The Irish Undergraduate Hournal by Gearoid O'Rourke

The

Undergraduate Journal of& Ireland Northern Ireland

• Volu m e I

A collection of winning essays from our innaugural year

The

Undergraduate Journal of& Ireland Northern Ireland

• Volu m e I

A collection of winning essays from our inaugural year

Published in 2010 by the Undergraduate Awards of Ireland & Northern Ireland. Undergraduate Awards of Ireland & Northern Ireland c/o Google Ireland Ltd, Gordon House, Barrow Street, Dublin 4 www.uaireland.com info@uaireland.com Copyright © 2010 The Undergraduate Awards of Ireland & Northern Ireland. All rights reserved. This book may not be reproduced, in whole or in part, including illustrations, in any form without the written permission of the publishers. Set in Kepler 9.75/11 by Gearóid O’Rourke of 50RSt, Dublin, Ireland. Printed by W&G Baird, Belfast.

The

Undergraduate Awards of& Ireland Northern Ireland

• Founders Patrick Cosgrave Oisín Hanrahan

Editorial Board Jim Barry – Chair Aine Maria Mizzoni – Vice-Chair Dr R. Barnett Prof. Don Barry Bobbie Bergin Dr. James Browne Martin Curley Maeve Donovan Dr. Peter Kennedy Dr. Brigid Laffan Prof. P.J. Prendergast Dr. Ferdinand von Prondzynski Dr. Francis Ruane Founding Parnters

Leading the charge to unlock Ireland’s true potential The following address was delivered by President Mary McAleese at the inaugural awards ceremony of the Undergraduate Awards of Ireland & Northern Ireland. This event took place in the Library of the Royal Irish Academy on Tuesday October 20th 2009.

ia dhíbh a chairde. Cuireann sé áthas orm bheith anseo libh inniu agus tá mé thar a bheith buíoch daoibh as an chuireadh a thug sibh dom. My thanks to Jim Barry for the invitation which allows me to be part of this gathering which celebrates the achievements of Ireland’s finest undergraduates. The Irish Undergraduates Awards are new and they are an important step forward in acknowledging the role played by our undergraduates in helping to advance Ireland’s ambition to be not just a smart economy but a just and decent sophisticated society. Mostly undergraduate essays, research and projects are done for the reward of marks that get them through the eye of the academic needle. Sometimes that important utilitarian end obscures the value to the wider world of scholarship of work that is insightful, creative and worthy of a much wider platform than the examiner’s pile. These awards encourage our top undergraduates to believe in the validity of their work and in their entitlement to a public place of respect within scholarly discourse. So it is particularly fitting that these awards should be inaugurated here in the Royal Irish Academy and that the winning entries should be published in the Undergraduate Journal of Ireland opening up the work of these awardees to a much larger audience. The Journal will quickly become required reading in academia and the public and private sectors as it not only showcases their ideas, observations, analyses and provocations but showcases too the foundational and inspirational work undertaken by the lecturers, departments and universities across Ireland which helped develop these young, curious minds and give them their confident voice. 6

If anyone thought our students were overwhelmed by the ambient economic uncertainty they can take courage and correction from the fact that over 1500 students submitted work for this inaugural award. Of these, thirty-three winners have been chosen from the nine Universities across the island of Ireland and from every conceivable discipline. The range of subject matter is breathtaking, from the topical “The Feasibility of Onshore Wind Farms in Ireland” to the intriguing “Can Sea Sponges Cure Cancer?” and the eminently practical “Integrated Ticket for Public Transport”. I also took particular pleasure in an essay entitled “In the male dominated writing culture of the Middle Ages, can a female voice ever be represented as authoritative and reasonable.” It all makes for one very exciting, eclectic journal a real melting pot of the best thinking of our best students and a new forum for the synergies that come from crossing disciplinary boundaries, different approaches and fresh thinking which will be one of the keys for a return to sustainable prosperity. A newly educated generation turned the tide of history to give us peace for the first time in centuries. It turned the tide of emigration and brought us from poverty to a new level of prosperity. The upward trajectory of economic growth has stalled in Ireland and elsewhere thanks to human frailty and fallibility. This generation lives with the consequences and is challenged to learn the lessons so that by their ingenuity there will be a new surge of prosperity and by their integrity it will be rooted in more enduring values and virtue. These young award winners whom we are celebrating today will lead the charge to unlock Ireland’s potential and deliver the Ireland of wide and equal opportunity that we have aspired to from the first courageous steps towards independence. I extend special thanks to all those who helped make the Irish Undergraduates Awards a reality in particular Oisín Hanrahan and Paddy Cosgrave who proposed the awards and all the Board Members who have driven this project of encouragement and recognition at a seminal moment in the lives of our students. A special thank you to the Universities for their important contribution, to Pauric Dempsey of the Royal Irish Academy for providing this magnificent venue for today’s ceremony and Kingsley Aikens of the Ireland Funds, Hugh O’Regan and Brendan Tuohy all of whom have been instrumental in taking the idea of the awards and turning it into reality. But the biggest thanks is due to all those who entered the Awards and especially those who have the distinction of being the first ever winners and so first ambassadors of what we hope will become a regular event. Every success to each one of you and I hope this recognition will encourage you to new levels of belief in yourself and in your potential service to our country. Comhghairdeas libh arís agus go raibh fada buan sibh. Go raibh maith agaibh. President Mary McAleese

Uachtar á n na hÉireann

Contents Leading the charge to unlock Ireland’s true potential Introduction from President Mary McAleese

Acknowledgements

Award Nominees

Nutritional factors affecting the fertility of Dairy Cows Claire Fitzsimons

Transcription & analysis Benjamin Larkin

The rectilinear houses of the Irish Early Neolithic: The introduction of new identities, ideologies & economies Russell Ó Ríagáin

Investigating the structural characteristics of transient protein-protein interactions Niamh Parkinson

Different cultures, came culture? International HRS in Whole Foods Market Inc. Anne Byrne, Grainne Conroy & Megan Huxhold

Catalytic methods for the destruction of chemical warfare agents under ambient conditions Linda O’Connor

113

Can Sea Sponges cure Cancer? Roisin O’Flaherty

127

The Son he never had: Zeus’ parthenogenetic creation of a surrogate son?

159

Melanie Hayes Beetlz – BON software model consistency checker for Eclipse Eva Darulová

167

The aetiology & management of gingival hyperplasia in organ transplant patients Emer Walshe

181

Bigas Luna’s Retratos Ibericos & the gendered performance of Self Ciara Barrett

197

Early human settlement in the British Isles & Northern Hemisphere glaciations Caroline Martin

211

An econometric investigation into whether the term spread helps to explain the dynamics of GDP growth in the euro area. Michael Curran

225

Should we allow a market for kidneys? An Economist’s consideration M. Lorraine Chadwick

239

In Ireland, recent legislation & policy in health, education & social services have changed the nature & practice of early childhood education care & services Dairine Taaffe

253

An integrated condition assessment & empirical approach to predict risk levels due to subsurface construction Julie Clarke & Laura Hannigan

261

Tragedy in triumph: The lost paradises of Hal the Hypocrite Tim Mc Inerney

275

The evolution of the adaptive immune system Darren Fitzpatrick

289

The Earth’s disciples: Geographers & the reinterpretation of Space in the 21st Century Drew Reid

301 9

Kingsley’s natural selection: The significance of Darwin in his works Abigail Rowe

311

Innéacs de bhailiúchán amhrán a rinne Cosslett Ó Cuinn i nGabhla, i dToraigh agus in Árainn Mhór Kayla Reed

329

A hundred indecisions: Paralysis in Mansfield’s “The Daughters of the Late Colonel” Emily Bourke

343

Irish nervous shock law is flexible but underdeveloped in comparison with the stricter doctrine adopted by the courts in other common law jurisdictions Peter Dunne

349

Adolescent preferences & priorities for the design of current augmentative & alternative communication devices Erika Jane Dowling

361

Connection Games James Leahy

381

How do we run on bumpy ground? Frederick A. English

383

Inflammation of the upper airway in obstructive sleep apnoea Brian Mac Grory

397

Men’s health promotion strategies & erectile dysfunction Maria Jarosinska

413

Define nursing & discuss what you consider to be the key components of nursing care Geraldine Galand

417

Analysis of the p53 protein activation in Xenopus embryos Lynne O’Shea

423

Consequentialists can never be good friends Thomas Morris

445

Domain dynamics & switching in ferroelectric mesowires Raymond McQuaid

453

Evolution of the measurement of body segment inertial parameters since the 1970s Laure-Anna Furlong

465

Party mobilisation & turnout decline in Sweden Mark Canavan

477

The direction of influence between language & thought Cliodhna O’Connor

489

Docetism & 1 John Eimhin J. Walsh

497

The “modern concept of childhood” is at odds with the everyday lives of children in the South & may lead to inappropriate programmes of action Yvonne O’Reilly

507

Acknowledgements

he inaugural awards and journal are a credit to the quality of the submissions and the commitment of the 33 academic panels who selected the winning papers. Excellent education is the cornerstone of any competitive and smart economy. The Undergraduate Awards of Ireland and Northern Ireland underpin this by recognising and celebrating the highest standards of undergraduate academic scholarship. My sincere thanks to all those who assisted in making the Undergraduate Awards of Ireland and Northern Ireland a reality and my congratulations to our Gold Medal Winners. Jim Barry & Aine Maria Mizzoni

Chair & Vice cHAir of the Editorial Board

s we look back on the first year of the Undergraduate Awards of Ireland and Northern Ireland what is most striking is the overwhelming support this initiative has received from so many diverse individuals and organisations. From academic institutions, to lecturers, to government bodies, to private individuals, to corporations, to students, the support has been incredible. To those who supported the awards in its first year and to those who supported the establishment of the awards prior to its first year we would like to extend our sincere thanks and express our utmost gratitude for their assistance in turning the idea of recognising undergraduate excellence into a reality. To all of the students that participated and to our winners, we would like to say thank you and congratulations. We hope the economic environment into which you will graduate will serve only as motivation to succeed, and that you will see opportunity and potential where those who have gone before you may have seen only uncertainty. We hope that those in government with the responsibility for creating the right environment for your spark of brilliance to succeed will deliver. Finally we would like to recognise and thank those who brought this journal to life through judging, editing, and through layout and design. Paddy Cosgrave & Oisin Hanrahan Founders of the Awards

Award Nominees Agriculture Michelle Guthrie Miriam Hirzel Niamh Bourke Breige Flynn Martin Breen Kevin Oxx Anthropology Eileen Murphy Dwaine Martin Kate O’Brien Margaret Dunne Sharon Costello Jindrich Mraz Tamryn Reinecke Tara McAssey Joanna McClatchie Archaeology Lorraine Shannon Jane O’Dwyer Ronan Considine Margaret Williams Mark O’Callaghan Biochemistry Eamon Geoghegan Christina Dix Lisa Vincenz Sarah Conmy

Georgina Murphy Jim O’Connell Ronan Lyne Darren Ruane Tatiana Papkovskaia Jonathan Roddy

Business Kristin Huber Orla Caffrey Mary Redmond Stephen Denham Alexander Mann Lisa de Jong Christoph Walsh Charlotte Wickham Mark O’Flynn Jack Berrill Jason O’Connor Joseph Cummins Danielle Ryan John Lavelle VictoriaWhelton Colin Kuehnhanss CaitrionaO’Connor Rory Costello Jennifer Cowman David Butler Jo-Ann O’Sullivan Declan Clancy Paula Corcoran

Jennifer Foley David Breslin Paul Gallagher Nathalie Ennis Chemistry Michelle McKinney Laura Moran Teresa Loftus Aoife Amy Malone Nordon Kathleen Melzer

Classics Robert Stratton Michael Debets Computer Science Fergal Walsh Niamh Nic Clámha Rebekah Burke Adrian Seung-Bum Gabriel-Miro Kwizera Lee Muntean Colin O’Brien John Reddin Jimmy Cleary Jeff Warren Wu Hao Brent Kelly Fathi Ramly Nicola Burns 15

Jonathan Synott Noel Kennedy Michael Waters

Dental Science Zohaib Ali Paul Hooi Marian Cottrell Harry Stevenson Erin Cecelia Bolton Paul Kielty Drama, Film & Music Emer FitzGerald Christopher Corcoran Aisling Byrne Emily Griffin Ellen-Jane Kruger Catherine Hughes Nina-Maria Häggblom Grace Kelley Laoibhse Louise Griffin Sara Joyce Cillian O’Connor Sarah Cronin Ben Murnane Sinéad Finegan Christopher Collins George Jackson Roisin McMullin Susannah Norris Michelle Cleary Ross Fortune Pauric Havlin Erica Mills Alexandra Christy Aoife Mac Alister Paul Fennessy Economics Xiang Fang Xin Xu James McLaughlin 16

Aidan O’Hare Jonathan Wyse Christopher Sale David Madden Michael Bracken Cillian Murphy

Education Oonagh MarianKeane Liam O’Reilly Sarah Falvey Engineering Colm Bhandal Ivan Rochford Deaglan Gibbons Aoibhín Gaynor Tomas Kelly Catherine Keigher Brian Kelly Nick Hyland Chris Hurley Rory Clune William Horgan Jeremiah O’Riordan Rory Gallagher Steven Ferguson Mark O’Connell Kate Smith Patrick Murphy Eamon Lannoyle David Ferns Paul Durcan John O’Donoghue Yuanyuan You English Helen Heaton Matthew Callaghan Brian Doyle Orna Mc Donald Karina Jakubowicz Robert Kiely

Conor Minogue Deirdre Ni Annarachain Nathaniel Forde Sinéad Murphy Stephanie Courtney David Bernard Alexandra Duchene Colin Sweetman Duncan Wallace Alyson Bailey Mary-Ann O’Dwyer Mary O’Halloran Steven Kelly Muireach Shankey-Smith Niamh Campbell Jean Hogan Eileen O’Mara Walsh Matthew Callaghan Vicki McKenna Ann Marie Wade

Genetics & Microbiology Helen Devine Colm O’Rourke Gareth O’Dwyer Aisling Miller Enda Shevlin Kate Ferguson Kaia Berstad Sarah Louise Gill Conor McKenna Geography Theresa Connell Joseph Usher Richard Webb Rory Flood Craig Rankin Laila Higgins Earth Sciences Shona O’Rourke John Bill

Robert Weatherill Wood Rotherham Jennifer Scully Bill Wood Eoin Mulvihill

History Hugh Taylor Giulia Ni Dhulchaointigh Aidan Conway Caitriona Ní Dhubhda Grace Bolton Oisín Smith David Gareth Toms Abigail Duignan David Durnin Brendan Corcoran Penny Baxter Frances Nolan Meaghan Woulfe Maire Breathnach Ní Ghormain Irish Colm Ó Neachtain Meabh Ní Coileain Catherine Curtin Giollosa Uí Lorcain Clair Johnston Languages Grzegorz Grzybek Matthew Callaghan Kathe Rothwell Gabija Guogyte Eithne Lonergan Sandra Quinn Matthew Krasa Meabh Keane Mathilde Chaigneau John Ryan

Law Brian J. Doyle Sana Farooq Khan Rosemary Henningan Alison Shanley Nikki O’Sullivan Sarah O’Meara Mary Flanagan Jane Mc Cooey Helen Kerr Joanne O’Toole-Byrne Martin Corrigan Deborah Magill Linguistics Orla Tighe Gavin Murphy Medicine & Health Sciences Peng Hor James M. O’Donnell Andrew W. Murphy Timothy O’Brien Thomas J. B. Kropmans Shane Corcoran Alison Cregan Edward O’Connor Sinead Healy Gareth Kiernan Ishwarya Balasubramanian Karen Connell Pádraig J. Mulholland Aoife Carey Kirsty Porter Ruth O’Connell Laura Gleesol Nursing & Midwifery Sinead Hayes Esther Funmilayo Afolalu Michelle Carroll

Pharmacy Emer Woods Louisa Conlon RebeccaRing FionaCarr Philosophy Michael James Regan RonanDaly Stephen McCarty Siobhan Moriarty Matthew Mckeever Olivia Russell M. David Walsh Evan Hargadon David Hastings Patrick Hastings Alexander Court Katie Mcneice Physics Jason Jensen Daniel Ryan Sonia Buckley Laura Horan Anna O’Faoláin de Bhróithe JenniferJoyce Physiotherapy Louise Reilly Sean James Ledger Andrea Mc Carthy Aideen Shinners Catriona O’Dwyer Politics Chad Keveny Rachel Gilliland Carmel Joyce Fakhra Zafar Patrick Kilmartin Lorcan Patrick Byrne 17

Sean Ó Conghaile Holly Wilson Byrne Aisling Lynch Paula Kennedy

Psychology Mark Glennon Odhran Irwin Michelle Downes Damien Daly Colin McDonnell Louise Smyth Sheila Armstrong Karen McAllister Ciara Amory Caoimhe Nic a’ Bháird Laura Mangan

Niamh Skelly Charles Crandon Fionnuala Malone Manus Moynihan Maria Aisling Higgins

Religion, Theology & Ecumenics Brendan Rea Stephen Murray Jill McArdle Ruth Lee Ronald A. Geobey Niamh Murphy Anna Williams Egle Zinkute Claire Dunne

John Philip Magennis Stefan Bartik

Sociology Clodagh Ni Chearbhaill Nicole Byrne Ciara Finlay Judy Brown Jane Wigglesworth Jean Byrne Violet Wilkin Sarah Lagan McGreevey Nicola Donnelly Stacey Thom Natasha Moore

AGRICULTURE PANEL

•

Judging Panel Prof. Dolores O’Riordan (University College Dublin) – Chair Prof. Pat Lonergan (University College Dublin) Prof. Séamus Fanning (University College Dublin) Dr. Eileen Gibney (University College Dublin) Dr. Deirdre O’Connor (University College Dublin) Judges’ Comments The paper entitled the Nutritional factors affecting the fertility of dairy cows authored by Claire Fitzsimons was unanimously selected as the winning paper by the assessment panel. The paper explores how the nutritional management of dairy cows can influence the reproductive efficiencies of the dairy herd. The subject material is well organised and there is a logical clear presentation of the all the relevant sections. The content of the paper is accurate and the conclusions drawn are based on well presented evidence. The panel were particularly impressed with the level of critical appraisal of the literature and the high level of synthesis demonstrated by the author. Overall the submission was considered to be a well- researched, topical original manuscript. The judging panel were very pleased to recommend Claire Fitzsimons for this award.

AGR IC U LT U R E

Nutritional factors affecting the fertility of Dairy Cows Claire Fitzsimons

Introduction he production of milk from the dairy cow is dependent on getting the cow in calf, maintaining the pregnancy and obtaining trouble-free parturition of the foetus. The success of this process relies on the fertility of the individual cow. There are many different measures of fertility, e.g. non-return rates after artificial insemination (AI), number of days not pregnant and calving interval (Butler et al, 1989), however conception rate is a measure that can be used internationally. Conception rate is defined as the percentage of cows which hold to service, with first service often used as the benchmark. A figure of 65% conception to first service is regarded as a very good figure (Blowey, 1999), however conception rates have fallen well below this figure, as seen in Fig. 1. This phenomenon of low conception rates to first service is being experienced world-wide in high yielding dairy cattle and has occurred in the last 10 to 15 years (Blowey, 1999). Ireland is by no means unique in this respect and has also experienced a decline in reproductive performance in the dairy herd since the mid seventies, not only is this characterised by low conception rates but also high rates of embryonic mortality (Moore et al, 2006). This decline has been linked with the increased proportion of North American Holstein Friesian genetics in dairy cows through intense artificial selection for high milk yield (Buckley et al, 2000), however this is not the only factor (Mulligan et al, 2007). It is widely accepted that there is an inverse relationship of conception rate to milk yield. Such intense selection 21

Fig. 1. Diskin et al (2006) estimate the reproductive performances of British-Friesians in 1980 compared to those of Holstein-Friesians in 2006. has altered the metabolism of the Holstein Friesian dairy cow. The large demand of high milk production immediately after parturition cannot be met by feed intake during early lactation and thus the cow falls into ‘negative energy balance’ (NEB) (Butler et al, 1989). NEB is where the cow uses her own body fat reserves to meet the demands of the mammary gland (Ball et al, 2004), commonly known as when the cow ‘milks off her back’ (Murphy, 1998). In order to minimise this NEB and excessive mobilisation of body fat, the nutrition of the cow must be optimised (Ball et al, 2004). Body condition scoring is a management aid that can be used to assess the current physiological status and fat reserves of the cow. In Ireland body condition scoring is conducted on a five point scale with the animal scored on a monthly basis, or however often the farmer desires (Gordon, 1996). Blowey (1999) states that poor conception rates may be a result of high protein diets, especially diets with high levels of rumen degradable protein (RDP). This may be due to the deleterious effect that high protein (especially high RDP) has on oocyte quality (Chagas et al, 2007), however this is contradicted in a study conducted by Kenny et al (2001) where it was established that high ammonia and urea had no negative effects on embryo survival. High crude protein must be excreted as urea which is an energy demanding process and may exacerbate the NEB being experienced by the cow (Roche, 2006) therefore it is possibly the affect that high protein has on NEB that influences fertility and not high protein per se. From a study conducted by Siciliano-Jones et al (2008) there is conflicting evidence in relation to the effects that supplementation of diets with trace elements has on the fertility of the dairy cow. Some studies suggest there is a role for these minerals in ameliorating poor reproductive performance and in parallel to this 22

Fig. 2. Graph showing how milk yield demand surpasse appetite (Blowey, 1999). other results contradict these findings. However, Blowey (1999) asserts that trace element and mineral deficiencies have been associated with substandard fertility, with an emphasis on the calcium-to-phosphorus ratio. There is a lot of evidence to support the beneficial role of feeding supplemental fatty acids on the fertility of dairy cows. Such benefits include assistance of uterine involution, reduction of uterine infections (Roche, 1996), increased numbers of ovarian follicles and increasing the level of progesterone release from the corpus luteum (Verkerk, 2000). Feeding supplemental fat in the diet can often lead to increased milk yield with no beneficial effects on the NEB of the cow. Nevertheless, some studies have shown positive effects on reproductive traits (Gardner et al, 2001). On consideration of all these factors, the part nutrition and its associated hormones and metabolites play in the reproductive efficiency in cattle is emphasised in this project.

Negative Energy Balance The most metabolically demanding time for the dairy cow is the transitional period between late pregnancy and early lactation (Gardner et al, 2001). Butler et al (1989) state that energy balance is the term used to describe the relationship between dietary energy intake and energy utilisation. Energy balance is calculated using the equation: NE1 (consumed) – NE1 (required) = daily energy balance (Where NE1 requirement includes maintenance & production). The reason why energy balance is used to establish the metabolic status of the 23

cow is because it is more accurate than measuring milk yield or other production traits (Butler et al, 1989). In early lactation, the dairy cow will often meet the demands of high milk yield regardless of dietary energy intake (Verkerk, 2000). This energy deficit is known as a negative energy balance (NEB) as demand exceeds supply (Butler et al, 1989). During this period there is mobilisation of body tissues (Verkerk, 2000, Wathes et al 2002) and thus the cow loses body condition (Wathes et al, 2002). After calving the subsequent NEB may last for several weeks (Butler et al, 1989). It must be remembered, however, that this is a normal process within the cow’s physiological system and some utilisation of body reserves will take place (Lucy, 2001). The point to remember is that the aim of the producer is to minimise the extent of this NEB as much as possible. NEB reaches its nadir within the first (Rizos et al, 2008) or second week of parturition (Butler et al, 1989). Butler et al (1989) also say that recovery or improvement in NEB may be the initiator of resumption of ovarian activity. The difficulty with NEB is more acute in primiparous heifers as they are still striving to achieve their mature body weight whilst in lactation. A factor which complicates the matter is that heifers are also changing their teeth at this time and makes eating uncomfortable. Despite all this, the nutrition must be sufficient for the cow to replace her lost body condition and gain some condition prior to being served by artificial insemination (AI) or natural Service (NS) (Blowey, 1999).

Gonadotrophins Under normal conditions, the dairy cow resumes ovarian activity shortly after parturition. From as early as 7 days post partum, follicle development may commence. Plasma concentrations of oestradiol decrease following expulsion of the calf and the placenta. The inhibition of FSH secretion is halted which leads to increasing plasma concentrations of FSH and follicle development recommences (Thatcher et al, 2006). Proceeding parturition the interval to resumption of ovarian activity is correlated with the duration of and the severity or nadir of the NEB (Butler et al, 2006). Negative energy balance can be seen to affect hypothalamic GnRH secretion, pituitary gonadotrophic secretions or the growth hormone – insulin-like growth factor (IFG) – insulin axis (Diskin et al, 2003). From Fig. 3. it is easy to understand how this balance can be easily disrupted. All the factors are intertwined and are cyclic. Disruption of one has negative effects on the rest of the cycle. The effect of NEB on GnRH of the hypothalamus is an example of this complex relationship. NEB does not directly affect secretion of GnRH from the hypothalamus, rather it is through a lack of positive feedback from oestradiol. GnRH secretion is dependent on the secretion of oestradiol from the pre-ovulatory dominant follicle (DF). The oestradiol from the DF stimulates GnRH secretion from the hypothalamus which acts on the anterior pituitary to secrete LH. This LH is required by the follicle to produce androgens and hence oestradiol. During periods of nutritional restriction in heifers, it has been shown that low con24

Fig. 3. The endocrine changes during the bovine oestrous cycle correlated with ovarian follicular and corpus luteum development from Moore et al (2006). E2 = Oestradiol, IGFBP -4 and -5 = insulin-like growth factor binding proteins 4 and 5, OvF = ovulatory follicle, LH = luteinising hormone, FSH = follicle stimulating hormone, PGF2α = prostaglandin F2α. centrations of oestradiol and therefore low positive feedback in the follicular phase may have contributed to reduced GnRH pulsatility (Diskin et al, 2003). The role of LH in the reproductive cycle of dairy cows is of paramount importance. It is responsible for the interval between calving and first ovulation, oocyte growth and oocyte maturation. Therefore, disruption of LH pulsatility and amplitude is considered a major side effect of NEB (Leroy et al, 2008). From Diskin et al (2003), it is suggested that LH pulsatility in beef heifers is only altered after a certain amount of body fat loss has occurred. However, due to the dairy cow being under severe metabolic stress from lactation, the amount of body weight loss needed to trigger this reduction in LH may be significantly reduced. In nutritionally restricted ovariectomised ewes it was found that the under nutrition led to lower concentrations of mRNA responsible for LH synthesis which led to the pituitary producing lower levels of LH. Diskin et al (2003) also make reference to a study which suggests that nutritional reduction in LH secretions may also in part be due to factors affecting GnRH secretion and pituitary receptivity to GnRH. There is evidence to suggest that NEB does not affect concentrations of FSH postpartum. Follicle growth commences in cows in response to elevated concentrations of FSH which occurs naturally around 10 days after calving. Research suggests that neither energy balance nor dietary intake has an affect on the initial rise 25

in concentrations of FSH after calving. The effects of NEB are not manifested in the limitation of FSH secretion or follicle development but are exhibited through the processes involving ovulation, namely follicle viability and LH secretion (Diskin et al, 2006; Diskin et al, 2003).

Metabolic Hormones and Metabolites Diskin et al (2003) state that the role of metabolic hormones such as growth hormone (GH), insulin, insulin-like growth factor I (IFG-I) and leptin in the control of ovarian follicle development is very important. These metabolic hormones are also vital intermediaries in the effects of energy balance or dietary intake. Falkenberg et al (2007) also state that changes in the GH – IGF-I axis are associated with severe NEB, e.g. GH resistance of hepatic tissues and down-regulation of liver GH receptors. Conventionally, high producing dairy cows experience a dip in the plasma concentration of the hormone IGF-I immediately after parturition. However, this is corrected by subsequent up-regulation of growth hormone receptors in the liver which stimulate the production and release of IGF-I (Taylor et al, 2004). The hepatic tissue of cows during NEB becomes resistant to GH, liver GH receptors are down-regulated, IGF-I synthesis decreases and plasma levels of IGF-I remain low despite an increase in GH (Taylor et al, 2004; Santos et al, 2007; Rizos et al, 2008). Diskin et al (2003) conclude that GH has more of a facilitatory rather than a direct role in reproduction. This is because of its regulatory effects on hepatic synthesis and secretion of IGF-I (Diskin et al, 2003; Santos et al, 2007). During early postpartum when cows are in NEB concentrations of insulin are seen to decrease in high yielding dairy cows. Research has shown that insulin appears to be a metabolic signal that restarts the GH – IGF-I system. Insulin enhances the follicular response to gonadotrophins which in turn regulates the growth of the follicle. This metabolic hormone may also have direct stimulatory effects on the maturing oocyte, however further research is needed in this area (Leroy et al, 2008). Insulin and IGF-I promote LH-stimulated androgen production from thecal cells of the follicle, which in turn promotes oestradiol secretion from the follicle which influences follicle development and competence (Diskin et al, 2003; Santos et al, 2007). It has also been shown that insulin increases circulating concentrations of IGF-I via an escalated rise of hepatic expression of mRNA for IGF-I (Diskin et al 2006). Insulin-like growth factor – I (IGF-I) is a growth factor involved in many process within the body to stimulate cell division or differentiation. The actions of IGF-I can be seen in the reproductive tract of bovines and is thought to play a role in the establishment and maintenance of pregnancy (Taylor et al, 2004). The site of action of IGF-I is generally assumed to be within the follicle, namely affecting the ability of thecal and/or granulosa cells to produce steroids and also stimulating their proliferation (Diskin et al, 2003; Stewart et al, 1996; Taylor et al, 2004). There is some evidence to suggest that IGF-I concentrations also affect pitui26

Fig. 4. Changes in mean concentrations of IGF-I in plasma and milk of 50 multiparous cows from two weeks before calving to 20 weeks after calving (Taylor et al, 2004). tary and hypothalamic function. Studies in vivo by Stewart et al (1996) have shown that IGF-I increases the number of LH binding sites in thecal cells which may account for the increased LH-stimulated androstenedione and progesterone production by these cells (Diskin et al, 2003). This leads to the subsequent enhancement of oestradiol production by granulosa cells which is a prerequisite for ovulation (Stewart et al, 1996; Diskin et al, 2003). It is also documented that IGF-I is considered a survival factor by preventing ovarian follicular cell apoptosis (Taylor et al, 2004; Stewart et al, 1996). Taylor et al (2004) state that with regards to the survival of the embryo, the GH – IGF-I system has an important role. In addition to this, IGF-I may have a direct role in the regulation of the growth of the embryo. In a study by Taylor et al (2004) it was shown that multiparous cows with low concentrations of IGF-I before and after calving were associated with a failure to conceive: see Fig 4 from Diskin et al (2006). It was also stated by Diskin et al (2003) that low concentrations of IGF-I in beef cows resulted in an extended post-partum interval (PPI). The results from the study conducted by Taylor et al (2004), showed that lower IGF-I concentrations post-partum and periods with a lack of ovarian activity were longer in cows with higher peak milk yields, Table. 1. This negative correlation between high milk yield and low IGF-I concentrations in dairy cows (Spicer et al, 1990) is related to higher concentrations of GH in these high yielding cows. More GH in the system leads to excessive fat mobilisation and an increased level of nutrient availability for milk production. This excessive fat mobilisation is associated with liver GH resistance and a subsequent reduction in the amount of IGF-I produced by the liver (Taylor et al, 2004). Although a lot of research is focused on the role of IGF-I in the reproductive 27

Fig. 5. Relationship between plasma concentrations of IGF-I during first 28 days of lactation & probability of conception rate to first service in dairy cows (Diskin et al, 2006). tract of dairy cows, it is important to realise that it is the Insulin-like Growth Factor binding proteins (IGFBP) that modulate the bioactivity of the hormone itself and contribute to fertility (Leroy et al, 2008; Spicer et al, 2008; Chagas et al, 2006). The IGFBPs transport (Jones et al, 1995) and increase the half life of IGF-I (Diskin et al, 2003; Diskin et al, 2006). These binding proteins are involved in the regulation of availability of IGF-I to target cells in the follicle. The NEB experienced by the cow post partum lowers the concentration of IGFBPs which limits this availability of IGF-I to the follicle cells which in turn limits the cells’ ability to act in association with pituitary gonadotrophs to stimulate cell proliferation and production of steroids. This proliferation of thecal and granulosa cells and their steroidogenesis is vital for ovulation (Diskin et al, 2006). Diskin et al (2003) state that glucose has an effect on the pulsatility of LH through its effect on GnRH. Glucose does not directly affect the pituitary gland but modulates GnRH release from the pituitary via detection sites in the central nervous system (brain). From this research, glucose may be considered a metabolic signal involved in the regulation of GnRH secretion. Low concentrations of blood glucose are thought to inhibit GnRH pulses from the pituitary and thus lead to low pulses of LH. As a result of this low LH pulsatility, the PPI of dairy cows in NEB is prolonged (Rizos et al, 2008). Leroy et al (2008) also hypothesise that low blood concentrations of glucose directly affect oocyte quality. Glucose is a vital metabolite for the developmental capacity of the oocyte. The conversion of glucose to pyruvate and lactate provides substrates for ATP production in the cumulus cells. Within the oocyte itself, glucose is metabolised for DNA and RNA synthesis via the pentose phosphate pathway. This DNA and RNA synthesis is involved in the meiotic progression or maturation of the oocyte. It has been demonstrated that follicular fluid concentrations of glucose can be influenced by nutritional status 28

Peak milk yield (kg/day) 26 to 39

Cows 41

IGF-I concentrations 1 week before calving 39

Minimum plasma IGF-I 32

IGF-I at first service 79

40 to 45

46 to 52

53 to 66

Table 1. Quartiles of peak milk yield, periods to return to cyclicity and plasma IGF-I concentrations (ng/ml) after calving (adapted from Taylor et al, 2004). of the cow. This low concentration of glucose or hypoglycaemia experienced in NEB alters the microenvironment of the pre-ovulatory follicle which is likely to compromise the developmental capacity of the oocyte. Circulating levels of metabolites such as non-esterified fatty acids (NEFAs) and beta-hydroxy butyrate (BHB) are indicative of the extent of the NEB experienced postpartum by the dairy cow. In early lactation the cow undergoes body fat mobilisation to satisfy the energy requirements for maintenance and lactation. The breakdown of these lipids results in the production and increase of NEFAs in the blood (Hoedemaker et al, 2004). This large rise in lipid mobilisation increases the uptake of NEFAs by the liver. When lipid mobilisation becomes excessive, the ability of the liver to metabolise the NEFAs is surpassed and triglycerides accumulate within the hepatic tissue causing fatty liver. This results in suboptimal liver function which has a negative effect on fertility (Hoedemaker et al, 2004; Leroy et al, 2008). Leroy et al (2008) say that previous research has shown that high NEFA levels experienced in NEB were reflected in the follicular fluid of dominant follicles of dairy cows. They also state that NEFAs may have toxic effects on the maturation rate of the oocyte. The relatively low fertilisation rate, cleavage and blastocyst formation rates may be from induction of apoptosis and cumulus cell necrosis. These trials were conducted in vitro; however, where trials were conducted in vivo, the results were not in agreement (Rizos et al, 2008). Accumulation of NEFAs in the liver leads to the formation of ketone bodies such as beta-hydroxy butyrate (BHB) (Beever, 2006). These ketone bodies have toxic effects on the cells of the immune system which leaves the cow susceptible to many infections. With the immune system of the cow at suboptimal levels, the fertility of the cow is indirectly compromised by these BHBs. The increase in circulating concentrations of BHBs is reflected in the follicular fluid. In vitro studies showed that high levels of BHBs were detrimental to oocyte quality, however this was due to a lack of glucose rather than the elevated levels of BHBs (Leroy et al. 2008). This is supported by in vivo studies where there was no relationship found between measured BHBs and commencement of luteal activity or subsequent 29

conception rate to first service (Rizos et al, 2008). Leptin, which is secreted by white adipocytes, is a peptide that is involved in the regulation of body weight and food intake (Boland et al, 2000; Block et al, 2001). High plasma concentrations of leptin have been associated with suppression of appetite, therefore it is considered a modulator of feeding behaviour. Leptin receptors have been found in reproductive organs and the pituitary of humans and rats (Boland et al, 2000; Diskin et al, 2003). Research has shown that genetic expression of mRNA for leptin receptors is different in ewes that were well fed and feed restricted (Boland et al, 2000) and the same has been observed in cattle (Diskin et al, 2003). From a study conducted by Block et al (2001) it was found that plasma concentrations of leptin were positively correlated with plasma concentrations of insulin and glucose and that leptin was negatively correlated with plasma concentrations of GH and NEFAs (Diskin et al, 2003), see Table 2. Diskin et al (2003) state the potential role that leptin has in relating energy balance with fertility, possibly through inhibition of neuropeptide Y (Boland et al, 2000). Neuropeptide Y regulates gonadotrophin release by inhibiting LH release from the pituitary of ewes (Diskin et al, 2003). All these data strongly suggest a link between leptin and reproduction in cattle, however the mechanism has not been clearly defined. Nevertheless, Vogue et al (2004) have conducted a study in vitro showing that leptin has no effect on the levels of granulosa cell IGFBP mRNA. Leroy et al (2008) make reference to studies conducted in vitro that suggest leptin promotes the survival of cumulus cells enveloping the maturing oocyte and enhances the developmental competence of the matured oocyte.

Body Condition Score According to Ball et al (2004) minimising NEB and thus excessive deposition and mobilisation of body fat in the dairy cow is a prerequisite for optimum fertility. A method of monitoring the cow’s body reserves is the technique of body condition scoring. The technique can be described as manual palpation of the quantity of subcutaneous fat cover on various parts of the body and allocating the cow a score on the basis of their covering of fat. Cows are usually scored on the thickness of fat cover over the tail head and lumbar area (see Fig. 6.). Edmonson et al (1989) devised the body condition score method mentioned above. It was based on a scale from 1 to 5, using 0.25 unit increments, with a score of 1 indicating emaciation and a score of 5 indicating obesity. The guidelines proposed by Edmonson et al (1989) allow the assessor to give an accurate BCS to the cow without assessing all areas of the cow. Due to the link between cattle body condition scores, milk yield and reproductive performance (Edmonson et al, 1989) (Table 3.), BCS is used as an indicator of overall nutrition (Borsberry, 2001) and as a component of a herd health plan (Mulligan et al, 2006). From Table 4. cows should be calving down at a BCS of 2.75 – 3.0 (Mulligan et al, 2006; Ball et al, 2004; Roche, 2006) and should not lose more than 0.5 units of BCS between parturition and first service (Roche, 2006). Mulligan et al (2006) state 30

Weeks relative to parturition Variables

-4

-1

NEFA (μm)

107

121

546

293

144

Glucose(mg/dl)

Leptin (ng/ml)

5.8

5.5

3.0

2.9

Insulin (ng/ml)

0.8

0.7

0.3

0.5

0.8

GH (ng/ml)

6.7

6.0

8.3

8.5

8.8

IGF-I (ng/ml)

124

Metabolite

Hormones

Table 2. Changes in plasma metabolites and hormones during the transition period (adapted from Block et al, 2001). that cows with a BCS of ≥4 in the last three weeks of gestation had a significantly lower feed intake in the period immediately pre-calving than cows with a lower BCS at the same time. These over-conditioned cows are automatically predisposed to fatty liver syndrome, difficult calving, retained placenta, reproductive tract damage, susceptibility to infection of the tract, displaced abomasum and an increased likelihood of developing milk fever (Mulligan et al, 2006; Ball et al, 2004). Chagas et al (2006) say that cows appear to have a target level for body reserves in early lactation, which would explain why fatter cows at calving have a tendency to lose more body fat at calving than thinner cows. Overfeeding in the dry period had deleterious effects on developing oocytes in vitro and embryo quality in vivo. The tissues in these over-conditioned cows are less responsive to insulin which leads to the reduction in uptake of glucose by the cells (Santos et al, 2007). Conversely, cows in very low BCS (<2.5) at calving are predisposed to a longer PPI which may be due to low LH pulsatility and reduced concentrations of oestradiol (no LH surge and ovulation). Cows with a low BCS after calving have dominant follicles (DF) with a decreased diameter, reduced insulin and IGF-I concentrations and low LH pulse frequency (Roche, 2006). Cows in very low BCS after calving have very little, if any, subcutaneous fat. BCS loss at these low levels is indicative of protein loss, not the loss of internal fat reserves (Chagas et al, 2007). According to Chagas et al (2007), cows in ‘low BCS at any time during early lactation are associated with delayed ovarian activity, infrequent LH pulses, poor follicular response to gonadotrophins and reduced functional competence of the follicle’. 31

Fig. 6. The technique of body condition scoring of cattle over the lumbar vertebrae (Ball et al, 2004).

Protein Balance in the Diet Dietary protein of dairy cows has two components, rumen degradable protein (RDP) and rumen undegradable protein (RUP). The RDP component is ingested protein that is degraded to ammonia (and various other non-protein nitrogen substances) by the rumen microbes whereas RUP is amino acids that bypass the rumen and are digested in the small intestine (Mulligan et al, 2007). It has been widely speculated that protein metabolism can impair reproductive efficiency (Tamminga, 2006) and much research has been conducted on this topic, however the results are not all in agreement. Present day cow diets typically have high levels of crude protein which leads to an excess of RDP (Ball et al, 2004). These high levels of RDP result in high levels of ammonia in the rumen with subsequent elevated systemic concentrations of ammonia and urea. The abnormal levels of these metabolites in the blood have been associated with reductions in dairy fertility (Kenny et al, 2002a; Verkerk, 2000; Chagas et al, 2007). Santos et al (2007) say that studies in vitro have shown that disruption of embryonic development has been associated with excessive concentrations of ammonia and urea. They state that high levels of urea nitrogen reduced conception rates of heifers and impaired the quality of embryos in lactating dairy cows. Santos et al (2007) suggest that the reason for these results was that the elevated concentrations of ammonia and urea alter the follicular fluid (Leroy et al, 2008) and oviductal environment. High concentrations of ammonia and urea were also seen to decrease uterine pH (Guo et al, 2004) which was associated with a reduction in fertility and embryo development (Santos et al, 2007). 32

Body Condition Score

Pregnancy Rate (%)

<1.5

1.6 – 2.0

2.1

2.6 – 3.0

3.1 – 3.5

>3.6

BCS at drying off

2.75

BCS at calving

3.0

BCS at breeding BCS at 150 days in milk (DIM) BCS at 200 DIM

>2.5 2.75

Table 3. The effect of body condition at service on fertility of dairy cows (Borsberry, 2001)

Table 4. Target BCS for dairy cattle (Holstein/Friesian) at different stages of the lactation cycle (Mulligan et al, 2006).

2.75

A trial conducted by Kenny et al (2002a) using nulliparous beef heifers found that high systemic concentrations of urea and ammonia did not have a deleterious effect on embryo survival rate (see Fig. 7). Elevated levels of these metabolites also did not affect systemic concentrations of glucose, insulin or progesterone in these heifers. Kenny et al (2001) also conducted a trial involving nulliparous heifers at pasture with high and low crude protein (CP) concentrations. They found from this trial that high CP levels lead to an increase in systemic ammonia and urea, however again they found no deleterious effect of these systemic concentrations on embryo survival rate or development. Despite these findings, Kenny et al (2002a) state that ‘the outcome may be different in high yielding dairy cows where high dietary protein and lactation-induced severe negative energy balance could lead to deleterious interactive effects on embryo viability.’ Feeding excess protein to dairy cows may exacerbate the negative energy balance, primarily due to the energy demanding process of converting this excess protein into the form of urea which can be excreted by the cow. Any enhancement of the NEB is going to further effect reproduction and therefore fertility (Roche et al, 2006).

The Role of Fatty Acids in Fertility The importance of lipids as components of the cell membrane cannot be underestimated. Lipids also serve as a dietary energy source (Santos et al, 2007; Childs et al, 2008). Gardner et al (2001) state that in previous studies supplemental fat was added to diets to decrease the extent of the NEB by increasing the energy density 33

Fig. 7. Embryo survival rate to day 40 within varying quartile concentrations of plasma urea on day 7 after AI (Kenny et al, 2002a). of the diet, however, often this just increased the milk yield of the cow, or reduced her DMI without alleviating the NEB. Despite these previous findings, there is evidence to show that fat supplementation improves fertility but the effects varied with different fatty acid (FA) sources (Santos et al, 2007). Roche (2006) says that feeding rumen by-pass fats can lead to the alteration the blood FA profile of cows and increase linoleic acid. It has been suggested that certain FAs may stimulate ovarian function, act as precursors of prostaglandins and increase cholesterol availability (Childs et al, 2008). The polyunsaturated acids, of the n-3 family, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have been used in a trial by Mattos et al (2004) looking at the effect of fish oil on uterine secretions of PGF2α of periparturient Holstein cows. Their study found that dietary supplementation with EPA and DHA reduced uterine synthesis of PGF2α. This may be from EPA and DHA displacing arachidonic acid, the precursor for PGF2α, and, or by competing with molecules for enzymes required for PGF2α synthesis. The inhibition of PGF2α around the time of maternal recognition of pregnancy (MRP), luteolysis (regression of the corpus luteum) may be halted, increasing the survival rate of small or underdeveloped embryos, thus increasing reproductive efficiency of dairy cows (Mattos et al, 2004; Childs et al, 2008). However, a trial conducted by Childs et al (2008) found that the aforementioned mechanism was not clear and needs further research. They stated that the role of FAs in improving fertility was probably through increased systemic cholesterol and/or increased corpus luteum size leading to a rise in progesterone. It is worth noting nevertheless that this trial used crossbred beef heifers that had 34

not the huge physiological burden of lactation on their system. The increase of plasma concentrations of arachadonic acid (Childs et al, 2008) results in the increase of prostaglandin F (PGF) synthesis. During the early post partum period PGF is important for uterine involution, upregulation of the immune system and neutrophil function. Increasing PGF synthesis would assist in normal involution of the uterus and enhancing immune function would also help prevent uterine infections during the transition period. These effects would significantly reduce the PPI and improve the reproductive efficiency of dairy cows (Roche, 2006).

Trace Elements It is an accepted fact that minerals or trace elements, such as zinc (Zn), manganese (Mn), copper (Cu) and cobalt (Co), are a vital component in the ruminant diet. These trace elements are important in immune function, lactation and fertility, however the role they play in fertility is highly debated (Siciliano-Jones et al, 2008). Mulligan et al (2007) state that trace element deficiencies have been associated with retained foetal membranes, abortion and weak calf syndrome. Hostetler et al (2003) also refer to studies where inadequate transfer of trace elements from the dam to the calf has resulted in impaired foetal growth and abnormalities to the central nervous system, skeleton and metabolism. A study conducted by Black et al (2004) found that cows treated with glass boluses of Se and Cu had higher conception rates and service to conception probabilities than other trace element strategies. Siciliano-Jones et al (2008) say that Mn is required for cholesterol which in turn is the precursor for oestrogen, progesterone and testosterone and Zn deficiencies have been linked to abnormal oestrus, abortion, altered myometrial contractibility with prolonged labour. However, the trial conducted by Siciliano et al (2004) concluded that supplementation of the diet with amino acid complexes of Zn, Mn and Cu and Co glucoheptonate did not improve the fertility of the cows in the trial. Conclusion Roche (2006) states that poor reproductive efficiency on farms results in a reduction in herd profitability, this being a universal finding. This is through a number of factors, namely prolonged calving interval leading to less milk produced per cow and fewer calves born, increased culling for poor fertility and increased replacement costs, increased labour, veterinary and semen costs. From the reviewed literature, it is apparent that the most taxing time on the dairy cow is the transition period. The transition period starts three weeks prior to calving and lasts up to three or more weeks after calving (Grummer, 1995). Therefore, it can be assumed that preparation of the cow for this demanding time begins long before the end of gestation. From Roche (2006), table 5. gives a summary of the targets needed to be obtained on farm for a successful and profitable reproductive cycle. This table shows that many of the risk factors affecting the targets to good reproductive efficiency can be controlled through nutrition and management at 35

farm level. During the last three weeks of pregnancy, it is possible for cows to fall into NEB prior to calving. This can occur in cows with excessive body condition. As it is recommended that a cow’s intake should be maximised during the transition period, ensuring that the cow is in optimum body condition helps to achieve maximum voluntary feed intake during this time (Mulligan et al, 2006). Where cows are on a grass silage diet, only the silage with the highest intake potential should be used (Mulligan et al, 2006). To achieve adequate intake of grass silage, it should have a high DM and digestible organic matter content and low ammonia nitrogen as a percentage of the total nitrogen content (McDonald et al, 2002). Unwittingly, farmers may decrease the DM intake of freshly calved cows by abruptly introducing them to pasture (Mulligan et al, 2007) without adequately preparing the rumen for this diet. If cows are out at pasture, sward height must be kept above 7cm, as heights below this have been shown to compromise DM intake of cows (Mulligan et al, 2006). As an alternative to this, cows can be fed a total mixed ration (TMR). According to Mulligan et al (2006) TMRs have been associated with higher DM intakes and lower NEB nadirs when compared to cows fed at grass. By utilising TMRs, palatable feed ingredients such as molasses can be used, which have been demonstrated to improve NEB in transition cows. Diskin et al (2006) have also stated that intakes of DM for cows have been higher on maize-based TMRs than cows grazing pasture. Santos et al (2007) point out that TMRs with less than 28% neutral detergent fibre (NDF) increase the risk for digestive upsets and acidosis. NDF has been shown to be more effective at maintaining proper rumen function than other non-forage fibre sources, however, diets above 35% NDF would restrict feed intake. Ensuring that 35 – 41% of the total DM of the ration is composed of non-fibrous carbohydrates will optimise overall energy intake, overall feed intake and production of microbial protein within the rumen (Santos et al, 2007). Although BCS is a practical method of monitoring body fat reserves of the cow and controlling the NEB to a certain extent, another possible technique to reveal the extent of the NEB is to monitor blood metabolites such as BHBs and NEFAs (Mulligan et al, 2006). The same authors found that the ration of milk fat : milk protein is much more useful. A ratio of <1.5:1 or 1.3:1 is an indicator of problem cows in early lactation. The development of an on-farm milk testing kit would enhance the farmer’s ability to pick out the cows that require attention and adjust their diet accordingly. However, the development of this technology would be difficult as there is still some contradicting evidence in the research (Mulligan et al, 2006). Another suggested method of diminishing the NEB experienced by dairy cows is the addition of propylene glycol to the diet (Nielsen et al, 2004). Nielsen et al (2004) conclude that propylene glycol does have beneficial effects on carbohydrate and fat metabolism of cows in early lactation, however the beneficial effects on fertility are unclear. In a study conducted by Rizos et al (2008), they found that supplementation with propylene glycol had no effect on reproductive efficiency of lactating dairy cows. 36

Reproductive process Normal uterine involution Resumption of ovulation High oestrus detection High conception rate to AI

Target to be achieved

Risk factors affecting targets

Dystocia Retained foetal membranes Uterine infection Loss of >0.5 BCS unit 90% by day 42 Low feed intake Uterine health Infrequent checks 85% per cycle Sub-oestrus High yields Excess BCS loss 50% per breeding Prior uterine problems Low P4 days 4-7 of pregnancy Day 50 pp

Table 5. Postpartum (pp) reproductive targets to be met in order to obtain high reproductive efficiency and the associated key risk factors affecting these ‘Undoubtedly, the reproductive performance of our dairy cows is limited by their nutritional status’ (Verkerk, 2000). The nutritional management of dairy cows has a huge influence on the reproductive efficiencies of the dairy herd. Although many of the reproductive problems manifest themselves in lactation and mating time, often the root of these problems lies in the previous dry period or early lactation. Mulligan et al (2007) also say that a healthy transition period, achieved through adequate nutrition has both direct and indirect affects on the reproductive performance of commercial dairy herds.

ANTHROPOLOGY PANEL

•

judging Panel Dr. Abdullahi El-Tom (NUI Maynooth) - Chair Dr. Steve Coleman (NUI Maynooth) Dr. Patty Gray (NUI Maynooth)

Judge’s comments This is an excellent essay that displays considerable scholarship, dediction and imagination. It shows clearly that candidate is capable of generating original material and excercising sophisticated panache of anlysis. Application of analytical tools proposed by Goffman, Kiesling, Duranti and others is indeed very impressive. We do not hesitate to nominate this essay for the award.

A n t h rop ol g y

Transcription & analysis Benjamin Larkin I. TRANSCRIPT Person A and Person B, brothers, both students, discuss their mutual interest in American football (NFL) and its recent impact overseas in Europe. Setting: Living room, sitting on couch. (1)1A: Okay!2 Ehh, first of all..ehh…3 could you tell me, eh, when you first got into NFL, eh American football, and, eh, why? B: Yes, eh… it was in September of 2006…emm..4 Why? I’m not really too sure; it was ----à5 just on the TV one time and, eh, sat down to watch it, and I just so happened to be supporting the team that I saw first on TV right now, so it was kind of strange the way it --à worked out. 1 Numbering of interactional exchanges for convenience. Interruptions don’t count as the start of an exchange. 2 Syntactical accent: “Okay!” characterized by and partnered with a brief rise in intonation often to indicate floor presence. 3 Medium pause. 4 Short pause. 5 Rising intonation (gradual).

[Carolina Panthers6

B: [And why???...because-- cos, it’s great, and I could go into that for a long time, but, y’know, y’know am just gonna say that. (((((((((((((((((((((((((7 (2)A: [wha-what, like, whad’you think makes.. the American football, as a sport, so superior to… say the likes of Rugby, or--8 or even soccer not in terms of its…emm..*ponders*9… not in terms of its fluidity, or its rules or anything, but but just in terms of its…excitement factor, sort_10 of? B:Well…the big word in the NFL is parity, and I think you see that every weekend… in ---à other words, every team has a chance. The system is set up in such a way that, y’know, if you’re the worst team in the league then the next year you have the top[]11 pick in the draft, i.e., you have the best chance of getting the best…eh… coming eh-- the upcoming college prospects, so, eh, that’s a big factor—But also just the action in the game and its, eh, à Although—plays are kinda broken up and some people say “Oh well it’s too slow” and all that, it’s eh, I just think it’s really fair and really, kind of, y’know, the best team usually does win in the end, and everything like that, so…yeah. It’s—it’s a game ----------------à with a lot more depth as well, it’s—it’s got more systems and there’s a lot more, eh, complications to the game and in my opinion that makes it better, so.._ ((( (4)A: [Yeah I mean, like, compared to soccer…it’s certainly emm….the way they have referees on the lines and stuff, like, like five. B: [Yeeah, yeah, more officials obviously helps. *laughs*. I agree. (5)A: [Four or five referees………Now we recently…emm…in the last 6 “Aaa” sustained speed increase. 7 Volume decrease (gradual). 8 False start. 9 Gestural brackets *aaa*, indicating a particular action or gesture not audibly describable. 10 �� Syntactical sharpness: an abrupt cessation of syntax by the manual closing of the larynx (“Oh_” when in a state of surprise; pre-empting your next statement, for example). 11 The � �� meeting of two syntactically sharpened words, often to illustrate their degree of connectedness or emphasis.

couple days in fact, and ))) à_ ehh… last year, the UK, br-brought over the, ye-, eh, NFL was brought over to the UK… I don’t know…. what do you ------------à Think_… d-d’you think America is just trying to—sort of—still-- still promote its sort of superiority and say that “We’re America and we—we’re giving you this sport” or do you ^^12 ^^ ^ à think it’s genuine (?) because--- I saw, when I looked up at the NFL logo in the stadium, I saw the NFL logo, the American flag on the left and the British flag on the right, and it just seems very………*purses* emm…it doesn’t seem very genuine because it just seems that the—they’re just sort of—it’s sort of a hand-me-down or something. They’re just—they’re not intending to merge in on any real level. B: Well *more assertively*, it depends what you mean by merge, but the-- obviously the -à popularity of the game in the UK is such that they felt that coming over to play a game would be a great, eh, thing to do for them. Obviously it’s all about money in the end. A:

[Yeah.

B: The fans clearly enjoy the game and last weekend’s game was… emm.. reeeally enjoyable so the—ehh—some people are saying they’re gona come back next year for two games, so… y’know… it’s---it’s just---the game is just getting bigger in the UK and Ireland, so expect a lot more games in the future, that’s what I’d say. ((((((((((((((((((((( <<<<<<<<ß----(6)A: Yeah, uhh, I mean, but what I say as—as--, what I see, as you said, is---is that it’s very commercialized sort of thing whereas in soccer—soccer’s been a woorld sport for ------à hundreds of years---Emm well maybe not hundreds of years maybe a hundred years, maybe a hundred years. But… what I see… is America, being such a commodity-driven, sort of, Federal state that it just---its sports and all of its 12 �� Sustained high pitch.

excitement, and even the waaay it---it emm… promotes its sports, and the way it does its sports in terms of four quarters. -à à )))))) That’s all to do with the advertising and the money they bring in. So, I-I-I’m just thinking that the “hand-me-down” if I can use that phrase again by—to the UK is really just another means of getting money and they’re saying that they’re gonna bring it back for two games next year---that’s just[]more[]money for them. B: [Yeah but keep in mind in soccer there’s no limit on the money you can spend whereas in the NFL there’s a salary cap so no matter how much money you get… from that, I mean it’s only gonna help the guys in suits in New York in the NFL offices there, but, y’know, that’sss *smirks*….nothing to do with the game---th-the bottom line is: as long as the salary cap’s in place, teams won’t be able to… y’know… kind of, overspend or anything like they do in soccer where a few teams dominate every year. <<<<<<<ß------v13 (7)A: Yeah, the-yeah, tha-that’s—it’s a lot fai-- B: [Going back to that parity word again.] (((((((((((((((((((( (8)A: Mmm. It’s a lot fairer in terms of, eh, the salary cap. That was one of the things that I originally, emm, thought……was the most fair aspect of American football---And of (B:

[Yep )

course the refereeing which, I mentioned already………… which is extremely… good_. ((((( (( ((((((((( B: ([Yes ) [Totally agree. (9)A: Emm… so_ Do you ever intend to eh…. pursue a maybe eh commentary car-er^^ career commentary or something along those lines for s-s-some sports? B: Emm… I don’t know how I’d go about doing that, but I don’t know really if 13 �� Instantaneous drop in pitch, often after a gradual drop, where the last syllable indicates that the speaker is finished.

I’d be…

^^^^^^^^^^^

good at[]that kind of thing…I might be good at, maybe articles in newspapers and stuff ß----------------v like that or whatever A: [Yeah. ^^^^^ B: But… ehh… I don’ know—it’s—you’d have to move ‘n’ everything and it would be a very awkward thing to do, but, you never know! ^^^^^^^^^^ (10)A: Yeah well sure-B: A: B:

[laughs] like— [See what the future holds] *optimistically*

A: [Yeah weh-well sure in-in Maynooth emm… I’m starting to contribute to the Advocate our broadsheet newspaper soo… that’s a good i—that’s a good thing for practice— B-but I think you are good at -----------------à ))) )))))) kind of the…… the particular.. way of.. talking in-in your podcasts and stuff. That’s th-B: a podcast reference, Ben??? *laughs* -----------------------------à

[Oh_ Is that

(11)A: Yes, it is B: [******14 I have a podcast… Aaanyway, continue! ‘ ‘ ‘ ‘ ‘ ‘ ‘ ‘ ‘ ‘ ‘ 15 (12)A: Ehh…*exhales*…okay *smirking*…and John is good as well, but I think John ^^^^ 14 �� Inaudible utterance, its degree of inaudibility characterized by overlap. 15 �� Sustained low volume.

))))) is—is More emm… he—he puts it on more—y-y-you sound more natural because you just… y-you don’t sound any different from the way you actually talk when you’re[] doing your podcast. B:

[Yes… ‘‘‘‘‘

(13)A: You d-don’t really sound any different at all. You sound the exact[] same, whereas John—sort of-- … becomes a bit more boisterous and “louds it up” as it were. B:

[Mmm…he gets a bit hyper at times

(14)A: [Yeah—he_—yeah he gets a bit hyper an’_speaks really fast… but emm… yeah. Where do you see that podcast going, actually? ^^^^^^^^^^ B: Welll…. there’s always gon[]na be limitations because… y’know the fact that we don’t have full-time jobs or anything means that we can’t..sign up to these things online where you have your own kind of_domain name and everything, y-y-your kind of__you have this, a kind of a money-based thing where you have your own website—obviously that would mean it would get more—downloads and everything but… we just don’t have the resources at the moment… But for the moment it’s just kind of a fun thing to do -----------------------------------------------------àvvvvv And, you know, that’s what we’ll do for the—y’know--the upcoming..ehh… months and so on—w-we’ll see if we can[] ad-advance it all—I-I think we can, but[]that’d be great. ‘ ‘ ‘ ‘ ‘ ‘ ‘ ‘ ‘ ‘ ‘ A: Cos’ your downloads have been increasing B:

[Yeah

[exponentially

A: tially

*laughs **in mockery* exponen-

[well not really exponentially, but—yeah they’re very solid now,

there’s about eighty a week or something which is..pretty good. A:

[Yeah that’s pretty good

B: Yes…humble beginnings..to…y’know…hopefully a successful future. ((((( ((((((((((((((((((((((((((((((( (15)A: Ye—and of course meeting the-the “Rants’n’Raves” guys has given you a certain (B:

[Yeeeeaah_)

degree of… inspiration— B: [It suuuure diiid. I was very happy with that. Eh-obviously I ------------à_ Didn’t..emm..kind of [] mention it in the podcast or anything, but[]..yeah… they have a very good podcast themselves which has been going for about four years now, so..yeah… I (((((((((((((( could probably e-mail them of something…and ask them how they do it_. ‘ ‘ ‘ ‘ ‘ ‘ ‘ ‘ ‘’ ‘ ‘ ‘ ‘ ‘ ‘’’’’’’’’ ‘ ‘’ ‘’ ‘ ‘ ‘ ‘ ((((((((((((((((((((((((((((^^ (16)A: [Excellent. *laughs* And Nick Halling..ehh… seeing him at breakfast, y’know—not the biggest deal (B:

[Yeeeaah_)

But (B: [Yeah! That was pretty good too—an-an seeming as how he was on TV last night ß------------à_ And I couldn’t really believe the fact that “Oohh I just met that guy” yeah—it was kinda ^^^^^ weird… yeah… out of all the hotels he stayed in our one *smirks*… just how it turns out sometimes. (17)A:

[Well it was the closest hotel to the stadium 45

B: Mmm… yeah it was pretty close, yeah, but, I mean—there’s a lot of hotels around so ---à (A: [Mm For him to stay in that particular one, was… and it’s raining…very very badly now_. ))))))))))))))))))))))) vv (((((((((( (18)A: Yeaaah -----àv B: [It’s always like this… ‘‘‘^ ^’ ‘ ‘ A: Not good ball weather… )))))))))) (((( B: Noo….I’m afraid not ß--v ‘‘‘‘‘‘‘ A: [Not good ball season, full-stop_*laughs*…… B: Yeah.. ‘’’’’’’’16 (19)A: It was like this last year as well ^^^^ ^^^ ^^^ B: [Yeeah… V (20)A: We jus-we just had a downer cos’ we couldn’t play ball. B: Yeah..well you know_—it’s that time of the year ^^^^ ----à ‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘ (21)A: Right, well, I think we’ll leave it there…and emm…y’know )))))))))))) ----à B: *sarcastically* Oh, no! Oh, okay. vvvv (22)A: [Thank you very much B: have to eat something now, anyway, so… A: [*Laughs awkwardly* A-alright. Okay! Ehh

[Well I

B: welcome

[You’re

16 �� Sustained low volume (barely audible)

(23)A: Yes, goodbye. B:

*satirically* [Byeee ^^^^^^ ------à )))))

II. CONVERSATION ANALYSIS Rather than forge an extensive, sequential, episodic list of the indexically rich “happenings” of this conversation, I will rather treat the form of talk in question here (the interview) as primary referent, and allude to several key instances when this form is disrupted. Analysis in this way ensures that the context of the interaction itself qua interview, as a social situation, a sum of cues, social capacities and stances and so on, is the point of departure and not, rather, the first instance at which, in a general sense, something “happens.” Taking a panoptic view at the outset, the conversation maintains coherence and intersubjectivity at most points (See Duranti 1997: 255). The rules for turntaking which apply to the interview are maintained, the register is generally formal on my part, but with the voluminous presence of discourse markers, and the subject matter sequential. Prosodically speaking, however, there is a gradual fluctuation, which is epitomized at the very end of the interaction. There are also periodic lapses in the interview response parameters by the interviewer himself (i.e. question-answer format), examples of which will be given below. As a result of such things, the footing fluctuates constantly from interview to informal conversation. Arguably, the interview itself is being continually reformulated into something more proper to the participants’ own coordinative abilities towards one another (Gumperz 1983: 141). Curiously, the very first exchange “(1)” between the two participants is worth brief comment. First of all, there are no ritual brackets used between the participants (Goffman 1983: 130). I immediately attempt to take the floor by the use of “Okay!”, a colloquially recognized expression. The pragmatic effectiveness of this single-worded utterance thus establishes my stance in relation to the interviewee (Briggs 1984: 21). An uneasiness of demeanour can be observed in the interviewee due to the above omission. Prosody generally hovers below habitually confident levels, and there is an overuse of discourse markers (Kiesling) such as “emm…” and “y’know.” Still, the social capacity of the interviewed subject is recognized instantaneously, evidenced by the first few responses: formalized, to-the-point replies. There are certain points in the early stages, however, when the interviewer attempts to elicit a reply, themselves considerable as adjacency pairs and indexical signs based on norms for response (Duranti 1997: 250): 47

B: “and in my opinion that makes it better, so… ß--A: [Yeah I mean, like, compared to soccer[emphasis added]…it’s certainly emm… the way they have referees on the line and stuff, like, like five. In this particular instance, judging from my own overuse of discourse markers and stuttering, I am actively picking up on the fading intonation, and switching register and hence topic, with the overall intention of maintaining coherence. This can be exemplified by Duranti’s “self-selection” in turn-taking, where the next speaker selects himself (Duranti 1997: 249). In this case, the subject matter of soccer is used as a common ground by myself, through which to re-engage the other participant as interview subject. In exchange (9), for instance, an elongated transition-relevant point is created by continual pauses, indicating my incomplete knowledge (and resorting to conjectural statements) with regard to the subject matter (Duranti 1997: 249). An unwelcome opportunity is provided for the interview subject to take control. Prosodic dips and syntactical sharpness pave the way for the discussion’s conclusion, and the first major shift in footing. Stepping back from the subject of soccer (having been utilized for reparative purposes), a reversion to the question-answer style arrives. A: “Emm…so_! Do you ever intend to eh…pursue a maybe eh commentary carer-career commentary or something along those lines for s-s-some sports? The difference between the first ten or so interactions and this one is that my prepared subject matter has been exhausted, and hence I am less confident. My tone becomes heightened to signify formality of register, and I stumble often with discourse markers. Broadly speaking, the footing changes overtly from informal conversation, with the back-and-forth style it permits, to the preferred interview format (Goffman 1983: 128). The second “part” of the conversation thus begins when a re-acceptance of this form is established, only for it to be subverted once more. Between interactions (9) and (11), the subject responds as interview subject once again, until perhaps the most indexically rich exchange in the conversation: A: [Yeah weh-well sure in-in Maynooth emm… I’m starting to contribute to the Advocate our broadsheet newspaper soo… that’s a good i—that’s a good thing for practice—B-but I think you are good at -----------------à ))) )))))) kind of the……the particular.. way of.. talking in-in your podcasts and stuff. That’s th-B: [Oh_ Is that a podcast reference, Ben??? *laughs* -----------------------------à 48

(11)A: Yes, it is B: [****** I have a podcast… Aaanyway, continue! ‘‘‘‘‘‘‘‘‘‘‘ By my mentioning of something analogous to his commentary aspirations, I’m steering away from the preferred topic. At the same time, however, a hesitance can be envisioned from the transcript on my part, as indicated by discourse markers, the topic arena I am now necessitated to shift towards is one in which personal success and confidence are embodied for the person being questioned. Upon mentioning the podcast, my brother latches onto the opportunity to make his pride known and with accompanying rises in prosody and syntactical accents, interrupts the prior flow of the conversation to adopt a social voice of inquisition more properly connected with sports commentary. He was, in a sense, trying to ratify outside participants to respond (Goffman 1983). Moreover, as a first-pair part of an adjacency pair and as an utterance of pointed indirectness, my impetus is to respond, but in a subdued fashion (11), after which the conversation immediately reverts back to its previous footing (Duranti 1997: 250; 301). As the supposed primary influence on the conversation, I refuse to reveal any scintilla of an index which might prompt a further focusing of the topical spotlight away from London. The final part of the conversation is curious because the original subject matter of London is reintroduced entirely as a marker of register. The context of the shared experience was of course recreational, and by utilizing this imagined contextual space, the interviewer is demoting himself to a position on this interactional floor beneath that of the interviewee, as the primary bearer of knowledge: (16)A: [Excellent. *laughs* And Nick Halling..ehh… seeing him at breakfast, y’know—not the biggest deal (B: [Yeeeaah_) But (B: [Yeah! That was pretty good too—an-an seeming as how he was on TV last night ß------------à_ And I couldn’t really believe the fact that “Oohh I just met that guy” yeah—it was kinda ^^^^^ weird… yeah… out of all the hotels he stayed in our one *smirks*… just how it turns out sometimes. In this instance, I was essentially attempting to create a footing based on familial solidarity, emblematized by my envious attitude towards his encounter with a celebrity. Put more simply, I was prompting a recreation and subsequent sharing of the experience. 49

The most obvious shift in footing which appears is the sudden switch in subject from the nostalgic (experiences in London) to the present context (the rain outside). The allusion to the rain can be taken as an indexical sign, especially when combined with the dipping in volume and clarity of phonetics, for my introduction of pre-closings and thus for my conclusion of the conversation. This eventually does arrive, after a blatant “winding down” in speed, pitch, and volume, between the two participants, with the collective intention of breaking off the conversation. This wasn’t done smoothly, though. The phatic function of language permeates lightly, in an attempt to drag out the conversation, but ultimately settles with the use of pre-closings: (21)A: Right, well, I think we’ll leave it there…and emm…y’know )))))))))))) ----à B: *sarcastically* Oh, no! Oh, okay. vvvv (22)A: [Thank you very much B: [Well I have to eat something now, anyway, so… A: [*Laughs awkwardly* A-alright. Okay! Ehh B: [You’re welcome (23)A: Yes, goodbye. B: ------à )))))

*satirically* [Byeee ^^^^^^

The satirical closing used by the interviewee is both a first and second order index (Kiesling 2004); a first in the sense that it completes the adjacency pair with a rising, satiricised intonation and a contrastingly loud volume to my first-pair part; a second as it establishes in a single syllable the broader, brotherly social relationship between the participants, and how strongly it is built in dialectic relation to that which the interview attempted to impose. Macro-analysis of the interaction thus reveals that the changes in footing, openly displayed and indexed by our attempts to maintain a solidarity through coherence, can only be done by keeping “the interview” as a perennial and loose referent. By our attempts to import discourse markers and vernacular variants (Kiesling 2004: 297), and indeed the norms for one-to-one talk shared individually between us (centred in our familial tie), the structured nature of the interview in fact deconstructs itself. Furthermore, mounted on top of the habitual context of discussion of the subject matter at hand, a formalized system of response (whether 50

prosodic, syntactical or morphological) as enforced periodically by myself, inevitably results in an interactional faux pas, as the very constituents of the frame for interaction are detrimental to that on which this frame relies to maintain its coherence, the topic of American football.

ARCHAEOLOGY PANEL

•

Judging Panel Dr. Colin Rynne (University College Cork) – Chair Dr. Carleton Jones (NUI Galway) Dr. Tomas Ó Carragáin (University College Cork) judges’ comments For the adjudication committee, there was only one clear winner of the best archaeological essay/dissertation award, Russell Ó Riagáin’s The rectilinear houses ofthe Irish early neolithic: the introduction ofnew identities, ideologies and economies. The excellence of this entry far exceeded that of the others, although some of the latter, in our view, were of considerable merit. The committee also notes that this essay was completed as part of course work for an undergraduate degree at University College Galway, and we request that this association is properly credited in the final award This dissertation is an outstanding overview of the key issues relating to the origins and development of this early neolithic house type, in terms not only of their form, function and fabric, but also of the meanings they embodied for their builders. The author argues, convincingly, that they were strongly linked to the introduction of agriculture into Ireland, and to the new ideologies, social forms and material culture associated with this development. Further linkages to the appearance of wheat and to their apparent physical relationship to both court and portal tombs are also adeptly explored. Indeed, throughout this essay there is such an analytical depth and sureness of touch with the material that the nonspecialist can easily follow even the more complex arguments.

a rc h a e ol o g y

The rectilinear houses of the Irish Early Neolithic: The introduction of new identities, ideologies & economies Russell Ó Ríagáin

I. ABSTRACT he appearance of the rectilinear house form in the Irish Neolithic landscape was both unprecedented and short lived. Their appearance coincided with the definite appearance of arable agriculture on the island. Their disappearance also coincided with the disappearance of this form of agriculture. The island wide similarity in their form and probable functions is remarkable. They served as both functional and symbolic focal points in the landscape for their inhabitants, and they had a major influence on burial practice. Evidence for both deliberate deposition and deliberate destruction has been found at a number of sites, indicating their ritual significance to contemporaries. They also had an important role in the socialisation of successive generations of agriculturalists. II. INTRODUCTION Much ink has been spilled assigning various symbolic roles to larger scale Neolithic monuments. Surely if contemporaries manipulated, and in turn interpreted, a vast repertoire of symbols in connection with various forms of burial, they must also have assigned symbolic value to the rest of their environment. The mental separa53

tion of domestic and ritual has only really been made in these post-Enlightenment times. Even today, as Bradley points out, rituals and symbols permeate everyday life (2005, 3). This study will examine the symbolism and evidence for ritual inherent in Irish rectilinear houses. It is possible from a close consideration of the evidence to see common cognitive processes at work, while at the same time using the differences in cognition between sites to gain a point of entry into the Neolithic mind. The form, dating, function and origin will be examined in this light, before discussing their symbolism, how contemporaries might have perceived them. Following this possible ritual activity, such as deposition, deliberate destruction and the link to burial rites will be discussed. The evidence from the houses will be used to help illuminate the circumstances surrounding the advent of agriculture in Ireland. The relation of the houses to their occupants and to other monuments will also be examined. Their disappearance from the record will also be examined, and the theory put forward that it was due to a change in subsistence patterns brought about by ecological factors, which had a subsequent effect on the ideology of contemporaries. The structures at Lough Gur will not be included in the classification under discussion, as they are of later date and a differing form (Grogan 2004, 106-7; Smyth 2006, 233-4).

Iii. LITERATURE REVIEW The greater majority of writing on the subject has been in the form of the published reports of a number of the sites. These take on a descriptive format, and are usually limited by their being chapters in edited books such as Armit et al (2003), Thomas & Darvill (1996), or in the journals. They are usually low on interpretation, with only 10-20% of the text, if at all, being devoted to this. Grogan’s three articles (1996, 2002, 2004) all outline the various Neolithic house forms in depth. While it is possible to dismiss them as “routinely cultural historical” (Gibson 1998, 359), they are nonetheless important syntheses of the evidence. Cooney & Grogan (1994) offer more interpretation on the houses, but only briefly. Cooney (2000) offers far more interpretation. In the first three chapters he provides a very useful analysis of the Neolithic landscape in Ireland and the role of the house within it, making use of a variety of interpretive approaches. Thomas (1996) and Cross (2001, 2003) provide the dissenting voices. They both question their designation as houses at all, offering varying alternatives. McSparron’s (2003a) article offers a revision of the dating methods and new dates for a number of sites, and as such is one of the most important articles published regarding the Irish early Neolithic. Smyth (2006) focuses on the rectilinear form, and builds upon the interpretive approach of Cooney, while providing an up to date synthesis of both the house details and revised dating. The article also focuses on the intentional use of fire, and on other symbolical aspects of the houses. Bradley (2007) discusses both the Irish and British evidence, and focuses on the origins and obsolescence of the houses, their symbolic destruction, their role in the community and their connection to tomb forms. 54

iV. FORM The majority of these rectilinear structures employed post and planks in their construction, with some use of wattle walling also, and use of slot trench foundations for the planking (Grogan 2004, 106; Smyth 2006, 237-8). Most of the structures had four external walls, but some houses possibly had apsidal ends, such as at Ballygalley 1, Ballyharry 1.2b and Knowth 2 (Grogan 2004, 107) or Tankardstown 2 and Ballyglass (Gowen & Halpin 1992, 25). The houses have been found both in isolation and in small groups of two or three (Grogan 2004, 109; Smyth 2006, 234). They have often been found in association with other evidence of activity, such as lithics scatters, pits or more ephemeral structures (Grogan 1996, 51). There seems to have been a marked preference for house location on sheltered south to west facing slopes, frequently overlooking bodies of water (Grogan 1996, 57). Cloghers overlooks the valley of the River Lee (Dunne & Kiely 1999, 14), and Drummenny overlooks the river valley of the same name (Dunne 2003, 165). Internal divisions could have been either wattle screens (Hughes 2004, 29), or more substantial walls that were continuations of the foundation trench, such as at Corbally 1 and 2 (Purcell 1999, 15). There might be a good deal to learn from the nature of these internal divisions, as they may be taken as representing functional, social and symbolic divisions. No direct evidence for roofing techniques or materials has been recovered (Grogan 1996, 49). Internal joists are suggested by the arrangements of posts and slot trenches at Ballygalley, Ballyglass, Ballynagilly and Tankardstown (Grogan 1996, 49). The roofs themselves could have been in the order of three to five metres or more in height (Grogan 1996, 55). Grogan states that “despite the range of sizes and variations in structural details, the houses form a homogenous group” (2004, 106). Smyth suggests that there was a common template or ideal form in use, based on inter-site similarities (2006, 242). If there was such a commonly held template, it could have also meant that there were other shared ideologies. However, a degree of heterogeny is also apparent in the form of these structures, which might also have been mirrored in differing functions and symbolic messages. There is considerable variation in shape, with some houses having one or more curved walls, others almost square in form (Grogan 2004, 107; Smyth 2006, 234). Their form can be subdivided into a number of subcategories. Grogan (2004, 105-6) divides them into the following groups, and while this is a little arbitrary it is also useful for the analysis of the structures: The orientation of the houses is also important. The overwhelming majority of the houses have their long axis aligned within 45º either side of east-west (Topping 1996, 160-162; Smyth 2006, 237). This conforms to pan-European patterns apparent in similar building forms (Topping 1996, 162). This has a functional explanation, as having the long wall of the house facing roughly south would maximise solar radiation and heat absorption by the roof (Topping 1996, 161-2). However, there are deviations from this norm apparent in the Irish evidence, such as at Ballyglass, (Topping 1996, 162; Smyth 2006, 237; Ó Nualláin 1972, 54). These may be explained as being due to a number of factors, such as topographical, social, locational or 55

House Type

Group A

Group B1

Group B2

Group C

Group D

Morphology

Square

Rectangular Rectangular 2 rooms

3 rooms

No. Sites

Size range m²

26.9-36.0

29.3-85.5

21-26.7

35.0-73.0

42-87.6

Average size m²

31.7

45.9

24.6

59.5

64.9

Table 1: Range of house sizes symbolic factors. Doorway location is also responsive to factors other than environmental (Topping 1996, 162-3). They may or may not be positioned to admit light into the structure, Ballyglass has evidence for a possible screen inside the door at the north-west corner (Topping 1996, 163; Ó Nualláin 1972, 54). Thresholds have important symbolic connotations. Their positioning may be due to some ideological factor, such as the position of particular features in the landscape, or possibly even the positions of stellar features. However, their location might also have been chosen for more functional reasons such as the position of other structures in the immediate area. They may also be orientated towards routeways. The houses at Enagh and Thornhill both have their entrances pointing towards the River Foyle, which at the time would have been an important routeway in a forested landscape (McSparron 2003b, 12). The river itself may have been assigned sacred properties by these people; there are certainly many examples of rivers being designated as deities in cultures right across time and space. This may have provided further reason for the orientation of their entrances towards the Foyle. The evidence so far points to the exclusive use of oak for the structural elements of the houses. The choice of oak may be a functional one, oak timber splits well (Cooney 2000, 58), and grows to quite large proportions. It also weathers quite well, becoming harder with exposure to the elements. However, there may be some symbolic significance in the choice of oak, as in many cultures the oak tree holds a sacred role. Its longevity of life may have been symbolically utilised by the builders, who may have sought to convey a message of their legitimacy in the landscape through its use, and also possibly a message of their own intended longevity. Interestingly, at Drummenny Lower oak pollen was absent from the suite of arboreal taxa identified at the site, which suggests that the oak used had not grown locally (Dunne 2003, 168). This could have meant that oak was sourced from beyond the immediate hinterland of the site in order to conform to a possible common template. Further evidence for possible conformity to a common template comes from the examination of the foundation trenches of a number of these sites. The foun56

dation trenches at sites such as Ballyharry, Cloghers, Haggardstown and Kishoge were cut into the underlying bedrock (Smyth 2006, 242). This represented considerable extra labour, and can be taken to indicate the adherence to a particular pattern, or to the importance of the site’s exact location. At Ballyharry, the foundation ditches of the various phases were cut into basalt (Moore 2003, 156), which would have required a considerable investment of labour due to the nature of the rock (Callan, J. 2008, pers comm.). In phase 2, round and possibly water-rolled stones were used for packing the foundation trenches, rather than the debris from the initial cutting of the trench (Moore 2003, 156). This shows that while adhering to a possible template, the builders also were incorporating a more localised ideology in their choice of rounded packing stones, which illustrates the need to examine each of these sites individually as well as on more general terms, as Smyth suggests (2006, 244). The continuous hewing of foundation trenches as one continuous unit also occurs at a number of sites, such as at Corbally, Gortaroe and Mullaghbuoy (Smyth 2006, 242). Interestingly, these trenches were then backfilled in the places where planks were not to be erected, such as at the entrance (Smyth 2006, 242). This might signify a symbolic importance attached to the enclosing aspect of the trench.

V. RECTILINEAR HOUSES AND THE INTRODUCTION OF AGRICULTURE Grogan assigns a timeframe of c. 4050-3850 BC to the houses on the basis of “the combined radiocarbon evidence” (2004, 111). However, a large proportion of these dates used in Grogan’s calculation are from structural. Dates from structural timbers can be somewhat misleading (McSparron 2003b, 11-2; Smyth 2006, 238-9), due to the fact that oak trees live for quite a long time, and the timbers may also have been weathered for a number of years before usage. Their possible reuse is also a factor. It is obvious from this evidence that the use of structural timbers as an absolute dating method for the houses leads to a skewed chronology. The use of samples from short lived species, such as hazel or charred grain, provides a far more accurate picture (McSparron 2003b, 11). Using short lived species samples, obtained from 9 houses on 5 sites, McSparron established a date range of 3800-3520 BC for 95% of the samples (2003b, 11). He was further able to assign a date range of 37303630 BC for 60.7% of the samples (ibid). Smyth has further expanded upon this, assigning 21 houses to the years c.3800-3520 cal. BC (2006, 238). However, it should be noted, that, as Smyth points out, it is difficult to tell if the dated material relates to the period of construction, use or abandonment of these buildings (2006, 238). These dates should lead to a rethinking on the introduction of the Neolithic to Ireland. If we are to assign a date of c.4000 BC or before to the introduction of agriculture (Cooney & Grogan 1994, 29-33), then it would mean that the houses developed long after the introduction of farming. However, there is no evidence of large scale agricultural activity until c.3800 BC (ibid, 32), which synchronises quite well with the updated chronology of rectilinear houses. Indeed, it is the charred triticum at Tankardstown that provides this date 57

(Cooney 2000, 40; Gowen 1987, 9). Up until that point, the evidence is fragmentary. The appearance of cereal type pollen in early post-glacial settlements may be accounted for by genetic mutation of wild grasses (O’Connell 1987 as quoted by Cooney 2000, 39). The elm decline of c.3800 BC causes problems in identifying the level of intentional forest clearance. The decline in the levels of elm pollen in the record may have occurred due to non-human factors (Cooney & Grogan 1994, 29). Pollen cores, such as those from Lough Sheeauns, Co. Galway and Beaghmore, Co. Tyrone record an increase in wheat-type pollen in these years also (Cooney 2000, 39-40; Waddell 2000, 27-8). The appearance of the rectilinear house at the same time as the appearance of wheat pollen in more substantial numbers, and the fact that charred grain or cereal-processing waste has been found on at least 12 sites (Smyth 2006, 240) points to the two being strongly linked. This essay argues that they were in fact two aspects of the same package, which arrived from outside Ireland with some form of population movement of scale as yet unknown. Agriculturalists arriving onto the island would have already built up lactose and gluten tolerance,1 which may have taken native populations a number of generations. Once these natives adopted the agricultural ‘package’ there would have been little to distinguish them those who had introduced agriculture. In the future, perhaps DNA analysis might be used to provide some evidence to clarify this. The dating of their disappearance will be discussed under the heading ‘obsolescence’

VI. FUNCTION There are a number of differing opinions as to the functions of these structures. Thomas (1996) doubts their designation as houses at all, as does Cross (2003). Grogan (1996, 2002, 2004), Cooney (2000), Smyth (2006) and Bradley (2007) all designate these structures as houses. None of the published descriptions of the excavations of these structures doubt that they are houses. However, the exact functions of each house within this framework may vary (Smyth 2006, 244). There is also no reason to preclude multifunctionality, but their primary function remains domestic. To refute Cross’ 2003 argument for their non-designation as domestic structures, houses can also be used on occasion as meeting halls, feasting halls, workspaces and for a variety of other functions and still remain, in essence, houses. Multifunctionality does not preclude domesticity. Thomas (1996, 2) states that the structures are atypical, and that the Neolithic in Britain and Ireland was characterised by transience (1996, 2, 4). While he does state that there was a complexity and heterogeneity in Neolithic settlement pattern (1996, 2), the article is an attempt to use a transient model to explain Neolithic settlement in both Britain and Ireland. He attempts to portray the rectilinear houses on both islands as atypical, and goes on to state that generalising using Céide as a model was also difficult, due to its uniqueness and doubtful date (1996, 1 In this I am indebted to Prof. Peter Woodman (October 2007) for bringing to my attention the fact that higher levels of lactose intolerance and Coeliac disease occur in those areas of Europe into which agriculture was introduced latest.

4). Thomas also assigns storage roles for the structures at Balbridie, Scotland and Ballygalley (1996, 9-10). The weight of evidence alone discounts Thomas’s model for Ireland in the early Neolithic, especially in light of the numerous discoveries in recent years. The most recent figure for the number of rectilinear Neolithic structures in Ireland stands at approximately 70 (Smyth 2006, 234). Smyth also points out that this figure is likely to continue to grow in the coming years (ibid). Thomas’ assertion that they were atypical hardly holds true on this evidence, at least for the period that these rectilinear structures appear in the archaeological record. However, when found in clusters, some of the buildings, such as the smaller ones, may not actually have functioned as houses. They might have had roles as stores, smokehouses, or a range of other functions. However, clusteration might not mean contemporaniety. The direct dating relationship between houses in many house clusters has not been established, and there are some sites such as Corbally where there is evidence for successive houses (Purcell 1999, 2002). Grogan outlines the evidence for other contemporary settlement forms of a more ephemeral nature (1996, 51). This evidence is scant, but these sites may represent specialised activity (Grogan 2002, 523), rather than evidence of some form of hierarchy, or of a level of settlement heterogeny à la Thomas et al. Some of the houses had sloping floors, such as that at Drummenny Lower (Dunne 2003, 170; Cross 2003, 200). This would not have made for comfortable sleeping arrangements if the buildings were domestic. However, these may have been exceptional buildings; the house at Drummenny seems to have had a very short life-span and may not have even been a domestic building in the strictest sense (Dunne 2003, 170). While there are dangers of projecting any form of modern conceptualisation back in time (Thomas 1996, 1-2; Jenkins, K. 1991 et al), the house remains a useful concept for the analysis of Neolithic social structures and settlement. It would seem from the amount of artefacts associated with domesticity found in relation to the structures in Ireland that they can be deemed as houses (Smyth 2006, 240-2). Cooney points out that, on the basis of the ethnographic record, the house can be shown to be a very cross cultural idea, but that the concept of home varies (2000, 52). In this he is correct, the term home is extremely subjective, relating to a person’s interaction, on an emotional and conceptual level, with an undefined structure. The term house refers more to a structure form within which some form of habitation is made. No clear correlation can be made between house floor area and the number of occupants (Cooney & Grogan 1994, 47). Cooney and Grogan assign a rough estimate of 5-10 individuals, before stating that this implied that the family was the basic social unit (1994, 48). They do, however, concede that factors such as social status and function also had an effect on house size (ibid). Grogan goes one step further and assigns 4m² to each person in these dwellings (1996, 57; 2004, 106). This can be criticised on many different levels. It is far too positivistic. It does not 59

take into account that houses might have been used in different ways by different groups. For one, there may have been a division of the sexes between houses, or the removal of liminal figures such as adolescent males. Moreover, this might only occur at different times of the year. Some may have been occupied by people of more elevated social status than others, meaning they may have had bigger dwellings, or possibly smaller ones by virtue of their non-performance of certain activities. Lévi-Strauss in his 1969 book The Raw and the Cooked spoke of the transformation value of fire. Fire is a symbol with many different meanings, and it has an important role in structuring daily routine (Cooney 2000, 61). Richards asserts that the hearth was the centre of people’s lives, a reference point from which they took their position and orientation (1990, 116). He also argued that it symbolised the unity and well being of the family (ibid). Cooney also points out that, in Neolithic houses, fire, as embodied in the hearth, had both an important functional and symbolic role (2000, 61). It was a central feature that people would have had to move around, cook on, and obtain heat and light from (ibid). Cooney also illustrates that there were a number of dichotomies involved, due to its capacity as a focus to divide the house or room into central and peripheral areas, warmer and cooler, brighter and darker (2000, 61). Cross disputes the multi-functional role assigned by Cooney to the hearths in rectilinear houses (2003, 199). She points out that “ these fires do not seem substantial enough to have played so many roles, the lack of elaboration and the overall size and the shallow penetration of oxidisation so not point to a central focus for the daily lives of a family group” (ibid). This is indeed a valid observation, and when taken in conjunction with ethnographic evidence it might be taken to mean that the fires were lit for light, heat and secondary cooking in linear feasting halls (Cross 2003, 1999). However, the houses might also have made use of a smaller internal fire and larger external cooking fire so as to prevent the danger to its inflammable structure posed by such a big fire.

VII. ORIGIN The form was not unknown in the contemporary British early Neolithic. There has been a long tradition of attempting to link the form to the continent also, both in Britain (practically everything written prior to the 1980s) and in Ireland (ApSimon 1969, 168; Ó Nualláin 1972, 56). There is a remarkable variance in the numbers between Ireland and Britain, and even more so between Ireland and lowland England (Bradley 2007, 38). Bradley points out that this can hardly have been due to differential survival (ibid), and states that the “contrast is a real one and has to be explained” (ibid, 39). However, the contrast may not have been as sharp as today, as while both islands have had long traditions of cultivation (Bradley 2007, 38), England has had a far stronger tradition of arable farming in later years, which would have led to a more severe truncation of the evidence. Also, far more landscape alterations have taken place in lowland England than anywhere else on the two islands. When this is taken in conjunction with the traditional higher popula60

tion density in England it can be seen that there is less chance for survival of this house form. On the continent, the relative stability of the linearbandkeramik period had come to an end almost a millennium before the beginning of the insular Neolithic (Last 1996, 27). By the end of the fifth millennium BC there had been a shift towards the use of small, non-rectilinear houses, rather than the use of the large longhouses of the LBK period (Last 1996, 27-30). Bradley points out that the rectilinear houses of the insular Neolithic(s) were much smaller in form, with less evidence for organisation into clusters (2007, 40). He does concede, however, that the latter pattern may be changing due to recent fieldwork evidence (ibid). Topping points out there was a similarity in form to be found in a series of structures around the northwestern periphery (1996, 158-9). However, he does this without providing any dating evidence, just drawing similarities on the grounds of morphology. It is most probable that a particular agriculturalist package spread into Atlantic and northern Europe. The fifth millennium BC was a time of flux, and it is quite possible that there were population movements occurring in north-west Europe. It is difficult to ascertain whether or not there were large scale movements of population into Britain and Ireland. The wild ancestors of wheat and barley, and of cattle and sheep did not exist in postglacial Ireland (Waddell 2000, 25). This implies human agency in their introduction, via immigration. With these people came new social and ideological forms, new subsistence methods and attendant material culture. Their difference from the previous norm on the island certainly would have set them apart for contemporaries. Pottery, cereal production, animal husbandry and rectilinear houses all occupied a central position in this new framework. New tools associated with agricultural practice, such as the ard and saddle querns also appeared at this time (Waddell 2000, 29). However, a degree of continuity in some lithic forms may also be seen in the record at some house sites. At Enagh, McSparron points out that the flint blade found there displayed Mesolithic attributes (McSparron 2003a, 170). The assemblage at Drummenny Lower also might indicate a level of continuity in form and use (Dunne 2003, 170). It is highly probable that these farmers introduced monumental tomb construction to Ireland also. This draws an interesting contrast between the longevity of their oaken houses and the permanence of their tombs (Cooney 2000, 58). The early dates found at Carrowmore and Croghaun Mountain, Co. Sligo may indicate tomb construction prior to the advent of Irish agriculture (Waddell 2000, 26). However, in this author’s opinion this region might be a special case, as it is quite possible that there was a stable population in the area exploiting the abundant natural resources of the two estuaries and their hinterlands. Also, the Carrowmore dates might have been derived from activity prior to the monumental phase there (Waddell 2000, 26). The Croghaun dates might also be distorted by old wood effect.

vii. SYMBOLISM The houses are certainly metonymic. To contemporaries they would have been 61

seen as representing the entire agricultural system. They can be seen as a statement of intent by the agriculturalists, as an assertion of their identity, both by the possible colonists and by the indigenous people who adopted the system also. Their angular form thrust skyward can be taken as representative of the humans’ new found mastery over their environment. With the introduction of this form came the introduction of the concept of angularity into the minds of contemporaries. This must surely have had an effect on the ideology of these people. With angularity came the introduction of corners into people’s perception of their built environment. This could have led to an increased definition of the roles of particular individuals within the social group, as there now was a possibility for people to be mentally assigned to different corners and thus categories. It could have led to a greater differentiation between the sexes. A particular concept from linguistics, and developmental psychology, might be applicable here. Words associated with female related concepts usually take a rounded and continuous form, be it at the level of a child first grasping at language, or in the languages spoken worldwide. In contrast to this, male related words usually take on a more angular and staccato form. With the introduction of angularity into the built environment, is it possible to take this as signifying an assertion of male dominance? It is also possible to engender in some ways another dichotomy also, that of external and internal. The outside be seen as male, with its angles projecting into the outside world. This outside world can be seen as the male domain in many ways. It was where danger lurked in the minds of contemporaries. It was where hunting and warfare took place. It was where those outside of the immediate occupant group were located. On the other hand, the internal area of the house symbolised enclosure, protection, nurturing and safeness, which can be more associated with maternity. Tool production and farming both may still have been mixed activities, although there was probably some division of activity based on gender. The morphology of court and portal tombs also suggests symbolic reference to the male and female form. Portal tombs may have been situated at the edge of a community (Jones, C. 2006, pers comm.). If court tombs were located at the symbolic centre of communities, then it may be that the male signifying portal tombs were put at the edge of the domestic zone to provide function, and the female court tomb at the centre of this zone. When taken in conjunction with the other cognition carried over from domestic to funerary settings, this might be significant. The rectilinear house is a conspicuous manipulation of the resources of the agriculturalists, and may have been an assertion of their power addressed both to the elements and to other humans. It was also a symbol of the triumph of domesticity over wildness. It is possible to apply here Hodder’s post-structuralist view of the emergence of Neolithic culture in light of the triumph of the cultivated (interior) world of the house, or domus, over the uncultivated, wild and savage exterior, or agrios (Dark, 1995, 186-7). This is an extremely useful concept which can be applied to the spread of agriculture in general and the changes it brought on so many levels. 62

The Irish rectilinear house’s morphological similarity with other European examples is also of interest. While it is of much smaller proportions to the LBK house and its derivatives, cognitive process may be identified in its use in Ireland. It may be that in the minds of the early farmers in Ireland that the rectilinear house was associated with a time of stability in the past, from where the knowledge of agriculture originated. This might explain the corrupted form, which is far smaller and housed what was most likely a single familial group, as opposed to the multiple families resident in the LBK houses. Lévi-Strauss described ‘house societies’, organised along the lines of kinship, which in turn led to the emergence of hierarchies (1979/1983 as quoted by Bradley 2007, 59). Whittle states that “the house provided much more than shelter, it encouraged the formalisation of behaviour” (1996, 26). The rectilinear house had a positive feedback effect on its occupants. It at once was affected by and had an effect on the ideology of contemporaries. Its genesis was due to an assertion of identity, and that identity came in turn to be shaped by the concept of the house. The house functioned as a means of socialisation for successive generations. The houses functioned as nodal points in the landscape and their use in a formalised way provided a means by which people created new attachments to place, and through this, new senses of identity and time (Whittle 1996, 26). They were the main arena for the unconscious passing on of the habitus from one generation to the other (Hodder, 2003, 92). The symbolic importance of wheat and stone implement production would also have been important in shaping the identity of these people, as would their burial monuments.

iX. RITUAL ACTIVITY Evidence for possible ritual activity is also apparent in the rectilinear house. The appearance of evidence for ritual activity does not mean that there were special ritual houses, more that ritual and domestic activity were inextricably linked (Bradley, 1998; 2003; 2007). Intentional deposition at the houses can be taken to indicate ritual, or at least symbolic activity. The later association of the burial monuments to the houses has important symbolic connotations. The deliberate destruction of the houses, either by demolition or by fire can also be viewed from a ritual perspective. Structural deposition had an important role in the life cycle of the house. Sifting through the published excavation results it is apparent that intentional deposition took place at every site, and often both at the beginning and end of each phase of use. This enables us to identify common cognitive processes at work on a general level, with local variations providing us with a point of entry into the culture of those carrying out the acts. A large-scale interpretative study on a site by site basis would certainly provide an opportunity to reconstruct early Neolithic ideology, especially if done in conjunction with the evidence from court tombs and portal tombs. 63

A large amount of pot sherds of carinated ware,2 lithics and other objects have been recovered from the foundation trenches of many of the houses. That such new technology would be discarded accidentally into these ditches is doubtful. Clay was transformed by fire into pottery, and when taken with the evidence for the other symbolic aspects of fire, the deposition of pottery into the ditches must have had a symbolic role. 2500 sherds of western Neolithic ware were found at Ballyharry (Moore 2003, 160), and there was also considerable evidence for deposition of stone artefacts at the site (ibid, 156-63). The use of rounded stones in the packing of House 1, Phase 2’s foundation has already been mentioned. There also was the possible ritual deposition of a basalt axe and large leaf shaped arrowhead in the central post-holes of the E and W slot trench, both blade edge downwards, under burnt material, but unburned themselves (Moore 2003, 158). This may have been in reference to the previous attack on the site, and if so it gives an insight into how the occupants thought another attack could be prevented, or that they chose to commemorate it in some way. Deposition also took place in a series of shallow pits containing a large range of material including porcellanite, possible jadeite axe rough-outs, pottery, Group VI polished flakes, burnt bone, charred hazelnut fragments and charred cereal grain (ibid). At nearby Ballygalley, the occurrence of such valuable material as Langdale tuff, from Cumbria, a possible Cornish greenstone axe, pitchstone from the Scottish island Arran and porcellanite from Tievebullagh or Rathlin can be taken to indicate profitable long distance trading contacts for the site (Simpson 1996, 129-132; Topping 1996, 167). That such wealth would be left behind accidentally is doubtful, implying intentional deposition. The association of food items in the deposits must also be considered to have been part of the same ritual, perhaps symbolically ‘cooked’ before deposition. Topping points out that it may have been competitive material exhibitionism at either a local or regional level (1996, 167). Ballygalley was covered by a cobbled surface some time after its intentional destruction, and this may have been the final phase of ritual associated with it (ibid). There may have been some ritual significance involved in the actual materials deposited. At Cloghers near Tralee, Co. Kerry a quartz core was found placed at the base of the substantial north-west post (Kiely 2003, 184). Quartz is a material that is vested with much symbolic value in ritual contexts (Parra, J. 2006, 2008, pers comm., Bergh 1995, 156, Cooney 2000, 176-8). It is used by Amazonian tribes in Columbia to accompany cremations, and is also used in shamanic and ceremonial rites (Parra, J. 2008, pers. comm.). Deposition at the base of post-holes occurs in both northern Thailand and Malaysia (Smyth 2006, 246). Quartz debitage has also been found at a number of house sites, such as Drummenny (Dunne 2003, 166), 2 It would be highly informative if a detailed lipid analysis was done on pottery from the sites, as it would provide an interesting insight into the diet of these people (Roycroft, N., 2007, pers comm.). Further stable isotope studies of human remains of the period would also prove useful in this regard. The rate of the build-up of lactose and gluten tolerance might be illustrated by studies such as these.

Enagh (McSparron 2003a, 172), Corbally 3 (Purcell 1999, 15) and Tankardstown South (Gowen 1987, 8). At Enagh, three pieces were also found in the fill of a posthole (McSparron 2003a, 172), which provides a possible cognitive link to Cloghers. Serpentine beads were found at Corbally 3 (Purcell 1999, 15), and serpentine items were also found at Ballygalley (Simpson 1996, 132). Serpentine3 has been assigned spiritual properties by a number of different cultures at different points in time (http://www.crystal-cure.com/serpentine.html), and it is possible that it might also have had some symbolic significance to the house builders. The transformational value of fire has already been discussed, and its role in the destruction of some of the houses might be significant. Its possible use for the clearance of land ahead of cultivation (Waddell 2000, 29), could also have been a symbolic act, with fire being employed as an agent in the triumph of the domestic over the wild. Drummenny, Tankardstown South 1 and 2, Kishoge, Ballyharry 2 and 3, Cloghers, Coolfore 2 and Monanny C were all destroyed by fire (Dunne 2003, 165; Gowen 1987, 7; Gowen & Target 1988, 156; O’Donovan 2001, 6; Moore 2003, 156, 158; Kiely 2003, 187; Ó Drisceoil 2003, 181; Walsh 2004, 36). Smyth refutes the common interpretation that these wooden thatched buildings burned down accidentally (2006, 246-7). She uses examples from experimental archaeology (carried out by Bankoff & Winter 1979; Shaffer 1993; Stevanovich 1997), in order to show that in order to burn a house down to its foundations, as at Monanny C, it would be necessary to artificially prolong the fire and maintain quite high temperatures (2006, 247-250). The examples used by Smyth also showed that an accidental fire would only burn for a short duration, in the order of 20 minutes, after which time it would be safe to enter the structure and put an end to any smouldering still ongoing (2006, 247). While the timbers used by the experimenters might not have been dried out to the same extent as in reality, the argument is still convincing. Houses may have been burned for non ritual purposes also, such as inter-polity warfare. The burning activity at Thornhill is one such example of this, with seven arrowheads being found in context with the burning of an external palisade (Logue 2003, 149-51). Ritual burning of a defeated enemy’s house might have been a possibility for some of the other sites. At Ballyharry, Phase 3 seems to have been ended by an attack which resulted in the burning of the north wall, leaving a number of projectile points in its vicinity (Moore 2003, 157; Smyth 2006, 247). Interestingly, in the subsequent rebuilding phase one of these projectiles was deposited under a rebuilt wall (Moore 2003, 158; Smyth 2006, 247). The evidence points to the life-cycle of the houses being deliberately ended by fire, at least in some cases. Perhaps the house was regarded as almost human, and strongly linked to its occupants (Bradley 2007, 59). The society might have assigned an important role to fire in the various rites of passage or indeed in daily 3 The mineral’s most prolific source is Clew Bay (Ryan, P. 2006, pers. comm.), and this may indicate trade between these areas.

life (Smyth 2006, 250). It might have been used to purify a site after the death of an occupant (ibid; Bradley 2007, 61). The abundance of cattle bones in the foundation trenches at so many sites might indicate a ritual feast at the end of the buildings’ life cycle. Cooking is another wayn which fire acts as an agent of transformation. Cross points out that it would have taken a large number of people to consume a cow, probably even an entire lineage (2003, 199). This feast might also have served as a reward for provision of labour for the building of another house or a court tomb. The placing of burnt bones in the foundation might then have been a symbolic feeding of the house or its spirit. Also significant is that fire also had a role in the rituals surrounding court tomb use, such as cremation and tomb preparation (Bradley 2007, 60). The artifactual assemblage found in court tombs bears remarkable similarity to the domestic assemblage (Bradley 2007, 60). The domestic items found in court tombs might actually be the contents of the tomb’s occupant’s house (Bradley 2007, 61). Bradley also points out that “it seems much more than a coincidence that human corpses should have been treated in exactly the same way as these buildings” (2007, 61). There may have been a similar thought process at work, with fire providing the means for movement from the world of the house to the world of the ancestors. The orthostats used in megalithic tombs might be representative of the timbers used in house construction (Cooney 2000, 58). The shape of the chambers in the tombs also might be taken as representative of the house form. It is possible to apply here Thomas’ notion of tombs being a mnemonic technology (1991, 9-11), serving as reminders of both the house and its occupants long after their demise. On this evidence, it is no coincidence that court tombs and portal tombs are to be found in the vicinity of many rectilinear houses. Both court tombs at Ballyglass are to be found built over the sites of houses (Ó Nualláin 1972, 49). Indeed, one of the tombs’ layout respected the ground plan of the rectangular house, leading the excavator to conclude that it was “difficult to avoid the conclusion that the house was deliberately demolished to make way for the construction of the tomb (Ó Nualláin 1972, 55). Habitation refuse has also been found under other court tombs such as Ballymarlagh, Co. Antrim and Ballybriest, Co. Derry (ibid, 56). Ballybriest itself is located to the north of the house at Ballynagilly. Extensive evidence for early Neolithic habitation, including rectilinear houses has been found underneath the passage tomb at Knowth (Roche 1989, 102-3). 2 sherds of Western Neolithic ware were found at a habitation site under the small passage tomb at Townleyhall by Eogan in 1963 (51). Indeed the chamber of the tomb resembles a rectilinear house in its ground plan. The passage tomb at Ballycarty is located a short distance from the house at Cloghers (Kiely 2003, 182). The portal tomb at Gaulstown is located in a townland neighbouring the house sites at Granny and Newrath (Hughes 2004, 26). The court tomb at Drumrat is intervisible with the house site at Drummenny (Dunne 2003, 166). Dunne also points out that the 50 or so megalithic tombs in south-west Donegal are located on warm slopes and ridges (2003, 169), which 66

matches the general siting of rectilinear houses. What this evidence shows is that in some locations the siting of a rectilinear house has an influence of the choice of site for megalithic tombs. It may be that later groups sought to legitimise the present by using sites associated with ‘the ancestors’. There may, however, be an even closer connection, as has been pointed out above, in that some house occupants may have been interred in court tombs (Bradley 2007, 61 etc.). This might explain why there seems to be direct continuity between the rectilinear house at Ballyglass and the subsequent court tomb.

X. OBSOLESCENCE Their disappearance may have been more due to ecological factors rather than cultural. A marked decline in cereal pollen occurs in the palynological record in the middle years of the fourth millennium BC. This period is also marked by the sharp rise in the abundance of dandelion pollen which indicates open grassland. An example of this is to be found in the core sample results from Lough Sheeauns (Waddell 2000, 28). This can be taken to indicate a shift towards a more pastoral economy. This could have been for a number of reasons, such as the appearance of pests (Bradley 2007, 43), climatic conditions or over-farming. There is evidence for accelerated bog formation in the later half of the millennium, and by 3200 BC the Céide system was becoming unviable (Cooney & Grogan 1994, 41). A cooling and dampening climate would have meant a cooling of the soils and a reduction in sunshine, which would have greatly diminished crop yields. With the shift to pastoralism came a shift towards greater mobility in the landscape. This would have made the rectilinear house redundant, as the population would have remained at one location for shorter periods. Circular form houses became the norm from these years, a domestic form which would remain in exclusive use until the medieval period. Perhaps the inhabitants also felt less need to assert their identity in so dramatic a fashion once the shift to pastoralism began (Bradley 2007, 44). The place of rectilinear houses in the landscape and ideology came to be replaced by the megalithic tombs, which may have replaced them as nodal points in the landscape for various social groups. XI. CONCLUSION The rectilinear house is the quintessential monument of the Irish early Neolithic. It is strongly linked to the introduction of farming and the new ideology, social form and material culture that accompanied it. Their distribution indicates that there may have been a degree of contact between different parts of the island, or a shared ideology from a shared heritage. The evidence for trade at sites such as Thornhill, Ballygalley and Ballyharry also illustrates inter-regional interaction. The evidence for small scale warfare at Ballyharry and Thornhill indicates that this interaction was not always positive. The house occupied a central place in both the formation of ideology and socialisation. It can be seen from the evidence outlined above that the people who dwelled in these houses manipulated a wide repertoire of symbols 67

in their everyday lives. The houses themselves were loaded with symbolism, symbols which displayed humanity’s dominance over its environment, which relayed unconscious messages about the structuring of society, gender symbolism, the battle between domus and agrios and many more. The houses functioned as the focal points of their communities, and it seems from the evidence that similar social forms were pan-insular. The occupants manipulated a number of symbols for ritual purposes regarding the houses. Evidence of this is to be found in the deliberate deposition before and after the house’s lifecycles, and in the acts of deliberate destruction by fire and/or demolition. As society shifted towards a pastoral economy, megalithic tombs came to replace the houses as the foci of their respective communities.

BIOCHEMISTRY PANEL

•

Judging Panel Prof. Cliona O’Farrelly (Trinity College Dublin) – Chair Prof. Rhodri Ceredig (NUI Galway) Dr. David Lloyd (Trinity College Dublin) JUDGES’ Comments The submission entitled Investigating the structural characteristics of transient protein-protein interactions was a laboratory project report which all three judges independently selected as a winner, each equally impressed with how it explored and analysed a complex biochemical topic in a lucid, engaging manner. This was a clearly written, well presented report of a research project carried out by the candidate, consisting of a Summary, Introduction (outlining the specific aims of the project), Materials and Methods, Discussion, References and Appendix. The report focused on the analysis and presentation of results from a series of challenging technologies used to study the interactions of proteins, yet was written and presented in an understandable and accessible way. This presentation was enhanced by the well chosen, elegant molecular-modelling figures included in the manuscript. What pleased us particularly about the report was that it was evident the candidate had thought profoundly and independently about the project as evidenced by a section in the Introduction entitled “Why bother?” and one in the Discussion entitled “Future studies”. The candidate is to be congratulated on the execution of this report and certainly deserves to win the prize.

bio C h e m i st ry

Investigating the structural characteristics of transient proteinprotein interactions Niamh Parkinson

Summary his investigation focuses on the interactions between the two electron transfer proteins, Cytochrome c (Cyt c) and Flavodoxin (Fld), as a model system for transient protein-protein interactions. The aim is to define the characteristics of such interactions that play roles in both driving the complex formation and in enabling optimum orientation of the proteins for a successful interaction. 2-D Heteronuclear Single Quantum Correlation (2D HSQC) NMR spectroscopy was used as the main tool for this study as it allows a fast analysis of these short-lived interactions in solution. The above method requires labeling of one of the interacting proteins with the 15 N isotope in order to detect changes to the NMR spectrum upon complex formation. Because of this each of the proteins involved were expressed in both the labelled and unlabelled form. Once proteins had been successfully isolated and purified sufficiently, 2D NMR experiments were carried out from the perspective of; A) 15N-Labelled Cyt c interacting with Fld and B) 15N-Labelled Fld interacting with Cyt c. The resulting chemical shift perturbations, when mapped onto the surface of the proteins, highlight the surface areas and residues most involved in the complex interface. In the case of Cyt c, the region most affected by complex forma71

tion is located around the edge of the heme co-factor responsible for the transfer of electrons. A similar result was found in the case of Fld in which the surface area affected was also located around the protruding FMN co-factor. Further NMR experiments exploiting the paramagnetic properties of oxidised Cyt c were also carried out. These results hold specific information regarding the orientation of the proteins, relative to the heme co-factor, during complex formation.

Introduction Protein-Protein Interactions: Proteins do not act alone but usually carry out their relevant functions within a static protein complex or via transient (short lived) complex formation. For how long and to what extent the proteins interact depends on the nature and purpose of the interaction. This is generally determined by the structural characteristics of the surface of the protein such as the three dimensional shape, electrostatic charge and chemistry occuring at the protein interface. Two proteins known to form a transient complex are Flavodoxin (Fld), and Cytochrome c (Cyt c). Although these proteins are not physiological partners, they are used here as a model for electron transfer or redox protein interactions. Redox protein-protein interactions are known to occur transiently and the proteins involved in such complexes have evolved to suit their respective functions. As described by D. S. Bendall, (Protein Electron Transfer, 1996) “… the affinity between a redox protein and its reaction partner must be high enough to achieve rapid electron transfer, but not so high as to prevent rapid dissociation of the products and turnover of the chain of carriers as a whole”. Bendall also mentions that, alongside affinity, specifity is another factor that must be brought into the balance. Cyt c, for example, is involved in the mitochondrial electron transport chain where it shuttles electrons between protein complexes. Therefore, it would not suffice if Cyt c displayed too high a specificity for one or more of the interacting partners as this would impede the overall turnover of electron transfer. Typical rates of electron transfer for similar types of complexes are of the order 105 M-1 s-1 (Feng and Swenson, 1997). For transient complexes it seems that both association and dissociation rate constants (kon and koff) are high, but what kind of features or characteristics of the interacting proteins support this mechanism of interaction? This was the question addressed by Crowley and Ubbink (2003) in their investigation of the protein interactions of the photosynthetic redox chain involving Cyt c6 and Plastocyanin. The outcome of this study was that the underlying factors of complex formation are conserved. For transient interactions this includes (a) the effect of the solvent shell on forming an encounter complex, (b) the effects of electrostatics on preorientation and the rate of association of the complex, (c) hydrophobic interactions in their contribution to specificity by aligning the cofactors and stabilising the encounter complex and (d) the size of the interface. However, although these aspects are conserved, the degree to which each one contributes energetically, varies among different complexes. For example, one protein complex 72

may be stabilised or driven mainly by electrostatics with hydrophobic effects playing only a small role. On the otherhand, for another protein complex, the opposite may be true.

Aims of this investigation This project aims to investigate the structural characteristics involved in the transient interactions occuring between yeast-iso-1-Cyt c from Saccharomyces cerevisiae and Fld from Escherichia coli using 2D (1H, 15N) NMR spectroscopy. The investigation is focused on highlighting the specific amino acids involved in the complex interface from the perspective of both Cyt c and Fld. This information provides a basis to understanding the chemistry and three-dimensional architecture that promotes complex formation while at the same time enabling fast complex dissociation. The interaction sites will be identified using chemical shift perturbation mapping. As previous research has also investigated interactions of these proteins with other partners, both physiological and non-physiological, (Hall et al., 2000; Hall et al., 2001; Worrall et al., 2003; Volkov et al., 2006) the results obtained here will be compared to some of those findings in the discussion. Introducing Cyt c and Fld The most widely known function of Cyt c is as an electron shuttle between complex III and complex IV in the sequence of events that leads to oxidative phosphorylation in the mitochondrial electron transport chain. It also plays an important role in apoptosis. Structurally speaking Cyt c is a globular, heme containing, all alpha protein, with a molecular weight of approximately 12.5 kDa. Its heme cofactor is located in a hydrophobic pocket, but close to the surface and slightly protruding from the protein. It is this heme which confers electron transfer ability to the protein. Around the heme is a hydrophobic patch comprised of non-polar amino acid residues which is further surrounded by a region rich in positively charged amino acids such as lysine and arginine (Figure 1A). Its partner for this study, Fld, is a negatively charged protein, comprised of alpha helices and beta sheets organised in the Rossmann fold structural motif, common to many nucleotide binding proteins. The cofactor in this case is a flavin mononucleotide (FMN) which, similar to the heme of Cyt c, is also protruding from the protein surface and is flanked by non-polar residues, (Figure 1B). Here the hydrophobic patch is surrounded by negatively charged amino acids such as glutamate and aspartate. With a molecular weight of approximately 14.5 kDa, it is slightly larger than Cyt c. Flavodoxin has several functions involving electron transfer. Originally thought to replace ferrodoxin in microorganisms during times when iron is lacking (Laudenbach, 1988), many other processes in which it is involved have since been uncovered, for example, the activation of anaerobic ribonucleotide reductase, (Bianchi et al., 1993). 73

Fig. 1: Electrostatic surfaces of (A) Cyt c and (B) Fld. Positive and negatively charged regions are represented by blue and red surfaces respectively. White/grey areas are representative of non-charged patches. The heme cofactor of Cyt c and the FMN cofactor of Fld are shown as spheres.

History of Cyt c and Fld The first 1H NMR data recorded in the study of this complex was that obtained by Hazzard and Tollin (1985). In the proton NMR spectra, several changes were observed in the heme related resonances of oxidised Cyt c upon complex formation with Fld, such as chemical shift changes and line broadening. This evidence supported previous kinetic studies which suggested a structural model, in which the complex is stabilized by four positively charged lysine residues on the surface of Cyt c and four complementary negatively charged carboxylates on the flavodoxin surface. Such a model served to explain the ionic strength dependance of interprotein electron transfer (Smith et al., 1981). This prompted Mathew et al., (1983), using computational studies, to investigate the role of electrostatic interactions in the favourable preorientation of the molecules before complex formation. These studies strongly supported this hypothesis that the interacting electrostatic fields align both proteins along a trajectory that enables close contact of the cofactors. Here, the ionic strength dependance of the reaction rate was attributed to the ions having a “shielding” effect on the electrostatic fields of both proteins, disrupting the attractive Coulombic forces over longer distances in solution. Similar observations were made by Weber & Tollin (1985), supporting evidence of the importance of electrostatic contributions in electron tranfer complexes. More recently Regarding the geometric complementarity of interacting proteins it would be natural to assume that one interacting protein would structurally accommodate the 74

other, almost like “molecular lego” (Gilardi et al., 2001). However true this may be of static protein complexes, the situation is different for electron transfer interactions in which fast dissociation is a key factor (to maintain sufficient turnover). The architecture at the interface of such interactions along with a statistical approach to the presence of certain amino acids occurring in redox interfaces has been previously described, (Crowley & Carrondo, 2004). The conclusion of this work is that the most abundant amino acids in complex interfaces are lysine and acidic residues such as aspartate and glutamate. Crowley and Carrondo also conclude that the degree of atom packing at the interface is low and the majority of complexes interact via small, flat interfaces. In the present investigation, the archcitecture of the interface will be studied on a different scale using a molecular docking program PATCHDOCK. This program constructs hypothetical protein-protein complexes using a computer based algorithm that takes into account mainly the three dimensional shape of the protein surface, with less weight being placed on the surface chemistry and other factors.

Main Strategy Crystallographic methods can often prove difficult when it comes to electron transfer complexes due to the high rate of dissociation. For this reason the main tool used here is 2D (1H, 15N) HSQC NMR spectroscopy as it allows fast analysis of these short-lived interactions in solution (Zuiderweg, 2002; Crowley and Ubbink, 2003). The approach using this technique is to obtain reference spectra for each of the free isotopically labelled proteins. 15N labelling of the proteins is neccessary for the detection of the backbone amide resonances, and was implemented during protein expression by growing the expression host on a medium containing 15 NH4Cl as the sole nitrogen source. Each amide group in the backbone of the protein is represented as a peak in the spectrum (except proline). The position of the peaks in the spectrum corresponds to the chemical shifts of the 1H and 15N atoms in the protein backbone. Chemical shifts hold information regarding the chemical environment of the atoms in the molecule. Therefore, changes in the chemical shift of a peak (seen as a change in the position of the peak in the spectrum) during a titration with a partner protein are interpreted as a change in the chemical environment of the amide group to which that peak corresponds. We in turn interpret this as idicative of complex formation. Paramagnetic studies Another part to this project involves paramagnetic studies, and is the combined exploitation of both the NMR technique and the different redox states in which Cyt c can exist. Paramagnetic experiments often require the insertion of paramagnetic spin labels into an interacting protein. (Volkov et al., 2006). However, the heme of ferric Cyt c provides a single naturally occurring probe as an unpaired electron orbits the iron at the centre of the heme. This unpaired electron acts like a small 75

bar magnetic within the applied magnetic field and as a result, exerts an effect on neighbouring resonances. Therefore, we can interpret the effects seen on Fld resonances due to the ferric Cyt c (FeIII), as opposed to ferrous Cyt c (FeII), as paramagnetic effects that can occur only if Fld comes in close contact with the heme. These effects hold specific information regarding the orientation of the proteins, relative to the heme co-factor, during complex formation.

Why bother? The study of the interactions between redox proteins is a vast and busy field of biochemistry today with a lot of focus on uncovering and understanding the chemical mechanisms underlying redox protein interactions. In the bigger picture there is a lot to be gained by broadening our understanding of such interactions. Identifying the structural and chemical characteristics responsible for a successful interaction between two proteins, may lead towards the discovery of compounds that can inhibit the interaction and potentially be developed as therapeutic agents. The paper “Towards a new therapeutic target; Helicobacter pylori flavodoxin” by Cremadesa et al., (2005) is a prime example of how uncovering a small difference in a generally conserved protein structure opened up a huge range of possiblilties and significance of this discovery is amplified by the pathogenicity of H. pylori alongside its resistance to many modern antibiotics. This would seem to be quite a random discovery, but would it have been discovered if nobody had bothered to look? Materials All reagents were obtained from Sigma. The chromatography column materials that were purchased from Amersham Scientific. See appendix for media recipes. Expression of Cyt c Prior to expression, the host, Escherichia coli strain BL21, was transformed with the expression vector pBTR1. This vector encodes for the yeast iso-1-cytochrome c protein along with an ampicillin resistance gene. The details of the transformation procedure are outlined in the appendix. Protein expression was carried out according to the method outlined by Morar et al. (1999). Using aseptic technique, 5 ml of LB media with added carbenicillin (70 μg/ml) was inoculated with a single colony. The tube containing the inoculated medium was then incubated on a shaking platform (220 rpm) at 37 ºC for 4.5 hrs. This pre-culture was then added to 1 L of LB Media containing carbenicillin, previously warmed to 37 ºC. The inoculated LB Media was then split between two sterile 2 L conical flasks. Cells were grown overnight at 30 ºC on a shaking platform (220 rpm). For the expression of 15N-labelled Cyt c the procedure was as described above, however pre-cultures were added to M9 minimal media containing 15NH4Cl as the sole nitrogen source 76

Expression of Fld The transformation procedure followed was similar to that described for Cyt c. In this case the host, E. coli strain BL21, was transformed with the expression vector pDH07, which encodes for the E. coli Fld protein along with an ampicillin resistance gene. The procedure differed in that the pre-culture grown overnight at 30 ºC before inoculating the media for the main cultures. Furthermore, the procedure for expression of this protein was again different in that the expression vector pDH07 contains a lac promoter region that requires induction using the lactose analogue, (Isopropyl-β-D-thio-galactoside) IPTG. Therefore, during incubation of main cultures, cell growth was closely monitored starting approximately 1 hr after inoculation. When the OD of the cultures at 600 nm reached 0.6, (found to occur ~ 2 hrs into growth period), IPTG was added to each flask to a final concentration of 1 mM. Cells were grown overnight at 30 ºC on a shaking platform (220 rpm). For the expression of 15N-labelled Fld the procedure was as described above, however pre-cultures were added to M9 minimal medium containing 15NH4Cl as the sole nitrogen source. Harvesting Cells In all cases the cells were collected by centrifugation at 5000 rpm for 15 minutes. The supernatant was discarded and the cell pellet was re-suspended in the minimum amount of suitable buffer required for re-suspension. In the case of Cyt c, cells were re-suspended in 25 mM KPi and 50 mM NaCl at pH 7. For Fld, cells were resuspended in Tris buffer, pH 7. EDTA was added to a final concentration of 1 mM. Cell Lysis The cell paste was frozen at -20 ºC and thawed to assist in lysing cells. DNase (1 mg/ ml) was added to a final concentration of approximately 0.05 mg/ml. MgSO4 was also added to a concentration of 1 mM. This was mixed until the paste took on a more water-like viscosity. Cells were lysed further using a French Press operating at a pressure of 1000 Pa. Unwanted cell membranes and debris were removed by centrifugation for 15 minutes at 15,000 rpm. The supernatant (cell extract) was collected for purification. In the case of Cyt c the cell extract appears a red/pink colour, for Fld the extract is a very dark yellow/brown. The cell extract was frozen at -20 ºC until purification procedures were ready to be initiated. Ammonium Sulphate Precipitation This step was implemented in the purification of Cyt c only and was carried out in an ice bath. (NH4)2SO4 was added gradually (towards a point of saturation) until precipitation of unwanted proteins is seen to occur in the base of the beaker. This is evident as a white powder-like aggregate in the bottom of the beaker. During the procedure care was taken to stir at a slow enough speed so as not to froth the solution. The precipitated protein was removed by centrifugation at 15,000 rpm for 15 minutes. 77

Dialysis Dialysis was necessary after ammonium sulphate precipitation in order to remove high levels of salt ions in the protein sample. The ionic strength at this point would prove too high for binding of Cyt c to the chromatography column. The cell extract was dialysed against a low salt, potassium phosphate buffer at pH 7. Cyt c purification Prior to purification the protein solution was filtered. For initial purification an ion exchange (CM Sepharose) chromatography column was used with fast protein liquid chromatography (FPLC). The dialysed cell extract was loaded onto the column and unwanted proteins were eluted using a low salt buffer of 25mM KPi and 25 mM NaCl at pH 7. Cyt c bound to the negatively charged column and was visible as a distinct red band at the top of the white column material. Cyt c was eluted at an increasing ionic strength gradient to a high salt buffer, 25 mM KPi and 100 mM NaCl at pH 7. Pink/red coloured fractions containing Cyt c were pooled and concentrated using ultrafiltration methods. Further purification was carried out on a Gel Filtration Column (Superdex G-75). The buffer used for Gel Filtration was 25 mM KPi and 100 mM NaCl, pH 7. Again pink/red coloured samples containing Cyt c were collected, pooled and concentrated. The purity of Cyt c was determined using the purity index (A 280/A410) ≤ 5 as a measure of high purity. Ascorbate was used to fully reduce the protein before calculating the purity index. In the case where oxidised Cyt c was required for paramagnetic studies, ferricyanide was used to oxidise Cyt c and then washed away by ultrafiltration methods. Fld purification The purification method used to isolate Fld is similar to that outlined by Mayhew and Massey (1969). Filtered protein solution was loaded onto a DEAE-Cellulose column equilibrated with a low salt phosphate buffer 25 mM KPi, 100 mM NaCl at pH 7. Fld was seen to bind as a dark blue/grey band. After unwanted proteins were washed off, Fld was eluted using a gradient of increasing ionic strength to a high salt buffer, 25 mM KPi, 1 M NaCl, pH 7. UV/vis Spectroscopy confirmed that the yellow/brown fractions contained Fld, which absorbs maximally at 466 nm, (Vetter & Knappe, 1971). These fractions were pooled and concentrated by ultrafiltration methods. This procedure was repeated in order to achieve better separation. Final purification was achieved using a Gel Filtration Column (Superdex G-75). Pooled fractions from the previous column were concentrated to 1 ml and the buffer was exchanged to 25mM KPi 100 mM NaCl, using ultrafiltration methods. Eluted fractions (now yellow) containing Fld, were pooled and concentrated again using ultrafiltration. Both the protein concentration and subsequent yield were calculated using the molar extinction co-efficient for bound FMN, ε466= 8.25 mM-1 cm-1 (Vetter & Knappe, 1971). The purity of Fld was determined based on the purity index used for D.vulgaris Fld (Mayhew et al., 1991), of A 273/A458 ≤ 4.4. However, due to the high absorbance of histidine, which would have an effect on this ratio, a ratio of 78

A 273/A466 ≤ 6.7 for the His6-tagged Fld was found to be of adequate purity and gave excellent NMR spectra. The yield of Fld was within the range of 80–100 mg of protein per litre of cell culture. This was slightly lower for Cyt c which around 50–60 mg per litre of cell culture.

Preparation of NMR samples Preparation: Ultrafiltration methods were used to concentrate protein samples to the desired concentration for NMR experiments. The buffer was also exchanged by this method to 20 mM KPi, 50 mM NaCl at pH 6. The concentrations of Cyt c and Fld were determined optically according to the absorbance peaks at 550 nm, ε550 = 27.5 mM-1 cm-1 , (Frohwirt & Margoliash, 1959) and 466 nm, ε466 = 8.25 mM-1 cm-1 (Vetter & Knappe, 1971) respectively. The working concentrations for the labelled proteins were ~0.2 mM in the case of Cyt c and ~0.15 mM in the case of Fld. The stock concentrations of proteins used to titrate during the NMR experiments were ~1.24 mM for Cyt c and ~2.7 mM for Fld. In all cases NMR samples contained 10% D2O to provide a lock signal. NMR Titration Experiments For all titrations: 2D (1H, 15N) HSQC NMR experiments were carried out on a VARIAN 600 MHz NMR Spectrometer at 30 ºC. The pH of the samples was adjusted to pH 6.0 prior to titration and this value was maintained throughout by checking the pH after each addition of partner protein. The spectra obtained were processed using VNMRj and CARA software. [15N]-Cyt c & Fld: Aliquots of Fld (2.7 mM) were added to Cyt c sample (0.15 mM) in microlitre amounts and 2D (1H, 15N) HSQC were spectra recorded after each addition. [15N]-Fld & Cyt creduced: Aliquots of Cyt c (1.24 mM) were added to Fld NMR sample (0.2 mM) in microlitre amounts and 2D (1H, 15N) HSQC spectra were recorded after each addition. Paramagnetic Studies [15N]-Fld & Cyt coxidised: As described above however the Cyt c sample (1.24 mM) was in the ferric (oxidised) state before it was added to Fld. Data Analysis Calculating the average change in chemical shifts (Δδavg): Changes observed in chemical shifts of resonances were monitored in MONOSCOPE by overlaying the spectra of the bound protein (at each step of the titration) onto the spectrum representing the free protein, (the reference spectrum). The peaklists for each spectrum were imported into EXCEL and compared. Differences were calculated for both the 15N and the 1H dimensions. The average change in chemical shift was calculated for the final step in the titration only. Averages were calculated using the equation (1) 79

where ΔδN represents the change in chemical shift of the nitrogen of the amide group and ΔδH represents the change in chemical shift of the proton of the amide group. Δδavg was then plotted as a function of residue number of the protein. Chemical Shift Perturbation Mapping: The molecular visualisation programme, PyMol (De Lano Scientific), was used for this process. The changes in the average chemical shifts were categorised into large, medium, small and insignificant. This was done for analysis and illustrative puposes only. By taking this information and mapping it onto the surface of the 3D crystal structure of the relevant protein, a 3D representation was constructed that highlights the region(s) on the proteins surface that are involved in the interface upon transient complex formation.

NMR results Linebroadening: An increase in linewidth of ~43% was observed in the peaks of the Cyt c spectrum after titration with Fld. An example of this is illustrated below.

Fig. 2. (A) Slice of the 1H dimension showing the increase in linewidth of the Cyt c T49 resonance. The red peak represents T49 of free Cyt c (0.15 mM) and the black peak represents T49 of Cyt c in the presence of Fld (Molar ratio Fld : Cyt c = 1.8). 80

Fig. 3. 2D (15N, 1H) HSQC reference spectra for (A) Cyt c and (B) Fld. The blue boxes highlight the sections which are enlarged in the lower images (C) and (D). (C): Overlay of a section of the Cyt c spectra. Black peaks represent free Cyt c. Red, blue and green peaks represent Cyt c in the presence of 0.02 mM, 0.06 mM and 0.25 mM Fld, respectively. (D): Overlay of a section of the Fld spectra. Black peaks represent free Fld. Red, blue and green peaks represent Fld in the presence of 0.05 mM, 0.1 mM and 0.3s mM Cyt c, respectively. Peaks are labelled using the one letter abbreviations for the corresponding residue, (* indicates unassigned resonances).

Observed changes in chemical shifts Figure 3A and B show the reference spectra obtained for Cyt c and Fld. Changes in the chemical shifts for several resonances of Cyt c and Fld were observed in the NMR titration experiments in both the 1H and 15N dimensions. This can be viewed by the overlaying the spectra obtained during the titration (Figure 3C and D). The average change in the chemical shifts (Δδavg) observed for all resonances is illustrated in Figure 4. These changes were categorised based on magnitude as illustrated by the vertical colour strips and dashed lines. Chemical shift perturbation maps The categories for Δδavg were mapped onto the surface of crystal structures of Cyt c (Louie and Brayer, 1990) and Fld (Hoover and Ludwig, 1997). This highlights the regions of the protein most affected by complex formation. In the case of Cyt c the resonances most affected are predominantly located on the face of the protein that surrounds the heme cofactor. The amino acids of Cyt c that correspond to significant Δδavg are K-2, K5, A7, T8, L9, T12, R13, C14, Q16, V20, E21, K72, K73, Y74, G77 and K79. Some of the effects extend around the sides of the heme containing face but no residues at the rear of the protein were significantly affected. The observed Δδavg for Cyt c resonances in the presence of Fld were within the range of 0-0.1 ppm and categorised as follows: Red (large) ≥ 0.08 ppm, orange (medium) ≥ 0.04 ppm, yellow (small) ≥ 0.02 ppm, grey (insignificant) < 0.02 ppm (Figure 5A). In the case of Fld similar results were observed regarding the location of the significantly affected amides. The Δδavg were predominantly observed for amides located around the FMN cofactor and, to some extent, either side of this face. Again, none of the residues at the rear of the protein were found to be affected by complex formation. The amino acids of Fld that demonstrate significant Δδavg are T11, N13, S39, K40, W56, Y58, G59, D67, D76, E73, E95, T103, E150 and D195. The observed Δδavg for Fld resonances in the presence of Cyt c were between 0-0.08 ppm and varied more within this range. For this reason the categories differed slightly compared to Cyt c data, in order to retain the detail of this variation. The categories are: Red (large) ≥ 0.04 ppm, orange (medium) ≥ 0.02 ppm, yellow (small) ≥ 0.01 ppm, grey (insignificant) < 0.01 ppm (Figure 5B). Paramagnetic results Paramagnetic effects were obtained by subtracting the chemical shifts observed for Fld, in the presence of (i) reduced Cyt c and (ii) oxidised Cyt c. Resonances which showed a difference of greater than + 0.03 ppm in the 1H dimension and/ or + 0.1 ppm in the 15N dimension were taken as significant (see Figure 6A and B). These values differ as the scale of the chemical shift in the 15N and 1H dimensions differ by a factor of ~5. Effects are seen on both polar and non-polar residues (Y57, W56, Q62, G12, N16, I75, T11) along with two negatively charged residues (D67 and D10). This entire region appears to be located just on one side of the cofactor (Figure 7A). However, on 82

Fig. 4. (A) Changes in the

average chemical shifts (Δδavg) for 15N labelled Cyt c in the presence of Fld, plotted as a function of residue number. (B) Δδavg for 15N labelled Fld in the presence of reduced Cyt c plotted as a function of residue number. (C) Δδavg for 15N labelled Fld in the presence of oxidised Cyt c plotted as a function of residue number. (All) Coloured bands and dashed lines indicate Δδavg categories: Red: Large Orange: Medium Yellow: Small Grey: Insignificant Fld categories differ to those seen for Cyt c as the Δδavg for Fld were more varied and on a smaller scale. See text.

Fig. 5. Chemical shift perturbation maps for (A) Cyt c in the presence of Fld and (B) Fld in the presence of Cyt c. Colour categories are described in the main text. The heme and FMN cofactors are shown as blue spheres. Each map view has been rotated 90º clockwise around the Y-axis, relative to the map above it. 84

further inspection it is evident that I143 is also affected. This hydrophobic residue is located just below the surface of the protein, within the binding pocket of the FMN cofactor (Figure 7B). These results signify the close proximity of the heme and the FMN cofactors during complex formation. They also hold specific information regarding the orientation of the proteins in the complex as will be discussed further.

Results of Docking Studies PATCHDOCK is a program that uses a computor algorithm to construct hypothetical complexes of any two molecules. The complex is constructed by piecing the surface of each protein into segments based on shape i.e: concave, convex or flat. The segments are then filtered and only segments which contain certain residues, considered ‘hot spot’ residues by the algorithm, are retained. These are then matched and scored based on geometric complementarity. Therefore the basis of matching is mainly by shape with less emphasis placed on chemistry. The program then outputs the best maches based on these criteria and discards other configurations. The PDB files for Cyt c and Fld, 1YCC (Louie and Brayer, 1990) and 1AG9 (Hoover and Ludwig, 1997) respectively, were submitted to PATCHDOCK and the top twenty results were analysed in PyMol. The top five results are shown in Figure 8 as an example of the output. None of the results showed the FMN and heme cofactors either within the suggested complex interface or in close proximity to one another. The significance of this observation will be outlined in the discussion. The Cyt c - Fld complex The chemical shift perturbation maps in Figure 5 illustrate the residues of each protein that are significantly affected upon complex formation. The perturbations are interpreted as a change in the chemical environment of the corresponding residues upon addition of the partner protein. There are several aspects of complex formation that may be responsible for these amides experiencing a change in their chemical environment. One such effect is changes in electrostatic potential. It is highly likely that this is responsible for some of the observed perturbations as the proteins are oppositely charged. Many charged residues demonstrated changes in amide chemical shifts. In the interface uncovered for Cyt c for example (Figure 5A) positively charged lysines (K-2, K5, K72, K73, and K79) along with one arginine (R13) make up for almost 50 % of the involved residues suggesting that charged residues are imperitive for complex formation. It seems possible that these positive charges are complemented by the negatively charged glutamates (E73, E95, and E150) and aspartates (D67, and D195) on the periphery of the binding site on Fld. This correlates well with previous findings on electrostatic interactions between Cyt c and Fld interactions (Mathew et al., 1983; Weber and Tollin, 1984; Hazzard and Tollin, 1985), and with other redox protein interactions such as Cyt c and Plastocyanin (Ubbink and Bendall, 1997) and also Cyt c and Cyt c Peroxidase (Volkov et al., 2006). 85

Fig. 6. Chemical shifts for Fld in (A) the 1H dimension and (B) the 15N dimension due to paramagnetic effects of oxidised Cyt c. Categorisation for chemical shift perturbation maps; (A) Blue (significant for 1H) ≥ ∓0.03 ppm and (B) Blue (significant for 15N) ≥ ∓ 0.1 ppm. 86

Fig. 7. (A) Chemical shift perturbation maps for Fld highlighting the regions of the protein surface that experience the paramagnetic effects of ferric (oxidised) Cyt c. This Figure illustrates how remarkably close to the FMN cofactor this region lies. (B) I143, located just beneath the protein surface, is also affected. The enlarged section on the left shows how this residue is also very close to the FMN. 87

Fig. 8. (A-E); Top five PATCHDOCK results for the complex of Cyt c and Fld. Cyt c is represented as grey cartoon with the heme in blue. Cyt c is in the same orientation for all five illustrations to highlight the different positioning of Fld around it. The heme and FMN cofactors are labelled. None of the complexes have the cofactors positioned together suggesting that the complex has low geometric complementarity at the actual interface. 88

Fig. 9. Comparisons between chemical shift perturbations and electrostatic potentials for Cyt c (A, C) and Fld (B, D).

Desolvation is a necessary component of complex formation. As proteins come closer together, water molecules that were previously bound to the surface groups are released resulting in a net entropy gain for the complex therefore, a large hydrophobic region at an interface confers more stability to a complex than a small hydrophobic region. This gain in entropy is a driving force for complex. In the Cyt c:Fld complex, desolvation is most likely responsible for changes seen in the amides of hydrophobic residues such as L9, W56, Y58 and G77 as well as for those residues that are able to partake in H-bonding such as T12 and Q16 of Cyt c and T11 and N13 of Fld. (Figure 9). With the release of water, inter-protein interactions are formed and many side-chains undergo conformational changes, thus altering their chemical environment or that of neighbouring side chains. This is another reason why changes in chemical shifts are observed. A particularly interesting finding is the presence of an arginine (R13), close to the heme of Cyt c and two aromatic residues (Y58 and W56) close to the FMN cofactor of Fld. Arginine, a positively charged residue with a long and flexible side chain, is one of the most abundant residues present in protein complex interfaces (Crowley and Golovin, 2005). It has the ability to form electrostatic interactions, in a co-planar manner, with the aromatic side chains of tyrosine, tryptophan and phenylalanine (particularly tyrosine). This type of interaction is called a cation-π interaction. Crowley and Golovin found that such interactions occur widely among all classes of protein complexes. It is possible that in the case of the Cyt c - Fld complex the R13 of Cyt c is engaging in cation-π interactions with Y58 and/ or W56 whose chemical shifts have been moderately perturbed by complex formation (Figure 5B). Mutagenesis experiments have found that a cation-π interaction has an energy of ~0.6 kcal/mol but that the overall contribution of cation-π interactions are small, possibly due to the high cost of desolvation upon burial of the long arginine (Paddock et al., 2005). This type of counteraction in terms of energy cost and benefit may be one of the mechanisms that promotes the right balance between specificity and affininty of the Cyt c – Fld complex, thus enabling the interaction to remain transient. The degree of specificty, conferred by the cation-π interactions, may be balanced with the level of affinity, which is driven by hydrophobic interactions and desolvation. Even more interesting however, is that on further inspection of this region of the Fld surface, another tyrosine (Y93) remains uneffected, which raises the question as to what other chemistry might be occuring that results in only Y58 and W56 being affected (Figure 10). Y57 was too broad for detection in the spectra so it is unknown whether this experiences a chemical shift. Lysine is also known to engage in cation-π interactions with tyrosine and tryptophan but with lower propensities than arginine. It also tends to be found at the periphery of interfaces rather than in the centre (Crowley and Golovin, 2005). Therefore, it is less likely that K72, Figure 10: Left hand side: The structure of Fld in cartoon representation. The box highlights the region that is rich in aromatic residues with side chains shown in 90

stick mode. The FMN cofactor is represented as blue sticks. Residue T11 was removed for clarity. Colour codes remain as per previous Δδavg categorisation for Fld. On the right hand side: Enlarged section showing Y58 and W56 (orange) that were moderately affected upon complex formation unlike Y93 that was not. The Y57 resonance was too broad to detect. K73 and K79 of Cyt c are involved in cation-π interactions with Y58 and W56 of Fld, although this cannot be disregarded. On comparision to the interface of the yeast Cyt c - Cytochrome c Peroxidase (CcP) complex (Guo et al., 2004) using the PDB file 1S6V, the part of the Cyt c molecule that lies closest to the CcP surface is an alpha helix containing an R13. As shown in Figure 11, the R13 of the Cyt c – CcP complex lies in close proximity to Y38 of CcP, forming a cation-π interaction. This suggests that in the present study, the same residue (R13) is forming these type of interactions upon complex formation with Fld.

Fld & Cyt c with other partners Some of the results from the current investigation are in agreement with previous studies. For example, the interactions of flavodoxin with its physiological partners, flavodoxin reductase and colbamin-methionine synthase, (Hall et al., 2001) bear a 91

Fig. 11. Cation-π interaction between R13 (magenta) of Cyt c and Y39 (orange) of CcP. Cyt c and CcP chains are shown as cyan and gray cartoons respectively with the heme cofactor of Cyt c in blue sticks. Residues 79 to 83 of the Cyt c chain have been removed for clarity. striking similarity to the chemical shift perturbations of Fld on titration with Cyt c. On comparison, it is clear that in both cases it is the face of Fld containing the FMN that is used as a binding interface with partner proteins. Also similar is the magnitude of the average chemical shift changes that were within the same range of approximately 0.01 - 0.1 ppm. Similar findings are evident regarding the interactions of Cyt c with other non-physiological partners (Ubbink & Bendall, 1997; Worrall et al., 2003). In the non-physiological complex with adrenodoxin (Worrall et al., 2003), many of the chemical shift perturbations correspond to those seen in the present study. Across the board the findings are conclusive that it is the heme containing face that Cyt c uses to interact in redox partnerships. When compared to the physiological complex of Cyt c and Cytochrome c Peroxidase (CcP) (Worrall et al., 2001) the binding sites appear more extensive for the interactions with CcP than for those seen for Cyt c with adrenodoxin or Fld.

Paramagnetic Results In this investigation paramagnetic effects signify close contact of an Fld nucleus 92

with the upaired electron orbiting the iron (FeIII) of the Cyt c heme cofactor. Most of the effected resonances (D10, T11, G12, N16, W56, Y57, Q62, and D67) are located at the surface of the protein remarkably close to the FMN cofactor. The furthest from the FMN is D67. It is noticeable that all of these residues are positioned only on one side of the FMN. Also significantly affected is the amide I143 which is situtated just below the surface of Fld but yet in close contact with the FMN. This suggests that this residue must come into close proximity with the heme of Cyt c also. There is further significance to these results. The changes in chemical shifts hold quantifiable information regarding the orientation of Fld to the heme cofactor of Cyt c. This can be calculated using the equation (2)

where Δδpara is the change in chemical shift due to paramagnetic effects (Crowley et al., 2001). This value is related to the angle (ϑ) at which the nucleus lies to the electron orbital and also the distance (r) from the nucleus to the iron. Therefore, the angle/ orientation at which Fld lies, either above or below the heme, can be calculated using the approximate distance at which the paramagnetic effects are experienced. The calculations were not carried out in this study due to time constraints.

Geometric complementarity The results from the studies carried out using PATCHDOCK indirectly suggest that geometric complementarity at the interface of the Cyt c – Fld complex is low. Patchdock is a molecular docking programme that searches for docking configurations in which the shape complementarity is maximised. It is expected that if geometric complentarity was an important aspect of binding, the results would include a complex in which the cofactors were in close proximity to each other to facilitate electron transfer. However, this was not the case. Of the top twenty results investigated, none portrayed the proteins in a reactive configuration. This may contribute to the transient nature of the interaction by prohibiting a large number of surface contacts at any one time. In other words structural accomodation by one protein of the 3D shape of the other, (such as a convex shape fitting into a concave, Figure 12B) would impede dissociation of the complex and subsequently limit the turnover of ET (Figure 12). Conclusion The Cyt c - Fld complex: Several conclusions can be made from the findings of this investigation. Firstly, and in agreement with previous studies of redox protein interactions, electrostatics play a fundamental role in Cyt c - Fld complex, preorientating the proteins and guiding them towards the reactive configuration. Charged 93

Fig. 12. (A) Schematic diagram illustrating the low geometric complementarity of Cyt c and Fld results shown in Figure 8. (B) This is most likely not the orientation adopted by the proteins in the complex as such a fit would impede dissociation and subsequently limit the turnover of ET. residues may also participate in salt bridges within the encounter complex. The discovery of the involvement of an arginine along with two aromatic residues in the complex interface suggests that cation-π interactions may be responsible for specifity of binding and guiding the cofactors into close proximity for electron transfer to occur. It is proposed that the energy cost due to desolvation of charged residues may counteract the benefit of the cation-π interaction as a mechanism to maintain a balance between affinity and specificity for the reaction to remain transient. Another mechanism supporting this balance may be the low geometric complementarity at the binding interface of the interacting proteins. This is indirectly suggested by the results of the molecular docking programme PATCHDOCK. Paramagnetic studies have shown that there is a dominant orientation of the proteins in the reactive complex in which the FMN cofactor is positioned alongside, and perhaps parallel to, the heme of Cyt c. These results require further analysis to deduce the orientation of Fld in relation to the heme of Cyt c. Overall, it has been shown that some of these findings correllate well with similar studies of these proteins, both with each other and with other partners. However in this study further insight has been gained into the possiblity of a cation-π interaction, the dominant orientation of the proteins during complex formation, and the absence of geometric complementarity of interacting surfaces. Further studies: There are many ways in which this complex could be investigated further. One such method is co-crystallisation of the complex. This can prove difficult for transient interactions as the interaction is just that, transient (Radaev et al., 2006). Therefore it may be advantageous to design a molecule which mim94

ics the surface of the partner protein (Fletcher & Hamilton, 2006; Thanos et al., 2006) which could be crystallized with the protein more easily than a complex. Some NMR studies have already been carried out using porphyrin molecules with negatively charged substituents (Aya & Hamilton, 2003; Crowley et al., 2007, unpublished work) to bind to cytochromes. It is possible that such studies, in this case involving Fld, could be carried out using porphyrin molecules with positively charged substituents that resemble the amino acid side chains of Lysine and Arginine. Apart from their potential as lead compounds for therapeutic agents, these molecules could further investigate the possibility of a cation-π interaction close to the FMN cofactor. Another possiblilty is to study these interactions using 2D (1H, 15 N) HSQC NMR similar to the methods outlined herein along with competition studies involving Cyt c. Small angle X-ray scattering methods have been used to further explore the orientation of the proteins within the Cyt c – Fld complex. This provides an envelope into which a best fit model of the reactive configuration of the complex can be applied. The data obtained from this technique is currently being analysed.

BUSINESS PANEL

•

Judging Panel Mr. William Kelly (Dublin City University) – Chair Judges’ Comments The judging panel were of the view that this paper met all three key criteria: it displayed originality, contained no significant weaknesses and demonstrated intellectual excellence. The paper examined the issues for Whole Foods Market Inc. - a US company with a very strong identity based on values derived essentially from its HR strategy - in expanding its operations to the UK. The judges felt that this paper set out the context very clearly and was very clearly written. It made excellent use of an academic literature that was thoughtfully analysed, reaching firm conclusions and recommendations. The recommendations appeared to the judges to be very sensible and collectively constituted an excellent plan. Please note Due to space constraints in the print version of this jurnal, only the introduction and recommendations of this essay are published here. The full text of the essay will be available from the Awards website at www.uaireland.com

BUSI N E S S

Different sultures, came culture? International HRS in Whole Foods Market Inc. Anne Byrne, Grainne Conroy & Megan Huxhold

Introduction hole Foods Market Inc. is a chain of organic food supermarkets founded in 1980 by the amalgamation of Safer Way Natural Foods and Clarksville Natural Grocery. Since then it has developed from a one shop operation in Texas, USA, to one of the leading food retailers in the USA, with over 265 stores in North America and the UK. In 1992, the company went public, floating on the Nasdaq Stock Exchange. Continuous accumulation of similar smaller stores has aided this growth – since 1980 the firm has accumulated eighteen regional competitors. Most recently, Whole Foods Market Inc. merged with Wild Oats Markets Inc1. The company has been listed as one of the “Fortune 100 Best Companies to Work For” every year since the inception of the list in 19982. Section 1 of this project will give an overview of the company and its current HRM strategy and practices. Section 2 will outline the HR strengths and weaknesses of the company and will identify a key people related business issue to be 1 Source: Whole Foods Market, (2008), Whole Foods Market Company, available online at: http:// www.wholefoodsmarket.com/company/index.html, accessed 04/04/2008. 2 Fortune, (2008), 100 Best Companies to Work For, available online at http://money.cnn.com/ magazines/fortune/bestcompanies/2008/index.html, accessed 04/04/2008

addressed, namely the issue of culture transfer and international HRS and HRM in Whole Foods Market’s UK operations. Section 3 will consist of an analysis of the literature and case-studies relevant to this key people related business issue. The final section of the project, Section 4, will detail the proposed HR strategy, strategic objectives and in depth HR practises for Whole Foods Market to implement is response to this international challenge.

Section IV

A. HR Strategy Problems with Culture Transfer The analysis in the previous section indicates that there are many challenges involved in the international HRS of companies with a heavy emphasis on company culture. The approach stems from an understanding that firstly, company culture cannot be directly transferred from Whole Foods USA to Whole Foods UK. This is due to national cultural and societal differences and practical problems. A number of the HR practices used by Whole Foods Market to reinforce and/or establish company culture in the USA cannot practically work in the UK (for example, the policy of 30% existing Whole Foods staff transferring to new stores.). These implementation difficulties with Whole Foods Market’s traditional methodologies will be highlighted throughout the following sections as the HR practices are explained. In addition, because of the nature of Whole Foods Market and the integral role HRS plays in the company’s brand image and business strategy, it would be foolhardy for Whole Foods to even attempt to directly transfer culture and HR practices. Responsive employees who fully believe in the culture of the company are integral to Whole Foods market’s brand image. In order for this to continue, Whole Foods employees need to have the capacity to facilitate organic cultural growth. Imposition of culture, or a culture which is not reflective of the needs of UK employees and consumers, will weaken the company’s brand. The UK Strategy Whole Foods Market’s HR strategy for the UK needs to fulfil two criteria: (a) it needs to be fully integrated with the company’s business strategy of quality and growth and (b) it needs adapt to fit the needs of the UK environment. With that in mind, it is proposed that Whole Foods adopt a strategy of identifying and fostering core Whole Foods company culture in the UK whilst recognising, accepting and even encouraging national cultural flexibility. 98

US WFM Culture

Core Culture

UK WFM Culture

Fig. 4(a). Venn diagram indicating the outcome of Whole Foods Market’s proposed HRS One of the challenges of this strategy is to overcome the potential for a perception of the imposition of “American” culture on UK employees. Practices must aim to be in tune with specific UK needs and allow scope for the national flexibility and organic growth of national company culture. In addition the aspects of culture being transposed from the USA should be presented as part of a “Whole Foods Culture” rather than an American culture. This strategy and its success is important for Whole Foods Market, not just for its UK operations but because of Whole Foods Market’s stated intention of further European expansion. A strategic plan needs to be in place to enable this future expansion.

B. HR Objectives In light of this strategy, the HR objectives for Whole Foods Market’s UK HR policy are as follows: • To identify the core aspects of Whole Foods Market company culture • To ensure that these core aspects are transferred to the UK • To ensure that those aspects which are transferred are perceived as a Whole Foods culture and not an imposition of national US culture • To enable and facilitate the broadening of Whole Foods company culture in the UK to allow a UK Whole Foods culture to develop • To enable employees in the UK to respond to national market needs • To continue Whole Foods Market’s success in utilising HR practices and quality in employee service as part of an overarching business strategy • To create flexibility in company culture and HR practices to aid the success of future growth in overseas markets In essence, these objectives are about balance. Whole Foods market must balance national responsiveness with the need to retain a unified brand image. 99

The following sections outline the specific HR practices to be implemented in order to achieve these objectives. Each of these practices will establish the core culture and a mechanism for transfer along with adaptation for the UK environment.

C. Staffing and Training & Development WFM has relied in the past on instituting staff from existing stores into new stores as a means of creating consistency in management and methods as well as establishing company culture. WFM aims for a 30% target of staff in a new store to be internally placed from other stores. In the UK context this threshold is difficult to maintain and WFM must consider this staffing issue and potential HRS change.

Factors WFM need to consider Cost? Expatriate staffing across international boundaries is very costly for the firm as there are significantly more rewards which must be made to expatriate staff to both incentivise and compensate for international transfer. In addition, the most common form of expatriation for international companies is at a high managerial level. On a cost and incentive basis it is difficult to justify or implement a high percentage of expatriation in lower levels. This poses difficulties for WFM who rely on the bottom-up promotion of company culture. How important is control? Control for WFM of processes etc. seems less important than the attainment of targets. Control can be exercised through central target setting without the need to control processes through expatriate management supervision. However, WFM brand image is central to their success, and employees and HRS are central to the brand, thus it may be important for this brand image to be controlled in a more direct manner. Industry type? WFM’s industry can be characterised as a “multi-domestic” industry and traditionally a low level of expatriate presence is seen in these areas as the cohesion of culture and strategy in these industries is seen as less important as domestic sectors can operate according to the needs of the specific market. A certain degree of expatriate employees at a regional high managerial level may be able to create the circumstances for the instigation of company culture whilst allowing for the organic growth of a new adapted culture suitable for the employees and market in the UK. 100

Host country characteristics? The UK has many business culture similarities to the US (as well as a number of differences). In addition, the educational levels in the UK of a similar base to that of the US. These factors indicate that it is possible to obtain high-calibre local management in the UK. Recommendation – Initial Recruitment The factors above indicate that it does not appear necessary or justified for high levels of expatriate employees in the UK. The question however is how this impacts upon company culture and what can be done to resolve this. Our recommendation takes a two-fold approach: (a) Limited expatriate presence Excessive expatriate presence is not justified for the above reasons. There is limited necessity in terms of a lack of high-calibre candidates in the UK, WFM industry type is such that autonomy on a store level is acceptable and control can be successfully implemented through target setting. Some expatriate presence is needed for communication and consistency reasons, but this should be reasonable limited. The issue outstanding relates to culture implementation. It is felt that the excessive dominance of parent-company nationals at a managerial level may create resentment about the imposition of culture rather than its organic growth. In addition, company culture in WFM is facilitated on a bottom-level basis which for practical reasons cannot be done in the UK by the introduction of expatriate bottom level staff. For these reasons it is felt that alternative methods of company culture growth should be found. (b) Impatriation Supplementary to a degree of impatriation should be the long term employment of UK employees in the US HQ level, once the UK region has been established. This will strengthen links between the regions and allow for greater coherence and integration of strategy. It will also create an additional knowledge basis and bridge for further European expansion. Communication difficulties and isolation of the second country region can be problems with international expansion, but a twoway process of staffing may prevent this from arising in the long run. Recommendation – Cross-Cultural Training and Development The way in which company culture can and should be fostered in the UK stores is through a detailed training and development plan. Training and development in the US has proved successful on a knowledge level through the WFM “University” and in fostering leadership skills through their team leader programme. These methods should be continued in the UK and supplemented with cross-national training as well as general team building training. Ultimately, company culture 101

has to be fostered in this manner rather than through an imposition from higher management or a costly bottom-level expatriation scheme. In addition to the established knowledge based and team based training methods already employed by Whole Foods market, the training and development plan will take a three step process as outlined below:

(a) Higher Management Training Host country higher management extended training and working in the US may also be successful. By allowing UK employees to work and train in the US and become immersed in the US culture, they may return with the ability to transfer WFM strategy, goals and practises to the UK. In addition, this manner of high level instigation of company culture and strategy may be more acceptable to lower level employees when it is seen to be coming from fellow UK citizens rather than being imposed by what can be seen as external interference. Regular travel to the USA by UK executives and strong combined management raining will provide the cohesion necessary to maintain a strong HRS and brand consistency. This continual cross-cultural training and communication allows the best practises from each region to develop, and each region to learn from the other. (b) Team Leader Training (US to UK) Another initial step in training should be the short-term (two-weeks) transfer of identified excellent team-leaders from the US to stores in the UK. This should be taken at an early stage, before practices and behaviours are too firmly established in the UK stores. This can foster a whole company attitude at the ground level. In addition, this method may be more successful than merely establishing higherlevel cross-cultural development as the informal, peer-based training may be more accessible for team leaders and workers in the UK. (c) Team Leader Training (UK to US) Once practices have been established in the UK, the next training and development step should be short-term training of potential team leaders/management in the US. The above training and development processes should be continued on a regular and long term basis over the course of the company’s life. This multi-tiered communication and training will allow each level of management to learn from the best practice of each nation and may foster a sense of cohesion.

Cost Obviously cross-cultural training, impatriation and expatriation will have an effect on the company’s cost base. This cost outlay is justified however, for two reasons. Firstly, this is a long-term investment in the brand identity of the company. A strong company culture is integral to Whole Foods Market’s success and by fos102

tering this through these processes, While Foods Market should be able to grow from strength to strength in the UK. Ultimately, HRS and HR practises will define the success of the UK operation and the initial cost outlays are justified because of their impact on overall company success. In addition, the processes recommended above are less costly than alternative methods which are employed by other companies engaging in international expansion. Expatriation is the most costly method of establishing culture and HRS in the new market and with the methods advocated above, expatriation is kept to a minimum, allowing culture to develop in a more organic manner whilst still retaining the necessary level of control and continuity.

Summary The aim through initial recruitment set-up and the long-term training plan is to foster the development of company culture in a way which retains the core aspects necessary for brand and company development, whilst allow employee and management autonomy to develop culture and practises which adapt to the differences between the UK and US. The practices will not be once off however, and each method will be continually used once implemented. The basis of this time line is to allow the time and scope for independent development of culture, whilst reinforcing this with the understanding and training of parent company methods.

D. Performance Appraisal In the US, Whole Foods uses performance appraisal as a mechanism of control to ensure that profitability targets are met. In terms of establishing strong foundations for the company in the UK market, we feel that performance appraisal has a crucial developmental role to play. We recommend that the first three years of the UK expansion be viewed as a “developmental phase”. After that the company will move into a more stable period or “flexible stability phase”.

Stage 1: The Developmental Phase (Years 1-3) “Act on the feedback then measure the impact”3 Whole Foods has invested heavily in the physical capital in the UK e.g. the flagship store in Kensington. In order to establish the necessary strong foundations to facilitate further expansion in the UK they must also invest in human capital. As stressed extensively throughout this project, Whole Foods’ key differentiator is superior quality service. It is important, therefore, to ensure that UK employees 3 Source: Craig (1999)

103

are delivering this. This involves providing employees with the necessary training and development to develop key skills. The main business objective of this phase is rapid growth of market share; therefore, an emphasis should be placed on sales in setting team targets. We suggest that a hybrid of 360* performance appraisal be used at regular intervals (every six months, for example). Supervisors, customers and colleagues from other teams would provide feedback on a team unit as a whole. This enables the team to gain an outsider perspective and to also to appreciate the interdependencies between the various teams in-store. Within the team itself, members would give feedback on each other. This aims to reduce the possibility of intra-team conflict by providing appropriate channels for people to air any frustrations. Whole Foods would then “act on the feedback”. This would be done by setting team sales targets for the next period, while at the same point, intervening to provide the training programmes deemed necessary based on the feedback received. The impact of this will then be measured at the end of the period when planned results are compared with actual. Whole Foods’ policy of making all stores’ results available internally would be especially useful in this phase as it will enable stores to learn from each other. This avoids the unnecessary duplication of mistakes while, leverages any successes across the entire organisation. We feel that the practices of the “Company Snapshot” and “Store Tour” could be introduced in the UK after the first year to 18 months.

Stage 2: The Flexible Stability Phase (Year 4 on approx) The purpose of the developmental phase is to recognise that major investment is needed to successfully establish Whole Foods in the UK. In the medium to longterm, however, profitability metrics cannot be ignored. Therefore, we suggest that after the first three years performance appraisal practices would start to converge more or less with current practices in the US. This would facilitate better integration between US and UK subsidiaries and would be supported by rewards practices such as gain-sharing. That said highlighting training needs will be an on-going practice in the UK as it is in the US. Recommendation Phase 1: Use performance appraisal to highlight training needs to support a policy of market share growth. Phase 2: Performance metrics sound adopt more of a profitability focus, converging more or less with US practices.

104

E. Pay and Rewards Highly Competitive Base Pay

Benefit Menu

+/-

Training Bonus Team Bonus Promotion Gain sharing

Fig. 4(a).

Should Whole Foods pay the same way? The lowest wage that Whole Foods pays in the US is 86% greater than the average minimum wage. In Phase two of this project, we asserted that the same wage would be merely 23% greater than the UK national minimum wage. This means that unless wage levels were increased substantially for the UK operations of Whole Foods this recruitment differentiator would be less pronounced and therefore less effective than in the US. But is that really the case? The national minimum wage in the UK is approximately 35% greater than that of the highest minimum wage paying state in the US, Washington ($8.074 or £.4.06 versus £5.525). In Kansas, the minimum wage ($2.65) equates to approximately £1.34 based on current currency conversion rates. This illustrates a fundamental difference between the two sides of the Atlantic on the concept of minimum wages. In the UK and indeed in Europe more generally, minimum wages are set in an effort to ensure that all employees can earn enough to cover the basic costs of living. In the US, state intervention in the economy is generally discouraged; therefore, it can be argued that the minimum wage levels are purposely set unrealistically low in order to allow businesses the freedom to determine what wage levels should be. This means that comparisons based on the level of “minimum wage premium” between wages in the US and the UK simply don’t compare like with like. A relatively high level of base pay is an initial attractor for potential employees. We recommend, however, that these rates be calculated with a view to offering higher rates than those offered by competing retailers in the UK rather than by adding US type premiums to an already high UK minimum wage. Offering relatively high base wages diminishes the need for frequent marginal pay increases which are common in many service jobs. Instead, we recommend that base wages be increased mainly in line with inflation. This is in an effort to foster a sense of 4 Source: US Dept. of Labour (2008) 5 Source: UK Dept. of Business, Enterprise and Regulatory Reform (2008)

105

team cohesion by minimising the pay differentials between employees of the similar positions.

Benefits: Universally beneficial? In the US, Whole Foods’ benefits package is a source of great employee motivation. This effect, however, is amplified by the minimal state provision of public amenities in the US. Europe, however, is home to the concept of the “welfare state”. In Phase 2 we posed the question of whether the benefit package, therefore, could possibly have the same impact in the UK as it does in the US. Whole Foods’ use of “welfare capitalisation” in the US hinges mainly on the provision of medical care. In the UK, however, 90% of citizens rely on the NHS for all their health-care needs.6 This suggests that applying the same benefits to the UK and the US would not prove as effective in the UK. The solution of this difficulty, however, lies in Whole Foods’ current benefit policy. US employees currently vote periodically on the benefits the most desire from a menu of benefit options. To make this relevant to the needs of the UK employee the principle of voting for benefits could remain while the menu of benefits offered could be modified. Modifications could include; a larger store discount, a greater focus on pension schemes or other innovations such as childcare subsidisation. The huge advantage of the voting system is that it will clarify quickly what UK employees value, therefore, avoiding the misuse of resources on schemes without any motivational impact. Collective Rewards The collective rewards package is the component most directly linked with performance appraisal. The performance appraisal component of this HR strategy distinguished between the early phase of expansion into the UK (developmental phase, years 1-3) and the the more stable phase which will emerge after the first three years approximately. We recommend that this two phase approach be carried through to the rewards package. The developmental phase should focus on gaining market-share, therefore, the focus should be on sales rather than profitability targets. Accordingly, teams bonuses would be awarded periodically to teams who exceeded their targets. The second component of this phase would focus on providing incentives to employees to take WFM University courses. This would be done by awarding training bonuses on completion of courses. This would increase the knowledge base of UK employees as well as, fostering the corporate culture. Moving towards the medium to long-term, operations in the UK will not be sustainable without being profitable. Profit-linked rewards, such as gain sharing, should therefore, be used. This also serves to integrate the UK stores into the overall whole Foods organisation. In the medium turn, members who display potential 6 Source: Mercer (2008)

106

leadership ability should receive leadership training in order to be able to benefit from the promotion opportunities that’ll become available as Whole Foods expands in the UK.

Recommendations(1) Calculate relatively high base wages competitive in the UK setting. (2) Retain the benefit vote but modify the benefit menu to suit the UK context. (3) The developmental phase should reward market share increases. In the medium to long term, rewards should be based around a profit focus.

F. Employee Relations Employee Relations & Unionisation: Does employee friendly Whole Foods need to be union friendly, too? The current HR strategy for Whole Foods in relation to unions is a union replacement. They look to match the benefits of union by making policies in-house. This is not union suppression, which acts to mute the voice of the employees.7 Factors Whole Foods needs to consider i. The difference in common union perception between the US and UK Ferner, et al. gives a comparative history of US and UK union activity. In America, union activity was fairly weak. This is contributed to the individual mindset of American workers and the ideology of the company being the resource of security for the worker not collective action. On top of this, industrial relations had the negative connotations of violence in the workplace, and disrupting order. The popularity of scientific management left little room for union regulation. In the UK, though, unions and collective bargaining had become the industrial policy and British public policy. Unions were seen as a voice for employees and were made part of the guidelines in the self-regulated work teams8. Because of its more positive connotations in Britain, more vigilance should be given to them. ii. The difference in US, UK, and EU laws on employee representation America The National Labor Relations Act of 19359 acts as the guidelines for American industrial relations and union activity. The act was made in the state of mind of America in the Great Depression. It seems to provide as many rights as it does re7 Source: Badigannavar, V. and J. Kelly. (2005) 8 Source: Ferner, A, et al. (2005) 9 Source: National Labor Relations Act. (1935)

107

strictions to unions. Most following legislation focuses on limiting union power including the LaborManagement Relations Act of 1947, the Labor-Management and Disclosure Act of 195910, and the Freedom of Information Act of 2000.

Britain Statutory Instrument 1999 No. 3323 - The Transnational Information and Consultation of Employees Regulations 1999 gave employers three options to improve employee relations including: the European Works Council, having an information and consultation procedure, or creating an agreement between the employers and the employees on consultation. Important is the fact that employees can opt out of the European Works Council through this act. This seems to represent the sentiment that representation can be in any form, weakening union voice. iii. Having their public image so entwined with their HR strategy Along with the differing common perceptions in union representation between America and the UK, comes differing public action when representation is forbidden in the company. The anti-union sentiment used in the USA by Whole Foods could tarnish their public image as a employee friendly employer. It could also give rise to government action making the union agreements legally-binding11. iv. The impact of further growth in Europe With further growth in Europe (Italy said to be next), comes a need for greater flexibility to union recognition. Recently, there has been an increase in union action in the low paying retail sector12. In Ireland, employees called for unionisation in Aldi. McDonald’s has seen union action in both Italy and France.13 Recommendation- Slightly Augmented Union Replacement Strategy i. Common Practice In the UK both John Lewis and Marks and Spencer’s hold union substitution strategies14. Whole Foods can look toward these companies to learn about the cultural importance placed on certain benefits and policies. ii. Sensitivity to Local Needs Wal-mart and ASDA When Wal-mart acquired ASDA in 1999, ADSA had already aligned their human 10 Source: U.S. Department of Labor. Employee Standards Administration 11 Source: Torrington, D., L. Hall and S. Taylor (2005) 12 Source: Muller-Camen, et al. (2001) 13 Source: Both examples from ibid 14 Source: Muller-Camen, et al. (2001)

108

resource strategies with that of Wal-mart. Because of this, most of the work was already done, but changes in the practices were introduced. Most being successful, but strain arose when it was thought that the parent company was wearing away present working conditions. These differences were viewed as being cultural differences15.

Whole Foods Fresh and Wild of the UK, acquired by Whole Foods, was imitating the Whole Foods strategy from the beginning16. Because of this, we can look to Wal-mart and ASDA as a good case study to base future problems on. Therefore, we recommend that Whole Foods keep their union replacement strategy in the initial stages, but to pay close attention to cultural differences using human resources. Whole Foods has the tools already in place to listen to their new employees. Voting on benefits will give Whole Foods better understanding for what is important to Britain and store autonomy will allow greater flexibility for every-day practices. Recommendation- Forward-Looking Union Strategy i. Discussed by Executives Objectively We also recommend a forward-looking plan of action toward union involvement. This plan would be reactionary, with executives from both the United States and Britain looking objectively at the employee needs and governmental policies that may leverage power. Looking at Ferner, et al’s three local forces (these include powerful actors in the local environment, subsidiary importance to the parent company, and the ideological norms of the area), the company can choose unionism in reaction to these local conditions without changing policies in the United States.17 ii. Looking towards Continental Europe With the increased threat of unionisation in the retail sector in continental Europe, this plan will be especially important with further expansion. The objectives of the plan would create a rational response to the tensions instead of placing nonunion emotions in the way. A flexible union strategy in Europe could be the difference between success and failure since Whole Foods relies so much on word-ofmouth advertisement to gain business. The company needs to be knowledgeable in how much importance each country places on unions to keep both the employees and the wider public happy. Cost The cost of this strategy will be very little considering all senior management will 15 Source: Fernie, et al. (2006) and Pioch (2007) 16 Source: Gewirtz, L. (2006) 17 Source: Ferner, A, et al. (2005)

109

Fig. 4(b). Summary of time-line of implementation receive some training in America. Whole Foods can take advantage of this time to involve them in the project. We believe the benefits outweigh the costs. Such a plan will have great benefits for the expansion of Europe.

G. Time Line of Implementation Ongoing projects which will start from the beginning of the implementation of Whole Foods Markets’ HR strategy include a process of installation of expatriate managers into the company’s UK operations. General training and development, as outlined, along with the pay and benefits package will also be implemented im110

mediately and will continue as part of the ongoing strategy. This will instil the overall Whole Foods culture whilst allowing a degree of flexibility in response to the UKL culture. Team bonuses and promotion opportunities will come into operation after the first year of strategy implementation. This will facilitate the development of company norms and will create more financially minded team attitudes. The final stage of implementation will involve a process of impatriation and gain-sharing opportunities. The aims of this final stage are to integrate the Whole Foods operations in the UK fully with US operations. In addition, the first phases of strategy implementation will focus on development to establish strong Whole Foods foundations in the UK. The second phase will be a period of flexible stability as UK operations become integrated, settled and perfected. With regards to union strategy, Whole Foods will adopt a union cooperation plan in response to the need which may arise. Up until then Whole Foods will continue its modified strategy of union replacement.

111

CHEMISTRY PANEL

•

JUDGING PANEL Prof. Kieran Hodnett (University of Limerick) – Chair Dr. Kevin M. Ryan (University of Limerick) Prof. John Cassidy (Dublin Institute of Technology) Dr. John Colleran (NUI Maynooth) Dr. Leigh Jones (NUI Galway) judges’ comments The winning project submitted by Roisin O’Flaherty addressed the synthesis of glycolipid analogues of α-Glactosyl Ceramide which are synthetic mimics of bioactive glucolipids found in sea sponges. The bioactive glycolipids have been shown to bind to and activate specific human cells (NKT) cells which regulate the immune system and prevent tumour formation. Two structural analogues of α-GalCer were prepared in this work with a significant variation in the alkyl chain length involving complex sequences of organic chemical reactions to prepare and isolate each. The quality of the work effort is excellent as is the depth of understanding evident from the report. The as synthesised compounds are comprehensively characterised using Nuclear Magnetic Resonance Spectroscopy and Mass Spectrometry with interpretations that are both thorough and concise. Both the structure of the report and style of writing makes for ease of reading and it is clear that considerable time and effort has been devoted to this work which results in a important contribution to this field of endeavour. The second winning essay submitted by Linda O’Connor addresses the significant issue of catalytic routes towards the chemical degradation of chemical warfare agents into less harmful substances. The essay reviews the chemical agents in categories of their effect on humans and with each agent explores the possible route to detoxification. The essay is comprehensive in both the range of chemical agents studied and methods of their destruction and references all the important contributions in this field. Significant recent developments in the area such as the effects of the counter chemicals on the environment are an important inclusion. While this essay is directed at readers with knowledge of chemistry, the discussion is well written and will be of general interest to all. 112

C h e m i st ry

Catalytic methods for the destruction of chemical warfare agents under ambient conditions Linda O’Connor

Introduction odern chemical warfare was first rolled out during World War I, where the French are credited with the first usage.1 It was, however, the Germans that really made the phenomenon of chemical warfare a reality during The Great War. From there, chemical and technological advances were made to bring us to chemical (and indeed biological) warfare in terms of modern day war. The Cold War between the United States of America and the then USSR was the closest the world came to all-out nuclear conflict. More recently the Iran-Iraq war of the 1980s implemented the use of mustard gas on a large scale. Attack using chemicals is not only confined to war; many terrorist attacks have utilised chemical warfare agents including the terrorist attack on the Japanese underground on 20 March 1995.2 The United Nations Convention on the Prohibition of the Development, Production, Stockpiling and Use of Chemical Weapons and on their Destruction is the most recent treaty signed and ratified in the fight against the use of chemical weapons.3 Chemical warfare agents can be classified according to their affect on humans. They include blister, nerve, choking, blood, vomiting, tear and incapacitating agents. The most significant of all these groups in terms of past use and military capacity are the nerve and blister agents. Nerve agents react irreversibly with cholinesterase, which results in acetylcholine accumulation, continual stimula113

ClH2C

H2O

CH2Cl

-HCl

1/2 O2

O HO

CH2Cl

ClH2C

CH2Cl

-HCl

1/2 O2

H2O

CH2Cl

O HO

ClH2C

CH2Cl

O Fig. 1. Some possible detoxifying reactions of sulphur mustard.6 tion of the body’s nervous system and eventual death. Examples of nerve agents include the G-Agents Sarin (GB), Tabun (GA), Soman (GD) and the V-Agent VX. Blister agents affect the lungs, eyes and cause blistering on the skin. Examples include Sulphur Mustard (HD) and Nitrogen Mustard (HN).4 In the course of this essay, I will look at the catalytic destruction of the chemical warfare agents. I will examine their chemistry and how they can be broken down into less harmful substances by catalytic chemical means.

Blister Agents Sulphur Mustard (HD) Sulphur Mustard, bis-2-chloroethyl sulphide, is a very potent blister agent and has been documented as an antimitotic, mutagenic, carcinogenic, teratogenic and cytotoxic agent. Skin, eyes and the respiratory tract are its primary target organs. In its pure state, sulphur mustard is a colourless oily liquid, but the industrial product is yellow to dark brown and has a characteristic sweetish smell.5 Sulphur mustard can be detoxified by dehydrohalogenation to form the chloroethyl vinyl sulphide, by nucleophilic attack to displace an activated aliphatic halogen, or by oxidation.6 Smith details in his review article how HD may be de114

H2O

H2O2

HCO4-

HCO3O

Fig. 2. Bicarbonate and molybdate affect the oxidation of sulphides and HD catalytically. toxified by partial oxidation to the sulphoxide (HD-O), but further oxidation to the sulphone (HD-O2) is not welcome since the sulphone of HD is also a vesicant, i.e. causes blisters. Hydrolysis of HD is another potential method of detoxification. This, however, presents a number of problems. HD has a very low solubility in water and droplets of the agent dispersed in water tend to form a polymerised crust, restricting the effectiveness of hydrolytic catalysis.7 As suggested by Smith, the ideal manner of detoxifying HD would be the selective oxidation to the sulphoxide, HD-O. This would allow for a simple and rapid approach to a HD outbreak, and could even be applied in a prophylactic surface treatment for critical items in order to make them immune from the threat of HD contamination.6 Work carried out by Noradoun and Cheng at the University of Idaho looked at the degradation of EDTA by oxygen activation using a zerovalent iron/air/water system. They developed an iron-based oxidation catalyst that used zero-valent iron in combination with EDTA and air to initiate a radical based Fe3+/Fe2+ redox cycle.8 Whilst developed to look at improving wastewater treatment plants and their effectiveness in decontaminating any waste products in their water systems, this aqueous oxidation chemistry could be applied to detoxify HD, and indeed nerve agents.6 A well known process in chemical degradation is oxidation using peroxides. Although powerful oxidants such as hypochlorite and peroxyacids (i.e. m-chloroperoxybenzoic acid) effect rapid oxidation of HD, they are rather nonselective, simultaneously producing both sulphoxide and sulphone. The milder oxidant hydrogen peroxide selectively yields the sulphoxide, but the reaction is too slow for the purpose of immediate decontamination.9 Wagner and Yang also showed that 115

recently peroxide activators such as molybdate and bicarbonate affect the rapid oxidation of sulphides and HD catalytically. Another process in the detoxification of sulphur mustard where considerable effort has been spent is the process of photoxidation.6 However, a considerable limiting factor in such a process is the need for the presence of light and this does not easily allow for “ambient conditions.” Dehydrohalogenation of HD using calcium oxide (CaO) was performed by Wagner et al using AP-CaO and CaO. On partially hydrated AP-CaO, a rather fast steady-state elimination of HCl occurs after a short induction period. This behaviour is attributed to acid-catalysed surface reconstruction (to regenerate fresh surface) and the formation of CaCl2, which is known to be more reactive than CaO.10 According to Smith, this reaction is not considered truly catalytic in nature, because an excess of CaO was used and islands of CaCl2 (which is a known catalyst for such dehydrohalogenation reactions) were likely formed during the reaction.6

Nerve Agents G-Agents The G-class of nerve agents are organophosphorous compounds that exert their neurotoxic effects by inhibiting acetylcholinesterase enzymes. They have relatively high vapour pressures, are moderately soluble in water and hydrolyse in water with half lives on the order of half a day.7 Because of this, G-Agents are considered as less of a technical challenge when it comes to their decontamination compared to less volatile, less soluble, less labile agents.6 Hydrolysis of both Sarin (GB) and Soman (GD) is possible as they are both soluble in water and has been reported under acidic, basic and neutral conditions.11 Several enzymes have been shown to accelerate this process, i.e. enzymatic hydrolysis.6 According to Raushel, microbial enzymes have been identified that are able to efficiently catalyse the hydrolysis of organophosphate nerve agents, including Sarin and Soman. The enzyme phosphotriesterase (PTE) was developed and used to catalyse the hydrolysis of G-agents. Figure 2 shows a working example for the reaction mechanism of organophosphate triester hydrolysis.12 In this mechanism, the organophosphate binds to the binuclear metal centre within the active site via coordination of the phosphoryl oxygen to the β-metal ion (more solvent exposed in this model). This interaction weakens the binding of the bridging hydroxide to the β-metal (as evidenced by the longer oxygen–metal distance in the complex relative to the unbound state). The metal oxygen interaction polarises the phosphoryl oxygen bond and makes the phosphorus centre more electrophilic. Nucleophilic attack by the bound hydroxide is assisted by proton abstraction from Asp301. As the hydroxide attacks the phospho116

Fig. 3. Working model for the hydrolysis of organophosphate nerve agents by phosphotriesterase (PTE).12 rus centre, the bond to the leaving group weakens, although 18O isotope effects and Brønsted analyses support the notion that the transition state is late. His354 may facilitate the transfer of a proton from the active site to the bulk solvent. Another protein, organophosphate acid anhydrolase (OPAA), has also been developed to catalyse the hydrolysis of the organophosphate triesters, including Soman and Sarin, but not VX.12 The same parameters were used as for PTE and the results showed that the enzyme displayed similar stereoselectivity, but the overall rate of hydrolysis was significantly reduced relative to PTE. Brajesh, in his paper on Microbial Degradation of organophosphorous compounds deals with a number of G-agents. Tabun (GA) is subject to hydrolysis and the first step in this process, under neutral and acidic conditions, includes formation of O-ethyl N,N-dimethyl amidophosphoric acid and hydrogen cyanide. This first step is rapid. The subsequent hydrolytic step, which is comparatively slow, is hydrolysis of O-ethyl N,N-dimethyl amidophosphoric acid to dimethylphosphoramidate and then finally to phosphoric acid. Under acidic conditions, hydrolysis to ethylphosphorylcyanide and dimethylamine occurs. The final product of all pathways is phosphoric acid.13 Sarin (GB or isopropyl methylphosphonofluoridate) and Soman (GD or pinacolyl methylphosphonofluoridate) can also be detoxified using microbial routes. 117

Fig. 4. Possible pathways for the degradation of GA.13

118

Fig. 4. Microbial degradation pathway for GB and GD. PMPA: pinacolylmethyl phosphonic acid.13

GD is an intermediate between GA and GB. It is less water soluble and more lipid soluble than the other two G agents, which results in more rapid skin penetration and greater toxicity. The major metabolites identified for GB degradation are isopropylmethylphosphonic acid (IMPA) and methyl phosphonic acid (MPA). Another organophosphorous G-agent used in chemical warfare is cyclosarin 119

(GF or O-cyclohexyl methylphosphonofluoridate). As already stated, enzymatic hydrolysis is one of a number of ways of accelerating the rate of hydrolysis. In a study carried out by Harvey et al the stereospecificity of the catalysis of cyclosarin was investigated. They discovered that organophosphorous acid anhydrolase (OPAA) and the wild-type phosphotriesterase (PTE) enzymes were all found to catalyze preferentially the hydrolysis of the (+)GF isomer.14 Previous studies, discussed above, have also shown that these two enzymes catalyse detoxification reactions of organophosphorous G-agents.12 There are, however, limitations to the enzymatic hydrolysis of G-agents. As stated previously, all hydrolysis reactions of organophosphorous G-agents ultimately end in an acidic by-product. This obviously causes the pH levels in the reaction to drop below 6, which in turn terminates the ability of the enzyme to react. Using hydrolysis catalysts to decontaminate comparatively large quantities of an agent therefore requires a buffer to maintain the pH at an optimum level.6 Typically this buffering capacity could be provided by acid-base pairs. It can also be generated by a competing enzymatic reaction such as the formation of ammonia from urea by urease to neutralise the acidic organophosphorous hydrolase (OPH) hydrolysis products on demand.15 The formation of ammonia from urea using urease typically has a pH of 6.5 and the enzyme OPH has a maximum activity at pH 8.5. Russel et al found that the competing reactions stabilised the pH until one of the reagents was almost completely consumed and by changing the relative concentrations of the two enzymes, a predicted pH was achieved and maintained, without the use of the classical acid-base buffers. Another limitation with regards enzymatic hydrolysis concerns the mass transport of the chemical warfare agent to the active enzyme. Active enzymes are typically confined to the intracellular matrix, regardless of whether the enzymes are naturally occurring or engineered into the cultured organism.6 Non-enz y matic hydrolysis using iodosylcarboxylates to encourage catalytic hydrolysis of G-agents and other organophosphates has also been studied in depth by Morales-Rojas and Moss at The State University of New Jersey. It is known that hypervalent iodine complexes can be used as a nucleophile for the cleavage of reactive organophosphorous substrates such as p-nitrophenyl diphenyl phosphate (PNPDPP) when solubilised in aqueous micellar solutions of cetyltrimethylammonium chloride (CTACl). Morales-Rojas and Moss used this knowledge and applied it to improve the reactivity of o-iodosyl- and o-iodylcarboxylate derivatives for the degradation of organophosphorous substrates.16

V-Agent Another nerve agent, VX (O-ethyl-S [2-(di-isopropylamino) ethyl] methylphosphonothioate) presents many more problems than the other chemical agents, due to the fact that it is much less labile than the G-agents. It is a persistent, odourless, amber-coloured liquid. Un-catalysed hydrolysis of VX does not occur at useful rates in pH neutral solutions, i.e. ambient conditions. Furthermore, one of the pos120

PNPO PhO

O OPh

O I

O O

OPh P

OPh

O HO-

H+ -H+

OH I O

PhO

O OPh

Fig. 5. Mechanism of idosylcarboxylate hydrolysis of p-nitrophenyl phosphate.6 sible hydrolysis products (EA-2192) is both much less reactive toward further nucleophilic attack and nearly as toxic as VX itself.6 According to Munro et al, VX undergoes water and hydroxyl ion-catalysed hydrolysis, but is not subject to acid-catalysed hydrolysis. Hydrolysis of VX proceeds by numerous pathways, and producing a number of degradation products. At pH values of < 6 and > 10, cleavage of the P-S bond predominates, resulting in formation of ethyl methylphosphonic acid (EMPA) and diisopropyl ethyl mercaptoamine (DESH). The latter compound can be oxidized to bis (2-diisopropylaminoethyl) disulfide (EA 4196) or react with the diisopropyl ethyleneimmonium ion (CH2)2N + (C3H7)2 to form bis (2-diisopropylaminoethyl) sulphide. At neutral and alkaline pH values (7-10), the first pathway competes with de-alkylation of the ethoxy group (cleavage of the C-O bond), the latter pathway yielding the environmentally stable EA 2192 and ethanol.7 Work carried out by Wagner et al also came up similar results.10 Noradoun and colleagues at the University of Idaho used the insecticide 121

HS H20

C2H5O P S CH3

CH(CH3)2

Diisopropyl ethyl mercaptoamine

pH < 6, <10

CH(CH3)2

O C2H5O P OH CH3 Ethyl methylphosphonic acid

CH(CH3)2 H20 pH 7-10

O HO P S CH3

CH(CH3)2 CH(CH3)2

S-2(disopropylaminoethyl) methyl phosphonthioate (EA 2192)

C2H5OH Ethanol

Fig. 6. Primary hydrolysis pathways of VX in the environment.7 malathion as a chemical analogue for VX. They carried out their study using oxygen activation at room temperature and pressure. Their proposed degradation scheme exhibits the desirable characteristics of green oxidation, i.e. environmentally innocuous reagents, solvents and products under mild reaction conditions.17 As is known, activation of molecular oxygen is of importance for catalysis. Monooxygenase systems found in nature, which are capable of efficiently oxidizing organic molecules using activated O2 under near RTP conditions, include cytochrome P450 and methane monooxygenase (MMO) both of which contain active iron centres. Cytochrome P450 enzymes require reducing equivalents to activate molecular oxygen to a state formally equivalent to that of H2O2 during the initial oxidation process. Therefore, peroxides have often been substituted for the reductive activation of O2 in abiotic studies mimicking cytochrome P450 oxidation. Biological and abiotic systems participating in the partial reduction of molecular oxygen create reactive oxygen species that may consist of superoxide ions and/or + hydrogen peroxide. An extremely reactive form of oxygen containing species, OH , is a product of the Fenton reaction (see equation 1 below) which is the reduction of H2O2 by a suitable iron center.17 Equation 1: FeII + H202

→

FeIII + OH- + OH

Noradoun and her group, in work done by them previous to this, examined the 122

(CH3)2CH

CH(CH3)2

H5C2

O VX

P O

Malathion

S S

C18H14O4

P O

Malaoxon

Fig 7. Structures of VX, Malathion and Malaoxon showing similarities in phosphorous moiety.17 use of zero valent iron, EDTA and air (ZEA) to create radical species in situ. The ZEA system is capable of deep oxidation even under mild reaction conditions. They also discovered that the ZEA reaction was capable of degrading chlorinated phenols to produce low molecular weight carboxylates.18 There are advantages to using the ZEA system when compared with other systems which have been investigated for the detoxification of organophosphorous compounds such as hydrolysis, palladium-based catalysis, UV induced photolysis, chemical and enzyme assisted oxidation. These include milder reaction conditions, inexpensive reagents, no precious metal catalysts and no need for special pressurized reactors. Additionally, the ZEA reaction proceeds at room temperature under one atmosphere and in aqueous solutions.17 She then applied this knowledge to the degradation of malathion, chosen because of its similarities to VX in the phosphorous moiety. Malathion (S-1,2-bis(ethoxycarbonyl)ethyl O,O-dimethyl phosphorodithioate) has a relatively low toxicity. In comparison, Malaoxon (S-1,2-di(ethoxycarbonyl) ethyl O,O-dimethyl thiophosphate) is far more toxic due to its higher binding efficiency for the enzyme acetylcholinesterase (AChE), inhibiting its control over the central nervous system. In this regard it is similar to organophosphorous nerve agents. The proposed ZEA system is capable of oxidizing both malathion and malaoxon to low molecular weight acids. This is a strong indication that the ZEA system can be used in the detoxification of organophosphorous nerve agents such as VX.17 Upon completion of the study, Noradoun et al found that the ZEA system was able to degrade both malathion and malaoxon. This is particularly significant because both share structural features with VX as shown above. The diagram below shows the proposed degradation scheme for malathion, showing the two non-polar intermediates, malaoxon and DES and the final reaction products as low molecular acids. Iminodiacetic acid has previously been identified as a degradation product of EDTA and has therefore been left out of the proposed scheme. 123

C18H14O4

O O O

O O

CO2 HCO3C2O42-

HOOC

P O

COOH COOH

Fig. 8. Malathion degradation scheme showing harsh oxidation of malathion and malaoxon to low molecular weight acids.17 The phosphorus–carbon and sulphur–carbon bonds of malathion are cleaved during the oxidation process leading to 17% recovery of the sulphur as sulphate and 4.5% recovery of the phosphorous as phosphate after 24 hours as examined by ion chromatography during the experimental process. Control studies showed no loss of product through adsorption onto the iron surface during the course of the reaction. According to Noradoun, the ZEA reaction has advantages over present oxidation technologies. Methods based on chemical oxidants such as bleach or H2O2 are attractive, though both have limitations such as long-term storage requirements, or possible safety hazards. For bleach-based oxidations reaction conditions must be properly maintained, e.g. VX destruction by bleach requires a sizable excess of HOCl/OCl– to achieve complete chemical oxidation. Furthermore, the use of copious amounts of chlorine has provoked environmental concerns over carcinogenic chlorinated organic compounds that can be produced, such as those produced in paper production. Methods using H2O2 in conjunction with peroxide activators such as bicarbonate and molybdate have been looked as a greener alternative. Although the products are less toxic, their release may still pose environmental concern. The downsides to using large excesses of highly concentrated H2O2 or bleach are the difficulties in transportation, long-term storage, operator safety as well as limited shelf life. The ZEA system would only require the storage of ZVI particles and EDTA, both of which have good stability. ZEA degradation of malathion has shown the system to be capable of degrading the phosphorus–sulphur groups. Pre124

vious studies have shown that the ZEA system is capable of degrading organics down to carbonates and simple carboxylates.18 Relative to other systems, another outstanding feature of the ZEA system is the use of mild reaction conditions, i.e. room temperature and atmosphere. This characteristic combined with inexpensive and stable reagents, establishes the ZEA system as a strong possibility as a field-portable organophosphorous remediation system.17

Conclusion Chemical warfare has been in existence since World War I, but in recent times it has become a more real threat, thanks to the increase in terrorism across the globe. Therefore, detoxicification of these chemical warfare agents is of vital importance. Catalytic destruction of these agents under ambient conditions is of particular significance as, should an attack occur, the problem must be dealt with as quickly as possible in order to minimise the destruction caused. Also, as one cannot predict when or where a chemical attack will happen, the need for the detoxification process to work efficiently under ambient conditions is key. From all the journals that I read and researched during the course of this essay, a recurring theme came through with regards to catalytic destruction of the nerve agents: the use of enzymes (biological catalysts) for the detoxification of the agents. Another issue that arose was the environmental aspect to the destruction of the agents. With climate change such a buzz word amongst scientists (and indeed everyone) today, protection of the environment is of the utmost importance when carrying out any kind of experimental scientific research. Noradoun and her colleagues carried out a number of studies into the destruction of chemical warfare agents, and in particular with regards the destruction of malathion – an analogue for VX – kept both the environmental aspect and the need for ambient conditions to the forefront of her research.

125

References 1. Duffy, M. 2009; Vol. 2009. 2. Okumura, T.; Takasu, N.; Ishimatsu, S.; Miyanoki, S.; Mitsuhashi, A.; Kumada, K.; Tanaka, K.; Hinohara, S. Annals of Emergency Medicine 1996, 28, 129-135. 3. Nations, U. 2008; Vol. 2009. 4. D’Agostino, P. A.; Chenier, C. L. Analysis of Chemical Warfare Agents: General Overview, LC-MS Review, In-House LC-ESI-MS Methods and Open Literature Bibliography, Defence R&D Canada, 2006. 5. Swamy, R. V.; Sugendran, K.; Ganesan, K.; Malhotra, R. C. Defence Science Journal 1999, 49, 117-121. 6. Smith, B. M. Chemical Society Reviews 2008, 37, 470-478. 7. Munro, N. B.; Talmage, S. S.; Griffin, G. D.; Waters, L. C.; Watson, A. P.; King, J. F.; Hauschild, V. Environmental Health Perspectives 1999, 107, 933-974. 8. Noradoun, C. E.; Cheng, I. F. Environmental Science & Technology 2005, 39, 7158-7163. 9. Wagner, G. W.; Yang, Y.-C. Industrial & Engineering Chemistry Research 2002, 41, 1925-1928. 10. Wagner, G. W.; Koper, O. B.; Lucas, E.; Decker, S.; Klabunde, K. J. The Journal of Physical Chemistry B 2000, 104, 5118-5123. 11. Yang, Y. C.; Baker, J. A.; Ward, J. R. Chemical Reviews 1992, 92, 1729-1743. 12. Raushel, F. M. Current Opinion in Microbiology 2002, 5, 288-295. 13. Brajesh K. Singh, A. W. FEMS Microbiology Reviews 2006, 30, 428-471. 14. Harvey, S. P.; Kolakowski, J. E.; Cheng, T.-C.; Rastogi, V. K.; Reiff, L. P.; DeFrank, J. J.; Raushel, F. M.; Hill, C. Enzyme and Microbial Technology 2005, 37, 547-555. 15. Russell, A. J.; Erbeldinger, M.; DeFrank, J. J.; Kaar, J.; Drevon, G. Biotechnology and Bioengineering 2002, 77, 352-357. 16. Morales-Rojas, H.; Moss, R. A. Chemical Reviews 2002, 102, 2497-2522. 17. Noradoun, C. E.; Mekmaysy, C. S.; Hutcheson, R. M.; Cheng, I. F. Green Chemistry 2005, 7, 426-430. 18. Noradoun, C.; Engelmann, M. D.; McLaughlin, M.; Hutcheson, R.; Breen, K.; Paszczynski, A.; Cheng, I. F. Industrial & Engineering Chemistry Research 2003, 42, 5024-5030.

126

c h e m i st ry

Sea Sponges cure Cancer? Synthesis of novel Glycolipid Analogues of α-Galactosyl Ceramide Roisin O’Flaherty

1. Abstract solated from a marine sponge Agelas mauritianus, α-Galactosyl Ceramide (α-GalCer) is a bioactive glycolipid that has therapeutic effects against bacteria, viruses, parasites and autoimmune diseases.1 Two α-GalCer analogues 2, 6 were successfully synthesised in the laboratory with 24% and 10% yields respectively. These glycolipids were synthesised in 2 and 4 steps respectively. A glycosyl halide 1 was prepared with excellent α-anomeric selectivity on reaction of 33% HBr acid in HAc with 1,2,3,4,6-penta-O-acetyl-galactopyranose, a relatively cheap starting material in a glycosylation reaction. The glycoside 2 was then synthesised in a reaction of the glycosyl halide 1 reacting with a long chain alcohol, 1-docosanol. A peptide unit 3 was prepared by reacting Boc-L-Serine with 1-tetradecylamine and NEt3 with a peptide coupling reagent TBTU in the presence of a racemisation suppressant HOBt. A hemiacetal sugar 4 was formed in order to deprotect the acetoxy group of the anomeric carbon of a galactose based sugar by the reaction of the 1,2,3,4,6-penta-O-acetyl-galactopyranose with benzylamine at 50°C, using THF as a solvent. This product 4 was then further reacted with trichloroacetonitrile in the presence of sodium hydride using CH2Cl2 as a solvent to yield a reactive imidate product 5. Compounds 3 and 5 were thus reacted with 0.04 N TMSOTf in CH2Cl2 at 0°C to give the α-GalCer analogue 6. Structural elucidation was carried out on 127

compounds 1, 2, 3, 4, 5, 6. Therefore two glycolipid compounds were synthesised: one containing a long lipidic chain, and one containing a medium lipidic chain that could have potential therapeutic applications against disease and cancer.

2. Introduction & literature review 2.1. Biology CD1 molecules are β2-microglobulin associated antigen-presenting proteins. 2 The ability of CD1 proteins to perform their role is most likely due to their ability to act as lipid binding proteins, which trap hydrophobic alkyl chains within a deep hydrophobic pocket in the protein. A β2-microglobulin molecule is a component of MHC (major histocompatibility complex) class I molecules, which in turn is one of two classes of MHC molecules. The MHC is a large gene family found in most vertebrates and plays important roles in the immune system and autoimmunity. A specific subset of CD1 molecules are CD1d molecules. The primary function of these CD1d proteins is to recognize and bind glycolipid antigens through lipidprotein interactions with receptors on Natural Killer T (NKT) cells.2, 3 NKT cells are a subset of T cells combining properties of NK cells and T cells. These NKT cells produce cytokines called interferons such as interferon-ɣ (IFɣ) and interleukin-4 (IL-4) which results in Th1 and Th2 immune responses, respectively. 4 The role of cytokines is to signal immune cells such as NKT cells to travel to the point of infection, the autoimmune disease or cancer. Th1 and Th2 are T helper cells which are a subset of lymphocytes, which is a type of white blood cell again aiding in the disease fighting process. Several studies have demonstrated the importance of NKT cells in immunoregulation, tumour immunity, and the prevention of autoimmune diseases in mice.5 It has also been suggested that activation of NKT cells induce secondary immune effect, including the activation of T cells and NK cells although this hypothesis remains to be confirmed.6 These secondary effects could be critical in fighting diseases and cancers. Bioactive glycolipids can be recognised and bound by CD1d-restricted NKT cells. A specific CD1d-restricted lymphoid subset is the human Vα24+Vβ11+ NKT cell which is potently activated by α-Galactosyl Ceramide (α-GalCer) presented by CD1d on antigen-presenting cells.6, 7 2.2 The importance of α-Galactosyl Ceramide A family of ceramide-like glycolipids were first isolated from a marine sponge, Agelas mauritianus.8 From these, α-GalCer was chosen to undergo clinical trials in the search for a compound that could inhibit liver metastases in mice.2, 9 Luckily, the liver is largely made up of NKT cells and CD1d molecules which enables the α-GalCer to aid the attack on diseases and cancer. 9 The structure of α-GalCer is 128

OH OH O HO HO O

O HN

C25H51 OH OH

C14H29

Fig. 2.1. Structure of immunostimulant α-GalCer.

shown in Figure 2.1. These compounds are only known to occur naturally in marine sponges but can be synthesised in the laboratory. A plausible reason for this is that they contain an α-anomeric linkage rather than a β-anomeric linkage. This distinguishes them from the ceramides that commonly occur in mammalian tissues which contain β-anomeric sugars.2 The glycolipid α-GalCer is a potent immuno-regulator and has been shown to have therapeutic effects against cancer and autoimmune diseases including multiple sclerosis, alopecia areata, Crohn’s disease, rheumatoid arthritis and systematic lupus erythematosus (SLE).10, 11, 24 The α-GalCer can have different effects on diseased cells. With certain types of diseases, the injection of α-GalCer can lead to a boost in the adaptive immunity to the infection and promotes healing. In other cases, such as autoimmune diseases the α-GalCer activates NKT cells to suppress tissue disruption and lessens the degree of disease. Obviously α-GalCer would be more efficient in the organs to which NKT cells primarily reside, including the liver (as outlined previously), spleen, and other lymphoid organs. Many synthetic routes for creating structural analogues of α-GalCer have been investigated. It has been shown that these analogues have both different activities and efficiencies to that of α-GalCer. Alterations in the structure of α-GalCer have been shown to have several effects: change in binding ability, change in activity/potency, change in the type of cell that presents the compound efficiently, or a change in the outcome of NKT cell activation in the terms of the types of cytokines produced. These factors could influence the biological impact against autoimmune diseases or cancer. We will investigate some effects in relation to alterations in the lipid tail, the carbohydrate head and the hydrophilic spacer group. Firstly, alterations in the lipid unit of the α-GalCer are investigated. There seems to be conflicting evidence in the literature about whether variations in the lipid chain can influence the binding of the α-GalCer analogues to the surface glycoproteins on T-cell membrane surfaces. LaBell and Jackobson provided evidence that a long hydrocarbon chain is necessary to influence the binding of the α-GalCer on a HIV cell surface glycoprotein, gp120.12 In contrast Silberger and Bhat showed that variations in the lipid length had little effect on binding efficiencies of α-GalCer an129

Ac O Ac O

O c A O O Ac O

AcO AcO AcO

OAc O

O O H

N H

O O

Fig. 2.2. Structure of glycolipid analogues of α-GalCer 2, 6.

alogues.13 The length of the lipid chain is a crucial factor in the activity of α-GalCer and its structural analogues with varying lengths, as shown by Colombo et al and Cateni et al.14, 15 The issue regarding the saturation of the lipid tail has not been fully investigated. Although this hypothesis is yet to be confirmed, its design can allow for the synthesis of both saturated and unsaturated compounds. However, in this project only saturated lipid chains are investigated. Secondly, alterations in the carbohydrate head are investigated. The carbohydrate group is indeed necessary in the production of synthetic analogues of α-GalCer. LaBell and Jackobson outlined the need for a carbohydrate head in the biding efficiencies of these compounds .12 Zing et al investigated attaching a sulfatide group to the C-3 position in the sugar moiety of α-GalCer.16 No significant effects of NKT cell stimulation were reported. Various papers discuss the synthesis of α-GalCer analogues using protecting groups such as acetoxy groups in place of the hydroxyl groups on the sugar moiety.2, 15 However, when analysing biological properties of these compounds, such as activity and binding efficiencies, they are usually deprotected. Protected α-GalCer analogues 2, 6 synthesised are shown in Figure 2.2. of varied chain lengths. Alterations in the hydrophilic spacer group are described in many papers but detailed analysis of their effects has yet to be investigated.

2.3 Reaction Involving the Sugar Moiety 2.3.1. SN2 Reactions The method of synthesis of the glycolipid 6 follows an SN2 reaction. The SN2 mechanism was first discovered by Edward David Hughes and Sir Christopher Ingold in the 1930’s. It is a type of nucleophilic substitution where a lone pair on a nucleophile attacks an electrophilic site expelling a leaving group in just one step as in 130

Nu-

X-

Scheme 2.1. Reaction mechanism of SN2 reaction where R= alkyl group, X= leaving group. Therefore it is a first order rate reaction which depends on the carbon skeleton and the leaving group. Scheme 2.1. In an SN2 mechanism, the rate of the reaction depends on the concentration of the starting reagent but is independent of the nucleophile concentration.

2.3.2. Koenigs-Knorr Reaction The Koenigs-Knorr reaction is a well known glycosylation reaction that utilises the SN1 reaction outlined in Section 2.3.1. It is named after William Koenigs and Edward Knorr. In 1893 a paper was published by Emil Fischer with the first preparation of alkyl glucosides as anomeric mixtures.17 These consisted of mainly α-anomeric selectivity. Shortly afterwards, a procedure was conducted for mainly β-anomeric selectivity, developed by Koenigs and Knorr.18 In general this reaction involves the use of glycosyl halides, such as the compound 1 synthesised in this project, to act as glycosyl donors. However modified Koenigs-Knorr reactions can be performed with alternative promoters. Kunz and Harreus successfully outlined promoters suitable for this reaction.19 The imidate product 5 in this project is another example of a modified Koenig-Knorr reaction which successfully acts as a glycosyl donor. 2.4 Activation and coupling for Peptide Bond Formation Peptide coupling reactions have been significantly advanced due to the development of new peptide coupling reagents in organic synthesis. Activation involves the attachment of a leaving group to increase reactivity for a subsequent reaction. Activation of a carbonyl group in a carboxylic acid is essential in peptide bond formation to form an amide. This is because amines form salts when reacted with a carboxylic acid. Thus very high temperatures are needed to form the subsequent amides, which could potentially decompose the sample.20 Therefore we shall discuss various amide coupling reagents. 2.4.1. Carbodiimide Reagents Carbodiimide reagents have been used for many years due to their moderate activity and reasonable price. DCC (N,N’-dicyclohexylcarbodiimide) is one of the most 131

Fig. 2.3. Structure of DCC, DIC, EDCI. N

HCl

C N

well known carbodiimide reagents and was first reported by Sheehan in 1955.21 It is particularly useful in synthesizing active esters and symmetrical anhydrides. The by-product of DCC however, is quite insoluble in many organic solvents. Since the by-product of DIC (1,3- Diisopropylcarboddimide) is readily soluble in chloroform, it seems to be a more attractive reagent. Another commonly used carbodiimide is EDCI (1-(3-(Dimethylamino) propyl)-3-ethyl-carboddimide hydrochloride). The structures of DCC, DIC and EDCI are shown in Figure 2.3. respectively. The use of carbodiimide reagents in peptide synthesis has increased with the use of various additives such as HOBt (1-hydroxylbenzotriazole) and HOAt (1-Hydroxy-7-azabenzotriazole). These additives have aided in reducing racemisation of products and increasing reaction rates.20

2.4.2. Phosphonium and Uronium reagents The most famous phosponium reagent is BOP (Benzotriazol-1-yloxytris(dimethylamino)-phosphonium hexafluorophosphate) as shown in Figure 2.4, which was introduced in 1975. It was the first serious alternative to carbodiimide reagents. However, there are serious disadvantages in using this coupling reagent. There is no selectivity in racemisation and a co-product synthesised in the reaction is toxic.21 Other phosphonium salts include PyCloP (chlorotri(pyrrolidino) phosphonium hexafluorophosphate), PyBroP (Bromotri(pyrrolidino) phosphonium hexafluorophosphate), and PyBOP (Benzotriazol-1-yloxytri(pyrrolidino)- phosphonium hexafluorophosphate). Due to the problems associated with the above phosphonium reagent BOP, the use of uronium reagents such as TBTU and HBTU has increased significantly. HBTU was first introduced in 1978 by Gross. 22 TBTU and HBTU work similarly and 132

N N N

N O

Figure 2.4. Structure of BOP

PF6

N both have ambiguity regarding their structure. These coupling reagents cannot be strictly called uronium reagents because in the crystalline state they are actually guanidinium derivatives.21 At present, these compounds are considered to be some of the most effective amide coupling reagents available, however, they are

N N N Figure 2.5. Structures of TBTU and HBTU respectively.

N O

PF6 N

N N N N

BF4

N 133

quite expensive. The structures of these compounds are shown below in Figure 2.5.

2.4.3 Acid halogenating reagents A paper in 1903 by Fischer first demonstrated the use of acid halides in peptide synthesis.21 In the case of extremely hindered amino acids, the use of acid halides is ideal as a peptide coupling reagent. They also have high reactivity which compliments their use in synthesis. However there is a drawback in that racemic peptide products are formed. One commonly used acid halogenating reagent is oxalyl chloride as shown in Figure 2.6. 2.4.4 Racemisation suppressants The most commonly used racemisation suppressant in peptide synthesis is HOBt. As illustrated in Figure 2.7, a certain level of hydrate is present in this compound. It was first reported to act as an additive in peptide synthesis in 1970 by Koenig and Geiger.21 As outlined earlier in Section 2.4.1., they act as racemisation suppressants and reactivity enhancers in peptide reactions. Other common examples not outlined above are HODhbt (3, 4-dihydro-3-hydroxy-4-oxo-1,2,3-benzotriazine) and N-hydroxytetrazole. 2.5 Overall aims of the project Given the potent activity of α-GalCer and the promising therapeutic effects on autoimmune diseases and cancer, there is an area of obvious interest in creating structural analogues. On the basis of the evidences outlined above, the overall aim was to prepare structural analogues of α-GalCer with varying lipid lengths (from C14 to C22) using coupling reagents. In this paper, the synthesis of analogues 2, 6 are described. The glycolipidic compounds also have a potential application as nutraceutical compounds due to the presence of lipid groups.23

3. Experimental 3.1. General Procedures 3.1.1. Reagents Reagents used were of AR grade and all solvents for synthesis, extraction and column chromatography were distilled and dried before use, if necessary. 3.1.2. Equipment H NMR and 13C NMR spectra were recorded with a Bruker Avance 300 MHz spectrometer operated at 300 MHz for 1H and 75 MHz for 13C at 298 K. NMR spectra were obtained by using CDCl3 as solvent; chemical shifts are expressed as δ units (ppm) relative to tetramethylsilane (TMS) as internal standard. The abbreviations s, d, dd, t, q, m and sb refer to singlet, doublet, doublet of doublet, triplet, quartet, 1

134

N N

Cl Cl

xH2O

N OH

O Fig. 2.6. Oxalyl Chloride

Fig. 2.7. Structure of HOBt

multiplet and singlet broad signal, respectively. 2D NMR experiments were also recorded with a Bruker Avance 300 MHz spectrometer at 298 K. The MS-CI spectra were measured with a Profile Kratos spectrometer. Optical rotations were measured on an AA-100 polarimeter. The α-D concentrations are given in g/ mL. The column chromatography was performed by using standard grade silica gel. Analytical thin layer chromatography (TLC) was carried out using commercial silica coated aluminium sheets: compound spots were visualized by staining with a suitable dye; either 5% sulphuric acid in ethanol or 0.5% ninhydrin in ethanol and charring. Infra-red spectra were obtained as film in the region 4000–400 cm−1 on a Nicolet Impact 400D spectrophotometer. Evaporation under reduced pressure was always affected with the bath temperature kept below 40 °C.

AcO AcO

OAc O

AcO

Fig 3.2. 2,3,4,6-tetra-O-acetyl-1-bromo-α-D-galactopyranose 1 (ROF 3.1)

HBr 33% in HAc (5 mL, 0.138 moles) was added to 1,2,3,4,6-penta-O-acetyl-galactopyranose (2 g, 5.124 mmol) on an ice water bath and was left to stir overnight at rt. The reaction was monitored closely by TLC (ethyl acetate: hexane 2:1). It was evaporated and the reaction mixture was dissolved in ethyl acetate (50 mL) and a 135

Ac O Ac O

O c A O O Ac O

Fig 3.3. 2,3,4,6-tetra-O-acetyl-1-O-docosanyl-β-D-galactopyranose 2 (ROF 8.1) red/orange solid was removed by filtration. The reaction mixture was washed with CH2Cl2 (50 mL) and saturated sodium carbonate (30 mL x 3) followed by brine (30 mL). The organic layer was dried over MgSO4, evaporated, highvacuum dried and stored in the fridge to give compound 1 (ROF 3.1) as a yellow/brown oil (1.575 g ,74.76 %). Rf = 0.55 (hexane /ethyl acetate 2:1). [α]20D = +142.96 (c 0.028, CH2Cl2). H-NMR (CDCl3, 300 MHz): δ = 6.74-6.73 (d, J=3.9 Hz, 1H; H-1), 5.52-5.51 (d, J=3.2 Hz, 1H; H-4), 5.41-5.36 (dd, J=3.2 Hz, J=10.6 Hz, 1H; H-3), 5.06-5.01 (dd, J= 3.9 Hz, J= 10.6 Hz, 1H; H-2), 4.54-4.49(t, J=6.4 Hz, 1H; H-5), 4.24-4.09 (m, 2H; H-6, H-7), 2.16-1.99 (4 x s, 12H; 4 x -OC=OCH3). 1

C-NMR (CDCl3, 75 MHz): δ = 169.92-169.35 (4 x s; 4 x OC=OCH3), 88.35 (d; C-1), 71.05 (d; C-5), 67.76 (d; C-3), 67.54 (d; C-4), 66.8634 (d; C-2), 60.73 (d; C-6), 20.37-20.23 (3 x q ; 3 x -OC=OCH3).

MS-CI: 82.97 (CH2OAc), 149.00, 324 (sugar with loss of CH2OAc group) IR (film from CH2Cl2) : 3483.07 (OHstretch), 3060.73 (CHstretch), 2964.31 (CHstretch), 2726.69 (CHstretch), 2422.43 (CHstretch), 2121.16, 1974.54, 1748.96 (C=Ostretch), 1648.37, 1432.22 (CH2 bend ), 1219.92 (C-O stretch), 737 (C-Br stretch) cm-1. Dry CH2Cl2 (35 mL) was added to a mixture of 1-docosanol (510 mg, 1.56 mmol) and silver carbonate (381 mg, 1.38 mmol) in the dark in argon at rt and was left stirring for 10 minutes. Molecular sieves were heated, ground and added to the mixture which was stirred for a further 30 minutes. Iodine (18 mg, 0.14 mmol) was then added followed by a solution of 1 (ROF 3.1) (283 mg, 1.38 mmol) in dry CH2Cl2 (5 mL) which was added dropwise over a period of 40 minutes. The reaction was left to stir overnight at room temperature. The reaction mixture was then vacuum filtered through Celite, washing with CH2Cl2 (30 mL). The filtrate was washed with brine (3 x 30 mL) and the organic layer was dried over MgSO4. It was then highvacuum dried to give an oil that was purified by column chromatography (hexane/ ethyl acetate 4:1) to give 2 (ROF 8.1) as white crystals (107 mg, 23.69 %). 136

Rf = 0.26 (hexane /ethyl acetate 4:1). [α]20D = -8.25 (c 0.004, CH2Cl2). H-NMR (CDCl3, 300 MHz): δ =5.39-5.39 (d, J=1 Hz, 1H; H-4), 5.38-5.17 (m, 1H; H-2), 5.04-4.99 (dd, J= 3.4 Hz, 10.4 Hz, 1H; H-3), 4.46-4.43 (d, J=7.8 Hz, 1H; H-1 ), 4.19-4.09 (m, 2H; OCH, H-6), 3.91-3.87 (m, 2H; OCH, H-7), 3.48-3.45 (t, J=6.9 Hz, 1H; H-5), 2.15 (s, 3H; OCOCH3), 2.05 (s, 6H; 2 x OCOCH3), 1.98 (s, 3H;-OCOCH3 ), 1.25 (s, 40H; -(CH2)20CH3), 0.90-0.86 (t, 6.5 Hz, 4H; -CH3). 1

C-NMR (CDCl3, 75MHz): δ = 170.39 (s; -OC=OCH3 ), 170.29 (s; -OC=OCH3 ), 170.20 (s; -OC=OCH3 ), 169.35 (s; -OC=OCH3), 101.37 (d; C-1), 70.99 (d; C-3), 70.57 (d; C-5), 70.31 (t; C-6), 68.96 (d; C-2), 67.09 (d; C-4), 61.29 (t; OCH2), 31.92 (t; -CH2CH2CH3), 29.62 (t; -OCH2CH2 ), 29.35 (t; -OCH2CH2(CH2)16), 25.82 (t; -CH2CH2CH2CH3), 22.68 (t; -CH2CH3 ), 20.67 (q;-OC=OCH3), 20.74 (q;- OC=OCH3), 20.59 (q; -OC=OCH3), 14.11 (q; -CH2CH3). 13

MS-CI: 331(fragment form sugar unit), 309 (C22H45), 229, 169 IR (film from CH2Cl2) :3483.92 (OHstretch from starting material), 3059.64 (CHstretch), 2919.21(CHstretch), 2850.95(CHstretch), 2119.04, 1751.25 (C=Ostretch) cm-1.

O O H H O

O N

N H

Fig. 3.4. N-tert-butoxycarbonyl-L-serine tetradecyl amide 3 (ROF 6.1) DMF (5 mL) was added to a mixture of Boc-L-Serine (250 mg, 1.22 mmol), TBTU (430 mg, 1.34 mmol) and HOBt (181 mg, 1.34 mmol) under nitrogen and was left to stir for 10 minutes. 1-Tetradecylamine (286 mg, 1.34 mmol) and NEt3 (0.2 mL, 1.46 mmol) was then added under nitrogen to the reaction mixture and was left to stir overnight. CH2Cl2 (25 mL), brine (30 mL) and 0.2 N hydrochloric acid (30 mL) was added. The aqueous layer was extracted with CH2Cl2 (3x 25 mL), and combined organic layers were washed with saturated sodium hydrogen carbonate solution (30 mL). The organic layer was dried over MgS04. The solvent was then evaporated under reduced pressure, vacuum dried to give an oil that was purified by column chromatography (hexane/ethyl acetate 1:1) to give 3 (ROF 6.1) as a white solid (337 mg, 57.89 %). 137

Ac O Ac O

O c A O H O

Ac O

Fig. 3.5. 2,3,4,6-tetra-O-acetyl-α,β-galactopyranose 4 (ROF 11.1) Rf = 0.30 (hexane /ethyl acetate 2:1). [α]20D = -8.58 (c 0.013, CH2Cl2). H-NMR (CDCl3, 300 MHz): δ =6.79 (s, 1H; -NHCH2), 5.69-5.67 (d, J= 7.5 Hz, 1H; -OH), 4.14-4.04 (m, 2H; Hα, Hβ), 3.65-3.59 (m, 2H; Hβ’, -NHC=O), 3.25-3.23 (m, 2H; -NHCH2), 1.45 (s, 12H; -OC(CH3)3), 1.25 (s, 24H; -NHCH2(CH2)12CH3), 0.90-0.86 (t, J = 6.42 Hz, 3H; -CH2CH3). 1

C-NMR (CDCl3, 75 MHz): δ =171.28 (s; -OC=O), 156.32 (s;-C=ONHCH2), 80.48 (s; -C(CH3)3), 77.45-76.61 (m, CDCl3, -CH2OH), 62.90 (t; NHCH2-), 54.84 (d; -NHCHCH2OH), 39.53 (t; -C=ONHCH2CH2), 31.91 -26.85 (t x 10; -NHCH2CH2(CH2)10), 28.29 (q; -OC(CH3)3), 22.68 (t; -CH2CH3), 14.10 (q;-CH2CH3). 13

MS-CI: 556.00, 345, 240 (C=ONHC14H29), 212 (-NHC14H29), 160 (-CH(CH2OH)NBoc), 57 (C(CH3)3) IR (film from CH2Cl2): 3319.60 (OHstretch), 3107.63 (NHstretch) 2924.92 (CHstretch), 2853.95 (CHstretch), 1706.4 (C=Ostretch), 1650.17 (NHbend), 1174.77 (COstretch) cm-1. Benzylamine (0.307 mL, 2.81 mmol) was added to a solution of 1,2,3,4,6-penta-O-acetyl-galactopyranose (1.224 g, 2.34 mmol) in dry THF (30 mL) and it was stirred overnight at 50°C in a silicon oil bath. CH2Cl2 (30 mL) was added followed by 0.4 N HCl (20 mL) and the organic layer was washed with brine (3 x 20 mL).The organic layer was dried over MgSO4 and was evaporated under reduced pressure to

AcO AcO AcO

OAc O O

NH CCl3

Fig. 3.6. 2,3,4,6-tetra-O-(2,2,2-trichloro-acetmidoyl)-α-D-galactopyranose 5 (ROF 12.1) 138

give 4 (ROF 11.1) as a brown oil (1.345 g, 122.93 %). This was used without further purification. Rf =0.47 (hexane /ethyl acetate 1:1). 4 (ROF 11.1) (0.7 g, 1.06 mmol) was dissolved in dry CH2Cl2 (5 mL) under nitrogen at rt. Trichloroacetonitrile (765 mg, 5.3 mmol) was added to the reaction mixture. Sodium hydride (17 mg, 0.707 mmol) was then added under nitrogen and the reaction mixture was left to stir for 40 minutes. The solvent was then evaporated under reduced pressure to give an oil that was purified by column chromatography (2:1 hexane/ ethyl acetate) to give 5 (ROF 12.1) as white crystals (310 mg, 79.32 %). Rf = 0.71 (hexane /ethyl acetate 1:1). [α]20D = +32.88 (c 0.658, CH2Cl2). H-NMR (CDCl3, 300 MHz): δ = 8.67 (s, 1H; -C=NH ), 6.61-6.01 (d, J=3.3 Hz, 1H; H-1), 5.57-5.57 (d, J=1.2 Hz, 1H; H-3); 5.56-5.38 (m, 2H; H-2, H-4), 4.47-4.42 ( t, J= 6.6 Hz, 1H; H-5), 4.20-4.05 (m, 2H; H-6, H -7) , 2.17 (s, 3H; -OC=OCH3 ), 2.03-2.01 (3 x s, 9H; -OC=OCH3 ). 1

C-NMR (CDCl3, 75MHz): δ = 170.29-169.96 (4 x s; -OC=OCH3), 160.95 (-OC=(NH) CCl3), 93.54 (d; C-1 ), 90.77 (s; -CCl3), 68.99 (d; C-5), 67.51-68.91 (3 x d; C-2,C-3, C-4), 61.25 (d; C-6), 20.65-20.54 ( 4 x q; 4 x -OC=OCH3).

MS-CI: 170 (-OCNHCCl3), 331(sugar without anomeric substituent), 347 IR (film from CH2Cl2): 3479.62 (NHstretch), 3319.88 (NHstretch), 2964.29 (CHstretch), 2922.87, 2851.67 (CHstretch), 1751.35 (C=Ostretch), 1677.40 (C=Ostretch), 1617.98 (CHstretch) cm-1. Dry CH2Cl2 (7 mL) was added to a mixture of 5 (ROF 12.1) (188 mg, 0.38 mmol) and 3 (ROF 6.1) (129 mg, 0.38 mmol) under nitrogen on an ice water bath. Over a period of 10 minutes a 0.04 N TMSOTf (0.95 mL) solution was added dropwise to the reaction mixture. It was then left to stir overnight at room temperature. The reaction was quenched with sodium hydrogen carbonate and washed with brine (3 x 30 mL). The organic layer was dried over MgSO4 and was evaporated under reduced pressure to give an oil that was purified by column chromatography (hexane/ ethyl acetate 3:1 to 2:1 to 1:1 to 1:1.5) to give 6 (ROF14.1) as yellow-white crystals (30 mg, 10.36%). Rf = 0.76 (hexane /ethyl acetate 1:1). [α]20D = -1.08 (c 0.004, CH2Cl2). 1

H-NMR (CDCl3, 300 MHz): δ = 6.36 (bs, 1H; -NHCH2), 5.40-5.39 (dd, J=0.9 Hz, J=3.4 139

AcO AcO AcO

OAc O

O O H

N H

O O

Fig. 3.7. 2,3,4,6-tetra-O-acetyl-1-O-[2-tert-butoxycarbonylamino-2-tetradecylcarbamoyl(S)-ethyl-β-D-galactopyranose 6 (ROF 14.1) Hz, 2H; H-4, NHCH), 5.21-5.15 (dd, J=7.9 Hz, J=10.5 Hz, 1H; H-2), 5.04-4.98 (dd, J=3.4 Hz, J=10.5 Hz, 1H; H-3), 4.57-4.54 (d, J= 7.9 Hz, 1H; H-1), 4.27 (bs, 1H; Hα ), 4.17-4.14 (t, J=1.9 Hz, 2H; H-6, H-7), 4.07-3.97 (m, 2H; H-5, Hβ), 3.76-3.70 (dd, J=7.9 Hz, J=10.4 Hz, 1H; Hβ’), 3.28-3.23 (dd, J=5.4 Hz, 11.0 Hz, 2H; -NHCH2 ), 2.16-1.98 (4 x s, 12H; -OC=OCH3), 1.45 (s, 9H; -(C=O)OC(CH3)3), 1.25 (s, 24H; -(CH2)12CH3), 0.90-0.86 (t, J=6.5 Hz, 3H; -CH2CH3). C-NMR (CDCl3, 75MHz): δ = 170.45 (s; -(C=O)OC(CH3)3), 102.00 (d; C-1) 170.08 (s; -C=ONHCH2), 170.01 (s; -OC=OCH3), 169.58 (s; -OC=OCH3), 169.28 (s; -OC=OCH3), 71.06 (d; C-5), 70.70 (d; C-3), 68.70 (d; C-2), 66.97 (d; C-4), 61.24 (d; C-6), 39.69 (t; -NCH2 ), 31.92 (t; -NHCH2CH2), 29.64-29.35,28.29-26.83 (5 x t; -CH2CH2(CH2)10CH2CH3), 29.28 (q; -(C=O)OC(CH3)3), 22.68 (t; -CH2CH3), 20.76-20.54 ( 3 x q; 3 x -C=OCH3), 14.11 (q; -CH2CH3). 13

MS-CI: 240 (C=ONHC14H29), 331 (sugar), 390. IR (film from CH2Cl2) : 3335.00 (NHstretch), 2925.52 (CHstretch), 2854.47 (CHstretch), 1754.88 (C=Ostretch), 1660.45 (C=Ostretch), 1527.79, 1467.57 (CHbend), 1368.16 (CHbend), 1225.46 (COstretch), 1172.18 (CNstretch) cm-1.

4. Results and Discussion 4.1. Synthesis of glycolipid 2 A retro-synthetic pathway of the glycolipidic analogue 2 of α-GalCer is depicted in Scheme 4.1. The glycosyl halide 1 is reacted with an alcohol group in an SN1 substitution reaction in the presence of Ag 2CO3 by a Koenigs-Knorr reaction to give a glycoside 2. 17 The glycosyl halide 1 in the protected form is a key intermediate that can be obtained by reaction of HBr 33% in acetic acid and 1,2,3,4,6-penta-O-acetyl140

C22H44OH

Scheme 4.1. Retro-synthesis of α-GalCer analogue 2.

AcO AcO

AcO

OAc O OAc

AcO AcO

OAc O Br

AcO AcO

AcO

HBr 33% in HAc

OAc O O

C22H45

Scheme 4.2. Synthesis of glycolipid derivatives 2. Reagents and conditions: (a) HBr/HAc, 0°C; (b) 1-Docosanol, CH2Cl2, Ag2CO3, I2, rt, N2. galactopyranose to give a 75% yield of the glycosyl halide 1. The synthetic route followed is shown in Scheme 4.2.

4.1.1. Synthesis of glycosyl halide 1 The glycosyl halide 1 was prepared from a reaction of 1,2,3,4,6-penta-O-acetylgalactopyranose with a 33 % solution of HBr in acetic acid. Purification was attempted by recrystallisation in methanol but a decomposition of compound 1 was observed. Therefore, the glycosyl halide 1 was prepared at 0 °C without further purification by recrystallisation and was stored in the fridge. It was characterised as a crude product and used in a subsequent reaction as in Scheme 4.2. Structural elucidation of the glycosyl halide 1 was performed through a detailed analysis of the COSY data (Appendices 1 (ROF 3.1)). Starting from the ano141

position H-1 H-4 H-3 H-2 H-5 H-6, H-7 OC=OCH3

δ (ppm) 6.74 5.52 5.41 5.06 4.54 4.24 2.16,2.11, 2.05,1.99

multiplicity d d dd dd t m 4xs

J (Hz) 3.9 3.2 3.2, 10.6 3.9, 10.6 6.4 n/a n/a

Table 4.1. 1H NMR Chemical Shift Assignments for glycosyl halide 1 in CDCl3. meric hydrogen signal (δ = 6.74, d, J=3.9 Hz), the sugar moiety spin system from C-1 to C-6 was assigned as in Table 4.1. The anomeric hydrogen (H-1) has a small coupling constant (J = 3.9 Hz) thus indicating that the galactopyranose sugar moiety is linked in the α position to the bromide leaving group. The anomeric hydrogen is coupled to a proton at C-2 resonating at δ 5.06 (dd, H-2), which in turn couples to a proton at C-3 (δ 5.41, dd, H-3). This signal is coupled to a proton at C-4 (δ 5.52, d, H-4) which is coupled to another proton at C-5 resonating at δ = 4.54 (t, H-5). Sequential assignments from this proton allowed us to assign the protons of C-6 (δ = 4.24, m, H-6, H-7). The signals of C=OCH3 were found to be resonating at δ = 2.16, 2.11, 2.05, 1.99 respectively. The 13C NMR spectrum contains 4 quaternary signals at δ = 169.92-169.35 for the carbonyl carbons of the protecting acetoxy groups. The anomeric carbon is at δ = 88.35 which couples to the anomeric proton in the HSQC spectrum. The sugar skeleton is elucidated from C-2 through to C-6 from the HSQC and DEPT-135 spectra. The methyl groups of the acetoxy groups are at the lowest chemical shift of δ = 20.37-20.23. The mass spectrum obtained for this compound show fragments with masses of 82.97, 149.00, 324 respectively. A source such as an electron ionization source produces many fragments so it comes as no surprise that the total mass of compound 1 is not present. The molecular weight of the glycosyl halide 1 is 411.20 and with the loss of the CH2OAc fragment at C-5 has a mass of 324.This mass is indeed present in the mass spectrum. The CH2OAc fragment corresponds to the peak with a mass of 82.97 thereby verifying the structure of the glycosyl halide 1. The IR spectrum was also a great tool in determining the presence of the glycosyl halide 1 with characteristic CHstretch bands present at 3060.73, 2964.31, 2726.69, 2422.43 cm-1 and a C-Brstretch at 737 cm-1. The [α]20D yielded a value of + 142.96 indicating the presence of chiral centres. The stereochemical outcome of the glycosyl donor 1 is determined by the anomeric effect. Substituents on a six-membered ring typically adopt the equatorial position to minimize steric interaction with the ring. In some instances however, 142

σ* (C-X)

Scheme 4.3. Partial donation of the O lone pair (n orbital) into the antibonding orbital ( σ*)in a pyranose ring. thermodynamic considerations have a preference for the axial position, which is known as the anomeric effect.25 This effect occurs for electronegative substituents such as oxygen, fluorine, chlorine and bromine at the anomeric centre of the sugar. When there is an electronegative substituent (X) in an axial position at the anomeric centre, the oxygen atom of the ring has one of its lone pairs of electrons antiperiplanar to the C-X bond. This lone pair can partially donate electrons into the anti-bonding (σ*) orbital of the C-X bond as in Scheme 4.3. This induces electron delocalisation around the ring and therefore is stabilising. Thus the anomeric substituent is in the α position as determined in NMR data (Table 4.1).

4.1.2. Synthesis of glycolipid 2 Once it was established that high α selectivity was attainable as in glycosyl bromide donors 1, β-selective glycosylation strategies were investigated.17 The neighbouring group at C-2 in the glycosyl donor 1 is protected with an ester group which is well documented to provide good anchimeric assistance.26 The presence of this neighbouring group at C-2 results in the formation of a β substituent in the glycoside 2 as in Scheme 4.2, instead of a mixture of stereoisomers. Our initial instinct for synthesizing the glycoside 2 led us to react the glycosyl halide 1, as in literature with the 1-Docosanol in the presence of AgOTf at low temperatures for activating the halide leaving group but very little sugar was present in the NMR proving that the reaction did not proceed.27 Ag2CO3 was then used in its place. This could be due to the fact that Ag2CO3 is believed to be a better activating group than AgOTf.28 Thus the glycosyl bromide donor 1 was reacted with a long chain alcohol group, 1-Docosanol, with Ag2CO3 activating the bromide leaving group and I2 acting as a catalyst to give the glycoside 2 in a poor yield of 24%. Possible reasons for this low yield could be attributed to formation of side-products such as a saponification reaction occurring or thermal decomposition of the product 2. Due to the exuding water free reaction conditions a direct saponification of starting compounds is unlikely. However, the thermostability of this compound is yet to be investigated. Structural elucidation (Appendices 2 (ROF8.1)) of the glycoside 2 was again performed through detailed analysis of the 1H NMR, 13C NMR and 2D NMR techniques such as COSY and HSQC. The anomeric proton was found to be a doublet at δ = 143

position

δ (ppm)

multiplicity

J (Hz)

H-2

5.38

n/a

H-4 H-3 H-1 H-6 H-7 H-5

-OCH -OCH

-OCOCH3 -OCOCH3 -OCOCH3

-(CH2)20CH3 -CH3

5.39 5.04 4.46 4.19 3.91 3.48 4.19 3.91 2.15 2.05 1.98 1.25 0.90

dd d

m m t

m m s

2xs s s t

3.4, 10.4 7.8

n/a n/a 6.9

n/a n/a n/a n/a n/a n/a 6.5

Table 4.2. 1H NMR Chemical Shift Assignments for glycoside 2 in CDCl3. 4.46 (Table 4.2.) with a coupling constant of 7.8 Hz. A galactose sugar moiety containing a β substituent contains trans diaxial hydrogen atoms which are aligned with a dihedral angle of 180° and give large J values. Therefore this large coupling constant indicates that the substituent on the sugar moiety in the glycoside 2 is in the β stereochemical arrangement. H-2 was found to be a multiplet at a δ = 5.38 with an intensity of 1. It was verified to be coupled to the anomeric hydrogen via the COSY data. This in turn was found to be coupled to a proton at C-3 (δ = 5.04, dd, H-3) which was coupled to a proton at C-4 (δ = 5.39, d, H-4). The signal at δ = 3.48 belongs to the H-5 proton (t, 1H) but it does not seem to couple with the H-4 proton on the COSY spectrum. This is probably due to the fact that the proton at the C-4 position is in the equatorial arrangement while the proton at the C-5 position is in the axial arrangement. Thus the dihedral angle is 60° and the axial/ equatorial coupling is very small and may not be observed in the COSY spectrum. Sequential assignments from this proton allowed us to assign the protons of C-6 with H-6 present at δ = 4.19 as part of a multiplet and H-7 present at δ = 3.91 as part of another multiplet. A proton from the OCH2 was found to be resonating in a multiplet with the H-6 compound and the other proton of the OCH2 was found to be resonating within the multiplet shared with the H-7 proton. The protons of the acetoxy groups were found to be resonating at δ = 2.15, 2.05, and 1.98 respectively. The signal for the long hydrocarbon chain was found to be resonating at δ = 1.25 144

with an integration of 40 as expected. The methyl group CH3 at the end of the chain was found to be resonating at δ = 0.90. From the COSY 2D NMR the sugar moiety was assigned with relative ease. It was more difficult to assign the other protons such as the OCH2 protons. However it did become apparent from the COSY NMR that the 2 protons in the OCH2 group are in different environments. Take the signal at δ = 4.19 as an example containing one of the protons of the CH2 group (OCH) and the H-6 signals. If you look closely at this position, it can be seen that there is coupling of the OCH to the long hydrocarbon chain (CH2)20 at δ = 1.25 and coupling between H-6 and H-7 at δ = 3.91. A similar deduction can be made about the signal at δ = 3.91. The signal for the long hydrocarbon chain was elucidated with ease due to the low chemical shift (δ = 1.25) and the large integration value of 40. Similarly the triplet at δ = 0.90 was found to be the methyl group at the end of the hydrocarbon chain. On analysis of the 13C NMR, HSQC and DEPT-135, the structure of the glycolipid 2 was further verified. The quaternary carbons of the acetoxy groups were found to be singlets at δ = 170.39, 170.29, 170.20, and 169.35 respectively which is in direct agreement with the DEPT-135 NMR as these signals are no longer present. The high chemical shifts of these signals are indeed indicative of carbonyl substituents. The signal at δ = 101.37 was found to be the anomeric carbon on the sugar moiety. This signal was deduced from analysis of the HSQC spectrum as it is coupled to the anomeric proton at δ = 4.46 on the 1H NMR. It appears at a chemical shift characteristic of an anomeric proton also. DEPT-135 further verifies this deduction as the peak appears in the negative direction. The signals C-3, C-5, C-6, C-2, C-4 were found to be resonating at δ = 70.99, 70.57, 70.31, 68.96, 67.09 respectively in the 13C NMR. In the HSQC spectrum, coupling between the various carbons and protons verified the assignation of these signals. DEPT-135 was in direct agreement with the HSQC data also with the CH peaks in the negative direction and the CH2 peak in the positive direction. The remainder of the signals were assigned to the carbon atoms in the long hydrocarbon chain and in the protecting groups. A hetronuclear NOE experiment irradiating protons would be helpful in the total determination of the structure. Since, however the structure of 2 is already elucidated by 1H NMR and 13C NMR, we can waive such measurements. The IR absorption bands for this compound simply verify the various functional groups and do not yield sufficient information to characterise this compound. These absorption bands were found at 3483.92 (OHstretch), 3059.64 (CHstretch), 2919.21 (CHstretch), 2850.95 (CHstretch), 2119.04, 1751.25 (C=Ostretch) cm-1. The absorption band of interest is present at 3483 cm-1 as it highlights the possibility of OH starting material. Acetylation of galactose with acetic anhydride and pyridine at room temperature produces the fully acetylated compound in Scheme 4.4. as a mixture of stereoisomers at the anomeric centre called anomers. It is well known that free sugars as seen in Scheme 4.4. come as an equilibrium mixture of anomers. The product in Scheme 4.4 was the starting material in the production of the glycolipid 2 as seen in Scheme 4.2. From the IR spectrum, it is clear that further purification 145

AcO AcO

AcO

OAc O

H O

a OAc

H O

O H O H

H O

Scheme 4.4. Synthesis of 1,2,3,4,6-penta-O-acetyl-galactopyranose. Reagents and conditions: (a) Ac2O, py, rt. of the glycolipid compound 2 is necessary. The mass spectra showed fragments at 31, 309, 229, and 169. The fragment at 331 is in direct agreement with the sugar moiety without the –OC22H45 substituent while the C22H45 fragment has a mass of 309 which is certainly present in the mass spectrum with a massive relative abundance, thus in good agreement with the proposed structure.

4.2. Synthesis of amino acid glycolipid 6 Firstly, the amide derivative of N-Boc serine 3 suitable for glycosylation was synthesized as shown in Scheme 4.5. This compound was reacted with the imidate product 5 that was synthesized as shown in Scheme 4.6. in a glycosylation reaction shown in Scheme 4.7. The reasoning for the choice of the amide derivative 3 was that serine-based lipids have been reported to exhibit similar bioactivity as ceramide mimics such as in α-GalCer.29 The whole synthetic process took 4 steps to synthesis the glycolipid 6 in 10% yield. 4.2.1. Synthesis of amide derivative 3 In early attempts at synthesizing the amide derivative 3, 1-tetradecylamine, DIC and NEt3 were reacted, a system that was used successfully in previous reports with DIC acting as an amide coupling reagent.30 The product 3 was formed as confirmed by TLC analysis in a small yield but unfortunately, the separation of the urea by-product and the desired product 3 proved to be very difficult as both the urea and the amide derivative 3 were readily soluble in chloroform. Our focus was therefore turned to another carbodiimide coupling reagent, EDCI, in a reaction under similar conditions. The advantage of using EDCI over DIC as a carbodiimide coupling reagent is the fact that the urea by-product formed from the EDCI reaction is water soluble whereas the urea formed from the DIC is not. Therefore purification of the product would be simpler using EDCI as an amide coupling reagent. This reaction did not proceed to completion as evident in the preliminary 1H NMR results however. TLC results showed no product formation either thus verifying the failed reaction. Our focus then turned to a different synthetic route where oxalyl chloride was reacted with 1-tetradecylamine but again we were met with 146

O HO

H O

O HO

58%

H O

N H

H C14H29

Scheme 4.5. Synthesis of amide derivative 3. Reagents and conditions: (a) TBTU/HOBt, 1-tetradecylamine, NEt3, DMF, rt.

AcO AcO AcO AcO

OAc O

AcO

90%

AcO

OAc O

AcO

79%

OAc O

AcO

OAc

AcO

NH CCl3

Scheme 4.6. Synthesis of sugar donor 5. Reagents and conditions: (a) Benzylamine, THF, 50°C; (b) Cl3CCN, NaH, CH2Cl2, rt.

O HO

H O

N H

AcO 10%

AcO

H C14H29

AcO

OAc O O

OAc O NH

N H

CCl3 C11H23

O O

Scheme 4.7. Synthesis of glycolipid 6.Reagents and conditions: (a) TMSOTf, CH2Cl2, 0°C. 147

failure. This unsatisfactory result led us to search for a more practical synthetic route to the compound 6, thus reverting to a uronium coupling reagent. TBTU seems to be one of the best amide coupling reagents, succeeding in difficult sterically hindered coupling and giving minimal racemisation when there is a danger.31 However, one disadvantage of the TBTU coupling reagent is the cost. HOBt is used to reduce chances of racemisation and side reactions by generating an active ester in situ. Therefore TBTU/ HOBt were reacted with 1-tetradecylamine and NEt3 to synthesise the amide derivative 3. Structural elucidation (Appendices 3 (ROF 6.1)) of the amide derivative 3 was performed primarily through detailed analysis of the 1H NMR, 13C NMR and also through 2D NMR techniques such as COSY and HSQC. The low field chemical shift at δ = 6.79 was assigned to the amide proton attached to the long hydrocarbon chain (-NHCH2) appearing as a broad singlet which is shown to be coupled to NHCH2 resonating at δ = 3.25 in the COSY NMR. The proton of the hydroxyl group (OH) is at a chemical shift of δ = 5.69 appearing as a doublet due to one of the diastereotopic protons at a close proximity. This signal is shown to couple to both these protons in the COSY NMR which are present at δ = 4.14 appearing as a multiplet (Hα, Hβ) and these protons are in turn coupled to the Hβ’ proton at δ = 3.65. The NH proton of the amide group N-Boc protecting group (NHC=O) is present at a chemical shift of δ = 3.65 along with the Hβ’ proton appearing as a multiplet with an integration of 2. These protons should couple to one another but it is unclear in the COSY data for the simple explanation of the small separation between the signals of the respective protons. The protons of the methyl groups of the protecting Boc group (-OC(CH3)3) of the serine derivative are present at δ = 1.45 with an integration of 9. The integration of the total peak is 12 indicating that there is still some impurity present in the sample to a small degree. At a low field chemical shift of δ = 1.25 the -(CH2)12CH3 protons are assigned and are shown to be coupled to the methyl end chain protons present at δ = 0.90 as triplets. Thus there is clear evidence of the presence of the amide derivative 3 (Table 4.3). position

δ (ppm)

multiplicity

J (Hz)

-OH

5.69

7.5

-NHCH2 Hα Hβ

Hβ’

-NHC=O -NHCH2

-OC(CH3)3

-NHCH2(CH2)12CH3

6.79 4.14 4.14 3.65 3.65 3.25 1.45 1.25

m m m m m s s

n/a n/a n/a n/a n/a n/a n/a n/a

Table 4.3. 1H NMR Chemical Shift Assignments for amide derivative 3 in CDCl3. 148

On analysis of the 13C NMR, the quaternary carbons of the carbonyl groups are present at high chemical shift at δ = 171.28 (s; -OC=O), 156.32 (s;-C=ONH) and 80.48 (s;-C(CH3)3) respectively. These signals are confirmed to be quaternary by the disappearing signals in the DEPT-135 NMR. The signal present at δ = 77.45 is characteristic of a CDCl3 solvent peak.32 As evident from the HSQC NMR and DEPT-135 NMR spectra, the carbon attached to the diastereotopic protons (Cβ) at δ = 77.22 (t; CH2OH) was structurally elucidated. At δ = 62.90 (t; NHCH2-) a CH2 group is present as evident in the DEPT-135 NMR. Similarly for chemical shifts δ = 54.84 (d; -NHCHCH2OH), 39.53 (t; -C=ONHCH2CH2), 31.91-26.85 (t x 10; -NHCH2CH2(CH2)10), 28.29 (q; -OC(CH3)3), 22.68 (t; -CH2CH3), 14.10 (q;-CH2CH3) the 13C NMR was analysed. The presence of the various functional groups was confirmed with carbon signals indicating the existence of the long hydrocarbon chain and the protecting Boc group. These were further confirmed and verified with the HSQC and DEPT135 NMR data. On analysis of the mass spectrum many fragments of the compound 3 were detected such as the C=ONHC14H29 fragment with a mass of 240.There also were fragments with masses of 212 (-NHC14H29) and 160 (-CH(CH2OH)NHBoc).An important fragment was one with mass 57 (C(CH3)3). The relative abundance of this fragment was very high. There was a fragment present with a mass of 556. This mass is far too high for the compound 3 in question, hinting at possibility of impurities. The IR spectra simply conveyed the presence of the various functional groups present such as the hydroxyl group present at 3319.60 cm-1 (OHstretch), the amide group with bands present at 3107.63 (NHstretch) 1706.4 (C=Ostretch), 1650.17 (NHbend), 1174.77 (COs) cm-1. Therefore compound 3 was indeed synthesised with relative success. tretch The low yield of this reaction would be the main problematic consideration. Possible improvements on this synthesis would include the use of HATU as the amide coupling reagent in place of the TBTU which again would be used in conjunction with the HOBt previously used.33 A slightly different solvent system, such as the use of different ratios of the solvent used or using different polarity solvents for the column chromatography might help in better separation to avoid impurities of the amide derivative 3.

4.2.2. Synthesis of imidate sugar donor 5 The imidate sugar donor 5 was synthesised from the reaction of a crude hemiacetal sugar 4 with trichloroacetonitrile and sodium hydride in CH2Cl2 under anhydrous conditions as in Scheme 4.5. The reaction proceeded via an addition reaction where the hydroxyl substituent at the anomeric carbon of the hemiacetal sugar 4 attacked the electrophilic carbon of the trichloroacetonitrile. The sodium hydride acted as a base aiding in the formation of the α imidate product 5. The preparation of the imidate product 5 to act as a sugar donor as in Scheme 4.5 consisted of a twostep reaction with excellent yields of 90 % and 79 % respectively. It was interesting to see the effects of using different glycosyl donors as in compounds 1 and 5 and to see whether the subsequent glycosylation reactions result149

ing in the formation of glycolipids 2 and 6 were improved as a result. Literature results have found that trichloroacetimidate-mediated glycosylation as an alternative method to the classical Koenigs–Knorr procedure now appears to be one of the most ideal glycosylation protocols. 17, 34 The first step in the synthesis of the reactive imidate 5 was the production of a hemiacetal sugar 4 from the same starting material (1,2,3,4,6-penta-O-acetyl-galactopyranose) used in the synthesis of the glycosyl halide 1. This starting material was reacted with benzylamine in THF at 50 °C to give the hemiacetal sugar 4 as in Scheme 4.6. Structural elucidation was carried out on compound 4 through analysis of 1H NMR and 13C NMR spectra but due to time restraints no COSY, DEPT-135 or HSQC NMR were carried out. Purification of the hemiacetal sugar 4 by doing column chromatography was not attempted due to the time restraints either. In certain terms the yield of 90% is somewhat misleading therefore as impurities are almost certain to be present. Column chromatography purification was carried out on the imidate sugar 5 and structural elucidation was carried out by the afore mentioned NMR techniques (Appendices 5 (ROF12.1)). Starting from the anomeric hydrogen signal (δ = 6.61, d, J=3.3 Hz), the sugar moiety spin system from C-1 to C-6 was elucidated as in Table 4.4. The anomeric proton (H-1) at δ = 6.61 is a peak of significant interest and through the 2D COSY NMR was indeed shown to be coupled to the proton at the C-2 position (δ = 5.56, H-2). All the other signals for the protons on the sugar moiety were present and coupled as expected. The signal of interest is the anomeric proton. The coupling constant of the anomeric proton was found to be 3.3 Hz indicating, as in the glycosyl halide 1 that the imidate substituent 5 is in the α substituent as predicted by the anomeric effect.35 Another peak of interest is one at δ = 8.67 (C=NH ) appearing as a singlet. Due to the highly electronegative N atom this proton is present at a high chemical shift. The protons of the protecting groups are present at low chemical shifts at δ = 2.17 (s, 3H; -OC=OCH3 ), 2.03-2.01 (3 x s, 9H; -OC=OCH3 ).

The 13C NMR spectrum display 4 quaternary signals (δ = 170.29-169.96) corresponding to the 4 carbonyl groups in the acetoxy protecting groups. Another quaternary carbon is present indicating the carbonyl carbon of the imidate group (δ = 160.95). The anomeric carbon is at a relatively high chemical shift (δ = 93.54) and from the HSQC spectrum it can be seen to couple to the anomeric proton. It is also shown to be a CH peak in the DEPT-135 as the signal is facing in the positive direction. The quaternary carbon of the imidate group (-CCl3) bounded to the three Cl atoms is present and no coupling is present in the HSQC as expected. The C-5 carbon is present at δ = 68.99 which has a high chemical shift due to the presence of the neighbouring electronegative oxygen. The signals for the C-2, C-3, C-4 are found at δ = 67.51-68.91 but it is difficult to assign each signal to a carbon as there is 150

Position

δ (ppm)

multiplicity

J (Hz)

H-1

6.61

3.3

C=NH H-3 H-2 H-4 H-5 H-6 H-7

-OC=OCH3 -OC=OCH3

8.67 5.57 5.56 5.56

n/a 1.2

n/a

4.20

n/a

2.17

4.47 4.20 2.03

m 3xs

6.6

n/a n/a n/a

Table 4.4. 1H NMR Chemical Shift Assignments for imidate sugar donor 5 in CDCl3. very close coupling occurring in the HSQC leaving the discrimination of these signals very difficult to assign. These CH signal assignments do agree with the DEPT135. The C-6 carbon is present at δ = 61.25 and is in agreement with both HSQC and DEPT-135 spectra. At a low chemical shift, four signals are present corresponding to the methyl groups in the acetoxy protecting groups at δ = 20.65-20.54. Thus it may be concluded that 1H, COSY, 13C, DEPT-135 NMR are in good agreement in the structural elucidation of compound 5. From the mass spectrum provided further structural characterisation can be made by the presence of the following fractions 170 (-OCNHCCl3) and 331 (sugar without anomeric substituent). The presence of the sugar moiety and the imidate group are sufficient information that the compound 5 is present. Briefly looking at IR spectra shows NH stretches, CH stretches and carbonyl stretches which is sufficient in the structural elucidation.

4.2.3. Synthesis of glycolipid 6 As in Scheme 4.7, the glycolipid 6 was synthesised by reacting the sugar imidate 5 with the amide derivative 3 in CH2Cl2 at 0 °C in the presence of a freshly made solution of TMSOTf. The TMSOTf acted as a lewis acid to activate the imidate leaving group of the reactive sugar 5 to form the glycolipid 6. Similar to the glycolipid 2, a β stereospecific substituent is expected in this glycosylation reaction. This glycosylation reaction of 5 with 3 afforded a low yield (10%) of glycolipid 6. Analysis of the 1H NMR and COSY spectra (Appendices 6 (ROF 14.1)) of this glycolipid 6 allowed assignation of the following protons. For the sugar the best entry point is the anomeric carbon (δ ≈ 100), to which the proton signal at δ = 4.57 (d, J= 7.9 Hz, 1H; H-1) can be assigned using the HSQC plot. This carbon signal is not seen 151

in either the 13C NMR or the DEPT-135 due to the bad signal/noise ratio. H-1 has one coupling partner at δ = 5.21 (dd, H-2). This H-2 cross peak in the COSY spectrum leads to H-3 (dd) at a chemical shift of δ = 5.04 as well as H-1.The signal of H-6 (δ = 4.17, t,) is very close to that of H-7 located at the same chemical shift, so the cross peak associated with J (6,7) is very close to the diagonal and difficult to detect. Nevertheless this signal is shown to be coupling with H-5 at δ = 4.07. The coupling constant between H-1 and H-2 (J=7.9 Hz) is relatively large, proving that the H-2 is in an anti-periplanar orientation with respect to the H-1. Thus, H-1 is in the axial position and the peptide substituent is in the equatorial position (β anomer) as expected. The signal at H-4 in the 1H NMR is seen at a chemical shift of δ = 5.40 as a doublet on top of a broad multiplet. The broad multiplet at this chemical shift is due to NHCH. As both signals are relatively close to one another it is hard to know for sure the coupling constant of the H-4 with respect to H-3 and H-5. Therefore it cannot be known for sure whether it is in the axial position. The significant differences between the coupling constants of the protons on the sugar are a strong indication that the molecule contains a six membered ring, rather than a flexible, pseudo-rotating five-membered one. This is confirmed by the fact that vicinal coupling constants with magnitudes of approximately 10 Hz are found; such values only appear for fixed antiperiplanar proton orientations. Since the substance is readily soluble in chloroform, and in view of the existence of the four methyl peaks at δ = 2.16, it is reasonable to assume that the saccharide part of the molecule is peracetylated. Thus it may be concluded that the sugar moiety is present in the glycolipid 6. It is not possible to determine the connectivity of the amino acid groups in the peptide part of this molecule because 1H, 1H coupling across an amide group is too small to be detected by a standard COSY experiment. However the proton peaks were found to be at δ = 6.36 (NHCH2) and 5.40 (NHCH) respectively. The chiral centre Cα of the serine derivative makes the methylene Hβ and Hβ’ diastereotopic, i.e., in the 1H NMR their chemical shifts are principally different, providing more complicated multiplets than originally anticipated. However, a connectivity network can be established starting from the signal at δ = 4.07 (Hβ, m) to a signal at δ = 3.76 (Hβ’, dd) indicating the coupling of these two protons. Hα is found at a chemical shift of δ = 4.27 which coupled to the –OCH2 carbon at δ = 61.24 in the HSQC data. The CH2 groups of the long hydrocarbon chain are present as a singlet at δ = 1.25 and are shown to be coupled to the methyl group of the long chain terminal at δ = 0.90. Overall the 1H NMR results are shown in Table 4.5. The 13C NMR can be divided into two groups: the signals belonging to the sugar moiety and the signals corresponding to the peptide group. The latter have different combinations of neighbour groupings. For the sugar moiety, 3 separate signals are present (δ = 170.01, 169.58, 169.58) for the protecting acetoxy groups. These are not present on the DEPT-135 spectrum. The acetoxy protecting group of the C-2 and C-3 are equivalent due to them being in the equatorial position while the C-4 protecting group is in the axial position. On approximation, the protecting group 152

position

δ (ppm)

multiplicity

J (Hz)

NHCH

5.40

0.9, 3.4

NHCH2 H-4 H-2 H-3 H-1 Hα

H-6 H-7 H-5 Hβ

Hβ’

-NHCH2

-OC=OCH3

-(C=O)OC(CH3)3 -(CH2)12CH3 -CH2CH3

6.36 5.40 5.21 5.04 4.57 4.27 4.17 4.17 4.07 4.07 3.76 3.28 2.16 1.45 1.25 0.90

dd dd dd d

bs t t

m m

dd dd

4xs s s t

n/a

0.9, 3.4

7.9, 10.5 3.4, 10.5 7.9

n/a 1.9 1.9

n/a n/a

7.9, 10.4 5.4, 11.0 n/a n/a n/a 6.5

Table 4.5. 1H NMR Chemical Shift Assignments for glycolipid 6 in CDCl3. of the C-5 carbon would have the lowest chemical shift of these signals due to the presence of the neighbouring CH2 group. The carbons on the skeleton are assigned with the aid of the HSQC spectrum. C-1 as described earlier is present at δ ≈ 100. C-5 (δ = 71.06) has a relatively high chemical shift due to the presence of the neighbouring electronegative O. The C-3, C-2, C-4, C-6 signals are at positions δ = 70.70, 68.70, 66.97, 61.24 respectively. The assignments of the methyl groups of the protecting groups is straightforward due to the HSQC spectrum and are at δ = 20.7620.54. The assignment for the peptide part of the molecule was more complicated due to overlapping of signals. The NHCH2 signal was easily distinguished to appear at δ = 39.69 from HSQC and the negative direction in the DEPT-135 (CH2 group). Due to the close signals in the region of δ = 61 ≈ 70 and low signal to noise ratio, assignation is difficult which left the Cβ unassigned but it is my strong opinion that it overlaps with the C-6 signal as there seems to be two signals at that position and it is in agreement with the HSQC spectrum provided. At δ = 31.92-29.35, 4 signals are present for the CH2 group of the long hydrocarbon and is confirmed by HSQC spectrum. At δ = 29.28 the methyl groups of the Boc protecting group are present. At δ = 28.29, 26.83 two further peaks are present for the long hydrocarbon chain and at δ = 14.11 the methyl terminal group of the lipid is present. All 1H and 13C chemical 153

shifts can be verified by calculations involving increment rules.3 The mass spectrum was analysed with the sugar fragment present at 331. The fragment at C=ONHC14H29 was present with a mass of 240 with a small relative intensity. The IR spectrum is again in agreement verifying various functional groups with OH bands, NH bands and CH stretches.

4.3. General Discussion For the sake of clarity, integration steps are omitted in my elucidation of the structures when discussing 1H NMR. In most cases the number of hydrogens corresponding to a given signal is obvious; if there is any doubt, comments are provided. The melting points of these compounds were not recorded as many of the compounds synthesised were obtained as oils and foams. Exact measurement of the temperature would be a difficult task to achieve, thus analysis of the melting point would be inconclusive and yield no structural information to us. The [α]20D measurements were indeed carried out, but simply verified whether the compounds in question were optically active. 5. Conclusion In conclusion, expedient methods for the synthesis of α-GalCer analogues 2, 6 in β-anomeric selectivity have been devised. These compounds differ significantly in structure from the previously studied and well documented α-GalCer. 2, 8, 9 These glycolipids are potentially useful for immunotherapy and cancer treatment. Glycosyl donors 1, 5 were synthesized in α-anomeric selectivity along with an amide derivative 3. The glycosyl donors 1, 5 could potentially be used in the synthesis of different analogues of α-GalCer in the future. A number of important properties have been suggested (Section 2.2) that would make analogues of α-GalCer superior agents to α-GalCer for a variety of applications in the prevention and treatment of disease. 37, 37, 38 In this project, these considerations were taken into account to synthesise unique compounds with different activities and binding abilities. For future development of the work, biological testing on the compounds 2, 6 in the deprotected form would verify whether these analogues were immunologically active. Synthesis of the α analogues of the compounds 2, 6 would also be of interest to compare the different effects of the anomeric selectivities on the activity and binding ability of the potential drug. Possible improvements in this project would be the purification of products 2, 6 by HPLC, which would remove some impurities not removed during previous column chromatography.

154

References 1 Hung, L.C.; Lin, C.C.; Hung, S.K.; Wu, B.C.; Jan, M.D.; Liou, S.H.; Fu, S.L. Biochem. Pharm. 2007, 73, 1957-1970. 2 Fan, G.T.; Pan,Y.S.; Lu,K.C; Cheng,Y.P.; Lin,W.C.; Lin,S.; Lin,C.H.; Wong,C.H.; Fang, J.M.; Lin, C.C. Tetrahedron 2005, 61, 1855–1862. 3 Plettenburg, O.; Bodmer-Narkevitch, V.; Wong, C.H. J. Org.Chem. 2002, 67, 45594564. 4 Goldsby, R.A.; Kindt, T.J.; Osborne, B.A. Immunology, Freeman, New York, 2000, 287-298. 5 Godfrey, D.I.; Hammond, K.J.; Poulton, L.D.; Smyth, M. J.; Baxter, A.G. Immunol. Today 2000, 21, 573–583. 6 Nieda, M.; Okai, M.; Tazbirkova, A.; Lin, H.; Yamaura, A.; Ide, K.; Abraham, R.; Juji, T.; Macfarlane, D.J.; Nicol, A. J. Blood 2004, 103, 383-389. 7 Kawano, T.; Cui, J.; Koezuka, Y.; Youra, I.; Kaneko, Y.; Motori, K.; Yeno, H.; Nakagawa, R.; Sato, H.; Kondo, E.; Koseki, H.; Taniguchi, M. Science 1997, 278, 1626-1629. 8 Nickel,M.; Brummer, F. J. Biotechnol. 2003, 100, 147-/159. 9 Elewaut, D.; Kronenberg, M. Semin. Immunol. 2000, 12, 561-568. 10 Wu, D.; Fujio, M.; Wong, C.H. Bioorg. Med. Chem. 2008, 16, 1073–1083. 11 Miyamoto, K.; Miyake, S.; Yamamura, T. Nature 2001, 413, 531–534. 12 LaBell, R.Y.; Jacobsen, N.E.; Gervay-Hague, J.; O’Brien, D.F. Bioconjugate Chem. 2002, 13, 143-149. 13 Bhat, S.; Spitalnik, S.L.; Gonzalez-Scarano, F.; Silberberg, D.H. Proc. Natl. Acad. Sci. U.S.A. 1991, 88, 7131-7134. 14 Colombo, D.; Franchini, L.; Toma, L.; Ronchetti, F.; Nakabe, N.; Konoshima, T.; Nishino, H.; Tokuda, H. Eur. J. Med. Chem. 2005, 40, 68-70. 15 Cateni,D.;Bonivento,P.;Procida,G.;Zacchigna,M.;Gabrielli-Favretto,L.;Scialino, G.; Banfi, E. Bioorg. Med. Chem. 2007, 15, 815-826. 16 Xing, G.W.; Wu, D.; Poles, M.A.; Horowitz, A.; Tsuji, M.; Ho, D.D.; Wong, C.H. Bioorg. Med. Chem. 2005, 13, 2907-2916. 17 Fischer, E. Ber. Dtsch. Chem. Ges. 1893, 26, 2400-2412. 18 Koenigs, W.; Knorr, E. Chem. Ber., 1901, 34, 957–981. 19 Kunz, H.; Harreus, A. Liebigs Ann. Chem. 1982, 41–48. 20 Jones, J., II; Amino Acid and Peptide Synthesis; Davies, S.G., Compton, R. G., Evans, J.; Gladden, L.F., Eds, Oxford: New York, 2002, p. 25. 21 Han, S.Y; Kim, Y.A. Tetrahedron 2004, 60, 2447–2467. 22 Dourtoglou, V.; Ziegler, J.C.; Gross, B. Tetrahedron Lett. 1978, 1269–1272. 23 Espín, J.C.; García-Conesa, M.T.; Tomás-Barberán, F.A. Phytochemistry 2007, 68, 2986–3008. 24 Sullivan, B.A.; Kronenberg, M. J. Clin. Invest., 2005, 115, 2328–2329. 25 Juaristi, E.; Cuevas, G. Tetrahedron., 1992, 24, 5019-5087. 26 Shvily, R.; Müller, T.; Apeloig, Y.; Mandelbaum, A. J. Chem. Soc., 1997, 2, 12211234. 155

27 Corzana, F.; Busto, J.F.; Engelsen, S.B.; 0nez-Barbero, J.; Asensio, J.L.; Peregrina, J.M.; Avenoza, A. Chem. Eur. J., 2006, 12, 7864-7871. 28 Nakata,T.;Nomura, S.;Matsukura, H. Tetrahedron. Let., 1996, 37, 213-216. 29 Fukunaga, K.; Yoshida, M.; Nakajima, F.; Uematsu, R.; Hara, M.; Inoue, S.; Kon do, H.; Nishimura, S.I. Bioorg. Med. Chem. Lett., 2003, 13, 813–815. 30 Joshi, B.P.; Park, J.;Kim, J.M.; Lohani,C.H.; Cho, H.; Lee, K.H. Tetrahedron. Let., 2008, 49, 98–101. 31 Lloyd-Williams, D.; Albericio, F. Chemical approaches to the synthesis of pepti des and proteins; Giralt, E., Eds, CRC Press: Boca Raton, 1997, pg 115-127. 32 Gottlieb, H.E.,; Kotlyar, V.; Nudelman,A. J. Org. Chem., 1997, 62, 7512-7515. 33 Carpino, L.A.; Abdel-Maksoud, A.A.; Mansour, E.M.E.; Zewail, M.A. Tetrahedron. Let., 2007, 48, 7404-7407. 34 Nakajima, N.; Saito, M.; Kudo, M.; Ubukata, M. Tetrahedron., 2002, 58, 35793588. 35 Pretsch, E.; Buhlmann, P.;Affolter, C. Tables of Spectral Data for Structural Determination of Organic compounds, Springer, 2003, 200-320. 36 Lin, C.C.; Shimazaki, M.; Heck, M.P.; Aoki, S.; Wang, R.; Kimura, T.; Ritzen, H.; Takayama, S.; Wu, S.-H.; Weitz-Schmidt, G.; Wong, C.H. J. Am. Chem. Soc. 1996, 118, 6826–6840. 37 Cheng, Y.P.; Chen, H.T.; Lin, C.C., Tetrahedron. Lett., 2002, 43, 7721–7723. 38 Demchenko, A. V.; Rousson, E.; Boons, G.J. Tetrahedron. Lett., 1999, 40, 6523– 6526.

156

157

CLASSICS PANEL

•

Judging panel Prof. Brian McGing (Trinity College Dublin) – Chair Judges’ commentary Athena is one of the most fascinating of the Olympian deities. In mythology she was said to have been born from the head of Zeus, who, in the oldest form of the myth, had become pregnant with Athena after swallowing Metis (which means ‘advice’ or ‘cunning intelligence’ in Greek). While this world of the gods has, for the modern reader at least, strange, fairytale elements, in Homer’s great poem of honour and death, the Iliad, it is made more familiar by its familial setting. It is, admittedly, an odd and rather dysfunctional family – Hera, Zeus’ wife, is also his sister; their son, Ares, is detested by his father; Athena is the product of a distinctly odd birth; and Zeus was a serial adulterer – and it was by no means an easy task to create a family out of the motley collection of Olympians that in mythology had many independent (and non-familial) roles. The assigning of gender roles was crucial for Homer’s creation of the Olympian family. Zeus, for example, has to be the ‘father,’ Hera the nagging and jealous wife. It is the relationship between the core members of this family that Melanie analyses in this paper with great skill, and, in particular, how the ambiguous, androgynous Athena fits in. The circumstances of her birth are reflected in her two main roles as both a loving daughter. And there remains something of Metis in her too, most obviously in her friendship with the wily Odysseus in the Odyssey, but also in the intelligent advice she gives Achilles at the beginning of the Iliad. Melanie disentangles these various relationships, and their consequences, with clarity, verve and considerable sophistication of analysis. The paper is well planned, written and referenced; it makes excellent, and critical, use of modern scholarship and ideas on both Homer and gender. To identify and problematize a topic, bring to bear ancient and modern evidence in a sophisticated manner, and produce a rational and ordered set of arguments in support of an independently devised case – these are some of the vital transferrable skills we seek to impart to students in studying the ancient world. This essay is an excellent demonstration of those skills, and Melanie is to be warmly congratulated on a first class piece of work. 158

C L A S SIC S

The Son he never had: Zeus’ parthenogenetic creation of a surrogate son? Melanie Hayes ‘The image of the Olympian family is determined by the image of the father.’1

his statement establishes the premise of this discourse, that Homer in his creation of a patriarchal society on Olympus defined the characterisations of the gods, though more noticeably the goddesses, in terms of their relationships with the patriarch. This treatment will claim that in subverting traditional aspects of the goddesses’ mythological personas, Homer highlights those characteristics that assist his creation of gender paradigms; characterisations reflecting gender concerns of contemporary Greek society. Positing the claim that an examination of the relationships that develop within this divine clan reveals a dichotomous divide, I will harness the exemplum of the divine coterie that emerges to highlight the gender concerns established by patriarchal relationships. One goddess, through her conflict with the patriarch, illustrates male concerns about the destructive power female sexuality; the other, through her very existence, signifies male appropriation of female reproductive functions. This disquisition will examine the validity of the title statement, that in subverting the female contribution, Zeus created an image of himself, a surrogate son in the androgynous Athene, who owed her loyalty to the male alone. As a mythopoetic creation, Homer’s Olympic family is not representative of any established system of Greek mythology.2 Homer goes to great lengths to portray a 1 Kerényi, C., C. Holme (trans) Zeus and Hera: archetypal image of father, husband, and wife (London: Rutledge & Kegan Paul, 1975), 59. 2 Kerényi 1975 : 42.

159

picture of a divine family all inhabiting the Olympic home of ‘father Zeus’. In establishing Zeus as the dominant male, the lord of the gods ruling over a collective community, this form of patriarchal society reflects that of Mycenaean Greece. Homer’s goddesses in turn act as mirrors to their mortal counterparts in their dependence on the dominant male for self definition. These characterisations are developed at the expense of traditional aspects of these goddess’s cult and mythic personas. Hera for example, the earth goddess and protector of marriage as Zeus’s consort is characterised as the archetypal nagging wife who keeps a jealous watch over her husband’s movements. The powerful nymph Thetis, champion of Zeus and Hephaestus is cast as a helpless but devoted mother, supplicating ‘father Zeus’ on behalf of her son. Aphrodite, an ancient fertility goddess born from the seed of Uranos3 becomes the rather ‘pathetic’ daughter of Zeus and Dione, whose relationship is juxtaposed against that of beloved and powerful Athene, the parthenogenetic daughter of Zeus.4 As a result of this androcentric community a subtle sort of theomancy occurs on Olympus, a cold war between the goddesses, each competing for the attention of Zeus, seeking his favour to grant their desires, vying for prominence and respect amongst the gods. This tension results in what Louden refers to as ‘catfights’5 between the goddesses: bitchy retorts are exchanged to undermine the opposition and elevate the goddesses in Zeus’ eyes. Take Athene’s attempt to humiliate her half-sister Aphrodite (5.418-430), calling to Zeus’ attention Aphrodite’s lack of warrior prowess and her crushing defeat at the hands -- but at the bidding of Athene -- of the mortal Diomedes. This scene emphasises the parodic nature of Aphrodite’s role as protector of Paris and Aeneas to Athene’s as mentor to Achilles.6 More importantly it illustrates the divide that emerges between the goddesses: with Hera and Athene as wife and ‘beloved daughter’ occupying the inner sanctum closest to Zeus, jealously guarding their influential positions from the other goddesses. (5.418-420) But Hera and Athene glancing aside at her began to tease the son of Kronus, Zeus, in words of mockery: the goddess grey-eyed Athene began to talk among them

The other side of the coin is represented in book 21. Having been scolded by Hera for her insolence in taking on the ‘august consort of Zeus’ (21.481) Artemis turns tell tale. Her pride and ears sore from the boxing, she flees to Olympus in tears lay3 Blundell, S, Women in ancient Greece (Harvard: Harvard University Press, 1995), 36. Blundell notes that Homer’s most frequent epithet to Aphrodite is the ‘Cyprian’ ; in recalling her place of birth in mythological tradition Homer may be subtly acknowledging the alternative tradition which he has manipulated. 4 While Homers doesn’t explicitly discuss the tradition of Athene’s birth she is referred to repetitively as ‘daughter of Zeus’, suppressing the tradition of her mother Metis’ conception of her. 5 Louden , B. ‘The Gods in epic or the divine economy’ in J.M. Foley (ed.), A companion to ancient epic ( Malden , 2005), 95. 6 Louden 2005: 97.

160

ing her troubles before Zeus, (21.510) implicating his wife as her abuser, who had ‘done this rash thing to her.’ The goddess Thetis inspires the jealousy of both Hera and Athene for her position of influence with Zeus. Noting the secret encounter between Zeus and Thetis (1.536-546) Hera rebukes Zeus for plotting behind her back, feeling as his wife she deserved to be privy to his counsels. Athene confides in Hera her jealous fears that Thetis has usurped her influential position in Zeus heart, (8.370, 8.374) Yet now Zeus hates me, and is bent to the wishes of Thetis… Yet time shall be when he calls me again his dear girl of the grey-eyes.’

So what unites this ‘divine coterie’7 against the others? Homer in a brief but controversial allusion to the ‘Judgement of Paris’ offers for some the uniting element ; their hatred for (24.27-30) Priam and his people, because of the delusion of Paris who insulted the goddesses when they came to him in the courtyard and favoured her who supplied the lust that led to disaster.’ O’Brien posits that it is the injured pride of the two goddesses, their jealousy at Paris’ preference for the allure of Aphrodite that inspires the combined wrath of Hera and Athene against the Trojans. While this theory fits with the Homeric characterisation of Hera as a jealous and vindictive goddess,--one could believe that ‘this petty affront’ as Slater puts it, could be the ‘source of [Hera’s] devastating rage’ -- its does not sit so easily with the portrait of Athene, the obliging asexual goddess. Shearer, rejecting the theory that Athene’s endless scheming and her energetic action on the battle field was because she was ‘miffed’ over Paris’ choice, posits rather that Athene, like the other gods, took part in this tug of war between sides for sheer sport and love of battle.8 What this debate does highlight is the contrasting characterisations of these two goddesses; their alternative methods of reaching their common goal, to win the favour of Zeus to achieve the destruction of Troy. This duo juxtaposes, in their relationship to Zeus, the nagging wife against the dutiful daughter; the vindictive matron and the helpful virgin. Highlighting the importance of sexuality in female characterisations, the sexual power of a female in her re-productory role correlates to negativity and antagonism while ‘benevolence among goddesses is highly correlated to virginity.’9 ‘Virginal and boyish Athene… [is] the most helpful female deity in the Greek pantheon’, Hera, maternal and sexual is the ‘most vindictive and 7 O’Brien, J.V., The transformation of Hera: a study of ritual, hero, and the goddess in the Iliad (Lanham: Rowman & Littlefield Publishers, Inc., 1993),91. 8 Shearer, A., Athene: image and energy (London: Viking Arkana, Penguin, 1996), 9. 9 Slater, P. E., The glory of Hera: Greek Mythology and the Greek family (Princeton: Princeton University Press, 1968), 66.

161

persecutory10. Finley describes Hera as the ‘most complete female… whom the Greeks feared a little and did not like at all.’11 Homer’s portrait of the Olympian family would appear to place Hera in this light. Referred to as a ‘brazen-faced mother’ by her son12 (18.395), ‘reckless of word’13 by her brother-in-law (8.209), she is honoured among the Gods only as Zeus’s consort, as one ‘who lie[s] in the arms of Zeus’ (14.213). Zeus continually fails to grant Hera her due respect as his wife; by his constant infidelities, and in excluding her from his counsel. He exerts his position of dominance (1.565) by threatening to whip her, reminding her of previous punishments at his hands (15.17-20). Zeus is ‘lord of Hera’ (7.411), but while he reverts to displays of brute strength to sub-ordinate her, Hera is characterised as utilizing her inherently devious and deceitful female nature, harnessing her sexuality to assert her will. Through her seduction of Zeus in book 14 (14.153-360), linked to the tale of her delusion of Zeus (19.91-138) by the refrain dolophrosunê (guile[ful]), Hera is cast as the manipulative female. ‘Hera seeks to manipulate, to outwit her spouse with calculating charm, deceit (apatê), and superior intelligence.’14 While this picture of the ‘scheming wife’ does not present a positive image of women it does highlight the strength of Hera’s character, fighting her subordinate position to the patriarch. Blundell describes her ‘strong and vigorous personality15’, Hera herself reminds Zeus of her dynastic claims to power, (18.364-5) As for me then, who claim I am highest of all the goddesses both ways, since I am eldest born and am called your consort. Though Hera’s claims rely on a patriarchal framework of male control, according to Pomeroy ‘the domination of Zeus over Hera … is constantly threatened. Hera, as her husband’s sister, is his equal, and is never totally subjugated.’16 While Zeus does not appear to take Hera’s claims for honour seriously, he ‘rebukes his wife-sister when it serves his purposes (eg. 1.544-50),’17 he does fear her wrath. When being supplicated by Thetis Zeus’ main concern is the reaction of his wife. (1.518-19) ‘This is a disastrous matter when you set me in conflict with Hera, and she troubles me with recriminations.’ 10 Ibid 11 Slater 1968: 66. 12 This portrait highlights Hera’s role as the archetypal ‘bad mother’, thus undermining her maternal contribution and stressing the importance of patrilineal succession. 13 ‘Reckless’ typifies the gender bias of characterising females as inherently uncontrolled and wild, something to be subdued by the dominant male. 14 O’Brien 1993: 179. 15 Blundell 1995: 34. 16 Pomeroy, S.B., Goddesses, Whores, Wives and Slaves: Women in Classical Antiquity (New York: Schocken Books, 1975), 7. 17 O’Brien 1993: 84.

162

While the threat of Hera’s wrath is a cause of anxiety for her spouse (15.18), – note Zeus’ desire that Thetis ‘go away for fear she see us’ (1.523)-- ‘the strongest of all the immortals ’does not concede to the wishes of his wife. For all her ‘forcefulness the pattern of male domination’ on Olympus remains in tact.18 Athene’s close relationship with her father throws the fraught interaction between Zeus and his wife into greater relief. Among the Olympians it is his virginal daughter that Zeus seems to admire and trust most. ‘Athene is warrior, judge, and giver of wisdom, but she is masculinised and denied sexual activity and motherhood.’19 Homer’s characterisation of the goddess Athene encapsulates the attributes of her father, to the detriment of many of her cultic attributes. She is the ‘destroyer of cities, divider of booty, goddess of spoil, marshaller of the host; bellowing she joins the action on the battle-field (20.48). Adopting aggressive male stances, she dons the aegis of her father (5.736). She is not, however, a goddess of uncontrolled violence, as Hera is characterised, rather her disciplined nature identifies her with the controlled male, ruled by the head instead of passions. Athene is known for schemes and strategy, she is Athene polyboulos (5.260), and like her father she is known for sophia (wisdom) and practical intelligence. Homer contrasts the controlled anger (4.20-25) of ‘the clever and supportive Athene, the child of the father20’ with Ares, who in his uncontrolled menos is associated with his mother.21 As an honorary male and obvious favourite is Athene the son Zeus never had? Zeus’ distain for his son Ares is categorically stated ‘to me you are the most hateful of all the gods’ (5.890) but what of strong-minded Apollo? Though he is ‘beloved Phoibos’ (15.221), Apollo ‘the worthiest son of Zeus’ is only once referred to as Zeus’ son (7.37); like Ares he is linked more with his mother Leto.22 Athene is the child, as far as Homer is concerned, of Zeus alone. Athene it would appear owes her position in the Olympian family as a surrogate son to her parthenogenetic birth, Zeus’ creation of a child in the image of her father. Athene is the son he never had… thank goodness. For while Homer suppresses any direct mention of the alternative traditions of Athene’s birth, of her mother Metis, in order to present Zeus as the sole parent, usurping the female reproductive role, this tradition can in many ways account for the bond between father and daughter. It was the act of swallowing Metis that assured Zeus’s triumphal dominance of the Olympian order; ‘he put her in his belly, fearing that she would give birth to something else mightier that the thunder-bolt.’23 Thus the patriarch prevented the prophesied birth of a son to Metis, one destined to over throw him as the su18 Blundell 1995: 34. 19 Pomeroy 1975) :8. 20 Blundell 1995: 34. 21 O’Brien 1993: 85. 22 Kerényi 1975: 55. 23 Doherty, L.E., Siren Songs: gender, audiences, and narrators in the Odyssey (Michigan: The University of Michigan Press, 1995), 1-2. This fragment of text cannot be confidently assigned to a specific work.

163

preme Olympian. ‘Zeus can rule forever because he has prevented the birth of an heir.’24 Athene, the result of a union between Zeus and Metis, born subsequently from Zeus head, as a female is no threat to Zeus hegemony. The circumstances of her birth dictate her ambiguous nature. Athene is the androgynous daughter who owes her ‘allegiance to her father and to the males he favours.’25 This ambiguity seems to be encapsulated in her patriarchaly determined virginity 26; being ‘born to her father’ and desiring to belong to him has produced , according to Kerényi, the virginity of the father’s daughter’27. The feminine aspects of Athene’s character, not overtly emphasised by Homer, reveal themselves in tender moments between father and daughter. She is ‘Tritogenia, dear daughter’ who Zeus has hurt with his disregard for her wishes; but she must ‘take heart’ his ‘meaning toward [her] is kindly meant’ (22.183-185). Zeus addresses Athene with the epithet, ‘bright’ or grey eyes’, his ‘favourite appellation for his favourite daughter’; one that may indicate a level of intimacy.28Athene acknowledges the special relationship and the signalling of intimacy with this epithet, predicting that the enmity between the pair caused by Thetis request will subside and he will ‘again call me his dear girl of the grey eyes’ (8.373).As the favourite child Athene has special privileges, but ‘because her words have a special way of reaching her father’s ear, there’s an especially delicate balance to be kept.’29 Note Zeus’s indignation with Athene (8.406-8), more so than with Hera, for the goddesses attempt at thwarting his plan; he is used to this behaviour from his wife, ‘it is his daughter’s defiance that has hurt and enraged him.’30 In turn accustomed in getting her way with her father Athene sulks when rebuked (8.460), her ‘wicked’ father has ‘crossed [her] high hopes.’ So Athene as both beloved daughter and surrogate son walks an ambiguous line. Blundell purports that Athene ‘transverses and transcends the boundary between masculine and feminine roles’ in many of her activities. Doherty states that ‘Athene is consistently portrayed as male-identified, most notably in her role as patron of warriors.’31 To Blundell, however, this role as ‘koutrophos to young men evokes a feminine quality: the role of helper, depicted in 18.204 when Athene arrays Achilles for battle, in its subordinate status is often associated with the female. The tradition of Athene’s birth which relates that she emerged from Zeus’ head dressed 24 Doherty 1995: 7. 25 ibid. 26 Blundell 1995 :26. 27 Kerényi 1975: 53. 28 Clay, J.S., The wrath of Athene: Gods and men in the Odyssey (Lanham/London: Rowman & Littlefield Publishers, Inc., 1997), 206. A form of this epithet is used by Odysseus at an intimate moment between mortal and goddess in the Odyssey. 29 Shearer 1996): 15. According to Shearer ‘she alone knows where he keeps the key to his thunder-bolt storeroom and has permission to use that mighty arsenal. 30 ibid. 31 Doherty 1995: 174n.39. Clay (1997, 181) notes that Zeus and Athene share the same sphere of influence among mortals, like Zeus Athene supports kings and warriors

164

in battle gear sits comfortably with Homeric Athene, the archetypal warrior goddess. Shearer, however, describes an lesser known aspect of this tale, that when Athene had ‘gained some distance from her father Zeus’s head …she was able to take off her armour’, ‘the fundamental elements returned to their accustomed ways’32, her feminine nature restored. Is Athene then truly ‘just for the male’? Returning to the non-Homeric tradition of Athene’s conception we should consider the fact that Metis remained inside Zeus becoming his attribute, as proclaimed by the epithet Metieta, meaning ‘counsellor’ or deviser33. Metis is cleverness personified, ‘Zeus the deviser’ uses metis to consolidate his rule over the gods. Athene in turn absorbs this attribute, one which seems to associate her with her father, but could also be construed rather as coming from her mother. That Homer was aware of this tradition is proclaimed by Athene herself… ‘I among the gods am renowned for my metis and wiles’ ( Odyssey 13.299).34 Metis as ‘the personification of prudence’35 transfers this attribute to her daughter; a quality Athene reflects in her first act of the Iliad ( 1.197-222.), in her prudent intervention she appeals to Achilles’ reason. A link between mother and daughter remains; Metis is held captive in Zeus’ belly acting as advisor , while Athene who is ‘ostensibly free and powerful’, ‘is likewise an advisor to males’36, and controlled ultimately by the patriarch Zeus. Athene, half of the divine coterie that emerged on andocentric Olympus, is a female whose primary ties are to males. She is the favourite child of Zeus who owes her loyalty to her father. Homer, in suppressing the role of Metis, claims Athene for Zeus alone, demonstrating that it is the father as sole parent and the dominant male who defines her character. The special relationship between father and daughter, a vivid contrast to the conflict between patriarch and his consort, is explained by the circumstances of her birth; one which has ‘secured the stability of Zeus’ political regime, and has at the same time validated patriarchal control within the family.’37 ‘Yes, with all my heart I am my father’s child’ (Eumenides 739); Homer has succeeded in establishing a patriarchally determined characterisation of Athene, which like those the other Olympian goddesses, would define her persona throughout antiquity; portrayals reflective of broader gender concerns. However in the tender relationship between father and daughter; in the obtuse references to Athene’s association not just with the male, but also the female, her mother Metis, Homer portrays Athene as an androgynous ‘tom-boy’ daughter rather than the son he never had; doted on by her father, her virginal status negating her feminine threat to the patriarch’s hegemony. 32 Shearer 1996: 5. 33 ibid 34 Clay 1997: 199. 35 Bell, R.E., Women of classical mythology: a biographical dictionary (New York: Oxford: OUP), 306. 36 Doherty 1995: 8. 37 Blundell 1995 : 28.

165

COMPUTER SCIENCE PANEL

•

JUDGING PANEL Dr. Fred Cummins (University College Dublin) – Chair Dr. John Mc Kenna (Dublin City University) Dr. Mikael Fernstrom (University of Limerick) Dr. Rem Collier (University College Dublin) Judges’ Commentary The paper selected as the winner of the Computer Science category is Beetlz – BON Software Model Consistency Checker for Eclipse by Eva Darulova. This paper describes an integrated approach to the specification and design of Java software artefacts based on a combination of the Business Object Notation (BON) and the Java Modeling Language (JML). The core work carried out is the identification of a mapping between BON and JML that allows BON specifications to be automatically translated into JML, which is then used to generate template Java code. Building on this, the report describes how tool support based on the core work has been developed and integrated in to one of the most popular Java development environments, Eclipse. In summary, the report describes an outstanding piece of computer science work. It is very well written, easy to read, and has good coverage and depth of all the relevant background topics. The core contributions of the work combine both theoretical and practical components that have been leveraged to deliver a high quality finished product that has been made available for use.

166

C om pu t e r s c i e nc e

Beetlz – BON software model consistency checker for Eclipse Eva Darulová

Abstract evelopment of a software project usually involves, to some extent, both modelling and specification languages. Although both are useful in their own right, using them together in an interconnected way brings many benefits to all stages of the development process. Work can proceed on both the model and the implementation concurrently. However, this approach requires tool support that keeps the two versions consistent and updates them when necessary. This report discusses the theoretical and practical considerations of a such a combination between the Business Object Notation and Java, together with the Java Modelling Language. It defines and discusses relations between individual concepts and presents their implementation in the automatic consistency checking Eclipse IDE plugin and tool `Beetlz’. Introduction Why another Eclipse tool? The term Software Engineering covers a broad field in computer science that in general can be described as researching ways to produce high-quality, cost-efficient and reliable software [1]. As software itself varies greatly across applications, so do the techniques that are used to produce it. Software engineering, although the name may imply so, is no exact science and building a faultless software product is, by its very nature, very difficult [2]. Examples of popular approaches to building reliable and manageable software are object-oriented programming (OO) [3] and formal methods 167

[4]. While the first is widely known through programming languages like C++ [5], Java [6, 7] and Eiffel [8], formal methods remain fairly unknown with the every-day programmer. Its main goal is to write a formal specification of a software system, that is a precise and complete description of exactly what the software is supposed to do and that can potentially also be used for verification purposes. To achieve the needed amount of precision a mathematical notation is needed, however, the extent of formalism depends on the program, its purpose and also user preference: a more rigorous example is the Z notation [9] (which can be somewhat off-putting for the mathematical layman), but it is also possible to only partially specify a system or to use an easier, if less powerful, notation. In whatever form though, once applied they can highlight problems at an early stage, reduce testing cost and increase overall quality. Closely tied to OO-programming is an approach called ‘Design by Contract’ (DbC) [10]: here a ‘contract’ is set up between a client (a class) that uses the services of a supplier (a function of another class). This specifies the minimum requirements the client has to obey before it can call a function (the precondition) and the minimum that the supplier guarantees to return (the postcondition). Additionally, each class specifies an invariant, which is basically a set of predicates that have to hold true at any point in time. By this contract, the responsibilities are clearly assigned and each piece of software concentrates on fulfilling its designated role. Another technique currently applied throughout software development is software modeling. It is used to describe the product at an abstract level, which depicts the program in a more understandable way than for example source code, so that all team members can be incorporated in discussions, from the designer, over the project manager to the actual programmer and tester. Examples include the popular modeling language UML (Unified Modeling Language) [11, 12] and the less known Business Object Notation (BON) [13, 14]. Both are object-oriented and thus easily applied together with common implementation languages. The result is that ideally, one has a high-level model to facilitate communication between the team members and a formal specification that ensures correctness of the product. In reality however, since updating the model to depict the ever-changing software requires effort, it is mostly abandoned and the resultant benefits are lost. If one provides tool support that helps in this updating process, the model is more likely maintained for the duration of the software development. This project joins the modeling language BON with the implementation language Java to show how such a combination is realizable. The mappings, or mathematically speaking the relations, are implemented by the ‘Beetlz’ tool, which takes input from BON and Java/JML and provides feedback on where the two artefacts are inconsistent. A brief introduction to BON and JML is given in chapter 2, on which chapter 3 then builds to describe the theoretical relations between BON on one side and Java and JML on the other. The report closes with conclusions and future work. For space reasons, this report is only an abbreviated version of the original. For the full report and the implemented tool please see [15, 16]. 168

i. Background i.i BON – a modelling method BON [14] is a modeling method for the design and analysis of object oriented programs and puts into practice the core of the object-oriented paradigm. BON specifies both a notation and a process for OO systems. Here, only the static textual notation will be investigated but details about other possible descriptions and about the process can be found in the book ”Seamless Object-Oriented Software Architecture” [14]. Only the formal description is considered in this case, since it most closely corresponds to implemented source code. The basic element of the formal description is the class. Since BON is strongly typed, a class also represents a type. Each class consists of a name, a header, generic parameters, an inheritance clause, a set of features (corresponding to Java methods and fields) and an invariant (see the example below). effective class KEEPER indexing about: “A type of personnel that looks after the animals.” inherit PERSONNEL feature name: STRING redefined getID: VALUE feedAnimal: BOOLEAN -> an: ANIMAL ensure delta animalsToLookAfter; an.hungry = false; end feature{PERSONNEL} animalsToLookAfter: SET[ANIMAL] invariant animalsToLookAfter.count < 50; end The name is unique in the system and therefore serves as an unambiguous identifier. Class headers convey more detailed information about the intended use of the class [14]: • deferred: Class not (fully) implemented. • effective: Class is implementing a deferred class or reimplementing an interface. • root: A process can start from here. There must be exactly one root class in each system [17]. 169

• interfaced: All features are visible to all classes. • reused: Class is reused from a library. • persistent: Class instances are potentially persistent. • generic: Class is parametrized. The allowed types can be further con strained. Any class providing some sort of functionality also has a set of features. A feature closely corresponds to a Java method or a Java field, as BON does not have a special concept for attributes. Each feature has a class-unique name, return and parameter types, a renaming clause and a pre- and postcondition. BON categorises features into queries and commands. While the first returns some value, but does not change the state of an ob ject, the latter does not return anything but may change ob ject state. This distinction is important as only queries, which are side-effect free, may be used in assertions. Note that BON does not allow ‘hybrids’ – features which both return a value and change state. Design by Contract is realised in BON by means of assertions. These constitute class invariants and feature’s preconditions and postconditions and are introduced by the keywords invariant, require and ensure respectively. They are also all inherited by child classes and must be obeyed. When redefining features, the covariant rule applies: preconditions may only be weakend, and postconditions strenghtened as prescribed by DbC [10]. In addition, the covariant rule applies to feature signatures as well to ensure correct and sensible use of inheritance relations. Assertions are written in first-order predicate logic which is extended by keywords that are necessary to allow for reasoning about features. Inheritance, marked by the keyword inherit can be simple (one parent class), multiple (several parent classes) or repeated (multiple inheritance from the same class). The first two types are common to most OO languages, while repeated inheritance is less common since it poses some challenges due to possible naming conflicts. BON also provides a way of grouping classes into clusters, which are similar to Java packages. However, since they ultimately can be expanded into class relations only, we will confine ourselves to looking at fully expanded static charts with classes only.

i.ii JML – a specification language Assuming the reader is fairly familiar with Java, we continue directly with its formal specification language JML [18]. It is particularly accessible, even for beginners, since it mostly uses an extended Java syntax and can be included directly in Java source code in the form of annotation comments. An example of such annotations is given below. /** * A type of personnel that looks after the animals. */ 170

public /*@ nullable_by_default @*/ class Keeper implements Personnel { private /*@ spec_protected @*/ Set < Animal > animalsToLookAfter; private /*@ spec_public @*/ String name; //@ invariant animalsToLookAfter.size() < 50; //@ constraint name == \old(name); @Override public /*@ pure @*/ int getID(){ ... }

}

//@ assignable animalsToLookAfter; //@ ensures an.hungry == false; public boolean feedAnimal(Animal an){ ...

//@ assignable \nothing; public List < String > getAnimalNames() { ... } /** * A Mop is an `integral’ part of each Keeper. */ public static class Mop{ } JML describes the interface and the behaviour of Java elements and is thus a behavioural specification language. It defines the interface and the behaviour of a Java module, such as a class or a method, by extending the interface with a specification. The interface is the standard Java declaration (in the case of a method this is the method declaration) and the behaviour is specified by an annotation comment. Each class can be annotated with one or more invariants, history constraints (constraints for short), and initially clauses [19]. Each method or constructor can be annotated with specification cases. Cases are inherited from super types and each case describes the behaviour that must be satisfied by the method or constructor and can be given in light-weight or heavy-weight form. The former only supplies the minimal information needed or wanted, whereas the latter is intended to supply a full specification. For all specifications and assertions it holds that only side-effect free or pure expressions may be used. Individual annotations and predicates are written in standard Java syntax extended by some keywords and operators necessary for proper reasoning. Sometimes the variables and methods declared in a Java 171

public interface do not provide enough detail and flexibility to describe a class’ behaviour. For this case, JML provides the model identifier, which lets the user define additional fields, methods, constructors and even types that can be used as part of the specification, but not part of the Java API [19]. Ghost fields are similar to model fields in that they abstract values for specifications, but they differ in that their values are not given by existent Java fields but by explicit initializations.

ii. Relations Now that the most important concepts have been defined, we turn our attention to a detailed confrontation and try to define relations for the individual elements. It should be kept in mind that Java is a possible refinement of BON. It is not the refinement though, since the two languages were developed independently. Therefore, it is in general the case that the BON model gives the minimum of information whereas the Java implementation will be much more expressive. It follows that information may be added when converting a BON model into Java source code and information may be lost when going in the other direction. This is in general not a deficiency, merely an abstraction, and so all places in the following chapter where an element is said to be ignored should be read with this in mind. Additionally, not all elements are relevant: the implementation will naturally have elements that serve merely as helpers, for instance, private fields or accessor methods. These elements are implementation details and are excluded from comparison. Therefore, defining a relation between BON and Java consists of identifying the relevant elements and relating those individually. Both BON and Java are object-oriented programming languages where the basic unit is the class and functionality is provided by features. Since OO programming is inherently modular, the comparison can be made in such a fashion as well. Thus, a comparison will be structured on a per-class and per-feature basis. This chapter defines the relations between BON, Java and JML, first for Java only elements and then relating BON’s assertion language to JML. Given two projects, the first task is to find which classes correspond to each other. Since class names are unique, they can be used for such an identification. Given the different naming conventions, DANGEROUS_ANIMAL

zoo.animal.DangerousAnimal

can be regarded as equal. All classes in BON are public, therefore Java’s class visibility is regarded as an implementation detail. It should also be noted that private classes are not part of the public API and thus are not included in comparisons.

ii.i BON – Java relations This section examines the interesting parts of relations without assertion elements. 172

ii.i.i Class modifier A BON model only declares simple classes, whereas Java distinguishes between classes, interfaces and enumerated types. The last two can be thought of as ordinary classes with certain restrictions: An interface only contains implicitly public constant fields and public static abstract methods and can thus be viewed as a type of an abstract class. One possibility for relating an interface is to restrict the BON class to be deferred and to have only deferred and public features. However, this mapping breaks down when model fields and methods or ghost fields are introduced. These are not abstract and should also appear as not abstract in the corresponding BON class. Enumerated types contain constants of the their own type and these are implicitly distinct. Hence an equivalent class in BON must define a set (which has distinct elements by definition) of constants of its own type. However, this is still not enough to uniquely identify an enumerated type, as normal methods are allowed in Java enum classes as well. For instance, a naming convention for this set, such as enumeration, can be agreed upon to solve the problem. ii.i.ii Inheritance Since BON does not make a distinction between a class and an interface, inheritance and interfacing is resolved by the same mechanism. Hence, a BON super class may correspond to a super class or an interface in Java. As far as typing is concerned, these are equivalent. Multiple inheritance, which is not allowed as such in Java, is solved in a similar fashion. All super classes of a class must be compared against all interfaces combined with the super class. Issues will arise, if the class inherits from multiple abstract classes. This clearly causes a compile error in Java. As described in subsection 3.1.1, an interface can relate to an entirely abstract class, in which case the conflict is solved. If it is not entirely abstract, there is no easy solution and an inconsistency remains. One way, although restrictive, is to limit the number of inherited abstract classes in BON to one. Since this can lead to changeable and unclear constraints, it may be more desirable to accept these discrepancies as inherent to the differences in the two languages. By providing multiple inheritance and feature renaming, BON also allows repeated inheritance. This may introduce potential naming conflicts and requires a procedure on how to resolve them. In BON, this has to be done manually by renaming features ([17], section 2.1) and hence requires careful thought on the designer’s side. Java, by disallowing multiple inheritance, does not support this type of inheritance directly. However, it can be realised by implementing an interface repeatedly. It is different in that this approach does not introduce any naming clashes [20]. Interfaces only provide a method declaration, so that each implementing class will only have one copy of each repeatedly defined method and no conflict arises. Any repeated inheritance with non-interfaces ultimately violates Java’s syntax so no relation is possible. 173

ii.i.iii Generics Types in both languages are allowed to have generic parameters. The principles used are equivalent ([3], chapter 10): a class may have an arbitrary number of generic parameters, each of which can be restricted. In BON this restriction is limited to one type, whereas in Java one may list an arbitrary number of types, all of which, interfaces included, are listed with the keyword extends. The order of Java constraints is arbitrary, hence it is sufficient for a relation if the one BON constraint is also present in the Java list. As with inheritance, types that are not in the model, and are thus assumed implementation details, should be ignored. The situation can also be solved by combining multiple Java types into one by, for example, declaring one interface that extends all interfaces listed. ii.i.iv Feature names Just as class names have to be matched during a comparison of a BON project and a Java implementation, so do feature names. Unlike for classes, BON does not have explicit naming conventions, although feature names are generally written in lowercase [14]. This is consistent with Java, where the convention also is to have the first letter lowercase. The difficulty arises when overloaded methods are used, a mechanism not allowed in BON. However disallowing overloading outright is likely to cause a lot of unnecessary errors. A middle course solution is to adopt the convention that overloaded features in BON are distinguished by numbering: feed, feed1, feed2 ... , and mapping them to Java methods on the basis of their count and type of formal parameters. Since Java is a refinement of BON, any additional methods in Java are ignored. However, all BON features are part of the relation, so for a tool this means that additional BON features have to be flagged as errors when checking the relation. As part of encapsulation and information hiding, a common procedure in Java is to declare variables private and provide access with getter and setter methods. The BON model describes and specifies the state of an object and will thus work with exactly those private features. Hence, a mechanism for distinguishing mere accessor methods from fields for specification is needed. One possibility is to ignore all methods with prefixes get- , has- , set- and is-. In reality, this proves to be too eager as it hides methods with proper functionality. If however, there exist two variables by the same name, except for one having one of the above prefixes, one can assume that it is an accessor. In that case, the accessor method is ignored and the corresponding field is used for the relation instead. Private variables are commonly used for JML specifications instead of accessor methods by changing their specification visibility with the keywords spec_public and spec_protected. For the purpose of relating two features, this visibility is considered instead of the pure Java modifier. If JML annotations are disallowed, then the visibility modifier of the Java fields must be chosen appropriately to allow them to be used in specifications. 174

ii.i.v Feature signature The feature signature consists in both languages of an optional return type and a number of optional formal parameters. Due to the possibility of overloaded methods the order of Java formal parameters is important. In BON this does not play a role, so a relation on the signature thus checks that the return types and the number of formal parameters match and that all types in the model are present in the implementation, in whichever order. It is assumed, that all input has compiled correctly, so it need not be checked whether the types actually exist and/or are valid. Types are matched primarily based on name, except for types that are being declared in the model itself, which automatically have a mapping from class relations. Furthermore, basic types and some commonly used classes and interfaces from Java’s standard library should be recognised. Since Java 1.5 a covariant redefinition of return types is allowed [7], but BON applies the covariant rule for the whole signature. For parameter types thus a conflict arises that can only be solved if we require that BON uses redefinition for return types only. ii.ii BON – JML relations A BON model can be used with a standard Java implementation, that is without use of JML, by simply ignoring assertions and all model and ghost annotated elements. It will then describe the program structure and relate directly to the Java API, but it will not provide feedback on specifications and thus correctness or reliability. JML is tailored to Java just as the BON assertion language is tailored to BON, so that it is possible to relate the two in a similar fashion as in section 3.1. Before looking into the relations, let us re-examine the way method specifications are written in JML. Heavy-weight specifications provide a full description of a method’s behaviour, but often one does not want to bring out the `big guns’, but merely provide some formalism, in which case light-weight specifications are particularly useful. In context of relations to BON’s assertion language, the latter are particularly interesting, since they follow similar notation syntax. For the sake of simplicity and in light that light-weight specifications can be written as heavyweight ones and vice-versa [21], the following relations always assume light-weight JML annotations. As described in section 2.1, model fields and methods and ghost fields are, for specification purposes, equal to fields and methods declared in Java. Since BON provides a specification only, it is natural to map all model and ghost elements to their BON counterparts, just like any Java declarations. ii.ii.i Nullity Every programmer who has encountered a NullPointerException in Java will acknowledge that it can make a big difference as to whether a reference can be null or not. As suggested by [22], JML now declares all reference types non_null by default. This stands in contrast with BON, where the opposite is the case. One 175

could choose to ignore this fact, however it may have an effect on how other assertions are written. non_null can be expressed in BON with an assertion in the invariant (in the case of queries) or in the pre- and postcondition (in the case of return and parameter types). In the other direction, if one chooses to follow BON’s default, one can easily do so by annotating the Java class by nullable_by_default. However, it is not possible to declare a BON class non_null by default.

ii.ii.ii Queries and Commands Since both BON and JML follow the Design by Contract theory, both allow only side-effect free expressions in assertions. BON ensures the correctness by strictly dividing its features into queries and commands and disallowing hybrids. In Java, no such assumptions are made by default and one has to specifically annotate a method as pure, for it to be allowed in assertions. Note that Java fields are allowed by default as well. Hence they can be thought of as implicitly pure. Therefore, there is a relation between a BON query and a Java pure method or a field. On the other hand, Java allows methods that both modify the state of an object and have a return value, so that a BON command is not entirely equivalent to a non-pure method. In the opposite direction, a Java `hybrid’ method translates into a command that changes state and a query that provides the return value. ii.ii.iii Frame condition Although the frame condition in BON is part of the postcondition and in Java it is a separate clause, they both serve the same purpose and list locations that may be modified during execution. A difference exists in the default values. BON’s delta clause, when missing, translates to modifying nothing for a query and modifying everything for a command. This stands in contrast to Java’s default of assignable \everything. Therefore, a consistency checking tool should not only check explicit frame condition clauses, but also generate an error whereever the default values do not match. Conclusion Consistency checks are commonly being performed during software development as they help to identify potential bugs and errors. Most common examples are compilers and typechechers for specific languages but work has also been done on tools that check the consistency between different software models [23], different representations within the same notation [24] or fully integrated industrial solutions [12]. This report extends this work in that it presents a relation between the model language BON and the concrete implementation language Java. The successful partial implementation shows that an automatic consistency checking tool is indeed feasible and meaningful even if the relation is not always perfect. Surprisingly, mappings between BON and pure Java constructs prove to be more complex and more involved than relations on the assertion languages. It may also seem to the casual reader that those relations have many deficiencies, but in fact the details 176

they are concerned with mostly turn out to be exotic and rather rare special cases. The Beetlz tool has been designed to be tolerant in those instances so that it can be readily used in software development. The basic relations between BON and Java have been implemented in the application named `Beetlz’ [16]. It provides automatic tool support for consistency checking between a BON model and a Java implementation and is available in a command-line version as well as an Eclipse plugin for all major platforms, see a screenshot in Figure 1. Potential future work on the tool itself includes support for additional JML elements, like multiple specification cases, heavy-weight specifications or further operators as well as some extensions to BON that would close some of the current gaps with respect to Java and JML. On the theoretical side, formalising the relations between BON and Java, which at present only exist in structured English, would make a very interesting but also quite involved future project. This project outlines how it is possible and advantageous to use a model of the software together with its implementation in a seamless manner. With added tool support, as the Beetlz tool demonstrates, updating of the model and/or the implementation is taken care of mostly automatically and thus can serve two purposes: • Encourage the use of software models in software engineering. • Reduce faults and misunderstandings resulting from poor communication with customers and/or team members.

Fig. 1.

177

References 1. I. Sommerville, Software Engineering. Pearson Education, 8 ed., 2007. 2. F. P. Brooks, “No Silver Bullet: Essence and Accidents of Software Engineering,” Computer, vol. 20, pp. 10–19, April 1987. 3. B. Meyer, Object-Oriented Software Construction. Prentice Hall PTR, 2nd ed., March 2000. 4. J. F. Monin and M. G. Hinchey, Understanding formal methods. Springer, 2003. 5. B. Stroustrup, The C++ Programming Language. Addison-Wesley Longman, 2000. 6. C. Horstmann, Java Concepts, 5th edition. Wiley, 2007. 7. J. Gosling, B. Joy, G. Steele, and G. Bracha, Java(TM) Language Specification, The (3rd Edition). Addison-Wesley Professional, July 2005. 8. B. Meyer, Eiffel, The Language. Prentice Hall, 1991. 9. J. Spivey, The Z Notation: a reference manual, 2001. 10. B. Meyer, “Applying design by contract,” IEEE Computer, vol. 25, pp. 40–51, 1 992. 11. M. Fowler, UML distilled: A Brief Guide to the Standard Object Modeling Language. Addison-Wesley, 3 ed., 2004. 12. Rhapsody: UML Model-Driven Development, Lynuxworks™, http://www.lynux works.com/partners/show_product.php?ID=248. 13. R. F. Paige and J. S. Ostroff, “A Comparison of the Business Object Notation and the Unified Modeling Language,” Tech. Rep. 03, York University, 1999. 14. K. Walden and J.-M. Nerson, Seamless Object-Oriented Software Architecture. Prentice Hall, 1995. 15. Beetlz, full report: http://kind.ucd.ie/documents/proposals/reports/ darulova09.pdf. 16. E. Darulova, F. Fairmichael, and J. Kiniry, Beetlz homepage, http://secure.ucd.ie/ products/opensource/beetlz/. 17. R. F. Paige and J. S. Ostroff, “Precise and Formal Metamodeling with the Business Object Notation and PVS,” Tech. Rep. 03, York University, 2000. 18. G. T. Leavens, A. L. Baker, and C. Ruby, “Preliminary design of JML: a behavioral interface specification language for java,” SIGSOFT Softw. Eng. Notes, vol. 31, pp. 1– 38, May 2006. 19. G. T. Leavens, E. Poll, C. Clifton, Y. Cheon, C. Ruby, D. Cok, P. Müller, J. Kiniry, P. Chalin, and D. M. Zimmerman, JML Reference Manual DRAFT, Revision: 1.231, 2008. 20. T. A. Gardner, Inheritance relationships for disciplined software construction. Springer, 2001. 21. A. D. Raghavan and G. T. Leavens, “Desugaring JML Method Specifications,” Tech. Rep. 00-03e, Computer Science Iowa State University, 2005. 22. P. Chalin and F. Rioux, “Non-null references by default in the Java modeling language,” in SAVCBS ’05: Proceedings of the 2005 conference on Specification 178

and verification of component-based systems, (New York, NY, USA), p. 9, ACM, 2005. 23. R. F. Paige, P. J. Brooke, and J. S. Ostroff, “Metamodel-based model conformance and multiview consistency checking,” ACM Trans. Softw. Eng. Methodol., vol. 16, no. 3, 2007. 24. B. Litvak, B. Litvak, S. Tyszberowicz, S. Tyszberowicz, A. Yehudai, and A. Yehudai, “Behavioral consistency validation of UML diagrams,” in Software Engineering and Formal Methods, 2003.Proceedings. First International Conference on, pp. 118–125, 2003.

179

DENTAL SCIENCES PANEL

•

Judging Panel Prof. Donald Burden (Queen’s University Belfast) – Chair Prof. Finbarr Allen (University College Cork) Prof. Helen Whelton (University College Cork) Prof. Brian O’Connell (Trinity College Dublin) Judges’ commentary Enlargement of the gums (gingival hyperplasia or gingival overgrowth) is a common side effect of the immunosuppressant drugs organ transplant patients are required to take to prevent transplant rejection. This is a significant clinical problem which has both aesthetic (psychosocial) and dental health implications for organ transplant patients. Gingival overgrowth may extend to interfere with mastication, occlusion and speech. Marked inflammatory changes can lead to the onset of gum disease (periodontal disease) and the potential loss of teeth. The Dental Sciences panel concluded that this paper represented an excellent evaluation of our current understanding of this complex area. The applicant conducted a comprehensive review of the relevant literature and followed this with a detailed and scholarly interpretation of how our understanding of this area has evolved with the advent of new studies. The paper provides an up-to-date analysis of the scientific studies which underpin our knowledge of the pathogenesis, risk factors and management of drug induced gingival overgrowth. The Dental Sciences panel agreed that the quality of this paper is such that it would merit consideration for publication in an appropriate peer reviewed professional journal.

180

De n ta l S c i e nc e s

The aetiology & management of gingival hyperplasia in organ transplant patients Emer Walshe

Introduction edication induced gingival enlargement is the most widespread side-effect of systemic medication on the periodontal tissues.1 Drugs associated with gingival overgrowth (GO) are broadly categorised according to their therapeutic actions, namely anticonvulsants, immunosuppressants and calcium channel blockers.2 Post-organ transplantation patients are medicated with immunosuppressants, most commonly with cyclosporin-A, (CsA), due to its selective action on the immune system. They may also be medicated with a calcium antagonist to attenuate CsA-induced nephrotoxicity.3 In 1983, Rateitschak-Pluss first reported cases of CsA-induced GO in humans,4 which was followed by reports of enlargement due to dihydropyridines in 1984.5 Gingival overgrowth associated with CsA is clinically indistinguishable from that elicited by the antiepileptic drug, phenytoin.6 The GO usually begins as a papillary enlargement and is more pronounced in the anterior segments and labial surfaces of the teeth.7,8,9 Gingival overgrowth is usually confined to the attached gingiva but may extend coronally and interfere with mastication, occlusion and speech.2,10 There are marked inflammatory changes demonstratable by bleeding upon probing.10 The onset of gingival overgrowth occurs within one to three months after initiation of CsA therapy.8,11 181

Definition of Terms Many terms have been used in the literature to describe clinically apparent enlargement of the papillary and marginal gingivae. It has been suggested that GO is a more general term that better describes the lack of understanding of the pathogenesis of the condition.12 Gingival hyperplasia is “an abnormal increase in the number of normal cells in a normal arrangement in an organ or tissue, which increases in volume.”13 According to Seymour and Jacobs,10 “the disagreement with regard to fibroblast numbers indicates that cyclosporin-induced gingival enlargement may not be a true hyperplasia” and suggests that gingival overgrowth is more appropriate terminology. Literature Review Cyclosporin A is a successful immunosuppressant drug, derived from the fungal species, Trichoderma polysporum and Cylindrocarpon, widely used in the prevention of organ transplant rejection.6 The drug has become the immunosuppressant of choice since 1978.14 Cyclosporin-A preferentially suppresses cell-mediated immune reactions.15 The drug binds to cyclophilin, a cytoplasmic protein that is important in T-cell responses to cytokines.16,17 This complex inhibits calcineurin, resulting in a decrease in interleukin-2, which is the stimulus for increasing the number of T-lymphocytes.17 It has been suggested that the intracellular concentrations of these proteins may be related to the sensitivity of T-lymphocytes.18 The prevalence of significant gingival changes in dentate patients medicated with CsA alone is approximately 25% to 30%.6,19,20,21 Calcium Channel Blockers Organ transplant patients may be additionally medicated with calcium channel blockers (CCBs) to attenuate CsA-induced nephrotoxicity3 and for their hypertensive action.22,23 Calcium channel blockers may be classified chemically as dihydropyridines, (nifedipine, isradipine, amlodipine,) phenylalkylamine derivatives (verapamil) and benzothiazepine derivatives (diltiazem).12 Calcium channel blockers can independently induce GO, although with a lower prevalence than CsA.24,25,26 Nifedipine is the most widely used CCB and has been implicated as a cause of GO.5,24,27,28,29,30,31,32,33 The severity of nifedipine-induced GO is associated with poor oral hygiene, pre-existing gingival inflammation and combination drug therapy.32 Gingival overgrowth has been reported in 15% to 83% of patients medicated with nifedipine.24,29,30,34 Gingival overgrowth may be associated with higher doses of nifedipine,29 although several studies failed to show any relationship between dose or plasma levels of nifedipine and GO.24,35,36,37,38,39 Risk Factors for DIGO Age and Demographic Variables Age has been shown to be an important risk factor for CsA-induced GO, with 182

adolescents being more susceptible to GO. 40,41 Age is not applicable for CCBs as the drugs are mainly used in middle-aged patients. It is suggested that fibroblast sensitivity to the drug may be influenced by a hormonal component.1 Increased circulating androgens and androgen metabolism in adolescents was found to be a major factor in causing CsA-and nifedipine-induced GO.42 This may stimulate a selected sub-population of fibroblasts to increase collagen synthesis, or decrease collagenase activity.42

Gender Studies relating to CsA and nifedipine suggest males are at greater risk than females for GO and the severity of changes is greater in males than females.22,39,43 Drug Variables There still remains controversy regarding the relationship between drug variables and the expression of drug-induced gingival overgrowth (DIGO). There is agreement that a baseline or threshold concentration of the drug is required to induce gingival changes although this may vary between individuals.40,44 Some studies have shown that GO is related to high doses of CsA,45,46,47while others show that drug dosage is a poor predictor of the gingival changes.22,24,36,40,48,49 A positive correlation has been reported between CsA blood concentration and the prevalence of GO.41,50 Correlations were also found between drug plasma concentration and the severity of GO,11,50 although studies failed to show a correlation between serum trough concentrations of CsA and the severity of GO.23,40 A positive correlation has been found between the salivary concentration of CsA and the extent of GO.20,40,41 Nimmi et al51 reported that dental plaque might act as a reservoir for CsA, which is released by stimulated salivary flow. Whole salivary concentrations of CsA are higher in patients taking the liquid form of the drug compared to the capsule form.52 Studies have revealed that patients exhibiting significant gingival changes had sequestration of both nifedipine and amlodipine.35,53 Thomason et al54 found that despite high levels of nifedipine sequestered in the gingival crevicular fliud (GCF), only the plasma concentration of nifedipine was identified as a risk factor for the severity of gingival changes. Duration of Therapy Although several studies have found no correlation between GO and the duration of therapy,21,23,55 Thomason et al54 found a positive correlation between therapy duration and severity of GO. Concomitant Medication It has been suggested that combined therapy may increase the prevalence but not the severity of GO.56 Combination therapies of nifedipine and CsA can produce more GO than if either drug was used independently.22,36,39,57,58 183

Periodontal Variables Plaque High plaque scores and gingival inflammation exacerbate the expression of DIGO.44 A positive correlation was found between GO scores and plaque scores,20,36,37,40 although others suggest gingival changes were unrelated to plaque scores.11,24,49 Most of the evidence that correlates the presence of bacterial plaque and GO is derived from cross-sectional studies, which is a significant limitation. It remains unclear whether plaque is a contributory factor or a consequence of the gingival changes,9,44 although the most recent classification system for periodontal diseases acknowledges plaque as a cofactor in the aetiology of drug-associated gingival enlargement.59 Oral Hygiene Oral hygiene has been identified as a risk factor for development and expression of GO.21,22,23,39,43,50 Longitudinal studies have supported the suggestion that the severity of DIGO increases in the presence of poor plaque control and gingival inflammation.8,20,60,61 Plaque control and removal of gingival irritants is beneficial for gingival health but does not inhibit the development of CsA-induced GO.49 Stone et al62 found that improved oral hygiene alone would not prevent GO but may reduce the severity of CsA-induced GO. Gingival Inflammation A positive correlation was found between GO and gingival inflammation.36 There remains a lack of agreement whether or not gingival inflammation is a determinant of CsA-induced GO. Varga et al63 revealed that patients with hyperplastic gingivitis prior to transplant surgery were highly likely to develop severe gingival changes post surgery. These findings may indicate susceptibility of the gingival tissues or fibroblasts to both plaque-induced inflammatory changes and CsA.44 Pathogenesis of DIGO The pathogenesis of DIGO is uncertain. It is likely to be associated with direct and indirect effects of CsA on fibroblasts and the extracellular components of the lamina propria, as well as targeted activation of growth factors.12 Disturbances in collagen metabolism of gingival tissue rather than an increase in the number of fibroblasts has been considered to be a possible mechanism in the pathogenesis of DIGO.64 Brown et al65 proposed that there is an interaction between the drug and gingival inflammation secondary to bacterial irritation and secondly, that the drug alters the cascade of biochemical events, resulting in increased gingival connective tissue production. Genetic factors are important in GO expression as they determine the heterogeneity of the gingival fibroblast. Functional heterogeneity exists among phenotypically stable fibroblasts in response to various stimuli.66 CsA and its major metab184

olite M-1767 could react with a phenotypically distinct subpopulation of gingival fibroblasts, stimulating deoxyribonucleic acid (DNA) synthesis and proliferation of gingival fibroblasts.67,68,69 This is maintained in the presence of lipopolysaccharide (LPS), which normally inhibits these cells, suggesting a role for plaque in the pathogenesis of GO.70,71 The increase in cell number coupled with a reduction in the breakdown of gingival connective tissue6 has been speculated to cause excessive extracellular matrix accumulation in CsA associated GO.72 Barclay et al24 suggested that CsA and CCBs reduce cytosolic free calcium in recruited T-lymphocytes and gingival fibroblasts. This impairs T-cell proliferation and collagenase synthesis.24 Studies of human lymphocyte antigen (HLA) have found that patients expressing HLA-DR173 and HLA-B379 have a protective role against CsA-induced GO, while patients expressing HLA-DR2 had an increased risk of developing GO.73

Connective Tissue Homeostasis Gingival fibroblasts control collagen production by synthesis and release of metalloproteinases and tissue inhibitor of metalloproteinases.74 An impairment of collagenase synthesis will result in poor collagenolysis, which may contribute towards GO.36 In vitro studies have shown that CsA causes a significant increase in collagen synthesis.75 Inflammatory Cytokines and Growth Factors Studies show that human gingival fibroblasts treated with drugs associated with GO increase production of fibroblast cytokines and prostaglandin E2 (PGE2).76,77 CsA does not induce PGE2 formation in gingival fibroblasts, but potentiates the response to tumor necrosis factor (TNF) alpha.77 Increased gingival levels of platelet-derived growth factor (PDGF) may be responsible for fibroblast proliferation and production of extracellular matrix constituents in GO.74 Hassell and Hefti6 proposed a scenario of cytokine-mediated regulation of fibroblast growth and protein synthesis. CsA inhibits production of interferon (INF)-g, leading to an imbalance of homeostasis in favour of enhanced proliferation and collagen production. Cytokine dependent alterations in extracellular matrix metabolism appear important to GO and could result in abnormal differentiation of cells, resulting in accumulation of fibroblasts with a range of proliferative phenotypes.78 Management of DIGO Dental management should be initiated pre-transplantation in conjunction with the patient’s medical team. A thorough clinical and radiographic examination should be carried out during early medical planning.79 Assessment of the oral hard and soft tissues, diet analysis and professional cleaning of teeth should follow transplant surgery.79 Treatment of DIGO is achieved by rigorous oral hygiene, debridement and surgical excision in cases where aesthetics, function or speech is compromised.80 185

Substitution/Withdrawal Drug withdrawal or substitution is an obvious solution in the management of DIGO. New-generation immunosuppressants (tacrolimus and mycophenolate mofetil) are alternative medications to the traditionally used CsA.2,81 Tacrolimus (FK506) has been shown to have potential as an alternative to CsA.82,83 Some authors reported that the drug is not associated with GO,81,82 while others suggested that the prevalence and severity of GO is less with tacrolimus compared with CsA.84,85 A reduction of GO has been reported following a change in therapeutics from CsA to tacrolimus,86,87,88 and changing to a same class CCB.89 Azithromycin, an antimicrobial agent has been shown to improve CsA-induced GO 90,91,92 and does not modify CsA levels.92 It has been suggested that the drug blocks CsA-induced cell proliferation and collagen synthesis.64 A review of clinical trials on systemic use of azithromycin suggests complete regression or amelioration of CsA-induced GO is possible.93 If a transplant patient is medically stable and the side effects of CsA are controlled, the medical team may be reluctant to alter the therapeutic regimen.94 Non-Surgical Management Selection of a treatment modality depends on the severity of the DIGO. Elimination of local factors, plaque control and regular periodontal maintenance therapy may ameliorate but not prevent DIGO in a susceptible patient.95 Plaque control should always be a first-line measure in treatment.79,96 There is evidence that good oral hygiene and plaque removal decreases the degree of GO and improves periodontal health.10,97 The use of chlorhexidine digluconate mouthwash (0.1% w/v) has reportedly reduced the incidence of DIGO recurrence following gingival surgery.98 Surgical Management Surgical treatment is only advocated where GO is severe.99 Gingival overgrowth may be assessed using the method described by Seymour et al. (1985).100 The index measures the degree of GO in a labio-lingual and apico-coronal direction. Surgical interventions have been suggested with GO index scores in excess of 30%.101 If drug therapy is likely to be continued for life, psychosocial considerations must be given in an effort to reduce the frequency and extent of surgical intervention.2 Factors to be considered when deciding on appropriate treatment include the extent of the surgical area, the presence of periodontitis, the presence of osseous defects combined with gingival enlargement lesions and the position of the bases of the pocket in relation to the existing mucogingival junction.96 The classic external bevel gingivectomy is a viable treatment option in small areas, (up to six teeth), with no evidence of attachment loss.96 The periodontal flap is indicated in situations with larger areas of GO, or areas where attachment loss combined with osseous defects are present.96 It was found that no difference exists between flap surgery and conventional gingivectomy with respect to recurrence of GO.102 Provided clinical guidelines based on research are adhered to, evidence 186

supports the biological compatibility of electrosurgery to excise papillary enlargement.103 The carbon dioxide (CO2) laser has been advocated in surgical management of DIGO due to decreased surgical time and rapid postoperative haemostasis.2 A comparison split-mouth crossover study conducted by Mavrogiannis et al (2006) revealed less recurrence of DIGO within a 6-month period with laser excision than conventional gingivectomy.102 The use of CO2 lasers in combination with conventional gingivectomy has been advocated for dual DIGO.104

Treatment Outcomes and Recurrence Rate Reduction in pocket depth achieved by flap surgery may be sustained for longer periods than by gingivectomy technique.105 The combination of CsA and dihydropyridine medication as well as gingival inflammation were found to be significant risk factors for an increase or recurrence of GO following periodontal treatment.56 Discussion and Conclusion The concominant use of calcium channel blockers with CsA has been demonstrated to increase the prevalence and severity of CsA-induced GO 39,84 although these drugs can independently induce GO.24,25,26 The clinical presentation of DIGO is the likely result of a complex interaction between growth factors and cytokines.14 It has been demonstrated that the pathogenesis of DIGO has a multifactorial aetiology.106 Studies suggest that the incidence and severity of DIGO in patients treated with CsA depends on plaque control, the level of gingival inflammation and extent of periodontal destruction, the dosage and duration of therapy, plasma and tissue concentrations of the drug, as well as age of the patient and perhaps the underlying medical condition.10 Drug variables, plaque-induced inflammatory changes in the gingivae and genetic factors appear to be most significant in the expression of GO. Multidisciplinary treatment plays a pivotal role in the overall management of organ transplant patients. The provision of a preventive periodontal programme before initiation of drug therapies implicated in DIGO has been recommended.79,107 This seeks to achieve effective control of local inflammatory factors (plaque and calculus) and may minimise the severity of gingival changes. The role of oral hygiene as a risk factor for expression of GO has been identified.21,22,23,39,43,50 Dental care guidelines recommend frequent patient recall and prophylaxis, as well as daily antibacterial mouthrinses.107 Meticulous oral hygiene,61 chlorhexidine digluconate mouthrinse98 and professional cleaning24 can be significant in reducing the rate and degree of GO recurrence.95 Withdrawal or substitution of the offending medication has proven successful.86,87,88 Tacrolimus is a new-generation immuno-suppressant, which is not associated with GO.81,82 Although tacrolimus has potential as an alternative immunosuppressant, many of the studies81,82,85 lack long-term follow-up results and have relatively small sample sizes. Azithromycin is a safe, cost-effective and long-lasting treatment for GO, without needing any change in the dose and monitoring of CsA 187

and avoiding the need for repeated surgical procedures.92 Surgical intervention may be considered after non-surgical measures fail to reduce the GO to an aesthetically acceptable appearance. Although gingivectomy still remains a viable treatment option, the resulting wound may be painful and require considerable post-operative precautions to prevent infection,2 which may lead operators to consider alternatives including a total or partial internal bevel gingivectomy.2 It is projected that the use of medications with the potential to cause GO will increase in the future.2,44 Early assessment of patients and initiation of preventive programmes will be important in the life-long management of organ transplant patients.

188

References

Seymour, R. A. (2006). Effects of medications on the periodontal tissues in health and disease. Periodontology 2000. 40: 120-129. 2. Marshall, R. I., Bartold, P. M. (1999). A clinical review of drug-induced gingival overgrowths. Australian Dental Journal. 44: (4) : 219-232. 3. Feehally, J., Walls, J., Mistry, N., Horsburgh, T., Taylor, J., Vietch, P.S. & Bell, P. R. F. (1987). Does nifedipine ameliorate cyclosporine A nephrotoxicity? British Medical Journal. 295: 310. 4. Rateitschak-Pluss, E. M., Hefti, A., Lortscher, R. & Thiel, G. (1983). Initial observation that cyclosporine-A induces gingival enlargement in man. J Clin Periodontol. 10: 237-246. 5. Lederman, D., Lumerman, H., Reuben, S., Freedman, P. (1984). Gingival hyperplasia associated with nifedipine therapy. Oral Surg Oral Med Oral Pathol. 57: 620-622. 6. Hassell, T. M., Hefti, A.F. (1991). Drug Induced Gingival Overgrowth: Old Problem, New Problem. Crit Rev Oral Biol Med. 2: 103-137. 7. Daley, T. D., Wysocki, G. P., Day, C. (1984). Cyclosporin therapy. Its significance to the periodontist. J Periodontol. 55: 708-712. 8. Tyldesley, W. R. & Rotter, E. (1984). Gingival hyperplasia induced by cyclosporin-A. Br Dent J. 157: 305-309. 9. Thomason, J. M., Kelly, P. J., Seymour, R. A. (1996). The distribution of gingival overgrowth in organ transplant patients. J Clin Periodontol. 23: 367-371. 10. Seymour, R. A. & Jacobs, D. J. (1992). Cyclosporine and the gingival tissues. J Clin. Periodontol. 19: 1-11. 11. Seymour, R. A., Smith, D. G. & Rogers, S. R. (1987). The comparative effect of azathioprine and cyclosporin on some gingival health parameters of renal transplant patients. J Clin. Periodontol. 14: 610-613. 12. Marshall, R. I., Bartold, P. M. (1998). Medication induced gingival overgrowth. Oral Diseases. 4: 130-151. 13. McCullough K ed. (1982). Dorland’s Pocket Medical Dictionary. W.B. Saunders Company: Sydney. 14. Calne, R. Y., Thiru, S., McMaster, P., Craddock, G. N., White, D. J. G., Evans, D. B., Dunn, D. C., Pentlow, B. D. & Rolles, K. (1978). Cyclosporin-A in patients receiving renal allografts from cadaver donors. Lancet. 1: 1323-1327. 15. Boltchi, F. E., Rees, T. D. & Iacopino, A. M. (1999). Cyclosporine A-induced gingival overgrowth: a comprehensive review. Quintessence International. 30: 775-783. 16. Trevor,A.J.,Katzung,B.G.,Masters,S.B.(2005).Katzung&Trevor’sPharmacology: Examination & Board Review. Lange. 7th Ed. 474-483. 17. Howland, R. D., & Mycek, M. J. (2006) Immunosuppressive Drugs. Lippincott’s Illusrated Reviews: Pharmacology. Lippincott, Williams & Wilkins. 3rd Ed. 485494. 18. Hess, A., Colombani, P. (1987). Mechanism of action of cyclosporine: a unifying 189

hypothesis. Adv Exp Med Biol. 213: 309-330. 19. Wysocki, G. P., Gretzinger, H. A., Laupacis A., Ulan, R.A. & Stiller, C.R. (1983). Fibrous hyperplasia of the gingival: a side effect of cyclosporine A therapy. Oral Surgery Oral Medecine Oral Pathology. 55: 274-278. 20. McGaw, T., Lam, S. & Coates, J. (1987). Cyclosporine-induced gingival over growth: correlation with dental plaque scores, gingivitis scores, and cyclosporine levels in serum and saliva. Oral Surgery Oral Medecine Oral Pathology 64: 293297. 21. Pernu, H.E., Pernu, L. M. H., Huttunen, K. R. H., Nieminen, P. A. & Knuuttila, M. L. E. (1992). Gingival overgrowth among renal transplant recipients related to imunosuppresive medication and possible local background factors. J Periodontol. 63: 548-553. 22. Thomason, J. M., Seymour, R. A., Ellis J. S., Kelly, P. J., Parry, G., Dark, J., Wilkinson, R., Ilde, J.R. (1996). Determinants of gingival overgrowth severity in organ transplant patients. An examination of the role of HLA phenotype. J Clin Periodontol. 23: 628-634. 23. King, G. N., Fulinfaw, R., Higgins, T. J, Walker, R. G., Francis, D. M. A. & Wiesenfeld, D.(1993).Gingivalhyperplasiainrenalallograftrecipientsreceivingcyclosporin-A and calcium antagonists. J Clin Periodontol. 20: 286-293. 24. Barclay S., Thomason J. M., Idle J. R., Seymour, R. A. (1992). The incidence and severity of nifedipine-induced gingival overgrowth. J Clin Periodontol. 19: 440441. 25. Miller, C. S. & Damm, D. D. (1992) Incidence of verapamil-induced gingival hyperplasia in a dental population. J Periodontol. 63:453-456. 26. Jorgensen, M. G. (1997). Prevalence of Amlodipine-Related Gingival Hyperplasia. J Periodontal. 68: 676-678. 27. Van der Wall E. E., Tuinzing, D. B., Hes, J. (1985). Gingival hyperplasia induced by nifedipine,an arterial vasodilating drug. Oral Surg Oral Med Oral Pathol. 60: 38-40. 28. Lucas, R. M., Howell, L. P., Wall, B. A. (1985). Nifedipine-induced gingival hyperplasia: a histochemical and ultrastructural study. J Periodontol. 56: 211215. 29. Barak S, Engelberg IS, Hiss Z. (1987). Gingival hyperplasia caused by nifedipine: histopathological findings. J Periodontol. 58: 639-642. 30. Slavin, J., & Taylor, J. (1987). Cyclosporin, nifedipine, and gingival hyperplasia [Letter] Lancet. 2: 739. 31. Hancock,R.H.,Swan,R.H.(1992).Nifedipine-inducedgingivalovergrowth:report of a case treated by controlling plaque. J Clin Periodontol. 19: 12-14. 32. James, J.A., Linden, G.J. (1992). Nifedpine-induced gingival hyperplasia. Dental Update. 19: 440-441. 33. Harel-Raviv, M., Eckler, M., Lalani, K., Raviv, E., Gornitsky, M. (1995). Nifedipine-induced gingival hyperplasia. A comprehensive review and analysis. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 79; 715-722. 190

34. Fattore, L., Stablein, M., Bredfelt, G., Semla, T., Moran, M., Doherty-Greenburg, J. (1991). Gingival hyperplasia: A side effect of nifedipine and diltiazem. Spec Care Dent 11: 107-109. 35. Ellis, J. S., Seymour, R. A., Monkman, S. C., Idle, J. R. (1993). Disposition of nifedipine in plasma and gingival crevicular fluid in relation to drug-induced gingival overgrowth. J Periodontal Res. 28: 373-378. 36. Thomason, J. M., Seymour, R. A. & Rice, N. (1993). The prevalence and severity of cyclosporine and nifedipine-induced gingival overgrowth. J Clin Periodontol. 20: 37-40. 37. Bullon, P., Machuca, G., Martinez-Sahuquillo, A., Rios, J. V., Rojas, J. Lacalle, J.R. (1994). Clinical assessment of gingival hyperplasia in patients treated with nifedipine. J Clin Periodontol. 21: 256-259. 38. Nery, E. B., Edson, R. G., Lee, K. K., Pruthi, V. K. & Watson, J. (1995). Prevalence of nifedipine-induced gingival hyperplasia. J Periodontol. 66: 572-578. 39. Thomason, J. M., Seymour, R. A., Ellis, J. S., Kelly, P. J., Parry, G., Dark, J., Idle, J. R. (1995). Iatrogenic gingival overgrowth in cardiac transplantation. J Periodontol. 66: 742-746. 40. Daley, T. D., Wysocki, G. P., Day, C. (1986). Clinical and Pharmacologic correlations in cyclosporine-induced gingival hyperplasia. Oral Surg. Oral Med. Oral Pathol. 62: 417-421. 41. Hefti, A. F., Eshenaur, A. E., Hassell, T. M., Stone, C. (1994). Gingival overgrowth in cyclosporine A treated multiple sclerosis patients. J Periodontol. 65: 744-749. 42. Sooriyamoorthy, M., Gower, D. B., Eley, B. M. (1990). Androgen metabolism in gingival hyperplasia induced by nifedipine and cyclosporin. J Periodont Res. 25: 25-30. 43. Ellis, J. S., Seymour, R. A., Steele, J. G., Robertson, P., Butler, T. J., Thomason, J. M. (1999). Prevalence of gingival overgrowth induced by calcium channel blockers: a community based study. J Periodontol. 70: 63-67. 44. Seymour, R. A., Ellis, J. S., Thomaon, J. M. (2000). Risk factors for drug-induced gingival overgrowth. J Clin Periodontol. 27: 217-223. 45. Adams, D., Davies, G. Gingiva hyperplasia associated with cyclosporine-A. (1984). Br Dent J. 157: 89-90 46. Rostock, M. H., Fry, H. R. & Turner, J. E. (1986). Severe gingival overgrowth associated with cyclosporine therapy. J Periodontol. 57: 294-299. 47. Thomason, J. M., Seymour, R. A., Ellis, J. S. (2005). Risk factors for gingival over growth in patients medicated with ciclosporin in the absence of calcium channel blockers. J Clin Periodontol. 32: 273-279. 48. Seymour, R. A., & Heasman, P. A. (1988). Drugs and the periodontium. J Clin Periodontol. 15: 1-16. 49. Seymour, R. A., & Smith, D. G. (1991). The effect of a plaque control programme on the incidence and severity of cyclosporin-induced gingival changes. J Clin Periodontol. 18: 107-110. 50. Somacarrera, M. L., Hernandez, G., Acero, J., & Moskow, B. S. (1994). Factors 191

relatedtotheincidenceandseverityofcyclosporine-inducedgingivalovergrowth in transplant patients. A longitudinal study. J Periodontol. 65: 671-675. 51. Nimmi, A., Tohnai, I., Kaneda, T., Takouchi, M. & Nagura, H. (1990). Immuno histochemical analysis of effects of cyclosporine A on gingival epithelium. Journal of Oral Pathology and Medecine 19: 397-403. 52. Modeer, T., Wondimu, B., Larsson, E et al (1992c). Levels of cyclosporine-A in saliva in children after oral administration of the drug in mixture or in capsule form. Scand J Dent Res 100: 366-370 53. Seymour, R. A., Ellis, J. S., Thomason, J. M., Monkman, S. & Idle, J. R. (1994). Amlodipine-induced gingival overgrowth. J Clin Periodontol. 21: 281-283. 54. Thomason, J. M., Ellis, J. S., Kelly, P. J. & Seymour, R. A. (1997) Nifedipine pharmacological variables as risk factors for gingival overgrowth in organtransplant patients. Clinical Oral Investigations. 1: 35-39. 55. Thomas, D. W., Baboolal, K., Subramian, N. & Newcombe, R. G. (2001). Cyclosporin A-induced gingival overgrowth is unrelated to allograft function in renal transplant recipients. J Clin Periodontol. 28: 706-709. 56. Pernu, H. E., Pernu, L. M., Knuttila, M. L. (1993). Effect of periodontal treatment on gingival overgrowth among cyclosporine A-treated renal transplant recipients. J Periodontol. 64: 1098-1100. 57. O’Valle, F., Mesa, F., Aneiros, J., Gomez-Morales, M., Moreno, E., Navarro, N., Cabellero, T., Masseroli, M., Garcia del Moral, R. (1995). Gingival overgrowth induced by nifedipine and cyclosporine A. Clinical and morphometric study with image analysis. J Clin Periodontol. 22: 591-597. 58. Margiotta, V., Pizzo, I., Pizzo, G., Barbaro, A. (1996). Cyclosporin- and nifedipineinduced gingival overgrowth in renal transplant patients: correlations with periodontal and pharmacological parameters, and HLA-antigens. J Oral Pathol Med. 25; 128-134. 59. Armitage, G. C. (1999). Development of a classification system for periodontal diseases and condition. Ann Periodontol. 4: 1-6. 60. Addy, V., McElney, J. C., Eyre, D. G., Campbell, D. & D’Arcy, P. F. (1983). Risk factors in phenytoin-induced gingival hyperplasia. J Periodontol. 54: 373-377. 61. Nishikawa, S., Tada, H., Hamasaki, A., Kasahara, S., Kido, J., Nagata, T., Ishida, H., Wakano, Y. (1991). Nifedipine-induced gingival hyperplasia: a clinical and in vitro study. J Periodontol. 62: 30-35. 62. Stone, C., Eshenaur, A., & Hassell, T. (1989). Gingival enlargement in cyclosporinetreated multiple sclerosis patients. J. Dent. Res. 68: (Abstr.), 285. 63. Varga, E., Lennon, M. A. & Mair, L. H. (1998). Pre-transplant gingival hyperplasia predicts severe cyclosporine-induced gingival overgrowth in renal transplant patients. J Clin Periodontol. 25: 225-230. 64. Kim, J. Y., Park, S. H., Cho, K. S. (2008). Mechanism of azithromycin treatment on gingival overgrowth. J Dent Res. 87 (11): 1075-1079. 65. Brown, R. S., beaver, W. T., bottomley, W. K. (1991). On the mechanism of druginduced gingival hyperplasia. J Oral Pathol Med. 20: 201-209. 192

66. Hassell, T. M., & Stanek, E. J. (1983). Evidence that healthy human gingival contains functionally heterogenous fibroblast subpopulations. Archs Oral Biol. 28; 617-625. 67. Mariotti, A., Hassell, T., Jacobs, D., Manning, C. J. & Hefti, A. F. (1998). Cyclosporin A and hydroxycyclosporine (M-17) affect the secretory phenotype of human gingival fibroblasts. Journal of Oral Pathology and Medecine. 27: 260-261. 68. Hassell,T.M.,Buchanan,J.,Cuchens,M.,Douglas,R.(1988).Fluorescenceactivated vital cell sorting of human fibroblast subpopulations that bind cyclosporine A. J Dent Res. 67: 273. 69. Jacobs, D., Buchanan, J., Cuchens, M., Hassel, T. M. (1990). The effect of cyclosporine metabolite OL-17 on gingival fibroblast subpopulations. J Dent Res. 69: 221. 70. Bartold., P. (1989). Regulation of human gingival fibroblast growth and synthetic activity by cyclosporine-A in vitro. J Periodont Res. 24: 314-321. 71. Barber, M. T., Savage, N. W., Seymour, G. J. (1992). The effect of cyclosporine and lipopolysaccharide on fibroblasts: Implications for cyclosporine-induced gingival overgrowth. J Periodontol. 63: 397-404. 72. Mariotti,A.(2005)ClinicalPeriodontology&ImplantDentistry.Lang,N.,Thorkild, K. 5th Ed. Blackwell Munksguard. 405-420. 73. Pernu, E. H., Knuuttila, M. L. E., Huttenen, K. R. H., Tiilikainen, A. S. K. (1994). DruginducedgingivalovergrowthandclassIImajorhistocompatibilityantigens. Transplantation. 57: 1811-1813.. 74. Hallmon, W. W., Rossmann, J. A. (1999). The role of drugs in the pathogenesis of gingival overgrowth. A collective review of current concepts. Periodontol 2000; 21: 176-196. 75. Schincaglia, G. P., Fornit, F., Cavallini, R., Piva, R., Calura, G., Del Senno, L. (1992). Cyclosporine A increases type 1 pro-colloagen production and mRNA level in human gingival fibroblasts in vitro. J Oral Pathol Med. 21; 181-185. 76. Modeer, T., Anduren, I., Lerner, U. H. (1992a). Enhanced prostaglandin biosyn thesisinhumangingivalfibroblastsisolatedfrompatientstreatedwithphenytoin. J Oral Pathol Med. 21: 251-255 77. Wondimu, B., Modeer, T. (1997). Cyclosporine A upregulates prostaglandin E2 production in human gingival fibroblasts challenged with tumour necrosis factor alpha in vitro. J Oral Pathol Med. 26: 11-16. 78. Trackman, P. C., Kantarci, A. (2004). Connective tissue metabolism and gingival overgrowth. Crit Rev Oral Bio Med. 15: 165-175. 79. MacCarthy, D., Claffey, N. (1991). Fibrous hyperplasia of the gingival in organ transplant patients. J Ir Dent Assoc. 37 (1) :3-5. 80. Claffey, N. (2003) Plaque induced Gingival Diseases. Clinical Periodontology and Implant Dentistry. Jan Lindhe. 4th Ed. Chapter 7: 203-4. 81. Greenberg, K. V., Armitage, G. C., & Shiboski, C. H. (2008). Gingival enlargement among renal transplant recipients in the era of new-generation immunosuppressants. J Periodontol. 79 (3): 453-460. 82. James, J. A., Jamal, S., Hull, P. S., Macfarlane, T. V., Campbell, B. A., Johnson, R. 193

W. G., Short, C. G. (2001). Tacrolimus is not associated with gingival overgrowth in renal transplant patients. J Clin Periodontol. 28 : 848-852. 83. Knoll, G. A. & Bell, R. C. (1999). Tacrolimus versus cyclosporine for immunosuppresioninrenaltransplantation:meta-analysisofrandomisedtrials. Br Med J. 318: 1104-1107. 84. Ellis, J. S., Seymour. R. A., Taylor, J. J., Thomason, J. M. (2004). Prevalence of gingival overgrowth in transplant patients immunosuppressed with tacrolimus. J Clin Periodontol. 31: 126-131. 85. De Oliveira Costa, F., Diniz Ferreira, S., de Miranda Cota, L. O., da Costa J. E., Aguiar, M. A. (2006). Prevalence, severity, and risk variables associated with gingival overgrowth in renal transplant subjects treated under tacrolimus or cyclosporine regimens. J Periodontol. 77: 969-975. 86. Bader, G., Lejeune, S. & Messner, M. Reduction of cyclosporine-induced gingival overgrowth following a change to tacrolimus. (1998). A case history involving a liver transplant patient. J Periodontol. 69: 729-732. 87. Hernandez, G., Arriba, L., Lucas, M. & de Andres, A. (2000). Reduction of severe gingival overgrowth in a kidney transplant patient by replacing cyclosporine A with tacrolimus. J Periodontal. 71: 1630-1636. 88. Hernandez, G., Arriba, L., Frias, M.C., de la Macorra, J. C., de Vicente, J. C., Jimenez, C., de Andres, A. & Moreno, E. (2003). Conversion from cyclosporine A to tacrolimus as a non-surgical alternative to reduce gingival enlargement: a preliminary case series. J Periodontol. 74: 1816-1823. 89. Westbrook, P., Bednarczyk, E. M., Carlson, M., Sheehan, H. & Bissada, N. F. (1997). Regression of nifedipine-induced gingival hyperplasia following switch to a same class calcium channel blocker, isradipine. J Periodontol. 68: 645-650. 90. Wahlstrom, E., Zamora, J. U., Teichman, S. (1995). Improvement in cyclosporineassociated gingival hyperplasia with azithromycin therapy. N Engl J Med. 332: 753-754. 91. Puig, J. M., Lloveras, J., Bosch, J. M., Munne, A., Mir, F., Barbosa, F. & Masramon, J. (1997). Treatment of gingival hyperplasia secondary to cyclosporine by the new macrolide azithromycin. Transplantation Proceedings. 29: 2379-2380. 92. Gomez, E., Sanchez-Nunez, M., Sanchez, J. E. (1997). Treatment of cyclosporininduced gingival hyperplasia with azithromycin. Nephrol Dial Transplant 12: 2694-2697. 93. Strachan, D., Burton, I., & Pearson, G. J. (2003). Is oral azithromycin effective for thetreatmentofcyclosporine-inducedgingivalhyperplasiaincardiactransplant recipients. Journal of Clinical Pharmacy and Therapeutics. 28: 329-338. 94. Khocht, A., Schneider, L. C. (1997). Periodontal management of gingival over growth in the heart transplant patient: A case report. J Periodontol. 68: 11401146. 95. AcademyReport,InformationPaperoftheAmericanAcademyofPeriodontology. Drug-Associated Gingival Enlargement. (2004). J Periodontol. 75: 1424-1431. 96. Camargo, P. M., Melnick, P. R., Pirith, F. Q. M., Lagos, R. & Takei, H. H. (2001). 194

Treatment of drug-induced gingival enlargement: aesthetic and functional considerations. Periodontology 2000. 27: 131-138. 97. Dongari, A., McDonnell, H. T., Langlais, R. P. (1993). Drug-induced gingival overgrowth. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 76: 543-548. 98. O’Neill, T. C. A., Figures, K. H. (1982). The effects of chlorhexidine and mechanical methods of plaque control on the recurrence of gingival hyperplasia in young patients taking phenytoin. Br Dent J. 152: 130-133. 99. Mavrogiannis, M., Ellis, J. S., Thomason, J. M., Seymour, R. A. (2006). The management of drug-induced gingival overgrowth. J Clin Periodontol. 33: 434439. 100. Seymour, R. A., Smith, D. G. & Turnbull, D. N. (1985). The effects of phenytoin and sodium valproate on the periodontal health of adult epileptic patients. J Clin Periodontol. 12: 413-419. 101. Thomason, J. M. & Seymour, R. A. (1990) Phenytoin-induced gingival over growth in general medical practice. Journal of Dental Research 69: 969. 102. Mavrogiannis, M., Ellis, J. S., Seymour, R. A., Thomason, J. M. (2006). The efficacy of three different surgical techniques in the management of drug-induced gingival overgrowth. J Clin Periodontol. 33: 677-682 103. Krejci, R. F., Kalkwarf, K. L. & Krause-Hohenstein, U. (1987). Electrosurgery-a biological approach. J Clin Periodontol. 14: 557-563. 104. Darbar, U., Hopper, C., Speight, P. (1997). Combined treatment approach to gingival overgrowth due to drug therapy. J Clin Periodontol. 23: 941-944. 105. Pilloni, A., Camargo, P. M., Carere, M. & C. Jr. (1998). Surgical treatment of cyclosporine-A and nifedipine-induced gingival enlargement: Gingivectomy versus periodontal flap. J Periodontol. 69: 791-797. 106. Seymour, R. A., Thomason, J. M., Ellis, J. S. (1996). The pathogenesis of druginduced gingival overgrowth. J Clin Periodontol. 23: 165-175. 107. Guggenheimer, J., Eghtesad, M. D., & Stock, D. J. (2003). Dental Management of the (solid) organ transplant patient. Medical Management Update. Oral Surg Oral Med Oral Path. 95 (4): 383-389.

195

DRAMA, FILM & MUSIC PANEL

•

Judging Panel Prof. Brian Singleton (Trinity College Dublin) – Chair Dr. Harvey O’Brien (University College Dublin) Dr. Paul Murphy (Queen’s University Belfast) Prof. Fiona Palmer (NUI Maynooth) Dr. Marcus Zagorski (University College Cork) Dr. Niamh Doheny (Huston Film School) Judges’ commentary This is an outstanding piece of writing of publishable standard. The author demonstrates finely honed skills in summary and analysis pacing her movement between context and close reading with almost uncanny precision. Her succinctness in compressing complex theoretical ideas in a way which does them justice but does not prevent her from moving forward is truly remarkable. This is a piece of writing that is never less than clear about what is in question and what relevance it has to the furtherance of its argument. The student’s reading of Spanish cinema is nuanced and well informed, and yet, again, she does not feel the need to become overly focused on historical context to the exclusion of a rhetorical point of view. The sense of a grounded critical orientation is extremely strong – demonstrated in the confidence with which she is able to summarise existing critical frameworks and then smoothly segue into her own, clearly delineated, point of view on the subject without being drawn into mechanical contradiction of other authors. The close reading of the films themselves is equally strong, and you feel it comes after sufficient groundwork has been done to allow her freedom to explore the films as she does. There is a tendency to relegate key descriptive passages to footnotes, and this may be something to do with word lengths, but the material in these (long) footnotes is also very good. If it were to be published, I think an ‘upgrade’ of all of these would be required. There is no question that this work is of a very high standard, both in terms of quality film studies work and purely as writing. The confidence, clarity, and sense of pace is excellent, and the work demonstrates both scholarship and execution equivalent with good Masters-level writing and even professionally published articles.

Dr a m a , F i l m & M usic

Bigas Luna’s Retratos Ibericos & the gendered performance of Self Ciara Barrett

n 1976, one year after the death of Franco and a year into Spain’s transicion period into secular, socialist democracy,1 Spanish film auteur-to-be Bigas Luna directed his first feature film, Tatuaje. Between this and the first film of his acclaimed Retratos ibericos, or Iberian trilogy, Jamon jamon in 1992 (followed by Huevos de oro in 1993 and La teta y la luna in 1994), Bigas Luna directed six films: Bilbao (1978), Caniche (1979), Renacer (1981), Lola (1985), Angustia (1987) and Les edades de Lulu (1990). Luna carried his work into the nineties with a distinct interest in themes of desire, sexuality, perversion, and generational and/or familial conflict.2 His films may be seen as in keeping with a trend towards deliberate provocative-ness from within Spanish cinema after 1975, when Francoist film censorship collapsed. Repressed for so long under the former regime, the visible presence of sex onscreen served as a vehicle for historical self-analysis,3 a symbol for, and indicative of, socio-political and artistic freedom. Bigas Luna, many of whose films earned the Spanish equivalent of an “X” or “NC-17” rating, may be seen, actively participated in this culture of revolutionary politics sublimated into artistic production. The most offensive of Luna’s films fall into the popular genre of the destape film, newly-born to post-Franco Spanish cinema, devoted to representing all that is 1 Kowalsky, Daniel. “Rated S: Softcore pornography and the Spanish transition to democracy, 19771982.” Spanish popular cinema. Antonio Lazaro Reboll and Andrew Willis, Eds. Manchester: Manchester University Press, 2004. (188) 2 Evans, Peter William. Jamon jamon, Bigas Luna. Barcelona: Ediciones Paidos, 2004. (13) 3 Ibid. (21)

197

crude and offensive.4 Like the work of Vicente Aranda (including Amantes from 1991, which breaks the taboo of explicitly showing an erect penis onscreen) and the accumulating repertoire of Pedro Almodovar (whose Pepi, Luci, Bom, released 1980, is prototypical of the kind of bad taste and good humour characteristic of destape films thereafter), Bigas Luna’s work of the transicion period may be seen as an oppositional cinema after the fact of oppression, in discourse with its repressed past by virtue of its very rejection of repressive influence. However, it has been argued by Peter Evans that by the 1990s Bigas Luna significantly opened himself to a more critical and ironic stance towards historical, political discourses surrounding Spanish society’s relationship to that same repressed past.5 It could be seen as a stance-as-distance: in his Retratos ibericos, he treats symbols of, and relative to, the traditionalist Spanish past with a tendency towards parody and/or irony. Arguably these are methods of discursive engagement allowing for a certain degree of self-detachment and critical perspective on the part of the director, a potential site for internalised socio-political conflict subsequently channelled into artistic proliferation. Alternatively, we might see Bigas Luna’s role as director, especially in the Retratos ibericos, as less a site in/on/from which to glean evidence of social change and see resulting conflicts played out, but, and as Anne Marie Stock has argued, as that of a “collector”—and with that, organizer and regenerator—of social observations, “identifying, analyzing and revealing the operative mechanisms of cinema.”6 Through self-consciously cinematic techniques and modes of representation, Stock argues that Bigas Luna “strives not to meet expectations but [rather] to underline them as such.”7 I would argue, in this vein, that by the time of Jamon jamon, incontestably a highly sexual film, Luna has taken to using the omnipresence of sex-for-the-sakeof-sex in contemporary Spanish cinema as a self-conscious jumping-off point for maturely critiquing gender politics and their modes of filmic representation, in relation to filmic discourses of Spanish nationhood. As Marvin D’Lugo says, sexuality is the “narrative ‘bait’” Bigas Luna uses in order to entice his audience into reading (into) the text of his films.8 In that it has a reputation for meaninglessness, apart from its present standing-in for what was previously necessarily absent from censored Spanish cinema, sex becomes the most potentially significant symbol, or space/site open to symbolic inscription, in the highly—even to the point of overly— symbolic texts of the Retratos ibericos. Indeed, the three films of the Retratos, La teta y la luna, Jamon jamon, and Hue4 Ibid. (21) 5 Ibid. (21) He writes, “Bigas Luna es el historiador de un mundo arcaico que se enfrenta a los retos del futuro.” 6 Stock, Ann Marie. “Eyeing Our Collections: Selecting Images, Juxtaposing Fragments, and Exposing Conventions in the Films of Bigas Luna.” Modes of Representation in Spanish Cinema. Jenaro Talens and Santos Zunzunegui, Eds. Minnesota: University of Minnesota Press, 1998. (171-172) 7 Ibid. (184) 8 D’Lugo, Marvin. “La teta i la lluna: The Form of Transnational Cinema in Spain”. Refiguring Spain: Cinema/Media/Representation. Marsha Kidner, Ed. Durham: Duke University Press, 1997. (207)

198

vos de oro9, are completely shot through with sexual images and symbols, most all of which are unambiguously phallic. In this light, the Retratos ibericos might be seen as evidence of Bigas Luna’s regression back to an alignment with more fully traditional and phallocentric discourses of filmic representation, apparently insistent on the symbolic ordering of images with predetermined and clichéd meanings. However, it will be my argument here that Bigas Luna so insists on the overrepresentation of symbols of patriarchy (alluding to Spain’s oppressively ordered fascist past), so insists on inscribing—in fact, and as I will be showing, quite literally writing—meaning into these texts that he intends to reveal the abusive nature of subjecting things—objectifying things, especially people, and even more especially women, as the frequent objects/victims of patriarchal discourse and practice—to the symbolic construction of meaning. Bigas Luna’s aims to abuse his own power as filmmaker, as constructor of meaning, in order ultimately to expose that power of symbolic ordering as always already illegitimate, as inherently unstable, built on reproduction after reproduction of gendered images and symbols so overdetermined, by this point, in terms of “meaning” that they have lost all true symbolic and narrative value in and of themselves. We may then see the films of this trilogy, upon close analysis, as working ever-so subtly and subversively to play against type and underline the extensive symbolic ordering of their narratives; they subvert the hold of traditional, patriarchal modes of representation and methods of narrativization from the inside out. For one thing, the characters of Bigas Luna’s Iberian Trilogy are all strictly typed, or significantly functional, in that they are obviously coded for a to-be-looked-for (and assumedly accessible) meaning. In all three films, the end credits identify the actors not by the names of the characters they play, but by the types that their characters, before they are even given voice, are always already performing. Cases in point: in Teta, only the young protagonist of the narrative, Tete, is linked directly by his (fictional) name to his real self, the actor Biel Duran. All others are identified by part, as opposed to person: thus the character of Estrellita (Mathilda May) is reduced to her part as “La Gabacha”, her husband Maurice (Gerard Darmon) to “El Gabacho”, her teenage lover Miguel (Miguel Poveda) “El Charnego”, and Tete’s mother (Laura Mana) simply “La madre”. In Jamon jamon, Silvia (Penelope Cruz) is “la hija de puta”, her mother Carmen (Anna Galiena) “la puta madre”, Silvia’s boyfriend Jose Luis (Jordi Molla) “el ninato”, his mother Conchita (Stefania Sandrelli) “la madre puta”, her husband Manuel (Juan Diego) “el padre”, and macho-man Raul (Javier Bardem) comically “el chorizo”. Finally, in Huevos, as in Teta, the male main character is allowed to retain his name (Benito, also played by Javier Bardem), but his first love Rita (Lisa Tovati) becomes, appropriately, “El primer amor, 47 kilos”, his wife Marta (Maria de Madeiros) “La mujer, 45 kilos”, his first mistress Claudia 9 Though out of chronology, this ordering of the films reputedly follows Bigas Luna’s own suggestion that they be watched in order of “the temporal progression of the trilogy from the simple world in which love, rather than eroticism or an aggressive sexuality, dominates, to progressively more brutal stages of sexual desire and its manipulation” (D’Lugo, Marvin. Op. Cir. p. 203)

199

(Maribel Verdu) “La mujer, 52 kilos”, and his last mistress Ana (Raquel Bianca) “La comehombres, ? kilos”. The actors and the roles they play are therefore recognized not as personalities or even personifications in and of themselves, but as signifiers of a second level of signified meanings. Consequently, both the characters and their respective actors are robbed of a certain degree of subjectivity; they become narrative objects, whilst the narrative itself is bared as an artificial means towards the end of signification, or the “making of meaning” from purposely-structured story elements and events. Before going any further, I would make the distinction here between the terms “part” and “person” as they will be used in this discussion. A “part” is a role, inanimate, before it is characterized, and thereby made animate. It is given voice and action, and ultimately personality, by the person who plays the role or part, who individually embodies this manufactured person and gives it (virtual) life. There is, of course, the question as to whether a role might ever be fully embodied in such a way (whereby the unreal—or as yet unrealised—character effectively appropriates the actor’s real body; s/he takes on—or is taken over by—a wholly new personality, which is no longer mere character but person-made-flesh). It may be that an actor can only go so far as to personify a character, taking on certain personality traits subsequently subsumed into his/her own always already apparent body and identity; the effect of this characterization is not only transitory—that is, impermanent—but transient, slipping always between the actor’s “real” personality and “unreal” character as function of part, and repeatedly taking the audience into and out again from the performance as a whole. Thus there is always a slippage or instability between the three elements of performance—part, person, and character/personality—inherent to characterization. It is just one example of the deconstructive elements and potential of cinema with which Bigas Luna plays. By making such use of typecasting obvious and explicit in the Retratos ibericos, Luna makes us see and re-read each performance therein as an instance of type masquerading as character. He discovers, unearths and exhibits the different layers of meaning out from under his actors’ performances, and accordingly out from under all their characters’ performances.10 They are forced (if they are really a “they”—after all, “they” the characters are not “real” people) to bear the burden of type from within these narratives—types verbalised, made manifest in the end credits, and looked at for what they are: constructive acts of signification that collapse, upon closer inspection, under the weight of their doubled and overdetermined meanings. Each character is revealed to be not an unreal identity but rather a hyperreal entity, a performance of a performance without original derivation from a “real”, in postmodern terms. In such a way, Bigas Luna exposes the act of character impersonation, as seen and as literally written into the texts of his Retratos ibericos, as a vehicle for the 10 Bigas Luna is credited not only for the direction but also for writing the Retratos ibericos with frequent collaborator Cuca Canals; therefore it is safe to say Luna is responsible, at least in part, for the scripting of his characters and how they are referred to in his films.

200

construction of narrative meaning, and further as a narrative myth. Characters are presented, are called out directly in these texts as specific types; their personalities, and with them their actions, are, being functions of their labels, always already foregone conclusions, and beyond predetermined, they are overdetermined symbols, copies of other copies of persons. They are always already paradoxically overloaded and emptied of significant meaning. However, if this thesis is flipped around, so that we say not that the characters of the Retratos ibericos are masks for types, but that that these types, imposed at the end credits after the fact of their being narratively played out, are in fact masks for successfully individuated characters, we realise these films to be even more densely (over)layered with meaning than previously thought. Especially as in cinema studies discourses on “masquerade” performance tend to serve the purposes of feminist criticisms of gender representation,11 I would like here to examine the ways in which Bigas Luna allows certain subtle and individual characterizations of gender types throughout the Retratos ibericos to subvert the very metanarrative of character-typing—stereotyping, archetyping, etc.—with which he is often seen to work in collusion. Jamon jamon has in particular drawn critical attention for its presentation of generic familial melodrama populated by heavily stereotypical characters,12 and it is, perhaps, that film out of the trilogy that most obviously engages with gender performance as relative to, and as a function of, character-type. Jamon jamon, on one level, may be seen as overly insistent on the traditional stereotyping of its female characters; it seems bent on cornering its actresses into over-played, overly familiar parts and performances, whose narrative significance is always already apparent. The three main female parts are, as identified in the end credits, “la puta madre” Carmen, the good mother who prostitutes herself for the sake of her children, “la madre puta” Conchita, the castrating mother whose sexual voraciousness is the undoing of her own son and lover, and “la hija de puta” Silvia, the pregnant daughter of Carmen who is wronged by two lovers over the course of her own foray into sexual liberation. All three parts are maternal, versions of the mother figure cliché, and are thus evidence of the film’s being in dialogue with specifically Spanish modes of representation and socio-political and historically situated constructs of meaning. As Gamez Fuentes points out in his article on “Women in Spanish Cinema”, the figure of the mother in modern Spanish films must everywhere be seen, directly or indirectly, as in the context of—and as an intertext with—the clichéd symbol who is both significant of patriarchal (Francoist) power, and by virtue of her gendered difference from the male, threatening to his authority.13 Her problematic/problematizing presence “as a fictional space which 11 Hayward, Susan. Cinema Studies, The Key Concepts. Third Edition. London and New York: Routledge, 2006. (132-134) 12 Evans, Peter William. Op.Cit. (14) 13 “Women, as the necessarily submissive element of the patriarchal power balance, pose a constant threat—not just to male superiority and power position—but to male identity itself. The very essence of traditional formulations of male identity hinges on men’s ability to reproduce themselves

201

has articulated historical-political conflict,”14 as Fuentes writes, explains why in contemporary Spanish cinema, maternal figures are often elided from texts, overburdened as they are by historical, socio-political, and uniquely Spanish meaning. But nevertheless they are emphatically present in Jamon jamon, which might lead us to believe that the very idiosyncrasy of Bigas Luna’s including not one, but three mother figures in this very modern text must be significant of his defiance of Francoism’s lingering influence over modern modes of representation and codes of signification—in itself a meaningful act of rebellion against traditional nationalist practices, both past and of the movie’s present. I have offered, however, that Luna’s own take on the mother as a gendered symbol of patriarchal/sexist discourses of power is rather more deconstructive of that same archetype’s signifying potential than it is respectful of an actual “significance” or “meaning.” Instead of leaving his three main female characters to be reread into their prescribed, typed roles, Luna literally pre-scripts them as types long clichéd in Spanish cinema, thereby allowing them to deviate in subtle ways from their prototypical models (with type predetermined, they bear with them already a weight of meaning that has only the potential to be cast off, as opposed to established/developed narratively). For the most part, these female types perform their traditionally gendered roles in traditionally “feminine” ways, but self-consciously and attentively so that they are in full control of their own female masquerade, their gender performativity. The most self-aware performance in Jamon jamon is that of Carmen, the puta madre, whose job as a prostitute requires her to repeatedly play up her difference to/for men, to reaffirm her own subjugation to their desires while being in complete control of her own abilities to do so—and therefore in complete control of masculine desire as well. This is most clearly evinced in the scene where Silvia’s boyfriend Jose Luis comes to Carmen begging for sex with her: assenting somewhat reluctantly, Carmen then performs a partial striptease and seduction for Jose Luis, the enjoyment of which, on her behalf, is somewhat ambiguous. It appears that her own sexual satisfaction derives from having the power to grant her sexual favours and/or to take them away, but not in the act of sex itself (Jose Luis reaches for her breasts, but she will not let him touch them; she touches him intimately, then moves away before he can actually go any further).15 Most interestingly, Carin the light of those role models and reproduce the patriarchal order.” (Jordan, Barry and Rikki Morgan-Tamosunas. Contemporary Spanish Cinema. Manchester and New York: Manchester University Press, 1998. p. 144) 14 Fuentes, Gamez. “Women in Spanish Cinema: ‘Raiders of the Missing Mother’?” Cineaste. 29 no 1, Winter 2003. (38-43) 15 The touching of breasts—and perhaps more significantly, the prevention of doing so—is a recurring trope of the trilogy. In Teta, the main character Tete’s primary goal is to claim “a breast of his own”, and he spends most of his time in the narrative trying to steal glimpses of (and a suckle at) the dancer Estrellita’s. In contrast to Carmen’s powerful and meaningful withholding of her breasts from Jose Luis’s desirous grasp in Jamon jamon, her daughter Silvia freely gives hers to both Jose Luis and Raul, who fetishize them as symbolic of tortilla and ham. For these men, her breasts

202

men then proceeds to mimic the sounds of her pet parrot, whilst performing a parody of Spanish dance movements; effectively she is mimicking a mimic, the parrot, whilst compounding Jose Luis’s sexual desire in performance for him and simultaneously referencing an aspect of traditionalist Spanish culture. The result is that her idealised status as the puta madre, with all its connotations of the nurturing Virgin and of the sexually gratifying whore, is contaminated by her self-consciously drawing attention to the performativity of her own feminine actions on multiple levels—sexual, socio-political/historical, and cultural—and the fact of her type, as the puta madre, being similarly performative. Also compounding the allusion to performativity on all levels is Jose Luis’s (Jordi Molla) performance of his character’s reaction to Carmen’s “seduction”: as Chris Perriam notes, physically he is “prone and masturbating”,16 acting out in exaggerated form the physical response of any audience—especially of the cinema—to performance, and especially that of female masquerade. Its intended audience is symbolize of maternal domestication and nourishment—Silvia’s breasts are thus overdetermined symbols, made to bear a weight of meaning attributable to patriarchal ideology. However, this weighting of Silvia’s breasts-as-symbols is played for laughs, judging by the immediate gusto with which each of her lovers immediately goes for her bosom, and how emphatically they declare her to taste of this tortilla and ham; her breasts therefore parody symbolism, more than they are supposed to have meaningful connotation from within the text of Jamon jamon. Finally, in Huevos, much is made of Benito’s ever-shifting privilege to touch the breasts of his various lovers: his first love Rita appears not to care whether or not he does; Claudia, his future mistress, prohibits him from touching them—they are, until she is ultimately used up and betrayed as sex object and tool for Benito’s commercial ambition, hers alone to handle and elicit pleasure from; Marta, Benito’s wife, like Rita (to whom he also compares her closely in weight) does not find anything objectionable to being handled; and ultimately Ana, with whom Benito ends up in Miami, has fullest control over her body— she has no particular hang-ups about her breasts being touched, but she knows how to use them as offerings at key moments when she wants attention or to make a point (like Claudia’s in the Spanish business world, her breasts are a bargaining tool with Benito; however, unlike Claudia, she dares to renege on her promise that “only you will fondle my breasts”); Ana is invulnerable. As a final thought, as breasts are so highly prominent in the Retratos texts—not only are they constantly literally visible, but also, as I have noted, they carry considerable symbolic weight—it would be interesting to discover to which gendered sphere they might appropriately be considered as belonging. Both men and women in the Retratos ibericos consider the possession of breasts as meaningful, as if personal control over them reflects a degree of social influence and liberty. Indeed, more than the women in these films appear to have penis envy, or to have interest or anything to do with the many phallic symbols throughout the Retratos (ham and bulls in Jamon, material possessions and skyscrapers in Huevos, human pyramids and ewers—though, complicating matters, these ewers might also be seen as symbolic of breasts—in Teta) men are constantly fixated on using or acquiring them, similar to the way they are almost always fixated on women’s breasts. Ultimately, I think this must prove that women’s breasts ain these three films are yet one more example of over-abundant phallic symbols, despite the fact that they belong to women’s bodies—or perhaps because of it, they show phallocentric structures of meaning and symbolism attempting to control the female body outside its comfort zone of manly material objects. Thus when a woman in the Retratos ibericos keeps her breasts to herself for her own pleasure, she subverts patriarchal authority over her body as symbol, and in fact, she denies the male pleasure of objectifying her body. 16 Perriam, Chris. Stars and Masculinities in Spanish Cinema, From Banderas to Bardem. Oxford: Oxford University Press, 2003. (133)

203

impotent in terms of its potential affect on the object of its gaze, hence audience response to audiovisual cues is, at least metaphorically, masturbatory, that is, procured for personal pleasure and enacted mentally and physically only on the self— the actual physical manifestation of elicited pleasure in no way affects the source of that pleasure.17 I shall return to discuss the problematic nature of subject/object relationships of desire in greater depth as regards the reversion of the male gaze back on itself as effected via the Retratos ibericos of Bigas Luna. For now, however, it is enough to say that in acting out the role of the sexually indulgent puta madre, the actress Anna Galiena is able paradoxically to individuate and to characterise her typical role away from the stereotypical; her control of the sexual situation successfully undermines and destabilises the puta madre type as sexually submissive, as opposed to dominating and (potentially) powerful. The other two films of the trilogy, Huevos de oro and La teta y la luna, similarly, though less obviously than in the instance of Jamon jamon detailed above, play with the idea of feminine performativity or masquerade as a function of greater role play; “type” is ultimately betrayed as an inadequate signifier of personality and/or female subjectivity.. Huevos offers a greater number of female roles (four: Benito’s “primer amor”, “la mujer, 52 kilos”, “la mujer, 45 kilos”, and “la comehombres”) than Jamon’s three, but interestingly they are allowed less overall subjective autonomy in their individual narratives and characterization. Whereas Jamon jamon is very much the shared story of six main characters, and as Celestino Deleyto has effectively argued, split relatively equally between its three men and three women,18 Huevos is rather more Benito Gonzalez’s personal narrative, with the four “main” female characters taking a relatively marginalized role.19 However, it is interest17 Laura Mulvey in her essay “Visual Pleasure and the Narrative Cinema” would argue, however, that ‘the gaze’, usually identified with the male, is, on the other hand, sadistically voyeuristic—that we take pleasure in subjecting the female to cinematic objectification because our very watching her for meaning implicates her from the very start in narrative processing. We inflict, according to Mulvey, narrative evens onto the passive female image. 18 Deleyto, Celestino. “Motherland: Space Femininity, and Spanishness in Jamon jamon (Bigas Luna, 1992)”. Spanish Cinema: The Auteurist Tradition. Peter William Evans, Ed. Oxford, Oxford University press, 1999. (270) 19 This discrepancy between Jamon and Huevos could, however, be down to the fact that generically they are very different films. Though both, as I am trying to show, ultimately deconstruct their own patriarchal structures of meaning by overloading on symbolism and ‘meaningful’ performances of type, this does not preclude a brief analysis of their genre codification—for it is just one more construct of meaning with which these narratives are to play. Jamon jamon, as Peter Evans has been seen to argue, “{e}s un gran melodrama”, therefore it is only fitting generically that its narrative should incorporate many (stereotypical) characters into a domestic setting, ending in the same place, not very far off in time from whence it began. Huevos, on the other hand, fits more the pattern of an epic tragedy, set across stretches of space and time, charting the rise and fall of its male protagonist, whose hubristic personality and ambition ultimately implode into self-pity and –destructiveness. It is, above all, the narrativization of Benito’s inner struggle against himself, so it is only natural that his story be Benito-centric. Incidentally, Robert Lang has written about the links between gender and genre constructions as pertains to the codification of meaning in symbolic discourse in his book Masculine Interests. He

204

ing to note that, in a way, the female characters of Huevos may all be read against one another, relative to type—or even that the final three may be read as versions of Benito’s first love, Rita. After all, it is to her, the “primer amor, 47 kilos”, that all the other women are compared—in terms of personality (mainly as a function of how “whorish” they are) and, more importantly it seems, in weight, just as if they were any gemstones ready for appraisal by Benito, (to continue in the metaphor) their “stone-cutter” of sorts. Claudia, heavier than Rita (which makes her apparently less desirable, though an authoritarian control over her breasts appears to lend her an idiosyncratic appeal to Benito), and Marta, his wife, lighter (she is otherwise boring unto herself, but being a “featherweight” in Benito’s arms appeals to his need to feel in command and control), together seem to comprise two halves of Benito’s ideal woman (who remains the cheating Rita). They are significantly visually doubled by virtue of Benito’s having drawn on them each like little more than two big blueprints. Also, in the scene leading up to and during their threesome with Benito, their mutual fascination with each other’s bodies and pleasure seems subversively to suggest the redundant presence of the man, Benito, in their womanly, sexual sphere. And finally, it is suggested that Claudia and Marta’s roles as lover and wife, respectively, are not mutually exclusive—that is, meaningful in and of themselves as parts played out for Benito’s sadistic pleasure—when Marta expresses her desire for them to switch places, so that she might have the excitement of being mistress and Claudia the comfort and security of playing wife. At no point do Claudia and Marta’s personalities or subjectivities switch, thus each of their individuated characterizations is preserved, but the social roles they play are revealed to be fluid and, to some degree, voluntary. Therefore, their characters take on distinctly female masquerades as dutiful wife and lover as they so choose; the parts they play as stereotypes/myths from within Spanish society do not actually determine their individual personalities. La teta y la luna is more conservative in terms of its narrative scope and characterization than the other two films of Bigas Luna’s Iberian Trilogy. As it is in many ways a children’s story, a coming-of-age narrative (perverted though it may be by sexuality and shades of morbidity), it presents more balance/stability and textual unity than do either of the other two of the Retratos. Thusly more generically clearcut, as compared to the melodramatic (with aspects of the horrific) Jamon jamon20 writes that “masculinity itself is a genre formation. Gender, like genre, is a performative accomplishment… Just as a film genre has no content until a number of genre films render it visible, gender [is].” (Lang, Robert. Masculine Interests. New York: Columbia Univeristy Press, 2002. p. 4) Thus we might see, perhaps, as the Retratos ibericos as being so variably generic as a reflection, or perhaps as a function, of the slightly shifting perspectives on gender and its performance we have seen from film to film. 20 Like both Huevos and Teta, Jamon incorporates a surrealist dream sequence, allusive of Dali and Bunuel, which, as with the other films, disrupts its particular generic, codified progression (in a previous note, I identified Jamon jamon as generically coded for melodrama). However, there are elements within it that, beyond flavouring the film with a touch of surrealism, also infect its narrative with the generic codings of horror. According to Deleyto, the ‘madre puta’ of Jamon, Conchita,

205

or the tragic Huevos de oro, Teta is located most firmly within phallocentric discourse. All conflicts are put to rights by its end, and the boy protagonist Tete is decidedly taken up into the patriarchal social structure and phallocentric discourse of its regionally specific Catalan setting,21 the specificity of which, in this case, denotes the tenacity of patriarchal symbolic order holding place/subjects to significant, objective meanings. Married though it has been to a precariously heavyhanded symbolism, by Teta’s end the film has still not been disrupted by an Jamonlike eruption of hypermasculine angst and anger, or the implosion of the same, such as at the end of Huevos de oro, when Benito despairingly cries out against every single symbol or marker of his past success and machismo. Nevertheless, there are indeed, as in Jamon and Huevos, instances of self-consciously performed female masquerade, played by Mathilda May playing “La Gabacha” Estrellita, that subversively draw attention to the complete artificiality—and thus the precarious fragility—of the wholly symbolic world to which Tete is inducted throughout the course of the narrative. Most obvious are those moments when Estrellita is onstage performing her act with Maurice, sending up the image of the demure ballerina, an idealised image of womanhood, in a performance that has her cheering for her partner’s farts, baring one of her breasts, and flitting inanely about the stage to an Edith Piaf song. Also in the beginning and ending credits of the film, Estrellita is seen emerging and finally disappearing back into a box like the figurine in a music box, aping the motions of an inanimate object which is itself the copy of a real female figure. In such a way she ironically copies her own feminine body after an inauthentic copy; she hyperrealizes herself to the point that subjugating herself to the male gaze—for which she predominantly performs onstage, judging from the breast-baring sketch—is emptied of any sexual significance because the body with which she presents herself is not significant of her own being but of some simularepresents the two aspects of the ‘monstrous feminine’ as defined by theorist Barbara Creed: the phallic woman and the archaic mother (who has the vagina dentata). (Deleyto, Celestino. Op. Cit. pp. 279-280) Meeting Creed’s criteria for monstrous femininity, Conchita both has been abandoned by her child in his attempts to insinuate himself into the patriarchal symbolic order (i.e. move out, marry Silvia, and raise a child of his own) and brings about a confrontation between this symbolic order “and that which threatens its stability”, that is, subjecting a macho male, Raul, to her sexual whims. (Creed, Barbara. Pandora’s Box: Essays in Film Theory. Melbourne: Australian Centre for the Moving Image, 2004. p. 39) Effectively, Conchita subjects both the two young main males to an encounter with the abject, that is, as defined by Kristeva, death and the corpse, “a weight of meaningless”, “ambiguity”, and an “attempt to release the hold of the maternal entity”. (Kristeva, Julia. Powers of Horror: An Essay on Abjection. New York: Columbia University press, 1982. pp. 4-13) This abject-ification, of sorts, of the Jamon text, fully disrupts and deconstructs its textual phallocentricism. 21 Teta’s setting is specifically “micro-regional” (D’Lugo, Marvin. Op.Cit. p. 198), whereas Jamon jamon, set in Los Mongros in Aragon, is more largely regional. (Deleyto, Celestino. Op. Cit. p. 271) Huevos covers the most space, set in several different places in Spain before the action relocates to Miami, Florida. This might be read across the Retratos ibericos as a movement from the most limited/immature framework of social discourse to the most international, which is also the most sexually mature and ultimately also the most divested of social consequence.

206

crum of an idealised womanly body. While D’Lugo has identified “Estrella’s role as the elusive object of collective desire that transforms the cultural fetishization of sexual identity into a constructive identity,”22 I believe it is rather more that she, as the “elusive object of collective desire” remains intangible to her diegetic and extra-diegetic audiences, in that her constant over-performance of this paradoxically parodic and sexually idealised ballerina protects her real identity from being used and construed/constructed as meaning as such.23 Overall, female masquerade in the Retratos ibericos, as it results in the constant confounding of type through subversive acts of characterisation and gender performativity, upends the phallocentric discourse of symbolism running parallel to these recurring instances of the subversion of gender-as-meaning in Bigas Luna’s Iberian Trilogy. But the films also go one further: other than destabilising the symbolic authority of the filmic image to convey meaning through the acting-out of female performance beyond the logistic realms of phallocentric discourse, Luna’s Trilogy paints male performativity of gender as equally malleable to females’ and as frequently disturbed. For example, the first-made Jamon jamon ends with (seemingly) macho through-and-through Raul kneeling, weeping, before Conchita, whose son he has just killed in an outburst of hypermasculine aggression and overcompensation for his sexual subordination to Conchita. In this case, Raul’s machismo is over-performed to the point where both body and mind can no longer support the performance, exploding outwards in violence against others, and imploding inwards on Raul’s sense of self. He can no longer express himself past a few gutteral apologies to Conchita, and after that, even verbal discourse and structures fail him. According to Chris Perriam, “[w]hat he seems to register in these moments is the shocked acceptance of the punishment for performing excessively and without nuance those masculine ideals that ought to have brought sexual and material success.” This is also seen in Huevos de oro,24 wherein Benito (who is also played by Javier Bardem) similarly systematically destroys every lasting symbol of his successful foray into the highly structured, heavily male-gendered business world. He collapses after cursing even “Passion”, the sexual liaison between man and woman upon which male dominance is theoretically founded. Then, as D’Lugo writes, Coming right after Huevos de oro, Teta might well be read as a manifestation of the longing for a return to simpler times moti22 D’Lugo, Marvin. Op. Cit. (212) 23 Adding one more dimension to the elusive complexity of Estrellita’s character as masked by her show persona is the fact of her character’s Portuguese heritage. She is consistently referred to as French in the film, and indeed she is married to a Frenchman, dances to Edith Piaf, and regularly wears a large ballet tutu; however, towards the beginning of the film Tete states that she is actually Portuguese—yet another aspect of her character that is elided in her performance of idealised femininity onstage. 24 Perriam, Chris. Op.Cit.(98)

207

vated by the Iberian male’s recognition of his ensnarement in the self-deluding myth of his own power and virility… yet the “age of innocence” evoked in Teta, similar to that of Huevos de oro, is fixed on the image of male anxiety and immobility, this time atop the human pyramid.25

Whereas “[t]he final scenes of both Jamon and Huevos could thus be interpreted as a nostalgic farewell to the macho Iberico, a figure unable to survive in a newly globalized, and at the same time de-centralized, Spain,”26 the lasting image of Tete set atop the (heavily phallic-coded) nationalistic symbol of the Catalan castella promises, at the end of the Retratos Ibericos cycle, the rebirth/resurgence of just such a macho figure. He has grown, similarly to Benito and Raul, to be fixated on women’s breasts as symbols of female difference, and thus deference, to the Spanish male authority that distinguishes them originally and dichotomously as female, the not-male. It is the ultimate sign of Tete’s initiation into patriarchal Spanish society that he finally “has balls” enough to climb to the top of the human tower, and that he has accordingly been recognized as such, as male, by the female objects of his affection, Estrellita and his mother, who give (again) their breasts to him in appreciation for his proven sexual difference.27 However, if we have learned anything from the similar narrative trajectories of Raul and Benito in Jamon and Huevos, respectively, we know that the achievement and over-performance of masculinity now—a flaunting of what he deems to be his hard-earned “balls”—can only result in later castration. Just as Raul and Benito face metaphorical castration—the diminishment of their sexual, economic, and social success—by the end of their narratives, and just as the well-known symbol of Spanish patriarchal-national identity the Osborne bull, omnipresent in Jamon jamon, is in that film literally (as much as a giant animal cut-out can be literally anything) and unceremoniously castrated, so it seems that Tete, following in the narrative footsteps of his predecessors, will, as a result of his similarly performing male masquerade, eventually be too. Consequently, enacted (in Jamon jamon and Huevos de oro) and promised (in La teta y la luna) throughout Bigas Luna’s Retratos Ibericos, we have the ultimate upheaval of what film theorist Laura Mulvey has famously criticised narrative cinema as imposing on the female figure, which is the bearing of the burden of narrative signification, of being made to represent, to symbolize meaning, by virtue 25 D’Lugo, Marvin. Op. Cit. (205) 26 Fouz-Hernandez, Santiago and Alfredo Martinez-Exposito. Live Flesh: The Male Body in Contemporary Spanish Cinema. London and New York: I.B. Tauris, 2007. (26-27) 27 Proof of Steve Neale’s position that “Where women are investigated, men are tested.” (Neale, Steve. “Prologue: Masculinity as Spectacle, Reflections on men and mainstream cinema”. Screening the Male: Exploring masculinities in Hollywood cinema. Steve Cohan and Ina Rae Hark, Eds. London: Routledge, 1993. p. 19)

208

alone of being looked at.28 Here instead, we have femininity and masculinity as seen to be equally performative, equally masqueraded, so that both the male and female are signifiers of socio-cultural types (whether they be valid and reliable reflections of “real” persons or not), and so that performances of either gender may be said to connote signification (to be read, to-be-looked-at) itself. The crucial difference is that throughout Luna’s trilogy of films, women appear to be always already aware and willing to self-perform, so that each individuated character is protected under several layers of parodic performance. For the male, however, and especially for the protagonists Raul and Benito, the act of looking outside the self in order to perform masculinity as an element of one’s character necessitates the uncomfortable crossing of a boundary between the self and that which exists outside it. This verges on bringing about abject experience, as defined by Kristeva, and results in the male characters’ ultimate crying out against this self-introspection-cumprojection of the self onto externalized character and personality. For as Mulvey has said, the male cannot bear the objectification of his own male selfhood to the gaze—even if it his own. To repeat an observation by Evans regarding characterization within Jamon jamon: “Es un gran melodrama… con se personajes que prototipos de la nuestra pais.”29 As a unified cycle of films, it is Bigas Luna’s objective to present by way of his Retratos Ibericos a (granted, heavily parodic and self-conscious) cast of prototypical character symbols, representing whom he sees as, if not populating his nation in fact, then representing through a phallocentric/patriarchal/symbolic discourse of cinema those reflections of self-hood made familiar to the Spanish nation through the filmic medium. Thus we have a prototypical self-effacing female of indeterminate origins set against an alternately enthusiastically macho-performative and self-doubting Spanish male. Whilst the female prototype is evidently capable of gaining some degree of ironic distance from herself as contextualized entity, the male, at least in the films of Bigas Luna, still finds it to be a destabilizing, abject experience. Thus we may see Bigas Luna as setting the Spanish male, and with him the future of Spanish cinema and modes of gender, genre, and symbolic representation on the edge of itself, located somewhere between past historical context, present ambition, and apprehension of the promise of future self-actualization—or disappoinment.

28 Mulvey explains, “According to the principles of the ruling ideology and the psychical structures that back it up, the male figure cannot bear the burden of sexual objectification. Man is reluctant to gaze at his exhibitionist like…In a world ordered by sexual imbalance, pleasure in looking has been split between active/male and passive/female…with their appearance coded for strong visual and erotic impact [women] can be said to connote to-be-looked-at-ness.” Thus the male gaze always already imposes meaning on the visual sign of the female. (Mulvey, Laura. Visual and Other Pleasures. Indianapolis: Indiana University press, 1988. pp.15-19) 29 Evans, Peter William. Op. Cit. (14)

209

EARTH SCIENCES PANEL

•

JUDGING PANEL Prof. Paul D. Ryan (NUI Galway) – Chair Dr. John Graham (Trinity College Dublin) Dr. Ed Jarvis (University College Cork) Judges’ COmments This essay analyses the possible reasons why fossils of Irish Pleistocene megafauna are not associated with evidence for early man, whilst the two are closely associated elsewhere particularly in the UK. It is a mature, balanced, well illustrated, well referenced and authoritative account that is worthy of publication in a journal promoting science. An essay of this quality can only help promote science in Ireland.

E A RT H S C I E NC E S

Early human settlement in the British Isles & Northern Hemisphere glaciations Caroline Martin “Evidence of evolution, including evolution of cultural complexity, is generally found not in a time series but rather in a series of discrete ‘snapshots’ that frequently cover a broad geographic area” (Vrba 1995).

Introduction he above statement refers to the scant fossilised remains and, in some cases, the historic folklore of erstwhile populations that shed intermittent light on the course evolution may take. Evolution and species migration, although characterised by changes in life’s genetics and behavioural patterns, are not processes solely defined by their organic components and cultural artefacts; the host environment of any given living assemblage steers evolutionary direction in space and time, and thus climatic signals in the geological record, which can be relatively unremitting, allow for an interrelationship between climate and evolutionary trajectories to be assessed. This hypothesis has been tested for the case of human evolution by Behrensmeyer (2006). The course of early human settlement in Britain correlates in time with the retreat and advance of Northern Hemisphere glaciations during the Pleistocene (~ 1800-11 thousand years before present (B.P.)) (Ashton and Lewis 2001). To date, no remains of human populations in Ireland have been found that are older than the 211

Holocene (~ 11,000-0 years B.P.). This study collates the relevant palaeoclimatological data – marine oxygen isotope stages –and archaeological data – mammalian faunal remains and evidence of human settlement – currently in the literature for the British Isles, so as to test the correlation in time of early human settlement with other major mammalian groups, within the climatic framework of coeval changes in environmental conditions, such as ice-sheet advance, sea-level fluctuation, temperature change, landscape alteration and habitat perturbation. By placing the timing and trends of early human settlement in Ireland within the context of that of Britain and mainland Europe, this account elucidates the contrasts between the distinct faunal and palaeoclimatological data sets characteristic of the British Isles. The role of climatic variability in the shaping of evolutionary trends is discussed with cross-referencing of case studies from Europe, the Americas and Asia. Climate change, together with the associated palaeogeographical variation of the British Isles during the Pleistocene, provides a backdrop from which to assess mammalian migratory patterns. The driving forces behind why early man travelled from mainland Europe to insular or peninsular Britain and Ireland across waterway barriers or land bridges has implications for understanding the stark contrasts within the British Isles’ prehistory.

Fact or ‘Artefact’? Attempts to study terrestrial geology or archaeology from a pre-glacial setting are thwarted by the fact that glaciers despoil the landscape by their rock-scouring ability. This argument, however, which is based on first principles, by no means eliminates faunal studies from pre-glacial and indeed inter-glacial environments; for example, extensive research in to Pleistocene Ireland was undertaken as part of The Irish Quaternary Fauna Project (Woodman et al. 1997). In their study of the British Late Mid-Pleistocene, relating climate, habitat preference and sea level, Ashton and Lewis (2001) provide a summary of the problems encountered in attempting to relate human remains and artefacts with population densities. Stuart (1995) compares remains of Pleistocene mammalian faunas, such as giant deer, hyena and humans from Europe, Britain and Ireland and highlights the difficulties in using faunal diversity as a measure of insularity of the British Isles due to uncertainties in age correlations. For example, a species of reindeer (Rangifer tarandus), known in Pleistocene Europe to be adapted to cold conditions, persisted in Britain into the Holocene, whilst several other cold-adapted taxa, such as artic fox, didn’t survive the Pleistocene/Holocene transition. However, in the case of Ireland, the obstacles pertain to having, as of yet, no Pleistocene human records with which to correlate with the other mammalian fossils that are present in abundance; perhaps they once existed but records are unfound or have been destroyed. This fact or ‘artefact’ that humans and other mammals did not coexist in Ireland until the Holocene has implications for the current understanding of the nature of human migratory patterns throughout Europe and indeed the rest of the world. 212

Fig.1. An outline of the temporal, palaeoclimatological and archaeological sequences of Quaternary divisions for Britain and Ireland based on δ180 sub-stages, glacial (G)/interglacial (I) stages as defined by pollen sub-stages, and cultural artefacts. Attention is drawn to two main points: firstly, the onset of the Midlandian pre-dates the Devensian, indicating the distinction between Britain and Ireland. Secondly, the first human settlements in Britain occur in the Cromerian, during which time Ireland was in the Pre-Gortian glacial. Data taken from Godwin (1956); Bowen and Sykes (1994); Tzedakis et al. (1997); West (2000); Waddell (2007). 213

For example, there is definitive evidence that Homo sapiens had migrated from Asia to the Americas by at least ~ 11,000 years B.P. via Beringia, the connective land bridge that existed in the Late Pleistocene between Alaska and Northeast Asia (Meltzer 1995; Fiedel and Haynes 2004; Gonzalez 2007). Evidence of the ‘Clovis’ method, an excellent example of precise lithic technology, designed for spearing fauna (Meltzer 1995), indicates that ‘Clovis’ man may have been the pioneer of North America that followed these fauna to Alaska out of Asia and thence to South America (Gonzalez 2007). The ‘Clovis’ theory relies on the acceptance of a clear temporal relationship between early man and their faunal quarries; however, there is mitochondrial DNA, archaeological and linguistic substantiation of an earlier group of Homo sapiens whose presence in North America is not supported by coeval migration with fauna via Asia, but nonetheless they appear to have been predecessors of the ‘Clovis’ people and may date to as far back as 40, 000 years B.P. (Nichols 1990; Schurr 2004). The earliest homininae (currently a subfamily of hominidae) records in Europe have recently been unearthed from the site of Sima del Elefante, Atapuerca, Spain, and date to 1.1-1.2 million years ago (Carbonell et al. 2008). Britain boasts artefacts from the genus Homo since ~ 500,000 years B.P., during the Cromerian interglacial in the Palaeolithic division of the Pleistocene (Bowen and Sykes 1994; Waddell 2007) (Fig. 1). In Ireland, the earliest homininae are Homo sapiens and the first settlements date to ~ 9,000 years B.P., in the Mesolithic division of the Holocene (Waddell 2007) (Fig. 1). This places rudimentary cultural and societal development of the genus Homo in Ireland up to ~ 500,000 years later than that of Britain, which itself is more in tune with early settlement of mainland Europe (Bowen and Sykes 1994; Waddell 2007; Niven 2007). Fig. 2 illustrates the global distribution and the timing of the first definitive settlement of early man during the Pleistocene, with an emphasis on the temporal and spatial contrasts between adjacent land masses. Biological and Botanical Evidence of Environmental Change Several key taxa of Pleistocene fauna and flora have been used to constrain the timing and nature of environmental change that affected northeast Europe. Evidence comes from terrestrial and marine samples that range from pollen grains and spores to foraminifera and ostracods to giant elk and mammoths. By representing migratory pulses, faunal turnovers provide insight in to palaeogeography and the behavioural patterns of major and mega-fauna in response to sea-level fluctuation (e.g. Turner 1995; Schreve 2001b), which in turn reflect the changing temperatures and physical conditions of the oceans that are preserved in the isotope signatures of micro-fauna (e.g. Bowen et al. 1989; Ashton and Lewis 2002), which can be corroborated with terrestrial palynological evidence that elucidates seasonal and longer climatic shifts (Turner and Kerney 1971; Tzedakis et al. 1997). Fig. 3 provides a summary of the broad scale temporal correlations between fauna, flora and climate that define the European environment during the Mid-Upper Pleistocene (500,000-0 years B.P.). 214

* ka ~500 ~1.6 Ma Northeastern Asia * Britain and Northwestern * Europe ~1.9 Ma ~1.1 Ma* * Iberia

~13 ka North America

~40 ka Indonesia and Papua New Guinea

* *

~12 ka

South America

* ka * ~40 Australia

Fig. 2. Global distribution of early man in the Pleistocene as indicated by stars. The dates, in thousands of years (ka) and millions of years (Ma), represent the timing of the earliest definitive settlement of early man on that land mass. Attention is drawn to three main points: Firstly, human settlement in Britain is dated to ~ 500 ka, whilst Ireland, ~250 km away, is unpopulated. Secondly, many other isolated land masses are unpopulated, including New Zealand, Madagascar and the Polynesian Islands. The colonisation of these islands coincides with the first definitive evidence of boat excursions (Cosgrove 2007); most are situated in further isolation from nearby populated land masses than Ireland is from Britain and mainland Europe. Thirdly, migration from North to South America, which must have been through a multifarious and sometimes harsh environment, took place in a matter of centuries. This represents a distance of ~17, 000 km. The African presence, being the birth place of human evolution, is denoted only by a single large star. Data taken from Groube et al. 1986; Bowen and Sykes 1994; Meltzer (1995); Gibbons (2001); Morwood et al. 2004; Zhu et al. (2004); Parfitt et al. (2005); Cosgrove (2007); Gonzalez (2007); Waddell (2007); Carbonell et al. (2008).

Ice Sheet Behaviour & Habitat Preference The Last Glacial Maximum (LGM) in Britain occurred during an ice age known as the Devensian, which persisted from ~ 110,000-10,000 years B.P. (Stuart 1982) and reached a maximum of southerly extent around ~ 22,000 years B.P. (Mix et al. 2001; Bowen et al. 2002). The Devensian broadly correlates in time with the Midlandian ice sheets, which periodically advanced across Ireland in what are known as Heinrich events during the last ice age, from ~ 120,000 – 10,000 years B.P., and like the Devensian reached their maximum extent ~ 22,000 years B.P. (Bowen et 215

al. 2002). In fact, some authors refer to both the Devensian and Midlandian ice sheets collectively as the British and Irish Ice Sheet (BIIS) (e.g. Bowen et al. 2002), which for studies of prehistoric human settlements, such as presented by White and Schreve (2000), is an oversimplification. It is shown in Fig. 1 that they are not entirely coincident. These glacial advances shoaled global sea levels to that of ~ 120 m below the present mean value (Siddall et al. 2003; Gonzalez 2007). For the British Isles, the magnitude of the rise and fall of sea level relative to present levels was of the order of 30-50 m (Keen 1995; Lambeck and Purcell 2001). These sea level fluctuations were sufficient to cause sub-aerial exposure of hitherto submerged land masses, including connective bridges between Ireland and Britain and between the British Isles and continental Europe and littoral and sub-littoral zones (Devoy 1985; Lambeck 1996; Lambeck and Purcell 2001; White and Schreve 2000). Isostatic rebound of the land occurred during the interglacial retreats of the ice sheets, causing local relative changes to sea level as differential uplift and subsidence occurred (Lambeck and Purcell 2001). It was during the warmer interglacial periods of the Pleistocene known as interstadials that a rich Mammalian fauna diversified in the British Isles (Woodman et al. 1997). During colder times, abandonment and migration took place, often southwards, when available ecospace in northern Europe was limited by the extent and distribution of the ice (White and Schreve 2000). The early interstadials also were times of great mammalian migrations from continental Europe to the British Isles, providing animals like woolly mammoth with essential exposed connective land bridges by which they could make the transition (White and Schreve 2000). Perhaps the necessary interplay of marine regression and land exposure was optimised during the early and late phases of interstadials, when ice sheets were less of a barrier whilst sea levels were still low or beginning to shoal. Conditions during the LGM, for example, may have imposed a climatic threshold, which when crossed would have rendered Ireland, and perhaps most of Britain, wholly inaccessible. The mammalian populations of Pleistocene Britain included settlements of Homo heidelbergensis, an ancestor of Homo neanderthalensis and Homo sapiens, as far back as 500,000 years B.P., where remains have been found in temporal, geographical and ecological association with several faunal taxa, such as tools carved from deer bones, butchery marks on large mammal bones and later even cave art depicting wild fauna (Pike et al. 2005; Waddell 2007; Ugan and Byers 2007a; Ugan and Byers 2007b). These early inhabitants exploited flint from within the southern chalk cliffs for use as weapons and tools (Roberts and Parfitt 1999). It has been proposed that early man, by exploiting fauna for food, clothing and materials, would have followed herds across land masses as glaciers advanced and retreated and that they would have settled accordingly (e.g. Haynes 1980). Such quasi-synchronous migrations could have occurred via land connections between continental Europe and Britain during the late Pleistocene (White and Schreve 2000). 216

Fig. 3. Temporal correlation between the marine oxygen isotope stages (OIS) 1 – 13, European palynological stages, and major faunal sites in Britain and Ireland. The oxygen isotope curve represents global ice volume fluctuations as derived from the composition of benthic foraminifera. The odd-numbered OIS stages (interglacials) are tuned to orbital frequencies. The palynological curve illustrates the percentage of pollen grains, which when high, signifies forest growth. A high percentage during interglacials shows that forests are favoured during these intervals; however the terrestrial pollen data records more climatic variability than the marine record. The dashed line and solid lines are based on data from two species of pine. Oxygen isotope and palynological graphs modified after Tzedakis et al. (1997). Data compiled from Martinson et al. (1987); Toth and Schick (1993); Mithen (1994); Woodman (1997); Aldhouse-Green (1998); Currant (1999); White and Schreve (2000); Schreve (2001b); Currant and Jacobi (2001); Stuart and Lister (2001); Waddell (2007). 217

M ajor fauna vs human occurrence

Major faunal assemblage dates (thousands of years B.P.)

500 450 400 350 300 250 200 150

R2 = 0.9971

100 50 0 0

100

200

300

400

500

Human artefact dates (thousands of years B.P.)

Fig. 4. Strong spatial and temporal correlation of British major faunal and human artefact assemblages since 500 ka. The gap in the data represents ~150 ka in Britain’s prehistory for which there is no evidence of human occupation. Data taken from Dawkins (1910); Stringer and Gamble (1993); White and Schreve (2000); Currant and Jacobi (2001); Schreve (2001a-b); Gowlett (2006); Gilmour et al. (2007); Waddell (2007). By collating relevant data, it is illustrated here that, there is a strong correlation in time between British sites of major fauna and those of early man since the Mid-Late Pleistocene (500,000-0 years B.P.) (Fig. 4). In contrast, the mammalian taxa of Late Pleistocene Ireland, whilst rich in major fauna, is devoid of remains of early man; however, a strong correlation in time exists between the major faunal groups since the Late Pleistocene of Britain and Ireland (50,000-0 years B.P.) (Fig. 5). Results show that unless the remains of Irish early man have been obliterated entirely or as of yet, are unfound, synchronous migration of major fauna and early man, in to Ireland, did not occur. Several authors provide palynological, palaeoclimatological and archaeological evidence of faunal evolutionary turnovers and colonisation – re-colonisation human settlement cycles in Britain, which occurred in response to the fluctuating climatic conditions during the Pleistocene (Stuart 1982; Stuart and Van Wijngaarden – Bakker 1985; Currant 1989; Tzedakis et al. 1997; Currant and Jacobi 2001) (Figs. 4-5). The same data types provide evidence for similar patterns of climatol218

ogy and biological behaviour existing in Pleistocene Ireland, with the exception of human activity (Fig. 3). It is possible that, the British Isles and Ireland in particular, being the extremity of a northwestward faunal migration pattern observed across the whole of Western Europe (Hewitt 2000), may have been characterised by less of a demand for fauna by early hunters. Woodman et al. (1997) suggested that the evidence for human activity in Late Pleistocene Britain was not sufficiently resolved to provide time constraints on the duration of discrete settlements, and that they may have been intermittent and relatively short-lived. Following this line of investigation, Woodman et al. (1997) suggested that the absence of Pleistocene humans in Ireland could be attributed to rising sea levels, which would have isolated the island during habitable interstadials from an already sparsely populated Britain, and would also explain why faunal diversity was somewhat lower. However, of the taxa that are identified to have been abundant in Ireland during the Pleistocene, several are known to have been principal species in Britain that were exploited there by early man as a staple resource (Waddell 2007) (Figs. 4-5).

Patterns of Climate, Palaeogeography & Mammalian Migration White and Schreve (2000) labour the point that the late glacial/early interstadial temporal distributions of human settlement in the British Isles represent pulses of abandonment and re-colonisation episodes. These would have been characterised by a time lag in deglaciation with respect to rising temperatures and sea-levels and it is suggested that efficient re-growth of flora would have promoted herbivore, then carnivore and/or human re-colonisation. In their tripartite model, the late glacial/early interstadial period, when reestablishment of erstwhile or new communities occurred, is the second of three phases, which combine palaeogeographical, palaeoclimatological and archaeological evidence in support of a working framework from which to reconstruct human settlement in Britain. The first phase is during maximum ice extent, when abandonment to the southeast occurs, and the third phase is during the regressive extremes of the interstadial, characterised by occupation of Britain coupled with isolation from mainland Europe. Skeletal remains of Pleistocene assemblages containing woolly mammoth, brown bear, spotted hyena, giant deer, reindeer, red deer, wolf, wild horse, arctic fox, hare and lemming are described from several locations across Britain and Ireland, during both glacial and interstadial times, where they survived the destructive weathering of the ensuing glaciers (Woodman et al. 1997; Currant and Jacobi 2001; Stuart and Lister 2001). If abandonment was the status quo of Pleistocene Britain, the latter point suggests that, during glacial advances, perhaps humans were the first to leave (Fig. 3). Some communities of fauna, such as those listed by Woodman et al. (1997), may have remained in un-glaciated pockets during total insularity. However, endemic evolution, such as there is evidence for in Late Pleistocene Jersey (Lister 1995), has not been reported from mainland British fauna sites of any age. In addition, evidence of pulsed migration of major fauna in to Ireland during the Pleistocene, including re-colonisation by some species, has been 219

M ajor Fauna (Britain and Ireland) vs time

Major faunal assemblage dates (thousands of years B.P.)

50 45 40 35 30 25 20

Ireland

Britain

10 5 5

Time (thousands of years B.P.)

Fig. 5. Strong temporal correlation of major faunal assemblages from Upper Pleistocene Britain and Ireland. Data taken from Currant (1989); Stuart (1995); Woodman et al. (1997); Coard and Chamberlain (1999); Currant and Jacobi (2001); Schreve (2001b); Gilmour at al. (2007); Waddell (2007). presented by Woodman et al. (1997). Ireland is not differentiated in the speculative investigation of mammalian migratory patterns presented by White and Schreve (2000) and the questions surrounding the absence of Pleistocene man persist. Using the tripartite model of White and Schreve (2000), the time-lag idea could have potential connotations for elucidating migratory patterns in the British Isles. If man and fauna abandoned and re-entered Britain on a cyclical basis, as suggested by the model and supported by archaeological evidence (Mithen 1994; Toth and Schick 1993; Aldhouse-Green 1998) (Fig. 3) during discrete windows of opportunity, then perhaps Ireland lay beyond the scope of reach, at least by land, to early man, who for genetic, social or demographic reasons, may not have travelled as far so fast as other mammalian faunas. There is evidence that ‘Clovis’ man spread from Alaska to Patagonia, a distance of over 17, 000 km, in fewer than 2, 000 years (Gonzalez 2007), but this is contested on the grounds of it being of insufficient time to be of a plausible evolutionary trajectory (Meltzer 1995). The most conservative evidence for the evolution 220

and geographical dispersal of early man in the Americas, based on mitochondrial DNA evidence, linguistic patterns and dispersal rates, puts their initial arrival at ~ 40,000-50,000 years B.P. (Meltzer 1995); therefore, at its most cautious estimate, migration from the north of North America to the south of South America took place in just under ten times less time than that of migration from the initial occupation of Britain at ~ 500,000 years B.P. to that of Ireland at ~ 9,000 years B.P. A more conservative estimate of the time lag between human colonisation of Britain and Ireland is met if human and major faunal migrations are coupled; this would place plausible human settlement in Ireland at ~ 120,000 years B.P. (Waddell 2007) and would reduce the time deficit to just over twice as long as human migration from North to South America.

Discussion The points presented in this study raise two possibilities: one, there being any combination of physical or biological restrictions that could have impeded human migration in to Pleistocene Ireland – for example, an impenetrable landscape such as thick vegetation, an insurmountable physical barrier in the form of water or ice, or having populations of insufficient densities with which to support re-establishment – or, that there did exist humans in Ireland in the Pleistocene, but that their remains have been obliterated, or as of yet, are unfound. The two ideas in support of no humans in Pleistocene Ireland will be further discussed here. Roe (1996) described two lithic cultures that influenced cultural development in Britain. The first of these are known as the Clactonian people and are largely defined by the absence of hand axes in their society. The second are Acheulean, who unlike the Clactonians, were well equipped with hand axes. If thick vegetation were to hinder human settlement in Ireland, it may be supposed that the Clactonians would have been particularly inept at felling niches for themselves. However, hand axes comprise some of the earliest artefacts of human settlement in Britain (Meltzer 1995), described from the Boxgrove site in Sussex and dated to ~ 500,000 B.P. (Roberts and Parfitt 1999), and so manpower was not the limiting factor. However, if Ireland was only accessible by tenuous land connections, as has been suggested by Devoy (1985), then perhaps migration was physically impeded during times when Britain was occupied by the more capable human settlers. The latter point is to some extent refuted by the abundant Irish Pleistocene fauna that would have made their way via land connections likely suitable, too, for human passage. Excursion by boat would seem to provide the obvious answer to the quandary of accessing island Ireland. However, at this time in prehistory, there is yet only unsubstantiated evidence that trans-oceanic migrations were taking place, and no evidence that Northern Europeans had developed the technology at this point (Meltzer 1995). Climatic conditions and environmental instability impose a constraint on population growth and migration speeds are thus retarded (Whitley and Dorn 1993). This puts pressure on founding groups to be large enough in size to cope with dis221

persal; according to Woodman et al. (1997) these were discrete and isolated settlements in Pleistocene Britain. Thus, there may have been population density limitations due to environmental duress, and physical barriers that prevented Ireland from being populated by humans until amelioration of the climate occurred in the Holocene, and agriculture took over from hunting as the main form of human sustenance; which offered incentives to devise technologies for the purpose of clearing land of coarse vegetation, and to demographically expand (Kalis et al. 2003). Many other parts of the world remained unpopulated by humans until well in to the Holocene, including New Zealand, Madagascar and the Polynesian Islands (Green and Sussman 1990). New Zealand, whose first human inhabitants arrived ~ 1,000 years B.P. (Diamond 2000), is over 2,000 km from mainland Australia, and as such is considerably more isolated than Ireland is from Britain (~ 240 km max.). Madagascar’s and the Polynesian Islands’ first humans did not arrive until the Late Holocene (Diamond 2000), but perhaps their location was not in the immediate paths of human migratory trajectories and in most cases, deep and vast expanses of water lay between them and the populated mainland. The delayed human migration from Britain to Ireland is analogous and somewhat temporally related to that of the inhabitants of Pleistocene Indonesia, who failed to cross the 100 km water divide to the ancient landmass of Sahul, north of Australia, despite their close proximity from 800,000-12,000 years B.P. (Morwood et al. 2004; Cosgrove 2007). Cosgrove (2007) heralds the arrival of man on Sahul at ~ 12,000 years B.P. as definitive evidence for the first trans-water way excursions by boat. To further the study of ‘late’ human migrations, attempts to correlate climatic and evolutionary patterns in the British Isles with those of Asia and Sahul, where major sea-level fluctuations are also recorded, should be undertaken.

Conclusion The fluctuating climate and geography that characterised the environment of Pleistocene Europe provides a framework with which to assess the trajectory of mammalian evolution across the British Isles. The oxygen isotope and terrestrial pollen records of the Pleistocene can be compared in order to temporally correlate the retreat and advance of Northern Hemisphere glaciations with shifting habitats on land. The contrasting faunal assemblages and human remains, in terms of temporal and spatial distribution and diversity, found thus far in Pleistocene Britain and Ireland, offer insight into the physical and biological constraints on mammalian migratory patterns. This allows comparisons to be made with the course of Asian and American mammalian migrations and evolution during the Pleistocene. Despite the destructive capacity of glaciers, several, well-preserved and diverse mammalian faunal and human artefact sites in Britain, dating to ~ 500,000 years B.P., have been comprehensively studied, with ample mammal catalogues presented for each of the investigation sites. Ireland hosts several, and in some cases equally diverse, faunal sites dating to ~ 120,000 years B.P. The principal difference 222

across the British Isles’ prehistory is the absence of human remains, in archaeological sites thus far unearthed, in Pleistocene Ireland. This fact, or ‘artefact,’ is particularly puzzling in light of there being such a rich and diverse fauna in Late Pleistocene Ireland analogous to the major fauna of Britain with which human remains are found in intimacy, as results of collated data in this account support. The fact that nearby Britain lay populated since just under half of a million years earlier suggests that, at least during ~ 500,000 – 120,000 years B.P., Ireland was not suitable for mammalian habitation. There is evidence that, the patterns of Pleistocene Britain and Ireland’s mammalian migrations indicate cyclical colonisation/re-colonisation patterns in response to changing environmental conditions dictated by the Northern Hemisphere Heinrich events, which were characterised by both temporally and spatially alternated pulses of ice-sheet advance and retreat. In studying the palaeogeographical and palaeoclimatological complexities that such a varying landscape introduces to mammalian environments, collated data in this account show that it essential to avoid describing the British Isles in terms of a single, British-Irish Ice Sheet when assessing mammalian migration. Such a generalization neglects the interplay of varying ice thicknesses, sea-levels, land exposure and uplift that differentially affected the particular land masses within the British Isles. Given that the environmental conditions in Ireland between ~ 120,000 – 9,000 years B.P. were suitable for a wide range of mammalian fauna, it is plausible to suggest that human occupation was hindered by inherent biological constraints. In particular, there being evidence that human settlements in Pleistocene Britain were discrete and intermittent, it may have been that population densities were insufficient to promote dispersal into Ireland.

223

ECONOMICS PANEL

•

Judging panel Prof. Niamh Brennan (University College Dublin) – Chair Prof. Frances Ruane (ESRI) Mr. Constantin Gurdgiev (Business&Finance Magazine) Mr. Donal de Buitleir (AIB) Mr. Austin Hughes (IIB Bank) Prof. Colm Harmon (University College Dublin) Judges’ comments While fixed income analysts use the yield curve to understand conditions in financial markets, economists use it to comprehend economic conditions. This term spread helps to forecast recessions and changes in real economic activity. Unlike most applications, the direction of the change in the spread is not indicative of the duration or the strength of the following recession. The best forecast of future real activity is provided by the level of the term spread, not the change in the spread, nor even the source of the change in the spread. This paper is concerned with in-sample prediction. Reliable quarterly data from the ECB with no gaps were used with residual analysis to justify the model. It was shown that including the spread of the previous year is sufficient. The results fit in with the stylised observation that the term spread has lost its predictive ability as a predictor of the growth in real GDP since the great Moderation and since the EMU was established. This paper shows that it is important to divide the sample into periods corresponding to different monetary regimes. The sale of human organs, whether from a cadaver or a living donor, is proscribed in virtually every country in the world. There is a persistent shortfall between the number of organs available and the demand for them. This is an intriguing economic research question because it is a significant health-care problem for which a market solution already exists. This report explores whether allowing a market for kidneys is economically efficient. The economics of kidney transplants is explored through a brief analysis of the current procurement approach and a critical appraisal of suggested market solutions. Transplant professionals are increasingly evaluating patients for transplantation who are more likely to die than receive a donor organ, while potential recipients cling to the hope that they may beat the odds and receive an organ while they are still healthy enough to undergo surgery. Economic solutions such as allowing a market for kidneys must be considered; the argument for blanket prohibition is flawed and should be rejected.

E C ONom ic s

An econometric investigation into whether the term spread helps to explain the dynamics of GDP growth in the euro area. Michael Curran

I. Introduction good predictor is a variable that helps to forecast another variable. While fixed income analysts use the yield curve (the difference between long and short yields) to understand conditions in financial markets, economists use it to comprehend economic conditions. This term spread helps to forecast recessions and changes in real economic activity since it incorporates expected changes in rates; it is therefore an indicator of future changes in real activity. Unlike most applications, the direction of the change in the spread is not indicative of the duration or the strength of the following recession, however: ‘The best forecast of future real activity is provided by the level of the term spread, not the change in the spread, nor even the source of the change in the spread.’ (Estrella, 2005: 6, my emphasis)

The literature suggests that the yield curve Granger causes output growth;1 however, this breaks down after the mid 1980s in the US, corresponding to 1 There are few empirical applications that test Granger Causality with more than two variables.

225

Greenspan’s term as chairman of the Fed, i.e. during the past twenty years, in what has been referred to as the ‘Great Moderation’, or the ‘maestro’ years. The spread does not Granger cause real GDP growth post-EMU, while it does preEMU, which may be explained by an update of information in the information sets used to form private expectations – i.e. the information contained in the yield curve. I.I A Brief History of the Literature Prelude from Estrella (2005) While research as it is presently recognised on the difference between long- and short-term interest rates originated in the late 1980s, the history of the subject dates back until at least 1913 with Mitchell, according to Estrella (2005). Kessel (1965) was the first to refer to the behaviour of the term spread, albeit in prose, rather than in quantitative terms. Using data dating back to 1858, he showed that the term structure turned negative at peaks in the business cycle. This difference or term spread, which is the slope of the yield curve was seen to be inversely proportional to real economic activity, as investigated by Laurent (1988), who used the term spread to predict GNP growth. Furlong (1989) was the first to look at the term spread between 10-year- and 3-month-interest rates. Estrella & Hardouvelis (1989, 1990, 1991) regressed real GNP growth on the spread between 10-year- and 3-month-interest rates. Reviewing data from 1870-2003 on Germany, Baltzer & Kling (2005) conclude that predictability changes intertemporally and is related to monetary policy. The robustness of this relation was considered by Stock & Watson (2003), who emphasised the necessity to search for changes in parameter values arising from changes in monetary policy regimes. Recent studies suggest that the relationship may have undergone some structural changes, especially with regard to parameter values. There are problems however, in using the Chow test since the assumptions on which it is based are violated for AR regressions.2 If one does not want to specify the point at which the structural break in the underlying relationship may have occurred, there are alternative methods such as the recursive residual test. With time series data the recursive estimation is appealing due to the property of times series, viz. that it gives a unique order to data. (Johnston & DiNardo, 1997: 118) Models with qualitative dependent variables appear to be more robust to shifts in policy or other economic conditions. (Estrella, Rodrigues & Schick, 2003) Binary variable models have the same accuracy as continuous variable models; however, the results are dependent on the sample period, especially for continuous variable models; binary models are more robust with respect to recessions. In many circumstances, the yield curve is the best indicator; ‘at predictive horizons beyond one quarter, there is no match for the term structure as a predictor of recessions.’ 2 It assumes that the two error terms (one for each equation) u1t and u2t are independently distributed and that error variances in the regression must be the same.

226

(Estrella, 2005: 8) With a tightening of monetary policy, a rise in the short term interest rates helps reduce inflationary pressures; the market expects a subsequent easing of monetary policy. The fact that expected future short-term rates are important determinants of current long-term rates induces an increase in long-term interest rates. Though monetary policy is not the only determinant, albeit an important one, of the predictive power of the yield curve for future real GDP growth, and while the Expectations Hypothesis is rejected in econometric tests, interest expectations play an important role in their relation with future real demand for credit and future inflation.3 Far from being a ‘passing phenomenon’, the predictive power of the yield curve may not have disappeared, but rather the values of the parameters may have changed. According to theory, there is a persistent predictive relationship between term spreads and future growth in real GDP, while the exact parameter values might change over time. As Estrella concludes, ‘although yield curve inversions may not e followed by recessions as a matter of universal mathematical principle, they should definitely raise warning flags about future output growth.’ (2005: 10)4

Bordo & Haubrich (2004)5 Like Baltzer and Kling (2007), Bordo & Haubrich find that a broader historical perspective is helpful in discovering the reasons behind the ability of the yield curve to predict future output. Perceptively, they make the point that recent work treats ‘the spread as one variable in a regression designed to predict future output’, citing the equation: DYt+4 = α + βspreadt + γ(L)DYt [1.1] where DYt is annual growth rate of real GNP (at a quarterly frequency) and γ(L) is lag polynomial of length four (current and three lags). They find that predictability changes both intertemporally and between different monetary regimes: low-credibility, high-inflation-persistence regimes have better predictability.6 Similar to the pre-EMU period, Bordo & Haubrich find that the sub-period before the Federal Reserve was established (1913) had the highest predictive ability; the term spread (before 1985) did better than the lags of GDP alone, particularly in the post-Bretton Woods period between 1971 and 1984. The predictive content of the term spread 3 Other important determinants include the risk of liquidity premia. 4 The feature of negative term spreads anticipating recessions is still reliable. 5 Intriguingly, Bordo & Haubrich include a passage reminiscent of Hume’s automatic price-specie flow mechanism, only in modern monetary form in order to illustrate the effect of inflation on prices and interest rates. 6 Bordo & Schwartz define a monetary regime: ‘as a set of monetary arrangements and institutions accompanied by a set of expectations … expectations by the public with respect to policymaker’s actions and expectations by policymakers about the public’s reaction.’ (1999: 152)

227

may be investigated by conducting a Granger causality test; the problem is how to know when the difference between the mean square errors is not due to chance alone; also the methods adapted do not indicate how the coefficients change over time or regimes. With a credible commitment to price stability, long-run expectations of inflation are approximately zero. Shocks can be real or inflationary;7 real shocks are taken as temporary, and like that of temporary inflation, have different effects on short-term and long-term interest rates (the expected inflation effect is assumed to dominate the liquidity effect with inflationary shocks). While the liquidity effect tends to lead to a steeper yield curve, only short term interests rise due to the inflationary shock and so eventually, the yield curve will become flatter; likewise, a real shock flattens the yield curve and may even invert it. As an inversion could be due to either real or inflationary shocks, the yield curve becomes a noisy signal under credible regimes. In a fiat money standard without credibility, inflation can be seen to follow a random walk, which is very persistent, so expectations are formed towards a persistently higher rate of inflation; short and long rates increase leaving the term spread unchanged. This contrasts to a temporary real shock, which tends to flatten the yield structure towards an inversion. The yield curve is a better predictor in less credible regimes because nominal shocks will raise short and long interest rates leaving the term spread unaffected, whereas under more credible regimes, only short rates change and so the signal from the yield curve becomes noisy, since both real and inflationary shocks affect the yield curve. In either regime (credible or non-credible), temporary inflation does not affect long-term interest rates, a result deriving from the expectations hypothesis combined with the Fisher equation: it = rt + pet [1.2] where i is the nominal interest rate, r is the real rate and pe is the expected inflation rate. After the demise of the Bretton Woods international monetary system, the fiat money regime succeeded, with a decade of high inflation (the OPEC oil price crisis had a part to play);8 my present paper covers the Euro-area since January 1970. Increasing persistency of inflation is taken as evidence of a regime shift after Bretton Woods by Bordo & Haubrich. The persistence of inflation is inversely proportional to credibility.9 This subject is perfectly suited to Bayesian econometrics, which Co7 An inflationary shock may occur as a monetary authority’s response to unemployment, for example. 8 Bordo & Schwartz (1997) poured vitriol over policymakers ‘use of inappropriate policy models and indicators’, evocative of statements made by centuries of previous economists about the monetary policy of John Law and his Mississippi system. 9 I take exception to treating low credibility and high persistence as synonymous since it may attribute causation to where there is only correlation: ‘persistence can provide a quantitative way to

228

gley & Sargent (2001) applied to a VAR, finding that persistence varies over time, being high in the 1970s and 1980s and lower since then. Bordo & Haubrich thus argue that persistence of inflation ought to be a key determinant of the predictive content of the term spread. Like great inflation regimes, the pre-EMU period witnessed very persistent inflation and good predictive power. My approach is justified by Bordo & Haubrich: “A somewhat different approach to uncovering the effect on predictability would be to correlate the two at a quarterly frequency. At least initially this gives a more continuous variable than shifts in regime and does not require assuming particular dates for regime changes” (2004: 27)

Fellner’s (1976, 1979) introduction of credibility to the lingua of economists was incorporated into the stance that the real costs of disinflation may be lower than expected. However, the New Classical Macroeconomic contention that there can be ‘gain without pain’ may be turned on its head by referring to the UK, which witnessed a fall in its inflation from 13.5% (1979) to 4.6% (1983) at the cost of a rise of unemployment from 5% to 12.4% in response to the massive monetary contraction – was there a credibility gap? The ECB is the most independent central bank in the world. (Salvatore, 2002) Post-EMU, there has been a continued pursuit of low inflation and an emphasis on transparency. This ‘echoes the convertibility system of the old gold standard.’ (Bordo & Haubrich, 2004: 23) Bordo & Haubrich conclude that the yield curve has predictive power for future growth over the past 125 years and is robust (across various specifications); low credibility (high persistence) monetary regimes tend to have better predictability. Their conclusion supports the belief that monetary regime is vital in interpreting the yield curve. It is ‘misleading to draw general conclusions from data generated in one inflation regime.’ (2004: 28) They articulately and astutely sell their theoretical and empirical results to policymakers with the witty phrase, viz. ‘credibility is not always an unmixed blessing.’ By this, they mean that following Friedman (1968), monetary policy can be made less a source of instability through credibility, but that credibility itself may create problems for policymaking since the information content from the yield curve source diminishes with credibility. Importantly, they view an historical perspective beneficial in illuminating the inflationary and real effects of different monetary regimes. distinguish policy regimes and assess how the predictive content of the yield differs across them.’ (Bordo & Haubrich, 2004: 24) A diligent worker may not reach his productive target, nor a hardworking student achieve high marks due to bad luck in the same way that a central bank may fail to meet its target, even if the public believes in what the central bank says it wants to achieve ex-ante – i.e. even if it has credibility.

229

Baltzer & Kling (2007) Using Bordo and Haubrich’s model with their own data, Baltzer & Kling (2007) inversely link credibility of monetary regimes with the predictive power of the yield curve. My paper compares the impact of different monetary regimes on the predictability of economic growth by having a sufficiently long study, although my paper uses standard simple multiple regression instead of structural VAR models. Like my paper, they regress economic growth rates (DYt) on lags of spreads β(L) spreadt (where L is the lag operator); unlike it they apply maximum likelihood to their equation: DYt+4 = α + β(L)spreadt + γ(L)DYt + εt [1.3]10 Peel & Ioannidis (2003) make a similar comparison as Baltzer & Kling, except that they focus on a monetary policy reaction function, which shows that when central banks focus solely on inflation (forecast) targeting, the relationship between economic growth and spreads breaks down. With non-credible regimes (pre-EMU) linked with high inflation persistence, short-term and long-term rates rise so that there is no effect on spreads; Baltzer and Kling treat real shocks as temporary, so only the short-term interest rate is affected and therefore the term spread changes; thus under a non-credible regime, only real shocks affect term spreads. Under a credible regime (post-EMU), inflation is perceived to be temporary, and so inflation and real shocks affect short term interest rates only and hence spreads; observing spreads becomes a ‘noisy signal’ – changes in spreads may be driven by either real economic shocks or inflationary shocks; as a result, under a credible monetary regime, spreads have low predictive power. Like the post-EMU period, spreads experienced low predictive power during the highly credible gold standard period as opposed to the interwar period (with an R2 of 0.62) that resembled the free float period pre-EMU. Baltzer & Kling conclude that they find that spreads are useful to improve predictability post 1971.

II. Data Description In contrast to former studies this present paper looks at real GDP growth as opposed to that of GNP in the Euro-area, since GDP is available and consistent during the time frame under investigation (1970 – 2006); other papers focus mainly on real GNP growth, e.g. Laurent (1988, 1989). Real GDP growth versus 10-year- minus 3-month-interest rates is a frequently used measure.11 148 quarterly observations were taken from the ECB on real GDP, the ten-year interest rate and the three10 This is merely the statistical version of the mathematical equation [1.1]. 11 As opposed to forecasting inflation, where forecasting horizons are matched, interest rates with maturity yields that are far apart should be used (and are used) in forecasting real activity; the 10-year interest rate is chosen, as on a consistent basis, it is the longest maturity available in most countries over a considerable sample period.

230

month interest rate spanning from the first quarter of 1970 to the final quarter of 2006.12 However, as the investigation concerned the annual growth in real GDP13, the first observation for term spread had to be omitted to make both the regressors and the regressand dimensionally compatible; also, since the focus is on lags of the growth rate, another observation is lost – a total of two observations are lost for any sample period; as a result, 146 observations of the growth rate in real GDP and the term spread were used for the full sample.14 The sample statistics for the data are reported in table 2.1. Figure 2.1 plots real GDP, which is clearly nonstationary as its mean rises over time; the growth rate of real GDP appears to be stationary from figure 2.4 (although the variance seems to be smaller after 1997 with the advent of the EMU) – logarithmic transformations reduce the variance, while the differences remove any deterministic trends15; figure 2.2 plots the ten year- versus the three month-interest rate; and figure 2.2 plots the spread between the two (i.e. the difference).

Variable

Real GDP (€)

10-yr (%)

3-m (%)

Maximum

1,763,745.4164

15.2246

16.1147

Term Spread (%) 3.0669

Real GDP growth (%) 7.6278

Minimum

739,110.1636

3.2624

2.0627

-2.3538

-6.424

Mean

1,216,702.1976

8.5295

7.6878

0.8478

2.3947

Std. Deviation

290403.8425

2.9306

3.4858

1.1104

2.2716

Table 2.1. Summary Statistics for the data used for Full Sample Period

iii. Empirical analysis This paper uses a formal statistical model in terms of a linear regression with continuous variables, instead of non-linear statistical equations, or those such as the logistic Generalised Linear Model for binary data. An advantage of this formal approach is that it quantifies guidelines regarding the responsiveness of real GDP 12 If the interest rate chosen is one controlled by the central bank, it will not fully reflect the expectations of participants in financial markets; in the US, the usefulness of the short-term Federal funds rate as a provider of information on market expectations is diminished by the Federal Reserve’s control over it. 13 Calculated by multiplying the quarterly growth by 4: [log(Yt+1) – log(Yi)]*100*4], where Yt is the real GDP at time t (t+1 is the next quarter). 14 The RHS observations run from 1970Q3 until 2006Q4 – in order to take account of first order lags of the growth rate of real GDP. 15 The real GDP time series is not a purely deterministic function, but rather it is a linear combination of functions; it comprises two waves: a high-frequency, short-period wave and a low-frequency, long-period wave; differencing eliminates the long-run component.

231

growth to changes in the term structure and provides specific lead-lag relationships. Lagged effects are included in order to distinguish between changes in market expectations of economic fundamentals (in which case the change in spread may be persistent) and temporary disequilibria in markets for interest-bearing assets (driving high frequency changes in spreads); interest rates may react contemporaneously to news, whereas GDP does not react as fast due to friction; the ECB raises interest rates when inflation is high, but the affect on the economy will be delayed with a lag on average of 9 months. One statistical issue is overlapping observations. Using quarterly data to estimate real GDP growth implies that two consecutive observations of real GDP growth tally with time periods having three quarters in common. In such circumstances, measures of statistical significance are rendered inconsistent, so must be replaced, for example, by generalised method of moments (Hansen, 1982). The above discussion suggests the following regression: yt = c + Si=1-to-priyt–i + Si=1-to-q gi xt–i + et [3.1] where yt is the growth rate of real GDP; xt denotes the term spread; p and q are the number of lags of yt and xt, respectively; and et is assumed to be a Normally distributed error term with constant variance and zero mean.

Whole-sample analysis The optimal number of lags determined from the Schwartz-Bayesian criterion was one for both the growth in real GDP and the term spread; the BIC corresponding to the regression for p = 1, q = 1 is 1.5023, which is the minimum value of the BIC for any number of lags. So, a regression was carried out on the equation: yt = c + riyt–1 + gi xt–1 + et [3.1a]. Figures 3.1.1 and 3.1.2 are histograms of actual (raw) residuals and Studentised residuals, respectively for the full sample. Importantly, while the bin size is large, it can be seen that the residuals are approximately normally distributed (the histogram of Studentised residuals is bell-shaped with about 95% of the area contained within ±2).16 Figures 3.1.3 and 3.1.4 plot actual and Studentised residuals, respectively. The variance is smaller for the Studentised residuals and for the period after 1997, so it would be better to look at the two samples individually as I have done in section 3.2; but since there are only seven outliers (oustside ±2) from 146 (<5%), it seems that assumption of normally distributed error terms of constant variance and zero mean is justified. The ith standardised residual is defined as:

16 Histograms will underestimate and overestimate the area to the left and right of the centre (zero), respectively

232

ei = ri σ^√(1 – hii) [3.2]

where hii is the diagonal element of the projection matrix H = X(XTX)-1XT and the estimate of σ2 is: σ2^ = RSS/(n – p)

[3.3]

where n is the number of observations and p is the number of parameters.

CONSTANT (c) 1.3365

Standard Error 0.2540

yt-1

0.1943

0.0810

2.3981

[.0178]

xt-1

0.6752

0.1650

4.0933

[.0000]

Regressor

Coefficient

T-Ratio

[Prob]

5.2614

[.0000]

Statistic R-Squared

0.1996

R-Bar-Squared

0.1884

BIC Durbin’s hStatistic F-Statistic

1.5023 F(1,143)

0.5507

[.5818]

15.000

[.0002]

Table 3.1. Results of Regression on [3.1a] for the full sample period:17 The positive intercept (1.3365) may be interpreted as the extra positive growth in real GDP after the first lag of yt and xt (i.e. yt-1 and xt-1) have been taken into consideration – an extra 1.3365% to be added to the growth of real GDP. The coefficient on yt-1 implies that 19.43% of the annual growth of real GDP in the previous quarter (t-1) is added to the annual growth of real GDP (t); that on xt-1 implies that 67.52% of the term spread in the previous period is added to the annual growth of real GDP (t). The p-values for c and g1 are far less than 0.01 and so these coefficients are statis17 Although not presented due to space constraints, the Durbin-Watson (DW) d statistic is approximately 2 for the whole sample (and for the individual samples in section 3.2) – ‘there is built-in bias against discovering (first-order) serial correlation.’ (Gujarati, 2003: 690) However, since this model is a modified autoregressive model, the d statistic is not appropriate to test for serial correlation in the data; instead, Durbin’s h statistic is used to detect autocorrelation between the errors. (Durbin, 1970)

233

tically significantly different from zero. At a 5% significance level, all the estimated coefficients are statistically significant; however, at the 1% significance level (α = 0.01), if the rigid Frequentist interpretation in the style of Neyman-Pearson of the p-value is adopted, then r1 is not statistically significant; however, Fisherians may interpret the p-value of r1 = 0.0178 as being close to 1% and so it would be less straight forward to decide on the basis of this value whether the null hypothesis should be rejected – a more Fisherian approach may suggest repeating the experiment – further investigation may be beneficial. I take α = 5% and reject the null hypothesis; the conclusion is that the intercept is significantly positive, and that both the first lag of the growth rate of real GDP and the first lag of the term spread are helpful in explaining the current growth in real GDP – all coefficients are significantly positive. 95% confidence intervals for the estimates are more informative: 95% confidence interval for b = (b^ – t0.025143SE(b^), b^ + t0.025143SE(b^)):18 95% confidence interval for c: (0.8285, 1.8445) 95% confidence interval for r1: (0.0323, 0.3563) 95% confidence interval for g2: (0.3452, 1.0052)

None of these intervals contain zero and so all estimates are significantly different from zero (in fact significantly positive, since they all lie to the right of zero on the number line). Derived in the appendix, the h statistic (0.5507, which is within ±3) under the null hypothesis asymptotically has standard normal distribution and so the probability of obtaining this value is not very small. The conclusion is that there is no evidence of positive or negative autocorrelation. The multiple coefficient of determination, the R 2 value (0.1996), suggests that the predictors – first lag of yt and first lag of term spread – explain 19.96% of the variation in the growth of real GDP; this compares with 0.1058 for a model without the term spread. The higher R 2 value should not be surprising as there are more variables in the unrestricted model. However the R 2 is not a good statistic; it is a non-decreasing function of the number of explanatory variables in the model and has no known distribution. The adjusted R 2 (R^bar2) of (.1884) takes into account the number of predictors in the model, being lower than the R 2 as expected.19 To compare the above model with a simpler one without the lag of the growth of the term spread (in order to justify adding the term spread to the model), the restricted20 F-test was carried out, since there is a common intercept: F = (R 2UR – R2R)/(difference in number of regressors) 18 t0.025143 » 2. 19 ‘… it is good practice to use R^bar2 rather than R 2 because R 2 tends to give an overly optimistic picture of the fit of the regression, particularly when the number of explanatory variables is not very small compared with the number of observations.’ (Theil, 1978: 135) 20 The restricted model is y t = c + ρ1y t-1 – i.e. without the lag of the term spread.

234

[3.4] =

(1 – R 2UR)/(df UR) (.1996 – .1058)/1 (1 – .1058)/(146 – 3)

where UR refers to the unrestricted model (i.e. equation [3.1a]) and R refers to the restricted model ([3.1a] without the lag of the term spread). The F value (15.0004) is highly significant since it is greater than that for F0.025,1,143 (3.91); this is confirmed from the p-value (0.0002), which is much less than 1%. The F-test compared the difference in model [3.1a] over and above a model with only a constant and a lag of the growth of real GDP: this shows that adding the first lag of the term spread to an equation with only the constant term and the first lag of the growth in real GDP improves the results.

Sub-sample analysis The results on splitting up the previous estimation into two sub-samples, (i) preEuropean Monetary Union (EMU) and (ii) post-EMU – i.e. from 1970Q3 until 1997Q4 and from 1998Q3 until 2006Q4, respectively – are reported in tables 3.2.1 and 3.2.2; the same equation [3.2] is used. The optimal lag length is p = 1 and q = 1 for both, determined from the minimum value of the BIC. Pre-EMU Figures 3.2.1 and 3.2.2 plot the actual residuals and the Studentised residuals for this period. Less than 5% of Studentised residuals lie outside ±2 (4 from 110); this

CONSTANT (c) 1.5966

Standard Error 0.2973

yt-1

0.0957

0.0944

1.0136

[.3131]

xt-1

0.9057

0.1963

4.6140

[.0000]

Regressor

Coefficient

T-Ratio

[Prob]

5.3700

[.0000]

Statistic R-Squared

0.2384

R-Bar-Squared

0.2241

BIC Durbin’s h Statistic F-Statistic

1.6682 F(1,107)

1.3508

[.1768]

21.285

[.0000]

Table 3.2.1. Results of Regression on [3.1a] for pre-EMU sample with one lag (p = 1, q = 1):

235

appears to suggest that the assumptions underlying the model for this data hold. The conclusion from the p-value accompanying the h statistic (0.1768) is that there is no evidence of positive or negative autocorrelation. The constant and slope coefficient on the first lag of the term spread are statistically significant, although the multiple regression coefficient on the first lag of the growth in yt is not. The R^bar2 (0.2241) is higher than the regression for the whole sample conducted above in section 3.1 suggesting that this model has a better fit over the pre-EMU period than over the whole period. However, it is important to note that in comparing two models on the basis of the multiple coefficient of determination (or the adjusted R2), the sample size (as well as the dependent variable) must be the same. The pvalue accompanying the F-statistic shows that pre-EMU, model 3.1a is an improvement over the same model without the lag of the term spread.

Post-EMU Figures 3.2.3 and 3.2.4 plot the actual residuals and the Studentised residuals for the post-EMU period. Just over 5% of Studentised residuals lie outside ±2 (2 from 34); this appears to suggest that the assumptions underlying the model for this data may not hold, although the closeness to 5% and the smaller sample size render this conclusion open to further investigation, especially from a Fisherian-Frequentist interpretation. Only the multiple regression coefficient on the first lag of the growth in yt is statistically significant; that of the first lag of the term spread is non-significant. Durbin’s h statistic once again suggests that there is no serial correlation between the disturbances (its p-value is .7604). The adjusted R 2 (0.3693) is higher than the regression for the pre-EMU sample suggesting that this model has a better fit over

CONSTANT (c) 1.0722

Standard Error 0.5378

yt-1

0.6316

0.1374

4.5983

[.0000]

xt-1

-.2041

0.3171

-.6437

[.5245]

Regressor

Coefficient

T-Ratio

[Prob]

1.9938

[.0550]

Statistic R-Squared

0.4075

R-Bar-Squared

0.3693

BIC Durbin’s h Statistic F-Statistic

0.3738 F(1,31)

-.3050

[.7604]

0.4133

[.5250]

Table 3.2.2. Results of Regression on [3.1a] for post-EMU sample with one lag (p = 1, q = 1) 236

the post-EMU period than over the pre-EMU period, and therefore than over the whole period. However, this contradicted by the p-value accompanying the F-statistic, which shows that post-EMU, model 3.1a is not a significant improvement over the same model without the lag of the term spread; adding the first lag of the term spread does not significantly improve the model without the term spread.

IV. Conclusion There is a two-way causation between economic activity (growth of real GDP) and the term spread. My model might be misleading since the spread affects the growth rate of real GDP, but not vice-versa. For further research, like Baltzer & Kling, I would recommend a structural VAR model to take into account feedback mechanisms, which imposes the ‘short run restriction that innovation in economic growth rates do not have an immediate impact on spreads.’ (Baltzer & Kling, 2007: 4) My paper is concerned with in-sample prediction.21 Reliable quarterly data from the ECB with no gaps were used with residual analysis to justify the model. It was shown that including the spread of the previous year is sufficient. The results fit in with the stylised observation that the term spread has lost its predictive ability as a predictor of the growth in real GDP since the great Moderation (post 1985 for the US) and since the EMU was established (for Europe). The cause in the US was the departure of Volcker and the presence of Greenspan, where volatility was reduced. The predictive ability of the term spread is better in times of more turbulence. The EU area has witnessed more stability since the EMU came into force in 1998 and correspondingly, the ability of the term spread to forecast the growth in real GDP has diminished.22 Lucas’ surprise inflation, with the implied policy proposal that Central Banks should not be transparent applied to the European economies pre-EMU following the breakdown of the Bretton Woods and James Callaghan’s speech to the UK Labour party that the belief that a country could spend itself out of recession was obsolete. Even though the BOE may seem to have more credibility today than the ECB, the importance of credibility proposed as early as 1976 by academics such as Fellner took time to channel through into Central Bank policy, much like the evolution of the concept of conjectural equilibria from General Equilibrium theory (developed in the 1960s and 70s), which did not pass into game theory until 1993 in the form of self confirming equilibria, and finally into macroeconomics until recently with the effort of Thomas Sargent and others. In conclusion, my paper shows that it is important to divide the sample into periods corresponding to different monetary regimes. It shows that the term spread improves the model’s ability to predict output growth. And it shows that credibility diminishes this ability. Credibility is a mixed blessing. 21 Bordo & Haubrich (2004) maintain that the out-of-sample predictive ability of spreads is lower. 22 The sample period ended in the third quarter of 2006, which marked the beginning of the current global recession. With volatility in the financial markets ebbing into the real economy, future studies could assess the possibility of a return of the yield curve’s predictability.

237

238

E C ONom ic s

Should we allow a market for kidneys? An Economist’s consideration M. Lorraine Chadwick

Abstract he sale of human organs, whether from a cadaver or a living donor, is proscribed in virtually every country in the world, and has historically been viewed as unethical by the world’s medical associations. In almost every country around the world also, there is a persistent shortfall between the number of organs available and the demand for them, resulting in loss of life for some and diminished quality of health for others. This is an intriguing economic research question, because it is a significant health-care problem for which a market solution already exists. The debate as to whether or not we should allow a market for kidneys is a compelling one which necessitates further investigation. This report explores the term ‘should’ from an economic perspective - allowing a market for kidneys is economically the efficient thing to do. The term ‘should’ is also considered from an institutional perspective which takes the broader social context of allowing a market for kidneys into account. The economics of kidney transplants is explored through a brief analysis of the current procurement approach and a critical appraisal of suggested market solutions put forward by economists. Retorts to these solutions are also considered. The broader social and ethical considerations which surround this debate have also been explored leading to my conclusion that this health care question has reached a critical juncture. Transplant professionals are increasingly evaluating patients for transplantation 239

who are more likely to die than receive a donor organ, while potential recipients cling to the hope that they may beat the odds and receive an organ while they are still healthy enough to undergo surgery. Economic solutions such as allowing a market for kidneys must be considered; the argument for blanket prohibition is flawed and should be rejected.

i. Introduction Shortages of commodities generally occur through either natural disasters or when governments impose a below market price on a commodity (McMillan, 2002). The shortfall between the demand for organs and the number available for transplantation exists primarily because of a scarce supply of transplantable kidneys; a situation which has arisen, according to Kaserman (2005), because both the purchase and sale of kidneys are considered criminal acts in most countries around the world. It has been argued that creating an open or a regulated market for kidneys would help alleviate this shortage; Barnett (2004) suggests that creating a regulated market might lessen the activities of current illegal ones. However, ethical considerations make the decision to ‘commodify’ kidneys more challenging; a market for kidneys may offend the personal or religious beliefs of some or may deter the more altruistic in society from donation (Titmuss, 1972). This paper is an exploration of the economics of kidney transplants. It considers the current statistics relating to kidney transplants to elucidate the shortfall between supply and demand, the current procurement approach, suggested market solutions, retorts to these solutions and the broader social and ethical considerations which surround this debate. The crux of the discussion lies with the implications of the term ‘should’; section two considers the term from an economic perspective with an emphasis on efficiency and incentives while the third section considers the term from the ethical approach with an emphasis on equality and fairness for potential donors and recipients. II. The Economics of Kidney Transplants Supply and Demand – The Statistics In terms of kidney transplant lists, the statistics are startling; the graph1 below illustrates the widening gap in the UK between those waiting for transplantation and the actual number of transplants which have taken place over a ten year period from 1997-20061. In the Republic of Ireland, statistics are similar; 1,482 people needed a kidney transplant as of 31 December 20062, however only 142 transplants were carried out in the same year. Not every kidney which becomes available for transplant can 1 www.uktransplant.org.uk/ukt/statistics/calendar_year_statistics/kidney/kidney.jsp 2 http://www.ireland.com/newspaper/breaking/2007/0326/breaking47.htm

240

be used; some kidneys may be deemed unsuitable by transplant personnel due to disease or other medical factors. In Ireland, the gap between those waiting for transplantation and those actually receiving one is increasing, although the deceased donor rate per million population in the Republic of Ireland is 19.8, which compares favourably with the figure of 13.2 in the UK (Collett, 2007). This can be explained by the fact that kidney donor levels have remained static over the past 10 years but the numbers of people being diagnosed with kidney problems which require dialysis and transplantation are increasing.3

The Current Procurement Approach Most donated organs4 in Ireland and the U.K. come from people who die while on life support, following a severe brain injury. Brain death, unlike a coma, is the complete and irreversible cessation of all brain function. Brain death usually occurs when a person receives a severe head injury, suffers a stroke or a brain haemorrhage, or any other event which deprives the brain of oxygen. In some countries organs are also taken from non-heart-beating donors (NHBDs)5. Organ donation is seen as a gift between the deceased donor and their family and the organ recipient. Kidneys can also be donated by living donors; in Ireland very few of these types of transplants have taken place due to constraints within the health service in terms of personnel and surgery facilities. With numbers on kidney transplant lists increasing and donor numbers remaining static, the reasons why the current approach of altruism is failing must be considered. According to Kaserman (2002), the issue of altruism and vested interests colliding within the current procurement system is one system failure which must be investigated. He contends that the current system of kidney procurement which has been adopted and maintained by most countries remains unaltered primarily due to the systems impact on profits to physicians and hospitals. He asserts that; “The economic truth is that reliance on altruism at one stage of production can serve the purpose of greed at another. A legal restriction on the purchase and sale of transplantable organs is economically equivalent to the formation and maintenance of a cartel in the provision of transplant services. Therefore, the current policy and the shortage it creates enhance the overall profitability of transplant providers. Such profitability, in turn, ensures continuing political support for that policy” (Kaserman, 2002:91). Expansion of Donor Criteria as a Supply-Side Solution One medical solution currently employed to address the shortage of donor kidneys is the increasing acceptance of ‘marginal’ kidneys by transplant surgeons desperate to see their patients receive an organ. Donor-criteria has gradually been 3 www.uktransplant.org.uk 4 Irish Kidney Association (2007) 5 �� NHBDs are patients who have died from cardiac death i.e. irreversible loss of heart and lung function.

241

expanded and kidneys are now being accepted from deceased donors who are geriatric, hypertensive and even proteinuric (Friedman, 2006). This situation is clearly not sustainable; transplanting ‘marginal’ kidneys will only lead to further medical problems for recipients, given that the kidney received was less than perfect at the point of transplantation. Many economists (Friedman, 2006, Barnett and Saliba, 2004, Becker and Elias 2003) and medical professionals (Hippen, 2005) have concluded that in order to alleviate increasing levels of demand, supply-side solutions such as allowing a ‘market’ for kidneys must be considered.

The Market Approach In terms of a market for kidneys, the law in most counties around the world currently bans the sale of human kidneys (Friedman, 2006). This effectively establishes a maximum legal price for kidneys of €0 which is known as a price ceiling. With the demand for kidneys increasing and supply remaining static6, an obvious shortfall between supply and demand is created. Some economists (Becker and Elias, 2003), (Kaserman, 2002) argue that this is a market failure which can be resolved by allowing a market for kidneys, which would increase the supply of transplantable kidneys therefore ensuring that those on transplant waiting lists receive the kidney they need. The mechanisms of the varying market solutions put forward by these economists will now be explored to determine if a market for kidneys should be considered. Incentives The issue of monetary incentives for organ donation is one which has been explored by Becker and Elias (2003). They contend that the introduction of monetary incentives into a market in the U.S. for live and cadaveric organ donations might increase the supply of organs for transplant sufficiently to eliminate current transplant waiting lists, without increasing the total cost of surgery by more than 12%. Becker and Elias (2003) build their argument through ‘value of life’ literature together with econometric models and sensitivity analysis to approximate the equilibrium cost of live transplants for kidneys. They conclude that: “the supply curve in this market would start just slightly above the cost of surgery since some cadaver organs would be made available cheaply. A rise in price would induce more cadaver organs to be offered, and perhaps even a few from live donors. Eventually, the available organs from cadavers would run out, and the supply price would rise sharply to reach the main market for live donors. At that point the supply elasticity rises sharply because the potential live donor market is huge relative to demand” (Becker and Elias, 2003:24). 6 Transplant Newsletter (2007)

242

Computing the Equilibrium Price for a Kidney Becker and Elias (2003:11) also “estimate the value or price of an organ from living donors by computing how much additional income or market consumption an individual will require in order to be indifferent between selling an organ or not. Following the value of life literature, the additional income required by an individual in order to be willing to sell his organ will be given by the change in the value of life induced by changes in health, or quality of life, mortality risk and full income.” Other factors are taken into account by both economists to compute what they determine is the total expected cost of donation per kidney. They have computed this cost to be $15,200 and the factors they considered in their computation include: Monetary compensation for the risk of death Monetary compensation for time lost during recovery Monetary compensation for risk of reducing quality of life (Becker and Elias, 2003:12).

Moreover, regardless of what the price of a kidney might end up being in a hypothetical market, it is the potential cost-savings achieved from a successful transplant compared to the long-term cost of dialysis that should form the crux of any economic debate in considering whether a market for kidneys should be allowed. Matas and Schnitzler (2004) have shown that in the U.S., a doubling of the number of organs procured from a market system would permit Medicare to pay $50,000 per kidney and still break even. This is an economic consideration which cannot be ignored in any economic debate surrounding a market for kidneys; the cost of a kidney transplant operation is usually a non-recurring cost while the cost of kidney dialysis per patient is a large recurring expense for health services to bear.

Cost of Queuing A further economic cost which should be considered is the cost of queuing. The economic cost of queuing is one which Becker and Elias (2003) explore and they contend that allowing a market for kidneys can also be contextualized in terms of value to society through the increase in numbers of people who would be transplanted without prolonged waiting times, as waiting time increases the risk factor for those waiting on kidney transplants. While this may have a positive societal or welfare benefit; “perhaps the most egregious effect of organ shortage on those people who wait, is the suffering and the deterioration in their quality of life while waiting for an organ” (Becker and Elias, 2003:19), the recurring economic cost in terms of dialysis per patient is also substantially reduced. 243

The Truncated Market In exploring the financial and market processes that would evolve if a free market in kidneys were to be permitted, the types of institutions which would develop, how transactions would be facilitated, what the short-run and the long-run effect would be on the price for kidneys and how such a market would function, Barnett and Saliba’s (2004) paper was particularly insightful. They assert that “the demand for kidneys unlike the demand for most goods is truncated. That is, it is satiated at a positive price; the quantity demanded does not increase if the price falls below the satiation price” (Barnett and Saliba, 2004:39). They further elucidate this point by asserting that “as long as the government remains as the payer of last resort, the demand curve is actually truncated at a price greater than zero because the maximum quantity of kidneys demanded is equal to the number of people on the waiting list, and no more” (Barnett and Saliba, 2004: 39). This point buttresses the argument to consider a market for kidneys; future demand which would drive the cost of organs will always be substantially offset by the far greater supply of potential organ vendors. Short-term Nature of the Market In a similar vein to Becker and Elias (2003), the matter of price is also considered by Barnett and Saliba (2004). Both are cognizant of the fact that if a free market for kidneys were permitted, the price of a kidney would be relatively high, but they estimate this to be only for an initial period. An example of this high price was experienced when an offer of a kidney for sale was posted on eBay. Prince (1999) noted that the price of the kidney rose from an initial offer of $25,000 to nearly $6 million during the week it was listed on the site. However, Barnett and Saliba (2004) stress that because the demand for kidneys is typically non-recurring, in the longer-term the price would decrease as demand declined. Auctioning a kidney on the internet is not the methodology economists who support a market for kidneys would advocate, but other compensation mechanisms they have put forward are explored briefly in the following paragraphs. Donor Compensation The issue of donor compensation is an area explored by Kaserman (2002). He compares compensation to that of an organ market and maintains that they differ in two ways; “with compensation, the form and amount of payment to organ suppliers are largely arbitrary, whereas market prices change with supply and demand so as to eliminate shortages. Second, markets provide greater incentives to individuals involved in the procurement process both to acquire more organs and to acquire them in a cost-efficient manner” (Kaserman 2002:100). Maintaining that if a market for kidneys were to be permitted, Kaserman (2002) also asserts that more organs would become available and consequently higher standards would be set for transplantable organs. He concludes that this would lead to the average quality of transplanted organs being higher through organ markets. The factors outlined 244

above are further reasons why a market for kidneys rather than a system of donor compensation should be considered. Barnett and Saliba (2004), in a similar vein to Becker and Elias (2003), are supportive of compensation for cadaveric kidneys but they assert that in a free market, the demand for kidneys to be harvested upon an individual’s death is likely to be very small, as relatively few people experience brain death while their bodily organs are still ‘viable’ – this is an essential prerequisite for cadaveric transplantation. Barnett and Saliba (2004) contend that the major source of kidney supply in a free market is more likely to be from living persons; as only one functioning kidney is necessary to lead a ‘healthy’ life, the potential supply from living individuals is enormous relative to the demand.

Financing the Market Another question which would have to be addressed if a market for kidneys were to be allowed, is how the financing for such a market would be transacted. In an effort to address this question, Barnett and Saliba (2004) compare four possibilities, options, futures, forward and spot markets and conclude that a spot market is the one most likely to emerge7. “Those living individuals who desire to sell one of their kidneys, assuming the price and other relevant factors are satisfactory, would make this known through a listing with one or more brokers” (Barnett and Saliba, 2004: 44). Brokers would gather initial medical information on the potential seller and if viability were established, the brokers then incur the expense of the required antigen testing� conducted to ensure blood and tissue match. Barnett and Saliba (2004) contend that because of the truncated demand curve, a gap would exist between the demand and supply prices at the actual quantity of kidneys exchanged, a difference which the economists note would equal the amount of rent per kidney exchanged that would depend on bargaining. Mechanisms would have to be put in place to ensure that these rents would not form part of a collusive arrangement between brokers and hospitals, this mechanism might take the form of regulation. Government Regulation and Policy Given the widespread government regulation of health care and medical industry, it would be likely that governments would establish an independent regulatory authority, which would heavily regulate brokers to minimize as far as possible collusion in the marketplace. This regulation could be justified if it prevented an occurrence of kidney theft through the maintenance of exacting data on the source and destination of each kidney brokered through the institution. Barnett and Saliba (2004) stress that these licensed brokers would be the only bodies from which a transplant patient could legally acquire an organ apart from cases of altruistic 7 Further details on Options, Futures and Forward Organ Markets can be exam-

ined in Barnett, W. and Saliba, M. (2004) ‘A Free Market for Kidneys: Options, Futures, Forward, and Spot.’ Managerial Finance, Vol. 30 (No.2): Pages 41-44

245

gifts between donors and recipients. In conclusion, this section has appraised some suggested market solutions put forward by economists in terms of allowing a market for kidneys and focused on the implication of the term ‘should’ from an economic perspective with an emphasis on efficiency and incentives. The next section deals with retorts to these suggestions.

III. The Context of the Economics of Kidney Transplants Direct Retorts to the Market for Kidney Transplants Many people still view organ donation as a purely altruistic gift and their concerns and difficulties with allowing a market for kidneys will be explored in this section of the report; the term ‘should’ will be considered from the ethical approach with an emphasis on equality and fairness for both potential donors and recipients. My reflections on their concerns will be dealt with at the end of this section. The concept of purchasing kidneys from compensated donors has traditionally been decried by medical associations and ethicists globally; they deem such transactions as morally irresponsible (Roth, 2007) or ethically unacceptable (ScheperHughes 2002a, b). Others contend that a market in kidneys would not be an equitable one for the donor. For example, Kolnsberg (2003:1056) maintains that “no matter what the market structure scenario, this initial application of economic theory leads to a conclusion that the donor-seller will not gain very profitably by selling his/her organs. In each scenario, the price for organs will drop in response to increasing supply. It seems that donor-sellers will not be able to profit in the long run from selling their organs. This stands true for both cadaver and living-donor organs.” Kolnsberg (2003) maintains that a naturally limited demand for transplants will keep prices low as increasing supply outstrips demand and third parties will limit the price they are willing to pay donor-sellers in order to maintain their own profitability. Kolnsberg (2003:1060) also asserts that a market for kidneys should not be allowed as “only the poorest would sell their organs at a risk to their wellbeing and for little financial reward in the long run. Although the selling of organs would conveniently increase supply, which benefits recipients, it would not really benefit donors.” While Kolnsberg views a market for kidneys as being potentially inequitable for donors, others view the concept of a possible market for kidneys as repellent to society as a whole and offer other suggestions in terms of kidney procurement. Broader Social Context - Moral & Ethical Considerations Roth (2005) contends that creating a market for kidneys is politically unfeasible and socially repugnant. He maintains that it would be difficult politically to change the current system of procurement and he also asserts that many people find the idea of donor compensation repugnant. Furthermore, Roth (2005) main246

tains that economists subscribe to a particular point of view which avows that if two people engage in a voluntary transaction; it must be because they both want to and because it makes both parties better off. However, Roth (2007) determines that transactions are morally repugnant when they are transactions that some people (certain members of society) don’t want other people (certain other members of society) to engage in. He maintains that economists must appreciate and engage with the phenomenon of repugnant transactions and he asserts that there are legitimate concerns about the monetisation of transactions which fall into three categories; concerns which he stresses apply to any proposed market for kidneys. The first of these concerns is what Roth (2007:44) calls objectification; “the fear that putting a price on certain things and buying or selling them might move them into a class of impersonal objects to which they should not belong.” A second concern of Roth’s is that offering substantial monetary payments for a kidney “might be coercive, in the sense that it might leave some people, particularly the poor, open to exploitation from which they deserve protection” (Roth, 2007:44). Roth’s third concern, which he asserts may not always be articulated clearly, is that “monetizing certain transactions that might not themselves be objectionable may cause society to slide down a slippery slope to genuinely repugnant transactions” (Roth, 2007: 45). Interestingly Roth (2007) also notes that while the repugnance associated with regard to a market for kidneys shares characteristics with repugnance for the monetisation of other types of transactions, the market for kidneys also has unique features. One of these features is the dilemma faced by transplant surgeons; taking a kidney from a health donor is contrary to the Hippocratic tradition of ‘first, do no harm’. As Roth (2007: 48) puts it, “a surgeon who is already overcoming some distaste for performing a nephrectomy (kidney removal) on a healthy person may find the distaste more difficult to overcome if he views himself as facilitating a commercial transaction.” Intriguingly, no tangible evidence of this type of dilemma is provided by Roth to substantiate this claim in his 2007 paper.

Kidney Exchange While Roth (2004) does not deny that an organ market would have some merits, he contends that a more practical and politically feasible approach to solving the current kidney shortage is that of an ‘organ exchange’. Roth (2004:2) puts forward the idea of a kidney exchange on a national scale in the U.S. which he explains involves “two donor-patient pairs such that each (living) donor cannot give a kidney to the intended recipient because of blood type or immunological incompatibility, but each patient can receive a kidney from the other donor.” Founded in New England in 2005, the New England Program for Kidney Exchange offers life-saving options to those seeking a kidney transplant, but whose potential living donor is not a good biological match due to either blood type incompatibility or cross-match incompatibility. The exchange uses a computer program to find cases where the donor in an incompatible pair can be matched to a recipient in another pair. Through 247

exchanging donors, a compatible match for both recipients may be found.

Conclusion In concluding this section of the report, I will argue that the current system of kidney procurement which emphasises donor altruism is positioned to fail and that arguments against organ markets also fail when they are considered in any great detail. Legalising a market for kidneys would have a positive outcome for society; the number of donors would very likely increase, countless lives would be saved and donors could be acknowledged for their donation through monetary compensation. This conclusion has been reached through the analysis of the work of those against a market for kidneys; the following paragraphs outline my retorts to those who are against considering a market for kidneys. In terms of Kolnsberg’s (2003) argument regarding donor compensation, it is my view that her line of reasoning is inconsistent. Kaserman (2005:894) explains my contention pithily when he asserts that if the impact of a proposed policy on social welfare (taken to be the sum of consumer and producer surplus) is examined, and if that policy is observed to increase such welfare, then “absent other non-economic objections, it should be implemented.” He further elucidates: “Instead of this traditional criterion and the huge amount of literature that exists to support it, Ms. K comes up with her own novel standard – whether the supplier of living donor organs will be able to earn significant positive economic profits in the long run. If the answer is no (as she attempts to demonstrate) then she argues that such sales should continue to be banned; despite the fact (which she conveniently ignores) that that ban is currently causing the deaths of over 6,000 patients each year” (Kaserman, 2005:894). Other suggested non-market solutions to this question are also inconsistent. Roth’s (2004) solution of a ‘kidney exchange’ will do nothing to alleviate current waiting lists in the United States due to the fact that kidney exchanges are rare; only five exchanges have been completed in centres in New England from the date of set up in September 2005 to 31 December 2005. While Roth (2005) maintains this low exchange rate is because databases are just being assembled, I would assert that even if levels of exchange were increased ten-fold it would still not have any serious impact on transplant waiting lists in the United States. Roth’s (2007) opinions on repugnant transactions also lack consistency in that he does not actually define what he means by the word repugnant; because the term is subjective it should have been clarified by him when building his argument. It is my understanding that Roth has classified transactions into two categories; acceptable and repugnant. While Roth does not (to the best of my knowledge) actually define the word repugnant, my understanding is that he deems transac248

tions to be repugnant when they are ‘offensive’ to some members of society. Many transactions take place on a daily basis which although legal, might be viewed by some members of society as repugnant. It is not unusual to see advertisements in newspapers seeking reproductive cells from healthy, intelligent students8,9 so why is it so ethically wrong to buy and sell a kidney? Both acts are basically the same thing; a transaction where one person willingly chooses to give away a part of their body in exchange for monetary compensation. It could be argued that selling sperm or ova is more repugnant than selling a kidney, as these cells have the potential to create new human life, while a kidney does not. Roth (2005, 2007) maintains that repugnance is viewed by economists as a side issue rather than a real phenomenon which he asserts must be considered when investigating this compelling question. It is difficult to view repugnance with any seriousness at all when one is not actually sure what is actually meant when Roth uses the term. If ‘transaction repugnance’ does exist, perhaps one solution to maintaining society’s confidence in a hypothetical market for kidneys would be to ensure that all facets of such a market would be regulated by an independent medical and patient body on a national and international scale. In support of this view, Hippen (2005:612) maintains that a defensible market in kidneys should, at the minimum, have the following four characteristics; “the priority of safety of the vendor and recipient, transparency regarding risks to the vendor and recipient and regarding institutional outcomes and follow-up care, institutional integrity… and operation under a rule of law.” Hippen (2005:613) also asserts that through fashioning policy at an institutional level, health professionals, vendors, donors and recipients “with compatible moral commitments can cooperate with each other, and, unlike the current system, the forbearance rights of each can be respected in full.” This is the type of market for kidneys which could be considered by policymakers in the coming years as the plight of those on dialysis continues to deteriorate. In addressing Roth’s (2007) concern about the objectifying of kidneys; economists such as Kaserman (2005), Becker and Elias (2003) and Barnett (2001), support the ‘commodification’ of kidneys; the main thrust of their argument asserting that the current prohibition of the purchase and sale of kidneys has resulted in unnecessary suffering for some people and premature death for others. It is clear therefore, that through the research conducted for this literature review, it is clear that the idea of establishing a market for kidneys, while not new, is now attracting unprecedented support from economists, ethicists and some members of the transplant community.

IV. Conclusion In life there are questions that never really go away. The idea of establishing a mar8 ‘Women Shopping for Super Sperm’, The Vancouver Sun, 10 December 2005 9 ‘Sperm Bank Seeks Donors’, Journal of Business, 17 June 2004

249

ket for kidneys is one of those questions. Today, it is a topic at the centre of much controversy. Rothman et al (2006:1524) note that “proponents emphasize the concept of autonomy; opponents invoke fairness and justice.” No matter the approach taken, it is clear that a shortage of kidneys exists and every solution put forward must be considered to address this problem. Removing the ban on the sale of kidneys or allowing some type of compensation for donors has become the solution most discussed by those involved in the debate. A healthy human is born with two kidneys, but only one is necessary to survive. This raises a very important question; should people have the right to sell a kidney they do not actually need? Property right issues surrounding body parts have becoming increasingly complex. Howley (2006:2) contends that “every corpse has a legal value of zero, but transplantable organs and tissues grow more valuable every day. Body parts aren’t legal property to the people born with them, but can be distributed by doctors, universities, biotech companies, and procurement agencies for profit or otherwise” (my emphasis). Is it right that the donor or the donor’s family receives no compensation? In effect, the donor is the only component of the current ‘market’ procurement system who does not receive payment. The following example illustrates this point succinctly. On Feb 16, 1990 Susan Sutton from Moore, Oklahoma, shot herself in the temple in an attempt to take her own life. She was declared dead in a local hospital some hours later and her parents gave permission for her heart, liver and corneas to be harvested for transplantation. “The hospital and medical teams that removed the organs received thousands of dollars for their services from patients who needed transplants, from the patients’ insurance companies or from Medicare or Medicaid. The nonprofit agency that coordinated the transplants also received thousands of dollars, as did the surgeons and hospitals where the transplants took place. But Ms. Sutton’s parents received nothing, and unable to afford the cost of a headstone, buried their 28 year old daughter in an unmarked grave” (Young, 1994:1)

Courts and legislatures habitually link their resistance to corporeal property rights with the corrupting power of markets. The United Network for Organ Sharing10 note that “the laws and regulations surrounding a deceased organ donation, allocation and transplantation have purposefully established a legal infrastructure that excludes property law concepts … instead, organs are donated for transplantation voluntarily (not sold or appropriated) and are regulated as a scarce national resource.” It is my view that economists are well positioned to engage in this debate; kidneys are a scarce resource and Economics is a study of how best to 10 www.unos.org (cited 17.11.07)

250

allocate scarce resources. As we move toward considering alternative solutions to the current shortage of kidneys, in time perhaps kidneys will be viewed without repugnance as a scarce economic resource. Remarkably, the fact that it is proscribed to either sell or buy a kidney has not actually stopped the sale of organs from occurring. The problems which have stemmed from the burgeoning global black market in kidneys are monumental and have led to a kind of transplant tourism or ‘neo-cannibalism’ as ScheperHughes (2004) describes it. Patients travel from wealthier countries without a black market organ trade to parts of the world where both an organ can be procured and an operation can be carried out, for a price. However, Hippen (2005:602) counters Scheper-Hughes argument when he asserts that “a regulated market in human organs is better suited to reduce organ trafficking by offering vendors and recipients alike a safe alternative, while significantly reducing the demand for organs that perpetuates organ trafficking.” On the same issue, Finkel quotes the Israeli nephrologist, Michael Friedlaender, at a conference in Denmark in 1999 as stating: “What’s happening now is absurd … airplanes are leaving every week. In the last few years, I’ve seen 300 of my patients go abroad and come back with new kidneys… it’s a free-for-all. Instead of turning our backs on this, instead of leaving our patients exposed to unscrupulous treatment by uncontrolled free enterprise, we as physicians must see how this can be legalized and regulated. … Examining those 300 patients brought me down from my high horse of ethics. Now I’m more practical. My patients don’t want my opinion on whether or not buying a kidney is moral – they want to know if it’s safe. And I have to say that it is. The current system of organ donation without remuneration is a failure” (Finkel, 2001:5).

In conclusion, one cannot deny the enormous challenges that come with introducing compensation into a deep-rooted scheme built on the premise that altruism is the only legitimate motive for giving. Yet, as death and suffering escalates, constructing a market-based compensation programme which will increase the supply of transplantable kidneys has undoubtedly become imperative. Concerns about donor safety must be given serious consideration certainly, but repugnance and vigilance are not in themselves arguments in opposition to change but rather, they are motivations for caution, concern and care.

251

EDUCATION PANEL

•

Juding panel Mr. Michael Cotter (Dublin City University) – Chair Mr. Padraig O’Murchu (Intel) Dr. Kevin Marshall (Microsoft) Mr. Paul Rowe (Educate Together)

252

E duc at ion

In Ireland, recent legislation & policy in health, education & social services have changed the nature & practice of early childhood education care & services Dairine Taaffe

Introduction hildren represent nearly one third of the population of Ireland (Hayes, 2002), and as such represent the future of Ireland and have a central place in our ever changing society as present and future citizens. Numerous significant policy documents and decisions have been developed in recent years in relation to the practice of early childhood education, marking what might be considered a change in attitude towards children in our society. This wealth of documents has endeavoured to provide Ireland with the highest quality of services and care for our children. The UN Convention on the Rights of the Child (UNCRC) is an international human rights treaty which grants a comprehensive set of rights to all children without discrimination, and this has had an important role in stimulating progress in this area within Ireland. In this essay I will argue that the adoption of the principles of the UNCRC has had a positive impact on this country in relation to the nature and practice of early childhood care and services. I intend to chose an area from social services, education and health (in that order) and discuss these in rela253

tion to developments in Irish policy and legislation and the effects of these policies on early childhood care and services. With regard to children’s rights, historically Ireland has an ethos of expecting children to be seen and not heard. Many believe this stigma is changing due to the increased awareness and acknowledgement of children’s rights. The UNCRC (1989) includes the participation rights of children (Article 12). This involves children having freedom of expression and the right to have a say in matters that affect their lives. Conversely authors such as Hayes (2002) and Martin (2000) believe children in Ireland are not given sufficient opportunity to speak for themselves and are voiceless in society. I will address this issue and examine the ways and means by which children are empowered and given a voice in society with relation to the relevant legislation and policies. Under the development rights of children, article 28 of the UNCRC (1989) states that every child has the right to education. Since 1990 and particularly since the millennium, the Irish government has endeavoured to improve early childhood services especially in education and these key milestones will be examined and how these have effected and changed practice within Ireland. A health survey carried out by the World Health Organisation in 2008 saw children in Ireland score very highly (Irish Examiner, 2008). An increased awareness of health inequalities has lead to policies being put in place in relation to children’s health. I am keen to explore these policies, focusing on traveller children and breastfeeding and their affects on services. According to the UNCRC (1989), every child has the right to avail of health and medical services and to enjoy the highest quality of health that is attainable (Article 24).

Social Services: Children’s Rights In recent years policy makers are recognising the importance of giving children their own voice. They are including children’s opinions in research and on topics relevant to them. The benefit of including children in policy making was clearly seen in the National Children’s Strategy (2000). Children and young people were consulted in the formation of this government policy, the publication of which is a huge step towards the implementation of the UNCRC recommendations. This document provides a clear policy statement which reflects the hopes and concerns of children themselves and all parties involved in working with children (DOHC, 2000). In this strategy three national goals were identified: children will have a voice, children’s lives will be better understood and children will receive quality supports and services (Richardson, 2005). The first national goal concerns giving children a voice in matters that affect their lives. Their opinions are to be given due weight in accordance with their age. One way in which the strategy hoped to achieve this was by putting in place new procedures in the public sector to boost participation by children in matters that affect them, and to promote and support the development of a similar system in the private and voluntary sector. As a result of the 254

strategy many significant developments were made; such as the establishment of a National Children’s Advisory Council, together with the National Children’s Office in 2002 (Richardson, 2005). Dáil na nÓg, the national children’s parliament, was set up giving children the opportunity to raise and debate issues of concern. The first meeting of Dáil na nÓg took place in 2001, and 200 children aged between eight and seventeen years attended, representing every county and socio-economic group (Office for the Minister for Children and Youth Affairs, 2002). A further measure of the strategy was that a children’s ombudsman be established by legislation as an independent office. The Ombudsman for the Children Act (2002) states that the role will be an independent office (DOHC, 2002). Again children were consulted on their views as to what should be the priorities of the Irish Children’s Ombudsman during the first 12 to 18 months of office. This is a prime example of when children were listened to and their opinions considered and valued (Children’s Rights Alliance, 2003). Another recommendation of the strategy was that children’s views should be represented at a national and local level in relation to relevant services. A 2002 progress report indicated that many city and county development boards had established mechanisms to give children a voice, therefore improving children’s participation at a local level.

Education The 1990s was a period of intense debate, examination and policy development in Irish education (Clancy, 2005). According to Clancy (2005) initially the main focus of this educational reform was focused at primary, secondary and third level. By comparison pre- school education received little attention until the late 1990s. The Report on the National Forum for Early Childhood Education was published in 1998. It explores some of the main areas involved in Early Childhood Education and Care, and proposes some areas in which intervention is needed. This was the beginning of a rapid growth of policies and legislation focusing on early years’ care and education. Following the Forum, the Department of Education and Science produced the White Paper on Early Childhood Education entitled ‘Ready to Learn’ (1999). This paper is concerned with children from birth to six years. It sets out the core objective of early childhood education as “supporting the development and educational achievement of children through high quality early education, with particular focus on the target groups of the disadvantaged and those with special needs” (Department of Education and Science, 1999, pp. 14). The Centre for Early Childhood Development and Education (CECDE) was established in 2002 on the recommendation of the White Paper (Citizens Information, 2009). The purpose of the CECDE was to begin implementing some of the key recommendations of the White Paper (Duignan, 2004). It published ‘Siolta: the National Framework for Quality in Early Childhood Education’ (2006), which has influenced the practice in childcare settings across the country (Citizens Information, 2009). Unfortunately due to cutbacks, the CECDE was forced to close in November 2008 (Carr, 2008). During its existence, the CECDE made a substantial contribution to the develop255

ment of policy and practice in early childhood education and care (St Patricks College, date unknown). Despite evidence to support the fiscal and social rationale for investment in early childhood education, there is still a great need for improvements in this area. In 2002 the Department of Education and Science invited the OECD Directorate for Education to conduct a review of Early Childhood Education policies and services in Ireland. The OECD team met with many government departments, agencies and other stakeholders dealing with early childhood issues and made site visits covering a range of services for young people from 4 months to 6 years of age. In 2004 OECD published their report on early childhood care and education in Ireland. It made a number of recommendations across the key areas of access, quality and co-ordination, some of these include: The integration of all early education and care policy and funding under one department or under a designated funding and policy organisation. It recommended that the White Paper, ‘Ready to learn’ (1999), be implemented. The urgent formation of a national plan for early childhood services development. The formation of a National Goal and Quality Framework. (Schonfeld, 2004)

The report also found that funding for early childhood services in Ireland has been low and made recommendations that there should be a significant increase in this funding (OECD, 2004). The report also described provision for under three year of age as very weak and coverage for three to six year olds among the lowest in the EU (Womens Health Council, 2009). Unfortunately many of the recommendation of this report have not been implemented. For example, there is still no universal department dealing with early education and care policy. The National, Economic and Social Forum report (NESF) (2005) demanded that early childhood education and care be made a priority and showed that investment in this area will yield significant future dividends. The NESF report showed that for every euro invested in early years’ education and care between €4.60 and €7.10 would be returned (NESF, 2005). Similar to the OECD report (2004), the NESF report showed that, among the OECD countries, Ireland has a low rate of investment in the early years’ education and care. In 2005 Ireland invested 0.2% GDP compared to an average of 0.4% in other OECD countries (NESF, 2005). The NESF strongly recommended that state funded quality care and education should be provided for all children in the year before they go to primary school (Ring, 2005).

Health 256

This section will address two areas in relation to health in childhood: namely breastfeeding and the health of traveller children. These were chosen as I have recognised them as two important areas in which there has been significant development. The UNCRC states that children have a right to a good standard of health and health care, and this right applies to all children without discrimination. Here in Ireland there is an ethnic minority group which experiences a level of health that is far short of the level experienced by the general population. The Children’s Rights’ Alliance (2004) states that children from the travelling community are particularly at risk of experiencing poverty and in turn have a poorer level of health than the general population of Ireland. In 1987 the infant mortality rate amongst travellers was 18.1 % compared to a national figure of 7.4%. In 1999 the rate of Sudden Infant Death Syndrome in traveller families was twelve times the national figure (Department of Health and Children, 2002). In 2002, The Department of Health and Children published ‘Traveller Health: A National Strategy’. The document contained 122 recommendations in relation to the improvement of travellers’ health. Many of the recommendation refer to the need for health care workers working with travellers to have additional training (Murphy, 2002). There have been significant changes since this document has been published, resulting in better services being provided for travellers and their children. Traveller health units around the country have drawn up regional plans in terms of traveller health. Also Primary Health Care projects have been developed for travellers around the country (Pavee Point, 2003). During the late 1980s and early 1990s the incidence of breastfeeding in Ireland was 32% - a very low figure in comparison to other countries. Babies who are breastfed receive better protection against disease in both the long and short term (Holden et al 2000). In 1992 there was a committee with representatives from various professional and voluntary groups set up to develop a national breastfeeding policy. This policy was published in 1994 and outlined a series of recommendations and targets aimed at improving the breastfeeding rate in Ireland (HSE, 2007). This strategy greatly changed attitudes and increased awareness in Ireland around breastfeeding. As a result of the policy Ireland put in place structures to implement the Baby Friendly Hospital Initiative (DOHC, 2005). This initiative encourages best practice in the maternity service which is crucial to the success of programmes to promote breastfeeding (Baby Friendly Hospital Initiative, 2008). Also under this policy there was a national breastfeeding coordinator appointed in 2001. In addition a national committee on breastfeeding was set up in 2002. This committee was to review the 1994 Breastfeeding policy and to produce a new five year strategic plan for breastfeeding in Ireland which was published in 2005 (DOHC, 2005). This expert working group was to continue the work begun with the 1994 policy by drawing up evidence based goals, targets and objectives to increase the uptake and duration of breastfeeding in Ireland (HSE, 2007).

Conclusion 257

Since 1990 there has been a huge growth in attention, discussion of, and debate about young children in Ireland. This began mainly from our ratification of the UN Convention on the Rights of the Child in 1992 and also our publication of ‘Our Children- Our Lives: The National Children’s Strategy’ (2000). This essay addresses the articles from the UN Convention which I felt were significant and which covered areas of social services, education and health. Firstly the issue of children’s participation rights and their right to have a voice and be heard in society was addressed. The first goal of the National Children’s Strategy (2000) was to give children a voice in matters that affected their own lives. The fact that this was the first goal shows the weight and importance that this policy rightly gives to this issue, because it, in turn, impacts on our information on all other areas of children’s lives in relation to their education, health and general well-being. It had significant outcomes which helped empower children across the country, namely the appointment of the Ombudsman for children which is a landmark step in the promotion of children’s rights and welfare. The developments arising from the National Children’s Strategy have been very positive and I believe have drawn attention to policy makers about the necessity to consult and include children at national and local level. In the late 1990s there was a huge move to focus on early years’ education with numerous policies and legislation being brought to light. The White Paper on Early Childhood Education led to the establishment of the CECDE which promoted and worked to implement the objectives of the white paper. Unfortunately the CECDE ceased business in 2008 as a result of lack of funding. This indicates a lack-lustre approach and commitment on the part of the government to early childhood education, care and services; and demonstrates that in times of less economic prosperity, children’s issues could once again slip down the agenda, having made good progress. The OECD report strongly criticised Ireland’s early childhood education especially in terms of access. Again only a few of the recommendation of this report have ever been implemented. The NESF report (2005) showed that investment in early years’ education results in large dividends being received in later years. Both the OECD (2004) and the NESF report (2005) suggested that more money be invested in early years’ services but in these recessionary times it is clear that early childhood services are one of the first to be cut. It is important to change the attitudes and opinion of the government and assure them that the necessary investment in this sector will reap benefits in later years. Certainly as a result of the ‘Traveller Health: A National Strategy’, there has been an improvement in the access to and availability of services for the travelling community. It is no longer possible to ignore the health needs of this vulnerable group in society. Although some of the recommendations of the strategy have been implemented, there is still a long way to go to get traveller health on par with that of the general population. The WHO (1985) prerequisites for health are adequate food, safe water and sanitation, decent housing, basic education and employment; these are areas that often fall short in travellers’ lives (Hainsworth, 1998). It is the responsibility of our government to improve each one of these services for the trav258

elling community and perhaps then the health status of this ethnic minority group may improve. The 1994 breastfeeding policy initiated many changes and improvements in this area. This policy led to numerous developments in breastfeeding protection, support and promotion within Ireland. It has been proven that breastfeeding is now more common; between 1981 and 1991 the rate of breastfeeding in Ireland remained static at 32% and in 2008 the rate was 47%. This is a huge success for both breastfeeding policies and they have clearly changed breastfeeding attitudes and practices within Ireland. Due to the scope of the essay it was impossible to discuss all the landmark documents in relation to health, education and social services since 1990. There has been a huge amount of literature published due to increased awareness and pressure coming from national and international sources for the government of Ireland to look more closely at early years’ education, care and services. However, I chose documents which I felt had been influential in the development of early childhood care, education and services, and have made the greatest impact within these areas. Some progress has been made, but there is still a need for significant improvement and for the impetus in this area to continue to be strong. If the Irish government takes its eye off of this area to the detriment of children, they will be as culpable as previous administrations who have been found wanting in relation to early childhood services and care.

259

ENGINEERING PANEL

•

Judging Panel Prof. Nick Quirke (University College Dublin) – Chair Prof. Clive Williams (Trinity College Dublin) Prof. Patrick FitzPatrick (University College Cork) Judges’ commentary This is an original contribution to predicting risk levels due to subsurface construction. The authors the propose a new, integrated methodology that uses a three-stage process as follows: (1) traditional empirical relationships for predicting ground movement from tunneling, (2) recent advances in condition assessments, and (3) architectural designators related to usage and preservation listings. The methodology is applied to a study area of nearly 260 buildings in the city centre of Dublin Ireland, which is being considered for a metro. Although the test case is for tunneling, the approach can be readily adapted to many other subsurface construction activities including excavation and piling. The committee felt that the paper was academically excellent and well-written.

E NGI N E E R I NG

An integrated condition assessment & empirical approach to predict risk levels due to subsurface construction Julie Clarke & Laura Hannigan

n 1939 Ralph Peck criticized the Civil Engineering community for taking a bifurcated approach to the prediction of building damage due to subsurface geotechnical works. Specifically, he observed that the Geotechnical Engineers concerned themselves only with subsurface issues believing that their results were largely independent of the presence and condition of structures above. He continued that Structural Engineers charged with the risk assessment of buildings approached their work nearly in isolation of the activities below ground. Seventy years later, although the state-of-the-art has enabled a better understanding of soil-structure interaction, the reality remains that risk assessment from subsurface construction, is not yet an integrated activity when done on a large-scale basis. To help move beyond this, the following project proposes a new, integrated methodology that considers a three-stage process that involves the following: (1) traditional empirical relationships for predicting ground movement from tunneling, (2) recent advances in condition assessments, and (3) architectural designators related to usage and preservation listings. The methodology is applied to a study area of nearly 260 buildings in the city center of Dublin Ireland, in an area slated for an upcoming metro. The results are compared to the Environmental Im261

pact Statement issued by the consultants for the official project. Although the test case is for tunneling, the approach can be readily adapted to many other subsurface construction activities including excavation and piling.

Introduction The potential risk to structures as a result of subsurface construction is commonly determined through empirical methods and the use of a three-stage damage assessment process. Such an approach was adopted by Burland (1995) for assessing the risk to buildings resulting from the London Underground Jubilee Line Extension, and it was also utilized with the construction of the underground Crossrail project in London (Torp-Petersen and Black, 2001). While surface settlements may inflict the greatest degree of damage, numerous factors relating to the building itself, not just the ground below it, have a large part to play. This study developed a new methodology to establish which buildings were susceptible to significant damage. While based on the traditional empirical methods and settlement formulae as utilized by the above projects, the current condition of the building, the land usage and the architectural significance were incorporated into predictions through the development of new damage scales. The methodology was applied to the proposed construction of Metro North. This lightweight rail system has been proposed for Dublin City by Ireland’s Railway Procurement Agency (RPA). The rail will provide a vital transport link within the city and will serve to unify existing infrastructural systems. The first 5.5km of the proposed route will consist of twin tunnels situated below ground level to avoid encroaching on Dublin City’s limited space. The location of the stops in the initial portion of the proposed route means that tunneling under Grafton Street, the commercial centre of the city and a designated Architectural Conservation Area, is unavoidable. Since ground loss, surface settlements, and horizontal movements can all result from tunneling through soils, the assessment of the impact this tunneling will have on structures in this area is of the utmost importance. Background The findings of Skempton and MacDonald (1956) and Burland and Wroth (1975) provide the basis for the damage assessment of buildings subjected to tunnelinginduced subsidence and have changed marginally over the past decades. As early as 1956, Skempton and MacDonald established damage limits from a survey conducted of 98 buildings. The limits were defined in terms of angular distortion: for load-bearing masonry structures an angular distortion of 1/300 was suggested as a limit above which cracking was likely to occur; for framed buildings an angular distortion of 1/500 was suggested. The relationship between the initial visible cracking and the tensile capacity of material, known as the critical tensile strain, was investigated by Burland and Wroth (1975), for buildings subjected to excavation-induced settlement. 262

Their study was based on the concept of critical tensile strain, originally introduced by Polshin and Tokar (1957), which showed that the onset of visible cracking was associated with a critical tensile strain (0.05% for brick walls). This finding was reinforced by Burhouse (1969), who investigated that the tensile strain varies from 0.038% to approximately 0.06% at the onset of cracking. Based on these studies, Burland and Wroth (1956) conducted an analysis by representing the structure under investigation as a uniform, weightless, elastic beam of length L, height H, and a unit thickness. The value of the deflection ratio, ∆/L, which caused visible cracking for a material with a known value of critical tensile strain, varied from 0.05 to 0.1% for brickwork and blockwork set in cement mortar, depending on the mode of deformation, the relative shear to tensile stiffness, and the geometry of the structure. This agreed with the various existing criteria for brickwork. The concept of the critical tensile strain was further developed by Boscardin and Cording (1989). To establish a risk level for buildings, they proposed a relationship between the tensile strain and potential damage categories (Table 1). Another vital parameter in assessing the potential impact of tunneling is the prediction of the resulting ground settlements. Peck (1969) proposed that the shape of a settlement trough above a tunnel may be approximated by a normal Gaussian distribution curve of the form. Sv = Smax exp

-x02 2i2

[Eq.1]

where Sv is the surface settlement at a distance x0 from the tunnel centerline, Smax is the maximum settlement, and i is the distance from the centre line to the point of inflection of the settlement trough. O’Reilly and New (1982) further investigated the extent of settlement by examining a variety of parameters, such as ground conditions, details of tunnel construction and percentage ground loss. For soft fissured clay, they found the trough width parameter, K, to have a value of 0.4 - 0.5, and the volume loss at the surface, Vl (%), to be between ½ and 3. Formulae for the maximum settlement (Smax) and the slope of each building were proposed by Rankin (1988) (Eq. 2 and Eq. 3). Smax = 0.0125Vl r2 I

[Eq. 2]

Slopemax = Smax i

[Eq. 3]

263

In addition, O’Reilly and New (1991) proposed an equation for ground settlements for the more complex scenario of twin tunnels Sv combined = Vl exp -x02 + exp -(x0 – D)2 Kz√(2π) 2(Kz)2 2(Kz)2

[Eq. 4]

where Vl is the volume loss and z is the tunnel depth. Traditional ground settlement troughs, based on greenfield conditions, were proven to be overly conservative when Potts and Addenbrooke (1997) showed that the inclusion of the presence of the structure reduced trough depth due to the building’s bending and axial stiffness. The study was conducted using the finite element (FE) program ICFEP (Imperial College Finite Element Program) and, as in Burland and Wroth’s (1975) study, the existing structure was represented as a beam located at ground level. Modification factors were developed as a result, which could be applied to greenfield values of deflection ratio and horizontal strain to give a more realistic prediction of the likely damage to be experienced by the existing structure. This provided an important development in creating more realistic settlement predictions. A study by Burd et al. (1999) agreed with the findings of Potts and Addenbrooke (1997) by revealing an approximate 30% decrease (compared to greenfield settlements) in ground settlements. Their analyses showed that the building appeared to act as a stiff beam resulting in a decrease in ground settlements but an increase in settlement trough width.

Scope The chosen study area focuses on the first 5.5km of the proposed route, beginning at St. Stephen’s Green and running north as far as the southern edge of the River Liffey (Figure 1). For this portion of the Metro line, twin tunnels are proposed, to be located at a depth of roughly 15-20m below ground level, with an excavated diameter of approximately 6.4m, situated 7m apart. This area of approximately 0.005km2 includes roughly 259 buildings. The majority of the buildings are Victorian or Edwardian, date from the late 19th century to the early 20th century and primarily consist of narrow, four-storey terraced masonry structures. Many of the buildings have historical importance and this is reflected in the high number of protected structures present in the area (approximately 42). Data Collection Scaled drawings were obtained for the buildings located in the study area, providing relevant dimensions. Fieldwork was also conducted and involved carrying out a visual assessment of each building. This provided information regarding glass 264

frontage, fan windows, window sills, lintels, ornamentation, part shear walls, full length shear walls, party walls, building material, parapets and penthouses. In addition, a photograph was taken of each individual building. This thorough inventory of photographs enabled the classification of the current condition in conjunction with damage scales described later.

Three-Stage Assessment Process To predict potential tunnel-induced damage for the buildings within the study area, a new methodology was developed, based on the three-stage assessment process, as outlined in Fig. 2. The assessment process selected is similar to those applied to previous tunneling projects, such as the London Underground Jubilee Line Extension (Burland, 1995) and the underground Crossrail project in London (Torp-Petersen and Black, 2001).

Fig. 2. Methodology This paper advances the three-stage assessment process by incorporating the current condition of the building into the process. In the past, a condition assessment of buildings has not routinely been part of the tunnel-induced damage prediction process. The assessment process requires time, effort and experience and, thus, is a whole field unto itself. However, the role it plays is important in the overall damage prediction process, and so it has been strongly incorporated into the proposed 265

new methodology.

Stage 1 Stage 1 of the analysis considered traditional empirical limits relating to the maximum settlement (Smax) and the slope of each building within an anticipated soil trough. Ground settlements were considered under greenfield conditions, where the presence of the building is ignored. The settlement troughs obtained, based on greenfield predictions, may be considered conservative. However, the detailed assessment in later stages will account for this initial conservatism. The maximum settlement (Smax) and the slope of each building were calculated using Equations 2, 3 and 4. It was necessary that various data be obtained for the aforementioned formulae: x0, the distance from the tunnel centerline to the building edge, was obtained by measuring the distance off scaled maps using AutoCAD; the percentage volume loss at ground level (Vl) was assumed to be 1%; the distance of the tunnel axis to ground level (z) was taken as 15m; the distance from the centre line to the point of inflection of the curve (i) was calculated using an equation proposed by Rankin (1988) (Eq. 5) where K was assumed to be 0.5

i = Kz

[Eq. 5]

Buildings with a slope of less than 1/500 and whose settlement was less than 10mm were considered to be of negligible risk (Rankin, 1988), and were eliminated from further study.

Stage 2 In Stage 2, a damage rating relating to the severity of potential damage was assigned to each building. This overall rating was determined using a combination of a condition assessment and limiting tensile strain calculations. Firstly, a category of damage was assigned to each building based on the structure’s current condition. The inventory of photographs compiled was utilized to assess the current condition of each building in conjunction with damage scales proposed by Burland et al. (1977) (Table 2) and Laefer et al. (2008) (Tables 3-5). The damage scale proposed by Burland et al. (1977) relates visible external cracking of the building to a damage level. The various damage scales developed by Laefer et al. (2008) considered external parameters such as protruding or loose brickwork, replaced or repaired brickwork, damage due to exposure, and plant growth. The scores achieved on each scale were weighted accordingly and totaled. The combined score was used then used to designate an overall damage category relating to the current condition. A separate analysis was then conducted, where a damage category was assigned to each building based on the limiting strain concept proposed by Burland 266

(1977) and the risk chart subsequently developed by Boscardin and Cording (1989) as outlined in Table 1. The two damage category ratings obtained for each building were then combined, to achieve a damage estimation based on both the current condition and as a result of the potential settlement. Buildings which received a damage level of moderate or greater were further considered in Stage 3 of the process.

Stage 3 Stage 3 of the assessment process involved the classification of the remaining buildings according to the architectural designators land usage and architectural significance. Scales were developed (Tables 7 and 8) which weighted these parameters, with higher modifiers given to those deemed to be of greater significance in influencing potential damage. The architectural significance of the building was deemed to be of greater importance in assessing potential damage and was thus weighted twice that of land usage, when the score from Table 6 and Table 7 were combined. The severity of potential damage was then predicted for each building based on the resulting combined score. Results In Stage 1 of the assessment process, 98 of the buildings in the study area (38%) were subjected to a predicted surface settlement of less than 10mm and a slope of less than 1/500, under greenfield conditions. They were therefore considered to be of negligible risk and were eliminated from further study. The remaining 161 buildings (62%) were further considered in Stage 2 of the assessment process (Fig.1 (a)). In Stage 2, a damage rating relating to the severity of potential damage was assigned to each building. This overall rating was determined using a combination of a condition assessment and limiting tensile strain calculations. The condition assessment rating was obtained using a combined score from Tables 2-6. All of the buildings fell into a damage category of slight or above. 33% of the 81 buildings in Stage 2 obtained a damage classification of negligible, 32% as very slight, 26% as slight, and 9% as moderate. None were classified as posessing a severe or very severe risk of damage, based on their current condition. Limiting tensile strain calculations also assigned a rating based on Boscardin and Cording’s damage scale (Table 1). 21% of the buildings fell into the slight category, 37% the moderate category, and 42% the severe to very severe category. These two ratings were then combined to receive the overall damage category based on both the current condition and limiting tensile strain of the building. 100 of the buildings considered at Stage 2 were classified as being of very slight to slight risk of damage, and were eliminated from further study. 61 buildings were further identified for Stage 3 consideration (Fig. 1 (b)). At this point it was noted that clusters of buildings susceptible to damage began to emerge; most notably at either end of Grafton Street. Of particular concern 267

Degree of Damage Negligible

Limiting Tensile Strain (%) 0 – 0.5

Very Slight

0.05 – 0.075

Slight

0.075 – 0.15

Moderate Severe to very severe

0.15 – 0.3

Risk Category

4 to 5

> 0.3

Table 1. Relationship between category of damage and limiting tensile strain (after Boscardin and Cording 1989) Risk Categor y 0 1 2 3

Degree of Damage

Description of Existing Damage

Negligible Very Slight

Hairline Cracks Fine cracks easily treated during normal decoration Cracks easily filled. Several slight fractures inside building. Exterior cracks visible

Slight Moderate

Severe

Very Severe

Cracks may require cutting out and patching. Doors and windows sticking.

0.1-1 1-5 5-15 or a number of cracks greater than 3

Extensive repair involving removal and replacement of walls, especially over doors 15-25 but also and windows. Windows and door frames depends on distort. Floor slopes noticeably. number of cracks Major repair required involving partial or Greater than 25 complete reconstruction. Danger of but depends on instability number of cracks

Table 2. Building Damage Classification (after Burland et al., 1977)

268

Approximate Crack Width (mm)

Risk Category 0

Degree of Damage Negligible

Very Slight

Slight

Moderate

Severe

Very Severe

Description of Existing Damage All bricks in the same plane A few bricks (1 – 3) are noticeably out of plane/ Mortar appears to be loose/ weak/ missing around 1 – 3 bricks Overall, more than 5 bricks appear to be slightly out of plane/ Gaps in mortar are more noticeable/ Just perceptible difference in line of brick Overall up to 10% of bricks are noticeably out of plane Noticeable slope in masonry Windows, lintels, doorframes etc. are noticeably tilted Overall, up to 15% of bricks are missing entirely Noticeably outward bulge in the wall Window lintels and doorframes are at an angle greater than 15 degrees More than 15% of bricks are missing entirely Sections of the wall are on the verge of collapse Repair work would require majority of wall to be rebuilt

Table 3. Protruding or Loose Brickwork (after Laefer et al., 2008) Risk Category 0

Negligible

Very Slight

Slight

Moderate

Severe

Very Severe

Degree

Description of Existing Damage None Brickwork was replaced as a result of filling a doorway or window. Replacement Occurred in rarely occurring small clusters (i.e. 2-6) of bricks. Replacement Occurred in larger clusters (greater than 6) More than 10% of the wall is comprised of replaced brickwork More than 25% of the wall is comprised of replaced brickwork

Table 4. Replaced or Repaired Brickwork (after Laefer et al., 2008)

269

Risk Category

Degree of Damage

Very Slight

Slight

Moderate

Severe

Very Severe

Negligible

Description of Existing Damage None

Isolated, rarely occurring chipping (i.e. 1-3 bricks)/ Lower perceptible damage of overall wall. Perceptible overall damage (weathering) of bricks in wall. Numerous examples of significant damage i.e. greater than 5%

Noticeable damage to greater than 15%of bricks in wall Greater than 25% of bricks are subjected to heavy chipping / spalling. Bricks are heavily eroded due to exposure

Table 5. Damage due to Exposure (after Laefer et al., 2008) Risk Category 0

Degree of Damage Negligible

Very Slight

Slight

Moderate

Description of Existing Damage None One or Two examples of weeds growing in typical places ( i.e. top of chimney, ledge etc) The weeds growing are more numerous as well as being more overgrown Whole wall ensconced with vegetation

Severe

Minor bush/tree growing out of masonry

Very Severe

Major (fully grown) tree growing out of masonry

Table 6. Plant Growth (after Laefer et al., 2008) are the buildings located at St. Stephen’s Green North, as this is in close proximity to where tunnel construction begins. The initial construction of the tunnel can often lead to increased settlements due to the engineer’s unfamiliarity with the soil conditions. These buildings were further considered in Stage 3 where a damage rating was assigned based on land usage and architectural significance (Tables 7 and 8). 95% of the buildings in Stage 3 were situated in a commercial/retail/business area or an area consisting of offices. 3% of the buildings were located in an educational/institutional/ community/civic area and 2% in a residential area with mixed uses. 74% of the buildings were situated in an Architectural Conservation Area or a Conservation Area but were not Protected Structures. Only 23% of the buildings 270

Land usage Other Spaces, Recreational Uses

Modifier/ Weight used 1

Residential Areas/Uses

Carparks

Areas under Construction

Residential with Mixed Uses (Commercial, Retail, Offices)

Offices/employment Uses

Commercial, Retail, Business Uses

Educational, Institutional, Community, Civic Uses

Table 7. Land Usage Weighting System Category Neither a Protected Structure nor located in an Architectural Conservation Area or a Conservation Area Located in an Architectural Conservation Area

Modifier/ Weight used 1 2

Located in a Conservation Area

Protected Structure

Protected Structure located in a Conservation Area Protected Structure located in an Architectural Conservation Area

4 5

Table 8. Architectural Significance Weighting System were Protected Structures and situated in an Architectural Conservation Area, and 3% of the buildings were Protected Structures or Protected Structures situated in a Conservation Area, but not holding concurrent designations. While two main clusters of buildings were identified in Stage 2, the more detailed analysis of the Stage 3 assessment highlighted that the buildings grouped near College Green had a more critical damage level. In addition, 1- 3 St. Stephen’s Green, St. Teresa’s Church on Clarendon Street, 96-98 Grafton Street, 71 Grafton Street and 2 College Street were classified as being at a severe risk of damage (Fig. 1 (c)). Overall, 5.4% of the total buildings in this study were determined to be at risk of severe damage and thus, will most likely require mitigation measures, such as underpinning or injection grouting, to protect their structure. In addition, 20% of 271

the buildings may be at risk of moderate damage, and may also require mitigation measures.

Environmental Impact Statement An Environmental Impact Statement (EIS), published by Ireland’s Railway Procurement Agency (RPA), analyzed the impact that Metro North will have on its surroundings.The EIS outlined an impact assessment which investigated tunnelinginduced ground movements and their effect on nearby structures. The process which was adopted for the investigation was similar to the three-stage damage assessment process conducted in this study and deals with a similar study area. The main difference is that the current condition of the building was not taken into account. The EIS notes five buildings to be at risk of severe damage as a result of tunneling; Trinity College Gate House; Bank of Ireland, College Green; Brown Thomas Department Store; St. Theresa’s Church, Clarendon Street; Gaiety Theatre. Firstly, Trinity College Gate House and Bank of Ireland, College Green could not be analyzed in this study due to the large size and complexity of the building. The hand calculations used were insufficient to encompass the complexity of such buildings and a finite element analysis program may need to be utilized to provide sufficiently accurate results. Two of the four remaining buildings considered at risk of severe damage by the EIS were eliminated in Stage 2 of this assessment. It is noted that these buildings are classified as protected structures. If this had been factored into the study at an earlier stage, these buildings may have received higher categories of damage and may not have been eliminated at Stage 2. St. Theresa’s Church, Clarendon Street was deemed to be at severe risk of damage by both reports. This indicates the severity of the potential damage that may be caused to this building as a result of tunneling, and also serves to confirm the validity of the three-stage assessment process adopted in this study. 1- 3 St. Stephen’s Green, 96-98 Grafton Street, 71 Grafton Street and 2 College Street were additional buildings identified in this report as being at a severe risk of damage, in comparison with the EIS. This exemplifies that conducting a damage assessment without taking the current condition of the building into account may omit buildings that could potentially suffer severe damage resulting from their sub-standard condition. Conclusions Traditional damage assessment processes adopt an empirical approach based on settlement calculations to predict risk levels, however, neglect the current condition of the building. A new methodology was developed to integrate the current condition of a building into the traditional damage assessment process, for predicting risk levels due to subsurface construction. This construction may include tunneling, excavation or piling. New damage scales were developed in Stage 2 and 272

(a)

(b)

(c)

Fig. 1 (a) Buildings susceptible to damage after Stage 1 (b) Buildings susceptible to damage after Stage 2 (c) Damage Category rating after Stage 3 Stage 3 of the assessment process to categorise the level of potential damage a building may be at risk of. This categorisation was performed in order to determine which buildings may be at risk, and subsequently which may require protective measures, as a result of tunnelling works. A flow chart was developed to provide a simple way of following the new methodology proposed in this report. In comparison with the Environmental Impact Statement produced by the RPA, a shortcoming was identified, as protected structures were not considered until the third stage. However, the identification of St. Theresa’s Church in both reports as being potentially susceptible to severe damage, indicates that the process adopted here has validity. Four additional buildings were noted as being at risk of potential severe damage. This highlights the fact that the inclusion of the current condition assessment of a building identifies buildings which may have been omitted otherwise. Predicting such risk levels accurately is a vital component of the subsurface construction process, so appropriate mitigation measures can be put in place, if required. 273

ENGLISH PANEL Panel Members Prof. Elmer Kennedy (University of Ulster) – Chair Prof. Nicholas Grene (Trinity College Dublin) Prof. Peter Denman (NUI Maynooth) Prof. Brian Carahar (Queen’s University Belfast) Prof. Jan Jedrzejewski (University of Ulster) Dr. Farnkie Sewell (University of Ulster) Dr. Anne Jamison (University of Ulster) Dr. Willa Murphy (University of Ulster) Judges’ commentarty This was a very impressive essay, analysing the treatment of the figure of Hal in two modern film adaptations of Shakespeare’s Henriad: Orson Welles’ Chimes at Midnight and Gus Van Sant’s My Own Private Idaho. The judges were particularly impressed by the clarity with which the author brought together modes of analysis appropriate for different genres of narrative – literary and filmic – to produce a thoroughly integrated and very persuasive analysis of his central thesis. There was also praise for the way the author used existing scholarship without ever becoming dependent on it, and for the essay’s sense of logic and unity that made it a serious piece of academic work rather than merely an exercise in literary/filmic criticism. In short, this was a highly original, technically well-informed, stylish and intellectually ambitious paper which stood out quite significantly in these respects from the other submissions.

E NGL I SH

Tragedy in triumph: The lost paradises of Hal the Hypocrite Tim Mc Inerney

“W

hat wouldst thou think of me if I should weep?” asks a recumbent Prince of Wales1 of his companion Ned Poins2 in one of the most powerful scenes of Orson Welles’s acclaimed screen adaptation of William Shakespeare’s “Henriad,” Chimes at Midnight (1966). As the camera shifts without warning from a group scene to a startlingly intimate close-up sequence that alternates between the two men, the film’s infamously harsh audio distortion has the remarkable effect of adroitly conveying a deafening silence. Invasive, scrutinising, and even contemptuous, Poins’s somewhat sinister face fills the screen as he slowly articulates: “I would think thee a most princely hypocrite.”3 It is perhaps fitting within the web of contradictions that characterises Shakespeare’s triad of Henry plays that the static sound quality of Orson Welles’s film version has a peculiar capacity to greater accentuate this moment of intense clarity.4 The effects of sudden cinematic tranquillity serve to transform this most crucial of transactions into a profound deliberation on the prince’s hypocrisy. Hal, who has finally arrived at that long foreshadowed moment when he must give up 1 Played by Keith Baxter 2 Played by Tony Beckely 3 In Shakespeare’s original: 2 Henry IV. II. ii 4 In fact some critics (notably Michael Anderegg) have argued that “The poor sound quality of Chimes At Midnight was intentionally engineered and is an indication of Welles’s art…” Howlett ed, p. 151.

275

his old friends and bad habits in favour of the straight and narrow path of kingship, is being judged – if not accused – by the film, and its audience, of a hypocrisy that has haunted every shadowy aspect of his character. In fact, Welles’s cinematic treatment of this dialogue serves to graphically highlight a theme that runs solidly throughout Shakespeare’s Henry plays: the disquieting detail that “Hal schools himself in hypocrisy.”5 From the Prince’s portentous declaration of “I know you all…” in the second scene of 1 Henry IV to his denunciation of “I know you not…” in the closing scenes of 2 Henry IV,6 the conceit of his duplicity lends a pervasive sense of anxiety to the way we receive this most baffling of Shakespearean kings. As John Masefield scathingly asserted in 1911, “Prince Henry is not a hero, he is not a thinker, he is not even a friend; he is common man whose incapacity for feeling enables him to change his habits whenever interest bids him… He makes a mockery of the drawer who gives him his whole little pennyworth of sugar.”7 Thirty years on, the Prince would find himself once again on the receiving end of some rather relentless interrogation on screen. Gus Van Sant’s treatment of the Henriad in My Own Private Idaho (1991) dwells on Hal’s hypocrisy to such an extent that his character, represented in the film’s Scott Favour,8 is portrayed as blossoming into an all-out villain. The treatment of the “Hal character” as a villain, or more importantly, a loser, is an acutely subversive element in the fibre of the original text, bound by all its superficial trappings of monarchical glorification. Born of a father who “addresses all rebels in terms that would be impeccable if only he and they could forget that he was once a rebel himself,”9 even Hal’s dramatic genesis is riddled with hypocrisy. He embodies a celebrated young beacon of royalty whose God-given destiny rises above his earthly shortcomings, while at the same time exemplifying the crude Machiavellian tendency towards manipulation in which this self-same destiny is undermined, satirised, and even openly ridiculed.10 In a world of modern media where little credence is given to the divine right of kings, it is little wonder that Hal, having been interrogated by the gaze of Welles’s camera, should eventually come to be vilified by Van Sant’s screenplay. Likewise, in the hypocritical world of Machiavellian self-service, the end that justifies the means, it seems, is 5 Joseph Mc Bride, ‘Chimes at Midnight ‘ in Gottesmen’s Focus on Orson Welles, cited in Pilkington, p. 134 6 1 Henry IV, I.ii.188, and 2 Henry IV, V.iv, 48, respectively 7 Masefield’s ‘Hal – the Unheroic Hero’ (New York, 1911), His criticism perhaps demonstrates how Prince Hal’s hypocrisy has invoked passionate condemnation for at least the last century. cited in Sanderson ed. p. 245 8 Played by Keanu Reeves. It is interesting to note the significance of the name ‘Scott,’ considering the ethnic bckground of the northern rebels in 1 Henry IV 9 M.M. Reese, ‘Father and Son’, from The Cease of Majesty, cited in Sanderson ed., p. 230 10 The possibility that the play is deliberate satire is an ever-present element in the Henry IV plays, L.C. Knight notes that there are four separate accounts given in the first part on how Henry IV has unjustly usurped the throne, and points to the possible irony in the closing lines of the play : “And since this business so fair is done, Let us not leave till all our own be won” [1 Henry IV, V.v.43-4] (Knight’s emphasis) from ‘Henry IV as Satire’ in Eric Bentley ed. The Importance of Scrutiny, cited in in Sanderson ed.,

276

not always worth its own weight. This essay will explore the extent to which Hal’s hypocrisy is expounded and represented in the films of both Welles and Van Sant. We will consider how the motifs of tragedy in triumph and hypocrisy in heroism are explored and explicated through the lens of twentieth-century cinematic production, while looking at the problematic effects on the historical hero when the triumphant assumption of kingship is framed within the context of irrevocable loss. We will investigate the treatment of Hal as a hypocritical ‘loser’ by way of three innovations that both films hold in common: the interpretation of the plays’ division of their action into different spheres that interact and compete for the audience’s attention and the reflection of these worlds in the plays’ main characters; the management of masculine ideology and the portrayal of relationships between men in this remarkably homosocial world; and finally the filmic treatment of time and space as a heuristic and representational mechanism. Above all, we will see how both films deal with the plays’ most disturbing implication: an inevitable loss of happiness; an unstable and nostalgically constructed sense of utopia that will, seemingly inevitably, come tumbling down. Behind the steely façade of a newly coronated Hal or a Scott Favour recently bequeathed with vast inheritance, there lies a world of lost happiness, personified in the heartbroken Falstaff. “Almost all serious stories in the world,” said Orson Welles of Chimes, “are stories of a failure with a death in it…but there is more lost paradise in them than defeat. To me, that’s the central theme in Western Culture: the lost paradise.”11 There is no denying that Prince Hal is a difficult character for an audience to empathise with, much less to valorise. While Van Sant’s film greets its audience with a gloss of the term “narcoleptic,” referring to the medical condition of the central character Mike Waters12, both his and Welles’s representation of the young Henry cannot help but leave one feeling that it might be more appropriate to investigate the term “sociopath.”13 While stopping short at diagnosing the Prince of Wales with Antisocial Personality Disorder, it cannot be avoided that Hal’s cold, remorseless and utterly destructive actions are more than a little problematic. We are invited by the opening scenes of the play to see the young prince, though wayward and unresponsive to his duties, as a paradigm of untempered virtue who prophesises his own glorious rise to greatness. It remains a categorically compli11 Welles, quoted in Juan Cobos and Miguel Rubio ed., ‘Welles and Falstaff: An Interview’ in Sight and Sound 35, (Autumn 1966), cited in Howlett p. 152 12 Played by River Phoenix 13 Incidentally: Sociopath: Adj; Someone with a personality disorder manifesting itself chiefly in anti-social attitudes and behaviour. Hence sociopathic a.; sociopathy. www.oed.com. Antisocial Personality Disorder (APD): … “The essential feature for the diagnosis is a pervasive pattern of disregard for, and violation of, the rights of others that begins in childhood or early adolescence and contains into adulthood. Deceit and manipulation are considered essential features of the disorder.” From the American Psychiatric Association (1994) in Diagnostic and Statistical Manual of Mental Disorders. Washington, DC: American Psychiatric Association. Cited on www. wikipedia.org

277

cated task however, to portray Hal’s premeditated induction into the society of thieves and petty criminals – only to publicly denounce them to make more of his assumption of “virtue,” – as anything less than unnecessary and indulgent, if not wantonly cruel. Indeed, it would take little more than a slight rephrasing of speech, or perhaps a more condemnatory title to re-introduce Hal as a maniacal powerhungry monster, whose virtuous soul itself was the “act,” put forth to make his black heart all the more horrifying when it raised itself onto the throne. As it is, however, Hal is all the more of a conceptual problem because of his active involvement in each of his contradicting social worlds.14 Shakespeare’s division of 1 Henry IV into the separate actions of the castle, the tavern and the rebels is certainly rich fodder for the cinema screen. Welles’s dramatic discrepancy between the long tall stone interiors of the castle and the rotund, labyrinthine vaults of the Boar’s Head lend these spaces a fundamentally representational value. They immediately introduce the foundational image of “straight” versus “crooked,” “direct” versus “convoluted” and “linear” versus “cyclical,” that is to be made central in Hal’s early speech on the sun:15 I know you all, and will awhile uphold The unyoked humour of your idleness; Yet herein will I imitate the sun, Who doth permit the base contagious clouds To smother up his beauty from the world That, when he please again to be himself, Being wanted, he may be the more wondered at … I’ll so offend to make offence a skill, Redeeming time when men least think I will. (Emphasis added, 1 Henry IV I.ii.188 – 210) This crucial speech, being as it is the play’s only direct explanation (or excuse) for Hal’s bizarre behaviour, is referenced consistently throughout the play. Furthermore, the prince’s use of the word “imitate” implies that we are not as of yet privy to the prince’s true motivations, but are only witnessing another layer of his hypocritical methodology. Moreover, the fact that he uses the language of imitation with the play’s consistent word-play on sun/son, inescapably recalls his father’s wishful fantasy in the first scene of 1 Henry IV that he is not his son at all, but a changeling impostor. Indeed, this speech figures Hal as asserting himself as an impostor in every social world he partakes in, imitating a member of the tavern 14 For the purposes of this essay we will leave the world of the rebels mostly undiscussed, due to the excision of Hotspur for the most part from Idaho. 15 As Anthony Davies notes, the castle/tavern are also oppositions of the phallic/yonic, this is all the more significant when we consider the patriarchal nature of hereditary kingship and the pansexual energy of the non-linear tavern.

278

community only so he can better imitate a prince of the castle, and thus signalling a basic hypocrisy as his sole means of social success. Without a doubt, Welles loses no time in bestowing the speech with its full representational weight. He places Hal outside the tavern, looking towards the high stonewalls of the castle; he is only a few feet from a watching Falstaff (who, incidentally, is not present in the original text), but has his back firmly turned away from him. Nearby is a crooked tree, gnarled and not yet in bloom, but nonetheless striving towards the heavens. The sky above obediently enacts the image of obscured brightness as the sun filters, accordingly, through a thick and unremitting layer of cloud. By placing him so literally between the two main “worlds” of the film, Welles is in fact removing Hal from either space, disassociating him from a context to as to better consider him in isolation. This moment of transition thus establishes him both as a dramatic unifier and as a “non-member” of either of these divorced social spheres. Hal will, of course, be envisioned later in the film as basking in the full light of the sun beside an eminently upright and leafy tree, not long before Poins christens him a hypocrite. Though Van Sant’s film pays a great deal of homage to Welles’s version, not least in this scene, the effect of representational transition in Chimes at Midnight is entirely abandoned in My Own Private Idaho. Van Sant’s parallel “worlds” are that of an abandoned hotel, with cavernous halls and endless passages much in the manner of Welles’s tavern, and a mahogany panelled office space, wherein Scott’s father is only ever seen. These opposing cinematic worlds, though clearly referencing those of Welles, come to work on a decidedly different dynamic. The mahogany office, as an influence on Hal’s fate, is hardly ever utilised in the film. It appears only in a handful of static, fleeting scenes, which function more like an allegory of convention itself than a world of its own. Indeed, in true allegorical fashion, it is filled with trophies, achievements and images of the past, establishing itself as a realm of the linear and progressive. Scott’s father too, is envisioned as little more than a signifier of impotence; Van Sant cuts through Welles’s ironic low angle shots of the throned king in all his usurping guilt, physical vulnerability and regal insecurity, and places him, firmly subordinate, in a wheelchair whereupon the camera looks down. Indeed, both throne and wheelchair as reifications of the king’s dependence and insecurity are made the main parodic focus in the mock interview scene16 in both film versions.17 The first works to represent the pompous fallacy of presumption, the second the ultimate ineffectuality that lies behind it. Neither in the original text nor in its film adaptations, it seems, are these dramatic worlds on an equal standing. While the castle is made a mockery of in the tavern, the tavern is feared in the castle as an aggressive and intimidating threat. The king’s agents can be dismissed form the tavern by the prince with a simple wave of the hand; while Hal bids the Sherriff “so let me intreat you leave the house” 16 �� In the original text at 1Henry IV, II.iv, 364 - 468 17 This scene was cut from the final edit of My Own Private Idaho, being deemed too long and apparently irrelevant. It is available on the DVD’s supplemental deleted scenes.

279

(1Henry IV, II.i.500), Scott utters a not so eloquent “fuck you.” In marked contrast, Falstaff’s intrusion on the Castle world threatens fundamental subversion. While only social incongruity is utilised as a transgression in the original text, the final scenes of both Welles’s and Van Sant’s films portray this royal interruption as having the power to strike fear and revulsion into the tenuous core of conventional society. Moreover, Welles’ directorial decision to introduce the uncontrollable Falstaff at the moment of Hal’s coronation suggests that this kind of disruption has the potential to destabilise the entire patriarchal world order. Ironically, the tavern is the realm of power in this play. That Hal should denounce this unusual territory of dramatic authority within the play for one that has been held up to the audience as ridiculous and deluded enacts yet another of his falling hypocrisies. The recognition of the Wellsian cinematic worlds and the subsequent shifting of their focus, has a dramatic effect on Idaho’s Hal character. Scott Favour delivers the same basic “sun” speech as his predecessor; albeit in a surprisingly effective modern rhetoric (“I will impress them all the more” muses Scott, “when such a fuck up, like me, turns good”). Unlike in Chimes however, the scene neglects to reflect his spherical ambivalence, focussing more on his relationship with the sometimesFalstaff-character, Bob. Though his overseen soliloquy takes place outside the abandoned hotel that stands in for the tavern, he looks through an open doorway that leads only onto a busy road. There is no tree, and there is little concern with the act of growing straight (so to speak). In fact, Scott’s already incongruous three piece suit makes much more explicit from the outset where his true dedications lie. His deficiency of equivocal language, too, makes all the plainer his indication of future abandonment to the watching Bob, and undermines the possibilities of spherical ambivalence that are so characteristic in Welles’s Hal. In Scott, Van Sant delivers a Hal character whose emotional journey (quite unlike that of Welles’s Hal) the audience is not invited to share. The cinematic ruminations on his facial expressions, indecisions, hesitations and even bewilderment that characterised Welles’s prince are cleanly excised from Idaho. The audience is given instead a mostly two dimensional and largely unreadable character that seems as intractable as his ruthless ambition. It follows that the great weight of ambiguity and complexity in Hal’s character are shifted onto the impenetrable Mike. As a herald of Falstaffian reaction and a paradigm of motiveless desire, it is only through him that the film invites us to consider Scott at all. Though the film introduces a pantomime Falstaff figure in the guise of Bob (who is, to be sure, heralded with renaissance music whenever he enters a scene), the film’s representation of Falstaff himself is entirely fragmented. It is no coincidence that in the very first scene of the film in which Mike is seen standing on an empty Idaho road, that he is wearing a tradesman shirt labelled with the name “Bob” on the breast pocket, nor that the beer that the “tavern” community drink is itself labelled “Falstaff.” If Bob is Falstaff, then so is Mike, if Mike is Falstaff then so is every crumbling dimension of the abandoned Portland hotel. The character of Mike – most often identified somewhat facilely with Ned Poins – actually takes 280

on a momentous breadth of significance in the film. He works both as a subversive unifier of the disparate worlds, and as the essence of a world that is itself fragmented. His position as a hustler brings him into the same conventional sphere of hypocritical patriarchal standards of Scott’s father, while firmly remaining part of a liminal and untouchable social caste. While he often does fill the shoes of Poins during some of the more direct allusions to the original text, his inscrutable depth of character and fundamental ambiguity means that he comes to represent the world that Scott must reject more than any other character in the film. It is in him that we see that enigmatic element of Falstaff that has Hal so captivated – an indescribable sense of camaraderie and mutual dependence, a deep urge to follow and conserve, perhaps most succinctly portrayed in Van Sant’s positioning of Scott and the sleeping Mike in a pastiche of Michelangelo’s Pieta early in the film.18 Certainly, Bob on his own has no direct equivalence to Welles’s Falstaff: he is pathetic when Welles’s character is wryly self-aware; he is explicit when Welles conceals a galaxy of unspoken complexity within his expressions and tones; and he is decidedly peripheral when Welles proudly dominates the narrative. In Idaho, Bob comes to represent, solely, the object of Hal’s conscious, mindful sadism. He is introduced in a distinctly subordinate manner: “he was fucking in love with me,” Scott tells Mike, and though he goes on to declare his paternal love for Bob as greater than that for his father and mother combined, his already asserted feelings for his father give this statement no particular depth. In fact, there is no one scene in Van Sant’s film wherein Scott’s love for Bob is made evident in any demonstrable way. Quite the opposite. Bob is figured as the victim of relentless and unremitting hatred. “Somewhere along the line,” says Nigel Wood, “the abuse of Falstaff becomes the allure of the prince…”19 The scene in which this second father is comically quizzed as to the presumed failure of the highway robbery, succinctly captures the conceptual differences between the two representations of Falstaff. Welles’s Falstaff is worked up into a frenzy by his mocking friends, before being allowed the dignity of his own characteristic hypocrisy. Falling back into good humour, he claims to have known about the robbery coup all along, while Hal’s reaction and his mischievous expression explicate that this is simply a silent agreement between the two that allows him to save face, if only at a superficial level. Scott’s management of the same scene is certainly not an occasion of jovial mockery; indeed it might be better likened to bearbaiting. Bob’s decreasingly credible explanations lead him into a psychologically tortuous corner of inescapable taunts and jeers. The camera moves dizzily from the callous heckling of the entire “tavern” community, encircling a furious and impotent Bob, who is offered no such rhetorical relief as his Wellsian counterpart. His attestations to having known all along are weak 18 Another feature of this tableau is the Portland monument in the background that reads “The coming of the white man,” an idea which is expanded throughout the film (Native American chanting heard in the distance during desert scenes, for instance) as a signifier of arbitrary sophistication and conventional authority. 19 Wood, p. 49

281

and pitiable, and are not in the least bit humoured by the rest of the crowd. In the mock-interview scene where Hal and Falstaff both imitate King Henry, the same cruelty can be distinguished. Instead of a medium for the complex relationship of criticism and admiration that characterises Welles’s Hal and Falstaff, Van Sant’s scene yet again becomes a vehicle to explicitly mediate the prince’s underlying hatred for his companion. As he takes the stage to enact his real father’s description of his adopted patriarch, his jocular digs descend into malicious humiliation. By the time he finishes the scene, there is no more semblance of pretence, and he is simply shouting obscenities at his crestfallen friend. This conflation of hatred and love is of course a central feature of the Hal character’s profound hypocrisy. In Chimes the complex relationship between the men in the film is unquestionably given a great deal of attention.20 As James Naramone has noted,21 in a world where women are remarkably scarce, Welles’s tavern stands in as a sort of feminine bubble; his round, affectionate figure serving as a binary foil for the masculine duties of the castle. However it is conceptualised, the rapport between Hal and Falstaff is certainly not a kind of affiliation between men that is tolerated within the castle walls. It follows that the sort of male-male relationships which society approves and the sorts that are to be disposed of at all costs, is an issue that has great resonance in both films. The aforementioned dialogue between Welles’s Poins and Hal is just one of many instances where it is suggested that they may, in fact, be lovers. The alternating close ups of them looking knowingly into each other’s eyes certainly have the appearance of being far from innocent. As Ace G. Pilkington notes, Welles did not refrain from including even the most explicit of the play’s references to homosexuality in the original shooting script of the play. In noticing the servant of Master Shallow for instance, Falstaff remarks sardonically: “Thus Davy serves you for good uses; he is your serving man and your husband.” To this Shallow replies: “When flesh is cheap and females dear, and lusty lads room here and there so merrily, and even along so merrily!”22 Undoubtedly, the character of Davy survives into the film as a paradigm of the post-war homosexual stereotype: near androgynous, lisping and mincing across the room in a devious, even conspiratorial fashion. The inclusion of this character imports a wealth of suspicion into the bawdy conduct of the tavern and gives a prominent voice to major implications of pansexual relationships. Indeed, Rubinstein notes that the original text utilises Davy, (whose having offered Falstaff “a cup of wine sir?”23 links him di20 Robin Wood states fallaciously and rather oxymoronically, “it might be argued that a strong homosexual undercurrent runs through Welles’s work, the more potent perhaps for never being exposed to light.” Cited in Pilkington, p. 185, note 105. As we will see, the homosexual theme is quite overt in the film, as in the play – and has been “exposed to light” quite a bit since the films production. 21 “In a sense…Falstaff acts both as a displaced mother, being associated throughout with softness, earthy affection, and nourishment… He is the figure who stands for the child’s need of love, intimacy, and human contact.” James Naramone, ‘The Magic World of Orson Welles’, cited in Davies p. 127 22 2 Henry IV, V. iii 56 23 2 Henry IV, V. iii 53

282

rectly to the classical figures of Jove and his boy lover Ganymede the cup bearer), to suggest a sexual element in the relationship between Falstaff and Hal. Most notably, when Falstaff accosts the newly coronated Hal he declares: “My king! My Jove! I speak to thee my heart!” The language he uses, writes Rubinstein, “leaves little doubt about their relationship.” Whatever the inference, the implications of unconventional sexuality in Chimes are difficult to ignore. During a scene in which Hal is berating Falstaff from the rafters,24 Welles shoots a curious sequence that has both Poins and the prince carousing with Doll Tearsheet, who just moments before been exchanging words of love with Falstaff. Here too, the implications of orgiastic tendencies run side by side with an implication that Doll may merely stand in as a correlative for the desire that exists between the three men themselves. The suggestion of a sexual relationship between Hal, Poins and Falstaff, has the power to intensify his abandonment on a grand scale. It implicates his dalliance with the seedier side of life in a whole web of personal and emotional involvement that both question his base desires and the nature of his ambitious motivations. If Hal is giving up a lover, or even a sense of a utopian physical intimacy with men that he will evidently never know again, it adds a whole new dimension to the loss he will suffer in kingship. The theme of homosexuality in both Bob and Mike as signifiers of a Falstaffian energy further fragments the spirals of power and pleasure that attract and repulse Hal/Scott. In Idaho, homosexual behaviour is figured as one of the main transgressions that constitutes Scott as a “fuck up.” In this film too, Scott’s “homosexuality” is expounded as his most explicit centre of hypocrisy and self-delusion. “His presence on the streets” writes Greenberg, “is provisional, a function of bristling oedipal revolt.”25 If even. In a dream-like sequence that depicts the Oregon hustlers as models on the covers of pornographic magazines – a grim rumination on the commercialisation, commodification and ultimate de-humanisation of prostitution – Scott’s position as a voluntary sex worker is incongruous and even odious. While Welles’s Hal’s condescension to the Boar’s Head seems to be met only with delighted acceptance, the underlying inference of Marie Antoinette playing milkmaid in Scott’s “slumming it” is explicitly criticised by the other hustlers in Idaho. Furthermore, Scott is not, as he asserts on numerous occasions, in fact homosexual. “It’s when you start doing things for free,” he says from the window of his magazine, “that you grow wings… grow wings and become a fairy.” Conversely, the character with whom the audience has been led to identify, the narcoleptic Mike, is positioned in a direct contrast to Scott’s hypocrisy. His innocent, unrequited love is faced with a cynical, disparaging, and intractable sense of sexuality. “Two guys can’t love each other,” Scott informs his clearly besotted friend during the Idaho fireside scene. “Yeah,” Mike replies, pausing before he marks film’s most poignant comment on the Hal character’s insidious hypocrisy: 24 In the original text at 2 Henry IV, II.iv “Lets beat him” suggest Poins at 248, “before his whore” 25 �� Greenberg, p. 24

283

“…well, I dunno. I mean, for me, I could love someone if I, you know, wasn’t paid for it… I love you, and, you don’t pay me.” The cloud-obscured Scott is bringing his conventional sun-bright ideology into a dark world that he only frequents in order to make for a vivid contrast. Unsurprisingly, it has a devastating effect. Placing the conventional ideology that underlies his faux-rebellion alongside Mike’s simple and disinterested assertion of real emotional significance showcases both the ridiculousness of a conventional morality and the hypocrisy that is instrumental in its deployment. Indeed, it is Scott’s own heterosexually sanctified “sexual tourist”26 mentality that is equated in the film with paid-for sex. “The film thereby suggests that compulsory heterosexuality is a form of self prostitution for the sake of normalcy.”27 His abandonment of a sphere wherein he is loved unconditionally in favour of preconceived assumptions of normative social order exposes him as no better nor worse than the father he criticises so much, and just as ruinous. It is little surprise that this heterosexually conventional self-prostitution is exactly what Scott enacts with Carmella. In an interesting movement of Van Sant’s film, the war against the rebels in the original play – which is utilised by Welles as the moment of the young prince’s eventual beaming through the clouds of tavern life – is replaced by a long deliberation on Scott’s decided assumption of heterosexual normativity. Utilising the language comedy and wooing fodder of the closing scenes of Henry V,28 and replacing war-time France with rural Italy, this latest enactment of hypocrisy sees the fragmentation of worlds descend even further into obscurity. “At this junction of Van Sant’s film, Mike is as much Hotspur as he is Poins, and the killing of Hotspur, robbing him of his youth, is here, as it is with Falstaff/Bob, a matter of breaking a heart.”29 Indeed, like Hotspur, Mike is sacrificed on the alter of Scott’s hypocritical assumption of normative, masculine convention; a spoil of the prince’s self-pleasing little game. All the more, it is at this point in the film where Hal traditionally rises up from the gutter to bask in the abundant sunlight of patriarchal kingship, that Scott is most completely portrayed as the film’s villain. On receiving notice of what is presumably his father’s demise (in a taxi decorated with his conventional, entirely inheritable and cash valued queen) the film allows us to see in him a fleeting moment of remorse, only to be over-taken by a decidedly Machiavellian smirk that leads him directly to his next scene as a suit-clad ‘yuppie’ in a limousine. In his portrayal as villain, perhaps the last piece of paradise this Hal loses is the shredded vestiges of his own empathetic humanity. Finally, one of the greatest cinematic representations of prince Hal’s losing by hypocrisy is to be found in the temporal arrangement of the films. Welles’s castle signifies succession and linear progression not just from father to son and from 26 To borrow a term from Tony Howard, in Jackson ed., p. 309 27 Jonathon Goldberg, ‘Hal’s Desire, Shakespeare’s Idaho’ in Wood ed. P. 52 28 Interestingly, it is Mike’s mother who has taught Carmella English, putting her in the position of Katherine’s nursemaid Alice in Henry V 29 Ibid, p. 52

284

prince to king, but from king to death. It is in his assumption of the patriarchally sanctified roles of king/businessman that the Hal character’s central tragedy becomes most evident. In Welles’s film, Hal’s almost literal “becoming” his father – that deluded, lacklustre, easily duped usurper – is no great joy for the audience. Furthermore, having seen him ridiculed in the play within a play, the audience has been actively led by another audience on stage to actively disrespect this social position; to see it as pretentious, detached, presumptuous and above all – hypocritical. No matter how regal and materially wealthy he is, the audience is overly invited to reflect on when Hal appears to have been most happy. The life before him seems devoid of any sense of self-affirmation in the present. The greatest part of King Henry’s concern throughout the play has been taken up with his own impending death, how he will be remembered and the linear progression of his line. The castle, it seems, has the power to accentuate mortality. Likewise, the scenes in Idaho that depict Scott’s father consistently assert his subjectivity to impermanence. Photographs of him as a young man are used as an almost comical contrast with the helpless old man in the office. His vulnerable physicality, exemplified by his being wheelchair-bound, is expounded graphically when the film allows us to hear the beating of his failing heart. The ultimate suggestion of both tropes is that social conformity holds death at its core. Conversely, a total conceptual subversion of linear time characterises both films’ depiction of the tavern world. Welles’s tavern is a temporal zone of the infinite present. Falstaff is near defined as living “in a timeless, fleeting moment [that] precludes fulfilling future promises.”30 No one in the Boar’s Head is concerned about what is going to happen in the future, and when Falstaff is dying, far from dwelling on it, the community often refuses to acknowledge its possibility.31 Even the promise of Hal’s impending kingship is looked towards only as a means by which the community can continue to live as they already do. Indeed, it is Hal’s forcing of Falstaff into the world of the linear by way of his brutal denunciation, his “redeeming time,” that leads to his death at all. As Toliver notes, central to the Prince’s transition is his conceptual subversion of both he and Falstaff’s timelessness, thereby effectively, and all too knowingly, killing his friend. His rejection speech is rife with assertion of predominant linear time: Presume not that I am the thing I was; … When thou dost hear I am as I have been, Approach me, and thou shalt be as thou wast (2 Henry IV, V.v.60)32 30 Harold E. Toliver, ‘Falstaff, The Prince, and The History Play,’ from Shakespeare Quaterly XVI, (Winter, 1965) in Sanderson ed. p. 177 31 Master Shallow’s feeble suggestion that Falstaff pay him back some money before he dies (2 Henry IV, V.v.84) could be read as a parody, if anything, of how much the tavern community, unlike their castle superiors, don’t prepare for the future. 32 Emphasis is Toliver’s, in Sanderson ed., p. 177

285

Idaho takes the cyclical nature of the tavern even further. Mike’s narcolepsy is used as a temporal frame for the film’s action in its entirety. His drifting in and out of sleep, dreams and memories undermine any sense of a dependable temporal linearity. Like the tavern community of Welles’s film, he and the other hustlers live hand-to-mouth, subsisting in a fragmented and deconceptualised sense of the present, itself represented in the constantly reappearing and never ending roads of the Idaho plains. Implicitly, he, like the whole tavern community, can never die. In Idaho, it is only the figurehead representation of Falstaff who succumbs to (appropriately symbolic) death. The double funeral scene at the end of the film offers two vastly differing images of death, which depend wholly on a subjection or rejection of a patriarchally defined time scheme. As Scott attends his father’s burial, having become, like Hal, an embodiment of the patriarch who he now must follow into the grave, the riotous funeral of the “tavern” community rises to drunken splendour in the background. The whole assemblage join in the lawless cries of “Bob!” neither in grief or lament, but in assertion of an irrepressible energy that they have all come to represent. While the superficial, caricatured and vilified signifier of Falstaff has been cast off as planned by the triumphant Scott, the enigmatic and magnetic appeal of the Falstaffian world, one which was the golden source of his own happiness has now been denied him forever. As Scott watches on, immobile and impotent, Hal has lost his little game. The price he must pay is his own immortality. The tragedy of Hal as hypocrite is the triumph of the traditional regal hero, with all his trappings of patriarchy, superiority, self preservation, anxiety and above all that linear spectre of impending death. In fact, that Hal loses so much in becoming a great and well-remembered king endures as the greatest hypocrisy of so many that riddle the plays – he is a perverse tragic hero parading himself as a valiant survivor in a heavenly office that the audience cannot help but feel whiffs all too much of Hell; his virtuous kingship is intrinsically linked with malicious humanity. Instead of falling from greatness, he rises to it. Instead of succumbing to a fatal error of judgement, he resists it. And instead of dying as King, he is reborn as Henry V. In doing so, he falls from greatness of a different kind: that of his own happiness; succumbs to the fatal error of conventional expectation; and dies as the rebellious, carefree Hal of the tavern. Indeed, the triumph of Hal’s role as an English king is showcased as being intrinsically linked with his tragedy as a human being. “History is enlarged here to make room for taverns and trollops and potations of sack and the heroic voice is modified by gigantic mockery, by the roared voice of truth.”33

33 Mark �� Van Doren, Shakespeare, cited in Milton CRance, ‘The Worlds of Prose and Verse in Henry IV Part 1’ in Sanderson ed., p. 350

286

287

GENETICS & MICROBIOLOGY PANEL

•

Panel members Prof. Tony Kavanagh (Trinity College Dublin) – Chair Dr. David McHugh (University College Dublin) Prof. Kevin Devine (Trinity College Dublin) Prof. Noel Lowndes (NUI Galway) Dr. Emmeline Hill (University College Dublin) Judges’ commentary Our immune system protects us from infectious diseases by enabling recognition of a vast array of potential pathogens, mobilizing effective defence responses and retaining a long-term memory of the encounter. This “adaptive” aspect of the immune response prepares us for future challenges and enables an even faster and stronger protective response if the same pathogen is encountered again. Adaptive immunity critically depends on a gene shuffling mechanism that can generate, in each of us, an essentially unlimited repertoire of receptors that recognize specific pathogens and other antigens. It appeared suddenly, some 500 million years ago, during vertebrate evolution at the point of divergence of the more advanced “jawed” vertebrate lineage from the primitive “jawless” lineage. Various hypotheses have been advanced to explain how the adaptive immune system arose during evolutionary time. The most important of these, the so-called “immunological ‘big bang’ theory” is discussed in the following essay.

Ge n et ic s & M ic robiol o g y

The evolution of the adaptive immune system Darren Fitzpatrick

Abstract pproximately 500 million years ago a divergence event within Vertebrata occurred. This resulted in two classifications of vertebrate, Agnatha, the more primal of the two and Gnathostomata. This divergence event marked both a speciation and the subsequent radiation of vertebrates. Somewhere within the estimated 500 million years since divergence, the adaptive immune system appeared. Enquiry into the origin of this system has opened disparate fields of investigation. This review focuses on the “big bang” theory which is an attempt to bring coherency to the multifaceted field of evolutionary immunology. Introduction Two patterns of immune system function in jawed vertebrates have evolved: the innate system and the adaptive system. The latter, the focus of this review, theoretically enables an organism to respond to an infinitude of antigens. Much is known regarding the structural components and mechanism of action of the vertebrate adaptive immune system. It is defined by the presence of clonal antigen receptors (immunoglobulins, T-cell receptors), recombination-activating genes (RAG1/2), organised lymphoid tissue, class I and class II major histocompatibility complexes (MHC I/II) and immunological memory as an emergent property of clonal selection, (Flajnik, 2004). Until recently, research on the presence of adaptive immunity in invertebrates has focused on sourcing evidence for structural and functional homologies/analogies to the vertebrate adaptive immune system. Such research has been invariably in vain (Flajnik, 2004). Immune-like responses have been documented across taxa. In Protozoa, Amoebae show intolerance for the transplantation of a foreign nucleus and self recognition in the form of remerging of severed pods (Tartar, 1970). In Porifera, the most 289

Fig. 1. Dendrogram showing evolutionary relationships between selected animal phyla and classes according to the current model (http://phylogeny.arizona.edu/tree/phylogeny.html). Speculative origin times of adaptive immune structures are indicated, as are documented histocompatibility systems. Divergence times are not to scale unless indicated.(Cited from Laird et al., 2000) primitive of the Metazoa, both allografts and xenografts are rejected and the rate of rejection increases for second set grafts (Hildemann et al., 1979; Pfeifer et al., 1992). The increase in rate of rejection is implicitly analogous to immunological memory in vertebrates. An elegant argument has been put forward by Vatclav Vetvicka and Petr Sima (Vetvicka and Sima, 1998) drawing a correlation between the evolution of complex structure, from single cells to multicellularity and organised tissue types and the complexity of immune responses. In light of the role of lymphoid tissues in lymphocyte maturation, such an argument has merits on phenomenological grounds. Structure is indeed a “conditio sine qua non” for function. However, phenomenological conclusions derived from phenomenological premises are not adequate in determining scientific theories when mechanistic details have been omitted. Similarity of function does not translate as homology (Klein, 1997). Considering the search for homology/analogy to the adaptive immune system in jawed vertebrates, it is clear that this system is thought of as the paragon of excellence for adaptive immunity (Zasloff, 2002). Hauton and Smith have determined criteria, the fulfilment of which they argue as necessary, prior to defining adaptive immunity in any species. The criteria were of course delineated a posteriori, i.e. deduced from an understanding of gnathostome adaptive immunity. These criteria I will quote: (1). Clear, unambiguous and reproducible evidence of at least some specificity and memory that cannot be attributed to anything other than an active response on behalf of the host, (2) a description of the 290

likely mechanism(s) underpinning the response, and (3) extensive experimental testing of these “new” hypotheses. (Hauton and Smith, 2007)

The significance of the many failures to determine homology between the jawed vertebrate system of adaptive immunity and the adaptive like features of invertebrate immunity is such that no shift in thinking with regard to the origin of the “bona fide” adaptive immune system has occurred. The prevalent theory still is that adaptive immunity has its origins during the divergence of Agnatha (jawless vertebrates) from Gnathostomata (jawed vertebrates) during Cambrian explosion (Forey and Janvier, 1993). This postulation is justified by the abrupt appearance of the Ig/TCR/MHC components (Fig. 1) in the most primitive of Gnathostomata, viz. Chondrichthyes (cartilaginous fish) and their absence in Agnatha (Marchalonis et al., 1998, Rast et al., 1997, Rast et al., 1994). The abrupt appearance of Ig/TCR/MHC components has been referred to as the immunological ‘Big Bang’ (Schluter et al., 1999). This will be discussed later. Throughout this review, reference will be made to adaptive immunity as it is currently understood in both Agnatha, in particular Petromyzon marinus and in Chondrichthyes, in particular Carcharhinus leucus and Carcharhinus plumbeus. These species are used as models because of their phylogenetic antiquity. They are the most basal of the vertebrates. In the absence of Cambrian genetic material, the above species are the closest to the last common ancestor of Agnatha and Gnathostomata, the divergence of which is the point of origin of the RAG based system of adaptive immunity.

Somatic Diversification: adaptive immunity as rearrangement Differential gene expression usually accounts for the phenotype of varying cell types and functions arising from intercellular genetic uniformity within a multicellular organism. The adaptive immune system operates contrary to this axiom of genetics. Genomic rearrangements via RAG mediated recombinations are responsible for the generation of diversity (GOD) of antigenic receptors and, as such, lymphocyte phenotype. An overview of the mechanism of somatic diversification as it occurs in Gnathostomata and comparison to the recently uncovered mechanism in agnathan Petromyzon marinus (sea lamprey) will ensue. The necessary machinery for somatic diversification in jawed vertebrates is as follows: (V) variable, (D) diversity and (J) joining gene segments, the lymphocyte specific recombination activating enzymes (RAG 1, RAG 2), recognition sequence signals (RSS) and the regular DNA repair pathway (Market and Papavasiliou, 2003). Each of the V, D and J segments are flanked by an RSS to which RAG 1 binds (Fugmann et al., 2000). The RS sequences are composed of a heptamer, a nonamer and a spacer of either 12 or 23 bp. In vitro, the recombination reaction will not proceed in the absence of RS sequences, the 12/23 rule (Akira et al., 1987; Lewis, 1994). 291

Fig. 2. Diargramatic representation of RSS. The nucleotides represented in bold print are conserved. Changes in the other nucleotides are tolerated (Lee et al., 2003) (Diagram cited from Market and Papavasiliou, 2003) The evolutionary significance of the RS sequence will be discussed later. Following the binding of RAG 1 to the RSS, RAG 2 is recruited and a site specific cleavage occurs between the V(D)J segments destined to become Ig’s or TCR’s and the RS sequence (Fig. 3). Cleavage results in the exposure of a 3’-hydroxyl group on the coding region. The products of the reaction, resulting from a Mg2+ dependent nucleophilic attack on the target phosphodiester bond, are the coding joint (CJ), i.e. the somatically diversified exon and a signal joint (SJ) (Agrawal, et al., 1998). CJs result from the opening of the hairpin and the addition of the nucleotides by terminal deoxynucleotidyl transferase. Some mechanistic features of the reaction have been omitted, most significantly the modifications generating P nucleotides (Bassing et al., 2002). Such details are outside the scope of this review. The generation of diversity that differentiates adaptive immunity from innate immunity occurs at multiple points in the recombination reaction. The number of gene segments incorporated into the recombinant DNA results in combinatorial diversity, junctional diversity due to insertions and deletions at the joining site of gene segments and the addition of non-templated nucleotides to the coding joints (Market and Papavasiliou, 2003, Bassing et al., 2003). The V(D)J segment then generated bestows a unique phenotype on the lymphocyte wherein the gene is expressed. Based on a sequence of 35 genes, Agnatha were shown to comprise a monophyletic group (Takezaki, et al., 2003). Extant Agnatha comprise both Myxinoids (Hagfishes) and Petromyzontids (Lamprey). The justification for utilising the lamprey as a model is the existence of synapomorhies amongst it and Gnathostomata (Takezaki, et al., 2003), thus enabling the elucidation of a more accurate picture of their last common ancestor. Immune responses are well documented in the lamprey. Immunization induced aggluttin proliferation (Marchalonis and Edelman, 1968) and accelerated rate of second set allograft rejection (Perey et al., 1968) are but two adaptive like responses that provoked interest in lamprey immunology. Morphologically, the cells associated with these responses resemble gnathostome lymphocytes (Mayer et al., 2002), they proliferate on exposure to antigens and express the transcription factors PU.1/Spi-B and Ikaros which have a role in lymphocyte differentiation in 292

Fig. 3. Overview of V(D)J recombination. 12RSS and 23 RSS are represented as black and white triangles, respectively, coding sequences as rectangles and proteins as shaded ovals (Fugmann, et al., 2000). The diagram illustrates the general mechanism of RAG recombination, i.e. RAG binding, synapsis, cleavage and generation of the resulting genomic rearrangement, the coding joint. (Diagram cited from Fugmann et al., 2000) mammals (Shintani, 2000; Mayer et al., 2002). This data combined enabled Pancer et al. (2004) to hypothesise that these lymphocytes were more likely to express genes involved in adaptive immunity (Pancer, et al., 2004, Pancer and Cooper, 2006). Following an analysis of the transcriptome of these lymphocytes, variable lymphocyte receptors (VLR) based on leucine rich repeats (LRR) were uncovered. Genomic analysis revealed the presence of a single germ-line VLR gene termed gVLR situated between upstream and downstream LRR cassettes. PCR analysis served to verify the hypothesis that insertion of varying LRR modules was the source of somatic diversification in lamprey lymphocytes and thus responsible for the observed VLR’s (Pancer, et al. 2004). The genetic and evolutionary relation of agnathan lymphocytes and gnathostome lymphocytes suggests that the last common ancestor of Agnatha and 293

Fig. 4. Comparison of RAG catalytic domain from Carcahinus leucas to 186, P2, P22, E. Coli Fim A and Fim B, transposons 2603 and 554, Human RAG 1 phages ф80, P1, λ and P4. The alignment was made using CLUSTALW and PRETTY. Black indicates amino acids similar to shark, human proteins are shaded and amino acids of neutral exchange value are boxed (Bernstein et al., 1996). (Diagram cited from Bernstein et al., 1996) Gnathostomata had lymphocytes or lymphocyte like cells. The aforementioned mechanism of somatic diversification and lymphocyte clonal selection in Petromyzon marinus fulfills the criteria of Hauton and Smith. Lamprey have a mechanism of adaptive immunity. The consequence of this is such that during vertebrate evolution, two modes of immune system related somatic rearrangement evolved (Pancer and Cooper, 2006). Questions regarding selective pressures and variances therein result from this point. It must be emphasised that somatic rearrangement in the lamprey is not RAG dependent. RAG is unique to Gnathostomata and enquiry into its mechanism of reaction, sequence, RSS dependency and inheritance has served to elucidate questions regarding the evolution of adaptive immunity in jawed vertebrates. RAG will occupy the next point of discussion.

RAG: The Origin of a ‘Cut and Paste’ Complex As discussed, the RAG 1/ RAG 2 complex is responsible for the somatic rearrangement of germline V(D)J genes and the subsequent creation of unique Ig’s and TCR’s during lymphocyte development. The reaction mediated by RAG is akin to a transposition reaction, i.e. involves the translocation of genomic elements. RAG has similarity to transposable elements, viz. RAG 1/2 have a compact genomic organisation, they are syntenic and adjacent, are transcribed simultaneously and are generally absent of introns (Agrawal, et al., 1998; Gellert, M., 1996). The transposition like features of RAG recombination are the Mg2+ nucleophilic attack by the post-cleavage 3’-hydroxyl group on the target phosphodiester bond and also RAG’s continued synapsis (binding to the RSS) post-cleavage (Agrawal, et al., 2006). In 294

Fig. 5. Comparison of RAG 2 Him A and Him D from both E. coli and S. typhimurium. Alignments made using CLUSTALW and PRETTY (Bernstein et al., 1996).(Diagram cited from Bernstein et al., 1996) vitro, RAG carries out legitimate intermolecular and intramolecular transpositions (Agrawal, et al., 2006; Hiom et al., 1998). The primary difference between RAG recombination in vivo and transposition reactions is the intra-molecular binding of the products. Transposition products are bound by the transposase to the target molecule whereas the recombinant signal joints in RAG recombination are ligated by the DNA repair pathway (Bogue and Roth, 1996). The similarity of RAG recombination to transposition has inspired research into the sequence similarity of the RAG genes and microbial transposases. A comparison of the RAG 1 catalytic domain sequence to recombinases from phages 186, P2, P22, E. Coli Fim A and Fim B, transposons 2603 and 554, Human RAG 1 phages ф80, P1, λ and P4 respectively is shown (Fig. 4.). In this sequence segment, the RAG proteins have 48% similarity and a 60% overall similarity (Bernstein et al., 1996). Similarly, RAG 2 was compared to the IHF proteins Him A and Him D from both E. 295

coli and S. typhimurium (Fig. 5.). The overall similarity is 44% and 43% for Him A and Him D, respectively. Most significantly, the similarity of the active domain, i.e. the N-terminal is 84% (Bernstein et al., 1996). The conservation of functional regions in homologous proteins is a general occurrence. These homologies when considered with the absence of RAG elements in Protostomata and Deuterostomata inclusive of Agnatha support the hypothesis that RAG originated via the horizontal transfer of a transposable element into an already existing receptor gene (Marchalonis and Schluter, 1998; Schluter, et al 1999). It has been hypothesised that aberrant phylogenetic patterns concerning gene distribution may be indicative of a horizontal transfer event (Li, 1997). RAG complies with this. The insertion of transposable elements is a well documented phenomenon (Marchalonis et al., 1998; Zapata et al., 1990), e.g. >100,000 retrotransposons in the human genome (Smith and Riggs, 1996). Considering RAG’s dependency on the RS sequence, it has also been hypothesised that this sequence formed part of the primordial transposon (Thompson, 1995). The conservative nature of the RSS supports this. RAG proteins are also conserved across Gnathostomata; 90% similarity exists between the entire shark sequence and the corresponding human segments (Marchalonis and Schulter, 1998). This coupled with the synteny of RAG1/2 and their inheritance as a cluster is indicative of positive selection.

The Ig Superfamily: Ancient and Modern The Ig domain characteristic of the Ig Superfamily is present in many metazoan taxa outside vertebrata e.g. there are 38,000 known varieties of the Down Syndrome Adhesion Molecule (DSAM) in Drosophila, they are known to exist also in Porifera and Coelenterata (Rougen and Hobert, 2001). These Ig domains are IgV like domains (Marchalonis et al. 2006). It is not known if these IgV like molecules are the prototypes on which the “bona fide” IgV was based. The absence of a CDR3 antibody has led to the proposition that these are statistical accidents resulting from gene duplication (Marchalonis, et al., 2006). Further, comparison of TCR Vγ chain with IgV in man has led to the hypothesis that TCR Vγ is the primordial Ig in vertebrates (Richards and Nelson, 2000). The plausible suggestion that the Ig domain was present in the last common ancestor of Agnatha and Gnathostomata has been put forward (Schluter et al., 1999). The Ig molecules are thought to have undergone a period of intense selection. This has been described as their achievement of a “canonical” form (Marchalonis, et al. 1998). The conservation of the Ig domains supports this due to their functional role in dimeric stabilisation and their place as a foundation for antigen binding domains (Marchalonis, et al. 1998). It has been proposed that Igs underwent a second phase diversification via the generation of orthologous genes (Marchalonis et al., 1998). This corresponds to the varying repertoire of Ig types across the vertebrate phyla: Ig, A, D, E, G, M in Mammalia, Ig M, Y, A, D in Aves, Ig M, N in Osteichthyes and as expected, only Ig M in Chondrichtyes (Weiser et al. 1969). The frequency of 296

occurrence of Ig subtype within species is of no evolutionary significance as this is determined by host-parasite interaction post-ontogeny. Gene duplication has been called upon to explain V(D)J multiplicity. This hypothesis is dependent on the 2R hypothesis or the hypothesis of tandem duplication of individual genes or segments (Hughes and Friedman, 2003). Both duplication hypotheses are a point of contention. It is accepted that the larger the genome, the higher the probability of mutation. On the basis of this and incorporating Marchonalis and Schluter’s (1998) notion that pathogen recognition is a by product of adaptive immunity, it has been hypothesised that gene duplication operating in response to selection pressures (Kondrashov and Kondrashov, 2006) resulted in a self surveillance system designed to detect non-self and cancerous self (Rolff, 2007). In light of the possible role of DNA methylation in epigenetic silencing post duplication (Rodin and Riggs, 2003) and also the role of methylation in cancer (Baylin and Ohm, 2006), Rolff (2007) hypothesises that increase in frequency of cancer may have selected for gene duplication resulting in V(D)J multiplicity, an efficient self surveillance system and pathogen recognition as a by product (Rolff, 2007).

Piece by Piece: The Proposal of a Model Firstly, as a point of semantics, it has been argued that all “inducible immune responses” are adaptive. Therefore, it was proposed that “combinatorial immunity” is a more apt description for what has hitherto been referred to as adaptive (Schluter et al., 1999). Considering that there is now a plethora of research being conducted into possible “adaptive” immune responses, the lamprey being one such example. I concur that pedantic and semantic improvements are necessary for the purpose of clarity. The model proposed by Marchalonis and Schulter (1998) is stochastic and thus in keeping with their immunological “big bang” theory (Schulter et al. 1999). The model has three components. These I will quote: (a) the rapid generation phase, (b) a rapid phase of decay or evolution under stringent selective conditions during which the generated immunoglobulin rapidly evolved to “canonical” form, (c) a rate of evolutionary change consistent with those of other proteins. (Marchalonis and Schluter, 1998).

Data for the above model was estimated using first order differential equations and the results were in keeping with Kimura’s proposition that evolutionary rate is proportional to quantity of conservation between two orthologous sequences (Kimura, 1969; Marchalonis and Schluter, 1998). The results to emerge from the model of differential equations proposed are of interest. They concern rate of protein evolution and the units are in substitutions per site per year. The rates determined are as follows: (a) 10 -7, (b)10-8 and (c) 10-9 297

(Marchalonis and Schluter, 1998). The decrease in rate corresponds with the “big bang” theory. However the model assumes that phases (a) and (b) occurred within 20 million years. This time span is based on divergence times deduced from the fossil record, thus a +/- 15% margin of error is expected (Ayala, 1997). This may be a weakness in the model. The “big bang” model has become “de rigueur” of late, partly I assume because of its orderliness, simplicity and logic. On a less aesthetic note, advances in immunogenetics are slowly serving to corroborate the model (Flajnik, 2007). An alternative model, or rather description, has been proposed (Klein and Nikolaidis, 2004). This model advocates traditional gradual evolution. It argues firstly that the lymphocytes, as described in the lamprey, are not genuine. The basis of this is the homology and not orthology between the Spi and Ikaros transcription factors. Clarity regarding the exact functions of Spi and Ikaros in the lamprey will conclude this. The model acknowledges the functional and structural similarity of RAG to transposons yet merely concludes that the transposon insertion hypothesis is controversial. No alternative is proposed.

Conclusion In the absence of a credible alternative model to pose an adequate challenge, the “big bang” hypothesis has merit in that it connects disparate phenomena and merges them to formulate a logical idea. Based on the findings in the lamprey, it can be justifiably declared that lymphocytes were likely present in the last common ancestor of Agnatha and Gnathostomata, possibly a Placoderm (Schluter, et al., 1999). The research previously described which highlights the similarities between RAG recombination and transposase activity are convincing. However, I contend that the range of microbes to which the RAG sequence compares favourably is perhaps too broad to conclude on the occurrence of a single transposition insertion event. Alternatively, transposase similarity in general and as such phylogeny may render it impossible to determine the exact nature of the insertion event. Gene duplication in general is controversial with regard to its mechanism of occurrence. However, not even Klein and Nikolaidis (2005) disagree that such an event had a role in the evolution of combinatorial immunity. I agree with the proposal of Rolff (2007), that cross phyla analysis of cancer occurrence in vertebrata may serve to show that gene duplication inadvertently selected for combinatorial immunity via selection for rigorous self-surveillance following genome expansion. Increased metabolic rate, as is characteristic of vertebrates, may also have a role akin to genome duplication due to the greater likelihood of mutation associated with higher nucleotide turnover (Rolff, 2007). This returns somewhat to the phenomenological argument of Vetvicka and Sima (1998). Increased metabolic rates resulting from evolution of complexity and the associated probability of mutation as proposed provide a possible mechanism, although incomplete for the evolution of defence reactions. It seems startling that the combinatorial immune system may have evolved pathogen recognition ability as an aside to that which selection 298

resulting from genome duplication and increased metabolic rate acted upon, i.e. increased self recognition. It would be facetious to conclude that combinatorial immunity was a lucky waste product. Clarity on the above points is required prior to the announcement of any conclusions. However, Occam’s razor demands simplicity and the “big bang” stochastic model is more parsimonious and coherent than the empty dismissal of Klein and Nikolaidis (2005). Should the “big bang” theory be further verified, and I contend that it will, it will serve to contravene Darwin’s gradualism. “Natura non facit saltum” may very well be an adage, not a maxim.

299

GEOGRAPHY PANEL

•

Juding Panel Prof. Patrick O’Flanagan (University College Cork) – Chair Dr. Úna Ní Chaoimh (University College Cork) Dr. Denis Linehan (University College Cork) Judges’ Comments This is a powerful and comprehensive essay. It is well written, engaging and thoughtful. It seamlessly deals with a series of extremely complex issues and reduces them to a highly interesting and readable format. The essay meets all the criteria as set out in your ‘guidelines’. It is extremely original in its remit. It demonstrates no significant weaknesses and his management of his chosen topic exhibits clear intellectual excellence. These qualities set it above and beyond all the other essays and which its nearest rival sadly displays.

Ge o gr a ph y

The Earth’s disciples: Geographers & the reinterpretation of Space in the 21st Century Drew Reid Introduction

“The only constant is change” (Heraclitus 540 - 480 BC)

s an interpretative study of the discipline of geography, this paper will not and cannot categorically answer the question as to whether geography is an academically integrated or divided subject. The directions taken in this field of study in terms of the physical and humanistic perspectives can be made intelligible and analysed but will still be at the mercy of contemporary ideas. To clarify, whatever interpretation is argued and presented in this paper will inevitably be a point of view that is a product of this individual’s scholarly experiences and personal elucidations that have in turn been influenced by the works of preceding geographic thought. In the contexts of this assignment, an opinion will be expressed and substantiated with academic sources that will offer an individualistic exegesis on the modernistic to post-modern trends in geographic thought. This paper will then suggest that the hemispherical nature of geography will progressively blend together into a more “fuzzy” subject area that will combine the more quantitative nature of physical geography with that of the more qualitative stream of human geography. With this perspective taken, an increasingly integrat301

ed science is proposed to emerge through technology and a clearer understanding of the global impacts of a global society is having upon this fragile Earth. Although there have been a number of paradigm shifts over the centuries in the field of geography, the dialogue between the spatial and the temporal have always managed to “fit in” with the thinking of the time. An example of this to be considered was the preponderance of validity Environmental Determinism gained during the late 19th century and early 20th century in Europe (Hartshorne, 1960, 56). Eminent human geographers such as Friedrich Ratzel, influenced by the Darwinistic theoretics of the time, and later Ellen Churchill Semple in the United States took ideas derived from the natural environment and evolution to steer geography along a path in line with the accepted scientific and socio-political perspectives of that era (ibid, 56-57). Using this example still, a retrospective view can see the faults and fallacies in the Deterministic model as an explanation for how we develop as a society, but the idea of evolution had, and still has, a valid point to make in the context of how geography as a discipline would advance. In this context, geography itself has evolved throughout history to the discipline it is today and will continue to do so in accordance within the context of society’s dictates (Holt-Jensen, 1988, 83-84). This explanation is supported by Harvey (1973) and Widberg (1978) who argue that progression within the field of geography “reflects the special interests of those who are in control of the means of production” (ibid, 84). In the opinion of the authors, the direction that both human and physical geography has taken has been as a result of it becoming politicised. Therefore, the evolutionary pattern seen is not one where the variables of interest are “left to their own devices” but more along the lines of a directed evolution from exterior forces. Contemporaneously, this politicisation of geography as argued by Johnston (2002) states that (geography) “departments compete for resources, including students, within and between universities” (Johnston, 2002, 133). With this contestation between the physical and human emerging, the consequential effects are a forced divergence from within the discipline itself as it engages in strategic self-interest and self-preservation. Historically, geography has gone through a number of dramatic shifts. These shifts have acted to splinter the subject into definable and specialised areas which has popularly been accepted as the reason why the discipline has split (Hartshorne, 1960, 68-69). Although this paper will not provide an in-depth analogy of them, reference to them as pivotal moments cannot be ignored. The modern and post-modern developments are of unique importance here and will be incorporated into the dialectic model of development and particular attention will be drawn to the 20th century where four key paradigm shifts in the discipline were seen: Environmental Determinism Chorological or Regional Geography The Quantitative Revolution Critical Geography (Holt-Jensen, 1988, Preface, 9) 302

The development of the discipline has seldom been harmonious. A dualism (physical and human) has emerged from the application of differing views on how the field of study should progress, be it separate or together (Harrison, 2004, 435). This separation is best exemplified by the approaches taken in regards to the objectivity (factual, measurable and quantifiable) of physical geography and the subjectivity (personal, interpretative and experiential) of human geography. However the collaborative instances have resulted in the imbrigation of human and physical geography. This overlap is desired in some instances to understand human-environmental phenomena, for example groundwater pollution as a result of intensive agricultural fertilisation of arable lands. Although, as stated earlier, geography has managed to “fit in” with the constructs of polity and society, it has done so through a metamorphosis of contrasting ideas and outside pressures. In understanding this, geography can be thought of as having a dialectical or contested arrangement between the physical and human aspects of the discipline. Harvey (1995) advocates this in saying “the world is inherently dialectical” and “the dialectic is simply one convenient set of assumptions or logic to represent certain aspects of physical, biological, and social processes” (Harvey, 1995, 10). To develop upon this idea of the dialectic, what follows is a conceptual model of how dialectics can be used to describe the direction, growth and mobility of geography.

Dialectic Model of Development Everything is made out of opposing forces/opposing sides Gradual changes lead to turning points, where one force overcomes the other Change moves in spirals, not circles (Rosser Jr, 1998, 5)

I. Everything is made out of opposing forces/opposing sides. In a geographic context this refers both the quantitative vs. qualitative or physical vs. human sides of the discipline shaping geography into a divided subject as Stoddart (1987) would argue by making reference to the increased divisions that have arisen due to the specialisation of sub disciplines in geography (Stoddart, 1987, 327-336). According to the author, this has led to a fragmentation of geography that has rendered communication between the two sides almost irrelevant. This notion of communication is raised by Bracken and Oughton (2006) who state that the oppositional aspects of geography comprise of “differences in epistemologies, knowledges and methods; different ways of formulating research questions; differences in communication and a range of attitudes across disciplines” (Bracken et al, 2006, 372). According to the authors and substantiated by Hartshorne (1960) 303

geographic study has developed along divergent lines as “each division would develop its distinct methods of observation and study” (Hartshorne, 1960, 65). The oppositional standpoints however as specified by Johnston (2002) may also be a “source of strength” which then offers to the discipline a diverse, broad yet highly specialised pool of knowledge from which geographers on both sides can draw (Johnston, 2002, 139). It is Johnston’s (2002) belief that this paper is concerned with as the development of geography had to diverge in order to re-integrate. The opposing approaches, namely the objective view of the physical geographer and the subjective view of the human geographer can be argued to have furthered the holistic nature of geography (Holt-Jensen, 1988, 128). The counter-arguments in geography therefore have acted and encouraged research to explain geographic phenomena which assist in the development of the subject.

II. Gradual changes lead to turning points, where one force overcomes the other. Paradigm shifts in the discipline have resulted in a dominance of one hypothesis over the other. An example of this is the superseding of the Quantitative Revolution during the 1960’s over the Regional or Chorological theories of the 1920’s. Regional geography was itself a turning point over Environmental Determinism which came about as a result of a reaffirmation that the proper topic of geography was study of places (regions). Regional geographers focused on the collection of descriptive information about places, as well as the proper methods for dividing the earth up into regions and not the characteristics of a place (especially human) being defined by environmental considerations (Livingstone, 1992, 353-354). The development of geography as a result of the Quantitative Revolution was a reaction by geographers of a physical geography background to return geography back into the “sciences” (Gould, 1985, 35). Its timing was so because of the advances made in technology at that time enabled great leaps to be made through the advent of new theoretical modelling previously unavailable (ibid, 36). The predominance of the Quantitative Revolution (Spatial Science) during this time were also a reaction by more “scientific” physical geographers to establish geography as a harder, more quantifiable discipline and move away from the “softer” image it had gained from Chorological studies that had dominated geography previously (Dalgaard et al, 2003, 50-51). In this example, the ideographic (human orientated) advocates were in the minority and the nomothetic (science orientated) geographers were in the majority. This “revolution” brought with it spatial and temporal modelling, geometric measurement, statistical analysis and developed positivistic thought (Livingstone, 1992, 355-356) (www.abdn.ac.uk). Another shift occurred in direct reaction to the Quantitative Revolution. Critical Geography arose as a riposte to positivism in the 1970’s – 1990’s as human geographers saw the need to de-emphasize the significance attributed to geographic phenomena as being objective and quantifiable in nature (Livingstone, 1992, 357-358). Using ideas derived from Phenomenology and Existentialism, importance was placed firmly on “meaning of 304

place” and the subjective view of the world (Holloway et al, 2001, 65). These postmodern approaches to geography are still influencing geographic research today through geographies of exclusion, femininity and marginalisation. In returning to positivistic thought, the Quantitative Revolution was the birthplace of modern technological geographic sub-disciplines such as Remote Sensing (RS) and GIS which are central to the core argument this paper proposes.

III. Change moves in spirals not circles. This is fundamental to the pattern of development in geography as change does not necessarily mean that an entirely new perspective substitutes a previously accepted theory but instead progression can be made on one side of geographic thought which then furthers the breadth or depth of both fields of study. This is critical to the influence that one particular sub-discipline can have on research on both sides. Change can occur in highly specialised geographies such as Remote Sensing and GIS but can then penetrate and help develop other sub-disciplines at the opposite end of the geographic spectrum. An example of such would be the RS and GIS digital mapping of onchocerciasis (river blindness) outbreaks in Mozambique conducted in 2000 by Aircare International (www.cdc.gov). This had implications for the study of settlement dispersion and agricultural practices in the region which had to be studied to ascertain their risk level from the disease. The settlements and their inhabitants had cultural and traditional ties to the river such as fishing which became the focus of human geographic study; hence a crossover between sub-disciplines was seen (ibid). The rapidity of change may depend on a number of factors such as funding and/or special interest by governments or other influential bodies which in turn prioritise one form of research over another (Bracken et al, 2006, 372). But this can then point those specialised subjects (RS and GIS) into new areas of research as demanded by humanistic studies (Thrift, 2002, 296). Using this example still, “computing will add an extra layer of flexibility and possibility to most social sciences and humanities research” (ibid, 296). With this, it is possible to see that common ground between physical and human geography can be reached as the impacts of new methods of observation and interpretation allow a platform from where collaborative research can be initiated from. Historically and contemporaneously, the debate has focused on the continued divergence of human and physical geography as proposed by the likes of Livingstone (1992) and Stoddart (1987), but it also can be said that integration looks more likely than ever with inter-disciplinary opportunities that the likes of RS and GIS can provide. The Future of Geography The chance for an integrated discipline in geography is not a mirage. In the current age of global Earth-observing satellite constellations and digital mapping techniques, the facilitation of data presentation and analysis of large and small scale phenomena is now, and in this individual’s opinion, the future prospect of geography. Thrift (2002) highlights the importance of technology and the role it will play 305

in fusing geography together by indicating that “in physical geography, we can see large-scale simulation becoming a way of life. But, in human geography, the possibilities have been counted to be less when they may actually be more” (Thrift, 2002, 296). The application of such technologies is only one half of the story. The development of Earth System Science (ESS) came about from the recognition that “geographers must consider multiple environments (natural, built, interactional, socio-cultural, and cognitive)” (Golledge, 2002, 2). ESS stresses the interconnectivity of systems on the Earth and “accepts that biophysical sciences and social sciences are equally important in any attempts to understand the state, and future of the Earth System” (Pitman, 2004, 137). The most prevalent example of interconnectivity amongst systems is the current issue on climate change. Through the use of Remote Sensing platforms (satellites, aircraft, buoys, ships and land based sensors) to monitor and record information, and GIS to spatially represent that data, greater knowledge and comprehension of the causes and effects of climate change can be better understood. Climate change is the most prolific exemplification of an integrated geography as it exhibits “Human-Environment Relations (HER)” (Golledge, 2002, 2). The author goes onto say that “the HER integrative approach that has a natural home in geography has resurfaced as an important knowledge seeking procedure” (ibid, 3). As the atmosphere is the most dynamic natural environment on the Earth, high temporal frequency monitoring allows for the impact of all elements both human and natural on the atmosphere to be measured. Belbin (2002) states that “in modern times, geographers have specialised in different geographies of space-time such as geomorphology, hydrology, climatology, urban and rural geography, political geography, demographic geography and feminist geographies” to name but a few (www.scienceinafrica.co.za). But these human and natural geographies are necessary to understand the complexities of the world as it functions as a system of integrated systems, each containing their own detailed environmental and social issues (www.scienceinafrica.co.za). This argument as proposed by Belbin is one that I agree with. Belbin (2002) adds to this by saying that the splintering of geography into its component parts has enabled the modern geographer to communicate more clearly with contemporary issues and that “the true geographer is still an integrationalist” (www.scienceinafrica.co.za). Belbin’s perspective is, in my view, wholly correct. How else can a geographer truly call him/herself a geographer without incorporating ideas from both sides of the discipline? It is accepted that future research will not engage upon an equally balanced measure of human and physical perspectives, but an integrated discipline must be embraced to some extent. In assigning cause and effect to either human interference on the landscape or vice versa for any given geographic event, ignoring that geography is a two-sided coin that complements each other is ignoring what Belbin professes about being a true geographer. How will geography re-integrate itself? This paper proposes that at a time when global geographic phenomena such as climate change now being fully appreciated and understood, global spatial monitoring can now effectively observe global sys306

tems such as the atmosphere at high temporal frequencies and be able to relay information that can identify the inter-relations between human and physical factors. Drawing on the theories of ESS, systematic observation has only relatively recently been able to develop through technological advances in observation techniques (Pitman, 2005, 139). The systems approach is holistic in nature and can be explained in a tri-conceptual framework as suggested by Arild Holt-Jensen (1988). 1. A set of fixed elements with variable characteristics: These are the structural aspects of the system, for example multi-scale settlements (rural and urban/developing and developed) and people, flora and fauna. These are the variables of interest that exhibit unique characteristics that also display connectivity between each other (Holt-Jensen, 1988, 141142). 2. A set of connections between the elements in the system: These are the functional aspects of the system. The function describes the “series of flows (exchange relationships) that occupy the connections” (ibid, 142). An example of this would be food chains in an ecosystem as an interrelated network. 3. A set of connections between the elements in the system & its environment: These are the developmental aspects of the system. Development represents the structural and functional changes that may take place over time (ibid, 144). Climate change is a clear example of a temporally active phenomenon that is impacting upon the structural and functional aspects of the world system.

The integrative approach of ESS and the use of technologies such as RS and GIS are bridging the gap between the human and physical divides as it is only now in contemporary academia that human induced climatic phenomenon can be observed and measured. Widely reported in the media, recent catastrophic geographic events like the “El Niño” (the replacement of cold upwelling water off the coasts of Ecuador and Peru by warm tropical water) have been attributed to rising carbon dioxide levels in the atmosphere from air pollution from industrialised countries. This affects weather systems globally and has far reaching effects in terms of prolonged droughts and bush fires (as experienced in Northern Australia and South-East Asia), flooding (as seen in Brazil, Chile and Northern Argentina) and milder or harsher than normal seasonal deviations in other parts of the world (www.pmel.noaa.gov). The “El Niño” example is here for a purpose, to fortify a point; human/physical interactions and their effects are relevant, present, and are spatially and temporally active and integrated understanding is the only possible way forward for geography to remain a viable discipline. Therefore effects of struc307

tural human induced pollution, deforestation, river damming, urbanisation and resource depletion can be linked to the humanities and to the “harder” sciences of physical geography as they are in essence, bound together in a unified whole. As Magilligan (2004) states “both physical geography and human geography have mutual interests in understanding the impact of human agency, and unravelling the role of human activity is an area of concern of each of the sub-disciplines” (Harrison et al, 2004, 438). Therefore the boundaries within geography will become less defined and as introduced in this paper, a more “fuzzy” discipline is proposed to emerge.

Conclusion Integration or division poses an open ended question depending on where your loyalties lie. It has been proposed in this paper that an integrated discipline will develop through a new inclusive approach to geography in the guise of ESS as Pitman (2005) puts forth. Crossovers between the quantitative and the qualitative, human and the physical can be made more intelligible through ESS and technology and a better awareness of the validity each can offer the other as Belbin (2002) proclaims can lead to a prosperous and valuable discipline. Geography or “Earth writing” is, in essence, these two practices of the human and the physical that defines the study of Geography. The complex environmental entity that is our Earth is home to the tangible and the spiritual and focusing on the ecological interaction between players and events at a variety of spatial scales defines the core focus of the discipline. Pursuing geography for the sake of knowledge then enables geographers, no matter what their specialization, to help identify solutions to many of the world’s problems that undermine our well-being as only one of a number of species that inhabit this space, this place we call home. Geography is therefore not sitting in an old fashioned dusty corner of the classroom, fragmented and ready to be consigned to an academic dustbin, but can be a modern, unified and contributory discipline that can do away with the diverse exclusivity it has become known for. The arrangement of geography has to embrace the new opportunity it has been given, a second chance if you will. In reference to Heraclitus, the only certainty is change and as for the future “the geographer will never be the master of his fate; his very reason always progresses by leading him into the unknown and unforeseen where he learns new things” (Bird, 1979, 24).

308

309

HISTORY PANEL

•

Panel Members Prof. Alan Sharp (University of Ulster) – Chair Prof. Roy Foster (Oxford University) Prof. Richard Aldous (University College Dublin) Judges’ commentary The Panel was impressed by the sophistication of intellectual approach of this work. Using an extremely broad and demanding range of sources and demonstrating a remarkable ease and familiarity with Victorian intellectual and scientific history, it reached judicious conclusions in a very well written and presented piece of work. We congratulate Ms. Rowe on an outstanding example of undergraduate history at its very best.

310

H I ST ORy

Kingsley’s natural selection: The significance of Darwin in his works Abigail Rowe

he second edition of On the Origin of Species (John Murray, 1860) contains an unattributed sentence regarding religious reaction to the publication. Darwin writes :

I see no good reason why the views given in this volume should shock the religious feelings of any one. A celebrated author and divine has written to me that ‘he has gradually learnt to see that it is just as noble a conception of the Deity to believe that He created a few original forms capable of self-development into other and needful forms, as to believe that He required a fresh act of creation to supply the voids caused by the action of His laws.’1

The ‘celebrated author and divine’ in question is Charles Kingsley, cleric, author and amateur natural scientist. The fact that Darwin felt it expedient to include this quote immediately alerts the reader to the controversy that the first edition had provoked within the religious establishment. The impact of The Origin, in the years following its publication, was multilayered and complex, provoking strong reaction from the scientific and religious communities, becoming visible in the arts and in philosophy, in essence fundamentally and irrevocably changed humanity’s 1 Darwin, Charles, On the The Origin of Species by means of Natural Selection, or the Preservation of Favoured Races in the Struggle for Life (John Murray, 1860, 2nd Ed., 2nd Issue) p. 481, retrieved 22 January 2009 from http://darwin-online.org.uk/content/frameset?viewtype=text&itemID=F37 6&pageseq=508.

311

view of itself. This essay seeks to investigate the impact of Darwinian theory on the works of one man, Charles Kingsley, who not only straddles the worlds of religion and literature throughout his career, but also continually reveals his fascination with the science of the day. Kingsley’s prolific and unstintingly didactic works reveal a purported acceptance and assimilation of Darwin’s theory of natural selection, with no antagonism posited between scientific fact and religious faith. Nevertheless, on closer examination, Kingsley’s professed agreement becomes more tenuous and starts to appear somewhat selective. Given that Kingsley was lauded as being ‘on board’ by Darwin himself, this essay will seek to explore the veracity of this reputation. To assess this it is necessary first to evaluate why Kingsley’s support was important to Darwin, and also to contextualise the publication of The Origin alongside Kingsley’s existing canon. Darwin understood that his theory of natural selection to all intents and purposes removed divine providence from the understanding of the development of life. Facing a two millennia account of natural history which was based on a providential plan, including the most contemporary thought regarding evolution and geology, the evidence laid out so accessibly in The Origin suggested to many that this foundational tenet of Western Christendom was erroneous. Whilst in The Origin Darwin studiously avoided the implications of his theory on the origin of mankind, he knew that this question was implicit in his text.2 As a man who avoided confrontation throughout his life, and expecting a polarised response to The Origin, he prepared himself for altercation. His nervous anticipation shows in the covering letters he sent to recipients of the complimentary copies, which reveal a self-deprecation to the point of seeming unconfident of his book. For example, to his former mentor, Henslow, Darwin writes ‘my dear old master in Natural History; I fear... that you will not approve of your pupil in this case,’ but further reading seems to suggest that Darwin’s nervousness was not about the content of the book but more about the fact that he felt it was published before he had time to complete it: ‘the book in its present state does not show the amount of labour which I have bestowed on the subject.’3 To Jenyns, Henslow’s brother-in-law, entomologist and cleric, he writes ‘please remember that my book is only an abstract, and very much condensed,’ and goes on to say that he ‘may, of course, be egregiously wrong; but I cannot persuade myself that a theory which explains (as I think it certainly does) several large classes of facts, can be wholly wrong.’4 Two years before publication, Darwin had written to his cousin Fox that he was working very hard at my Book, perhaps too hard. It will be very big & I am become most deeply interested in the way facts fall into groups. I am like Crœsus overwhelmed with my riches in facts and I mean to 2 His preface refers to the work on human variation published by Dr D.C.Wells in 1813 and 1818. 3 Francis Darwin ed., The life and letters of Charles Darwin, including an autobiographical chapter (John Murray, London, 1887) Vol 2, p. 218. 4 ibid., Vol. 2, p.220.

312

make my Book as perfect as ever I can.5

With such assurance in the solidity of his evidence it may rather be this drive for perfection, coupled with the pressure to go to press and an understanding of the implications to the prevailing worldview, which explain the anxieties and equivocations present in his letters. His thoughts regarding the opinions of those who were not primarily men of science show that he was aware that popular acceptance of his theory would hold some sway over the establishment; talking of ‘intelligent men, accustomed to scientific argument, though not naturalists’ he says ‘it may seem absurd, but I think such men will drag after them those naturalists who have too firmly fixed in their heads that a species is an entity.’6 In the context of the time, ‘such men’ would include the influential gentlemen and noblemen amongst whom a lay interest in natural theology, geology, botany, entomology and zoology would be fairly common. Kingsley was one such man.7 Known to society primarily as an author of some note and a cleric of questioned stance, he was avocationally drawn to natural history.8 He was known for his interest and collected specimens for Gosse whilst in the West Country.9 Self-deprecating regarding his own scientific knowledge, Kingsley later was to write: I know very little about these matters, and cannot keep myself ‘au courant’ of new discoveries, save somewhat in Geology, and even in that I am no mineralogist , and palaeontologist. Science is grown too vast for my head.10

Notwithstanding this, the respect Kingsley received from the scientific establishment is clear.11 It is imperative, however, to interpret Kingsley’s scientific inter5 Charles Darwin, Letter 2049 — Darwin, C. R. to Fox, W. D., 8 Feb [1857] retrieved 22 January 2009 from http://www.darwinproject.ac.uk/darwinletters/calendar/entry-2049.html. 6 Darwin, Francis, Letters, Vol. 2, p. 245. 7 Charles Kingsley, (1819-1875) cleric, author, professor, social reformer and amateur scientist, had much in common with Charles Darwin (1809-1882). Both were gentlemen, though Kingsley was born into a genteel poverty that Darwin would never know, and both followed the gentlemanly pursuits of geology, entomology, zoology and botany. Furthermore, both had expectations on them to enter the clergy; for Darwin, this was seen as an expedient career given his distaste for medicine, but for Kingsley it was a true vocation. See Chitty, Susan, The Beast and The Monk: A Life of Charles Kingsley, (London, 1974), Colloms, Brenda, Charles Kingsley The Lion of Eversley, (London, New York, 1975), Desmond, Adrian and Moore, James, Darwin, (Penguin, London, 1992). 8 Kingsley had previously come up against the establishment in his work with Chartist reformers and his prominent role in advocating Christian Socialism. See Colloms, Lion of Eversley, p. 174. 9 Indeed Gosse used Kingsley’s samples as the basis of a whole chapter in The Aquarium (J. Van Voorst, 1854), cited in Colloms, Lion of Eversley, p.185. 10 Fanny Kingsley, Charles Kingsley: His Letters ad Memories of His Life, (London, 1884) p. 293. This is from a letter from Kingsley to Rev. F. Maurice written in 1869. 11 Hanawalt writes that ‘He... obtained acquaintance with men of science who were impressed by

313

est within the context of his lifelong understanding of nature. His school friend from Helston Grammar School, Cowley Powles writes: His passion was for natural science and art. With regard to the former, I think his zeal was led by strong religious feeling – a sense of the nearness of God in His works.12

Kingsley succinctly makes this explicit when, at age 17, he writes home to his mother saying ‘I am reading my Bible and my Paley;’13 to Kingsley, the two went hand in hand, yet he was well aware of the tension this necessitated in light of unfolding scientific evidence: ...for if in any age or country the God who seems to be revealed by Nature seems different from the God who is revealed by the then popular religion, then that God, and the religion which tells of that God, will gradually cease to be believed in.14

This is evident in his literary works, all of which feature a man of science in a leading role. His protagonist in the 1949 novel Yeast: A Problem, for example, avers that: My only Bible as yet is Bacon. I know that he is right, whoever is wrong. If that Hebrew Bible is to be believed by me, it must agree with what I know already from science.15

This shows clearly that Kingsley believed that scientific findings should bolster religious and theological understanding and not undermine it. Kingsley was one of the first to receive a copy of the first edition of The Origin, having been sent a preview by John Murray at the behest of Darwin himself. He was also one of the first to respond to Darwin, and his positive response, quothis zeal and his sincerity’. Mary Wheat Hanawalt, Charles Kingsley and Science, Studies in Philology, Vol. 34, No. 4 (Oct., 1937), p. 591. She cites Chambers, Darwin, Gray, Huxley, Miller, Wallace and White as such men. 12 Ibid., p. 8. 13 Ibid., p. 10. 14 Charles Kingsley,The Natural Theology of the Future, read at Sion College in 1871, retrieved 8th January 2009 from http://www.online-literature.com/charles-kingsley/scientific/7/. 15 Yeast: A Problem, (Savill and Edwards, London, 1959) p. 162. This Baconian influence is evident within Kingsley’s work; his application of ideas of perfectibility arise from Bacon’s linking of progress and providence; scientific progression by empirical methods being underscored by scripture. Kingsley cites Bacon in sermons calling him ‘the wisest of all mortal men since the time of Solomon’; sermon 11, Solomon, from The Water of Life and Other Sermons retrieved January 28th 2009 from http://www.online-literature.com/charles-kingsley/water-of-life/11/, see also The Fount of Science, Sermons on National Subjects, retrieved January 28th 2009 from http://www.onlineliterature.com/charles-kingsley/sermons-national/12/ .

314

ed above, was genuinely welcomed. Darwin’s biographers, Desmond and Moore, portray Darwin as a man emotionally affected by the responses of others, taking ‘the knocks very personally’ when reactions were negative16. Kingsley’s positive response was therefore, at the other end of the spectrum, hugely important to him. Desmond and Moore describe him as ecstatic.17 Kingsley’s Darwinian credentials grew as he assimilated the theory of natural selection into his work. His lack of fear of controversy, following his notoriety regarding his Chartist engagements, meant he was highly vocal on the matter. Huxley, also a man who relished the sparring that ensued, writes of him that he ‘is an excellent Darwinian’ and, with evident pleasure, repeats an anecdote in which Kingsley defends an accusation of heresy levelled by Lady Aylesbury with the words ‘what can be more delightful to me Lady Aylesbury, than to know that your Ladyship and myself sprang from the same toadstool.’18 Indeed Huxley and Kingsley, sharing such characteristics, embracing Darwinism and going on to correspond in highly personal letters, became good friends.19 The correspondence between Kingsley and Darwin shows the mutual respect held between them. Darwin’s response to Kingsley’s effusive reaction – ‘I am much gratified by your kindness.— At any future time I shall be delighted to answer any objections as far as lies in my power, or to receive any suggestions’20 – typically seeks to further engage with his correspondent on the subject matter. During this period of initial reaction, Darwin, soon after, writes of Kingsley’s response in letters to Lyell, Huxley, and Gray.21 This in itself reveals the significance that Darwin felt was appropriate to Kingsley’s reaction. He continued to respect Kingsley’s scientific input to the extent that his Descent of Man quotes evidence provided by Kingsley: ‘the fishermen of Rochelle assert “that the males alone make the noise during the spawning-time; and that it is possible by imitating it, to take them without bait.”’22 Further correspondence shows Kingsley reporting discussions he encountered socially, regarding The Origin: We have just returned from Lord Ashburton’s at the Grange, where the Bishop of Oxford, the Duke of Argyle, and I have naturally talked much about you and your book... The Duke is calm, liberal, and 16 Adrian Desmond and James Moore, Darwin, (Penguin, London, 1992) p.492. 17 Ibid., p.477. 18 Huxley to F. Dyster, 29 February 1860, Thomas Huxley Papers, Imperial College of Science and Technology, London ,from Desmond, A., and Moore, J., Darwin, (London, 1991), p. 488. 19 Indeed Kingsley’s communication with Huxley is significant as Huxley was so often the public face of the controversy, dealing with the confrontations that so terrified Darwin. Given Darwin’s reliance on Huxley, and Huxley’s relationship with Kingsley, part of the reason that Kingsley was important to Darwin is therefore through Huxley. 20 Letter 2561 — Darwin, C. R. to Kingsley, Charles, 30 Nov [1859] retrieved 21 January 2009 from http://www.darwinproject.ac.uk/darwinletters/calendar/entry-2561.html. 21 Darwin, Francis, Letters, vol. 2, pp. 237, 282 and 287. 22 Attributed: The Rev. C. Kingsley, in ‘Nature,’ May, 1870, p. 40. in Chapter 12, Charles Darwin, The Descent of Man, (John Murray, 1871) retrieved 21 January 2009 from http://www.literature.org/authors/darwin-charles/the-descent-of-man/chapter-05.html.

315

ready to hear all reason; though puzzled, as every one must be, by a hundred new questions which you have opened... [there follows a discussion regarding the identification of birds]... My own view is—and I coolly stated it, fearless of consequences— that the specimen before us was only to be explained on your theory, and that cushat, stock dove, and blue rock, had been once all one species; and I found—to show how your views are steadily spreading—that of five or six men, only one regarded such a notion as absurd... 23

One can easily see that Kingsley’s correspondence must have been gratifying to Darwin when many clerics were denouncing his theories vociferously. For his own part, Kingsley genuinely seemed to enjoy the controversy and his role within it; in the preface to the fourth edition of Yeast: A Problem (1859) he writes: ‘provided the leaven of sound inductive science leaven the whole lump, what matter who sets it working?’24 His enthusiasm for the excitement surrounding the publication is visible in his correspondence. He writes to F.D.Maurice that the ‘state of the scientific mind is most curious; Darwin is conquering everywhere, and rushing in like a flood, by the mere force of truth and fact.’25 Both men thus can be seen to have reaped personal benefits from their growing correspondence. Kingsley’s work before the publication of The Origin was, for the most part, written for the moral and social improvement of the readership. It often contained scientific terminology along with an expression of Kingsley’s beliefs regarding the mutually inclusive relationship of science and religion. He was aware of the problems associated with intertwining what was often polarised. He can be seen to express this through his protagonist, Lancelot, in Yeast: A Problem: He had the unhappiest knack (as all geniuses have) of seeing connections, humorous or awful, between the most seemingly antipodal things... If he wrote a physical-science article, able editors asked him what the deuce a scrap of high-churchism did in the middle of it? If he took the same article to a high-church magazine, the editor could not commit himself to any theory which made the earth more than six thousand years old. ... 26

In 1849 Alton Locke was published. Essentially a novel about the need for social reform, Alton Locke embraces ideas of perfectibility and Kingsley’s beloved Chartist 23 Charles Kingsley, 1877, in Fanny E. Kingsley, ed. Charles Kingsley: his letters and memories of his life. (London: Henry S. King, 1877) Volume 2 pp. 135-6. 24 Charles Kingsley, Yeast, A Problem, 4th ed. 1859 retrieved 22 January 2009 from http://infomotions.com/etexts/gutenberg/dirs/1/0/3/6/10364/10364.htm. 25 Kingsley to F.D. Maurice in Kingsley, Fanny E., ed. Charles Kingsley: his letters and memories of his life. (London: Henry S. King, 1877) Volume 2 p. 175. 26 Yeast, pp. 255-6.

316

reform, whilst commenting on the extreme difficulty faced by anyone attempting social mobility.27 Although the novel predominantly expounds on these themes, it also brings into its narrative the idea of science and transformation. The feverish dream of the eponymous Locke in chapter 36 shows a lengthy and descriptive sequence of evolution occurring: Locke goes from being ‘the lowest point of created life; a madrepore rooted to the rock’ through many stages until he reaches humanity.28 Klaver writes that ‘the idea of successive creations on a perfect (divine) plan’ intrigued Kingsley, hence ‘it is not surprising that he should have tried to link the animal and spiritual in an even more comprehensive theory of successive development in which a notion of improvement stands central.’29 Further to Locke’s physical evolution, he then enters a period of spiritual development and improvement with a Mosaic episode; Kingsley here is explicitly connecting the evolved man with the providential plan of God for mankind. For Kingsley, science and religion are not only related and requisite parts of the whole, but mutually bolster each other. Thus mankind, the evolved savage, with the word of God, and his own good intention, is perfectible: You went forth in unconscious infancy--you shall return in thoughtful manhood.--You went forth in ignorance and need—you shall return in science and wealth, philosophy and art. You went forth with the world a wilderness before you--you shall return when it is a garden behind you. You went forth selfish-savages--you shall return as the brothers of the Son of God.30

In this novel, Kingsley, ten years before the publication of The Origin, is using the most contemporary theories regarding evolution, at least at an allegorical level, to express his beliefs regarding the improvement of mankind. The correlation between will and transformation that Kingsley shows here is integral to the work of Lamarck, for whom the intention to transform is a vital part of the process. Kingsley’s assimilation of Lamarckian evolution retains a moral direction which keeps mankind at the centre of the story. Within four years of the publication of The Origin, however, Kingsley had produced a work which directly draws on Darwin’s theory of natural selection, revealing his genuine understanding of the theory, and also containing entertaining satire on the reception of the book and the scientific establishment. This new novel, 27 See footnote 15. 28 Kingsley, Charles, Alton Locke, Ch. XXXVI, retrieved 23 January 2009 from http://www.gutenberg.org/dirs/etext05/8allk10.txt. 29 Jan Marten Ivo Klaver , Jean Paul, Carlyle and Kingsley: The Romantic Tradition in Alton Locke .s Dreamland, retrieved 12 January 2009 from http://www.ledonline.it/linguae/allegati/linguae0103klaver.pdf 30 Kingsley, Alton Locke, Chapter 36, retrieved 23 January 2009 from http://www.gutenberg.org/ dirs/etext05/8allk10.txt.

317

The Water Babies (1863) also contained elements of the popular understanding of natural selection, which was to lead to a social Darwinism far from its originator’s intent.31 As in Alton Locke, the protagonist experiences a falling experience into a de-evolved state. Tom, on falling into the river, becomes a foetal aquatic being, with full consciousness. The book charts his progress, ultimately into a ‘great man of science... and all this from what he learnt when he was a water-baby, underneath the sea.’32 The transformation of Tom is the main narrative. As ‘a fairy tale,’ the reader is not required to seek for realism; likewise, in Alton Locke, Kingsley feels the need to set Locke’s transformation into a dream, in order to maintain the realist integrity of the novel. His placing of evolutionary sequences into unreal domains allows him full rein with its metaphorical application. In The Water Babies, having thus located the entire narrative, we shall see that Kingsley freely applies his understanding of Darwinism. As we have seen, by this time evolution was, for Kingsley, the scientific sine qua non: in The Water Babies his adoption of the new theory of natural selection is assimilated throughout. For example, the last of the Gairfowl represents a non-adaptive species approaching obsolescence. Living on her lone rock, awaiting extinction she bemoans the adapted species which will continue after her end: ‘they must all have wings, forsooth, now, every new upstart sort of bird, and fly.... In the days of my ancestors no birds ever thought of having wings, and did very well without; and now they all laugh at me because I keep to the good old fashion.’33

Shortly after this Tom encounters the hoodie crows which peck to death a ‘ladycrow’ who does not behave in the expected manner.34 This example of the competition in nature and the strongest of a species surviving is brutal and shows the recognition of what would come to be called ‘the survival of the fittest.’35 (Whilst this was popularly understood from The Origin, Darwin himself later also argued for humanity’s hegemony as due to the development of being prepared to form community bonds that carry the weak.36) Tom’s encounter with Mother Carey is an ex31 For example, Herbert Spencer, in 1862, writes that ‘though these positions are not enunciated in The The Origin of Species, yet a common friend gives me reason to think that Mr. Darwin would coincide in them... in many cases a group of races, now easily distinguishable from one another, was The Originally one race... The civilized European departs more widely from the mammalian archetype than does the Australian’. Spencer, Herbert, First Principles, retrieved 22/01/09 from http:// socserv.mcmaster.ca/~econ/ugcm/3ll3/spencer/firprin.html. 32 Charles Kingsley, The Water Babies, Chapter VIII, retrieved 15th January 2009 from http://www. gutenberg.org/dirs/etext97/wtrbs10h.htm. 33 Water Babies, Chapter VII. 34 ibid. 35 Herbert Spencer, Principles of Biology (Williams and Norgate, London, 1864), vol. 1, p. 444. 36 Charles Darwin, The Descent of Man, (John Murray, 1871) retrieved 21 January 2009 from http:// www.literature.org/authors/darwin-charles/the-descent-of-man/chapter-05.html.

318

position of the creation of species not being an act of God; she tells Tom that she is ‘not going to trouble myself to make things, my little dear. I sit here and make them make themselves,’ which Tom recognises as more wonderful than merely making things.37 This entirely fits with Kingsley’s initial response to Darwin on reading The Origin. Furthermore, Kingsley addresses artificial selection, with the story of a fairy who created butterflies and comes to Mother Carey to boast of this. Mother Carey’s response is ‘that anyone can make things, if they will take time and trouble enough: but it is not every one who, like me, can make things make themselves.’38 With the thesis of a progression of the development of species came popular fears regarding the possibility of regression. This was touched upon in the preface to The Origin and later theorised by Darwin’s cousin Galton.39 The Water Babies contains a lengthy sequence containing a salutary warning of this possibility. The Doasyoulikes, a civilised and hardworking people, become lazy with their achievements and gradually become more simian until they were all dead and gone, by bad food and wild beasts and hunters; all except one tremendous old fellow with jaws like a jack, who stood full seven feet high; and M. Du Chaillu came up to him, and shot him, as he stood roaring and thumping his breast. And he remembered that his ancestors had once been men, and tried to say, “Am I not a man and a brother?” but had forgotten how to use his tongue; and then he had tried to call for a doctor, but he had forgotten the word for one. So all he said was “Ubboboo!” and died.40 Tom is told, by the fairy Mrs Doasyouwouldbedoneby, a moral persona of Mother Carey, that I can make beasts into men, by circumstance, and selection, and competition, and so forth ...if I can turn beasts into men, I can, by the same laws of circumstance, and selection, and competition, turn men into beasts.41

Kingsley thus again aligns the scientific with the moral, keeping mankind at the centre of the evolutionary narrative. Gillian Beer describes this use of Darwinian theory as a propensity to ‘colonise it with human meaning, to bring man back 37 Water Babies, Chapter VII. 38 ibid, Chapter VI. 39 Darwin, The Origin, p. preface quoting Saint-Hilaire: ‘En résumé, l’observation des animaux sauvages démontre déjà la variabilité limité des espèces. Les expériences sur les animaux sauvages devenus domestiques, et sur les animaux domestiques redevenus sauvages, la démontrent plus clairement encore’, retrieved 23 January 2009 from http://www.literature.org/authors/darwin-charles/ the-origin-of-species/preface.html. For Galton see Jean Gayon, Matthew Cobb, Darwinism’s Struggle for Survival: Heredity and the Hypothesis of Natural Selection (Cambridge University Press, 1998), pp. 147-178. 40 Water Babies, Chapter VI. 41 ibid.

319

to the centre of its intent.’42 Kingsley had, previous to the publication of The Origin, already done this in the Alton Locke evolution sequence, and maintained this anthropocentric stance in The Water Babies when applying the theory of natural selection. Contemporary reaction to this narrative sequence is worthy of note. The Anthropological Review of November 1863 recognises it as an application of ‘the Darwinian laws to the supposed “degradation” of the ape from the human species’ and feels ‘bound to point out that the great flaw in the Darwinian theory, which Professor Kingsley, to a certain extent, we believe, advocates, is admirably illustrated in this passage.’43 A tenuous argument as to why ‘the further transmutation of the scansorial man into the ape would have been rendered functionally unnecessary’ disregards the moral allegory of the tale focussing only on the scientific. This is pertinent as it reveals that the critical reception of the novel was not limited to the literary establishment; this work was being judged on a scientific level. Kingsley was, of course, an Honorary Fellow of the Anthropological Society of London, whose members would be expected to follow his work, but we can see that even his children’s fiction gained the attention of the scientific community. The Doasyoulikes sequence still reveals, albeit in reverse, Kingsley employing a Rosseauian acceptance of the educable noble savage. Darwin also wrote firsthand to Kingsley about this: That is a grand & almost awful question on the genealogy of man to which you allude. It is not so awful & difficult to me, as it seems to be most, partly from familiarity & partly, I think, from having seen a good many Barbarians. I declare the thought, when I first saw in T. del Fuego a naked painted, shivering hideous savage, that my ancestors must have been somewhat similar beings, was at that time as revolting to me, nay more revolting than my present belief that an incomparably more remote ancestor was a hairy beast.44

His experiences with the Fuegians had forced him to consider this in depth. One Fuegian who had spent time in England and become, to the Victorian mind, civilised, only to ‘regress’ to his former behaviour on returning, made a particular impact on Darwin: we could not recognise poor Jemmy. It was quite painful to behold him; thin, pale, & without a remnant of clothes, excepting a bit of blanket round his waist: his hair, hanging over his shoulders; & so 42 Gillian Beer, Darwin’s Plots, Evolutionary Narrative in Darwin, George Eliot and NineteenthCentury Fiction, (Cambridge,2000) p.7. 43 AnthropologicalReview, vol.1, No 3 (Nov., 1863) p. 474. 44 Letter 3439 — Darwin, C. R. to Kingsley, Charles, 6 Feb [1862] retrieved 22 January 2009 from http://www.darwinproject.ac.uk/darwinletters/calendar/entry-3439.html.

320

ashamed of himself, he turned his back to the ship as the canoe approached. When he left us he was very fat, & so particular about his clothese, that he was always afraid of even dirtying his shoes; scarcely ever without gloves & his hair neatly cut. — I never saw so complete & grievous a change.45

Darwin, from the fact that Jemmy had been able to become Anglicised, recognised the fact that all men are the same and mused on this: Although essentially the same creature, how little must the mind of one of these beings resemble that of an educated man. What a scale of improvement is comprehended between the faculties of a Fuegian savage & a Sir Isaac Newton — Whence have these people come?46

Kingsley shows the opposite of such thought in The Water Babies, in his descriptions of the Irish gillie. When describing Dennis’ propensity for telling ‘your honour’ exactly what he wants to hear, Kingsley describes the gillie as simple, rather than expressing an understanding of the socio-political circumstances that render Dennis vulnerable to his employer: instead of being angry with him, you must remember that he is a poor Paddy, and knows no better; so you must just burst out laughing; and then he will burst out laughing too, and slave for you, and trot about after you, and show you good sport if he can—for he is an affectionate fellow, and as fond of sport as you are—and if he can’t, tell you fibs instead, a hundred an hour; and wonder all the while why poor ould Ireland does not prosper like England and Scotland, and some other places, where folk have taken up a ridiculous fancy that honesty is the best policy.

This representation of the Irish as comparatively uncivilised, descends into evolutionary terms in a letter that Kingsley sent to his wife when visiting Ireland in 1860, when he famously describes the Irish as ‘human chimpanzees’ and is unable to associate this with the economic effect of British rule. He says that he believes that ‘they are happier, better, more comfortably fed under our rule than they ever were.’47 The following day he writes of his distress at the post-famine devastation to whole villages, but in this case he excuses this on economic grounds and says nothing to suggest, in his usual mould, that the circumstances may have produced the 45 Charles Darwin, Beagle diary (1831-1836) retrieved January 15 2009 from http://darwin-online. org.uk/content/frameset?viewtype=text&itemID=EHBeagleDiary&keywords=fuegian&pages eq=430. 46 ibid, see also Descent, chapters 7 and 21. 47 Kingsley, Letters, p.236.

321

character. This blind spot is notable and shows a variance with Darwin’s thoughts regarding the Fuegians, and indeed, Darwin later questions the theorising of Irish inferiority as expounded by Greg and Galton.48 Kingsley, like many Victorians, associates less ‘civilised’ with less evolved. In an 1862 letter he writes to Darwin, discussing a hypothesis regarding missing links and states ‘we are not niggers, who can coexist till the 19th century with gorillas a few miles off.’49 This is implicit in The Water Babies, when the salmon is speaking to Tom about trout: My dear, we do not even mention them, if we can help it; for I am sorry to say they are relations of ours who do us no credit. A great many years ago they were just like us: but they were so lazy, and cowardly, and greedy, that instead of going down to the sea every year to see the world and grow strong and fat, they chose to stay and poke about in the little streams and eat worms and grubs; and they are very properly punished for it; for they have grown ugly and brown and spotted and small.50

In a lecture given in 1871, Kingsley does discuss popular fears about race and explicitly avers his agreement with Darwin: Next, as to Race. Some persons now have a nervous fear of that word, and of allowing any importance to difference of races. Some dislike it, because they think that it endangers the modern notions of democratic equality. Others because they fear that it may be proved that the negro is not a man and a brother. I think the fears of both parties groundless. As for the negro, I not only believe him to be of the same race as myself, but that--if Mr. Darwin’s theories are true--science has proved that he must be such. I should have thought, as a humble student of such questions, that the one fact of the unique distribution of the hair in all races of human beings, was full moral proof that they had all had one common ancestor.51

Given the eleven year span of time since his bestialisation of the Irish, one may be tempted to draw from this that he no longer subscribed to his earlier views. However, within the same lecture, his continual extolling of the Englishman as the pinnacle of humanity leaves an ambiguity, or even a dissonance, in his opinion. 48 Darwin, Descent, chapter 5. 49 Letter 3426 — Kingsley, Charles to Darwin, C. R., 31 Jan 1862, ] retrieved 22 January 2009 from http://www.darwinproject.ac.uk/darwinletters/calendar/entry-3426.html. 50 Water Babies, Chapter III. 51 Charles Kingsley, The Natural Theology of the Future, read at Sion College in 1871, retrieved 8th January 2009 from http://www.online-literature.com/charles-kingsley/scientific/7/.

322

This dissonance is reflected primarily in the difference between his private correspondence and the opinions he presents in the public sphere. The free use of simian imagery, seen in letters to his wife and to Darwin, is not made explicit in his published work. His advocacy of Darwinian theory in general, however, is explicitly revealed in his preaching. In his famous sermon ‘The Shaking of the Heavens and the Earth,’ Kingsley lists prior times when the foundations of worldview and belief had been shaken, both theological and scientific, and aligns Darwinism with these pivotal points in history: The Copernican system shook them, when it told men that the earth was but a tiny globular planet revolving round the sun. Geology shook them, when it told men that the earth has endured for countless ages, during which whole continents have been submerged, whole seas become dry land, again and again. Even now the heavens and the earth are being shaken by researches into the antiquity of the human race, and into the origin and the mutability of species, which, issue in what results they may, will shake for us, meanwhile, theories which are venerable with the authority of nearly eighteen hundred years, and of almost every great Doctor since St. Augustine.52

His message, in this exhorting and emotive sermon, is from his text: ‘Yet once more, signifieth the removing of those things that are shaken, as of things that are made, that those things which cannot be shaken may remain’ (Heb 12:26-7): that which science does not shake, that is God himself, will remain solid. He continually reiterates the compatibility of science, and in particular, Darwinism, with religion and theology, and advocates an embracing of science. Interestingly, he prefaces his 1874 publication of Westminster Sermons with the lecture quoted above, ‘The Natural Theology of the Future.’53 Kingsley clearly perceives and requests that his scientific lectures must be considered alongside his sermons. Again we see that his religion and his science remain inextricable. His body of sermons and lectures show exactly the same acceptance of Darwinian theory as his novels. He remains keen to promote scientific advancement, and specifically Darwinism, in every forum to which he has access. Thus we see that Kingsley was indeed an ardent advocate of Darwinism. He became of personal importance to Darwin partly because of Darwin’s susceptibility to the opinions of others and loathing of confrontation, and partly due to Kingsley’s established status and reputation. An eminent cleric such as Kingsley gave Darwin a significant validation within the ecclesiastical establishment, which was as a sphere was for the most part hostile to Darwin, yet mattered to 52 Charles Kingsley, The Shaking of The Heavens and The Earth, retrieved 23 January 2009 from http://www.online-literature.com/charles-kingsley/water-of-life/6/. 53 Charles Kingsley, Westminster Sermons (London: Macmillan, 1874).

323

him. Nonetheless, as a promulgator of Darwinian theory, Kingsley notably retains a providential view of natural history, with consistent reference to elements of Lamarck and Paley: he never moves away from both the intentional will of the species to change, and a complete acceptance of an integral theistic greater plan. Thus, natural selection is continually presented by Kingsley as equated to providential history, and further, both are depicted as symbiotically bolstering the other. His initial reaction to The Origin, encapsulated in his first letter to Darwin, remains his enduring stance, staying true to the sentiments so welcomed by Darwin in 1859, yet selectively assimilating elements which maintain his worldview. The specific application of Darwinism within Kingsley’s work is likewise selective, showing signs of following the popular interpretations of Darwinism rather than the work actually proposed by the man himself, as, for example, we saw with his treatment of the Irish in The Water Babies and in his private letters to his wife. That being said, Kingsley was recognised by both followers and opponents of the theory as a Darwinian. His readiness to accept the theory of natural selection and his enthusiasm in promulgating it are clear from his personal writings and his published works, yet if the theory had not been published, it is clear that Kingsley would have continued to integrate the latest scientific theories within his work; the same application of contemporary scientific findings is seen in Yeast and Alton Locke as is found in The Water Babies; it is the theories which have shifted, not Kingsley’s use of them. Science is also highly visible in his sermons, with Darwinian theory plainly presented as a new and pivotal step in the incremental development of science since Copernicus. The mutual relationship of science and religion is one of the driving forces in works spanning his entire career. The evidence presented by Darwin compelled and excited Kingsley. The highly public nature surrounding the reception of The Origin fed Kingsley’s natural bent towards both controversial debate and championing a cause. All these elements combined proved compelling for Kingsley, who remained unwaveringly proud to have his name associated with the theory proposed in The Origin.

324

325

IRISH PANEL judging panel Dr Regina Uí Chollatáin (UCD) - Chair Dr Pádraigín Riggs (UCC) Dr Brian Ó Catháin (NUIM) Due to space constraints the second winner in thsi category has been omitted from this journal. However the essay is available online at www.uaireland.com JUDGes’ Comments Winner 1 Innéacs cuimsitheach, eolgaiseach a chlúdaíonn bailiúchán amhrán a rinne Cosslett Ó Cuinn i nGabhla, i dToraigh agus in Árainn Mhór átá anseo. Ábhar taighde bunaidh ar ardchaighdeán é a léiríonn tuiscint an-mhaith ar an ábhar féin, ar na foinsí béaloidis agus ar thábhacht na hoibre seo i gcaomhnú thraidisiún luachmhar na n-amhrán Gaeilge. Mar aon le treoir don léitheoir,tugann réamhrá an innéacs eolas ar chúlra Uí Chuinn agus ar a chuid oibre ar amhránaíocht na Gaeilge sna ceantair a ríomhtar san innéacs. Ceann de na gnéithe is spéisiúla faoin saothar seo ná an bhéim a chuirtear ar chúrsaí canúnachais agus ar an dóigh gur féidir taighde a dhéanamh ar chanúintí na Gaeilge trí staidéar a dhéanamh ar leaganacha éagsúla, logánta na n-amhrán. Chloígh an mac léinn le cur chuige straitéiseach a chuirfidh áis thaighde den scoth ar fáil do phobal na Gaeilge, áis ar féidir tógáil uirthi ag leibhéal iarchéime agus na bunchlocha leagtha sa saothar seo. Rinneadh eagarthóireacht an-mhaith ar an ábhar féin sa tslí gur baineadh barr feabhais intleachtúil amach ag an leibhéal seo. Dá bharr seo tá an Chéad Duais á bronnadh ar an iontráil seo i gcomhpháirt le hiontráil amháin eile. This is a comprehensive, well-informed index which covers a collection of songs collected by Cosslett Ó Cuinn in Gola and in Aranmore. This original high standard research demonstrates a very good understanding of the subject area, of the folklore sources and of the importance of this work in the valuable preservation of the Irish song tradition. Alongside a guide for the reader, the foreword to the index provides information on the background of Ó Cuinn and his work on the Irish song tradition in the districts which are dealt with in the index. One of the most interest326

ing aspects of this work is the emphasis that is put on dialectal traits. The student maintained a strategic approach which will provide the Irish public with an excellent research tool, one which can be developed at postgraduate level now that the foundations have been laid through this work. The material was very well edited which showed intellectual excellence at this level. As a result of all the above this submission is being awarded joint first.

Winner 2 San aiste seo déantar anailís chuimsitheach ar an eolas atá bailithe ar chillíní na bpáistí, ar bhunús stairiúil na gcillíní, agus ar thuiscintí an phobail ar ghné den saol a coinníodh rúnda ar chúiseanna áirithe ar feadh i bhfad. Úsáideann an mac léinn an t-eolas áitiúil mar fhoinse bhunaidh agus mar phointe tosaigh le plé a dhéanamh ar cheist dhomhanda. Luaitear an ‘briseadh croí faoi rún’ i dteideal na haiste agus is léir go dtugtar fóram agus guth do ghné shainiúil a bhain le pobal na Gaeltachta, go háirithe don chuid sin de phobal na Gaeltachta nach raibh guth acu, na páistí seo a cuireadh gan aitheantas ceart. Tugann comhthéacs an taighde mionsonraí chun solais a léiríonn tuiscint dhomhain ar an ábhar. Baintear úsáid as foinsí ilghnéitheacha chun an taighde a chur i láthair i slí éifeachtach, chumasach agus léirítear fianaise luachmhar i gcomhthéacs acadúil ar thuairimíocht an phobail chomhaimseartha. Cé go bhfuil cuid áirithe den taighde bunaidh lonnaithe in iarthar na hÉireann, ní leasc leis an mac léinn dul i ngleic le comhthéacs domhanda na gcillíní a léiríonn cur chuige léannta, intleachtúil. Éiríonn leis an mac léinn barr feabhais a bhaint amach a chuireann ábhar bunaidh os comhair an léitheora. Mar thoradh air seo ar fad tá an chéad duais á bronnadh ar an aiste seo i gcomhpháirt le hiontráil eile. This essay presents a comprehensive analysis of information which has been collected about children’s burial grounds, about the historical background of the burial sites and about the community understanding on an aspect of life which remained a secret over a long period of time. The student uses the local knowledge as an original source to discuss a global issue. The ‘secret heartbreak’ is mentioned in the essay title and clearly a forum and voice is given to a particular aspect of the Gaeltacht community. The context of the research brings minute details to light which show a deep understanding of the subject. Various sources are used to present the research in an effective, competent manner, and there is valuable evidence of contemporary public opinion in an academic context. Although a certain amount of the research is based in the west of Ireland, the student embraces the global context of the burial grounds. The student achieves an excellent standard which presents original material to the reader. As a result of this, this submission is being awarded joint first. 327

328

I R I SH

Innéacs de bhailiúchán amhrán a rinne Cosslett Ó Cuinn i nGabhla, i dToraigh agus in Árainn Mhór Kayla Reed

liocht atá anseo as aiste níos faide a rinneadh mar thionscadal don chéim BA sa Nua-Ghaeilge. Sa bhunaiste sin, rinneadh iarracht innéacs cuimsitheach a dhéanamh de na hamhráin a bhailigh an tUrramach Cosslett Ó Cuinn i nGabhla, i dToraigh agus in Árainn Mhór i dTír Chonaill, sa dóigh is gurbh fhéidir a n-aithint agus a gcur i gcomparáid le leaganacha eile. Tá céad amhrán san innéacs iomlán agus iad eagraithe de réir aibítre. Sa leagan gearr seo, tugtar 29 de na hamhráin ba shuaithní acu. Faoi ainm gach amhráin, luaitear an cineál amhráin atá ann agus nóta ar bith a scríobh Ó Cuinn faoin amhrán. Luaitear cé uaidh a bhfuair Ó Cuinn an t-amhrán, agus cén áit. Luaitear sonraí aitheantais an amhráin: an dialann ina scríobh Ó Cuinn é, an uimhir a thug Ó Cuinn air, agus uimhir an leathanaigh. Tá sonraí an amhráin féin luaite: cé mhéad véarsa atá ann, cé mhéad líne atá i ngach véarsa, agus cé acu atá líne ar bith ar lár. Ina dhiaidh sin, tugtar an chéad líne de gach véarsa. Rugadh Cosslett Ó Cuinn ar 27 Feabhra 1907 i nDoire Achaidh, Co. Aontroma, agus mhair sé go dtí 6 Nollaig 1995. Ghnóthaigh Ó Cuinn céim onóracha i dTean329

gacha Clasaiceacha ó Choláiste na Tríonóide in 1929, agus chuaigh sé le ministéireacht ina dhiaidh sin. Músclaíodh a shuim sa Ghaeilge nuair a bhí sé ar an Ollscoil agus thosaigh sé ag triall ar an Ghaeltacht. Lean Ó Cuinn ar aghaidh ag saothrú na Gaeilge agus bhain sé clú amach mar scoláire, mar aistritheoir agus mar bhailitheoir béaloidis. Líon Ó Cuinn 39 ndialann d’ábhar béaloidis a bhailigh sé i gCúige Uladh go mór mór. San innéacs seo, dírítear ar thrí cinn de na dialanna sin ina bhfuil ábhar a fuair sé i nGabhla, i dToraigh agus in Árainn Mhór.1 Gabhla: Tháinig 39 de na hamhráin as Gabhla, agus 11 giota. Chruinnigh Ó Cuinn na hamhráin sin nuair a bhí sé i nGabhla i 1930 agus arís i 1932.2 Tá na hamhráin sin níos giorra ná na hamhráin a fuair sé i dToraigh agus in Árainn Mhór. Fuair sé na hamhráin ó Fhrainc Mac Fhionnlaoich, ó Charlie Neansaidh, ó S. Ó Gallchobhair, agus ó Chathal Éamoinn Rua.3 Toraigh: Fuair Ó Cuinn 29 amhrán istigh i dToraigh agus é ar cuairt ann i mí Iúil, 1939. Fuair sé na hamhráin ó John Tom Ó Mianáin, ó Cháit Tom Ní Mhianáin, ó Shéamas Ó Dubhtháin Pádraig (Jimmy), ó Éamonn Ó Dubhtháin, ó Shéamas Mac Ruaidhrí agus ó Phádraig Mac Ruaidhrí.4 Árainn Mhór: Bhí Ó Cuinn ar cuairt in Árainn Mhór i mí Lúnasa, 1940. Bhailigh sé 32 amhrán agus dhá ghiota ó Bhidí Chaitlíne Nic a’ Bhaird, ó Róise Ní Ghrianna, ó Uilliam Ó Ceallaigh, agus ó Bhidí Fransaí Ní Dhomhnaill.5 Is beag eagarthóireacht a rinne mé ar scríbhinní Uí Chuinn ar mhaithe leis an leagan is dílse den ábhar a aithrisíodh do Ó Cuinn a chur ar fáil. Nuair a chuaigh Ó Cuinn ag bailiú ábhair i nGabhla ar dtús, ní raibh sé ag foghlaim na Gaeilge ach le corradh is bliain. Is léir ón ábhar a bhailigh sé ann go raibh deacrachtaí aige an chanúint a thuiscint: tá líon mór focal a raibh sé in amhras fúthu.6 Cúpla bliain ina dhiaidh sin, nuair a bhí sé ag breacadh síos amhrán agus scéalta i dToraigh agus in Árainn Mhór agus cumas maith teanga aige, bhí deacrachtaí aige go fóill muintir Thoraí a thuiscint.7 Rinne sé iarracht na fuaimeanna sin a scríobh amach cé bith; tá tábhacht foghraíochta ag baint leis an bhunleagan ar an ábhar sin, fiú nuair is féidir buille faoi thuairim a thabhairt den fhocal féin. Is cosúil ón ábhar a bhailigh Ó Cuinn go raibh sé ag iarraidh miondifríochtaí sa chaint ó cheantar go ceantar a léiriú. Scríobh sé smaoitighim agus muitir in áit smaoiním agus muintir, go díreach mar atá sa chaint. Léirigh sé na difríochtaí idir chanúintí na dtrí oileán chomh maith: scríobh sé théann agus choidhe in Árainn Mhór agus théid agus chaoidhche in Oileán Thoraí. Bhí trí leagan éagsúla den fhorainm réamhfhoclach dom aige: domh a bhí aige i nGabhla den chuid is mó, dom i dToraigh agus damh in Árainn Mhór.8 Dá réir sin, tá sé tábhachtach ó thaobh thaifead na teanga de nach gceilfí na leaganacha seo ar an léitheoir. Rinne mé mionleasuithe ar an phoncaíocht. Den chuid is mó, ní raibh aon fhleiscín sa bhuntéacs nuair a tháinig t- agus n- roimh ghuta, ach bhí nuair a tháinig h- roimh ghuta. D’athraigh mé sin go bhfuil sé ag teacht le nós an lae inniu. Níor thug Ó Cuinn ainm an amhráin i gcónaí. D’úsáid mé an chéad líne den amhráin sa chás sin, ach amháin nuair a bhí ainm so-aitheanta air, mar shampla, Éirigh Suas a Stóirín. 330

Ní d’aon ghnó a thosaigh Ó Cuinn ag cruinniú amhrán, ach d’fhág sé cnuasach tábhachtach ina dhiaidh. Fuair sé leaganacha d’amhráin nach bhfuil le fáil i bhfoinsí eile agus léirigh sé dílseacht as an choiteann do na leaganacha a chuala sé.

Innéacs Ag Siubhail Amach Dé Dómhnaigh Cur síos: amhrán grá. Tá Béarla measctha tríd an 3ú véarsa. Bidí Chaitilín, An Phlochóg, Árainn Mhór. Dialann 25, amhrán 16, lch 29, 4 véarsa 4 líne. “Ag siubhail amach Dé Dómhnaigh a d’fhag mo chroidhe trom” “Cé (gaidé) dheanfa mé i márach is cé dheanfa mé aríst” “Go hIreland ma théighimsa true fancy must go” “Mar an lán mara ag éirghe fá thaobh an Chnuic Bháin” Amhrán na Scadán9 Cur síos: amhrán iascaireachta. Jimmy, Oileán Thoraí. Dialann 14, amhrán 34, lch 82-89, 6 véarsa 8 líne. Níl ach 7 líne sa 5ú véarsa agus 4 líne sa 6ú véarsa. “Chuaidh John Ó Míonáin na nDúinnibh” “Thainic an Tír Chonaill ‘na Chámuis” “Thainig an sagart ‘un tosaigh” “Da mbeitheá ar an Tír Mhór agus ar aontaigh” “Nach truaigh é a fhear Maighistear Sinkan” “Tá bóchall beag beadaidhe ar an bhaile seo” An Bhanaltra Cur síos: amhrán grá. Tá leagan den amhrán seo in Folksongs of Britain & Ireland.10 F. Mac Fhionnlaoich, Oileán Ghabhla. Dialann 2, amhrán 3, lch 9-12, 8 véarsa 4 líne. Níl ach 3 líne sa 5ú véarsa. “Nuair a fuair mé féin san bhanaltra amach go bruach loch Éirne” “Míle m’anam ar maidín thú ‘s aríst ag teacht na hoidhche” “Ní theachaidh síol i dtalamh ariamh níos deise ná síol aorna” “A chailíní ‘s a chailíní an méid agaibh tá le pósadh”11 “Ar a theacht abhaile damh féin ar a hocht a chloig san oidhche” “Is deas a’ fear i mbaile mé agus níl dúil agam i seanchainnt” “Má thugann tú mil ar maidin damh, ná bé an leanbh aimhréidh” “Tá cailleach i bpáirt na hUilinne agus bhí sí díthe comharsanach” An Bhean Ba Mheasa Liomsa Faoi an Ghréin Cur síos: amhrán grá. Scríobh Ó Cuinn nóta ag bun an leathanaigh deiridh: “Féach Píaras Feirtéir.” Dán de chuid an Fheirtéirigh atá ann go dearfa, agus tá an 331

bunleagan le fáil in Dánta Phiarais Feiritéir.12 Róise Ní Ghrianna, Creag an tSeabhaic, Árainn Mhór. Dialann 25, amhrán 6, lch 14-15, 8 véarsa 4 líne. “An bhean ba mheasa liomsa faoi an ghréin” “Nach fáda fáda bhí tú amuigh” “Is truagh nach dteachaidh an ghaoth ó dheas” “D’fhan mé leatsa bliadhan nó dhó” “Bean adaigh ba tanaidhacha na taobh a ghloine” “Da ba mise an t-éan a rachadh i bhfad” “Seanfhocal agus é bheith fíor” “Fádódh téine le loch” An Lá Sin a D’fhág Mise Toraigh Cur síos: amhrán deoraíochta. Tá leagan den amhrán seo in The Irish of Tory Island.13 Jimmy, Oileán Thoraí. Dialann 14, amhrán 26, lch 58-59, 6 véarsa 4 líne. Níl ach líne amháin den 5ú véarsa, ach tá 5 líne sa 6ú véarsa. “Lá sin a d’fhág mise Toraigh ba deas mo cheapóg nótaí” “Lá sin ag dul go Glascú dom dhul ar bord an California” “An chéad fhear a thainig orainn le siosur a bhain dúinn ar gcuid gruaige” “Ag eirghe domsa ar maidín ‘s mé istoigh ag bean a’ lóistín” “Siud a rabh na fideógaí atá ag cruinniú isteach na hoibridheannaí” “A Mhuire agus a Rí nach mise an fear bhí amaideach” Bláth na gCraobh14 Cur síos: amhrán grá. Tá leagan den amhrán seo in Dhá Chéad de Cheoltaibh Uladh.15 Tá an 5ú véarsa le fáil san amhrán An Buachaill Deas Óg chomh maith.16 Oileán Ghabhla. Dialann 2, amhrán 23, lch 45-46, 6 véarsa 4 líne. “Rachaidh mé na phobal i mbárach” “San uair nach tú a bhí i ndán damh” “Is craobh ar a’ phobal a dfhag tú” “’S is ro dheas a brollach ‘s a braghaidh” “Dá mbéadh ‘s ag do mhuitir í Sheaghain”17 “D’fhag mé annsin í i naoi dtraigh” Conall Cearnach Cur síos: fuadach sí/ suantraí. Scéal an amhráin mar a fuair Ó Cuinn é: “Tugadh duine isteach sa bheinn uair amháin a rabh Conall Cearnach air. An bhean a bhí sé a gul a phósadh bhí sí istoigh róimh.” Oileán Ghabhla. 332

Dialann 2, amhrán 59, lch 90-91, 3 véarsa 4 líne. “Spré ort nach mise Meadhbha” “Bhí dhá ghearáin déag agam” “Huis o hú agus ohó mo leanabáin”18 Cuach na Finne Cur síos: amhrán grá. Baineann cuid de na véarsaí seo le Siún Ní Dhuibhir atá in Dhá Chéad de Cheoltaibh Uladh agus in Amhráin Chúige Uladh, ach más é an t-amhrán céanna atá anseo, leagan neamhghnáth atá ann.19 Oileán Ghabhla. Dialann 2, amhrán 21, lch 41-43, 10 véarsa 4 líne. Níl ach 2 líne sa chéad véarsa. “A Chuach na Finne ma d’imigh tú i ndiaidh do nead” “A gheirrseach bheag bheadaigh bhí i reathaí i ndiaidh na bhfear” “Dá mbeadh ‘s ag mo muitir gur i gCuileann a tharluigh mé” “O bhí bean agam a’s caithfeadh sí an píop a ghrádhadh” “Is saighduir sighilte mé d’migh as garda an ríogh” “D’éirigh mé ar maidín agus ghluais mé ‘un aonaigh Iubhair” “‘S a Shiubhan Ní Dhuibhir an misde leat mé bheith tinn” “O Maire leanna a tharluigh an óigbhean chiúin” “O thíar i nGaillimh tá searc agus rún mo chléibh” “Gan bo gan gamhan mo leanbh gur fagadh mé” Dailtín Toighe Móir Cur síos: amhrán grá. Árainn Mhór. Dialann 25, amhrán 21, lch 37-38, 6 véarsa 4 líne. “Dailtín toighe móir ní phósfad go deó” “Is ag Neidí tá an cú is deise ar a lúth” “Racha mé ar cuairt na bhaile udaigh suas” “Caidé an fáth damh bheith ag coimhit ar sgeimh deas na mná” “Is aici atá Leitir ‘Ic a Baird” “Tá mé mo luighe le corradh ‘s le mí” Dán an Bháis Cur síos: dán diaga. Tá leagan den amhrán seo le cluinstin ar an téip Seal Mo Chuarta le Caitlín Ní Dhomhnaill as Rann na Feirste ach níl na véarsaí seo ar fad ann.20 Tá cuid eile de na véarsaí le fáil in Dánta Diaga Uladh.21 Róise Ní Ghrianna, Creag an tSeabhaic, Árainn Mhór. Dialann 25, amhrán 5, lch 12-13, 9 véarsa 4 líne. Níl ach 2 líne sa dara véarsa. “Éistigidh liomsa anois a pheacthach” “Tiocfaidh sé go colbha do leaptha” “Tiocfaidh sé ag bun na coise” “Cuirfimuid duine fá choinne an tsaghairt” 333

“Nach minic a bhí tú do luighe ar meisce” “Bréagach thú ars an cholann” “Tiocfaidh Mícheál as na Flaithis” “Dhéanfar draichead réidh dhé a ghloine” “Béidh na haighle22 ar uachtar uisce” Dán an Túir Cur síos: dán diaga. Tá an t-amhrán seo i gcló in Cosslett Ó Cuinn le Risteárd Ó Glaisne.23 Tá leagan eile le fáil in Dánta Diaga Uladh.24 Bidí Chaitilín, An Phlochóg, Árainn Mhór. Dialann 25, amhrán 1, lch 1-6, 26 véarsa 4 líne. “A ghiolla atá faoin tsiabadh” “Ó chuir tú an cheist orm in onoir Iosa” “Ceist eile agam ort aríst” “Fiche bliadhan go Dómhnach s’ chuaigh thart” “Is doiligh liom sin a chreidbheáil uait” “Creid thusa go dtiocfaidh an uair” “Ní mise a rinn a’ t-olc” “A chromádaigh mo chroidhe”25 “Bheirfinn comhairle duid” “Nuair a bhí mise ar shaoghal shalach na gcathuighthe” “Nuair a rachainn ‘un Aifrinn Dé Dómhnaigh” “Nuair a thiocfainn na bhaile tráthnóna” “Bhí easnaidheach mhór ar mo theaglach” “Bhí mé sanntach súl-radharcnach” “Níor leig26 mé ríamh i gcoisde an bháis” “Annsin a chonnaic mé bunadh Chríosta” “Labhair an t-Údás Nimhe”27 “Cé gur do sheirbhís bhí sé a dhéanamh” “Níl a fhios agam arsan t-athair síorrthaidhe” “Annsin a labhair Muire faoi umhlaidheacht” “Ba é a thug an deoch nimhe” “(Maise) a mháthair nach dtearn an t-olc” “A Mhic mo chroidhe na leig leis é” “Sin tús agus deireadh mo scéil” “Ach go bé guidhe Mhuire ar a héanmhac” “Ní hé an uair a béas rosg na súl á mbriseadh” Dán na hAoine Cur síos: dán diaga. Tá 19 leagan den amhrán seo le fáil in Caoineadh na dTrí Muire,28 ach is iad na leaganacha DA3 agus DA4, a tógadh síos ó Chaitlín Óg Ní Dhomhnaill, Croith Uí Bhaoighill agus ó Anna Nic Eiteagáin, Mín a’ Ceachan, faoi seach, na leaganacha is cóngaraí don leagan seo.29 334

Bidí Chaitilín, An Phlochóg, Árainn Mhór. Dialann 25, amhrán 3, lch 8-10, 10 véarsa 4 líne. Tá 6 líne sa véarsa deiridh. “Sí seo an Aoine thursach bhrónach” “A Rí mhór na hAoine nach tursach a bíos tú” “Nuair a chualaidh an Mhaighdean gur gabhadh a héanmhac” “Casadh fuil Íosa uirthi go híseal sa ród dí” “Le sin tháinig smúid as cuimse ar na réaltaí” “Chuir siad culaith amadáin ar Éanmhac Íosa” “Sin agaibh ár Slanuigheóir agus é ag dul ‘a chéasadh” “Thóg siad suas ar chrann dólais na páise é” “Thug siad cupan bhinéagra dó a Dhia nárbh a deoch ghéar é” “Bhí a gcuid claimhtheach leóbhtha is iad rólíomhtha” Dán na Sgabail Cur síos: dán diaga. Tá amhrán darb ainm “Sgaball Mhuire” le fáil in Dánta Diaga Uladh, ach níl mórán cosúlachta idir an leagan sin agus an leagan seo.30 Bidí Chaitilín, An Phlochóg, Árainn Mhór. Dialann 25, amhrán 4, lch 10-12, 8 véarsa 4 líne. “Tá an mhaighdean faoi thuirse is tá an mhaighdean faoi bhrón” “A mhic a tsoluis agus a athair a’ truaigh” “A chairde gaoil faithchilligidh an bás” “A chairde gaoil faithchilligidh an bás” “Ag éirghe dúid ar maidin dean do chasaoid le Dia” “Ag éirghe damh ar maidin bhí mé i dtrioblóid a’ tsaoghail” “Tabhair an sgabal is chaith í gach lá” “Peacach bocht mise a pheacaigh go mór” Éirigh Suas a Stóirín Cur síos: amhrán grá. Leagan neamhchoitianta den amhrán seo. Tá an gnáthleagan le fáil in Ceolta Gael 2.31 Jimmy, Oileán Thoraí. Dialann 14, amhrán 19, lch 44-45, 7 véarsa 4 líne. Níl ach 3 líne sa 5ú véarsa. “I ngleanntán na Coilleadh Uaignighe is lag brónach mar bhíos” “Is nuair a éirighimse ar maidín as amharcaim uaim” “Bheirimsa mo bheannacht thart romham insa tslighe” “Rise up my darling nó nach bhfuil tú do shuighe” “Na fagaidh droichmheas orm ma tá mé bog óg” “Bheirimsa mo mhallacht don mhnaoi óg a dtigh32 mo dhéidh” “Racha mise i márach go hAonach a’ Ghleanna” Gleann Éinigh33 Cur síos: amhrán pósta. Sa scéal a fuair Ó Cuinn, dúradh gur tháinig saor as Connachta agus a mhac go Dún na nGall ag tógáil tí agus go raibh cailín sa teach 335

sin. Bhí an t-athair ag iarraidh go bpósfadh a mhac í, ach bhí an mac i ngrá le cailín a bhí sa bhaile i gConnachta. Thug siad deoch láidir don mhac agus pósadh an bheirt agus é ólta. Nuair a tháinig sé chuige féin, rinne sé ceol cráite faoin chéad bhean nach mbeadh aige choíche.34 Árainn Mhór. Dialann 25, amhrán 23, lch 40-41, 5 véarsa 4 líne. “Tá oileán beag i lár na hÉirne a bhfásann ‘féar air go luath” “Go Connachta síar sé mo bhrón nach dtéighim a choidhe” “Is truagh nach bhfuil mé agus mo chéile beag óg” “Dá mbéadh a fhios ag mo mhuirnín go cinnte mar tá” “Dar a nglacfadh mo dhá láimh ‘leabhair bána ‘s chan aon bhréag” Inis Oirthir a’ Port a D’fhág Mé Cur síos: amhrán iascaireachta. Oileán Thoraí. Dialann 14, amhrán 37, lch 87, 3 véarsa 4 líne. “Inis Oirthear a’ port a d’fhág mé” “Chuirfinnse leitir inns ortsa a Dhálaigh” “Má chluineann Mag Gaoith é ní bhíonn sé sastaí” Is Uait Aon Phóg Amháin35 Cur síos: amhrán grá. Jimmy, Oileán Thoraí. Dialann 14, amhrán 24, lch 54-55, 5 véarsa 4 líne. Níl ach 3 líne sa chéad véarsa. “Is uait aon phóg amháin sé d’iarfainn ‘e mhalairt leat” “A bhailintín ná meall36 orm níl geall agam ar aon duine ach thú” “Fásfaidh féar agus fásas fríd an fhairrge uilig go léir” “Ach go bé gur tú bhí i ndán dom gheobhainn árus ag mo mhuintir féin” “Seo cluanaidhe beag dá luaidh liom anoir i dtús mo shaoghail” Luan an tSléibhe Cur síos: dán diaga. Tá leagan den amhrán seo le fáil in Amhráin Hiúdaí Fheilimí agus leagan eile in Na Cruacha: Scéalta agus Seanchas.37 Bidí Chaitilín, An Phlochóg, Árainn Mhór. Dialann 25, amhrán 2 lch 6-8, 9 véarsa 4 líne. Tá 6 líne sa 4ú véarsa agus sa 6ú véarsa agus tá an líne deiridh ar lár sa 9ú véarsa. “Sé Luan an tSléibhe luan an léirsgrios” “Oiread do spéic do chlog Mhic Dé”38 “Tiocfaidh an uair go mbeidh muid buadharthaí” “Annsin a thiocfas a Déagh Mhac ceart a dhéanamh” “Annsin a thiocfas a mhaighdean dheas barramhail spéireamhail” “Sin na maolruisg a shíl do dhéidhsa” “Diomchar sí a héanmhac trí raithche na héanbhruinn” 336

“A’ té chuireas a dhóchas as rí an Dómhnaigh” “Do chroidhe a dhortú don aithrighe ró-gheall” Máire an tSeóid39 Cur síos: amhrán grá. Éamonn Ó Dubhtháin, Oileán Thoraí. Dialann 14, amhrán 13, lch 29-30, 3 véarsa 8 líne. “Ag dul fríd Chonnla40 dom do casadh an cúilfhionn orm” “Stad an ainnir seal beag baoideach” “Fuadh mé un seancharr le fear ón chomhursanacht” Máire Óg na gCiabh Cur síos: amhrán grá. Oileán Ghabhla. Dialann 2, amhrán 33, lch 52, 3 véarsa 4 líne. Níl ach 2 líne sa dara véarsa. “A Mháire Óg na gciabh fá impidhe ó Dhia” “Le lamhachta gunnaí móra, teinnte crábhacha na dhiaidh” “Bhí cíos agus géarrtha agus ministéirí gallta” Naoi gCnó ar a’ gCnoibhínn41 Cur síos: Laoi Fiannaíochta. Cuirtear ceist ar sciathóg faoi na laethanta nuair a rinneadh ar dtús é agus tugann sé cuntas ar na laochra uile a tháinig ag amharc air. Uilliam Ó Ceallaigh, Léidhb Gharbh, Árainn Mhór. Dialann 25, amhrán 7, lch 16-17, 7 véarsa 4 líne. Níl ach 3 líne sa 4ú véarsa. “Sgíachóg ó abhall amach”42 “Táim annseo le haimsir” “Lá dá rabh Fionntún agus é ag cnuasach” “Ag éirghe dó na sheasamh” “D’fhas mé mo lúrthainn”43 “Clann na Baoisc, Clann na Bóinne, Clann Cormaic ‘ic Airt” “Le linn Chormaic Mhic Airt” Nár Dheas a Bheith in Oileán Thoraigh Cur síos: amhrán deoraíochta. Chum Séamas Mac Ruaidhrí thart faoin bhliain 1924 agus é ar an choigríoch i Meiriceá.44 Tá leagan den amhrán seo in The Irish of Tory Island.45 Séamus Mac Ruaidhrí, Oileán Thoraí. Dialann 14, amhrán 1, lch 1, 3 véarsa 4 líne. “Nár dheas a bheith in Oileán Thoraigh” “Is truagh nach bhfuil mé ag iollaidh a’ mhónaidh” “Is é ruaigeadh an smúid dubh go luath as m’aigne” 337

Níl Ór ar Pláta na a’ tSeóid ‘a’ Bhreághachta Cur síos: amhrán grá. Árainn Mhór. Dialann 25, amhrán 22, lch 38-39, 4 véarsa 8 líne. Níl ach 6 líne sa 3ú véarsa. “Níl ór ar pláta na a’ tseóid ‘a’ bhreághachta” “A Mháire a ruansearc éalaigh liomsa” “Mo chreach a Mháire mhodhthamhail ó chonnaic mé tú ‘óigbhean” “Diarr mise ciúmhas uirthi de’n phlúid a bhí faoithe” Ógánaigh na gCarad Cur síos: amhrán grá. Tá leagan den amhrán seo in The Irish of Tory Island.46 Bidí Chaitlín Nic an Bháird, An Phlochóg, Árainn Mhór. Dialann 25, amhrán 12, lch 24, 4 véarsa 4 líne. “A Ógánaigh na gcarad car chodhla tú aréir” “Ag éirghe damh ar maidín is paidir damh an deór” “Dá mbéinn ar an éanlaith udaigh éirigheas go hárd” “Is truagh nach bhfuil mé is mo mhíle grádh” Padraic Mac Ruaidhrí48 Cur síos: Amhrán iascaireachta. Oileán Ghabhla. Dialann 2, amhrán 14, lch 29-30, 4 véarsa 8 líne. “A Phadraic ‘ac Ruaidhrí a chorp an duine uasal” “Ó Nansaidh tá an craobh leat i dToraigh go siorraidhe” “Tá coirce agus aorna chomh fairsing le mónadh” “Tá ‘n rigging in ordú ní baoghal da cuid seoltaí” Tabhair Sgéal Uaim go hÁran49 Cur síos: amhrán pósta. Oileán Ghabhla. Dialann 2, amhrán 39, lch 57, 4 véarsa 4 líne. Tá 6 líne sa 4ú véarsa. “Tabhair sgéal uaim go hÁran” “Tá Séamus ions’ a’ leabaidh” “Bhuail Cutaidh an doras” “Thíos i mBaile an Uachtar” Tá Raiche ar an Bhaile seo ag Eoin Cur síos: Aoir. Cait Tom Ní Mhíonáin, Oileán Thoraí. Dialann 14, amhrán 32, lch 78-79, 3 véarsa 8 líne. “Tá raiche ar an bhaile seo ag Eóin” “gCuala sibh raiche an chinn bháin” “Deir Ned ‘ac Colla más fíor” 338

Tarlach Beag Scrábach Cur síos: amhrán pósta. Scríobh Ó Cuinn go ndearnadh an t-amhrán seo faoi fhear as Rann na Feirste a phós bean as Gaoth Dobhair.50 Oileán Ghabhla. Dialann 2, amhrán 35, lch 54, 2 véarsa, 4 líne agus 5 líne. “Tarlach beag scrabach a bhfuil air dath a’ leaban” “Taobh thall ó Ghaoth Dobhair gan bean insa’ tír” Toraigh na dTonn Cur síos: amhrán ag moladh Oileán Thoraí. D’inis Cait Tom Ní Mhíonáin scéal an amhráin do Ó Cuinn; gur fágadh seoltóir ar an bhlár i dToraigh nuair a d’imigh a bhád gan é. Chuir bunadh an oileáin fáilte fhial roimhe agus rinne sé an t-amhrán seo. Cait Tom Ní Mhíonáin, Oileán Thoraí. Dialann 14, amhrán 8, lch 11, 3 véarsa 4 líne. “Toraigh na dtonn agus na dtom agus na mbeann a bhí árd” “Is mise bhí gan chéill rinn an éagcaointe thart faoi mur gcoim” “A Thoraigh ó thuaidh go buan go mairidh tú beó”

339

References 1. Ó Glaisne, 1996: 2, 4-5, 22-23, 436. 2. Ó Glaisne, 1996: 22, 50. 3. Ó Canainn, 1994: 28; Ó Cuinn, 1930-1932. 4. Ó Cuinn, 1939; Ó Glaisne, 1996: 79. 5. Ó Cuinn, 1940; Ó Cannainn, 1994: 28; Ó Cnámhsí, 1988: 194; Ó Glaisne, 1996: 81. 6. Ó Glaisne, 1996: 4-5, 15, 22; Ó Canainn, 1994: 24 7. Ó Glaisne, 1996: 78-85. 8. Ó Cuinn, 1930-32; Ó Cuinn, 1939; Ó Cuinn, 1940; Ó Glaisne, 1996: 80, 425. 9. Nóta a scríobh Ó Cuinn: “Éamonn ‘ac Ruaidhrí a rinn.” 10. Kennedy, 1975: 79. 11. Ní hé seo an véarsa atá in An Ghiobóg, cé go dtosaíonn sé leis an líne chéanna. 12. Ó Duinnín, 1934: 109. 13. Hamilton, 1974: 55. 14. Malaidh an tSléibhe Bháin; Ó Muirgheasa, 1974: 137. 15. Ó Muirgheasa, 1974: 137-136. 16. Ó Laoire, 2002: 344. 17. “’S dá mbeadh fhios ag d’athair a Sheáin,” an leagan a bhí i dToraigh den líne seo. Ó Laoire, 2002: 344. 18. Scríobh Ó Cuinn nóta roimh an véarsa seo: “Bhí fear ag tarraingt uirthi fear mór fáda agus é ar mire.” 19. Méith, 1977: 42; Ó Muirgheasa, 1974: 53-54. 20. Ní Dhomhnaill, 1992. 21. Ó Muirgheasa, 1969: 172-175. 22. na haingle; Ní Dhomhnaill, 1992. 23. Ó Glaisne, 1996: 82-85. 24. Ó Muirgheasa, 1969: 176- 178. 25. chomráda, Ó Glaisne, 1996: 83. 26. loic, Ó Glaisne, 1996: 84. 27. Iúdas, Ó Dónaill, 2005. 28. Partrige, 1983: 236-253. 29. Partrige, 1983. Tá leagan DA3 ar na leathanaigh 238-239, agus tá leagan DA4 ar na leathanaigh 239-240. 30. Ó Muirgheasa, 1936: 122-123. 31. Ó Baoill, 1997: 54. 32. údaigh/ úd. 33. Cuaichín Ghleann Néifín, Tógfaidh Mé mo Sheoltaí. 34. Ó Cuinn, 1940. 35. Tá an t-amhrán seo an-chosúil leis an amhrán A Valaintín a fuair Ó Cuinn in Árainn Mhór. 36. Feall. 37. Ó Baoighill, 200: 94-95; Ní Dhíoraí, 2009: 178. 340

38. “Ar an treas béid de chlog Mhic Dé” Ó Baoighill, 2001: 94. 39. Tugtar Máirín Seoighe ar an amhrán seo i gConnachta. Ó Cuinn, 1930/1932. Tá leagan congárach de seo le fáil in Ceol na nOileán. Ó Ceallaigh, 1993: 38. 40. Chonga, Ó Ceallaigh, 1993: 38. 41. Ó Canainn, Innéacs Garbh. 42. Sciathóg ó abhaill amach? .i. sciathóg a rinneadh as adhmad ó chrann úll? 43. Scríobh Ó Cuinn “lúireach” ar imeall an leathanaigh. Ó Cuinn, 1940. 44. Ó Cuinn, 1939. 45. Hamilton, 1974: 73. 46. Hamilton, 1974: 59. 47. Scríobh Aodh Ó Canainn gurbh as Toraigh Pádraig ‘ac Ruaidhrí agus gur ghadaí mara é. Ó Canainn, Innéacs Garbh. 48. Nóta a scríobh Ó Cuinn: “Rinn Hiudaigh ‘ac Cathmhaor.” 49. Ó Cuinn: 1930-1932. 50. Nóta a scríobh Ó Cuinn: “Caitilín Ní Mhíonáin (Cait Tom) a chuala é 17 nó 18 mbl ó shoin ó Mháire Dhonnchaidh .i. M. bean Mhic Ruaidhri bhí os cionn 100 bl d’aois.”

341

LANGUAGES PANEL

•

Judging panel Prof. Tom Moylan (University of Limerick) – Chair Prof. Patricia Coughlan (University College Cork) Dr. Patrick Brereton (Dublin City University) Dr. Ross Dawson (Liverpool John Moores University) Dr. Maureen Connor (Mary Immaculate College) jugdes’ comments The award for best undergraduate paper in the category of “Language, Literature and Cultural Studies” goes to Emily Bourke’s “‘A Hundred Indecisions’: Paralysis in Katherine Mansfield’s ‘The Daughters of the Late Colonel’,” written for Dr. Patricia Moran’s module on “British Modernism” in the English Section of the Department of Languages and Cultural Studies at the University of Limerick. Over fifty papers were submitted in this category, and after careful examination the panel agreed that Ms. Bourke’s paper most fully met the criteria set out for this award, as a paper that exhibits “substantial originality” and “intellectual excellence.” Bourke’s essay is a sensitive and well-crafted analysis of Katherine Mansfield’s character study, in which the psychological condition of two sisters is understood within the context of their social upbringing, finding them by the end of the story to be constrained and compromised in the space and time of their family situation. The essay draws on contemporary literary and cultural theory without lapsing into abstraction or jargon, and it develops its argument through a carefully detailed close reading of the formal operations of the text. The essay is written a style that is sophisticated and comfortable, astute and accessible. One panel member concluded that the essay is “a balanced, capable, and highly intelligent interpretation” that exhibits a strong “ability to explain and analyse how theme is realised in a narrative.” Another noted that the essay “pays close attention to the text and exhibits impressive powers of observation.” A third concluded that the essay offers a “nuanced and reflexive examination … framed at a very high level of exposition.” We congratulate Emily Bourke on her accomplished writing.

342

L A NGuAGE S

A hundred indecisions: Paralysis in Mansfield’s “The Daughters of the Late Colonel” Emily BourkE

n “The Daughters of the Late Colonel,” Katherine Mansfield portrays two characters in a state of total paralysis, trapping them both spatially and temporally in order to emphasise their psychic claustrophobia and expose the horrors of the unlived life. Josephine and Constantia, despite being grown women, have had their adult selves repressed by their domineering father, and their actions – or lack thereof – speak of the power of this paralytic hold that the Colonel has over his daughters. Through both the characters’ performances and the structure of the story, Mansfield explores the various ways in which this imposed stasis presents itself. The week following the death of the Colonel aptly portrays this paralysis. It is apparently “one of the busiest weeks of [the sisters’] lives,” despite the notable lack of any action or decision on their part (Mansfield 211). If this is a busy week, then one must wonder what their ordinary lives are like. Josephine and Constantia show no indication of having developed any adult sense of practicality, and seem stuck in their identity as “daughters.” When they have the enormous responsibility of dealing with their father’s death thrust upon them, an event which begins to force them out of their complacent roles, they react by obsessing over minute, inconsequential details instead of confronting the situation directly. Constantia’s first worry, for example, is who should get their father’s top hat (211). These women have been conditioned to be docile and, as a result, are completely paralysed when pre343

sented with the opportunity for freedom. It is perhaps unfair to discuss the two protagonists as a single entity at all times: although neither Constantia nor Josephine manage to break free from their paralytic states, they nonetheless react to their changing situations in different ways. Constantia’s name is a testament to her personality — she is entirely unwilling to change, and expresses little desire to break out of her established routine. The first image of her that Mansfield provides is that she is “like a statue” (211), and this description holds true throughout the story; her role in life is, to her, set in stone. The one “decision” that she manages to make is “to be weak for once,” backing it up with, “[i]t’s much nicer to be weak than to be strong” (219). This juvenile desire for things to be “nice” is the driving force behind her character, and she resists doing anything that will make her situation otherwise. Josephine, on the other hand, makes a more concerted effort to move forward, even if her endeavours are unsuccessful. With her father gone, along with the constant support for her childish behaviour, her adult self makes a valiant push for development. She tries to take the initiative — answering letters of condolence, entering her father’s room with the intention of going through his possessions, and even managing to tell Nurse Andrews that she thinks a particular butter dish is “extravagant” (214), while Constantia merely daydreams about a “line of camels” instead of engaging with the situation (213). Josephine’s attempts to assume responsibility, although buried among many displays of naivety, show a spark of independence that is lacking in her sister. Unfortunately, this small sense of self-sufficiency is not enough to save Josephine from her psychic paralysis, and she remains trapped in the time and space that the Colonel has created for his two daughters. The sisters are entombed in this world of their father’s creation, a space which has all of the characteristics of a living burial. They do not leave the apartment at all during the course of the story, and it is not too great a leap of the imagination to guess that this is not an unusual occurrence, as Josephine describes a visit from their nephew Cyril as “one of [the] rare treats” of their seldom-interrupted interior lives (221). Indeed, the rarity of this kind of event is emphasised by the absurd lengths that they go to in order to entertain the boy, serving extravagant cakes “that stood for [Josephine’s] winter gloves or the soling and heeling of Constantia’s only respectable shoes” (221). In the context of the sisters’ enclosed, secretive lives, every deviation from the usual routine is either profoundly exciting, as with Cyril’s visit, or explosively dramatic. The idea of having Communion in the drawing-room “terrif[ies] them” (215), and Josephine imagines she can hear her father “absolutely roaring” at them for having buried him (216). The most significant, prolonged example of this tension is in the “settl[ing] about” of the Colonel’s things, when Mansfield creates a palpable air of restraint and suspense as Josephine and Constantia prepare to enter their father’s room “without knocking even” (217). The Colonel’s room is the centre of all the spatial claustrophobia in the lives of Constantia and Josephine. It is a monument to his tyranny, even after he has passed away. The opening of the “settling about” scene contains one of Josephine’s 344

hints of independence, but her father’s memory soon quashes it. She has made “a list of things to be done,” which includes the extremely practical “go through Father’s things and settle about them” (217). The prospect of actually going through the door, however, causes her to revert to her usual, childish attitude: “‘You – you go first,’ she gasped, pushing Constantia” (217). The atmosphere inside the room, when they finally manage to make their way through the door, still retains a powerful sense of the Colonel’s presence. He may be dead, but his daughters have imbued the room with such an atmosphere of suspense and terror that his power over them continues. He is, in their minds, “ready to spring” from every piece of furniture (218), and berate and chastise the women for their “gimcrack excursion” to the cemetery (216). Constantia has latched on to this idea of her father’s continued existence, and encourages Josephine to cultivate it too. “Don’t you think – don’t you think we might put it off for another day?” she whispered. “Why?” snapped Josephine [...] “It’s got to be done. But I do wish you wouldn’t whisper, Con.” “I didn’t know I was whispering,” whispered Constantia. “And why do you keep staring at the bed?” said Josephine, raising her voice almost defiantly. “There’s nothing on the bed.” “Oh, Jug, don’t say so!” said poor Connie. “At any rate, not so loudly.”

Josephine felt herself that she had gone too far. (218)

Every step forward that Josephine attempts to take is countered by Constantia’s own inability to escape her paralysis. Josephine wants to assert her defiance and “raise her voice”, but has only a tenuous grasp on her confidence. Exchanges like this reveal her inability to stand up to uncertainty and insecurity, and expose the fact that she is just as psychologically incapacitated as her sister. She subsequently follows Constantia in “be[ing] weak for once,” and leaves behind their main chance to symbolically rid themselves of their father’s control (219). Josephine cries, “I can’t open,” and is not merely referring to the chest of drawers (218). She cannot open herself up to the world beyond absolute paternal subjugation. They fail to clear the space of his stifling, crippling presence, and thus fail to free up space for themselves, either psychically or spatially. Josephine and Constantia are not just confined to an enclosed space, they are trapped in time as well, and the structure of the story reinforces this. Through a series of flashbacks and interior monologues, Mansfield ensures that the rhythm of the narrative is constantly interrupted and sent in a backwards motion. The sisters are repeatedly confronted with the past, and never given the chance to move into the future, or even to think about it. In asking Nurse Andrews to stay with them, for example, they trap themselves in the spectacle of their father’s death for a further week, whereas if they’d been alone they could have acted just as they wanted 345

to, and asked Kate “if she wouldn’t have minded bringing them a tray wherever they were” (213). They avoid dealing with the future wherever possible, and instead intertwine the past and the present for as long as they can, pushing change further and further away. This sense of postponement is ever-present in the story — putting off acknowledgement of the Colonel’s death, delaying their decision about whether or not to keep Kate on, constantly meandering down tangential trains of thought — and Mansfield plays on it to create humour. There is a hilarious absurdity in much of the women’s indecision, on topics such as the colour of their dressing gowns and the possible ways to cook their fish, and this heightened sense of the preposterous creates an air of comedy that Mansfield uses to give the story’s ending powerful resonance. If the comedy lies in repeated postponement, then the tragedy lies in realising that there is nothing left to postpone any more. This tragedy reaches its climax in the final section of the story, where Josephine and Constantia almost begin to recognise and overcome their lamentable situation in life. As the realisation that their father has died and his stick “never will thump again” starts to dawn on them (226), a ray of hope literally breaks through into their world; “a square of sunlight, pale red [...] came and went and came – and stayed, deepened – until it shone almost golden” (227). The contrast of this sunlight, and the barrel organ’s “bright notes, carelessly scattered” (227), with prior descriptions of the “whiteness” and “coldness” of their father’s room is stark (218). It suggests hope for the sisters’ future; the possibility of colour and variety in their lives to come. Josephine is now able to acknowledge a “queer little crying noise” inside her, one which speaks of a longing for things to be different, as she considers what their lives could have been like “if mother had lived” (227). Similarly, Constantia stands “wondering” by her Buddha, but “not as usual, not vaguely” (228). She actually engages with memories that cause “longing,” and sees them as being infinitely more “real” than her life of “arranging father’s trays and trying not to annoy father” (228). These are all, however, still memories. Although the sisters are ruminating on their own personal satisfactions for once, and finding the courage to question the inadequacy of their lives to date, they have still not broken out of the past and its entrapments. Constantia makes a valiant effort to do so in the story’s final paragraphs, only to be thwarted by vagueness once again: She wanted to say something [...] frightfully important, about – about the future and what... “Don’t you think perhaps – ” she began. [...] A pause. Then Constantia said faintly, “I can’t say what I was going to say, Jug, because I’ve forgotten what it was... that I was going to say.” Josephine was silent for a moment. She stared at a big cloud 346

where the sun had been. Then she replied shortly, “I’ve forgotten too.” (228-9)

The flash of clarity passes, the beam of bright sunshine disappears, and the sisters slip back into their attitudes of complacent passivity. Though they were so close to breaking out of their temporal paralysis, they instead let the moment slip out of their grasp. The humorous air that pervades so much of the story is entirely absent in its conclusion, which remains tragically irresolute and devoid of progress. The spatial and temporal paralysis that Mansfield creates for Josephine and Constantia plays a huge part in the continuation of their psychic claustrophobia. In worrying whether or not they have buried their father alive, the sisters manage to bury themselves alive instead, and Mansfield thus shows how the Colonel’s overbearing presence has stunted the daughters’ development and robbed them of their independence. When he dies, he leaves the women trapped in a single place and time, with no way to break free and make their lives their own. Their passivity, resulting from this paternal stranglehold, is the ultimate horror of the story – the sisters’ lives pass them by one day at a time, and their submissive conditioning leaves them powerless to take any action at all.

347

LAW PANEL

•

Judging panel Dr. Eoin O’Dell (Trinity College Dublin) – Chair

348

L AW

Irish nervous shock law is flexible but underdeveloped in comparison with the stricter doctrine adopted by the courts in other common law jurisdictions Peter Dunne

he law of nervous shock is among the most controversial of all torts. For more than a century, recovery for this particular type of injury has divided the common law world. There have been, and remain, many differing opinions as to how the courts should perceive illness to the mind without any accompanying physical harm1. In this essay, I propose to discuss these varying attitudes, placing particular emphasis on the diverging approaches adopted by the courts in Ireland, England and Australia. It will be seen that while the law in this jurisdiction remains flexible in comparison with the stricter English doctrine, the Irish courts’ continued allegiance to proximity considerations, in some form, appears conservative having regard of the recent Australian adoption of reasonable foreseeability simpliciter2.

1 McMahon & Binchy ‘Law of Torts’ page 462 2 �� Tame v NSW (2002) HCA 35, Annetts v Australian Stations (2002) HCA 35, Gifford v Strang Patrick Stevedoring (2003) HCA 33 see F A Trindade ‘Reformulation of the nervous shock rules’ 2003 LQR 119 (APR) 204-210

349

While the varying tests for determining liability in nervous shock and the class of person who may bring a claim have given rise to much heated debate, the common law world does at least appear to agree that damages may only be recovered for a recognizable psychiatric illness. Lord Denning MR identified such limitation at an early stage when he stated that the courts have ‘to draw a line between sorrow and grief for which damages are not recoverable; and nervous shock and psychiatric illness for which damages are recoverable’3. This central principle now forms the law in every jurisdiction and is often referred to by the courts, most recently by McHugh J in the Australian High Court4 and McMahon J in the Irish Circuit Court5. The reasoning for the limitation stems from the fact that ‘grief’ and ‘sorrow’ are normal human emotions6. It would surely call into question the efficacy of the courts system if it were to grant recovery for all naturally occurring feelings. The divisions that exist today in relation to the law of nervous shock reflect the diverging attitudes that mental illness has historically evoked within the various jurisdictions7. The common law has always entertained differing opinions as to the right to recover damages for mental injury. These opinions have often depended on individual perceptions of psychiatric illness. In Ireland, the courts historically favoured a flexible approach to recovery. The Irish judiciary, and in particular Palles CB, recognized at an early stage that mental illness is a peculiar physical state which may itself give rise to both physical and palpable injuries8. The late nineteenth century cases of Byrne v Southern and Western Railway CO9’ and Bell v Great Northern Railways Co10 established the principle that a person who suffers nervous shock resulting in a psychiatric illness may recover as against the person who caused that nervous shock11. Understanding of the sufferings of mental injury was not, however, universal. The courts in England and Australia adopted a much stricter, conservative approach to the law. In Victorian Railways Commissioners v Coultas12 , the House of Lords Privy Council refused damages for the fright a pregnant woman suffered when almost hit by an oncoming train. In Chester v Waverley Corporation13 , the Australian High Court took a similar view that a mother would not foreseeably suffer nervous shock as result of witnessing the drowned body of her child. Such early scepticism clearly stemmed from a lack of knowledge of mental illness but serves to illustrate the perceived need, which arguably still exists 3 Hinz v Berry (1970) 1 All E.R. (per Lord Denning at pg 1075) 4 Giffard v Strang Patrick Stevedoring (2003) HCA 33 5 Curran v Cadbury’s Ltd (2000) 2 ILMR 321 at 351 6 Val Corbett ‘Tort Liability for Psychiatric Damage; Nothing to Fear? (1997) 7 Irish Student Law Review 7 McMahon v Binchy ‘Law of Torts’ page 464-465 8 (1890) 26 LR (Ir) 428 at 442 9 Court of Appeal, February, 1884 10 �� (1890) 26 LR (Ir) 428 11 �� (1992) ILRM per Denham J at 731 12 �� (1888) 13 AC 222 13 �� (1939) 62 C.L.R. 1

350

today, to protect defendants from liability ‘ for an indeterminate amount for an indeterminate time to an indeterminate class’14. In the years following those early decisions, the Common law has come a long way in its understanding of both medical science and the need to provide sufficient redress for deserving plaintiffs. There is now uniform acceptance that, in certain circumstances, it is wholly appropriate to allow recovery for negligently inflicted nervous shock15. However, the means for assessing what constitutes appropriate circumstances and the class of person who may recover remains the subject of heated debate16. This divergence of opinion is largely attributable to the different approaches to the law as enunciated by Lord Wilberforce and Lord Bridge in the seminal English case of McLoughlin v O’Brian17. While their Lordships both accepted that the plaintiff in McLoughlin18 should succeed in her action, they disagreed as to the test for imposing liability. The Common law jurisdictions have subsequently had to decide between the two approaches, which their Lordships offered in that case. In England, the courts have followed the stricter, more complex test of Lord Wilberforce19, emphasizing the need to place limitations on recovery. Plaintiffs seeking recovery for nervous shock in England are today divided into primary and secondary victims20, depending on their level of participation in the accident. While a primary victim may recover relatively easily, secondary victims must surmount a number of public policy considerations known as the ‘Alcock Mechanisms’21. In Australia, the courts have endorsed the more flexible approach advocated by Lord Bridge22. In three recent decisions23, the High Court has expressly accepted reasonable foreseeablity simpliciter as the determinant of liability. While proximity limitations may be referred to when considering foreseeability, they are not of themselves preconditions to recovery. The Irish position with regard to nervous shock remains uncertain, perhaps reflecting the underdeveloped nature of the law in this jurisdiction. While it appears that reasonable foreseeabilty plays a central role in determining liability in Ireland, the case law shows that the courts continue to have regard of proximity considerations. In Kelly v Hennessy24 , Hamilton CJ laid down five requirements25, which an Irish plaintiff must satisfy to recover damages in nervous shock. In her accompanying judgment, Denham J referred to a reason14 �� Cardozo J as cited by Lord Wilberforce in McLoughlin v O’Brian (1983) 1 A.C. 410 at 31 15 �� See Kennedy J in Dulieu v White (1901) 2 K.B. 660 16 �� McMahon & Binchy ‘Law of Torts’ pp 465-468 17 �� (1982) 2 All E.R. 298 18 �� (1982) 2 All E.R. 298 19 �� (1982) 2 All E.R. 298 20 �� Page v Smith (1996) AC 155 per Lord Lloyd of Berwick 21 �� Lord Wilberforce’s proximity considerations as adopted and amended by the House of Lords in Alcock v Chief Constable of South Yorkshire Police (1992) 1 AC 310 22 �� (1982) 2 ALL E.R. 298 at 442 23 �� Tame v NSW (2002) HCA 35, Annetts v Australian Stations (2002) HCA 35, Gifford v Strang Patrick Stevedoring (2003) HCA 33 24 �� (1996) 1 ILRM 321 25 �� (1996) 1 ILRM 321 at 326

351

ably foreseeable injury arising out of proximity in relationship, time and space26. The various approaches to nervous shock, as they stand, illustrate the divisions that currently exist between the main common law jurisdictions. Such divisions become increasingly apparent when considering recovery for those who were not directly involved in the accident. However, despite this reality, it may be seen that the common law has attained a certain amount of uniformity in relation to plaintiffs whose mental disturbance arise out of an actual injury or fear of injury to themselves. In England, Lord Lloyd of Berwick has identified such persons as ‘Primary victims’, those who were within the area of foreseeable physical injury during the accident27. It is ironic that while the English law is criticized for placing complex, arbitrary limitations on the right to recover for nervous shock 28, there are comparatively few considerations for primary victims to satisfy. If a plaintiff in England can show that he is a primary victim, he may recover as against the defendant even if there is no physical injury. Similarly, the Courts in both Ireland and Australia have looked favorably upon recovery for those who can show that they were participants in an accident. However, having regard of Hamilton CJs fifth condition29 and the Australian High Court’s interpretation of foreseeability30, it appears that a participant in an accident must show that ‘injury in the form of psychiatric injury as opposed to personal injury in general was reasonably foreseeable’31. As already noted, the real controversy with regard to the law of nervous shock arises out claims by those who suffer psychiatric illness through injury, or fear of injury, to a third party. In England, such persons are considered ‘secondary victims’ as they were not themselves within the area of foreseeable physical harm32. In order to recover damages, the House of Lords has decided that such ‘secondary victims’ must overcome a number of policy considerations called the ‘Alcock Mechanisms’33. It is these limitations, which have divided the common law world. The first of the ‘Alcock mechanisms’ is proximity of relationship. While the importance of a link between the ‘primary’ and ‘secondary’34 victims of an accident is recognized in all common law jurisdictions, it is the particularly restrictive interpretation of such relationship adopted in the English jurisdiction, which has caused such great debate. In England, the courts adhere to the strict mantra that ‘the closer the tie, the greater the claim for consideration35 ’. In Alcock v Chief Consta26 �� (1996) 1 ILRM 321 at 336 27 �� (1996) AC 155 28 �� Mullany and Handford ‘Tort Liability for Psychiatric Injury’ (1993) Sweet & Maxwell 29 �� (1996) 1 ILRM 321 at 326 30 �� Gifford v String Patrick Stevedoring (2003) HCA 33 31 �� (1996) 1 ILRM 321 at 326 32 �� (1996) AC 155 per Lord Lloyd of Berwick 33 �� Lord Wilberforce’s proximity considerations as adopted and amended by the House of Lords in Alcock v Chief Constable of South Yorkshire Police (1992) 1 AC 310 34 �� ‘Primary’ and ‘Secondary’ are here used in the context that Denham J indicated in her judgment in ‘Kelly v Hennessy’ (1996) 1 ILRM 321 at 335 35 �� (1983) 1 AC 410 per Lord Wilberforce

352

ble of South Yorkshire Police36 , Lord Ackner interpreted such close tie as one of ‘love and affection’37. A close relationship may be presumed in the case of parents and spouses, but other plaintiffs should have to adduce evidence to satisfy the requirement. In Alcock, the plaintiff, Brian Harrison, was refused recovery because he had not proven a sufficiently close relationship with his two dead brothers. In Ireland, proximity of relationship seems to form part of the duty of care in nervous shock, but the courts have shown themselves much more willing to adopt a flexible approach to the issue. In Kelly v Hennessy38 , Denham J identified the need for a ‘close’39 relationship, but without definition or limitation. It may be instructive that in the recent case of Cuddy v Mays40 , the High Court was satisfied that brotherhood could satisfy proximity of relationship in this jurisdiction. In Australia, a relationship to the victim of an accident is not a precondition to recovery but rather a consideration for determining reasonable foreseeability. In Gifford v Strang41, McHugh J opined that the administration of justice would be better served if people in recognizable relationships were automatically considered to fall within the required proximity. However, such requirement might as easily be fulfilled by association or mere presence. The issue of proximity of relationship has caused great controversy among the common law jurisdictions. The idea of ‘relatives squabbling to prove their especial love for the deceased in order to win money damages’42 has led many to favor the more flexible Irish and Australian approaches. However, it would be equally as unjust to see a defendant exposed to liability wholly disproportionate to his negligence43 and it is submitted that in the interests of justice there must be a point where the courts say ‘thus far and no further’44. The second ‘Alcock mechanism’ requires proximity to the accident in time and space. In England, a secondary victim who seeks to recover for nervous shock must satisfy the courts that he was close in time and space to the accident or its immediate aftermath45. The House of Lords’ strict definition of what constitutes the immediate aftermath has meant that many plaintiffs have failed to surmount this consideration. In Alcock v Chief Constable of South Yorkshire Police46 their lordships denied recovery to the plaintiff, Robert Alcock, because identifying his brotherin-law’s body in a morgue nine hours after the Hillsborough disaster fell outside the aftermath. Indeed, in McLoughlin47, Lord Wilberforce suggested that a mother 36 �� (1992) 1 AC 310 37 �� (1992) 1 AC 310 per Lord Ackner 38 �� (1996) 1 ILRM 321 39 �� (1996) 1 ILRM 321 at 336 40 �� Unreported High Court 28/11/03 41 �� Gifford v Strang Patrick Stevedoring (2003) HCA 33 42 �� Professor Jane Stapleton at pg 95 ‘In restraint of tort’, ‘Frontiers of Liability’, ed Birks (1994) 43 �� (1983) 1 AC 410 per Lord Wilberforce 44 �� (1999) 1 All E.R. 1 per Lord Steyn at 39 45 �� (1983) 1 AC 410 per Lord Wilberforce as accepted by their lordships in Alcock 46 �� (1992) 1 AC 310 47 �� (1983) 1 AC 410

353

coming upon her family two hours after they had been horrifically injured in a car crash was just within the limits of what was acceptable. In Ireland, the court decisions suggest that proximity in time and space do form part of the law of nervous shock. However, considering how far both Mrs. Mullally48 and Mrs. Kelly49 were away from the accidents to their families and the time it took them to come upon their loved ones in the hospital, it seems that the Irish courts have adopted a proximity more analogous to that outlined by Brennan J50 than the strict doctrine followed in the English courts. The Australian Judiciary has never adhered to the idea of proximity in time and space as forming part of the law in that jurisdiction. Deane J in Jaencsh v Coffey51 spoke of causal proximity, the idea of the aftermath being over when it was no longer foreseeable that the scene would cause nervous shock. In three recent decisions, the Australian high court has rejected the need for sudden shock52. This means that parents who are aware of their son’s probable death for some months, may recover for the shock they receive during that period and upon learning of his confirmed death53. This flexible approach, although new, would appear to conform to the idea of causal proximity, it being reasonably foreseeable that the months of worrying would cause the parents psychiatric injury. The need for proximity in time and space to an accident remains an immensely controversial area of the law of nervous shock. In Australia particularly, academics and judges alike have criticized what they see as recovery depending upon a race between the plaintiff and an ambulance54 and ‘measuring liability in cases like Alcock with the aid of a stopwatch’55. However, while perhaps the more flexible Irish model is to be preferred, proximity, especially of time, must be considered in assessing recovery. It should not be forgotten that in cases of nervous shock the courts are attempting to engage the defendant’s responsibility for his negligence. The longer the time that elapses between the negligent act and the nervous shock, the more speculative the causal link and the more likely it is that a novus actus will have intervened. The final, and perhaps most controversial, proximity requirement is direct perception of the accident. In McLoughlin v O’Brian56 Lord Wilberforce stated that nervous shock must come through sight or hearing of the event or its immediate aftermath. The House of Lords has adopted the ‘Told Rule’57 whereby a plaintiff 48 �� Mullally v Bus Eireann (1992) ILRM 722 49 �� (1996) 1 ILRM 321 50 �� Jaensch v Coffey (1984) 54 ALR 417 Brennan J spoke of a more flexible aftermath doctrine 51 �� (1984) ALR 54 at 462 52 �� Tame v NSW (2002) HCA 35, Annetts v Australian Stations (2002) HCA 35, Gifford v Strang Patrick Stevedoring (2003) HCA 33 53 �� Annetts v Australian Stations (2002) HCA 35 54 �� (1984) 54 ALR 417 per Brennan J 55 �� Mullany and Hanford ‘Hillsborough Replayed’ (1997) L.Q.R. (JUL) pp 410-417 56 �� (1983) 1 AC 410 57 �� Gillian Kelly discusses this rule in ‘Post Traumatic Stress Disorder and The Law’ (2000) Round Hall Sweet and Maxwell pp 35-39

354

may not recover for shock caused by what he is told or learns through an electronic medium. Such strict interpretation of the rule has been much debated in all common law jurisdictions. It is difficult to understand why a mother who sees her child alive, but badly injured in a hospital ward is considered to suffer greater shock than the mother who is informed of her child’s death over the telephone58. It is perhaps because of the controversy surrounding this particular policy limitation that the High Court of Australia has expressly affirmed that the law in that jurisdiction ‘should not, and does not, limit liability for damages for psychiatric injury to cases where a plaintiff has directly perceived a distressing phenomenon or its immediate aftermath’59. Thus, in Annetts v Australian Stations, the plaintiff parents were entitled to recover even though they had not actually witnessed their son’s death and only identified his decomposed body by way of a photograph. In Ireland, there is a paucity of cases that discuss the necessity of direct perception, illustrating once more that the law is somewhat underdeveloped in this jurisdiction. However, considering that both Hamilton CJ and Denham J made reference to the fact that Mrs. Kelly had directly perceived her families suffering in Jervis Street hospital60, it is reasonable to believe that such perception, perhaps in a more flexible form, is necessary for recovery in this jurisdiction. While direct perception of an accident is the only proximity consideration to have been addressed, and affirmed, by the Canadian higher Courts61, it would appear to be the most dubious of all the proximity requirements. There is a growing body of opinion within the common law that strict policy limitations should be rejected in favour of reasonable foreseeability simpliciter. In Dillon v Legg62 , Tobriner J stated that while proximity limitations may form part of a wider reasonable foreseeability test, they should not of themselves be preconditions to recovery. As noted above, this approach has been expressly adopted by the Australian High Court63 and both Val Corbett64 and Gillian Kelly65 suggest that the Irish jurisdiction should follow suit. It is submitted that ‘this is a temptation that should be resisted’66. Such an approach can only lead to uncertainty and injustice in the law. If the courts are free to pick and chose the policy considerations they apply, there would be no uniformity. Different judges might apply different limitations 58 �� Mullany and Handford ‘Tort Liability for Psychiatric Injury’ (1993) Sweet & Maxwell 59 �� Annetts v Australian Stations (2002) HCA 35 per Gleeson CJ at 18 60 �� (1996) 1 ILRM 321’ 61 �� Ambrazik v Brenner (1968) Vol 65 D.L.R. 651 62 �� 68 Cal 2d 728 (1968) 63 �� Tame v NSW (2002) HCA 35, Annetts v Australian Stations (2002) HCA 35, Gifford v Strang Patrick Stevedoring (2003) HCA 33 64 �� Val Corbett ‘Tort Liability for Psychiatric Damage; Nothing to Fear? (1997) 7 Irish Student Law Review 65 �� Gillian Kelly ‘Post Traumatic Stress Disorder and The Law’ (2000) Round Hall Sweet and Maxwell at pg 38 66 �� (1985) AC 210 Lord Keith resisting the tendency to treat Lord Wilberforce’s Two Stage Test as in itself a definitive test for the imposition of the Duty of Care

355

or give particular weight to one proximity factor over another. Recovery of damages would come to depend, not on the rule of law, but on the individual judge’s perception of nervous shock. In considering recovery for psychiatric illness, the courts have often taken Lord Aktin’s neighbour principle67 as their starting point. Proximity is a central feature of neighborhood. One of the criticisms placed at Lord Wilberforce’s Two-stage Test68 was that it could be read to equate the duty of care with reasonable foreseeability alone. Such an idea has been unanimously rejected by the courts on both sides of the Irish Sea69. Clearly it is established principle that proximity must play some role in determining a common law duty of care. The diverging opinions on nervous shock that exist throughout the common law world have given rise to great debate on how the law should treat the claims of specific types of person. In particular, the position in law of employees and rescuers has been a source of much controversy. In England, the House of Lords has been reluctant to place employees in any advantageous position. Lord Steyn has stated that it should not automatically follow from an employer’s duty to protect against physical injury that such duty exists in relation to psychiatric harm70. In White v Chief Constable of South Yorkshire Police71, their Lordships decided that unless a plaintiff employee can show that he was exposed to foreseeable physical injury, so as to qualify as a primary victim, he must surmount the Alcock Mechanisms in order to recover as against his employer. This strict approach is in stark contrast with the more flexible attitude of the courts in Ireland. In this jurisdiction, where the courts have expressly addressed employees’ recovery for nervous shock, McMahon J has stated that there is a duty on an employer to ensure not only the physical but also the psychiatric safety of his workers72. In Australia, an employer’s duty not to cause psychiatric harm has been established law since the landmark decision in Mount Isa Mines Ltd v Pusey73 . McHugh J in the Australian High Court has recently reaffirmed Mount Isa as good law and extended the employers duty to include taking reasonable care to avoid situations, which would cause an employee’s family foreseeable injury 74. It is unclear why the common law courts in Ireland and Australia have chosen to impose such a duty upon employers and it seems that the more restrictive approach adopted in England is to be preferred. Certainly in White v Chief Constable of South Yorkshire Police75 it would have been extremely unfair if the plaintiff policemen had recovered as employees when others such as the St Johns Ambulance who performed similar, if not more 67 �� (1932) AC 580 68 �� (1978) AC 728 at 751 69 �� Yuen Kun-yeu v AG of Hong Kong (1987) 2 All E.R. 705 and ‘Glencar Explorations plc and Andaman Resources plc v Mayo County Council’ (2002) 1 ILRM 481 70 �� (1999) 1 All E.R. 1 71 �� (1999) 1 All E.R, 1 72 �� Curran v Cadbury’s Ltd unreported judgment of the Circuit Court December 17th 1999 at pg 7 73 �� (1971) 125 per Windeyer J 74 Gifford v Strang Patrick Stevedoring (2003) HCA 33 75 �� (1999) 1 All E.R. 1

356

difficult, duties were denied. In their article, Hillsborough Replayed,76 Mullany and Handford have attempted to address this inequality but without satisfactory conclusion. Similarly in this jurisdiction, McMahon J has stated that such ‘distinction is not deemed offensive or objectionable per se’77 in Ireland but offers little in the way of valid explanation why this should be so. It is submitted that if the law is seeking to achieve a truly fair equilibrium, such pursuit will not be served by making arbitrary distinctions, which do not accurately reflect the reality of a particular situation. The common law has managed to reach a position of uniformity on recovery for the employee who is unwittingly made, or believes he has been made, a causative link in an accident78. The Courts in all the major jurisdictions have agreed that such employee should recover as against his employer’s negligence. This was first recognized in Dooley v Cammell Laird & Co Ltd79 where the plaintiff employee recovered for the nervous shock he sustained when the load which his crane was carrying fell, due to defective equipment, and caused him to believe he had killed his colleagues. Delivering judgment in that case, Donovan J laid down the principle, which has been adopted by the other jurisdictions that ‘if...that fear is not baseless or extravagant, then it is…a consequence reasonably to have been foreseen that he (the plaintiff) may himself suffer a nervous shock’80. However, if such fear is irrational the plaintiff is not likely to succeed81. In Ireland, McMahon J cited Dooley as good law when he allowed Mrs. Curran to recover for the shock she suffered as a result of turning on a factory machine when the machine fitter was still inside82. Historically the Courts have looked favorably upon recovery for rescuers83. In Frost v Chief Constable of South Yorkshire Police Henry LJ, in the Court of Appeal, stated that the law must ‘ensure that those brave and unselfish enough to go to the help of their fellow men will be properly compensated if they suffer damage as a result’84. However, in accordance with the current strict approach favoured by the courts in England, the House of Lords has ruled that rescuers should no longer be treated differently from ordinary citizens unless they can show that they objectively put themselves or reasonably believed that they had put themselves in danger85. This decision is hard to reconcile with the earlier decision in Chadwick v The British Transport Commission86 , which was based not on the fear of damage but rather on 76 �� Mullany and Hanford ‘Hillsborough Replayed’ (1997) L.Q.R. (JUL) pp 410-417 77 �� Curran v Cadbury’s Ltd unreported judgment of the Circuit Court December 17th 1999 at pg 25 78 �� Gillian Kelly ‘Post Traumatic Stress Disorder and The Law’ (2000) Round Hall Sweet and Maxwell at pg 54 79 �� (1951) 1 Lloyd’s Rep 271 80 �� (1951) 1 Lloyd’s Rep 271 at 277 81 �� Fletcher v Commissioners for Public Works in Ireland (2003) 2 IRLM 94 82 �� Curran v Cadbury’s Ltd unreported judgment of the Circuit Court December 17th 1999 83 �� Chadwick v British Transport Commission (1967) 2 All E.R. 945 84 �� (1997) 1 All ER 540 pp 567-568 85 �� (1999) 1 All ER 1 86 �� Chadwick v British Transport Commission (1967) 2 All E.R. 945

357

rewarding altruism and the need to compensate the plaintiff for the horrific scenes he encountered in the Lewisham train disaster. While the law in both Ireland and Australia is comparatively sparse in relation to the claims of rescuers, it appears, having regard to the similarities which exist between the position of employees and rescuers and the extent to which the Australian judiciary was willing to extend liability in the case of the former, that the courts in both jurisdictions would take a more flexible attitude with regard to recovery than their counterparts in England. Nervous shock remains, as it has always been, a particularly controversial area of Tort Law. While the judiciary’s understanding of this form of injury has greatly increased, much of its suspicion has remained. This suspicion has now led to a division of opinion across the common law world and the formulation of two distinct tests for assessing liability. While perhaps the more flexible Irish interpretation of proximity is to be preferred, it is submitted that policy limitations must play a role in determining liability for nervous shock.

358

359

LINGUISTICS PANEL

•

judging panel Prof. Grace Neville (University College Cork) – Chair Dr. Loic Guyon (Mary Immaculate College) Dr. Anne Gallagher (NUI Maynooth) Dr. Sifora Pierce (University College Dublin) Dr. Jean-Philippe Imbert (Dublin City University) Dr. Paul Ryan (Waterford Institute of Technology) Judges’ commentary This is an outstanding piece of scientific research: well researched and well presented. It is comprehensive, authoritative, original, detailed and written with great clarity. The student has invested an extraordinary amount of effort in this work as the 30 pages of appendices, tables and questionnaires make clear.

360

L I NGU I ST IC S

Adolescent preferences & priorities for the design of current augmentative & alternative communication devices Erika Jane Dowling ABSTRACT Purpose: This study investigates what adolescents consider important in determining whether a communication device is attractive and socially acceptable with peers. Features of the DynaVox V™, Tango™ and Pathfinder Plus™were explored. Method: A questionnaire addressing; appearance of communication devices; telecommunications; voice output, rate enhancement and vocabulary selection was used to investigate the attitudes of 97 adolescents without communication impairments. Data were analysed quantitatively using chi-square analysis, total & percentage scores and qualitatively using four themes. Results: Overall, participants were willing to sacrifice appearance for communication efficiency. Features such as durability, portability, voice intelligibility and vocabulary to support social interaction were prioritised. Chi Square scores indicate that boys are significantly more likely to select a DynaVox V™. Conclusion: Future communication devices should be reliable, capable of interconnectivity and support the development of social networks. As adolescents have unique preferences, opportunities must be provided to ensure involvement when selecting a device. 361

BACKGROUND Adolescence During adolescence the approval of friends becomes critical [1]. Dissatisfaction with body image can become a key source of emotional turmoil [2], leading to feelings of self consciousness and a fear of being labelled ‘different’ [3]. The expression of personal and group identity becomes critical [4]. Adolescents crave acceptance and dread isolation, and social interaction is both the means for and the measure of such acceptance. Adolescents spend a lot of time chatting, iteratively re-living past events with friends. Features of adolescent interaction include the use of slang [5], and a fast rate of communication [6]. Advancements in mainstream technology have also led to changes in adolescent interaction. Text messaging and email now play an important role in the maintenance of social networks [7, 8]. Adolescents With Complex Communication Needs Adolescent AAC users experience the need for a positive self image and to participate in conversation [9]. Considering the pre-occupation with appearance at this age, the stigma of a disability can be difficult. Adolescents who feel self conscious may abandon their communication device as it looks ‘embarrassing’ [10], or due to a fear of being rejected by peers [11]. Peer acceptance is important for the development of social competence [12]. An AAC system is designed to supplement spoken communication, creating opportunities for participation [13]. However, negative attitudes may pose barriers to the inclusion of adolescents requiring AAC [14]. Augmentative and Alternative Communication AAC is a ‘tool’ that supports communication and provides opportunities for social interaction [15]. However, some AAC users may reject their communication device due to inappropriate vocabulary, unreliability [16], if the device is not socially reinforcing or is rejected by peers [(17), (18)]. Therefore, there is a need to design a communication device that supports social participation, creates a positive self image and positive attitudes by peers. Current Voice Output Communication Aids (VOCA’s) If AAC systems are attractive, adolescent AAC users may be motivated to use their device, serving to enhance self esteem and facilitate interaction [19]. Current VOCA’s are products of great innovation, but are not without disadvantages [20]. They have limited aesthetic appeal. Complex device navigation strategies can decrease communication rate, while long pauses may result in a negative impression of the user’s communicative competence [9]. The absence of age appropriate vocabulary can distance the AAC user from peers. Poor voice intelligibility and naturalness can have negative implications for self expression [14]. A limited range of voice 362

choices raises questions about the role of voice in reflecting the user’s communication identity [3].

Justification And Aims Of This Research Study There is a paucity of information relating to the features of AAC technology that might be considered desirable by adolescents and thus influence selection. These issues prompted the research questions: What design features of AAC technology would typically developing adolescents identify as desirable? The reviewed devices are (a) DynaVox V™ (b) Tango™ RESNA Page 10(c) of 26 Pathfinder Plus™ Table 1.1; This table describes the three communication aids that were reviewed in this research study Device Manufacturer

DynaVox V™ DynaVox Systems

Tango™ Blink-twice

Pathfinder Plus™ Prentke- Romich Co.

Dedicated options

Choice of both1

Dedicated

Dynamic 23cm x 20 cm x 7cm

Fixed 4.5cm x 31.8 cm x 11.2

Fixed 30.5 cm x 24.77 cm x 7.62 4 lbs 11oz 2.5 lbs 2.02kg Weight Direct selection, auditory Direct selection and Direct selection via Selection method scanning, joystick, Morse scanning method keyboard and switch code, activated scanning Choice of 5 colours, White/ grey with green Blue/ Grey square shape Design square shape with two buttons, cylinder shape, with 128 static keys; front mounted speakers. touch screen and 6 control each button has a symbol Touch screen buttons with a word/ phrase stored. Synthesised & digitised Digitised, Synthesised & Synthesised -choice of Voice output option inc. DECtalk and voice morphing ten voices AT & T natural voices (expression and prosody) RealSpeak™ natural voice Compact flash expansion Air card – enables Telecommunication A Bluetooth adaptor to 2 send/ receive texts slot – for future use of device to operate as cell features mobile & Bluetooth phone (send/ receive call/ texts) calculator, address book, Digital camera calculator, play MP3 Entertainment MP3 player, games files, notebook journal features Word, character and Phrase bank and pop up Spelling, word Rate enhancement phrase prediction keyboard to allow for prediction and icon features 3 4 Slots , Quickfires efficient communication prediction InterAACT Language streams; quick Semantic compaction Vocabulary access to topics and (Unity 32/128); meaning relevant vocabulary is assigned to graphical icons 1 The DynaVox V™ also comes in an open format where it operates as a fully functioning XP computer 2 all devices provide computer connectivity allowing for internet activity – this requires the use of wires/ cables or in the case of the Pathfinder Plus™ infrared is available. 3 Slots – provide easy access to related words that can be used to complete a message 4 quickfires – short conversational interjections that are available on the main page Display Size

363

What aspects of adolescent daily life might influence the design of AAC technology? What design modifications might increase the appeal of future communication devices?

METHODOLOGY Research Design This is a non experimental questionnaire - based study. The questionnaire consisted of 29 items and focused on three themes: (a) physical appearance (b) functions and features (c) components related to communication. The Communication Aid Protocol [21] served as a guide for developing the questionnaire, and themes are based on those described by Light [22]. To ensure face validity, Senior Speech and Language Therapists reviewed the questionnaire and agreed the items were applicable to the project. A preliminary form of the questionnaire was field tested and subsequently modified for use in the study. Modifications included changes to the structure and changes to five questions. Participants Ninety-seven typically developing adolescents participated in this study, and completed the questionnaire outlinedRESNA above. Inclusion criteria for participants Page 14 of 26 were; (a) between the ages of 15 years and 16:11 years; (b) fluent in English; (c) attending mainstream secondary school. Table 2.2; This table provides a breakdown of the participants in this research study according to their gender and age Gender Boys (n =52) Girls (n=45)

Age 15 years 16 years 15 years 16 years

Number of participants 34 18 32 13



Procedures Ethical Approval for the project was given by Trinity College Dublin. A PowerPoint presentation about the field of AAC and purpose of the study was created. A loan of the communication devices was not possible; to compensate a DVD of each device in operation was made. This was based on a video demonstration of the Tango™. The same sentences were programmed into each device to ensure consistency and eliminate bias. Data collection took place in the participant’s school over a one hour period. First The PowerPoint presentation was shown and then the DVD. Participants then completed the questionnaire Data Analysis 364

Page 11 of 26

RESNA

Table 2.1; This tables provides examples of the items contained in the questionnaire used in this research study Section A - Physical appearance of the communication device

Sample Question 1. Which communication device do you think is the most attractive to look at? Circle which one and why 2. Based on how the communication device looks, if you were at the cinema and had to order tickets using one of the communication devices, circle which one you feel most comfortable using? 3. Tick which communication device you think has the most appealing colour, shape or size: Device 1 Device 2 Device 3   

Colour Shape Size

4. How important is it that the design of a communication device would not embarrass you or make you feel isolated from friends? 5. Would you consider it important that the external design of device is tailor made to the individuals needs and interests i.e. customize the device? 6. If you needed to use a communication device, what would you prioritise when choosing your device?  How the communication device looks Or  The amount of information the device can hold that will allow you to communication B – Functions and Features of Communication Devices

Telecommunications How important is it that the communication device Ability to text friends and family Ability to phone friends and family Games to entertain you Ability to access the internet Ability to email friends/ family Ability to browse the web (e.g. connect to bebo/ google) Ability to take pictures with a built in camera Ability to take video recordings with a built in camera Ability to listen to and download music Communication device has Bluetooth

365

RESNA

C – Parts of the communication device related to communication

Page 12 of 26

How communication devices sound (voice output) When designing a communication device for a teenager, what features of the voice that speaks would be important for the person who uses the device and the listener. 1

Voice is clear and easily understood The voice is natural sounding (i.e. easy to listen to) The voice does not sound computerised (sounds like human voice) The voice is the same gender as you The voice sounds similar to peers (same age group) The voice is the same nationality/ has the same accent as you You can change the voice on the communication device to reflect how you are feeling e.g. angry, sad, happy, afraid You can change the voice to a whisper or shout The voice can be heard in noisy situations e.g. restaurant The voice is a similar speed/ rate to natural speakers Rate enhancement features: These are the strategies that increase the rate of communication output of the user and makes communication quicker and better. 1 The communication device has features to speed up communication rate The communication device can predict what you are typing to communicate (like predictive text on your mobile phone) Rate of communication is similar to typical conversation It would be important that the rate of communication does not stop me from talking with friends (e.g. if it’s too slow I can’t get my say) It would be important that I am not embarrassed by slow rate of communication It would be important that people do not think I am unintelligent (less smart) because of the slow rate of communication using a communication device. Spell check features – if I’m typing a word for the device to say, it recognises that I have spelt it wrong Word morphology features (e.g. change word from singular to plural)

366

Page 13 of 26

RESNA

Vocabulary Selection 1. If you had to use a communication device, what would be the three most important topics to be included on the device. Please tick three boxes only. Personal information (age, where I live etc) My family My friends School My home Music I like Films and TV I like What I like to eat/ drink What annoys me What I’m good at Things I need help with Things I’ve done in the past Others (please specify) 2. If you had a communication device that could only store 5 words, what words would you choose that would allow you to communicate your basic needs (e.g. hungry, stop, yes) 3. If you needed a communication device and had to choose people to select messages/ words to put on your communication device, who would you prefer:  People who know a lot about language  People who know a lot about you – family  People who know a lot about you – friends 4. If you needed a communication device, would you prefer to have words that allow you to:  Interact and chat with people  Learn the school curriculum 

The coding system used to develop the questionnaire was used to qualitatively describe findings. The data was sorted into the themes of ‘the 21st century adolescent’, ‘physical appearance’, ‘functions’ and ‘components of the communication device’. Data was summarised for the 4 coding themes and 8 subthemes. Quantitative analysis methods (Chi-Square analysis, and total and percentage rating scores) were used to compare and contrast preferences across gender, and to rank features according to level of importance. 367

Page 15 of 26

RESNA

Table 2.3 This table provides a summary of themes and subthemes identified from the data to be analysed Themes subthemes Examples The Modern Adolescent Physical appearance (Attributes of the external device)

Communication device features

   

Self image and psychosocial issues Functions (purpose and uses of the communication device)

Telecommunications (internet and phone use)

Play and entertainment features Adolescent life

           

Section C; Components of device related to communication

Digital camera Video recordings Listen to music Games Importance of telecommunications and entertainment as part of adolescent life Frequency of telecommunication and entertainment use in adolescent daily life

  

Intelligibility Naturalness (emotion & prosody) Personal attributes & identity (age, gender, nationality)

Rate enhancement features



Rate enhancement features (prediction, word morphology, spell check) Psychosocial factors – impact of rate enhancement on self perception Communication topics, context & partners Core vocabulary Psychosocial issues – appropriate vocabulary for adolescents and who should select adolescent vocabulary

Vocabulary selection

  

368

Social acceptability of communication device Attitudes to communication devices Email Phone Instant text message Bluetooth

Voice output



Preferred and least preferred communication device Preferred/ least preferred communication device features Changes to reviewed communication devices and general AAC technology Features of communication devices identified as important

RESNA

Page 16 of 26

Table 3.1; This table describes the influence of adolescent life and their preferences (listed from most to least important features) on the design of communication devices Who would they talk to?

1. 2.

My best friend My mum

Where and when would they talk? School At home

My brothers and sisters

Going out

My dad

My boyfriend/ girlfriend

At sports training At friends house

What topics would they talk about? Family Personal information Things I need help with My friends What they like to eat and drink

Are interested in doing what? All kinds of sports Watching television Listening to music Talking/texting friends Hanging out with friends



RESULTS The Modern Adolescent Over 70% of participants spend time talking with ‘my best friends’, primarily in school. Adolescents talk about a variety of things; personal information, family and friends were considered most important. Texting, internet access and listening to music were identified as important features of adolescent life. External Appearance of Communication Devices Participants identified reliability and portability as most important, while colours and use of skins were not considered important. Over 96% of participants (% rating score) stated the design of a communication device should not embarrass the AAC user. Recommended changes and modifications to communication devices included the use of a touch screen and a reduction in size. Participants prioritised practical features over aesthetics. 82.5% considered memory capacity for communication more important than appearance. However, over 86% stated that further thought should be given to the aesthetic appeal of AAC technology. The DynaVox V™ was identified as the most popular communication device, participants liked its colour and flat screen. Over 60% selected it as the most attractive, and the device they would feel most comfortable using in public. Chi square analysis revealed a significant gender effect. Boys showed a significant preference for the DynaVox V™. Boys selected the DynaVox V™ as the most attractive communication device (p = 5.96, at p<0.5) and the device they would feel most comfortable using at the cinema (p = 7.57, at p<0.1). The Tango™ was second favourite due to its small size and interesting shape. 369

Page 17 of 26

RESNA

Table 3.2; This table outlines the ranking of communication device design characteristics that are considered important by adolescents (listed from most to least important) Overall ranking (determined by total Ranking as determined by percentage number of points) rating (number of students selecting important, very and critically important) 1. durability and reliability 351/ 388 1. light and portable 98.9% (won’t break easily) 2. light and portable

331

2. durability and reliability (won’t break easily)

97.9%

3. weight (not too heavy)

323

3. size (not too big)

97%

4. size (not too big)

298

4. weight (not too heavy)

94%

5. materials (comfortable to carry and touch)

284

5. materials (comfortable to carry and touch)

91.7%

6. themes – reflects what I like

244

6. themes – reflects what I like

80.4%

7. look cool to others

241

7. interesting shape (not just a box)

78.3%

8. interesting shape (not just a box)

218

7. look cool to others

78.3%

9. choice of different skins

211

8. choice of different skins

70%

10. colours (can be different colours)

172

9. colours (can be different colours)

57.5%



The Pathfinder Plus™ was the least popular communication device, 98.97% of participants selected it as the least attractive due to its bulky appearance and large number of selection keys.

Functions (Purpose And Use Of The Communication Device) Results emphasise the importance of distance communication, more than 90% of participant’s text every day. The integration of text messaging, email and music were of paramount importance. For some participants communicative function was more important than telecommunications, and should only be integrated ‘if not going to take away from communication potential’. Components Of The Device Related To Communication Adolescents expressed the need for a voice that is not only intelligible, but that also sounds natural with qualities reflecting characteristics of the user e.g. gender. Participants felt that communication rate should not hinder social interaction 370

RESNA

Page 18 of 26

Table 3.3; This table outlines the ranking of communication device features that need to be modified and improved upon as determined by adolescents (listed from most to least important) Overall ranking (determined by total Ranking as determined by percentage number of points) rating (number of students selecting important, very and critically important) 1.communication device 303/388 1. communication device 93.8% should have a touch screen should have a touch screen 2. reduce size of communication device

287

2. reduce size of communication device

90%

3. communication device should have less buttons

255

3. communication device should have less buttons

84.5%

4. communication device should look more like a mobile phone 5. communication devices should be different shapes

252

4. communication devices should be different shapes

78.3%

222

73.1%

6. use gender specific features in the design of communication devices 7. use of skins to change the appearance of communication devices 8. communication devices should have a choice of more colours 9. communication device has pictures on the outside

210

5. use gender specific features in the design of communication devices 6. communication devices should have a choice of more colours 7. use of skins to change the appearance of communication devices 8. communication devices should look more like a mobile phone 9. communication device has pictures on the outside

10. communication devices should have more buttons

18.5%

189

184

136

65.9%

63.9%

60.8%

39.1%



with peers. Almost 58% of participants stated they would react to slow rate of communication by abandoning the communication device. Adolescents prioritised the programming of vocabulary to express basic human needs More than 96% of participants prioritised vocabulary to support social relationships over academic learning. Two thirds of participants would want these words to be selected by a friend, with only 8.2% wanting input from a professional speech and language therapist.

DISCUSSION Effect Of Device Type Adolescents rated the DynaVox V™ and Tango™ as most popular. Their design does not look conspicuous and may be easily integrated into adolescent life, thus re371

Page 19 of 26

RESNA

Table 3.4; This table provides a summary of adolescents most and least preferred communication devices that were reviewed in this research study DynaVox V (N) Tango Pathfinder (N) Plus (N) Most attractive communication 62 35 0 device (39 boys & 23 girls) (13 boys & 22 girls) Least attractive communication 1 0 96 device Device you would feel most 60 36 1 comfortable using at the cinema (39 boys & 21 girls) (13 boys & 23 girls) Device which best reflects 59 38 0 RESNA Page 20 of 26 technology (34 boys & 25 girls) (18 boys & 20 girls) 

Table 3.5; This table outlines the telecommunications and entertainment functions to be included in the design of a communication device according to adolescent preferences (listed from most to least important) Overall ranking (determined by total Ranking as determined by percentage number of points) rating (number of students selecting important, very and critically important) 1. the ability to text friends 316/388 1. ability to text friends and 97% and family family



372

2. ability to phone friends and family

261

2. ability to listen to, and download music

84.5%

3. ability to listen to, and download music

255

3. ability to phone friends and family

80%

4. ability to access the internet 243

4. ability to access the internet

78.3%

5. ability to browse the web (e.g. connect to Bebo™)

241

5. ability to browse the web (e.g. connect to Bebo™)

77.3%

6. ability to email friends and family

239

6. ability to email friends and family

76.2%

7. communication device has Bluetooth

202

7. communication device has Bluetooth

64.9%

8. ability to take pictures with a built in digital camera

193

8. ability to take pictures with a built in digital camera

59.7%

9. games to entertain you

163

9. games to entertain you

56.7%

10. ability to take video recordings

161

10. ability to take video recordings

51.5%

Page 25 of 26

RESNA

Chart 3.1 % of participants who can/can’t imagine life without access to phone etc

Page 21 of 26

Chart 3.2 % participants who spend time on the internet everyday

RESNA

Chart 3.3; % of participants who spend time texting everyday Table 3.6; This table outlines the voice output features that are considered important by adolescents (listed from most to least important) Overall ranking (determined by total Ranking as determined by percentage number of points) rating (number of students selecting important, very and critically important) 1. voice is clear and easily 384/388 1. voice is clear and easily 100% understood understood 2. voice is natural sounding

351

3. voice is similar speed/ rate to natural speaker

346

4. voice does not sound computerised 4. You can be heard in noisy situations

340

5. voice is the same gender as you

329

6. voice is the same nationality/ accent as you

301

7. you can change the voice to reflect how you are feeling

300

8. you can change the voice to whisper and shout

286

340

2. voice is natural sounding 2. voice is similar speed/ rate to natural speaker 3. voice does not sound computerised 3. you can be heard in noisy situations 4. voice is the same gender as you 4. you can change the voice to reflect how you feel 4. voice is the same nationality/ accent as you 5. you can change the voice to whisper and shout

98.9% 98.9%

6. voice sounds similar to peers

87.6%

97.9% 97.9% 92.7% 92.7% 92.7%

89.6%



9. voice sounds similar to peers

262



373

ducing self consciousness. The sophisticated design and choice of colours of the DynaVox V™ was favoured, reflecting the choice adolescents have when selecting an i-POD. The Tango™ was favoured for its small size, indicating adolescents require a device they can carry and use in all environments. Keys and buttons were considered undesirable, contributing to the unpopularity of the Pathfinder Plus™. As Semantic Compaction is a feature of the Pathfinder Plus™, the static keyboard is essential for effective communication. Attitudes may be less negative if participants were given the opportunity to operate the device. When selecting a communication device for adolescents, the use of learning trials to demonstrate the communication potential of the Pathfinder Plus™ may help to ensure that it is not disregarded due to its appearance. The unique preferences demonstrated by participants emphasises the importance of ensuring adolescents participate in the selection of a communication device. Similar procedures described by Sigafoos et al [23] could be adopted to ensure active involvement of adolescents during the selection process.

Influence Of Adolescent Life On The Design Of AAC Technology Adolescents, who are described as being pre-occupied with body image [6], were prepared to sacrifice cosmetic appeal for communication efficiency. Memory capacity for communication was considered more important than appearance. As participants communicate in a variety of environments, characteristics such as portability and size were of prime interest. Adolescents identified ‘best friends’ as their main social network, where they chat about life experiences. Communication devices must then allow AAC users to share personal narratives with peers [3]. As most participants would want swear words programmed on a communication device, AAC users should then have access to age appropriate vocabulary, to promote group inclusion [3]. Unfortunately, inclusion and acceptance can be compromised by negative societal attitudes. Participants stated that “friends might not like you anymore and think you’re stupid” and “people would recognise you as the person with the huge device and bullying would be a problem”. These findings highlight the need to challenge negative societal attitudes towards AAC users. Suggestions For The Design Of Future AAC Technology Although individual differences are to be expected among adolescents, table 4.1 provides a summary of the recommendations that may be considered in the design of future communication devices. However, advances in technology will be of little use unless barriers to participation are overcome and strategies to support participation are implemented. Limitations Of The Current Investigation & Future Research Participants were from a single school and represented a narrow socio-economic group. Results can be only generalised to similar individuals. Identifying the pri374

RESNA

Page 26 of 26

Chart 3.4 % of participants that think features that should be integrated into communication devices



Figure 3.5: This figure presents participants reaction (in terms of percentages) to slow rate of communication 9.70% avoid talking to friends

33.00% still try to talk to friends

57.70% avoid using the communicati on device

Figure 3.6; This figure presents the percentage of participants who choose different people to select vocabulary for communication device

375

orities of people who use AAC should be the focus of future research. This research could be replicated with different communication devices to determine if similar findings would be achieved. Studies [(2), (6)] suggest there is a greater emphasis on physical appearance during the ages of 10-16years. Replicating this study with younger adolescents would determine if more importance would be place on appearance. Research must focus on identifying factors that promote the development of social networks for adolescents that use AAC. For example, “The Social Networks Model” [24] considers AAC within the context of the individual, family and peers.

Conclusion Investigating the preferences of adolescents provides valuable insights into how the design of future devices may be improved. Future AAC technology should be reliable, robust, capable of interconnectivity and support the development of social networks. As independence is important for adolescents, opportunities must be provided to ensure they are involved in selecting their device.

376

RESNA

Page 24 of 26

Table 4.1 Suggested design features to increase the appeal of AAC technologies for adolescents Type of Feature Design Suggestion Physical Durability and reliability – communication devices are critical medical devices appearance and but they can and do break easily. There is a need to develop AAC systems that Design are robust and do not easily breakdown or crash. Characteristics Colour and Shape – use a single bright colour & develop AAC systems that vary in shape (not only square/ rectangular) Size and weight – develop lightweight devices that are easy to carry and integrate into adolescent daily life without vocabulary or storage limitations. Display and access – use a dynamic display that is accessed through a touch screen. Personalisation of devices – incorporate the adolescent’s interests into the external design of communication devices to allow for self expression. The design should support self esteem and the user’s social image among peers. Interconnectivity and Telecommunications

Interconnectivity – develop AAC systems that easily connect to other mainstream technologies without messy wires and cables. Computer and internet access are fundamental activities that allow adolescents to fully participate in school and social settings. Telecommunication features – incorporate instant text messaging, email and telephone to allow AAC users communicate with peers via multiple communication modalities Music – AAC systems should be able to download and play music files Entertainment Features – incorporate entertainment features such as video, camera and games, only if they do not decrease the communication efficiency of AAC technology

Features related to communication

Voice output – develop synthetic voices that are intelligible and reflect the intonation and pitch patterns of natural human speech. Communication output – develop AAC systems that allow for a faster rate of output to enable AAC users contribute to conversation with friends. Vocabulary – program a wide range of vocabulary to indicate needs and wants and to allow the user interact with their same age peers. Vocabulary selection should include input from friends, family and professionals.



377

REFERENCES 1. Fortman, J. (2003). Adolescent language and communication from an inter group perspective. Journal of Language and Social Psychology. 22 (1), 104-111 2. Hartzell, H.E. (1984). The challenge of adolescence. Topics In Language Disorders. 4 (2), 1-9. 3. Smith, M.M. (2005). The Dual Challenges of Aided Communication and Adolescence. Augmentative and Alternative Communication. 21 (1), 67-79. 4. Erikson, 1950 in Bee, H & Boyd, D (2004). The Developing Child: International Edition. 10th Ed. US: Allyn and Bacon Pearson Education 5. Nipplod (1985) cited in, Smith, M.M. (2005). The Dual Challenges of Aided Communication and Adolescence. Augmentative and Alternative Communication. 21 (1), 67-79. 6. Turkstra, L.S. (2000a). Should my shirt be tucked in or left out? The Communication Context of adolescence. Aphasiology. 14 (4), 349-364. 7. von Tetzchner, S., & Martinsen, H. (1992). Introduction to symbolic and augmentative communication. London: Whurr Publishers 8. McNaughton, D. & Bryen, D.N. (2007). AAC Technologies to Enhance Participation and Access to meaningful Societal Roles for Adolescents and Adults with Developmental Disabilities who require AAC. Augmentative and Alternative Communication. 23 (3), 217-229. 9. Hoag, L.A., Bedrosian, J.L., Johnson, D.E., Molineux, B. (1994). Variables Affecting Perceptions of Social Aspects of the Communicative Competence of an Adult AAC user. Augmentative and Alternative Communication. 10, 129-137. 10. Clarke (2001) cited in, McNaughton, D., Rackensperger, T., Benedek-Wood, E., Krezman, C., Williams, M.B., Light, J. (2008). “A child needs to be given a chance to succeed”: Parents of Individuals who use AAC Describe the Benefits and Challenges of Learning AAC Technologies. Augmentative and Alternative Communication. 24 (1), 43-55. 11. Turkstra, L., Ciccia, A., Seaton, C. (2003). Interactive Behaviours in Adolescent Conversation Dyads. Language, Speech and Hearing Services in Schools. 34, 117-127. 12. Armita et al, 1998 cited in, Lilienfeld, M. & Alant, E. (2005). The social interaction of an adolescent who uses AAC: The evaluation of a peer training programme. Augmentative and Alternative Communication. 21 (4) 278-294. 13. Wilkinson, K.M., & Hennig, S. (2007). The State of Research and Practice in Augmentative and Alternative Communication for Children with Developmental/ Intellectual Disabilities. Mental Retardation and Developmental Disabilities Research Reviews. 13, 58-69. 14. Lilienfeld, M., Alant, E. (2002). Attitudes of Children Toward an Unfamiliar Peer Using an AAC Device With and Without Voice Output. Augmentative and

378

Alternative Communication. 18 (2), 91-101. 15. Light, J. (1997). “Communication is the Essence of Human Life”: Reflections on Communicative Competence. Augmentative and Alternative Communication. 13 (2), 61-70. 16. Smith, M.M., Connolly, I. (2008). Roles of aided communication. Perspectives of adults who use AAC. Journal of Disability and Rehabilitation; Assistive Technology. 3 (5), 260-273. 17. Rackensperger, T., Krezman, C., McNaughton, D., Williams, M.B., D’Silva, K. (2005). “When I First Got It, I Wanted To Throw It Off A Cliff”: The Challenges and Benefits of Learning AAC Technologies as Described by Adults who use AAC. Augmentative and Alternative Communication. 21 (3), 165-186. 18. Angelo, D.H., Kokoska, S.M., Jones, S.D. (1996). Family perspectives on augmentative and alternative communication: families of adolescents and young adults. Augmentative and Alternative Communication. 12 (1), 13-22. 19. Light, J., Drager, K., Nemser, J.G. (2004). Enhancing the Appeal of AAC TechnologiesforYoungChildren:LessonsfromToyManufacturers.Augmentative and Alternative Communication. 20 (3), 137-149. 20. Smith, J. (2006). This way of life: top ten “most wanted” AAC features. Retrieved September 9th 2008 from http://www.thiswayoflife.com/toptenaac.html 21. O’Keeffe, B.M., Brown, L., Schuller, R. (1998). Identification and rankings of 22. communication aid features by five groups. Augmentative and Alternative Communication. 14 (1), 37-50. 23. Light, J., Page, R., Curran, J., Pitkin, L. (2007). Children’s Ideas for the Design of AAC Assistive Technologies for Young Children with Complex Communication Needs. Augmentative and Alternative Communication. 23 (1), 1-14. 24. Sigafoos, J., O'Reilly, M., Ganz, J.B., Lancioni, G.E., Schlosser, R.W. (2005). Supporting self-determination in AAC interventions by assessing preference for communication devices. Journal of Technology and Disability. 17 (3), 143-153 25. Blackstone, S.W. & Hunt Berg, M. (2003). Social Networks: A communication inventory for individuals with complex communication needs and their partners. Monterey, CA; Augmentative Communication, Inc.

379

MATHEMATICS PANEL

•

judging panel Prof. Daniel M. Heffernan (NUI Maynooth) – Chair Dr. Oliver Mason (NUI Maynooth) Prof. Stephen Kirkland (NUI Maynooth) Prof. Gary McGuire (University College Dublin) Dr. Edward Cox (University College Dublin) Prof. John Carroll (Dublin City University) Judges’ commentary The paper was very well written, very well presented and clearly represents a lot of work by the author. In the paper the student has put together an impressive survey of background material and outlined the theory and history of the major connection games in the genre in considerable detail. In this, he has also shown an appreciation of the role of graph theory and other branches of mathematics in analysing these games and in constructing computer algorithms to play them. A major focus of the project is on the particular game “ZigZag,” discussed in Sections 5 and 6. Here a considerable amount of non-trivial original analysis is carried out using a blend of probability and elementary combinatorics. In particular, the possibility of drawn games is demonstrated and an algorithm is described for calculating minimal spanning paths in a ZigZag board. This is then used to identify particularly strong squares on the board. Conditions for an unbiased board are also investigated and in Section 6, an implementation of the game of ZigZag in java is developed. This appears to be the first attempt to do this and is an impressive output from an undergraduate project.

380

M AT H E M AT IC S

Connection Games James Leahy

Abstract onnection Games are a genre of Abstract Board Games which have seen a significant increase of interest over the last few years. Although significant analysis has been carried out on such classic games like Hex, Y and Go since their creation, less known connection games haven’t seen the same fortune. This thesis considers a relatively unknown and unstudied game, Zig-Zag. The results and methods implemented in this thesis may be of use in other connections games, especially within the genre of separate path pure connections games. MoZZ, a Monte-Carlo Zig-Zag program, could serve as role model for games in which the players are constrained in moving within a subsection of the board at each play. Due to space constraints this essay is not reproduced in full here. It can accessed in its unabridged form on www.uaireland.com

381

MEDICINE PANEL

•

judging panel Dr. Geraldine Boylan (University College Cork) – Chair Dr. Sean Connolly (St. Vincent’s University Hospital) Dublin Prof. Edward Johns (University College Cork) Prof. Fidelma Dunne (NUI Galway) Prof. Colin Bradley (University College Cork) Judges’ commentary Both submissions were very well written, well structured and easy to follow. Most of the other submissions reviewed were either abstracts or journal paper type submissions and it was difficult to see how much work was the student’s own. The two submissions chosen by the panel were unique in that they represented a significant body of work from an undergraduate student, that seemed to be the students own work and not driven by a larger research group agenda. The first submission by Brian McGrory is an excellent and up to date review of the current knowledge in the subject area of inflammation of the upper airway in OSA. The student critically appraised the literature and then discussed how his findings might be applicable to clinical practice. It is well-written, free of typos and grammatical errors and is clearly structured. The second submission by Fred English was a more unusual approach to a subject area conducted by the student alone and had an element of uniqueness. Clear enthusiasm for the subject area was clearly evident. Again this was well-written and structured.

382

M E DIC I N E

How do we run on bumpy ground? Frederick A. English

We are nothing but a bundle of different sensations….. David Hume, Scottish Philosopher

Introduction1 very day humans carry out a constant stream of actions that seem simplistic and monotonous. The reality is very different: the complexity of mere survival is immense and mystifying. The task itself is a testament to this, to the brilliance of the nervous system and all its contributors. This paper strives to provide a concise, well-rounded neurophysiological account of how the task is completed. This is achieved initially through the separation of the different processes involved. Firstly the paper details the sensory inputs necessary and how these are detected and transmitted. The paper continues to analyse how these inputs are processed and how reactive action is taken. The task requires the conception, planning and execution of various complex movements, the processes involved in this are also explained. The source material for this work is grounded primarily in academic journals with background generated from textbook and note sources. The examination of these media has revealed that this task has produced much research from most realms of the applied sciences. The author endeavours to provide an insight into some of the experimental techniques used and to simplify some of the conflicting theories involved. 1 Nota Bene: The problem; “Running On Bumpy Ground” is hereinafter referred to as “The Task.”

383

Can You Feel It?

“I’d rather leave all my autonomic functions with as much autonomy as they please.” Lewis Thomas Sensory Inputs The task requires many sensory inputs from three main categories of senses. One of the first to classify all three of these categories was C.S. Sherrington in the 1890’s.2 The five special senses which are well known, coupled with balance, are termed the exteroceptive senses. These are the senses with which we perceive the outside world. In this case how we see the profile of the terrain, how we feel the soles of our feet on the ground and how we stay upright as we move swiftly along. The stretching of internal organs (e.g. during hunger) and our sense of pain is sensed through the interoceptive senses. These senses are involved with how we sense the inside of our bodies in specific areas. There is little work for the interoceptive senses in the task – unless injury occurs. The third, and arguably most remarkable sense is proprioception. Proprioception is an unconscious sensory flow from the muscles, tendons and joints of our body. Information regarding muscle tone, force, position and motion is constantly flowing, automatically in proprioception. The relevant roles of these senses and their receptors will be outlined in this section. Each of the inputs has deficiencies in some humans, commonly known is blindness. Less commonly known, proprioceptive and exteroceptive deficiencies exist. Cases of “electrical silence” or lack of proprioception have been recorded.3 These patients developed the remarkable skill of compensation by using other inputs, such as hearing and sight, to determine the positions of joints etc. It is thought from these patients that each of these input systems do not act independently. The action of one can be conducted, albeit less efficiently, by another. This allows for the compensation to take effect. Exteroceptive Inputs In order to complete the task several different inputs must be examined. The first of these inputs are those which are derived using the exteroceptive senses, i.e. the senses used to perceive the outside world. In this case sight, touch, and balance are the tools of reconnaissance. Hearing, although not usually employed, can compensate when proprioception fails.4 The Visual System The organ of sight, the eye, first detects the lay of the land. This is achieved through light passing through the iris and focusing on the retina. Various photosensitive 2 Sherrington, C. S. (1906) The Integrative Action Of The Nervous System. New Haven, Yale U.P. :335-43 3 Sacks, O. (1970) The man who mistook his wife for a hat 1st Ed. New York: Touch Stone : 49-51 4 Sacks, O. (1970) The man who mistook his wife for a hat 1st Ed. New York: Touch Stone : 43-53

384

receptors in the retina make up the image through a process of edge detection. Edges are detected depending on their position in the visual field. They are first detected by the ganglion cells in the retina. These cells operate by combing inhibitory and excitatory responses to light, depending on where it strikes the receptive field of the ganglion cell. This information is then transmitted to the brain along the optic nerve via the lateral geniculate nucleus in the thalamus to the primary cortex (located on the medial surface of the occipital cortex) where it is processed further. The primary cortex contains three types of cell which continue to build the image through detecting edges, corners and curves. This image is preserved during running using the vestibulo-ocular reflex. This is a compensatory reflex through which the images are stabilized during running by moving the eye in the opposite direction to the head. This maintains the image in the centre of the visual field.5 In order to successfully complete the task, all elements of the visual system described must be in full working order otherwise compensation must occur.

Exteroceptive Inputs The Skin It is generally accepted that the cutaneous receptors act to compliment the effects of other proprioceptive inputs. This has been identified through experimentation with anaesthesia of skin afferents surrounding joints revealing a decrease in overall proprioception.6 Before beginning any action the body needs to be aware of its position, its hypothetical “zero.” The skin contains several mechanoreceptors which detect pressure, stretch, pain and temperature. This detection of pressure enhances the ability of the central nervous system (CNS) to deduce which areas of the brain are in contact with the ground. When running, especially on mixed terrain, it is vital the body be aware of its foot position. While it is has been shown that the use of running shoes diminishes cutaneous feedback somewhat,7 mechanoreceptors in the soles of the feet still produce feedback. There are several types of skin receptor which each play a role in this feedback. Bearing in mind the task at hand, Merkel discs, which are located near the surface of the skin and detect light pressure accurately, may not be frequently stimulated as they require accurate pressure. Messinners corpuscles, cutaneous receptors used for light tapping may not be stimulated to a great degree as we run across the terrain. There are two cutaneous receptors that have been shown to come into play. The Pacinian corpuscle, which detects vibration, is located deeper 5 Martin J. Tovée (1996), An introduction to the visual system. Cambridge University Press :180198. 6 Gandevia S. C. (1976) Joint sense, muscle sense, and their combination as position sense, measured at the distal interphalangeal joint of the middle finger. Journal Of Physiology 260(2):387–407. 7 Robbins, S. Hanna A. E. (1987) Running-related injury prevention through barefoot adaptations. Medicine and Science in Sports and Exercise, 19(2):148-156.

385

in the cutaneous layer. This corpuscle may enhance the proprioceptive inputs during joint changes by informing the CNS of vibration.8 The second of these cutaneous mechanoreceptors is the Ruffini ending, located in the dermis, which detects skin stretch. Proprioceptive mapping of cruciate ligaments in sheep has found the Ruffini endings to be strongly represented in the complex sensory network innervating the ligament.9 The structure of both the Pacinian and Ruffini structures relevant to joint articulation will be outlined in the coming pages.

Exteroceptive Inputs The Vestibular System The detector of balance and acceleration, this system may well be the most important of the exteroceptive systems. It is the first sensory arrangement to develop in the foetus and is responsible for the most rudimentary task – our ability to determine gravity, i.e. which way is up. Given the task this is crucial in order for us to begin. The relevant structures and functions are outlined below. The vestibular apparatus contains organs called macule. Each macula is covered by a gelatinous substance in which many otoliths are embedded. Representations for all angles of orientation allow the vestibule to detect acceleration, gravity and tilt in any direction. Also in the macula are thousands of hair cells which project up into the gelatinous layer. The bases and sides of the hair cells synapse with the sensuous endings of the vestibular nerve. When a body accelerates the otoliths fall backward on the hair cilia due to their greater inertia in relation to the surrounding fluids. Each hair cell has between 50 – 70 stereocilia and one large kinocilium which are all attached by filamentous attachments. When the stereocilia are bent towards the kinocilium the filamentous attachments are pulled open causing specialised ion channels to open and a result in a depolarisation. Conversely, bending the stereocilia away from the kinocilium the tension is decreased and a hyperpolarisation occurs. Therefore as the orientation of the head in space changes during the task, the weight of the otoliths bend the cilia appropriate signals will be sent to the brain to control equilibrium.10 The importance of this may well be illustrated by testing in a gravity free environment. Research conducted by the North American Space Agency has shown that subject were unable to determine “up” in a gravity free environment.11 This is due to the stagnation of the stereocilia due to the lack of gravity. With respect to the task the vestibular system is crucial in our ability to carry it out effectively. 8 Allen, A.. M. Soifer, H.J. (2001) Neural Anatomy of the Transverse Carpal Ligament Clinical Orthopaedics & Related Research. (386):218-221, 9 Raunest, J. Sager, M. E. (1998) Proprioception of the cruciate ligaments: receptor mapping in an animal model. Archives of Orthopaedic and Trauma Surgery 118(3):159-163 10 Ref: UCC PL3020: “Sixth Weekly Assignment” – English F. Submitted Reid, G. 8/11/07 (UNPUBLISHED) 11 Philips, T. (2001) Mixed Up in Space. (Online) Available: http://science.nasa.gov/headlines/ y2001/ast07aug_1.htm (13/12/2009)

386

The collaboration of sensory information with the visual system in the previously described vestibulo-ocular reflex is vital in order to carry out the task smoothly.

Interoceptive Inputs & Nociception Interoception was the second of the terms coined by Sherrington in the 1900’s. It is the least relevant to the task at hand and also the least studied. The interoceptive network draws from stimuli in the internal organs and tissues through its afferents. These afferents are substantially smaller and more numerous; it is this difference that has lead to the gap in research. Sherrington thought the system to be responsible for visceral sensation; it is now known that the sensations from other physiological stimuli are also involved.12 Our sense of pain, nociception, is an element of the interoception. This is not normally relevant to the task unless injury occurs. Injury or pain is detected through free nerve endings. These high threshold mechanoreceptors are the nociceptors that detect chemical, thermal and mechanical stimuli. These nociceptors are located in external tissues (e.g. cutaneous nociceptors) and internally in the muscles, joints and some major organs.13 Several, less obvious, pertinent factors are relevant to interoception. Detection of heartbeat, sweat loss, water balance, lactate accumulation, CO2 levels and thirst are all modalities that are subconsciously detected through these receptors deep within the body. The complexity of the system is further reaching: these stimuli can interact with each other modify physiological states e.g. a high rate of sweat loss will trigger thirst, high heart beat will trigger increased breathing rate etc. Interestingly one stimulus can increase the sensitivity to other stimuli. Studies have shown that pain and thirst are closely linked in the CNS. If the runner should get injured while thirsty the sense of pain will be more intense than if he/she were hydrated.14 Recent research has suggested that interoception, through a combination of many of these stimuli, detects our emotional response to an action, e.g. interoception may control our thoughts to embarking on the run in the first instance.15 Overall interoception controls many of the inputs necessary for life but few related solely to the task. Without these stimuli being detected subconsciously and continuously we may not have the ability to complete any other tasks especially those which may serve to alter homeostasis to such an extent. Proprioception & The Somatosensory System The term somatosensory is derived from the Latin “soma” meaning body. Freud suggested that it was this sense that provided a sense of self or “body ego.16. It has 12 Fowler, C.J. (2003) VISCERAL SENSORY NEUROSCIENCE: INTEROCEPTION Brain 126(6): 1505-1506 13 Kandel E.R., Schwartz, J.H., Jessell, T.M. (2000) Principles of Neural Science, 4th ed. :472-479. New York: McGraw-Hill 14 Farrell, J.Et. Al. (2006) Unique, common, and interacting cortical correlates of thirst and pain. Proc Natl Acad Sci 103(7): 11-15 15 Wiens, S. (2005) Interoception In Emotional Experience Current. Opinions In Neurology 18(4): 442-447 16 Sacks, O. (1970) The man who mistook his wife for a hat 1st Ed. New York: Touch Stone : 49

387

been suggested that the more global somatosensory system is, by extension, a broader division of the sense of touch. Our sense of touch, in relation to the external environment, is discussed under exteroceptive inputs as it relates generally to our perception of the outside world. Several of these inputs have been shown to enhance proprioception but not to generate it independently. Proprioception (from the Latin “proprius” meaning one’s own) is a division of the somatosensory system which takes its inputs from deeper sources. These inputs, from low threshold mechanoreceptors, provide the CNS with feedback regarding body position, timing, intensity and movement. Proprioception is not a tool of reconnaissance but an integral element of life, constant, subconscious information pertaining to when, where and who we are. In 1889 Alfred Goldschedier suggested all proprioception was based on muscle, tendon and articular receptors.17 It is now accepted that this is carried out by the three structures that follow.

Proprioception & The Somatosensory System Muscle Spindles Muscle spindles are the most complex form of proprioceptor. Put simply, the function of muscle spindles is to inform other neurons of the length of the muscle and the velocity at which a change or stretch is taking place. The muscle spindle contains intrafusal muscle fibres on which sensory endings are laid. The status of the muscle fibres is then detected by afferent neurons located on the capsule and relayed. The density of these spindles is dependent on the degree of fine movement in the joints, i.e. this is high in the fingers, face etc. Muscle spindles are vitally important given the task of running on bumpy ground. When the muscles are stretched so in turn are the spindles. This triggers the myotatic reflex in which the muscle contracts to counteract the lengthening. This can be best observed in the application of a patella hammer to the patellar tendon which causes a contraction of the quadriceps femoris. Muscles responsible for posture and the defiance of gravity (i.e. those in the arms, legs etc.) have a particularly high density of muscle spindles. In normal proprioception many spindles provide information in order to give the brain a “picture” of where and when a muscle is in space and time. A study of the tibialis anterior muscle showed any irregularity e.g. poor footing when running is quickly detected and reactive action taken. Muscle spindles were also found to detect, and alter if necessary, changes in contraction acceleration when running.18 Proprioception & The Somatosensory System Joint Receptors 17 Zschr, K. (1893). Hirschwald Taf Halbleinenband der Zeit. Med 20 (4):577 18 Burke, D. Hagbarth, K. Löfstedt, L. (1978) Muscle spindle activity in man during shortening and lengthening contractions. Journal Of Physiology. 277(4):131–142.

388

In discussing joint receptors it is important to remember that proprioception is largely a division of the extended sense of touch. The receptors that detect the position of joints as they articulate are similar to the cutaneous mechanoreceptors mentioned previously. The difference is their location within the body. The pacinian corpuscle receptor is sensitive to high frequency vibration. With respect to joint articulation, the receptors are located in the tissues surrounding joints and deep within the skin. The morphology of these receptors varies depending on their exact locus e.g. vater-pacinian corpuscles present in the finger. Those found in articular surfaces are smaller than the cutaneous variant and take a conical shape.19 Each corpuscle is surrounded by layers of connective tissue and connected to a sensory neuron. Movement of a joint causes a proportional deformation of the corpuscle and creates a generator potential. The greater the deformation the greater the intensity of the stimulus. The connective tissue layers provide the corpuscle with its rapid adaptation function, and enable the CNS to determine the degree of joint movement as it is proportional to the deformation in the corpuscle. As a result the articular corpuscle is inactive when static or as joints move at a constant velocity. The corpuscle relies on changes in acceleration and deceleration to create a stimulus.20 In opposition to the pacinian corpuscle is the ruffini ending which is active when static. This is a low threshold slow adapting receptor whose stimulus is drawn from joint position when static or when a limb occupies a set mid range position. These mid range receptors detect the degree and frequency of movements. These endings are commonly found in the capsule of the knee joint and various ligaments associated with the limbs. These endings have many morphological variants, most commonly taking the form of several encapsulated globules ending in a single mylenated parent axon. It is the interaction of these two receptor types that permit the CNS to detect the presence and degree of joint movement during the task.

Proprioception & The Somatosensory System The Golgi Tendon Organ (GTO) The function of this organ is two-fold: protection and detection. These high-threshold, slow adapting mechanoreceptors are located in the musculotendinous tissue in series with muscle fibres (i.e. its afferents are interwoven with fibrils in the tendon). During contraction these collagen fibrils are lengthened and this stimulates the Golgi tendon organ afferents which relay information pertaining to muscle tension. The function of the GTO is similar to that of muscle spindles in that they gather information regarding changes in muscle. Unlike the spindles the GTO is 19 Scott M. Et Al. (2000) “Proprioception and Neuromuscular Control in Joint Stability” . 1st Ed. USA: Human Kinetics :13-15 20 Kandel ER, Schwartz JH, Jessell TM (2000) Principles of Neural Science, 4th ed., New York: McGraw-Hill. :443

389

only active during contraction of the tendon. The GTO is primarily concerned with the tension in the muscle as opposed to its length.21 The GTO provides protection by preventing excessive stretches on muscles provided through an inhibitory reflex that induces relaxation. This reflex arc operates by impulses sent through afferent neurons to the CNS; at this point these sensory neurons synapse with motor neurons of the same muscle and a relaxation is signalled through efferent neurons.22

Think About It… “I move, therefore I am a self, (I think).” – Rodolfo Llinas Neural Pathways This section serves to illustrate how the sensory information reaches the brain for processing. Stiumli detected by the three sensory systems previously discussed are transferred to the brain through various pathways depending on modality. In order for the task to be completed this information needs to first reach its target processor (e.g. the cortex etc) and continue to initiate further actions to continue running. This must happen instantaneously and constantly. The end site, or target processor, of these pathways is dependent on the sensory information to be processed. For example visual stimuli are ultimately processed in the primary visual cortex at the rear of the brain as discussed. The senses of pain and that of discriminative touch target the cerebral cortex. Each sensation is transmitted by sensory axons to the spinal dorsal root ganglion. Each spinal nerve contains one ganglion. Uniquely, the impulse passes directly to the proximal process without passing though the cell body. The impulse continues up the spinal cord primary afferents until synapsing with the secondary afferents at the medulla. These secondary afferents ascend the spinal cord to the thalamus and synapse finally to reach the cerebral cortex.23 Proprioception primarily targets the cerebellum. When muscle spindles are stimulated the impulses travel to the spinal cord via the sensory axon. In the reflex arc, branches synapse directly with the motor units of the same muscle and cause it to contract. Other branches synapse with inhibitory interneurons, found exclusively within the spinal cord and brain, which lead to the antagonist muscle in the same limb e.g. the quadriceps/hamstring relationship in the leg.24 This inhibition 21 Pansky, B. (1975)Dynamic Anatomy and Physiology 2nd Ed. New York: MacMillan :189-190 22 Reference List Continued Williams, W., Bannister D, Gray’s Anatomy, 37th Ed (1997) New York: Churchill Livinstone: 915. 23 Kandel E.R., Schwartz, J.H., Jessell, T.M. (2000) Principles of Neural Science, 4th ed. :472-479. New York: McGraw-Hill 24 Barrett, C. P. &Kearney, R. E (1998) Effect of proprioceptive neuromuscular facilitated stretching with warm-up on ankle joint dynamics. Proceedings of the Canadian Medical & Biological Engineering Society Conference, Edmonton, , 24:26-27.

390

aids the contraction of the extensor should the flexor be inhibited; this is a reciprocal process. Finally, several branches synapse with interneurons leading to the cerebellum where body movements are coordinated. The axons that carry these impulses are classified according to their diameter which determines their conduction velocity. The continuous nature of proprioception requires the fastest of these axons classified as “Aa” axons. Discriminative touch is conducted through “Ab” neurons which are slightly smaller than the “Aa” axons. Most sensory systems travelling to the cortex will have to cross “sides” owing to its contralateral operation. This differs for each system, these “Ab” neurons cross high in the medulla and where as the pain neurons, “Ac,” cross low in the spinal cord. The proprioceptive system does not cross as it targets the cerebellum, which operated ipsilaterally.25 The combination of these signalling pathways and processes allows the task to be carried out sub-consciously to a great extent. Particularly, the inhibitory feedback provided by the proprioceptors which both prevents injury and heightens control of movement during the task.26

Divisions Of The Brain & Sensory / Motor Interactions Several areas of the brain that must interact in order to complete the tasks which plan and execute movements through an afferent/efferent system. Below are the main components. The Motor Cortex The motor cortex is the region of the cortical area that influences motor movements. The motor cortex is subdivided into three sections which each have individual roles. The primary motor cortex, located in Brodmann area 4, is responsible for generating the neural impulses controlling execution of movement. The premotor cortex, located in Brodmann area 6, is responsible for motor guidance of movement and control of proximal and trunk muscles of the body. The third subsection is the supplementary motor area, located medially in Brodmann area 6, and is responsible for planning and coordination of complex movements including those requiring two limbs. Anticipation of a movement has been shown to generate neural transmissions in these areas. Another important area, located in Brodmann areas 5 and 7 is the parietal cortex. This is tasked with transforming input from the somatosensory system into motor commands. The information is taken from the somatosensory areas and internal models of movement are created before the premotor and motor cortices are involved.27 25 T. Paus, A. Zijdenbos, K. Worsley, D. L. Collins, J. Blumenthal,J. N. Giedd, J. L. Rappaport, A. C. Evans, (1999) ``Structural maturation of neural pathways in children and adolescents: an in vivo study’’. Science, 283:1908-1911, 26 Nicholls, J. G. Et Al (2001) From Neuron To Brain. 4th Ed. Massachusetts: Sinauer 27 Kandel ER, Schwartz JH, Jessell TM (2000) Principles of Neural Science, 4th ed., New York: McGraw-Hill.

391

The Cerebellum The cerebellum can best be described as the internal clock that is essentially responsible for the timing of actions. The cerebellum, facilitated by the basal ganglia, allows smooth, controlled and voluntary deployment of actions during elementary and dynamic movements. If the ground were to alter during the process of running the cerebellum would correct for this. The cerebellum analyses what movement was planned (by the motor cortex) and compares this with what movement is occurring (through somatosensory receptors). Any compensation or correction is then carried out with the aid of the basal ganglia, relayed through the thalamus. This allows for movement to be restored according to the altered internal model generated. This is the latter phase of the activation sequence in motor areas which encompasses messages from many cortices.28 Walking Rhythm A contemporary of Sherrington, T. G. Brown, suggested in 1911 that a central pattern generator (CPG) existed to provide basic rhythmic movement.29,30 This was confirmed through studying animals with removed afferents or through the use of curare.31 It is commonly observed that a reflex exists where the force of walking can be removed quickly if the foot becomes unloaded while on uneven ground. Given the task this is sure to happen. A 1994 study conducted by M.A Gorrsani using decerebrate cats walking on specially designed treadmills where the foot was unloaded spontaneously. The cats responded as normal by reducing force after a short delay and continuing walking. It was concluded while the CPG was partly responsible for the generation of this movement; the reflex in the periphery also played a key role.32 It is now accepted that the CPG generates simple alterations and the initial activation. The reflexes act by adjusting the force up or down; if these are inadequate the latency period increases and voluntary corrections may be needed.33 Given the task, the duration of this latency period will greatly determine the speed and ease with which the task is completed. A long latency period coupled with the forces of gravity may lead to the subject calling on the vestibular system 28 Dongier, M. (2007) Canadian Institute Of Neuroscience; The Brain From Top To Bottom. (Online) Available: http://thebrain.mcgill.ca/flash/i/i_06/i_06_cr/i_06_cr_mou/i_06_cr_mou.html 16/11/07 29 Brown, T. G. (1911). The intrinsic factors in the act of progression in the mammal. Proceedings of the Royal Society B 84, 308-319. 30 Sherrington, C. S. (1910). Flexion-reflex of the limb, crossed extension reflex and reflex stepping and standing. The Journal of Physiology 40, 28-121. 31 Rossignol, S. (1996). Neural control of stereotypic limb movements. In Handbook of Physiology, Section 12, Exercise: Regulation and Integration of Multiple Systems, ed. Rowell, L. B. & Shepherd, J. T., pp. 173-216. Oxford, New York. 32 Stein R. B., Misiaszek J. E, Pearson, K. G, (2000) Functional role of muscle reflexes for force generation in the decerebrate walking cat. The Journal of Physiology 525 781-791 33 Gorrasini, M. A., Prochazka, A. K., Hiebert, G. W. & Gauthier, M. J. A. (1994). Corrective responses to loss of ground support during walking. I. Intact cats. Journal of Neurophysiology 71, 603-610

392

to once again determine up.

Brains Or Brawn….Brains. “When brains are needed, brawn won’t help.” Yiddish Proverb Action Potential & The Neuromuscular Junction Impulses pertaining to movement are relayed from the brain. This signal is relayed to the motor neurons for execution. The muscles, which are the end point of this chain, will execute this movement through contraction. In order for the impulse to reach the muscle it must travel through the axon of the motor unit which emerge from the spinal cord. At the end of the axon is a synapse which connects the axon to the muscle fibre. This specialised synapse is termed the neuromuscular junction (NMJ) as it is the link between nervous and musculoskeletal systems. Release of the neurotransmitter aceylycholine (ACh) into the synapse is stimulated by the arrival of the impulse to the end of the axon. The ACh is then bound to ACh receptors on the surface of the muscle fibre. The muscle fibre is densely populated with these receptors. The binding of the ACh to the muscle fibre creates a new impulse which spreads rapidly inducing contraction in the fibre. The ACh needed to completed this is stored in pre synaptic vesicles from which it is secreted into the NMJ. The post synaptic membrane of the muscle fibre has a high distribution of specialised binding proteins called Nicotinic receptors which bind the ACh. This binding opens an ion channel which allows sodium (Na) enter the fibre and regenerate the impulse resulting in contraction.34 The initial impulse that is released from the brain into the axon is known as an action potential. These action potentials are stimulated through the changes in a cells resting potential through altering concentrations of Na, potassium and calcium. ACh is released through the binding of ACh to the nicotinic receptors. If a sufficient amount of Na is released the resting potential of the muscle fibre will be raised and a muscular action potential will be generated resulting in contraction.35 Force Regulation And Application This section serves to address how the muscular force is regulated and applied when completing the task. The key component is the use of motor control, which is generated through sensory feedback from structures such as the GTO. This feedback, created by low level controls signals, allows the creation of complicated behaviors such as the task. In order to explain the regulation of force the rudiments of the motor system must be discussed. 34 Kandel E.R., Schwartz, J.H., Jessell, T.M. (2000) Principles of Neural Science, 4th ed. :472-479. New York: McGraw-Hill 35 Dongier, M. (2007) Canadian Institute Of Neuroscience; The Brain From Top To Bottom. (Online) Available: http://thebrain.mcgill.ca/flash/i/i_06/i_06_m/i_06_m_mou/i_06_m_mou.html 16/11/07

393

Limb Mechanics Limb mechanics are controlled by a division of the peripheral motor system that filters the CNS generated patterns of muscle activity into a purposeful movement. The basic structure of motor output is the motor unit. A motor unit is made up of a motor neuron and the muscle fibres that innervate it. The filter must process many factors that may affect the conversion of these patterns into actual movements. These include practical elements such as the length of the fibre and factors that may influence neurotransmission such as histology.36 Architectural features such as the length of tendons, morphology of muscle and angles of various fibres must also be contended with.37 The motor unit acts as a buffer that “smoothes” out the signal to form graceful movements despite the variants in the mechanic of the limbs involved. Neural Centres Of Control Control of the motor system of sensimotor control is facilitated by a complex system of circuits including the spinal cord, the brainstem and the cerebral cortex. The spinal cord operates automatic movements such as reflexes. The cortex is responsible for voluntary motor tasks and learned reactions e.g. hand to face in protection. The cortex supports two problems relating to motor control planning and execution. Planning in particular involves a movement strategy that will result in the end goal of a smooth movement. This is made possible through the recruitment of muscles etc. The primary motor cortex or M1 skilled motor tasks such as voluntary movement which pertain to the task.38 The primary motor cortex receives a variety of sensory feedback from proprioceptors that impact on movement strategies and force application.39 Conclusion A human runs on bumpy ground through a series of processes which operate in a loop. These processes are integrated to the extent that each operates so that it can best assist the operation of the next process. These processes include the reconnaissance of the surfaces, the generation of movement patterns, the application of these patterns and the continuous review of their application. From writing this paper the author concludes that studying the task could well occupy the life’s work of many generations of scientists. It is clear that the body and its systems have adapted so fantastically that such complex processes can be carried out subconsciously. The integration between muscle and nerve is truly fascinating. In concluding this essay it is the opinion of the author that much more 36 Burke, R. E., Levine, D. N., Tsairis, P. Zajac, F. E. (1973) Physiological types and histochemical profiles in motor units of the cat gastrocnemius. J. Physiology. (Lond.) 234: 723–748 37 Cheng, E. J. Scott, S. H. (2000). Morphometry of Macaca mulatta forelimb. I. Shoulder and elbow muscles and segment inertial parameters. J. Morphology. 245, 206–224 38 Porter, R. & Lemon, R. N. (1993) Cortical Function and Voluntary Movement Clarendon: Oxford. 39 Scott, S. H. (2004) �� Optimal feedback control and the neural basis of volitional motor control nature (5):534-547

394

could have been included, more angles covered and more depth provided. Solace is taken in this simple quotation: “If the human brain were simple enough for us to understand, we would be too simple to understand it.”

395

396

M E DIC I N E

Inflammation of the upper airway in obstructive sleep apnoea Brian Mac Grory

I. Introduction bstructive sleep apnoea (OSA) inflames the upper airway. Upper airway inflammation can arise as a result of any number of diverse environmental and physiological factors (e.g. Wouters et al, 2002). Nevertheless, inflammation corresponding to OSA is both distinctive in its character and vital to the progression of this condition. The upper airway consists of the nasal cavity, the pharynx and the larynx. These structures function as a conduit for food, inhaled and exhaled air and as instruments of phonation. The conflicting nature of these requirements means that the upper airway is uniquely prone to injurious processes even in the absence of major pathology. Inflammation is a vascular response to injury. It is both a powerful response to traumatic injury and an initiator of the healing and reconstructive process. It acts via an immense, concerted and tightly regulated barrage of plasma-derived factors, inflammatory cells and chemical messengers such as cytokines, eicosanoids and other smaller, volatile messengers. It is beyond the scope of this discussion to attempt to describe all of the inflammatory mediators observed in the upper airway in OSA but a summary explanation of the components that will receive the most attention in this paper is provided for reference in the appendix. Repeated episodes of hypoxia followed by re-oxygenation are accompanied by a vigorous inflammatory response. This extends from the upper airway, down the bronchial tree (Salerno et al, 2004; Li et al, 2007; Devouassoux et al, 2007) and is also manifested systemically (Ford et al, 2002; Tazaki et al, 2004; Yokoe et al, 2003; Minoguchi et al, 2004). The systemic inflammatory response, as this is called, 397

mainly involves the endothelium and affects diffuse sites in the body. The systemic inflammation has been implicated in a bewildering array of serious illnesses. Inflammatory markers are recognized as valid predictors of coronary heart disease (Ridker, 1999; Tziakas et al, 2007) because they play a role in acute thrombosis and atheroma. Inflammation particular to the upper airway has been receiving substantial attention in the literature in the recent past. It has already been recommended as a diagnostic tool for assessing the severity of OSA (Li et al, 2008 (1)). In addition, preliminary results show that pharmacological therapy directed against the inflammatory response (an oral leukotriene modifier) leads to improved breathing during sleep, in children with OSA (Goldbart et al, 2005; Kheirandish et al, 2006). Recent reviews have focused on the local and systemic inflammatory responses as separate entities. While the focus of this paper will be the inflammatory response localized to the upper airway, I will devote some time to the contrapuntal interaction between the two of them. In this discourse, I intend to briefly outline the pathology of OSA. Next, I will document the inflammation of the nasal cavity, pharynx and larynx as a physiological response to OSA: its causes, its manifestation and its effects. Then, I will examine whether reversing OSA will reverse the inflammatory response, which should follow if OSA is the causative factor. I will conclude with some remarks on the results from earlier in the paper.

II. Obstructive Sleep Apnoea OSA is a progressive condition characterized by repeated occlusive events of the airway during sleep. The upper airway, for the purposes of this paper, could be considered as a delicate, muscular tube which is prolonged superiorly from the trachea. Its function necessitates the capacity to close completely at times, while at others to remain open while opposing negative transmural pressure. Occlusive events are precipitated by reduced motor drive to the muscles protecting pharyngeal patency. The airway narrows (in a lateral dimension (Schwab et al, 1995) prior to transient obstruction leading to hypoxia and hypercapnia. 50% of sufferers obstruct at the level of the velopharynx while the other 50% obstruct at the base of the tongue (Chaban et al, 1988). It is common for the pharynx to be obstructed at more than one site. Obstruction of the airway also elicits a vigorous reflex sympathetic response, which leads to arousal from sleep. This leads to fragmented sleep causing neurocognitive and neurobehavioural abnormalities. It is interesting to note that even the worst afflicted patients only experience apnoeic events during sleep. These apnoeic events lengthen as the night progresses (Charbonneau et al, 1994) and this is due to attenuated reflex responses in the brainstem (Montserrat et al, 1996). Its severity is assessed via the apnoea/hypopnea index (AHI), which measures the number of occlusive events per hour during sleep. The AHI will be referred to numerous times throughout the paper. 398

AHI 0 - 5 per hour

Severity of OSA Normal

5 – 15 h per hour

Mild disease

Incidence – Men: 17–26% Women: 9–28%

15 – 30 per hour

Moderate disease

Men: 15% Women: 5%

30+ per hour

Severe disease

Men: 7–14% Women: 2–7%

(Adapted from Alam et al, 2007) Table 1

The risk factors are multitudinous: 1. Obesity: This is the major risk factor – a 10% weight gain is associated with a 500% increased chance of suffering from apnoeic events (Peppard et al, 2000). Crucially, overall body fat deposition is important, while, counter-intuitively, subcutaneous fat of the neck is less so (Schäfer et al, 2002). 2. Anatomical factors: An anatomically compromised upper airway strongly correlates with obstructive sleep apnoea. Of note, a lengthened airway, a posteriorly displaced maxilla and a narrow mandible are significant risk factors. 3. Inflammatory conditions of the upper airway, including chronic rhinitis, which leads to airway obstruction by enlarging the soft-tissue structures of the upper airway (Young et al, 1997). 4. Other risk factors: – Wetter at al (1994) reported an increased risk of OSA associated with cigarette smoking. – Genetic factors have also been identified for example the “apolipoprotein E epsilon4 gene” (Kadotani et al, 2001). – Lesions of the head and neck including tumours (Payne et al, 2005). OSA frequently accompanies and compounds other obstructive respiratory diseases (Kessler et al, 2001) and it increases mortality from any cause (Yaggi et al, 2005).

III. Mechanisms Behind Inflammation It is worth discussing two notable features of OSA which underlie inflammatory changes in the mucosa and muscular tissue of the upper airway: A. Mechanical Trauma 1. Compromised pharyngeal calibre necessitates an accentuated background tone in the muscles which act to establish and maintain upper airway patency. 399

This remains true in both wakefulness and non-occlusive sleep (Suratt et al, 1988; Mezzanotte et al, 1992). 2. It forces the dilator muscles to repeatedly and forcefully contract in order to restore airway patency after an apnoeic event. 3. A particular feature of sleep apneas is the requirement for certain dilator muscles to contract while lengthening. Van Lunteren et al (1989) recorded eccentric contractions of the geniohyoid and sternohyoid muscles in airway occlusion in the cat. These muscles function to oppose negative intraluminal pressure. McCully and Faulkner (1986) documented the damaging effects of eccentric contractions on the extensor digitorum longus muscle in mice. This muscle is a “fast-twitch” muscle much like the airway dilators. They demonstrated that extent of the injury was proportional to the peak force generated by the muscle. This immediately suggests a mechanism for the worsening muscle injury as the condition progresses. 4. It subjects the soft tissues of the upper airway to continuous vibratory trauma during sleep because of increased airway resistance. This manifests as snoring. Excessive contractile activity damages muscular tissue by exposing it to profound oxidative stress while vibratory trauma and eccentric contraction damages the muscles directly. As the severity of the condition worsens with time, these types of trauma become more prominent. Mucosal damage intensifies while the dilator muscles receive insufficient rest and myopathy ensues.

Effects of Mechanical Trauma The above observations are pertinent to the inflammatory response. A paper by Nagaraju et al. (1998) showed that primordial muscle cells have the potential to generate their own inflammatory mediators. Myoblast and myotubes from a single donor were incubated with cytokines (IL-1α, IL-1β, TNF-alpha and interferongamma) to induce further cytokine synthesis. It was shown that proinflammatory stimuli induce the expression of other cytokines such as IL-6, transforming growth factor-beta, and granulocyte-macrophage colony-stimulating factor (which is indicative of activity by macrophages and T-cells) by muscle cells themselves, as well as the up-regulation of human leukocyte antigen (HLA). Steensberg et al. (2002) corroborated the above results but in an in-vivo model in humans: the arterial plasma levels of IL-6 increase within approximately 2 hours of strenuous exercise (the study continued for 3). Again, these studies only serve to prove that skeletal muscle is capable of doing this and this review does not suggest that this in any way approximates the profile seen in OSA. In addition, Almendros et al. (2007) examined the effects of vibratory stimuli on the upper airway in a live-rat model. They subjected the upper airway of 8 live, anaesthetised rats to vibratory trauma. They then assessed the level of expression of the genes coding for tumour necrosis factor-alpha and macrophage inflammatory protein 2 in the soft palate. Compared to 8 controls, there was a six-fold increase in the levels of TNF-alpha genes and a 2.4 fold increase in the level of macrophage inflammatory protein 2 genes. This study only examined the effect of 400

vibration for 3 hours. Also the pattern used (1 second of vibration: 3 seconds of no stimulus) is not representative of the typical profile found in sleep. Nevertheless, one can draw the conclusion that vibratory stimuli induce at least some form of early inflammation in mucosal tissue. Boyd et al. (2004) showed differing inflammatory profiles among mucosa and muscle – a reflection of the fact that the muscles engage actively in maintaining upper airway patency while other soft tissues are only affected by mechanical distortion and vibratory trauma in OSA (of course, it is also a reflection of the differing intrinsic capabilities of the tissues). The Boyd paper will be referenced several times throughout this discourse.

B. Chronic Intermittent Hypoxia Sleep apnoea leads to cycles of chronic intermittent hypoxia. When the airway occludes, lung filling is ceased and the partial pressure of oxygen in the blood is transiently reduced. Tissues are damaged by this cycle of hypoxia/reoxygenation (in some tissues, this may ironically be more damaging than pure continuous hypoxia) and by the associated release of oxygen free radicals. Effects of Chronic Intermittent Hypoxia Hypoxia is recognized as a powerful inducer of the inflammatory response in all tissues. Hypoxia activates factors responsible for transcribing numerous cytokines including interleukin-8, CCL11 (eotaxin-1), and nitric oxide synthase (Steinke et al, 2008). Early et al. (2007) demonstrated that fibroblasts removed from the upper-airway and subjected to hypoxic conditions produce CCL11 and other cytokines, notably chemokines. Caveats Sériès et al. (2004) showed that obesity itself is a cause of inflammation in the uvula. It is worth pointing this out because since obesity is such a significant risk factor, not all of the inflammation observed will be due to obstructive sleep apnea itself. Sériès et al. examined surgically resected sections of the uvula in both obese subjects with OSA and normal-weight subjects with OSA. Using inmunohistochemistry, they found that the levels of both helper (CD4+) T-cells, cytotoxic (CD8+) T-cells and macrophages were higher among the obese subjects with OSA than normal-weight subjects with OSA. This is a plausible result as leptin has been shown to be an inflammatory mediator in a diverse array of circumstances (Siegmund et al, 2002; Rafail et al, 2008). Though to reaffirm the crucial role that OSA plays, plasma leptin levels are higher in obese patients with OSA than in obese patients without OSA (Yun et al, 2004). In addition, as pointed out above, smoking is a risk factor for OSA and it must be realised that, at least in some subjects, inflammation of the upper airway may be partly due to smoking. 401

IV. What is Observed? A. The Local Response In OSA patients, both qualitative and quantitative, prospective and retrospective studies have consistently shown a marked level of chronic inflammation in the upper airway. These studies are invariably cross-sectional in nature but useful results can be derived nonetheless. Boyd et al. (2004) performed the most comprehensive documentation of the inflammatory response in the upper airway in human subjects. They derived palatal and tonsillar tissues from 11 OSA subjects and 7 controls. Crucially their examination included the muscular layer of the soft palate. They applied primary antibodies directed against leukocytes, macrophages and T-cells. Their study revealed: 1. a striking level of inflammation in both mucosal and muscular tissues of the soft palate and 2. a marked difference in the inflammatory profile between these two types of tissues. In the mucosal layer they demonstrated that there were 2.8 times the level of cytotoxic t-cells, 2.3 times the level of helper t-cells and over 3 times the level of IL-2 receptor positive T-cells in OSA patients compared with controls. In contrast, the muscular layer displayed 3 times the level of helper T-cells and 3 times the level of IL-2 receptor positive T-cells in OSA patients compared with controls. Interestingly, the level of cytotoxic T-cells was the same in the muscular layer of OSA patients and controls, and not increased as in the mucosal layer. This is important because is demonstrates that the muscle exhibits a distinct immune response to the other soft tissues and that the t-cells found in the muscle are not just collateral from the mucosa. Sekosan et al. (1996) examined the levels of cellular infiltrate and oedema in the uvulas of OSA patients who had undergone palatal surgery and compared them to the levels in random post mortem specimens. They found a higher level of leukocytes in the lamina propria of the mucosal layer of the uvula in OSA patients versus controls. Also, the thickness of the lamina propria of the uvula was increased three-fold, suggestive of oedema and inflammation. Paulsen et al. (2002) performed a similar study and found a two-and-a-half fold increase in the levels of leukocytes in the uvular mucosa of OSA patients compared with controls. These cells were predominantly CD3+ T-lymphocytes. Woodson et al. (1991) found extensive evidence of damage and remodelling in the uvula and soft palate in patients with OSA including severe oedema. There are also reduced levels of neprilysin in the uvular epithelium (Zakkar et al, 1997). Neprilysin levels are frequently decreased in tissues as a result of oxidative stress. Sériès et al. (2004) suggest that elevated inflammatory cell infiltrate in the uvula may not be causally related to sleep apnea but rather to obesity; in their study they found a positive correlation between T-cell count and BMI and not T-cell count and AHI. In the larynx, inflammation is present in 90% of patients with OSA and the level of inflammation positively correlates with AHI (Payne et al, 2006). Carpagno et al. (2002) examined the levels of interleukin-6 and 8-isoprostane 402

levels in the exhaled breath of human subjects with OSA. They demonstrated that the levels of these two inflammatory markers were proportional to the apnoea/ hypopnea index. In other words, subjects with OSA had higher levels of them in the upper airway than control subjects (and obese subjects without OSA exhibited intermediate levels). The levels in exhaled breath a reasonable surrogate for levels of inflammation in the upper airway though studies, which measured the levels in a more direct manner, would be more valuable. There are higher levels of exhaled pentane in both the oral and nasal exhaled air of patients with OSA than controls. This is particularly marked after sleep but remains true throughout the day (Olopade et al, 1997). There are higher levels of exhaled nitric oxide in the exhaled nasal air in OSA patients than in controls. However, in the oral exhalant there were comparable levels before sleep and reduced levels after sleep compared to controls. Nitric oxide, as a marker of inflammation, therefore, poses an interesting question about the differences in inflammation between the nasal cavity and the pharynx. Carpagno et al. (2008) corroborated the above results with respect to nitric oxide in the oral exhaled air. Goldbart et al (2006) extended these results for paediatric OSA: he confirmed the presence of leukotrienes and prostaglandins in the exhaled breath condensate of children with OSA. Rubinstein (1995) examined the nasal lavage fluid of OSA patients. He showed that the number of cells present in the fluid and the percentage of those cells that were polymorphonuclear leukocytes were greater than in controls (these results were confirmed and extended by Müns et al. (1995)). Furthermore, bradykinin and vasoactive intestinal peptide concentrations were higher in OSA patients than in controls. Both of these results were obvious before and after sleep, indicating that the level of irritation can reach a level that causes residual inflammation to be present throughout the day.

B. The Systemic Response A full discussion of the systemic (endothelial) inflammatory changes wrought by sleep apnoea is beyond the scope of this article. Suffice it to say that plasma levels of TNF-alpha, cytokines like interleukin-6, interleukin-1 beta, C-reactive protein and, importantly, reactive oxygen species are all increased in OSA (Hatipoglu and Rubinstein, 2003). The antioxidant capacity of OSA patients is reduced (Christou et al, 2003) and consequently their susceptibility to cell damage by these reactive oxygen species is increased. Furthermore, the intermittent hypoxia which is a hallmark of OSA has been shown to stimulate the production of even more cytokines as well as nuclear factor kappa-B (Bergeron et al, 2005) which can itself act as a stimulus to systemic inflammation (Htoo et al, 2006). These inflammatory changes can lead to compromised endothelial function systemically (Ip et al, 2004) and can induce or exacerbate cardiovascular morbidities (Tazaki et al, 2004; Lefebvre, 2008). A comparison of some of the main mediators of the systemic and local inflammatory responses is provided overleaf: 403

The dichotomy of local and systemic inflammation will be returned to later in the paper.

Systemic Inflammation

Local Inflammation

↑ C-reactive protein ↑ IL-6 ↑ TNF-α ↑ VEGF ↑ EPO ↑ NF Kappa-B ↑ Reactive O2 Species ↓ Nitric Oxide Adiponectin

↑ IL-6 ↑ 8-Isopentane ↑ Neutrophils ↑ CD4+ T cells ↑ CD8+ T cells*

(EPO = erythropoeitin, VEGF = vascular endothelial growth factor; *mucosal layer-specific; adapted from Bergeron et al, 2005) Table 2.

v. Effects of Inflammation McNicholas et al. (1982) examined a naturally occurring model of upper airway inflammation in humans – seasonal allergic rhinitis. They examined 7 patients who suffered from this condition both during a symptomatic period and also in a non-symptomatic period. In this way, subjects acted as their own control. They demonstrated that during periods of exacerbated rhinitis with consequent nasal inflammation, nasal resistance was doubled. Hence, the number of apnoeic events was increased (from 0.7/hour in the asymptomatic period to 1.7/per hour during the symptomatic period). These apnoeas were also shorter in the asymptomatic period at 6 seconds (compared to over 15 seconds in the symptomatic period). Of course, these symptoms are extremely mild and none of the patients would technically qualify as having obstructive sleep apnoea, even transiently. Nevertheless, this study is vitally important because it demonstrates that even mild upper airway inflammation can lead to an increase in the AHI independent of the other characteristics of OSA that lead to apnoeic events (such as confounding anatomical characteristics or attenuated neural reflexes). It is easy to see, then, how the inflammation seen in OSA can impact on the progressive nature of the condition. Upper airway inflammation in OSA causes an increase in temperature of the upper airway mucosa (Sériès and Marc, 1998). At end-expiration, the tempera404

ture of the uvula was shown to be 0.4°C higher in OSA patients than in controls. Both the posterior pharyngeal wall and the soft palate were around 1°C warmer at end-expiration in OSA patients. At the end of a ten-second voluntary apnoea, the temperature of the soft palate and the posterior pharyngeal wall was also greater in OSA patients than in controls. The fact that these measurements were present after expiration and after an apnoeic episode is significant because these are periods when the moderating properties of airflow past the tissues are less prominent. Thus, these results can be seen to reflect the intrinsic heat-generating capacity of the tissues. One limitation of the above study is that no attempt was made to control for the relative body fat content of each of the subjects. Parapharyngeal fat, especially, may influence the temperature of the mucosal tissues in a manner completely unrelated to sleep apnoea due to its vibrant metabolic activity. There are extensive nerve lesions in the upper airway (Svanborg et al, 2001; Boyd et al, 2004). Under pro-inflammatory conditions, cytokines have been demonstrated to cause profound neuropathy (Creange et al, 1998). Laryngeal inflammation inversely correlates with upper airway sensory function (Payne et al, 2006). In the paper by Boyd et al., discussed above, it was noted that there were elevated inflammatory T-cells in the muscles of the upper airway as well as in the mucosa. They suggest that the denervation changes may partly be due to cytotoxicity by these inflammatory cells. As backup, they cite a study (Harvey et al, 1995) which demonstrates that CD8+ (cytotoxic) T-cells can stimulate peripheral neuropathies. However, in their own paper, they report that the levels of CD8+ T-cells in the muscles of the palate are comparable between controls and OSA patients, which essentially invalidates their proposal. Their other putative mechanisms are unconvincing for nerve damage. Based on a broad review of the literature, their suggestion has much merit, however their argument needs to be more carefully crafted. Friberg et al. (1998) documented extensive abnormalities in muscle fibers and neuropathy in the upper airway of snorers while Spies et al. (1995) demonstrated that, in rats, activated T-cells and TNF-alpha were capable of inducing neuropathy. TNF-alpha can also cause muscle weakness by reducing the responsiveness of individual muscle myofilaments to calcium ions (Reid et al, 2002). Nitric oxide can inhibit skeletal muscle force (Kobzik et al, 1994). Inflammatory infiltrate leads to remodeling of the epithelial layer upper airway. Paulsen et al. (2002) demonstrated that leukocyte infiltration causes disturbance of the anchorage between the upper airway epithelium and sub-epithelial connective tissue. Specifically, they correlated leukocyte infiltration with a profound reduction in staining for cytokeratin 13, which is a crucial structural protein in epithelial cells. Furthermore, there was a loss of connective tissue papillae (vital anchoring structures) at the epithelial-connective tissue interface – a further reflection of the damaging effect of inflammation on the upper airway epithelium. It follows from these results that inflammatory changes cause extensive damage to the airway: weakening of the muscles, impaired neural sensing mechanisms (which will impair the crucial afferent limb of the neural reflexes which seek to 405

keep the airway patent) and enlargement of soft tissue structures. This will lead to increased airway resistance and therefore vibratory trauma. It will also compromise the motor control of the airway. Put simply, it will magnify exactly those conditions that brought it about. Hence, it will lead to more inflammation and subsequently more damage to the upper airway. This is a situation of positive feedback, which means the condition will perpetuate and aggravate itself. Thus, inflammation plays an important part in the progressive, protean nature of the condition.

VI. Effects of CPAP If inflammatory changes are caused by the obstructive sleep apnoea syndrome, it must follow that targeting OSA therapeutically causes the inflammation to subside. In order to definitively show that OSA is the root cause, we must see evidence that the inverse is the case: reduced severity of OSA causes reduced severity of inflammation. To paraphrase, the intensity of inflammation should be proportional to the apnoea-hypopnea index. Is this evident in the literature? To show this, one must target OSA therapeutically in a way that tackles only the apnoea and not the other concomitant factors such as obesity, smoking or anatomical discrepancies. Luckily, there exists, in practise, a method of doing just this: continuous positive airway pesssure. CPAP is currently the recommended treatment for OSA (Sullivan et al, 1981). It effectively and safely alleviates the manifestations of OSA. In addition, its withdrawal heralds an immediate reoccurrence of these manifestations (Philips et al, 2007). Therefore, it is useful for our purposes. It works by ventilating the sufferer via a nasal mask, applying air at a “titrated pressure” (i.e. a pressure specific for and tailored to each patient) in order to minimise the occurrence of apnoeic events. Unfortunately, CPAP itself induces an early, neutrophil-rich, inflammatory response in rats (due to mechanical pressure exerted by the face-mask) but this is localised to the nasal wall (Almendros et al, 2008). Furthermore, it irritates the nasal passage in a significant proportion of patients: 25% suffer from nasal congestion as a result and 35% suffer from sneezing and nasal drip (Pépin et al, 1995). Therefore, the results of studies involving CPAP and the upper airway inflammatory response must be interpreted with care. The response of systemic inflammation to CPAP garners far more attention in the literature, probably because of its implications in cardiovascular disease. There is bountiful evidence that CPAP alleviates the systemic inflammatory response. For instance, Minoguchi et al. (2006) showed that CPAP reduces systemic inflammation – leading to reduced levels of C-reactive protein and 8-isoprostane excreted in the urine. It also leads to a reduction in the production of oxygen free radicals to normal levels (Schulz et al, 2000). These results are relevant because they demonstrate the effect of CPAP, in principle, on inflammation in OSA. The most convincing account of the effects of CPAP on upper airway inflammation comes from Petrosyan et al. (2007). In this study, an extremely comprehensive examination of upper airway inflammation was performed before and after 1 month of CPAP therapy in 26 patients with OSA and in 19 controls without OSA. 406

They demonstrated that OSA increased exhaled nitric oxide (both nasal and oral), carbon monoxide, 8-isoprostane, and leukotriene B4. Then, they proceeded to show that CPAP convincingly reduced the levels of these inflammatory markers in exhaled air directly in line with its effects on the AHI. It is unsurprising, so, that 6 months of CPAP partially reverses the sensory impairment in the upper airway which is a feature of OSA (Kimoff et al, 2001). This would seem to indicate a regrowth of nerve fibers, which is consistent with an abating of the inflammatory response. Therefore, there is empirical proof that OSA is the cause of upper airway inflammation.

VII. Conclusion Based on evidence documented in this article, five conclusions can be drawn: 1. Inflammation is observed in the upper airway of patients with OSA. 2. OSA causes this inflammation. 3. This inflammation causes profound structural and functional changes which contribute to the pathology of OSA. 4. This inflammation is ameliorated via continuous positive airway pressure, a therapy that specifically combats the apnoeic events defining OSA. 5. The inflammatory response in the upper airway is a legitimate target of treatment in patients afflicted with OSA and therapies directed against it can have tangible, beneficial effects in the clinic. The nature of inflammation in the upper airway: What is the function of inflammation in the UA? Inflammation as a result of repeated trauma is classically thought to be beneficial by causing fibrosis and toughening of the tissues affected. In the case of the muscles that preserve airway patency, it may be that at the outset of the condition, inflammation (and concomitant fibrosis) braces the muscle against the strains it must endure during, and prior to, apnoeic events in sleep. On the same note, perhaps fibrosis of the mucosa makes the tissues more rigid in the face of, and therefore less prone to, excessive vibratory trauma. It is possible that the inflammatory response is both appropriate and useful in the early stages of OSA. However, it is likely that with long-term trauma (in the order of years), the inflammatory response becomes excessive and starts to mediate compromising changes of the airway. A central question is whether inflammation of the upper airway arises as a result of OSA, or if OSA arises as a result of inflammation of the upper airway. The initial genesis of OSA is unlikely to be due to inflammation, in the majority of cases. Yet, it almost certainly contributes to the progression of the condition through its deleterious effects on nervous tissue, muscular tissue or constriction of the airway via expansion of soft tissue structures. 407

The local and systemic inflammatory responses A recurring theme in the literature is that of the local versus systemic inflammatory response. One could easily leave with the impression that effects localised to the upper airway are somehow separate from global effects in the organism. On what basis should it be postulated that the inflammation seen in the upper airway is immune to systemic response? This would be quite a bizarre notion given the veritable cocktail of damaging mediators coursing through the bloodstream of a patient with OSA. Furthermore, there are reactive oxygen species present in the blood which both recruit neutrophils and cause direct tissue damage with an inevitable inflammatory adjunct. Based on a review of the literature, I suggest that the inflammatory response seen in the upper airway is a reflection of both local and systemic factors. The systemic inflammation pervades the whole body, by definition, and this includes the upper airway though this is partially masked by local inflammation. The Boyd paper, referenced above, triumphantly proclaimed that even within the upper airway there was compartmentalisation of the inflammatory response. It did not highlight the fact that there was almost certainly effluent cellular infiltrate from one area permeating into an adjacent area. In the context of this paper, the areas in question are the muscular and mucosal layers of the soft palate. Any given tissue in a patient with OSA must suffer from the intermittent hypoxaemia brought about by sleep. A paper by Veasey et al. (2004) showed oxidative damage of the motor nucleus of the hypoglossal nerve in OSA. The hypoglossal nerve innervates pharyngeal dilators and sleep-related decrements in activity of this nerve are central to obstructive events in OSA. But while the hypoglossal nerve will be more active than other nerves during periods of hypoxaemia (and therefore, more prone to hypoxia), its damage will, in principle, be comparable to damage exhibited in nerves systemically. Nervous tissue is profoundly affected by OSA. Now, nerves have a nutritional as well as an electrophysiological/functional relationship with the muscles they innervate. It follows that neuropathy will lead to damage and inflammation in muscle because of lack of stimulation and a loss of nutrition. Therefore there is direct and also an indirect effect of hypoxia on muscle tissue systemically. Again, this does not exclude the upper airway. Petrof et al. (1994) were able to show that muscle fiber type transitions are localised to the upper airway in dogs with OSA (the English bulldog – a naturally occurring model of OSA). They did this by comparing two prominent upper airway dilators with a muscle obscure to the upper airway – the anterior tibialis. They also claimed that damage and fibrotic change was localised to the upper airway musculature in experimental models. In fact, there was quite a marked increase in peripheral muscle damage. I notice an unmistakable increase in damaged fibers in the anterior tibialis muscle in their experimental animals. A perusal of “figure 2” from their paper reveals that the bulldogs had over 3 times the proportion of damaged fibers that controls had. The authors dismiss this as statistical insignificance but I feel this deserves more attention than they afford it. This damage may 408

be due to inflammation and this would suggest that muscles are damaged on a system-wide basis; hence damage in the upper airway is partly a reflection of the systemic response. The systemic and local even share a common mediator – interleukin-6. Furthermore, all of the remaining mediators involved in either response are known to stimulate different mediators, in turn, both directly by acting as communicating molecules and indirectly by causing tissue damage. In any case, it has long been established that OSA indirectly causes a whole host of systemic conditions (one need only look at the cardiovascular complications inflicted by OSA). Naturally, there are differences in inflammatory response between areas of the body, but this should not preclude us from recognising the overlap. I am not suggesting that systemic inflammation has a pivotal role in the upper airway, but if we are to be serious about exploring the inflammatory profile in OSA, it must not be ignored.

Further study There are bountiful opportunities for further study in the area of upper airway inflammation in sleep apnea as there are many gaps in our knowledge: 1. There is an obvious failing in all of the studies that profile the inflammatory response in the tissues of the airway: they are cross-sectional studies. And they are cross-sectional in two ways, which is something that is not pointed out often enough in the literature: • They take literal cross-sections of tissue for examination by microscopy and immunohistochemistry. This is flawed because as far as I know, there has been little attempt made either to ensure that the sections are derived from corresponding layers of tissue between experiments or to make sure that sections represent a spectrum of muscle layers. Both of these types of experimentation are important, in my view. • They are cross-sectional in terms of time i.e. they document the inflammatory response at only one distinct moment. I have found no longitudinal studies on upper airway inflammation. In human studies this is inevitable because tissues can only be obtained at the time of surgery or death. However, in animal models, such as the popular rodent model, it would be both possible and useful to examine the inflammatory profile over a period of time to better understand the progression (and rate) of the inflammatory response. Of course, both of these imply a greater intensity in terms of numbers of subjects and therefore greater cost, which is an understandable deterrent to pursuing them. 2. As I alluded to above, it should be examined if the inflammatory response is initially protective in the upper airway, as it is in other tissues. 3. We should attempt to answer the question as to whether treatment with anti-oxidants would yield beneficial results. This may well attenuate the oxidative stress endured by tissues of the upper airway in sleep apnoea, and so reduce in409

flammation. This question has relevance both for the local and systemic response. 4. Follow up studies should be performed to the Petroysan paper to more fully account for the changes in upper airway inflammation caused by treatment with CPAP. 5. Studies to explore further avenues of diagnosis for OSA, using the inflammatory response as a surrogate, should be undertaken. On March the 3rd of this year, the FDA approved the use of a handheld device (the Niox Mino) for use by primary care professionals in the diagnosis of inflammatory airway disease, specifically asthma. It measures fractional exhaled nitric oxide. Nitric oxide is a prominent component of airway inflammation in asthma and, as has been established above, in OSA. It is very possible that this device, or a similar one, could make a valuable contribution to the diagnosis of OSA which, at present, remains difficult and cumbersome. Furthermore, other inflammatory markers (interleukin-6, interleukin-10, 8-isoprostane and TNF-alpha) have been demonstrated to be a reliable diagnostic tool in assessing the severity of OSA (Li et al, 2008 (2)). It would be a tremendous clinical advantage if there were a device – for routine primary care use – that could assess the levels of these markers in breath condensate. 6. Finally, and in my opinion most importantly, we should examine to what extent the systemic inflammatory response impacts the local response. In the manner of the Petrof paper, sites distant from the upper airway should be investigated for damage of muscle and other tissues and for the presence of inflammatory mediators because this would allow us to deduce a similar effect on the upper airway. It is almost certain that the upper airway feels the echoes of the systemic inflammation but that these are muffled by the local response. I feel that this is indubitably important in the pursuit of an exhaustive characterization of upper airway inflammation; the pursuit of rigorous science.

410

411

NURSING PANEL

•

judging panel Prof. Kathy Murphy (NUI Galway) – Chair Prof. Eileen Savage (University College Cork) Dr. Abbey Hyde (University College Dublin) Dr. Bernie Quinlan (University of Limerick) Judges’ Comments Winner 1 This work focused on health promotion strategies for men with erectile dysfunction. The essay examined in-depth how health promotion strategies to be used to help men with this problem. It was well-researched, used a very good range of literature and was applied to practice. The work was original, particularly well written and well beyond what could be expected of an undergraduate student. The panel were impressed by the student’s capacity to discuss abstract theories, make sense of them and apply them in practice. The essay was analytical and the panel felt the student had the capacity to do really well in the future. Winner 2 This work focused on the key components of nursing care. It consisted of a concise analysis of what nursing is and the implications of this for mental health nursing. The literature in this area can be obtuse but this student was able to demonstrate a very good understanding and the ability to synthesise this. The work was very well-informed and referenced. The student demonstrated a high level of analytical ability and was able to apply complex concepts to practice. This work was impressive and well beyond what would be expected of an undergraduate student.

412

N U R SI NG

Men’s health promotion strategies & erectile dysfunction Maria Jarosinska

Introduction he purpose of this paper is to discuss the relevance of health promotion strategies to encourage optimal health and well being in the adult male. In order to understand the current situation regarding men’s health and the need for specially designed health promotion, this paper will first discuss how men react to illness and their health seeking behaviour. A brief explanation of what health promotion entails will then be outlined leading to a macroscopic focus on Erectile Dysfunction (ED). From review of the current literature there is a dearth of research literature on ED. In view of this the author asserted that it was imperative that this topic be highlighted by examining its impact on men’s overall mental and physical health. This paper aims to provide global epidemiology rates to highlight its incidence and prevalence rates. Finally a discussion on how health promotion strategies regarding ED could target and reach men will be offered. Men often accept symptoms of ill-health as part of aging despite the anxiety these are causing them (Cunningham-Burley et al, 1996). Thus many men delay seeking help when they are ill and often only do so when they consider themselves old enough to be worried. Irish statistics show that women live on average five years longer then men despite the life expectancy at birth increasing significantly for both men and women over the past few decades (Central Statistics Office, 2004). To understand this inequality an insight into what it is like being a man in the modern western world is needed. Courtenay (2000) explains that the majority of men support the cultural belief that their body is structurally more efficient and 413

superior to women’s and that caring for one’s health is considered feminine. Therefore they will refrain from seeking help believing that powerful men are those for whom health and safety is irrelevant. White (2006) agrees that as well as being biologically different, men are also brought up into a different social world. Embarrassment, fear, a threat to masculinity and guilt over using an under-resourced health system have been shown to cause barriers in men’s health seeking behaviour (George & Fleming, 2004). In view of this fear of being regarded as non-masculine it is reasonable to believe that an issue like ED poses great threat and anxiety. It is likely to lead to huge psychological implications and as men find sexual and mental issues the hardest to discuss with their doctors the need for health promotion is crucial. The core of health promotion lies in the effort to effect changes in the health behavior of individuals and is achieved through activities in overlapping areas such as prevention, health education and promotion (Downie et al, 1990, Peersman 2001). Central in the goal of health promotion is the concept of empowerment, which enables the individuals to take responsibility and control over their own health (Yeo, 1993). Furthermore it can be divided into primary, secondary and tertiary health promotion. Primary health promotion aims at preventing ill health from arising by promoting healthy lifestyle choices, reducing risk factors associated with illness and thereby improving the quality of life (Ewles & Simnet, 2003). Thus the primary prevention of ED would include promoting weight loss and physical activity as it has been seen to improve sexual function (Esposito et al, 2004). Secondary health promotion is aimed at individuals who might be at risk of or suffering from illness by preventing them from reaching a chronic or irreversible stage and restoring their former state of health (Ewles & Simnet, 2003). With regards to ED this would be directed towards men who find themselves suffering from the illness and encourage them to seek treatment as early consultation and support through medical and psychological therapy improves the outcome. Furthermore it might prevent the illness from reaching a stage where the man’s selfesteem is severely affected leading to relationship breakdowns. Tertiary health promotion is aimed at people who suffer from a chronic illness or permanent disability and aims to enhance their potential of healthy living by avoiding unnecessary suffering, restrictions and complications (Ewles & Simnet 2003). Therefore this type of health promotion would be used for men with chronic ED due to surgery, trauma or certain medications. The interventions would include education about mechanical aids such as vacuum pumps, potency drugs and counseling aimed at restoring the man’s sexual life and thereby boosting his self esteem. ED is also known as impotence and described as a recurrent inability to attain or maintain an erection adequate for sexual performance (Steggall 2007). It is a health concern most commonly affecting the older adult as epidemiology rates show that 8 per cent of men in their forties suffer from ED compared to 40 per cent of men in their sixties (McKinlay 2000). Prevalence rates vary internationally with Sweden 414

having the lowest rate of 5 per cent and Japan the highest with 39 per cent (Hatzimouratidis, 2007). In the United Kingdom alone it is estimated that around three million of the male population are affected (Riley 2002). However, it is likely that these figures are highly underestimated as despite the increasing public awareness of the issue less then half of the men affected seek help (Kubin et al 2003). Furthermore, there is a delay in the time between the onset of symptoms and the decision to seek treatment. Up to three and a half years may pass from the initial symptoms until commencing treatment and many patients seek help only when their symptoms have worsened (Steggall et al 2006, Haro et al 2006). A variety of lifestyle choices and psychological factors affect the quality of a man’s erection. These include certain medications, smoking, alcohol consumption, using recreational drugs, negative body image, relationship breakdowns and a lack of trust for the partner (Ralph & McNicholas 2000). It would be worth mentioning all these risk factors when carrying out primary health promotion with an emphasis on the fact that ED can be the first sign of an undetected vascular disease (Jackson 2006). Portraying it as a symptom of an underlying silent disease rather then a personal failure could encourage men to get it investigated as a matter of urgency. Steggall (2006) suggests putting up health promotion posters in the waiting area of health centers, as it will make it clear that it is acceptable to talk about ED with the practice nurse or GP. This will help eradicate the taboo around the subject and serve as a reminder that while there they might as well make an appointment or talk directly to the GP when being seen. Men should also be informed that although potency drugs are widely available through the internet it is much wiser to attend a GP for a prescription as it can be difficult to differentiate between counterfeit and genuine medication (Steggall, 2007). Mass-media also plays an important role in helping men realise they are not alone in suffering from this problem, particularly when respected sports people make appearances discussing it (George & Fleming, 2004). Thus the more macho aspects of society such as sports clubs and work places would have a higher likelihood of reaching men. According to White (2000) any health initiatives targeting men should be non-judgemental, non-threatening, male-focused, creative, willing to go to men, seeing beyond their behaviour and using humour appropriately. Richardson (2004) found that a close female friend or relative was most likely to influence reluctant men to attend physicians. This suggests that women play a significant role in making men aware of their health as men who have good relations with their significant others would be more likely to acknowledge the problem, seek help and get treated. Furthermore, there needs to be a willingness to wait for success as some initiatives can take months to be accepted. However, George and Fleming (2004) assert that men are willing to become more involved in their health if the information and services are there to empower them. Therefore, health promotion should not try to pressure men into seeking help, as it is more likely to be successful if men are allowed to make their own choices. 415

Conclusion This paper has discussed the importance of health promotion to improve the health status of adult men by drawing upon ED as a male specific problem. It has discussed men’s health seeking behaviour followed by a definition of what health promotion entails at primary, secondary and tertiary levels. The discussion then lead onto a brief outline of what ED is and how it affects men’s mental and physical health. From the evidence provided in this essay it is clear that all men are at risk of temporary or long lasting health issues due to their reluctance to seek medical assistance. Therefore, it is imperative to address specific issues through specially designed health promotion targeting men so that they are encouraged to seek medical help and thereby achieving optimal health and well being.

416

N U R SI NG

Define nursing & discuss what you consider to be the key components of nursing care Geraldine Galand

his paper will survey the field of nursing from the 1850’s, when it was established as a formal theory and practice by Florence Nightingale, up to the present. The writer will define nursing and discuss care, therapeutic relationship and the nursing process as key components of nursing care. Nursing as a vocation, or calling, was practised by religious orders during the European Middle Ages (Taylor et al., 2008). However, according to the Oxford English Dictionary (1989), the first use of the word nursing, in reference to a profession occurred in 1860 in Florence Nightingale’s “Notes on Nursing;” in fact, Nightingale developed the framework for modern nursing and insisted on proper education for nurses. She realized the important part played by hygiene and environment in the maintenance and restoration of health. The concept of caring for the patient as a whole – as a person – is evident in her care of the soldiers in the Crimea. As well as tending to their wounds and illnesses, she paid attention to their interpersonal needs. Nightingale offered the soldiers the opportunity to learn to read and write, thus making it possible for them to maintain contact with families and loved ones. Those relationships were further enhanced by Nightingale setting up a Money Order Office which enabled the soldiers to send their wages home (Dossey, 2000). A hundred years after Nightingale’s “Notes,” Henderson (1960), observing that there was no international definition of nursing, offered the concept of “the unique function of the nurse.” She explained that the nurse can assist the patient 417

in becoming well by aiding him in the performance of tasks to restore his sense of health and well-being. Henderson offers fourteen “basic components” by which the nurse helps the patient maintain all basic activities of living; for example, assistance with breathing, alimentation, elimination and hygiene. It is important to note that the idea of nursing has continued to mature, and now enjoys a more substantial, broader definition. An Bord Altranais (2000) offer such a definition, quoting the World Health Organization and International Council of Nurses in “The Scope of Nursing and Midwifery Practice Framework: Nursing helps individuals, families and groups to determine and achieve their physical, mental and social potential... Nursing promotes the active involvement of the individual and his or her family, friends, social group and community, as appropriate, in all aspects of health care...Nurses share with other professionals and those in other sectors of public service the function of planning implementation and evaluation to insure the adequacy of the health system. (ABA, 2000)

Caring is an intrinsic part of nursing, but is not easily defined; Kyle (1995) suggests that caring is an invisible component of nursing. Henderson et al (2007) conducted a study of patients’ assessment of their nursing care. The study showed that patients felt cared for when nurses responded to their individual needs in a timely fashion. This suggests that caring is a feeling, reactive to a concrete action of the nurse; for example, changing the sheets when a patient is anxious and perspiring heavily. Caring is experienced when the patient perceives genuine interest on the part of the nurse. “The Scope of Nursing and Midwifery Practice Framework,” when enumerating the values that should underpin nursing, begins by asserting that the best interests of the patient and highest quality of care should be “foremost” (ABA, 2000). Patients’ sense of self worth and can be increased if they perceive from the care received that they are not a burden to the nurse but are part of a joint treatment endeavour with the nurse (Taylor et al., 2008). Being involved in their own care plans and in setting of goals desired is likely to ensure greater participation by the patient in the treatment process. Showing respect for patient choices and being supportive helps further the connection between the nurse and patient and helps build trust between them (Forrest, 1989). “Caring is nursing, and nursing is caring” (Leininger 1988, p. 83). However, caring for others can be an emotional burden for nurses. Nurses also need to be cared for; and so support from fellow staff, and being part of a team, are important to a nurse’s sense of wellbeing, and can improve her capacity for caring. Nursing staff need their efforts of good care giving to be recognised by their supervisors. And supervisors who are perceived as caring towards patients and their families, and supportive and sincere with staff, have a positive effect on morale, which is benefi418

cial to all concerned (Forrest, 1989). Another important aspect of caring is the nurse’s establishment of a working therapeutic relationship. This is a helping professional relationship within which patients’ specific needs are met and a sense of trust can be built. There are three basic characteristics which define this relationship: it is interactive, with both the nurse and patient participating to the extent of their ability, there are specific goals to be met within a certain time frame, and both parties have responsibilities within the relationship. However, the nurse is professionally accountable for the outcomes and the means by which they are achieved. Additionally, nurses need to be sensitive to a patient’s physical, mental and emotional barriers when establishing communication. Anxiety, fear or something as simple as a full bladder can have a negative influence on communication (Taylor et al, 2008). Within this therapeutic relationship, perhaps the most essential skills for the nurse to develop are listening, restatement and clarification. Only the patient can tell the nurse exactly how he is feeling and what his thoughts and perceptions are. Restating or paraphrasing what the patient is saying indicates that the nurse is paying attention and actively listening. Clarification occurs when the nurse and patient are able to put into words what the patient is feeling. Feelings are not always easy to verbalise, but something not understood by the nurse cannot be let pass or ignored. The nurse can encourage clarification with a simple question, for example, “can we go over that again?” (Stuart and Laria, 1998). Developing a working therapeutic relationship is important in all areas of nursing but is a major component in the area of psychiatric nursing, as much of the treatment process involves verbal communication concerning the patients thoughts, feelings and experiences (Stuart & Laria, 1998). And while touch is described as a basic means of non-verbal communication, Stuart and Laria (1998) note that touch should be used “judiciously,” as patients may be sensitive to issues of closeness. There are three phases to a therapeutic relationship: orientation, working, and termination. In the orientation phase the nurse establishes the terms of the relationship and invites the patient to participate. It is important that the nurse introduces herself, and, as well, asks the patient how he wishes to be addressed. The terms of the relationship are agreed upon: these include frequency, duration, location and goals. An important part of the orientation phase is clarifying to the patient the terms of confidentiality. The nurse orients the patient about the facility and its routines. The working phase is normally the longest phase. At this point the nurse and patient are working together to achieve their agreed-upon goals. Therapeutic relationship enters the termination phase when the end of the initial agreement is reached. Irrespective of the outcome, termination is difficult for both the patient and the nurse (Taylor et al, 2008). The nurse is one part of the treatment team, and the nurse’s therapeutic relationship described above is only one component of the team’s relationship with the patient. However, she is an important part; An Board Altranais refers to nurs419

es as the “cornerstone” that creates links between team members from different disciplines involved in looking after the patient (ABA, 2008). Each member has a specific role but the very notion of “team” indicates that all the members are interdependent. For example, the nurse relies on the doctor to provide an accurate diagnosis and appropriate intervention; the doctor trusts the nurse to provide total care for the patient during treatment and until optimal health is restored to the patient. The nurse has the most enduring and substantial therapeutic relationship with the patient (Faulkner, 1996). Within the hospital setting of the psychiatric services, nurses provide considerable support for people with acute illnesses and “play a significant part in a highly skilled team” (ABA, 2008). The nursing process is another key component of nursing care. “The nursing process is the way one thinks like a nurse” (Murray & Atkinson , 1994, p.1). The aim of the nursing process is to help nurses develop a plan of care suited to a patients individual needs. It is a five step plan consisting of assessing, diagnosing, planning, implementing and evaluating the strengths and needs of a patient, to help the patient return to an appropriate level of functioning (Lindberg et al, 1998). At the assessment stage, the nurse gathers information relating to the patient and their needs. This is obtained from the patient, the nurse’s own observations, the patient’s family and the patient’s health chart. From this information, a nursing diagnosis is reached. Based on this diagnosis, the nurse and patient agree on specific, realisable goals to be attained. Implementation involves putting this plan into action; and evaluation measures the success of the plan. Finally, the term “process” refers to the fact that this is an ongoing, continuous activity between the nurse and patient ( Lindberg et al, 1998). There are various models within which the nursing process may be carried out. Walsh (1989) differentiates clearly between the nursing process and a nursing model in his definition: “a model tells us what nursing care should be like, the nursing process describes how it should be organised” (Newton 1991, p. 7). The Roper, Logan & Tierney model identifies “twelve activities of living;” these include breathing, eating and drinking, mobilising and working and playing. If any one or more of these is compromised, nursing intervention may be required. For example, to be unable to mobilise oneself due to a broken limb can affect other activities of living, such as working, playing and sleeping. The nursing process would be used as described above to assess the patient’s needs; to diagnose the needs of the patient in relation to all activities of living that are affected; to plan and implement care; and to evaluate the outcomes (Newton, 1991). In conclusion, this paper has shown that from the 1850’s, when Nightingale demonstrated that nursing can be carried out in an organised and professional way to benefit patients, nurses have responded by nurturing that professional concept to the point that today there is an international definition and accepted body of components that allows the process to be carried out systematically by nurses as part of a interdisciplinary team. 420

If Florence Nightingale came to NUI Galway School of Nursing campus today – attended lectures, talked with students, visited the library – she could be satisfied that her work had been well done. She would see that nurses – men as well as women now – practice a theory based profession and have become, as An Bord Altranais declares, “the cornerstone” of a team-based medical care paradigm.

421

PHARMACY PANEL

•

Judging Panel Prof. David Jones (Queen’s University Belfast) – Chair

422

PH A R M AC Y

Analysis of the p53 tumour suppressor protein activation in Xenopus embryos Lynne O’Shea

Introduction

Xenopus general development enopus laevis, the African clawed frog has been a standard model for development for many years. This is due to the fact that Xenopus embryos develop at an extremely rapid rate. During development the Xenopus egg is comprised of two distinct halves; the animal pole and the vegetal pole. Fertilisation occurs within the pigmented animal pole. When the sperm enters the animal hemisphere, it causes a cytoplasmic rearrangement called the cortical rotation (towards the point of sperm entry). Xenopus development can be divided into cleavage, gastrulation and neurulation, and these stages are completed within 24 hours at room temperature. Nieuwkoop and Faber developed a numerical stage series to distinguish between the different stages in Xenopus development. According to this stage series, stage 8 is the mid-blastula, stage 10 the early gastrula, stage 13 the early neural and stage 20 the end of neurulation (Gilbert, 2006). Cleavage occurs in the embryo following fertilisation (more rapidly in the animal pole) and continues rapidly and synchronously for 12 divisions, at this point the mid-blastula transition (MBT) occurs. The rate of cleavage then slows down 423

and the synchrony of the cell divisions is lost. The MBT is the time at which transcription of the zygotic genome commences (Newport and Kirschner, 1982 a + b). Gastrulation follows the MBT, this is a phase of morphogenetic movements when the tissue around the equator called the marginal zone, becomes internalized through an opening called the blastopore. This then distinguishes the typical three-layered structure of the outer ectoderm, middle mesoderm and the inner endoderm. The start of gastrulation is indicated by the development of the dorsal lip of the blastopore. The blastopore becomes elongated laterally and then becomes a complete circle. Early Gastrula Transition (EGT) is the second transition period in Xenopus embryos and occurs a few cycles after MBT. EGT is characterized by a significant lengthening of the gap phases of the cell cycle, this lengthening may reflect the gain of additional checkpoints or other cell cycle properties which may be necessary for differentiation (Wallingford et al., 1997). The next stage of development is called the neurula, where the ectoderm on the dorsal side becomes the central nervous system. The neural plate becomes visible as a keyhole-shaped region bordered by raised neural folds and covering a large proportion of the dorsal surface of the embryo. These folds then rise and move together to form the neural tube which later closes and becomes covered by the ectoderm, now called epidermis. During and after neurulation the body becomes elongated and the whole trunk and tail region are derived from the posterior quarter of the neurula. This is driven by a continuing process of cellular intercalation both in the notochord and in other tissues also. Together the neural tube, notochord and somites are known as the dorsal axis.

33 Gy

Apoptosis Induced MBT

St.1

St. 8

Fertilization Cleavage

St.10.5

St.16

St.21

Gastrulation Neurulation

Figure 1: Apoptosis induced by !-irradiation at Stage 10.5 during

Xenopus development. along the develbottom Fig.1. Apoptosislaevis induced early by γ-irradiation at Stage 10.5The duringarrow Xenopus laevis early represents development Xenopus laevis. DNA laevis. damage opment. The arrowthe alonglinear the bottom represents theoflinear development of Xenopus !-irradiation causes cell cell cycle arrest bysynchronous synchronous DNAinduced damage by induced by γ-irradiation causes cycle arrestfollowed followed by apoptosis at Stage (Anderson et al., 1997; Hensey Gautier, 1997; and StackGautier, and apoptosis at 10.5-11. Stage 10.5-11. (Anderson et al.,and 1997; Hensey Newport, 1997;1997) Stack and Newport, 1997) 424

Radiation Response Ionizing radiation induces a large variety of DNA lesions, including

It has been well established that if developing Xenopus embryos are subjected to irradiation pre-MBT then apoptosis is induced in the embryo at a stage postMBT, usually between Stages 10 and 11 (Figure 1). Radiation Response Ionizing radiation induces a large variety of DNA lesions, including single- and double-strand breaks (DSBs), and base and sugar damage (Hutchinson, 1985; Ward et al, 1988); among them, DSB is the most dangerous and are generally considered as the typical form of DNA damage resulting from irradiation. In response to DNA damage, checkpoints engage the signal transduction cascade, which consists of sensors, transducers and effectors (Zhou and Elledge, 2000). Sensor proteins recognize the damage and probably act on DNA damage directly through a group of proteins including RAD9, RAD1, RAD17, HUS1 and a few others. The transducers are downstream signaling proteins that include kinases such as ATM/ATR in mammals, which are capable of phosphorylating target proteins known as effector kinases, including CHK1/CHK2. The outcome of this signaling cascade is cell cycle arrest coupled with DNA repair, which in turn leads to cell survival or alternatively apoptotic cell death in cases where repair is not possible. Xenopus Radiation Xenopus embryos undergo a period in which they are resistant to radiation; this is during the first 12 divisions. During this stage the cells in the embryo are resistant to radiation and neither cell cycle arrest nor apoptosis is produced, as would be the expected radiation response. However, as the development of the embryo continues radiation sensitivity is generated in the developing embryo. This in turn causes the activation of a cell death pathway (Hensey and Gautier, 1997). The shift from radio-resistant to radio-sensitive may be induced by the translocation of p53, a DNA damage checkpoint protein, from the cyctoplasm to the nucleus within the cell. This in turn results in an increase in activated p53 in the embryo (Stancheva, Hensey and Meehan, 2001). One way of studying p53 is to knockdown the protein and compare the results obtained this way to those when p53 is intact. This is a good established way of determining protein function.

Transcription factor p53, what it is & what it does: During development some cells must ‘die’. Unwanted cells are eliminated during embryogenesis, metamorphosis and tissue turnover. This process is called programmed cell death or apoptosis. Apoptosis is an important mechanism for removing tumorigenic cells. The ability of the tumor suppressor protein p53 to trigger apoptosis is a key defence against cancer. p53 (named after its molecular size in humans) is the most important tumor suppressor (O’Brate and Giannakakou, 2003). More than half of all human cancers either have lost p53 protein or have mutations in the gene, making loss of p53 by far the most common alteration in 425

Aging

Develop m-ent

p53

Apoptosi s

Cell Cycle Arrest

Fig. 2. Tumor suppressor gene p53 and its functions; development, cell cycle arrest, apoptosis and aging. human cancer and therefore a prime target for treatment. All normal cells have low levels of p53. p53 becomes activated by DNA damage (Lane, 1992). Abundance and activity of the tumor suppressor p53 are regulated by many different post-translational modifications. These include phosphorylation, acetylation, ribosylation, O-glycosylation, ubiquitination and SUMOylation (Melchior and Hengst, 2002). Two types of event can be triggered by the activation of p53: cell cycle arrest or apoptosis. Being “guardian of the genome” if possible p53 will trigger a checkpoint to allow any damage to be repaired, however if this is not possible then the cell will be destroyed by apoptosis. During apoptosis the cell becomes more compact, blebbing occurs at the membranes, chromatin becomes condensed and DNA is fragmented. This is the most severe way that p53 can guard the genome. Cell death will prevent subsequent replication of DNA mutations if repair is not possible.

Xenopus p53 Fortunately, p53 is evolutionarily conserved (Figure. 3) (Soussi et al., 1987). This 426

Fig.3. Sequence comparison of human p53 with Xenopus p53. Common sequ�� ence is indicated by a black background, linking the sequences together. 427

makes it possible to study p53 regulation and activation in Xenopus embryos. As with human p53, Xenopus p53 (Xp53) plays an important role in development. No transcription occurs during early development of the embryo before the 12th cell division. The protein is synthesized in excess during oogenesis and kept in the cytoplasm as opposed to the nucleus. The cytoplasmic localization at this stage is thought to indicate that p53 is inactive at this stage. The maternal store of p53 RNA is degraded during development and it is thought that most of the oocyte p53 protein store is preserved until the tadpole stage (Tchang et al. 1993). Further understanding endogenous mechanisms of p53 activation is important in the development of p53 as a therapeutic target. Activation of p53 in the transition from radio-resistance to radio-sensitivity in early embryos may prove important. Understanding this ‘switch’ may prove useful in the development of future cytotoxic treatments. Studies on small molecule inhibitors of p53 antagonist proteins have increased the possibility that p53 activation via the removal of its endogenous antagonist (Mdm2) is an attractive alternative to current cytotoxic therapy (Vassilev, 2006).

Morpholinos, anti-sense oligonucleotides: Morpholinos (MO’s) are based on the same concept as DNA binding, which is complementary base pairing which takes advantage of the hydrogen bonds that are formed between the bases of nucleic acids (Heasman, 2002). The substantial difference between MO’s and DNA is that the standard nucleic acid bases are linked to morpholine rings as opposed to deoxyribose rings. Another difference is that the morpholine ring linkage is via phosphorodiamidate groups as opposed to DNA’s phosphates. The use of p53 MO has been well established in the knockdown of p53 in Xenopus embryos. The MO used in the knockdown experiments carried out corresponded to the MO used in the Cordenonsi et al. paper. This MO was seen to exhibit knockdown effects on the protein in Western blot analysis (Cordenonsi et al, 2003). Experimental procedures Materials All chemicals were from Sigma unless noted. The morpholino and control morpholino were from GENETOOLS. Embryological methods Xenopus embryos were obtained by standard methods and staged according to Nieukoop and Faber (1967). Freshly squeezed eggs were fertilized in vitro by brushing with dissected testis, dejellied using 2% Cysteine and irradiated by a 137Cs source to give a dose of 33Gy, using a Gammacell 40 irradiator. Embyos were irratiated at 3.5-4h post-fertilization. Following the first cleavage, at about 1.5 h, embryos were sorted and incubated at 17°C for the remainder of the experiment. 428

binding of other molecules to the sequence in question. This in turn prevents translation and subsequently causes knockdown of the p53 protein.

MO: CTTGGAAGGAGACTCTGGCC G T A C C. Xp53: GCCTCCATAATG G A A C C T T C C T C T G A G A C C G G C A

TGG

Fig. 4. Morpholino sequence matched up against Xp53 sequence. The highlighted ATG represents the start codon. Following fertilization embryos which would undergo micro-injections were transferred to 1x MMR (100 mM NaCl, 2 mM KCl, 1 mM MgCl2, 2 mM CaCl2, 0.1 mM EDTA, 5 mM HEPES, pH 7.8) containing 3% Ficoll and 1x Penicillin/Streptomycin. Injected embryos were subsequently transferred to 0.1x MMR, 3% Ficoll and 1x Penicillin/Streptomycin at St.6-7 (pre-MBT).

Morpholino’s & Micro-injections The morpholino (MO) used in this experiment was a 25 base pair long oligonucleotide and was synthetically made to match with the specific RNA sequence for Xenopus p53 (Xp53) indicated in Figure 4. In this case, the sequence matched by the MO provides a steric block preventing the binding of other molecules to the sequence in question. This in turn prevents translation and subsequently causes knockdown of the p53 protein. Engineering a MO is more complicated than constructing a molecular sequence with complementary base pairs to a target sequence. There are certain rules that must be observed to insure efficacy of the MO in question. These include selecting a target sequence that is no more than 25 bases away from the ATG translational start site. The further the target sequence is away from the start site the less efficient the MO is. In this case the morpholino binds directly after the ATG starting sight. Another important consideration is self-complemen�� tarities, that is, bases within the structure should not be able to bind to each other causing the sequence to overlap. To increase water solubility no more than a total of 9 guanines or 3 continuous guanines are allowed in a 25 base MO. In order to control against any results that may be caused by the injection itself as opposed to p53 knockdown a control MO was used. This is an oligonucleotide that does not bind to any specific sequence. Embryos micro-injected with control MO were used as a baseline to compare the embryos micro-injected with p53 MO against. This takes into account any results caused by the actual injection as op429

posed to p53 knockdown. The MO and control MO were administered to the selected embryos via microinjection. A tapered needle called a micropipette is used to perform micro-injections. It is created by using a pipette puller. The pipette puller heats a glass capillary tube to its softening point and then a weight is dropped to pull and elongate the softened glass. This causes the capillary tube to taper at one end. Under a microscope using a scalpel and a forceps the tip of the needle is broken. This tapered needle is then filled with mineral oil, which is highly unreactive. The micropipette is then placed in the microinjection apparatus. Using the apparatus, a plunger�� expels 5µL of mineral oil from the micropipette. This allows the same quantity of MO or control MO to be backfilled into the micropipette for microinjection into the embryos.

Embryonic death & survival curves The morphological criteria defining embryonic death was the change in color and appearance of the embryo. The animal pole turns an opaque white, and non-adherent cells, or cell fragments and yolk platelets from lysed cells, could be seen to collect within the vitelline membrane space, giving a globular white appearance to the embryonic surface. Embryos were scored as dead when greater than 50% of the cells within an embryo appeared white. Thus, percentage survival refers to the percentage of surviving embryos in a population, i.e. embryos that do not turn white, or embryos that have less than 50% of their surface appearing white. Xenopus Extracts Xenopus crude cytoplasm extracts were made by snap freezing the embryos at a given stage, using liquid Nitrogen in eppendorfs. These embryos were then gently ground using a pestle. Once this was complete the embryos were then centrifuged at 4ºC at 1610g for 10 minutes. This causes the embryos to be separated into 3 defined layers: lipid (yolk), cytoplasm and pigmented debris. The cytoplasm is then removed using a pipette and placed into a new eppendorf in order to under to undergo a 2nd ‘clarifying’ spin, being centrifuged under the same conditions as the primary spin. Following this spin the sample should again be separated into 3 layers again, however the quantity of the lipid layer and the pigmented debris layer is remarkably reduced. The large cytoplasm layer was removed and isolated for subsequent analysis. Separation of Proteins in extract Following the crude cytoplasm extract a Bradford assay was carried out to determine how much protein was present in the sample. This is essential to ensure a consistent quantity is used for loading during subsequent SDS-PAGE and Western blot analysis. Following the Bradford assay the samples were prepared for loading 430

into the SDS-PAGE. This involved diluting the extract using PBS. Following the dilution SDS-sample buffer was added to the sample in a 1:1 ratio. The SDS sample buffer is an anionic detergent which denatures the protein and also applies a negative charge to each protein in direct proportion to its mass (approximately 1.4g SDS per 1.0g protein). Adding SDS unfolds the protein which means proteins with similar molecular weights but differences in folding patterns exhibit similar migration through the gel. This is because the proteins are now separated solely by molecular weight. Following the addition of SDS-sample buffer to the extract, the sample is then heated at 86ºC for 10 minutes. Heating the sample is used to help denature the protein. At this stage the samples are ready to be loaded onto the gel. In addition to loading the samples, markers which indicate specific apparent molecular weights are also loaded onto the gel. T h e gel is then set up, using 1x Running Buffer made from 10x stock (0.25M Trizma base, 1.92M Glycine, 1% SDS made up to 1L with distilled water). An electric current was then passed through the gel, from the top cathode to the bottom anode. This results in the proteins being separated in accordance to their molecular weights.

Western blotting After proteins have been separated by electrophoresis, individual protein bands, in this case p53 can be identified by using antibodies that are specific to that protein. However, in order for the antibodies to bind its target, the proteins in the gel must first be transferred from the gel to a nitrocellulose membrane. We used the semidry method of Western blotting to transfer our proteins. This involved sandwiching the gel and the nitrocellulose membrane between 8 sheets of blotting paper. This sandwich was soaked in Transfer buffer (25 mM Trizma base, 192mM Glycine, 20% Methanol, 0.1% SDS, pH 8.8). An electric current was run through the set up, subsequently transferring the proteins in the gel to the nitrocellulose membrane. Antibody detection Following the transfer of the proteins to the membrane, non-specific binding sites were blocked by immersing the membrane in 5% milk, 1x PBS 0.3% Tween for 1 hour. Following removal from the blocking buffer, the membrane was placed in a primary anti-body overnight (15 hours). The primary antibody used in this case was antipeptide C2 antibody. This was raised against the COOH2 peptide of the Xp53 sequence, as indicated in Figure 3. On removal from the primary antibody the membrane underwent 3 x 10 minute washes with PBS 0.3% Tween. Once the washes were complete the membrane was incubated in HRP goat anti-rabbit secondary antibody for 30 minutes. This was followed by another set of 3 x 10-minute washes with PBS 0.3%Tween. 431

The protein bands were then detected on the membrane using Amersham ECL Western blotting detection reagents. Autoradiography film was exposed to the ECL prepared membrane and developed in order to detect any probed p53 protein bands (this stage is carried out in a dark room).

Results: p53 present in Xenopus Embryos A Western blot analysis was performed using extracts from embryos collected at stage 10.5-11. The results showed that p53 was present in the embryos just below 51kDa and this corresponds to the apparent molecular weight of Xenopus p53 (4648kDa). It was also found that another band was consistently detected using Western blot analysis at a higher molecular weight. It is though that this may represent a variation of the p53 protein, such as phosphorylated, acetylated or ubiquitinated p53. γ-irradiation and Xenopus Embryos It was found that γ-irradiation administered at Stage 5 of development induced apoptosis in embryos when they reached Stage 10.5- Stage 11 (28 hours post fertilization, with periods of 17°C incubation). The apoptosis was rapid and synchronous. Development of the embryos slowed down prior to the stage at which apoptosis was induced. It took over 60 minutes at room temperature for the embryos to develop from Stage 10 to Stage 10.5 (Figure 5a). The damage inflicted on the embryos by the γ-irradiation was too severe to be repaired and apoptosis is necessary in this case (Figure 5b). A sample of γ-irradiated embryos (n=30) and the control, non-irradiated embryos (n=30) were collected at Stage 9.5-10 and extract was made. When these extracts were subsequently analysed by Western blot for the presence of p53, no significant difference was seen between the two samples (Figure.5c). This indicates that γ-irradiated does not affect the quantity of p53 in the embryos. The effect of p53 morpholino (MO) injection on Xenopus laevis embryos and apoptosis p53 MO was microinjected into both blastomeres of a selection of 2-cell embryos. The sample of injected embryos (n=40) was matched with a corresponding sample of non-injected embryos to served as the control (n=40). The embryos that were microinjected with the MO developed at a slower rate of development from Stage 8 onwards. This corresponds to the time when the MBT occurs. The non-injected embryos were collected at Stage 9.5-10 at 27 hours post fertilization, whereas the MO injected embryos were collected at the same stage 28 hours post fertilization. Apart from the different time frame of development, the development of the embryos seemed to be the same; no other differences were noted at this stage. 432

Fig.5a. Percent survival curve for irradiated embryos. Embryos were irradiated (33Gy) at 4 hours post fertilization, which corresponds to Stage 5. Percent survival refers to the percentage of the population of embryos in which apoptosis had not been induced. Apoptosed embryos were defined by having a white speckled appearance covering greater than 50% of the embryo surface. Apoptosis is induced in the irradiated embryos at Stage 10.5, which corresponds to 28 hours post fertilization. The non-irradiated control embryos are represented by the yellow squares (n=52) and the γ-irradiated embryos are represented by the green triangles (n=54).

Fig. 5b. The embryo on the left shows a non-irradiated embryo during early neurulation, the embryo on the right shows the corresponding irradiated embryo. The irradiated embryo has undergone apoptosis and the animal pole has turned an opaque white, and nonadherent cells, or cell fragments and yolk platelets from lysed cells, can be seen to collect within the vitelline membrane space, giving a globular white appearance to the embryonic surface. 433

Fig. 5c. Western blot analysis of p53 in irradiated (a) and non-irradiated (b) embryos using antipeptide antibody C2. T�� h ere was no significant difference in the band intensity between the two extracts. This indicates γ-irradiation does not affect p53 levels in embryos.

Fig.6. Western blot analysis of p53 in non-injected control embryos (a) and p53 morpholino injected embryos (38.2ng) (b). There is a significant decrease in the amount of p53 present in the morpholino injected embryos compared to the control embryos. This indicates that injecting embryos with morpholino does in fact cause p53 knockdown. Analysis of the embryo extracts using Western blot showed a significant difference in the intensity of the bands representing p53 (Figure 6). The Western blot indicated that injecting the embryos with MO decreased the quantity of p53 in the embryo. From this result it can be concluded that p53 is knocked down in embryos microinjected with p53 MO. However, some p53 remains present in the extract, indicating that p53 is not completely knocked down in the sample. Once it was determined that p53 knockdown was occurring following microinjection with MO, the next step was to determine what affect the MO would have on the survival curve of the embryos following γ-irradiation. In order to get a more pronounced effect than the one exhibited above in Figure 6, a larger amount of MO was injected. The higher concentrations of MO were subsequently administered to Xenopus embryos. This round of injections consisted of 3 gradations of concentration; 153ng (n=40), 229ng (n=40) and 381ng (n=40). The embryos were then subdivided into groups as indicated in Table 1 below. The 153ng MO injected embryos showed only a very slight difference in the time at which apoptosis occurred. The non-injected embryos underwent apoptosis at 434

Group 1 Group 2 Group 3 Group 4

153ng MO injection + irradiation (n=42) 229ng MO injection + irradiation (n=37) 381ng MO injection +irradiation (n=43) No injection + irradiation (n=40

153ng MO injection (n=38) 229ng MO injection (n=43) 381ng MO injection (n=37) No injection (n=40)

Table 1. Different concentrations of MO injections. The non-injected embryos in group 4 served as controls for the other 3 groups. 27h post fertilisation. At this time development in the MO injected irradiated embryos was shown to arrest. These MO injected embryos subsequently apoptosed at 28 post fertilization. (Figure 7a). The 229ng MO injected embryos showed a more significant difference in the time at which apoptosis occurred compared to the non-injected embryos (Figure 7b). Apoptosis was seen in the non-injected irradiated embryos at Stage 10.5-11, at this point the MO injected embryos arrested development. Apoptosis occurred in the MO injected embryos at 29h post fertilization compared to 27h post fertilization in the non-injected embryos. The highest concentration of MO injected, 381ng, appeared to cause some toxic effects which led to the elimination 20% of the embryos by 10h post fertilization. This concentration of MO seems to be too high. This resulted in the MO injected embryos apoptosing at 26.5h post fertilization, this is actually before the noninjected embryos underwent apoptosed at 27h post fertilization. The percentage survival curve showed the results of apoptosis due to toxicity as well as due to irradiation (Figure 7c). The results obtained from the survival curves equated to subsequent Western Blot analysis (Figure 7d). This was carried out on corresponding groups of embryos to the ones analysed above. The embryos were collected for extract at stage 10 and had not undergone irradiation. It was shown that p53 was present in the non-injected embryos, however was not present in the other 3 samples; 381ng MO injected, 229ng MO injected and 153ng MO injected. The lack of p53 in the 381ng injected embryo extract may be due to embryonic death as well as protein knockdown. This high concentration was found toxic during the survival curve analysis of the embryos (Figure 7c). It is known that toxicity is an issue with higher MO amounts (Nutt et al. 2001). Taking the result from Figure 7b we can conclude that the loss of p53 is delaying the apoptotic response. This implicates p53 in the DNA damage responses in Xenopus. 435

100 75 50 25

27 .5

Fig .7a. This represents a survival curve of two groups of irradiated embryos. One group was injected with 153ng of p53, the other group was not injected. It was found that there was a delay in apoptosis being induced in the embryos that were injected with MO. The control embryos apoptosed at 27 h post fertilization whereas the MO injected embryos apoptosed 28 hours post fertilization.

100 75 50 25

.5 26

Fig. 7b. This represents a survival curve of two groups of irradiated embryos. One group was injected with 229ng of p53 MO and the other group was not injected. It was found that the MO injected embryos apoptosed at 29 h post fertilization as opposed to the 27 h post fertilization apoptosis observed in the non-injected control embryos. 436

Fig. 7c. This represents a survival curve of two groups of irradiated embryos. One group was injected with 381ng of p53 MO and the other group was not injected. It was found that at this concentration of MO that toxicity effects were observed in the embryos injected. This led to the embryos gradually apoptosing from 10h post fertilization onwards. This led to the MO injected embryos reaching 0% survival before the non-injected sample.

Fig. 7d. Western blot analysis of p53 in (a) non-injected embryos, (b) 381ng MO injected, (c) 229ng MO injected and (d) 153ng MO injected embryos. The results showed that p53 was knocked down in all 3 MO injected groups and present in the non-injected group (a).

437

Use: Group 1 Group 2 Group 3

Survival Curve

229ng p53 MO injection + irradiation (n=45) 229ng Control MO injection + irradiation (n=36) No injection + irradiation (n=40)

229ng p53 MO injection (n=35) 229ng Control MO injection (n=44) No injection (n=40)

Western Blot Extract 229ng p53 MO injected (n=50) 229ng Control MO injected (n=50) No injection (n=50)

Table 2. Embryos were segregated into 3 Groups; 299ng p53 MO injection, 299ng Control MO injection and Non-injected. All groups were split into irradiated and non-irradiated for survival curve analysis. Separate non-irradiated groups were used to collect extract for Western blot analysis. It was shown above that after performing morpholino experiments with three different concentrations of MO, (381ng, 229ng and 153ng) that 229ng of MO showed the greatest elongation of the time at which the embryos underwent apoptosis. This experiment was repeated as indicated in Table 2. In addition to p53 MO injections embryos were injected with Control MO and an uninjected cohort was also analysed. The survival curve (Figure 8a) showed a dramatic difference between the irradiated p53 MO injected embryos and both the irradiated uninjected and the irradiated Control MO injected embryos. The p53 MO injected embryos apoptosed at 34h post fertilisation. This is compared to the apoptosis induced in the other two groups (Control MO and non-injected) which apoptosed at 28h post fertilisation. The uninjected and Control MO embryos apoptosed at Stage 10.5-11, at this point the MO injected embryos underwent developmental arrest. Subsequent Western blot analysis showed no significant difference for p53 present in any of the three different groups (Figure 8c). This was an unexpected result.

438

100 75 50 25

5 .7 33

5 .2 33

5 .7 27

5 .2 27

Fig. 8a. This represents a survival curve of three groups of embryos. One group was injected with 229ng of p53 MO, the second was not injected and the third was injected with 229ng of control MO. The results showed that following irradiation the non-injected embryos and the control injected embryos died between Stage 10.5-11 at 29h-post fertilization. The p53 injected embryos underwent apoptosis at 34h post fertilization.

Fig. 8b. The embryo on the left (a) shows an irradiated p53 MO injected embryo, the embryo on the right (b) shows th�� e corresponding irradiated Control MO embryo. Both embryos were at 33h post fertilisation, however only the Control MO injected embryo had undergone apoptosis.

Fig. 8c. Western blot analysis of p53 in (a) non-injected embryos, (b) 229ng p53 MO injected and (c) 229ng Control MO injected embryos. No significant difference was seen between any of the groups analysed. 439

Discussion I was able to detect p53 using Western blot analysis and perform survival curve analysis, as previously reported (Hensey and Gautier, 1997; Stancheva, Hensey and Meehan, 2001). No apparent difference was observed between the p53 levels in γ-irradiated embryos and non-irradiated embryos when analysed by Western blot. This is surprising in the context of human p53. Previous studies have observed that p53 is upregulated in irradiated embryos (Laven and Gueven, 2006). One possibility is that the upregulated p53 may carry a post-translation modification (PTM) that has not drifted from the parent p53 in relation to apparent molecular weight. This would mean the upregulation was being masked. There are a few possible ways to verify if this is the case. One would be to use PTM specific antibodies i.e. antibodies that are specific for acetylated p53 etc. Another way to assess the different PTM variants that may be present is to use 2D gel electrophoresis. This would not only separate the protein by apparent molecular weight but also by pH. Each different PTM would have a slightly different pH which would mean they could be split and analysed individually. The third way to investigate this possibility would be to use Mass Spectrometry. This is still highly experimental at the moment but it is possible to detect the different PTM p53’s present by this method. MO experiments showed two interesting results from survival curve analysis. Knockdown of p53 caused a significant shift in survival curve. Unfortunately the Western blots were not consistent, only showing knockdown of p53 in one of the experiments. A gradation of different concentrations of MO were used to distinguish the quantity that would provide the most effective result for survival curve and Western blot analysis. This gradation distinguished the toxic concentration (381ng) at one end of the scale and the non-effective concentration (153ng) at the oppo�� site end of the scale. This experiment distinguished 229ng to be the most effective quantity of MO for survival curve analysis. Subsequent survival curve studies further verified this result. As already mentioned Western blot analysis for these subsequent experiments proved inconclusive, with results varying from apparent p53 knockdown to no effect on p53 knockdown observed. Due to time restraints further analysis by Western blot was not available, however, it may be interesting to carry out further Western blot experiments using an antibody specific to acetylated p53 as opposed to the C2 antibody used. This would indicate whether the p53 targeted by the MO carried the post-translation modification of acetylation. This may account for the variation in Western blot analysis while consistent results were observed from corresponding survival curves. The key experiment to conclusively implicate p53 in this response would be to rescue the phenotype. This would involve overexpressing p53 in Xenopus embryos, and then using p53 MO to knockdown ‘excess’ p53. This could be carried out by concurrently microinjecting p53 and MO into the embryo. However, due to the nature of the MO it may bind the p53 with which it is being co-injected and prevent 440

it being expressed. This obstacle could be overcome by injecting human p53 as opposed to Xenopus p53. Due to the highly conserved nature of p53 between the two species the human p53 should be functionally active within the Xenopus embryo. The MO would knockdown only the endogenous p53 present within the embryo. If the phenotype was rescued in this way it would be evident that p53 is involved in shifting the apoptotic radiation response seen. One possible consideration is the fact that Xenopus laevis has an allotetraploid genome. This may mean that the targeted p53 gene may be represented by two slightly different copies commonly called an “A” form and a “B” form. These two forms of the p53 gene are likely to show little difference in functionality but may vary enough in sequence to prevent the MO from binding effectively. Slight differences in nucleotide sequence can significantly reduce the binding effect of the MO. If this is the case, Xenopus laevis may then require two MOs to completely knockdown the function of p53 (Khokha et al. 2002). A previously well established study carried out observed the knockdown of p53 in MO injected embryos, used only the animal caps from the Xenopus embryos for extract collection and western blot analysis (Cordenonsi et al, 2003). The sole use of the animal caps may be a significant advantage to detecting p53 knockdown. p53 is transcribed in the animal half of the embryo. The MO should block translation of p53. This block of translation which subsequently leads to the knockdown of the protein in the animal cap may be masked in Western blot analysis by the large quantity of p53 already present in the vegetal portion of the embryo. It may prove more effective to use this method of collection as opposed to the whole embryo method used. Accumulating evidence suggests that p53 is important for DNA damage induced apoptosis. Experiments previously carried out in which the transcriptional activity of p53 was inhibited led to non-transcriptional events being solely implicated in the apoptotic response of p53 (Hensey and Gautier, 1997). Ruling out the possibility of transcription dependent apoptosis as the method by which p53 exerts its effect leads to further understanding the radiation response induced. Many subsequent studies in this area have also led to transcription independent apoptosis being nearly solely concerned in this apoptotic action of p53 (Moll et al., 2005). The pathways which are involved in the transcription independent apoptotic response may prove to be a target for future cytotoxic therapies. Recent studies have described two different mechanisms of p53 transcription-independent apoptosis. In one case p53 is localized to the cytosol and in the other p53 is localized directly at the mitochondria. Both these mechanisms cause permeablilization of the outer mitochondrial membrane. This causes the release of cytochrome c and activation of caspase 3 by activating Bax or Bak, the Bcl-2 family members. Activated p53 can translocate to the mictochondrial outer membrane (MOM) and promote apoptosis by interacting with BCL-XL. Subsequently pro-apoptotic f�� actors, such as tBID and BAX are released. Mitochondrial p53 can also release BAK 441

from inhibitory BAK-MCL-1 complexes, this enables BAK-dependent apoptotic cell death. The p53 target PUMA can release p53 from inhibitory p53-BCL-XL complexes. Cytosolic p53 can then promote mitochondrial translocation of BAX and apoptosis (Fuster et al, 2007). A small molecule named pifithrin-µ (PFT- µ) selectively inhibits p53 mitochondrial translocation. This is done by reducing its affinity to BCL-XL and BCL-2, without interfering with the p53 transcription function. PFT- µ has been shown to strongly reduce thrymocyte-cell death induced by γ-irradiation. The use of this small molecule in Xenopus embryo experiments to investigate p53 mitochondrial translocation may prove to be valuable. This inhibitor may prove useful in further understanding transcription-independent p53 activity. Further understanding may lead to the development of possible future therapies. It is thought that PFT-µ could counteract some of the side-effects mediated by p53-dependent apoptosis in tissues such as bone morrow, lymphoid organs and the gut during radiation therapy. This is supported by the fact that it has been shown to rescue irradiated mice from lethal bone-marrow failure (Fuster et al, 2007).

Concluding remarks Further understanding endogenous mechanisms of p53 activation will be important to pursuing p53 activation as a therapeutic target. Specifically further understanding of the switch from radio-resistant to radio-sensitive may prove useful in targeting tumours that are resistant to radiation therapy.

442

443

PHILOSOPHY PANEL

•

judging Panel Dr. Felix Ó Murchadha (NUI Galway) – Chair Dr. Michael Dunne (NUI Maynooth) Dr. Lilian O’Brien (University College Cork) Dr. Paul O’Grady (Trinity College Dublin) Dr. Tim Mooney (University College Dublin) Dr. Jeremy Watkins (Queen’s University Belfast Judges’ Commentary The judging panel agreed unanimously that this was a first class essay, which had publishing potential. It demonstrates both an excellent understanding of Consequentialist ethical theory and the capacity for independent philosophical thought. The essay begins by asking whether Consequentialism with its instrumental emphasis on maximizing the good, can account for the apparently intrinsic value of friendship. Citing a number of critics of Consequentialism, Morris asks whether a Consequentialist can be a good friend. What follows is a thoughtful, thorough and meticulous discussion which attempts to bring defenders and critics of Consequentialism into fruitful dialogue on this issue. The main contributors to the debate are all discussed in a concise but comprehensive manner. With fair and forceful arguments Morriss shows that Consequentialism does not negate the possibility of good friendship, but rather “demands of our friends that they are good for us.” The essay begins with a quotation from Montaigne and demonstrates an awareness of the classical accounts of friendship, which informs the manner in which he pursues the theme of the essay. This essay is very well written, the research is impeccable and the conclusions balanced and convincing.

444

PH I L OS OPH Y

Consequentialists can never be good friends Thomas Morris For the perfect friendship which I am talking about is indivisible: each gives himself so entirely to his friend that he has nothing left to share with another: on the contrary, he grieves that he is not two-fold, three-fold or four-fold and that he does not have several souls, several wills, so that he could give them all to the one he loves. Michel De Montaigne1 As a matter of untutored sociological observation, I should say that in general [consequentialists] are exceptionally trustworthy and that the sort of people who might do you down are rarely [consequentialists]. J.J.C. Smart2

ccording to Ronald M. Dworkin, there lies at the heart of all moral and political theories an emphasis either on duty, goals, or rights.3 The aim of consequentialism, in all its many forms, is on goals and the maximising of these goals is what takes priority. While a consequentialist may pursue these objectives through different means – be it act consequentialism or rule consequentialism – fundamentally, it is the result of one’s actions that matter. In contrast to this however, it is argued that one’s friendship with another individual should not be concerned with that which can be gained from the friend1 De Montaigne, Michel, On Friendship, translated by Screech, M.A., (London: Penguin, 2003) 15 2 Smart, J.J.C., (”The Methods of Ethics and The Methods of Science,” Journal of Philosophy, 62 (New York: Journal of Philosophy Inc, 1965), p.348.) 3 Dworkin, Ronald M., “Justice and Rights”, Takings Rights Seriously, (Boston: Harvard University Press, 1977) 170

445

ship, but rather with the demands and duties that the friendship places upon the agent. Critics like David Annis believe that friendship should be an end in and of itself, which possesses an intrinsic value.4 They state that for friendship to be treated instrumentally, as a means to a greater goal, is to undermine the very principle that distinguishes it as such an important phenomenon in one’s life. And so the question is asked: are consequentialism and friendship compatible? Can a consequentalist be a good friend? Firstly, it must be recognised that the concept of friendship is ambiguous. There are no underlying rules to friendship and as such it is a disposition with openended prescriptions. How one ought to act towards a friend can be unclear, and in certain circumstances, there is much debate as to how far one’s duty towards a friend should go.5 Furthermore, the role that friendship plays in one’s life is also a topic of hot debate. While it is clear to some critics, like Ferdinand Schoeman, that friendship possesses an intrinsic value and that a bond of friendship can “become a unique community with a being and value of its own,”6 for others, like Elizabeth Telfer, friendship is “life enhancing” and as such, could be understood as a means to a good end.7 As consequentialism is a system of practical reasoning that seeks means to good ends, then it is difficult to see how it would be incompatible with an instrumental conception of friendship. Yet, while one can recognize that friendship does possess some instrumental value, that itself does not deny the fact that the traditional and common perception of friendship is one in which we do things for our friends simply because they are our friends, and not because of some pay-off later down the line. As Janet Reohr puts it: “unlike most other relations, [friendship] has no ultimate conclusion, no end result or product.”8 While the nature of friendship is itself a subject worthy of further study, for the purpose of this investigation it is suffice to say that the characteristics of friendship described by opponents of consequentialism share the following qualities: it is non-instrumental (insofar that it is not entered for the sole purpose of reaching a goal), that friends value each other as distinct, individual personalities, and that there exists deep emotional attachments between friends that prevent individuals from remaining impartial towards their friends. It is this conception of friendship that I will use when considering consequentialism’s compatibility with friendship. In his critique of consequentialism, Bernard Williams argues that “among the 4 Annis, David, “The Meaning, Value, and Duties of Friendship”, American Philosophical Quarterly, 24, (Oxford: Blackwell, 1987) 49 5 For example, if ‘friend A’ asks ‘friend B’ for assistance in breaking the law, under what, if any circumstances, should ‘friend B’ oblige? This is an intriguing question, but for the purpose of this essay, is one that will not be pursued. 6 Schoeman, Ferdinand, “Aristotle on the Good of Friendship”, Australasian Journal of Philosophy, 63: (Sydney: AAPP, 1985) 280 7 Telfer, Elizabeth.,“Friendship”, Proceedings of the Aristotelian Society, 71, (London: Aristotelian Society, 1971) 239 8 Reohr, Janet Friendship: An Exploration of Structure 7 Process, (New York: Garland Publishing Inc., 1991) 21

446

things that make people happy” is “being taken up or involved in any of a vast range of projects or […] commitments.”9 In his view, a “good life” is one in which an agent pursues individual projects and commitments in order to build a life for the future. These projects, he argues, are what shape our identities, and so any moral theory should provide the requisite space for their pursuit. In Williams’ view, however, consequentialism does not allow for this space. Its insistence on following the courses of action that result in the most good, means that “when the sums come in from the utility network […] one must just step aside from one’s own projects.” Williams sees it as “absurd to demand of a man, that he should acknowledge the decision which [his] calculation requires” at the expense of his own projects, and this he states, is one of consequentialism’s biggest problems.10 In such a step, Williams is articulating the problem of impartiality that seems inherent in some forms of consequentialism and even acknowledged by its proponents. In his article “Alienation, Consequentialism and the Demands of Morality,” Peter Railton provides the examples of John who “invariably shows great sensitivity to his wife’s needs” because: I’ve always thought that people should help each other when they’re in a specially good position to do so. I know Anne better than anyone else does, so I know better what she wants and needs. Besides, I have such great affection for her that it’s no great burden – instead, I get a lot of satisfaction out of it. Just think how awful marriage would be, or life itself, if people didn’t take special care of the ones they love.11

Railton sees John as inhabiting “a distant, objective point of view – a moral point of view where reasons must be reasons for any rational agent and so must have an impersonal character even when they deal with personal matters.”12 The problem with this position – defined by Railton as “subjective consequentialism”13 – is that it attempts to use consequentialism as a calculating device, and in doing so, alienates the individual from his own choices. As a result, subjective consequentialism, in which the individual acts according to the available action which would promote the most good, gives rise to a loneliness or emptiness and “makes certain valuable sorts of relationships impossible.”14 Subjective consequentialism thus leads to emotional detachment, with the agent seemingly impartial towards other subjects, and merely “playing the role” 9 Williams, Bernard & Smart, J.J.C., ”A Critique of Utilitarianism”, Utilitatarianism: For and Against (Cambridge: Cambridge University Press, 1973) 112 10 Ibid, 116 11 Railton, Peter, “Alienation, Consequentialism, and the Demands of Morality”, Philosophy and Public Affairs, Vol 13, No. 2 (Princeton: Princeton University Press, 1984) 135 12 ibid 136 13 ibid 152 14 ibid 137

447

designated by the outcome of consequential calculations. Such an attitude seems at odds with the conception of “true” friendship, which demands partiality and individuality to be valued. Indeed, a key feature of friendship is that friends are unique and thus irreplaceable. For this reason, the “plenty more fish in the sea” response to someone who is upset at the break-up of a relationship is never adequate. What people want is that particular friend, and in contrast to social network websites, like MySpace for example, where people collect “friends” and numbers do count, with “true” friendship – the kind that Montaigne describes – it is not as simple as replacing one friend with another person. When a friendship is lost, some aspects of the relationship’s value can never be replaced. Be it on the basic level: that the individual had a shared history with that friend, to the more profound idea that particular friends shape our own identity in particular ways. Subjective consequentialism does not recognise the importance of these particularities and thus seems incompatible with friendship. Consequentialism, however, is not only considered incompatible with friendship, but according to some critics, is potentially damaging to an individual who seeks to balance the two. In his article “The Schizophrenia of Modern Ethical Theories,” Michael Stocker alludes to the clash that follows from being directly motivated in a way that is appropriate to friendship, while simultaneously being directly motivated by the prescriptions of consequentialism. This clash, he argues, leads to a split in the individual’s psyche and a position of “moral schizophrenia,” which is “psychologically uncomfortable, difficult, or even untenable,” leaving one’s life “essentially fragmented and incoherent.”15 The strength of Stocker’s argument lies in the way it seems applicable to both act and rule consequentialism. For while act consequentialists – those who justify an act by an appeal to the goodness of the act’s consequences – could certainly justify acts of friendliness, they would have to concede the separation between their reason for committing an individual act, and the over-arching motive for their behaviour. In order to avoid “moral schizophrenia,” in which the agent is seemingly pulled in opposite directions, the agent would have to align his reasons with their motives. But in doing so, his purposes would either have to break away with consequentialism, or alternatively adopt the impersonal nature of consequentialism. Subsequently, it would therefore be incompatible with the traditional conception of friendship. Likewise, rule consequentialists – for whom actions are right if they follow rules that result in the most good – fall foul of the same problem, because even if they acted friendly as a result of the rule that one should be friendly, for example, this again lacks the personal consideration that should be afforded to our individual friends. For Stocker, even if consequentialists could be good friends, we could never know for certain why they perform certain actions: If acting out of friendship is composed of purposes, dispositions to have pur15 Stocker, Michael, “The Schizophrenia of Modern Ethical Theories”, Journal of Philosophy, 73 (New York: Journal of Philosophy Inc, 1976) 456

448

poses, and the like, where these are purposes properly so-called, and thus not essentially described by the phrase “out of friendship,” there seems […] no guarantee that the person cares about and likes, [nor] has friendship for the “friend.”16 Stocker’s argument is compelling because it suggests that even if a consequentialist was friendly for the sake of being friendly, from the external perspective, the recipient of that friendliness could never know if the consequentialist was acting out of friendliness or because of an ulterior motive, namely, the hope of a benefit further down the line. However, while it a compelling argument, one cannot help but feel that Stocker has an idealized conception of friendship, within which all parties can always “guarantee” that their friends are acting from the best intentions of friendliness. Yet it must be conceded that this problem is more pronounced in the relationships that a consequentialist may have. Furthermore, cast in the terminology of mental illness, Stocker’s portrayal of the consequentialist’s dilemma of “moral schizophrenia” provides a startling critique of consequentialism. But is it a fair critique? Are consequentialists really incapable of being good friends? One way in which a consequentialist may overcome Stocker’s concerns is through developing the ability to make a decision without having to constantly relate to their fundamental moral aim, yet at the same time, still regard the moral aim as something important. In other words, the agent should develop a character which incorporates the possibility of reconsidering that character, should it be necessary. This, in Railton’s eyes is the “sophisticated consequentialist” who “has a standing commitment to leading an objectively consequentialist life, but who need not set special stock in any particular form of decision making.”17 Put simply, the agent accepts consequentialism, but has the freedom to decide how to calculate and when to calculate the options that can provide the most overall good. This allows individuals to be subjective about their relationships and saves them from having to make implausible and impractical calculations regarding issues like love and loyalty, which in some cases would be self-defeating. The sophisticated consequentialist can thus block “paralyzing” time-consuming deliberations towards decisions by developing a standing disposition towards the things he prioritizes.18 As such, Railton seems to suggest that an agent can have a pro-friendship disposition as an overarching motivation which, once entered into, grants the agent freedom to value friendships positively in any way that he pleases. Seen this way, consequentialists can value individuals as individuals, not as instrumental means, and like Railton’s exemplar Juan, can be more dedicated to “close relationships” than the “some higher goal.”19 For Cocking and Oakley however, Railton’s version of an “indirect” consequen16 Stocker, Michael, “Values and Purposes: The Limits of Teleology and the Ends of Friendship,” Journal of Philosophy, 78 (New York: Journal of Philosophy Inc, 1981) pp. 756-57 17 Railton, Peter, “Alienation, Consequentialism, and the Demands of Morality”, Philosophy and Public Affairs, Vol 13, No. 2 (Princeton: Princeton University Press, 1984) 153 18 ibid 154 19 ibid 150

449

tialism “does not succeed in meeting the real problem” of friendship.20 For in shifting the goal-posts outwards, Railton still has not avoided the issue of non-optimal relationships – relationships that are not working towards the overall good for the agent. In their opinion, a consequentialist is required to walk away from a nonoptimal relation because it is not promoting the overall good. However, it must be recognised that the conception of “non-optimal” is vague. On the one hand, it may be that a relationship is producing “good” for an individual, but that there are other projects that the agent could pursue which would produce more “good.” Yet, on the other hand, non-optimal could indeed mean a negative output in terms of the relationship’s “good.” Understood this way, one must ask: why is it wrong (or even incompatible with friendship) for someone to walk away from a friendship that isn’t working, or in some cases, even damaging? Surely to take such a step is not to view the relationship just instrumentally. Indeed, it could be argued that a friendship which is damaging, in some cases to both parties, loses its intrinsic value and so one is justified in walking away from such a relationship, both on an instrumental level and on the level of intrinsic value. Furthermore, Railton’s “sophisticated consequentialist” is an individual that can see the benefit of non-optimal relationships because he is attuned to the greater benefits of friendship in general. Yet, from a different perspective, perhaps this is the very reason that the sophisticated consequentialist cannot make good friends. Because a sophisticated consequentialist invariably finds himself in a position where he must: value his friend for being a friend, and value his friend, providing this friendship is consistent with promoting the most good. Point (b) is what leads Williams to state: consequentialists have one thought too many.21 Indeed, it could be argued that there is something strange about the notion of indirect consequentialism, because in believing there is something beyond friendship which is necessary to justify it, isn’t it only by something akin to self-deception that we are able to continue our friendships? Finding an answer is difficult, but of all the arguments, Railton’s conception of a sophisticated consequentialist seems the most viable. The sophisticated consequentialist is an agent that is not estranged from the world. He is unwilling to forsake the commitments and projects that have shaped his identity merely because there is a small utility to gain from doing so. Yet he isn’t bound to a romantic, idealised conception of friendship and love which seems to posit that we must not want to gain anything from these relations. As a result, if his situation is one in which the friendship is far from optimal, then he will indeed realign his disposition towards friendship. But he is not going to do this at a drop of a hat. This is far from the portrayal of the cold, calculating consequentialist who enters into each relationship with a list of pros and cons. Instead, the sophisticated consequentialist is 20 Cocking, D. & Oakley, J.,“Indirect Consequentialism, Friendship, and the Problem of Alienation”, Ethics,106: (Chicago: The University of Chicago, 1991) 104 21 Williams, Bernard ”Persons, Character and Morality,” reprinted in Moral Luck (Cambridge:Cambridge University Press, 1981) 18

450

an individual who treats friendship rather much like we all do. Indeed, how often does one hear someone say of a loved-one’s friend: “he’s no good for her”? If consequentialists cannot make good friends because they will end a friendship when it’s no longer “optimal,” then perhaps the problem is not with the consequentialists, but rather with a conception of friendship which demands we maintain friendships which are harmful towards us and others. At the root of this question of friendship is the deeper question of whether consequentialism is a viable moral theory. As Neera Badhwar states, because friendship is such an important project for so many of us, “an adequate moral theory must be compatible with the attitudes and practical requirements of true friendship.”22 Yet, from a consequentialist’s point of view, this isn’t the case. Indeed, Elinor Mason reverses the strategy and does not see friendship as a test of consequentialism, but rather, she sees consequentialism as challenging friendship: “if personal relationships are a vital part of human well-being, then consequentialism will recommend rather than oppose them.”23 Consequentialism, therefore, does not negate the possibility of a good friendship, but instead demands of our friendships that they are good for us. Consequentialism, as defined by Philip Pettit, “is the view that whatever values an individual or institutional agent adopts, the proper response to those values is to promote them.”24 It is a succinct definition but one that encapsulates the difficulties with the problem in hand. In one regard, friendship seems compatible with consequentialism as the agent need only adopt friendship as a value for it to be promoted. Yet, the very fact that the promotion of that value comes as a demand from the over-arching theory, for some, undermines the whole point of friendship. This is because it is the value of friendship itself that should demand its promotion, and not a doctrine of practical reasoning which dictates how it is we deal with those things we value. However, it could be argued that the critics, in their criticisms of consequentialism, have themselves “one thought too many.” Indeed, if one holds a value dearly, and that value does not negatively affect someone else’s value, then surely it is right and just to promote that value? Consequentialism, and in particular, “sophisticated consequentialism” in this regard, can be seen as a safeguard for practical common-sense, and a mechanism that ensures we do promote the things we value, namely because they are the things that make life worth living. To that end, consequentialism is potentially compatible with friendship, and consequentialists can make good friends.

22 Badhwar, Neera Kapur “Why it is Wrong to Be Always Guided by the Best: Consequentialism and Friendship”, Ethics, 101 (Chicago: The University of Chicago, 1991) 485 23 Mason, Elinor “Can an Indirect Consequentialist Be a Real Friend?”, Ethics, 108 (Chicago: The University of Chicago, 1998) 393 24 Pettit, Philip, “Consequentialism”, A Companion to Ethics, (Oxford: Blackwell, 1991) 19

451

PHYSICS PANEL

•

judging panel Dr. Creidhe O’Sullivan (NUI Maynooth) – Chair Dr. Nicholas Devaney (NUI Galway) Dr. Martin Leahy (University of Limerick) Dr. Eilish McLoughlin (Dublin City University) Dr. Síle Nic Chormaic (University College Cork) Judges’ commentary The winning submission deals with the fabrication and characterisation of single crystalline barium titanate (BaTiO3) nanowires and nanocolumns cut from thin crystal planar sheets at QUB. Fabrication is done using focused ion beam milling. The research is motivated by the drive for device miniaturisation in ferroelectric memories and in particular the move from 2D to 3D geometries in order to increase bit densities per chip. The functional characteristics of thin film (2D) single crystal sheets have been well studied but the author identifies a need for further research into the switching characteristics of ferroelectric mesowires. His work therefore represents an original contribution to the field. The results were very interesting and not what might be first expected. This report is of very high quality and is extremely well presented. The goals of the project are clearly set out from the start and are put into context by an excellent introduction. The importance of experimental design and the interpretation of results are highlighted. An impressive amount of original research has been undertaken and additional ideas for future lines of research presented.

452

PH Y SIC S

Domain dynamics & switching in ferroelectric mesowires Raymond McQuaid

emory is changing. In ferroelectric non-volatile random access memories, component miniaturisation that enables increasing chip storage capacities will soon be accompanied by a radical move from two-dimensional planar architectures to more complex three-dimensional geometries. In a logical step from the study of such planar thin-films, 1μm width ferroelectric Barium Titanate wires have been fabricated and functionally tested. Surprisingly, voltage switching between binary storage states was easier in these wires than in a planar sheet of the same 300nm thickness. In testing the rationale for this behaviour, 600nm width wires were fabricated and tested, being more difficult to switch as predicted. A material is described as ferroelectric if it displays two key properties, namely a co-operative alignment of electric dipoles that exists in the absence of an externally applied electric field, and secondly, that the orientation of these dipoles can be reoriented by an applied field of sufficient magnitude. The possibility of ‘polarisation ‘switching’ between two distinct states has made ferroelectrics suitable candidates for binary solid state memory applications. Indeed, non-volatile ferroelectric random access memory (FeRam) has found success in niche markets, being mass manufactured and integrated, for some years now, into SMART railcards and Sony PlayStation consoles. As well as continuing the relentless miniaturisation of microelectronic components, a radical move anticipated in the next few years is the move from 2D planar capacitor geometries to fully 3D integrated devices. This is because planar capaci453

tor arrays will be unable to realise target storage densities, arising due to the projected capacitor electrode area being unable to generate sufficient charge for the sense amplifiers to reliably discriminate between binary states. Whilst the functional characteristics of planar ferroelectric ‘thin films’ commercialised in current FeRam technologies are relatively well understood, this is not the case for more morphologically complex 3D nanostructures. Importantly, since dipolar switching occurs by creation and growth of domains, an understanding of domain dynamics, lacking thusfar for such complex geometries, is crucial for application. Effects associated with reduced size expected in ferroelectric behaviour when length scales enter the mesoscopic regime and below will therefore have important implications for more complex nanoshapes, providing complementary interest from both academic and technological standpoints. The transition from studying the functional behaviour of planar sheet structures to wire geometries (physically constrained in an additional dimension) therefore constitutes a natural progression in the investigation of more complex nanostructures. Wire structures are fabricated from single crystalline Barium Titanate (BaTiO3, a perovskite ferroelectric material) using a Focused Ion Beam Microscope (FIB), offering arguably the cleanest window available to date for fundamental studies. FIB instrumentation combines imaging and micromachining capabilities at micro/nanoscales by exposing a sample surface to a finely focused (~7nm diameter) beam of Gallium ions allowing for both precise location milling (patterning) and high spatial resolution imaging1. Firstly, single crystal sheets of material must be obtained from which the wires are later FIB defined. Sheets, or ‘lamellae,’ ~6x12μm2 in area and of uniform 300nm thickness are obtained as the remaining material separating two FIB milled trenches [fig.1a]. These are freed from the bulk (by further milling) and removed using a sharp, charged glass needle and micromanipulator [fig.1b], being subsequently transferred face-down onto a passive single crystal MgO substrate. The BaTiO3 lamella and substrate surfaces are platinised (by sputter coating) [fig.1c] following a thermal anneal to expel gallium contamination and recover ion-beam induced damage. Two large electrodes (contact pads) are FIB milled with the lamella located in the interelectrode gap, being defined by careful FIB milling of a 2x6μm2 strip of platinum from the lamella surface [fig.2a]. Several wires are then FIB defined from this exposed strip [fig.2b] and a final anneal performed before functional testing. Functional testing of wire switching behaviour is performed using an LCR meter, electrical contact with the wire structure being made indirectly via the contact pads using tungsten needles. A DC axial bias (applied field) is driven along the wires, cycling the polarity of which allows a hysteretic relationship between polarisation and applied field (characteristic of ferroelectrics) to be investigated. Po1 At high beam currents (103-104pA) precise location milling (i.e. material removal) enables

top-down patterning of the target material, whereas at lower currents rastoring the beam over the surface allows for high spatial resolution imaging by detection of secondary electrons subsequently emitted from the surface.

454

(a)

(b)

(c)

Fig 1 (a) FIB machined lamella is remaining material standing in trench, 300nm in thickness. Platinum bar deposited to protect lamella from ion beam exposure during fabrication can be seen to extend above trench. Platinum bar (grey) is subsequently removed before being removed form trench. (b) Fine needle extraction of BaTiO3 lamella. (c) Lamella after being

(a)

electrode

(b)

Fig 2 (a) Schematic of test arrangement for planar sheet (capacitor) arrangement. Further milling by Gallium (Ga) ion beam defines three 1µm width wires illustrated schematically in (b). Three wires are fabricated to increase the signal-to-noise ratio from the structure with the reasonable assumption that the wires switch independently. BaTiO3 structure is indicated

larisation switching (as the bias is cycled) occurs over a voltage range (on the order of unity volts) [fig.3a] rather than a single ‘snap-action’ voltage where all dipoles switch at the same threshold. Crucially, as the field is increased in magnitude from zero volts, an increasing number of dipoles become aligned until the wire’s polarisation is fully switched (aligned with the field) i.e. an increment in polarisation ΔP, owing to the field increment ΔE, is due to the alignment of additional dipoles with the field. Accordingly, in the limit, the derivative dP/dE scales as the dipole population switching per unit applied field. Because (in the studied experimental geometry) polarisation is proportional to the charge Q and electric field to the bias V, dP/dE is therefore proportional to dQ/dV. Since this is by definition capacitance, LCR measurement of the hysteretic capacitance-voltage (CV) profile produces a visual map of dipole population switching (per unit voltage) as a function of applied bias [fig.3b]. The background capacitance contribution from the MgO substrate and external circuitry is compensated by measuring a ‘dummy’ structure, having no BaTiO3 wires in the interelectrode gap. The real wire test structure and dummy structure are machined on the same MgO substrate and mounted on a copper block with resistance heaters attached, permitting CV measurement as a function of temperature. 455

C Lots of

switching

ΔE ΔP

Eapp

Less switching

V Fig 3 (a) Schematic of typical ferroelectric hysteresis loop. The positive and negative polarisation values for zero field (Eapp = 0) provide the basis for a non-volatile binary storage system. A finite increment in polarisation with field increment is illustrated. (b). A typical CV loop schematic, being the derivative of the PE hysteresis loop shown, acts a map of dipole switching as a function of applied bias. Hysteresis in CV profiles is manifest as the offset in the two peaks. All of the switching population data is contained in either peak, scaling as the capacitance value.

A planar sheet structure is also fabricated, and CV profile measured, so that its switching behaviour may be directly compared with the 1μm width wires. In overlaying the obtained (normalised) CV profiles it is evident that more switching occurs over at higher voltages for the planar sheet geometry [fig.4], i.e. switching is more difficult in the sheet. This behaviour is consistent at both room and higher temperatures. The standard distribution is employed to quantify the spread in each case [fig.5], with the observed trend supported by duplicate wire and plate structures fabricated and subjected to the same measurement and analysis. Since wires have the larger surface-to-volume ratio, we would expect surface drag related effects that would inhibit polarisation switching to be more pronounced than in the planar sheet structure, making wires more difficult to switch. How can we rationalise the contrary behaviour that is in fact observed? In order to understand this result we must consider another well-known property of ferroelectrics, that of domain formation. Domains are regions in which the dipole moments in adjacent unit cells share a common alignment direction, being separated by energetically costly boundary regions through which the local polarisation direction changes, called ‘domain walls’. Because in ferroelectrics the development of a spontaneous dipole moment arises due to physical distortion of the crystal unit cell, domains may form to minimise the macroscopic charge developed at free surfaces, or the resulting macroscopic strain when cooled into the 456

(a)

(b)

Normalised capacitance

--- SHEET --- 1µM WIRE 5µm

Bias (V)

5µm

4 (a) Overlaid normalised CV loops for 1µm wire and sheet geometries at room temperature. In FigFig 4 (a) Overlaid normalised CV loops for 1μm wire and sheet geometries at room tempercomparing a single peak from both structures it is clear that more switching occurs at higher voltages ature. In comparing a by single peak from both capacitance structures values it is clear that more ocfor the sheet, inferred the higher normalised at the ‘wings’ of switching the peaks. (b) Close-up FIB voltages photos of for the the planar sheet and wireby geometries respectively fromcapacitance top. The capacitance curs at higher sheet, inferred the higher normalised values signal from each of the three wires is a parallel combination, and hence summed, enhancing the at the ‘wings’ of the peaks. (b) Close-up photos of the planar and wire geometries signal-to-noise ratio as intended. BaTiO3 isFIB shaded in green, MgO in red sheet and platinum in grey. respectively from top. The capacitance signal from each of the three wires is a parallel combination, and hence summed, enhancing the signal-to-noise ratio as intended. BaTiO3 is shaded in green, MgO in red and platinum in grey.

ferroelectric phase. Uncompensated surface charges non-parallel to free surfaces gives rise to ‘depolarising fields’ that oppose the characteristic dipole ordering. The magnitude of any such field is inversely proportional to the surface charge separation and hence to dimension of the ferroelectric over which the field acts, and can therefore be very large in meso/nanoscale ferroelectrics. In particular, because the studied wire geometries are connected to the host lamella at either end they are shape constrained, giving rise to 90o domain formation in order to conserve their macroscopic shape2. These consist of regions of orthogonal polarisation (i.e. unit cells packed orthogonally) separated by domain walls at 45o with respect to the crystallographic planes [fig.6]. Interestingly, previous experimental verification of domain periodicity (or size) scaling laws for lamella and wires3, as function of the critical sample dimension in each case4, indicates that the same approximate domain periodicities are observed in 1μm width wires as for lamellae (of the same 300nm thickness). We 2 90o domain configuration identified in wires and lamella by previous investigation by group

at QUB. 3 See Schilling A. et al Nano Letters 7, 072260 (2007) 4 Thickness for lamella (due to the elastic energy of the largest-area lamella faces, and hence their separation being the dominant dimension) and width for wires (where depolarisation energetics, and hence charged surface separation, determines domain scaling).

457

Sheets

Standard deviation (V)

1µm wires

Characteristic width decreasing (µm)

5 The voltage standard deviation, determined a single a CV loop, is represen Fig.Fig 5. The voltage standard deviation, determined from afrom single peak ofpeak a CV of loop, is rephow difficult the structure is to switch - the larger the value the harder it is to switch. Each a resentative of how difficult the structure is to switch - the larger the value the harder it is to point for the ‘sheets’ or ‘1µm wires’ is a duplicate structure. Uncertainty bars are based switch. Each additional point for the ‘sheets’ or ‘1μm wires’ is a duplicate structure. Unceruncertainty in determining precisely the voltage range over which switching is observed to occ tainty bars are based on the uncertainty in determining precisely the voltage range over which switching is observed to occur.

then dismiss any difference in domain periodicities as being responsible for the observed difference in switching behaviours. Instead we look to images revealing the domain configurations in a 1μm width wire section and in a lamella (obtained using a scanning transmission electron microscope, STEM), being available from previous investigations. Both structures exhibit sequences of 90o domains [fig.7a,b] however a more ordered domain sequence is apparent in the 1μm wire geometry. More tortuous domain wall paths are observed in the sheet geometry, especially at boundaries where 90o domain packets change orientation. When an axial bias is applied, switching is described to occur by migration of such domain walls as to increase the total domain area with polarisation aligned with the field (until a fully switched, aligned monodomain state is achieved). In this dynamic picture, increased instances of ‘hard-impingement’ are expected to occur at locations where propagating domain walls meet in their field induced motion and become ‘locked,’ impeding further progress in domain realignment. We expect larger applied fields 458

Fig. 6. Schematic illustrating 90o domains with domain walls at 45o. Polarisation is indicated by arrows and a measure of the domain size, labelled λ, is included.

to be required in order to ‘depin’ these impinged walls and thus may explain the significant switching observed to occur at greater applied biases in the lamella geometry compared to the wires. We may attribute the enhanced domain ordering inherent to the wires as being due to the additional dimensional constraint compared to the lamella, restricting the number of possible domain nucleation sites5 available upon initial cooling into the ferroelectric phase. Nucleated domains grow independently and with the lamella’s greater nucleation site distribution comes more instances of hard impingement in the subsequent domain growth and hence relative disorder. This occurs less so in the wires where a relatively more ordered domain sequence develops along the wire’s length. In order to further test the validity of correlating static domain imagery with dynamic switching behaviour, a finer wire structure, 600nm in width, was fabricated and measured. Speculation as to the switching behaviour of the finer wires is made by inspection of previously (STEM) obtained static domain imagery as for the 1μm width case. Of note is the prevalence of ‘zig-zagging’ in the orientation of 90o domain packets through the wire, so-called ‘superperiods’, apparent around the half-micron width regime and below. These alternate the polarity of the uncompensated charge along each charged surface, thereby suppressing the depolarising field (directed across the wire, orthogonal to these surfaces), compared to the 1μm wire case which has mainly same charge build-up on either surface [fig.8a]. This emergence of superperiod formation with reduced wire width may be attributed to the increasing influence of depolarisation energetics as the charged surface separation is reduced. That this behaviour is not prevalent at the 1μm width is likely due to competition between minimisation of depolarisation energy and energy cost of the unfavourable head-to-head dipole configuration required at the boundary where 90o domains change orientation [fig.8b]. Additionally, do5 Above a critical temperature called the ‘Curie’ temperature no long range ordering exists

and hence no domains are observed. Therefore upon cooling into the ferroelectric phase the localised centres where domains appear, and subsequently grow from, are known as ‘nucleation sites’.

459

main size scaling laws indicate 600nm wires to have a greater domain density than 1μm width wires (keeping other dimensions constant). We envisage that with the drive for more complex domain ordering to minimise depolarisation energy, hard impingement in the dynamic picture may serve to inhibit switching in this more densely-packed complex domain arrangement, compared to the 1μm width case. This is especially so, due to the necessary reorientation of head-to-head dipoles required to move the domain wall under axial biasing, having greater activation energies than neighbouring dipoles which are only mutually perpendicular. For the finer wires, a broader switching distribution is indeed evident when the 1μm and 600nm width CV loops are overlaid, consistent at both room and high temperatures. The result, that in reducing a single lateral dimension of the planar sheet geometry, to create 1μm and subsequently 600nm wire geometries, does not lead to a progressive increase in switching difficulty, is surprising. The enhanced switching difficulty in both planar sheet and 600nm wires, relative to 1μm width wires, has been explained by hard impingement of domains in a dynamical picture, arising albeit for different reasons – disorder in the sheet domain configuration and depolarisation considerations for the 600nm wires. The critical dependence of switching behaviour on domain dynamics in mesoscale, and inevitably nanoscale, wire geometries is evidenced, with cross section aspect ratio a critical engineering consideration for optimisation in any future wire-based memory applications.

460

461

PHYSIOTHERAPY PANEL

•

Judging panel Dr. Brian Caulfield (University College Dublin) – Chair Dr. Juliette Hussey (Trinity CollegeDublin} Prof. Marie Guidon (RCSI)

462

PH Y Sio t h e r a p y

Evolution of the measurement of body segment inertial parameters since the 1970s Laure-Anna Furlong

Introduction ince the development of biomechanics as a sub-discipline within movement science in the last 35 to 40 years (1), analysis techniques have evolved rapidly. To attain the goals of sports biomechanics - performance enhancement, comfort, injury prevention and safety (2) - it has been necessary to further develop techniques to both quantify and analyse data. Research questions have evolved from quantification of movement to questioning how and why movement occurs, and optimisation of performance. Methods of reconstruction such as the 3D Direct Linear Transformation (DLT) (3) and 2D-DLT (4) have evolved from creation to determination of the most accurate reconstruction method (5). Motion analysis has evolved from force-time data (6) to online systems and real-time feedback (7). Errors from soft tissue motion are now investigated to quantify and correct (8-9). Data smoothing has evolved from Winter et al.’s original paper on removal of kinematic noise (10) to modern work by Robertson and Dowling (11) investigating optimal filter design. Computer modelling has evolved from simplistic models of the 70s and 80s investigating simple locomotion (12) to sophisticated modern models of high bar gymnastics (13), high jump (14) and muscle stiffness of 463

the horse (15). Initial work on co-ordination by Bernstein (16) has now evolved into a distinct field of motor control (17-18), with its own measurement issues (19). The focus of this article, however, is on the evolution of measurement techniques for determination of body segment inertial parameters (BSIP) with particular emphasis on development of mathematical models and scanning and imaging techniques.

How can inertial parameters be determined? The three main methods of determining inertial parameters are cadaver studies (20-21), mathematical modelling (22-25) and scanning and imaging techniques (26-31). Each has its own advantages and disadvantages, and continuously evolved over the past 40 years. Early work by Dempster (21) calculated segmental masses as a percentage of total body mass, segment density, locations of the centre of gravity and lengths of radii of gyration as proportions of segment length based on eight elderly male cadavers and was built upon by Barter (32), Clauser et al. (33) and Chandler et al. (34). Chandler et al. (34) used palpable anatomical landmarks to identify the ends of segments (for example, the radiale was defined as the point at the proximal, lateral border of the head of the radius. This point was located by palpating downward in the lateral dimple at the elbow and getting the subject to pronate and supinate the forearm slowly so the radius could be felt rotating under the skin). This was in contrast to the subjective determination of joint centres as used by Dempster (21). Cadavers are normally not population-specific as they are typically of elderly males, quite different to any athletic or clinical population being studied. An increased demand for subject specific parameters hence led to development of mathematical models whereby the body is represented as a series of geometric solids; measurement of anthropometrics (segment width, depth or perimeter) allows for calculation of segment volume which when combined with density values (typically from cadaver studies such as Dempster (21)), permit calculation of segment mass. Why are these parameters important? Determination of BSIP such as mass, centre of mass and moment of inertia is important due to their use in kinetics calculations (35) with researchers wishing to make data as subject-specific as possible (36). In a clinical population, kinetics may be used to aid monitoring of joints post-trauma or post-operatively, or identify areas of particular stress. It may be used to identify a particular gait pattern that predisposes a patient to injury. Until the mid-90s, researchers concentrated on devising inertia models (21-23, 25-27) but more recent work has attempted to quantify the importance of accurate inertial parameters (37-38) and developed geometric-mathematical models of increasing sophistication such as that of Cheng et al. (30) and Gittoes and Kerwin (39) (40). Inertial parameters vary as a function of age (41), contracture of the muscle (42), limb morphology (43), body composition (39) and sporting background (44) but relative importance of these variances is still unknown. Some authors (38, 45-48) reported low importance of uncertainty 464

Fig. 1. Hanavan’s model (22). The simplistic modelling of each segment resulted in large error in calculation of mass in segment parameters, whilst others (37, 49-50) reported large variation in subsequent joint kinetics. Rao et al. (51) observed modelling the body as simple geometric shapes largely affected BSIP values calculated, particularly in segments such as the foot; Hanavan’s (22) simplistic foot model was improved upon by Hatze (23), by remodelling it as 103 unequal trapezoidal plates, each with non-linear varying density.

The evolution of mathematical models Hanavan’s model (Figure 1) (22) was the first mathematical inertia model based on experimentally determined mass distributions and anthropometry of the person concerned, but had a number of limitations, namely the assumption all segments were rigid, of uniform density and uniform shape. High levels of inaccuracy were hence observed. Hatze’s model (Figure 2) (23) is presently the most accurate and reliable inertia model available (52). It used gender-dependent dependent density values, modelled the separate parts of the shoulder girdle, did not assume segment symmetry and realised the non-uniformity of segment shape. Hatze used the same segments as Hanavan (22) but with two additional shoulder girdle segments and alterations to hands and feet. The shoulder girdle, trunk segments and buttocks segments were geometrically quite complicated, with different gender-dependent density values used in the buttocks, thighs and calves. The 242 anthropometric measurements al465

lowed for high levels of personalisation, but took 80 minutes to collect which obviously does not suit most subjects. No comparison of error in whole body moment of inertia (vertical axis) was made, where largest error may have been expected, with no evidence present that the author calculated moment of inertia about the anatomical vertical axis for the shoulder girdle. The method of removal of systematic error from the data was not reported. This model reports the lowest error between measured and predicted total body mass (0.5%), but its practicality is questionable. The third, and perhaps most commonly used model due to its compromise number of measures, is that of Yeadon (Figure 3) (25), consisting of 40 sub segments and 95 anthropometric measurements, requiring 30-40 minutes contact time. Despite reported error of ~3%, (six times greater than Hatze (23)), Yeadon (25) considered the accuracy of his model to be sufficient due to reduced measuring time. The accuracy of the three models is comparable as they all used Dempster’s density data (21) resulting in the only difference between them being volume measurement. The model was originally developed for use in gymnastics, assuming no movement at the neck, wrists or ankles hence limiting its applicability to sports with large motion at these joints. Yeadon represented the body as a series of stadium solids and truncated cones, with a semi-ellipsoid for the head, each of which represented their body part more accurately than that of Hanavan (22). The stadium represented trunk volume particularly well (Figure 4), evolving from

Fig. 2. Segment definition as used by Hatze (23). The same segment definition was used for the left and right. A number of improvements to Hanavan’s model (22) were made, amongst these being improved modelling of the hands as a prism and hollow half-cylinder to which an arched rectangular cuboid was added to represent the thumb

466

Fig. 3. Yeadon’s model, consisting of 40 sub-segments and requiring 95 anthropometric measurements (25) previous work modelling the trunk as an ellipse. A common limitation of all mathematical models, however, is that they cannot account for how soft tissue motion alters inertial characteristics of a segment (42) or the asymmetrical location of internal organs (53).

The evolution of scanning and imaging techniques Imaging techniques have been used to identify segment inertial parameters, with an acceptable level of success and removing potential harm from radiation exposure during gamma and DXA scanning. Jensen (26) digitised reference markers placed on segment boundaries and joint centres of three children of different somatotype (ectomorph, endomorph, mesomorph) and used Dempster’s (21) data to calculate segment mass; this was the first paper to use a photogrammetric method. The body was modelled as a number of 0.2 cm high elliptical cylinders, the validity of which was confirmed by Wicke and Lopers (54). They also found increased image-size resulted in increased accuracy. This method was accurate to within 1.16-1.82% of total body mass, more accurate than other methods available at the time with further advantages that equipment was easily accessed, marker placement took ten minutes and digitising only two hours. Later work by Hatze and Baca (55) and Sarfaty and Ladin (56) continued development of an image-based method of obtaining anthropometric dimensions. Baca (29) used a similar protocol to that of Jensen (26), with segment boundaries identified by use of black ribbon around the end which as noted by Sarfaty and Ladin (56) reduced magnitude of error. Use of sub-pixel accuracy reduced error from optical distortion, inaccurate edge-detection procedures and also user-spec467

Fig. 4. Cross-sections of the a) thorax b) stadium solid and c) ellipse. This clearly illustrates the improved representation of the thorax when modelled as a stadium as opposed to an ellipse (25) ified upper and lower segment boundaries for edge-detection. Video images were gathered in the anterior, lateral (left and right side) and coronal views, and later processed by a programme called VIDANT which allowed for sub-pixel accuracy and edge estimation, initial estimation of segment edge, projection of distances in the reference plane, scaling of image dimensions to object space dimensions as well as correction of distortions. Segment dimensions obtained could be input into Hatze’s 17-segment model (23) for segment volume determination and later combined with density data of Dempster (21) and Clauser et al. (33) to quantify segment mass. Maximum difference between the new image-based system and directly measured anthropometrics was 7.9% for the left forearm with average difference between 1 & 2%, implying the image-based method was a potential substitute for time–consuming direct measurement. Gittoes et al. (31) further developed this work, digitising body segments based upon Yeadon’s model (25). Peak Motus was used to digitise, which is more commonly used than the system of any other image-based study. Three photos (front of body, right and left lateral sides) were taken in a doorframe upon which 6 reflective markers were placed to allow for calibration. Even less contact time was required with the athlete as the segment boundaries were defined by eye, removing need for attachment of markers or ribbons. Digitising the points took approximately 30 minutes. Speed and decreased athlete contact time are the main advantages of this method. Difference between measures of total body mass as calculated by image and direct mass were found to be 2.10% and 2.87% respectively, supporting its suitability as an alternative to time-intensive direct measurement. Scanning techniques were originally developed in the 80s and were seen as an evolution from Jensen’s (26) and Hatze’s (23) mathematical models. Zatsiorsky and Seluyanov (27) obtained mass and inertial characteristics from a gamma-scanning technique, but radiation exposure was an obvious disadvantage. Underlying tissue mass could be evaluated by intensity of absorption of the gamma-ray. The body was segmented into similar sized areas as previous cadaver studies to allow for comparison and segment mass, location of the centre of mass, radii of gyration, moments of inertia around the three axes and over 150 regression equations were determined. In contrast to cadaver studies, the shank and thigh were separated along the line of the knee joint (previous work often included a portion of the fe468

mur in the shank mass, distorting both shank and thigh mass), and the thigh was dissected from the trunk along a plane passing through the anterior superior iliac spine at an angle of 37° to the sagittal plane of the body. The equations developed are still seen today as the most accurate for kinetics calculations (35, 51). More recent scanning studies have used computer tomography (CT) (57-59), dual X-ray absorptiometry (DXA) (60-61) or magnetic resonance imaging (MRI) (30, 62) due to minimal or, as with MRI, no, exposure to radiation. Pain and Challis (63) calculated BSIP calculation using a sonic digitizer, whilst Pinti et al. (64) determined BSIP using an optical scanner, with similar results to Jensen’s model (26). Cost and limited access to equipment is a major disadvantage however. The validity of using DXA to obtain BSIP was determined by Durkin et al. (60) who calculated segment length, mass, centre of mass location and moment of inertia about the centre of mass for both a cadaver leg and a cylinder. Values obtained were cross-referenced to direct measurement to check accuracy and were found to be accurate and highly reliable. Two highlighted disadvantages were, however, radiation exposure and the two-dimensional nature of the image as only frontal plane data was available (the author acknowledged as data was gathered quickly, this was not an issue). Holmes et al. (61) further developed DXA, by determining fat mass, lean mass, wobbling mass and bone mineral content of the thigh, leg and leg and foot segments, applicable when modelling wobbling mass.

The evolution of wobbling mass models Pain and Challis (63), during development of their high resolution method of calculating BSIP, found contraction of lower leg muscle altered BSIPs, particularly mass distributions. This change highlights a weakness of the rigid body model commonly used in biomechanical analysis, as redistribution of segmental mass may influence forces and moments at a joint. Both Gruber et al. (65) and Pain and Challis (42) found different forces were calculated using rigid body and wobbling mass models, with wobbling mass typically returning lower values. This highlighted a gap in the literature for a wobbling and rigid mass model to determine BSIPs. Gittoes and Kerwin (39) hence designed one of the first models for determination of subject-specific BSIP for wobbling and rigid masses (Figure 5), which was applied to females and used in later work by Gittoes et al. (66). Using an adapted Yeadon model (25), 59 geometric solids (40 soft tissue, 17 bone, 2 lungs) were used to represent the components of the body to an accuracy of less than 3.0% (maximum error of 4.9%). The authors discussed the role lung volume and density variation during breathing played in model error, the limitations of the uniform density assumption (as investigated by Ackland et al. (58)) and the use of Dempster’s density data. Ackland et al. (58) found intra-segment density data varied, suggesting future work may utilise methods such as DXA scanning to obtain personalised segment density values, which if used in conjunction with anthropometric dimensions may combine to produce a much more realistic and accurate model. 469

Fig. 5. Segment and tissue distribution in the wobbling mass inertia model developed by Gittoes and Kerwin (39). Soft tissue is shown as white, bone as light grey and lungs as dark grey

What areas are currently being concentrating on? Work this decade has developed simpler methods of BSIP calculation (68-70), and built on previous work (31, 71). Population-specific models are devised as researchers realise the generalised models of the 60s, 70s and 80s do not reflect the populations being investigated. Jensen was one of the first to recognise that the inertial properties of adults cannot be extrapolated to children; he published a number of papers (41, 72-76) investigating changes in children’s inertial characteristics of children over a period of time. Jensen and Fletcher (77) and Pavol et al. (78) devised BSIP models of elderly adults, based on a growing trend of research into the biomechanics of older adults. Cheng et al. (33) determined BSIP of Chinese adults from MRI, whilst Nikolova and Toshev (79) calculated BSIP of the Bulgarian population using a 16-segment mathematical model. Conclusions Immense development of measurement of BSIP has occurred since the 1970s. Hatze’s model (23) is currently the ideal, but its excessive time requirement limits its widespread use. Wobbling mass models are potential areas of growth in the future, and advances in measuring techniques such as DXA should aid this. Increasingly accurate and user-friendly techniques are likely to lead to more subjectspecific models. Inertia modelling has been an important biomechanical analysis technique to date, and that importance looks set to continue into the future. 470

REFERENCES 1. Hamill J. Biomechanics curriculum: its content and relevance to movement sciences. Quest. 2007;59:25-33. 2. Schwamader H. Issues and challenges of applied sport biomechanics research. J Biomech. 2007;40(S2):14. 3. Abdel-Aziz YI, Karara HM. Direct Linear Transformation from comparator coordinates into object space co-ordinates in close range photogrammetry. In: American Society of Photogrammerty Symposium on Close Range Photogrammetry; 1971; Falls Church, VA: American Society of Photogrammetry. 4. Walton J. Close-range cine-photogrammetry: A generalized technique for quantifying gross human motion [dissertation]. Pennsylvania State University; 1981. 5. Brewin MA, Kerwin DG. Accuracy of scaling and DLT reconstruction techniques for planar motion analyses. J Appl Biomech. 2003;19:79-88. 6. Henry FM. Force-time characteristics of the sprint start. Res Q. 1952;23:301-18. 7. Chen SJ, Pipinos I, Johanning J, Radovic M, Huisinga JM, Myers SA, et al. Bilateral claudication results in alterations in the gait biomechanics at the hip and ankle joints. J Biomech. 2008;41:2506-14. 8. Engsberg JR, Lenke LG, Bridwell KH, Uhrich ML, Trout CM. Relationships between spinal landmarks and skin surface markers. J Appl Biomech. 2008;24:94-7. 9. Schache AG, Baker R, Lamoreux LW. Influence of thigh cluster configuration on the estimation of hip axial rotation. Gait Post. 2008;27:60-9. 2008. 10. Winter DA, Sidwall HG, Hobson DA. Measurement and reduction of noise in kinematics of locomotion. J Biomech. 1974;7:157-9. 11. Robertson DGE, Dowling JJ. Design and responses of Butterworth and critically damped digital filters. J Electromyogr Kines. 2003;13:569-73. 12. Onyshko S, Winter DA. A mathematical model for the dynamics of locomotion. J Biomech. 1980;13:361-8. 13. Hiley M, Yeadon MR. The margin for error when releasing from the asymmetric bars for dismounts. J Appl Biomech. 2005;21:223-35. 14. Wilson C, Yeadon MR, King MA. Considerations that affect optimised simulation in a running jump for height. J Biomech. 2007;40:3155-3161. 15. Shahbazi-Moghadam M, Khosravi NA. A mechanical model to estimate legs muscle stiffness coefficients in horse during jumping. In: Kwon YH, Shim J, Shim JK, Shin IS, editors. Scientific Proceedings of the XXVI International Symposium on Biomechanics in Sport; 2008 Jul 14-18; Seoul National University, Korea. Seoul: International Society of Biomechanics in Sports; 2008. 16. Bernstein NA, The coordination and regulation of movements. Oxford, UK: Pergamon. 1967. 17. Oghi S, Morita S, Loo KK, Mizuike C. A dynamical systems analysis of spontaneous movements in newborn infants. J Motor Behav. 2007;39(3):203-214. 18. Jordan K, Challis JH, Newell KM. Walking speed influences on gait cycle variability. Gait Posture. 2007;128-34. 471

19. Peters BT, Hadad JM, Heiderscheit BC, Van Emmerik REA, Hamill, J. Issues and limitations in the use and interpretation of continuous relative phase. J Biomech. 2003;36: 271-4. 20. Braune W, Fischer O. The center of gravity of the human body as related to the German infantryman (ATI 138 452). Available from National Technical Information Services, Leipzig. 1889. 21. Dempster WT. Space requirements of the seated operator (WADC Technical Report 55-159, AD-087-892). Dayton, OH: Wright-Patterson Air Force Base. 1955. 22. Hanavan EP. A mathematical model of the human body (AMRL Technical Report 64-102). Dayton, OH: Wright-Patterson Air Force Base. 1964. 23. Hatze H. A mathematical model for the computational determination of parameter values of anthropometric segments. J Biomech. 1980;13:833-43. 24. Yeadon MR, Morlock M. The appropriate use of regression equations for the estimation of segmental inertia parameters. J Biomech. 1989;27:683-9. 25. Yeadon MR. The simulation of aerial movement – II. A mathematical inertia model of the human body. J Biomech. 1990;23(1): 67-74. 26. Jensen RK. Estimation of the biomechanical properties of three body types using a photogrammetric method. J Biomech. 1978;11:349-58. 27. Zatsiorsky V, Seluyanov V. The mass and inertia characteristics of the main segments of the human body. In: Matsui H, Kobayashi K, editors. Biomechanics VIII-B; Champaign, IL: Human Kinetics; 1983. p1152-9. 28. Mungiole M, Martin PE. Estimating segment inertial properties: comparison of magnetic resonance imaging with existing methods. J Biomech. 1990;23:1039-46. 29. Baca A. Precise determination of anthropometric dimensions by means of image processing methods for estimating human body segment parameter values. J Biomech. 1996;29(4):563-7. 30. Cheng CK, Chen HH, Chen CS, Lee CL, Chen, CY. Segment inertial properties of Chinese adults determined from magnetic resonance imaging. Clin Biomech. 2000;15(8):559-566. 31. Gittoes MJR, Bezodis IN, Wilson C. (forthcoming), An image-based approach to obtaining anthropometric measurements for inertia modelling. Submitted to J Appl Biomech. 32. Barter JT. Estimation of the mass of body segments (WADC Technical Report 57-260). Dayton, OH: Wright-Patterson Air Force Base. 1957. 33. Clauser CE, McConville JV, Young JW. Weight, volume and centre of mass of segments of the human body (AMRL Technical Report 69-70). Dayton, OH: WrightPatterson Air Force Base. 1969. 34. Chandler RF, Clauser CE, McConville JT, Reynolds HM, Young JW. Investigation of the inertial properties of the human body (AMRL Technical Report 74-137). Dayton, OH: Wright-Patterson Air Force Base. 1975. 35. Durkin JL, Dowling JJ. Analysis of body segment parameter differences between four human populations and the estimation errors of four popular mathematical models. J Biomech Eng-T ASME. 2003;125:515-22. 472

36. Irwin G, Kerwin DG. Inter-segmental coordination in progressions for the longswing on high bar. Sports Biomech. 2007;6(2):131-44. 37. Silva MP, Ambrosio JA. Sensitivity of the results produced by the inverse dynamic analysis of a human stride to perturbed input data. Gait Post. 2004;19:35-49. 38. Reinbolt, JA, Haftka RT, Chmielewski T, Fregly BJ. Are patient-specific joint and inertial parameters necessary for accurate inverse dynamics analyses of gait?. IEEE T Bio-med Eng. 2007;54(5):782-93. 39. Gittoes MJR, Kerwin DG. Component inertia modelling of segmental wobbling and rigid masses. J Appl Biomech. 2006;22:148-54. 40. Hatze, H. Biomechanics of sports – selected examples of successful applications and future perspectives. In: Riehle HJ, Vieten MM, editors. Proceedings of the XVI International Symposium on Biomechanics in Sports; 1998 Jul 21-25; Konstanz, Germany. Konstanz: International Society of Biomechanics in Sports. 1998. 41. Jensen RK. Changes in segment inertia proportions between 4 and 20 years. J Biomech. 1989;22(6/7): 529-36. 42. Pain MTG, Challis JH. The influence of soft tissue movement on ground reaction forces, joint torques and joint reaction forces in drop landings. J Biomech. 2006;39:119-24. 43. Dellanini L, Hawkins D, Martin RB, Stover S. An investigation of the interactions between lower-limb bone morphology, limb inertial properties and limb dynamics. J Biomech. 2001;36:913-9. 44. Erdmann WS. Morphology biomechanics of track and field competitors. In: Menzel HJ,Chagas MH, editors. Scientific Proceedings of the XXV International Symposium on Biomechanics in Sport; 2007 Aug 23-27; Ouro Preto, Brazil. Ouro Preto:International Society of Biomechanics in Sports. 2007. 45. Challis JH. Accuracy of human limb moment of inertia estimations and their influence on resultant joint moments. J Appl Biomech. 1996;12:517-30. 46. Challis JH, Kerwin DG. Quantification of the uncertainties in resultant joint moments computed in a dynamic activity. J Sport Sci. 1996;14:219-31. 47. Pearsall DJ, Costigan PA. The effect of segment parameter error on gait analysis results. Gait Post. 1999;9:173-83. 48. Ganley KJ, Powers CM. Determination of lower extremity anthropometric parameters using dual energy X-ray absorptiometry: the influence on net joint moments during gait. Clin Biomech. 2004;19:50-6. 49. Andrews JG, Mish SP. Methods for investigating the sensitivity of joint resultants to body segment parameter variations. J Biomech. 1996;29:651-4. 50. Kingma I, Toussaint HM, De Looze MP, van Dieen JH. Segment inertial parameter evaluation in two anthropometric models by application of a dynamic linked segment model. J Biomech. 1996;29:693-704. 51. Rao G, Amarantini D, Berton E, Favier D. Influence of body segments’ parameters estimation models on inverse dynamics solutions during gait. J Biomech. 2006;39:1531-1536. 52. Hatze H. Parameter identification for human body segment models. Theor Iss 473

Erg Sci. 2005;6(3-4): 331-4. 53. Bartlett R. Sports Biomechanics: reducing injury and improving performance. Bath, UK: Routledge. 1999. 54. Wicke J, Lopers B. Validation of the volume function within Jensen’s (1978) elliptical cylinder model. J Appl Biomech. 2003;19:3-12. 55. Hatze H, Baca A. Contact-free determination of human body segment parameters by means of videometric image processing of an anthropometric body model’, in Proceedings of the International SPIE Congress on Image Processing, San Diego, CA, USA. 1992. 56. Sarfaty O, Ladin Z. A video based system for the estimation of the inertial properties of body segments. J Biomech. 1993;26:1011-6. 57. Huang HK. Evaluation of cross-sectional geometry and mass density distributions of humans and laboratory animals using computerized tomography. J Biomech. 1983;16(10):821-32. 58. Ackland TR, Henson PW, Bailey DA. The uniform density assumption: its effect upon the estimation of body segment inertial parameters. Int J Sport Biomech. 1988;4:146-53. 59. Pearsall DJ, Reid JG, Livingston LA. Segmental inertial parameters of the human trunk as determined from computed tomography. Ann Biomed Eng. 1996;24(2):198210. 60. Durkin JL, Dowling JJ, Andrews DM. The measurement of body segment inertial parameters using dual energy X-ray absorptiometry. J Biomech. 2002;35:1575-80. 61. Holmes JD, Andrews DM, Durkin JL, Dowling JJ. Predicting in vivo soft tissue masses of the lower extremity using segment anthropometric measures and DXA. J Appl Biomech. 2005;21:371-82. 62. Martin PE, Mungiole M, Marzke MW, Longhill JM. The use of magnetic resonance imaging for measuring segment inertial properties. J Biomech. 1989;23(10):10391046. 63. Pain MTG, Challis JH. High resolution determination of body segment inertial parameters and their variation due to soft tissue motion. J Appl Biomech. 2001;17:326-334. 64. Pinti A, Renesson JL, Leboucher J, Dumas GA, Lepoutre FX, Poumarat G. Inertia parameter calculation using a SYMCAD optical scanner. Comput Meth Biomech Biomed Eng. 2005;S1:213-4. 65. Gruber K, Ruder H, Denoth J, Schneider K. A comparative study of impact dynamics: wobbling mass model versus rigid body models. J Biomech. 1998;31:439-44. 66. Gittoes MJR, Brewin MA, Kerwin DG. Soft tissue contributions to impact forces using a four-segment wobbling mass model of forefoot-heel landings. Hum Movement Sci. 2006;25:775-787. 68. Pataky TC, Zatsiorsky VM, Challis JH. A simple method to determine body segment masses in vivo: accuracy, reliability, and sensitivity analysis. Clin Biomech. 2003;18:364-8. 69. Kodek T, Munih M. An identification technique for evaluating body segment pa474

rameters in the upper extremity from manipulator-hand contact forces and arm kinematics. Clin Biomech. 2006;21:710-6. 70. Monnet T, Vallee C, Lacouture P. Identification of mass and mass centre position of body segments. Comput Meth Biomech Biomed Eng. 2008;11(1):165-6. 71. Dumas R, Cheze L, Verriest JP. Adjustments to McConville et al. and Young et al. body segment inertial parameters. J Biomech. 2007;40:543-53. 72. Jensen RK. The effect of a 12-month growth period on the body moments of inertia of children. Med Sci Sport Exer. 1981;13(4):238-42. 73. Jensen RK. Body segment mass, radius and radius of gyration proportions of children. J Biomech. 1982;15(4):347. 74. Jensen RK. The developmental relationship between a joint torque and its mass distribution in boys, five to sixteen years. J Biomech. 1985;18(7):530. 75. Jensen RK. The growth of children’s moment of inertia. Med Sci Sport Exer. 1986;18(4):440-5. 76. Jensen RK. Growth of segment principal moments of inertia between four and twenty years. Med Sci Sport Exer. 1988;20(6): 594-604. 77. Jensen RK, Fletcher P. Body segment moments of inertia of the elderly. J Appl Biomech. 1993;9:287-305. 78. Pavol MJ, Owings TM, Grabiner MD. Body segment inertial parameter estimation for the population of older adults. J Biomech. 2002;35:707-12. 79. Nikolova GS, Toshev YE. Estimation of male and female boy segment parameters of the Bulgarian population using a 16-segmental mathematical model. J Biomech. 2007;40:3700-7.

475

POLITICS PANEL

•

Juding Panel Dr. Mary Murphy (NUI Maynooth) – Chair Dr. Iain McMenamin (Dublin City University) Dr. John Barry (Queen’s University Belfast) Dr. Maura Adshead (University of Limerick) Judges’ commentary This is an extremely well-written paper throughout and demonstrates a clear grasp of the main issues in Swedish electoral politics – voting patterns, turnout and the party system, including party loyalty. The author addresses a normatively vital question. It is clear and sophisticated in its use of concepts. The essay manages to combine a wide range of theory and detailed evidence in a way which engages critically and thoughtfully with the literature. It does not rely excessively on one author or viewpoint. The piece’s principal weakness was that the force of the overall argument sometimes did not emerge sufficiently clearly. Structurally ‘the party systems approach’ section could be a separate section. The Swedish Green Party is strangely absent form discussion. More could be said about a ‘decrease in the quality of contacts’ and the impact of referenda on the party system in Sweden (their use relative to other EU countries for example? There is a slight tendency towards informal colloquialisms (‘my Marxist drum;’ ‘Putnam lingo’). There is a good introduction with confident use of theory and arguments/explanations of others and an impressive array of authors, thinkers, methodological approaches and schools of thought used throughout. There are some very well-argued points explaining the role/s of political parties in relation to declining voter turnout and voting patterns. There is confident development of independent argument, using appropriate literature as evidence and leading to an excellent, provocative and thought-provoking conclusion.

476

P OL I T IC S

Party mobilisation & turnout decline in Sweden Mark Canavan

his essay will explore the relationship between the Swedish party system and voting turnout by the electorate, in national parliamentary elections. It will begin with a brief discussion of the importance of electoral participation in representative democracies, and more specifically, why a declining rate of voter turnout is potentially destructive of democracy. I will then move on to the task of justifying my focus on political variables ahead of structural variables (such as demography), and in particular why I belief the party system has the status of an intervening variable in explaining cross-national and temporal differences in turnout. However this essay will not focus too much attention on a comparative perspective but will instead focus its attention on the role of the Swedish Party system in determining voting patterns in Sweden. My main task will be to analysis the current voting turnout in Sweden, and then to account for changes within this rate, especially over the last 13 or so years. It is always precarious to try to set out definitional criteria of so diffuse a term as ‘democracy’. To say that democracy necessarily requires certain criteria within a state is in many ways to enter into a heated normative theoretical debate. Nevertheless, and despite its diffusiveness, democracy isn’t everything. It does have clearly demarcated boundaries, and whether one takes a ‘minimalistic’ or more substantive view of what constitutes democracy, the holding of regular and contested elections in a representative democracy is an inescapable feature of its constitution (Whitehead, 2003, 242). In a democracy the ‘supreme power’ of the people has to express their wishes, expectations, demands and interests to their representatives; and this requires a minimum level of engagement. This, at least, 477

is a point upon which ‘populist’ democratic theorists, such as Benjamin Barber, and more elitist democratic theorists such as Joseph Schumpeter could agree on. However this is where the agreement ends. As Van Deth and Elff succinctly put it, the need for a minimum level of involvement is accepted; however the debate in democratic theory is about the “degree of involvement in a democratic system” (Van Deth and Elff, 2004, 478). Some contemporary authors following on in the Schumpeterian tradition, such as Rosema, argue that in the least low-turnout doesn’t matter, and at the most it is a positive attribute of modern democracy. He argues that a low-turnout, in which most voters rationally consider their electoral choice, is preferable to a high-turnout where the majority of votes are made on the basis of some politically arbitrary judgement or preference (Rosema, 2006, 3). The problem with this argument is that there is certainly no guarantee that those who show at the polls will cast a more quality vote. Just because they are the less inert, and possibly more motivated citizens does not automatically imply that their political judgement is more beneficial for the so-called common good. Rosema’s argument is in many ways based on the judgement that those who do not bother to vote do so not just out of inertia and disinterest. While standing accused of fence-sitting, it is perhaps more empirically to the point to cite D’Art and Turner who contend that in ‘real terms’; for those who favour greater income equality a high participation rate can be said to be beneficial; while those who favour small, limited government, greater participation can involve greater cost (2007, 105). However this does not answer as to whether low and decreasing turnout can be seen as a symptom of dissatisfaction with the political system. While not attempting to beat my Marxist drums too loudly, low and decreasing turnout, can also be a symptom of alienation from the political system at large. Again this comes back to the debate about whether apathy can be considered a political good or as destructive of the democratic political system. It is perhaps prudent to concede that one hundred percent turnout is not something which is likely to be achieved (without that is, compulsory voting laws) in anything resembling Dahl’s polyarchy. However, disregarding any aforementioned conception of the ‘good life’, such as the belief that a particular economic system is- a priori- inherently better, and looking towards democracy primarily as a dispute resolution mechanism, it is perhaps more prudent to have the greatest possible number of citizens in a society playing the ‘democratic game’, rather than having a very substantial percentage of the citizenry being passive receivers of governmental output, to which they had no input.

Party Systems There are indeed many variables which go towards explaining temporal, spatial and cross-national differences in turnout rates. Wattenberg neatly sums up the methodological and conceptual question confronting any research into voting patterns, “which is more important in causing more or fewer people to go to the polls, partisan or demographic changes?”; to which his reply is ‘partisan’ (Watten478

berg, 2000, 71). His main argument is that in spite of the prevalence of supposed countervailing demographic pressures, turnout has been declining almost uniformly throughout the OECD (Wattenberg, 2000, 71). For instance, if one takes the demographic factors proposed by Lipset in the 1950s: that men vote more than women, the educated more than the less educated and the old more than the young; a socio-demographic analysis alone would not be able to explain the current downward trend in voter decline. However these ‘push’ theories of voting patterns still warrant much attention (Van Deth and Elff, 2004, 478). While education, for instance, has increased in all OECD countries to a scale that was almost unimaginable in the 1960s, voting turnout has declined, even among the young more educated generations. Despite this, authors have still found a strong correlation between certain types of education and high turnout (Hillygus 2005). Perhaps it is unwise to consider in any more than nominal terms, the party system to be an independent variable. However its status as an intervening variable is not as doubtful. While we cannot, of course separate political parties from the character of the citizens that vote or do not vote for them or from their social circumstances, it is naive to assert that political parties themselves do not have a reciprocal affect upon voters’ orientations to the political system as a whole. As Gronlund asserts, “it is assumed that voter turnout is dependent, not only on social structure, but also on individual voters’ rational evaluation. Basically, this individual rationality interferes with the ‘‘pure’’ effects of the social environment” (Gronlund, 2004, 504) According to Goldstein and Ridout, there are also clear normative implications of such an approach, “If propensities to vote are not only determined by immutable demographic factors but by environmental and strategic factors as well, then reducing the structural barriers to voting and strengthening the amount or quality of mobilization may bring more people to the polls” (Goldstein and Ridout, 2004, 4). Schattschneider once asserted that modern democracy is unthinkable without political parties. He referred not only to political party’s’ historical role in many countries in expanding citizen participation, but to party’s various functional roles as organisations in sustaining democracy (Dalton and Wattenberg, 2000, 1). This view attributes many functions to political parties that- even if not constitutionally enshrined- are fundamental to the successful functioning of a parliamentary democracy. Most importantly to consider in my current discussion is V.O. Key’s classification of party functions ‘in the electorate’ (Dalton and Wattenberg, 2000, 5). Briefly, these amount to: simplifying and aggregating choices for voters; as democratic teachers educating the citizenry in ‘civic virtue’ and everyday issues; generating symbols of identification and loyalty which stabilise the democratic system (because people are less likely to be swayed by demagogic personalities); and mobilising the electorate both directly (through personal contact with a party member for instance) and indirectly (through reducing the informational costs of voting, for instance) (Dalton and Wattenberg, 2000, 6-7). As my point of departure I take the premise: that support for a particular politi479

cal party or group of political parties- or more importantly lack thereof- can colour an individual citizen’s orientation towards the entire political system. The main theme I will be pressing throughout my investigation into the relationship between the party system and voting patterns in Sweden, is Dalton and Wattenberg’s ‘defreezing’ of party systems hypothesis; and its consequences on voter turnout. This hypothesis suggests that party systems across Europe, and even further afield, are losing their post-war structure. Essentially this is a result of a shift from the traditional religious, urban-rural, and classed-based cleavage voting structure of modernity to a freer floating, post-materialist voting pattern that characterises late modernity. This results in the emergence of new categories of voters, whom the old political parties and rigid party models are unable to accommodate. Furthermore, parties are rapidly losing their traditional grass-roots grounding, as the electoral market forces them to become ‘catch-all’ parties pandering to the demands of a heterogeneous middle-class. With the erosion of their societal base, people are less likely to display long-term partisan commitments, nor to retain “enduring feelings of party identification” (Sundberg, 1999, 232). Dalton and Wattenberg suggest that there are several trends that point towards the declining influence of political parties. For instance most established parties have seen their membership wane, and contemporary publics seem to exhibit declining trust in partisan politics (especially among key groups such as the young or immigrant communities). They assert that this amounts to at least a transformation in the role played by political parties in the electorate; and at most a pattern of partisan decline (Dalton and Wattenberg, 2000, 3). Sundberg applies the ‘defreezing’ hypothesis to the Scandinavian party system. He confirms that the post-materialist argument of Dalton and others, is supported in as far as there is an erosion of the ability of the traditional class and agrarian cleavages to explain party choice. However, the outcome expected by the postmaterialist argument does not hold in the Scandinavian case. Sundberg maintains that the expected electoral instability and destabilisation of the party system has not occurred to a great extent: “New parties have emerged...the number of parties is higher than in the 1950s, class as a social cleavage has faded, but the established three pole parties show no significant sign of break-up” (Sundberg, 1999, 234). In a similar testing of the defreezing hypothesis, Svallfors finds that class differences have been relatively stable overtime in Sweden. He maintains that support for the welfare state amongst middle class voters, is less to do with the ‘stratification’ effect of the universal welfare state, and more to do with the political articulation of class by parties. In other words, ‘class’ voting has more to do with a political identity than with ones objective positioning within the class structure (Svallfors, 2004, 130). The above findings do not refute the ‘defreezing’ hypothesis. However both do make the case that despite high electoral volatility since the 1970s, but particularly throughout the 1990s, Sweden still has a rigid party system composed of a ‘core three’. More significantly, and in contrast to other countries such as Germa480

ny, France and Britain, there is still two very much, distinguishable left and right blocs. It is still highly unlikely that the Social Democrats in Sweden would go into coalition with the Moderates or Liberal party for instance. In short, voters still have an actual choice between competing alternatives in Sweden, whereas this is less markedly so in other Western European countries. I will now go on to examining what makes Sweden unique in international voting pattern terms, and how this can in part be attributable to its party system. Turnout in Sweden At this point I intend to describe the current state of play in Sweden regarding turnout levels, vis-a-vis other OECD countries. Wattenberg asserts that there are few trends in political science that are so widely generalizable as the decline in voting turnout across the OECD countries. The median change across the OECD has been a 10 per cent decline from the post-war peak in the 1950s; with a median turnout rate of 70 percent. However both Sweden and Denmark are the only two countries in the OECD not to have experience a decline in turnout since the 1950s. In fact the last election in 2006 reached an impressive 82, compared to 79 per cent in 1950. However if the 1960s are taken as the base year, then Sweden is undergoing, a worrying rate of decline (Swedish Election Studies Program, 2001). Since the 1960s Swedish turnout has fallen by roughly the same rate as found in other OECD countries since the 1950s. More pertinently this has not been in a linear fashion but rather was only slight in the 1980s, followed by more substantial drop-offs during the 1990s and into the 2000s. From the peak in 1976 of 91.8 per cent, turnout declined to 86 per cent in 1988, then to a low of roughly 81 per cent in 1998 and 2002. Despite this in the 2006 national election the rate of decline seemed to stem off as turnout was at about the 82 per cent mark (Statistics Sweden 2007). While admittedly, Swedish turnout is still at a high level in international comparison, the rate of decline is worrying. Moreover, there seems to be mounting evidence that attitudes towards politics have become more in line with other OECD countries. This could suggest that turnout rate may decline further. If attitudes towards politics are changing amongst Swedes, this could herald a departure from the “activist, participatory and egalitarian” model of citizenship traditionally associated with Sweden (Amna et al. 2007, 2). Wattenberg suggests that attitudes change quite rapidly, whereas behavioural tendencies, such as regular voting, tend to take a longer time to change. This is the idea that present turnout may in some ways be explained by past turnout, because voting may be habit-forming. This is especially the case where individuals are reinforced by the success of their candidate (Geys, 2004, 15). Therefore the question is if political attitudes have changed in Sweden, to perhaps become more in line with other rich industrialised countries, will voter turnout follow? Wattenberg contends that as party loyalty and collective identification with a political group has gone down in OECD countries, so has voter turnout (Wattenberg, 2000, 66). This is due to various reasons. Firstly this is because “partisanship provides a standing predisposition that guides voter preferences....people vote for 481

‘their’ party in the belief that the party...best represents their interests” (Dalton, McAllistar and Wattenberg, 2000, 38). Without this voters are left “adrift in a complicated political world” and voting to them is likely to either involve more informational costs, or seem arbitrary (Wattenberg, 2000, 66). Similarly even if people still have a party identification it is likely to matter less to them because the ‘linkages’ between social groups and parties have declined (Wattenberg, 2000, 66). Certainly there seems to be a marked decline in political loyalty in Sweden, as elsewhere. Since the 1970s there has been a higher electoral instability, with voters beginning to move between blocs. Despite the apparent stability of the core three parties, loyalty has never been fully re-established (Bergman, 2004, 229). For instance in Barton’s typology (1955) measuring political interest and partisanship, 36 percent of respondents described themselves as ‘partisans’ in 1963, whereas only 28 percent did in 1998. Those who described themselves as ‘independents’- as having an interest in politics but no party affiliation- rose from 14 percent in 1968 to 28 percent in 1998. This figure fits in with Wattenberg’s assertion that the people who do vote increasingly do so to express an opinion- not out of an enduring commitment to a party. Perhaps the most potentially damaging finding of this survey on voter turnout is the numbers of people who place themselves in the ‘apathetic’ category. This has risen from 21 percent in 1968 to 30 percent in 1998 (Swedish Election Studies Program, 2001) There are also worrying levels of turnout within certain societal sub-groups, especially within immigrant communities. For example only 63.8 and 68.2 of Asians and Africans respectively voted in the 2002 general election, compared with 82.7 per cent of native born Swedes (Statistics Sweden 2007). This divergence in voting patterns, are perhaps demonstrative of the inability of the old party system to attract new categories of voters. As the Demokratiutredningen 2003 states “ethnicity is the new class marker”, and this means parties old class based parties must respond to the possible emergence of a new cleavage within Swedish society (Amna et al. 2007, 9). However since new categories of voters not incorporated into mass politics, they remain ephemeral. The parties that devised the original rules of the game are still favoured in that they are able to isolate their supporters from competitors insofar as their voters retain a collective identity (Sundberg, 1999, 223)

The Decline of Party Mobilisation If we concede that people’s loyalty to established parties is weakening, then one must consider why this is the case. There are undoubtedly multiplicities of underlying causes that go towards explaining this phenomenon. However, there is an obvious relation between changes in the party system and changes in people’s party loyalty and political interest. As levels of party loyalty decline, parties become less able and less willing to recruit new members to their grass-roots base. This has an impact on their ability to ‘directly’ mobilise their constituents. This means that as parties get fewer members the quality of their linkages to the community de482

creases. As Wattenberg puts it, “As voters come to experience campaigns through television rather than through personal contact with members of a party organisations, voting has become less of a social act and more of a civic duty” (Wattenberg, 2000, 66).

The above assertion is closely related to the idea that voluntary institutions are sources of social capital within a society, and this adds to civic activity (such as voting). The basic idea behind this is that as social networks decrease in volume and inter-relational quality, there is a reduction at the aggregate level in civic involvement. Indeed Putnam’s main observation in ‘Bowling Alone’ is that modern society has become increasingly individualistic, and this has important ramifications for the successful functioning of democracy (Rothstein and Stolle 2003, 6-9). Sweden is a case in point in this respect. For instance, Rothstein and Stolle argue that Swedes have traditionally exhibited very high levels of social capital, because of the importance of broad-based organisations (‘bridging organisations’ in Putnam lingo), such as political parties, the labour movement, the farmers’ movement and the temperance movement (Rothstein and Stolle 2003, 7). Rothstein and Stolle contend that voluntary organisations are important to democracy because they entail opportunities to learn civic virtues and democratic attitudes (Rothstein and Stolle 2003, 13). However most vitally for our current discussion, the character of these organisations affects the values their members exhibit. For instance, it is unlikely that the ‘democratic dividend’ -in the form of mobilisation of the electorate by party members- can be supplanted by increasing membership in leisure and cultural organisations; given the rapid decrease in membership of political parties (Rothstein and Stolle 2003,10-4). In Sweden membership of political parties is declining at an alarming rate. For instance the total number of party members fell from 1,483,000 in 1990 to 346,000 in 2002 (Bergman 2004, 213). This further increases the parties incentive to change their internal structure towards more elite-based and professionalised organisations- able to survive without a mass membership base. According to many authors, the lack of mobilisation in political parties, and groups such as labour movements is the major reason for the decline in turnout in the USA (Goldstein and Ridout, 2002, 3-4). According to May’s law of curvilinear disparity, as parties lose their mass base, the remaining membership, and subsequent members in the stripped down organisation will be a hardcore few (Wildfedt, 1999, 323). This law paints a picture of the inside of parties as insular sects, unaccustomed to the give and take of electoral politics. Wildfedt suggests that to a certain extent, there has been an increase in ideological distance between voters and members in two out of three parties in Sweden in the period 1985-94 (Wildfedt, 1999, 323).This largely makes the party cadre more distrustful of the members decision-making ability and less likely to allow internal party democracy, thus further reducing incentives 483

for members to join their party. Furthermore, parties having found alternative methods of funding become even further detached from their membership base, and more akin to professional marketing firms. As Putnam puts it: “Financial capital-the wherewithal for mass marketing-has steadily replaced social capital-that is, grassroots citizen networks-as the coin of the realm” (in Goldstein and Ridout, 2002, 5). Thus we see the dynamic of a downward spiral of party mobilisation and a decrease in the quality of contacts between parties and the electorate.

However it must be said that in Sweden this scenario has not materialised to any great extent. While parties’ membership rolls have waned drastically, Berg contends that political parties remain essential in the democratic chain in their role of mobilising the electorate. They are still largely self-financing and they still remain open to membership influence; the national leadership still has little say in candidate selection at the local or regional level, for instance (Bergman 2004, 214). Furthermore, it could be argued that union membership, in its close affiliations with the social democratic party and ideology, still provides a ‘democratic dividend’ similar to that of party mobilisation. D’Art and Turner claim that strong unions are important in giving workers an experience of democratic participation in workplace and a “sense of political efficacy”; thereby encouraging participation in politics (D’art and Turner, 2007, 107). Wattenberg also sees the increasing use of referenda in modern day European democracies, as hastening the decline of mobilisation of party mobilisation (Wattenberg, 2000, 70). This has weakened the incentive to vote for elected officals. We can see in the Swedish referenda over the last couple of decades, especially the 2003 referendum over EMU, reveal a willingness to go against the party, and perhaps protest against what many have seen as the ‘elititist’ position of the main political parties. To compound this protest, the EMU election also had a very high turnout (Aylott, 2005, 549). Decline in mobilisation of voters by political parties, is often attributed to the indistinguisability of the parities from one another. Indeed Wattenberg notes that the rapid decline in turnout in the 1980s in many countries could be attributable to ‘punctuated equilibrium’- shakeups in the party system (Wattenberg, 2000, 74). An interesting proposition put forward by Wattenberg, for the sudden decline in turnout in 1980s Germany, for instance, was the Free Democrats change in coalition partners in 1982-3, which changed the government from a socialist one to a non-socialist one. He asserts that this reduced incentives to vote in subsequent elections because it seemed to matter less whether the CDU or SPD headed government. Similarly a ‘punctuated equilibrium’ is visible in the UK, when the largest drop in turnout was between 1992-97, during the unveiling of Blair’s ‘New Labour’ (Wattenberg, 2000, 75). According to Wattenberg this meant that “it [Labour] was 484

far more successful in gaining a large vote share while at the same time less able to bring citizens of low socio-economic status to the polls” (Wattenberg, 2000, 76). Wattenberg’s argument is largely a reformulation of the ‘Downsian Closeness Model’. This suggests that the closer the election contest, the more likely people are to vote. This can be for two reasons: that the individual voters ‘utility’ from turning out is expected to increase and that close elite contestation provokes more elite mobilisation efforts (Geys, 2006, 17-8). Wattenberg’s main assertion is that as traditional class-based politics declines, this precipitates the spread of the ‘catch-all’ party. Those on the marginality of the middle-class, or those whom the new catch-all party does not appeal to, are left with few viable alternatives to vote for; therefore increasing numbers of them abstain from voting (Wattenberg, 2000, 66-7). Lindstrom argues that Swedish parties are increasingly following this trend, and an increasing number of voters are questioning the relevance of the rigid five-party system. This is not because there are not additional parties, but rather because the parties are becoming indistinguishable from one another (Bergman, 2004, 212). Lindvall and Rothstein also see a weakening of the link between policy output and the voters character. They assert that this marks the advent of the decline of the ‘strong society’ that Erlander envisaged (Lindvall and Rothstein 2006, 49). However in many ways the above assertions are alarmist. Their proposition that parties are not fulfilling the policy preferences of their constituents, seems to be more of an argument propounding what these citizen’s interest ‘really is’. For instance Wildfeld finds in his comprehensive study that “There is no evidence of a decline in the representativeness of the parliamentarians”, and generally provides evidence to suggest that elected officals in Sweden are not losing touch with their electorate (Wildfeld, 1999, 307-8&312-4). The second benefit of a close contestation is in its effects in spurring increased elite contestation. This has several effects; increasing campaign expenditures, for instance, which has a positive effect on voter turnout (Geys, 2002, 20). This tends to increase the so-called ‘get-out-the-vote’ campaigns, which try to sway marginal voters, who are the least likely to vote. As Geys puts it these campaigns: “try to enlarge the feeling of ‘civic duty’ of the voter” (Geys, 2002, 21). However the fact that these type of campaigns are less the result of individual parties efforts to increase their vote share, and more the result of a concerted cross-party agenda to increase the share of voter turnout, speaks volumes of the still ’consensual’ nature of Swedish politics. Sundberg describes this idea of the party system as entailing: “close cooperation between parties despite deep cleavages. Leaders feel a commitment to the unity of the country as well as to democratic principles” (Sundberg, 1999, 222). This might seem like too rosy a picture of the Swedish party system. However there are grains of truth in such a description. For instance while in some countries low turnout might be seen as an inevitable outcome of the electoral market, and individual parties, with little to gain from a rise in turnout do little to stem its decline. However in Sweden there have been 485

serious efforts to stem flow of decline, despite its relatively high turnout. For instance, there have been efforts to make Swedish politics more interesting. This has involved making Riksdag debates livelier and attempts to increase public awareness and access to everyday political matters in the Riksdag (through televising debates for instance) (Lee, 1998, 225-6&435). Moreover there have been serious and far-reaching government sanctioned commissions authorised to investigate turnout decline (Amna et al. 2007, 2-3).

Conclusion While it is important not to be too alarmist about turnout decline in Sweden, the opposite is also true. One cannot be too casual in their treatment of Swedish turnout, just because it remains at a high level. After all, Swedish political culture has always prided itself on setting higher standards, in terms of democracy, than thought possible in other countries. Erlander’s Metal Workers Speech in 1961, is a case in point. He outlined his opposition to EEC membership on the grounds that Sweden had higher ‘social democratic’ ambitions than other European countries (Stig, 1997, 116). So how far has Sweden strayed from the ideal of social democracy? While turnout is just one measure of the health of democracy in a country it is an important one. Definitely, the rate of decline is worrying, as is the apparent inequality of political interest amongst social sub-groups- such as the difference between turnout in immigrant groupings and in ‘majority-ethnic’ Swedish groupings. It is also difficult to refute the assertion that, the high level of current turnout rates, could be a result of a ‘habitual voting’ pattern; rather than a result of some other subjective reason to vote such as political interest or party loyalty. I have already showed how attitudes in these categories have purportedly changed over time since the ‘60s and ‘70s. Also, Amna et al., in their study of young, upper-secondary level youths in Scandinavian (the next cohort of ‘first time voters’), find that “young Scandinavians cannot be characterised as the most politically interested or participative” from an internationally perspective (Amna et al. 2007, 2). On the other hand such subjective measurements are fraught with (sometimes gross) empirical and conceptual inaccuracies. For instance, political interest measures take little account of the cross pressures thesis, which assumes that voters are subject to multiple social pressures to vote. One experiences such social pressure within social networks, especially ones with ‘quality’ relational linkages (Geys, 2002, 15). Therefore Rothstein and Stolles (very preliminary) assertion, that Swedish society has very high levels of social capital; means that there may still be quite strong social pressure to turn out to vote in Swedish elections (Rothstein and Stolles, 2003, 15-7). Another side of the coin is that, Swedish political parties may still exert a strong mobilisation effect on the electorate. It could be somewhat irrelevant whether voters remain largely politically disinterested throughout most of the cabinet term, 486

once parties can still perform their functions within the electorate, such as reducing informational costs and applying social pressure on marginal constituents. The question about whether Swedish parties can still perform their mobilisation duties is an open one. As I have pointed out the rapid decline in party membership, does not appear to bode well for increasing the ‘social’ dimension of voting. However, undoubtedly other methods will be found to mobilise the electorate, as Sweden moves perhaps towards a more ‘post-materialist’ voting pattern.

487

PSYCHOLOGY PANEL

•

judging panel Dr. Mark A. Elliott (NUI Galway) – Chair Prof. Julian Leslie, (University of Ulster) Dr. Stanislava Antonijevi (NUI Galway) Dr. Olive Healy (NUI Galway) Judges’ commentary The paper is a critical review showing a confident, experienced writing style that both poses and answers relevant questions using an easy narrative. The material is well sourced and up-to-date and the issue is topical – addressed in a novel fashion by putting an issue of mind into a socially relevant context. This all indicates a very mature line of thinking, deserving of an award at the highest level.

488

P S YC HOL O G Y

The direction of influence between language & thought Cliodhna O’Connor

n George Orwell’s dystopian novel 1984, the government exerts control over its citizens by creating a new language, “Newspeak,” which does not provide for the expression of “dangerous” concepts such as freedom or equality. The effect of this is to make such concepts “literally unthinkable” (Orwell, 1948). This fictional example is illuminating in beginning an examination of the relationship between thought and language. Does language merely provide for the expression of independently-existing ideas, or could it, as Orwell suggests, determine the very ideas that can be conceived? Inspecting the society around us, implicit beliefs in both perspectives are apparent. Psychological experiments, for example, typically take verbal productions as indexical of internal functioning, relying on the assumption that language is an echo of thought. The crusade to promote “politically correct” speech, on the other hand, is driven by the belief that the way we speak about something affects the way we think about it. In everyday functioning in society then, people seem to subscribe both to the notion that thought influences language, and that language influences thought. This essay will examine how well this bi-directional perspective reflects scientific evidence on the language-thought relation. It is clear that language is important in cognitive development, serving as the medium through which facts are learned and concepts are named. What is up for debate is whether language builds these concepts in the first place, or merely reflects meanings that were already present in a non-linguistic form. According to the classic Piagetian view, it is conceptual development that precedes linguistic acquisition. Linguistic mastery is achieved after (and because of) the maturation 489

of relevant cognitive structures. Such a thought®language relation is also evident in the writings of nativists (e.g. Fodor, 1975; Jackendoff, 1992), who believe that humans have a set of innate concepts onto which linguistic codes are mapped (or “bootstrapped,” as Pinker [1989] termed it). Empirical evidence supports the idea that conceptual representations precede linguistic representations: for example, children will often very rapidly generalise a new spatial word (e.g. up/down) across events to which it applies (Bowerman & Choi, 2001). This suggests that the concept was already in place before the verbal term was acquired. A purely unidirectional thought®language relation in development is likely a simplistic position however. Evidence suggests that the linguistic information a child acquires plays a role in structuring their non-linguistic cognitive patterns. For example, Korean speech generally contains fewer nouns than English, and this appears reflected in the conceptual development of Korean children, who are found to perform worse than English infants on object categorisation tasks1 (Gopnik & Meltzoff, 1997). Research also shows that children will use a new linguistic structure without having developed a complete understanding of the concept it conveys – for example, they will produce the term “because” before fully understanding causality (Byrnes & Gelman, 1991). Conceptual development is not therefore a necessary precondition for linguistic acquisition. It is likely, though, that quibbling over “what comes first” in language and thought may be a simplistic way in which to approach the issue. Fiedler (2008) redirects the focus of research to the interaction between them: “Rather than searching for an answer to the antecedence question – whether the mind speaks or the tongue thinks – the aim is to describe and substantiate how language and cognition are mutually contingent on each other in complex and manifold ways” (39). Attention should be focused on the nature of the bi-directionality in the relationship – when and how development in one domain facilitates development in the other. Such a perspective is taken by Gopnik and Meltzoff (1997). They suggest that some cognitive development is indeed a prerequisite for language acquisition, and may also motivate semantic development. A child faced with a particular conceptual problem may be drawn to attend to relevant linguistic structures. The examination of these linguistic patterns accordingly expands the child’s capacity to solve the problem in which he is engaged. Thus, the acquisition of language requires an existing conceptual base, but once language is acquired it expands and restructures that conceptual system.2 This interactional perspective is more intuitively satisfying, and accounts for more of the empirical evidence, than a formulation of either of the unidirectional language-thought relationships. 1 Their comprehension of action concepts (means-end relationships) is accelerated relative to English children. 2 An analogy Gopnik and Meltzoff (1997) give is helpful in understanding this interactive process: A physics student may be involved in a particular problem, encounter a novel term in his research on it, develop an understanding of the term, and that understanding enables her to solve the original problem.

490

Traditionally, language has been approached as, to use Chomsky’s (1975) phrase, “a mirror of the mind” – as a reflection rather than determinant of thought. An interactional position on the language-thought relationship requires acceptance that language does not merely mirror, but also affects thought. It was the emergence of the so-called Sapir-Whorf hypothesis in the 1940s, drawn from the ideas of linguists Edward Sapir and Benjamin Lee Whorf, that gave credibility to the idea of linguistic determinism. Whorf contended that our perception of things like time, space and matter is not universal and innately given, but is determined by how our languages provide for their expression. Differences in linguistic structure will therefore be reflected in corresponding differences in conceptual structure; speakers of different languages will see the world differently. For example, Whorf (1956) observed that while English tends to construct time in terms of linear units (hours, days, etc.), the Hopi language represents time more as a cyclical, continuous process. He proposed that the way Hopi society understood time was fundamentally different to that of English speakers as a result.3 Whorf’s ideas generated much enthusiasm, and initial research in the area was promising. Much of this work took place in the area of colour perception, which to many appeared a particularly suitable arena in which the hypothesis could be tested – colour is objectively measurable, practically all languages have some colour terms, and the colour systems of different languages vary considerably. Early research was supportive of the idea of linguistic influence on colour perception (e.g. Brown & Lenneberg, 1954). However, in 1969 Berlin and Kay published research indicating extensive similarities4 in the colour perception of speakers of different languages. This suggestion of a universal, language-independent perceptual experience was a blow to linguistic determinism, and may have served as a stimulus for the growth of the marked antagonism to Whorf’s ideas evident in the literature for the last number of decades. Criticism of Whorf can be quite heated, and often vitriolic. For many, the language-thought relationship is an ideologically-driven one, touching on issues such as innateness, human autonomy, and the existence of an objectively real external world.5 This ideological nature can perhaps account for the tone of the discourse, described by Levinson (2003): “It is as if the topic of ‘Whorfianism’ is a domain where anybody can let off steam, go on a mental holiday, or pounce upon an ideological enemy” (25). Many writers have positioned Whorf as an advocate of the rather extreme notion (often termed the “strong” version of the Sapir-Whorf hy3 Whorf (1956) gave the following elaboration on the difference between the societies: “One might say that Hopi society understands our proverb ‘Well begun is half done’; but not our ‘Tomorrow is another day’ (148). 4 For example, commonality in the shade people choose as the best representative of the category “red”. 5 J.B. Carroll, in an introduction to Whorf (1956), wonders what it is about the linguistic determinism idea that inspires such reaction: “Perhaps it is the suggestion that all one’s life one has been tricked, all unaware, by the structure of language into a certain way of perceiving reality” (27).

491

pothesis) that all thought is completely determined by language. This argument is an easy one to demolish, and many have seized on the opportunity to do so (e.g. Pinker, 1994). However, from a scientific perspective this amounts to “knocking down a straw man” (Smith, 1996). An inspection of Whorf’s writings reveals that he did not propose anything so extreme or simplistic as the ideas his critics attribute to him.6 Thus much of the anti-Whorf discourse is, as Gumperz and Levinson (1996) note, directed at a mythical target. A reliance on secondary sources means that this misrepresentation is reinforced and perpetuated, and Whorf’s actual ideas are not given the recognition they merit. Whorf in fact advocated the “softer” proposal of linguistic relativity – that language influences but does not determine thought. This has some considerable empirical support, which will be discussed here. Testing of the linguistic relativity idea has proved particularly successful within the domain of spatial perception. While some languages (such as English) use a relative system of spatial reference (with terms such as left/right), others rely on absolute referents (e.g. north/south). This linguistic pattern appears to have cognitive consequences: speakers of languages in which space is represented in absolute or relative terms tend to use that system in non-linguistic spatial memory and problem solving tasks (Majid, Bowerman, Kita, Haun & Levinson, 2004). In describing spatial containment (“in”), Korean makes an obligatory distinction between objects which fit together tightly or loosely. The perceptions of events by Korean speakers are much more likely to spontaneously include this distinction than those of English speakers, who tend not to notice it (Boroditsky, 2003). Linguistic variation in spatial systems therefore appears correlated with corresponding variation in spatial perception. The mathematical domain provides further evidence of linguistic influence on thought. While basic numeracy skills are present in all mammals, the emergence of linguistic symbols for numerical meanings enables the development of complex arithmetic processes (Tomasello, 2003). Those whose linguistic knowledge does not provide for sophisticated numerical representations are at a disadvantage in numerical tasks. The language of the Brazilian Piraha tribe, for example, contains terms only for “one,” “two” and “many.” Members of this tribe have difficulty in distinguishing between arrays of four and five objects, and their memory for numbers of objects presented is poor (Gordon, 2004). Linguistic symbolisation of mathematical meanings appears to facilitate incorporation of those meanings into one’s cognitive patterns. Grammatical gender is supposedly conceptually meaningless. However, experimental studies reveal an influence of gender in descriptions and memory of objects (Boroditsky, Schmidt & Phillips, 2003). The word for “key” is masculine in German and feminine in Spanish, and there is a corresponding difference in German and 6 As the following quote illustrates: “Language, for all its kingly role, is in some sense a superficial embroidery upon deeper processes of consciousness, which are necessary before any communication, signalling, or symbolism whatsoever can occur” (Whorf, 1956, p. 239)

492

Spanish people’s descriptions of what a “key” is7 (Konishi, 1993). Shared gender also predicts errors made in object-naming tasks (Kousta, Vinson & Vigliocco, 2008). It does appear that the way one must grammatically speak about something influences the way in which it is thought about. Boroditsky et al. (2003) do not see this as that surprising, making the good point that a child learning a language has no reason to not treat grammatical gender as a meaningful distinction. The most widely publicised aspect of Berlin and Kay’s (1969) work was their findings of commonalities in colour perception. However, their research also bears evidence of clear cross-linguistic differences in colour perception, for example variation in the boundaries drawn between colour categories. Berlin and Kay’s work may therefore discredit the concept of linguistic determinism, but it simultaneously provides support for linguistic relativity. The finding of linguistic influence on colour perception is now a robust one (e.g. Davidoff, Davies & Robertson, 1999; Pilling & Davies, 2004). This is quite impressive, as colour perception is not actually the most natural place to search for linguistic influence on cognition – intuitively, language is most likely to exert an impact in more abstract domains which cannot be accessed by direct sensory perception. Whorf in fact explicitly dismissed basic perceptual processes as susceptible to linguistic modulation (Edwards, 1997). This makes the evidence for linguistic relativity in colour perception all the more significant. Language is inherently social, and it is reasonable to propose that it could exert an influence on socially-directed thought. For example, some languages force their speakers to categorise people they meet in terms of their status relative to them (e.g. tu/vous, du/Sie). It is an interesting question whether this makes speakers of these languages more sensitive to status relations in their thinking about people.8 Linguistic influence on social perception was addressed experimentally by Hoffman, Lau and Johnson (1986), who noted that different languages have terms encompassing different sets of personality characteristics. Chinese, for example, has a single term (shi gú) which represents a personality that is worldly, experienced, socially skilful, devoted to family and reserved. English has no corresponding phrase. Hoffman et al.’s (1986) study suggested that the shi gú term provided Chinese participants with a cognitive schema, which influenced their impressions and memory of character descriptions to which they were exposed in the experiment.9 Hoffman et al. (1986) attribute their findings of differences in cognitive tasks to the consequence of differences in linguistic structure; it should be noted however that there is a strong possibility that culture confounds the language-cognition relationship here. Chinese may have a term for the group of traits because they 7 While Germans used terms like “hard”, “heavy” and “useful”, Spanish descriptions were composed of more feminine characteristics like “golden”, “shiny” and “intricate”. 8 After the French Revolution, the use of vous was banned as it was seen as reinforcing unequal power dynamics in society. 9 For example, they were more likely to remember the character as possessing traits which were not actually presented in the description, but were congruent with the shi gú schema.

493

co-occur more commonly within the Chinese culture, and this cultural exposure may also account for the cognitive effects found in Hoffman et al.’s experiments. Indeed, interpretation of many reported language-thought correlations is made problematic by the possibility of confounds like culture. For example, Carroll and Casagrande (1958) noted that the Navajo language places particular emphasis on shape, and found that Navajo children’s concept of shape was advanced relative to American or European children. This could be interpreted as indicating that the linguistic emphasis given to shape accelerates its conceptual development. However, Carroll and Casagrande also found that the shape representations of middle-class children from Boston were more similar to Navajo children than those of working-class Harlem children. As the American children spoke the same language, the conceptual difference between them was probably due to environmental influences – the middle class children could, for example, have been more exposed to toys that draw attention to shape (e.g. blocks). It is possible then that it is the environment rather than the grammar of Navajo children that advances their understanding of shape. Different cultures and environments (e.g. rural/urban) may necessitate attention to different aspects of the world, with the result that conceptual representations of the world will vary across cultures. If a certain thing is particularly important in a society, there is also a greater imperative for that to be coded linguistically. Linguistic and thought patterns may therefore be correlated due to a common determinative factor – cultural/environmental significance – rather than a direct relationship between them. Attention given to possible confounds in the language-thought relationship is negligent in most linguistic relativity studies. This is not the only weakness evident in the literature, which has some considerable methodological10 and conceptual flaws. Kronenfeld (2000) highlights three particular imperatives for the literature: operational definitions of “thought” and “language,” precise specification of the form and mechanisms of the relationships proposed to exist between them, and an emphasis on scientific rigor in the examination of these. The first of these is particularly important. “Thought” and “language” are both impossibly broad categories, to the extent that asking about their relationship in those terms is scientifically meaningless. In research on the thought-language relation it is important to specify what one takes “thought” to mean – consciousness, basic perception, logical reasoning, memory, conceptualisation – as well as the level of linguistic analysis (e.g. syntactic/grammatical) one is using. A lack of attention to this issue means that the field has become fragmented and confusing, with different researchers measuring very different things under the common labels of “thought” and “language.” Slobin (1996) addresses this somewhat, changing the focus from the static abstract entities of “thought” and “language” to the online, dynamic activities of “thinking” and “speaking.” Slobin has pioneered an approach to linguistic relativity in terms of “thinking for speaking,” or the thinking that takes place while fitting 10 Many of these are elucidated by Lucy (1996).

494

ideas into available linguistic forms in order to construct an utterance. In order to produce a grammatical sentence in any language, certain characteristics of the event must be marked. This requires that attention be paid to these characteristics. Linguistic relativity may therefore amount to speakers of different languages habitually noticing different aspects of the world.11 Slobin (1996) states that “thinking for speaking is not a Whorfian straightjacket” (86). Language does not make some forms of thought necessary or impossible, but it can make them more likely or more “natural” (Hunt & Agnoli, 1991). Thinking for speaking thus redirects the question of linguistic influence from potential thought to habitual thought.12 Slobin’s perspective on the thought-language relation is very much an interactional one. A dispassionate appraisal of the evidence must lead to the conclusion that this is the most sensible way in which to approach the issue. A certain level of conceptual development is necessary for individuals to acquire language. Additionally, the structure of languages is probably determined by the cognitive requirements of their speakers – we need a medium that provides for the communication of questions or assertions and the representation of important concepts (Slobin, 1979). Language is therefore patterned upon cognitive structure. This influence is reciprocal: language may function to reinforce pre-existing cognitive frameworks, and can also alter their nature. Language enables the construction of abstract concepts that cannot be formed on the basis of direct sensory experience, provides a tool through which thought can take place, and directs attention to certain aspects of the world over others. Influence therefore operates through a complex bi-directional system. The very question of the relationship between “language” and “thought” presupposes that these are separate and dissociated entities, which is in itself a misleading stance. Language and thought are intimately and inextricably connected. The untangling of this interconnection should be the critical priority of forthcoming theory and research.

11 There is evidence that bilinguals think about things differently when working within their different languages (Kousta et al., 2008). This is consistent with the idea that linguistic influence happens on an immediate online basis, through fitting thoughts into the relevant linguistic frame, rather than through shaping the form of the basic conceptual store that is shared between languages. 12 Psychology must take some of the blame for having channelled the focus of linguistic relativity research to potential rather than habitual usage (Edwards, 1997). Experimental tasks usually test the limits of cognition rather than habitually occurring naturalistic thought patterns.

495

RELIGION PANEL

•

judging panel Dr. Zuleika Rodgers (Trinity College Dublin) – Chair Dr. Anne Fitzpatrick (Trinity College Dublin) Dr. Oliver Scharbrodt (University College Cork) Prof. Brian Bocking (University College Cork) Prof. Seamus O’Connell (NUI Maynooth)

judges’ comments The literary and theological examination of the text of 1 John in this essay serves to address the question of the relationship between eschatology and the development of community identity. The approach adopted provides a lens through which this Johannine community’s development of its ecclesiology and sense of mission can be viewed as both a polemic and an attempt at reconciliation against those— maybe internally— who opposed their worldview.

496

R e l igion

Docetism & 1 John Eimhin J. Walsh

cursory examination of the differences between the Johannine epistles and the Gospel of John reveals significant stylistic variations. The gospel has a clear evangelistic flavour suggesting its intention is to be used within a missionary context, whereas the epistles serve to confirm the belief of those who have ‘seen from the beginning.’ 1 Even more evident is the polemical edge in the epistles which seems to defend Johannine orthodoxy against a perceived threat. Building on this polemical intention this essay will open with a discussion of the place of the epistles in the Johannine corpus, commenting on some of the stylistic features, and then examine what can be recreated about the opponents from the internal and external evidence. In closing the importance of the distinctive Johannine ecclesiology and eschatology will be considered. Enrst Kasemann has argued that we have no grounds to call 1 John an antidocetic polemic.2 However, if we accept that the Johannine community had a reflective worldview,3 as the highly theological nature of the writings suggests, then it is not unreasonable to argue that if, or when, the reflective theological thought that underpins 1 John was attacked a reasoned defence would be made. Kasemann does raise an important point by questioning the polemical nature of the letter since to examine 1 John in isolation would not adequately convince a sceptic of the existence of a polemical edge. However when the other epistles are considered the situation changes. A literary analysis of the Johannine epistles helps reveal the order of their composition and this helps to uncover the intended purpose of 1 John.4 Perhaps the most significant evidence of a dispute in 1 John is the repeated 1 J.A.T. Robinson, ‘The destination and purpose of the Johannine epistles,’ New Testament Studies 7 (1960-1) p. 56. 2 David J. Hawkin, The Johannine world (New York, 1996) p. 32. 3 The self-reflective theology can be seen in the confessional statements of 1:6, 1:8, 1:10, 2:4, 2:6, 2:9 & 4:20. 4 J.C. Thomas, ‘The order of the composition of the Johannine Epistles’ Novum Testamentum 37.1 (1995) p. 68.

497

reference to ‘false teaching.’ This theme is prevalent in 1 and 2 John but is conspicuously absent from 3 John. This omission indicates that the threat of falsity is either not present or is being denied when 3 John was composed. 5 While Raymond Brown argues that 3 John represents the last canonical evidence of the Johannine community’s existence 6 it seems unlikely that such a great threat as that of twn planwtwn would be denied by an authorship that is frank and self-reflective in a great number of other cases. 7 Furthermore the author of 3 John indicates that he will soon travel to the community (3 John 13) indicating an intention to be with the community. Consequently, J.C. Thomas believes that 3 John is the earliest of the epistles, dating from a time when no perceived threat existed. 2 John reads like an attempt to warn the community of an imminent threat. 2 John 7 expresses a concern that those who deny the flesh of Christ are deceivers (o J planwtwn) and antichrists (oiJ a n* ticristoi). The lack of a strategic argument suggests that 2 John was composed prior to 1 John, which reads as a more reasoned theological response on the teaching of the opponents with a development of the themes begun in 2 John.8 If we accept 1 John as the latest of the epistles9 and place it in the context of the others we see that it is not unreasonable to assume a polemical motive. The presence of deceivers would even encourage it. The question then turns to the structure of the epistle, of which there is little scholarly consensus. Stephen Smalley has presented a structural analysis of the epistle which attempts to account for the various complexities surrounding the two major themes, that God is light (1 John 1:5-7) and that believers are children of God (1 John 3:1 – 5:13). He explains the structure as hinging on these two theses after which the obligations mandated by belief are elaborated. In either case the conditions are renunciation of sin (1:82:2, 3:4-9), obedience (2:3-11, 3:10-24), rejection of worldliness (2:12-17, 4:1-6) and faithfulness (2:18-29, 5:5-13). 10 Such a cyclical understanding of the structure is interesting and important in articulating the themes of the letter, but it ultimately rests on accepting 1:5 and 3:10 as the thesis statements. Brown comes to the conclusion that 1:5 and 3:10 are thesis statements by logical deduction from the phrase kai e s* tin h J a g* gelia. However the reoccurrence of such phraseology in 2:25 as well as in modification in 3:23 and 5:11 11 indicates that rather than didastically foundational, the phrasing is part of the literary scheme. Thomas proposes a literary reading of the structure based on the repetition of e a* n ei p* wmen, o J legwn, oi d* awen and the seven occurrences of paV o J followed by the 5 Thomas, ‘The order of the composition of the Johannine Epistles’ p. 70. 6 Thomas, ‘The order of the composition of the Johannine Epistles’ p. 69. 7 The authors’ self-reflective honesty can be seen, for example, in 2 John and 3 John. 8 Thomas, ‘The order of the composition of the Johannine Epistles’ p. 73. 9 The placement of 3 John poses the most difficulty. Importantly dating it later than 1 John, does not effect the suggestion that 1 John precedes 2 John. 10 �� J.C. Thomas, ‘The literary structure of 1 John’ Novum Testamentum 40.4 (1998) p. 371. 11 �� 1 John 3:23 kai au t@ h e s* tin h J e n* tolh au t* ou... 1 John 5:11 kai au t@ h e s* tin h J marturia...

498

participle. While this is a useful analysis Thomas uses it to form a mirrored structure that sees ‘love one another’ (3:11-18) as the cardinal point.12 This structure seems to impose a theology upon the epistle which is closer to Thomas’ than the author’s structural intention. Perhaps a better way of understanding the epistle is in the context of other polemical literature and by building on the precedent of Brown’s suggestion that the Johannine community consists of various layers. If we view the structure as having literary, thematic, polemical, instructive and paraenetic layers we may get a more accurate flavour of the author’s intention. It is not unreasonable to deduce that a layered community would receive a layered letter enabling it to be read on many levels. Indeed the list of admonishments to specific members of the community 13 (2:12-14) suggests that function allocation to different layers of the community could have an important and often overlooked place in the structure of the letter. Johannine thought, in a broad sense, certainly helped to encourage ChristianGnostic thought and myth,14 but this was due primarily to its relationship to the dualist thought contained within it. Dualism permeated a wide range of Hellenistic, Semitic and early Christian thought worlds, and there as many brands of dualism as there are sources that use it. The dualism in 1 John represents some of these styles albeit with some idiosyncrasies.15 The statement in 1 John 1:5 that ‘God is light and in him is no darkness’ is a dualistic proposition that can be analysed on a number of levels. There is the obvious cosmic dimension which sees good and evil veiled in light and darkness imagery, but there is also an ethical and metaphysical dimension. Darkness and light represent two opposing choices whereby choosing light involves living in conformity with divine revelation through Jesus Christ. By contrast darkness involves self-identification with an implied opposing force.16 If we identify these opposing forces as oiJ a n* ticristoi a further literary dualism is evident whereby Christ and antichrist 17 become mutually exclusive and conflictual constructs. These ethical and literary dimensions are found throughout Johannine literature, evidenced by the dualistic interpretation of truth and, by implication falseness, throughout the epistle (1 John 1:6, 1:8, 2:4, 2:21, 4:6). This represents a literary development of the gospel tradition of truth and falsehood seen in John 3:21. 18 Thus taking the gospel as preceding the epistles19 we can see that dualism is significant throughout Johannine history. The development of a metaphysical dualism in 1 John 2 represents a distinc12 �� Thomas, ‘The literary structure of 1 John’ p. 373. 13 �� Ruth B. Edwards, The Johannine Epistles (Sheffield, 1996) p. 74. 14 �� Alister H.B. Logan, ‘John and the Gnostics – the significance of the Apocryphon of John for the debate about the origins of the Johannine Literature’ in Stanley E. Porter & Craig A. Evans (ed.) The Johannine Writings (Sheffield, 1995) p.126. 15 �� Judith M. Lieu, The theology of the Johannine epistles (Cambridge, 1991) p. 80. 16 �� Lieu, The theology of the Johannine epistles p. 81. 17 �� Gregory C. Jenks, The origins and early development of the antichrist myth (Berlin, 1991) p. 1. 18 �� Judith M. Lieu, The second and third epistles of John (Edinburgh, 1986) p. 69. 19 �� Cf. Raymond E. Brown, The community of the beloved disciple (New Jersey, 1979) p. 175.

499

tive brand of Johannine dualism which distinguishes it from a potentially Gnostic interpretation. 1 John 2:15-17, for example, encourages renunciation of material possessions which are ‘not of the father.’ It continues saying that the ‘world passes away,’ but any potential materialistic pessimism is negated by the clear indication that God endures forever (1 John 2:17). Thus, the world, although passing away, contains those who have chosen light and consequently it is not thoroughly demonised.20 This demonstrates that there is no absolute cosmic dualism, which sets the material as a contrast to the spiritual. This metaphysical aspect to Johannine dualism carefully distinguishes the community from other dualist groupings. The inclusion of a future dimension offers something distinctive as the dark world which is passing away will, in the Johannine schema, pass into light (1 John 2:8). Thus present and past experience is contrasted with the future. However, this eschatologically dualistic perception is rooted in the present and the past, as those who have followed a p* ’ a r* chV are those who have passed from death into life (1 John 3:14). 21 Such a modified dualism makes space for the soteriological significance of Christ’s atoning death, by blending the meaning of the Easter experience with the established philosophical scheme of dualism. While it is certainly possible to see some aspects of Johannine thought as indicative of the later Gnostic rejection of the incarnation or resurrection,22 (especially given that 1 John does not include a resurrection)23 to view the epistle’s dualism as an absolute Gnostic cosmic dualism fails to appreciate the thought world of 1 John.24 The deliberate reworking of a distinctive dualism with a past (cosmic), present (ethical) and future (eschatological) dimension indicates an engagement with an existing thought world shared with later Gnostic sects.25 It seems appropriate to briefly examine the connection to other non-Gnostic dualisms before moving to examine the opponents. There is a startling repetition of vocabulary in the thought worlds of the Qumran and Johannine communities.26 The references to people walking in darkness (1 John 1:5-7), the angel of darkness (1 John 5:19) and the spirit of truth (1 John 4:6) indicate familiarity with the comic and ethical dualisms expressed in 1QS 3:13-4:26.27 It is impossible to argue that the author of the epistle was influenced by the Dead Sea Scrolls; however the parallel ought to be noted as it shows the prevalence of dualist thought forms that span a cosmic and ethical realm. Aside from dualism the letter can be placed in its historical context by com20 �� Lieu, The theology of the Johannine epistles p. 80 - 87. 21 �� Lieu, The theology of the Johannine epistles p. 82. 22 �� Charles E. Hill, The Johannine corpus in the early church (Oxford, 2004) p. 291. 23 �� Wendy E. Sproston North, The Lazarus story within the Johannine Tradition (Sheffield, 2001) p. 62. 24 �� Lieu, The theology of the Johannine epistles p. 84. 25 �� Raymond E. Brown, The Gospel and Epistles of John (Minnesota, 1988) p 15. 26 �� Brown, The Gospel and Epistles of John p. 14. 27 �� Lieu, The theology of the Johannine epistles p. 82. cf. James H. Charlesworth, ‘A critical comparison of the dualism in 1 QS III:13 – IV:26 and the dualism contained in the fourth gospel’ New Testament Studies 15 (1968).

500

parative analysis with some common rhetorical devices of the contemporary literature. The epistles of Paul had been written with a self-conscious character which is not found in the impersonal catholic epistles of John28 but one interesting similarity between the two styles is the use of a paranetic layer.29 Just as the literary style of John is less self-conscious, so is the exhortation to imitation. The rhetorical purpose of paranesis is not the transmission of any new teaching but rather it is an exhortation to emulate and fulfil existing teaching. This is attested to in 1 John 2:7 where the intended teaching is rooted firmly in past instruction.30 Some scholars have attempted to distance 1 John from contemporary paranesis as it does not mirror the Pauline usage of the style however, a comparative analysis with nonChristian literature shows that Hellenistic paranesis usually offers some mild rebukes.31 Examples, from 1 John, held up for emulation include Jesus (2:6) and the received teaching (1:1, 2:7), while the instructive citation of Genesis 3 32 serves a paranetic purpose in forming part of a subsequent instruction (1 John 3:19). The string of six admonishments (2:12-14) illuminate something of the church structure but also serve a paranetic function of imitation according to individual abilities and strengths while also fulfil the reprobation criteria.33 Cumulatively, these admonishments comprise an exhortation to abide in the established teaching and precedent of the community. So far the polemical nature of the letter has been established and the use of a distinctive dualism and traditional paranesis has been placed in the community’s context. Now this essay will move to consider more specifically the role of spirit in the Johannine community and its role in the perceived threat. It is the intensely dualistic framework and the community’s reliance upon contrast which makes the addressees so susceptible 34 to ‘prophets speaking in the spirit.’ 35 Such prophets offered an alternative pneumatology which threatened the basis of many Johannine suppositions.36 The author of the epistle avoids using spirit language to describe the crisma which he passionately claims for the community (1 John 2:20). The endorsement of crisma with careful use of language that is identified with a community37 indicates that the opponents viewed crisma as spiritual. The author is placed in the difficult position of defending his commu28 �� Lieu, The second and third epistles of John p. 49. 29 �� Martin Hengel, The Johannine Question (London, 1989) p. 48. 30 �� The only admitted novelty in the instruction is related to the eschatological schema of darkness passing away into light. 31 �� Terry Griffith, Keep yourselves from idols (Sheffield, 2002) p. 7. 32 �� Cf. 1 John 3:11-19. 33 �� Edwards, The Johannine Epistles p. 74. 34 �� Lieu, The second and third epistles of John p. 145. 35 �� Tricia Gates-Brown, Spirit in the writings of John: Johannine pneumatology in social scientific perspective (London, 2003) p. 241. 36 �� By identification of the crisma with a community of believers it is also rooted in material reality rather than supernatural abstract speculation. This helps to strengthen the hypothesis of an ultimately positive perception of the material. 37 �� Gates-Brown, Spirit in the writings of John p. 246.

501

nity’s crisma in light of opposition and to achieve this he turns towards tradition. He claims that the community, in addition to the crisma, also has the tradition of oá h n! a p* ’ a r* chV which the opponents do not have.38 It is in this light that the author turns to the stylistic repetition of themes of the gospel prologue in his own prologue, emphasising the testimony of the logou thV zwhV (1 John 1:1).39 If, as seems likely, we perceive the word of life as Jesus40 then it is possible to conclude that the opponents professed a radical penumatology which claimed superiority of the spirit over Jesus. 41 This can be perceived as a threat to Johannine ecclesiology which emphasises Christ as the broker of divine access. If, as Terry Griffith argues, 1 John has a pastoral layer 42 we could understand John’s preoccupation with asserting brokerage Christology, through the par− rousia and paraklatwn, as an effort to restore a fear that Jesus could no longer broker access to God since he was no longer on earth. This fear could have been engendered in the community by the opposition which would help to explain the author’s repetition of motifs that are strong in the gospel.43 By reorienting the community to the message which it has heard a pJ a JrchV, in a dualistic manner with which they are familiar, the author hopes to convince the community to act boldly (1 John 2:28) in defence of Jesus Christ their advocate with the father (2:1); a theme introduced in the gospel (John 3).44 The profoundly spiritualist mentality of the opponents forms the backdrop for the confessional statements in 1 John. There are eleven explicit claims that are countered in the letter.45 It is helpful to list them thusly: If we say that: We have fellowship with him while we walk in darkness we lie (1:6) We have no sin, we deceive ourselves (1:8). We have not sinned, we make him a liar (1:10) He who says that: “I know him” but disobeys his commandments is a liar (2:4) He abides in him ought to walk in the same way in which he walked (2:6) He is in the light and hates his brother is in the darkness (2:10) If anyone says that: 38 �� Brown, The gospel and epistles of John p. 105. 39 �� Raymond E. Brown, The epistles of John (London, 1983) p. 303, cf. Sproston North, The Lazarus story within the Johannine Tradition p. 66. 40 �� Gates-Brown, Spirit in the writings of John p. 248. 41 �� Griffith argues it has not just a pastoral layer but a pastoral purpose. See Griffith, Keep yourselves from idols p. 1. 42 �� Cf. Robinson, ‘The destination and purpose of the Johannine epistles’ p. 58. 43 �� Gates-Brown, Spirit in the writings of John p. 259. 44 �� Taking ‘explicit’ as involving use of the creedal formulae pisteuw, a *rneomai or legw. 45 �� This table is formed from various sources including Hawkin, The Johannine World p. 92, and Hengel, The Johannine Question p. 59.

502

“I love God” and hates his brother…is a liar (4:20).

He who believes that: Jesus is the Christ is a child of God (5:1) Jesus is the son of God…overcomes the world (5:5) Any (spirit) who denies that: Jesus is the Christ is the antichrist (2:22-23) That Jesus has come in the flesh is not of God (4:2-3) 46 The statements are, usually, followed by a testimonial to its meaning. By reverse reasoning we can infer that the creedal statements which the author emphasises represent those beliefs which are under threat by the opponents. By analysing the statements it becomes evident that the issue is not denial of the physical reality of Jesus’ humanity, as some docetic sects would believe, but rather they are denying that Jesus’ human actions have a bearing on his being the Christ. In this light the debate can be understood as being not classically docetic, but rather Christological with an emphasis on the soteriological significance of the crisma.47 It is the appearance of crisma which gives the debate a docetic flavour. The author of 1 John seeks to reverse the belief of the opponents, which is permeating the community, that Jesus’ death, like the rest of his life, was of salvific significance. In this light the statement that “Jesus Christ has come in the flesh” (4:2) is a central confessional statement of the community. It can be interpreted as meaning: Jesus Christ having come - ie. carried out his soteriological purpose – in ie. with the instrumentality of – the flesh - ie. his entire being.48 Furthermore, the pneumatological context of the statement (4:1) serves to ground the community in brokerage Christology. When this is placed alongside the references to “water and the blood” (5:6 cf. 1:7) it seems likely to suggest that the opponents had a docetic understanding of the baptism and the resurrection.49 Taken together these statements can be compared with what we know of contemporary docetic thought systems. There are undeniable similarities between the false teaching countered by 46 �� Martinus C. de Boer, ‘The death of Christ and his coming in the flesh (1 John 4:2)’ Novum Testamentum 33 (1991) p. 328, cf . Brown, Epistles of John pp. 595, 58-59, 76. 47 �� ‘Jesus Christ having come in flesh…’ = ‘Jesus Christ having carried out his soteriological purpose with the instrumentality of his entire being…’ see De Boer, ‘The death of Jesus Christ and his coming in the flesh’ pp. 345 – 346. 48 �� Rudlof Schnackenburg, The Johannine Epistles (Kent, 1992) p. 18. 49 �� Brown, The Community of the Beloved Disciple p. 106, cf. Schnackenburg, The Johannine Epistles p.20.

503

1 John and the anti-docetic polemics of Ignatius of Antioch.50 However another docetic pattern was that recorded by Irenaeus of Lyons and ascribed to Cerinthius. This pattern separated the human Jesus and the heavenly Jesus, seeing the crisma as something sporadic; 51 remaining with Jesus only between his baptism and death. Having lost the crisma at death Jesus handed over his brokerage of divine mediation to the Holy Spirit.52 This belief sees the incarnation as something that is simply apparent whereby the cristoV enters Jesus rather than them being organically fused together. This is probably influenced by a Judaeo-Christian philosophy that has been heavily inspired by Platonism. Before ascribing the opponents to the Cerinthian school we ought to heed to Brown’s warning and examine whether this influence came from within or without the community.53 Brown argues that the vagueness of some of the gospel passages encouraged conflicting interpretations of the gospel as a whole. An example of this would be the descending of the Holy Spirit in John 1:33. As such the conflict could have arisen from an alternative interpretation within the community. Such an approach is undeniably valid however the question as to why some aspects of the community interpreted it differently remains. At this point Hengel’s Cerinthian analysis may be useful. The potent imagery of flesh and blood and the burly language referring to false teachers could be seen as an outside intellectual influence which subsequently gained a foothold from within the community. When examined in this manner there is a benefit to both Hengel’s and Brown’s analysis. Regardless of the cause of the teaching, a reconstruction of the opponent’s beliefs seems to favour the involvement of an adoptionist-docetic Christology, where those who claimed to have the sperma through the Holy Spirit preferred to engage in a radically pneumatic Christianity 54 with some contrasting values to the remainder of the community. 55 This may have later developed into the Ebionite heresy. The context discussed earlier of a distinctive dualism that was not absolute indicates the community’s preference to operate in a dualistic framework that values the eschatological importance of the material world. In this regard it seems unlikely that the one-dimensional Christology of classical docetism where Jesus Christ is exclusively spirit would be popular. The Cerinthian approach, with its duality of being, seems to have a more comprehensible base in the Johannine community. In conclusion 1 John presents us with a community whose Christological ecclesiology was brought into being by the word, and who viewed its purpose as per50 �� Hengel, The Johannine Question p. 60. 51 �� Such mediation controversies were not uncommon. For example the Colossian ‘heresy’ where angels were perceived as mediators of Christ. See Robinson, ‘The destination and purpose of the Johannine epistles’ p. 61. 52 �� Brown, The Community of the Beloved Disciple pp. 105 -107. 53 �� Schnackenburg, The Johannine Epistles p. 19. 54 �� John Painter, ‘The Opponents in I John’ New Testament Studies 32 (1986) p. 67. 55 �� Johan Ferreira, Johannine Ecclesiology (Sheffield, 1998) p. 203.

504

petuating the word which they had heard ‘from the beginning.’ This community held dear to cosmic, ethical and eschatological dualism which was rooted in the belief that Jesus’ entire life and death was bound up with being cristoV. By contrast the opponents, who possibly came from within the community, were influenced by an adoptionist-docetic Christology that saw Jesus as sporadically possessing the crisma.This Christology had a logical root in the community’s dualism but it encouraged the superiority of spirit over flesh. This posed a threat to established Johannine Christology, pneumatology and soteriology, and in response the author of 1 John employed a polemical tactic to achieve his pastoral objective of rooting the community in their established Christology with its eschatological hope of parrousia. For the Johannine community this means affirming their past and present experience, and aligning it with their future hope. In this regard the thesis statement of 1 John is the call to abide in that which they have experienced since the beginning – o @ h n # a p* áa r* chV. Through this strategy the author tries to prevent a split by encouraging them to ‘love one another (4:12).’

505

SOCIOLOGY PANEL

•

judging panel Prof. Pat O’Connor (University of Limerick) – Chair Dr. Ciaran McCullagh (University College) Cork Prof. Mary Corcoran (NUI Maynooth) Dr. Iarfhlaith Watson (University College Dublin) Aifric O’Grada (University College Cork) Judges’ commentary The three central elements that the judges looked for in the essays were aAn understanding of the sociological literature on the topic under consideration; the ability to communicate sociological ideas and concepts in a clear and accessible fashion; the ability to bring a new and unexpected insight to bear on the topic under consideration The winning essay combines significant elements of all three criteria. Firstly, it demonstrates conceptual and theoretical sophistication. Secondly, rather than sentimentalising the topic of childhood, it explores children’s experience of the world of work in the South. In a provocative but accessible way, it questions the moral certainty of western ideas about childhood as it discusses what is the right thing to do in relation to children in the developing world. It does this by contrasting the views of Western ‘outsiders’ with those of children actually living in the South. It thus demonstrates the usefulness of an agency approach and the importance of involving children in sociological research. The essay is also extremely topical in that it is a sociological framing of some of the issues raised in popular culture such as Slum Dog Millionaire, The White Tiger etc. Overall, the panel felt that it demonstrated the relevance of the sociological imagination to challenging assumptions which are taken for granted about childhood and did so in a stimulating and original way. Hence it was unanimously identified as the winner of the Undergraduate Awards in Sociology 2009.

506

The “modern concept of childhood” is at odds with the everyday lives of children in the South & may lead to inappropriate programmes of action Yvonne O’Reilly

his essay begins by elaborating on the conception of childhood in Western Industrialized countries that evolved in tandem with capitalism, the need for workers and organized religion and its need for converts. It refers to the removal of children from public space to the home environment and the perception that the street is a morally corrupting influence (Boyden, 1997; Glauser, 1997). The inference is that children are innocent and require protection, time to grow and explore in readiness for adult society (Abercrombie, 2000) whereas deviations from the norms are condemned. This ethnocentric conception of childhood has been exported to the South where children have a significant role in a ‘survival economy’ (Liebel, 2003: 272) and has led to inappropriate policy and outcomes for many children’s lives in the developing world. The essay refers to Glauser’s work with ‘street children’ and highlights the need to define terms and concepts that reflect the reality of the situation in developing countries in order for appropriate policy implementation and outcome. It also refers to Boyden’s (1997) research that examines the Globalization of Childhood and accompanying policy highlighting 507

the contradictions inherent in the application of a global standard via the UN Convention on the Rights of the Child 1989 that emphasizes protection and best interests of the child, but in practice may have adverse effects on children of the third world. Consequently, a focus on child labour and education and an emphasis on social order rather than need, echoed attitudes of the 19th century industrialized north. However, the UN Convention on the Rights of the Child has been key to focusing governments’ attention on the conditions of its children and more recently a focus on the views of children, which leads us to touch on Liebel’s (2003) work with working children’s organizations to demonstrate an alternative workable notion of childhood developed by and for children themselves, possibly the unfurling of a new ‘independent childhood.’ The modern concept of childhood developed following the need for converts in the wake of the religious reformation. Evidence from 18th and 19th centuries points to an increasing association with innocence, the inculcation of discipline and conscious parenting with the emergence of a new conception of childhood. This arose in parallel with the emergence of capitalism, the requirement for workers in turn leading to the erosion of the productive family and a shift from a reliance on extended kinship to the emergence of the nuclear family. Furthermore, Glauser (1997: 193) points to the provision of state welfare and the removal of children to the home environment leading to ‘conformity in child rearing’ to the extent that parents are condemned for leaving children unattended or even with a child minder. According to Boyden in Glauser (1997: 196) condemnation of groups of children in public or on street corners led to categorizations of such activity as delinquent behavior with street life considered to be ‘morally polluting to the young.’ These conceptions were exported to the South via colonialism, welfare provision and human rights legislation and disregarded the fact that the majority of the poor in the south have no clear demarcation between public and private living; for instance whole families live and work on the street across the developing world. It also disregarded states’ abilities to provide welfare; in turn the contextual nature of childhood in an unequal world. Furthermore, Boyden (1997: 211) tells us that the lack of investment in welfare provision has generally meant that only the most visible social problems are dealt with giving rise to ‘a constant risk of state intervention.’ Furthermore, the majority of the poor in the south have no clear demarcation between public and private living, for example whole families live and work on the street across the developing world. In addition, welfare is at the hands of the police in the majority of cases and with the significant numbers of ‘street children’ perceived as a threat to the norms and values of the dominant in society, it poses a threat to the well being if not survival of some street children due to the constant pressure to have children removed from the street with little concern for their outcome. For example, Boyden (1997: 210) tells us numerous studies (Dorfman, 1984; UNICEF, 1985; Henriques, 1986) found that street children have suffered brutality and even death at the hands of 508

the police. Glauser’s (1997: 145-6) research on street children in Asuncion, Paraguay sees a need to distinguish between children of the street (those who live and work on the street) and children in the street (those who use the street as a workplace) due to confusion concerning the level of association with the street which is reproduced by international organizations. For instance UNICEF defines street children as ‘children without family contact’ while other international agencies see them as on ‘a continuum,’ sometimes or always on the street, whereas in reality there are no absolute categories as children’s association with the street may be irregular. For example, runaways and child soldiers, Glauser (1997, 148) says, ‘do not fit the standard image of children of the street.’ But both categories are applied universally yet misrepresent the reality and importantly the local context of the situation. Consider the dominant Western perception of street children as ‘….runaways, homeless or as street gangs…’ (Glauser, 1997: 150) and contrast this with the fact that in India whole families live in the street and in Brazil this phenomenon is increasing due to migration to mega cities. Furthermore Glauser (1997: 150) believes international agencies and institutions devise policy based on these ‘ill defined terms and concepts’ such that those excluded from these definitions are forgotten and become ‘invisible to society’ or are even perceived as ‘irretrievable’ (Glauser, 1997: 150). Glauser’s triangular model of street children is useful in explaining the broad categories as it identifies a threshold where the majority of street children below it are characterized by contact with their families and use the street to live, work and play in. These children are primarily from rural areas and can sometimes move above the threshold, the outcome of a long process. The upper half of the model represents those street children whose socialization takes place away from the family, generally without the help and protection they need. Glauser (1997: 159) refers to it as ‘a place of last resort’ with very little movement downwards. Evidently life is unstable for street children despite attempts by them to find a more stable life, but can become more precarious when welfare policy primarily aimed at ‘preventing disruption of normality’ subsequently defines children as abandoned or vagrant thus criminalizing children and setting up a cycle of interaction with state authorities. In addition, the absence of formal substitutes for socialization in Latin America and Africa compounds the downward spiral these children experience. Thus the global standard of childhood is often unattainable for poor communities in the developing world where the reality of childhood starkly contrasts with northern conceptions of childhood. For example, in Britain it is illegal for children under fourteen to be in charge of infants and small children, whereas Peru’s census records a sizeable proportion of six to fourteen year olds as head of households, the main breadwinners or sole person responsible for younger siblings (Boyden, 1997: 203). In addition Patil (1986) in Boyden (1997: 203) found that approximately 6% of children in Bangladore are the main earners of the family, while in AIDS ridden African countries children are increasingly left to care for orphaned siblings. In addition, education, a primary Millennium Development Goal (to achieve univer509

sal primary education by 2015) is considered the ‘panacea to underdevelopment’ (Boyden, 1997: 201) but disregards the local cultural context in which education is provided, the availability of which can often overlook its quality. For instance in post colonial societies the language through which education is delivered is often the former ruler’s one, as in Jamaica where poor children are taught through English instead of their spoken language, Creole, resulting in high levels of illiteracy at the end of the school cycle. Furthermore Boyden (1997) points out that the quality of education provision matches one’s status in the caste system in India, both factors leading to the decision by many parents of poor children not to send them to school but to work instead. Consequently, the phenomenon of working children (Myers, 1999) is widespread in diverse cultures and contexts in developing countries yet initially human rights legislation’s goal was a blanket ban on it ignoring the rewards for the child workers, the family and the wider community. For example a study by the International Labour Organization (ILO) of children in the garment industry in Bangladesh (Boyden and Myers, 1995) to establish if it would be beneficial to ‘enforce global childhood standards through a penalty’ (Boyden, 1997: 221) revealed that child workers make important contributions to family income, empower females in a Moslem society and were healthier and consumed better quantity and quality of food compared with the child workers who were removed from the industry. In fact the ex child workers were worse off; were not attending school; suffered worse ill health and were involved in more hazardous work than when working in the garment industry. Further research in Bangladore, Nepal and Brazil highlighted that work can in fact be rewarding for children, with only 5% of children in the Bangladore study claiming economic necessity as reasons for working, while 42% citied ‘failure to advance in school’ (Boyden, 1997) as reason to work. Evidently children are increasingly ‘the backbone of the informal sector’ (Boyden, 1997: 210), and are a valuable asset to the community and a necessary resource for family survival in developing countries (Boyden, 1997; Glauser, 1997; Myers, 1999). Additionally Myers (1999) points to this new awareness of situations and contexts based on empirical research, and the consideration of children’s views shifting the focus from abolition to ending the worse forms of child labour. Accordingly organizations of working children have developed (sometimes with the help of adults but solely run by working children between 12-16 years) across the third world since the eighties and have succeeded in reversing the stance of dedicated child labour abolitionists such as the social scientist Michel Bonnet. These organizations stress rights, participation, recognition for their contribution to society, equality with adults, codeterminanation in society and importantly emphasize their own agency in improving their lives (Liebel, 1999: 266-271). Considering these aims is it any wonder the working children’s organizations have criticized the Convention for not going far enough (Liebel, 1999). Liebel (2003: 273) sees these organizations as challenging unequal relations and making way ‘for an understanding of the subject until now unknown or unac510

cepted in the western world’ based on an ethos of ‘human dignity and respect for human life.’ Liebel uses Touraine’s concept of ‘social subject’ as ‘no longer at the mercy of the power of others, but rather to freely devise one’s own environment and life.’ These organizations go beyond the modern concept of childhood and low level participation endorsed in the Convention. Ironically they have encountered obstruction from those very institutions that are working for children’s rights, perhaps Liebel (2003: 275) claims, because they ‘present themselves as working children’ [emphasis original]. Furthermore Liebel sees their ‘subject understanding’ emerging from traditional cultural practices such as passing on land and animals along with the responsibility for them among Native American and African peoples where children are seen as ‘subjects and owners of rights.’ Moreover the social and cultural transformation taking place in developing countries and especially AIDS ridden Africa have created a new type of childhood that requires imaginative solutions to new hardships and problems. Consequently international organizations such as UNAIDS are beginning to acknowledge that they must include young people in order to gain their perspective, and view children as true participants not as victims (Liebel, 2003). According to Liebel, (2003: 265) working children have proved themselves capable subjects such that the social scientist Per Miljesteig is hoping to persuade the World Bank to involve working children in making its decisions. Liebel (2003: 278) suggests that these organizations epitomize a new ‘Independent childhood’ one that bypasses the modern or ‘automatic’ conception of western childhood and has proven successful in improving working children lives in Africa and Latin America. In addition Liebel (2003: 278) points out that children’s Working Organization initiatives still require the acknowledgement and support of adults for their efforts enabling them perceive themselves as ‘successful survivors.’ In some countries governments acknowledge these organizations as legitimate participants, and when recognized working children benefit from more respect, better health care and better portrayal by the media. This indicates a better understanding of street and working children’s lives and has potential for a universal shift in the perception of these children from delinquent to valuable social subjects that will hopefully transfer into more appropriate programmes of action for children. In conclusion, the modern concept of childhood – a social construct – developed in Western industrialized society and exported to peripheral economies of the south where diverse forms of childhood are culturally and economically contingent, presents challenges for the application of a global standard in child rearing as endorsed initially by human rights legislation which ignored the phenomenon of ‘street children’ and children as heads of households, and led to an emphasis on social order rather than the needs of children sometimes with devastating effects. However, latterly the UN Convention on the rights of the Child 1989 prioritizes the best interests of the child and has seen a shift from aiming for the abolition of child labour to the cessation of exploitation and the improvement in 511

children’s working conditions based on relatively recent empirical research which considered children’s views and established both the contribution of child labour to the well being and even survival of families and the benefits for working children themselves. These findings have initiated what may be a new paradigmatic approach to childhood illustrated by the development of children’s working organizations across the third world, initiated by and organized for working children that places emphasis on children as social subjects affirming what Liebel calls a new ‘independent childhood’ that hopefully materializes into more appropriate programmes of action for children.

512

513

securing a greener future NTR plc is securing a greener future by addressing three of the world’s paramount issues – climate change, resource sustainability and security of energy supply. We do this by building green energy and resource-sustaining businesses in the solar, wind, biofuel, recycling and waste management sectors.

www.ntrplc.com Thank you to all those who make the inaugural year of the Undergraduate Awards of Ireland such a success!