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 29) Which of the following is a metalloid in the third period of the periodic table? A) Al B) Si C) P D) S Answer: B Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) Which of the following is a transition metal in the fourth period of the periodic table? A) Ga B) Ca C) Fe D) Ag Answer: C Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

31) Which of the following elements is a chalcogen? A) H B) N C) O D) F Answer: C Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) Which of the following elements is a halogen? A) He B) B C) F D) Kr Answer: C Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) Which of the following is not a main group element? A) S B) As C) Cu D) Xe Answer: C Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) Which of the following elements is an actinide? A) Np B) Pr C) W D) Fr Answer: A Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

35) Which of the following is a transition element? A) Co B) Eu C) Es D) He Answer: A Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) Which representative element is found in the fourth group and fifth period? A) Br B) Te C) Sn D) Ge Answer: C Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 37) Which of the following elements may have a cation that has 16 electrons? A) Si B) P C) S D) Cl Answer: D Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) Which of the following elements can have an anion with 18 electrons? A) Cl B) Ar C) Sc D) Fe Answer: A Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

39) Which ion contains 18 electrons? A) Ca+ B) Cl2C) ArD) P3Answer: D Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 40) How many electrons are found in a Fe3+ ion? A) 23 B) 26 C) 29 D) 56 Answer: A Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 41) How many protons are found in a N3- ion? A) 7 B) 10 C) 14 D) 15 Answer: A Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) Which has more electrons? A) BrB) Sr2+ C) Rb D) As3+ Answer: C Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

43) Which of the following has more electrons than neutrons? A) 24Mg2+ B) 27Al C) 75As3D) 32S2Answer: D Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 44) Which of the following has more protons than electrons? A) Mg2+ B) Al C) P3D) O2Answer: A Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 45) Ionization energy ________ from top to bottom in a group and ________ from left to right in a period. A) increases; increases B) increases; decreases C) decreases; increases D) decreases; decreases Answer: C Section: Section 3.7 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 46) Which of the following has the highest ionization energy? A) O B) Sn C) As D) C Answer: A Section: Section 3.7 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

47) Which of the following has the lowest ionization energy? A) F B) P C) Ca D) Cs Answer: D Section: Section 3.7 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 48) Fr+ is called ________. A) a cation B) an anion C) an isotope D) a non-metal Answer: A Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 49) Which of the following pairs are isotopes? A) Ca2+ and Mg2+ B) 199Hg and 200Hg C) 18O and 19F D) 238U and 238Np Answer: B Section: Section 3.7 Learning Outcome: 3.7 Define isotopes. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 50) Which cation has the atomic number of 20 and a charge of +2? A) C2+ B) Mg2+ C) Ca2+ D) S2+ Answer: C Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

51) Which species has 16 protons, 18 neutrons and 18 electrons? A) 34S2+ B) 34S2C) 36Ar2+ D) 36Se2Answer: B Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 52) Ions are ________. A) atoms that have gained electrons B) atoms or groups of atoms with a net electrical charge that is not equal to zero C) atoms that have lost electrons D) all of the above Answer: D Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 53) Which element, isotope, or ion listed below contains 16 protons, 17 neutrons, and 18 electrons? A) 33Ar2B) 33S2C) 33Cl D) 34S2Answer: B Section: Section 3.7 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 54) Which element, isotope, or ion listed below contains 35 protons, 46 neutrons, and 36 electrons? A) 81Kr+ B) 81Br C) 81Kr D) 81Br Answer: D Section: Section 3.7 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

3.2 True/False Questions 1) The conservation of mass law states that matter can neither be created nor destroyed during a chemical reaction. Answer: TRUE Section: Section 3.1 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) Atoms combine to form molecules (compounds) in simple, whole number ratios. Answer: TRUE Section: Section 3.1 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 3) In Dalton's atomic theory, all matter is made up of atoms. Answer: TRUE Section: Section 3.1 Learning Outcome: 3.2 Describe how Dalton explained formulas of compounds. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 4) The law of constant composition states that atoms must combine in a one to one ratio. Answer: FALSE Section: Section 3.1 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 5) An alpha particle consists of two protons and two neutrons. Answer: TRUE Section: Section 3.3 Learning Outcome: 3.3 Name and describe the subatomic particles in an atom. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 6) The atomic weight for an atom is the weighted average of all the naturally occurring isotopes. Answer: TRUE Section: Section 3.4 Learning Outcome: 3.6 Explain the meaning of an atom's atomic mass and mass number. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 7) Each element is defined by its atomic number. Answer: TRUE Section: Section 3.4 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

8) A neutral atom of the isotope phosphorus-32 contains 15 protons, 17 neutrons, and 15 electrons. Answer: TRUE Section: Section 3.4 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) Tritium is an isotope of carbon. Answer: FALSE Section: Section 3.4 Learning Outcome: 3.7 Define isotopes. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) Two isotopes of the same element differ only in the number of neutrons found in the nucleus. Answer: TRUE Section: Section 3.4 Learning Outcome: 3.7 Define isotopes. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 11) The oxygen-17 isotope has more protons than neutrons in its nucleus. Answer: FALSE Section: Section 3.4 Learning Outcome: 3.7 Define isotopes. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) The oxygen-17 (-2) isotopic anion contains more electrons than either protons or neutrons. Answer: TRUE Section: Section 3.4 Learning Outcome: 3.7 Define isotopes. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) Group IIA of the periodic table contains elements that are gaseous non-metals. Answer: FALSE Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) Group VIIIA of the periodic table contains elements that are gaseous non-metals. Answer: TRUE Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

15) The periodic table contains more elements that are classified as non-metals than elements of any other type. Answer: FALSE Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Magnesium is the element that appears in the second group of the second period. Answer: FALSE Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) Radium is the only noble gas that is radioactive. Answer: FALSE Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Barium is an alkali earth metal. Answer: FALSE Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) Krypton is a noble gas. Answer: TRUE Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) Sulfur belongs to the chalcogen family. Answer: TRUE Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) Platinum is used in the catalytic converters of the cars. Answer: TRUE Section: Section 3.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) Lanthanides are rare earth elements. Answer: TRUE Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17 Copyright © 2015 Pearson Education, Inc.

23) Earth's gravitational force is incapable of keeping the atmospheric helium from escaping into space. Answer: TRUE Section: Section 3.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) Noble gases occupy Group VII in the periodic table. Answer: FALSE Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) Mercury is the only metal that is a liquid at room temperature. Answer: TRUE Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) Iodine is the only non-metal that is a solid at room temperature. Answer: FALSE Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) The most stable isotope of oxygen has 8 neutrons. Answer: TRUE Section: Section 3.6 Learning Outcome: 3.7 Define isotopes. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) It is easier to remove an electron from the outside shell of a K atom than from the outside shell of a Na atom. Answer: TRUE Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 29) One needs to supply energy from an outside source to form a cation from a neutral atom. Answer: TRUE Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

3.3 Short Answer Questions Write the atomic symbols for the following neutral isotopes. 1) lead-207 Answer: atomic number 82, mass number 207, symbol Pb Section: Section 3.4 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) cobalt-60 Answer: atomic number 27, mass number 60, symbol Co Section: Section 3.4 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) uranium-235 Answer: atomic number 92, mass number 235, symbol U Section: Section 3.4 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) strontium-90 Answer: atomic number 38, mass number 90, symbol Sr Section: Section 3.4 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) Why are the elements in Group VIIIA called the "noble gases"? Answer: The noble gases are unreactive with other elements. Section: Section 3.6 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

3.4 Matching Questions Match the scientist in the left column with his contribution to the chemistry field that appears in the right column. A) Rationalized that matter is neither created nor destroyed B) Proved that matter is always conserved C) Discovered (with Thomson) the proton D) Discovered the electron E) Believed that the matter could be infinitely subdivided F) Postulated that matter is made up of tiny atoms G) Constructed the periodic table H) Demonstrated the existence of the neutron 1) Antoine Lavoisier Section: Section 3.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) Democritus Section: Section 3.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Aristotle Section: Section 3.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) Dmitri Mendeleev Section: Section 3.5 Learning Outcome: 3.8 Explain Mendeleev's discovery. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) John Dalton Section: Section 3.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) J.J. Thomson Section: Section 3.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) James Chadwick Section: Section 3.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

8) E. Goldstein Section: Section 3.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 1) B 2) F 3) E 4) G 5) A 6) D 7) H 8) C

Match every element in the first column with its symbol in the second column. A) Na B) Co C) Po D) Cu E) Mn F) Ni G) Fe H) N I) Si J) K K) S L) Au M) Ag N) Rn O) Ra P) P Q) Mg 9) Sulfur Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) Potassium Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) Manganese Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) Magnesium Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) Radium Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) Radon Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

15) Nitrogen Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Nickel Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) Polonium Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Iron Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) Sodium Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) Silver Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) Silicon Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) Phosphorus Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) Gold Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) Copper Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) Cobalt Section: Section 3.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 9) K 10) J 11) E 12) Q 13) O 14) N 15) H 16) F 17) C 18) G 19) A 20) M 21) I 22) P 23) L 24) D 25) B 23 Copyright © 2015 Pearson Education, Inc.

Match every element in the first column with an occurrence in the second column. A) Plating car bumpers B) Computer Chips C) Bicycle Frames D) Antacids E) Diamonds F) Thermometers G) Steel H) Soda cans 26) Silicon Section: Section 3.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) Chromium Section: Section 3.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) Magnesium Section: Section 3.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 29) Carbon Section: Section 3.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) Iron Section: Section 3.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) Mercury Section: Section 3.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) Titanium Section: Section 3.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) Aluminum Section: Section 3.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 26) B 27) A 28) D 29) E 30) G 31) F 32) C 33) H

Classify each of the elements in the first column with a family name in the second column. A) Actinide B) Gaseous Halogen C) Liquid Metal D) Gaseous Chalcogen E) Lanthanide F) Solid Chalcogen G) Alkali metal H) Noble Gas I) Metalloid J) Liquid Halogen K) Solid Halogen L) Alkaline earth metal M) Transition element 34) Oxygen Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 35) Cerium Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) Potassium Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 37) Calcium Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) Tellurium Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 39) Iodine Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

40) Xenon Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 41) Uranium Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) Lithium Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) Mercury Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 44) Silver Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 45) Bromine Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 46) Strontium Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 47) Silicon Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 48) Krypton Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

49) Chlorine Section: Section 3.6 Learning Outcome: 3.9 Identify groups, periods, metals, and nonmetals in the periodic table. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 34) D 35) E 36) G 37) L 38) F 39) K 40) H 41) A 42) G 43) C 44) M 45) J 46) L 47) I 48) H 49) B

Match each statement from the first column with the correct species in the second column. A) 3H B) 4He+ C) 30P D) 35C11E) 27A1 F) 1H+ G) 12C H) 23Na+ 50) Has a mass number equal to 27 Section: Section 3.7 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 51) Has ten electrons Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. I) 7Be Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 52) Has a nuclear charge of +15 Section: Section 3.7 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 53) Has an equal number of protons, neutrons, and electrons Section: Section 3.7 Learning Outcome: 3.6 Explain the meaning of an atom's atomic mass and mass number. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 54) Has no neutrons Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 55) Has a number of electrons equal to that of neutrons, but different than that of protons Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

56) Has no electrons Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 57) Has a number of neutrons (other than zero) which is less than the number of protons Section: Section 3.7 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 58) Has a number of neutrons twice that of protons Section: Section 3.7 Learning Outcome: 3.5 Explain what the atomic number and the mass number tell you about an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 59) Has a number of neutrons twice that of electrons Section: Section 3.7 Learning Outcome: 3.10a Explain what cations and anions are and how to form them. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 50) E 51) H 52) C 53) G 54) F 55) D 56) F 57) I 58) A 59) B

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 4 The Modern Model of the Atom 4.1 Multiple-Choice Questions 1) The units of h (Planck's constant) are ________. A) J.s B) J/s C) m/s D) J/nm Answer: A Section: Section 4.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) Which color light is composed of photons having the largest energy? A) blue B) green C) yellow D) red Answer: A Section: Section 4.1 Learning Outcome: 4.1 Describe electromagnetic radiation in terms of its wavelength, frequency, and energy. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Which type of electromagnetic radiation is composed of photons having the largest energy? A) microwaves B) radio waves C) x rays D) gamma rays Answer: D Section: Section 4.1 Learning Outcome: 4.1 Describe electromagnetic radiation in terms of its wavelength, frequency, and energy. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) Which color light is composed of photons having the longest wavelength? A) blue B) green C) yellow D) red Answer: D Section: Section 4.1 Learning Outcome: 4.1 Describe electromagnetic radiation in terms of its wavelength, frequency, and energy. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 1 Copyright © 2015 Pearson Education, Inc.

5) What is the wavelength (in meters) of radio waves that have a frequency of 89.9 MHz? (wavelength × frequency = speed of light; speed of light = 3.0 × 108 meters/sec.) A) 3.3 centimeters B) 2.7 × 1016 millimeters C) 0.30 meters D) 3.3 meters Answer: D Section: Section 4.1 Learning Outcome: 4.1 Describe electromagnetic radiation in terms of its wavelength, frequency, and energy. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) Calculate the energy in joules of microwave radiation of wavelength 12.7 centimeters. (E = hν, h = 6.63 × 10-34 J.sec; speed of light = wavelength × ν, speed of light = 3.0 × 108 meters/sec.) A) 4.9 × 1019 J B) 7.3 × 10-19 J C) 3.6 × 10-18 J D) 1.6 × 10-24 J Answer: D Section: Section 4.1 Learning Outcome: 4.2 Calculate the energy of light. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) What is the main difference between "classical physics" and "quantum physics"? A) Quantum physics requires the speed of light to be a constant value. B) Classical physics requires that only certain, allowed values for energy be used. C) Quantum physics requires that only certain, allowed values for energy be used. D) Quantum physics can only describe the behavior of very small objects, like atoms and molecules. Answer: C Section: Section 4.2 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 8) Which feature of Bohr's atomic model is no longer accepted as true by today's scientists? A) Most of an atom's mass is located within the nucleus. B) Electrons have only certain, allowed energy values. C) Electrons orbit the nucleus in fixed circular paths. D) Each principal quantum level can hold a maximum of 2n2 electrons. Answer: C Section: Section 4.3 Learning Outcome: 4.8 Describe Bohr's Subshells and why they are needed. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

9) In a single atom, what is the maximum number of electrons that can have quantum number n = 4? A) 10 B) 14 C) 18 D) 32 Answer: D Section: Section 4.3 Learning Outcome: 4.4 Describe Bohr's shells (orbits) and how they relate to quantized energy and n. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) For the electron of a hydrogen atom, which of the following quantum "jumps" requires the most energy? A) from n = 3 to n = 4 B) from n = 2 to n = 3 C) from n = 4 to n = 5 D) from n = 1 to n = 2 Answer: D Section: Section 4.4 Learning Outcome: 4.4 Describe Bohr's shells (orbits) and how they relate to quantized energy and n. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) Which of the following subshells does not appear in the third shell? A) s B) p C) d D) f Answer: D Section: Section 4.5 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) Which of the following subshells appear in the second shell? A) s B) s, p C) s, p, d D) p Answer: B Section: Section 4.5 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

13) The correct order of increasing energy in the following subshells is: A) 2p, 3s, 4s, 3p, 3d B) 2p, 3s, 3p, 4s, 3d C) 2p, 3s, 3p, 3d, 4s D) 2p, 3s, 3d, 3p, 4s Answer: B Section: Section 4.5 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) What is the maximum number of electrons in an 4f subshell? A) 14 B) 10 C) 7 D) 28 Answer: A Section: Section 4.5 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) What is the maximum number of electrons in a 3p subshell? A) 10 B) 3 C) 6 D) 5 Answer: C Section: Section 4.5 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Which is the correct electronic configuration for Se (atomic number 34) in the ground state? A) 1s22s22p63s23p63d104s24p4 B) 1s22s22p63s23p63d104s04p6 C) 1s22s22p63s23p64s23d104p4 D) 1s22s22p63s23p63d104s03p6 Answer: C Section: Section 4.5 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

17) Which is the correct electronic configuration for Fe (atomic number 26) in the ground state? A) 1s22s22p63s23p64s23d6 B) 1s22s22p63s23p63d8 C) 1s22s22p63s23p63d64s2 D) 1s22s22p63s23p64s24p6 Answer: A Section: Section 4.5 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Which of the following elements has the electronic configuration: 1s22s22p63s23p3? A) Al B) P C) S D) Si Answer: B Section: Section 4.5 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) What is the number of outer shell electrons in fluorine? A) 2 B) 5 C) 7 D) 9 Answer: C Section: Section 4.5 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) How many valence electrons are in silicon? A) 2 B) 4 C) 5 D) 7 Answer: B Section: Section 4.5 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

21) The total number of electrons that can be accommodated in 3d is ________. A) 5 B) 2 C) 6 D) 10 Answer: D Section: Section 4.5 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) 9) A metal is an element that tends to ________ valence electrons in chemical reactions, becoming a(n) ________ in the process. A) lose; cation B) gain; anion C) lose; anion D) gain; cation Answer: A Section: Section 4.6 Learning Outcome: 4.13d Describe the octet rule and how it applies to metals and nonmetals. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 23) A non-metal is an element that tends to ________ valence electrons in chemical reactions, becoming a(n) ________ in the process. A) lose; cation B) gain; anion C) lose; anion D) gain; cation Answer: B Section: Section 4.6 Learning Outcome: 4.13d Describe the octet rule and how it applies to metals and nonmetals. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 24) The size of boron is ________ than that of oxygen and ________ than that of aluminum. A) smaller; larger B) larger; larger C) smaller; smaller D) larger; smaller Answer: D Section: Section 4.6 Learning Outcome: 4.12c Describe the periodic trends in atomic size and ionization energy. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

25) What is the trend in atomic size in the series of Group IIA elements Be through Ra? A) Atomic size increases in this series. B) Atomic size decreases in this series. C) Atomic size remains unchanged in this series. D) Atomic size increases at first, then decreases in this series. Answer: A Section: Section 4.6 Learning Outcome: 4.12c Describe the periodic trends in atomic size and ionization energy. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) Which of the following elements is the smallest size chalcogen? A) H B) N C) O D) F Answer: C Section: Section 4.6 Learning Outcome: 4.12c Describe the periodic trends in atomic size and ionization energy. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) Which of the following cations will have the electronic configuration 1s22s22p63s23p6? A) Co2+ B) Ca2+ C) Sc1+ D) Cl1+ Answer: B Section: Section 4.7 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) Which of the following anions will have the electronic configuration 1s22s22p63s23p6? A) K1B) Cl1C) S2D) Br1Answer: B Section: Section 4.7 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

29) The likely formula of the compound formed between Al and S is ________. A) Al2S B) AlS2 C) Al2S3 D) Al3S2 Answer: C Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) The likely formula of the compound formed between Ca and O is ________. A) Ca2O B) CaO2 C) Ca2O3 D) CaO Answer: D Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) Which of the following elements never obeys the octet rule? A) hydrogen B) nitrogen C) carbon D) chlorine Answer: A Section: Section 4.7 Learning Outcome: 4.13d Describe the octet rule and how it applies to metals and nonmetals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) Which of the following ions does not match the electronic configuration 1s22s22p63s23p64s23d104p6? A) Br1B) Sr2+ C) As3D) Se2+ Answer: D Section: Section 4.7 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

33) Which of the following ions have electronic configuration: 1s22s22p63s23p6? A) FB) Mg+2 C) P-3 D) SAnswer: C Section: Section 4.7 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) Which of the following ions does not have the neon electron configuration? A) S4+ B) Mg2+ C) O2D) Al3+ Answer: A Section: Section 4.7 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 35) Which of the following ions does not include [Kr] in its shorthand electron configuration? A) Sr2+ B) Te2C) Se6+ D) Mo Answer: C Section: Section 4.7 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) Atoms in which of the following groups will likely gain three electrons? A) IIIA B) VA C) VIIA D) both A and B Answer: B Section: Section 4.7 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

37) Atoms in which of the following groups will likely lose three electrons? A) IIIA B) VA C) IIA D) IVA Answer: A Section: Section 4.7 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) The relative ratio of atoms in the binary compound AlxOy is ________. A) x = 2, y = 3 B) x = 3, y = 2 C) x = 5, y = 2 D) x = 2, y = 5 Answer: A Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 39) The valence shell ________. A) always contains eight electrons. B) is the lowest energy shell in an atom. C) contains electrons in the outermost shell. D) is always the same for anions and cations. Answer: C Section: Section 4.7 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 40) Below are four pairs of atoms and ions. In which pair is the larger of the two species written first? A) S2- and S B) Cu2+ and Cu C) O and O2D) Cr3+ and Cr Answer: A Section: Section 4.7 Learning Outcome: 4.12c Describe the periodic trends in atomic size and ionization energy. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

41) The ion that has 14 protons and 18 electrons is ________. A) Si4+ B) Si4C) N4+ D) N4Answer: B Section: Section 4.7 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) Which of the following has attained a noble gas electronic configuration? A) Si4+ B) Cl1+ C) Al3D) Cr3+ Answer: A Section: Section 4.7 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) The elements of Group VIIIA are almost entirely non-reactive with any of the other chemical elements. Which of the following statements best explains this observed behavior? A) Group VIIIA elements comply with the octet rule. B) Group VIIIA elements are so rare that no one has ever studied their reactive properties in any detail. C) Group VIIIA elements are all gases, and gases are generally non-reactive. D) No explanation given here can explain why Group VIIIA elements do not react with any of the other chemical elements. Answer: A Section: Section 4.7 Learning Outcome: 4.13d Describe the octet rule and how it applies to metals and nonmetals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 44) Predict the formula of the compound produced in a reaction between barium (Ba) and oxygen (O). A) BaO2 B) BaO C) BaO3 D) Ba2O3 Answer: B Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11 Copyright © 2015 Pearson Education, Inc.

45) Predict the formula of the compound produced in a reaction between lithium (Li) and phosphorus (P). A) LiP B) Li2P3 C) LiP2 D) Li3P Answer: D Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 46) Which of the following elements is the largest size halogen? A) He B) I C) F D) Kr Answer: B Section: Section 4.7 Learning Outcome: 4.12c Describe the periodic trends in atomic size and ionization energy. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 47) The scientist credited with developing the current mathematical model of the atom is ________. A) Bohr B) Schrödinger C) Planck D) Rutherford Answer: B Section: Section 4.8 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 48) Which orbital is dumbbell-shaped? A) 2s B) 3p C) 4d D) 5g Answer: B Section: Section 4.8 Learning Outcome: 4.15f Describe what an orbital is and the types of orbitals that exist in an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

49) Which orbital is a spherical shape? A) 2s B) 3p C) 4d D) 5f Answer: A Section: Section 4.8 Learning Outcome: 4.15f Describe what an orbital is and the types of orbitals that exist in an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 50) Which s orbital is the largest? A) 1s B) 2s C) 3s D) 4s Answer: D Section: Section 4.8 Learning Outcome: 4.15f Describe what an orbital is and the types of orbitals that exist in an atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4.2 True/False Questions 1) The only possible way for an excited state electron to return to the ground state is to emit energy in the form of visible light. Answer: FALSE Section: Section 4.1 Learning Outcome: 4.5 Explain the difference between a ground state and an excited state electron configuration. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) The wavelength is the distance measured between two crests, but not between two troughs. Answer: FALSE Section: Section 4.1 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 3) The speed of light is about 186,000 miles per minute. Answer: FALSE Section: Section 4.1 Learning Outcome: 4.2 Calculate the energy of light. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

4) Both the energy and the wavelength of electromagnetic radiation are related by the constants c, the speed of light, and Planck's constant, h. Answer: TRUE Section: Section 4.1 Learning Outcome: 4.1 Describe electromagnetic radiation in terms of its wavelength, frequency, and energy. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 5) Blue visible light has a lower energy than red visible light. Answer: FALSE Section: Section 4.1 Learning Outcome: 4.1 Describe electromagnetic radiation in terms of its wavelength, frequency, and energy. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) Blue visible light has a higher frequency than red visible light. Answer: TRUE Section: Section 4.1 Learning Outcome: 4.1 Describe electromagnetic radiation in terms of its wavelength, frequency, and energy. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) Microwave is radiation of a lower energy than that of visible light. Answer: TRUE Section: Section 4.1 Learning Outcome: 4.1 Describe electromagnetic radiation in terms of its wavelength, frequency, and energy. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) Red light is the lowest frequency of light in the visible region of the electromagnetic spectrum. Answer: TRUE Section: Section 4.1 Learning Outcome: 4.1 Describe electromagnetic radiation in terms of its wavelength, frequency, and energy. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) The frequency of infrared radiation that has a wavelength of 1.5 × 103 nm is 2.0 × 107 sec-1 (given: speed of light = 3.0 × 108 m/sec). Answer: FALSE Section: Section 4.1 Learning Outcome: 4.1 Describe electromagnetic radiation in terms of its wavelength, frequency, and energy. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

10) The wavelengths in infrared radiation are larger than those of the ultraviolet region. Answer: TRUE Section: Section 4.1 Learning Outcome: 4.1 Describe electromagnetic radiation in terms of its wavelength, frequency, and energy. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) The observed line spectra of electrically excited gas samples tend to support the notion that electron energies are quantized. Answer: TRUE Section: Section 4.2 Learning Outcome: 4.3 Explain what is meant by "Quantized Energy." Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) In Bohr's theory, electrons can jump from one energy level to another or from one orbit to another. Answer: TRUE Section: Section 4.3 Learning Outcome: 4.4 Describe Bohr's shells (orbits) and how they relate to quantized energy and n. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 13) Once an atom gets excited, it may remain in that excited state indefinitely. Answer: FALSE Section: Section 4.4 Learning Outcome: 4.5 Explain the difference between a ground state and an excited state electron configuration. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 14) An electron in the excited state does not necessarily return to a ground state in a single jump. Answer: TRUE Section: Section 4.4 Learning Outcome: 4.5 Explain the difference between a ground state and an excited state electron configuration. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 15) Phosphorus atoms have five valence electrons. Answer: TRUE Section: Section 4.5 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

16) The f-block represents a region on the periodic table that is ten elements wide. Answer: FALSE Section: Section 4.5 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 17) The p-block represents a region on the periodic table that is six elements wide. Answer: TRUE Section: Section 4.5 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 18) The n = 5 principal energy level can hold a maximum of 25 electrons. Answer: FALSE Section: Section 4.5 Learning Outcome: 4.4 Describe Bohr's shells (orbits) and how they relate to quantized energy and n. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) The correct shortcut for writing the electronic configuration of Sr is [Ar]4s2. Answer: FALSE Section: Section 4.5 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) The number of electrons in the valence shell of an atom is equal to the group number for the representative elements. Answer: TRUE Section: Section 4.5 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) Atoms tend to increase in size as one moves from left to right across a period. Answer: FALSE Section: Section 4.6 Learning Outcome: 4.12c Describe the periodic trends in atomic size and ionization energy. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 22) Metals generally become more reactive as one proceeds down a column (group). Answer: TRUE Section: Section 4.6 Learning Outcome: 4.12c Describe the periodic trends in atomic size and ionization energy. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 16 Copyright © 2015 Pearson Education, Inc.

23) The atomic radius can be measured by x-ray diffraction. Answer: TRUE Section: Section 4.6 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 24) The atom size decreases as one proceeds from top to bottom down a group. Answer: FALSE Section: Section 4.6 Learning Outcome: 4.12c Describe the periodic trends in atomic size and ionization energy. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 25) +1 is the only charge sodium ions normally have. Answer: TRUE Section: Section 4.6 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) If an element has a small electron affinity value it can easily lose an electron. Answer: FALSE Section: Section 4.6 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 27) Halogens have large electron affinity values. Answer: TRUE Section: Section 4.6 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 28) Should an oxygen atom (O) gain two electrons, it would then have the same ground state electronic configuration as an atom of neon (Ne), thus satisfying the octet rule. Answer: TRUE Section: Section 4.7 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 29) A non-metal is an element that tends to gain valence electrons in chemical reactions becoming a cation in the process. Answer: FALSE Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

30) H+ has one electron. Answer: FALSE Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) Carbon can assume both +4 and -4 charges. Answer: TRUE Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) One example of a d orbital looks like a four-leaf clover. Answer: TRUE Section: Section 4.8 Learning Outcome: 4.15f Describe what an orbital is and the types of orbitals that exist in an atom. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 33) Modern scientists accept the notion that electrons are found in circular orbits around a central, positively charged nucleus. Answer: FALSE Section: Section 4.8 Learning Outcome: 4.15f Describe what an orbital is and the types of orbitals that exist in an atom. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 34) Modern atomic theory places electrons into complex mathematical probability functions called "orbitals." Answer: TRUE Section: Section 4.8 Learning Outcome: 4.15f Describe what an orbital is and the types of orbitals that exist in an atom. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 35) Shells get larger as the principal quantum number n increases. Answer: TRUE Section: Section 4.8 Learning Outcome: 4.4 Describe Bohr's shells (orbits) and how they relate to quantized energy and n. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

36) The 95% boundary indicates the area where 95% of the time the electron may be found. Answer: TRUE Section: Section 4.8 Learning Outcome: 4.15f Describe what an orbital is and the types of orbitals that exist in an atom. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 4.3 Short Answer Questions 1) Write the complete electronic ground state configuration for tellurium (Te). Make sure the terms in your answer are listed in order of increasing energy. Answer: Two possible, equally correct answers: the abbreviated [Kr] 5s24d105p4, or the complete 1s22s22p63s23p64s23d104p65s24d105p4. Section: Section 4.5 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) List the sublevels of the n = 3 principal energy level, and state the maximum number of electrons contained within each of these sublevels. Answer: n = 3: 3s, containing 2 electrons 3p, containing 6 electrons 3d, containing 10 electrons Section: Section 4.5 Learning Outcome: 4.4 Describe Bohr's shells (orbits) and how they relate to quantized energy and n. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Which element is the more reactive, sodium (Na) or potassium (K)? Answer: Potassium (K) possesses a more accessible, single valence electron by virtue of its larger size. This lone electron is found farther from the nucleus in potassium than sodium, and is easier to remove, thus making it more reactive. Section: Section 4.7 Learning Outcome: 4.11b Describe the relationship between the periodic table and an atom's electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) Write the complete electronic ground state configuration of the Se2- ion. Which other element (if any) shares this electronic configuration? Answer: Se : 1s22s22p63s23p64s23d104p6. This is the same electronic configuration as the element krypton (Kr). Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

4.4 Matching Questions Match the outermost occupied orbital(s) in the first column with the corresponding element in the second column. A) Cu B) Dy C) Sr D) Th E) Mn F) Br G) Xe 1) 5s2 Section: Section 4.5 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) 4p5 Section: Section 4.5 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) 3d5 Section: Section 4.5 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) 4s13d10 Section: Section 4.5 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) 5p6 Section: Section 4.5 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

6) 6s24f10 Section: Section 4.5 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) 7s26d2 Section: Section 4.5 Learning Outcome: 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 1) C 2) F 3) E 4) A 5) G 6) B 7) D

Classify each of the following as ground state, excited state, or impossible electronic configurations. A) Excited State B) Ground State C) Impossible State 8) 1s22s22p63s13p3 Section: Section 4.5 Learning Outcome: 4.5 Explain the difference between a ground state and an excited state electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) 1s22s22p63s23p8 Section: Section 4.5 Learning Outcome: 4.5 Explain the difference between a ground state and an excited state electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) 1s22s22p63s23p64s1 Section: Section 4.5 Learning Outcome: 4.5 Explain the difference between a ground state and an excited state electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) 1s22s22p63s23p64s24p1 Section: Section 4.5 Learning Outcome: 4.5 Explain the difference between a ground state and an excited state electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) 1s22s22p63s23p64s23d5 Section: Section 4.5 Learning Outcome: 4.5 Explain the difference between a ground state and an excited state electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) 1s22s22p63s23p64s13d104p1 Section: Section 4.5 Learning Outcome: 4.5 Explain the difference between a ground state and an excited state electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

14) 1s22s22p63s23p64s23d12 Section: Section 4.5 Learning Outcome: 4.5 Explain the difference between a ground state and an excited state electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 8) A 9) C 10) B 11) A 12) B 13) A 14) C

Match each element in the first column with the most likely valence charge of its ion in the second column. A) (+4 or -4) B) (0) C) (-2) D) (+1) E) (+2) F) (-3) G) (+3) H) (-1) 15) Li Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) O Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) S Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) C1 Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) Si Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) Ba Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24 Copyright © 2015 Pearson Education, Inc.

21) N Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) Br Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) Cs Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) Ne Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) Al Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) P Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) Ca Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) I Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25 Copyright © 2015 Pearson Education, Inc.

29) He Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion and 4.10a Identify the period, group, and valence electrons given an electron configuration. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 15) D 16) C 17) C 18) H 19) A 20) E 21) F 22) H 23) D 24) B 25) G 26) F 27) E 28) H 29) B

Match the following species in the first column with the corresponding electronic configuration in the second column. A) 1s22s22p63s2 B) 1s22s22p63s23p2 C) 1s22s22p63s23p64s2 D) 1s22s22p63s23p1 E) 1s22s22p63s23p4 F) 1s22s22p63s23p6 G) 1s22s22p6 H) 1s22s22p63s23p5 30) Mg Section: Section 4.5 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) Mg2+ Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) Ca Section: Section 4.5 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) Ca2+ Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) Al Section: Section 4.5 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 35) Si Section: Section 4.5 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) Si4+ Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27 Copyright © 2015 Pearson Education, Inc.

37) Si4Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) S Section: Section 4.5 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 39) S4+ Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 40) S6+ Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 41) S2Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) N3Section: Section 4.7 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) C1 Section: Section 4.5 Learning Outcome: 4.9 Write the ground state electron configuration for an atom and an ion. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 30) A 31) G 32) C 33) F 34) D 35) B 36) G 37) F 38) E 39) A 40) G 41) F 42) G 43) H

Match every binary compound in the first column with the correct coefficient of x and y in the second column. A) x = 2, y = 1 B) x = 1, y = 2 C) x = 2, y = 3 D) x = 4, y = 1 E) x = 1, y = 1 or x =1, y = 2 F) x = 3, y = 2 G) x = 1, y = 3 H) x = 1, y = 4 I) x = 3, y = 1 J) x = 1, y = 1 44) AlxCly Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 45) NaxSy Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 46) MgxOy Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 47) CaxNy Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 48) CxCly Section: Section 4.7 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

49) LixCy Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 50) AlxSy Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 51) PxHy Section: Section 4.7 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 52) CxOy Section: Section 4.7 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 53) LixNy Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 54) NaxOy Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 55) BxFy Section: Section 4.7 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 56) BaxCly Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

57) LixHy Section: Section 4.7 Learning Outcome: 4.14e Predict the formula of a compound formed from a metal and a nonmetal using the Octet Rule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 44) G 45) A 46) J 47) F 48) H 49) D 50) C 51) G 52) E 53) I 54) A 55) G 56) B 57) J Match the scientist in the left column with his contribution. A) Proposed that the electrons inside of an atom could only have specific, discrete amounts of energy. B) Proposed energy quantization to explain the energy characteristics of light emitted by heated objects. C) Developed the model of an atom. D) Suggested the existence of a tiny, massive positively charged nucleus. 58) Max Planck Section: Section 4.24.3 Explain what is meant by "Quantized Energy." Learning Outcome: Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 59) Niels Bohr Section: Section 4.2 Learning Outcome: 4.4 Describe Bohr's shells (orbits) and how they relate to quantized energy and n. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 60) Ernest Rutherford Section: Section 4.8 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 61) Erwin Schrödinger Section: Section 4.8 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. Answers: 58) B 59) A 60) D 61) C

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 5 Chemical Bonding and Nomenclature 5.1 Multiple-Choice Questions 1) Which of the following statements best describes an ionic bond? A) a strong lattice of positively and negatively charged atoms held together by electrical forces B) the bonding type present in bound, non-metal atoms C) the equal sharing of two electrons between adjacent atoms D) the bonding type present between two metal atoms Answer: A Section: Section 5.1 Learning Outcome: 5.1 Define an ionic bond and predict when it is likely to occur. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) Which of the following is considered an elemental substance? A) I2 (iodine) B) H2O (water) C) Fe (an iron nail) D) A and C are elemental substances. E) All of the preceding are elemental substances. Answer: D Section: Section 5.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Which of the following substances is molecular (composed of individual molecules) in composition? A) carbon in coal B) drinking water C) a copper ingot D) helium in a balloon Answer: B Section: Section 5.2 Learning Outcome: 5.4 Describe what a molecule is and give some examples. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) Which phrase best describes a covalent bond between two atoms? A) a stable arrangement of charged atoms held together by electrostatic forces B) a stable arrangement of atoms made by sharing two electrons between adjacent atoms C) uncommon, as electrons are free to jump from one atom to another D) an exchange of nuclei between two atoms Answer: B Section: Section 5.3 Learning Outcome: 5.5 Describe what a covalent bond is and what gives rise to it in terms of attractions. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 1 Copyright © 2015 Pearson Education, Inc.

5) Which of the following exists as a diatomic molecule? A) neon B) oxygen C) phosphorus D) silicon Answer: B Section: Section 5.3 Learning Outcome: 5.4 Describe what a molecule is and give some examples. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) Which of the following may not exist as a diatomic molecule? A) oxygen B) nitrogen C) argon D) hydrogen Answer: C Section: Section 5.3 Learning Outcome: 5.4 Describe what a molecule is and give some examples. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) The number of valence electrons in silicon is ________. A) 2 B) 4 C) 6 D) 8 Answer: B Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) The number of valence electrons in sulfur is ________. A) 2 B) 4 C) 6 D) 8 Answer: C Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

9) The number of valence electrons in magnesium is ________. A) 2 B) 4 C) 6 D) 8 Answer: A Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) The number of valence electrons in aluminum is ________. A) 2 B) 3 C) 5 D) 7 Answer: B Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) The number of valence electrons in neon is ________. A) 2 B) 4 C) 6 D) 8 Answer: D Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) The number of valence electrons in nitrogen is ________. A) 2 B) 3 C) 5 D) 6 Answer: C Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

13) Which of the following elements has the highest number of valence electrons? A) magnesium B) lithium C) argon D) phosphorus Answer: C Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) How many covalent bonds can an element of Group VA form with other elements? A) 4 B) 3 C) 2 D) 1 Answer: B Section: Section 5.4 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) How many valence electrons does a single, neutral iodine atom have? A) 3 B) 4 C) 5 D) 7 Answer: D Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) How many covalent bonds can a single oxygen atom form with other elements? A) 3 B) 4 C) 2 D) 1 Answer: C Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

17) Every single COVALENT bond represents ________ electrons. A) one B) two C) four D) One cannot say unless the atoms that make up the bond are known. Answer: B Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 18) Which of the following represents the correct Lewis dot structure for selenium (Se)? A) B) C) D) Answer: B Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) Which of the following elements has the lowest number of valence electrons? A) magnesium B) lithium C) argon D) phosphorus Answer: B Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) To follow the octet rule, how many electrons must a neutral sulfur atom gain when forming a negative ion? A) 1 B) 2 C) 6 D) 8 Answer: B Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

21) How many unpaired electrons does the oxide anion (O2-) have? A) 3 B) 2 C) 1 D) 0 Answer: D Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) How many valence electrons are needed to construct the Lewis dot structure of the BCl3 molecule? A) 11 B) 21 C) 24 D) 32 Answer: C Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) What is the most likely formula of the neutral, ionic compound formed by magnesium and oxygen? A) Mg2O B) MgO2 C) Mg3O2 D) MgO Answer: D Section: Section 5.4 Learning Outcome: 5.2 Predict the formula of an ionic compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) What is the most likely formula of the neutral, ionic compound formed by lithium and nitrogen? A) Li2N B) Li3N C) LiN D) LiN2 Answer: B Section: Section 5.4 Learning Outcome: 5.2 Predict the formula of an ionic compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

25) Which of the following does not have the same number of valence electrons as the other three elements? A) nitrogen B) phosphorus C) beryllium D) arsenic Answer: C Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) Which of the following has the same number of valence electrons as sulfur? A) nitrogen B) oxygen C) arsenic D) boron Answer: B Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) Which of the following elements has the least number of valence electrons? A) krypton B) potassium C) calcium D) aluminum Answer: B Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) Which of the following pairs has the same number valence electrons? A) magnesium and potassium B) lithium and calcium C) argon and xenon D) phosphorus and tellurium Answer: C Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

29) The expected binary compound between magnesium and bromine is ________. A) MgBr B) MgBr2 C) Mg2Br D) Mg2Br2 Answer: B Section: Section 5.4 Learning Outcome: 5.2 Predict the formula of an ionic compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) The expected formula between aluminum and oxygen is ________. A) AlO B) AlO2 C) Al2O D) Al2O3 Answer: D Section: Section 5.4 Learning Outcome: 5.2 Predict the formula of an ionic compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) The expected formula between silicon and fluorine is ________. A) SiF B) SiF2 C) SiF4 D) SiF6 Answer: C Section: Section 5.4 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) The expected formula between sodium and oxygen is ________. A) NaO B) Na2O2 C) Na2O D) Na2O3 Answer: C Section: Section 5.4 Learning Outcome: 5.2 Predict the formula of an ionic compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

33) The expected formula between calcium and oxygen is ________. A) CaO B) CaO2 C) Ca2O D) Ca2O5 Answer: A Section: Section 5.4 Learning Outcome: 5.2 Predict the formula of an ionic compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) The expected formula between calcium and iodine is ________. A) CaI B) Cal2 C) Ca2I D) Ca2I3 Answer: B Section: Section 5.4 Learning Outcome: 5.2 Predict the formula of an ionic compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 35) The expected formula between magnesium and sulfur is ________. A) MgS B) MgS2 C) Mg2S D) Mg2S3 Answer: A Section: Section 5.4 Learning Outcome: 5.2 Predict the formula of an ionic compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) The expected formula between potassium and sulfur is ________. A) KS B) K2S3 C) K2S D) KS2 Answer: C Section: Section 5.4 Learning Outcome: 5.2 Predict the formula of an ionic compound. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

37) The expected formula between hydrogen and nitrogen is ________. A) HN B) NH2 C) NH3 D) NH4 Answer: C Section: Section 5.4 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) What is the number of single bonds in C2H6O? A) 5 B) 6 C) 7 D) 8 Answer: D Section: Section 5.4 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 39) Water has ________ covalent bonds and ________ lone pairs. A) 2; 2 B) 2; 4 C) 2; 0 D) 2; 6 Answer: A Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 40) Methane has ________ covalent bonds and ________ lone pairs. A) 4; 2 B) 4; 1 C) 4; 0 D) 2; 4 Answer: C Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

41) Phosphine, PH3, has ________ covalent pairs and ________ lone pairs. A) 3; 0 B) 3; 1 C) 3; 2 D) 2; 0 Answer: B Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) Hydrazine, N2H4, has ________ covalent bonds and ________ lone pairs. A) 2; 2 B) 4; 2 C) 3; 4 D) 5; 2 Answer: D Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) Hydrazine has ________ valence electrons. A) 14 B) 12 C) 10 D) 8 Answer: A Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 44) Nitrogen trifluoride has ________ valence electrons. A) 20 B) 22 C) 24 D) 26 Answer: D Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

45) Nitrogen trifluoride has ________ valence electrons that are contributed by the nitrogen atom. A) 5 B) 8 C) 10 D) 12 Answer: A Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 46) Nitrogen trifluoride has ________ bonds, ________ of which are single bonds. A) 3; 3 B) 5; 1 C) 7; 2 D) 8; 3 Answer: A Section: Section 5.4 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 47) Nitrogen trifluoride has ________ lone pairs of electrons. A) 2 B) 5 C) 8 D) 10 Answer: D Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 48) Carbon tetrafluoride has ________ total valence electrons. A) 24 B) 28 C) 32 D) 36 Answer: C Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

49) Which of the following has at least one double bond? A) hydrogen B) carbon dioxide C) chlorine D) nitrogen Answer: B Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 50) How many resonance structure could be drawn for the nitrate ion? A) 0 B) 1 C) 2 D) 3 Answer: D Section: Section 5.5 Learning Outcome: 5.10a Draw resonance forms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 51) Acetylene, C2H2, has ________. A) two single bonds B) two double bonds C) one triple bond D) both A and C Answer: D Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 52) The number of valence electrons in the carbonate anion is ________. A) 20 B) 22 C) 24 D) 26 Answer: C Section: Section 5.5 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

53) The number of valence electrons that belong to the oxygens in the carbonate anion is ________. A) 15 B) 18 C) 20 D) 24 Answer: C Section: Section 5.5 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 54) The number of valence electrons in the nitrate anion is ________. A) 23 B) 24 C) 28 D) 30 Answer: B Section: Section 5.5 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 55) The phosphate anion has ________ valence electrons. A) 29 B) 30 C) 32 D) 36 Answer: C Section: Section 5.5 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 56) Each atom in the oxygen molecule contributes ________ valence electrons for a total of ________ electrons A) 6; 12 B) 6; 8 C) 8; 6 D) 12; 6 Answer: A Section: Section 5.5 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

57) Which of the following has a triple bond? A) water B) carbon dioxide C) oxygen D) nitrogen Answer: D Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 58) Which of the following has more than one double bond? A) carbon monoxide B) carbon dioxide C) oxygen D) nitrogen Answer: B Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 59) Which of the following gases does not have a triple bond? A) hydrogen cyanide B) acetylene, C2H2 C) carbon dioxide D) nitrogen Answer: C Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 60) Which of the following does not have at least one multiple covalent bond? A) carbon dioxide B) ethene, C2H4 C) hydrogen cyanide D) ethane, C2H6 Answer: D Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

61) Which of the following is the molecular formula for ozone? A) O3 B) O3C) O3-2 D) O2-2 Answer: A Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 62) The numerical rating of an atom's ability to attract the shared electrons is called ________. A) electronegativity B) ionization C) covalency D) redistribution Answer: A Section: Section 5.6 Learning Outcome: 5.11b Define electronegativity and describe its periodic trends. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 63) Which of the following bonds will have the smallest difference in electronegativity? A) HBr B) NaF C) H2 D) HSAnswer: C Section: Section 5.6 Learning Outcome: 5.11b Define electronegativity and describe its periodic trends. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 64) Which of the following bonds will have the largest difference in electronegativity? A) HBr B) NaF C) H2 D) HSAnswer: B Section: Section 5.6 Learning Outcome: 5.11b Define electronegativity and describe its periodic trends. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

65) If the electrons are shared equally between the two atoms, the bond is called ________. A) ionic B) non-polar covalent C) hydrogen bonding D) polar covalent Answer: B Section: Section 5.6 Learning Outcome: 5.12c Describe bond polarity using electronegativity. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 66) In a(n) ________ bond, the electrons are transferred. A) ionic B) covalent C) hydrogen bonding D) polar covalent Answer: A Section: Section 5.6 Learning Outcome: 5.12c Describe bond polarity using electronegativity. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 67) In a(n) ________ bond, the electrons are shared unequally. A) ionic B) non-polar covalent C) hydrogen bonding D) polar covalent Answer: D Section: Section 5.6 Learning Outcome: 5.12c Describe bond polarity using electronegativity. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 68) Identify the most polar covalent bond. A) C-C B) C-H C) C-F D) C-Cl Answer: C Section: Section 5.6 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

69) Identify the least polar covalent bond. A) C-C B) C-H C) C-F D) C-Cl Answer: A Section: Section 5.6 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 70) Identify the ionic bond. A) C-S B) Na-F C) N-O D) F-F Answer: B Section: Section 5.6 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 71) Which of the following phrases best describes the H-O bonds present in water (H2O)? A) nonpolar and ionic B) nonpolar and covalent C) polar and ionic D) polar and covalent Answer: D Section: Section 5.6 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 72) Which of the following compounds has a covalent bond? A) NaCl B) KBr C) LiH D) H2 Answer: D Section: Section 5.6 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

73) Identify the most electronegative element. A) fluorine B) oxygen C) carbon D) sodium Answer: A Section: Section 5.6 Learning Outcome: 5.11b Define electronegativity and describe its periodic trends. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 74) Identify the least electronegative element. A) fluorine B) oxygen C) carbon D) sodium Answer: D Section: Section 5.6 Learning Outcome: 5.11b Define electronegativity and describe its periodic trends. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 75) The central atom in sulfuric acid is ________. A) oxygen B) sulfur C) hydrogen D) none of the above Answer: B Section: Section 5.6 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 76) Consider a bond A-B. If the difference in electronegativity is 1.0, the bond is considered ________. A) ionic B) covalent C) polar covalent D) hydrogen Answer: C Section: Section 5.6 Learning Outcome: 5.12c Describe bond polarity using electronegativity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

77) Consider a bond A-B. If the difference in electronegativity is 3.5, the bond is considered ________. A) ionic B) covalent C) polar covalent D) hydrogen Answer: A Section: Section 5.6 Learning Outcome: 5.12c Describe bond polarity using electronegativity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 78) Consider a bond A-B. If the difference in electronegativity is 0.0, the bond is considered ________. A) ionic B) covalent C) polar covalent D) hydrogen Answer: B Section: Section 5.6 Learning Outcome: 5.12c Describe bond polarity using electronegativity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 79) What is the chemical name of the compound whose formula is K2O? A) dipotassium oxygen B) potassium oxide C) potasside oxygen D) potassium oxygen Answer: B Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 80) What is the chemical formula of calcium phosphate? A) CaPO4 B) Ca2PO4 C) Ca3PO4 D) Ca3(PO4)2 Answer: D Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

81) What is the chemical formula of rhenium(VII) oxide? A) ReO7 B) ReO4 C) Re2O7 D) Re3O6 Answer: C Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 82) What is the chemical name given to the compound whose formula is N2O4? A) nitrogen quadraoxide B) nitrogen (IV) oxide C) nitrogen (II) oxygen (IV) D) dinitrogen tetraoxide Answer: D Section: Section 5.7 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 83) What is the chemical formula of a compound named ammonium sulfide? A) NH4S B) (NH4)2S C) (NH4)S2 D) (NH4)2S3 Answer: B Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 84) What is the chemical formula of the compound named potassium bicarbonate? A) KHCO3 B) K2(HCO3) C) K(HCO3)2 D) K3HCO3 Answer: A Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

85) What is the chemical name of the compound whose formula is MgSO 4? A) magnesium sulfite B) magnesium sulfur tetraoxide C) magnesium sulfide D) magnesium sulfate Answer: D Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 86) Which of the following is not a binary compound? A) sodium chloride B) sodium hypochlorite C) sodium sulfide D) sodium hydride Answer: B Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 87) Which of the following is a binary compound? A) sodium perchlorate B) sodium chlorate C) sodium hypochlorite D) sodium chloride Answer: D Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 88) When a binary compound is composed of a metal and a non-metal it is called ________. A) binary ionic B) binary covalent C) binary coordinate D) either B or C Answer: A Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

89) A binary covalent compound is composed of ________. A) two metalloids B) a metal and a non-metal C) two non-metals D) either A or C Answer: D Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 90) Which of the following is a binary ionic compound? A) potassium sulfide B) phosphorus trichloride C) sulfur hexafluoride D) water Answer: A Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 91) Which of the following is not a binary ionic compound? A) lithium sulfide B) potassium iodide C) calcium chloride D) hydrogen sulfide Answer: D Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 92) Which is not a binary covalent compound? A) CO B) H2O C) CaF2 D) SiO2 Answer: C Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

93) Which of the following sets is comprised exclusively of ionic binary compounds? A) H2O, SiO2, NO B) CoCl2, CaCO3, AlPO4 C) Co(H2PO4)2, KCl, PCl3 D) KI, Al2O3, Li2S Answer: D Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 94) Which of the following sets is comprised exclusively of covalent binary compounds? A) H2O, SiO2, NO B) CoCl2, CaCO3, AlPO4 C) Co(H2PO4)2, KCl, PCl3 D) KI, Al2O3, Li2S Answer: A Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 95) The compound H2SO3 is called ________. A) sulfurous acid B) sulfuric acid C) hydrogen sulfide D) sulfite acid Answer: A Section: Section 5.7 Learning Outcome: 5.18i Name and give formulas for acids. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 96) The compound HClO is called ________. A) hydrochloric acid B) hypochlorous acid C) perchloric acid D) hyperchloric acid Answer: B Section: Section 5.7 Learning Outcome: 5.18i Name and give formulas for acids. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

97) The compound H2CO3 is called ________. A) carbonic acid B) carbonous acid C) carbonium acid D) bicarbonic acid Answer: A Section: Section 5.7 Learning Outcome: 5.18i Name and give formulas for acids. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 98) Which of the following cations does not have a +2 charge? A) ferrous B) stannous C) cobaltous D) cuprous Answer: D Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 99) Which of the following cations have the most positive charge? A) cobaltic B) ferric C) stannic D) mercuric Answer: C Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 100) Which of the following cations have the least positive charge? A) cobaltic B) ferric C) stannic D) mercuric Answer: D Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

101) Which of the following cations have the least positive charge? A) cobaltous B) ferrous C) stannous D) cuprous Answer: D Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 102) Which of the following cations has a +2 charge? A) cobaltic B) ferric C) cupric D) stannic Answer: C Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 103) Which of the following polyatomic ions is positively charged? A) ammonium B) carbonate C) dihydrogen phosphate D) acetate Answer: A Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 104) Which of the following may be classified as oxyanion? A) perchlorate B) bromide C) ammonium D) chloride Answer: A Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

105) Which of the following AQUEOUS acids does not have the -ic ending? A) H2SO4 (aq) B) HF (aq) C) HCN (aq) D) H2SO3 (aq) Answer: D Section: Section 5.7 Learning Outcome: 5.18i Name and give formulas for acids. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 106) Which of the following AQUEOUS acids does not have the -ous ending? A) H2SO3 B) HNO2 C) HClO2 D) H2CO3 Answer: D Section: Section 5.7 Learning Outcome: 5.18i Name and give formulas for acids. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 107) Which of the following may not be classified as a polyanion? A) perchlorate B) chlorate C) chlorite D) chloride Answer: D Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 108) Which of the following polyatomic ions has a -2 charge? A) ammonium B) carbonate C) dihydrogen phosphate D) acetate Answer: B Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

109) Which of the following polyatomic ions is the most negatively charged? A) ammonium B) carbonate C) phosphate D) acetate Answer: C Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 110) Which of the following polyatomic ions has the least atoms per formula unit? A) ammonium B) carbonate C) dihydrogen phosphate D) acetate Answer: B Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 111) Which of the following polyatomic ions has the most atoms per formula unit? A) ammonium B) carbonate C) hydrogen phosphate D) acetate Answer: D Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 112) Which of the following anions has the largest number of oxygen atoms per formula unit? A) carbonate B) dichromate C) hydrogen phosphate D) perchlorate Answer: B Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

113) Which of the following anions has the lowest number of oxygen atoms per formula unit? A) carbonate B) dichromate C) hydrogen phosphate D) perchlorate Answer: A Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 114) Which of the following anions has its number of oxygen atoms equal to a number other than 4? A) permanganate B) perchlorate C) hydrogen phosphate D) nitrate Answer: D Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 115) Which of the following anions has its number of oxygen atoms equal to a number other than 3? A) carbonate B) chlorate C) dihydrogen phosphate D) nitrate Answer: C Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 116) Which of the following anions has its number of oxygen atoms equal to a number other than 2? A) chromate B) chlorite C) acetate D) nitrite Answer: A Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

117) Which of the following does not have a charge of -2? A) carbonate B) chromate C) dichromate D) nitrate Answer: D Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 118) Which of the following does not have a charge of -1? A) bicarbonate B) bisulfate C) hydrogen phosphate D) nitrite Answer: C Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 119) Which of the following ions has a relative ratio of oxygen atoms to the central atom that is not a whole number? A) dichromate B) bicarbonate C) permanganate D) perchlorate Answer: A Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 120) Identify the ion with a -3 charge. A) phosphate B) chlorate C) chromate D) ammonium Answer: A Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

121) Identify the ion with a -2 charge. A) phosphate B) chlorate C) chromate D) ammonium Answer: C Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 122) Identify the ion with a +1 charge. A) phosphate B) chlorate C) chromate D) ammonium Answer: D Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 123) Identify the ion with a -1 charge. A) phosphate B) chlorate C) chromate D) ammonium Answer: B Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 124) Identify the ion with a -4 charge. A) carbide B) permanganate C) dichromate D) nitride Answer: A Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

125) Which anion does not have -3 charge? A) phosphide B) phosphate C) chlorate D) nitride Answer: C Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 126) Which of the following anions has 3 oxygen atoms and a net charge of -2? A) permanganate B) chlorate C) carbonate D) nitrate Answer: C Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 127) Which of the following anions has 2 oxygen atoms and a net charge of -1? A) permanganate B) chlorite C) bicarbonate D) nitrate Answer: B Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 128) Which of the following anions has 2 oxygen atoms and a net charge of -1? A) hypochlorite B) peroxide C) bicarbonate D) chromate Answer: B Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

129) Which of the following anions does not have 2 oxygen atoms and a net charge of -1? A) sulfite B) nitrite C) chlorite D) peroxide Answer: A Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 130) Which of the following ions contains oxygen? A) chlorite B) cyanide C) chloride D) ammonium Answer: A Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 131) Which of the following compounds contains oxygen? A) potassium cyanide B) calcium peroxide C) ammonium sulfide D) ferrous chloride Answer: B Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 132) The H- ion is called ________. A) hydroxide B) hydride C) hydranion D) hydrogen Answer: B Section: Section 5.7 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

133) The HCO3- ion is called ________. A) carbide B) bicarbonate C) carbonate D) carboxide Answer: B Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 134) The formula for the carbonate ion is ________. A) CO32B) C2O42C) HCO3D) C22Answer: A Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 135) The formula Ca3N2 is called ________. A) calcium nitrate B) calcium nitrite C) dicalcium trinitride D) calcium nitride Answer: D Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 136) Potassium dihydrogen phosphate has the formula ________. A) KH2PO4 B) K2HPO4 C) K2H2PO4 D) K(H2PO4)2 Answer: A Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

137) The formula for hydrocyanic acid is ________. A) HCNO B) HCN C) H2CN D) H2CNO Answer: B Section: Section 5.7 Learning Outcome: 5.18i Name and give formulas for acids. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 138) CuClO is called ________. A) cuprous chlorate B) cupric chlorate C) cuprous hypochlorite D) cuprous chlorite Answer: C Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 139) The formula for sodium acetate is ________. A) NaC2H2O2 B) NaCH2O2 C) NaC2H3O2 D) NaC2H4O Answer: C Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 140) The formula for sodium sulfite is ________. A) Na2S B) Na2SO3 C) Na2S2O3 D) Na2SO4 Answer: B Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

141) Which of the following anions has the largest number of oxygen atoms and at the same time has the most negative charge? A) carbonate B) phosphate C) permanganate D) chromate Answer: B Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 142) Which of the following formulas does not include a parenthesis? A) sodium dichromate B) ammonium carbonate C) aluminum bicarbonate D) magnesium dihydrogen phosphate Answer: A Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 143) Which of the following formulas includes a parenthesis? A) sodium dichromate B) magnesium carbonate C) aluminum nitrate D) magnesium hydrogen phosphate Answer: C Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 144) Which of the following elements does not have at least two differently charged cations? A) magnesium B) copper C) cobalt D) iron Answer: A Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

145) Which of the following elements has at least two differently charged cations? A) magnesium B) calcium C) cobalt D) lithium Answer: C Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 146) The electronegativity of chlorine is 3.0 while that of iodine is 2.5. The correct way of writing the formula of a molecule composed of one chlorine and one iodine atoms and the corresponding name are ________. A) ClI, chloroiodine B) ClI, chlorine monoiodide C) ICl, iodine monochloride D) ICl, iodochlorine Answer: C Section: Section 5.7 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5.2 True/False Questions 1) Natural sugars are broken down into glucose in our body. Answer: TRUE Section: Section 5.2 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) Water, H2O and hydrogen peroxide, H2O2, have identical properties. Answer: FALSE Section: Section 5.2 Learning Outcome: 5.4 Describe what a molecule is and give some examples. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Energy is released as two atoms, such as two hydrogen atoms, form, a bond. Answer: TRUE Section: Section 5.3 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 4) A covalent bond is formed by the sharing of the innermost electrons. Answer: FALSE Section: Section 5.3 Learning Outcome: 5.5 Describe what a covalent bond is and what gives rise to it in terms of attractions. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 37 Copyright © 2015 Pearson Education, Inc.

5) When covalent bonds are broken energy is released. Answer: FALSE Section: Section 5.3 Learning Outcome: 5.5 Describe what a covalent bond is and what gives rise to it in terms of attractions. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 6) A single bond is always represented by two electrons. Answer: TRUE Section: Section 5.3 Learning Outcome: 5.4 Describe what a molecule is and give some examples. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 7) Elements that belong to the same group have the same number of valence electrons. Answer: TRUE Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 8) Covalent bonds are formed between atoms that share pairs of electrons. Answer: TRUE Section: Section 5.4 Learning Outcome: 5.5 Describe what a covalent bond is and what gives rise to it in terms of attractions. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 9) A single, neutral chlorine atom has seven valence electrons. Answer: TRUE Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) Only helium among the Group VIIIA elements has two valence electrons. Answer: TRUE Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) Sulfur and chlorine have the same number of valence electrons. Answer: FALSE Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

12) Calcium and barium have the same number of valence electrons. Answer: TRUE Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) Elements that belong to the same period have the same number of valence electrons. Answer: FALSE Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) In its ground state, sulfur has two valence electrons and needs four more electrons to reach the octet. Answer: FALSE Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) In its ground state, carbon has four valence electrons and needs four more to reach the octet. Answer: TRUE Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Phosphorus usually forms three bonds. Answer: TRUE Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) Silicon has five valence electrons. Answer: FALSE Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Hydrogen may have a +1 or -1 charge. Answer: TRUE Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

19) The bonding pair of electrons is the pair that makes up the bond when drawing structures. Answer: TRUE Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 20) Lone pairs of electrons do not count when trying to figure out if an element in a formula obeys the octet rule. Answer: FALSE Section: Section 5.4 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 21) Nitrogen in ammonia has three bonds and one non-bonded pair of electrons. Answer: TRUE Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) Oxygen in water has two bonds and one non-bonded pair of electrons. Answer: FALSE Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) When a hydrogen is combined with a non-metal it assumes the -1 charge. Answer: FALSE Section: Section 5.4 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) Sulfur in hydrogen sulfide has two bonds and one non-bonded pair of electrons. Answer: FALSE Section: Section 5.4 Learning Outcome: 5.5 Describe what a covalent bond is and what gives rise to it in terms of attractions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) A triple bond may be considered a multiple covalent bond. Answer: TRUE Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

26) Carbon monoxide is the only compound that forms between carbon and oxygen. Answer: FALSE Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) Sulfur tetrafluoride is the only compound that forms between sulfur and fluorine. Answer: FALSE Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) Silicon dioxide is the compound that forms between silicon and oxygen. Answer: TRUE Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 29) Silicon in silicon dioxide has four bonds and zero non-bonded pair of electrons. Answer: TRUE Section: Section 5.5 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) Carbon dioxide obeys the octet rule. Answer: TRUE Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) There are no lone pairs in ethane. Answer: TRUE Section: Section 5.5 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) The sulfur atom in sulfur dioxide has two unpaired electrons. Answer: FALSE Section: Section 5.5 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

33) Carbon dioxide has two non-bonded pairs of electrons. Answer: FALSE Section: Section 5.5 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) Multiple covalent bonds arise when two atoms will share more than one pair of electrons with each other. Answer: TRUE Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 35) The nitrogen molecule has 10 total valence electrons. Answer: TRUE Section: Section 5.5 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) The electrons in a carbon-chlorine covalent bond are "shared" exactly equally between these two atoms. Answer: FALSE Section: Section 5.6 Learning Outcome: 5.12c Describe bond polarity using electronegativity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 37) If the electronegativity difference between the two atoms that make up a bond is 0.0, then the compound is covalent. Answer: TRUE Section: Section 5.6 Learning Outcome: 5.11b Define electronegativity and describe its periodic trends. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) If the electronegativity difference between the two atoms that make up a bond is 2.1, then the bond is considered polar covalent. Answer: FALSE Section: Section 5.6 Learning Outcome: 5.11b Define electronegativity and describe its periodic trends. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 39) Fluorine is the most electronegative element in the periodic table. Answer: TRUE Section: Section 5.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42 Copyright © 2015 Pearson Education, Inc.

40) A chemical compound formed from lithium and chlorine should be ionic in character. Answer: TRUE Section: Section 5.6 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 41) The least electronegative element is oxygen. Answer: FALSE Section: Section 5.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) Sodium is the least electronegative in the group H, S, Cl, and Na. Answer: TRUE Section: Section 5.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) Sulfur is the most electronegative in the group H, S, Cl, and Na. Answer: FALSE Section: Section 5.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 44) Compounds formed from carbon and hydrogen should be ionic in character. Answer: FALSE Section: Section 5.6 Learning Outcome: 5.12c Describe bond polarity using electronegativity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 45) Metals are generally more electronegative than non-metals. Answer: FALSE Section: Section 5.6 Learning Outcome: 5.11b Define electronegativity and describe its periodic trends. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 46) Magnesium in magnesium chloride has two bonds and two non-bonded pair of electrons. Answer: FALSE Section: Section 5.6 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 47) Sodium chloride has bonded pairs of electrons. Answer: FALSE Section: Section 5.6 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43 Copyright © 2015 Pearson Education, Inc.

48) The nitrite, sulfite and bicarbonate anions have the same number of hydrogen atoms. Answer: FALSE Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 49) The ion P3- is named phosphate. Answer: FALSE Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 50) The compound P2O5 is named diphosphorus pentaoxide. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 51) The chemical compound, Na2S, has the is named sodium sulfate. Answer: FALSE Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 52) Metals are always going to be the more electropositive elements in a bond as long as they are attached to a non-metal. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.11b Define electronegativity and describe its periodic trends. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 53) Germanium has four valence electrons. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 54) Carbon may have a +4 or -4 charge. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

55) Hydrogen cyanide may also be called hydrocyanic acid when in aqueous solution. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.18i Name and give formulas for acids. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 56) The correct name for ammonia is nitrogen hydride. Answer: FALSE Section: Section 5.7 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 57) Another name for the hydrogen sulfate anion is bisulfate. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 58) Twice as many hydrogen atoms than oxygen atoms are present in the acetate anion. Answer: FALSE Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 59) Twice as many oxygen atoms than hydrogen atoms are present in the dihydrogen phosphate anion. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 60) The perchlorate, phosphate and sulfate anions have the same number of hydrogen atoms. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 61) The bicarbonate, bisulfate and dihydrogen phosphate anions have the same number of hydrogen atoms. Answer: FALSE Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

62) In naming binary compounds, the negatively charged ion has the -ide suffix. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 63) The hypochlorite, permanganate, and cyanide ions are called oxyanions. Answer: FALSE Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 64) The chlorate, bisulfate, and chromate anions are called oxyanions. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 65) The number of valence electrons in the ammonium ion is 10. Answer: FALSE Section: Section 5.7 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 66) The compound P2O3 is named diphosphorus pentoxide. Answer: FALSE Section: Section 5.7 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 67) The compound Ca3(PO4)3 is named dicalcium triphosphate. Answer: FALSE Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 68) The compound CS2 is named carbon disulfide. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

69) Fe(OH)2 is named ferrous hydroxide. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 70) Ca3P2 is named calcium phosphate. Answer: FALSE Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 71) The bonds that are associated with covalent bonds are among the strongest a chemist may encounter. Answer: TRUE Section: Section 5.7 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 72) When vaporized into steam water molecules decompose into hydrogen and oxygen molecules. Answer: FALSE Section: Section 5.7 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 73) The ferrous ion is referred to as iron (III). Answer: FALSE Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 74) Ions that may be named with -ous and -ic suffixes have only two stable ions. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 75) The negatively charged species is written first when writing a formula. Answer: FALSE Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

76) Ammonium chloride may be considered as an exception of an ionic compound although it does not include any metals in its formula. Answer: TRUE Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5.3 Short Answer Questions Draw the dot structures for the atomic or molecular species shown. Be sure to include all relevant resonance structures. 1) NO3Answer:

Section: Section 5.5 Learning Outcome: 5.10a Draw resonance forms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) CNAnswer: Section: Section 5.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) BF3 Answer:

Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) H2Se Answer: Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

5) O3 (ozone) Answer:

Section: Section 5.5 Learning Outcome: 5.10a Draw resonance forms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) CH2ClF Answer:

Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) NI 3 Answer:

Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) SO2 Answer:

Section: Section 5.5 Learning Outcome: 5.10a Draw resonance forms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) How many valence electrons are required from each element when constructing a complete Lewis dot structure of the compound CF2C12? Answer: 4 from carbon, 7 more from each of 4 halogens. Total of 32 valence electrons. Section: Section 5.5 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

10) Would you expect a chemical bond formed between the elements boron and chlorine to be ionic or covalent in character? Answer: Simple answer: bonding between two non-metals is covalent in nature. Complex answer: The electronegativity difference is not great enough for boron-chlorine bonding to be truly ionic (0.9). This value is similar to H-Cl bonds (~18% ionic character). Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G8 Global: Communicate effectively in writing.

5.4 Matching Questions Match the description from the column on the left to the molecular species that appear on the right column. A) Ca2+ B) CO2 C) LiCl D) CO E) N2 F) Cr2O72G) CH4 1) An ionic compound. Section: Section 5.6 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) A molecule with a triple bond. Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) A cation. Section: Section 5.6 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) A covalent, non-polar molecule. Section: Section 5.5 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) An anion. Section: Section 5.6 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) A compound with one double bond. Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

7) A compound with two double bonds. Section: Section 5.5 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 1) C 2) E 3) A 4) G 5) F 6) D 7) B

Match the names in the second column with each of the ions that appear in the first column. A) carbonate B) nitrite C) bicarbonate D) nitride E) cyanide F) nitrate G) ammonium 8) N3Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) NH4+ Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) NO2Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) NO3Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) CNSection: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) CO32Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) HCO3Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 8) D 9) G 10) B 11) F 12) E 13) A 14) C 53 Copyright © 2015 Pearson Education, Inc.

Match the names in the second column with each of the names hat appear in the first column. A) sulfite B) bisulfite C) sulfide D) bisulfate E) hydrogen sulfide F) thiocyanate G) sulfate 15) S2Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) SO32Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) SO42Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) SCNSection: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) H2S Section: Section 5.7 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) HSO3Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

21) HSO4Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 15) C 16) A 17) G 18) F 19) E 20) B 21) D Match the names in the second column with each of the chlorine containing anions that appear in the first column. A) hypochlorite B) perchlorate C) chloride D) chlorate E) chlorite 22) ClSection: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) ClO4Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) ClO3Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) ClO2Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) ClOSection: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 22) C 23) B 24) D 25) E 26) A

Match every phosphorus anion formula in the left column with the corresponding name in the right column. A) dihydrogen phosphate B) phosphide C) hydrogen phosphate D) phosphate 27) H2PO4Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) HPO42Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 29) PO43Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) P3Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 27) A 28) C 29) D 30) B

Identify the following as binary ionic or binary covalent compound. A) binary covalent B) binary ionic 31) CCl4 Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) CaI2 Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) MgO Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) CO2 Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 35) NaCl Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) PI3 Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 37) Cal2 Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) SF4 Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

39) LiN3 Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 40) BaO Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 41) BF3 Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) H2O2 Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) SrCl2 Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 44) Rb3N Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 45) Ba2N3 Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 46) RaF2 Section: Section 5.7 Learning Outcome: 5.13d Predict if a bond is covalent, polar covalent, or ionic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 31) A 32) B 33) B 34) A 35) B 36) A 37) B 38) A 39) B 40) B 41) A 42) A 43) B 44) B 45) B 46) B

Match each element that appears on the left column with the number of valence electrons that appears on the right column. A) 6 B) 3 C) 8 D) 1 E) 4 F) 7 G) 2 H) 5 47) oxygen Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 48) nitrogen Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 49) carbon Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 50) sulfur Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 51) phosphorus Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 52) hydrogen Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 53) calcium Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 59 Copyright © 2015 Pearson Education, Inc.

54) fluorine Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 55) lithium Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 56) chlorine Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 57) argon Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 58) boron Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 59) neon Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 60) helium Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 61) sodium Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 62) aluminum Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 47) A 48) H 49) E 50) A 51) H 52) D 53) G 54) F 55) D 56) F 57) C 58) B 59) C 60) G 61) D 62) B 60 Copyright © 2015 Pearson Education, Inc.

Match each element that appears in the left column with the number of electrons it needs to fulfill its octet which appears on the right column. A) 6 B) 5 C) 7 D) 1 E) 4 F) 0 G) 2 H) 3 63) oxygen Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 64) nitrogen Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 65) carbon Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 66) sulfur Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 67) phosphorus Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 68) hydrogen Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 69) beryllium Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 61 Copyright © 2015 Pearson Education, Inc.

70) fluorine Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 71) lithium Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 72) chlorine Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 73) argon Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 74) boron Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 75) neon Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 76) helium Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 77) sodium Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

78) aluminum Section: Section 5.4 Learning Outcome: 5.7 Draw dot diagrams for atoms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 63) G 64) H 65) E 66) G 67) H 68) D 69) A 70) D 71) C 72) D 73) F 74) B 75) F 76) F 77) C 78) B

Match the pair of elements that appear in the first column with the general expected formula that appears in the second column. A) A3B B) A2B3 C) A2B D) AB E) AB2 F) A4B3 G) AB4 H) A3B2 I) A4B J) AB3 79) carbon and chlorine Section: Section 5.4 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 80) hydrogen and oxygen Section: Section 5.4 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 81) nitrogen and fluorine Section: Section 5.4 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 82) aluminum and sulfur Section: Section 5.4 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 83) boron and fluorine Section: Section 5.4 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 84) silicon and oxygen Section: Section 5.4 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

85) aluminum and nitrogen Section: Section 5.4 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 86) magnesium and oxygen Section: Section 5.4 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 87) calcium and nitrogen Section: Section 5.4 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 88) lithium and bromine Section: Section 5.4 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 89) beryllium and chlorine Section: Section 5.4 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 90) sodium and oxygen Section: Section 5.4 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 91) potassium and nitrogen Section: Section 5.4 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 92) lithium and silicon Section: Section 5.4 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 93) aluminum and carbon Section: Section 5.4 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

94) calcium and sulfur Section: Section 5.4 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 79) G 80) C 81) J 82) B 83) J 84) E 85) D 86) D 87) H 88) D 89) E 90) C 91) A 92) I 93) F 94) D

Match the formula in the first column with the correct name in the second column. A) ammonia B) methane C) hydrogen peroxide D) ozone E) glucose F) hydrazine 95) CH4 Section: Section 5.2 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 96) NH3 Section: Section 5.4 G) hydrochloric acid Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 97) O3 Section: Section 5.7 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 98) H2O2 Section: Section 5.7 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 99) C6H12O6 Section: Section 5.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 100) HCl Section: Section 5.7 Learning Outcome: 5.18i Name and give formulas for acids. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 101) N2H4 Section: Section 5.4 Learning Outcome: 5.16g Name and give formulas for binary covalent compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 95) B 96) A 97) D 98) C 99) E 100) G 101) F

Match the compound in the left column with the total number of non-bonding pairs of electrons in the right column. A) 10 B) 1 C) 2 D) 3 E) 9 F) 6 G) 0 H) 4 102) ammonia Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 103) water Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 104) methane Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 105) hydrogen chloride Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 106) carbon monoxide Section: Section 5.5 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 107) carbon dioxide Section: Section 5.5 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 68 Copyright © 2015 Pearson Education, Inc.

108) phosphorus trichloride Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 109) bromine Section: Section 5.7 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 110) boron trichloride Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 111) hydrogen sulfide Section: Section 5.7 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 112) ammonium ion Section: Section 5.7 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 113) aluminum chloride Section: Section 5.7 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 114) nitrogen gas Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 115) silicon tetrahydride Section: Section 5.4 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 69 Copyright © 2015 Pearson Education, Inc.

116) phosphorus pentachloride Section: Section 5.7 Learning Outcome: 5.6 Draw a covalent bond and count the valence electrons owned by each atom. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 102) B 103) C 104) G 105) D 106) C 107) H 108) A 109) F 110) E 111) C 112) G 113) E 114) C 115) G 116) G

Match every compound in the first column with the proper account of bonds that appear in the second column. A) has two single bonds and one double bond B) has four single bonds and one double bond C) has one single bond and one triple bond D) has one double bond E) has four single bonds and one triple bond F) has two double bonds G) has one triple bond H) has five single bonds I) has two single bonds and one triple bond J) has four single bonds K) has three single bonds 117) carbon dioxide Section: Section 5.7 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 118) ammonia Section: Section 5.4 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 119) hydrogen cyanide Section: Section 5.7 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 120) ethene Section: Section 5.7 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 121) acetylene Section: Section 5.7 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 122) hydrazine Section: Section 5.4 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

123) nitrogen Section: Section 5.7 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 124) oxygen Section: Section 5.7 Learning Outcome: 5.8 Draw dot diagrams for molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 117) F 118) K 119) C 120) B 121) I 122) H 123) G 124) D

Match the total number of atoms that appear in the right column with every binary compound that appears in the left column. A) 4 B) 5 C) 3 D) 7 E) 2 125) cuprous sulfide Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 126) cobaltic chloride Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 127) ferric oxide Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 128) stannic nitride Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 129) stannous oxide Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 130) mercurous oxide Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 131) calcium hydride Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

132) aluminum oxide Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 133) barium fluoride Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 134) cobaltous sulfide Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 135) cupric fluoride Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 136) aluminum hydride Section: Section 5.7 Learning Outcome: 5.14e Name and give formulas for binary ionic compounds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 125) C 126) A 127) B 128) D 129) E 130) C 131) C 132) B 133) C 134) E 135) C 136) A

Match the total number of atoms that appear in the right column with every compound that appears in the left column. A) 16 B) 6 C) 5 D) 3 E) 15 F) 7 G) 10 H) 11 I) 8 J) 13 K) 4 137) cupric sulfite Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 138) cobaltic chlorite Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 139) ferric cyanide Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 140) stannic chromate Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 141) stannous hypochlorite Section: Section 5.7 Learning Outcome: 5.15f Name and give formulas for compounds possessing transition metals. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 142) sodium dihydrogen phosphate Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

143) sodium cyanide Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 144) aluminum perchlorate Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 145) barium bisulfate Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 146) potassium nitrite Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 147) sodium carbonate Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 148) ammonium chromate Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 137) C 138) G 139) F 140) H 141) C 142) I 143) D 144) A 145) J 146) K 147) B 148) E

Match the anion in the left column with the general structure in the right column. A) AB2B) AB32C) ABD) AB3E) AB43F) AB42G) AB4149) nitrate Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 150) sulfate Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 151) perchlorate Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 152) hypochlorite Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 153) carbonate Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 154) chromate Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 155) phosphate Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

156) cyanide Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 157) chlorate Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 158) permanganate Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 159) sulfite Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 160) nitrite Section: Section 5.7 Learning Outcome: 5.17h Name and give formulas for compounds possessing polyatomic ions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 149) D 150) F 151) G 152) C 153) B 154) F 155) E 156) C 157) D 158) G 159) B 160) A

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 6 The Shape of Molecules 6.1 Multiple-Choice Questions 1) In a molecule having four pairs of electrons around the central atom and a pyramidal shape, how many bonding pairs of electrons does the central atom have? A) 2 B) 1 C) 4 D) 3 Answer: D Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) Which of the following pictures best illustrates a tetrahedral shape for the molecule AB 4? A)

Answer: A Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

3) Which of the following pictures best illustrates a trigonal planar shape for the molecule AB 3? A)

Answer: D Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) Which compound listed below would you expect to have the greatest H-C-H bond angle? A) CH2ClF B) CH2 CI2 C) CH4 D) CH2O Answer: D Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

5) Which compound listed below has a bond angle of 180° around the central atom? A) H2O B) CO2 C) CC14 D) NH3 Answer: B Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) In a molecule having four pairs of electrons around the central atom and a pyramidal shape, how many lone pairs of electrons does the central atom have? A) 2 B) 1 C) 4 D) 3 Answer: B Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) In a molecule having four pairs of electrons around the center atom and a bent shape, how many bonding pairs does the central atom have? A) 2 B) 1 C) 4 D) 3 Answer: A Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) In a molecule having three pairs of electrons around a central atom and a trigonal planar shape, how many lone pairs of electrons does the central atom have? A) 1 B) 0 C) 2 D) 3 Answer: B Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

9) When drawing the three-dimensional structure diagram of a molecule the bold line ________. A) shows a bond that projects out from the page. B) shows a bond that goes back behind the page. C) indicates that the bond is in the plane of the page. D) One cannot say unless the formula of the molecule is known. Answer: A Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 10) When drawing the three-dimensional structure diagram of a molecule the dotted line ________. A) shows a bond that projects out from the page. B) shows a bond the goes back behind the page. C) indicates that the bond is in the plane of the page. D) One cannot say unless the formula of the molecule is known. Answer: B Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 11) When drawing the three-dimensional structure diagram of a molecule the solid (not bold or dotted) line ________. A) shows a bond that projects out from the page. B) shows a bond that goes back behind the page. C) indicates that the bond is in the plane of the page. D) One cannot say unless the formula of the molecule is known. Answer: C Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 12) Which of the following statements is correct about the pyramidal structure? A) The pyramidal structure is very similar to the tetrahedral structure except one electron pair in the pyramidal structure replaces a bond in the tetrahedral one. B) The pyramidal structure is the shape of the ammonia molecule. C) The bond angles around the central atom very close to the 107°. D) All above statements are correct. Answer: D Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

13) Which of the following statements is correct about the bent structure? A) The bent structure has three bonding electrons pairs with at least one lone pair around the central atom. B) The bent structure is the shape of the ammonia molecule. C) The bent structure has bond angles around the central atom very close to the 105°. D) All above statements are correct. Answer: C Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 14) Which of the following molecules is not linear? A) hydrogen cyanide B) beryllium chloride C) boron trifluoride D) acetylene, C2H2 Answer: C Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) Which of the following molecules is linear? A) hydrogen chloride B) ethane, C2H6 C) ethene, C2H4 D) ammonia Answer: A Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Which of the following molecules is not tetrahedral? A) carbon tetrachloride B) chloroform, CHCl3 C) methane, CH4 D) boron trifluoride Answer: D Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

17) Which of the following molecules is tetrahedral? A) sulfur trioxide B) sulfur dioxide C) sulfur dichloride D) ammonium ion Answer: D Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Which of the following molecules is bent? A) water B) sulfur dioxide C) carbon dioxide D) both A and B Answer: D Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) Which of the following molecules is bent and has a bond angle close to 118° around the central atom? A) sulfur dioxide B) boron trifluoride C) ammonia D) both A and C Answer: A Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) Which of the following molecules is pyramidal and has a bond angle close to 107° around the central atom? A) sulfur dioxide B) boron trifluoride C) ammonia D) both A and C Answer: C Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

21) The angle around nitrogen in the ammonium ion is ________. A) 60° B) 90° C) 109.5° D) 120° Answer: C Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) The angle around boron in boron trifluoride is ________. A) 60° B) 90° C) 109.5° D) 120° Answer: D Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) The angle around carbon in hydrogen cyanide is ________. A) 105° B) 109.5° C) 120° D) 180° Answer: D Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) What is the molecular shape of H2S? A) tetrahedral B) pyramidal C) linear D) bent Answer: D Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

25) What is the molecular shape of CC14? A) tetrahedral B) pyramidal C) linear D) bent Answer: A Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) What is the molecular shape of NO2A) tetrahedral B) pyramidal C) linear D) bent Answer: D Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) What is the molecular shape of CH2O? A) tetrahedral B) bent C) trigonal planar D) pyramidal Answer: C Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) What is the steric number of the central atom in CH 4? A) 1 B) 2 C) 3 D) 4 Answer: D Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

29) What is the steric number of the central atom in carbon disulfide? A) 1 B) 2 C) 3 D) 4 Answer: B Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) What is the steric number of the central atom in boron trichloride? A) 1 B) 2 C) 3 D) 4 Answer: C Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) Which of the following compounds would be soluble in a nonpolar solvent? A) H2S B) NH3 C) CC14 D) SO2 Answer: C Section: Section 6.3 Learning Outcome: 6.7 Explain how molecular polarity leads to intermolecular attraction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) Which of the following compounds would you expect to be the most polar molecule? A) H2S B) H2Se C) H2Te D) H2O Answer: D Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

33) Which of the following compounds contains bonds that are the most polar (greatest electronegativity difference between hydrogen and the central atom)? A) H2O B) H2S C) H2Se D) H2Te Answer: A Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) Which of the following compounds is non-polar? A) acetylene, C2H2 B) ethene, C2H4 C) methane D) All of the above are non-polar. Answer: D Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 35) Which of the following nitrogen-containing compounds is least polar? A) NH3 B) CH3 - N = N - CH3 C) (CH3 CH2)3N D) (CH3)3N Answer: A Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) Which of the following sulfur-containing compounds or ions is not polar? A) SO3 B) H2S C) HSD) SOCl2 Answer: A Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

37) Which of the following chlorine-containing compounds is not polar? A) CHCl3 B) CH2Cl2 C) HCl D) CCl4 Answer: D Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) Which of the following compounds is polar? A) SO3 B) CO2 C) CS2 D) H2CO Answer: D Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 39) Which of the following compounds is non-polar? A) SO2 B) CH2O C) CS2 D) SOCl2 Answer: C Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 40) Which of the following compounds is pure covalent? A) H2CO B) Cl2SO C) O2 D) CO Answer: C Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

41) Which of the following compounds is polar? A) N2 B) O2 C) SOCl2 D) CO2 Answer: C Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) Which of the following compounds will be affected by the presence of an electric field? A) H2 B) O2 C) HCl D) N2 Answer: C Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) In which of the three phases of matter would you expect hydrogen bonding between water molecules to be the strongest? A) solid phase (H2O Os very close together) B) liquid phase (H2O Os more separated than solid phase) C) gas phase (H2O Os much farther apart than liquid phase) D) It is equally strong in all three phases. Answer: A Section: Section 6.4 Learning Outcome: 6.9 Describe how intermolecular attractions arise between dipolar molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 44) Dipole dipole forces are an important factor to consider in determining whether or not a substance will dissolve in water (a molecule which has a dipole). Which of the following compounds would you expect to be the most soluble in water? A) CCl4 B) NH3 C) N2 D) CO2 Answer: B Section: Section 6.4 Learning Outcome: 6.9 Describe how intermolecular attractions arise between dipolar molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12 Copyright © 2015 Pearson Education, Inc.

45) Dipole dipole forces are an important factor to consider in determining whether or not a substance will dissolve in water (a molecule which has a dipole). Which of the following compounds would you expect to be the least soluble in water? A) BF3 B) NH3 C) HF D) H2S Answer: A Section: Section 6.4 Learning Outcome: 6.9 Describe how intermolecular attractions arise between dipolar molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 46) Which of the following compounds will be the least soluble in water? A) CH3OH B) CH4 C) NH3 D) CH3CH2OH Answer: B Section: Section 6.4 Learning Outcome: 6.9 Describe how intermolecular attractions arise between dipolar molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6.2 True/False Questions 1) When drawing the three-dimensional structure diagram of a molecule the bold line goes back behind the page. Answer: FALSE Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) The ball-and-stick model emphasizes the bonding pattern. Answer: TRUE Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 3) In the VSEPR model the multiple bond is treated as a single electron group, just the way a single bond is treated. Answer: TRUE Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 13 Copyright © 2015 Pearson Education, Inc.

4) The angle around the central atom in the pyramidal structure is very close to that of the tetrahedral one. Answer: TRUE Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 5) Any molecule of the form AX3 is tetrahedral. Answer: FALSE Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 6) SO2, HCN and CO2 are linear. Answer: FALSE Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) NH3, CH3-, and PCl3 are pyramidal. Answer: TRUE Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) When determining the shape of a molecule, count all electron groups around the central atom. Answer: TRUE Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 9) When naming the shape of a molecule count only the lone pairs. Answer: FALSE Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 10) The pyramidal structure is the tetrahedral arrangement minus a bond but with a lone pair. Answer: TRUE Section: Section 6.2 Learning Outcome: 6.2 Explain the principles behind VSEPR theory. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

11) Sulfur dioxide is linear. Answer: FALSE Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) The bond angle in carbon tetrachloride is 109.5°. Answer: TRUE Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) The bond angle in ammonia is 109.5°. Answer: FALSE Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) Bonds are regions of negative charge and therefore repel each other. Answer: TRUE Section: Section 6.2 Learning Outcome: 6.5 Explain polarity in terms of individual bonds and an entire molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) Carbon tetrachloride is polar. Answer: FALSE Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) SO3, CO2, and CS2 are all non-polar. Answer: TRUE Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) Carbon dioxide contains polar bonds and is a nonpolar molecule. Answer: TRUE Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Carbon tetrachloride contains polar bonds and is a polar molecule. Answer: FALSE Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15 Copyright © 2015 Pearson Education, Inc.

19) Compounds with polar bonds may be nonpolar. Answer: TRUE Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 20) A polar covalent compound is unaffected by the presence of an electric field. Answer: FALSE Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 21) The difference in electronegativity between H and in HF is higher than that between H and Cl in HCl. Answer: TRUE Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6.3 Short Answer Questions Use VSEPR theory to predict the shape of the molecule or complex ion shown. Draw a Lewis dot structure to assist you in determining these shapes. 1) CO32Answer:

3) NO3Answer:

7) O3 (ozone) Answer:

11) PO43Answer:

Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Judge whether or not the molecule or polyatomic ion shown is polar or non-polar. Draw a dipole vector to indicate the direction of any net polarity. 12) SO3 Answer: non-polar Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) NO+ Answer: polar

Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) CBr4 Answer: non-polar Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) BF3 Answer: non-polar Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

16) NO2Answer: polar

6.4 Matching Questions Match each molecule in the left column with the shape of the central atom that appears in the right column. A) linear B) trigonal plamar C) tetrahedral D) bent E) trigonal planar F) pyramidal 1) hydrogen sulfide Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) water Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) ammonia Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) boron trifluoride Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) acetylene, C2H2 Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) sulfur dioxide Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) sulfur trioxide Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21 Copyright © 2015 Pearson Education, Inc.

8) ammonium ion Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) ethylene, C2H4 Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) carbon tetrachloride Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) hydrogen cyanide Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) phosphorus trihydride Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) nitrogen trifluoride Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) carbon disulfide Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 1) D 2) D 3) F 4) E 5) A 6) D 7) B 8) C 9) E 10) C 11) A 12) F 13) F 14) A

Match each molecule in the left column with an angle around the central atom that appears in the right column. A) 105° B) 107° C) 120° D) 118° E) 109.5° F) 180° 15) hydrogen sulfide Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) water Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) ammonia Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) boron trifluoride Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) acetylene, C2H2 Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) sulfur dioxide Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) sulfur trioxide Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

22) ammonium ion Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) ethylene, C2H4 Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) carbon tetrachloride Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) hydrogen cyanide Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) phosphorus trihydride Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) carbon disulfide Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) nitrogen trifluoride Section: Section 6.2 Learning Outcome: 6.4 Draw a molecule's shape for molecules possessing multiple bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 15) A 16) A 17) B 18) C 19) F 20) D 21) C 22) E 23) C 24) E 25) F 26) B 27) F 28) B

Match the shape and number of electron groups at the central atom on the left column with the number of bonding pairs of electrons on the central atom on the right column. A) 4 B) 3 C) 2 29) tetrahedral, four Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) pyramidal, four Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) bent, four Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) trigonal planar, three Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) linear, two Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 29) A 30) B 31) C 32) B 33) C

Match each of the ions that appears in the left column with the corresponding shape on the right column. A) bent B) trigonal planar C) linear D) pyramidal E) tetrahedral 34) CH3+ Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 35) CH3Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) NO3Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 37) HC2Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) HCO3Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 39) NH4+ Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 40) CO2 Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

41) NH2Section: Section 6.2 Learning Outcome: 6.3 Draw and name a molecule's shape starting from a dot diagram. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 34) B 35) D 36) B 37) C 38) B 39) E 40) C 41) A

Identify each of the molecules in the left column as polar or non-polar. A) non-polar B) polar 42) CH4 Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) HC1 Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 44) PCl3 Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 45) NH3 Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 46) H2O Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 47) H2S Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 48) H2C CH2 Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 49) CH2Cl2 Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

50) SO3 Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 51) CH3Cl Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 52) Br2 Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 53) CCl4 Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 54) CS2 Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 55) CH3CH3 Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 56) C2H2 Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 57) CO2 Section: Section 6.3 Learning Outcome: 6.6 Predict the relative polarity of a molecule. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 42) A 43) B 44) B 45) B 46) B 47) B 48) A 49) B 50) A 51) B 52) A 53) A 54) A 55) A 56) A 57) A

Identify whether each of the compounds in the left column has intermolecular dipole-dipole forces. A) no dipole-dipole forces B) dipole-dipole forces 58) NH3 Section: Section 6.4 Learning Outcome: 6.7 Explain how molecular polarity leads to intermolecular attraction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 59) CH4 Section: Section 6.4 Learning Outcome: 6.7 Explain how molecular polarity leads to intermolecular attraction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 60) CH3OH Section: Section 6.4 Learning Outcome: 6.7 Explain how molecular polarity leads to intermolecular attraction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 61) NH2OH Section: Section 6.4 Learning Outcome: 6.7 Explain how molecular polarity leads to intermolecular attraction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 62) CH3SH Section: Section 6.4 Learning Outcome: 6.7 Explain how molecular polarity leads to intermolecular attraction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 63) CH3OCH3 Section: Section 6.4 Learning Outcome: 6.7 Explain how molecular polarity leads to intermolecular attraction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 64) H2C O Section: Section 6.4 Learning Outcome: 6.7 Explain how molecular polarity leads to intermolecular attraction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 65) C2H6 Section: Section 6.4 Learning Outcome: 6.7 Explain how molecular polarity leads to intermolecular attraction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30 Copyright © 2015 Pearson Education, Inc.

66) C3H8 Section: Section 6.4 Learning Outcome: 6.7 Explain how molecular polarity leads to intermolecular attraction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 58) B 59) A 60) B 61) B 62) B 63) B 64) B 65) A 66) A

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 7 Intermolecular Forces and the Phases of Matter 7.1 Multiple-Choice Questions 1) Which of the three phases of matter (solid, liquid, or gas) has particles moving at the highest average velocity? A) solid B) liquid C) gas D) The particles in all three phases have about the same average speed. Answer: C Section: Section 7.1 Learning Outcome: 7.1 Describe the three phases of matter from a molecular viewpoint. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) Which of the three phases of matter (solid, liquid, or gas) has particles separated by the least amount of distance? A) solid B) liquid C) gas D) The separation distance is about the same in all three phases. Answer: A Section: Section 7.1 Learning Outcome: 7.1 Describe the three phases of matter from a molecular viewpoint. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Which of the three phases of matter (solid, liquid, or gas) has particles that are fast-moving and independent of each other? A) solid B) liquid C) gas D) All of the above feature loose arrangements of particles. Answer: C Section: Section 7.1 Learning Outcome: 7.1 Describe the three phases of matter from a molecular viewpoint. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

4) Which of the three phases of matter (solid, liquid, or gas) features particles in a fixed, rigid arrangement? A) solid B) liquid C) gas D) All three phases of matter have rigid arrangements of particles. Answer: A Section: Section 7.1 Learning Outcome: 7.1 Describe the three phases of matter from a molecular viewpoint. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) Which of the three phases of matter (solid, liquid, or gas) features particles that are easily compressible? A) solid B) liquid C) gas D) All three phases of matter are compressible. Answer: C Section: Section 7.1 Learning Outcome: 7.1 Describe the three phases of matter from a molecular viewpoint. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) Which of the three phases of matter (solid, liquid, or gas) features particles that are no longer held together by intermolecular forces? A) solid B) liquid C) gas D) All three phases of matter will do this. Answer: C Section: Section 7.1 Learning Outcome: 7.1 Describe the three phases of matter from a molecular viewpoint. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) A change of state from a gas to a liquid is called ________. A) sublimation B) condensation C) evaporation D) melting Answer: B Section: Section 7.1 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

8) The change of state from a liquid to a gas is called ________. A) sublimation B) condensation C) evaporation D) melting Answer: C Section: Section 7.1 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 9) The change of state from a solid to a gas is called ________. A) melting B) sublimation C) evaporation D) condensation Answer: B Section: Section 7.1 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 10) The change of state from a solid to a liquid is called ________. A) melting B) sublimation C) evaporation D) condensation Answer: A Section: Section 7.1 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 11) Which of the following statements is true about intermolecular forces of attraction between molecules? A) They tend to hold molecules together. B) Cooling is responsible for the substance's liquefaction. C) The solidification of a substance usually requires lower temperatures than in the case of liquefaction. D) All of the above are true. Answer: D Section: Section 7.1 Learning Outcome: 7.1 Describe the three phases of matter from a molecular viewpoint. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

12) The term "normal" boiling point indicates ________. A) the temperature at which a liquid evaporates under the atmospheric pressure found at sea level. B) the temperature at which a liquid boils under the atmospheric pressure found at sea level. C) the temperature at which a liquid boils under any pressure conditions D) both A and B Answer: B Section: Section 7.1 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 13) Which of the following chemical substances would you expect to have the lowest boiling point (you may consider molecular mass and the degree of intermolecular forces as primary controlling factors)? A) CH4 B) CH3CH3 C) CH3CH2CH3 D) CH3CH2CH2CH3 Answer: A Section: Section 7.2 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) Between individual molecules of NO2 in the solid state, which of the following types of intermolecular forces would you expect to be dominant? A) hydrogen bonding B) London forces C) van der Waals forces D) dipole-dipole forces Answer: D Section: Section 7.2 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

15) Which of the following substances would you expect to be a liquid at room temperature, assuming that strong intermolecular forces need to be present to be a liquid at room temperature? A) N2 B) CS2 C) H2 D) O2 Answer: B Section: Section 7.2 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Which of the following chemical substances would you expect to have the highest melting point? A) water, H2O B) methyl alcohol, CH3OH C) nitrogen dioxide, NO2 D) hydrogen sulfide, H2S Answer: A Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) Which of the following sublimes? A) sugar B) iron C) mothballs D) margarine Answer: C Section: Section 7.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Which of the following does not sublime? A) mothballs B) iodine crystals C) salt D) dry ice Answer: C Section: Section 7.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

19) Which of the following is not a solid at 0 °C? A) salt B) carbon dioxide C) sugar D) iron Answer: B Section: Section 7.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) Which of the following statements about London forces is correct? A) London forces are also called dispersion forces. B) London forces are relatively weakly attractive. C) London forces occur between polar and nonpolar molecules. D) All the above statements are true. Answer: D Section: Section 7.2 Learning Outcome: 7.3 Describe London forces and their magnitude. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 21) Nonpolar molecules may exhibit ________. A) London forces B) hydrogen bonding C) dipolar forces D) all of the above Answer: A Section: Section 7.2 Learning Outcome: 7.3 Describe London forces and their magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) Polar molecules may exhibit ________. A) London forces B) hydrogen bonding C) dipole-dipole forces D) all of the above Answer: D Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

23) London forces are extremely weak for ________. A) nitrogen gas B) methane gas C) oxygen gas D) all of the above Answer: D Section: Section 7.2 Learning Outcome: 7.3 Describe London forces and their magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) Which of the following experiences the strongest London forces? A) carbon tetrachloride B) water C) hydrogen D) helium Answer: A Section: Section 7.2 Learning Outcome: 7.3 Describe London forces and their magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) The main reason why carbon tetrabromide is a solid at room temperature when compared to carbon tetrachloride which is a liquid is because ________. A) carbon tetrabromide is tetrahedral in shape. B) carbon tetrachloride has the weaker London forces than carbon tetrabromide. C) carbon tetrabromide may undergo hydrogen bonding. D) all of the above Answer: B Section: Section 7.2 Learning Outcome: 7.3 Describe London forces and their magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) Which of the following chemical substances would you expect to have the highest boiling point (you may consider molecular mass and the degree of intermolecular hydrogen bonding as primary controlling factors)? A) methane, CH4 B) ammonia, NH3 C) methyl alcohol, CH3OH D) ethyl alcohol, CH3CH2OH Answer: D Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

27) Which of the following chemical substances would you expect to exhibit hydrogen bonding? A) methyl chloride, CH3Cl B) methyl alcohol, CH3OH C) octane, C8H18 D) methane, CH4 Answer: B Section: Section 7.3 Learning Outcome: 7.4 Describe hydrogen bonding and predict when it can occur. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) Which of the following chemical substances would you expect to exhibit hydrogen bonding? A) NH3 B) CH3OH C) HF D) all of the above Answer: D Section: Section 7.2 Learning Outcome: 7.4 Describe hydrogen bonding and predict when it can occur. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 29) Which of the compounds below has a large permanent dipole? A) methane B) hydrogen C) acetone D) nitrogen Answer: C Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) Which of the following does not have a dipole? A) carbon tetrachloride B) acetone C) ammonia D) water Answer: A Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

31) The strength of an O-H bond is about equal to ________ kJ/bond A) 16 B) 50 C) 100 D) 400 Answer: D Section: Section 7.3 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) The strength of a hydrogen bond is about ________ percent of the strength of a normal O-H bond A) 1 B) 4 C) 16 D) 50 Answer: B Section: Section 7.3 Learning Outcome: 7.4 Describe hydrogen bonding and predict when it can occur. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) To form hydrogen bonds, molecules must contain ________. A) an N-H bond B) an O-H bond C) an H-F bond D) at least one of the above mentioned bonds Answer: D Section: Section 7.3 Learning Outcome: 7.4 Describe hydrogen bonding and predict when it can occur. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 34) Which of the following will have the highest boiling point? A) CH3OCH3 B) CH3CH2OH C) HOCH2-CH2OH D) CH3CH3 Answer: C Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

35) Which of the following will have the lowest boiling point? A) CH3OCH3 B) CH3CH2OH C) HOCH2-CH2OH D) CH3CH3 Answer: D Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) The force(s) responsible for holding the DNA molecule in a very long twisted zipper is ________. A) hydrogen bonding B) London forces C) dipolar forces D) interionic forces Answer: A Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 37) Which of the following will have the highest boiling point? A) HI B) HBr C) HCl D) HF Answer: D Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) Which of the following will have the lowest boiling point? A) H2S B) H2Te C) H2Se D) H2O Answer: A Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

39) Which of the following influences the strength of the intermolecular forces? A) distance between interacting molecules B) relative orientation between interacting molecules C) location of the molecule in a liquid or solid D) All of the above influence the strength of the intermolecular forces. Answer: D Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 40) Which of the following intermolecular force is the strongest? A) London forces B) van der Waals forces C) hydrogen bonding D) dipole forces Answer: C Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 41) How does vancomycin function to kill bacteria? A) destroys the bacterial DNA B) interferes with cell wall construction C) inhibits protein synthesis D) prevents bacteria metabolism Answer: B Section: Section 7.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) Which intermolecular force is important for the function of the antibiotic vancomycin? A) London forces B) van der Waals forces C) hydrogen bonding D) dipole forces Answer: C Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

43) Which of the following can be called a non-molecular ionic solid? A) water B) sodium chloride C) methane D) hydrogen Answer: B Section: Section 7.4 Learning Outcome: 7.6 Describe what a nonmolecular substance is on an atomic level. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 44) Which of the following may not be considered an ionic compound? A) sodium chloride B) magnesium oxide C) ammonia D) potassium bromide Answer: C Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 45) Which statement is true about network solids? A) They have extremely high melting points. B) They are covalent substances. C) They are large network molecules held by covalent compounds. D) All of the above are true. Answer: D Section: Section 7.4 Learning Outcome: 7.7 Explain why nonmolecular compounds typically have very high melting points. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 46) Which of these has the highest melting point? A) diamond B) iron C) sodium D) bromine Answer: A Section: Section 7.4 Learning Outcome: 7.7 Explain why nonmolecular compounds typically have very high melting points. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

7.2 True/False Questions 1) The melting and freezing points are identical for the same compound. Answer: TRUE Section: Section 7.1 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) At the freezing point the molecules are effectively frozen in place. Answer: TRUE Section: Section 7.1 Learning Outcome: 7.1 Describe the three phases of matter from a molecular viewpoint. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Solid carbon dioxide is also known as dry ice. Answer: TRUE Section: Section 7.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) The freezing point of dry ice is 0 °C. Answer: FALSE Section: Section 7.1 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) The attractive forces between carbon dioxide molecules are considerably stronger than those found in water molecules. Answer: FALSE Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) The terms "dispersion forces" and "London forces" are interchangeable. Answer: TRUE Section: Section 7.2 Learning Outcome: 7.3 Describe London forces and their magnitude. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 7) Polar molecules do not exhibit London forces. Answer: FALSE Section: Section 7.2 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

8) London forces become significant for large molecules with many atoms and many electrons. Answer: TRUE Section: Section 7.2 Learning Outcome: 7.3 Describe London forces and their magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) The acetone molecule has a large dipole because of the electronegativity difference between carbon and oxygen. Answer: TRUE Section: Section 7.2 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) Water has a much higher boiling point than acetone due to the ability of water to undergo hydrogen bonding. Answer: TRUE Section: Section 7.3 Learning Outcome: 7.4 Describe hydrogen bonding and predict when it can occur. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) Vancomycin is the first line of defense against bacteria. Answer: FALSE Section: Section 7.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) The replacement of a single NH group on vancomycin causes the antibiotic to become ineffective. Answer: TRUE Section: Section 7.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) Quartz contains atoms that are held together with hydrogen bonding. Answer: FALSE Section: Section 7.4 Learning Outcome: 7.4 Describe hydrogen bonding and predict when it can occur. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) Molecular substances have a higher melting point than non-molecular substances Answer: FALSE Section: Section 7.4 Learning Outcome: 7.7 Explain why nonmolecular compounds typically have very high melting points. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

15) Quartz and diamond are non-molecular solids, where the atoms are held together with covalent bonds. Answer: TRUE Section: Section 7.4 Learning Outcome: 7.6 Describe what a nonmolecular substance is on an atomic level. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7.3 Short Answer Questions Identify the following crystalline solids as ionic, molecular, or metallic. 1) calcium chloride, CaC12 Answer: ionic Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) glucose, C6H12O6 Answer: molecular Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) chromium, Cr Answer: metallic Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) iodine, I2 Answer: molecular Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) copper (II) carbonate, CuCO3 (or cupric carbonate) Answer: ionic Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

Based upon the formulas and melting points, decide whether each of the following crystalline substances should be classified as an ionic solid, a molecular solid, a metal or a network solid. 6) magnesium chloride, MgC12, m.p.: 714 °C Answer: ionic solid Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) niobium, Nb, m.p.: 2468 °C Answer: metal Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) silicon carbide, SiC, m.p.: 2700 °C Answer: network solid Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) ethanol, C2H6O, m.p.: -117 °C Answer: molecular solid Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) sodium fluoride, NaF, m.p.: 993 °C Answer: ionic solid Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) What is the general trend in terms of increasing melting point for ionic solids, molecular solids, and network covalent solids? Answer: Molecular < ionic < network covalent. This trend is based primarily on the strength of the structural framework. Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16 Copyright © 2015 Pearson Education, Inc.

7.4 Matching Questions Identify each of the compounds in the left column as molecular or non-molecular. A) non-molecular B) molecular 1) water Section: Section 7.4 Learning Outcome: 7.6 Describe what a nonmolecular substance is on an atomic level. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) sodium oxide Section: Section 7.4 Learning Outcome: 7.6 Describe what a nonmolecular substance is on an atomic level. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) graphite Section: Section 7.4 Learning Outcome: 7.6 Describe what a nonmolecular substance is on an atomic level. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) ammonia Section: Section 7.4 Learning Outcome: 7.6 Describe what a nonmolecular substance is on an atomic level. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) sodium chloride Section: Section 7.4 Learning Outcome: 7.6 Describe what a nonmolecular substance is on an atomic level. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) methane Section: Section 7.4 Learning Outcome: 7.6 Describe what a nonmolecular substance is on an atomic level. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) hydrogen Section: Section 7.4 Learning Outcome: 7.6 Describe what a nonmolecular substance is on an atomic level. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) silicon dioxide Section: Section 7.4 Learning Outcome: 7.6 Describe what a nonmolecular substance is on an atomic level. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17 Copyright © 2015 Pearson Education, Inc.

9) carbon tetrachloride Section: Section 7.4 Learning Outcome: 7.6 Describe what a nonmolecular substance is on an atomic level. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) aluminum oxide Section: Section 7.4 Learning Outcome: 7.6 Describe what a nonmolecular substance is on an atomic level. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) copper Section: Section 7.4 Learning Outcome: 7.6 Describe what a nonmolecular substance is on an atomic level. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 1) B 2) A 3) A 4) B 5) A 6) B 7) B 8) A 9) B 10) A 11) A

Match the description of processes that appear in the left column with the corresponding change of states on the right column. A) sublimation B) evaporation C) melting D) condensation E) freezing 12) liquefaction of butter on hot bread Section: Section 7.1 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) "disappearance" of mothballs Section: Section 7.1 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) water boiling Section: Section 7.1 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) ice formation on a pond during winter Section: Section 7.1 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) collection of water droplets on the medicine cabinet mirror during a prolonged hot shower Section: Section 7.1 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 12) C 13) A 14) B 15) E 16) D

Match the temperatures in the left column with the processes described in the right column. A) boiling point of ethanol B) boiling point of nitrogen C) deposition point of carbon dioxide D) boiling point of water E) melting point of water F) boiling point of hydrogen 17) -253 °C Section: Section 7.2 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) -196 °C Section: Section 7.2 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) -78 °C Section: Section 7.2 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) 0 °C Section: Section 7.2 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) 78 °C Section: Section 7.2 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) 100 °C Section: Section 7.2 Learning Outcome: 7.2 Explain what is necessary for one phase to transform into another. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 17) F 18) B 19) C 20) E 21) A 22) D

Match each of the substances in the left column with the STRONGEST type of bonding that it exhibits. A) hydrogen bonding B) London forces C) network covalent bonding D) metallic 23) water Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) carbon tetrabromide Section: Section 7.2 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) iron Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) hydrogen fluoride Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) carbon tetrachloride Section: Section 7.2 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) quartz Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

29) ammonia Section: Section 7.3 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) diamond Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) graphite Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) boron trifluoride Section: Section 7.2 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) titanium Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) methane Section: Section 7.2 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 35) sodium Section: Section 7.4 Learning Outcome: 7.5 Predict the most important intermolecular force present and its effect on physical properties. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 23) A 24) B 25) D 26) A 27) B 28) C 29) A 30) C 31) C 32) B 33) D 34) B 35) D

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 8 Chemical Reactions 8.1 Multiple-Choice Questions 1) Which of the following statements is correct about a superconductor? A) It possesses the extraordinary property, when cooled, to have a magnet float as if defying gravity. B) It conducts electricity with zero resistance. C) It prevents magnetic field lines from penetrating it. D) All of the above statements are correct about a superconductor. Answer: D Section: Section 8.1 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) In a gas-phase reaction ________. A) only the products are gases B) only the reactants are gases C) both the reactants and the products are gases D) solids and liquids may be present, but at least one reagent must be a gas Answer: B Section: Section 8.2 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 3) Which process releases energy? A) bond formation B) bond breaking C) both A and B D) none of the above Answer: A Section: Section 8.2 Learning Outcome: 8.1 Describe what a chemical reaction is in general terms and in terms of chemical bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) Which process absorbs energy? A) bond formation B) bond breaking C) both A and B D) none of the above Answer: B Section: Section 8.2 Learning Outcome: 8.1 Describe what a chemical reaction is in general terms and in terms of chemical bonds. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

5) Which of the following equations has 1:1:1:1 as the coefficient ratio when balanced? A) H2SO4 + KOH → K2SO4 + H2O B) Zn + HCl → H2 + ZnCl2 C) CH4 + O2 → CO2 + H2O D) NaOH + HCl → NaCl + H2O Answer: D Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) Which of the following equations has 1:2:1:1 as the coefficient ratio when balanced? A) H2SO4 + KOH → K2SO4 + H2O B) Zn + HCl → H2 + ZnCl2 C) CH4 + O2 → CO2 + H2O D) NaOH + HCl → NaCl + H2O Answer: B Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) Which of the following balanced reactions does not have at least one 6 as a coefficient? A) H2SO4 + Al(OH)3 → Al2(SO4)3 + H2O B) H3PO4 + Ba(OH)2 → Ba3(PO4)2 + H2O C) C6H12O6 + O2 → CO2 + H2O D) C2H2 + O2 → CO2 + H2O Answer: D Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 8) The coefficients are respectively ________ for the following equation. Fe2O3 + Al → Al2O3 + Fe A) 1: 2: 1: 2 B) 2: 3: 2: 3 C) 1: 2: 2: 1 D) 2: 3: 3: 4 Answer: A Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

9) The coefficients are respectively ________ for the following equation. C4H10 + O2 → CO2 + H2O A) 1: (13/2): 4: 5 B) 2: 13: 8: 10 C) 1: 13: 4: 5 D) either A or B Answer: D Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) Which of the following equations does not have 1:2:1:2 as the coefficient ratio when balanced? A) H2SO4 + KOH → K2SO4 + H2O B) Ca(OH)2 + HCl → CaCl2 + H2O C) CH4 + O2 → CO2 + H2O D) K + H2O → H2 + KOH Answer: D Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) Which of the following has 6 as one of the coefficients when the equation is balanced? A) H2SO4 + Al(OH)3 → Al2(SO4)3 + H2O B) C2H6O +O2 → CO2 + H2O C) Mg + HCl → H2 + MgCl2 D) Al(OH)3 + HCl → AlCl3 + H2O Answer: A Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 12) What is the coefficient for iron after the following reaction is balanced? Fe + O2 → Fe2O3 A) 1 B) 3 C) 4 D) 6 Answer: C Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

13) What is the sum of all coefficients after the following equation is balanced? C8H18 + O2 → CO2 + H2O A) 4 B) 18 C) 32 D) 61 Answer: D Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 14) What is the sum of all coefficients after the following equation is balanced? K2CrO4 + Al(NO3)3 → Al2(Cr O4)3 + KNO3 A) 4 B) 8 C) 12 D) 15 Answer: C Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 15) Which of the following reactions is a single replacement reaction? A) HCl + NaOH → NaCl + H2O B) Mg + HCl → H2 + MgCl2 C) CaCl2 + H2O → CaCl2 ∙ 2H2O D) KClO3 → KCl + O2 Answer: B Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Which of the following reactions is a double replacement reaction? A) HCl + NaOH → NaCl + H2O B) Mg + HCl → H2 + MgCl2 C) CaC12 + H2O → CaCl2 ∙ 2H2O D) KClO3 → KCl + O2 Answer: A Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

17) Which of the following reactions is a decomposition reaction? A) HCl + NaOH → NaCl + H2O B) Mg + HCl → H2 + MgCl2 C) CaCl2 + H2O → CaCl2 ∙ 2H2O D) KClO3 → KCl + O2 Answer: D Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Which of the following is an example of a combination reaction? A) HCl + NaOH → NaCl + H2O B) Mg + HCl → H2 + MgCl2 C) 2 Na + Cl2 → 2NaCl D) KClO3 → KCl + O2 Answer: C Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) Which of the following equations is not a combustion reaction? A) C2H6O + O2 → H2O + CO2 B) CH4 + O2 → CO + H2O C) KClO3 → KCl +O2 D) Fe + O2 → FeO Answer: C Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) The following equation is an example of a ________ reaction. NaClO3 → NaCl + O2 A) combination B) combustion C) decomposition D) double replacement Answer: C Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

21) The following equation is an example of a ________ reaction. Zn + CuCl2 → Cu + ZnCl2 A) combination B) single replacement C) double replacement D) decomposition Answer: B Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) The following equation is an example of a ________ reaction. K2SO4 + BaCl2 → BaSO4 + KCl A) combination B) single replacement C) double replacement D) decomposition Answer: C Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) Which of the following equations is not a single replacement reaction? A) H2SO4 + Mg(OH)2 → H2O + MgSO4 B) Zn + HCl → H2 + ZnCl2 C) Al + Fe2O3 → Al2O3 + Fe D) Na + H2O → NaOH + H2 Answer: A Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) Which of the following equations is not a double replacement reaction? A) H2SO4 + Mg(OH)2 → H2O + MgSO4 B) Mg + HCl → H2 + MgCl2 C) AlCl3 + H2O → Al(OH)3 + HCl D) AgNO3 + NaCl → AgCl + NaNO3 Answer: B Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

25) Which of the following equations is not a decomposition reaction? A) CaSO4 ∙ 2H2O → CaSO4 + 2 H2O B) NaClO3 → NaCl + O2 C) H2O2 → H2O + O2 D) K + H2O → KOH + H2 Answer: D Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) Which of the following equations is not a combination reaction? A) H2 + O2 → H2O B) C2H4 + Br2 → C2H4Br2 C) CH4 + O2 → CO2 + H2O D) Fe + O2 → Fe3O4 Answer: C Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) Which of the following equations is a combustion reaction? A) MgO + HCl → MgCl2 + H2O B) Al + Fe2O3 → Al2O3 + Fe C) KClO3 → KCl + O2 D) CH4 + O2 → CO2 + H2O Answer: D Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) The following equation is an example of a ________ reaction. C8H18 + O2 → CO2 + H2O A) synthesis B) decomposition C) double displacement D) combustion Answer: D Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

29) The spectator ions in the following precipitation equation are ________. AgNO3 + NaCl → AgCl + NaNO3 A) Ag+ and NO3B) Na+ and NO3C) Ag+ and ClD) Na+ and ClAnswer: B Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) Which ions are not spectator ions in the following precipitation equation? AgNO3 + NaCl → AgCl + NaNO3 A) Ag+ and NO3B) Na+ and NO3C) Ag+ and ClD) Na+ and ClAnswer: C Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) The following equation is an example of a ________ reaction. Pb(NO3 )2+ 2KI → PbI2 + 2KNO3 A) synthesis B) precipitation C) single replacement D) decomposition Answer: B Section: Section 8.5 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

32) The spectator ions in the following precipitation equation are ________. Pb(NO3)2+ 2KI → PbI2 + 2KNO3 A) Pb2+ and IB) K+ and NO3C) K+ and ID) Pb2+ and NO3Answer: B Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) Which of the following is the least soluble in water? A) sodium sulfate B) lead (II) nitrate C) potassium chloride D) calcium sulfate Answer: D Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) Which of the following salts is insoluble in water? A) K2SO4 B) AgNO3 C) CaCO3 D) Na3PO4 Answer: C Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 35) Which of the following salts is soluble in water? A) AgCl B) BaCO3 C) Ca(SO4) D) NaNO3 Answer: D Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

36) Which hydroxide is insoluble in water? A) sodium hydroxide B) barium hydroxide C) aluminum hydroxide D) calcium hydroxide Answer: C Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 37) Which hydroxide is soluble in water? A) lead (II) hydroxide B) magnesium hydroxide C) calcium hydroxide D) strontium hydroxide Answer: C Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) Which chloride is soluble in water? A) lead (II) chloride B) calcium chloride C) mercury (I) chloride D) silver chloride Answer: B Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 39) Which sulfate is insoluble in water? A) ammonium sulfate B) strontium sulfate C) sodium sulfate D) potassium sulfate Answer: B Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 40) Which sulfate is soluble in water? A) calcium sulfate B) barium sulfate C) lithium sulfate D) lead (II) sulfate Answer: C Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

41) Which sulfide is insoluble in water? A) lead (II) sulfide B) potassium sulfide C) ammonium sulfide D) sodium sulfide Answer: A Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) Which phosphate is soluble in water? A) ammonium phosphate B) cobalt (II) phosphate C) aluminum phosphate D) barium phosphate Answer: A Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) Which lead (II) compound is soluble in water? A) lead (II) sulfate B) lead (II) carbonate C) lead (II) chloride D) lead (II) nitrate Answer: D Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 44) Which of the following equations is not a precipitation reaction? A) Na2SO4 + CaCl2 → CaSO4 + NaCl B) MgCl2 + AgNO3 → Mg(NO3)2 + AgCl C) NaOH + HCl → NaCl + H2O D) NaCl+ AgC2H3O2 → AgCl + NaC2H3O2 Answer: C Section: Section 8.5 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 45) The following equation is an example of a ________ reaction. AgNO3 + NaCl → AgCl + NaNO3 A) combination B) precipitation C) single replacement D) decomposition Answer: B Section: Section 8.5 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11 Copyright © 2015 Pearson Education, Inc.

46) Which ions are not spectator ions in the following precipitation equation? Pb(NO3)2+ 2KI → PbI2 + 2KNO3 A) Pb2+ and IB) K+ and NO3C) K+ and ID) Pb2+ and NO3Answer: A Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 47) When aqueous solutions of sodium phosphate and calcium nitrite are mixed, the spectator ions are ________. A) calcium and nitrite B) sodium and phosphate C) calcium and phosphate D) sodium and nitrite Answer: D Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 48) When aqueous solutions of calcium hydroxide and hydrobromic acid are mixed, the spectator ions are ________. A) calcium and bromide B) hydrogen and hydroxide C) calcium and hydroxide D) hydrogen and bromide Answer: A Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

49) When aqueous solutions of sodium nitrate and potassium chloride are mixed, the spectator ions are ________. A) potassium and nitrate B) sodium and chloride C) both A and B D) no spectator ions are present Answer: C Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 50) The net ionic equation for the following reaction is ________. AgNO3 + NaCl → AgCl + NaNO3 A) Ag+ (aq) + NO3- (aq) → AgNO3 B) Ag+ (aq) + Cl- (aq) → AgCl (s) C) Na+ (aq) + NO3- (aq) → NaNO3 D) NaCl + AgNO3 → AgCl (s) Answer: B Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 51) If the following ions Ca2+, NO3-, Na+ and SO42- are placed in a test tube, the precipitate formed is ________. A) NaNO3 B) CaSO4 C) Ca(NO3)2 D) Na2SO4 Answer: B Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

52) If the following ions Ba2+, Cl-, K+ and SO42- are placed in a test tube, the precipitate formed is ________. A) BaSO4 B) KCl C) BaCl2 D) K2SO4 Answer: A Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 53) If the following ions Ca2+, Cl-, Na+ and CO32- are placed in a test tube, the precipitate formed is ________. A) CaCO3 B) NaCl C) CaCl2 D) No precipitate will be formed. Answer: A Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 54) The precipitate formed when sodium chloride and lead (II) nitrate are placed in a test tube is ________. A) lead (II) chloride B) sodium nitrate C) lead (II) hydroxide D) No precipitate will be formed. Answer: A Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

55) The precipitate formed when barium nitrate and potassium chromate are placed in a test tube is ________. A) barium nitrate B) barium chromate C) potassium nitrate D) potassium chromate Answer: B Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 56) The precipitate formed when hydrochloric acid and sodium hydroxide are placed in a test tube is ________. A) sodium hydroxide B) sodium chloride C) hydrochloric acid D) No precipitate will be formed. Answer: D Section: Section 8.6 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 57) The net ionic equation for the following reaction is ________. H2SO4 + KOH → K2SO4 + H2O + 2A) K (aq) + SO4 (aq) → K2SO4 B) H+ (aq) + OH- (aq) → H2O C) K+ (aq) + OH-(aq) → KOH D) H+ (aq) + SO42- (aq) → H2SO4 Answer: B Section: Section 8.6 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 58) It takes ________ mole(s) of potassium hydroxide to neutralize ________ moles of sulfuric acid. A) 1; 1 B) 1; 2 C) 2; 1 D) 3; 1 Answer: C Section: Section 8.6 Learning Outcome: 8.6 Write chemical reactions that involve acids and bases. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 15 Copyright © 2015 Pearson Education, Inc.

59) It takes ________ mole(s)of calcium hydroxide to neutralize ________ moles of sulfuric acid. A) 1; 1 B) 1; 2 C) 2; 1 D) 1; 3 Answer: A Section: Section 8.6 Learning Outcome: 8.6 Write chemical reactions that involve acids and bases. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 60) It takes ________ mole(s) of sulfuric acid to neutralize ________ moles of aluminum hydroxide. A) 2; 3 B) 3; 2 C) 1; 2 D) 1; 1 Answer: B Section: Section 8.6 Learning Outcome: 8.6 Write chemical reactions that involve acids and bases. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 61) The number of moles of sodium hydroxide needed to neutralize one mole of nitric acid is ________. A) 1 B) 2 C) 3 D) 0.5 Answer: A Section: Section 8.6 Learning Outcome: 8.6 Write chemical reactions that involve acids and bases. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

8.2 True/False Questions 1) Bond breaking releases energy. Answer: FALSE Section: Section 8.2 Learning Outcome: 8.1 Describe what a chemical reaction is in general terms and in terms of chemical bonds. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) Bond formation releases energy. Answer: TRUE Section: Section 8.2 Learning Outcome: 8.1 Describe what a chemical reaction is in general terms and in terms of chemical bonds. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 3) The coefficients in the balanced equation are 1: 6: 2: 3. Au2S3 + H2 → Au + H2S Answer: FALSE Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 4) The coefficients in the balanced equation are 2: 2: 3. KClO3 → KCl + O2 Answer: TRUE Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) The coefficients in the balanced equation are 1: 19: 8: 3. C8H6 + O2 → CO2 + H2O Answer: FALSE Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) Another term for the combination reaction is a synthesis reaction. Answer: TRUE Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

7) In a combustion reaction, oxygen is typically one of the reactants. Answer: TRUE Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 8) In a decomposition reaction, one compound breaks down into two or more simpler compounds or elements. Answer: TRUE Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 9) In a combination reaction two or more compounds yield two or more compounds. Answer: FALSE Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 10) A combustion reaction always involves carbon dioxide formation. Answer: FALSE Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 11) One needs to balance a chemical reaction before identifying the type of reaction. Answer: FALSE Section: Section 8.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) In a precipitation reaction, all ions and compounds are soluble in water. Answer: FALSE Section: Section 8.5 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) All nitrates are soluble in water. Answer: TRUE Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) All hydroxides are insoluble in water. Answer: FALSE Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

15) Silver (I) chloride is insoluble in water, while silver (I) acetate is soluble in water. Answer: TRUE Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Only the halides of lead (II) and silver (I) are insoluble in water. Answer: FALSE Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) Ammonium phosphate is soluble in water, but ammonium carbonate is insoluble in water. Answer: FALSE Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) When the following ions barium, chloride, sodium and sulfate are placed together in a test tube, barium sulfate precipitates out. Answer: TRUE Section: Section 8.5 Learning Outcome: 8.5 Predict the precipitate and write a chemical equation for precipitation reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) It takes two moles of sulfuric acid to neutralize one mole of sodium hydroxide. Answer: FALSE Section: Section 8.6 Learning Outcome: 8.6 Write chemical reactions that involve acids and bases. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 20) An alternative name for hydrochloric acid is muriatic acid. Answer: TRUE Section: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) An alternative name for lye is potassium hydroxide. Answer: FALSE Section: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

8.3 Matching Questions Match each of the equations in the left column with the correct relative coefficient ratio when the equation is balanced that appears in the right column. A) 2: 3: 2: 4 B) 1: 1: 1: 1 C) 1: 3: 2: 2 D) 1: 2: 2: 1 E) 1: 2: 1: 1 F) 1: 3: 3: 4 1) CH4 + Br2 → CH3Br + HBr Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 2) CH4 + O2 → CO + H2O Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 3) Mg + HBr → MgBr2 + H2 Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 4) CaCl2 +AgNO3 → Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) C3H8O + O2 → CO + H2O Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) C2H4 + O2 → CO2 + H2O Section: Section 8.3 Learning Outcome: 8.3 Write and balance chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 1) B 2) A 3) E 4) D 5) F 6) C

Match every equation in the left column with its type that appears in the right column. A) Combination B) Double replacement C) Decomposition D) Combustion 7) H2SO4 + NaOH → Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. E) Single replacement 8) Mg + HCl → H2 + MgCl2 Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) CH4 + O2 → CO2 + H2O Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) NaClO3 → NaCl + O2 Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) P + Cl2 → PCl3 Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) Na2SO4 + PbCl2 → PbSO4 + NaCl Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) CH4 + Br2 → CH3Br + HBr Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

14) Mg + N2 → Mg2N3 Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) Mg + HBr → MgBr2 + H2 Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) NaCl +AgNO3 → Section: Section 8.5 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) H2O2 → H2 + O2 Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) C2H4O + O2 → CO + H2O Section: Section 8.4 Learning Outcome: 8.4 Describe and identify the different reaction types. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 7) B 8) E 9) D 10) C 11) A 12) B 13) B 14) A 15) E 16) B 17) C 18) D

Predict whether each of the compounds listed on the left column is water soluble or insoluble. A) water insoluble B) water soluble 19) potassium nitrate Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) silver (I) chloride Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) lithium acetate Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) lead (II) sulfate Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) cobalt (II) sulfide Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) potassium bromide Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) ammonium phosphate Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) barium carbonate Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) aluminum hydroxide Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) lithium sulfate Section: Section 8.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 19) B 20) A 21) B 22) A 23) A 24) B 25) B 26) A 27) A 28) B 23 Copyright © 2015 Pearson Education, Inc.

Match the acid-base pairs. A) HNO3 B) HCl C) SO42D) OHE) H2SO4 F) NO2 G) H3O+ 29) the conjugate acid of NO3Section: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) the conjugate acid of ClSection: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) the conjugate base of HSO4Section: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) the conjugate acid of HSO4Section: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) the conjugate base of H2O Section: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) the conjugate acid of H2O Section: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 29) A 30) B 31) C 32) E 33) D 34) G

Match each of the acids that appear in the left column with a use or alternative name that appears in the right column. A) used to dissolve metals B) found in lemons C) used to clean steel, also known as muriatic acid D) used in car batteries E) used to etch glass F) is the active ingredient in vinegar 35) hydrochloric acid Section: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) sulfuric acid Section: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 37) acetic acid Section: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 38) citric acid Section: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 39) hydrofluoric acid Section: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 40) nitric acid Section: Section 8.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 35) C 36) D 37) F 38) B 39) E 40) A

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 9 Stoichiometry and the Mole 9.1 Multiple-Choice Questions 1) What is the mass in grams of 1.000 mole of P 2O5? A) 239.03 g B) 61.96 g C) 142.0 g D) 46.98 g Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 2) What is the mass in grams of 1.000 mole of a compound whose formula is C3H7O2? A) 29.14 g B) 68.22 g C) 37.54 g D) 75.09 g Answer: D Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 3) Which of the following has the least number of atoms? A) (NH4)3PO4 B) Na2P2O3 C) (NH4)2Cr2O7 D) K4Fe(CNO)6 Answer: B Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

4) Which of the following has the greatest number of atoms? A) (NH4)3PO4 B) Na2P2O3 C) (NH4)2Cr2O7 D) K4Fe(CNO)6 Answer: D Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) The correct sequence of decreasing number of atoms per formula unit in the following is ________. A) (NH4)3PO4 > Na2P2O3 > Na3PO4 B) Na3PO4 > (NH4)3PO4 > Na2P2O3 C) Na2P2O3 > Na3PO4 > (NH4)3PO4 D) (NH4)3PO4 > Na3PO4 > Na2P2O3 Answer: D Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) The number of oxygen atoms in 1 mole of Al2(SO4)3 is ________. A) 3 B) 4 C) 12 D) none of the above Answer: D Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) The molar mass of Ca3(PO4)2 is ________. A) 310 B) 279 C) 246 D) 215 Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

8) The molar mass for Pb(CO3)4 is ________. A) 447 B) 409 C) 327 D) 303 Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 9) Which of the following has a molar mass equal to 133? A) (NH4)3PO3 B) Ca3(PO4)2 C) Al2(SO3)3 D) Co2(CO3)2 Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) Which of the following has the highest molar mass? A) (NH4)3PO3 B) Ca3(PO4)2 C) Al2(SO3)3 D) Co2(CO3)2 Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) Which of the following pairs does not share the same molecular mass when rounded to the nearest whole number? A) CH3OH and oxygen gas B) CO and nitrogen gas C) C2H6O and C2H4O2 D) C4H10O and C3H6O2 Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

12) The molar mass of a compound XClO3 is 106.5. The molar mass (rounded to the nearest whole number) of X is ________, which is ________. A) 39; K B) 23; Na C) 7; Li D) 1; H Answer: B Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G4 Demonstrate the quantitative skills needed to succeed in chemistry. 13) The molar mass of a compound X(HCO3)2 is 146. The atomic weight of X when rounded to the nearest whole number is ________, which is ________. A) 24; Mg B) 40; Ca C) 51; V D) 56; Fe Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G4 Demonstrate the quantitative skills needed to succeed in chemistry. 14) The molecular mass of a compound X(NO3)3 is 213. The atomic mass of X is ________, which is ________. A) 27; Al B) 51; V C) 56; Fe D) 59; Co Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G4 Demonstrate the quantitative skills needed to succeed in chemistry.

15) The molar mass of a compound Ca(MO3)2 is 160. The atomic mass of M is ________, which is ________. A) 12; C B) 14; N C) 32; S D) 35; Cl Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G4 Demonstrate the quantitative skills needed to succeed in chemistry. 16) The molar mass of a compound Al2(XO4)3 is 342. The atomic mass of X is ________, which is ________. A) 31; P B) 32; S C) 52; Cr D) 55; Mn Answer: B Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G4 Demonstrate the quantitative skills needed to succeed in chemistry. 17) Alkanes have the general molecular formula C nH2n+2. Thus, when n = 1, the alkane is CH4, when n = 2, the alkane is C2H6 etc. If an alkane has a molar mass between 140 and 150, this alkane is ________. A) C9H20 B) C12H26 C) C10H22 D) C11H24 Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

18) Alkenes have the general molecular formula C nH2n. Thus, when n = 2, the alkene is C2H4. If an alkene has a molecular mass between 65 and 75, this alkene is ________. A) C5H12 B) C5H10 C) C6H3 D) C6H12 Answer: B Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 19) Alkynes have the general molecular formula CnH2n-2. Thus, when n = 2, the alkyne is C2H2 etc. If an alkyne has a molecular mass between 75 and 85, this alkyne is ________. A) C6H10 B) C6H12 C) C5H16 D) C7H12 Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 20) Which of the following quantities does not share the same molar mass as the others when rounded to the nearest whole number? A) Al2(SO4)3 B) C12H22O11 C) C24H38O D) Pb3(PO4)4 Answer: D Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

21) Which of the following contains the least number of atoms? A) 1.0 mole C6H14 B) 3.0 moles N2O5 C) 12.0 moles silver D) 3.0 moles water Answer: D Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 22) Which of the following contains the greatest number of atoms? A) 1.0 mole C6H14 B) 3.0 moles N2O5 C) 12.0 moles silver D) 3.0 moles water Answer: B Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 23) 12 g of carbon is equal to ________. A) the mass of one atom B) the mass of one molecule C) the mass of one mole D) the mass of half a mole Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 24) 16 g of oxygen gas is equal to ________. A) the mass of one atom B) the mass of one molecule C) the mass of one mole D) the mass of half a mole Answer: D Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

25) A sample of calcium that contains Avogadro's number of atoms has a mass of ________. A) 20 g B) 40 g C) 80 g D) 160 g Answer: B Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 26) A sample of calcium that contains one-half Avogadro's number of atoms has a mass of ________. A) 20 g B) 40 g C) 80 g D) 160 g Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 27) A sample of calcium that contains four times Avogadro's number of atoms has a mass of ________. A) 20 g B) 40 g C) 80 g D) 160 g Answer: D Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 28) A sample of calcium that contains twice Avogadro's number of atoms has a mass of ________. A) 20 g B) 40 g C) 80 g D) 160 g Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 8 Copyright © 2015 Pearson Education, Inc.

29) A sample of oxygen gas that contains Avogadro's number of molecules has a mass of ________. A) 8.0 g B) 16.0 g C) 32.0 g D) 64.0 g Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 30) A sample of oxygen gas that contains Avogadro's number of atoms has a mass of ________. A) 8.0 g B) 16.0 g C) 32.0 g D) 64.0 g Answer: B Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 31) A sample of oxygen gas that contains one-half of Avogadro's number of molecules has a mass of ________. A) 8.0 g B) 16.0 g C) 32.0 g D) 64.0 g Answer: B Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 32) A sample of oxygen gas that contains twice Avogadro's number of molecules has a mass of ________. A) 8.0 g B) 16.0 g C) 32.0 g D) 64.0 g Answer: D Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 9 Copyright © 2015 Pearson Education, Inc.

33) A sample of methane gas that contains Avogadro's number of molecules has a mass of ________. A) 8.0 g B) 16.0 g C) 32.0 g D) 64.0 g Answer: B Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 34) A sample of methane gas that contains Avogadro's number of atoms has a mass of ________. A) 3.2 g B) 6.4 g C) 16.0 g D) 80.0 g Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 35) Which of the following does not have the same number atoms as the other three choices? A) three moles Na2SO3 B) six moles of water C) nine moles NaCl D) five moles CH4 Answer: D Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 36) What is the mass of 0.0500 moles aluminum sulfate? A) 6.15 g B) 10.95 g C) 17.1 g D) 19.8 g Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

37) What is the molar mass of a compound X if 0.0400 moles weigh 21.6 g? A) 540 B) 185 C) 216 D) 864 Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 38) 0.3 moles of a certain calcium compound weigh 93 g. This compound may be ________. A) calcium nitrate B) calcium chromate C) calcium phosphate D) calcium sulfate Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 39) 0.02 moles of a certain aluminum compound has a mass of 1.56 g. This compound may be ________. A) aluminum hydroxide B) aluminum nitrate C) aluminum cyanide D) aluminum permanganate Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 40) 0.05 moles of a certain compound has a mass of 17.1 g. This compound may be ________. A) aluminum sulfate B) lead (II) chloride C) cobalt (III) oxide D) magnesium carbonate Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

41) Which of the following will not have the same number atoms as the other three choices? A) K2Cr2O7 B) (NH4)2S C) Al(ClO2)3 D) Ba(HCO3)2 Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 42) Which of the following has 14 atoms per formula unit? A) (NH4)2SO3 B) Al(ClO4)3 C) Pb(CrO4)2 D) Mg3(PO4)2 Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 43) The number of atoms in 2.4 g of magnesium metal is ________. A) 6.0 × 1022 B) 3.7 × 1022 C) 2.5 × 1022 D) 1.7 × 1022 Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 44) A certain food contains 60 mg of table salt. This is approximately equal to ________ formula units. A) 6 × 1023 B) 6 × 1022 C) 6 × 1020 D) 6 × 1026 Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 12 Copyright © 2015 Pearson Education, Inc.

45) The number of oxygen atoms present in 32.4 g of N2O5 is ________. A) 5.00 B) 9.03 × 1023 C) 4.51 × 1023 D) 1.81 × 1023 Answer: B Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 46) Which is the correct statement about one mole of ammonia, NH 3? A) It contains 14 g nitrogen and 3 g hydrogen. B) It contains 6.02 × 1023 molecules. C) It contains 1.8 × 1024 atoms of hydrogen. D) all of the above Answer: D Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 47) The number of phosphorus atoms in one molecule of H 3PO4 is ________. A) 1 B) 8 C) 6.02 × 1023 D) 4.8 × 1023 Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 48) The total number of atoms in two moles SO3 is ________. A) 4 B) 8 C) 1.2 × 1024 D) 4.8 × 1024 Answer: D Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

49) The mass of one formula unit of Al2(SO4)3 is ________ g. A) 342 B) 0.0029 C) 5.7 × 10-22 D) 8.0 × 10-27 Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 50) Which of the following does not contain 3.0 × 1024 atoms? A) 60 g of carbon B) one mole of methane C) two moles of water D) 160 g sulfur Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 51) Which contains more carbon? A) 24 g methane B) 140 g sodium carbonate C) 40 g carbon monoxide D) 15 g octane, C8H18 Answer: A Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 52) One molecule of water contains ________. A) one mole of hydrogen B) one mole of oxygen C) one atom of oxygen D) 16 g of oxygen Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

53) The ingredients to make 50 servings of fruit punch are: ∙ 2-1/2 cups white sugar ∙ 6 cups water ∙ 2 (3-ounce) packages strawberry flavored gelatin mix ∙ 1 (46-fluid-ounce) can pineapple juice ∙ 2/3 cup lemon juice ∙ 1 quart orange juice ∙ 2 (2-liter) bottles lemon-lime flavored carbonated beverage How many servings of punch can you make using the above recipe, if you have 2 gallons of pineapple juice, 8 (2-liter) bottles of lemon-lime flavored soda and 2 gallons of orange juice? Assume you have plenty of all the other ingredients. A) 125 servings B) 200 servings C) 278 servings D) 375 servings E) 400 servings Answer: B Section: Section 9.2 Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry and G5 Demonstrate an understanding of the impact of science on society. 54) The mass of CaCl2 that contains 17.8 g of chlorine is ________. A) 35.6 g B) 53.4 g C) 27.9 g D) 20.5 g Answer: C Section: Section 9.2 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 55) The number of moles of chlorine atoms in 12.5 g of carbon tetrachloride is ________. A) 0.081 B) 0.162 C) 0.325 D) 0.648 Answer: C Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

56) The mass of oxygen present in 11.7 g of Al2(CO3)3 is ________. A) 7.20 g B) 14.4 g C) 8.10 g D) 4.05 g Answer: A Section: Section 9.2 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 57) Which has more ions—2.0 moles of Al2(SO4)3 or 3.0 moles of Na3PO4? A) 2.0 moles of Al2(SO4)3 B) 3.0 moles of Na3PO4 C) There are equal number of ions in both ionic compounds. D) It cannot be determined based on the information given. Answer: B Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 58) 0.011 moles of an element has a mass of 2.56 g. This element is ________. A) Pb B) V C) Ac D) Th Answer: D Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G4 Demonstrate the quantitative skills needed to succeed in chemistry. 59) What is the mass of hydrogen that will react with 0.203 g of Li to form LiH? A) 0.015 g B) 0.030 g C) 0.060 g D) 0.120 g Answer: B Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

60) What is the mass of sulfur that will react with 0.527 g of copper metal to yield copper (I) sulfide? A) 0.066 g B) 0.132 g C) 0.264 g D) 0.198 g Answer: B Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 61) 0.842 g chlorine will combine with ________ g of sulfur to produce SCl2. A) 0.481 B) 1.870 C) 0.305 D) 0.379 Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 62) Two moles of hydrogen react with excess nitrogen to produce ________ moles of ammonia.. N2 + 3 H2 → 2 NH3 A) 1.3 B) 2.0 C) 1.0 D) 6.0 Answer: A Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 63) If 4 moles of nitrogen produces 2 moles of nitrogen dioxide, then the percent yield is ________. N2 + 2 O2 → 2 NO2 A) 100% B) 50% C) 25% D) 12.5% Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 17 Copyright © 2015 Pearson Education, Inc.

64) If 14 kg of nitrogen yields 23 kg of nitrogen dioxide, then the percent yield for the reaction is ________. N2 + 2 O2 → 2 NO2 A) 100% B) 50% C) 25% D) 12% Answer: B Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 65) The maximum number of moles of water that can be produced from 0.5 moles of C 3H8O is ________. 2 C3H8O + 9 O2 → 6 CO2 + 8 H2O A) 0.5 B) 2 C) 4 D) 8 Answer: B Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 66) If 5.0 moles of ammonia is produced, then the number of hydrogen molecules consumed is ________. N2 + 3 H2 → 2 NH3 A) 5.0 B) 7.5 C) 3.2 D) 1.0 Answer: B Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

67) What is the percent yield for a given process, if 4.0 kg of a product is recovered from a reaction whose theoretical yield is 5.6 kg? A) 41% B) 62% C) 71% D) 89% Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 68) The balanced equation involves the corresponding coefficients ________. NaHCO3 → Na2CO3 + CO2 + H2O A) 1: 1: 1: 1 B) 1: 2: 1: 1 C) 2: 1: 1: 1 D) 2: 1: 2: 1 Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 69) The balanced equation involves the corresponding coefficients ________. H2SO4 + Cu → SO2 + H2O + CuSO4 A) 2: 1: 1: 2: 1 B) 1: 1: 2: 2: 1 C) 2: 1: 2: 1: 1 D) 2: 1: 1: 2: 2 Answer: A Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 70) The balanced equation involves the corresponding coefficients ________. NH3 + O2 → NO + H2O A) 2: 3: 2: 3 B) 2: 5: 2: 3 C) 4: 5: 4: 6 D) 2: 2: 3: 3 Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 19 Copyright © 2015 Pearson Education, Inc.

71) The balanced equation involves the corresponding coefficients ________. C2H6O + O2 → CO2 + H2O A) 1: 2: 2: 3 B) 1: 3: 2: 3 C) 2: 7: 4: 6 D) 2: 9: 4: 6 Answer: B Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 72) The balanced equation involves the corresponding coefficients ________. C6H14 + O2 → CO2 + H2O A) 1: 9: 6: 7 B) 1: 10: 6: 7 C) 2: 19: 12:14 D) 2: 21: 6: 7 Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 73) The balanced equation involves the corresponding coefficients ________. NaN3 → Na + N2 A) 2: 2: 3 B) 1: 2: 3 C) 2: 1: 3 D) 3: 3: 2 Answer: A Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

74) The maximum number of moles of carbon dioxide that can be produced from four moles of C3H8O is ________. 2 C3H8O + 9 O2 → 6 CO2 + 8 H2O A) 4 B) 6 C) 8 D) 12 Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 75) Which reactant is present in excess if 10.0 g of CaO react with 3.0 mol of H 2O? CaO + H2O → Ca(OH)2 A) Ca(OH)2 B) CaO C) H2O D) None of the above, the amounts exactly balance. Answer: C Section: Section 9.3 Learning Outcome: 9.3 Identify a limiting reactant if present and calculate the theoretical and percent yield when a limiting reactant is present. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 76) Which of the following abides by the principle of mass conservation according to the balanced reaction? 4 K + O2 → 2 K2O A) 39.0g K + 16.0g O2 → 94.0g K2O B) 156.0 g K + 24.0g O2 → 188.0g K2O C) 156.0g K + 32.0g O2 → 188.0g K2O D) 78.0g K + 32.0g O2 → 110.0g K2O Answer: C Section: Section 9.3 Learning Outcome: 9.3 Identify a limiting reactant if present and calculate the theoretical and percent yield when a limiting reactant is present. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

77) The theoretical number of carbon dioxide moles produced from 3 moles of C 2H6O is ________. C2H6O + O2 → CO2 + H2O A) 3 B) 4 C) 6 D) 9 Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 78) The theoretical number of carbon dioxide moles produced from 6 moles of NaHCO 3 is ________.' NaHCO3 → Na2CO3 + CO2 + H2O A) 1 B) 3 C) 6 D) 12 Answer: B Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 79) The theoretical number of moles of water produced from 8 moles of NaHCO 3 is ________. NaHCO3 → Na2CO3 + CO2 + H2O A) 2 B) 4 C) 8 D) 16 Answer: B Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

80) What is the theoretical mass of carbon dioxide produced from 4.0 moles of NaHCO 3? NaHCO3 → Na2CO3 + CO2 + H2O A) 1.0 g B) 22 g C) 44 g D) 88 g Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 81) What is the theoretical mass of water produced from 10 moles of NaHCO 3? NaHCO3 → Na2CO3 + CO2 + H2O A) 180 g B) 90 g C) 45 g D) 18 g Answer: B Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 82) Determine the percent yield of an experiment in which 1.00 mole of NaHCO 3 was consumed and 22.0 g of carbon dioxide was isolated. NaHCO3 → Na2CO3 + CO2 + H2O A) 100.% B) 50.0% C) 37.5% D) 25% Answer: A Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

83) The theoretical number of moles of water produced from 2 moles of C 2H6O is ________. C2H6O + O2 → CO2 + H2O A) 2 B) 3 C) 6 D) 9 Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 84) What is the theoretical mass of carbon dioxide produced from one mole of C 2H6O? C2H6O + O2 → CO2 + H2O A) 6 g B) 44 g C) 88 g D) 176 g Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 85) Determine the percent yield of an experiment in which 1 mole of C 2H6O was consumed and 22 g of carbon dioxide was isolated. C2H6O + O2 → CO2 + H2O A) 100% B) 50% C) 37.5% D) 25% Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

86) The theoretical number of moles of carbon dioxide produced from 3.0 moles of C 6H14 is ________. C6H14 + O2 → CO2 + H2O A) 3.0 B) 6.0 C) 9.0 D) 18 Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 87) The theoretical number of water moles produced from two moles of C 6H14 is ________. C6H14 + O2 → CO2 + H2O A) 1 B) 6 C) 7 D) 14 Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 88) What is the theoretical mass of carbon dioxide produced from one mole of C 6H14? C6H14 + O2 → CO2 + H2O A) 6 g B) 44 g C) 132 g D) 264 g Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

89) The % yield of an experiment in which 1.0 mole of C6H14 was used and 22 g of carbon dioxide was isolated is ________. C6H14 + O2 → CO2 + H2O A) 100% B) 50% C) 17.5% D) 8.3% Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 90) The theoretical number of moles of sodium produced from 4 moles of NaN 3 is ________. NaN3 → Na + N2 A) 1 B) 2 C) 4 D) 8 Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 91) The theoretical number of moles of nitrogen produced from 6 moles of NaN 3 is ________. NaN3 → Na + N2 A) 2 B) 6 C) 9 D) 18 Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

92) The theoretical mass of sodium produced from 2.0 moles of NaN 3 is ________. NaN3 → Na + N2 A) 11.5 g B) 23 g C) 34.5 g D) 46 g Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 93) The percent yield of an experiment in which 2.0 moles of NaN 3 was used and 21 g of nitrogen was isolated is ________. NaN3 → Na + N2 A) 100% B) 50% C) 37.5% D) 25% Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 94) The minimum number of moles of oxygen needed to completely consume 4 moles of C3H8O is ________. 2 C3H8O + 9 O2 → 6 CO2 + 8 H2O A) 4 B) 9 C) 13.5 D) 18 Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

95) The theoretical yield of water produced from of 2.0 moles of C 3H8O is ________ g. 2 C3H8O + 9 O2 → 6 CO2 + 8 H2O A) 8 B) 18 C) 36 D) 144 Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 96) If 36 g of water are produced from two moles of C3H8O, the percent yield of the reaction is ________. 2 C3H8O + 9 O2 → 6 CO2 + 8 H2O A) 100% B) 50% C) 25% D) 10% Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 97) The theoretical number of moles of copper that will react with 4 moles of sulfuric acid is ________. H2SO4 + Cu → SO2 + H2O + CuSO4 A) 2 B) 4 C) 6 D) 8 Answer: A Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

98) The theoretical number of moles of sulfur dioxide produced from 4 moles of sulfuric acid is ________. H2SO4 + Cu → SO2 + H2O + CuSO4 A) 2 B) 4 C) 6 D) 8 Answer: A Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 99) The theoretical number of moles of water produced from 4 moles of sulfuric acid is ________. H2SO4 + Cu → SO2 + H2O + CuSO4 A) 2 B) 4 C) 6 D) 8 Answer: B Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 100) The theoretical mass of sulfur dioxide produced from 2.0 moles of sulfuric acid is ________. H2SO4 + Cu → SO2 + H2O + CuSO4 A) 8.0 g B) 16.0 g C) 32.0 g D) 64.1 g Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

101) The percent yield of an experiment in which 2.0 moles of copper was used and 18 g of water was isolated is ________. H2SO4 + Cu → SO2 + H2O + CuSO4 A) 100% B) 50% C) 37.5% D) 25% Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 102) How many grams of oxygen will react with 20 g of ammonia? NH3 + O2 → NO + H2O A) 71 g B) 94 g C) 24 g D) 47 g Answer: D Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 103) How many grams of NO will form when 40 g of oxygen are used? NH3 + O2 → NO + H2O A) 30 g B) 15 g C) 45 g D) 60 g Answer: A Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

104) How many grams of ammonia are consumed if 45.0 g of NO are formed in a 100% yield? NH3 + O2 → NO + H2O A) 6.51 g B) 13.0 g C) 26.0 g D) 39.0 g Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 105) What is the percent yield if 52 g of ammonia produce 45 g of NO? NH3 + O2 → NO + H2O A) 100% B) 49% C) 25% D) 18% Answer: B Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 106) What is the mass of NO expected if 104 g of ammonia are consumed in a 100% yield? NH3 + O2 → NO + H2O A) 45.7 g B) 91.5 g C) 183 g D) 366 g Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 107) 14 g of nitrogen will react with ________ g of oxygen. N2 + 2 O2 → 2 NO2 A) 8 B) 16 C) 32 D) 64 Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 31 Copyright © 2015 Pearson Education, Inc.

108) 14 g of nitrogen will yield ________ g of nitrogen dioxide. N2 + 2 O2 → 2 NO2 A) 23 B) 46 C) 92 D) 194 Answer: B Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 109) 64 g of oxygen will yield ________ g of nitrogen dioxide. N2 + 2 O2 → 2 NO2 A) 23 B) 46 C) 92 D) 184 Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 110) The maximum amount of IF7 that can be obtained from 25.0 g is fluorine is ________. I2 + F2 → IF7 A) 63 g B) 48.9 g C) 24.5 g D) 12.3 g Answer: B Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

111) How many moles of aluminum chloride can be obtained from 4.5 moles of aluminum and excess chlorine? Al + Cl2 → AlCl3 A) 1.5 B) 3.0 C) 4.5 D) 6.0 Answer: C Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 112) Which reactant is the limiting reagent if 6 mol of H2 and 4 mol of O2 are used? 2H2 + O2 → 2H2O A) O2 B) H2 C) neither H2 nor O2 D) both H2 and O2 Answer: B Section: Section 9.4 Learning Outcome: 9.3 Identify a limiting reactant if present and calculate the theoretical and percent yield when a limiting reactant is present. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 113) Which reagent will be used up first if 78.1 g of O2 is reacted with 62.4 g of C4H10? 2 C4H10 + 13 O2 → 8 CO2 + 10 H2O A) C4H10, butane B) oxygen C) water D) carbon dioxide Answer: B Section: Section 9.4 Learning Outcome: 9.3 Identify a limiting reactant if present and calculate the theoretical and percent yield when a limiting reactant is present. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

114) How many grams of CO2 can be made from reacting 78.1 g of O2 and 62.4 g of C4H10? 2 C4H10 + 13 O2 → 8 CO2 + 10 H2O A) 66.1 g CO2 B) 141 g CO2 C) 189 g CO2 D) 378 g CO2 E) 430 g CO2 Answer: A Section: Section 9.4 Learning Outcome: 9.3 Identify a limiting reactant if present and calculate the theoretical and percent yield when a limiting reactant is present. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 115) The reaction was performed in the lab and 50.1 g of CO 2 was collected from the reaction of 78.1 g of O2 with 62.4 g of C4H10. The percent yield of this reaction is ________. 2 C4H10 + 13 O2 → 8 CO2 + 10 H2O A) 11.7 % B) 13.3 % C) 26.5 % D) 35.7 % E) 75.8 % Answer: E Section: Section 9.4 Learning Outcome: 9.3 Identify a limiting reactant if present and calculate the theoretical and percent yield when a limiting reactant is present. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 116) The reaction was performed in the lab and 50.1 g of CO 2 was collected from the reaction of 78.1 g of O2 with 62.4 g of C4H10. How many grams of the excess reactant are left over. 2 C4H10 + 13 O2 → 8 CO2 + 10 H2O A) 15.7 g B) 21.8 g C) 28.0 g D) 40.6 g E) 45.8 g Answer: D Section: Section 9.4 Learning Outcome: 9.3 Identify a limiting reactant if present and calculate the theoretical and percent yield when a limiting reactant is present. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

117) Which statement is true about the empirical formula? A) The empirical formula is always different than the molecular formula. B) The empirical formula is always the same as the molecular formula. C) The empirical formula may be different than the molecular formula. D) The empirical formula cannot be determined solely by the % composition. Answer: C Section: Section 9.5 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 118) Which statement is true about the molecular formula? A) The molecular formula is always different than the empirical formula. B) The molecular formula is always the same as the empirical formula. C) The empirical formula may be different than the molecular formula. D) The empirical formula can be determined solely by the % composition. Answer: C Section: Section 9.5 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 119) Which statement is true when comparing acetic acid C2H4O2 and formaldehyde CH2O? A) Their empirical formulas are identical. B) Their molecular formulas are identical. C) Their molecular formulas are different. D) both A and C Answer: D Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 120) If the empirical formula of a compound is CH 2O and the molecular weight is 180, the molecular formula is ________. A) CH2O B) C2H4O2 C) C3H6O3 D) C6H12O6 Answer: D Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

121) Which of the following has its empirical formula different than its molecular formula? A) CH2S B) C2H7N3 C) C3H6N3 D) C5H7O3 Answer: C Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 122) Which of the following pairs does not share the same empirical formula? A) CH2O and C3H6O3 B) C6H6 and C2H2 C) C2H6O and CH3O D) C3H4Br2 and C9H12O6 Answer: D Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 123) Which of the following does not share the same empirical formula as the other three? A) CH2O B) C6H12O6 C) C8H16O8 D) C12H22O11 Answer: D Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 124) What is the empirical formula of C8H6O3? A) CHO B) C4H3O C) C4H3O2 D) C8H6O3 Answer: D Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

125) A certain compound has the following composition: C= 40.0% and H= 6.7%. The empirical formula is ________. A) CH B) CH2O C) C6H6O D) CHO Answer: B Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 126) An independent experiment showed that the molecular weight of isopropyl alcohol is approximately 62. The molecular formula therefore is ________. A) C2H6O2 B) C3H8O2 C) C3H8O D) C3H10O2 Answer: C Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 127) 5.82 g isopropyl alcohol yield 7.001 g of water and 12.6 g of carbon dioxide upon combustion. The empirical formula is ________. A) CH2O B) C3H8O C) C2H6O D) C3H9O Answer: B Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

128) Combustion of 6.51 mg of a compound produces 20.46 mg of carbon dioxide and 8.36 mg of water. The empirical formula is ________. A) CH2O B) C2H3 C) C2H3O D) CH2 Answer: D Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 129) Combustion of 5.00 mg of a compound produces 15.2 mg of carbon dioxide and 7.80 mg of water. The empirical formula is ________. A) CH2 B) C2H5 C) C3H7 D) C4H10 Answer: B Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 130) Combustion of 5.00 mg of a compound produces 9.60 mg of carbon dioxide and 5.90 mg of water. The empirical formula is ________. A) CH2O B) C2H5 C) C2H6O D) C4H10O Answer: C Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

131) What is the molecular formula of a compound that weighs 46 g/mol and analyzes to 52.2% C, 34.8% O, and 13% H? A) C3H2O2 B) C2H6O C) CH3O D) C2H5O2 Answer: B Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 132) A compound is found to be 43.7% phosphorus and 56.3% oxygen. Given the molecular mass as 285 ± 10, calculate the empirical and molecular formulas. A) PO2; P4O8 B) P2O5; P4O10 C) P2O3; P6O9 D) P4O10; P4O10 Answer: B Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 133) A sample is composed of 2.78 g of iron and 1.19 g of oxygen. The empirical formula is ________. A) FeO2 B) Fe2O5 C) Fe2O3 D) FeO Answer: C Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

134) Which compound has the percent composition of 15.8% Al, 28.1% S and 56.1% O? A) Al2(SO4)3 B) Al2(SO3)3 C) Al2S3 D) Al2(S2O3)3 Answer: A Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 135) A chromium-silicon compound contains 73.52% chromium. The empirical formula is ________. A) CrSi B) CrSi2 C) Cr2Si D) Cr3Si2 Answer: D Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 136) An iron oxide is 72.4% in iron. Its empirical formula is ________. A) FeO B) Fe2O C) Fe2O3 D) Fe3O4 Answer: D Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 137) An iron oxide is 77.7% in iron. Its empirical formula is ________. A) FeO B) Fe2O C) Fe2O3 D) Fe3O4 Answer: A Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 40 Copyright © 2015 Pearson Education, Inc.

138) An iron oxide is 70.0% in iron. Its empirical formula is ________. A) FeO B) Fe2O C) Fe2O3 D) Fe3O4 Answer: C Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 139) Which of the following compounds is expected to have oxygen? A) compound W: %C= 40.2% ; H= 6.8%; N= 10.3%; S= 19.2% B) compound X: %C= 52.3% ; H= 4.1%; Br= 30.4%; S= 13.2% C) compound Y: %C= 25.6% ; H= 8.8%; I= 45.3%; N= 20.2% D) compound Z: %C= 48.1% ; H= 8.6%; F= 28.2%; P= 15.0% Answer: A Section: Section 9.5 Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 140) A certain compound is found to contain 1.45 g of Na, 2.05 g of S and 1.5 g of O. Its empirical formula is ________. A) Na2SO B) NaS2O C) Na2S2O3 D) NaSO2 Answer: C Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 141) 0.540 g of bromine combine with 0.858 g of iodine to yield a compound X. The empirical formula of the compound described above is ________. A) Br2I B) BrI2 C) Br2I3 D) BrI Answer: D Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

142) A compound has the following elemental composition: C = 58.8%, H= 13.8%, N = 27.4%. The empirical formula of this compound is ________. A) C5H14N B) C5H10N2 C) C5H14N2 D) C5H15N2 Answer: C Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 143) The empirical formula for a compound that is 48.7% C, 13.6% H and 37.8% N is ________. A) C4H9N2 B) C3H8N C) C3H10N2 D) C4H10N Answer: C Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 144) If the empirical formula is CH2, and the molecular weight is equal to 180 ±10, then the molecular formula is ________. A) C6H12O6 B) C14H21 C) C8H12O4 D) C13H26 Answer: D Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

145) Hydrazine contains 87.5% nitrogen and 12.5% hydrogen. If the molecular mass is 32 ± 6, the molecular formula is ________. A) N2H B) N2H2 C) N2H3 D) N2H4 Answer: D Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 146) A 4.000 g sample of a certain cobalt oxide contains 2.937 g of cobalt. The empirical formula is ________. A) CoO B) CoO2 C) Co2O D) Co3O4 Answer: D Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 147) A selenium-chlorine compound is 35.7% in selenium. Its empirical formula is ________. A) SeCl B) SeCl2 C) SeCl3 D) SeCl4 Answer: D Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

148) 0.68 g of sulfur combine with 1.51 g of chlorine. The empirical formula of this compound is ________. A) SCl B) SCl2 C) SCl4 D) SCl6 Answer: B Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 149) The element in C7H5NO3 whose % composition is 31.8% is ________. A) carbon B) hydrogen C) nitrogen D) oxygen Answer: D Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 150) What is the percentage by mass of iron (Fe) in the mineral hematite (Fe 2O3)? A) 40% B) 60% C) 70% D) 30% Answer: C Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 151) What is the percentage by mass of hydrogen in ordinary water (H 2O)? A) 20% B) 11% C) 60% D) 40% Answer: B Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

152) Methanol (CH4O) weighs 32 g/mol. What is the mass percentage of carbon in methanol? A) 63% B) 50% C) 20% D) 38% Answer: D Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 153) Ilmenite (FeTiO3) is the primary ore from which the element titanium (Ti) is isolated. What is the percentage of titanium by mass in this mineral? A) 20% B) 32% C) 80% D) 68% Answer: B Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 154) Which contains the highest percentage of oxygen? A) H2O2 B) Na2O2 C) HgO D) CO2 Answer: A Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 155) Which contains the least percentage of oxygen? A) H2O2 B) Na2O2 C) HgO D) CO2 Answer: C Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

156) Which contains the highest percentage of hydrogen? A) HCl B) H2SO4 C) H3PO4 D) H2O Answer: D Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 157) Which contains the lowest percentage of hydrogen? A) HCl B) H2SO4 C) H3PO4 D) H2O Answer: B Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 158) Which of the following compounds has its carbon composition equal to 52.1%? A) C2H6O B) CH3Cl C) C4H8O2N2S D) C10H20O4N2S Answer: A Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 159) Which of the following compounds has its hydrogen composition equal to 2.4%? A) C4H7Cl B) CH2Cl2 C) C2H3NO2 D) C10H20ONS Answer: B Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

160) Which of the following compounds has its oxygen composition equal to 50.0%? A) (NH4)2CO3 B) CH2O2 C) C2H3NO2 D) C10H20ONS Answer: A Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 161) Which of the following compounds has its nitrogen composition equal to 29.2%? A) C2H3NO2 B) C10H20ONS C) (NH4)2CO3 D) N2H4 Answer: C Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 162) Which of the following compounds has its chlorine composition equal to 83.5%? A) C2H3ClO2 B) C10H17ClS C) CCl4 D) CH2Cl2 Answer: D Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 163) Which of the following compounds has its sulfur composition equal to 18.6%? A) C6H8SO2N2 B) C7H14S C) CH2SO2 D) COS Answer: A Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

164) Which of the following compounds has its combined carbon and hydrogen composition equal to 37.0%? A) C4H7Cl B) CH2O2 C) C2H3NO2 D) C10H20ONS Answer: C Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 165) Which of the following compounds has its combined carbon and oxygen composition equal to 76.7%? A) C4H7Cl B) CH2O2 C) C2H3NO2 D) C10H20ONS Answer: C Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 166) Which of the following has the highest percent of oxygen? A) N2O B) Al2O3 C) K2CO3 D) KMnO4 Answer: B Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 167) Which of the following has the lowest percent of oxygen? A) N2O B) Al2O3 C) K2CO3 D) KMnO4 Answer: C Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

168) Which of the following percent compositions does not correspond to one of the elements of NaNO3? A) 56.4% B) 19.4% C) 16.5 % D) 27.1% Answer: B Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 169) Which of the following percentage compositions does not correspond to one of the elements of C6H12O6? A) 43.4% B) 40.0% C) 6.7% D) 53.3% Answer: A Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 170) Which of the following percentage compositions does not correspond to one of the elements of C9H8O4? A) 4% B) 26% C) 36% D) 60% Answer: B Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 171) 0.540 g of bromine combine with 0.858 g of iodine to yield a compound X. Its percent composition is ________. A) Br = 38.6%, I = 61.4% B) Br = 61.3%, I = 38.6% C) Br = 32.8%, I = 67.2% D) Br = 67.2%, I = 32.8% Answer: A Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

172) What is the mass percent of Sn in tin (IV) oxide? A) 26.96% B) 64.97% C) 78.77% D) 93.69% E) 96.73% Answer: C Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 9.2 True/False Questions 1) One mole of oxygen gas has fewer atoms than one mole of ozone gas. Answer: TRUE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) One molecule of oxygen gas has fewer atoms than one mole of ozone gas. Answer: TRUE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) One mole of methane has the same mass as one mole of oxygen gas. Answer: FALSE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) One mole of methane has approximately the same mass as half a mole of oxygen gas. Answer: TRUE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) One mole of carbon monoxide has the same mass as one mole of nitrogen gas. Answer: TRUE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 50 Copyright © 2015 Pearson Education, Inc.

6) The number of molecules of a certain mass of any compound is always higher than the number of moles of the same compound. Answer: TRUE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) The number of atoms of a certain mass of any compound may be lower than the number of molecules of the same compound. Answer: FALSE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) The number of atoms in one formula unit of (NH 4)2Cr2O7 is 17. Answer: FALSE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 9) K4Fe(CN)6 and Al2(SO4)3 have the same number of atoms per formula unit. Answer: TRUE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) K4Fe(CNO)6 has more atoms per formula unit than Al(C3H5O2)3. Answer: FALSE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) (NH4)4Fe(CNO)6 has 36 atoms per formula unit. Answer: FALSE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

12) 26 g of aluminum have the same number of atoms as 26 g of iron. Answer: FALSE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 13) 18 g of water have the same number of atoms as 48 g of ozone. Answer: TRUE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 14) One mole of hydrogen gas has 6.02 x 1023 atoms Answer: FALSE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 15) One mole of ozone, O3, has 1.8 x 1024 atoms. Answer: TRUE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 16) There are more atoms in one formula unit of Na3PO4 than in one molecule of HCl. Answer: TRUE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 17) There are more atoms in 20 g Na3PO4 than in 20 g HCl. Answer: FALSE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

18) 21.2 g KBr is equal to 0.178 moles of KBr. Answer: TRUE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 19) The mass of two moles of potassium dichromate is 294.2 g. Answer: FALSE Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 20) When 10 moles of hydrogen and 10 moles of oxygen are mixed to produce water, the limiting reagent is hydrogen. Answer: TRUE Section: Section 9.4 Learning Outcome: 9.3 Identify a limiting reactant if present and calculate the theoretical and percent yield when a limiting reactant is present. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 21) The molecular formula is the simplest formula using whole numbers. Answer: FALSE Section: Section 9.5 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 22) The empirical formula is never equal to the molecular formula. Answer: FALSE Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) Acetic acid, C2H4O2, and glucose, C6H12O6, have the same empirical formula. Answer: TRUE Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

24) Formaldehyde, CH2O, and glucose, C6H12O6, have the same empirical formula, which happens to be equal to the molecular formula of formaldehyde. Answer: TRUE Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) The percent composition of chlorine in C6H8NCl is 23.4%. Answer: FALSE Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 26) The empirical formula of laughing gas that contains 63.6% N and 36.4% O is N 2O. Answer: TRUE Section: Section 9.6 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 27) The percent composition of carbon is equal to the percent composition of oxygen in carbon monoxide, CO. Answer: FALSE Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 28) The percent composition of sulfur is approximately equal to the percent composition of oxygen in sulfur dioxide, SO2. Answer: TRUE Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 29) The percent of nitrogen in ferric nitrate is 17.4%. Answer: TRUE Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 30) A lead-sulfur compound contains 86.6% Pb. Its empirical formula is PbS 2. Answer: FALSE Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 54 Copyright © 2015 Pearson Education, Inc.

31) The molecular formula for a compound with an empirical formula of CH 2O and a molar mass of 120, is C3H6O3. Answer: FALSE Section: Section 9.6 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 32) The percent of aluminum in bauxite (also known as aluminum oxide) is 52.9%. Answer: TRUE Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 9.3 Short Answer Questions 1) Determine the number of grams of copper present in a 4.0 kg sample of the mineral chalcopyrite (CuFeS2). Answer: 1400 grams Section: Section 9.2 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 2) Determine the amount of carbon (in grams) present in 0.525 grams of benzoic acid (C 7H6O2). Answer: 0.361 grams of carbon Section: Section 9.2 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 3) Determine the amount of oxygen present (in grams) in 1.00 grams of the artificial sweetener aspartame (C14H18N2O5). Answer: 0.272 grams oxygen Section: Section 9.2 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 4) What is the theoretical yield in grams of K3[Fe(C2O4)3], if 5.700 grams of FeCl3 is used, and K2C2O4 is present in excess? FeC13 + 3K2C2O4 → K3[Fe(C2O4)3] + 3KCl Answer: 15.36 grams Section: Section 9.3 Learning Outcome: 9.2 Balance chemical reactions and calculate the theoretical yield and percent yield for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

5) What is the theoretical yield in grams of BaSO4, if 0.6200 mol Na2SO4 and 0.7000 mol BaCl2 are mixed? Na2SO4+ BaC12 → BaSO4 + 2NaCl Answer: 0.6200 mol; 144.7 grams Section: Section 9.4 Learning Outcome: 9.3 Identify a limiting reactant if present and calculate the theoretical and percent yield when a limiting reactant is present. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) Determine the molecular formula for a compound that weighs 44.1 g/mol and is 81.7% C and 18.3% H by mass. Answer: C3H8. From an original analysis of 2.66 mol H per 1 mol C. Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) Determine the molecular formula for a compound that weighs 176.13 g/mol and is 40.9% C, 54.5% O, and 4.6% H by mass. Answer: C6H8O6 Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 8) Determine the molecular formula for a compound that has a molar mass of 157.01 g/mol and is 45.9% C, 50.9% Br, and 3.21% H by mass. Answer: C6H5Br Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 9) Determine the molecular formula for a compound that has a molar mass of 135 g/mol and is 44.4% C, 51.9% N, and 3.7% H by mass. Answer: C5H5N5 Section: Section 9.5 Learning Outcome: 9.4 Calculate a compound's empirical and actual formula from % by mass elemental compositions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

9.4 Matching Questions Match each compound in the left column with the corresponding number of atoms per formula unit in the right column. A) 19 B) 23 C) 22 D) 13 E) 17 1) (NH4)3PO3 Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 2) Al2(SO4)3 Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 3) Ca3(PO4)2 Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 4) K4Fe(CNO)6 Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) Al (C2H3O2)3 Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 1) A 2) E 3) D 4) B 5) C

Match each compound in the left column with its corresponding molecular mass in the right column. A) 342 B) 310 C) 88 D) 122.5 6) Ca3(PO4)2 Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) C4H8O2 Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 8) Al2(SO4)3 Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 9) KClO3 Section: Section 9.2 Learning Outcome: 9.1 Describe what a mole is and how it relates to formulas of substances, molar mass, and chemical equations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 6) B 7) C 8) A 9) D

Match each compound in the left column with the corresponding percent of nitrogen that appears in the right column. A) 29.2% B) 63.6% C) 7.7% D) 30.4% 10) N2O Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) NO2 Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 12) (NH4)2CO3 Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 13) C18H26N2O4S Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 14) Ca(CN)2 Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 10) B 11) D 12) A 13) C 14) D

Match each compound in the left column with the corresponding percent of sulfur that appears in the right column. A) 8.7% B) 22.6% C) 41.1% D) 40.6% 15) Na2S Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 16) Na2SO4 Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 17) Na2S2O3 Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 18) C18H26N2O4S Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 15) C 16) B 17) D 18) A

Match each compound in the left column with the corresponding percent of carbon that appears in the right column. A) 48.6% B) 55.6% C) 69.0% D) 33.6% E) 41.8% 19) C6H8ClN Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 20) C3H10N2 Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 21) C4H8Cl2O Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 22) C6H8N2O2S Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 23) C10H6O3 Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 19) B 20) A 21) D 22) E 23) C

Match each compound in the left column with the corresponding percent of oxygen that appears in the right column. A) 50.0% B) 26.1% C) 43.8% D) 18.6% E) 27.6% 24) C2H3NO2 Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 25) (NH4)2CO3 Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 26) C10H6O3 Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 27) C6H8N2O2S Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 28) C10H16O3 Section: Section 9.6 Learning Outcome: 9.5 Calculate % by mass elemental compositions from a molecular formula. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 24) C 25) A 26) E 27) D 28) B

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 10 Electron Transfer in Chemical Reactions 10.1 Multiple-Choice Questions 1) What is electricity? A) flow of atoms B) flow of protons C) flow of neutrons D) flow of electrons Answer: D Section: Section 10.1 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) Which of the following does not have the same number of electrons when compared with the rest? A) Mg2+ B) O2C) F D) Ne Answer: C Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Which of the following has 8 electrons in the outer shell? A) Ca2+ B) Cl+ C) S2+ D) Fe3+ Answer: A Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) In which case is chlorine in its highest oxidation state? A) sodium hypochlorite B) sodium chloride C) sodium perchlorate D) sodium chlorate Answer: C Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

5) What is the oxidation state of manganese in the compound KMnO4? A) +4 B) +2 C) +7 D) -4 Answer: C Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) What is the oxidation state of chromium in the compound K2Cr2O7? A) +4 B) +6 C) +7 D) -1 Answer: B Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) Which atom in the compound K2C2O4 has a positive oxidation state? A) potassium B) carbon C) both potassium and carbon D) both potassium and oxygen Answer: C Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) Which atom in the compound KClO3 has a negative oxidation state? A) potassium B) oxygen C) both potassium and chlorine D) both chlorine and oxygen Answer: B Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

9) What is the oxidation state of the nitrogen atom in the compound NCl3? A) 0 B) +3 C) +5 D) -3 Answer: B Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) What is the oxidation state of the carbon atom in the compound CO2? A) +2 B) +3 C) +4 D) -2 Answer: C Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) Which atom(s) has a more positive oxidation state on the product side than the reactant side? Fe2O3 + 3CO → 2Fe + 3CO2 A) iron B) oxygen C) carbon D) carbon and iron Answer: C Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 12) Which atom(s) has a more negative oxidation state on the product side than the reactant side? Fe2O3 + 3CO → 2Fe + 3CO2 A) iron B) oxygen C) carbon D) carbon and oxygen Answer: A Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

13) In a chemical bond, which atom gets ownership the shared electrons? A) the larger element B) the smaller element C) the more electronegative element D) the most electropositive element Answer: C Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) In the water molecule, which atom holds the shared electrons between hydrogen and oxygen? A) oxygen B) hydrogen C) both are shared equally D) One cannot say unless the state of water is known. Answer: A Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) Which of the following elements may have more than one oxidation number? A) hydrogen B) sodium C) calcium D) lithium Answer: A Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Which of the following elements may have an oxidation number of +1 or -1? A) hydrogen B) sodium C) potassium D) lithium Answer: A Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

17) Which of the following elements may have an oxidation number other than +2? A) magnesium B) calcium C) barium D) iron Answer: D Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Which of the following elements may not have an oxidation number of -1? A) chlorine B) hydrogen C) sodium D) fluorine Answer: C Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) Which of the following elements may have +4 charge? A) magnesium B) aluminum C) carbon D) chlorine Answer: C Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) Which of the following elements may have a +3 charge when it becomes an ion? A) magnesium B) aluminum C) carbon D) chlorine Answer: B Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

21) In which of the following is oxygen not at the -2 oxidation state? A) water B) methanol C) hydrogen peroxide D) carbon dioxide Answer: C Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) The only element that is more electronegative than oxygen is ________. A) chlorine B) fluorine C) nitrogen D) sulfur Answer: B Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) The overall charge of sodium dichromate is ________. A) 0 B) +1 C) +2 D) -2 Answer: A Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) What is the sum of the oxidation states in the following species H2SbO3-? A) 0 B) -1 C) +2 D) -2 Answer: B Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

25) The oxidation state of nitrogen in the ammonium ion is ________. A) +3 B) +1 C) -3 D) -1 Answer: C Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 26) The oxidation state of sulfur in the sulfate ion is ________. A) +6 B) +7 C) -2 D) +4 Answer: A Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 27) The oxidation state of chlorine in the perchlorate ion is ________. A) +8 B) +7 C) -1 D) +6 Answer: B Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 28) Identify the compound that contains bromine with a +3 oxidation state. A) NaBrO2 B) NaBrO3 C) NaBrO D) NaBrO4 Answer: A Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

29) Halogens most often have an oxidation state of ________. A) +1 B) -1 C) +7 D) -3 Answer: B Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) The oxidation state of chlorine in sodium perchlorate is ________. A) -1 B) +1 C) +3 D) +7 Answer: D Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 31) Which of the following is true for the following reaction? Mg + O2 → 2 MgO A) Magnesium is oxidized. B) The oxidation state of magnesium in MgO is +2. C) Oxygen is reduced. D) All of the above are true. Answer: D Section: Section 10.2 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) Which of the following is true for the following reaction? Cu + ZnCl2 → CuCl2 + Zn A) Cu is oxidized. B) Cu is a reducing agent. C) Zn+2 is reduced. D) All of the above statements are correct. Answer: D Section: Section 10.2 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

33) Which of the following is true for the following reaction? Zn + CuCl2 → ZnCl2 + Cu A) The solution will turn blue. B) The solution will turn from blue to light blue. C) The gray zinc powder will disappear. D) Both B and C are correct. Answer: D Section: Section 10.2 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) The oxidation state of phosphorus in P4 is ________. A) +4 B) +3 C) -3 D) 0 Answer: D Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 35) The oxidation state of oxygen gas is ________. A) -4 B) +2 C) -2 D) 0 Answer: D Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 36) What is reduction? A) loss of electrons B) increase in oxidation number C) gain of electrons D) two of the above Answer: C Section: Section 10.3 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

37) What is oxidation? A) loss of electrons B) increase in oxidation number C) gain of electrons D) two of the above Answer: D Section: Section 10.3 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 38) The oxidizing agent is ________. A) reduced in a redox equation B) oxidized in a redox equation C) reduced in an oxidation reaction D) oxidized in a reduction reaction Answer: A Section: Section 10.3 Learning Outcome: 10.3 Identify the oxidizing agent and reducing agent in an electron transfer reaction. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 39) The reducing agent is ________. A) reduced in a redox equation B) oxidized in a redox equation C) reduced in an oxidation reaction D) oxidized in a reduction reaction Answer: B Section: Section 10.3 Learning Outcome: 10.3 Identify the oxidizing agent and reducing agent in an electron transfer reaction. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 40) Identify the reducing agent in the following chemical process (a lead storage battery). Pb + PbO2 + 2H+ + 2HSO4- → 2PbSO4 + 2H2O A) PbO2 B) Pb C) H+ D) 2HSO4Answer: B Section: Section 10.3 Learning Outcome: 10.3 Identify the oxidizing agent and reducing agent in an electron transfer reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

41) Identify the reduced species in the following chemical process (a lead storage battery). Pb + PbO2 + 2H+ + 2HSO4- → 2PbSO4 + 2H2O. A) PbO2 B) Pb C) H+ D) 2HSO4Answer: A Section: Section 10.3 Learning Outcome: 10.3 Identify the oxidizing agent and reducing agent in an electron transfer reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) Identify the oxidizing agent in the following chemical process. Fe + Cu(NO3)2 → Fe(NO3)2 + Cu A) Fe B) Cu+2 C) NO3D) Cu Answer: B Section: Section 10.3 Learning Outcome: 10.3 Identify the oxidizing agent and reducing agent in an electron transfer reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) Identify the oxidized species in the following chemical process. Fe + Cu(NO3)2 → Fe(NO3)2 + Cu A) Fe B) Cu+2 C) NO3D) Cu Answer: A Section: Section 10.3 Learning Outcome: 10.3 Identify the oxidizing agent and reducing agent in an electron transfer reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

44) Identify the reducing agent in the following chemical process. Cu + 2AgCl → CuC12 + 2Ag A) Ag B) Ag+ C) ClD) Cu Answer: D Section: Section 10.3 Learning Outcome: 10.3 Identify the oxidizing agent and reducing agent in an electron transfer reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 45) Identify the reduced species in the following chemical process. Cu + 2AgCl → CuC12 + 2Ag A) Ag B) Ag+ C) ClD) Cu Answer: B Section: Section 10.3 Learning Outcome: 10.3 Identify the oxidizing agent and reducing agent in an electron transfer reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 46) Identify the equation that has the greatest number of electrons transferred. A) NaClO → NaClO2 B) 2 Mg + O2 → 2 MgO C) CuCl → CuCl2 D) NaClO2 → NaClO4 Answer: D Section: Section 10.3 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 47) Identify the equation that has the least number of electrons transferred A) NaClO → NaClO2 B) 2 Mg + O2 → 2 MgO C) CuCl → CuCl2 D) NaClO2 → NaClO4 Answer: C Section: Section 10.3 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12 Copyright © 2015 Pearson Education, Inc.

48) Identify the element that was oxidized. H2O + CO2 → H2CO3 A) carbon B) oxygen C) hydrogen D) None of the elements were oxidized. Answer: D Section: Section 10.3 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 49) Identify the element that was reduced. H2SO4 + Al(OH)3 → Al2(SO4)3 + H2O A) aluminum B) sulfur C) oxygen D) No elements were either oxidized or reduced. Answer: D Section: Section 10.3 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 50) Identify the element that was oxidized. 3 P + 5 HNO3 + 2 H2O → 5 NO + 3 H3PO4 A) phosphorus B) nitrogen C) oxygen D) No elements were either oxidized or reduced. Answer: A Section: Section 10.3 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

51) Identify the oxidizing agent. I2 + 6 H2O + 5 Cl2 → 2HIO3 + 10 HCl A) I2 B) H2O C) Cl2 D) the oxygen in water Answer: C Section: Section 10.3 Learning Outcome: 10.3 Identify the oxidizing agent and reducing agent in an electron transfer reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 52) Identify the oxidation-reduction equation. A) NaOH + HCl → NaCl + H2O B) AgNO3 + NaCl → AgCl + NaNO3 C) CH4 + 2 O2 → CO2 + 2 H2O D) CaO + CO2 → CaCO3 Answer: C Section: Section 10.3 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 53) A fuel cell is essentially a battery which uses the following reaction to produce electricity. What is happening at the cathode of such a fuel cell? 2H2 + O2 → 2H2O A) Hydrogen is being oxidized. B) Oxygen is being oxidized. C) Nothing at all is happening there. D) Oxygen is being reduced. Answer: D Section: Section 10.4 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

54) What chemical process is happening at the anode of a fuel cell, which uses the following reaction to generate electricity? 2H2 + O2 → 2H2O A) Hydrogen is being oxidized. B) Oxygen is being oxidized. C) Nothing at all is happening there. D) Oxygen is being reduced. Answer: A Section: Section 10.4 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 55) The reactants in a dry cell are ________. A) Cu+2 and Zn B) Zn+2 and Cu C) Zn and MnO2 D) Zn+2 and Al Answer: C Section: Section 10.4 Learning Outcome: 10.4 Construct (diagram) a battery and label its parts and direction of electron flow given a balanced redox reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 56) The following reaction is an example of a ________ battery. Zn + Cu+2 → Zn+2 + Cu A) zinc-copper B) copper-zinc C) copper-silver D) copper-zinc--hydrogen Answer: A Section: Section 10.4 Learning Outcome: 10.4 Construct (diagram) a battery and label its parts and direction of electron flow given a balanced redox reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

57) Consult the EMF activity series and predict which of the following changes will occur if an iron nail is placed in an aqueous solution containing the (Sn2+) ion. A) Nothing at all will happen (no reaction). B) Tin will be further oxidized. C) Iron will be reduced. D) Iron will be oxidized. Answer: D Section: Section 10.5 Learning Outcome: 10.5 Use the EMF series to construct (diagram) a battery and label its parts and direction of electron flow. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 58) Consult the EMF activity series and predict which of the following changes will occur if an 24K gold ring (pure gold) is placed in an aqueous solution containing hydrochloric acid. A) Nothing at all will happen (no reaction). B) Hydrogen will be further oxidized. C) Gold will be reduced. D) Gold will be oxidized. Answer: A Section: Section 10.5 Learning Outcome: 10.5 Use the EMF series to construct (diagram) a battery and label its parts and direction of electron flow. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 59) Which of the following is the most easily reduced? A) Mn2+ B) Fe2+ C) Zn2+ D) Cu2+ Answer: D Section: Section 10.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 60) Which of the following is the most easily reduced? A) K+ B) Na+ C) Au+ D) Hg2+ Answer: C Section: Section 10.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

61) Which of the following is most easily oxidized? A) Ni B) Pb C) Li D) Cr Answer: C Section: Section 10.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 62) Which of the following is most easily oxidized? A) Fe B) Al C) Cu D) Au Answer: B Section: Section 10.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 63) The equation for rust formation is ________. A) 4 Fe + 3 O2 + 2 H2O → 2 Fe2O3 + H2O B) 2 Fe + O2 → 2 FeO C) MnO2 + 2 Fe → Mn + 2 FeO D) CuO + Fe → Cu + FeO Answer: A Section: Section 10.6 Learning Outcome: 10.6 Describe the corrosion of metals in terms of electron transfer reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 64) Which of the following reactions is a combustion reaction? A) NaOH + HCl → NaCl + H2O B) AgNO3 + NaCl → AgCl + NaNO3 C) CH4 + 2 O2 → CO2 + 2 H2O D) CaO + CO2 → CaCO3 Answer: C Section: Section 10.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

65) Which of the following reactions is not an oxidation-reduction reaction? A) 2 Na + H2O → 2 NaOH + H2 B) Mg + 2 HCl → MgCl2 + H2 C) CH4 + 2 O2 → CO2 + 2 H2O D) CaO + CO2 → CaCO3 Answer: D Section: Section 10.6 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10.2 True/False Questions 1) Electricity is the flow of electrons. Answer: TRUE Section: Section 10.1 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) In a chemical reaction the easiest electrons to be transferred are the core electrons (also called inner shell electrons). Answer: FALSE Section: Section 10.2 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 3) When drawing dot structures, lone pairs of electrons are assigned completely to the atom on which they are drawn on the dot diagram. Answer: TRUE Section: Section 10.2 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 4) In a chemical bond the less electronegative element gets complete ownership of both the shared electrons. Answer: FALSE Section: Section 10.2 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 5) In Mg2+ the magnesium ion has 10 electrons. Answer: TRUE Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) In S2- the sulfur anion has 16 electrons. Answer: FALSE Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18 Copyright © 2015 Pearson Education, Inc.

7) Ca2+, K+ and Cl- have the same number of electrons. Answer: TRUE Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) The oxidation state of an atom in its natural occurring elemental form is always equal to zero. Answer: TRUE Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 9) The only tetraatomic element is sulfur. Answer: FALSE Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) All four halogens, F, Cl, Br and I, are diatomic in their free state. Answer: TRUE Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) The oxygen anion almost always has the charge of -2. Answer: TRUE Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) The sum of the oxidation states of all atoms in a formula must add up to the overall charge of the formula. Answer: TRUE Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 13) The overall charge of calcium sulfate is -2. Answer: FALSE Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) The highest oxidation state that sulfur can have is +6. Answer: TRUE Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

15) The lowest oxidation state sulfur can have is in the sulfite form. Answer: FALSE Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 16) The oxidation state of metals is almost always a positive number. Answer: TRUE Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 17) The oxidation state of non-metals is almost always a negative number. Answer: FALSE Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 18) A reducing agent is itself oxidized. Answer: TRUE Section: Section 10.3 Learning Outcome: 10.3 Identify the oxidizing agent and reducing agent in an electron transfer reaction. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 19) The cathode is the electrode where oxidation occurs. Answer: FALSE Section: Section 10.4 Learning Outcome: 10.4 Construct (diagram) a battery and label its parts and direction of electron flow given a balanced redox reaction. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 20) The cathode is called the positive electrode. Answer: TRUE Section: Section 10.4 Learning Outcome: 10.4 Construct (diagram) a battery and label its parts and direction of electron flow given a balanced redox reaction. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 21) A spontaneous electrochemical cell is called a galvanic cell. Answer: TRUE Section: Section 10.4 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

22) More active metals lose electrons to ions of less active metals. Answer: TRUE Section: Section 10.5 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 23) Corrosion of a ship's hull can be inhibited if another metal that is more active is attached to the hull. Answer: TRUE Section: Section 10.6 Learning Outcome: 10.6 Describe the corrosion of metals in terms of electron transfer reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 10.3 Short Answer Questions 1) Assign the oxidation state of: a) each rhenium, in Re2O7 b) zirconium, in ZrCl4 c) sulfur in Na2S2O3 d) iodine in KIO3 Answer: a) +7 (each) b) +4 c) +2 d) +5 Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 2) Assign the oxidation state of: a) barium, in BaCl2 b) sodium, in Na2O c) selenium, in H2SeO3 d) aluminum, in Al2O3 Answer: a) +2 b) +1 c) +4 d) +3 Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

3) Assign oxidation states to each of the atoms in the following chemical species: a) SiO2 b) NOc) TlCl d) V2O5 Answer: a) Si +4, O -2 b) N +1, O -2 c) Tl +1, Cl -1 d) V +5, O -2 Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 4) Assign oxidation states to each of the atoms in the following chemical species: a) H2S b) Cu2S c) HBrO2 d) KHCO3 Answer: a) H +1, S -2 b) Cu +1, S -2; c) H +1, O -2, Br +3 d) K +1, H +1, O -2, C +4 Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) Which of the reactions above are examples of electron transfer reactions? (a) Ba(OH)2 + H2SO4 → 2H2O + BaSO4 (b) NaOH + HCl → NaCl + H2O (c) 2H2 + O2 → 2H2O (d) C2H6O + 3O2 → 2CO2 + 3H2O Answer: both (c) and (d) Section: Section 10.3 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

6) For each reaction above that can be classified as an electron transfer reaction, state which element(s) gain, and which element(s) lose, electrons. (a) Ba(OH)2 + H2SO4 → 2H2O + BaSO4 (b) NaOH + HCl → NaCl + H2O (c) 2H2 + O2 → 2H2O (d) C2H6O + 3O2 → 2CO2 + 3H2O Answer: Reactions (a) and (b) cannot be classified as electron transfer reactions. In reaction (c), H's lose electrons, gained by O's. In reaction (d), carbon is oxidized by oxygen (reduced). Section: Section 10.3 Learning Outcome: 10.2 Use oxidation states to decide if electron transfer is occurring during a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) Train tracks, iron rails,are difficult to weld. Large pieces of iron, like train tracks, can be "spot-welded" by placing a mixture of powdered aluminum and iron (III) oxide between the two pieces of iron and adding to that a small amount of sulfuric acid to get a reaction started. a) Write a balanced chemical equation for the reaction of aluminum and iron (III) oxide (ignore the role of sulfuric acid in this). b) Identify the oxidizing and reducing agents. c) Identify the oxidation and reduction products. Answer: a) 2Al + Fe2O3 → Al2O3 + 2Fe b) Al is the reducing agent; Fe (III) is the oxidizing agent. c) Fe is the reduction product; Al (III) is the oxidation product. Section: Section 10.3 Learning Outcome: 10.6 Describe the corrosion of metals in terms of electron transfer reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

10.4 Matching Questions Match each element in every anion in the left column with its oxidation state that appears in the right column. A) -1 B) 0 C) -3 D) -2 E) +6 F) +3 G) +7 H) +2 I) +4 J) +5 1) manganese in potassium permanganate Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 2) phosphorus in magnesium phosphate Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 3) carbon in the sodium bicarbonate Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 4) chlorine in hydrochloric acid Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) chromium in potassium chromate Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) sulfur in sulfuric acid Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

7) oxygen in water Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 8) iron in iron (III) chloride Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 9) iron in iron metal Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) bromine in potassium bromide Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) magnesium in magnesium hydroxide Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 12) oxygen in hydrogen peroxide Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 13) nitrogen in ammonia Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 14) carbon in carbon dioxide Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 1) G 2) J 3) I 4) A 5) E 6) E 7) D 8) F 9) B 10) A 11) H 12) A 13) C 14) I

Match each cation in the left column with its corresponding number of electrons that appears in the right column. A) 54 B) 2 C) 10 D) 18 15) magnesium ion Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) lithium ion Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) aluminum ion Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) calcium ion Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) sodium ion Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) potassium ion Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) barium ion Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) cesium ion Section: Section 10.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 15) C 16) B 17) C 18) D 19) C 20) D 21) A 22) A

Match each element in the left column with its most likely oxidation state in the right column. A) +2 B) -1 C) -3, +3, 5 D) -2 E) +4,-4 F) +3 G) +1 H) -3 23) magnesium Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) aluminum Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) oxygen Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) chlorine Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) potassium Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) barium Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 29) nitrogen Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

30) sulfur Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) fluorine Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) strontium Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) carbon Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) arsenic Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 23) A 24) F 25) D 26) B 27) G 28) A 29) H 30) D 31) B 32) A 33) E 34) C

Match each compound in the left column with the corresponding chlorine oxidation state that appears in the right column. A) +3 B) +5 C) -1 D) +1 E) +7 35) sodium chloride Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 36) sodium hypochlorite Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 37) sodium chlorate Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 38) sodium chlorite Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 39) sodium perchlorate Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 35) C 36) D 37) B 38) A 39) E

Match each compound in the left column with the corresponding sulfur oxidation state that appears in the right column. A) +4 B) 0 C) +6 D) +2 E) -2 40) sodium sulfite Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 41) sodium sulfate Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 42) sodium sulfide Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 43) sulfur dioxide Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 44) sulfur, S8 Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 45) sulfur dichloride Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 40) A 41) C 42) E 43) A 44) B 45) D

Match each compound in the left column with the corresponding nitrogen oxidation state that appears in the right column. A) +3 B) +5 C) 0 D) +4 E) +2 F) -3 46) sodium nitrite Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 47) sodium nitrate Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 48) sodium nitride Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 49) nitrogen dioxide Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 50) nitrogen gas Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 51) dinitrogen pentoxide Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 52) nitrogen monoxide Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 46) A 47) B 48) F 49) D 50) C 51) B 52) E 31 Copyright © 2015 Pearson Education, Inc.

Match each compound in the left column with the corresponding carbon oxidation state that appears in the right column. A) +4 B) -4 C) 0 D) +2 E) -1 53) Na2CO3 Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 54) C60 Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 55) C2H2 Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 56) CO Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 57) CH4 Section: Section 10.2 Learning Outcome: 10.1 Assign oxidation states to atoms in compounds and molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 53) A 54) C 55) E 56) D 57) B

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 11 What If There Were No Intermolecular Forces? - The Ideal Gas 11.1 Multiple Choice Questions 1) Pressure is defined as ________. A) the amount of force per unit area B) the amount of force per unit volume C) the amount of work per unit area D) the amount of work per unit volume Answer: A Section: Section 11.1 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) 1 atm is equal to ________. 1 atm = 760 torr. A) 760 cm Hg B) 760 mm Hg C) 76 torr D) 76 mm Hg Answer: B Section: Section 11.1 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) 0.15 atm is equal to ________. 1 atm = 760 torr. A) 11.4 torr B) 114 torr C) 1.14 × 10-5 torr D) 1.14 × 10-3 torr Answer: B Section: Section 11.1 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 4) 380 mm Hg is equal to ________ atm. A) 0.50 B) 2.0 C) 5.0 D) 20.0 Answer: A Section: Section 11.1 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

5) 855 torr is equal to ________ cm Hg. 1 atm = 760 torr. A) 1.13 B) 85.5 C) 855 D) 8550 Answer: B Section: Section 11.1 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) A pressure of 76.0 cm Hg would be equivalent to what height of a water column? The density of mercury = 13.6 g/mL. A) 5.59 cm B) 55.9 cm C) 0.18 cm D) 1030 cm Answer: D Section: Section 11.1 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) The value of the gas constant R is equal to ________ L∙atm/ K∙mole. A) 0.0821 B) 8.21 C) 82.1 D) 0.00821 Answer: A Section: Section 11.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) If the pressure of a gas sample is quadrupled and the absolute temperature is doubled, by what factor does the volume of the sample change? A) 2 B) 1/2 C) 1/4 D) 1/8 Answer: B Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

9) A gas under an initial pressure of 0.60 atm is compressed at constant temperature from 27 L to 3.0 L. The final pressure becomes ________. A) 0.060 atm B) 0.54 atm C) 5.4 atm D) 54 atm Answer: C Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) How many moles of gas are found in a container that occupies a volume of 5.50 L with a pressure of 0.335 atm at A) 0.0753 moles B) 0.898 moles C) 13.3 moles D) 1.11 moles Answer: A Section: Section 11.2 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) The number of moles of hydrogen gas present in a 1,500 mL container at 298 K and 2.0 atm pressure is ________. A) 0.65 moles B) 0.12 moles C) 0.26 moles D) 0.52 moles Answer: B Section: Section 11.2 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 12) For an ideal gas, which pairs of the variables below are inversely proportional to each assuming all other variables are kept constant? A) P and n B) V and T C) V and P D) V and n Answer: C Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

13) For an ideal gas, which pairs of the variables below are directly proportional to each assuming all other variables are kept constant? A) P and n B) n and T C) V and P D) all of the above Answer: A Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) A fixed amount of a gas has both its temperature and volume doubled. What happens to its pressure? A) It doubles. B) It is halved. C) It quadruples. D) It remains the same. Answer: D Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 15) Imagine a balloon that you blow up to a full size. What do you expect to happen if you pour liquid nitrogen at 77 K over the surface of the balloon? Assume that the pressure does not change significantly. A) increase slightly in size B) decrease significantly in size C) stay exactly the same size as before D) One cannot say unless the composition of the gas is known. Answer: B Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

16) Imagine a balloon that you blow up to a full size. What do you expect to happen if you suspend the balloon over a bunsen burner? Assume that the pressure does not change significantly. A) increase significantly in size until it bursts B) decrease significantly in size C) stay exactly the same size as before D) One cannot say unless the composition of the gas is known. Answer: A Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 17) Calculate the volume occupied by 18.0 g of water vapor at 100 °C and 1.00 atm. A) 11.2 L B) 22.4 L C) 30.6 L D) 61.2 L Answer: C Section: Section 11.2 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 18) Assuming that the pressure and quantity of a gas sample remain constant, what will be the final volume of a 4.86 L sample of a gas at 281 °C which is cooled to 225 °C? A) 5.19 L B) 4.37 L C) 2.92 L D) 2.78 L Answer: B Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 19) Assuming that the pressure and quantity of a gas sample remain constant, what will be the final volume of a 4.86 L sample of a gas at 281 °C when it is heated to 300 °C? A) 5.03 L B) 3.89 L C) 2.92 L D) 2.78 L Answer: A Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5 Copyright © 2015 Pearson Education, Inc.

20) 1.86 moles of a gas occupy 245 L at 281 °C under a pressure of 0.346 atm. When the pressure is increased to 0.886 atm while keeping the same temperature, the new volume will be ________. A) 627 L B) 799 L C) 95.7 L D) 47.8 L Answer: C Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 21) Assume that the temperature and quantity of a gas sample remain constant. A 1.6 L sample of a gas is originally at 330 K and 4.84 atm. Calculate the final pressure when the volume is reduced to 840 mL. A) 9.22 atm B) 4.61 atm C) 18.44 atm D) 3.66 atm Answer: A Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 22) A 4.23 L sample of a gas is originally at 747 mm Hg at 297 K. The volume occupied by the same quantity of gas under the same temperature and 700. torr is ________. 1 atm = 760 torr. A) 3.96 L B) 4.51 L C) 1.88 L D) 1.68 L Answer: B Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

23) A gas occupies 340 mL at 273 K and 610 torr. What is the final temperature when the pressure is increased to 1 atm, and the volume being held constant? 1 atm = 760 torr. A) 67 °C B) 267 °C C) 340 °C D) 613 °C Answer: A Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 24) Which statement is true for an ideal gas? A) The pressure of a gas increases when its volume decreases. B) The pressure of a gas increases when its temperature increases. C) The pressure of a gas increases when the number of gas moles increases. D) All of the above statements are correct. Answer: D Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) A gas sample occupies a volume of 8 L at 20 °C. What is the temperature at which the gas would double its volume? A) 40 °C B) 10 °C C) 273 K D) 586 K Answer: D Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 26) 0.024 moles of nitrogen gas occupy 4.0 L at 0.90 atm pressure. What will be the final volume if the container is allowed to expand and the pressure is reduced to 0.30 atm while the temperature is kept constant? A) 1.33 L B) 3.6 L C) 6.0 L D) 12 L Answer: D Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7 Copyright © 2015 Pearson Education, Inc.

27) If the volume of a given gas sample doubles, what happens to the temperature of the gas? The amount of gas and the pressure of the gas stay the same. A) increase by a factor of 2 B) decrease by a factor of 2 C) stay exactly the same Answer: A Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 28) If the pressure of a given gas sample doubles, what happens to the volume of gas? The amount of gas and the temperature of the gas stay the same. A) increase by a factor of 2 B) decrease by a factor of 2 C) stay exactly the same Answer: B Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 29) A gas occupies a volume of 480 mL at 127 °C and 140 mm Hg. What mathematical expression will yield the correct volume at 177 °C and 400 mm Hg? A) 480 × (140/400) × (450/400) B) 480 × (400/140) × (450/400) C) 480 × (140/400) × (400/450) D) 480 × (400/140) × (400/450) Answer: A Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 30) A gas occupies a volume of 0.500 L at 125 °C and 0.443 atm. What mathematical expression will yield the correct temperature at 0.750 L and 0.689 atm? A) (0.689 × 0.750 × 125)/(0.443 × 0.500) B) (0.443 × 0.500 × 398)/(0.689 × 0.750) C) (0.443 × 0.500)/(0.689 × 0.750 × 398) D) (0.689 × 0.750 × 398)/(0.443 × 0.500) Answer: D Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 8 Copyright © 2015 Pearson Education, Inc.

31) STP conditions stand for ________. A) 0 K, 1 atm B) 0 °C, 760 cm Hg C) 0 °C, 760 mm Hg D) 0 K, 76 cm Hg Answer: C Section: Section 11.3 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 32) A gas occupies 2.00 L at 298 K and 2.10 atm. The volume of this gas at STP is ________. A) 22.4 L B) 2.24 L C) 3.84 L D) 2.00 L Answer: C Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 33) Which of the following gases occupy the largest volume at STP? A) 12.00 g He B) 2 mol of water C) 38.00 g F2 D) 6.022 × 1023 molecules of ammonia Answer: A Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 34) The volume of 2.3 g nitrogen gas at STP is ________. A) 1.8 L B) 11.2 L C) 22.4 L D) 44.8 L Answer: A Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

35) Which of the following gases will have the same density at STP? A) oxygen and methane B) hydrogen and helium C) carbon monoxide and nitrogen D) hydrogen chloride and fluorine Answer: C Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 36) Which of the following gases occupy the smallest volume at STP? A) 4.032 g H2 B) 1.000 mol of carbon dioxide C) 35.45 g Cl2 D) 6.022 × 1023 molecules of O2 Answer: C Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 37) The density of carbon dioxide as STP is ________. A) 0.46 g/ L B) 1.97 g/ L C) 3.94 g/ L D) 5.62 g/ L Answer: B Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 38) What weight of nitrogen gas will occupy a volume of 1.25 L at a pressure of 1.0 atm and a temperature of 200.°C? A) 0.45 g B) 0.90 g C) 1.80 g D) 3.60 g Answer: B Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

39) The volume occupied by 4.00 g oxygen gas at STP is ________. A) 22.4 L B) 11.2 L C) 5.60 L D) 2.80 L Answer: D Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 40) 0.249 g of a diatomic element occupies a volume of 125. mL at 120. °C and 2.00 atm. This element is ________. A) nitrogen B) oxygen C) chlorine D) bromine Answer: B Section: Section 11.3 Learning Outcome: 11.4 Calculate the Molar Mass of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 41) An unknown gaseous substance has a density of 1.06 g/L at 31 °C and 371 torr. Its molecular weight is ________. A) 27 g/mol B) 54 g/mol C) 81 g/mol D) 108 g/mol Answer: B Section: Section 11.3 Learning Outcome: 11.4 Calculate the Molar Mass of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 42) An unknown gaseous substance has a density of 1.06 g/L at 31 °C and 371 torr. If the substance has the following percent composition: 88.8% C and 11.2% H, its molecular formula is ________. A) CH3 B) C2H3 C) C4H6 D) C2H5 Answer: C Section: Section 11.3 Learning Outcome: 11.4 Calculate the Molar Mass of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

43) The density of hydrogen gas at STP is ________ the density of oxygen under identical conditions. A) four times larger than B) eight times larger than C) sixteen times smaller than D) equal to, since both densities are taken under the same conditions Answer: C Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 44) 0.123 g of a gas occupy a volume of 124 mL at 120. °C and 760. torr. Its molar mass is ________ g/mol. A) 22.4 B) 28.1 C) 71.1 D) 32.0 Answer: D Section: Section 11.3 Learning Outcome: 11.4 Calculate the Molar Mass of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 45) 0.123 g of a gas occupy a volume of 124 mL at 120. °C and 760. torr. The possible formula of the gas is ________. A) CH4 B) CO2 C) Cl2 D) O2 Answer: D Section: Section 11.3 Learning Outcome: 11.4 Calculate the Molar Mass of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 46) The molar volume of an ideal gas is ________. A) always equal to 22.4 L at room temperature B) proportional to the molecular weight of the gas C) always equal to 22.4 L at STP D) inversely proportional to the molecular weight of the gas Answer: C Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

47) Which gas has a density equal to 1.43 g/L at STP? A) nitrogen B) oxygen C) helium D) carbon monoxide Answer: B Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 48) The density of carbon tetrachloride at 0.94 atm and 398 K is ________. A) 1.11 g/L B) 2.21 g/L C) 4.43 g/L D) 8.86 g/L Answer: C Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 49) The density of sulfur vapor at 1273 K and 740 mm Hg is 0.5977 g/L. Its molar mass is ________. A) 32 B) 64 C) 96 D) 128 Answer: B Section: Section 11.3 Learning Outcome: 11.4 Calculate the Molar Mass of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 50) The density of sulfur vapor at 1273 K and 740 mm Hg is 0.5977 g/L. Sulfur at that temperature will be ________. A) monoatomic B) diatomic C) triatomic D) tetraatomic Answer: B Section: Section 11.3 Learning Outcome: 11.4 Calculate the Molar Mass of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

51) Find the number of liters occupied by 3.0 moles of nitrogen gas at STP. A) 67 L B) 7.5 L C) 4.8 L D) 0.13 L Answer: A Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 52) Find the number of liters occupied by 3.0 g of nitrogen gas at STP. A) 67 L B) 7.5 L C) 2.4 L D) 0.13 L Answer: C Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 53) Which statement is not true about an ideal gas? A) Ideal gas molecules travel in a straight line. B) Molecular collisions are elastic. C) The intermolecular forces in gas molecules are very weak except when they collide. D) Higher temperatures slow down the speed of the molecules. Answer: D Section: Section 11.3 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 54) The number of moles of oxygen that are present in a 15-L container at STP is ________. A) 0.1 B) 0.67 C) 0.89 D) 336 Answer: B Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

55) 14.0 g of nitrogen gas will occupy ________ at STP. A) 1.12 L B) 2.24 L C) 11.2 L D) 22.4 L Answer: C Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 56) 88.0 g of carbon dioxide gas will occupy ________ at STP. A) 11.2 L B) 22.4 L C) 44.8 L D) 67.2 L Answer: C Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 57) 3.01 × 1023 molecules of methane gas will occupy ________ at STP. A) 11.2 L B) 22.4 L C) 44.8 L D) 67.2 L Answer: A Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 58) The density of hydrogen gas at STP is ________. A) 0.045 g/L B) 0.090 g/L C) 0.180 g/L D) 0.360 g/mL Answer: B Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

11.2 True/False Questions 1) The atmospheric pressure increases as an airplane increases in altitude. Answer: FALSE Section: Section 11.1 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 2) At sea level, if a low pressure system comes through then the atmospheric pressure is below 760 mm Hg. Answer: TRUE Section: Section 11.1 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 3) Ideal gas molecules undergo non-elastic collisions. Answer: FALSE Section: Section 11.1 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 4) The term elastic indicates that no kinetic energy is transferred during a collision. Answer: TRUE Section: Section 11.1 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 5) The pressure of 2.00 atm is equal to 152 cm Hg. Answer: TRUE Section: Section 11.1 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) The pressure of 0.500 atm is equal to 0.500 mm Hg. Answer: FALSE Section: Section 11.1 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) In the Ideal gas law, temperature is measured in K. Answer: TRUE Section: Section 11.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

8) 1 torr is equal to 1 cm Hg. 1 atm = 760 torr. Answer: FALSE Section: Section 11.2 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) 76 cm Hg is equal to 1 atm. Answer: TRUE Section: Section 11.1 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) 0.0309 atm is equal to 23.5 cm Hg. Answer: FALSE Section: Section 11.1 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) 947 mbar is equal to 0.933 atm. 1 atm= 1.015 bar. Answer: TRUE Section: Section 11.1 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 12) 124 cm Hg is equal to 1.63 atm. Answer: TRUE Section: Section 11.1 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 13) 30.19 inches of Hg is equal to 1.009 atm. Answer: TRUE Section: Section 11.1 Learning Outcome: 11.1 Describe the units of pressure and how pressure is created by a gas. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 14) As temperature increases the volume of a gas increases, even if the pressure is not kept constant. Answer: FALSE Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

15) As the volume of a gas is allowed to double, its pressure is halved as long as the temperature is kept constant. Answer: TRUE Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 16) As the temperature of a gas increases, its pressure increases as long as the volume is kept constant. Answer: TRUE Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 17) Increasing the temperature of a gas from 100 K to 200 K will cause the volume to double. Answer: TRUE Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 18) Increasing the temperature of a gas from 100 °C to 200 °C will cause the volume to double. Answer: FALSE Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 19) One of the assumptions taken when dealing with ideal gas law is that most volume occupied by a gas is actually empty space. Answer: TRUE Section: Section 11.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) The typical units for the density of gases are g/L. Answer: TRUE Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) The molar volume of any gas is equal to 22.4 L at any temperature. Answer: FALSE Section: Section 11.3 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18 Copyright © 2015 Pearson Education, Inc.

22) The molar volume of any gas whether diatomic or monatomic is 22.4 L at STP. Answer: TRUE Section: Section 11.3 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) The molar volume of 32 g of oxygen gas is 22.4 L at STP. Answer: TRUE Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) The molar volume of water vapor at its boiling point is 22.4 L. Answer: FALSE Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) The density of nitrogen is equal to that of carbon monoxide at STP. Answer: TRUE Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 26) The density of methane is equal to the density of oxygen under the same conditions. Answer: FALSE Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 27) The ideal gas law may be applied also to a mixture of gases. Answer: TRUE Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 28) The density of a gas is independent of temperature. Answer: FALSE Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

11.3 Matching Questions Match each set of two variables of an ideal gas that appears in the left column with the corresponding relationship (proportional or inversely proportional) that appears in the right column. A) proportional B) inversely proportional 1) pressure and volume Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) pressure and temperature Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) volume and temperature Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) volume and number of moles Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) pressure and number of moles Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 1) B 2) A 3) A 4) A 5) A

Match the event that appears in the left column to the corresponding consequence that appears in the right column. A) pressure decreases B) volume decreases C) volume increases D) temperature decreases E) pressure increases F) temperature increases 6) At constant temperature, as pressure increases, ________. Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) At constant temperature, as volume decreases, ________. Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) At constant pressure, as volume increases, ________. Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) At constant pressure, as temperature increases, ________. Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) At constant volume, as pressure decreases, ________. Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) At constant volume, as temperature decreases, ________. Section: Section 11.2 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 6) B 7) E 8) F 9) C 10) D 11) A 21 Copyright © 2015 Pearson Education, Inc.

Match the event that appears in the left column to the corresponding consequence that appears in the right column. A) the density increases B) the pressure increases C) the pressure decreases D) the density decreases 12) At constant pressure and temperature, as the molecular mass of a gas decreases, ________. Section: Section 11.3 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) At constant temperature and for the same gas, as density increases, ________. Section: Section 11.3 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) At constant pressure and for the same gas, as the T decreases, ________. Section: Section 11.3 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) At constant temperature and for the same gas, as density decreases, ________. Section: Section 11.3 Learning Outcome: 11.2 Describe the relationship between any two variables that characterize a gas are related when the remaining variables are held constant. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 12) D 13) B 14) A 15) C

Match each gas that appears in the left column with its corresponding density, at STP, that appears in the right column. A) 0.900 g/L B) 2.86 g/ L C) 1.43 g/L D) 3.93 g/L E) 1.34 g/L F) 0.760 g/ L 16) ethane, C2H6 Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 17) sulfur dioxide Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 18) ammonia Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 19) neon Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 20) carbon tetrafluoride Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 21) oxygen Section: Section 11.3 Learning Outcome: 11.5 Calculate the density of a gas using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 16) E 17) B 18) F 19) A 20) D 21) C

Match the volumes that appear in the left column with the other variables that appear in the right column. A) 40.0 g of fluorine gas at STP B) 40.0 g of fluorine gas at 900 torr and 298 K C) 48.0 g ozone at STP D) 3.9 g helium gas at -20 °C and 800 mm Hg E) 16.0 g oxygen gas at STP F) 0.30 moles of methane gas at STP 22) 6.72 L occupied by ________. Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 23) 19.2 L occupied by ________. Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 24) 11.2 L occupied by ________. Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 25) 22.4 L occupied by ________. Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 26) 23.6 L occupied by ________. Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 27) 21.7 L occupied by ________. Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 22) F 23) D 24) E 25) C 26) A 27) B

Match the number of moles represented in the left column with each of the following quantities of substances, measured at STP. A) 12.1 L of neon gas B) 32.0 g of oxygen gas C) 44.8 L of ammonia gas D) 3.00 liters of acetylene E) 16.0 g of oxygen gas 28) 0.540 moles Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 29) 1.00 mole Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 30) 0.500 mole Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 31) 2.00 moles Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 32) 0.134 moles Section: Section 11.3 Learning Outcome: 11.3 Perform calculations using the Ideal Gas Law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 28) A 29) B 30) E 31) C 32) D

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 12 Solutions 12.1 Multiple Choice Questions 1) Solutions are considered to be which general type of matter? A) homogeneous mixtures B) heterogeneous mixtures C) pure substances D) pure elements Answer: A Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) In a solution made by dissolving 50 grams of calcium chloride ( ) in 1000 grams of water, which component is considered to be the solute? A) Water is the solute. B) Both water and calcium chloride are solutes in this example. C) Calcium chloride is the solute. D) The solute cannot be determined from the information given. Answer: C Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) In a solution made by dissolving 200 grams of sugar in 1000 grams of water, which component is considered to be the solvent? A) Water is the solvent. B) Both water and sugar are solvents in this example. C) Sugar is the solvent. D) The solvent cannot be determined from the information given. Answer: A Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

4) In a dilute saline solution the solute is in the form of ________. A) Na+ and ClB) NaCl (s) C) NaCl (ℓ) D) both A and B Answer: A Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 5) Which of the following solutions are possible? A) Both the solvent and solute are liquids. B) Both the solvent and solute are solids. C) The solvent is a liquid and the solute is a gas. D) All of them are possible. Answer: D Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) Sterling silver is a solution (ALLOY) of ________. A) silver and zinc B) silver and gold C) silver and copper D) silver and iron Answer: C Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 7) Which of the following is a solution? A) air B) amalgam C) metal alloys D) All of the above are solutions. Answer: D Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

8) Which of the following is not a solution? A) ice in water B) vinegar in water C) sugar in water D) metal alloys Answer: A Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 9) The solute in a saline solution is ________. A) water B) salt C) the salt solution D) One cannot say unless the exact concentration is known. Answer: B Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 10) Which of the following statements is correct? A) Energy is needed to overcome the solute-solute attractive forces. B) Energy is needed to overcome the solvent-solvent attractive forces. C) Solvation releases energy. D) All the above statements are correct. Answer: D Section: Section 12.2 Learning Outcome: 12.2 Describe the energetics and intermolecular attractions associated with creating a solution. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 11) Which of the following has the highest hydration energy? A) sodium chloride B) magnesium chloride C) aluminum chloride D) silicon tetrachloride Answer: D Section: Section 12.2 Learning Outcome: 12.2 Describe the energetics and intermolecular attractions associated with creating a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

12) Which of the following has the lowest hydration energy? A) sodium chloride B) magnesium chloride C) aluminum chloride D) silicon tetrachloride Answer: A Section: Section 12.2 Learning Outcome: 12.2 Describe the energetics and intermolecular attractions associated with creating a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) The statement "like dissolves like" justifies why ________. A) water will dissolve ethyl alcohol B) octane will dissolve methane C) water will not dissolve fats D) All of the above statements are correct. Answer: D Section: Section 12.2 Learning Outcome: 12.2 Describe the energetics and intermolecular attractions associated with creating a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) Which of the following examples demonstrates a net decrease in entropy? A) melting an ice cube B) adding cream to hot coffee C) ripping a finished jigsaw puzzle into a thousand pieces D) assembling a 1000-piece jigsaw puzzle E) All of the preceding are examples of net increases in entropy. Answer: D Section: Section 12.3 Learning Outcome: 12.2 Describe the energetics and intermolecular attractions associated with creating a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 15) If a solute is to be soluble in a given solvent, which step in the solution-making process must have a negative value for its energy? A) the physical separation of solvent particles B) the physical separation of solute particles C) the formation of solvent/solute interactions D) All three of the preceding steps must be negative for a solute to be soluble. Answer: C Section: Section 12.3 Learning Outcome: 12.2 Describe the energetics and intermolecular attractions associated with creating a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4 Copyright © 2015 Pearson Education, Inc.

16) How are solubility and temperature generally related in a system consisting of a solid solute and a liquid solvent? A) Solubility generally increases with increasing temperature. B) Solubility generally increases with decreasing temperature. C) Changing the temperature has no effect on solubility. D) Solubility generally decreases with increasing temperature. Answer: A Section: Section 12.4 Learning Outcome: 12.5 Describe how temperature and pressure affect solubility of gaseous and solid solutes. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) How are the solubilities of gases (solutes) in liquids (solvents) affected by changing pressure? A) Gases are more soluble in liquids when the pressure is decreased. B) Pressure has no effect on how soluble a gas is in a liquid. C) Gases are less soluble in liquids when the pressure is increased. D) Gases are more soluble in liquids when the pressure is increased. Answer: D Section: Section 12.4 Learning Outcome: 12.5 Describe how temperature and pressure affect solubility of gaseous and solid solutes. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Under what conditions would a gas be most soluble in a liquid? A) high temperature and high pressure B) high temperature and low pressure C) low temperature and high pressure D) low temperature and low pressure Answer: C Section: Section 12.4 Learning Outcome: 12.5 Describe how temperature and pressure affect solubility of gaseous and solid solutes. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) Which of the following statements is correct? A) Temperature usually increases the solubility of a solid in water. B) Pressure usually increases the solubility of a gas in water. C) Solubility involves the statement "like dissolves like." D) All of the above statements are correct. Answer: D Section: Section 12.4 Learning Outcome: 12.5 Describe how temperature and pressure affect solubility of gaseous and solid solutes. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

20) Which of the following is the least water soluble at 50°C? A) Ce2(SO4)3 B) KBr C) NaNO3 D) CH3COONa Answer: A Section: Section 12.4 Learning Outcome: 12.6 Calculate the solubility of a solute or the grams of solute required for saturation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) Which of the following is the most water soluble at 50°C? A) CH3COONa B) NaNO3 C) Ce2(SO4)3 D) KBr Answer: B Section: Section 12.4 Learning Outcome: 12.6 Calculate the solubility of a solute or the grams of solute required for saturation. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) Which end, the polar end or the nonpolar end, of a detergent molecule is attracted to dirt particles? A) the polar end B) both the polar and the nonpolar end C) neither the polar nor the nonpolar end D) the nonpolar end Answer: D Section: Section 12.9 Learning Outcome: 12.13d Describe the two parts of a soap molecule and how it functions to make unlikes dissolve. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 23) Which end, the polar end or the nonpolar end, of a detergent molecule is attracted to water? A) the polar end B) both the polar and the nonpolar end C) neither the polar nor the nonpolar end D) the nonpolar end Answer: A Section: Section 12.9 Learning Outcome: 12.13d Describe the two parts of a soap molecule and how it functions to make unlikes dissolve. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 6 Copyright © 2015 Pearson Education, Inc.

24) Soap consists of a long ________ head and a long ________ tail. A) polar; polar B) polar; nonpolar C) nonpolar; polar D) nonpolar; nonpolar Answer: B Section: Section 12.9 Learning Outcome: 12.13d Describe the two parts of a soap molecule and how it functions to make unlikes dissolve. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 25) The spherical structure of a soap molecule that is formed when soap molecules are in contact with water is called ________. A) detergent B) hydrophobic end C) hydrophilic end D) micelle Answer: D Section: Section 12.9 Learning Outcome: 12.13d Describe the two parts of a soap molecule and how it functions to make unlikes dissolve. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 26) What is the molarity of 3.68 mL of a solution containing 0.0025 moles of calcium chloride? A) 6.8 × M B) 0.68 M C) 1.5 M D) 6.8 × M Answer: B Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 27) The molarity of a solution that contains 5.85 g of NaCl in 2.0 L of solution is ________. A) 2.93 M B) 0.050 M C) 5.0 M D) 0.29 M Answer: B Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

28) To prepare 100 mL of 0.4 M HCl solution from a stock solution of 2 M HCl solution one needs to ________. A) dilute 20 mL of 2 M HCl solution with 100 mL of HCl solution. B) dilute 20 mL of 2 M HCl solution with enough water to make a total volume of 100 mL of solution. C) use 500 mL of 2 M HCl solution and boil it down to a final volume of 100 mL of solution. D) dilute 80 mL of 2 M HCl solution to a total volume of 100 mL of solution. Answer: B Section: Section 12.5 Learning Outcome: 12.7 Calculate and then describe how to prepare a specific volume of a solution that has a specified molar concentration. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 29) To prepare 500. mL of 0.5 M NaCl from a stock of 2.0 M NaCl one needs to ________. A) dilute 125 mL 2.0 M NaCl with enough water to a total of 500. mL solution B) dilute 125 mL 2.0 M NaCl with 500. mL water C) dilute 375 mL 2.0 M NaCl with enough water to a total of 500. mL solution D) dilute 375 mL 2.0 M NaCl with 500. mL water Answer: A Section: Section 12.5 Learning Outcome: 12.7 Calculate and then describe how to prepare a specific volume of a solution that has a specified molar concentration. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 30) 25 mL of a 0.1 M NaCl solution contains ________ g of NaCl. A) 0.0025 B) 0.15 C) 2.5 D) 0.25 Answer: B Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 31) 7.5 g of calcium carbonate in 150 mL of aqueous solution will provide a ________ M solution. A) 0.10 B) 0.50 C) 1.0 D) 2.0 Answer: B Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

32) 200. mL of a 0.100 M NaCl solution contains ________ g of NaCl. A) 1.17 B) 11.7 C) 117 D) 5.85 Answer: A Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 33) 500 mL of a 0.4 M sodium nitrate contains ________ moles of sodium ions and ________ moles of nitrate ions. A) 0.4; 0.2 B) 0.2; 0.4 C) 0.4; 0.6 D) 0.2; 0.2 Answer: D Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 34) 500 mL of a 0.4 M calcium nitrite contains ________ moles of calcium ions and ________ moles of nitrite ions. A) 0.4; 0.2 B) 0.2; 0.4 C) 0.4; 0.6 D) 0.2; 0.2 Answer: B Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 35) 500 mL of a 0.4 M potassium dichromate contains ________ moles of potassium ions and ________ moles of dichromate ions. A) 0.4; 0.2 B) 0.2; 0.4 C) 0.4; 0.6 D) 0.2; 0.2 Answer: A Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

36) 500 mL 0.4 M aluminum nitrate solution contains ________ moles of aluminum ions and ________ moles of nitrate ions. A) 0.6; 0.2 B) 0.2; 0.4 C) 0.2; 0.6 D) 0.2; 0.2 Answer: C Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 37) 10.0 mL of 0.50 M HCl solution neutralizes ________ mL of 0.50 M NaOH solution. A) 5.0 B) 10. C) 20. D) 40. Answer: B Section: Section 12.5 Learning Outcome: 12.10a Perform calculations regarding reactions that occur in solution that involve reaction stoichiometry and reactant concentrations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 38) 10.0 mL of 0.50 M sulfuric acid neutralizes ________ mL of 0.50 M ammonium hydroxide solution. A) 5.0 B) 10. C) 20. D) 40. Answer: C Section: Section 12.5 Learning Outcome: 12.10a Perform calculations regarding reactions that occur in solution that involve reaction stoichiometry and reactant concentrations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 39) 10.0 mL of 0.50 M sulfuric acid neutralizes ________ mL of 0.50 M magnesium hydroxide solution. A) 5.0 B) 10. C) 20. D) 40. Answer: B Section: Section 12.5 Learning Outcome: 12.10a Perform calculations regarding reactions that occur in solution that involve reaction stoichiometry and reactant concentrations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

40) 10.0 mL of 0.50 M hydrochloric acid neutralizes ________ mL of 0.50 M magnesium hydroxide solution. A) 5.0 B) 10. C) 20. D) 40. Answer: A Section: Section 12.5 Learning Outcome: 12.10a Perform calculations regarding reactions that occur in solution that involve reaction stoichiometry and reactant concentrations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 41) The percent composition of a solution made by dissolving 5.0 g NaOH in 20. g of water is ________. A) 4.0% B) 5.0% C) 20.% D) 25% Answer: C Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 42) How many grams of NaCl are in 200 g of a 10 percent-by-mass salt solution? A) 10 g B) 20 g C) 40 g D) 80 g Answer: B Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 43) How many grams of water are in 100 g of a 30 percent-by-mass sugar solution? A) 30 g B) 60 g C) 70 g D) 100 g Answer: C Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

44) Phenolphthalein turns ________ when the solution is basic. A) clear B) blue C) pink D) orange Answer: C Section: Section 12.7 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 45) Henry's law gives the relationship between ________. A) colligative properties and the freezing point B) solubility of a gas and concentration C) solubility of a gas and pressure D) hydrophobic and hydrophilic solutions Answer: C Section: Section 12.4 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 46) An impurity ________ the melting point of a compound. A) decreases B) increases C) has no effect on D) One cannot say unless the physical properties of the compound are known. Answer: A Section: Section 12.8 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 47) An impurity ________ the boiling point of a compound. A) decreases B) increases C) has no effect on D) One cannot say unless the physical properties of the compound are known. Answer: B Section: Section 12.8 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 48) Which of the following is not a colligative property? A) molarity B) freezing point depression C) vapor pressure lowering D) boiling point elevation Answer: A Section: Section 12.8 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

49) What is the freezing point depression of a sugar solution prepared by dissolving 375.00 g of sucrose (342.3 g/mol) in 1500.0 g of water (Kf of water = 1.86 °C∙ kg solvent/mol solute)? A) 1.36 °C B) -1.36 °C C) -1.86 °C D) -0.465 °C Answer: B Section: Section 12.8 Learning Outcome: 12.12c Calculate vapor pressure lowering, freezing point depression, boiling point elevation, and solute molar mass for solutions via colligative property laws. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 50) A 0.2119 g sample of an acid, HA, was neutralized by 34.7 mL of 0.0500 M NaOH solution. The molecular mass of the acid is ________. A) 61 B) 92 C) 122 D) 244 Answer: C Section: Section 12.8 Learning Outcome: 12.10a Perform calculations regarding reactions that occur in solution that involve reaction stoichiometry and reactant concentrations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 51) 4.173 g of an organic compound (non-electrolyte) lowered the freezing point of 100.0 g of nitrobenzene by 2.6 °C. If the Kf of nitrobenzene is 8.1 °C∙ kg solvent/mol solute, the molecular mass of the non-electrolyte is ________. A) 260 B) 195 C) 65 D) 130 Answer: D Section: Section 12.8 Learning Outcome: 12.12c Calculate vapor pressure lowering, freezing point depression, boiling point elevation, and solute molar mass for solutions via colligative property laws. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 52) If the empirical formula is C4H3N and the molecular weight is 130 g/mole, then the molecular formula is ________. A) C16H12N4 B) C12H9N3 C) C4H3N D) C8H6N2 Answer: D Section: Section 12.8 Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 13 Copyright © 2015 Pearson Education, Inc.

53) A 2.154 g sample of an unknown non-electrolyte is dissolved in 50. g of water (Kf of water = 1.86 °C∙ kg solvent/mol solute). If the solution freezes at -1.23 °C, the molecular mass of the non-electrolyte is ________. A) 33 B) 65 C) 130 D) 260 Answer: B Section: Section 12.8 Learning Outcome: 12.12c Calculate vapor pressure lowering, freezing point depression, boiling point elevation, and solute molar mass for solutions via colligative property laws. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 54) A 2.00 g sample of a non-electrolyte (molar mass = 118) is dissolved in 55.0 g of benzene (Kf of benzene is What is the freezing point depression of the solution? A) 1.58 °C B) 3.16 °C C) 0.79 °C D) 2.33 °C Answer: A Section: Section 12.8 Learning Outcome: 12.12c Calculate vapor pressure lowering, freezing point depression, boiling point elevation, and solute molar mass for solutions via colligative property laws. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 12.2 True/False Questions 1) Transparent solutions are examples of homogeneous matter. Answer: TRUE Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) The solvent in a saline solution is water. Answer: TRUE Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) A solid solution is a solution of two metals that are not necessarily evenly distributed in each other. Answer: FALSE Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14 Copyright © 2015 Pearson Education, Inc.

4) The solute in a sugar solution is water. Answer: FALSE Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) Vinegar is a liquid solution where acetic acid serves as the solvent. Answer: FALSE Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) Alloys are solid solutions. Answer: TRUE Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) Air is a gas solution where oxygen is the solvent. Answer: FALSE Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) A mixture is not necessarily a solution. Answer: TRUE Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) If a liquid is volatile it evaporates readily. Answer: TRUE Section: Section 12.1 Learning Outcome: 12.2 Describe the energetics and intermolecular attractions associated with creating a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) A mixture of sand, sodium carbonate, and calcium oxide is a homogeneous solution. Answer: FALSE Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

11) is expected to have a greater energy of hydration than . Answer: TRUE Section: Section 12.2 Learning Outcome: 12.2 Describe the energetics and intermolecular attractions associated with creating a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) The process of surrounding solute ions with solvent molecules is called solvation. Answer: TRUE Section: Section 12.2 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) Situations of great disorder are said to have "high entropies." Answer: TRUE Section: Section 12.3 Learning Outcome: 12.4 Describe the role of entropy in forming solutions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) It is not possible to make a solution in which both the solute and the solvent are gases. Answer: FALSE Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) For most molecular solids an increase in temperature generally causes an increase in solubility. Answer: TRUE Section: Section 12.4 Learning Outcome: 12.5 Describe how temperature and pressure affect solubility of gaseous and solid solutes. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) The bends, a condition encountered by divers, is attributed to the rapid depressurized escape of nitrogen from blood to form bubbles in the blood. Answer: TRUE Section: Section 12.4 Learning Outcome: 12.5 Describe how temperature and pressure affect solubility of gaseous and solid solutes. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

17) Once the temperature of 100.°C is reached, liquid water spontaneously becomes a gas. Answer: FALSE Section: Section 12.4 Learning Outcome: 12.5 Describe how temperature and pressure affect solubility of gaseous and solid solutes. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) A hydrophobic group will be attracted to water. Answer: FALSE Section: Section 12.9 Learning Outcome: 12.2 Describe the energetics and intermolecular attractions associated with creating a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) Dry cleaning uses perchloroethane to remove grease and oil from clothes. Answer: TRUE Section: Section 12.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 20) Nonpolar solutes will usually dissolve in polar solvents. Answer: FALSE Section: Section 12.5 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 21) Polar solutes will usually dissolve in polar solvents. Answer: TRUE Section: Section 12.2 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 22) C8H18 will dissolve in CCl4. Answer: TRUE Section: Section 12.2 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) NH3 will dissolve in BF3. Answer: FALSE Section: Section 12.2 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

24) Hydrocarbons, such as pentane C5H12, are water soluble. Answer: FALSE Section: Section 12.2 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) A solution prepared by dissolving 24 g potassium sulfate in 150 mL total solution has a molarity of 0.92 M. Answer: TRUE Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 26) Molarity is defined as moles of solute per liter of solvent. Answer: FALSE Section: Section 12.5 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 27) There is no difference between the "molarity" and the "percent composition" of a given solution. Answer: FALSE Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) A 1.0 percent by mass of saline solution contains 1 g of NaCl plus 99 g of water. Answer: TRUE Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 29) A 20 percent by mass of NaOH solution is made by dissolving 5 g NaOH in 25 g water. Answer: FALSE Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 30) 25 mL of 0.2 M NaOH solution will neutralize 10 mL of 0.5 M HCl solution. Answer: TRUE Section: Section 12.7 Learning Outcome: 12.10a Perform calculations regarding reactions that occur in solution that involve reaction stoichiometry and reactant concentrations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 18 Copyright © 2015 Pearson Education, Inc.

31) 100 mL of 1.0 M KOH solution will neutralize 100 mL of 1.0 M H2SO4 solution. Answer: FALSE Section: Section 12.7 Learning Outcome: 12.10a Perform calculations regarding reactions that occur in solution that involve reaction stoichiometry and reactant concentrations. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 32) The addition of NaCl to water will decrease the freezing point. Answer: TRUE Section: Section 12.8 Learning Outcome: 12.12c Calculate vapor pressure lowering, freezing point depression, boiling point elevation, and solute molar mass for solutions via colligative property laws. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) A saline solution will boil at 100 °C. Answer: FALSE Section: Section 12.8 Learning Outcome: 12.12c Calculate vapor pressure lowering, freezing point depression, boiling point elevation, and solute molar mass for solutions via colligative property laws. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12.3 Short Answer Questions 1) How does the phrase "like dissolves like" help to explain why a solute like sodium chloride (NaCl) and a solvent like water should form a solution? Answer: Both are polar substances. Ionic compounds tend to dissolve in polar solvents. Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) What are two physical properties of water that make it an especially useful and common solvent? Answer: 1) Water is a highly polar molecule. 2) Water has the ability to form hydrogen bonds. Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Use the general rule "like dissolves like" to briefly explain why vegetable oil (nonpolar) will not dissolve in water (polar). Answer: Water and vegetable oil are not "likes." One is polar, and one is nonpolar. One should not expect that a solution of the two can be easily made. Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19 Copyright © 2015 Pearson Education, Inc.

4) Briefly, how does increasing the pressure of a gas over a given solvent increase the amount of that gas that can be dissolved in that solvent? Answer: Increasing the pressure of a gas above a solvent "forces" gas particles in between solvent particles. Section: Section 12.4 Learning Outcome: 12.5 Describe how temperature and pressure affect solubility of gaseous and solid solutes. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) If 30 grams of sodium chloride are added to 100 mL of water, will the resulting volume of the solution be less than, exactly, or greater than 100 mL? Answer: A solution made in this way will have a total volume greater than the volume of the water initially (>100 mL). Section: Section 12.5 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) What volume of a 1.05 M stock solution of HCl should be used to prepare 4.00 L of a 0.0920 M HCl solution? Answer: 350. mL Section: Section 12.5 Learning Outcome: 12.7 Calculate and then describe how to prepare a specific volume of a solution that has a specified molar concentration. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) How many moles of potassium permanganate ( ) are in 28.86 mL of a 5.2 × solution of ? Answer: 1.5 × moles Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

8) What are the three ways that "percent composition" can be described for a given solution? Answer: 1) Percent by mass, defined as mass of solute per mass of solution. 2) Percent by volume, defined as volume of solute per volume of solution. 3) Percent mass per volume, defined as mass of solute per volume of solution. Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

9) How many grams of NaOH are needed to prepare 500. mL of an aqueous solution that is 10.0% NaOH by mass? (Assume the density of such a solution to be 1.08 g/mL.) Answer: 54 g NaOH Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) How many grams of are in 2.60 L of a 1.28 M solution of ? Answer: 566 grams Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

12.4 Matching Questions Match each term in the left column with the corresponding definition that appears in the right column. A) insoluble in water, such as the nonpolar hydrocarbon tail of a detergent molecule B) soluble in water, such as the polar end of a detergent molecule C) the spherical structure formed by detergent molecules when added to water D) a measure of the disorder in a system E) a solution of two or more metals 1) micelle Section: Section 12.9 Learning Outcome: 12.13d Describe the two parts of a soap molecule and how it functions to make unlikes dissolve. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) hydrophobic Section: Section 12.9 Learning Outcome: 12.13d Describe the two parts of a soap molecule and how it functions to make unlikes dissolve. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 3) hydrophilic Section: Section 12.9 Learning Outcome: 12.13d Describe the two parts of a soap molecule and how it functions to make unlikes dissolve. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 4) alloy Section: Section 12.1 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 5) entropy Section: Section 12.3 Learning Outcome: 12.3 Define entropy and its natural tendency. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. Answers: 1) C 2) A 3) B 4) E 5) D

Match each sodium salt solution in the left column with the corresponding number of sodium ion moles that appear in the right column. A) 0.04 B) 0.02 C) 0.06 6) 100 mL of 0.2 M sodium hydroxide solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) 100 mL of 0.2 M sodium sulfate solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 8) 100 mL of 0.2 M sodium phosphate solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 9) 100 mL of 0.2 M sodium chromate solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) 100 mL of 0.2 M sodium nitrate solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) 100 mL of 0.2 M sodium hypochlorite solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 12) 100 mL of 0.2 M sodium cyanide solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 6) B 7) A 8) C 9) A 10) B 11) B 12) B

Match each of the aqueous solutions on the left with the corresponding molarity that appears in the right column. A) 1.3 M B) 0.80 M C) 4.4 M D) 2.80 M E) 0.5 M F) 0.11 M G) 0.60 M 13) 2.0 moles of glucose in solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 14) 0.70 moles NaCl in 250 mL of solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 15) 0.50 moles HCl in 375 mL of solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 16) 0.60 moles KI in 1.0 L of solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 17) 0.50 moles NaOH in 4.5 L of solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 18) 0.16 moles KOH in 2.0 x 103 mL of solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 19) 2.2 moles of sugar in 5.0 x 102 mL of solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

20) 0.90 moles HI in 1.5 L of solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 13) E 14) D 15) A 16) G 17) F 18) B 19) C 20) G Match each solution that appears in the left column with the corresponding mass of solute that appears in the right column. A) 3.9 g B) 0.15 g C) 1.07 g D) 15.6 g E) 78 g 21) 25.0 mL of 0.10 M NaCl Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 22) 3.0 x 102 mL of 1.5 M K2SO4 Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 23) 1.50 L of 0.0694 M CsOH Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 24) 800. mL of 0.050 M H2SO4 Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 25) 125 mL of 0.0250 M C12H22O11 Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 21) B 22) E 23) D 24) A 25) C

Match each mass of solute and molarity of the solution that appears in the left column with the corresponding total volume of the solution that appears in the right column. A) 2.0 L B) 1.20 L C) 0.99 L D) 10.0 mL 26) 0.15 M nickel(II) sulfate solution containing 47 g of solute Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 27) 1.10 M lead(II) nitrate solution containing 437 g of solute Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 28) 0.32 M HNO3 solution containing 20. g of solute Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 29) 0.0510 M H2SO4 solution containing 50.0 mg of solute Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 26) A 27) B 28) C 29) D

Match each sulfate salt solution in the left column with the corresponding number of sulfate ion moles that appear in the right column. Assume all salts dissolve in water. A) 0.0002 B) 0.0001 C) 0.0003 30) 500 mL of 0.0002 M sodium sulfate solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 31) 500 mL of 0.0002 M magnesium sulfate solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 32) 500 mL of 0.0002 M aluminum sulfate solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 33) 500 mL of 0.0002 M ammonium sulfate solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 34) 500 mL of 0.0002 M iron(III) sulfate solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 35) 500 mL of 0.0002 M tin(IV) sulfate solution Section: Section 12.5 Learning Outcome: 12.8 Perform calculations on solutions that make use of Molarity. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 30) B 31) B 32) C 33) B 34) C 35) A

Match each of the solutions in the left column with the corresponding w/w % of that solution that appears in the right column. A) 5.0% B) 25% C) 2.0% D) 20.% E) 40.% F) 11% 36) 20. g NaOH in 50. g of solution Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 37) 5.0 g NaCl in 25 g of solution Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 38) 2.0 g KBr in 40. g of solution Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 39) 5.0 g LiI in 250 g of solution Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 40) 15 g sugar in 60. g of solution Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 41) 1.0 g CaCl2 in 9.0 g of solution Section: Section 12.6 Learning Outcome: 12.9 Perform calculations on solutions that involve its concentration in terms of percent composition. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 36) E 37) D 38) A 39) C 40) B 41) F 28 Copyright © 2015 Pearson Education, Inc.

Match the term in the left column with the corresponding definition that appears in the right column. A) the point at which the number of moles of acid equal the number of moles of base B) a process used to find out when stoichiometrically equal quantities of an acid and a base neutralize each other C) a compound that is used to detect the end point of a titration by a color change D) a solution whose concentration is accurately known E) a piece of glassware through which a solution volume is accurately dispensed during neutralization 42) standardized solution Section: Section 12.7 Learning Outcome: 12.1 Describe a solution in terms of solvent, solute, and homogeneity. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 43) buret Section: Section 12.7 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 44) equivalence point Section: Section 12.7 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 45) indicator Section: Section 12.7 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 46) titration Section: Section 12.7 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. Answers: 42) D 43) E 44) A 45) C 46) B

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 13 When Reactants Turn into Products 13.1 Multiple Choice Questions 1) Which of the following is an exothermic reaction? A) burning propane gas in a barbecue B) burning gasoline when driving a car C) creating an explosion by detonating nitroglycerine D) All of the above are exothermic reactions. Answer: D Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 2) Which of the following is endothermic? A) melting ice B) freezing water C) dry ice formed from carbon dioxide D) condensing water vapor Answer: A Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 3) Which statement is true about the reaction energy profile? A) plots the relative energies of both the reactants and products B) plots energy on the y-axis C) traces the progress of the reaction on the x-axis D) All of the above are true. Answer: D Section: Section 13.2 Learning Outcome: 13.4 Sketch a reaction energy profile. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

4) The difference in energy between the reactants and products in a chemical reaction is called ________. A) the heat of reaction B) the activation energy C) the energy of products D) either B or C Answer: A Section: Section 13.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) If the products have a higher energy than the reactants ________. A) the reaction is exothermic B) the reaction is endothermic C) the reactants have less energy than the products D) both B and C Answer: D Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) If the reaction has a negative overall energy change, then ________. A) the reaction is exothermic B) energy is absorbed by the reactants C) the reaction is endothermic D) the products are not stable Answer: A Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) Which of the following is true about enzymes? A) They speed up reactions in a selective fashion. B) They are very large proteins. C) They contain specifically shaped pockets that fit only specific reactant molecules. D) All of the above are true. Answer: D Section: Section 13.3 Learning Outcome: 13.5 Describe what a catalyst is and how it affects a reaction's rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

8) Which of the following is an example of a substitution reaction? A) OH + → Br + -+ B) + → + + O C) 2Mg + → 2MgO D) + → 2HI Answer: A Section: Section 13.3 Learning Outcome: 13.1 Describe what a chemical reaction is in terms of mechanism, bonds broken, and bonds formed. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) Which of the following reaction coordinate diagrams represents a chemical reaction that is endothermic? A)

Answer: C Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G3 Read and interpret graphs and data.

10) Which of the following reaction coordinate diagrams represents a chemical reaction that is exothermic? A)

Answer: A Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G3 Read and interpret graphs and data.

11) Which of the following represents a reaction coordinate diagram for a chemical reaction whose ΔErxn = 0? A)

Answer: D Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G3 Read and interpret graphs and data. 12) Which of the following "adjustments" can be made to a chemical reaction system to increase the rate of reaction? A) increase the reaction temperature B) increase the concentrations of the reactants C) add a catalyst D) All of the above will increase the rate of reaction. E) None of the above will increase the rate of reaction. Answer: D Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

13) Which of the following is not a substitution reaction? A) NaOH + HCl→ NaCl + H2O B) AgNO3 + NaCl → NaNO3 + AgCl C) 2Fe + O2 → 2FeO D) CH3OH + HCl → CH3Cl + H2O Answer: C Section: Section 13.3 Learning Outcome: 13.1 Describe what a chemical reaction is in terms of mechanism, bonds broken, and bonds formed. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) Which of the following does not influence the speed of a chemical reaction? A) concentration of the reactants B) molecular mass of the reactants C) surface area of solid reactants D) temperature Answer: B Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) Consider the reaction A → B with the following data: Energy of reactants = 50 kJ/mole; Energy of products = 70 kJ/mole; Energy of transition state = 80 kJ/mole. The reaction is ________, has a heat of reaction of ________ kJ/mole, and the energy of activation is ________ kJ/mole. A) exothermic; 20; 30 B) endothermic; 20; 30 C) exothermic; 30; 20 D) endothermic; 30; 20 Answer: B Section: Section 13.3 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G4 Demonstrate the quantitative skills needed to succeed in chemistry.

16) Consider the reaction C → D with the following data: Energy of reactants = 30 kJ/mole; Energy of products = 20 kJ/mole; Energy of transition state = 60 kJ/mole. The reaction is ________, has a heat of reaction of ________kJ/mole, and the energy of activation is ________ kJ/mole. A) exothermic; -10; 30 B) endothermic; 10; 30 C) exothermic; 40; 30 D) endothermic; 40; 30 Answer: A Section: Section 13.3 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G4 Demonstrate the quantitative skills needed to succeed in chemistry. 17) Consider the reaction X → Y with the following data: Energy of reactants = 25 kJ/mole; Energy of products = 75 kJ/mole; Energy of transition state = 100 kJ/mole. The energy of activation for the reverse reaction is ________ kJ/mole. A) 25 B) 50. C) 75 D) 100 Answer: A Section: Section 13.3 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 18) Consider the reaction X → Y with the following data: Energy of reactants = 50 kJ/mole; Energy of reaction = -30 kJ/mole; Energy of transition state = 90 kJ/mole. The energy of products for the reaction is ________ kJ/mole. A) -30 B) 20 C) 30 D) 80 Answer: B Section: Section 13.3 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7 Copyright © 2015 Pearson Education, Inc.

19) In order for a chemical reaction to occur, ________. A) the reactants must be in sufficient concentration B) the products must be of lower energy than the reactants C) the reactants must be of lower energy than the products D) the reactants must possess sufficient energy to overcome the barrier of the activation energy Answer: D Section: Section 13.3 Learning Outcome: 13.3 Describe the relationship between activation energy Ea and reaction rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 20) Which of the following is not true when the temperature of the reaction mixture is decreased? A) The average kinetic energy of both the reactant and product molecules is decreased. B) The rate of the reaction is decreased. C) The fraction of reactant molecules that have a low kinetic energies is increased. D) The activation energy of the reaction is increased. Answer: D Section: Section 13.3 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) Which of the following is true about the activation energy? A) It may increase by decreasing the temperature. B) It may decrease by decreasing the temperature. C) It may increase by increasing the concentration of reactants. D) It is practically independent of both temperature and concentration of reactants. Answer: D Section: Section 13.3 Learning Outcome: 13.3 Describe the relationship between activation energy Ea and reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) If the kinetic energy of the reactant molecules is not high enough to overcome the activation energy barrier, ________. A) the reverse reaction will occur B) no reaction takes place C) the reaction will occur anyway D) the products will form at a slower rate Answer: B Section: Section 13.3 Learning Outcome: 13.3 Describe the relationship between activation energy Ea and reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

23) The energy of activation may be affected by ________. A) increasing the concentration of the reactants B) higher temperature C) decreasing the concentration of the reactants D) the presence of a catalyst Answer: D Section: Section 13.3 Learning Outcome: 13.3 Describe the relationship between activation energy Ea and reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) Which of the following is true about a catalyst? A) It increases the rate of a reaction. B) It can be used in trace amounts. C) It is not used up in the process. D) All of the above are true. Answer: D Section: Section 13.3 Learning Outcome: 13.5 Describe what a catalyst is and how it affects a reaction's rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) In a catalyzed reaction the activation energy is ________ when compared to the uncatalyzed reaction. A) identical B) less C) more D) either less or more depending on the reaction Answer: B Section: Section 13.3 Learning Outcome: 13.5 Describe what a catalyst is and how it affects a reaction's rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 26) Which of the following may be considered as biochemical catalysts? A) carbohydrates B) DNA C) enzymes D) lipids Answer: C Section: Section 13.3 Learning Outcome: 13.5 Describe what a catalyst is and how it affects a reaction's rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

27) Generally in a biochemical reaction the first step involves ________. A) the reaction of the enzyme with the active site of the substrate B) the reaction of the substrate with the active site of the enzyme C) the reaction of the substrate with the enzyme-substrate complex D) the reaction of the enzyme with the enzyme-substrate complex Answer: B Section: Section 13.3 Learning Outcome: 13.1 Describe what a chemical reaction is in terms of mechanism, bonds broken, and bonds formed. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

28) In each of the following diagrams, the x-axis is the reaction coordinate and the y-axis is the potential energy. Which diagram corresponds to a reaction that has an activation energy of 35 kJ and an overall reaction energy of -110 kJ? A)

Answer: A Section: Section 13.3 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G3 Read and interpret graphs and data.

29) In each of the following diagrams, the x-axis is the reaction coordinate and the y-axis is the potential energy. Which diagram corresponds to a reaction that has an activation energy of 40 kJ and an overall reaction energy of -125 kJ? A)

Answer: D Section: Section 13.3 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G3 Read and interpret graphs and data.

30) Which of the following can be done to increase the likelihood that a chemical reaction will take place? A) decrease the average speed of the reacting molecules B) induce more collisions between reacting molecules C) remove all the water from the reaction mixture D) break the reaction up into a series of steps Answer: B Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

31) In the diagram above, the two containers shown (Box A and Box B) have exactly the same size (volume), are held at the same temperature, and contain the same reactant molecules (dots). In which box will the rate of reaction be faster? A) Box A B) Box B C) The rate will be about the same in each box. D) There is no way to tell which will be faster from this diagram. Answer: B Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G3 Read and interpret graphs and data.

32) In the diagram above, the containers shown (Box A and Box B) contain exactly the same number of the same reactant molecules and are at the same temperature. In which box will the rate of reaction be faster? A) Box A B) Box B C) Rate is about the same in each box. D) No way to tell which is faster from this picture. Answer: B Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G3 Read and interpret graphs and data. 33) Which of the following does not affect the rate of a reaction? A) the concentration of the reactants B) the energy of activation C) the temperature D) the external pressure Answer: D Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) Which of the following is not a term involved in determining the overall rate of a chemical reaction? A) the total number of collisions per unit time B) the total number of collisions in the gas phase C) the fraction of collisions with energy greater than the activation energy D) the fraction of collisions which occur with a favorable orientation Answer: B Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

35) This factor depends on concentration and can be manipulated. A) the total number of collisions that occur per unit time B) the fraction of collisions with energy larger than the energy of activation C) the fraction of collisions with the proper orientation D) All of the above are correct. Answer: A Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) The fraction of collisions with the proper orientation depends on ________. A) the strength of the bonds that are to be broken B) the molecular shape of the molecule C) the concentration D) both A and B Answer: B Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 37) Which of the following statements is true? A) Lowering the concentration of the reactants increases the number of collisions. B) Increasing the concentration of the reactants decreases the rate of reaction. C) Increasing the collision rate increases the rate of the reaction. D) Decreasing the collision rate occurs at higher temperatures. Answer: C Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) The rate of a reaction may be increased by ________. A) increasing the concentration of reactants B) increasing the temperature C) adding a catalyst D) all of the above Answer: D Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

39) Which of the following factors could increase the reaction rate? 2A + B2 → 2AB I. decreasing the temperature II. adding a catalyst III. increasing the surface area of solid reactants A) I and II B) I, II, and III C) I and III D) II and III E) III only Answer: D Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 40) The units for the rate of a reaction are ________. A) concentration per unit of time B) concentration multiplied by the unit of time C) unit of time per unit of concentration D) One cannot say with certainty since rate laws vary from reaction to reaction. Answer: A Section: Section 13.5 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 41) If the concentration of A is doubled while the concentration of B is unchanged, the rate will ________. A (g) + 3 B (g) → C (g) + 2 D (g) Rate = k[A][B]3 A) stay the same B) be reduced by a factor of 8 C) double D) be increased by a factor of 8 Answer: C Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

42) If the concentration of B is doubled while the concentration of A is unchanged, the rate will ________. A (g) + 3B (g) → C (g) + 2D (g) Rate = k[A][B]3 A) stay the same B) be increased by a factor of 6 C) double D) be increased by a factor of 8 Answer: D Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 43) The overall order of this reaction is ________. A + B + C → Products Rate = k[A]1[B]-1[C]2 A) 2 B) 3 C) 4 D) 5 Answer: A Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 44) The overall order is ________. Rate = k[A]3[B]-1 A) -1 B) 0 C) 2 D) 3 Answer: C Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 45) The overall order is ________. Rate = k[A]2[B]1 A) -1 B) 0 C) 2 D) 3 Answer: D Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 19 Copyright © 2015 Pearson Education, Inc.

46) Doubling the concentration of A leads to doubling the rate, while doubling the concentration of B has no effect on the rate. The rate equation is, therefore, ________. A+B→C A) Rate = k[A][B] B) Rate = k[A] C) Rate = k[A]2 D) Rate = k[A]2[B] Answer: B Section: Section 13.5 Learning Outcome: 13.8 Derive a reaction's rate law from kinetic data. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 47) Doubling the concentration of A leads to doubling the rate, while doubling the concentration of B quadruples the rate. The rate equation is, therefore, ________. A+B→C 2 A) Rate = k[A][B] B) Rate = k[A] C) Rate = k[A]2 D) Rate = k[A]2[B] Answer: A Section: Section 13.5 Learning Outcome: 13.8 Derive a reaction's rate law from kinetic data. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 48) The following data was obtained at 100 °C. 2 Y (g) + X (g) → Z (g)

The rate law for this reaction is ________.. A) Rate = k[Y]2[X] B) Rate = k[Y][X]2 C) Rate = k[Y][X] D) Rate = k[Y]2[X]2 Answer: B Section: Section 13.5 Learning Outcome: 13.8 Derive a reaction's rate law from kinetic data. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

49) The following data was obtained at 100 °C. 2Y (g) + X (g) → Z (g)

The rate law for this reaction is ________. A) Rate = k[Y]2[X] B) Rate = k[Y][X]2 C) Rate = k[Y]3[X] D) Rate = k[Y]3[X]0 Answer: D Section: Section 13.5 Learning Outcome: 13.8 Derive a reaction's rate law from kinetic data. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 50) The following data was obtained at 20 °C. 2Y (g) → Z (g)

The rate law for this reaction is ________. A) Rate = k[Y]2 B) Rate = k[Y] C) Rate = k[Y]0 D) Rate = k[Y]-1 Answer: A Section: Section 13.5 Learning Outcome: 13.8 Derive a reaction's rate law from kinetic data. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

51) The following data was obtained at 20 °C. 2W (g) → V (g)

The rate law for this reaction is ________. A) Rate = k[W]2 B) Rate = k[W] C) Rate = k[W]0 D) Rate = k[W]-1 Answer: A Section: Section 13.5 Learning Outcome: 13.8 Derive a reaction's rate law from kinetic data. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 52) The following data was obtained at 20 °C. X (g) → Y (g)

The rate law for this reaction is ________. A) Rate = k[X]2 B) Rate = k[X] C) Rate = k[X]0 D) Rate = k[X]-1 Answer: C Section: Section 13.5 Learning Outcome: 13.8 Derive a reaction's rate law from kinetic data. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

53) Which of the following statements regarding reaction mechanisms is true? A) A mechanism is a series of steps whereby reactants are converted to products. B) Reaction mechanisms must be determined experimentally. C) Neither A nor B is true. D) Both A and B are true. Answer: D Section: Section 13.6 Learning Outcome: 13.1 Describe what a chemical reaction is in terms of mechanism, bonds broken, and bonds formed. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 54) Which of the following responses contains the two rate factors that comprise the rate constant (k) for a given chemical reaction? A) the temperature and the number of collisions per unit volume B) the number of collisions per unit volume and the fraction of collisions with a favorable orientation C) the number of collisions with energy greater than the activation energy and the fraction of collisions with a favorable orientation D) the number of collisions with energy greater than the activation energy and the temperature Answer: C Section: Section 13.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 55) The order of the reaction with respect to A, B, and the total order respectively is ________. A + B → Products Rate = k[A][B] A) 1, 1, 1 B) 1, 1, 2 C) 1, 2, 2 D) 1, 2, 3 Answer: B Section: Section 13.5 Learning Outcome: 13.8 Derive a reaction's rate law from kinetic data. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 56) The order of the reaction with respect to A, B, and the total order respectively is ________. A + B → Products Rate = k[A]3[B]0 A) 3, 1, 1 B) 3, 0, 2 C) 3, 0, 3 D) 3, 1, 4 Answer: C Section: Section 13.5 Learning Outcome: 13.8 Derive a reaction's rate law from kinetic data. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 23 Copyright © 2015 Pearson Education, Inc.

57) The slow step in the multistep mechanism of a reaction ________. A) controls the rate at which the products are formed B) is the only step that involves the breaking of bonds C) is equally significant in measuring the rate D) is insignificant in the formation of products Answer: A Section: Section 13.6 Learning Outcome: 13.1 Describe what a chemical reaction is in terms of mechanism, bonds broken, and bonds formed. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 58) Which of the following statements is false? A) The rate determining step is always the slowest step in a multistep mechanism. B) The rate constant always changes with a variation in temperature. C) The energy of activation affects the speed of reaction. D) The rate of a reaction is independent of the concentration of reactants. Answer: D Section: Section 13.6 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13.2 True/False Questions 1) Knowing the mechanism of a reaction is advantageous because one may influence its rate to make the reaction useful. Answer: TRUE Section: Section 13.1 Learning Outcome: 13.1 Describe what a chemical reaction is in terms of mechanism, bonds broken, and bonds formed. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) An endothermic reaction usually leads to cooling. Answer: TRUE Section: Section 13.2 Learning Outcome: 13.1 Describe what a chemical reaction is in terms of mechanism, bonds broken, and bonds formed. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 3) For chemical reactions to occur at all, "old" bonds must be broken and "new" bonds must form. Answer: TRUE Section: Section 13.2 Learning Outcome: 13.1 Describe what a chemical reaction is in terms of mechanism, bonds broken, and bonds formed. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 24 Copyright © 2015 Pearson Education, Inc.

4) For an endothermic reaction, the value for ΔErxn is a negative number. Answer: FALSE Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 5) For an exothermic reaction, the energy level of the products is lower than the energy level of the reactants.. Answer: TRUE Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 6) The reaction energy profile can tell if a reaction is exothermic or endothermic. Answer: TRUE Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 7) An exothermic reaction always leads to a release in energy. Answer: FALSE Section: Section 13.2 Learning Outcome: 13.1 Describe what a chemical reaction is in terms of mechanism, bonds broken, and bonds formed. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 8) In an exothermic reaction, more energy is absorbed on the reactant bonds breaking than is released as the product bonds form. Answer: FALSE Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 9) In an endothermic reaction, the top of the energy barrier to the products is a higher value than the top of the energy barrier to the reactants. Answer: FALSE Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

10) If the forward reaction is exothermic, the reverse is endothermic. Answer: TRUE Section: Section 13.2 Learning Outcome: 13.1 Describe what a chemical reaction is in terms of mechanism, bonds broken, and bonds formed. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 11) When the products are higher in energy than the reactants, the reaction is endothermic. Answer: TRUE Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 12) The value of Ea(reaction) is equal to the difference Ea(reactants) - Ea(products). Answer: FALSE Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 13) A catalyst need not be present in large quantities. Answer: TRUE Section: Section 13.3 Learning Outcome: 13.5 Describe what a catalyst is and how it affects a reaction's rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 14) The reaction: HCl + NaOH → H2O + NaCl is a substitution reaction. Answer: TRUE Section: Section 13.3 Learning Outcome: 13.1 Describe what a chemical reaction is in terms of mechanism, bonds broken, and bonds formed. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) Adding a catalyst increases the rate of reaction by providing the additional energy needed to overcome a large energy of activation. Answer: FALSE Section: Section 13.3 Learning Outcome: 13.5 Describe what a catalyst is and how it affects a reaction's rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 16) Enzymes serve as catalysts in biochemical reaction systems. Answer: TRUE Section: Section 13.3 Learning Outcome: 13.5 Describe what a catalyst is and how it affects a reaction's rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26 Copyright © 2015 Pearson Education, Inc.

17) A catalyst lowers the activation energy for a chemical reaction. Answer: TRUE Section: Section 13.3 Learning Outcome: 13.5 Describe what a catalyst is and how it affects a reaction's rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 18) A lower energy of activation leads to more products favored in the reaction. Answer: TRUE Section: Section 13.3 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 19) A catalyst works by providing a new mechanism, higher in energy that the original reaction. Answer: FALSE Section: Section 13.3 Learning Outcome: 13.5 Describe what a catalyst is and how it affects a reaction's rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 20) The transition state for a reaction occurs at the bottom of the energy barrier. Answer: FALSE Section: Section 13.3 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 21) The magnitude (size) of the energy of activation for the reverse reaction is exactly identical as it is for the forward reaction in an exothermic (or endothermic) process. Answer: FALSE Section: Section 13.3 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 22) A catalyst can be recovered at the end of the reaction. Answer: TRUE Section: Section 13.3 Learning Outcome: 13.5 Describe what a catalyst is and how it affects a reaction's rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 23) Reaction rates can be varied by changing either the concentrations of the reacting species or the temperature at which the reaction is carried out. Answer: TRUE Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

24) The rate constant is dependant on the activation energy and reactant orientation during a collision. Answer: TRUE Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 25) The reactants must collide with an energy greater than the energy of activation for the reaction to occur. Answer: TRUE Section: Section 13.4 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 26) The greater the concentration of the reactants, the greater the rate of the reaction. Answer: TRUE Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 27) Based on the collision theory, decreasing temperature for a reaction increases the reaction rate. Answer: FALSE Section: Section 13.4 Learning Outcome: 13.6 Describe in words and mathematically how concentration and inherent factors affects reaction rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 28) Based on the collision theory, adding a catalyst to a reaction increases the reaction rate. Answer: TRUE Section: Section 13.4 Learning Outcome: 13.5 Describe what a catalyst is and how it affects a reaction's rate. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 29) It is possible to determine a given reaction's mechanism without performing any experiments of any kind. Answer: FALSE Section: Section 13.5 Learning Outcome: 13.1 Describe what a chemical reaction is in terms of mechanism, bonds broken, and bonds formed. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

30) The rate is second order with respect to the reactant and second order overall. Rate = k[A]2 Answer: TRUE Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) The rate is second order with respect to the reactant and sixth order overall. Rate = k[A]2[B]3 Answer: FALSE Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) The rate determining step is always the fastest step. Answer: FALSE Section: Section 13.6 Learning Outcome: 13.1 Describe what a chemical reaction is in terms of mechanism, bonds broken, and bonds formed. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 13.3 Short Answer Questions 1) Calculate a value for ΔErxn for a chemical reaction, if the reactants have an energy of +300 kJ/mol and the products have an energy of +100 kJ/mol. Is this reaction exothermic or endothermic? Answer: -200 kJ/mol. Reaction is exothermic. Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 2) Calculate a value for ΔErxn for a chemical reaction if the reactants have an energy of -400 kJ/mol and the products have an energy of +100 kJ/mol. Is this reaction exothermic or endothermic? Answer: +500 kJ/mol. Reaction is endothermic. Section: Section 13.2 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

3) Examine this reaction coordinate diagram, and answer the questions that follow.

a) Estimate the value for the activation energy for this reaction. b) Calculate ΔErxn. c) Is this reaction exothermic or endothermic? Answer: a) 150 kJ/mol b) -200 kJ/mol c) Exothermic Section: Section 13.3 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G3 Global: Read and interpret graphs and data and G4 Global: Demonstrate the quantitative skills needed to succeed in chemistry.

4) Examine this reaction coordinate diagram and answer the questions that follow.

a) Estimate the value for the activation energy for this reaction. b) Calculate ΔErxn. c) Is this reaction exothermic or endothermic? Answer: a) 350 kJ/mol b) +200 kJ/mol c) Endothermic Section: Section 13.3 Learning Outcome: 13.2 Calculate DErxn and identify a reaction as exothermic (downhill in energy) or endothermic (uphill in energy). Global Obj: G3 Global: Read and interpret graphs and data and G4 Global: Demonstrate the quantitative skills needed to succeed in chemistry. 5) Compare the roles of catalysts and enzymes in chemical reactions: a) How are enzymes and catalysts similar? How are they different? b) Describe a chemical process that is aided by enzyme action. Answer: a) Both will lower the activation energy of a chemical process by providing an alternate pathway for the reaction. They differ in setting: "catalyst" is not the term generally applied to this similar action in biological or life processes. For that, the term "enzyme" is used. Catalysts are often a single chemical species of simple structure and function. Enzymes are large, complex molecules. b) The text specifically mentions that sucrose metabolism is aided by enzymatic action; although many other answers are possible here. Section: Section 13.3 Learning Outcome: 13.5 Describe what a catalyst is and how it affects a reaction's rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G8 Global: Communicate effectively in writing.

6) Industrial chemists often have their choice of catalysts to use when designing, for example, a factory that produces ammonia. Explain why biochemists studying life processes (such as protein metabolism) do not have the same variety of choices for which enzyme they would use. Answer: Enzymes are specifically designed, and shaped in such a way as to only act upon certain molecules, such as proteins, sugars, and so on, at the expense of any others. Enzymes are not as general in function as catalysts used in an industrial application. The "lock and key" mechanism is the explanation for enzyme activity. Section: Section 13.3 Learning Outcome: 13.5 Describe what a catalyst is and how it affects a reaction's rate. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G8 Global: Communicate effectively in writing. Use the table below to answer the question that follows:

7) The above data were obtained in a kinetic study of the reaction. a) Determine the orders x and y, assuming that rate = k[NO] x[Cl2]y. b) Determine the value for the rate constant, k, in Experiment 2. c) Determine the overall order of this reaction. Answer: a) x = 2 (second order in NO), y = 1 (first order in Cl2) b) k = 0.67 M-2sec-1 c) Reaction is third order overall. Section: Section 13.5 Learning Outcome: 13.8 Derive a reaction's rate law from kinetic data. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

8) Write the overall balanced equation that is consistent with the following mechanism: Step 1: Step 2:

↔ +

(fast) → 2HI (slow)

Next, give a rate law expression that is consistent with this proposed mechanism. Explain a series of three experiments that could help you to determine the values for the overall order of reaction, and the orders of the individual terms in your proposed rate law expression. Answer: I2 + H2 → 2HI rate = k[H2][I2] Any variation on the method of initial rates (known concentrations, measure rate, vary concentration of one reactant with respect to the other and measure rate) will work here. Section: Section 13.6 Learning Outcome: 13.8 Derive a reaction's rate law from kinetic data. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G8 Global: Communicate effectively in writing.

13.4 Matching Questions Match the rate of each reaction in the left column with the overall order that appears in the right column. A) 3 B) 1 C) 0 D) 2 E) 4 1) Rate = k[A]2[B]-1 Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 2) Rate = k[A]1[B]2 Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 3) Rate = k[A][B] Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 4) Rate = k[A]2[B]2 Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) Rate = k[A][B]-1 Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) Rate = k[A]3[B]0 Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) Rate = k[A]3/[B] Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 34 Copyright © 2015 Pearson Education, Inc.

8) Rate = k[A]/[B] Section: Section 13.5 Learning Outcome: 13.7 Understand the meaning of reaction orders in a rate law. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 1) B 2) A 3) D 4) E 5) C 6) A 7) D 8) C

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 14 Chemical Equilibrium 14.1 Multiple Choice Questions 1) When a reaction shows one arrow pointing from left to right, this means ________. A) the reaction has reached equilibrium B) the reaction favors the right direction C) there is practically no reactant left D) both B and C Answer: B Section: Section 14.1 Learning Outcome: 14.1 Describe equilibrium for a chemical reaction in terms of forward and reverse reaction rates. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) Which statement is true about equilibrium? A) The forward reaction rate is greater than the reverse reaction rate. B) The reverse reaction rate is greater than the forward reaction rate. C) The forward reaction rate is equal to the reverse reaction rate. D) Either A or B depending on the reaction. Answer: C Section: Section 14.1 Learning Outcome: 14.1 Describe equilibrium for a chemical reaction in terms of forward and reverse reaction rates. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Which of the following statements about the equilibrium constant is incorrect? A) If Keq > 1 the reaction favors product formation. B) If Keq > 1 the reaction does not favor product formation. C) If Keq = 1 the reaction is at equilibrium. D) If Keq < 1 the reaction does not favor product formation. Answer: B Section: Section 14.3 Learning Outcome: 14.2 Describe equilibrium for a chemical reaction in terms of its position. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

4) The equilibrium concentrations for the reaction at 300 K are [Cl2] = 0.75 M, and [PCl5] = 0.73 M. Based on the calculated value of the equilibrium constant, the reaction is ________. Cl2 (g) + PCl3 (g) PCl5 (g) A) favorable B) unfavorable C) temperature dependent D) temperature independent Answer: A Section: Section 14.3 Learning Outcome: 14.2 Describe equilibrium for a chemical reaction in terms of its position. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) Increasing the pressure will ________. 2 HCl (g) Cl2 (g) + H2 (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: C Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) Which of the following statements best describes the rate of the forward reaction as it approaches equilibrium? A) The rate increases as equilibrium is approached. B) The rate decreases as equilibrium is approached. C) The rate remains constant. D) The rate slows down, then increases, as equilibrium is approached. Answer: B Section: Section 14.2 Learning Outcome: 14.3 Explain why forward and reverse reaction rates change so as to obtain equilibrium. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) Which of the following statements is true for a chemical reaction that has not reached an equilibrium? A) The "reverse" reaction rate is zero. B) The "forward" reaction rate is zero. C) The "forward" and "reverse" reaction rates are equal. D) Both A and B are true statements. E) None of the above are true statements. Answer: E Section: Section 14.2 Learning Outcome: 14.3 Explain why forward and reverse reaction rates change so as to obtain equilibrium. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2 Copyright © 2015 Pearson Education, Inc.

8) For this chemical reaction at equilibrium: N2 (g) + 3H2 (g) 2NH3 (g) which of the following statements is true of the reaction rate? A) The forward rate is faster than the reverse rate. B) The reverse rate is faster than the forward rate. C) Both the forward and reverse rates are zero. D) The forward and reverse rates are the same. Answer: D Section: Section 14.2 Learning Outcome: 14.7 Describe an equilibrium constant in terms of the rate constants for the forward and reverse reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) For the following reaction, the equilibrium constant, Keq, is equal to 53.3. What is the concentration of I2 at equilibrium, if the concentrations of HI and are 0.212 M and 1.576 M, respectively? H2 + I2 2HI A) 1.576 M B) 0.000535 M C) 0.212 M D) 0.314 M Answer: B Section: Section 14.3 Learning Outcome: 14.4 Write the equilibrium expression constant for a chemical reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) The following chemical reaction has reached equilibrium. 2NO (g) + O2 (g) 2NO2 (g) Calculate the equilibrium constant, Keq, if the concentrations of reactants and products are 1.26 × 10-10 M for NO, 2.28 × 10-3 M for O2, and 9.32 × 10-6 M for NO2. A) 2.40 × B) 3.28 × C) 2.61 × D) 2.40 × Answer: D Section: Section 14.3 Learning Outcome: 14.5 Calculate the value of the equilibrium constant for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

11) The following chemical reaction has reached equilibrium. (g) (g) Calculate the equilibrium constant, Keq, if the concentrations of and are 0.0238 M and 0.196 M, respectively. A) 8.34 B) 346 C) 0.621 D) 1.61 Answer: D Section: Section 14.3 Learning Outcome: 14.5 Calculate the value of the equilibrium constant for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 12) For which of the following values of an equilibrium constant, Keq, would you expect the equilibrium to lie farthest to the right? A) 0.491, at 20 °C B) 1.04, at 20 °C C) 10.6, at 20 °C D) 1.46 × , at 20 °C Answer: C Section: Section 14.3 Learning Outcome: 14.6 Interpret the meaning of an equilibrium constant based on its magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) For which of the following values of an equilibrium constant, Keq, would you expect the equilibrium to lie farthest to the left? A) 0.491, at 20 °C B) 1.04, at 20 °C C) 10.6, at 20 °C D) 1.46 × , at 20 °C Answer: D Section: Section 14.3 Learning Outcome: 14.6 Interpret the meaning of an equilibrium constant based on its magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

14) Calculate the equilibrium concentration of N2 for the following reaction. + The equilibrium constant Keq is 0.055 and the concentrations of and are 1.20 M and 0.225 M, respectively. A) 0.0915 M B) 0.533 M C) 0.915 M D) 3.41 M Answer: B Section: Section 14.3 Learning Outcome: 14.4 Write the equilibrium expression constant for a chemical reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 15) The equilibrium constant is equal to which of the following? A) kforward / kreverse B) kreverse / kforward C) kforward × kreverse D) 1 / (kforward/kreverse) Answer: A Section: Section 14.3 Learning Outcome: 14.4 Write the equilibrium expression constant for a chemical reaction. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) If the value of the equilibrium constant for the forward reaction is 5.0 × 10 10, the value of the equilibrium constant for the reverse reaction is ________. A) -5.0 × 1030 B) 5.0 × 10-10 C) 2.0 × 10-11 D) 2.0 × 10-10 Answer: C Section: Section 14.3 Learning Outcome: 14.5 Calculate the value of the equilibrium constant for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 17) If the value of the equilibrium constant for the reverse reaction is 2.5 × 10-6, the value of the equilibrium constant for the forward reaction is ________. A) -2.5 × 10-6 B) 4.0 × 105 C) 2.5 × 106 D) 4.0 × 107 Answer: B Section: Section 14.3 Learning Outcome: 14.5 Calculate the value of the equilibrium constant for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5 Copyright © 2015 Pearson Education, Inc.

18) The equilibrium constant expression for the reaction is ________. N2 (g) + 3H2 (g) 2NH3 (g) A) Keq = [N2] [3H2]3 / [2NH3]2 B) Keq = [NH3]2 / [N2] [H2]3 C) Keq = [N2] [H2]3 / [NH3]2 D) Keq = [2NH3]2 / [N2] [3H2]3 Answer: B Section: Section 14.3 Learning Outcome: 14.4 Write the equilibrium expression constant for a chemical reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 19) The equilibrium constant expression for the reaction is ________. 2SO3 (g) + 2Cl2 (g) 2SO2Cl2 (g) + O2 (g) A) Keq = [SO2Cl2] [O2] / [SO3] [Cl2] B) Keq = [SO3] [Cl2] / [SO2Cl2] [O2] C) Keq = [SO2Cl2]2[O2] / [SO3]2[Cl2]2 D) Keq = [SO3]2[Cl2]2 / [SO2Cl2]2[O2] Answer: C Section: Section 14.3 Learning Outcome: 14.4 Write the equilibrium expression constant for a chemical reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 20) The equilibrium concentrations for the reaction at 673 K are [H2] = 0.63 M, [N2] = 0.45 M, and [NH3] = 0.24 M. The value of Keq is ________. N2 (g) + 3H2 (g) 2NH3 (g) A) 0.85 B) 1.18 C) 0.51 D) 1.96 Answer: C Section: Section 14.3 Learning Outcome: 14.5 Calculate the value of the equilibrium constant for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

21) The equilibrium concentrations for the reaction at 300 K are [Cl2] = 0.75 M, [PCl3] = 0.45 M, and [PCl5] = 0.73 M. The value of Keq is ________. Cl2 (g) + PCl3 (g) PCl5 (g) A) 2.2 B) 0.15 C) 0.048 D) 4.7 Answer: A Section: Section 14.3 Learning Outcome: 14.5 Calculate the value of the equilibrium constant for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 22) Consider the reaction with Kc = 0.211. Which of the following pairs of concentrations indicate that the system is not at equilibrium? N2O4 (g) 2NO2 (g) A) [N2O4] = 0.00140 M; [NO2] = 0.0172 M B) [N2O4] = 0.00280 M; [NO2] = 0.0243 M C) [N2O4] = 0.00452 M; [NO2] = 0.0309 M D) [N2O4] = 0.00840 M; [NO2] = 0.0572 M Answer: D Section: Section 14.3 Learning Outcome: 14.7 Describe an equilibrium constant in terms of the rate constants for the forward and reverse reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 23) Equal numbers of moles for A and B are added to the reaction vessel and equilibrium established. At that point ________. A + 3B 2C A) [A] < [B] B) [A] > [B] C) [A] = [B] D) One cannot say unless the equilibrium constant value is known. Answer: B Section: Section 14.3 Learning Outcome: 14.7 Describe an equilibrium constant in terms of the rate constants for the forward and reverse reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

24) Increasing the pressure will ________. 2SO2 (g) + O2 (g) 2SO3 (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: A Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) Decreasing the pressure will ________. 2SO3 (g) + 2Cl2 (g) 2SO2Cl2 (g) + O2 (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: B Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) Decreasing the volume will ________. 2SO3 (g) + 2Cl2 (g) 2SO2Cl2 (g) + O2 (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: A Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) Adding more oxygen will ________. 2SO2 (g) + O2 (g) 2SO3 (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: A Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

28) Removing product will ________. 2SO2 (g) + O2 (g) 2SO3 (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: A Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 29) Increasing the pressure will ________. 2NH3 (g) N2 (g) + 3H2 (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: B Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) Decreasing the concentration of ammonia gas will ________. 2NH3 (g) N2 (g) + 3H2 (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: B Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) Increasing the volume will ________. 2NH3 (g) N2 (g) + 3H2 (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: A Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

32) Increasing the concentration of hydrogen gas will ________. O2 (g) + 2H2 (g) 2H2O (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: A Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) Removing ammonia as soon as it is formed will ________. N2 (g) + 3H2 (g) 2NH3 (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: A Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) Adding iron(III) chloride will ________. FeCl3 (aq) + KSCN (aq) 3[Fe(SCN)6] (aq) + 3KCl (aq) yellow colorless red colorless A) turn the solution more red. B) turn the solution less red. C) turn the solution clear. D) have no effect on the color. Answer: A Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

35) Adding KSCN will ________. FeCl3 (aq) + KSCN (aq) K3[Fe(SCN)6] (aq) + 3KCl (aq) yellow colorless red colorless A) turn the solution more red. B) turn the solution less red. C) turn the solution clear. D) have no effect on the color. Answer: A Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) Adding a couple of drops of an aqueous KCl solution will ________. FeCl3 (aq) + KSCN (aq) K3[Fe(SCN)6] (aq) + 3KCl (aq) yellow colorless red colorless A) turn the solution more red. B) turn the solution less red. C) turn the solution clear. D) have no effect on the color. Answer: B Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 37) Adding H2O to the reaction vessel will ________. 2H2S (g) + 3O2 (g) 2SO2 (g) + 2H2O (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: B Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

38) Adding helium to the reaction vessel will ________. 2H2S (g) + 3O2 (g) 2SO2 (g) + 2H2O (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: C Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 39) Removing sulfur dioxide as it is formed will ________. 2H2S (g) + 3O2 (g) 2SO2 (g) + 2H2O (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: A Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 40) Increasing the pressure will ________. 2H2S (g) + 3O2 (g) 2SO2 (g) + 2H2O (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: A Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 41) Increasing the volume of the system will ________. 2H2S (g) + 3O2 (g) 2SO2 (g) + 2H2O (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: B Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

42) Which of the following will shift the equilibrium to the left? 2H2S (g) + 3O2 (g) 2SO2 (g) + 2H2O (g) A) adding sulfur dioxide B) adding hydrogen sulfide C) decreasing the pressure D) both A and C Answer: D Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) Adding excess oxygen will ________. CH4 (g) + 2O2 (g) CO2 (g) + 2H2O (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is not known Answer: A Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 44) If oxygen is removed this will ________. CH4 (g) + 2O2 (g) CO2 (g) + 2H2O (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: B Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 45) If the reaction vessel is expanded, this will ________. CH4 (g) + 2O2 (g) CO2 (g) + 2H2O (g) A) shift the reaction to the right B) shift the reaction to the left C) have no effect D) cannot be determined, since the temperature is unknown Answer: C Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

46) Which of the following will shift the reaction to the right? CH4 (g) + 2O2 (g) CO2 (g) + 2H2O (g) A) adding excess oxygen B) removing carbon dioxide as soon as it is formed C) increasing the pressure D) both A and B Answer: D Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 47) Adding a catalyst will ________. FeCl3 + KSCN K3[Fe(SCN)6] + 3KCl yellow colorless red colorless A) turn the solution red. B) turn the solution less red. C) turn the solution clear. D) have no effect on the color. Answer: D Section: Section 14.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 48) In an endothermic reaction, adding heat will ________. A) increase the amount of products B) decrease the amount of reactants C) decrease the amount of products D) both A and B Answer: D Section: Section 14.5 Learning Outcome: 14.9 Predict which way an equilibrium will shift upon heating or cooling a reaction and if the reaction is exothermic or endothermic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 49) For an endothermic reaction, lowering the temperature of the reaction will ________. A) increase the amount of products B) decrease the amount of reactants C) decrease the amount of products D) both A and B Answer: C Section: Section 14.5 Learning Outcome: 14.9 Predict which way an equilibrium will shift upon heating or cooling a reaction and if the reaction is exothermic or endothermic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

50) In an exothermic reaction, adding heat will ________. A) increase the amount of products B) decrease the amount of reactants C) decrease the amount of products D) both A and B Answer: C Section: Section 14.5 Learning Outcome: 14.9 Predict which way an equilibrium will shift upon heating or cooling a reaction and if the reaction is exothermic or endothermic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 51) For an exothermic reaction, lowering the temperature of the reaction will ________. A) increase the amount of products B) decrease the amount of reactants C) decrease the amount of products D) both A and B Answer: D Section: Section 14.5 Learning Outcome: 14.9 Predict which way an equilibrium will shift upon heating or cooling a reaction and if the reaction is exothermic or endothermic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 52) For the following endothermic reaction, what condition will increase the yield of product? N2 (g) + 2H2 (g) N2H4 (g) A) high temperature, high pressure B) high temperature, low pressure C) low temperature, high pressure D) low temperature, low pressure Answer: A Section: Section 14.5 Learning Outcome: 14.9 Predict which way an equilibrium will shift upon heating or cooling a reaction and if the reaction is exothermic or endothermic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 53) For the following exothermic reaction, what condition will increase the yield of product? C2H2 (g) + H2O (g) CH3CHO (g) A) high temperature, high pressure B) high temperature, low pressure C) low temperature, high pressure D) low temperature, low pressure Answer: C Section: Section 14.5 Learning Outcome: 14.9 Predict which way an equilibrium will shift upon heating or cooling a reaction and if the reaction is exothermic or endothermic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

54) The solubility product expression for silver(I) sulfate is ________. A) Ksp = [Ag+] [SO4-2] B) Ksp = [2 Ag+] [SO4-2] C) Ksp = [Ag+]2[SO4-2] D) Ksp = [2Ag+]2[SO4-2] Answer: C Section: Section 14.7 Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 55) If the solubility of a certain salt A2B is 1.4 × 10-4 M, the value of the solubility product will be ________. A) 2.7 × 10-12 B) 1.1 × 10-11 C) 1.6 × 10-11 D) 3.6 × 10-12 Answer: B Section: Section 14.7 Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 56) The solubility of SrF2 in water (given Ksp = 2.6 × 10-9 ) is ________. A) 4.3 × 10-4 M B) 1.2 × 10-4 M C) 7.6 × 10-5 M D) 8.7 × 10-4 M Answer: D Section: Section 14.7 Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 57) If the solubility of copper(II) sulfate is 4.9 × 10 -3 M, the solubility product is ________. A) 2.4 × 10-5 B) 9.6 × 10-5 C) 1.2 × 10-2 D) 8.7 × 10-8 Answer: A Section: Section 14.7 Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

58) If the solubility of calcium fluoride is 2.0 × 10-4 M, the solubility product value is ________. A) 1.6 × 10-12 B) 3.2 × 10-11 C) 4.0 × 10-8 D) 8.0 × 10-12 Answer: B Section: Section 14.7 Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 14.2 True/False Questions 1) At equilibrium, the concentrations of reactants and products are always exactly the same. Answer: FALSE Section: Section 14.1 Learning Outcome: 14.2 Describe equilibrium for a chemical reaction in terms of its position. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) At equilibrium, the amount of product present is always greater than the amount of reactant present. Answer: FALSE Section: Section 14.1 Learning Outcome: 14.2 Describe equilibrium for a chemical reaction in terms of its position. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 3) At equilibrium, the rate of the forward reaction is equal to the rate of the reverse reaction. Answer: TRUE Section: Section 14.1 Learning Outcome: 14.3 Explain why forward and reverse reaction rates change so as to obtain equilibrium. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 4) A reaction is approaching equilibrium when the rate of a forward reaction slows down and the rate of a reverse reaction speeds up. Answer: TRUE Section: Section 14.1 Learning Outcome: 14.3 Explain why forward and reverse reaction rates change so as to obtain equilibrium. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 5) An equilibrium condition can be achieved only when 100% of the reactants have been converted to products. Answer: FALSE Section: Section 14.1 Learning Outcome: 14.1 Describe equilibrium for a chemical reaction in terms of forward and reverse reaction rates. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 17 Copyright © 2015 Pearson Education, Inc.

6) Reducing the pressure will shift the equilibrium to the right. Cl2 (g) + 3F2 (g) ⇔ 2ClF3 (g) Answer: FALSE Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) The double arrow in a chemical reaction indicates that the equilibrium is established since the rate of the forward reaction is equal to the rate of the reverse reaction. Answer: TRUE Section: Section 14.1 Learning Outcome: 14.1 Describe equilibrium for a chemical reaction in terms of forward and reverse reaction rates. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 8) A reaction is close to equilibrium when a rapid reverse reaction slows down and a slower forward reaction speeds up. Answer: TRUE Section: Section 14.2 Learning Outcome: 14.3 Explain why forward and reverse reaction rates change so as to obtain equilibrium. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 9) The concentrations of reactants and products do not change as equilibrium is approached, only the rate at which products are formed and reactants are consumed. Answer: FALSE Section: Section 14.2 Learning Outcome: 14.3 Explain why forward and reverse reaction rates change so as to obtain equilibrium. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 10) A reaction that favors products has a Keq > 1. Answer: TRUE Section: Section 14.3 Learning Outcome: 14.6 Interpret the meaning of an equilibrium constant based on its magnitude. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 11) A product favored reaction has Keq = 1. Answer: FALSE Section: Section 14.3 Learning Outcome: 14.6 Interpret the meaning of an equilibrium constant based on its magnitude. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

12) If the value of the equilibrium constant for the forward reaction is 2.5 × 10 30, the value of the equilibrium constant for the reverse reaction is 4.0 × 10-30. Answer: FALSE Section: Section 14.3 Learning Outcome: 14.5 Calculate the value of the equilibrium constant for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 13) At 500 K, the equilibrium concentrations of each species are [PCl5] = 0.008 M, [PCl3] = 0.02 M, and [Cl2] = 0.02 M. The equilibrium constant value is 0.5. PCl5 ⇔ PCl3 + Cl2 Answer: FALSE Section: Section 14.3 Learning Outcome: 14.5 Calculate the value of the equilibrium constant for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 14) For the following reaction at 1500 K, the equilibrium concentrations of each species are, [N2] = 0.10 M, and [N2H4] = 0.10 M. The equilibrium constant value is 0.04. N2H4 (g) ⇔ 2 H2 (g) + N2 (g) Answer: TRUE Section: Section 14.3 Learning Outcome: 14.5 Calculate the value of the equilibrium constant for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 15) Among the two reactions whose equilibrium constants are 0.003 and 30, the one that will produce greater quantities of products is the one whose equilibrium constant is 30. Answer: TRUE Section: Section 14.3 Learning Outcome: 14.6 Interpret the meaning of an equilibrium constant based on its magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) If a chemical reaction at an equilibrium state is disturbed, the reaction will compensate for the disturbance in some way so that equilibrium can be restored. Answer: TRUE Section: Section 14.4 Learning Outcome: 14.3 Explain why forward and reverse reaction rates change so as to obtain equilibrium. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 17) If more reactants are added to a chemical reaction already at equilibrium, a shift to the products is required to restore an equilibrium condition. Answer: TRUE Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 19 Copyright © 2015 Pearson Education, Inc.

18) Removing ozone as soon as it is formed will shift the equilibrium to the right. 3O2 (g) ⇔ 2O3 (g) Answer: TRUE Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) Expanding the reaction vessel will shift the equilibrium to the right. 3O2 (g) ⇔ 2O3 (g) Answer: FALSE Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) Reducing the pressure will shift the equilibrium to the left. N2 (g) + 2O2 (g) ⇔ 2NO2 (g) Answer: TRUE Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) Decreasing the concentration of nitrogen will shift the equilibrium to the left. N2 (g) + 2O2 (g) ⇔ 2NO2 (g) Answer: TRUE Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) Reducing the pressure will shift the equilibrium to the right. N2 (g) + O2 (g) ⇔ 2NO (g) Answer: FALSE Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) Adding extra nickel will shift the equilibrium to the right. Ni (s) + 4CO (g) ⇔ Ni(CO)4 (g) Answer: FALSE Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

24) The equilibrium condition of a chemical reaction is not related to temperature. Answer: FALSE Section: Section 14.5 Learning Outcome: 14.10a Predict the effect on Keq when a reaction is heated or cooled. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) Changing the temperature of a reaction will not change the equilibrium value. Answer: FALSE Section: Section 14.5 Learning Outcome: 14.10a Predict the effect on Keq when a reaction is heated or cooled. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) Adding a catalyst to any reaction will always change the value of the equilibrium constant. Answer: FALSE Section: Section 14.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) If the solubility product of tin(II) carbonate is 1.03 × 10-9, the molar solubility is 3.21 × 10-5 M. Answer: TRUE Section: Section 14.7 Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 28) No reaction exists in which 100% of the reactants are consumed. Answer: TRUE Section: Section 14.7 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 29) The term "molar solubility of a salt" refers to the molar concentration of one anion (or cation) formed in an aqueous, saturated solution of that salt. Answer: TRUE Section: Section 14.7 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

14.3 Short Answer Questions 1) Write an expression for the equilibrium constant (Keq) for the following reaction. HCl (g) + H2O (l) H3O+ (aq)+ Cl- (aq) Answer: Keq = [ ][H3O+] / [HCl] Section: Section 14.3 Learning Outcome: 14.4 Write the equilibrium expression constant for a chemical reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 2) Write an expression for the equilibrium constant (Keq) for the following reaction. + (aq) NH3 (g) + H2O (l) (aq) + +] / [ Answer: Keq = [ ][ ] Section: Section 14.3 Learning Outcome: 14.4 Write the equilibrium expression constant for a chemical reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 3) Write an expression for the equilibrium constant (Keq) for the following reaction. (g) (g) Answer: Keq = [ /[ Section: Section 14.3 Learning Outcome: 14.4 Write the equilibrium expression constant for a chemical reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 4) Write an expression for the equilibrium constant (Keq) for the following reaction. (g) + (g) 2HF (g) Answer: Keq = / [ ][ ] Section: Section 14.3 Learning Outcome: 14.4 Write the equilibrium expression constant for a chemical reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) Write an expression for the equilibrium constant (Keq) for the following reaction. (g) + (g) (g) + NO (g) Answer: Keq = [ ][NO]/[ ][ ] Section: Section 14.3 Learning Outcome: 14.4 Write the equilibrium expression constant for a chemical reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) Write an expression for the equilibrium constant (Keq) for the following reaction. + (aq) + OH- (aq) (aq) + O (l) +][ Answer: Keq = [ ]/[ ] Section: Section 14.3 Learning Outcome: 14.4 Write the equilibrium expression constant for a chemical reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 22 Copyright © 2015 Pearson Education, Inc.

7) Predict the shift in the direction of the reaction for the following chemical reaction: (g) + (g) (g)+ O (g) a) if methane ( ) is added b) if carbon dioxide ( ) is added c) if water ( O) is removed Answer: a) shift right b) shift left c) shift right Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) Predict the shift in the direction of the reaction for the following chemical reaction: 4HCl (g) + (g) (g) + O (g) a) if water ( O) is added b) if chlorine ( ) is removed c) if oxygen ( ) is removed Answer: a) shift left b) shift right c) shift left Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) If

is removed from the following reaction already at equilibrium: + 2HI what would be expected to happen to the rate of the reverse reaction? Answer: The rate of the reverse reaction is not dependent on the removal of a reactant. Therefore, the rate of the reverse reaction remains unchanged. Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G4 Demonstrate the quantitative skills needed to succeed in chemistry.

10) If more

is added to the following reaction already at equilibrium:

what would be expected to happen to the rate of the forward reaction? Answer: Forward reaction rate increases as reactants are converted to products. Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) Oxygen (O2) and ozone (O3) coexist in the stratosphere and are in equilibrium with one another: a) Assuming that no other factors affect this equilibrium, if ozone ( ) is being "depleted" (somehow removed from the reaction system entirely), what is the direction of the equilibrium shift? b) What must be happening to the concentration of oxygen ( ) as a result of the equilibrium shift predicted in part a? Answer: a) With no other factors, equilibrium can only be restored by a shift to the right. b) When this shift to the right occurs, the amount of oxygen must decrease. Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G4 Demonstrate the quantitative skills needed to succeed in chemistry. 12) Predict the shift in the direction of the reaction for the following chemical reaction: + ultraviolet light a) if oxygen ( ) is added. b) if ozone ( ) is removed. c) if oxygen ( ) is removed. d) if more ultraviolet light is added. Answer: a) shift right b) shift right c) shift left d) shift right Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

13) Predict the direction in which the reaction will shift for the following reactions if the temperature is increased: a) CO + + O (exothermic) b) + 2HI (endothermic) c) CO + O + (exothermic) Answer: a) shift to the left b) shift to the right c) shift to the left Section: Section 14.5 Learning Outcome: 14.9 Predict which way an equilibrium will shift upon heating or cooling a reaction and if the reaction is exothermic or endothermic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) Predict the direction in which the reaction will shift for the following reactions if the temperature is decreased: a) + NO + (endothermic) b) + O CO + (endothermic) c) + (exothermic) Answer: a) shift left b) shift left c) shift right Section: Section 14.5 Learning Outcome: 14.9 Predict which way an equilibrium will shift upon heating or cooling a reaction and if the reaction is exothermic or endothermic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) For the following exothermic reaction: CO + OH predict the direction of the reaction if: a) temperature is decreased with the concentrations remaining the same. b) a catalyst is added with the concentrations AND temperature remaining the same. c) the concentration of is halved. Answer: a) a shift to the right b) no effect c) a shift to the left Section: Section 14.5 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products and 14.9 Predict which way an equilibrium will shift upon heating or cooling a reaction and if the reaction is exothermic or endothermic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

16) For the following endothermic reaction: C (s) + (g) 2CO (g) predict the direction of the reaction if: a) CO concentration is increased with the temperature remaining constant. b) some carbon (C) is removed with the temperature remaining constant) c) the temperature is increased with the concentrations unchanged. Answer: a) shift left b) no effect c) shift right Section: Section 14.5 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products and 14.9 Predict which way an equilibrium will shift upon heating or cooling a reaction and if the reaction is exothermic or endothermic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

14.4 Matching Questions Identify each of the equilibrium constant values in the first column as "Equilibrium lies to the right/products favored" or "Equilibrium lies to the left/reactants favored." A) Equilibrium lies to the right/ products favored B) Equilibrium lies to the left/reactants favored 1) 0.563 Section: Section 14.3 Learning Outcome: 14.6 Interpret the meaning of an equilibrium constant based on its magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) 4.23 Section: Section 14.3 Learning Outcome: 14.6 Interpret the meaning of an equilibrium constant based on its magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) 2.3 × 103 Section: Section 14.3 Learning Outcome: 14.6 Interpret the meaning of an equilibrium constant based on its magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) 4.5 × 10-2 Section: Section 14.3 Learning Outcome: 14.6 Interpret the meaning of an equilibrium constant based on its magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) 3.7 × 103 Section: Section 14.3 Learning Outcome: 14.6 Interpret the meaning of an equilibrium constant based on its magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) 2356.3 Section: Section 14.3 Learning Outcome: 14.6 Interpret the meaning of an equilibrium constant based on its magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

7) 3.1 × 10-8 Section: Section 14.3 Learning Outcome: 14.6 Interpret the meaning of an equilibrium constant based on its magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) 6.2 × 1010 Section: Section 14.3 Learning Outcome: 14.6 Interpret the meaning of an equilibrium constant based on its magnitude. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 1) B 2) A 3) A 4) B 5) A 6) A 7) B 8) A Match each reaction and its equilibrium concentrations that appear in the left column with the corresponding equilibrium constant value that appears in the right column. A) 25 B) 12.3 C) 5.0 9) N2 (g)+ 2 H2 (g) N2H4 (g) [H2] = 0.20 M, [N2] = 0.10 M, [N2H4] = 0.10 M Section: Section 14.3 Learning Outcome: 14.5 Calculate the value of the equilibrium constant for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) 2 NH3 (g) N2 (g) + 3H2 (g) [H2] = 0.420 M, [N2] = 0.600 M, [NH3] = 0.060 M Section: Section 14.3 Learning Outcome: 14.5 Calculate the value of the equilibrium constant for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) N2O5 (g) 2 O2 (g) + [N2O] = 0.50 M, [O2] = 1.0 M, [N2O5] = 0.10 M Section: Section 14.3 Learning Outcome: 14.5 Calculate the value of the equilibrium constant for a reaction. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 9) A 10) B 11) C

Predict the effect of increasing pressure in each of the reactions in the first column by choosing the appropriate direction shift in the right column. A) no effect B) right (→) C) left (←) 12) 2 SO3 (g) + 2 Cl2 (g) Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) 2 NH3 (g) N2 (g) + 3 H2 (g) Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) l2 (g) + H2 (g) 2 HI (g) Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) O2 (g) + 2F2 (g) 2 OF2 (g) Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) CH4 (g) + 2 O2 (g) Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) 2 C8H18 (g) + 25 O2 (g) Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 12) B 13) C 14) A 15) B 16) A 17) C

Predict the effect of increasing the concentration of the bolded species in each of the balanced equations in the first column by choosing the appropriate direction shift in the right column. A) left (←) B) right (→) 18) 2 SO3 (g) + 2 Cl2 (g) Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) 2 NH3 (g) N2 (g) + 3 H2 (g) Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) l2 (g) + H2 (g) 2 HI (g) Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) O2 (g) + 2 F2 (g) 2 OF2 (g) Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) CH4 (g) + 2 O2 (g) Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) 2 C8H18 (g) + 25 O2 Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 18) A 19) B 20) B 21) A 22) A 23) B

Consider the reaction: C (s) + CO2 (g) 2 CO (g) (endothermic). Match each equilibrium change described in the left column with the corresponding consequence in the right column. A) Equilibrium is shifted to the right. B) No effect on the equilibrium. C) Equilibrium is shifted to the left. 24) adding heat Section: Section 14.5 Learning Outcome: 14.9 Predict which way an equilibrium will shift upon heating or cooling a reaction and if the reaction is exothermic or endothermic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) adding a catalyst Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) adding carbon monoxide Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) adding extra carbon Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) adding extra carbon dioxide Section: Section 14.4 Learning Outcome: 14.8 Predict which way an equilibrium will shift upon a disturbance of adding or removing one or more reactants and/or products. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 29) increasing the pressure Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) cooling the mixture Section: Section 14.5 Learning Outcome: 14.9 Predict which way an equilibrium will shift upon heating or cooling a reaction and if the reaction is exothermic or endothermic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

31) expanding the reaction vessel Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) decreasing the pressure Section: Section 14.4 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 24) A 25) B 26) C 27) B 28) A 29) B 30) C 31) A 32) A

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 15 Electrolytes, Acids, and Bases 15.1 Multiple Choice Questions 1) Which of the following compounds is an electrolyte when dissolved in distilled water? A) ethyl alcohol B) sucrose C) sodium sulfate D) oxygen Answer: C Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) Which of the following acids can produce only one H3O+ ion per molecule of acid when dissolved in water, although itself has other non-ionizable hydrogens? A) hydrobromic acid B) sulfurous acid C) hypochlorous acid D) acetic acid Answer: D Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) What are the ions formed in glucose, C6H12O6? A) C6H11O6- + H+ B) C6H11O5+ + OHC) CO2 + H2O D) No ions are formed. Answer: D Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

4) Which of the following solutions would you expect not to conduct electricity? A) NaCl in water B) CO in water C) HCl in water D) in water Answer: B Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) Which of the following compounds is a strong electrolyte when dissolved in distilled water? A) sodium chloride B) sucrose C) acetone (nail polish remover) D) ethyl alcohol Answer: A Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) Which of the following acids is a triprotic acid when dissolved in water? A) hydrobromic acid B) sulfuric acid C) hypochlorous acid D) phosphoric acid Answer: D Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) Which of the following acids is a diprotic acid when dissolved in water? A) hydrobromic acid B) sulfuric acid C) hypochlorous acid D) phosphoric acid Answer: B Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

8) Which of the following acids produces more than one H 3O+ ion per molecule of acid when dissociated in water? A) hydrobromic acid B) carbonic acid C) hypochlorous acid D) acetic acid Answer: B Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) Which of the following acids does not produce more than one H3O+ ion per molecule of acid when dissociated in water? A) carbonic acid B) sulfurous acid C) phosphoric acid D) acetic acid Answer: D Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) Which of the following acids does not produce two H3O+ ion per molecule of acid when dissociated in water? A) hydriodic acid B) sulfurous acid C) sulfuric acid D) carbonic acid Answer: A Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) Which of the following compounds is a weak electrolyte when dissolved in distilled water? A) phosphoric acid B) nitric acid C) potassium chloride D) glucose Answer: A Section: Section 15.3 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

12) Which of the following acids is a strong acid? A) acetic acid B) hydrofluoric acid C) phosphoric acid D) hydrochloric acid Answer: D Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) Which of the following acids is a weak acid? A) sulfuric acid B) hydrochloric acid C) nitric acid D) carbonic acid Answer: D Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) The compound HA is an acid that is soluble in water. Which of the "beakers" below shows HA behaving as a weak acid in water? A)

D) Both A and C are weak acids in water. Answer: C Section: Section 15.3 Learning Outcome: 15.5 Describe the species present in a solution of a strong acid versus a weak acid. Global Obj: G3 Read and interpret graphs and data. 4 Copyright © 2015 Pearson Education, Inc.

15) The compound HA is an acid that is soluble in water. Which of the "beakers" below shows HA behaving as a strong acid in water? A)

Answer: B Section: Section 15.3 Learning Outcome: 15.5 Describe the species present in a solution of a strong acid versus a weak acid. Global Obj: G3 Read and interpret graphs and data. 16) Why is HF in water considered a weakly acidic solution, while HCl and HBr in water are considered strongly acidic solutions? A) HF does not dissolve in water. B) HF only partially dissociates into ions in water. C) HF has a weak conjugate base, . D) Both B and C are correct. Answer: B Section: Section 15.3 Learning Outcome: 15.3 Describe the difference between a weak and strong electrolyte in terms of equilibrium. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

17) Which of the following compounds is not a strong electrolyte when dissolved in distilled water? A) potassium chloride B) sulfuric acid C) acetic acid D) potassium hydroxide Answer: C Section: Section 15.3 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Which of the following compounds is a non-electrolyte when dissolved in distilled water? A) sodium chloride B) hydrochloric acid C) sodium hydroxide D) ethyl alcohol Answer: D Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) Which of the following compounds is not a weak electrolyte when dissolved in distilled water? A) ammonia B) acetic acid (vinegar) C) potassium chloride D) hydrogen fluoride Answer: C Section: Section 15.2 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) Which of the following acids is the strongest acid? A) acetic acid, Ka = 1.8 × 10-5 B) nitrous acid, Ka = 4.5 × 10-4 C) hydrogen peroxide, Ka = 2.4 × 10-12 D) hypochlorous acid, Ka = 3.5 × 10-8 Answer: B Section: Section 15.3 Learning Outcome: 15.3 Describe the difference between a weak and strong electrolyte in terms of equilibrium. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6 Copyright © 2015 Pearson Education, Inc.

21) Which of the following compounds is the weakest acid? A) acetic acid, Ka = 1.8 × 10-5 B) nitrous acid, Ka = 4.5 × 10-4 C) hydrogen peroxide, Ka = 2.4 × 10-12 D) hypochlorous acid, Ka = 3.5 × 10-8 Answer: C Section: Section 15.3 Learning Outcome: 15.3 Describe the difference between a weak and strong electrolyte in terms of equilibrium. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) When hydrofluoric acid is dissolved in water, the ionized species are ________. A) H3O+ and OHB) H2F- and H3O+ C) H3O+ and FD) H2F+ and OHAnswer: C Section: Section 15.3 Learning Outcome: 15.5 Describe the species present in a solution of a strong acid versus a weak acid. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) Which of the following bases produces two OH- ions per formula unit of base when dissolved in water? A) potassium hydroxide B) calcium hydroxide C) aluminum hydroxide D) ammonia Answer: B Section: Section 15.4 Learning Outcome: 15.6 Recognize bases and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) Which of the following bases produces only one OH- ion per molecule of formula unit when dissolved in water? A) potassium hydroxide B) calcium hydroxide C) aluminum hydroxide D) barium hydroxide Answer: A Section: Section 15.4 Learning Outcome: 15.6 Recognize bases and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

25) Which of the following acids could be considered an Arrhenius acid? A) HCl B) COOH + C) D) All of the above are Arrhenius acids. Answer: D Section: Section 15.4 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) Which of the following compounds could be considered an Arrhenius base? A) HCl B) COOH C) KOH D) HF Answer: C Section: Section 15.4 Learning Outcome: 15.6 Recognize bases and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) Which of the following compounds can behave both as a Bronsted-Lowry acid and a Bronsted-Lowry base? A) CH4 B) H2O C) SiH4 D) H2 Answer: B Section: Section 15.5 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) The acid in the forward reaction is ________. HCO3- + H2O → H2CO3 + OHA) HCO3B) H2O C) H2CO3 D) OHAnswer: B Section: Section 15.5 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

29) Which of the following compounds qualifies as a Bronsted-Lowry base? A) CH4 B) NH3 C) SiH4 D) H2 Answer: B Section: Section 15.5 Learning Outcome: 15.8 Describe ammonia (NH3) as a base in terms of the Bronsted-Lowry definition. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) Which of the following compounds or ions qualifies as a Bronsted-Lowry acid? A) KOH B) NH3 C) D) NH4+ Answer: D Section: Section 15.5 Learning Outcome: 15.8 Describe ammonia (NH3) as a base in terms of the Bronsted-Lowry definition. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) Which of the following compounds does not qualify as a Bronsted-Lowry base? A) CH4 B) NH3 C) PH3 D) H2O Answer: A Section: Section 15.5 Learning Outcome: 15.10a Describe a solution of a weak base in terms of the Bronsted-Lowry Definition. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 32) Which of the following compounds does not qualify as a Bronsted-Lowry acid? A) HF B) H2CO3 C) H2 D) H2O Answer: C Section: Section 15.5 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

33) Which of the following bases is a weak base? A) sodium hydroxide B) ammonium hydroxide C) lithium hydroxide D) potassium hydroxide Answer: B Section: Section 15.6 Learning Outcome: 15.6 Recognize bases and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) Which of the following bases is a strong base? A) potassium hydroxide B) ammonium hydroxide C) aluminum hydroxide D) fluoride ion Answer: A Section: Section 15.6 Learning Outcome: 15.6 Recognize bases and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 35) Which of the following bases is the weakest base? A) ammonia, Kb = 1.7 × 10-5 B) aniline, Kb = 4.2 × 10-10 C) trimethylamine, Kb = 7.4 × 10-5 D) methylamine, Kb = 4.4 × 10-4 Answer: B Section: Section 15.6 Learning Outcome: 15.6 Recognize bases and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 36) Which of the following bases is the strongest base? A) ammonia, Kb = 1.7 × 10-5 B) aniline, Kb = 4.2 × 10-10 C) trimethylamine, Kb = 7.4 × 10-5 D) methylamine, Kb = 4.4 × 10-4 Answer: D Section: Section 15.6 Learning Outcome: 15.6 Recognize bases and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

37) The base in the forward reaction is ________. NH3 + H2O → N + + OHA) N + B) H2O C) NH3 D) OHAnswer: C Section: Section 15.6 Learning Outcome: 15.8 Describe ammonia (NH3) as a base in terms of the Bronsted-Lowry definition. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) When ammonia is dissolved in water, the ionized species are ________. A) NH4+ and OHB) NH2- and H+ C) NH4+ and HD) NH2+ and HAnswer: A Section: Section 15.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 39) Acidic solutions ________. A) have a higher concentration of hydronium ions than hydroxide ions B) have a lower concentration of hydronium ions than hydroxide ions C) turn red litmus paper to blue D) colorize phenolphthalein solutions Answer: A Section: Section 15.7 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 40) Basic solutions ________. A) have a higher concentration of hydronium ions than hydroxide ions B) have a lower concentration of hydronium ions than hydroxide ions C) turn blue litmus paper to pink D) decolorize phenolphthalein solutions Answer: B Section: Section 15.7 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

41) What is the hydroxide-ion concentration of an aqueous solution having a hydrogen-ion concentration of 4.75 × mol/L? A) 2.10 × mol/L B) 5.25 × mol/L C) 4.75 × mol/L D) -4.75 × mol/L Answer: A Section: Section 15.7 Learning Outcome: 15.15f Calculate hydronium and hydroxide concentrations given the pH. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 42) Which substance is the most acidic? A) coffee B) milk C) oven cleaner D) baking soda Answer: A Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 43) Which substance is the most basic? A) blood B) milk C) household ammonia D) milk of magnesia Answer: C Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 44) Which solution is the most basic solution? A) a solution whose [H+] = 100 B) a solution whose [OH-] = 10-14 C) a solution whose pH = 0 D) All of the above have the same degree of basicity. Answer: D Section: Section 15.8 Learning Outcome: 15.14e Understand and calculate the pH of a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

45) Which solution is the most acidic solution? A) a solution whose [H+] = 10-1 B) a solution whose [OH-] = 10-10 C) a solution whose pH = 0 D) All of the above have the same degree of acidity. Answer: C Section: Section 15.8 Learning Outcome: 15.14e Understand and calculate the pH of a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 46) What is the hydrogen-ion concentration of an aqueous solution having a pH of 4.72? A) 4.72 × mol/L B) 4.72 mol/L C) 0.67 mol/L D) 1.91 × mol/L Answer: D Section: Section 15.8 Learning Outcome: 15.15f Calculate hydronium and hydroxide concentrations given the pH. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 47) What is the hydroxide-ion concentration of an aqueous solution having a pH of 4.72? A) 4.72 × mol/L B) 1.91 × mol/L C) 5.25 × mol/L D) 1.91 × mol/L Answer: C Section: Section 15.8 Learning Outcome: 15.15f Calculate hydronium and hydroxide concentrations given the pH. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 48) What is the pH of an aqueous solution having a hydrogen-ion concentration of 6.83 × mol/L? A) 6.83 B) 0.83 C) 2.17 D) 1.03 Answer: C Section: Section 15.8 Learning Outcome: 15.14e Understand and calculate the pH of a solution. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

49) What is the pOH of an aqueous solution having a hydrogen-ion concentration of 6.83 × mol/L? A) 16.17 B) 11.83 C) 2.17 D) 1.03 Answer: B Section: Section 15.8 Learning Outcome: 15.14e Understand and calculate the pH of a solution. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 50) The pH of an aqueous solution is 9.35. What is the pOH? (pH + pOH = 14 for aqueous acid/base systems). A) 4.65 B) 0.971 C) -4.65 D) 0.668 Answer: A Section: Section 15.8 Learning Outcome: 15.14e Understand and calculate the pH of a solution. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 51) The pH of blood is approximately ________. A) 5.2 B) 7.0 C) 7.4 D) 9.1 Answer: C Section: Section 15.8 Learning Outcome: 15.14e Understand and calculate the pH of a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 52) The pH of diabetic patients can be as low as ________. A) 3.2 B) 5.8 C) 6.8 D) 7.0 Answer: C Section: Section 15.8 Learning Outcome: 15.14e Understand and calculate the pH of a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

53) A drop of a full unit in the pH scale ________. A) reduces the acidity 10× B) increases the acidity 10× C) reduces the acidity 2× D) increases the acidity 2× Answer: B Section: Section 15.8 Learning Outcome: 15.13d Understand base-10 logarithms. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 54) A change in pH from 10 to 7 ________. A) increases the acidity 1000× B) reduces the acidity 3000× C) increases the acidity 3× D) increases the acidity 3000× Answer: A Section: Section 15.8 Learning Outcome: 15.13d Understand base-10 logarithms. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 55) The pH of natural rainwater is close to ________. A) 5.6 B) 6.3 C) 7.0 D) 8.2 Answer: A Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 56) Stomach juices have a pH close to ________. A) 1.5 B) 2.8 C) 4.5 D) 7.0 Answer: A Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

57) The conjugate acid of H2PO4- is ________. A) H3PO4 B) HPO42C) PO43D) H4PO4+ Answer: A Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 58) The conjugate base of H2PO4- is ________. A) H3PO4 B) HPO42C) PO43D) H4PO4+ Answer: B Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 59) The conjugate acid of HCO3- is ________. A) H2CO3 B) CO32C) CO22D) H3CO3Answer: A Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 60) The conjugate base of HCO3- is ________. A) H2CO3 B) CO32C) CO22D) H3CO3+ Answer: B Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

61) The conjugate base of ammonia is ________. A) NH2B) NHC) N3D) NH4+ Answer: A Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 62) Which of the following conjugate pairs would form a good buffer? A) HCl/ B) / O + C) / D) / Answer: C Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15.2 True/False Questions 1) A concentrated solution of a non-electrolyte such as glucose can be made to conduct electricity. Answer: FALSE Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) Deionized water can conduct electricity. Answer: FALSE Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Sucrose (table sugar) is a strong electrolyte. Answer: FALSE Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

4) An electrolyte is a substance that, when dissolved in water, yields a solution that conducts electric current. Answer: TRUE Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 5) A sodium hydroxide solution is a non-electrolyte. Answer: FALSE Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) Solid sodium chloride is a strong electrolyte. Answer: FALSE Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 7) Sodium chloride (NaCl) is considered an electrolyte because it dissolves in water into positive and negative ions. Answer: TRUE Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 8) A baking soda solution is a strong electrolyte. Answer: TRUE Section: Section 15.2 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 9) A sodium sulfate solution will not conduct an electric current. Answer: FALSE Section: Section 15.2 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18 Copyright © 2015 Pearson Education, Inc.

10) An aqueous solution of HCl is called hydrochloric acid. Answer: TRUE Section: Section 15.3 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) Hydrochloric, hypochlorous and hydrobromic acids produce only one H 3O+ ion per molecule of acid when dissolved in water. Answer: TRUE Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) Carbonic acid, phosphoric acid, and sulfuric acid can produce two H 3O+ ions per molecule of acid when dissolved in water. Answer: FALSE Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) CH3CO2H has four acidic hydrogens. Answer: FALSE Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) Sulfuric acid is a diprotic acid. Answer: TRUE Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) Acetic acid is a diprotic acid. Answer: FALSE Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Arrhenius' definition of a base is an electrolyte that contains a metal and hydroxide ions that dissociate when placed in water. Answer: TRUE Section: Section 15.4 Learning Outcome: 15.6 Recognize bases and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

17) The compound HCl is considered a Bronsted-Lowry base because it increases the concentration of when it dissociates in water. Answer: FALSE Section: Section 15.5 Learning Outcome: 15.10a Describe a solution of a weak base in terms of the Bronsted-Lowry Definition. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Water can serve both as a Bronsted-Lowry acid and Bronsted-Lowry base. Answer: TRUE Section: Section 15.5 Learning Outcome: 15.10a Describe a solution of a weak base in terms of the Bronsted-Lowry Definition. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) PH3 cannot serve as a Bronsted-Lowry base. Answer: FALSE Section: Section 15.5 Learning Outcome: 15.10a Describe a solution of a weak base in terms of the Bronsted-Lowry Definition. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) In a solution of a strong monoprotic acid in water, the hydrogen-ion concentration is approximately equal to the molarity of the acid. Answer: TRUE Section: Section 15.7 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) Approximately one out of every 555 million water molecules autoionize. Answer: TRUE Section: Section 15.7 Learning Outcome: 15.11b Describe what is meant by the autoionization of water in terms of equilibrium. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) The autodissociation of water gives pure water a pH of 4 and thus a higher concentration of than . Answer: FALSE Section: Section 15.8 Learning Outcome: 15.11b Describe what is meant by the autoionization of water in terms of equilibrium. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

23) An aqueous solution of pH 9.5 is more basic than an aqueous solution of pH 8.2. Answer: TRUE Section: Section 15.8 Learning Outcome: 15.14e Understand and calculate the pH of a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) The hydrogen-ion concentration of a solution of pOH 10.5 is 3.16 × mol/L (remember that pH + pOH = 14 for aqueous systems). Answer: TRUE Section: Section 15.8 Learning Outcome: 15.5 Describe the species present in a solution of a strong acid versus a weak acid. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 25) An aqueous solution of pOH 5 is more basic than an aqueous solution of pOH 8. Answer: TRUE Section: Section 15.8 Learning Outcome: 15.14e Understand and calculate the pH of a solution. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) The pH of natural rainwater is 5.6 due to the carbon dioxide in the atmosphere. Answer: TRUE Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) Milk is slightly basic. Answer: FALSE Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) If the pOH of a solution is 9, the [H+] = 10-5 M. Answer: TRUE Section: Section 15.8 Learning Outcome: 15.14e Understand and calculate the pH of a solution. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 29) The carbonate ( )/bicarbonate ( ) pair represents a base and its conjugate acid. Answer: TRUE Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

30) A solution of HF/ can act as a buffer. Answer: TRUE Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31) "Buffered" solutions are resistant to pH changes, even when small amounts of strong acid or base are added to them. Answer: TRUE Section: Section 15.9 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 32) A solution of HCl/ can act as a buffer. Answer: FALSE Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 33) H2PO4- is the conjugate acid of PO42-. Answer: FALSE Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 34) HPO42- is the conjugate base of H2PO4-. Answer: TRUE Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15.3 Short Answer Questions 1) What were the three main defining characteristics of acids, according to the alchemists? Answer: 1) a sour taste 2) turned litmus paper colored blue to red 3) ability to dissolve active metals by reacting with them to produce hydrogen gas Section: Section 15.1 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G8 Global: Communicate effectively in writing. 2) What were the defining characteristics of bases as known to the alchemists? Answer: 1) a bitter taste 2) turned litmus paper colored red to blue 3) formed slippery solutions when dissolved in water Section: Section 15.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G8 Global: Communicate effectively in writing. 22 Copyright © 2015 Pearson Education, Inc.

3) Write down the chemical equation for the reaction of ammonia ( ) with water. In aqueous solution, what is the formula for conjugate acid of ammonia? + is the conjugate acid of ammonia in aqueous Answer: + O→ + . solution. Section: Section 15.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G8 Global: Communicate effectively in writing. 4) What is the pH of an aqueous solution that has a hydrogen-ion concentration of 4.83 × mol/L? Answer: 8.32; by -log[ ] Section: Section 15.8 Learning Outcome: 15.14e Understand and calculate the pH of a solution. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) What is the concentration of a solution of pH 8.36? Answer: 2.29 × mol/L. Section: Section 15.8 Learning Outcome: 15.15f Calculate hydronium and hydroxide concentrations given the pH. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) The pH of an aqueous solution of acetic acid is 3.76. What is the concentration of in this solution? Answer: Otherwise known as . In this case, 5.75 × mol/L. Section: Section 15.8 Learning Outcome: 15.15f Calculate hydronium and hydroxide concentrations given the pH. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) The stomach is very sensitive to changes in pH (particularly highly acidic conditions). Suggest why aspirin, acetylsalicylic acid, causes stomach upset. What is the purpose of so-called buffered aspirin tablets? Answer: Taking aspirin automatically lowers pH in the stomach, as would ingesting any acidic substance. The gimmick behind buffered aspirin is to package in a tablet both the aspirin (the acid) and a solid mixture of compounds which form a buffer when dissolved in the stomach. The buffer action tends to resist the change in pH brought about by ingesting the aspirin, and thus minimize any stomach upset. Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G8 Global: Communicate effectively in writing.

15.4 Matching Questions Identify each of the substances that appear in the left column as an electrolyte or non-electrolyte. A) non-electrolyte B) electrolyte 1) aqueous sucrose solution Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 2) solid sodium chloride Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 3) aqueous hydrochloric acid solution Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) aqueous sodium chloride solution Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 5) aqueous sulfuric acid solution Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) gasoline Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 24 Copyright © 2015 Pearson Education, Inc.

7) aqueous baking soda solution Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 8) aqueous rubbing alcohol Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 9) pure water Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 10) sports drink Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 11) seawater Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 12) tap water Section: Section 15.1 Learning Outcome: 15.2 Recognize whether a compound is an electrolyte or not from its formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. Answers: 1) A 2) A 3) B 4) B 5) B 6) A 7) B 8) A 9) A 10) B 11) B 12) B

Match each of the acids that appear in the left column with the maximum number of H3O+ produced per molecule of acid. A) 3 B) 1 C) 2 13) hydrochloric acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) sulfuric acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) nitric acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) phosphoric acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) acetic acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) carbonic acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) sulfurous acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

20) hypochlorous acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 13) B 14) C 15) B 16) A 17) B 18) C 19) C 20) B

Identify each of the acids that appear in the left column as a strong acid or a weak acid. A) weak acid B) strong acid 21) hydrobromic acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) sulfuric acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) nitric acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) phosphoric acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) acetic acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) carbonic acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) hydrofluoric acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) hypochlorous acid Section: Section 15.3 Learning Outcome: 15.4 Recognize acids and their properties from their formula. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 21) B 22) B 23) B 24) A 25) A 26) A 27) A 28) A 28 Copyright © 2015 Pearson Education, Inc.

Identify the household products that appear in the left column as acidic or basic. A) Acidic B) Basic 29) Coffee Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 30) Blood Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 31) Milk of magnesia Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 32) Lemonade Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 33) Natural rainwater Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 34) Rainwater that falls in industrial areas Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 29 Copyright © 2015 Pearson Education, Inc.

35) Milk Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 36) Household ammonia Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. Answers: 29) A 30) B 31) B 32) A 33) A 34) A 35) A 36) B

Identify each [H3O+] / [OH-] / pH / pOH that appears in the left column as acidic or basic. A) Basic B) Acidic 37) [H3O+] = 1.2 × 10-9 Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 38) [OH-] = 1.2 × 10-8 Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 39) pH = 5.24 Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 40) pOH = 9.1 Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 41) [H3O+] = 4.2 × 10-2 Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 42) [OH-] = 1.2 × 10-4 Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 43) pH = 10.24 Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 31 Copyright © 2015 Pearson Education, Inc.

44) pOH = 3.1 Section: Section 15.8 Learning Outcome: 15.12c Describe both qualitatively and quantitatively whether an aqueous solution is acidic, neutral, or basic. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 37) A 38) B 39) B 40) B 41) B 42) A 43) A 44) A Match each substance in the left column with the corresponding fact in the right column. A) It is the conjugate base of CH3CO2H. B) It does not have a conjugate base. C) It is the conjugate acid of HCO3-. D) Its conjugate acid is HSO3-. E) Its conjugate base is CO32-. F) Its conjugate base is HSO3-. 45) HCO3Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 46) H2SO4 Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 47) ClSection: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 48) H2CO3 Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 49) CH3CO2Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 50) SO32Section: Section 15.9 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 45) E 46) F 47) B 48) C 49) A 50) D

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 16 Nuclear Chemistry 16.1 Multiple Choice Questions 1) Isotopes have ________. A) the same number of protons but different number of neutrons B) the same number of neutrons but different number of protons C) the same number protons and the same number of neutrons D) different number protons and neutrons Answer: A Section: Section 16.1 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) 16O, 17O and 18O are ________ of oxygen. A) isotopes B) isomers C) isobars D) none of the above Answer: A Section: Section 16.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Heavy water is ________. A) water that contains cations such as magnesium, ferric and calcium B) water whose hydrogens are deuterium C) water whose hydrogens carry one neutron D) both B and C Answer: D Section: Section 16.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) Which of the following particles has a mass number of 1? A) proton B) neutron C) helium D) both A and B Answer: D Section: Section 16.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

5) Which of the following particles is a nucleon? A) proton B) electron C) positron D) both A and B Answer: A Section: Section 16.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) Mass defect is ________. A) the amount of mass that is converted to energy during a nuclear reaction B) the amount of mass produced during a nuclear reaction C) the amount of energy released when an atom forms from its subatomic particles D) the amount of energy absorbed when an atom forms from its subatomic particles Answer: A Section: Section 16.1 Learning Outcome: 16.1 Understand what an atom's mass defect is and its relationship to binding energy. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 7) Binding energy is ________. A) the amount of mass that is converted to energy during a nuclear reaction B) the amount of mass produced during a nuclear reaction C) the amount of energy released when an atom forms from its subatomic particles D) the amount of energy absorbed when an atom forms from its subatomic particles Answer: C Section: Section 16.1 Learning Outcome: 16.1 Understand what an atom's mass defect is and its relationship to binding energy. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 8) Which of the following is the easiest to block from penetrating? A) alpha emissions B) beta emissions C) neutrons D) gamma rays Answer: A Section: Section 16.3 Learning Outcome: 16.4 Understand what radioactivity is and the symbols used to represent it. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

9) The n/p ratio is greater than 1 for stable isotopes, when the atomic number is larger than ________. A) 10 B) 18 C) 20 D) 24 Answer: C Section: Section 16.2 Learning Outcome: 16.2 Understand what the Band of Stability is and its relationship to the neutron to proton ratio. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 10) The only element whose most stable isotope has n/p < 1 is ________. A) hydrogen B) carbon C) oxygen D) helium Answer: A Section: Section 16.2 Learning Outcome: 16.2 Understand what the Band of Stability is and its relationship to the neutron to proton ratio. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) Which of the following half-lives is the most stable for an isotope? A) 0.015 hr B) 0.92 min C) 56 s D) 72 s Answer: D Section: Section 16.2 Learning Outcome: 16.3 Understand what half life is. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) Which of the following half-lives is the most stable for an isotope? A) 0.001 s B) 0.92 s C) 56 s D) 72 s Answer: D Section: Section 16.2 Learning Outcome: 16.3 Understand what half life is. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

13) If the half-life of an isotope is 5 hr, the amount of 20.0 g remaining after 15 hr will be ________. A) 2.5 g B) 5.0 g C) 6.67 g D) 10.0 g Answer: A Section: Section 16.2 Learning Outcome: 16.3 Understand what half life is. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 14) How long will it take for a 5.0 g tritium sample to decay down to 0.313 g? The half-life of tritium is 12 years. A) 12 yrs B) 24 yrs C) 48 yrs D) 96 yrs Answer: C Section: Section 16.2 Learning Outcome: 16.3 Understand what half life is. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 15) Which of the following does not have an atomic number of 1? A) proton B) neutron C) electron D) deuterium Answer: B Section: Section 16.3 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Which of the following has an atomic number of 0? A) proton B) neutron C) positron D) deuterium Answer: B Section: Section 16.3 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

17) Which of the following does not carry proton(s)? A) 1H B) alpha rays C) deuterium D) gamma-rays Answer: D Section: Section 16.3 Learning Outcome: 16.4 Understand what radioactivity is and the symbols used to represent it. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Which of the following does not carry neutrons? A) 1n B) alpha rays C) 1H D) deuterium Answer: C Section: Section 16.3 Learning Outcome: 16.4 Understand what radioactivity is and the symbols used to represent it. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) An alpha particle may be represented by ________. A)

B) 1n C) 4He D) 1H Answer: C Section: Section 16.3 Learning Outcome: 16.4 Understand what radioactivity is and the symbols used to represent it. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 20) An beta particle may be represented by ________. A)

B) 1n C) 4He D) 1H Answer: A Section: Section 16.3 Learning Outcome: 16.4 Understand what radioactivity is and the symbols used to represent it. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

21) An gamma particle may be represented by ________. A)

C) γ D)

Answer: C Section: Section 16.3 Learning Outcome: 16.4 Understand what radioactivity is and the symbols used to represent it. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 22) Which is the lightest among the following particles? A) proton B) neutron C) alpha particle D) beta particle Answer: D Section: Section 16.3 Learning Outcome: 16.4 Understand what radioactivity is and the symbols used to represent it. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) Which of the following particles is the heaviest? A) deuterium B) neutron C) alpha particle D) beta particle Answer: C Section: Section 16.3 Learning Outcome: 16.4 Understand what radioactivity is and the symbols used to represent it. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) The process below is an example of ________. 238U → 234Th + 4He A) alpha emission B) beta emission C) gamma emission D) neutron emission Answer: A Section: Section 16.3 Learning Outcome: 16.5 Determine the products of the various forms of radioactive decay. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

25) Which of the following is able to penetrate the easiest through human tissue? A) alpha rays B) beta rays C) neutrons D) gamma rays Answer: D Section: Section 16.3 Learning Outcome: 16.4 Understand what radioactivity is and the symbols used to represent it. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) When a neutron is transformed into a proton what else is emitted? A) a beta particle B) a gamma particle C) an alpha particle D) None of the above. Answer: A Section: Section 16.3 Learning Outcome: 16.4 Understand what radioactivity is and the symbols used to represent it. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) Which of the following transformations is not an electron capture? A) 201Hg → 201Au B) 81Rb → 81Kr C) 231Th → 231Pa D) p → n Answer: C Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 28) Which of the following transformations is not an alpha emission? A) 14C → 14N B) 225Ac → 221Fr C) 241Am → 237Np D) 208Po → 204Pb Answer: A Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

29) Which of the following is not a beta emitting reaction? A) 231Th → 231Pa B) 131I → 131Xe C) 90Sr → 90Y D) 226Ra → 222Rn Answer: D Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 30) When carbon-14 is converted to nitrogen-14 ________. A) an electron is captured B) an alpha particle is emitted C) an electron is released D) a neutron is released Answer: C Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 31) When nickel-63 is converted to copper-63 ________. A) an electron is captured B) an alpha particle is emitted C) an electron is released D) a neutron is released Answer: C Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 32) When radium-226 is converted to radon-222 ________. A) an electron is captured B) an alpha particle is emitted C) an electron is released D) a neutron is released Answer: B Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

33) The mercury-197 to gold-197 conversion is accompanied by ________. A) an electron capture B) an electron release C) an alpha emission D) a neutron capture Answer: A Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 34) When an unstable nucleus emits a beta particle ________. A) its mass number is decreased by four units B) its atomic number is decreased by two units C) its atomic number is increased by one unit D) its mass number is decreased by one unit Answer: C Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 35) When an unstable nucleus emits an alpha particle ________. A) its mass number is decreased by four units B) its atomic number is decreased by one unit C) its atomic number is increased by one unit D) its mass number is decreased by one unit Answer: A Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 36) When an unstable nucleus expels a positron ________. A) its mass number is decreased by four units B) its atomic number is decreased by one unit C) its atomic number is increased by one unit D) its mass number is decreased by one unit Answer: B Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

37) What is the missing particle in the reaction below? ? + 6Li → 2 4He (alpha particles) A) 3H B) 1H C) 2H D) 4He Answer: C Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 38) What is the missing particle in the reaction below? 1p + 0e →? A) 2p B) 1H C) 1n D) 4He Answer: C Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 39) Identify X in the reaction below. 238U + 12C → 244Cf + X A) 6 electrons B) 1 alpha particle C) 3 protons D) 6 neutrons Answer: D Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 40) Identify X in the reaction below. 27Al + 4He → X + 1n A) 31P B) 30P C) 30S D) 31Si Answer: B Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

41) Identify X in the reaction below. X + 1n → 142Ba + 91Kr + 3 1n A) 235Th B) 238U C) 235U D) 234Pa Answer: C Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 42) The main problem that nuclear reactors have when uranium-235 serves as the fuel is ________. A) the production of more neutrons that the reaction consumes B) the production of gamma rays C) the consumption of more alpha particles than the available alpha particles D) the immense amount of energy produced Answer: A Section: Section 16.5 Learning Outcome: 16.8 Understand nuclear fission, nuclear fusion, and their impact on society. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 43) Nuclear radiation is harmful because of ________. A) the high energy particles produced B) the electromagnetic radiation emitted by a nucleus during the nuclear change C) the ionizing of biological molecules D) all of the above Answer: D Section: Section 16.5 Learning Outcome: 16.8 Understand nuclear fission, nuclear fusion, and their impact on society. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 44) The reaction below is an example of ________. 12C + 12C → 24Mg A) fission B) fusion C) isotope coupling D) transmutation Answer: B Section: Section 16.5 Learning Outcome: 16.8 Understand nuclear fission, nuclear fusion, and their impact on society. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11 Copyright © 2015 Pearson Education, Inc.

45) The reaction below is an example of ________. 230U → 139Ba + 89Kr + 2 1n A) fission B) fusion C) isotope D) transmutation Answer: A Section: Section 16.5 Learning Outcome: 16.8 Understand nuclear fission, nuclear fusion, and their impact on society. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16.2 True/False 1) 12C is the most stable carbon isotope. Answer: TRUE Section: Section 16.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) The n/p > 1 ratio appears in elements whose atomic number is greater than 24. Answer: FALSE Section: Section 16.1 Learning Outcome: 16.2 Understand what the Band of Stability is and its relationship to the neutron to proton ratio. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) 40Ar, 40K and 40Ca are isotopes. Answer: FALSE Section: Section 16.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) 35Cl and 37Cl are isotopes. Answer: TRUE Section: Section 16.1 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) The larger the half-life value, the more stable the isotope. Answer: TRUE Section: Section 16.2 Learning Outcome: 16.3 Understand what half life is. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

6) A nuclear reaction involves much higher energies than a chemical reaction. Answer: TRUE Section: Section 16.2 Learning Outcome: 16.8 Understand nuclear fission, nuclear fusion, and their impact on society. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 7) An electron is an example of a nucleon. Answer: FALSE Section: Section 16.2 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 8) Isotopes with the lowest possible n/p ratio are usually the most stable. Answer: TRUE Section: Section 16.2 Learning Outcome: 16.2 Understand what the Band of Stability is and its relationship to the neutron to proton ratio. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 9) The half-life of an isotope decreases as the initial concentration decreases. Answer: FALSE Section: Section 16.2 Learning Outcome: 16.3 Understand what half life is. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 10) Both the proton and neutron have the same mass number. Answer: TRUE Section: Section 16.3 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 11) The atomic number of a neutron is 1. Answer: FALSE Section: Section 16.3 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 12) An alpha particle is neutral. Answer: FALSE Section: Section 16.3 Learning Outcome: 16.4 Understand what radioactivity is and the symbols used to represent it. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 13) A beta particle has a -1 charge. Answer: TRUE Section: Section 16.3 Learning Outcome: 16.4 Understand what radioactivity is and the symbols used to represent it. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 13 Copyright © 2015 Pearson Education, Inc.

14) The daughter isotope of 200Hg when it undergoes alpha-emission is 196Pt. Answer: TRUE Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 15) The daughter isotope of 203Po when it undergoes alpha-emission is 207Pb. Answer: FALSE Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 16) The daughter isotope of 210Po when it undergoes beta-emission is 210At. Answer: TRUE Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 17) Many radioactive nuclei release energy in the form of electromagnetic radiation, such as gamma rays. Answer: TRUE Section: Section 16.3 Learning Outcome: 16.4 Understand what radioactivity is and the symbols used to represent it. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 18) 13C is the carbon isotope used for radioactive carbon dating. Answer: FALSE Section: Section 16.4 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry and G5 Demonstrate an understanding of the impact of science on society. 19) The half life of 14C is 5,715 years. Answer: TRUE Section: Section 16.4 Learning Outcome: 16.3 Understand what half life is. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry and G5 Demonstrate an understanding of the impact of science on society. 20) A fusion reaction creates more energy than a fission reaction. Answer: TRUE Section: Section 16.5 Learning Outcome: 16.8 Understand nuclear fission, nuclear fusion, and their impact on society. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

21) A fission reaction is always endothermic. Answer: FALSE Section: Section 16.5 Learning Outcome: 16.8 Understand nuclear fission, nuclear fusion, and their impact on society. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 22) If nuclear energy is released all at once, a nuclear bomb can be created. Answer: TRUE Section: Section 16.5 Learning Outcome: 16.8 Understand nuclear fission, nuclear fusion, and their impact on society. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 23) Nuclear radiation can cause biological damage by the weakening or breaking of bonds. Answer: TRUE Section: Section 16.6 Learning Outcome: 16.8 Understand nuclear fission, nuclear fusion, and their impact on society. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry and G5 Demonstrate an understanding of the impact of science on society. 24) During the MRI procedure the human is placed in a magnetic field and radio waves are used to probe certain nuclei in the body. Answer: TRUE Section: Section 16.6 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry and G5 Demonstrate an understanding of the impact of science on society. 16.3 Short Answer Questions 1) What is the mass defect of the carbon-14 isotope (in g/mol)? Carbon-14 has an atomic mass of 14.0032 g/mol. Answer: 0.1135 g/mol Section: Section 16.1 Learning Outcome: 16.1 Understand what an atom's mass defect is and its relationship to binding energy. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 2) What is the mass defect of the lithium-9 isotope in g/mol? Lithium-9 has an atomic mass of 9.0273 g/mol. Answer: 0.0485 g/mol Section: Section 16.1 Learning Outcome: 16.1 Understand what an atom's mass defect is and its relationship to binding energy. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 15 Copyright © 2015 Pearson Education, Inc.

3) Calculate the binding energy of oxygen-16 in J/mol. This isotope has an atomic mass of 15.9949 g/mol. Answer: 1.238 x J/mol Section: Section 16.1 Learning Outcome: 16.1 Understand what an atom's mass defect is and its relationship to binding energy. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 4) Calculate the binding energy of neon-22 in J/mol. This isotope has an atomic mass of 21.9914 g/mol. Answer: 1.724 x J/mol Section: Section 16.1 Learning Outcome: 16.1 Understand what an atom's mass defect is and its relationship to binding energy. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) The half-life of chlorine-34 is 1.52 seconds. How much time will pass before a given sample of chlorine-34 decays by 60%? Answer: 2.01 seconds. Section: Section 16.2 Learning Outcome: 16.3 Understand what half life is. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) Calculate the amount of energy released when this nuclear reaction occurs inside an atomic warhead: 1n + 235U → 137Te + 97Zr + 2 1n (235U = 235.0439 g/mol; 137Te = 136.9254 g/mol; 97Zr = 96.9110 g/mol; 1n = 1.00866 g/mol) Answer: 1.790 × 1013 J/mol Section: Section 16.5 Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) Uranium-238 can capture a neutron inside a nuclear reactor (a so-called breeder reactor), producing an isotope of plutonium and two beta particles. The plutonium can then itself be used as a nuclear fuel. Write a balanced equation for the breeder reactor's production of plutonium (include isotope number) from uranium-238. Answer: 238U + 1n → 239Pu + 2 -1e Section: Section 16.5 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

8) Fusion reactors of the future hope to make use of the following reaction: 2H + 3H → 4He + 1n How much energy is released in this process (in J/mol)? (2H = 2.0141 g/mol; 3H = 3.0160 g/mol; 4He = 4.0026 g/mol; 1n = 1.00866 g/mol) Answer: 1.70 × 1012 J/mol. Section: Section 16.5 Learning Outcome: 16.8 Understand nuclear fission, nuclear fusion, and their impact on society. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. For the following nuclear reactions, supply the missing isotope, or elementary particle. 9) 22Na → ________ + +1e Answer: 22Ne Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 10) ________ → 226Rn + 4He Answer: 230Ra Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) 14N + 4He → ________ + 1H Answer: 17O Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 12) 238U + ________ → 239Np + -1e Answer: 1n Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 13) 1n + ________ → 140Ba + 90Kr + 3 1n Answer: 232U Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

14) 3H + 2H → ________ + 1n Answer: 4He Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 15) 137Nd → 24Mg + ________ Answer: 113Cd Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 16) 37Ar + -1e → ________ Answer: 37Cl Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 17) 146Sm → ________ + 142Nd Answer: 4He Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 18) 16O + 4He → ________ Answer: 20Ne Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

16.4 Matching Questions Match each of the transformations that appear in the left column with the process that appears in the right column. A) beta emission B) electron capture C) alpha emission 1) 238U → 234Th Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 2) 40K → 40Ar Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 3) 1p → 1n Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 4) 14C → 14N Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 5) 230Th → 226Ra Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) 209Bi → 209Po Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 7) 210Po → 206Pb Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

8) 197Hg → 197Au Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 9) 17F → 17O Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 1) C 2) B 3) B 4) A 5) C 6) A 7) C 8) B 9) B

Match each isotope in the left column with its location on the band of stability that appears in the right column. A) directly on B) below C) above 10) carbon-12 Section: Section 16.2 Learning Outcome: 16.2 Understand what the Band of Stability is and its relationship to the neutron to proton ratio. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) iron-56 Section: Section 16.2 Learning Outcome: 16.2 Understand what the Band of Stability is and its relationship to the neutron to proton ratio. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) hydrogen-1 Section: Section 16.2 Learning Outcome: 16.2 Understand what the Band of Stability is and its relationship to the neutron to proton ratio. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) calcium-40 Section: Section 16.2 Learning Outcome: 16.2 Understand what the Band of Stability is and its relationship to the neutron to proton ratio. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) uranium-238 Section: Section 16.2 Learning Outcome: 16.2 Understand what the Band of Stability is and its relationship to the neutron to proton ratio. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) cobalt-60 Section: Section 16.2 Learning Outcome: 16.2 Understand what the Band of Stability is and its relationship to the neutron to proton ratio. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 10) A 11) A 12) B 13) A 14) C 15) A

Match each of the isotopes that appear in the left column with the corresponding mechanism that provides a more stable product (a p/n ratio closer to 1) that appears in the right column. A) alpha emission B) beta emission 16) protactinium-234 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) radium-226 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) uranium-238 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) bismuth-214 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 16) B 17) A 18) A 19) B

Match each of the isotopes that appear in the left column with the daughter isotope produced via an alpha-emission. A) thorium-234 B) flerovium-286 C) radon-220 D) lead-206 E) bohrium-262 F) meitnerium-275 20) uranium-238 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 21) radium-224 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 22) livermorium-290 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 23) meitnerium-266 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 24) polonium-210 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 25) roentgenium-279 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 20) A 21) C 22) B 23) E 24) D 25) F

Match each of the isotopes that appear in the left column with the daughter isotope produced via a beta-emission. A) molybdenum-96 B) beryllium-9 C) francium-223 D) protactinium-234 E) fluorine-19 26) radon-223 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 27) lithium-9 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 28) thorium-234 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 29) niobium-96 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 30) oxygen-19 Section: Section 16.3 Learning Outcome: 16.6 Write and balance nuclear reactions. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. Answers: 26) C 27) B 28) D 29) A 30) E

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 17 The Chemistry of Carbon 17.1 Multiple Choice Questions 1) The ability of carbon to connect and link together is called ________. A) isomerism B) allotropism C) catenation D) ring formation Answer: C Section: Section 17.1 Learning Outcome: 17.1 Understand the allotropes of carbon and the ability of the carbon atom to catenate to form hydrocarbons. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) Which of the following are allotropes of carbon? A) fullerene B) diamond C) graphite D) All of the above are allotropes of carbon. Answer: D Section: Section 17.1 Learning Outcome: 17.1 Understand the allotropes of carbon and the ability of the carbon atom to catenate to form hydrocarbons. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 3) Which of the following line drawings represents an unsaturated hydrocarbon? A) B) C)

Answer: B Section: Section 17.2 Learning Outcome: 17.3 Draw and interpret line drawings of hydrocarbon molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

4) Which of the following hydrocarbon molecules is the most unsaturated? (Think also: Which of the following needs to have the most hydrogens added to achieve saturation?) A)

B) C) D)

Answer: A Section: Section 17.2 Learning Outcome: 17.3 Draw and interpret line drawings of hydrocarbon molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

5) In the above compounds, how many more hydrogen atoms would you need to add to the hydrocarbon line drawing on the left in order to fully saturate it like the compound on the right? A) 4 B) 2 C) 6 D) 5 Answer: A Section: Section 17.2 Learning Outcome: 17.3 Draw and interpret line drawings of hydrocarbon molecules. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 6) Petroleum ________. A) is mostly a mixture of compounds that are composed of carbon and hydrogen B) is mostly a mixture of compounds that are covalent C) is the source of many polymers, fertilizers, insecticides, and plastics D) All of the above apply to petroleum. Answer: D Section: Section 17.2 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

7) Which of the following unbranched hydrocarbons is not saturated? A) C6H14 B) C10H22 C) C9H16 D) C16H34 Answer: C Section: Section 17.2 Learning Outcome: 17.1 Understand the allotropes of carbon and the ability of the carbon atom to catenate to form hydrocarbons. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) Which of the following unbranched/acyclic hydrocarbons is saturated? A) C6H14 B) C10H20 C) C12H22 D) C5H10 Answer: A Section: Section 17.2 Learning Outcome: 17.1 Understand the allotropes of carbon and the ability of the carbon atom to catenate to form hydrocarbons. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) Which of the following unbranched/acyclic hydrocarbons will only have one double bond? A) C6H14 B) C10H20 C) C12H22 D) C5H8 Answer: B Section: Section 17.2 Learning Outcome: 17.1 Understand the allotropes of carbon and the ability of the carbon atom to catenate to form hydrocarbons. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) Which of the following unbranched/acyclic hydrocarbons may have a triple bond? A) C6H14 B) C10H20 C) C12H22 D) C5H10 Answer: C Section: Section 17.2 Learning Outcome: 17.1 Understand the allotropes of carbon and the ability of the carbon atom to catenate to form hydrocarbons. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

11) Which of the following unbranched/acyclic hydrocarbons may have three double bonds? A) C6H10 B) C10H16 C) C12H22 D) C5H12 Answer: B Section: Section 17.2 Learning Outcome: 17.1 Understand the allotropes of carbon and the ability of the carbon atom to catenate to form hydrocarbons. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) The number of possible isomers of molecular C5H12 is ________. A) 2 B) 3 C) 4 D) 5 Answer: B Section: Section 17.3 Learning Outcome: 17.4 Understand and recognize isomers. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 13) Which of the following names is incorrect? A) 1-hexene B) 2-hexene C) 3-hexene D) 4-hexene Answer: D Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) Which of the following formulas may be attributed to an alkyne? A) C4H8O B) C4H10O C) C4H8O2 D) C4H6 Answer: D Section: Section 17.3 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

15) Which of the following is a hydrocarbon? A) C4H8O B) C4H10O C) C4H8O2 D) C4H6 Answer: D Section: Section 17.3 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) The IUPAC name of C5H12 in a straight chain is ________. A) ethane B) butane C) hexane D) pentane Answer: D Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) The IUPAC name of C3H4 is ________. A) propane B) butene C) propyne D) propene Answer: C Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) What is the chemical formula of 2,3-dimethylhexane? A) C6H14 B) C7H18 C) C8H18 D) C6H18 Answer: C Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

19) Which straight chain hydrocarbon has the lowest boiling point? A) C6H14 B) C4H10 C) C2H6 D) C3H8 Answer: C Section: Section 17.4 Learning Outcome: 17.6 Understand the basic properties of hydrocarbon molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

20) In aspirin, a carboxylic acid whose structure is shown above, which labeled H atom is the one that is acidic (makes the entire structure one of the carboxylic acid subclass)? A) B) C) D) Answer: B Section: Section 17.5 Learning Outcome: 17.9 Understand some of the properties bestowed on functionalized hydrocarbons by the functional group. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) Which compounds typically have an unpleasant smell? A) amines B) esters C) alcohols D) ethers Answer: A Section: Section 17.5 Learning Outcome: 17.9 Understand some of the properties bestowed on functionalized hydrocarbons by the functional group. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

22) Chloroalkanes (R-X) have roles in which of the following applications or processes? A) As "nonstick" coatings and films B) As refrigerants C) As destroyers of the ozone layer D) All of the above Answer: D Section: Section 17.5 Learning Outcome: 17.9 Understand some of the properties bestowed on functionalized hydrocarbons by the functional group. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 23) Ethers were once used extensively as ________. A) antibiotics (germ-killers) B) paint thinners C) fuel for automobiles D) anesthetics Answer: D Section: Section 17.5 Learning Outcome: 17.9 Understand some of the properties bestowed on functionalized hydrocarbons by the functional group. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 24) People put lemon juice, a source of citric acid, on fish to quench the "fishy" smell, even on perfectly good fish fillets. What type of chemical reaction is occurring when people are quenching the fishy smell by adding lemon juice? A) an oxidation-reduction reaction B) a double displacement reaction C) an acid-base reaction D) a single displacement reaction Answer: C Section: Section 17.5 Learning Outcome: 17.9 Understand some of the properties bestowed on functionalized hydrocarbons by the functional group. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

25) Which of the following formulas may be attributed to a ketone? A) C4H8O B) C4H10O C) C4H8O2 D) C4H6 Answer: A Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) Which of the following formulas may be attributed to a carboxylic acid? A) C4H8O B) C4H10O C) C4H8O2 D) C4H6 Answer: C Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 27) Which of the following formulas may be attributed to an amine? A) C4H10S B) CH5N C) C4H8O2 D) C4H6 Answer: B Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 28) Which of the following formulas may be attributed to an UNSATURATED alcohol? A) C4H8O B) C4H10O C) C4H8O2 D) C4H6 Answer: B Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

29) What is the chemical formula for methanol? A) CH3OH B) CH3OCH3 C) CH3CH2OH D) CH3NH2 Answer: A Section: Section 17.5 Learning Outcome: 17.8 Assign functionalized hydrocarbons a name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 30) Which of the following is not classified as a functional group? A) the C O of an aldehyde B) the -COOH of a carboxylic acid C) the CH3 of an alkane D) the -OH of an alcohol Answer: C Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17.2 True / False Questions 1) Unlike carbon, nitrogen has the potential of bonding to other atoms of itself, but cannot form long chains of nitrogen. Answer: TRUE Section: Section 17.1 Learning Outcome: 17.1 Understand the allotropes of carbon and the ability of the carbon atom to catenate to form hydrocarbons. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) Carbon always forms four bonds in a compound. Answer: TRUE Section: Section 17.1 Learning Outcome: 17.1 Understand the allotropes of carbon and the ability of the carbon atom to catenate to form hydrocarbons. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 3) No other element in the periodic table is able to covalently bond with other atoms of its own kind as extensively as carbon. Answer: TRUE Section: Section 17.1 Learning Outcome: 17.1 Understand the allotropes of carbon and the ability of the carbon atom to catenate to form hydrocarbons. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

4) Diamond is a hydrocarbon. Answer: FALSE Section: Section 17.1 Learning Outcome: 17.1 Understand the allotropes of carbon and the ability of the carbon atom to catenate to form hydrocarbons. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 5) When making models of n-octane, the chain appears to be linear. Answer: FALSE Section: Section 17.2 Learning Outcome: 17.6 Understand the basic properties of hydrocarbon molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) The H-C-H angle in alkanes is 109.5°. Answer: TRUE Section: Section 17.2 Learning Outcome: 17.6 Understand the basic properties of hydrocarbon molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) There are three possible isomers of molecular formula C4H10. Answer: FALSE Section: Section 17.2 Learning Outcome: 17.4 Understand and recognize isomers. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) The IUPAC name for C4H8 as a straight chain is butane. Answer: FALSE Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) Octane has a lower boiling point than decane. Answer: TRUE Section: Section 17.4 Learning Outcome: 17.6 Understand the basic properties of hydrocarbon molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) C Br is an alkyl halide. Answer: TRUE Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

11) C N is a primary amine. Answer: TRUE Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) All amines contain a nitrogen atom. Answer: TRUE Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 13) The general formula for an ether is R-O-R. Answer: TRUE Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) Organic amines are acidic. Answer: FALSE Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) The formula C5H10O may be applicable to an aldehyde or a ketone. Answer: TRUE Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) The formula C2H6O may be attributed to an alcohol or an ether. Answer: TRUE Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

17) The formula C5H10O may be attributed to a carboxylic acid. Answer: FALSE Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Methanol is the compound used in automobile radiators as antifreeze. Answer: FALSE Section: Section 17.5 Learning Outcome: 17.9 Understand some of the properties bestowed on functionalized hydrocarbons by the functional group. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 19) 1-propanol is the formula for rubbing alcohol. Answer: FALSE Section: Section 17.5 Learning Outcome: 17.9 Understand some of the properties bestowed on functionalized hydrocarbons by the functional group. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 20) Ethanol may be obtained via the fermentation of grains. Answer: TRUE Section: Section 17.5 Learning Outcome: 17.9 Understand some of the properties bestowed on functionalized hydrocarbons by the functional group. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society.

17.3 Short Answer Questions 1) How many carbon atoms are there in the longest possible continuous chain in the following molecule?

Answer: There are 9. Section: Section 17.3 Learning Outcome: 17.3 Draw and interpret line drawings of hydrocarbon molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) How many carbon atoms are there in the longest possible continuous chain in the following molecule?

Answer: There are 12. Section: Section 17.3 Learning Outcome: 17.3 Draw and interpret line drawings of hydrocarbon molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) How many carbon atoms are there in the longest possible continuous chain in the following molecule?

Answer: There are 7. Section: Section 17.3 Learning Outcome: 17.3 Draw and interpret line drawings of hydrocarbon molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) Give a line drawing of Answer:

Section: Section 17.3 Learning Outcome: 17.3 Draw and interpret line drawings of hydrocarbon molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

5) Give a line drawing of Answer:

Section: Section 17.3 Learning Outcome: 17.3 Draw and interpret line drawings of hydrocarbon molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) The hydrocarbon benzene has the formula

, and a line drawing that looks like this:

How many additional hydrogen atoms are needed to fully saturate this structure? Answer: 6 will be needed. Section: Section 17.3 Learning Outcome: 17.3 Draw and interpret line drawings of hydrocarbon molecules. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 7) Given this hydrocarbon line drawing, state its IUPAC name:

Answer: 3-ethyl-5-methylheptane or 5-ethyl-3-methylheptane Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) Given this hydrocarbon line drawing, state its IUPAC name:

Answer: 2,2,4,4-tetramethylpentane Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) Given this hydrocarbon line drawing, state its IUPAC name:

Answer: 2,3-dimethyl-2-butene Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

10) Construct a line drawing for the hydrocarbon whose IUPAC name is 2,2,4-trimethylpentane. Answer:

Answer: 1-chloro-3,4-dimethylpentane Section: Section 17.5 Learning Outcome: 17.8 Assign functionalized hydrocarbons a name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

15) Give the IUPAC name of this compound:

Answer: 1-bromo-2,5-dimethylheptane Section: Section 17.5 Learning Outcome: 17.8 Assign functionalized hydrocarbons a name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Give the IUPAC name for this alcohol:

Answer: 2-propanol or isopropyl alcohol Section: Section 17.5 Learning Outcome: 17.8 Assign functionalized hydrocarbons a name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) Give the IUPAC name for this alcohol:

Answer: 6-methylheptan-3-ol or 6-methyl-3-heptanol Section: Section 17.5 Learning Outcome: 17.8 Assign functionalized hydrocarbons a name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) Give a systemic name for this compound: Answer: methyl propyl ether (1-methoxypropane is the IUPAC name.) Section: Section 17.5 Learning Outcome: 17.8 Assign functionalized hydrocarbons a name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) Give the IUPAC name for this compound:

Answer: diisopropyl ether 2-isopropoxypropane is the IUPAC name.) Section: Section 17.5 Learning Outcome: 17.8 Assign functionalized hydrocarbons a name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

20) Draw the structure of butanal. Answer:

Section: Section 17.5 Learning Outcome: 17.8 Assign functionalized hydrocarbons a name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) 1,4-diaminobenzene is one component used to make Kevlar, which is then used in bulletproof vests. Draw the line structure of 1,4-diaminobenzene. Remember that benzene has the structure:

Labeling of carbons begins at "1" in the "12 o'clock" position and proceeds clockwise. Answer:

Answer: 2-butanone Section: Section 17.5 Learning Outcome: 17.8 Assign functionalized hydrocarbons a name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) Give the IUPAC name for the compound whose line drawing structure is:

Answer: 3-methylpentanal Section: Section 17.5 Learning Outcome: 17.8 Assign functionalized hydrocarbons a name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

24) Circle and identify the organic functional groups in the following molecule:

Answer: Contains an alcohol and an ether Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 25) Circle and identify the organic functional groups in the following molecule:

Answer: Contains a ketone and an alcohol Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26) Circle and identify the organic functional groups in the following molecule:

Answer: Two carboxylic acid groups Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

27) Match the molecular formula in the left column with the corresponding alcohol in the middle column and the appropriate application in the right column. Molecular Formula 1. CH3CH2OH 2. CH3OH 3. HOCH2CH2OH 4. (CH3)2CHOH

Alcohol A- ethylene glycol B- methanol C- 2-propanol D- ethanol

Application I- wood alcohol II- antifreeze used in autos III- alcohol found in liquor IV- rubbing alcohol

Answer: 1-D-III; 2-B-I; 3-A-II; 4-C-IV Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

17.4 Matching Questions Match the name of each alkane in the left column with the condensed formula that appears in the right column. A) CH4 B) CH3CH2CH2CH2CH2CH3 C) CH3CH2CH2CH2CH3 D) CH3CH2CH2CH3 E) CH3CH3 F) CH3CH2CH3 1) methane Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) pentane Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) propane Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) ethane Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) butane Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) hexane Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 1) A 2) C 3) F 4) E 5) D 6) B

Match the name of each alkene in the left column with the condensed formula that appears in the right column. A) CH3CH2CH=CHCH2CH3 B) CH2=CHCH2CH2CH2CH3 C) CH3CH=CHCH3 D) CH3CH=CHCH2CH3 E) CH2=CHCH3 F) CH3CH=CHCH2CH2CH3 G) CH2=CHCH2CH2CH3 H) CH2=CHCH2CH3 I) CH2=CH2 7) 1-pentene Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) propene Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 9) 2-butene Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) ethene Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 11) 2-hexene Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) 2-pentene Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

13) 3-hexene Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) 1-butene Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) 1-hexene Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 7) G 8) E 9) C 10) I 11) F 12) D 13) A 14) H 15) B

Match the name of each alkyne in the left column with the condensed formula that appears in the right column. A) CH3CH2C≡CCH2CH3 B) HC≡CCH2CH2CH3 C) CH3C≡CCH3 D) CH3C≡CH E) HC≡CCH2CH2CH2CH3 F) CH3C≡CCH2CH3 G) CH3C≡CCH2CH2CH3 H) HC≡CH I) HC≡CCH2CH3 16) 1-hexyne Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 17) 1-pentyne Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) propyne Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 19) ethyne Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) 3-hexyne Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 21) 2-pentyne Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

22) 2-butyne Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) 1-butyne Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) 2-hexyne Section: Section 17.3 Learning Outcome: 17.5 Assign hydrocarbon molecules an IUPAC name. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 16) E 17) B 18) D 19) H 20) A 21) F 22) C 23) I 24) G

Match each formula in the left column to the corresponding organic family in the right column. A) alcohol B) carboxylic acid C) alkyl halide D) ketone E) amine 25)

Section: Section 17.5 Learning Outcome: 17.7 Recognize the various functional groups often present in functionalized hydrocarbons and how they are named. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 26)

29)

Introductory Chemistry: Atoms First, 5e (Russo/Silver) Chapter 18 Synthetic and Biological Polymers 18.1 Multiple Choice Questions 1) The monomer used in making PVC is ________. A) chloroethene B) chloroethane C) chloroethyne D) chlorbenzene Answer: A Section: Section 18.2 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) Which of the following is made out of PVC? A) tiles B) raincoats C) plumbing pipes that carry sewage D) all of the above Answer: D Section: Section 18.2 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) The monomer used to make Teflon is ________. A) tetrafluoroethane B) tetrafluoroethene C) tetrafluorooctane D) tetrafluorobenzene Answer: B Section: Section 18.2 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) Which is/are the starting reagent(s) required for the synthesis of Nylon 66? A) hexanedioic acid chloride B) 1,6-diaminohexane C) vinyl chloride D) both A and B Answer: D Section: Section 18.3 Learning Outcome: 18.3 Know the monomers used to make nylon and how they polymerize via formation of an amide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

5) The bond found between the monomers in Nylon-66 is a(n) ________ bond. A) amide B) ester C) ketone D) alcohol Answer: A Section: Section 18.3 Learning Outcome: 18.3 Know the monomers used to make nylon and how they polymerize via formation of an amide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) Which of the following is a polysaccharide? A) sucrose B) starch C) glucose D) DNA Answer: B Section: Section 18.4 Learning Outcome: 18.4 Understand what monosaccharides, disaccharides, polysaccharides such as starch and cellulose, and carbohydrates are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills and G5 Demonstrate an understanding of the impact of science on society. 7) What is the repeating monomer found in cellulose? A) glucose B) fructose C) sucrose D) amylose Answer: A Section: Section 18.4 Learning Outcome: 18.4 Understand what monosaccharides, disaccharides, polysaccharides such as starch and cellulose, and carbohydrates are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 8) What two functional groups are found at the ends of any protein structure? A) alcohol and amine B) amine and carboxylic acid C) alcohol and carboxylic acid D) amine and aldehyde Answer: B Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

9) Which of the following amino acids has more than one amine group? A) lysine B) alanine C) glycine D) glutamic acid Answer: A Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) The number of amino acids that are used to build all proteins is ________. A) 4 B) 10 C) 20 D) 30 Answer: C Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry. 11) The name of the bond that combines two amino acids together is called ________. A) peptide B) glycoside C) acetal D) ketal Answer: A Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) The number of amino acids that a human body cannot synthesize is ________. A) 5 B) 10 C) 15 D) 20 Answer: B Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G4 Demonstrate the quantitative skills needed to succeed in chemistry.

13) The essential amino acids are ________. A) the amino acids that make all proteins known on earth B) the amino acids that the body can synthesize C) the amino acids that the body cannot synthesize D) the amino acids that get metabolized Answer: C Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 14) The term used to describe a substance with a medium number of amino acids is ________. A) peptide B) polypeptide C) protein D) polymer Answer: B Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 15) In sickle-cell anemia patients, ________ type(s) of amino acid has been replaced by another amino acid. A) 1 B) 5 C) 10 D) all Answer: A Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 16) Which of the following is not an amino acid? A) threonine B) tyrosine C) thymine D) lysine Answer: C Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

17) Which of the following is not an amine base present in DNA? A) thymine B) alanine C) cytosine D) guanine Answer: B Section: Section 18.6 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 18) DNA molecules, as found in human cells, are best described as ________. A) a large, single-stranded molecule made of proteins B) a large, double-stranded molecule that contains phosphate groups, carbohydrate units, and bases from amino acids C) a polysaccharide D) a large, double-stranded molecule made of amino acids Answer: B Section: Section 18.6 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 19) Which of the following statements about a DNA molecule is incorrect? A) All DNA molecules are made from a repeating unit consisting of a phosphate group, a sugar group, and an amine base. B) Complementary base pairs in DNA molecules are held together by hydrogen bonds. C) Normal DNA is double-stranded and helical in shape. D) Complementary bases in DNA molecules are held together by covalent bonds. Answer: D Section: Section 18.6 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 20) Which of the following may be classified as a natural biopolymer? A) starch B) protein C) DNA D) all of the above Answer: D Section: Section 18.6 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

21) Which of the following does not appear in a DNA strand? A) deoxyribose sugar B) phosphate C) amino acids D) amine base Answer: C Section: Section 18.6 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 22) Which of the following nucleic acids is not found in DNA? A) guanine B) uracil C) cytosine D) adenine Answer: B Section: Section 18.6 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 23) What is the biomolecule found in the shell of a virus? A) carbohydrate B) DNA C) fatty acid D) protein Answer: D Section: Section 18.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 24) What is the complementary DNA strand of ATCGATT? A) ATCGATT B) TTAGCTA C) CGATCGG D) TAGCTAA Answer: D Section: Section 18.6 Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

18.2 True/False Questions 1) Polymers are very large molecules. Answer: TRUE Section: Section 18.1 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 2) Teflon is synthesized with a monomer containing carbons and chlorines. Answer: FALSE Section: Section 18.2 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Nylon contains only one type of monomer. Answer: FALSE Section: Section 18.3 Learning Outcome: 18.3 Know the monomers used to make nylon and how they polymerize via formation of an amide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) Sucrose is the smallest building block for carbohydrates. Answer: FALSE Section: Section 18.4 Learning Outcome: 18.4 Understand what monosaccharides, disaccharides, polysaccharides such as starch and cellulose, and carbohydrates are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) All amino acids are made of only carbon, hydrogen, and oxygen atoms. Answer: FALSE Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 6) Only 10 different amino acids are needed to build every type of protein molecule found in humans. Answer: FALSE Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

7) The human body is able to synthesize as much of every type of amino acid as it needs. Answer: FALSE Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 8) Lysine is considered an essential amino acid. Answer: TRUE Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 9) Amino acids are the smallest building blocks for proteins. Answer: TRUE Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) DNA molecules contain codes from which proteins and other materials can eventually be synthesized. Answer: TRUE Section: Section 18.6 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 11) DNA molecules contain four specific base pair codes, which can be assigned to the individual amino acids. Answer: FALSE Section: Section 18.6 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 12) Through the "genetic engineering" of human DNA, it is hoped that someday a wide variety of diseases can be prevented or cured. Answer: TRUE Section: Section 18.6 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry.

13) The complete human genetic "blueprint" (the human genome) was determined many years ago, and is really not all that complicated. Answer: FALSE Section: Section 18.6 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry. 14) Viruses are not living organisms. Answer: TRUE Section: Section 18.6 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry and G5 Demonstrate an understanding of the impact of science on society. 15) Human DNA molecules consist of just a single strand, just like protein molecules. Answer: FALSE Section: Section 18.6 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry and G5 Demonstrate an understanding of the impact of science on society. 16) It is possible to splice specific pieces of DNA between two different types of living organisms. Answer: TRUE Section: Section 18.6 Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry and G5 Demonstrate an understanding of the impact of science on society. 18.3 Short Answer Questions 1) Connect three monomeric styrene units to make a short segment of the polymer polystyrene. The structure of styrene is below.

Answer:

Section: Section 18.2 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

2) Connect three monomeric acrylonitrile units to make a short segment of the polymer polyacrylonitrile. The structure of acrylonitrile is below.

Answer:

Section: Section 18.2 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Connect three monomeric chloroprene units to make a short segment of the polymer neoprene, polychloroprene. The structure of chloroprene is below.

Answer:

Section: Section 18.2 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) Identify the monomeric unit in the following polymer structure:

Answer: methyl methacrylate,

Section: Section 18.2 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

5) Draw the repeating, monomeric unit of Kevlar, a polyamide made from terephthalic acid and 1,4-diaminobenzene. These compounds are pictured below:

Answer:

Section: Section 18.3 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 6) Contrast the terms "monomer" and "monosaccharide." What types of materials are usually constructed from monomers? What types of materials are usually made from monosaccharides? Answer: The term "monomer" is generally reserved (as the text seems to delineate) for synthetic polymer building blocks, and are not substances ordinarily found in living systems (styrene, chloroprene, etc.). The term "monosaccharide" refers to naturally occurring simple sugars, from which starches and celluloses are made by living organisms. Section: Section 18.4 Learning Outcome: 18.4 Understand what monosaccharides, disaccharides, polysaccharides such as starch and cellulose, and carbohydrates are. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry and G5 Demonstrate an understanding of the impact of science on society. 7) Think for a moment about the terms "polymer" and "polysaccharide." Is it right to refer to polysaccharides as "nature's polymers"? Why or why not? Answer: To a degree, it think it is fair to think of polysaccharides as "natural polymers." Even the reaction chemistry is similar at its base, as cellulose is made in a condensation-style polymerization of glucose monomers. Section: Section 18.4 Learning Outcome: 18.4 Understand what monosaccharides, disaccharides, polysaccharides such as starch and cellulose, and carbohydrates are. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry and G5 Demonstrate an understanding of the impact of science on society.

8) Cellulose and starch are both polysaccharides of glucose. Explain why humans can consume and digest starch but not cellulose. Answer: Cellulose and starch differ by the orientation of the -OH group: α glucose has the -OH group pointing downward (axial) and is the monomer unit that forms starch; while β-glucose has the -OH group pointing outward (equatorially) and is the monomer unit that forms cellulose. Humans do not have the enzyme to metabolize cellulose. Section: Section 18.4 Learning Outcome: 18.4 Understand what monosaccharides, disaccharides, polysaccharides such as starch and cellulose, and carbohydrates are. Global Obj: G1 Demonstrate an understanding of the principles of scientific inquiry and G5 Demonstrate an understanding of the impact of science on society. 9) Construct a polypeptide consisting of alanine, valine, and serine. Circle the peptide bonds. The structures of the amino acids (prior to linkage) are shown below:

Answer:

Circle each OCNH amide linkage (2). Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 10) Write the three-letter, abbreviated amino acid sequence of this polypeptide (review the figure in the text that shows the structures of the various amino acid residues while doing this exercise):

Answer: ala-phe-gly-cys Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12 Copyright © 2015 Pearson Education, Inc.

11) Assume the following three-base code system is true:

Construct the amino acid sequence coded by the following piece of a DNA molecule: GTATTAGCCCTATTAGACCCT Answer: val-ser-leu-met-ser-ala-phe Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 12) Assume the following three-base code system is true:

Construct the amino acid sequence coded by the following piece of a DNA molecule: ATATTAGACGCCCCTGTATTA Answer: gly-ser-ala-leu-phe-val-ser Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

13) Assume the following three-base code system is true:

Construct the amino acid sequence coded by the following piece of a DNA molecule: TTAATAGCCGCCGAC Answer: ser-gly-leu-leu-ala Section: Section 18.5 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 14) Construct the complementary strand of this piece of a DNA molecule: GTACCTTGGTAATTG Answer: C A T G G A A C C A T T A A C Section: Section 18.6 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 15) Construct the complementary strand of this piece of a DNA molecule: TTACCGTGCCATAGC Answer: A A T G G C A C G G T A T C G Section: Section 18.6 Learning Outcome: 18.5 Understand the relationship between amino acids and proteins and the peptide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills.

18.4 Matching Questions Match the plastic in the left column with the monomer in the right column. A) hexanedioic acid and 1,6-diaminohexane B) chloroethene C) tetrafluoroethene D) propylene oxide E) ethene 1) PVC Section: Section 18.2 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 2) Polyethylene Section: Section 18.2 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 3) Teflon Section: Section 18.2 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 4) polypropylene oxide Section: Section 18.2 Learning Outcome: 18.1 Understand what a polymer and a monomer are. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. 5) nylon Section: Section 18.3 Learning Outcome: 18.3 Know the monomers used to make nylon and how they polymerize via formation of an amide bond. Global Obj: G2 Demonstrate the ability to think critically and employ critical thinking skills. Answers: 1) B 2) E 3) C 4) D 5) A