Gene Therapy & Molecular Biology Volume 10 Issue A by Niko Boulikas

GENE THERAPY & MOLECULAR BIOLOGY FROM BASIC MECHANISMS TO CLINICAL APPLICATIONS

Volume 10 Number 1 June 2006 Published by Gene Therapy Press

GENE THERAPY & MOLECULAR BIOLOGY FREE ACCESS www.gtmb.org

!!!!!!!!!!!!!!!!!!!!!!!! Editor

Teni Boulikas Ph. D., CEO Regulon Inc. 715 North Shoreline Blvd. Mountain View, California, 94043 USA Tel: 650-968-1129 Fax: 650-567-9082 E-mail: teni@regulon.org

Teni Boulikas Ph. D., CEO, Regulon AE. Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9853849 Fax: +30-210-9858453 E-mail: teni@regulon.org

!!!!!!!!!!!!!!!!!!!!!!!! Assistant to the Editor Maria Vougiouka B.Sc., Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9858454 Fax: +30-210-9858453 E-mail: maria@cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!! Associate Editors

Aguilar-Cordova, Estuardo, Ph.D., AdvantaGene, Inc., USA Berezney, Ronald, Ph.D., State University of New York at Buffalo, USA Crooke, Stanley, M.D., Ph.D., ISIS Pharmaceuticals, Inc, USA Crouzet, Joël, Ph.D. Neurotech S.A, France Gronemeyer, Hinrich, Ph.D. I.N.S.E.R.M., IGBMC, France Rossi, John, Ph.D., Beckman Research Institute of the City of Hope, USA Shen, James, Ph.D., Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan, Republic of China & University of California at Davis, USA. Webb, David, Ph.D., Celgene Corporation, USA Wolff, Jon, Ph.D., University of Wisconsin, USA

!!!!!!!!!!!!!!!!!!!!!!!! Editorial Board Akporiaye, Emmanuel, Ph.D., Arizona Cancer Center, USA Anson, Donald S., Ph.D., Women's and Children's Hospital, Australia Ariga, Hiroyoshi, Ph.D., Hokkaido University, Japan Baldwin, H. Scott, M.D Vanderbilt University Medical Center, USA Barranger, John, MD, Ph.D., University of Pittsburgh, USA Black, Keith L. M.D., Maxine Dunitz Neurosurgical Institute, Cedars-Sinai Medical Center, USA Bode, Jürgen, Gesellschaft für Biotechnologische Forschung m.b.H., Germany Bohn, Martha C., Ph.D., The Feinberg School of Medicine, Northwestern University, USA Bresnick, Emery, Ph.D., University of Wisconsin Medical School, USA Caiafa, Paola, Ph.D., Università di Roma “La Sapienza”, Italy

Chao, Lee, Ph.D., Medical University of South Carolina, USA Cheng, Seng H. Ph.D., Genzyme Corporation, USA Clements, Barklie, Ph.D., University of Glasgow, USA Cole, David J. M.D., Medical University of South Carolina, USA Chishti, Athar H., Ph.D., University of Illinois College of Medicine, USA Davie, James R, Ph.D., Manitoba Institute of Cell Biology;USA DePamphilis, Melvin L, Ph.D., National Institute of Child Health and Human, National Institutes of Health, USA Donoghue, Daniel J., Ph.D., Center for Molecular Genetics, University of California, San Diego, USA Eckstein, Jens W., Ph.D., Akikoa Pharmaceuticals Inc, USA Fisher, Paul A. Ph.D., State University of New York, USA

Galanis, Evanthia, M.D., Mayo Clinic, USA Gardner, Thomas A, M.D., Indiana University Cancer Center, USA Georgiev, Georgii, Ph.D., Russian Academy of Sciences, USA Getzenberg, Robert, Ph.D., Institute Shadyside Medical Center, USA Ghosh, Sankar Ph.D., Yale University School of Medicine, USA Gojobori, Takashi, Ph.D., Center for Information Biology, National Institute of Genetics, Japan Harris David T., Ph.D., Cord Blood Bank, University of Arizona, USA Heldin, Paraskevi Ph.D., Uppsala Universitet, Sweden Hesdorffer, Charles S., M.D., Columbia University, USA Hoekstra, Merl F, Ph.D., Epoch Biosciences, Inc., USA Hung, Mien-Chie, Ph.D., The University of Texas, USA Johnston, Brian, Ph.D., Somagenics, Inc, USA Jolly, Douglas J, Ph.D., Advantagene, Inc.,USA Joshi, Sadhna, Ph.D., D.Sc., University of Toronto Canada Kaltschmidt, Christian, Ph.D., Universität Witten/Herdecke, Germany Kiyama, Ryoiti, Ph.D., National Institute of Bioscience and Human-Technology, Japan Krawetz, Stephen A., Ph.D., Wayne State University School of Medicine, USA Kruse, Carol A., Ph.D., La Jolla Institute for Molecular Medicine, USA Kuo, Tien, Ph.D., The University of Texas M. D. Anderson Cancer USA Kurachi Kotoku, Ph.D., University of Michigan Medical School, USA Kuroki, Masahide, M.D., Ph.D., Fukuoka University School of Medicine, Japan Lai, Mei T. Ph.D., Lilly Research Laboratories USA Latchman, David S., PhD, Dsc, MRCPath University of London, UK Lavin, Martin F, Ph.D., The Queensland Cancer Fund Research Unit, The Queensland Institute of Medical Research, Australia Lebkowski, Jane S., Ph.D., GERON Corporation, USA Li, Jian Jian, Ph.D., City of Hope National Medical Center, USA Li, Liangping Ph.D., Max-Delbrück-Center for Molecular Medicine, Germany Lu, Yi, Ph.D., University of Tennessee Health Science Center, USA Lundstrom Kenneth, Ph.D. , Bioxtal/Regulon, Inc. Switzerland Malone, Robert W., M.D., Aeras Global TB Vaccine Foundation, USA Mazarakis, Nicholas D. Ph.D., Imperial College London, UK Mirkin, Sergei, M. Ph.D., University of Illinois at Chicago, USA Moroianu, Junona, Ph.D., Boston College, USA

Müller, Rolf, Ph.D., Institut für Molekularbiologie und Tumorforschung, Phillips-Universität Marburg, USA Noteborn, Mathieu, Ph.D., Leiden University, The Netherlands Papamatheakis, Joseph (Sifis), Ph.D., Institute of Molecular Biology and Biotechnology Foundation for Research and Technology Hellas, USA Platsoucas, Chris, D., Ph.D., Temple University School of Medicine, USA Rockson, Stanley G., M.D., Stanford University School of Medicine, USA Poeschla, Eric, M.D., Mayo Clinic, USA Pomerantz, Roger, J., M.D., Tibotec, Inc., USA Raizada, Mohan K., Ph.D., University of Florida, USA Razin, Sergey, Ph.D., Institute of Gene Biology Russian Academy of Sciences, USA Robbins, Paul, D, Ph.D., University of Pittsburgh, USA Rosenblatt, Joseph, D., M.D, University of Miami School of Medicine, USA Rosner, Marsha, R., Ph.D., Ben May Institute for Cancer Research, University of Chicago, USA Royer, Hans-Dieter, M.D., (CAESAR), Germany Rubin, Joseph, M.D., Mayo Medical School Mayo Clinic, USA Saenko Evgueni L., Ph.D., University of Maryland School of Medicine Center for Vascular and Inflammatory Diseases, USA Salmons, Brian, Ph.D., (FSG-Biotechnologie GmbH), Austria Santoro, M. Gabriella, Ph.D., University of Rome Tor Vergata, USA Sharrocks, Andrew, D., Ph.D., University of Manchester, USA Shi, Yang, Ph.D., Harvard Medical School, USA Smythe Roy W., M.D., Texas A&M University Health Sciences Center, USA Srivastava, Arun Ph.D., University of Florida College of Medicine, USA Steiner, Mitchell, M.D., University of Tennessee, USA Tainsky, Michael A., Ph.D., Karmanos Cancer Institute, Wayne State University, USA Sung, Young-Chul, Ph.D., Pohang University of Science & Technology, Korea Taira, Kazunari, Ph.D., The University of Tokyo, Japan Terzic, Andre, M.D., Ph.D., Mayo Clinic College of Medicine, USA Thierry, Alain, Ph.D., National Cancer Institute, National Institutes of Health, France Trifonov, Edward, N. Ph.D., University of Haifa, Israel Van de Ven, Wim, Ph.D., University of Leuven, Belgium Van Dyke, Michael, W., Ph.D., The University of Texas M. D. Anderson Cancer Center, USA White, Robert, J., University of Glasgow, UK White-Scharf, Mary, Ph.D., Biotransplant, Inc., USA Wiginton, Dan, A., Ph.D., Children's Hospital

Research Foundation, CHRF , USA Yung, Alfred, M.D., University of Texas, USA Zannis-Hadjopoulos, Maria Ph.D., McGill Cancer

Centre, Canada Zorbas, Haralabos, Ph.D., BioM AG Team, Germany

!!!!!!!!!!!!!!!!!!!!!!!! Associate Board Members

Aoki, Kazunori, M.D., Ph.D., National Cancer Center Research Institute, Japan Cao, Xinmin, Ph.D., Institute of Molecular and Cell Biology, Singapore Falasca, Marco, M.D., University College London, UK Gao, Shou-Jiang, Ph.D., The University of Texas Health Science Center at San Antonio, USA Gibson, Spencer Bruce, Ph.D., University of Manitoba, USA Graâ&#x20AC;˘a, Xavier, Ph.D., Temple University School of Medicine, USA

For submission of manuscripts and inquiries: Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org

Gu, Baohua, Ph.D., The Jefferson Center, USA Hiroki, Maruyama, M.D., Ph.D., Niigata University Graduate School of Medical and Dental Sciences, Japan MacDougald, Ormond A, Ph.D., University of Michigan Medical School, USA Rigoutsos, Isidore, Ph.D., Thomas J. Watson Research Center, USA

Instructions to authors: Gene Therapy and Molecular Biology (GTMB) FREE ACCESS www.gtmb.org Scope Gene Therapy and Molecular Biology, bridging various fields is one of the most rapid with free access at gtmb.org. The scope of Gene Therapy and Molecular Biology is to promote interaction between researchers in the fields of Gene Therapy and Molecular Biology providing rapid publication of review articles and research papers. Articles (both invited and submitted) review or report novel findings of importance to a general audience in gene therapy, molecular medicine, gene discovery, and molecular biology with emphasis to molecular mechanisms. The journal will accept papers on all aspects of gene therapy, including gene delivery systems, gene therapy of cancer and other diseases (e.g. CFTR, hemophilia, AIDS, restenosis) at the clinical, preclinical or cell culture stage, gene discovery, cancer immunotherapy, DNA vaccines, use of DNA regulatory elements in gene transfer, cell therapy and transplantation, arraying technologies & DNA chips, peptide libraries and drug discovery related to gene therapy, cell targeting, gene targeting, therapy with oligonucleotides (antisense, ribozymes, triplex). The authors are encouraged to elaborate on the molecular mechanisms that govern a gene therapy approach. Gene Therapy and Molecular Biology will also publish articles on, transcription factors, DNA replication, recombination, repair, chromatin, nuclear matrix, DNA regulatory regions, locus control regions, protein phosphorylation, signal transduction, development, and on molecular mechanism of human disease. To make the publication attractive authors are encouraged to include color figures.

Type of articles Both review articles and original research articles will be considered. In addition, short 1-2 page news & views will also be considered for publication. Original research articles should contain a generous introduction in addition to experimental data. The articles contain information important to a general audience as the volume is also addressed to researches outside the field. There is no limit on the length of the articles provided that the subject is interesting to a general audience and covers exhaustively a field. The typical length of each manuscript is a approximately 4-20 printed page including Figures and Tables. This is 12-60 manuscript pages. Charges, Complimentary reprints & Subscriptions There are no charges for color figures or page numbers. Corresponding authors get a one-year free subscription (hard copy) plus 25 reprints free of charge. The free subscription can be renewed for additional years by having one paper per year accepted for publication. The free electronic access to articles published in " Gene Therapy and Molecular Biology " to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in gene therapy (from molecular mechanisms to clinical trials), the high quality in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board being assembled are prognostic factors of a big success for GTMB.

Sections of the manuscript Each manuscript should have a Title, Authors, Affiliation, Corresponding Author (with Tel, Fax, and E-mail), Summary, key words , running title and Introduction; review articles are subdivided into headings I, II, III, etc. (starting with I. Introduction) subdivided into A, B, C, and further subdivided using 1, 2, 3, etc. You can further subdivide into 1, 2, 3, etc. Research articles are divided into Summary; I. Introduction; II. Materials and Methods III. Results; IV. Discussion; Acknowledgments; and References. Please include in your text citations the name of authors and year in parenthesis; for three or more authors use: (name of first author et al, with year); for two authors please use both names. Please delete hidden text for references. In the reference list, please, type references with year and Journal in boldface and provide full title of the article such as: Buschle M, Schmidt W, Berger M, Schaffner G, Kurzbauer R, Killisch I, Tiedemann J-K, Trska B, Kirlappos H, Mechtler K, Schilcher F, Gabler C, and Birnstiel ML (1998) Chemically defined, cellfree cancer vaccines: use of tumor antigen-derived peptides or polyepitope proteins for vaccination. Gene Ther Mol Biol 1, 309-321. To avoid delays it is essential to submit an electronic and a hard copy version of your manuscript via e-mail and mail in a floppy, CD-ROM or ZIP, containing the manuscript that will be used to typeset the paper. Please include in the digital media: Tables, if any, (preferably as a Microsoft Word text) and Figure legends. Please use Microsoft Word, font “Times” (Mac users) or “Times New Roman” (PC users) and insert Greek or other characters using the “Insert/Symbol” function in the Microsoft Word rather than simple conversion to font “Symbol”. Please boldface Figure 1, 2, 3 etc. as well as Table 1, 2, etc. throughout the text. Please provide the highest quality of prints of your Figures; whenever possible, please provide in addition an electronic version of your figures. Article contributors are kindly requested to provide a color (or black/white) photo of themselves (preferably 4x5 cm or any size) or a group photo of the authors, as we shall include these in the publication Submission and reviewing Peer reviewing is by members of the Editorial Board and external referees. Please suggest 2-3 reviewers providing their electronic addresses, mailing addresses and telephone/fax numbers. Authors are sent page proofs. Gene Therapy and Molecular Biology is published in on high quality paper, hardbound, and with excellent reproduction of color figures. Reviewing is completed within 5-15 days from receiving the manuscript. Articles accepted without revisions (i.e., review articles) will be published online (www.gtmb.org) in approximately 1 month following submission. Please submit an electronic version of full text and figures preferably in jpeg format. The electronic version of the figures will be used for the rapid reviewing process. High quality prints or photograph of the figures and the original with one copy should be sent via express mail to the Editorial Office. Citation in MedLine Articles accepted for publication by GTMB or Cancer Therapy can be included in MedLine (PubMed) as full articles upon the request of authors provided that the authors have completed their published

work under a government grant by NIH (or EU/Japan government grant). If this is you case, please consult the NIH Manuscript Submission System http://www.nihms.nih.gov/. Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org The free electronic access to articles published in "GTMB" to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in cancer, the anticipated high quality in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board being assembled are prognostic factors of a big success for the newly established journal.

Gene Therapy and Molecular Biology (GTMB) is covered in the following Thomson Scientific services: " Science Citation Index Expanded (also known as SciSearch# ) " Biotechnology Citation Index# " Journals Citation Reports/Science Edition

Table of contents

Gene Therapy and Molecular Biology Vol 10 Number 1, June 2006

Pages

Type of Article

Article title

Authors (corresponding author is in boldface)

1-12

Mini Review

Dequan Chen and Donald E. Texada

13-16

Research Article

17-30

Research Article

31-40

Review Article

Low-usage codons and rare codons of Escherichia coli Structural analysis of the elongated part of an abnormal hemoglobin “Hemoglobin Cranston” Delivery of human apolipoprotein (apo) E to liver by an [E1–, E3–, polymerase–, pTP–] adenovirus vector !containing a liver-specific promoter inhibits atherogenesis in immunocompetent apoE-deficient !mice Naturally occurring translational models for development of cancer gene therapy#

41-54

Review Article

55-60

Research Article

61-70

Review Article

71-94

Review Article

Design of functional dendritic polymers for application as drug and gene delivery systems

95-100

Review Article

101-108

Research Article

109-112

Research Article

113-122

Research Article

The role of BRCA1 AND BRCA2 in hereditary breast cancer The analysis of dose response curve comes in useful for the assembly of multi-siRNAs expressing cassettes The isolation of chlamydia pneumoniae in atherosclerosis patients in Iran by PCR method Using N-(2-hydroxypropyl) methacrylamide copolymer drug

CDK inhibitors in 3D: Problems with the drugs, their development plans or their linkage to disease? Antioxidative gene therapy using superoxide dismutase in ischemiareperfusion injury of testes in rats Viral vectors in pancreatic cancer gene therapy

Viroj Wiwanitkit

Julian D. Harris, Ian R. Graham, Andrea Amalfitano, James S Owen, George !Dickson

Jaime F. Modiano, Matthew Breen, Susan E. Lana, Nicole Ehrhart, Susan P. Fosmire, Rachael Thomas, Cristan M. Jubala, Angela R. Lamerato!Kozicki, Eugene J. Ehrhart, Jerome Schaack, Richard C. Duke, Gary C. Cutter and Donald Bellgrau Andrew Hughes

Roland Pálffy, Roman Gardlík, Július Hodosy, Lukác Halcák, Peter Celec Min Li, Joel A. Rodriguez, William E. Fisher, Xiaoliu Zhang, Changyi Chen and Qizhi Yao Zili Sideratou, Leto-Aikaterini Tziveleka, Christina Kontoyianni, Dimitris Tsiourvas, Constantinos M. Paleos Athina Christopoulou and John Spiliotis Laura Poliseno, Monica Evangelista, Mauro Giacca and Giuseppe Rainaldi Fatemeh Fallah, Gita Eslami, Mehdi Bootorabi, Bahram Kazemi, Hossein Goudarzi, Elham Mazaheri Matthew Oman, Jihua Liu, Jun Chen, David Durrant, Hung-Sheng Yang, Yongwen He, Pavla Kopecková,

123-132

Research Article

133-146

Review Article

147-160

Research Article

161-164

Review Article

bioconjugate as a novel approach to deliver a Bcl-2-targeting compound HA14-1 in vivo Epstein-Barr Virus downregulates expression of DNA-Double strand break repair proteins in nasopharyngeal cancer Mechanisms of malignant glioma immune resistance and sources of immunosuppression Characterization of the cytotoxic effect of a chimeric restriction enzyme, H1ยบ-FokI The study of 16S rRNA in meningitis by molecular biology assay

Jindrich Kopecek and Ray M. Lee

Prabha Balaram, Smriti M Krishna, Susan James, Vino. T. Cheriyan, Sreelekha Therakathinal Thankappan, Aleyamma Mathew German G. Gomez and Carol A. Kruse Naved Alam and Donald B. Sittman

Hossein Goudarzi, Gita Eslami, Fatemeh Fallah, Bahram Kazemi

Gene Therapy and Molecular Biology Vol 10, page 55 Gene Ther Mol Biol Vol 10, 55-60, 2006

Antioxidative gene therapy using superoxide dismutase in ischemia-reperfusion injury of testes in rats Research Article

Roland Pálffy1, 2, Roman Gardlík1, 2, Július Hodosy1, Celec1, 2, 3, *

3, 4

, Lukác Halcák5, Peter

BiomeD Research and Publishing Group Department of Molecular Biology, Faculty of Natural Sciences, Comenius University, Bratislava, Slovak Republic 3 Institute of Pathophysiology, Faculty of Medicine, Comenius University, Bratislava, Slovak Republic 4 Department of Animal Physiology and Ethology, Faculty of Natural Sciences, Comenius University, Bratislava, Slovak Republic 5 Institute of Medical Chemistry, Biochemistry and Clinical Biochemistry, Faculty of Medicine, Comenius University, Bratislava, Slovak Republic 2

__________________________________________________________________________________ *Correspondence: Peter Celec, MD, Dipl. Ing., BSc, PhD, Institute of Pathophysiology, Department of Molecular Biology, Faculty of Medicine, Comenius University, Sasinkova 4, 813 72, Bratislava, Slovak Republic; e-mail: petercelec@gmail.com Key words: gene therapy, superoxide dismutase, ischemia-reperfusion injury, testes, torsion, thiobarbituric acid reacting substances Abbreviations: Ischemia-reperfusion injury, (IRI); Luria-Bertani, (LB); malondialdehyde, (MDA); reactive oxygen species, (ROS); superoxide dismutase, (SOD); Thiobarbituric acid reacting substances, (TBARS) Received: 5 December 2005; Revised: 9 January 2006 Accepted: 7 February 2006; electronically published: February 2006

Summary Ischemia-reperfusion injury (IRI) is associated with increased production of reactive oxygen species and thus with oxidative stress. Antioxidative pre-treatment prevents the free radical induced tissue impairment in experiment, as has been shown previously. However, clinical use requires long-term treatment with high doses of antioxidants. Gene therapy using safe vector constructs provides a useful tool for gene transfer in vivo. To evaluate the effects of superoxide dismutase (SOD) gene therapy on oxidative stress induced tissue impairment in an experimental model of IRI of testes. Male Wistar rats (n=18) were pre-treated either by single intratesticular injection of 500 µg of plasmid pcDNA3 containing the Mn-SOD cDNA or by adequate volume of saline two days prior to the IRI. Ischemia (30 minutes) was induced by torsion of a random testis in each rat. After 30 minutes of reperfusion (detorsion), both testes were removed. Malondialdehyde (MDA) as major product of lipoperoxidation were measured in testes homogenates. Samples were also analysed by electron microscopy. Although not reaching the level of statistical significance our results show that IRI increased the oxidative stress induced tissue impairment and SOD gene pre-treatment could partly compensate and reduce the MDA level. This decrease is even superior without IRI. This study does not provide any evidence, but indicates the possibilities of antioxidative gene therapy in IRI of testes. Further larger studies should prove the efficiency of this approach on other organs using wider palette of markers of tissue impairment. main factors contributing to reperfusion injury of the ischemic tissues such as myocardium (Chen et al, 1998; Li et al, 1998; Zhu et al, 2000) or testis (Koksal et al, 1999, 2003; Visser and Heyns, 2003). Reasons of oxidative stress are relatively well studied and contain the formation of free radicals after increased oxygenation during reperfusion of ischemic tissue that has adapted to an

I. Introduction Damage of various tissues caused by ischemiareperfusion injury is related to formation of many different oxygen and oxygen-derived free radicals called reactive oxygen species (ROS). These toxic molecules are natural side-products of many metabolic pathways. Oxidative stress occurs if the level of newly generated ROS is higher than the antioxidative status of the cells. It is one of the

Pálffy et al: Gene therapy for ischemia-reperfusion injury in testes environment of low oxygen concentration during hypoxia/ischemia (Bertuglia and Giusti, 2003). Free radicals and ROS involved in damaging processes of oxidative stress are mostly superoxide anion (!O2-), hydroxyl radical (!OH) and singlet oxygen (1O2). Inability to degrade these ROS is the primary cause of irreversible ischemia-reperfusion injury (Zhu et al, 2000). To scavenge free radicals, except low molecular weight scavengers like ascorbic acid, vitamin E etc. (Llesuy et al, 1995), which are mostly of exogenous origin, there are also endogenous enzymatic antioxidant systems including superoxide dismutase, catalase, glutathione peroxidase and glutathione reductase, which are acting on different level in various tissues (Chen et al, 1998) and endogenous nonenzymatic antioxidants like gluthatione and urate (Miller et al, 1993). Superoxide dismutase (SOD) seems to be the best described and mostly studied antioxidant enzyme, that catalyses the dismutation of superoxide anion (mainly as a product of intracellular respiration) to oxygen and hydrogen peroxide, which is later degraded by catalase to form water and molecular oxygen. Superoxide anions can take part in a reaction that generates much more toxic hydroxyl radicals, what emphasizes the important role of SOD in ROS reduction. There are three biological forms of SOD bearing an important antioxidant activity: 1. mitochondrial tetrameric manganese-containing Mn-SOD, which is mainly present in mitochondria, but is synthesized in cytosol and coded by a nuclear gene; 2. cytosolic dimeric copper/zinc-containing Cu/Zn-SOD; 3. extracellular SOD - tetrameric glycoprotein containing Cu/Zn which occurs mostly in the extracellular and interstitial space. A major part of total intracellular amount of free radicals is generated in mitochondria, therefore we used cDNA coding mitochondrial Mn-SOD in our study. Testicular disorders such as varicocele or torsion of testis are considered to be related with sperm dysfunction and male infertility (Koksal et al, 1999; Visser and Heyns, 2003). ROS-mediated oxidative stress is one of crucial reasons of infertility and decreased sperm viability (Koksal et al, 2003). Increased level of free radicals may cause degeneration of testicular tissue. Torsion of testis is a common clinical status occurring mainly in young male population (Greenfield et al, 2002) and caused by ischemia after twisting the testicular cord through several revolutions. Depending on the rate of twisting and duration of the torsion, various levels of damage and atrophy can be observed in the testicular tissue. This damage is caused by oxidative stress during ischemiareperfusion injury. Reduced antioxidative status of spermatozoa, decreased motility and ineffective spermatozoon-oocyte fusion occur as a consequence of the rise of ROS production (Koksal et al, 2003). It is evident, that SOD plays an important role in scavenging of ROS in testes, because in comparison to rat liver, the activity of catalase and glutathione peroxidase is much lower in the testicular tissue (Peltola et al, 1992). Besides other adverse effects, ROS also induce lipoperoxidation that changes membrane permeability, it leads to protein impairment, and to enzyme inactivation and at the end to DNA damage. Plasmatic membranes of

spermatozoa contain high concentrations of polyunsaturated fatty acids and therefore are highly sensitive to oxidative stress. In this study we have examined the oxidative stress in testicular tissue and measured the level of malondialdehyde (MDA) that is a product of lipoperoxidation and can be considered as direct quantitative marker of ROS induced lipid impairment. Gene therapy presents a great potential for ischemiareperfusion damage protection in various tissues. We used an experimental rat model of ischemia-reperfusion (torsion and detorsion of testes) to prove the biological function of intratesticulary administered Mn-SOD gene. Considering the potential safety risk of viral vectors usage, we decided to utilize naked DNA (plasmid) vector.

II. Materials and methods A. Vector The vector molecule for introduction the Mn-SOD gene was obtained from Dr. Larry W. Oberley and Dr. Yuping Zhang from University of Iowa (Figure 1).

B. Vector isolation and purification Plasmid pcDNA3 containing the Mn-SOD gene was transformed into competent cells of host strain E.coli DH1 (F-, rec A, hsd R, sup E, end A, gyr A96) using CaCl2 and heat-shock method. DH1 strain is suitable for production of large amounts of plasmid. Transformed cells and cultures were selected by cultivation on Petri dishes with Luria-Bertani (LB) cultivation medium containing ampicilin (100 µg/ml LB) as a selective marker. For consecutive isolation of plasmid we used the Birnboim and Doly (1979) protocol. The purification of DNA was done using phenol-chlorophorm extraction. The purity and concentration of extracted plasmid DNA was approved by photometric methods.

C. Animal experiment Male Wistar rats (n=18) were involved in the experiment. The plasmid was introduced randomly into right or left testis by injection of 100 µl of plasmid DNA solution in sterile water. This represented 500 µg of pure DNA for each rat. Corresponding volume of saline solution was injected into the remaining testis of each rat. On the third day after plasmid administration (48 hours), torsion-T of testis (randomly right or left) was simulated by 5-fold clockwise rolling of testis.

Figure 1. Map of the pcDNA3 vector containing the SOD cDNA used in this study.

Gene Therapy and Molecular Biology Vol 10, page 57 After 30 minutes of ischemia, we restored the blood flow by 5fold counterclockwise rotation (detorsion-DT, reperfusion phase). In this process, the increased oxygenation of ischemic tissue induced oxidative stress. After another 30 minutes of reperfusion, both the twisted and non-twisted testes were surgically removed, frozen until measurement of oxidative stress markers or fixed in 3% glutaraldehyde for ultrastructural examination. Acquired testicular tissues were divided into 4 groups: ctrl-testes with injected saline without T (n=9), SODtestes with injected Mn-SOD plasmid without T (n=9), torsiontestes with injected saline with T-DT (n=9), SOD+torsion-testes with injected Mn-SOD plasmid with T-DT (n=9). One testis from the 2nd group (SOD) was atrophic and thus has not been involved in further examination.

endogenous source of therapeutic protein by introducing a gene, which codes such enzyme. Many protocols use replication of deficient adenoviruses as vectors for transferring cDNA of catalase (Zhu et al, 2000), or SOD (Li et al, 1998) into myocardium or intravenously. These studies have confirmed the protective effect of antioxidant-coding introduced genes on ischemiareperfusion damage of rabbit hearts with highest level of antioxidant expression on second and third day after gene transfer. Another study demonstrated an important role of Cu/Zn-SOD in reducing the oxidative stress in mouse hearts by disrupting SOD I gene (coding Cu/Zn-SOD) (Yoshida et al, 2000). There was no activity of Cu/ZnSOD in hearts of knock-out mice (SOD I -/-) and high MDA level was detected. Increased activity of SOD was noticed in transgenic mice after ischemia and reperfusion (Chen et al, 1998). Ischemia-reperfusion injury of various tissues is a typical experimental and clinical inducer of oxidative stress (Filho et al, 2004; Akgur et al, 1993; GonzalezFlecha et al, 1993). This does not affect only the myocardium, kidneys, organ transplants, but also testes. MDA as the end product of fatty acid breakdown is a widely used marker of lipoperoxidation (Celec et al, 2003). MDA belongs to the main components of thiobarbituric acid reacting substances. Although not significant, our results have shown indeed, that the ischemia-reperfusion injury in an experimental model of testicular torsion and detorsion increases concentrations of a lipoperoxidation marker like MDA (Figure 2). Swelling mitochondria from testicular tissue after ischemiareperfusion injury without antioxidative treatment are shown on Figure 3. SOD gene therapy using naked plasmid DNA injected 48 hours before the onset of the reperfusion injury could partly compensate the increased ROS production and decrease the MDA level. The antioxidative effects of SOD are even more evident in the SOD group without torsion-detorsion (Figures 2, 4).

D. MDA determination Collected samples of testes were frozen (-20 °C) until measurement (2 days). MDA was measured in testes homogenates (10%) by spectrofluorometric method ("ex.=535nm, "em.=553nm) after derivatization with 0.6% thiobarbituric acid in acidic medium of acetic acid (100°C, 45 min.) After derivatization, the colored product was extracted to n-butanol, centrifuged (6000g, 10 min) and measured against a standard solution (1,1,3,3-tetrametoxypropan). MDA concentration in tissues was expressed on the basis of the calibration curve in µmol.g-1.

E. Statistical analysis Data was analyzed using One way ANOVA (MDA level as a parameter, groups as factor) with Bonferroni modified posthoc t-test with # = 0.05. The results are presented as mean + standard error of the mean. The computations were done with SPSS 11.0 for Windows and Microsoft Excel 2000®.

III. Results and discussion Many previous studies have examined the therapeutic effect after in vivo intravascular or local application of recombinant antioxidant enzymes (SOD, catalase). The disadvantage of the direct protein application is their low stability in circulation, inability to enter the cells and the induction of antibodies production after long-term administration. Gene therapy provides stable and

Figure 2. MDA concentrations measured in testes homogenates.

Pรกlffy et al: Gene therapy for ischemia-reperfusion injury in testes

Figure 3. Arrows show swelling mitochondria from testicular tissue after ischemia-reperfusion injury without antioxidative treatment.

Figure 4. Arrows show mitochondria from testicular tissue after ischemia-reperfusion injury protected by antioxidative gene therapy using superoxide dismutase. The inner mitochondrial membrane is clearly visible, and no signs of swelling or other injuries are present.

Gene Therapy and Molecular Biology Vol 10, page 59 Chen Z, Siu B, Ho YS, Vincent R, Chua CC, Hamdy RC, Chua BH (1998) Overexpression of MnSOD protects against myocardial ischemia/reperfusion injury in transgenic mice. J Mol Cell Cardiol 30, 2281-9. Filho DW, Torres MA, Bordin AL, Crezcynski-Pasa TB, Boveris A (2004) Spermatic cord torsion, reactive oxygen and nitrogen species and ischemia-reperfusion injury. Mol Aspects Med 25(1-2), 199-210. Gonzalez-Flecha B, Cutrin JC, Boveris A (1993) Time course and mechanism of oxidative stress and tissue damage in rat liver subjected to in vivo ischemia-reperfusion. J Clin Invest 91(2), 456-64. Greenfield SP, Seville P, Wan J (2002) Experience with varicoceles in children and young adults. J Urol 168, 1684-8. Kamata H, Hirata H (1999) Redox regulation of cellular signalling. Cell Signal 11, 1-14. Koksal IT, Erdogru T, Toptas B, Gulkesen KH, Usta M, Baykal A, Baykara M (1999) Effect of experimental varicocele in rats on testicular oxidative stress status. Andrologia 34, 2427, 2002. Koksal IT, Usta M, Orhan I, Abbasoglu S, Kadioglu A (2003) Potential role of reactive oxygen species on testicular pathology associated with infertility. Asian J Androl 5, 959. Llesuy S, Milei J, Picone V, Gonzalez Flecha B, Beigelman R, Boveris A (1995) Effect of vitamins A and E on ischemiareperfusion damage in rabbit heart. Mol Cell Biochem 145(1), 45-51. Li Q, Bolli R, Qiu Y, Tang XL, Murphree SS, French BA (1998) Gene therapy with extracellular superoxide dismutase attenuates myocardial stunning in conscious rabbits. Circulation 98, 1438-48. Miller JK, Brzezinska-Slebodzinska E, Madsen FC (1993) Oxidative stress, antioxidants, and animal function. J Dairy Sci 76(9), 2812-23. Peltola V, Huhtaniemi I, Ahotupa M (1992) Antioxidant enzyme activity in the maturing rat testis. J Androl 13, 450-5. Subramanian R, Volovsek A, Ho YS (1993) Lack of change in MnSOD during ischemia/reperfusion of isolated rat heart. J Mol Cell Cardiol 25, 1179-86. Visser AJ, Heyns CF (2003) Testicular function after torsion of the spermatic cord. BJU Int 92, 200-3. Yoshida T, Maulik N, Engelman RM, Ho YS, Das DK (2000) Targeted disruption of the mouse Sod I gene makes the hearts vulnerable to ischemic reperfusion injury. Circ Res 86, 264-9. Zhu HL, Stewart AS, Taylor MD, Vijayasarathy C, Gardner TJ, Sweeney H (2000) Blocking free radical production via adenoviral gene transfer decreases cardiac ischemiareperfusion injury. Mol Ther 2, 470-5.

The results of this study are similar to those obtained by other groups using SOD gene therapy in other organs. Nevertheless, data dealing with antioxidative gene therapy of testes are lacking. The main limitation of our study is the low number of animals and observed markers of tissue impairment. We are aware of the facts that other biochemical markers of oxidative stress like glutathione or hydroxynonenal might be measured. We have decided to concentrate on MDA because of the high susceptibility of the testicular tissue to lipoperoxidation. In addition, the relatively short reperfusion period might influence the results. Future research should concentrate on functional parameters like sperm count, viability and fertility. Further studies will also clarify the possibilities of using antioxidative gene therapy in clinical situations.

IV. Conclusion According to our knowledge we are the first to describe the possibilities of SOD gene therapy in ischemia-reperfusion injury of testes. Our results should be proved in larger studies using other markers of tissue impairment.

Acknowledgements The authors are supported by Grant of the Comenius University 116/2004 and 117/2004 and the Grant Agency for Science and Technology APVT-20-003104.

References Akgur FM, Kilinc K, Aktug T (1993) Reperfusion injury after detorsion of unilateral testicular torsion. Urol Res 21(6), 395-9. Bertuglia S, Giusti A (2003) Microvascular oxygenation, oxidative stress, NO suppression and superoxide dismutase during postischemic reperfusion. Am J Physiol Heart Circ Physiol 285, 1064-71. Birnboim HC, Doly J (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res 7, 1513-23. Celec P, Jani P, Smrekova L, Mrlian A, Kudela M, Hodosy J, Boor P, Kristova V, Jakubovsky J, Jezova D, Halcak L, Bozek P, Slamova J, Ulicna O, Hojsik D, Jurkovicova I (2003) Effects of anabolic steroids and antioxidant vitamins on ethanol-induced tissue injury. Life Sci 74, 419-34.

Pรกlffy et al: Gene therapy for ischemia-reperfusion injury in testes

Gene Therapy and Molecular Biology Vol 10, page 95 Gene Ther Mol Biol Vol 10, 95-100, 2006

The role of BRCA1 AND BRCA2 in hereditary breast cancer Review Article

Athina Christopoulou 1,* and John Spiliotis2 1

Department of Internal Medicine, Section Oncology, St. Andrews General Hospital Patras, Greece Department of Surgery, Mesolongi General Hospital, Mesolongi, Greece

__________________________________________________________________________________ *Correspondence: Athina Christopoulou M.D, Ph.D, Department of Internal Medicine, Section of Oncology, â&#x20AC;&#x153;St. Andrewsâ&#x20AC;? General Hospital, Votsi 31,33, Patras, Greece; Tel: +30- 6942402626; E-mail: athinachris@in.gr Key words: hereditary breast cancer, BRCA1, BRCA2 Abbreviations: National Surgical Adjuvant Breast and Bowel Project Breast Cancer Prevention Trial, (NSABP-P1); prophylactic mastectomy, (PM); prophylactic oophorectomy, (PO) Received: 5 December 2005; Revised: 14 February 2006 Accepted: 17 February 2006 electronically published: March 2006

Summary BRCA1 and BRCA2 account for most cases of hereditary breast cancer in the United States and Europe. These are suppressor genes that are inherited in an autosomal dominant fashion. Several studies showed that the histologic and molecular phenotype of BRCA-associated tumors is different from that of nonhereditary tumors. There is a difference in steroid receptor status between BRCA1 and 2 tumors regard to chemoprevention of breast cancer with antiestrogenes. 93-100% of BRCA2 associated breast cancers are ER/PR+. Breast cancers associated with BRCA1 mutations are frequently of a higher grade and are hormone receptor-negative in one third of them. A higher proportion of cancers related to a BRCA1 mutation have atypical or typical medullary histologic features. The lifetime cumulative risk of invasive breast cancer for individuals with BRCA1 or BRCA2 mutations ranges from 50% to 87%. Familial breast cancer, however, accounts for fewer than 10% of all breast cancers, and BRCA1-related and BRCA2-related familial disease constitutes only two-thirds to three-fourths of these cases. Among women younger than 35 years old with breast cancer, 10% to 15% have a BRCA1 mutation. Woman with BRCA 1/2 mutations already affected by the disease have a risk, to age 70, of contralateral breast cancer that ranges between 50% and 64%. It has been difficult to determine whether germline BRCA 1/2 status has an effect on breast cancer outcome and the results from several studies remain controversial. There are preliminary data that BRCA 1/2 related tumors may have a faster growth rate than sporadic tumors. In these women prophylactic mastectomy, chemoprevention with tamoxifen or prophylactic oophorectony are reasonable options. Genetic testing for BRCA 1/2 mutations should be done in those with a significant family history of breast or ovarian cancer, those with a diagnosis of breast or ovarian cancer below 50 years of age and those with a blood relative who is known to have a mutation in BRCA 1 or 2. Ongoing clinical trials will determine who the optimal subjects are for screening, how screening and counseling should be conducted and what type of societal involvement is needed so that genetic screening can be used without exposing the subject to unexpected risks and consequences.

Recent advances in molecular genetics have identified a number of genes associated with inherited susceptibility to cancer and have provided a means to begin identifying individuals and families with an increased risk of cancer. One of the most exciting and highly anticipated break throughs in cancer genetics was the cloning of BRCA1 and BRCA2 in early nineties (Nooster et al, 1994; Palma et al, 2006). Breast cancer is the most prevalent type of cancer in women and several epidemiologic studies have identified

I. Introduction In the European Union, the number of breast and ovarian cancer cases diagnosed every year is 115/100.000 and 18/100.000, respectively. Genetic susceptibility as a result of highly penetrant germ line inactivation in cancer predisposition genes characterizes approximately 5-10% of breast cancers, 10% of ovarian cancer and 25% of the early onset of breast cancer (Nooster et al, 1994; Palma et al, 2006).

Christopoulou and Spiliotis: The role of BRCA1 AND BRCA2 in hereditary breast cancer some risk factors for breast cancer, including a family history of the disease. There is a clearly documented two to fourfold increase in risk of breast cancer among women with one or more first-degree relatives with the disease. (Pharoah et al, 1997). The magnitude of the risk increases with the number of affected relatives in the family, the closeness of the relationship and the age at which the affected relative was diagnosed. The younger the age at diagnosis, the more likely it is that a genetic component is present (Coditz et al, 1993). Studies of families with a hereditary pattern of breast cancer have also revealed an association with ovarian cancer among some individuals with a genetic predisposition for breast cancer. Families in which both breast and ovarian cancers are present in the some lineage have significantly increased likelihood of carrying a cancer-predisposing mutation. (Couch et al, 1997; Shattuck Eidens et al, 1997).

and ovarian cancer that warrants consideration of more intensive preventive and screening strategies. Men with BRCA1 or BRCA2 mutation have an elevated risk of breast cancer, although the overall risk is low. An increasing body of research has shown that there are differences in the breast cancer phenotype found in breast carcinoma obtained from BRCA1 mutation carriers compared with those found in BRCA2 mutation carriers and that these cancers may also have characteristics distinct from sporadic cases. For example, when compared with sporadic cases, BRCA1 mutations associated breast cancers are more likely to be invasive ductal, high-grade carcinoma with lymphocyte mutation. DCIS by itself or with invasive components is found less often in BRCA1 mutation-positive tumors. In addition aneuploidy, estrogen and progesteron receptor negativity and positive status for P53 overexpression and erb-2 are more likely to be observed in tumors from mutation cancers (BCLC 1997; Boyd et al, 2000). Unlike with BRCA1 mutation carriers, no distinct phenotype for breast cancers in BRCA2 mutation carriers has emerged. However, one important finding is that, compared with breast cancers from BRCA1 mutation carriers, BRCA2 mutation-positive tumors have a higher rate of steroid receptor positivity (Chappuis P et al, 2000). The literature provides no consensus about the survival rates for cases of breast cancer in BRCA1 mutation carriers compared with sporadic cases of breast cancer. Several studies have shown that survival rates are less favorable compared with sporadic cases. This finding is consistent with the histopathological features in mutation carriers, which suggest a more adverse prognosis. However, other studies have shown that survival rates are similar. Limited data for BRCA2 mutation carriers suggest that their survival after breast cancer is equivalent to that observed for the general population, however most studies are needed (Phillips et al, 1999).

II. Hereditary breast cancer syndrome The majority of breast cancers are sporadic occurring, in women without a family history of breast cancer. Approximately 15% to 20% of breast cancers are associated with some family history of breast cancer but no evidence of autosomal transmission. Only a small propotion of all breast cancer up to 10% are attributable to germline mutation in single, highly penetrant cancer susceptibility genes, such as BRCA1 and BRCA2. These cancers result from a strong genetic predisposition and cancer susceptibility in these families is transmitted in an autosomal dominant fashion (Claus, 1996). BRCA1 or BRCA2 have been estimated to include approximately 45% breast cancer susceptibility syndromes that are transmitted as a dominant autosomic trait, accounting for about 40% cases of families with both early onset breast cancer (Wooster and Weber, 2003). Although the exact function of BRCA1 and BRCA2 and their role in breast carcinogenesis are not completely known, it appears that they may not only function as tumor-suppressor genes but also play a role in DNA repair. The genes perform multiple discrete functions and tumor is initiated when genetic instabilities lead to increased mutations in these genes (Hall et al, 1990). In women the overall range of risk of breast cancer associated with mutations in the BRCA1 or BRCA2 gene is from 40% - 85% over a lifetime, whereas the lifetime risk in the general population is approximately 12.5%, and differ in populations 2% in Japan and 14% in USA (Begg, 2002). In women who are BRCA1 or BRCA2 mutation carriers and have a history of breast cancer, the lifetime risk of contralateral breast cancer is also elevated, at 40% to 60% (Meijers et al, 2002). BRCA1 and BRCA2 mutation carriers have a very elevated risk of ovarian cancer, ranging from 15% to 40%, compared with an approximate risk of 2% in the general population (Easton et al, 1995). It is generally accepted, that carriers of mutations in BRCA1 or BRCA2 have an excessive risk for both breast

III. Assessment of hereditary breast cancer-genetic testing Hereditary patterns of cancer are often characterized by early age at onset, high penetrance, bilaterality in paired organs and association with other types of tumors. In many families, an apparent pattern of vertical transmission consistent with autosomal dominant inheritance, in which the genetic mutation is transmitted to 50%. Individuals who belong to populations such as Ashkenasi people, may also have an increased chance of carrying a BRCA1 or BRCA2 mutation, especially in the setting of a family history of breast or ovarian cancer or both (Malone et al, 2000). Individuals who have only a family history of breast and/or ovarian cancer may also be at risk. For this reason, risk assessment and counseling are considered to be integral components of genetic screening for hereditary breast cancer. These individuals should be considered to accurately determine their risk and to offer screening and general prevention recommendations.

Gene Therapy and Molecular Biology Vol 10, page 97 The selection of appropriate candidates for genetic testing is based on personal and familial characteristics that determine the individual’s prior probability of being a mutation carrier, and on the psychosocial degree of readiness of the person to receive genetic test results. Statistical models based on personal and family history characteristics have been developed to estimate a person’s chance of having a BRCA1 or BRCA2 mutation (Parmigiani et al, 1998; Berry et al, 2002). These models may aid the counselor in making genetic testing decisions. The potetitial benefits, limitations and risks of genetic testing are also important considerations in the decisionmaking process. There are two types of definitive results for which it is clear whether the patient has elevated cancer risks. True positive results indicate that a deleterious, risk-conferring mutation was identified. True negative results mean that an individual has tested negative for a deleterious mutation. In such cases, cancer risks are thought to be reduced to the level of general population. False negative results can occur as a laboratory error, as can false positive results. Uniformative results arise when BRCA1 and BRCA2 analysis fails to reveal the presence of a deleterious mutation and hereditary risk cannot be ruled out. In these instances, the individual and her relatives need to be counseled that they may still be at increased risk for hereditary breast cancer and should be managed on the basis of the pattern of cancers observed in their family. For patients who belong to families with known BRCA1 and BRCA2 mutations, post-test counseling should point out that although the individual has not inherited the mutation, a negative test result does not eliminate the risk of developing cancer, therefore, they should be encouraged to adhere to population screening guidlines for cancer. In addition, in the context of these results, there is no reason to recommend ovarian screening or consideration of prophylactic surgery. If the patient does not belong to a family with a known BRCA1 or BCRA2 mutation, a negative result must be interpreted with caution. The patient may carry an undetected BRCA1 or BRCA2 mutation or a mutation in another susceptibility gene. Post-test counseling and management of these patients must be highly individualized and based on family and personal medical history. For families with strong histories of breast and ovarian cancer, an undetected gene alteration may still be present and autosomal dominant risks many still apply. Risk management in these patients must be individualized, based on the patient’s personal and family history of cancer. The individual can also be informed that the significance of the mutation may become clarified through further research and should also be encouraged to periodically reconsult with a cancer genetics service to see if the variant has been reclassified (Nooster et al, 1994; Palma et al, 2006).

IV. Screening recommendations A plan of individualized risk management should be discussed with the patient who is found to carry a BRCA1 or BRCA2 mutation. An aggressive surveillance plan should be considered by women with BRCA1 and BRCA2 mutation, both before and after menopause. The emphasis is on initiating screening considerably early than standard recommendations as a reflection of the early age of onset seen in hereditary breast/ovarian cancer. Recent reports have demonstrated that MRI may be more sensitive than mammography. These women must begin imaging studies at 25 years old. In addition, because interval breast cancers found in mutation carriers undergoing annual imaging studies, a shorter screening interval every 6 months may be indicated (Brelelmans et al, 2001). However, because some cancers may be missed by mammography and MRI, the importance of breast physical examinations should not be discounted beginning at age of 18 years old. Frequent clinical performed exams (two or four times per year). are an important component of the management plan for mutation carriers. A pelvic examination, CA-125 determination and concurrent trans vaginal ultrasound, should be performed every 6 to 12 months, starting at ages 30 to 35 (Warner et al, 2001). This management detects I or II clinical stage of ovarian cancer in max 10% of BRCA1/2 carriers, so this method is of low effectiveness (Eisinger et al, 2004). The clinical management of these subjects must be performed in a multidisciplinary approach by a team of different specialists.

V. Management of hereditary breast cancer A. Chemoprevention An important question for many BRCA1 and BRCA2 mutation carriers is whether tamoxifen is effective in reducing breast cancer risk. Because several studies have shown a reduction in breast cancer risk for premenopausal mutation carriers who have undergone oophorectomy, it is possible that tamoxifen may be similarly efficacious because the drug blocks estrogen receptors. In retrospective case-control study of more than 200 mutation carriers with breast cancer who received tamoxifen in the adjuvant setting, it was found that, tamoxifen reduced the risk of contralateral breast cancer for BRCA1 and BRCA2 mutation carriers by 50%. However, complete information regarding the estrogen receptor status of patients was not included; thus it is unclear whether risk reduction is equivalent in these groups (Narod et al, 2000). A number of studies investigated the possible activity of hormone deprivation in reducing breast cancer incidence in women at risk of developing breast cancer. Briefly in the NSABP-P1 Trial (Fisher et al, 1998) more than 13.000 “high-risk” women were randomised between 1992 and 1997 to receive tamoxifene 20mgr/d or placebo for 5 years and, overall, a 50% reduction of

Christopoulou and Spiliotis: The role of BRCA1 AND BRCA2 in hereditary breast cancer (2002) BRCA pro validation, sensitivity of genetic testing of BRCA1/2, and prevalence of other breast cancer susceptibility genes. J Clin Oncol 20, 2701-2712. Boyd J, Sonoda Y, Federici MG, Bogomolniy F, Rhei E, Maresco DL, Saigo PE, Almadrones LA, Barakat RR, Brown CL, Chi DS, Curtin JP, Poynor EA, Hoskins WJ (2000) Clinicopathologic features of BRCA-linked and sporadic ovarian cancer. JAMA 283, 2260-2265. Breast Cancer Linkage Consortium (1997) Pathology of familial breast cancer differences between breast cancers in carriers of BRCA1 or BRCA2 mutations and sporadic cases. Lancet 349, 1505-1510. Brekelmans CT, Seynaeve C, Bartels CC, Tilanus-Linthorst MM, Meijers-Heijboer EJ, Crepin CM, van Geel AA, Menke M, Verhoog LC, van den Ouweland A, Obdeijn IM, Klijn JG; Rotterdam Committee for Medical and Genetic Counseling (2001) Effectiveness of breast cancer surveillance in BRCA1/2 gene mutation carriers and women with high familial risk. J Clin Oncol 19, 924-930. Chappuis PO, Nethercot V, FouPkes WD (2000) Clincopathological characteristics of BRCA1 and BRCA2-related breast cancer. Sem Surg Oncol 18, 287-295. Claus EB, Schildkraut JM, Thompson WD, Risch NJ (1996) The genetic attributable risk of breast and ovarian cancer. Cancer 77, 2318-2324. Colditz GA, Willett WC, Hunter DJ, Stampfer MJ, Manson JE, Hennekens CH, Rosner BA (1993) Family history and the risk of breast cancer. JAMA, 270, 338-343. Couch FJ, DeShano ML, Blackwood MA, Calzone K, Stopfer J, Campeau L, Ganguly A, Rebbeck T, Weber BL (1997) BRCA1 mutations in women attending clinics that evaluate the risk of breast cancer. N Engl J Med 336, 1409-1415. Cuzick J, Forbes J, Edwards R, Baum M, Cawthorn S, Coates A, Hamed A, Howell A, Powles T; IBIS investigators (2002) First results from the international breast cancer intervention study (IBIS-I). Lancet 360, 817-824. Easton DF, Ford D, Bishop T (1995) Breast and ovarian cancer incidence in BRCA1-mutation carriers. Breast Cancer Linkage Consortium. Am J Hum Gen 56, 265-271. Eisinger F, Bressac B, Castaigne D, Cottu PH, Lansac J, Lefranc JP, Lesur A, Nogues C, Pierret J, Puy-Pernias S, Sobol H, Tardivon A, Tristant H, Villet R (2004) Identification and management of hereditary predisposition to cancer of the breast and the ovary. Bull Cancer 91, 219-237. Fisher B, Costantino JP, Wickerham DL, Redmond CK, Kavanah M, Cronin WM, Vogel V, Robidoux A, Dimitrov N, Atkins J, Daly M, Wieand S, Tan-Chiu E, Ford L, Wolmark N (1998) Tamoxifen for prevention of breast cancer: report of the National Surgical Adjuvant Breast and Bowel project P-1 study. J Natl Cancer Inst 90, 1371-1388. Hall JM, Lee MK, Newman B, Morrow JE, Anderson LA, Huey B, King MC (1990) Linkage of early breast cancer to chromosome 17q21. Science 250, 1684-1689. Kauff ND, Satagopan JM, Robson ME, Scheuer L, Hensley M, Hudis CA, Ellis NA, Boyd J, Borgen PI, Barakat RR, Norton L, Castiel M, Nafa K, Offit K (2002) Risk-reducing salpingooophorectomy in women with a BRCA1 or BRCA2 mutation. N Engl J Med 346, 1609-1615. Malone KE, Daling JR, Neal C, Suter NM, O'Brien C, CushingHaugen K, Jonasdottir TJ, Thompson JD, Ostrander EA (2000) Frequency of BRCA1/A2 mutations in a populationbased sample of young breast carcinoma cases. Cancer 88, 1393-1402. Meijers-Heijboer H, van Geel B, van Putten WL, HenzenLogmans SC, Seynaeve C, Menke-Pluymers MB, Bartels CC, Verhoog LC, van den Ouweland AM, Niermeijer MF, Brekelmans CT, Klijn JG (2001) Breast cancer after

invasive breast cancer incidence was found with tamoxifen. The later published data from IBIS-I trial also demonstrates the reduction of breast cancer risk by 32% in tamoxifen group (Cuzick et al, 2002). Small studies performed with BRCA1 mutation carriers with breast cancer, however, provide preliminary data suggesting that tamoxifen may still play a role in risk reduction in this group, but further studies are needed.

B. Surgical approach The option of prophylactic mastectomy (PM) should be discussed with women with an inherited susceptibility to breast cancer. Two studies with different lengths of follow up demonstrated that PM substantially reduces the risk of breast cancer in mutation carriers. It will be important to continue to follow carriers longer to determine if any of them develop breast cancer later (Meijers-Heijboer 2001; Scheuer et al, 2002). It is important to note that occult cancers have been detected at the time of proplylactic surgery, so careful pathological analysis of the tissue is important. In general, the current evidence suggests that PM reduces the risk of breast cancer by more than 90% among women with BRCA1 and BRCA2 mutation (Schrag et al, 1997). Two studies support that prophylactic oophorectomy (PO) reduce the risk of breast cancer in both BRCA1 and A2 mutation carriers. In particular, findings from a study by Rebbeck et al, (2002) reveals that PO reduced the risk of breast cancer by more than 50%. A prospective study by Kauff et al, showed a trend for risk reduction for breast cancer and a statistically significant decreased risk for the combined endpoints of breast and ovarian cancers (Rebbeck et al, 1999; Kauft ND 2002). Although prophylactic surgery is at present, the most effective means of reducing risk, this may not be the preferred option for some women. PO will induce surgical menopause in premenopausal women, if not appropriately managed can interfere significantly with a womanâ&#x20AC;&#x2122;s quality of life. The decision to proceed with PM involves multiple consideration. However, the surgery is extensive and requires many weeks for recuperation. Moreover, body image can be markedly affected. Patients who are likely to carry mutations must be able to weigh the benefits, risks and limitations of BRCA1 and BRCA2 testing before deciding to proceed. The benefits must be balanced against a number of important limitations of testing. These include the possibility of finding a mutation of uncertain significance or missing a mutation because of limited test sensitivity.

References Begg CB (2002) On the use of familial aggregation in population-based case probands for calculating penetrance. J Natl Cancer Inst 94, 1221-1226. Berry DA, Iversen ES Jr, Gudbjartsson DF, Hiller EH, Garber JE, Peshkin BN, Lerman C, Watson P, Lynch HT, Hilsenbeck SG, Rubinstein WS, Hughes KS, Parmigiani G

Gene Therapy and Molecular Biology Vol 10, page 99 prophylactic bilateral mastectomy in women with a BRCA1 or BRCA2 mutation. N Engl J Med 345, 159-164. Narod SA, Brunet JS, Ghadirian P, Robson M, Heimdal K, Neuhausen SL, Stoppa-Lyonnet D, Lerman C, Pasini B, de los Rios P, Weber B, Lynch H; Hereditary Breast Cancer Clinical Study Group (2000) Tamoxifen and risk of contralateral breast cancer in BRCA1 and BRCA2 mutation carriers: a case-control study. Lancet 356, 1876-1881. Palma M, Ristori E, Ricevuto E, Giannini G, Gulino A (2006) BRCA1 and BRCA2: The genetic testing and the current management options for mutation carriers. Crit R Oncol Hemat 57, 1-23. Parmigiani G, Berry DA, Aguilar O (1998) Determining carrier probabilities for breast-cancer susceptibility genes BRCAl and BRCA2. Am J Hum Genet 62, 145-158. Pharoah PD, Day NE, Duffy S, Easton DF, Ponder BA (1997) Family history and the risk of breast cancer: A systematic review and meta-analysis. Int J Cancer 71, 800-809. Phillips KA, Andrulis IL, Goodwin PJ (1999) Breast carcinomas arising in carriers of mutations in BRCA1 or BRCA2: are they prognostically different? J Clin Oncol 17, 3653-3663. Rebbeck TR, Levin AM, Eisen A, Snyder C, Watson P, CannonAlbright L, Isaacs C, Olopade O, Garber JE, Godwin AK, Daly MB, Narod SA, Neuhausen SL, Lynch HT, Weber BL (1999) Breast cancer risk after bilateral prophylactic oophorectomy in BRCA1 mutation carriers. J Natl Cancer Inst 91, 1475-1479.

Scheuer L, Kauff N, Robson M, Kelly B, Barakat R, Satagopan J, Ellis N, Hensley M, Boyd J, Borgen P, Norton L, Offit K (2002) Outcome of preventive surgery and screening for breast and ovarian cancer in BRCA mutation carriers. J Clin Oncol 20, 1260-1268. Schrag D, Kuntz KM, Garber JE, Weeks JC (1997) Decision analysis: effects of prophylactic mastectomy and oophorectomy on life expectancy among women with BRCA1 and BRCA2 mutations. N Engl J Med 336, 14651471. Shattuck-Eidens D, Oliphant A, McClure M, McBride C, Gupte J, Rubano T, Pruss D, Tavtigian SV, Teng DH, Adey N, Staebell M, Gumpper K, Lundstrom R, Hulick M, Kelly M, Holmen J, Lingenfelter B, Manley S, Fujimura F, Luce M, Ward B, Cannon-Albright L, Steele L, Offit K, Thomas A, et al (1997) BRCA1 sequence analysis in women at high risk for susceptibility mutations. JAMA, 278, 1242-1250. Warner E, Plewes DB, Shumak RS, et al, (2001) Comparison of breast magnetic resonance imaging, mammography, and ultrasound for surveillance of women at high risk for hereditary breast cancer. J Clin Oncol 19, 3524-3531. Wooster R, Neuhausen SL, Mangion J, Quirk Y, Ford D, Collins N, Nguyen K, Seal S, Tran T, Averill D, et al (1994) Localization of breast cancer susceptibility gene, BRCA2, to chromosome 13q12-13. Science 265, 2088-2090. Wooster R, Weber BL (2003) Breast and ovarian cancer. N Engl J Med 348, 2339-2347.

Christopoulou and Spiliotis: The role of BRCA1 AND BRCA2 in hereditary breast cancer

100

Gene Therapy and Molecular Biology Vol 10, page 101 Gene Ther Mol Biol Vol 10, 101-108, 2006

The analysis of dose response curve comes in useful for the assembly of multi-siRNAs expressing cassettes Research Article

Laura Poliseno1, Monica Evangelista1, Mauro Giacca2 and Giuseppe Rainaldi1,* 1 2

Laboratory of Gene and Molecular Therapy, Institute of Clinical Physiology, CNR, Pisa, Italy; International Center for Genetic Engineering and Biotechnology, Trieste, Italy

__________________________________________________________________________________ *Correspondence: Dr. Giuseppe Rainaldi, Laboratory of Gene and Molecular Therapy, Institute of Clinical Physiology, CNR, Area della Ricerca, Via Moruzzi,1, 56124 Pisa, Italy; FAX: +39 050 3153327; Tel: +39 050 3153108; E-mail: g.rainaldi@ifc.cnr.it Key words: simultaneous gene expression knock-down, competition among siRNAs, multi-shRNA vectors Abbreviations: Dulbeccoâ&#x20AC;&#x2122;s modified Eagleâ&#x20AC;&#x2122;s medium (DMEM); Fetal Bovine serum (FBS); Insulin-like growth factor I receptor (IGFIR); multiple cloning site (MCS); platelet-derived growth factor receptor ! (PDGF-R!); urokinase type plasminogen activator (uPA)

Received: 14 November 2005; Accepted: 8 March 2006; electronically published: March 2006

Summary The construction of vectors that would allow the simultaneous expression of multiple siRNAs targeted against different genes is hampered by the competition between siRNAs. In this work, the simultaneous knock-down of four genes involved in smooth muscle cells activation, migration and proliferation was considered. We used the knockdown of EGFP reporter assay to evaluate the dose response curves of the four shRNA expressing plasmids. We found that each siRNA reached the highest acitivity (as evaluated from the plateau phase) with different kinetics (as evaluated from the KD). Due the specificity of KD, the mono-specific plasmids were tested against their targets by the addiction of saturating amounts of each of the other shRNA-expressing plasmid. In this way, stronger from weaker shRNAs were distinguished and KD seemed to account for it. Moreover, when stronger shRNAs were assembled, the resulting plasmid was able to simultaneously transcribe active shRNAs genes. These results indicate that expression cassettes for different siRNAs having similar KD can be efficiently and rapidly assembled into multi-specific multi-siRNA plasmids. A practical correlate of these observations is that, in order to obtain effective multi-gene knock down, only siRNAs with similar inhibitory kinetics need to be delivered to the cells.

different regions of the same RNA do not always show additive/synergistic effects (Holen et al, 2002; Kawasaki et al, 2003; Hsieh et al, 2004) and that inactive siRNAs decrease the efficiency of active ones (McManus et al, 2002; Wunsche and Sczakiel, 2005). Hence, the construction of vectors that would allow either the expression of shRNA targeted against different regions of the same gene, in order to increase target gene knockdown efficiency, or the simultaneous expression of multiple siRNAs targeted against different genes is highly dependent on the competition between siRNAs. Insulinlike growth factor I receptor (IGF-IR), platelet-derived growth factor receptor ! (PDGF-R!), urokinase type plasminogen activator (uPA) and "v integrin genes are involved in the control of arterial of smooth muscle cell activation, proliferation and migration (Kopp and de

I. Introduction Since the demonstration that synthetic siRNAs can be used to successfully knock-down gene expression, several efforts have been made to prolong their temporally limited activity. For this purpose, different RNA polymerase III-dependent siRNA expression cassettes have been developed and inserted into retroviral, lentiviral and adenoviral vectors (Brummelkamp et al, 2002). In this context, the possibility to construct vectors for the delivery of multiple siRNAs represents a further challenge in RNAi applications (Elbashir et al, 2002; Leirdal and Sioud, 2002; Anderson et al, 2003; Yu et al, 2003; Schuck et al, 2004). One of the concerns that arises when multiple siRNAs are present inside the cells is their possible competition for the RNAi machinery. Indeed, it has been reported that pools of active siRNAs targeted against

101

Poliseno et al: Multi-specific multi-siRNA plasmid construction Martin, 2004). In order to achieve the simultaneous downregulation of these genes as a therapeutic approach for prevention of arterial restenosis, it is crucial to know if active siRNAs targeted against these genes compete or not with to each other. We have already identified active siRNAs against these genes on the basis of functional asymmetry (Schwarz et al, 2003) and internal instability (Khvorova et al, 2003) and proved that they are active against their own targets (Poliseno et al, 2004). The reasons are that the antisense strand is loaded in RISC complex more efficiently if its stability is lower than that of sense strand, while a low stability in the middle of the antisense strand facilitates the mRNA cleavage. However, these parameters seem inadequate to predict also if the selected siRNAs compete to each other, in that we found no clear relationship between them and competition. Titration experiments by using exogenously added siRNAs have already indicated that the efficacy of RNAi results from the equilibrium between the number of target mRNA molecules produced by the transcription

machinery and the number of molecules that are effectively cleaved (Elbashir et al, 2002; Holen et al, 2002). We reasoned that each siRNA challenged against its own target should generate a specific dose-response curve. This was true since we distinguished stronger (higher KD values) from weaker (lower KD values) shRNA. We also demonstrated that shRNA with similar dose-response curves can be assembled in a plasmid to give an effective multi-gene knock-down.

II. Materials and methods

A. shRNA expressing plasmids The position of the siRNAs targeted against porcine genes (I, P, U and A siRNA) is shown in Figure 1A. Plasmids expressing the shRNAs under the control of the H1-RNA promoter (pI, pP, pU, pA pMCSpSUPER plasmids) are depicted in Figure 1B. They were constructed according to the procedure described in the legend of Figure 4 (first-third step).

Figure 1. Activity of shRNA expressing plasmids. (A) Target genes involved in arterial restenosis (Kopp and de Martin, 2004), location of target sequence and siRNA nicknames. (B) Schematic representation of the 300 bp siRNA expression cassettes. pMCSpSUPER plasmids expressing I shRNA (pI), P shRNA (pP), U shRNA (pU) and A sRNA (pA) are depicted. The 600 bp spacer is reported on the right. Arrows indicate the direction of transcription. (C) Schematic representation of the reporter pEGFP-C1 hybrid plasmids used for the EGFP knock-down reporter assay. Indicated fragments of porcine genes were obtained by RT-PCR amplification from porcine coronary smooth muscle cells and cloned downstream of EGFP open reading frame in pEGFP-C1 plasmid. The forward primer contained a stop codon in order to ensure correct translation of the EGFP protein (Poliseno et al, 2004). Dotted box: CMV promoter; light gray box: EGFP ORF; white box: pIGF-IR porcine gene fragment; dashed box: pPDGF-R ! porcine gene fragment; dark gray box: puPA porcine gene fragment; black box: "# porcine gene fragment.

102

Gene Therapy and Molecular Biology Vol 10, page 103 bands was performed using OptiQuant Acquisition and Analysis software.

B. Reporter genes To assess shRNA activity against their respective targets, we applied an already developed EGFP knock-down reporter assay (Poliseno et al, 2004). Briefly, a fragment of the target gene obtained by RT-PCR amplification from porcine coronary smooth muscle cells was cloned downstream of the EGFP open reading frame in pEGFP-C1 plasmid. The forward primer contained a stop codon in order to ensure translation of wt EGFP protein. Any shRNA targeting the resulting hybrid transcript determines a decrease in cellular fluorescence, which is then quantified by flow cytometry. The hybrid plasmids used as targets in the EGFP knock-down reporter assay are reported in Figure 1C.

III. Results A. Dose response curves of shRNAexpressing plasmids We tested the dose-response effect of different concentrations of the four single-copy shRNA-expressing plasmids against a fixed concentration of their respective targets. We observed that the maximal activity was reached at ~8 pM for all the four plasmids. It corresponded to a 83.9, 89.2, 78.2 and 84.2% decrease of EGFP fluorescence for pI, pP, pU and pA respectively (Figure 2). Of interest, when analyzing the relative efficiencies of the four plasmids at lower concentrations, we observed that KD (the concentration at which 50% of the maximal activity of each plasmid was obtained) was 1.73, 2.19, 2.40 and 6.11 pM for pP, pI, pU and pA respectively (insert of Figure 2). These results highlight that each shRNA reached the highest acitivity (as evaluated from the plateau phase) with different kinetics (as evaluated from KD).

C. Recipient cells and transfection HEK293T human embryonic kidney cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) +10% Fetal Bovine serum (FBS) at 37°C in a humified atmosphere containing 6% CO2. The cells to be transfected were seeded at a density of 6x105 cells/30-mm dish. After 24h, 40 pM hybrid plasmids were cotransfected in HEK293T cells with the indicated amounts of the appropriate shRNA expressing plasmid using Polyfect (Quiagen, Hilden,D) according to manufacturer’s recommendations. At 36 h post transfection, fluorescence was measured by flow cytometry (FACScalibur, Becton Dickinson, San Josè, CA) using 104 cells per sample.

B. Competition between shRNAs

D. Northern blotting

The efficacy of the mono-specific plasmids against their targets in the presence of saturating amounts of all the other siRNA-expressing plasmids is shown in Figure 3. The activity of pI against pIGF-IR reporter gene was reduced by 19% by pP, by 23% by pU and by 24% by pA. The activity of pP against its pPDGF-R! reporter gene was almost unaffected by the co-transfection of any of the

The pI, pP and pIP plasmids (40 pM) were transfected into HEK293T cells, as reported above. After 3 days, total RNA was extracted an analyzed by Northern blotting according to an established procedure (Czauderna et al, 2003). [32P]-5'-endlabelled ssDNA oligonucleotides probes were used to detect hairpin I siRNA (5’-tctcttgaaggaaatgacagttctctcc-3’), and P siRNA (5’-tctcttgaagtcgcagatcttgaccagc-3’). Cellular tRNA Val (5'-gaacgtgataaccactacactacggaaac-3') was used as a control. After PhosphoImager scanning, quantification of the radioactive

Figure 2. Dose response curves. 40pM hybrid plasmids were cotransfected in HEK293T cells with the indicated amounts of pI (!,-), pP (!,!!!), pU (",-) and pA (#,--) plasmids. The mean ± SD of at least 3 independent experiments is reported. The 1 to 8pM concentration range is expanded in the inserted graph.

103

Poliseno et al: Multi-specific multi-siRNA plasmid construction

Figure 3. Effects of competition among the different shRNA-expressing plasmids. Each shRNA expressing plasmid (160 pM) was transfected into HEK293T cells with its EGFP hybrid reporter plasmid (40 pM) and with each of the other shRNA expressing plasmids (160 pM). The intensity of cellular EGFP fluorescence was measured at 36 h after transfection. The results are expressed in percentage relative to the fluorescence of cells transfected with the each of the reporter-effector pair together with empty pMCSpSUPER plasmid.

other siRNA plasmids. Most notably, however, the activity of pU (puPA reporter gene) was reduced by 54% and that of pA (p"# reporter gene) was virtually abolished by the simultaneous expression of pI or pP. Taken all the combinations of Figure 3, the results clearly indicate that “stronger” siRNAs (pP and pI) work at the detriment of “weaker” ones (pU and pA).

C. Construction and bispecific shRNAs vector

validation

the 2-copy plasmid were as effective as those from the one-copy plasmids to knock-down EGFP expression (Figure 5C).

IV. Discussion Short interfering RNAs are successfully employed to knock-down gene expression for both functional genomics and therapeutic purposes. The possibility to construct vectors for the expression of siRNAs targeted against more than one gene would be a further challenge in RNAi applications. All the isoforms of the same gene or a cluster of genes involved in the same pathway could be knockeddown at once, with a conceivable increase in efficiency, especially in the study of complex signal transduction cascades and in the therapy of multifactorial diseases. This implies that to construct a multi-shRNA expression plasmid, the knowledge whether the selected siRNAs compete or not to each other is crucial. In this work, we considered four genes the simultaneous downregulation of which would be beneficial for the prevention of restenosis. Using the knock-down of the EGFP reporter gene, we determined dose response curves of shRNA expressing plasmids against their own target genes. From each curve we derived the maximal activity and KD. By ordering activity values (P>A>I>U) and KD values (P>I>U>A), it came out that the two ranks are not coincident, indicating that KD accounts for some other characteristic of siRNAs.

As the order of KD values correlates with the hyerarchy established by the competition experiments, we assembled pP and pI with the expectation that transcripts of the bi-specific pIP plasmid should be still active in achieving optimal gene knock-down of target mRNA. Hence, we started out by adapting the cassette multimerization procedure of Robinett (Robinett et al, 1996) to the construction of the bi-specific plasmid pIP (Figure 5A), which derives from the assembly of pI and pP. The procedure is described in the legend of Figure 4. To demonstrate that the bi-specific plasmid is able to simultaneously deliver transcriptionally active shRNAs genes, we measured the expression of shRNAs and their efficiency to knock-down the reporter gene when expressed from both the single-copy and the multi-copy plasmid. We observed that the P shRNA and the I shRNA were transcribed from the 1-copy and the 2-copy plasmids at comparable level (Figure 5B) and that trascripts from

104

Gene Therapy and Molecular Biology Vol 10, page 105 Interestingly, the rank established by the competition experiments (P>I>U>A) well correlated with that of KD values (P>I>U>A), so that stronger shRNAs were those with lower KD (pP = 1.73pM and pI =2.19 pM), whereas weaker siRNAs were those with higher KD (pU = 2.40pM and pA = 6.11pM). All together these findings indicate that shRNA with very close KD values can be used for the

simultaneous expression inside cells. Indeed, when we assembled pP and pI to construct the bi-specific plasmid pPI, it resulted that both cassettes were transcribed and that the transcripts were comparably active. This indicates the feasibility of the multi-copy shRNA cassette delivery approach and its efficacy in achieving optimal knockdown efficiency.

Figure 4. Construction of a multishRNA expressing plasmid. Schematic representation of the strategy used to construct the bispecific pIP plasmid. First Step: Cloning of the pSUPER expression cassette (Brummelkamp et al, 2002) into the pMCS’3 plasmid using Eco RI and Sal I restriction sites, to obtain pMCSpSUPER plasmid. pMCS’3 contains a multiple cloning site (MCS) flanked by Not I restriction sites in the pCMV-MCS backbone (Stratagene). Second Step: Cloning of the 600 bp spacer. An irrelevant 600 bp DNA PCR product, containing restriction sites for Sal I at one end and for Xho I and Bam HI at the other end, was cloned into pMCSpSUPER using the Sal I and Bam HI restriction sites. Sal I and Xho I restriction products are compatible for ligation and reconstitute a site that cannot be re-cut by either enzyme. As a consequence, both Sal I and Xho I are maintained as unique sites within the spaced pMCSpSUPER plasmid. Third Step: Cloning of the hairpin I siRNA and P siRNA sequence into the pSUPER cassette of spaced pMCSpSUPER, to obtain pI and pP, respectively. Fourth Step: The pP cassette was extracted using the Sal I and Bam HI restriction sites and cloned into the pI plasmid by using the Xho I and Bam HI restriction sites. The fourth step can be repeated, each time leading to the duplication of the number of the shRNA cassettes contained within the pMCS’3 plasmid. For all cloning steps, the recA - E. coli strain Stbl2 was used. By using the Not I restriction sites in the MCS, an insert containing all the shRNA cassettes can be easily extracted and cloned into any other suitable vector for in vivo transduction. White box: 300 bp pSUPER expression cassette; dark gray box: hairpin I siRNA sequence; light gray box: hairpin P siRNA sequence; dashed box: 600 bp spacer.

105

Poliseno et al: Multi-specific multi-siRNA plasmid construction

Figure 5. Multi-specific multi-shRNA plasmid transcription and activity. (A) Schematic representation of the bi-specific pIP plasmid. Arrows indicate the direction of transcription. (B) Northern blot of hairpin I and P siRNA transcripts. HEK293T cells were transfected with 450 pM of the mono-specific pI and pP and the bi-specific pIP plasmid. After three days, total RNA was extracted and analyzed by northern blotting. A representative experiment of three is reported. (C) 40pM hybrid pIGF-IR (upper part) or pPDGF-R ! (lower part) reporter plasmid were cotransfected into HEK293T cells with their respective mono-specific shRNA plasmid or with the bispecific pIP shRNA plasmid (160 pM). Cellular fluorescence was evaluated 36 h after transfection. The values are the mean Âą SD of three independent experiments and represent the reduction in fluorescence expressed in percentage relative to the cells transfected with the mono-specific shRNA expressing plasmid.

In conclusion, this work demonstrates that KD accounts for the competition between siRNAs and that expression cassettes for different shRNAs can be efficiently and rapidly assembled into a multi-specific multi-shRNA plasmids. A practical correlate of these observations is that, in order to obtain effective multi-gene knock-down, only siRNAs with similar inhibitory kinetic need to be delivered into cells. The goal of selecting such siRNAs can be easily met by the systematic analysis of their dose-response curves.

References Anderson J, Banerjea A, Akkina R (2003) Bispecific short hairpin siRNA constructs targeted to CD4, CXCR4, and CCR5 confer HIV-1 resistance. Oligonucleotides 13, 303312. Brummelkamp TR, Bernards R, Agami R (2002) Stable suppression of tumorigenicity by virus-mediated RNA interference. Cancer Cell 2, 243-247. Czauderna F, Fechtner M, Aygun H, Arnold W, Klippel A, Giese K, Kaufmann J (2003) Functional studies of the PI(3)-kinase signalling pathway employing synthetic and expressed siRNA. Nucleic Acids Res 31, 670-682.

106

Gene Therapy and Molecular Biology Vol 10, page 107 Elbashir SM, Harborth J, Weber K, Tuschl T (2002) Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods 26, 199-213. Holen T, Amarzguioui M, Wiiger MT, Babaie E, Prydz H (2002) Positional effects of short interfering RNAs targeting the human coagulation trigger Tissue Factor. Nucleic Acids Res 30, 1757-1766. Hsieh AC, Bo R, Manola J, Vazquez F, Bare O, Khvorova A, Scaringe S, Sellers WR (2004) A library of siRNA duplexes targeting the phosphoinositide 3-kinase pathway: determinants of gene silencing for use in cell-based screens. Nucleic Acids Res 32, 893-901. Kawasaki H, Suyama E, Iyo M, Taira K (2003) siRNAs generated by recombinant human Dicer induce specific and significant but target site-independent gene silencing in human cells. Nucleic Acids Res 31, 981-987. Khvorova A, Reynolds A, Jayasena SD (2003) Functional siRNAs and miRNAs exhibit strand bias.Cell 115, 209-216. Kopp CW, de Martin R (2004) Gene therapy approaches for the prevention of restenosis. Curr Vasc Pharmacol 2, 183-189. Leirdal M, Sioud M (2002) Gene silencing in mammalian cells by preformed small RNA duplexes. Biochem Biophys Res Commun 295, 744-748. McManus MT, Haines BB, Dillon CP, Whitehurst CE, van Parijs L, Chen J, Sharp PA (2002) Small interfering RNA-mediated

gene silencing in T lymphocytes. J Immunol 169, 57545760. Poliseno L, Evangelista M, Mercatanti A, Mariani L, Citti L, Rainaldi G (2004) The energy profiling of short interfering RNAs is highly predictive of their activity. Oligonucleotides 14, 227-232. Robinett CC, Straight A, Li G, Willhelm C, Sudlow G, Murray A, Belmont AS (1996) In vivo localization of DNA sequences and visualization of large-scale chromatin organization using lac operator/repressor recognition. J Cell Biol 135, 1685-1700. Schuck S, Manninen A, Honsho M, Fullekrug J, Simons K (2004) Generation of single and double knockdowns in polarized epithelial cells by retrovirus-mediated RNA interference. Proc Natl Acad Sci U S A 101, 4912-4917. Schwarz DS, Hutvagner G, Du T, Xu Z, Aronin N, Zamore PD (2003) Asymmetry in the assembly of the RNAi enzyme complex. Cell 115, 199-208. Wunsche W, Sczakiel G (2005) The activity of siRNA in mammalian cells is related to the kinetics of siRNA-target recognition in vitro: mechanistic implications. J Mol Biol 345, 203-209. Yu JY, Taylor J, DeRuiter SL, Vojtek AB, Turner DL (2003) Simultaneous inhibition of GSK3" and GSK3! using hairpin siRNA expression vectors. Mol Ther 7, 228-236.

107

Poliseno et al: Multi-specific multi-siRNA plasmid construction

108

Gene Therapy and Molecular Biology Vol 10, page 113 Gene Ther Mol Biol Vol 10, 113-122, 2006

Using N-(2-hydroxypropyl) methacrylamide copolymer drug bioconjugate as a novel approach to deliver a Bcl-2-targeting compound HA14-1 in vivo Research Article

Matthew Oman1, Jihua Liu1, Jun Chen1, David Durrant1, Hung-Sheng Yang1, Yongwen He1, Pavla Kopecková2, Jindrich Kopecek2 and Ray M. Lee1,* 1 2

Huntsman Cancer Institute, Department of Pharmaceutics and Pharmaceutical Chemistry, University of Utah, Salt Lake City, UT 84112

__________________________________________________________________________________ *Correspondence: Ray M. Lee, Huntsman Cancer Institute at the University of Utah, Salt Lake City, Utah 84112, USA Current address: Massey Cancer Center, Virginia Commonwealth University, 1101 E. Marshall St. P.O. Box 980230, Richmond, VA 23298; E mail: rlee5@vcu.edu Key words: apoptosis, HPMA copolymer bioconjugate, HA14-1, xenograft Abbreviations: ethyl 2-amino-6-bromo-4-(1-cyano-2-ethoxyl-2-oxoethyl)-4H-chromene-3-carboxylate, (HA14-1); N-(2hydroxypropyl)methacrylamide, (HPMA); Fluorescein-5- isothiocyanate, (FITC) Received: 1 July 2005; Accepted: 31 January 2006; electronically published: March 2006

Summary Bcl-2 plays a critical role in regulation of apoptosis and tumor pathogenesis; thus it’s a good therapeutic target for cancer. Small compounds blocking Bcl-2 have been identified but their efficacy in vivo has hardly been demonstrated. We developed water-soluble N-(2-hydroxypropyl)methacrylamide (HPMA) copolymers containing a Bcl-2 targeting compound HA14-1. Their efficacy was confirmed in cell lines, and tested in a tumor xenograft model. Intraperitoneal injected copolymer HA14-1 bioconjugates suppressed tumor growth by 50%. Using FITC as a marker to trace biodistribution, we demonstrated that the concentration of the copolymer was sufficient to induce apoptosis. This was confirmed by the presence of activated caspase 9 in tumor treated with the copolymer HA14-1 bioconjugate, but not in normal organs or tumor treated with a control polymer. No toxicity was observed in liver and kidney, where copolymers are excreted. The HPMA copolymer is thus a promising strategy for in vivo delivery of Bcl-2-targeting compounds to solve their poor solubility problem and to enhance tumor selectivity.

(Degterev et al, 2001; Tzung et al, 2001; Chan et al, 2003; Kitada et al, 2003; Zhang et al, 2003). They induce apoptosis in many cell lines with IC50 mostly in µM range (Wang et al, 2000; Chen et al, 2002; An et al, 2004). The most potent Bcl-2 inhibitor currently is ABT-737, which is two to three orders of magnitude more potent than other Bcl-2 inhibitors (Oltersdorf et al, 2005). Many potential strategies of using Bcl-2 inhibitors have been developed using HA14-1. Synergistic effects have been shown between HA14-1 and many other compounds, including chemotherapeutic agent cytarabine (Lickliter et al, 2003), proteasome inhibitor bortezomib (Pei et al, 2003), TRAIL, (Hao et al, 2004), MEK inhibitor PD184352 (Milella et al, 2002), and peripheral benzodiazepine receptor inhibitor PK11195 (Chen et al, 2002). Similar to other Bcl-2 inhibitors, the most potent agent, ABT-737, is not active

I. Introduction Overexpression of Bcl-2 family apoptotic inhibitors contributes to tumor pathogenesis and drug resistance (Cory and Adams, 2002; Cory et al, 2003; Gross et al, 1999). Bcl-2 is a good therapeutic target for the development of novel cancer therapy (O'Neill and Hockenbery, 2003). One way to down-regulate Bcl-2 is by an antisense oligonucleotide that is currently in clinical trials (Pepper et al, 2001). Another approach is to develop small molecular compounds fitting into a hydrophobic pocket of Bcl-2 that interacts with the BH3 domain of pro-apoptotic members of the Bcl-2 family (Muchmore et al, 1996; Aritomi et al, 1997). Based on a structure-based molecular screen, HA14-1 was first identified (Wang et al, 2000). Subsequently, several other compounds were also found to bind and inhibit Bcl-2, including antimycin, BH3Is, gossypol, chelerythrine and polyphenols

113

Oman et al: HPMA copolymer as a novel approach to deliver a Bcl-2-targeting Calbiochem (San Diego, CA). FITC was from Molecular Probes (Eugene, OR). TUNEL assay kits were from Roche (Penberg, Germany). MTT assays were from Chemicon International Corp. (Temecula, CA). Antibodies against activated caspases 9 were from Cell Signaling Technology Inc. (Cambridge, MA).

in inducing cell death by itself, but synergizes chemotherapeutic agents (Oltersdorf et al, 2005). Before developing small molecule Bcl-2 inhibitors into a clinically useful drug, there are three major hurdles that need to be solved. One is its poor water solubility that makes drug formulation difficult. This is likely a universal problem for all Bcl-2 inhibitors because they fit into the hydrophobic pocket of Bcl-2. The second is lacking tumor selectivity, and the third is its low potency, but now overcome by the availability of ABT-737. These three problems could be solved by conjugating Bcl-2 inhibitor such as HA14-1 to HPMA copolymers. Macromolecular therapeutics derived from HPMA copolymer-drug bioconjugates are novel approaches to deliver chemotherapeutic agents into tumors (Jensen et al, 2001, 2002; Kasuya et al, 2001; Kopecek et al, 2001; Lu et al, 2002; Luo et al, 2002; Peterson et al, 2003). HPMA copolymer drug bioconjugates are internalized by endocytosis and remain in endosomes/lysosomes (Kopecek et al, 2001). Depending on the linkage to the side chains of biopolymers, conjugated drugs can be either non-cleavable or cleavable in lysosomes. If cleavable, the compound attached to the side chain termini can be cleaved by a protease and released from lysosomes to other organelles (Jensen et al, 2001). Doxorubicin, geldanamycin, mesochlorin e6, antisense oligonucleotides, and anti-angiogenic compound TNP-470 have been delivered into tumor cells successfully using HPMA copolymer drug bioconjugates (Kasuya et al, 2001; Jensen et al, 2002; Lackner et al, 2003; Nishiyama et al, 2003; Peterson et al, 2003; Satchi-Fainaro et al, 2004). In mouse tumor models, the HPMA copolymer doxorubicin bioconjugate was more effective than free doxorubicin in an ovarian cancer xenograft that expressed a multiple drug resistance (MDR) gene (Minko et al, 2000). The copolymer-drug bioconjugate also has an advantage of preferential accumulation in solid tumors, known as the enhanced permeability and retention (EPR) effect (Langer, 1998; Moses et al, 2003). Based on these favorable characteristics, we developed HPMA copolymer HA14-1 bioconjugates which potentially move HA14-1 or other insoluble Bcl-2-targeting compounds closer to clinical application.

B. Synthesis and characterization of HPMA copolymer bound HA14-1 The bioconjugates were prepared via a two-step procedure. First, polymer precursors (Kopecek et al, 2001; Lu et al, 2002)were prepared by radical precipitation copolymerization of comonomers: (a) HPMA, (b) N-methacryloylglycylglycine pnitrophenyl ester (non-degradable spacer) or Nmethacryloylglycylphenylalanylleucylglycine p-nitrophenyl ester (degradable spacer), and optionally (c) methacryloylated FITC (3-methacryloylaminopropyl thioureidyl fluorescein). The molar ratio of monomer units in the polymerization mixture were 94: 5: 1. The polymer precursors were characterized by size exclusion chromatography (to determine the molecular weight), the content of p-nitrophenyl ester (ONp) groups and FITC moieties. In the second step, the HA14-1 was bound to the polymer precursors by aminolysis of p-nitrophenyl ester groups at polymer side-chain termini by amine group of HA14-1. Example of binding procedure: 100 mg (0.030 mmol ONp groups) of polymer precursor (copolymer of HPMA and Nmethacryloylglycylphenylalanylleucylglycine p-nitrophenyl ester) was dissolved in 0.75 ml dimethylsulfoxide and 18 mg HA14-1 (0.045 mmol) was added while stirring. After dissolution the dimethylaminopyridine catalyst (8 mg, 0.03 mmol) was added and the reaction mixture was stirred 4 h at room temperature. The polymer was precipitated into acetone: diethylether (3:1) mixture, filtered off, washed, and dried. The conjugate was purified by 24 h dialysis at 4 oC, first in ethanol/H2O, and then in H2O, using dialyzing tubing with 6-8 kDa cut off. The yield after dialysis was 70 mg. The content of HA14-1 was determined by UV spectroscopy using the extinction coefficient ! 9300 M-1cm -1 in MeOH, "max 273 nm. The composition of copolymers is shown in Table 1.

C. Mouse xenograft model Nude mice (BALB/cAnNCr-nu/nu, NCI Developmental Therapeutics Program) were injected with 5 x 106 A2780 cells at both flanks subcutaneously on day 1. Tumors became visible after 13 days. Intraperitoneal injection of the copolymer-drug bioconjugates or normal saline was performed twice a week for five doses. Paclitaxel and free HA14-1 was dissolved in DMSO before injection. The largest diameter of the tumor was measured in three dimensions, twice a week, before each injection. The size of the tumor was calculated by the formula V = (4/3) x # x R1 x R2 x R 3, where R 1, R2, R3 are the largest radii of the tumor in three dimensions.

II. Materials and methods A. Materials A2780 cells were grown in the RPMI supplemented with 10% fetal bovine serum, penicillin-streptomycin-glutamine and insulin (10 Âľg/ml) (Life Technology Inc.). HA14-1 was from

Table 1. Characterization of HA14-1 conjugates Conjugate # 1 2 3

Oligopeptide spacer -GlyGly-GlyPheLeuGlyN/A

HA14-1 wt%a 10.1 8.7 -

FITC wt% b 1.3 1.0

spectrophotometric determination using extinction coefficient ! = 9300 M-1 cm -1 (ethanol) spectrophotometric determination using extinction coefficient ! = 78000 M-1 cm-1 (borate buffer pH 9.1) c SEC, Superose 6 HR10/30 column, buffer 30% acetonitrile in PBS; calibration by polyHPMA fractions. b

114

Mw c, kDa 25 28 25

Gene Therapy and Molecular Biology Vol 10, page 115 HL60 cells and required a concentration up to 50 µM to achieve significant apoptosis (Figure 2). Because the noncleavable copolymer did not show any activity in cell lines, we focused on the cleavable HPMA copolymer HA14-1 conjugate to test their efficacy by mouse xenograft model in vivo.

D. Analysis of the biodistribution of the copolymer drug bioconjugate All major organs and tumors were dissected, cut into small pieces and dounced with loose and tight pistons 10 times in a buffer containing 50 mM Tris (pH7.4), 100 mM NaCl, 1 mM EDTA, 1% Triton X-100, and 1 mM PMSF. The homogenates (100 µl) were transferred to a 96-well plate and the fluorescence of FITC was determined using a microplate reader (Bio-Tek Instrument Inc., Winooski, VT), and converted to fmole using a standard curve established by the cleavable copolymer. Protein concentrations of the homogenates were determined by the BioRad protein assay.

B. Biodistribution of the cleavable HPMA copolymer HA14-1 bioconjugate We then studied the biodistribution of the HPMA copolymer HA14-1 bioconjugate using mice with established subcutaneous tumors. After being injected intraperitoneally with the bioconjugate, the mice were sacrificed at 6, 24, 48, 72 and 168 hours. The fluorescence of FITC was quantified and compared with a standard curve established by the cleavable HA14-1 bioconjugate. Because the cleavable copolymer bioconjugate contains both FITC and HA14-1, we measured the fluorescence activity of FITC, converted to fmole per mg of protein extracted from the organ. This information represented the accumulation of the copolymer in normal tissues and tumors. The concentration (fmole/mg) was highest in the kidney and liver, likely related with the metabolism or excretion of the copolymer in these two organs. The spleen and bowel also contained high concentrations, which was apparently due to intraperitoneal injection. Tumor contained a level comparable to the spleen and bowel, but much higher than organs outside of the peritoneal cavity, such as lung, heart and brain (Figure 3a). We also calculated the total amount of FITC in normal organs and tumors by multiplying the concentration of FITC with the total amount of protein. The liver and kidney contained the most FITC, whereas tumor had a level comparable to bowel. Other organs contained very little FITC (Figure 3b), supporting the preferential accumulation of the copolymer in tumor. To determine whether the concentration of the copolymer in tumor was sufficient to induce apoptosis, we treated A2780 cells with 50-150 µM of the cleavable bioconjugate in vitro and analyzed the concentration of FITC (right panel, Figure 3c). The concentration of FITC in tumor was comparable to that detected in vitro at 100 µM (left panel, Figure 3c), which induced about 11% of apoptosis by TUNEL assays (Figure 2).

E. Histological examination and TUNEL staining Pieces of normal organs and tumors were fixed in formalin and processed by the Department of Pathology at the University of Utah Hospital for regular sections and H & E staining. Unstained sections were also analyzed by TUNEL staining according to the manufacturer’s protocol.

III. Results A. Induction of apoptosis by the copolymer HA14-1 bioconjugate in cell lines Two HPMA copolymer HA14-1 bioconjugates were designed to evaluate the requirement of lysosomal cleavage. One is non-cleavable in the lysosomes with a Gly-Gly linker, and the other is cleavable due to the presence of a Gly-Phe-Leu-Gly linker (Figure 1a). The linkage of HA14-1 to the copolymer is stable in the blood stream; thus the release of HA14-1 only happens intracellularly. The cleavable conjugate also contains FITC (Figure 1a) to trace its biodistribution. A third polymer with FITC was used as a control copolymer. We tested the copolymer HA14-1 bioconjugates with HL60 leukemia cells and found that the cleavable bioconjugate was more effective than the non-cleavable (Figure 1b). The non-cleavable bioconjugate required up to 150 µM to achieve killing; whereas 50-100 µM of the cleavable bioconjugate was sufficient (Figure 1c). Monomeric HA14-1 had a dose-dependent apoptotic effect as described (Chen et al, 2002). TUNEL assays also confirmed that cell death was due to apoptosis (Figure 1c). Although the HPMA copolymer appeared to require a higher concentration, we did not consider that a problem due to significantly advantage of the HPMA copolymer HA14-1 conjugate due to the advantages of copolymers, including water solubility, the route of uptake through endocytosis, and the preferential accumulation in tumor (Langer, 1998; Moses et al, 2003). The high effective concentration and the failure of releasing free HA14-1 in blood are two safety features and advantages of the copolymer to avoid toxicity. Studies with A2780 ovarian cancer cells showed a similar result in that the non-cleavable copolymer was less effective than the cleavable form (Figure 2). When cells were treated with 50, 100 and 150 µM of the cleavable copolymer HA14-1 bioconjugate for 24 hours, the percentages of apoptotic cells, determined by TUNEL assays, were 6.44%, 11.43%, and 19.35%, respectively. A2780 cells were more resistant to free HA14-1 than

C. Testing copolymer HA14-1 bioconjugates in a mouse xenograft model We then used the same mouse xenograft model to test the efficacy in vivo. Tumors become visible after 13 days, and mice were injected intraperitoneally with normal saline (group 1), FITC-only copolymer (group 2), cleavable HA14-1 copolymer (group 3) and free HA14-1 in DMSO (group 4) at days 13, 17, 20, 23 and 27. Mice treated with paclitaxel in DMSO at 10 mg/kg were used as positive controls (group 5). The amount of copolymer HA14-1 bioconjugates injected in Group 3 was equivalent to 5 mg/kg of free HA14-1 (group 4). The amount of bioconjugates in Groups 2 and 3 were equal in FITC to ensure that the accumulation of FITC did not contribute to the decrease of tumor size. After 5 injections, we observed

115

Oman et al: HPMA copolymer as a novel approach to deliver a Bcl-2-targeting

Figure 1. (a) Structures of HPMA copolymer HA14-1 bioconjugates. (b) Induction of apoptosis by free HA14-1 and copolymer HA14-1 bioconjugates. HL60 cells were treated with DMSO (control), 25 µM HA14-1, 100 µM non-cleavable bioconjugate, or 100 µM cleavable bioconjugate. Cells were counted on day 0, 1, 2, and 4. (c) TUNEL assays of HL60 cells after incubation with drugs for 24 hours. In the left panel, cells were treated with the non-cleavable conjugate at 0, 50, 100, and 150 µM. In the middle panel, cells were treated with the cleavable bioconjugate at 0, 50, 100 µM, and dose-dependent apoptosis was observed. In the right panel, cells were treated with free HA14-1 at 0, 10, 25, and 50 µM before the TUNEL assays.

116

Gene Therapy and Molecular Biology Vol 10, page 117

Figure 2. Induction of apoptosis in A2780 cells. A2780 cells were treated with PBS or DMSO controls, non-cleavable or cleavable HA14-1 copolymer bioconjugates, or free HA14-1 at different concentrations for 24 hours. Cells were analyzed with TUNEL assays to determine the percentage of apoptosis. The TUNEL positive cells were gated and the percentages of TUNEL positive cells are indicated.

a statistical difference between groups 1/2 and 3, and the mice did not show any sign of stress or toxicity in their average weight and behavior (Figure 4a). Mice in group 3 that were injected with cleavable copolymer HA14-1 bioconjugates had smaller tumors than those injected with the copolymer containing FITC alone. At day 27, the average volume of tumors in the normal saline or FITC copolymer groups was twice the size compared with the cleavable copolymer HA14-1 bioconjugates. However, despite the growth of the tumor was suppressed compared with the control group, the size of tumor still steadily increased even with the injection of HA14-1-containing bioconjugates (Figure 4a). The average sizes of tumor in groups 4 and 5 were smaller than those in groups 1, 2, and 3, but only group 5 treated with paclitaxel achieved statistical significance compared with group 3 (Figure 4a).

D. Histological sections of liver, kidney and intestine failed to show any sign of toxicity The biodistribution study revealed higher levels of FITC present in the liver, kidney, and bowel, raising a concern about toxicity in these three organs. We examined their histological sections to search for any sign of drug toxicity. H & E staining revealed that they are completely normal (Figure 5), indicating that the copolymer induces minimal toxicity. Sections of tumor showed high proliferation by multiple mitotic figures, consistent with the continuous growth shown in Figure 4. Examination of the unstained sections revealed that the fluorescence of FITC was diffusely present in tumor (Figure 5), intestine and kidney (not shown). Interestingly, FITC in liver was not detected in hepatocytes but in sinusoids, most likely Kupffer cells, a type of macrophages that are active in phagocytosis (Figure 5).

117

Oman et al: HPMA copolymer as a novel approach to deliver a Bcl-2-targeting

Figure 3. Biodistribution of the cleavable copolymer HA14-1 bioconjugate. (a) The concentration of FITC (fmole/mg of protein) in each organ and tumor. Mice with established tumors were injected with the cleavable copolymer HA14-1 bioconjugate and sacrificed at 6, 24, 48, 72 and 168 hours (two mice each), and visceral organs were removed and total protein extracted. The fluorescence of FITC was measured by a microplate reader in triplicates, and converted into fmole based on a standard curve established by the cleavable copolymer HA14-1 bioconjugate. The concentrations of FITC per milligram of protein were calculated. (b) The total amount of FITC in each organ and tumor was calculated by multiplying the concentration with the total protein. (c) The concentrations of FITC (fmole/mg) accumulated in tumor (left panel) were compared to those of A2780 cells treated in vitro with the cleavable copolymer HA14-1 bioconjugate (right panel). Treatment in vitro was done with 50, 100, and 150uM for 24 hours before cells were harvested for the determination of the concentration of FITC.

Figure 4. Effect of HPMA copolymer HA14-1 bioconjugates in a mouse xenograft model. (a) BALB/cAnNCr-nu/nu mice were injected with A2780 cells and tumors became visible after 13 days. Copolymers was injected intraperitoneally at days 13, 17, 20, 23, 27 and tumor volumes were measured. Each group were injected with 0.1 c.c. normal saline, the FITC control copolymer, the cleavable HPMA copolymer HA14-1 bioconjugate, free HA14-1 or paclitaxel positive control. (b) Photographs of representative mice treated with the copolymer HA14-1 bioconjugate (top mouse) and the control copolymer (bottom mouse).

118

Gene Therapy and Molecular Biology Vol 10, page 119

Figure 5. H & E staining of liver, kidney, bowel and tumor from mice treated with the HPMA copolymer HA14-1 bioconjugate. The two left lower panels show different distribution of FITC in tumor and liver. No FTIC was seen in the hepatocytes but high activity was in the liver sinusoids.

E. Presence of apoptotic markers in tumors treated with HA14-1-containing polymers but not in normal organs

IV. Discussion Bcl-2 is a good target to develop novel cancer therapies. Targeting Bcl-2 has become potentially feasible by the identification of small molecular compounds that fit into a hydrophobic pocket occupied by the BH3 peptide. However, due to the nature of binding, all small molecular compounds identified so far have poor water solubility. Besides, most pro-apoptotic agents may not have the desired tumor selectivity due to ubiquitous expression of Bcl-2. The new agent ABT-737, although significantly more potent than other Bcl-2 inhibitor, still has the same problem of poor solubility that needs to be solve before its clinical application. We used a commercially available Bcl-2-targeting compound, HA14-1, and proved that Bcl2-targeting compounds can be made water-soluble and thus suitable for intravenous administration. The accumulation of copolymer in tumor may also solved the problem of non-selectivity. The HPMA copolymers, due to their molecular weight, could not diffuse through the plasma membrane. They enter cells through endocytosis and remain in endosomes that eventually fuse with lysosomes. The HPMA copolymers we synthesized to contain two kinds of linkers between HA14-1 and the backbone of the polymer. One (GFLG) is lysosomal cleavable, and the other (GG) is non-cleavable. As expected, the lysosomal cleavable form was more effective than the non-cleavable form, indicating that the release of free HA14-1 is essential for its activity.

To demonstrate apoptosis in tumor after treatment with the copolymer, we analyzed protein extracts from each organ and tumor. Because HA14-1-induced apoptosis is associated with release of cytochrome c to the cytoplasm for activation of the apoptosome complex and caspase 9 (Li et al, 1997), we investigated whether tumor extracts contained activated caspases. Immunoblotting with the antibody specific to activated caspase 9 (37 kD) was positive in tumor samples but not in extracts from normal organs (Figure 6a). This result was consistent with the normal histological sections of liver and kidney shown in the previous section, and it also established tumor killing by the copolymer HA14-1 bioconjugate. We also performed TUNEL assays to demonstrate apoptosis in tumor treated with the copolymer HA14-1 conjugates. The tumor treated with the FITC control copolymer rarely exhibited positive TUNEL cells; whereas tumor treated with the copolymer HA14-1 bioconjugate had more TUNEL positive cells (Figure 6b), confirming that apoptosis was only present in the tumor treated with the copolymer HA14-1 bioconjugate.

119

Oman et al: HPMA copolymer as a novel approach to deliver a Bcl-2-targeting

Figure 6. Induction of apoptosis in tumor but not in normal organs. (a) Activation of caspase 9 in tumors. Mice treated with the HPMA copolymer HA14-1 bioconjugate were sacrificed and all major organs were dissected and harvested for Western blotting. The blot was probed with antibodies against activated caspase 9 (37 kD) or tubulin as a loading control. (b) TUNEL staining of the apoptotic cells in sections from tumors treated with the copolymer HA14-1 bioconjugates (left panel) or the FITC control bioconjugate (right panel). Both pictures were taken at 400 X magnification.

This finding can be explained by the fact that the amino group of HA14-1 used for conjugation fits in the hydrophobic pocket (Wang et al, 2000), and the polymer precludes the incorporation of conjugated-HA14-1 into the pocket. In the mouse xenograft model, tumor growth was suppressed by the HPMA copolymer HA14-1 bioconjugate by about 50%. The appearance of activated caspase 9 suggested that apoptosis occurred in tumor treated with the HA14-1-containing copolymer. However, merely 50% of tumor growth suppression reflects that HA14-1 itself is not very potent to A2780 cells as shown in Figure 2. H & E section of the copolymer-treated tumor revealed a high mitotic index, indicating that cells still proliferate fast despite the 50% growth suppression by the copolymer HA14-1 bioconjugate. This finding provides the rationale to combine the HPMA copolymer HA14-1 bioconjugate with chemotherapeutic agents to enhance the therapeutic efficacy. Combination with other agents synergistic with HA14-1, such as chemotherapeutic drug cytarabine, bortezomib, or other compounds currently in development may help to solve this problem (Chen et al, 2002; Milella et al, 2002; Lickliter et al, 2003; Pei et al, 2003; Hao et al, 2004). We included FITC in the cleavable bioconjugate to analyze the biodistribution of the copolymer and examined the enhanced permeability and retention effect of the copolymer conjugates. The kinetics study revealed that accumulation of FITC in tumor reached a plateau at 6 hours. This study is based on the consensus that the linker

for HA14-1 is not degradable in circulation and that the backbone along with the non-cleavable FITC is retained in cells (Jensen et al, 2001, 2002; Kasuya et al, 2001; Kopecek et al, 2001; Lu et al, 2002; Luo et al, 2002; Peterson et al, 2003). This is very important for copolymer drug delivery because a rapid release of free drug in circulation will certainly cause significant toxicity. Although we detected high concentrations of FITC in liver and kidney, which is likely due to a normal excretion of the copolymer, it was comforting not to detect any evidence of toxicity in these two organs by histological staining and immunoblotting analysis. In conclusion, we have developed a feasible approach to convert a water-insoluble Bcl-2 targeting compound to a soluble copolymer-drug bioconjugate. This strategy eliminates the major hurdles for development of Bcl-2-targeting compounds. Although HA14-1 is not the ideal compound for further clinical development, our proof-of-principle study confirmed that HPMA copolymer drug conjugate is suitable to carry Bcl-2 inhibitors into tumor to induce apoptosis and suppress tumor growth in vivo without inducing toxicity in normal organs. This reagent will allow us to test combination strategies and to address how targeting Bcl-2 may enhance available chemotherapeutic agents in vivo.

Acknowledgements We thank Dr. Joseph Holden for helping the analysis of histological sections, Dr. Wayne Green for the flow cytometry study. This work is supported by the Marsha 120

Gene Therapy and Molecular Biology Vol 10, page 121 Lickliter JD, Wood NJ, Johnson L, McHugh G, Tan J, Wood F, Cox J and Wickham NW (2003) HA14-1 selectively induces apoptosis in Bcl-2-overexpressing leukemia/lymphoma cells and enhances cytarabine-induced cell death. Leukemia 17, 2074-2080. Lu ZR, Shiah JG, Sakuma S, Kopeckova P and Kopecek J (2002) Design of novel bioconjugates for targeted drug delivery. J Control Release 78, 165-173. Luo Y, Bernshaw NJ, Lu ZR, Kopecek J and Prestwich GD (2002) Targeted delivery of doxorubicin by HPMA copolymer-hyaluronan bioconjugates. Pharm Res 19, 396402. Milella M, Estrov Z, Kornblau SM, Carter BZ, Konopleva M, Tari A, Schober WD, Harris D, Leysath CE, Lopez-Berestein G, Huang Z, Andreeff M (2002) Synergistic induction of apoptosis by simultaneous disruption of the Bcl-2 and MEK/MAPK pathways in acute myelogenous leukemia. Blood 99, 3461-3464. Minko T, Kopeckova P and Kopecek J (2000) Efficacy of the chemotherapeutic action of HPMA copolymer-bound doxorubicin in a solid tumor model of ovarian carcinoma. Int J Cancer 86, 108-117. Moses MA, Brem H and Langer R (2003) Advancing the field of drug delivery: taking aim at cancer. Cancer Cell 4, 337-341. Muchmore SW, Sattler M, Liang H, Meadows RP, Harlan JE, Yoon HS, Nettesheim D, Chang BS, Thompson CB, Wong S, Let al (1996) X-ray and NMR structure of human Bcl-xL, an inhibitor of programmed cell death. Nature 381, 335-341. Nishiyama N, Nori A, Malugin A, Kasuya Y, Kopeckova P and Kopecek J (2003) Free and N-(2hydroxypropyl)methacrylamide copolymer-bound geldanamycin derivative induce different stress responses in A2780 human ovarian carcinoma cells. Cancer Res 63, 7876-7882. Oltersdorf T, Elmore SW, Shoemaker AR, Armstrong RC, Augeri DJ, Belli BA, Bruncko M, Deckwerth TL, Dinges J, Hajduk PJ, Joseph MK, Kitada S, Korsmeyer SJ, Kunzer AR, Letai A, Li C, Mitten MJ, Nettesheim DG, Ng S, Nimmer PM, O'Connor JM, Oleksijew A, Petros AM, Reed JC, Shen W, Tahir SK, Thompson CB, Tomaselli KJ, Wang B, Wendt MD, Zhang H, Fesik SW, Rosenberg SH (2005) An inhibitor of Bcl-2 family proteins induces regression of solid tumours. Nature 435, 677-681. O'Neill JW andHockenbery DM (2003) Bcl-2-related proteins as drug targets. Curr Med Chem 10, 1553-1562. Pei XY, Dai Y and Grant S (2003) The proteasome inhibitor bortezomib promotes mitochondrial injury and apoptosis induced by the small molecule Bcl-2 inhibitor HA14-1 in multiple myeloma cells. Leukemia 17, 2036-2045. Pepper C, Hooper K, Thomas A, Hoy T and Bentley P (2001) Bcl-2 antisense oligonucleotides enhance the cytotoxicity of chlorambucil in B-cell chronic lymphocytic leukaemia cells. Leuk Lymphoma 42, 491-498. Peterson CM, Shiah JG, Sun Y, Kopeckova P, Minko T, Straight RC and Kopecek J (2003) HPMA copolymer delivery of chemotherapy and photodynamic therapy in ovarian cancer. Adv Exp Med Biol 519, 101-123. Satchi-Fainaro R, Puder M, Davies JW, Tran HT, Sampson DA, Greene AK, Corfas G and Folkman J (2004) Targeting angiogenesis with a conjugate of HPMA copolymer and TNP-470. Nat Med 10, 255-261. Tzung SP, Kim KM, Basanez G, Giedt CD, Simon J, Zimmerberg J, Zhang KY and Hockenbery DM (2001) Antimycin A mimics a cell-death-inducing Bcl-2 homology domain 3. Nat Cell Biol 3, 183-191. Wang JL, Liu D, Zhang ZJ, Shan S, Han X, Srinivasula SM, Croce CM, Alnemri ES and Huang Z (2000) Structure-based discovery of an organic compound that binds Bcl-2 protein

Rivkin Ovarian Cancer Research Foundation (R.M.L.) and NIH grant support (J.K.).

References An J, Chen Y and Huang Z (2004) Critical upstream signals of cytochrome C release induced by a novel Bcl-2 inhibitor. J Biol Chem 279, 19133-19140. Aritomi M, Kunishima N, Inohara N, Ishibashi Y, Ohta S and Morikawa K (1997) Crystal structure of rat Bcl-xL. Implications for the function of the Bcl-2 protein family. J Biol Chem 272, 27886-27892. Chan SL, Lee MC, Tan KO, Yang LK, Lee AS, Flotow H, Fu NY, Butler MS, Soejarto DD, Buss AD and Yu VC (2003) Identification of chelerythrine as an inhibitor of BclXL function. J Biol Chem 278, 20453-20456. Chen J, Freeman A, Liu J, Dai Q and Lee RM (2002) The apoptotic effect of HA14-1, a Bcl-2-interacting small molecular compound, requires Bax translocation and is enhanced by PK11195. Mol Cancer Ther 1, 961-967. Cory S and Adams JM (2002) The Bcl2 family: regulators of the cellular life-or-death switch. Nat Rev Cancer 2, 647-656. Cory S, Huang DC and Adams JM (2003) The Bcl-2 family: roles in cell survival and oncogenesis. Oncogene 22, 85908607. Degterev A, Lugovskoy A, Cardone M, Mulley B, Wagner G, Mitchison T and Yuan J (2001) Identification of smallmolecule inhibitors of interaction between the BH3 domain and Bcl-xL. Nat Cell Biol 3, 173-182. Gross A, McDonnell JM and Korsmeyer SJ (1999) BCL-2 family members and the mitochondria in apoptosis. Genes Dev 13, 1899-1911. Hao JH, Yu M, Liu FT, Newland AC and Jia L (2004) Bcl-2 inhibitors sensitize tumor necrosis factor-related apoptosisinducing ligand-induced apoptosis by uncoupling of mitochondrial respiration in human leukemic CEM cells. Cancer Res 64, 3607-3616. Jensen KD, Kopeckova P, Bridge JH and Kopecek J (2001) The cytoplasmic escape and nuclear accumulation of endocytosed and microinjected HPMA copolymers and a basic kinetic study in Hep G2 cells. AAPS PharmSci 3, E32. Jensen KD, Kopeckova P and Kopecek J (2002) Antisense oligonucleotides delivered to the lysosome escape and actively inhibit the hepatitis B virus. Bioconjug Chem 13, 975-984. Kasuya Y, Lu ZR, Kopeckova P, Minko T, Tabibi SE and Kopecek J (2001) Synthesis and characterization of HPMA copolymer- aminopropylgeldanamycin conjugates. J Control Release 74, 203-211. Kitada S, Leone M, Sareth S, Zhai D, Reed JC and Pellecchia M (2003) Discovery, characterization and structure-activity relationships studies of proapoptotic polyphenols targeting B-cell lymphocyte/leukemia-2 proteins. J Med Chem 46, 4259-4264. Kopecek J, Kopeckova P, Minko T, Lu ZR and Peterson CM (2001) Water soluble polymers in tumor targeted delivery. J Control Release 74, 147-158. Lackner M, Forsich C, Winter F, Kopecek H and Wintner E (2003) In situ investigation of laser-induced ignition and the early stages of methane-air combustion at high pressures using a rapidly tuned diode laser at 2.55 microm. Spectrochim Acta A Mol Biomol Spectrosc 59, 2997-3018. Langer R (1998) Drug delivery and targeting. Nature 392, 5-10. Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES and Wang X (1997) Cytochrome c and dATPdependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479-489.

121

Oman et al: HPMA copolymer as a novel approach to deliver a Bcl-2-targeting and induces apoptosis of tumor cells. Proc Natl Acad Sci U S A 97, 7124-7129. Zhang M, Liu H, Guo R, Ling Y, Wu X, Li B, Roller PP, Wang S and Yang D (2003) Molecular mechanism of gossypol-

induced cell growth inhibition and cell death of HT-29 human colon carcinoma cells. Biochem Pharmacol 66, 93103.

122

Gene Therapy and Molecular Biology Vol 10, page 61 Gene Ther Mol Biol Vol 10, 61-70, 2006

Viral vectors in pancreatic cancer gene therapy Review Article

Min Li1, 2*, Joel A. Rodriguez 1, William E. Fisher 2, Xiaoliu Zhang 4, Changyi Chen 1 and Qizhi Yao1, 3* 1

Molecular Surgeon Research Center, Elkins Pancreas Center, Michael E. DeBakey Department of Surgery, 3 Department of Molecular Virology and Microbiology, 4 Center for Cell and Gene Therapy, Baylor College of Medicine, Houston, Texas 77030 2

__________________________________________________________________________________ *Correspondence: Dr. Min Li or Dr. Qizhi Yao, Michael E. DeBakey Department of Surgery, Baylor College of Medicine, One Baylor Plaza, Mail stop: NAB 2010, Houston, Texas 77030, USA; Phone: (713) 798-3237 or (713) 798-1765; Email: minli@bcm.tmc.edu or qizhiyao@bcm.tmc.edu Key words: Viral vectors, Gene therapy, Pancreatic cancer, Cancer phenotype, Immunotherapy, Suicide gene therapy, Antiangiogenic therapy, Transductional targeting, Transcriptional targeting, Retrovirus, Adenovirus, Toxicity, Oncolytic viral therapy, Reovirus, Abbreviations: argine-glycine-aspartate, (RGD); cat endogenous virus, (CEV); conditionally replicating adenoviruses, (CRADs); coxsackie adenoviral receptor, (CAR); cytosine deaminase, (CD); fibroblast growth factor receptors, (FGFRs); gancyclovir, (GCV); gibbon ape leukemia virus, (GALV); herpes simplex virus, (HSV); multiplicity of infection, (MOI); murine leukemia virus, (MLV); rat insulin promoter, (RIP); ribonucleotide reductase M2 subunit, (RRM2); vascular endothelial growth factor, (VEGF) Received: 11 October 2005; Accepted: 6 February 2006; electronically published: February 2006

Summary Pancreatic cancer is the fourth leading cause of cancer related deaths, and effective diagnostic and therapeutic strategies are lacking. Molecular research seeking genetic events and signaling pathways that are crucial in pancreatic carcinogenesis holds promise for the development of effective gene therapy strategies. The success of such strategies will depend on efficient, specific, and safe gene delivery to target cells as well as improved target cellspecific gene expression. Adenoviral vectors and retro/lenti-viral vectors have gained significant popularity in cancer gene therapy strategies because of their superior gene transfer efficiency and stable gene expression property, respectively. Many studies have been done to deliver tumor suppressor genes or suicide genes using adenovirus or retro/lenti-virus vectors to treat pancreatic cancer. Another promising therapeutic strategy for pancreatic cancer is the use of conditionally replicating (oncolytic) viruses. These viruses can selectively replicate in cancer cells, and their progeny viruses subsequently spread to surrounding cells, therefore achieving a large scale of viral infection. Several viruses, including adenovirus, herpes simplex virus (HSV), and reovirus have been modified for oncolytic purpose, and incorporation of extra tumoricidal strategies such as enzyme-directed pro-drug and fusogenic viral glycoproteins can further potentiate their anti-tumor capacity. This review provides a brief overview of gene therapy strategies using different viral vectors and anti-tumor activities of oncolytic viruses for pancreatic cancer treatment. chemotherapy and radiation therapy. Recently, many studies have focused on gene therapy as an alternative treatment for pancreatic cancer. The progression of pancreatic cancer is thought to occur through the accumulation of multiple genetic alterations resulting in either gain or loss of gene functionalities. Current molecular research efforts aim to detect the genes that are either over- or under-expressed and the resulting effect on signaling pathways, malignancy potential, chemo- and radio-resistance, and the immune response. Ultimately, this information may lead to the identification of new molecular targets for cancer gene therapy, in which a

I. Introduction Pancreatic cancer is the fourth leading cause of cancer deaths in the United States. The mortality rate of pancreatic cancer is the highest among solid tumors, with an overall 5-year survival rate less than 5% (Jemal et al, 2003). Due to its asymptomatic nature in early stages and a lack of sensitive and specific diagnostic tools, pancreatic cancer is usually undetected until metastasis has occurred and curative therapy is no longer possible. There are currently no effective biomarkers available for early detection of the disease, and even the most aggressive monitoring of high-risk patients is inadequate. Furthermore, pancreatic cancer is highly resistant to both 61

Li et al: Viral vectors in pancreatic cancer gene therapy specific gene may be delivered for overexpression or for inhibition of abnormally overexpressed genes. The success of cancer gene therapy strategies largely depends on efficient and safe gene delivery. Among the gene delivery vehicles, viral vectors are the most commonly used to deliver genes of interest and therefore have been widely studied. Adenovirus vectors have been used mainly because of their superior gene transfer efficiency. Retrovirus vectors have been mainly used for stable expression of target genes, which makes them suitable for gene therapy for hereditary and metabolic diseases as they often require large vector doses and longterm gene expression. Furthermore, viral replication and oncolytic properties can be utilized in cancer gene therapy, and the immune response that they elicit may be used to eliminate cancer cells.

II. Overview of gene strategies for pancreatic cancer

residual or micrometastatic disease commonly occurring after pancreatic resection (Tseng and Mulligan 2002). A number of genes including VEGF receptors and NK4 are being investigated for their ability to interfere with angiogenic signaling pathways (Tseng et al, 2002; Maehara et al, 2002; Saimura et al, 2002). Recently, adenoviral delivery of a soluble form of vascular endothelial growth factor (VEGF) receptor, Flk1, resulted in pancreatic tumor growth inhibition in mice (Tseng et al, 2002). Replication-deficient retroviruses encoding truncated VEGF receptor-2 were found to block VEGF signaling, resulting in significantly reduced subcutaneous tumor growth and inhibition of tumor neoangiogenesis (Tseng et al, 2003). In contrast to conventional therapies, antiangiogenic therapies are believed not to target the tumor cells themselves but their nutritional support via inhibition of blood vessel formation.

therapy

C. Reverting the cancer phenotype Strategies using this approach rely on the premise that either inhibition or restoration of single gene functions may revert the cancer phenotype. Oncogenes that have been targeted in pancreatic cancer gene therapy include Kras and CaSm (Kijima and Scanlon, 2000; Brummelkamp et al, 2002; Kelley et al, 2003). Methods used to inhibit oncogene expression include antisense and ribozyme technologies (Kijima and Scanlon, 2000; Kelley et al, 2003). Antisense RNA constructs bind to the complimentary RNA sequence of the targeted gene to block translation, and ribozyme RNAs bind to and cleave the targeted complimentary RNA sequence. During recent years, siRNA technology has been extensively explored for this purpose (Berberat et al, 2005; Taniuchi et al, 2005; Wey et al, 2005). Approaches to restore tumor suppressor gene functions and to revert the cancer phenotype involve p53 and p16 genes. Wild-type p53 gene was delivered to pancreatic cancer cell lines via adenoviral (Bouvet et al, 1998) and retroviral vectors (Hwang et al, 1998), and subsequent suppression of cancer cell proliferation was observed in vitro and in vivo in an immunocompromised murine model. Replacement of p16 in pancreatic cancer cell lines has been accomplished using adenoviral vectors and has yielded favorable results (Kobayashi et al, 1999), and concurrent replacement of both p53 and p16 has resulted in tumor growth suppression in vitro and in vivo using adenoviral vectors (Ghaneh et al, 2001).

In general, optimization of efficient, specific, and safe gene delivery to the cellular target will lead to successful gene therapy strategies for cancer. Current gene therapy strategies for pancreatic cancer can be grouped into two categories: 1) the efficacy of gene therapy does not rely on the rate of transduction of tumor cells; and 2) the efficacy of gene therapy does rely on the efficient transduction of most or all tumor cells. Accordingly, as the efficiency of gene transfer technology continues to improve, strategies in the former group may achieve clinical success earlier than those in the latter group (Tseng and Mulligan 2002). Methods of gene therapy that require only limited transduction include immunotherapy, antiangiogenic strategies, and bone marrow resistance strategies, which all lead to amplified, systemic effects after gene transfer to a relatively small number of cells. Gene therapy strategies that require efficient gene delivery to most or all of the tumor cells in vivo include those that aim to revert the cancer phenotype and those that aim to induce selective tumor cell death.

A. Immunotherapy Current strategies for immunotherapy for pancreatic cancer usually involve one of two approaches. The first involves the modification of tumor cells (primary or allogeneic) to secrete immunostimulatory cytokines (Jaffee et al, 1998, 2001; Sangro et al, 2004). The second approach involves the genetic modification of antigenpresenting cells to express tumor-specific antigens or immunostimulatory gene products (Pecher et al, 2002; Tang et al, 2002). A wide variety of viral and non-viral vectors have been employed in both approaches in pancreatic tumors and other tumor types, and there is currently no consensus as to the optimal method of gene delivery (Tseng and Mulligan 2002).

D. Suicide gene therapy Gene therapy strategies that rely on efficient transduction of most or all tumor cells in order to cause selective tumor cell death include gene-directed prodrug activation, also referred to as â&#x20AC;&#x153;suicideâ&#x20AC;? gene therapy, selectively delivers genes to tumor cells. When expressed, these genes act to convert systemically administered, nontoxic prodrugs into active chemotherapeutic agents. In this way, the effect of the toxic metabolite is localized to the neoplasm (Yazawa et al, 2002). One of the most commonly used genes in this approach is the herpes simplex virus thymidine kinase (HSV-tk) gene, which phosphorylates systemically administered gancyclovir (GCV) to produce gancyclovir monophosphate, that is

B. Antiangiogenic therapy Antiangiogenic gene therapy strategies have been the subject of intense investigation, as angiogenesis is known to be required for solid tumor growth (Folkman, 1971). This strategy may be particularly useful in the treatment of 62

Gene Therapy and Molecular Biology Vol 10, page 63 then further phosphorylated by the host cells to its toxic form, gancyclovir triphosphate. Pancreatic cancer studies involving HSV-tk transduction by adenoviral and retroviral vectors have yielded success in vitro and in vivo in pre-clinical models. For example, Makinen et al. demonstrated that rat pancreatic carcinoma cells could be efficiently destroyed by GCV-mediated killing following delivery of HSV-tk by adenovirus and retrovirus vectors, leading to tumor necrosis and shrinkage in vivo (in which tumor cells were subcutaneously transplanted after transduction) (Makinen et al, 2000). In a separate study, Rosenfeld et al. demonstrated a similar antitumor effect of GCV with an adenovirus- HSV-tk construct in both in vitro and in vivo settings in an immunocompromised animal model (Rosenfeld et al, 1997). Block et al, 1997 also demonstrated the efficacy of in vivo HSV-tk transduction in producing GCV sensitivity and tumor necrosis. Carrio et al, 1999 has shown enhanced pancreatic tumor regression by a combination of adenovirus and retrovirusmediated delivery of the HSV-tk gene. One potential advantage of the HSV-tk/GCV strategy is that nontransduced tumor cells have exhibited cell death in the presence of GCV due to a “bystander effect” (Block et al, 1997; Rosenfeld et al, 1997; Makinen et al, 2000). Potential mechanisms for this effect include: 1) the transfer of gene product and/or activated toxic compound to adjacent nontransduced cells via phagocytosis or gap junctions, and 2) induction of an immune response that leads to nontransduced cell death (Yazawa et al, 2002). Current gene delivery technology does not allow for the expression of HSV-tk in every tumor cell, and the bystander effect may help to compensate for this deficiency. Still, current efforts to improve suicide gene therapy, including the optimization of gene transfer to tumor cells by adenoviral vectors, will likely increase the therapeutic effect of this approach. However, due to the lack of cell specificity of adenoviral vectors, a variety of targeting strategies have been engineered into this vector system. For example, the transcriptional targeting strategy aims to limit transgene expression to the targeted tumor cells and is being employed in suicide gene therapy (discussed in detail in a later section).

understood and perhaps responsible for detrimental toxicity, may actually play a role in the elimination of cancer cells. Adenoviral vectors are particularly attractive vehicles at delivering suicide genes. In addition, a bystander effect seen in suicide gene therapy may compensate for the low transduction efficiency in tumors. This effect may be enhanced through the fusion of the prodrug-activating gene with a secretory gene (Rots et al, 2003). Transduction efficiency and tumor penetration may also be improved by targeting strategies as described below. The broad tropism of adenoviruses does, however, result in decreased specificity of gene transfer, and the future clinical success of cancer gene therapy strategies will depend on improved targeting specificity of this vector. Improved specificity is particularly crucial in strategies which result in direct cytotoxicity (as in suicide gene therapy) or cytolysis (as in oncolytic viral therapy). Two methods of enhancing therapeutic targeting are currently being investigated for use in several cancer gene therapy strategies, the first one concentrating on transduction and the other one on transcription. In addition, individual strategies may incorporate unique methods of improving specificity.

A. Transductional targeting Transductional targeting produces cell-specific infection, thereby allowing systemic administration of the vector yield localized infection at sites of interest. Such improved specificity results in more specific transgene expression, reducing the required therapeutic dose and avoiding the involvement of normal tissues. In addition, inflammatory and immune responses against the vector may be reduced (Rots et al, 2003). Finally, infectivity and transduction efficiency may be enhanced in tumors that do not express the primary adenoviral cell surface receptors. Adenovirus infection begins with the interaction between the host cell primary coxsackie adenoviral receptor (CAR) and the adenoviral fiber protein, termed “knob”. Internalization of the virus particle involves the interaction between host cell integrins and the integrinbinding motif argine-glycine-aspartate (RGD) sequence of the viral penton base protein (Rots et al, 2003). One method of transductional targeting utilizes recombinant fusion proteins which bind to the adenoviral fiber and to a non-CAR tumor cell surface receptor. This retargeting towards non-CAR receptors is particularly important in order to increase the infectivity and transduction efficiency in tumors such as pancreatic cancer, as these tumors do not express adequate levels of CAR. This approach was used to redirect adenoviral vectors to epidermal growth factor receptors (EGFRs) on pancreatic carcinoma cells, leading to enhanced gene transduction efficiency and specificity (Wesseling et al, 2001). Redirection with specific fusion proteins that bind the adenoviral knob and fibroblast growth factor receptors (FGFRs) on pancreatic carcinoma cells resulted in increased efficiency of suicide gene delivery (Kleeff et al, 2002). A second method of transductional targeting genetically alters the adenoviral knob by deleting CAR-binding sequences and replacing it with foreign sequences that recognize specific receptors

III. Adenoviral vectors for gene delivery Adenoviruses are non-enveloped viruses with double-stranded DNA genome. The virion has icosahedral capsids which are consisted of twelve vertices and seven surface proteins, and is about 70 to 90 nm in size. Adenoviral vectors are well-suited for use as gene delivery vehicles in the treatment of cancer. They provide superior in vivo gene transfer efficiency and have the ability to infect a wide variety of dividing and non-dividing cells. Since clinical trials have demonstrated that suboptimal tumor transduction frequencies correlated with limited therapeutic benefit, adenoviral vectors have the advantage of improving levels of transduction efficiency (Yamamoto et al, 2003). In addition to superior transduction efficiency, adenoviral vectors have large cloning capacities and can be produced in high titers (Halloran et al, 2000). Furthermore, their immunogenicity, though poorly 63

Li et al: Viral vectors in pancreatic cancer gene therapy such as integrins or other proteins that are selectively expressed on the surface of tumor cells. Such genetic alteration of the adenoviral fiber protein may, as in the first strategy, result in enhanced infectivity in tumor types which do not express adequate levels of CARs.

involving intravascular adenoviral delivery in cancer patients have shown acceptable toxicity profiles to date (Reid et al, 2002), and the immune response generated by adenoviral vectors may actually help to eliminate noninfected cancer cells. Nevertheless, a better understanding of the immune response to these vectors is necessary in order to ensure safety and to preserve readministration efficacy in cases of recurrent cancer. Indeed, modulation or evasion of the immune response is particularly important during readministration of the vector, when the neutralizing antibody response to a previous exposure may be significant. Preclinical attempts to achieve this have included adenoviral serotype switching, masking the vectors with polymers such as peglation during both initial treatment and readministration, plasmapharesis (removing circulating neutralizing antibodies), coadministration of anti-inflammatories, and incorporation of immunomodulatory genes into the vectors.

B. Transcriptional targeting Transcriptional targeting utilizes tumor-specific promoters for gene expression. This targeting strategy is particularly important in suicide gene therapy and oncolytic viral therapy, in which cytoxicity or cytolysis of the involved cells takes place. One recent study of suicide gene therapy utilized the rat insulin promoter (RIP) to drive the expression of the 5-fluorcytosine-activating enzyme, cytosine deaminase (CD), demonstrating pancreatic cancer-specific cytotoxicity in vitro (Wang et al, 2004). In oncolytic viral therapy strategies, tumor-specific promoters may be used to drive the expression of an essential gene of the virus. The efficacy of transcriptionally targeted adenovirus vectors has been studied in a number of tumors, including hepatocellular carcinomas, breast carcinomas, colon cancer, melanoma, neuroblastomas, and prostate cancer (Post et al, 2003). A recent phase I trial in prostate cancer patients documented the safety of intraprostatic delivery of CV706, a PSAselective, replication competent adenovirus (DeWeese et al, 2001). In one preclinical study for pancreatic carcinoma, the cycloxygenase (COX)-2 promoter was incorporated into infectivity-enhanced conditionally replicating adenoviruses (CRADs) to drive the expression of the adenovirus E1 gene, resulting in strong and selective antitumor effects in vitro and in vivo (Yamamoto et al, 2003).

IV. Retrovirus mediated gene delivery Retrovirus is another widely used vector for cancer gene therapy. Unlike adenovirus, retroviruses (except for lentiviruses) only infect dividing cells. The retrovirus genome can be stably integrated into the host chromosome DNA. Although the transduction efficiency of a retrovirus is usually less than 10%, the inserted gene can be stably expressed in target cells, which makes the retrovirus vector an attractive strategy for cancer gene therapy. Duxbury et al. used retrovirus mediated siRNA to block the ribonucleotide reductase M2 subunit (RRM2), and found that RRM2 gene silencing decreased pancreatic adenocarcinoma cell invasiveness and gemcitabine chemoresistance (Duxbury et al, 2004). Brummelkamp et al. constructed a retroviral vector to specifically and stably inhibit the expression of the oncogenic K-rasV12 allele, but not the wild type K-ras, in human tumor cells. Loss of expression of K-rasV12 led to the loss of anchorageindependent growth and tumorigenicity. This study demonstrated that viral delivery of siRNAs can be used for tumor-specific gene therapy to reverse the oncogenic phenotype of cancer cells (Brummelkamp et al, 2002). Many studies have also used retrovirus vectors to deliver suicide genes into tumor cells (Carrio et al, 2001; Greco et al, 2002). One report indicated that significant inhibition of pancreatic tumor growth could be achieved by a combined delivery of HSV-tk by adenovirus and retrovirus vectors (Carrio et al, 1999). Modifying the retrovirus vector to make it more effective in transducing tumor cells is another important aspect in tumor gene therapy. Howard et al. constructed a pseudotyped retroviral vector containing either the amphotropic murine leukemia virus (MLV-4070A) envelope, the cat endogenous virus (CEV) envelope RD114, or the rhabdovirus vesicular stomatitis virus glycoprotein (VSV-G), and used these pseudotyped vectors to transduce three pancreatic cancer cell lines. They found that retroviral vectors pseudotyped with VSVG provided the best transduction efficiency for human pancreatic tumor cells when compared to either MLV4070A- or CEV RD114- pseudotyped retroviral vectors.

C. Toxicity and the immune response Efforts to improve cell-specific gene delivery and expression will likely decrease the toxicity of the viral vector, by preventing transduction and expression of the gene in normal cells. Targeted delivery will also reduce the required therapeutic dose, minimizing the inflammatory and immune responses to the vector (Rots et al, 2003). Indeed, the humoral and cellular immune responses towards the vector, transgene, and infected cells are known to be substantial and may result in severe toxicity (Hemminki and Alvarez, 2002). The mechanisms underlying these responses are extremely complex and poorly understood, as they include both the innate and acquired immune responses to both viral and therapeutic genes. Efforts to fully understand the complex interactions between the vector and host became particularly important after a large-dose infusion of the first generation adenovirus resulted in the death of a young patient with ornithine decarboxylase deficiency (Marshall, 1999). This unfortunate event revealed the danger of large-dose adenoviral vector administration, especially in the treatment of hereditary and metabolic disease in which large doses are required and readministration is often necessary. However, adenoviral vectors remain in favor for use in cancer gene therapy strategies. Clinical trials 64

Gene Therapy and Molecular Biology Vol 10, page 65 Their results suggest that the use of VSV-G glycoprotein for pseudotyping recombinant retroviruses enhances the delivery and expression of the therapeutic gene in human pancreatic tumor cell lines and may be important for designing modified retroviral vectors for better transduction efficiency in pancreatic cancer gene therapy (Howard et al, 1999).

(Nemunaitis et al, 2000, 2001). A recent phase I trial in pancreatic cancer patients demonstrated no objective tumor response and did not document viral replication. However, this clinical trial did show that CT-guided local injection of ONYX-015 was well-tolerated (Mulvihill et al, 2001). As in suicide gene therapy, improved transductional and transcriptional targeting is needed for more efficient and specific gene delivery and expression. In the case of oncolytic viral therapy, transcriptional targeting may be achieved by utilizing tumor-specific promoters to direct transcription of essential viral genes such as E1a. Although preclinical and clinical studies of oncolytic viral therapy have shown limited single-agent efficacy, this strategy may be enhanced by combining traditional chemotherapy and radiotherapy (Chen et al, 2001), or by the addition of immunostimulatory genes such as IL-12, IL-24 and GMCSF to maximize the anti-tumor effect (Zhao et al, 2005; Qian et al, 2002). The administration of ONYX-015 in combination with cisplatin and 5fluorouracil has yielded significant phase II clinical success in head and neck cancer patients, including a high proportion (27%) of complete responses (Khuri et al, 2000). A recent phase I/II trial in pancreatic cancer patients demonstrated the feasibility and safety of administering the virus under endoscopic ultrasoundguided injection in combination with gemcitabine administration (Hecht et al, 2003). Furthermore, this study demonstrated that increased tumor responses could be achieved by the combination therapy. Conditionally-replicating adenoviruses may also function as gene delivery vehicles. Prodrug activation genes (â&#x20AC;&#x153;suicideâ&#x20AC;? genes) are the most studied therapeutic genes delivered by this strategy. However, the incorporation of HSV-tk into the genomes of oncolytic adenoviruses has yielded conflicting results: the findings of Nanda et al, 2001 demonstrated enhanced antitumor activity over oncolytic viral therapy alone, while the findings of Lambright et al, 2001 demonstrated no augmentation of antitumor activity, possibly due to the inhibition of viral replication by GCV activation. The combination of oncolytic adenoviral therapy and double suicide gene therapy has also been explored. The incorporation of HSV-tk and cytosine deaminase (which leads to the activation of the prodrug, 5-fluorocytosine) yielded antitumor activity in prostate cancer patients (Freytag et al, 2002). Preclinical evidence suggests that this last strategy of combining oncolytic viral therapy with double suicide gene therapy may be able to potentiate the effectiveness of radiotherapy in a clinical setting (Rogulski et al, 2000).

V. Oncolytic viral therapy Human viruses have the natural ability to efficiently infect and kill target cells. Therefore genetically engineering human viruses to kill tumor cells, while sparing normal cells, represents an attractive approach to antitumor therapy. Oncolytic viruses have two principal advantages. First, unlike conventional chemotherapy and radiotherapy, they specifically target cancer cells because of their restricted ability to replicate in normal cells. Second, unlike replication-incompetent vectors, oncolytic viruses produced from initially infected tumor cells can spread to surrounding tumor cells, thereby achieving greater distribution of virus and enhanced antitumor effects. Oncolytic viruses are most commonly constructed by deleting viral genes necessary for efficient replication in normal cells but not tumor cells. They can also be constructed by regulating the transcription of viral replication proteins through the use of exogenous, tissuespecific promoters (i.e. transcriptional targeting), or by retargeting viral infection specifically to tumor cells (i.e. transductional targeting) (Post et al, 2003). Several of these conditionally-replicating viruses are under investigation in clinical trials. Additionally, other viruses such as reovirus and Newcastle Disease virus are being investigated for their inherent tumor-selective properties in oncolytic viral therapy (Norman and Lee, 2000; Sinkovics and Horvath, 2000).

A. Oncolytic adenovirus The first engineered virus to enter clinical trials was dl1520 (ONYX-015), a conditionally-replicating adenovirus (CRAD). This particular CRAD has a deletion of E1B-55kD, a gene that inhibits the function of the tumor suppressor gene, p53. It was hypothesized that ONYX-015 replication would be limited in normal cells (i.e. cells containing wild type p53 gene) but that replication could occur in tumor cells (i.e. cells containing mutant p53 gene) (Kasuya et al, 2005). Preclinical data suggest that the modulation of ONYX-015 replication by p53 expression may vary according to the origin of tumors and that the virus may not possess clear tumor selectivity; some preclinical studies have demonstrated a clear association (Bischoff et al, 1996; Rogulski et al, 2000), while others have not (Rothmann et al, 1998; Harada and Berk, 1999). Furthermore, clinical trials involving ONYX-015 as a single agent have demonstrated low efficacy. Recent phase II trials of ONYX-015 administered to head and neck cancer patients via intratumoral injection did, however, demonstrate selective tumor destruction, transient viral replication, and mutant p53-associated necrosis

B. Oncolytic herpes virus HSV has been modified for oncolytic purposes, most commonly by deleting either one or both of the virally encoded r34.5 or ICP6 genes. Deletion of the viral r34.5 gene, which functions as a neurovirulence factor during HSV infection (Chou et al, 1990), blocks viral replication in nondividing cells (Chou and Roizman, 1992; Bolovan et al, 1994; McKie et al, 1996). The viral ICP6 gene encodes the large subunit of ribonucleotide reductase, which 65

Li et al: Viral vectors in pancreatic cancer gene therapy generates sufficient dNTP pools for efficient viral DNA replication (Boviatsis et al, 1994; Mineta et al, 1994; Chase et al, 1998), and is abundantly expressed in tumor cells but not in non-dividing cells. Consequently, viruses with a mutation in this gene can preferentially replicate in and kill tumor cells. The oncolytic HSV G207, which has been extensively tested in animal studies and is currently being tested in clinical trials, has a deletion of both copies of the r34.5 locus and an insertion mutation in the ICP6 gene with the E. coli lacZ gene (Mineta et al, 1995; Todo et al, 1999; Walker et al, 1999). Alternatively, an oncolytic HSV can be constructed by using a tumor-specific promoter to drive r34.5 or other genes essential for HSV replication (Chung et al, 1999). As compared with other viruses that have been investigated for oncolytic purposes, HSV possess several unique features that enhance their potential as antitumor agents. First, antiherpetic medications such as acyclovir and gancyclovir are available as safety measures in the event of undesired infection or toxicity from the HSV. Second, productive infection with HSV usually kills target cells much more rapidly than infection with other viruses. For example, HSV can form visible plaques in cultured cells in only 2 days, in contrast to 7 to 9 days for adenovirus. In vitro studies have also shown that at a multiplicity of infection (MOI) of 0.01, an HSV can kill almost 100% of cultured cancer cells in 2 days (Fu and Zhang, 2002), while a much higher dose or a longer infection time is required to achieve equivalent cell killing with adenovirus (Yu et al, 1999). Rapid replication and spreading among target cells may be important for a virus to execute its full oncolytic potential in vivo, as the bodyâ&#x20AC;&#x2122;s immune mechanism may be more likely to restrict the spread of slower growing viruses. Third, HSV seems to be able to replicate and spread even in the presence of antiHSV immunity. This feature has been most clearly demonstrated during recurrent HSV infection, in which the virus can still grow and spread extensively in local skin, despite obvious antiviral immunity. Moreover, preexistence of anti-HSV immunity in experimental animals has no significant effect on the therapeutic potency of oncolytic HSVs administered either intratumorally or systemically (Chahlavi et al, 1999; Lambright et al, 2000; Yoon et al, 2000). Fourth, HSVs have wide cell tropism, infecting almost every type of human cells that have been tested so far. Thus, oncolytic viruses derived from HSV would likely have wide applicability among cancer patients. Finally, the risk of introducing an insertion mutation during HSV oncolytic therapy appears minimal because HSVs generally do not integrate into cellular DNA. Oncolytic HSVs were initially designed and constructed for the treatment of brain tumors, especially glioblastomas (Martuza et al, 1991; Mineta et al, 1995). Subsequently, they have proved to be effective in treating a variety of other human solid tumors, including breast cancer (Toda et al, 1998; Fu and Zhang, 2002). The safety of the oncolytic virus G207 has been extensively tested in mice (Sundaresan et al, 2000) and in a primate species (Aotus) that is extremely sensitive to HSV infection (Hunter et al, 1999; Todo et al, 2000). These studies have

confirmed that oncolytic HSVs are safe for in vivo administration. These encouraging results in animals have prompted clinical trials of these viruses in patients with malignant gliomas (Markert et al, 2000; Rampling et al, 2000). However, recent studies indicate that current oncolytic viruses, although safe, may have only limited anti-tumor activity on their own. Pro-drug converting enzymes, such as HSV tk, as mentioned above, have been combined with oncolytic viruses in an attempt to improve the anti-tumor potency. This has not been successful most likely because the antitumor effect of pro-drug activation is offset by its inhibitory action on viral replication (Gustin et al, 2002; Tseng and Mulligan 2002). Recently, it was suggested that the syncytia-forming property of fusogenic membrane glycoproteins might be useful in cancer therapy (Kasuya et al, 2001; Gilliam and Watson, 2002; Fu and Zhang, 2002 Nakamori et al, 2003; Nakamori et al, 2004a, b). Since these viruses kill their target cells through formation of multinucleated syncytia, involving membrane fusion between infected and uninfected cells, they have the theoretical advantage affecting adjacent cells that have not been directly infected. For example, it has been shown that a C-terminal truncation of the gibbon ape leukemia virus (GALV) envelope glycoprotein leads to a constitutive and hyperfusogenic version of the GALV envelope glycoprotein (GALV.fus) (Lieberman et al, 2001; Fu et al, 2003). Transduction of this gene into a range of human tumor cells results in efficient cell destruction through syncytia formation (Sakorafas and Tsiotos, 2001; Fu and Zhang, 2002; Fu et al, 2003). Furthermore, the bystander killing effect from this hyperfusogenic glycoprotein is at least ten times higher than the effect from the suicide genes HSV-TK or cytosine deaminase (Gunzburg and Salmons, 2001). We have demonstrated that incorporation of cell-membrane fusion properties into an oncolytic HSV can dramatically enhance the antitumor activity of the virus (Fu et al, 2003). This new class of oncolytic viruses, called fusogenic oncolytic HSVs, kill tumor cells by two efficient and complementary mechanisms: direct cytolysis (through virus replication) and cell membrane fusion. The combination of these tumor-killing mechanisms may even yield a synergistic antitumor effect, as syncytia formation in the tumor tissue can facilitate the spread of the virus, leading in turn to widespread syncytia formation. Our studies have demonstrated that the fusogenic oncolytic HSV virus potently infects and kills human pancreatic cancer cells in vitro (unpublished data). It has also recently been discovered that the insulin promoter is active in human pancreatic adenocarcinoma and could thus be used as a pancreatic cancer specific promoter (Halloran et al, 2000). It has been reported that the insulin promoter-tk with gancyclovir selectively ablates human pancreas cancer both in vitro and in vivo. Therefore, the combination of the pancreatic cancer specific promoter, and the potent fusogenic oncolytic virus might be an attractive strategy in pancreatic cancer gene therapy. The genetically engineered tumor-specific fusogenic oncolytic virus using the insulin promoter will have two major advantages. First, the tumor-specific expression of the fusogenic protein will allow systemic delivery resulting in

Gene Therapy and Molecular Biology Vol 10, page 67 F (1996) An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science 274, 373-6. Bolovan CA, Sawtell NM, Thompson RL (1994) ICP34.5 mutants of herpes simplex virus type 1 strain 17syn+ are attenuated for neurovirulence in mice and for replication in confluent primary mouse embryo cell cultures. J Virol 68, 48-55. Bouvet M, Bold RJ, Lee J, Evans DB, Abbruzzese JL, Chiao PJ, McConkey DJ, Chandra J, Chada S, Fang B, Roth JA (1998) Adenovirus-mediated wild-type p53 tumor suppressor gene therapy induces apoptosis and suppresses growth of human pancreatic cancer (seecomments). Ann Surg Oncol 5, 681-8. Boviatsis EJ, Scharf JM, Chase M, Harrington K, Kowall NW, Breakefield XO, Chiocca EA (1994) Antitumor activity and reporter gene transfer into rat brain neoplasms inoculated with herpes simplex virus vectors defective in thymidine kinase or ribonucleotide reductase. Gene Ther 1, 323-31. Brummelkamp TR, Bernards R, Agami R (2002) Stable suppression of tumorigenicity by virus-mediated RNA interference. Cancer Cell 2, 243-7. Carrio M, Mazo A, Lopez-Iglesias C, Estivill X, Fillat C (2001) Retrovirus-mediated transfer of the herpes simplex virus thymidine kinase and connexin26 genes in pancreatic cells results in variable efficiency on the bystander killing: implications for gene therapy. Int J Cancer 94, 81-8. Carrio M, Romagosa A, Mercade E, Mazo A, Nadal M, GomezFoix AM, Fillat C (1999) Enhanced pancreatic tumor regression by a combination of adenovirus and retrovirusmediated delivery of the herpes simplex virus thymidine kinase gene. Gene Ther 6, 547-53. Chahlavi A, Rabkin S, Todo T, Sundaresan P, Martuza R (1999) Effect of prior exposure to herpes simplex virus 1 on viral vector-mediated tumor therapy in immunocompetent mice. Gene Ther 6, 1751-8. Chase M, Chung RY, Chiocca EA (1998) An oncolytic viral mutant that delivers the CYP2B1 transgene and augments cyclophosphamide chemotherapy. Nat Biotechnol 16, 444-8. Chen Y, DeWeese T, Dilley J, Zhang Y, Li Y, Ramesh N, Lee J, Pennathur-Das R, Radzyminski J, Wypych J, Brignetti D, Scott S, Stephens J, Karpf DB, Henderson DR, Yu DC (2001) CV706, a prostate cancer-specific adenovirus variant, in combination with radiotherapy produces synergistic antitumor efficacy without increasing toxicity. Cancer Res 61, 5453-60. Chou J, Kern ER, Whitley RJ, Roizman B (1990) Mapping of herpes simplex virus-1 neurovirulence to ! 134.5, a gene nonessential for growth in culture. Science 250, 1262-6. Chou J, Roizman B (1992) The !1(34.5) gene of herpes simplex virus 1 precludes neuroblastoma cells from triggering total shutoff of protein synthesis characteristic of programed cell death in neuronal cells. Proc Natl Acad Sci U S A 89, 326670. Chung RY, Saeki Y, Chiocca EA (1999) B-myb promoter retargeting of herpes simplex virus !34.5 gene-mediated virulence toward tumor and cycling cells. J Virol 73, 755664. Couper JJ, Harrison LC, Aldis JJ, Colman PG, Honeyman MC, Ferrante A (1997) Adenoviral-mediated herpes simplex virus thymidine kinase gene transfer: regression of hepatic metastasis of pancreatic tumors. Pancreas 15, 25-34. DeWeese TL, van der Poel H, Li S, Mikhak B, Drew R, Goemann M, Hamper U, DeJong R, Detorie N, Rodriguez R, Haulk T, DeMarzo AM, Piantadosi S, Yu DC, Chen Y, Henderson DR, Carducci MA, Nelson WG, Simons JW (2001) A phase I trial of CV706, a replication-competent, PSA selective oncolytic adenovirus, for the treatment of locally recurrent prostate cancer following radiation therapy. Cancer Res 61, 7464-72.

efficient tumor cell killing in primary and metastatic lesions while sparing the host from toxicity. Second, unlike the replication-incompetent vectors, this oncolytic virus will spread from initially infected tumor cells to surrounding tumor cells. The use of this knowledge to create a tumor specific fusogenic, oncolytic HSV virus is promising as a potential adjunct to surgical resection. This strategy could also potentially be applied to other cancers.

C. Reovirus therapy Reovirus is a unique oncolytic virus because it infects cells with an activated Ras signaling pathway (Wilcox et al, 2001; Ring, 2002; Etoh et al, 2003). About 80% of pancreatic cancer cells have Ras mutations, which makes the reovirus an attractive candidate in pancreatic cancer therapy. Etoh et al. used oncolytic reovirus to infect five different pancreatic cancer cells (Panc-1, MIA PaCa2, PK1, PK9, and BxPC-3). They found that all five cell lines were infected by reovirus and the susceptibility to reovirus infection correlated with elevated Ras activity in these cell lines. After intratumor injection of reovirus, decreased tumor growth was observed in a unilateral murine xenograft model using Panc-1 and BxPC-3 cells. Moreover, reovirus replication was observed only within the tumor and not in surrounding normal tissues. These results indicate that reovirus might be a novel oncolytic viral therapy against pancreatic cancer (Etoh et al, 2003).

VI. Conclusion Adenovirus and retrovirus vectors have been widely used in cancer gene therapy because of their superior gene transfer efficiency and stability, respectively. Tumor suppressor genes, suicide genes, or immunomodulatory genes have been delivered to tumor cells using adenovirus or retrovirus vectors to treat pancreatic cancer, and the results are promising. Numerous efforts have also been made to enhance the therapeutic benefits by improving transduction efficiency and tumor specificity. Oncolytic viral therapy offers another great promise for pancreatic cancer therapy because the virus targets cancer cells specifically, and spreads within the tumor mass even if it only infects a small number of cells initially. Several viruses, such as adenovirus, herpes simplex virus (HSV), and reovirus have been used as oncolytic viruses to treat cancers. Modified oncolytic HSV that contains a fusogenic viral protein provides more potent anti-tumor capacity in several cancers. A comprehensive therapy using combined oncolytic virus and tumor suppressor gene or suicide gene therapy, along with conventional radiation and chemotherapy, might provide superior treatment for pancreatic cancer.

References Berberat PO, Dambrauskas Z, Gulbinas A, Giese T, Giese N, Kunzli B, Autschbach F, Meuer S, Buchler MW, Friess H (2005) Inhibition of heme oxygenase-1 increases responsiveness of pancreatic cancer cells to anticancer treatment. Clin Cancer Res 11, 3790-8. Bischoff JR, Kirn DH, Williams A, Heise C, Horn S, Muna M, Ng L, Nye JA, Sampson-Johannes A, Fattaey A, McCormick

Li et al: Viral vectors in pancreatic cancer gene therapy Duxbury MS, Ito H, Benoit E, Zinner MJ, Ashley SW, Whang EE (2004) Retrovirally mediated RNA interference targeting the M2 subunit of ribonucleotide reductase: A novel therapeutic strategy in pancreatic cancer. Surgery 136, 2619. Etoh T, Himeno Y, Matsumoto T, Aramaki M, Kawano K, Nishizono A, Kitano S (2003) Oncolytic viral therapy for human pancreatic cancer cells by reovirus. Clin Cancer Res 9, 1218-23. Folkman J (1971) Tumor angiogenesis: therapeutic implications. N Engl J Med 285, 1182-6. Freytag SO, Khil M, Stricker H, Peabody J, Menon M, DePeralta-Venturina M, Nafziger D, Pegg J, Paielli D, Brown S, Barton K, Lu M, Aguilar-Cordova E, Kim JH (2002) Phase I study of replication-competent adenovirusmediated double suicide gene therapy for the treatment of locally recurrent prostate cancer. Cancer Res 62, 4968-76. Fu X, Tao L, Jin A, Vile R, Brenner MK, Zhang X (2003) Expression of a fusogenic membrane glycoprotein by an oncolytic herpes simplex virus potentiates the viral antitumor effect. Mol Ther 7, 748-54. Fu X, Zhang X (2002) Potent systemic antitumor activity from an oncolytic herpes simplex virus of syncytial phenotype. Cancer Res 62, 2306-12. Ghaneh P, Greenhalf W, Humphreys M, Wilson D, Zumstein L, Lemoine NR, Neoptolemos JP (2001) Adenovirus-mediated transfer of p53 and p16(INK4a) results in pancreatic cancer regression in vitro and in vivo. Gene Ther 8, 199-208. Gilliam AD, Watson SA (2002) Emerging biological therapies for pancreatic carcinoma. Eur J Surg Oncol 28, 370-8. Greco E, Fogar P, Basso D, Stefani AL, Navaglia F, Zambon CF, Mazza S, Gallo N, Piva MG, Scarpa A, Pedrazzoli S, Plebani M (2002) Retrovirus-mediated herpes simplex virus thymidine kinase gene transfer in pancreatic cancer cell lines: an incomplete antitumor effect. Pancreas 25, e21-9. Gunzburg WH, Salmons B (2001) Novel clinical strategies for the treatment of pancreatic carcinoma. Trends Mol Med 7, 30-7. Gustin A, Pederson L, Miller R, Chan C, Vickers SM (2002) Application of molecular biology studies to gene therapy treatment strategies. World J Surg 26, 854-60. Halloran CM, Ghaneh P, Neoptolemos JP, Costello E (2000) Gene therapy for pancreatic cancer--current and prospective strategies. Surg Oncol 9, 181-91. Harada JN, Berk AJ (1999) p53-Independent and -dependent requirements for E1B-55K in adenovirus type 5 replication. J Virol 73, 5333-44. Hecht JR, Bedford R, Abbruzzese JL, Lahoti S, Reid TR, Soetikno RM, Kirn DH, Freeman SM (2003) A phase I/II trial of intratumoral endoscopic ultrasound injection of ONYX-015 with intravenous gemcitabine in unresectable pancreatic carcinoma. Clin Cancer Res 9, 555-61. Hemminki A, Alvarez RD (2002) Adenoviruses in oncology: a viable option? BioDrugs 16, 77-87. Howard BD, Boenicke L, Schneider-Brachert W, Kalthoff H (1999) Enhanced retroviral transduction efficiency of pancreatic tumor cell lines using different envelope glycoproteins. Ann N Y Acad Sci 880, 366-70. Hunter WD, Martuza RL, Feigenbaum F, Todo T, Mineta T, Yazaki T, Toda M, Newsome JT, Platenberg RC, Manz HJ, Rabkin SD (1999) Attenuated, replication-competent herpes simplex virus type 1 mutant G207: safety evaluation of intracerebral injection in nonhuman primates. J Virol 73, 6319-26. Hwang RF, Gordon EM, Anderson WF, Parekh D (1998) Gene therapy for primary and metastatic pancreatic cancer with intraperitoneal retroviral vector bearing the wild-type p53 gene. Surgery 124, 143-50.

Jaffee EM, Hruban RH, Biedrzycki B, Laheru D, Schepers K, Sauter PR, Goemann M, Coleman J, Grochow L, Donehower RC, Lillemoe KD, O'Reilly S, Abrams RA, Pardoll DM, Cameron JL, Yeo CJ (2001) Novel allogeneic granulocytemacrophage colony-stimulating factor-secreting tumor vaccine for pancreatic cancer: a phase I trial of safety and immune activation. J Clin Oncol 19, 145-56. Jaffee EM, Schutte M, Gossett J, Morsberger LA, Adler AJ, Thomas M, Greten TF, Hruban RH, Yeo CJ, Griffin CA (1998) Development and characterization of a cytokinesecreting pancreatic adenocarcinoma vaccine from primary tumors for use in clinical trials. Cancer J Sci Am 4, 194203. Jemal A, Murray T, Samuels A, Ghafoor A, Ward E, Thun MJ (2003) Cancer statistics, 2003. CA Cancer J Clin 53, 5-26. Kasuya H, Nomoto S, Kimata H, Harada A, Takeda S, Hayashi S, Nakao A (2001) Gene therapy for pancreatic cancer. Hepatogastroenterology 48, 957-61. Kasuya H, Takeda S, Nomoto S, Nakao A (2005) The potential of oncolytic virus therapy for pancreatic cancer. Cancer Gene Ther 12, 725-36. Kelley JR, Fraser MM, Hubbard JM, Watson DK, Cole DJ (2003) CaSm antisense gene therapy: a novel approach for the treatment of pancreatic cancer. Anticancer Res 23, 200713. Khuri FR, Nemunaitis J, Ganly I, Arseneau J, Tannock IF, Romel L, Gore M, Ironside J, MacDougall RH, Heise C, Randlev B, Gillenwater AM, Bruso P, Kaye SB, Hong WK, Kirn DH (2000) a controlled trial of intratumoral ONYX015, a selectively-replicating adenovirus, in combination with cisplatin and 5-fluorouracil in patients with recurrent head and neck cancer. Nat Med 6, 879-85. Kijima H, Scanlon KJ (2000) Ribozyme as an approach for growth suppression of human pancreatic cancer. Mol Biotechnol 14, 59-72. Kleeff J, Fukahi K, Lopez ME, Friess H, Buchler MW, Sosnowski BA, Korc M (2002) Targeting of suicide gene delivery in pancreatic cancer cells via FGF receptors. Cancer Gene Ther 9, 522-32. Kobayashi S, Shirasawa H, Sashiyama H, Kawahira H, Kaneko K, Asano T, Ochiai T (1999) P16INK4a expression adenovirus vector to suppress pancreas cancer cell proliferation. Clin Cancer Res 5, 4182-5. Lambright ES, Amin K, Wiewrodt R, Force SD, Lanuti M, Propert KJ, Litzky L, Kaiser LR, Albelda SM (2001) Inclusion of the herpes simplex thymidine kinase gene in a replicating adenovirus does not augment antitumor efficacy. Gene Ther 8, 946-53. Lambright ES, Kang EH, Force S, Lanuti M, Caparrelli D, Kaiser LR, Albelda SM, Molnar-Kimber KL (2000) Effect of preexisting anti-herpes immunity on the efficacy of herpes simplex viral therapy in a murine intraperitoneal tumor model. Mol Ther 2, 387-93. Lieberman SM, Horig H, Kaufman HL (2001) Innovative treatments for pancreatic cancer. Surg Clin North Am 81, 715-39. Maehara N, Nagai E, Mizumoto K, Sato N, Matsumoto K, Nakamura T, Narumi K, Nukiwa T, Tanaka M (2002) Gene transduction of NK4, HGF antagonist, inhibits in vitro invasion and in vivo growth of human pancreatic cancer. Clin Exp Metastasis 19, 417-26. Makinen K, Loimas S, Wahlfors J, Alhava E, Janne J (2000) Evaluation of herpes simplex thymidine kinase mediated gene therapy in experimental pancreatic cancer. J Gene Med 2, 361-7. Markert JM, Medlock MD, Rabkin SD, Gillespie GY, Todo T, Hunter WD, Palmer CA, Feigenbaum F, Tornatore C, Tufaro F, Martuza RL (2000) Conditionally replicating herpes

Gene Therapy and Molecular Biology Vol 10, page 69 simplex virus mutant, G207 for the treatment of malignant glioma: results of a phase I trial. Gene Ther 7, 867-74. Marshall E (1999) Gene therapy death prompts review of adenovirus vector. Science 286, 2244-5. Martuza RL, Malick A, Markert JM, Ruffner KL, Coen DM (1991) Experimental therapy of human glioma by means of a genetically engineered virus mutant. Science 252, 854-6. McKie EA, MacLean AR, Lewis AD, Cruickshank G, Rampling R, Barnett SC, Kennedy PG, Brown SM (1996) Selective in vitro replication of herpes simplex virus type 1 (HSV-1) ICP34.5 null mutants in primary human CNS tumours-evaluation of a potentially effective clinical therapy. Br J Cancer 74, 745-52. Mineta T, Rabkin SD, Martuza RL (1994) Treatment of malignant gliomas using ganciclovir-hypersensitive, ribonucleotide reductase-deficient herpes simplex viral mutant. Cancer Res 54, 3963-6. Mineta T, Rabkin SD, Yazaki T, Hunter WD, Martuza RL (1995) Attenuated multi-mutated herpes simplex virus-1 for the treatment of malignant gliomas. Nat Med 1, 938-43. Mulvihill S, Warren R, Venook A, Adler A, Randlev B, Heise C, Kirn D (2001) Safety and feasibility of injection with an E1B-55 kDa gene-deleted, replication-selective adenovirus (ONYX-015) into primary carcinomas of the pancreas: a phase I trial. Gene Ther 8, 308-15. Nakamori M, Fu X, Meng F, Jin A, Tao L, Bast RC Jr, Zhang X (2003) Effective therapy of metastatic ovarian cancer with an oncolytic herpes simplex virus incorporating two membrane fusion mechanisms. Clin Cancer Res 9, 2727-33. Nakamori M, Fu X, Pettaway CA, Zhang X (2004) Potent antitumor activity after systemic delivery of a doubly fusogenic oncolytic herpes simplex virus against metastatic prostate cancer. Prostate 60, 53-60. Nakamori M, Fu X, Rousseau R, Chen SY, Zhang X (2004) Destruction of nonimmunogenic mammary tumor cells by a fusogenic oncolytic herpes simplex virus induces potent antitumor immunity. Mol Ther 9, 658-65. Nanda D, Vogels R, Havenga M, Avezaat CJ, Bout A, Smitt PS (2001) Treatment of malignant gliomas with a replicating adenoviral vector expressing herpes simplex virus-thymidine kinase. Cancer Res 61, 8743-50. Nemunaitis J, Ganly I, Khuri F, Arseneau J, Kuhn J, McCarty T, Landers S, Maples P, Romel L, Randlev B, Reid T, Kaye S, Kirn D (2000) Selective replication and oncolysis in p53 mutant tumors with ONYX-015, an E1B-55kD gene-deleted adenovirus, in patients with advanced head and neck cancer: a phase II trial. Cancer Res 60, 6359-66. Nemunaitis J, Khuri F, Ganly I, Arseneau J, Posner M, Vokes E, Kuhn J, McCarty T, Landers S, Blackburn A, Romel L, Randlev B, Kaye S, Kirn D (2001) Phase II trial of intratumoral administration of ONYX-015, a replicationselective adenovirus, in patients with refractory head and neck cancer. J Clin Oncol 19, 289-98. Norman KL, Lee PW (2000) Reovirus as a novel oncolytic agent. J Clin Invest 105, 1035-8. Pecher G, Haring A, Kaiser L, Thiel E (2002) Mucin gene (MUC1) transfected dendritic cells as vaccine: results of a phase I/II clinical trial. Cancer Immunol Immunother 51, 669-73. Post DE, Khuri FR, Simons JW, Van Meir EG (2003) Replicative oncolytic adenoviruses in multimodal cancer regimens. Hum Gene Ther 14, 933-46. Qian Q, Sham J, Che X, Xu J, Xue H, Cui Z, Zhu B, Wu M (2002) Gene-viral vectors: a promising way to target tumor cells and express anticancer genes simultaneously. Chin Med J (Engl) 115, 1213-7. Rampling R, Cruickshank G, Papanastassiou V, Nicoll J, Hadley D, Brennan D, Petty R, MacLean A, Harland J, McKie E,

Mabbs R, Brown M (2000) Toxicity evaluation of replication-competent herpes simplex virus (ICP 34.5 null mutant 1716) in patients with recurrent malignant glioma. Gene Ther 7, 859-66. Reid T, Warren R, Kirn D (2002) Intravascular adenoviral agents in cancer patients: lessons from clinical trials. Cancer Gene Ther 9, 979-86. Ring CJ (2002) Cytolytic viruses as potential anti-cancer agents. J Gen Virol 83, 491-502. Rogulski KR, Freytag SO, Zhang K, Gilbert JD, Paielli DL, Kim JH, Heise CC, Kirn DH (2000) In vivo antitumor activity of ONYX-015 is influenced by p53 status and is augmented by radiotherapy. Cancer Res 60, 1193-6. Rogulski KR, Wing MS, Paielli DL, Gilbert JD, Kim JH, Freytag SO (2000) Double suicide gene therapy augments the antitumor activity of a replication-competent lytic adenovirus through enhanced cytotoxicity and radiosensitization. Hum Gene Ther 11, 67-76. Rosenfeld ME, Vickers SM, Raben D, Wang M, Sampson L, Feng M, Jaffee E, Curiel DT (1997) Pancreatic carcinoma cell killing via adenoviral mediated delivery of the herpes simplex virus thymidine kinase gene. Ann Surg 225, 609-18, discussion 618-20. Rothmann T, Hengstermann A, Whitaker NJ, Scheffner M, zur Hausen H (1998) Replication of ONYX-015, a potential anticancer adenovirus, is independent of p53 status in tumor cells. J Virol 72, 9470-8. Rots MG, Curiel DT, Gerritsen WR, Haisma HJ (2003) Targeted cancer gene therapy: the flexibility of adenoviral gene therapy vectors. J Control Release 87, 159-65. Saimura M, Nagai E, Mizumoto K, Maehara N, Okino H, Katano M, Matsumoto K, Nakamura T, Narumi K, Nukiwa T, Tanaka M (2002) Intraperitoneal injection of adenovirusmediated NK4 gene suppresses periton eal dissemination of pancreatic cancer cell line AsPC-1 in nude mice. Cancer Gene Ther 9, 799-806. Sakorafas GH, Tsiotos GG (2001) Molecular biology of pancreatic cancer: potential clinical implications. BioDrugs 15, 439-52. Sangro B, Mazzolini G, Ruiz J, Herraiz M, Quiroga J, Herre ro I, Benito A, Larrache J, Pueyo J, Subtil JC, Olague C, Sola J, Sadaba B, Lacasa C, Melero I, Qian C, Prieto J (2004) Phase I trial of intratumoral injection of an adenovirus encoding interleukin-12 for advanced digestive tumors. J Clin Oncol 22, 1389-97. Sinkovics JG, Horvath JC (2000) Newcastle disease virus (NDV): brief history of its oncolytic strains. J Clin Virol 16, 1-15. Sundaresan P, Hunter WD, Martuza RL, Rabkin SD (2000) Attenuated, replication-competent herpes simplex virus type 1 mutant G207: safety evaluation in mice. J Virol 74, 383241. Tang ZH, Qiu WH, Wu GS, Yang XP, Zou SQ, Qiu FZ (2002) The immunotherapeutic effect of dendritic cells vaccine modified with interleukin-18 gene and tumor cell lysate on mice with pancreatic carcinoma. World J Gastroenterol 8, 908-12. Taniuchi K, Nakagawa H, Hosokawa M, Nakamura T, Eguchi H, Ohigashi H, Ishikawa O, Katagiri T, Nakamura Y (2005) Overexpressed P-cadherin/CDH3 promotes motility of pancreatic cancer cells by interacting with p120ctn and activating rho-family GTPases. Cancer Res 65, 3092-9. Toda M, Rabkin SD, Martuza RL (1998) Treatment of human breast cancer in a brain metastatic model by G207, a replication-competent multimutated herpes simplex virus 1. Hum Gene Ther 9, 2177-85. Todo T, Feigenbaum F, Rabkin SD, Lakeman F, Newsome JT, Johnson PA, Mitchell E, Belliveau D, Ostrove JM, Martuza

Li et al: Viral vectors in pancreatic cancer gene therapy RL (2000) Viral shedding and biodistribution of G207, a multimutated, conditionally replicating herpes simplex virus type 1, after intracerebral inoculation in aotus. Mol Ther 2, 588-95. Todo T, Rabkin SD, Sundaresan P, Wu A, Meehan KR, Herscowitz HB, Martuza RL (1999) Systemic antitumor immunity in experimental brain tumor therapy using a multimutated, replication-competent herpes simplex virus. Hum Gene Ther 10, 2741-55. Tseng JF, Farnebo FA, Kisker O, Becker CM, Kuo CJ, Folkman J, Mulligan RC (2002) Adenovirus-mediated delivery of a soluble form of the VEGF receptor Flk1 delays the growth of murine and human pancreatic adenocarcinoma in mice. Surgery 132, 857-65. Tseng JF, Farnebo FA, Kisker O, Becker CM, Kuo CJ, Folkman J, Mulligan RC (2003) Pancreatic cancer growth is inhibited by blockade of VEGF-RII. Surgery 134, 772-82. Tseng JF, Mulligan RC (2002) Gene therapy for pancreatic cancer. Surg Oncol Clin N Am 11, 537-69. Walker JR, McGeagh KG, Sundaresan P, Jorgensen TJ, Rabkin SD, Martuza RL (1999) Local and systemic therapy of human prostate adenocarcinoma with the conditionally replicating herpes simplex virus vector G207. Hum Gene Ther 10, 2237-43. Wesseling JG, Bosma PJ, Krasnykh V, Kashentseva EA, Blackwell JL, Reynolds PN, Li H, Parameshwar M, Vickers SM, Jaffee EM, Huibregtse K, Curiel DT, Dmitriev I (2001) Improved gene transfer efficiency to primary and established human pancreatic carcinoma target cells via epidermal growth factor receptor and integrin-targeted adenoviral vectors. Gene Ther 8, 969-76. Wey JS, Gray MJ, Fan F, Belcheva A, McCarty MF, Stoeltzing O, Somcio R, Liu W, Evans DB, Klagsbrun M, Gallick GE, Ellis LM (2005) Overexpression of neuropilin-1 promotes constitutive MAPK signalling and chemoresistance in pancreatic cancer cells. Br J Cancer 93, 233-41. Wilcox ME, Yang W, Senger D, Rewcastle NB, Morris DG, Brasher PM, Shi ZQ, Johnston RN, Nishikawa S, Lee PW, Forsyth PA (2001) Reovirus as an oncolytic agent against experimental human malignant gliomas. J Natl Cancer Inst 93, 903-12. XP, Yazawa K, Yang J, Kohn D, Fisher WE, Brunicardi FC (2004) Specific gene expression and therapy for pancreatic

cancer using the cytosine deaminase gene directed by the rat insulin promoter. J Gastrointest Surg 8, 98-108. Yamamoto M, Davydova J, Wang M, Siegal GP, Krasnykh V, Vickers SM, Curiel DT (2003) Infectivity enhanced, cyclooxygenase-2 promoter-based conditionally replicative adenovirus for pancreatic cancer. Gastroenterology 125, 1203-18. Yazawa K, Fisher WE, Brunicardi FC (2002) Current progress in suicide gene therapy for cancer. World J Surg 26, 783-9. Yoon SS, Nakamura H, Carroll NM, Bode BP, Chiocca EA, Tanabe KK (2000) An oncolytic herpes simplex virus type 1 selectively destroys diffuse liver metastases from colon carcinoma. FASEB J 14, 301-11. Yu DC, Sakamoto GT, Henderson DR (1999) Identification of the transcriptional regulatory sequences of human kallikrein 2 and their use in the construction of calydon virus 764, an attenuated replication competent adenovirus for prostate cancer therapy. Cancer Res 59, 1498-504. Zhao L, Gu J, Dong A, Zhang Y, Zhong L, He L, Wang Y, Zhang J, Zhang Z, Huiwang J, Qian Q, Qian C, Liu X (2005) Potent antitumor activity of oncolytic adenovirus expressing mda-7/IL-24 for colorectal cancer. Hum Gene Ther 16, 84558.

Min Li

Gene Therapy and Molecular Biology Vol 10, page 1 Gene Ther Mol Biol Vol 10, 1-12, 2006

Low-usage codons and rare codons of Escherichia coli Mini Review

Dequan Chen* and Donald E. Texada Department of Ophthalmology, Louisiana State University Health Sciences Center, Shreveport, LA 71130

__________________________________________________________________________________ *Correspondence: Dequan Chen, Ph.D., Institute for Retina Research, 8210 Walnut Hill Lane, PBI, Suite 010, Dallas, TX 75231, USA; Phone: (214) 345-6801; email: dequan.chen@irrdallas.org. Key words: low-usage codon, rare codon, common codon, major codon, codon usage, infrequent codon, rare tRNA, codon optimization, and rare tRNA supplementation Abbreviations: Escherichia coli, (E. coli); rare codon, (RC); rare codon cluster, (RCC) Received: 4 September 2005; Accepted: 28 December 2005; electronically published: January 2006

Summary In Escherichia coli (E. coli), a low-usage codon is defined as a codon that is used rarely or infrequently in the genome with usage frequency lower than the smallest value (or frequency cut-off) among the usage frequencies of non-degenerate codons (Met codon AUG and Trp codon UGG) and the optimal codons for amino acids Leu, Ile, Val, Ser, Pro, Thr, Ala, Arg, Gly and Gln that have 2 or more degenerate codons with each having specific corresponding cognate tRNA for the optimal codon. A rare codon (RC), an infrequent codon or a minor codon is equivalently defined as a synonymous codon or a stop codon that is not only used rarely or infrequently in a genome but also decoded by a low-abundant tRNA (rare tRNA) or other factor(s) in an organism. The translational rate for a sense RC is much lower than that for a common (major) codon due to tRNA availability. A low-usage codon is not necessarily a RC, e.g., Cys codons UGU and UGC, Thr codons ACU and ACG, or His codons CAC and CAU are not rare codons of E. coli. However, a RC is definitely a low-usage codon. In E. coli, there are about 30 low-usage synonymous sense codons but only 20 of them are determined to be the bacterial RCs including 7 (AGG, AGA, CGA, CUA, AUA, CCC and CGG) used at a frequency of < 0.5% (Group I) and 13 (ACA, CCU, UCA, GGA, AGU, UCG, CCA, UCC, GGG, CUC, CUU, UCU and UUA) used at a frequency of > 0.5% (Group II). Studies have demonstrated that all the RCs in Group I and the first 6 RCs in Group 2 can cause translational problems in E. coli. target gene, the mRNA low stability and slow translational efficiency, the uneasy protein folding, the target protein degradation by E. coli proteases, the different codon usage between the organism of the foreign gene and native E. coli, or the toxicity of the expressed target protein (Olins et al, 1993; Makrides, 1996; Jonasson et al, 2002). A number of studies have revealed that RCs and rare codon clusters (RCC) are capable of qualitatively and quantitatively causing expression problems in E. coli or other organisms (Kane, 1995; Makrides, 1996; Gurvich et al, 2005), and these problems mainly occur on translation level rather than on transcription level or other levels. The main translational problems caused by RCs or RCCs include (a) that rare codons reduce the translation rate of the target gene, (b) the expressed target protein is low or undetectable, (c) amino acids are misincorporated into the target protein, (d) truncated or amino acids-deleted peptides or proteins are synthesized, and (e) frame-shifted peptides or proteins are synthesized (Pedersen, 1984; Pohlner et al, 1986; Sorensen et al, 1989; Gurskii et al,

I. Introduction Many proteins including those that can be used in treatment of certain disease (e.g., insulin), can rarely be obtained in large quantities from their natural sources. Besides, their purification or isolation is often not easy, and the cost is often pretty high. Recombinant DNA techniques have been successfully used in the past to express and purify these kinds of proteins. The bacterium E. coli has been and will continue to be the main, popular and first-choice expression host because it facilitates recombinant protein expression by its relative simplicity, its inexpensive and fast high-density cultivation, its wellknown genetics and the availability of a large number of compatible tools including mutant strains, recombinant fusion partners and plasmids (Gold, 1990; Hodgson, 1993; Olins and Lee, 1993; Kane, 1995; Makrides, 1996; Jonasson et al, 2002; Sorensen and Mortensen, 2005a; Sorensen and Mortensen, 2005b). However, not every foreign gene can be efficiently expressed in E. coli, probably due to the unique and subtle structure of the 1

Chen and Texada: E. coli low-usage codons and rare codons 1992b; Kane et al, 1992; Gursky and Beabealashvilli, 1994; Vilbois et al, 1994; Kane, 1995; Calderone et al, 1996; Kleber-Janke and Becker, 2000; Kapust et al, 2002; McNulty et al, 2003; Flick et al, 2004; Shu et al, 2004; Choi et al, 2004; Chen et al, 2004; Gurvich et al, 2005). However, different groups often arbitrarily used different sets of codons as their rare or low-usage codons, or equivalently used low-usage codons and rare-tRNA associated codons. This may at least result in the following problems: (a) some codons are rare codons or low-usage codons to some groups but not to others, and vice versa; and (b) over- or under-estimation of the effects of rare codons on the expression of a gene even in the same system just because of the difference of low-usage or rare codons being defined or studied. To overcome these problems, universal meanings for low-usage codon and/or rare codon should be defined and the list of low-usage codons or rare codons in an organism should be determined. Therefore, the objectives of this review are mainly to unify and differentiate the meanings of a lowusage codon and a rare-tRNA associated codon (RC in short) as well as to determine the lists of the low-usage codons and rare-tRNA associated codons in E. coli.

not used with equal frequency in a genome (Ikemura, 1985; Sharp et al, 1988; Zhang et al, 1991; Sorensen et al, 2005a). This is also true for non-synonymous codon usage (non-random usage of different codons for different amino acids). Therefore, the codon usage among degenerate codons in each organism is biased, with some codons more preferred (at higher usage frequency or used more frequently) than the other(s). Further, studies also found that codon usage bias is greater in highly expressed genes than poorly expressed genes (Gouy and Gautier, 1982; Sharp and Li, 1986; Makrides, 1996). That is to say, highly expressed genes in an organism mostly use preferred codons (especially the most preferred or optimal codons) and avoid non-preferred codons while poorly expressed genes use fewer preferred or optimal codons but more non-preferred codons (Ikemura, 1985). Meanwhile, codon pair usage was even found not to be random (Nussinov, 1981; Lipman and Wilbur, 1983; Gutman and Hatfield, 1989; Irwin et al, 1995). The codon usage frequencies for the 64 codons (3 stop codons, and 61 sense codons - codons that encode amino acids) of E. coli, calculated from the GenBank genetic sequence data (Releases # 63, 69 and 147), are shown in Table 1 . The data in the table demonstrate that as the total number of the codons or protein-coding genes included in each GenBank release increases (especially from #69 to #147, which is about 8 times increase), the calculated frequency for a given sense codon changes as follows: (a) The frequencies of low-usage codons (highlighted by red, purpurple and blue) has a tendency to increase (those of CUC, GUA, UCG, CCA, CAU, UGU, CGA, UCU and ACU increase very little while those of others a lot) except those of CAC, UGC and UCC (the last two usage frequencies decrease very little); (b) The frequencies of some high-usage codons change very little (those of GUA, ACU, GCC, GCA and GAU increase while those of AUG, GUU, GUC, GCU, AAA, GAG and AGC decrease), (c) The frequencies of some high-usage codons have a tendency to increase (for those of UUU, AUU, UAU, CAA, AAU and UGG) while the frequencies of other high-usage codons, on the contrary, have a tendency to decrease (for those of UUC, CUG, AUC, GUG, CCG, ACC, GCG, UAC, CAG, AAC, GAC, GAA, CGU, CGC GGU and GGC). The above results may imply the following: (1) Some codons, whether at high-usage (see above b) or at low-usage (see above a), are used at about the same frequency in the old sequenced proteins (e.g., the proteins included in GenBank release #69) as in the new sequenced proteins (e.g., the proteins included in GenBank release #147 but not in #69). Therefore, their usagefrequencies change very little between the GenBank releases, and the usage frequency calculated from GenBank release #69 or 147 should all well represent their real-time codon usage frequencies (Table 1). (2) Most low-usage codons (see above a) and some high-usage codons (see above c) are not well used by the old sequenced proteins, and the new sequenced proteins (e.g., the proteins included in GenBank release #147 but

II. Codon usage in E. coli Codon usage was defined by Zhang et al in 1999 as the number of times (frequency) a codon is translated per unit time in the cell of an organism. This is a definition for real-time codon usage. But it is hard to be measured in vivo. Zhang et al, used 3 different methods to estimate the codon usage in E. coli and other organisms in their studies including measuring the average frequencies of codons in the sequenced protein-coding genes in an organism. All their methods gave approximately the same results as regards the hierarchy for “most used’ and “least used” codons within each synonymous codon family (Zhang et al, 1991). Therefore, it is reasonable to use averaged codon frequency of the sequenced protein-coding reading frames of an organism to roughly represent the real-time codon usage although this may over-estimate the usages of infrequently or rarely used codons and underestimate those of frequently used codons because different reading frames are used and translated for different number of times in the organism at a given time (Zhang et al, 1991). Besides, this is what codon usage generally means to many scientists in the past and at present. Before the 1980s and after the discovery of genetic code redundancy or degeneracy (an amino acid except Met and Trp is encoded by 2 to 6 codons), it was often thought that degenerate codons for the same amino acid were used randomly in a genome. This is based on the simplest assumption that all genomes have uniform codon usage meaning that synonymous codons (degenerate codons for same amino acid) are used with equal frequency. As more and more sequence data (especially the gene sequences of bacterium E. coli and yeast Saccharomyces cerevisiae) appeared in the late 1970s and early 1980s, it came to light that (a) synonymous codon usage is consistently similar for all genes within each type of genome or organism (Grantham et al, 1980a,b, 1981), and (b) synonymous codon usage was not random, i.e., synonymous codons are 2

Gene Therapy and Molecular Biology Vol 10, page 3 not in #69) have used more of them. Therefore, their usage frequencies increase over the total number of protein genes included in the GenBank releases. Two factors should contribute to the phenomenon: one factor is that these codons especially low-usage codons are more frequently used in the new sequenced protein genes (most of them are poorly expressed), which results in the increase of their calculated usage frequencies; the other factor, on the contrary, is that poorly expressed genes have low expression rates at a give time of the bacterial life, and averaging over the entire genome without weighting the number of times different reading frames are being translated leads to over-estimation of their codon usage frequencies (Zhang et al, 1991). Therefore, the real-time codon usage frequencies for these codons should be much lower than the data calculated from GenBank release #147 but somewhere around the data from GenBank release #69 (Table 1). (3) Some high-usage codons (see above c) are well used by the old sequenced proteins, and the new sequenced proteins (e.g., the proteins included in GenBank release #147 but not in #69) have used less of them. Therefore, their usage frequencies decrease over the total number of protein genes included in the GenBank releases. The above two factors should also contribute to this but in

a reverse direction: the first factor is that these codons are less frequently used in the new sequenced protein genes (most of them are poorly expressed), which results in the true decrease of their calculated usage frequencies; the second is that poorly expressed genes have low expression rates at a give time of the bacterial life, and averaging over the entire genome without weighting the number of times different reading frames are being translated leads to under-estimation of the codon usage frequencies for these codons (Zhang et al, 1991). Therefore, the real-time codon usage frequencies for these codons should be much higher than the data from GenBank release #147 but somewhere around the data from GenBank release #69 or even #63 (Table 1). The above analysis suggests that the frequency values listed in the II columns (calculated from GenBank release #69) of Table 1 most likely and approximately better represent the real-time codon usage frequencies in E. coli. Dong et al, measured E. coli codon usage frequencies at different bacterial growth rates (0.4-2.5 doublings per hour), which were calculated from the coding frames of 140 protein mRNAs (Dong et al, 1996). The results has been adapted and presented to Table 2.

Table 1. Codon frequencies used by protein-coding reading frames of E. colia Ib

II c

III d

UUU 18.85

19.2

22.46

UUC 18.07

18.2

15.62

UUA 10.52

10.9

UUG 11.33

11.5

CUU 9.92 CUC 9.70

II c

III d

UCU 10.47

10.4

10.94

UCC 9.43

9.4

9.29

14.98

UCA 6.52

6.8

12.86

UCG 7.89

8.0

10.2

12.49

CCU 6.57

9.9

10.08

CCC 4.19

CUA 2.97

3.2

4.47

CUG 54.10

54.6

46.04

AUU 27.27

27.2

AUC 26.97

II c

III d

II c

III d

UAU 15.09

15.4

18.34

UGU 4.80

4.7

5.35

UAC 13.29

13.4

12.01

UGC 6.07

6.1

5.99

9.94

UAA 1.99

2.0

1.99

UGA 0.80

0.8

1.04

8.52

UAG 0.20

0.2

0.29

UGG 12.90

12.8

13.78

6.6

7.90

CAU 11.35

11.6

12.47

CGU 24.70

24.1

18.92

4.3

5.63

CAC 10.74

10.7

8.82

CGC 21.50

22.1

18.38

CCA 8.12

8.2

8.63

CAA 13.07

13.2

14.38

CGA 3.06

3.1

4.03

CCG 23.91

23.8

19.35

CAG 29.68

30.1

28.12

CGG 4.62

4.6

6.49

29.67

ACU 10.83

10.2

11.02

AAU 16.30

16.3

22.83

AGU 7.37

7.2

10.73

26.5

22.69

ACC 24.37

24.3

21.39

AAC 24.35

23.9

21.20

AGC 14.95

15.2

15.00

AUA 3.94

4.1

8.22

ACA 6.53

6.5

10.70

AAA 37.47

36.5

35.60

AGA 2.14

2.1

4.47

AUG 26.33

26.5

25.95

ACG 12.54

12.7

13.78

AAG 11.94

12.0

13.05

AGG 1.32

1.4

2.56

GUU 20.79

20.1

20.04

GCU 17.86

17.4

17.36

GAU 32.14

32.3

32.88

GGU 28.48

27.6

24.93

GUC 14.09

14.2

14.04

GCC 23.18

23.5

23.87

GAC 22.03

21.8

18.83

GGC 30.41

30.2

25.66

GUA 12.06

11.6

11.90

GCA 20.92

20.8

21.60

GAA 43.75

43.4

38.02

GGA 6.95

7.0

10.61

GUG 24.68

25.3

23.47

GCG 32.94

33.1

27.99

GAG 19.03

19.2

18.80

GGG 9.63

9.7

11.58

a. The usage of each codon is expressed as the frequency per 1000 codons, which is calculated by division of the absolute number of the indicated codon by the total number of codons used in all the sequenced E. coli protein-coding sequences or reading frames. b. Taken from Zhang et al (1991). Codon usage frequency was calculated from 323059 codons of 968 protein coding reading frames (CDS) (GenBank Version 63.0, 15 March 1990). c. Taken from Wada et al (1991). Codon usage frequency was calculated from 524410 codons of 1562 protein coding reading frames (CDS) (GenBank Version 69.0, September 1991). d. Taken and adapted from http://www.kazusa.or.jp/codon (Nakamura et al, 2000). Codon usage frequency was calculated from 4182749 codons of 13778 protein coding reading frames (CDS) (GenBank Version 147.0, 1 June 2005).

Chen and Texada: E. coli low-usage codons and rare codons Table 2. Real-time codon frequencies used by protein-coding reading frames of E. colia Rate b

Growth 0.4

1.07

2.5

Rate b

Growth 0.4

1.07

Rate b

Growth

2.5

0.4

1.07

2.5

Rate b

Growth 0.4

1.07

2.5

UUU 12.55

10.30

7.92

UCU 13.12

14.14

16.33

UAU 10.68

8.90

6.72

UGU 4.23

3.64

2.76

UUC 22.68

22.44

23.25

UCC 11.15

12.09

11.68

UAC 16.20

16.71

16.52

UGC 5.29

4.77

3.81

UUA 6.13

4.64

2.73

UCA 3.89

3.09

1.98

UAA 2.77

3.38

4.18

UGA 0.31

0.23

0.19

UUG 6.63

5.72

4.27

UCG 6.05

4.58

2.51

UAG 0.00

0.00

UGG 9.76

8.69

7.03

CUU 5.70

4.64

3.86

CCU 4.99

4.79

4.38

CAU 9.23

8.11

6.78

CGU 31.12

36.61

43.82

CUC 6.19

5.52

4.09

CCC 3.32

2.10

1.09

CAC 13.90

13.91

14.21

CGC 22.25

22.39

20.59

CUA 2.15

1.53

0.82

CCA 6.52

6.40

5.18

CAA 10.91

8.98

7.01

CGA 1.32

0.99

0.67

CUG 60.13

61.29

60.75

CCG 29.51

28.88

28.82

CAG 29.24

28.33

27.28

CGG 1.75

1.23

0.62

AUU 21.38

19.26

15.79

ACU 13.88

16.76

20.64

AAU 9.79

7.79

5.61

AGU 3.99

3.01

2.19

AUC 36.68

39.15

43.86

ACC 26.51

27.10

26.70

AAC 27.95

28.64

29.21

AGC 11.97

10.69

9.31

AUA 0.93

0.75

0.52

ACA 3.48

2.99

2.61

AAA 44.43

49.07

55.01

AGA 1.12

0.84

0.63

AUGc 25.32

25.82

25.90

ACG 7.53

6.21

4.17

AAG 12.08

13.74

17.22

AGG 0.09

0.05

0.03

GUU 31.31

35.63

43.18

GCU 28.85

32.14

39.49

GAU 24.25

22.40

19.27

GGU 38.29

40.49

45.55

GUC 11.25

9.71

7.67

GCC 19.80

16.81

11.81

GAC 28.72

30.93

33.74

GGC 35.62

35.54

34.17

GUA 15.87

18.65

22.31

GCA 22.13

22.38

24.87

GAA 53.10

55.10

57.86

GGA 2.71

2.21

1.26

GUG 21.40

18.93

14.98

GCG 30.33

28.45

24.11

GAG 16.57

17.04

16.97

GGG 4.81

3.57

2.36

a. Taken from Dong et al (1996). The usage of each codon is expressed as the frequency per 1000 codons. The codon frequencies were the averages from 140 proteins and calculated on the basis of the relative weight fraction of each protein and on the assumption that the amount of a protein accumulated in the cell during the steady growth is proportional to the amount of its corresponding mRNA in the bacteria. b. Growth rate is expressed as doublings per hour. Different growth rates were obtained by varying the nutrient contents of the culturing media (Dong et al, 1996). c. The data for AUG usage frequency are the sum of the frequencies for Metf1, Metf2, and Metm.

Although the number of protein coding frames used is very small, the frequency values were obtained by weighting every protein amount at each growth rate of E. coli according to the data reported by Pedersen et al (Pedersen et al, 1978). Therefore, the codon usage frequencies in Table 2 are real-time codon usage values. The data in Table 2 demonstrate that (a) E. coli codon usage is biased at all studied bacterial growth rate, (b) the frequencies of low-usage sense codons (marked by red and purple) decrease with increasing growth rate, and (c) the frequencies of some high-usage sense codons (UUC, AUC, GUU, GUA, UCU, ACU, GCU, GCA, CAC, AAC, AAA, GAC, GAA, CGU and GGU) increase while those of others decrease over the increase of growth rate. In addition, most codon usage frequencies in Table 2 are in good agreement with those in Table 1.

to various growth conditions (Gouy et al, 1982), the adaptation of codons to tRNA availability (Ikemura, 1980, 1981a,b, 1985), the adaptation of codon-anticodon paring or interaction to have optimal or intermediate energy strength (Grosjean et al, 1978; Grosjean and Fiers, 1982), the adaptation of codon mutations to form specific mRNA secondary structure(s), etc. But codon adaptation to tRNA availability are attributed to have played a key role in the formation of biased codon usage because organismspecific codon usage patterns were demonstrated to correlate with the abundance spectra of organism-specific populations of isoaccepting or cognate tRNAs (Ikemura, 1980, 1981a,b, 1985). The relative contents of tRNAs for normally growing E. coli, which were measured by Ikemura (1981a, 1981b, 1985), are listed in Table 3. The data (relative contents for 38 or 40 tRNAs) in the table demonstrate that: (a) the abundance of tRNAGly3 is the highest (relative amount is 1.1) among all the E. coli tRNAs and it can recognize/decode two codons (GGU and GGC), immediately followed by tRNAVal1, tRNAAla(GCY) and

III. tRNA abundance in E. coli Codon usage bias in an organism may have been formed during evolution by the combinatory effects of various factors such as the adaptation of gene expressivity 4

Gene Therapy and Molecular Biology Vol 10, page 5 tRNAIle1 (relative amounts are 1.05, 1.04 and 1.0 respectively) in succession with the first recognize 3 codons (GUA, GUG and GUU) while the latter 2 recognizing 2 codons (GCC and GCU, AUU and AUC respectively); (b) tRNA Leu1 is a tRNA that recognizes only one single codon (CUG) and at the same time has the highest abundance (relative amount is 1.0); (c) some tRNAs including the cognate tRNAs for CUA, AUA, CGG, AGA and AGG, ACA and ACG, CCC, or UGU and UGC, have very low abundances while the abundances for other tRNAs are different with relative amounts ranging from 0.1 to 0.9; and (d) UCU (for Ser), GUU (for Val), GCU (for Ala), and GGG (for Gly) are recognized by 2 isoacceptor-tRNAs. In addition, the relative contents of tRNAs (43 or 45 tRNAs) for E. coli growing at different rates (0.4, 0.7, 1.07, 1.6 and 2.5 doublings/hour), measured by Dong et al (Dong et al, 1996), are listed in Table 4.The data in Table 4 suggest that tRNA abundance in E. coli varies with bacterial growth rate - increases over the increase of growth rate (the increase amplitude varies with different tRNAs). Most tRNA relative contents in Table 4 are in agreement with those in Table 3. The data of Tables 1 and 2, with those of Tables 3 and 4, altogether support the concept that the usage frequency of synonymous codon often reflects or correlates with the abundance of its cognate tRNA in E. coli (Garel, 1974; Garel et al, 1981; Ikemura, 1985; Bulmer, 1987; Emilsson and Kurland, 1990; Emilsson et al, 1993; Kane, 1995; Makrides, 1996; Dong et al, 1996).

(such as high-usage codons with high-abundant tRNAs and low-usage codons with low-abundant tRNAs), together with the so far reported expression problems derived from low-usage codons and/or their cognate tRNA availability, suggest that just one term to cover all the above meanings is not enough. To satisfy the above requirements, a RC, an infrequent codon or a minor codon is equivalently defined as a synonymous codon that is not Table 3. Relative contents of tRNAs in E. coli a tRNA Leu: 1 2 UUR CUA Val: 1 2 Gly: 1 2 3 Ala: 1 GCY Arg: 1, 2 CGG AGR Ile: 1 2 Lys Glu 2 (1) Asp 1 Thr: 1+3 4 Asn Gln: 1 2 Tyr: 1+2 Ser: 1 3 UCY His Trp Pro: 1 2 3 Phe Cys Met: m f1 f2

IV. Definition of low-usage codon and rare codon Low-usage codon is often called RC, minor codon, and infrequent codon because all of them imply that the usage of such a codon in a genome or an organism is low or very low, in other words, the codon is used rarely or infrequently in a genome or an organism. All the above terms have been equivalently used in the past. But different groups defined different sets of codons as their low-usage codons (although most groups included the several least usage codons in their low-usage codon sets) due to (a) the different numbers of the available proteincoding gene sequences for calculating the codon usage frequencies, and (b) the arbitrary frequency cut-offs which were used by different people (e.g. 0.5%, 1.0%, or 1.1%) to define the boundary between low-usage codons and common codons. The above may result in the following problems: (a) some codons, are low-usage codons to some people but not to others, and vice versa; e.g., GUC and GCC were considered as RC by Pedersen (1984) but not us; (b) different results or conclusions regarding the effects of low-usage codons on the expression of a gene(s) (often over- or under-estimation occurs) may be obtained for the same system just because of the difference of lowusage codons being defined or studied; (c) the results from different groups, for the same gene, are often hard to be compared with each other. Therefore, universal definition(s) for the above terms, or universal terms with fixed meanings is required. The correlation of the usage frequency of a synonymous codon with its cognate tRNA abundance

Recognized codon CUG CUU, CUC UUA, UUG CUA GUA, GUG, GUU* GUC, GUU* GGG* GGA,GGG* GGU, GGC GCA, GCG, GCU* GCC, GCU* CGU, CGC, CGA CGG AGA, AGG AUU, AUC AUA AAA, AAG GAA, GAG GAU, GAC ACU, ACC ACA, ACG AAU, AAC CAA CAG UAU, UAC UCU*, UCA, UCG AGU, AGC UCC, UCU* CAC, CAU UGG CCG CCC CCU, CCA, CCG UUU, UUC UGU, UGC AUG AUG AUG

Content b 1.00 0.30 0.25 minor 1.05 0.40 0.10 0.15 1.10 0.85 1.04 0.90 minor minor 1.00 0.05 1.00 0.90 0.80 0.80 minor 0.60 0.30 0.40 0.50 0.25 0.25 0.40 0.30 major minor major 0.35 minor 0.30 0.40 0.10

a. Taken and adapted from Ikemura (1981a,b, 1985) b. The content is the relative amount to that of tRNALeu1(CUG) that is normalized to 1.0 and approximately on the order of 104 molecules per cell for normally growing E. coli. *. A single codon is recognized by 2 tRNAs.

Chen and Texada: E. coli low-usage codons and rare codons Table 4. Relative contents of tRNAs in E. coli at different growth rates tRNA

Leu:

Val:

Gly: Ala: Arg:

Ile: Lys Glu Asp Thr:

Asn Gln: Tyr: Ser:

His Trp Pro:

Phe Cys Met:

1 2 3 4 5 1 2A 2B 1+2 3 1B 2 2 3 4 5 1+2 2 1 1 2 3 4 1 2 1 2 1 2 3 5

1 2 3

m f1 f2

Recognized codon(s)

CUG CUC, CUU CUA, CUG UUG UUA,UUG GUA, GUG, GUU GUC, GUU GUC, GUU (GGG) / (GGA,GGG) GGC, GGU GCU, GCA, GCG GCC CGU, CGC, CGA CGG AGA AGG (AUC, AUU) / AUA AAA, AAG GAA, GAG GAC, GAU , ACC, ACU ACG ACC, ACU ACA, ACU, ACG AAC, AAU CAA CAG UAC, UAU UAC, UAU UCA, UCU, UCG UCG AGC, AGU UCC, UCU CAC, CAU UGG CCG CCC, CCU CCA, CCU, CCG UUC, UUU UGC, UGU , AUG AUG AUG

Growth Rate (doublings per hour) 0.4

0.7

1.07

1.6

2.5

1.00 0.21 0.15 0.43 0.25 0.86 0.14 0.14 0.48 0.98 0.73 0.14 1.06 0.14 0.19 0.09 0.78 0.43 1.05 0.54 0.02 0.12 0.25 0.20 0.27 0.17 0.20 0.17 0.28 0.29 0.08 0.31 0.17 0.14 0.21 0.20 0.16 0.13 0.23 0.36 0.16 0.27 0.16

1.06 0.25 0.18 0.45 0.25 0.86 0.14 0.17 0.51 1.08 0.83 0.15 1.03 0.18 0.17 0.11 0.84 0.48 1.10 0.58 0.03 0.14 0.26 0.22 0.27 0.19 0.22 0.17 0.27 0.39 0.07 0.31 0.18 0.16 0.20 0.17 0.18 0.13 0.26 0.35 0.18 0.34 0.16

1.19 0.29 0.19 0.49 0.29 0.78 0.17 0.19 0.55 1.19 1.00 0.17 1.10 0.10 0.19 0.11 0.94 0.52 1.18 0.60 0.04 0.15 0.27 0.23 0.31 0.26 0.25 0.19 0.27 0.39 0.08 0.32 0.20 0.19 0.24 0.25 0.16 0.16 0.30 0.37 0.21 0.43 0.17

1.51 0.33 0.23 0.68 0.26 1.35 0.19 0.26 0.78 1.41 1.24 0.23 1.68 0.16 0.23 0.17 1.34 0.62 1.71 0.85 0.04 0.19 0.34 0.35 0.43 0.22 0.36 0.33 0.37 0.49 0.10 0.38 0.26 0.24 0.29 0.19 0.28 0.18 0.33 0.50 0.29 0.45 0.24

1.57 0.42 0.22 0.66 0.27 1.45 0.20 0.31 0.79 1.77 1.49 0.25 1.81 0.16 0.25 0.16 1.75 0.74 2.08 1.10 0.05 0.22 0.39 0.49 0.52 0.31 0.44 0.30 0.36 0.52 0.10 0.40 0.29 0.31 0.36 0.19 0.27 0.18 0.36 0.50 0.31 0.72 0.27

only used rarely or infrequently in a genome but also decoded by a low-abundant tRNA (rare tRNA) or other factor(s) such as less-efficient translation releasing factor(s) in an organism. Therefore, a RC encoding an amino acid is a rare-tRNA associated codon while a RC for translation termination is a stop codon with lowest usage frequency in a genome. Meanwhile, a low-usage codon is defined as a codon (whether synonymous or not) that is used rarely or infrequently in a genome, and its

usage frequency should be: (a) lower than the usage frequencies of the non-degenerate codons (that is, AUG for Met, and UGG for Trp); (b) lower than the usage frequencies of the optimal codons for amino acids (Leu, Ile, Val, Ser, Pro, Thr, Ala, Arg, Gly and Gln) with 2 or more degenerate codons because these amino acids have 2 or more tRNA carriers with at least one to specify the corresponding optimal codon of each amino acid; (c) lower than the smallest value (cut-off frequency) among 6

Gene Therapy and Molecular Biology Vol 10, page 7 tRNAAsn which has a relative amount of 0.6 (Ikemura, 1985) or > 0.27 (Dong et al,1996). Besides, the usage frequencies of AAU calculated from the 3 GenBank releases are much higher than those (14.95, 15.2 and 15.0 per thousand) of AGC (the optimal codon of Ser). Moreover, UGU and UGC for Cys, CAC and CAU for His, AAG for Lys, and AAU for Asn are not regarded as rare codon in Table 5 because these amino acids all have 2 synonymous codons that are respectively decoded by a single tRNA (Crick’s “wobble hypothesis” can explain why a single tRNA can recognize multiple degenerate codons (Crick, 1966). In addition, whether the above 10 low-usage sense codons that have been excluded from E. coli rare codon list can cause significant expression problems, has never been reported. There are 9 amino acids (Phe, Tyr, His, Gln, Asn, Lys, Asp, Glu and Cys) that have only 2 synonymous codons. Tables 3 and 4 demonstrate that (a) the 2 synonymous codons of Phe, His, Asn, Lys, Cys, Asp or Glu are specified by a single tRNA; (b) the 2 codons (UAU and UAC) of Tyr are non-differentially recognized by the 2 tyrosinyl tRNAs (tRNATyr1 and tRNA Tyr2); and (c) Gln has 2 tRNAs and each recognize a Gln codon (tRNAGln1 for CAA and tRNAGln2 for CAG). Although there exists usage difference in the 2 synonymous codons for each of the 8 amino acids Phe, Tyr, His, Asn, Lys, Asp, Glu and Cys, it is not due to their tRNA availability (Grosjean et al, 1978) but mainly to gene expressivity (Gouy et al, 1982; Ikemura, 1985). The usage differences in the 2 synonymous codons of the above 8 amino acids may be explained by the “rules” proposed for the choice or usage preference of the synonymous codons that are decoded by a single tRNA (Gouy et al, 1982; Ikemura, 1985). Therefore, any codon for the above amino acids (except Gln) cannot be regarded as a rare codon even though it may be a low-usage codon according to the usage cut-off determined as described above. In this paper, the following codons are considered to be the rare sense codons of E. coli and are classified into 2 groups: (a) Group I: AGG, AGA, CGA, CUA, AUA, CCC and CGG (arranged from least usage to high usage based on the average usage frequency). The usage frequency of each codon calculated from GenBank release #69 is < 0.5%. (b) Group II: ACA, CCU, UCA, GGA, AGU, UCG, CCA, UCC, GGG, CUC, CUU, UCU and UUA (arranged from least usage to high usage based on the average usage frequency). The usage frequency of each codon calculated from GenBank release #69 is > 0.5% but < 1.1%. Some rare sense codons in Group II (namely the first highlighted 6 in the above list) have been reported to be involved in translational problems (Konigsberg and Godson, 1983; Chen and Inouye, 1990a; Ma et al, 2003; Zhou et al, 2004). According to this, Group II can further be classified into 2 subgroups: Group IIa: ACA, ACU, UCA, GGA, AGU and UCG; Group II b: CCA, UCC, GGG, CUC, CUU, UCU and UUA. At present, whether rare sense codons in Group IIb can cause expression problems have not been reported, and

the usage frequencies listed in (a) and (b). Therefore, cutoff frequency is an objective value rather than an arbitrary one for defining the boundary between low-usage codons and common codons in each organism. Data in Tables 1 and 2 suggest that the usage frequency of Trp codon UGG is the very cut-off frequency value of E. coli.

V. Determination of E. coli low-usage codons and rare codons Based on the above definitions, a low-usage codon is not necessarily a RC but a RC is definitely a low-usage codon. All the 3 stop codons (UAA, UAG and UGA) of E. coli (Tables 1 and 2) are the least usage codons of the bacterium. According to the above definitions, they should be low-usage codons. However, UAA cannot be regarded as the rare stop codon but a major stop codon of E. coli because it has the highest usage among the 3 stop codons. The low-usage sense codons of E. coli, based on the 1.28% cut-off of usage frequency calculated from GenBank release #69 (Table 1, columns of “II”) and on the 0.869% cut-off of real-time usage frequency calculated from 140 proteins of E. coli growing at the rate of 1.07 doublings/hour (Table 2), are all listed in Table 5. The relative tRNA contents measured by Ikemura (1980, 1981a,b, 1982, 1985) and Dong et al, 1996 are also included in the table. The 3 stop codons are all E. coli lowusage codons, but not listed in Table 5. Based on the above RC definition, 10 low-usage sense codons out of the 30 listed in Table 5 are excluded from the list of E. coli rare sense codons because of the following reasons: (a) UGU and UGC. They are the only synonymous codons of Cys, and both are decoded by a single tRNACys which has a relative amount of > 0.36 (Dong et al, 1996). (b) ACU and ACG. They are 2 synonymous codons of Thr (the total is 4), but they recognized by more than 2 tRNAs. ACU is recognized by tRNAThr1, tRNAThr3 and tRNAThr4, and the sum of the relative contents of these 3 tRNAs is > 0.45 (Dong et al, 1996) or 0.8 (Ikemura, 1985). ACG is recognized by tRNAThr2 and tRNAThr4, and the sum of the relative contents of these 2 tRNAs is > 0.32 (Dong et al, 1996) or minor (Ikemura, 1985). (c) CAC and CAU. They are the only synonymous codons of His, and both are decoded by a single tRNAHis which has a relative amount of 0.4 (Ikemura, 1985) or > 0.14 (Dong et al, 1996). (d) UUG. UUG is one of 6 synonymous codons of Leu, and is decoded by 2 tRNAs-tRNALeu4(UUG) and tRNALeu5(UUA,UUG). The relative amount of tRNALeu4(UUG) is 0.43 (Dong et al, 1996) while tRNALeu5(UUA,UUG) has a the relative amount of 0.25 (Ikemura, 1985) or > 0.25 (Dong et al, 1996). (e) GUA. GUA is one out of the 4 synonymous codons of Val. The single tRNA that can decode this codon is very high abundant and the relative amount is 1.05 (Ikemura, 1985) or > 0.78 (Dong et al, 1996). (f) AAG. Lys has only 2 synonymous codons AAA and AAG, and the 2 codons are decoded by a single tRNALys which has a relative amount of 1.0 (Ikemura, 1985) or > 0.43 (Dong et al, 1996). (g) AAU. Asn has only 2 synonymous codons AAU and AAC, and the 2 codons are decoded by a single 7

Chen and Texada: E. coli low-usage codons and rare codons Table 5. Low-usage sense codons of E. coli a

Amino Acid Arg Arg Arg Leu Ile Pro Arg *Cys *Cys Thr Pro Ser Gly Ser Ser Pro Ser Gly Leu Leu ยงThr

Ser *His Leu ยงLeu *His #Val *#Lys ยงThr *#Asn

Codon AGG AGA CGA CUA AUA CCC CGG UGU

Codon frequency (per thousand)b GenBank release # Growth Rate 63 69 147 0.4 1.07 2.5 1.3 1.4 2.6 0.09 0.05 0.03 2.1 2.1 4.5 1.32 0.99 0.67 3.1 3.1 4 1.32 0.99 0.67 3 3.2 4.5 2.15 1.53 0.82 3.9 4.1 8.2 0.93 0.75 0.52 4.2 4.3 5.6 3.32 2.1 1.09 4.6 4.6 6.4 1.75 1.23 0.62 4.8 4.7 5.3 4.23 3.64 2.76

Cognate tRNA relative amount and other codons c Growth Rate f Amount d Other Codons Other Codons e e 0.40 1.07 2.50 minor AGA 0.09 0.11 0.16 / minor AGG 0.19 0.19 0.25 / minor CGU,CGC 1.06 1.1 1.81 CGU,CGC minor / 0.15 0.19 0.22 CUG minor / 0.78 0.94 1.75 AUC,AUU g minor / 0.16 0.16 0.27 CCU minor / 0.14 0.1 0.16 / minor UGC 0.36 0.37 0.5 UGC

UGC ACA CCU CCU UCA GGA AGU UCG UCG CCA UCC GGG GGG CUC

6.1 6.5 6.6

6 10.7 7.9

5.29 3.48 4.99

4.77 2.99 4.79

3.81 2.61 4.38

minor minor major

UGU ACG CCG,CCA

6.6 7 7.4 7.9

6.8 7 7.2 8

9.9 10.6 10.7 8.5

3.89 2.71 3.99 6.05

3.09 2.21 3.01 4.58

1.98 1.26 2.19 2.51

0.25 0.15 0.25 minor

UCU,UCG GGG AGC UCU,UCA

8.1 9.4 9.6

8.2 9.4 9.7

8.6 9.3 11.6

6.52 11.2 4.81

6.4 12.1 3.57

5.18 11.7 2.36

9.7

9.9

10.1

6.19

5.52

4.09

major / 0.15 0.1 0.3

CCG,CCU UCU GGA / CUU

CUU ACU ACU ACU UCU CAC UUA UUG

9.9 10.8

10.2 10.2

12.5 11

5.7 13.9

4.64 16.8

3.86 20.6

0.3 0.8

CUC ACC

10.5 10.8 10.5 11.3

10.4 10.7 10.9 11.5

10.9 8.8 15 12.9

13.1 13.9 6.13 6.63

11.1 13.9 4.64 5.72

16.3 14.2 2.73 4.27

/ 0.4 0.25 0.25

UCC CAU UUG UUA

11.3 12.1 11.9 12.5

11.6 11.6 12 12.7

12.5 11.9 13.1 13.8

9.23 15.9 12.1 7.53

8.11 18.7 13.7 6.21

6.78 22.3 17.2 4.17

0.4 1.05 1.0 minor

CAC GUU.GUG AAA ACA

16.3

22.8

9.79

7.79

5.61

0.6

AAC

UUG CAU GUA AAG ACG ACG AAU

0.36 0.2 0.16 0.13 0.29 0.48 0.31 0.29 0.08 0.13 0.17 0.48

0.37 0.23 0.16 0.16 0.39 0.55 0.32 0.39 0.08 0.16 0.2 0.55

0.5 0.49 0.27 0.18 0.52 0.79 0.4 0.52 0.1 0.18 0.29 0.79

0.21

0.29

0.42

UGU ACG,ACU CCC CCA,CCG UCU,UCG GGG g AGC UCU,UCA / CCG,CCU UCU GGA g / CUU

0.21 0.02 0.25 0.2 0.17 0.14 0.25 0.43

0.29 0.04 0.27 0.23 0.2 0.19 0.29 0.49

0.42 0.05 0.39 0.49 0.29 0.31 0.27 0.66

CUC ACC ACC ACA,ACG UCC CAU UUG /

0.25 0.14 0.86 0.43 0.12 0.2 0.27

0.29 0.19 0.78 0.52 0.15 0.23 0.31

0.27 0.31 1.45 0.74 0.22 0.49 0.52

UUA CAC GUU,GUG AAA / ACA,ACU AAC

a. Low-usage sense codons of E. coli were selected and include: all the codons at a cut-off of < 1. 28% frequency calculated from GenBank release #69, and all the codons at a cut off < 0.869% real-time frequency when E. coli was at the growth rate of 1.07 doublings/hour. The cut-offs are the lowest frequency values among those of non-degenerate codons (Met and Trp) and the optimal codons for amino acids with more than 2 degenerate codons (Leu, Ile, Val, Ser, Pro, Thr, Ala, Arg and Gly). b. The data are codon usage frequencies calculated from the sequence data of GenBank release #63, 69 or 147 (refer to Table 1) or calculated by Dong et al, 1996 from 140 proteins coding frames when E. coli was at different growth rate of 0.4 doublings/hour (refer to Table 2). c. The relative amount is the amount relative to that of tRNALeu1(CUG) that is normalized to 1.0. a. Taken and adapted from Ikemura Ikemura (1981a,b, 1985) (refer to Table 3). b. The other synonymous codons that are also recognized by the same tRNA. c. Taken and adapted from Dong et al, 1996 (refer to Table 4).

Gene Therapy and Molecular Biology Vol 10, page 9 d. The tRNA ILe2 co-migrated with tRNA ILe1 on 2-D PAGE. The latter recognizes AUU and AUC while the former recognizes AUA, and the relative content for different growth rate is the sum of both tRNAs. The tRNAGly1(GGG) also co-migrated with tRNAGly2 (GGA,GGG) on 2-D PAGE, and the relative content for different growth rate is similarly the sum of both tRNAs. * Cys, His, Lys and Asn all have 2 synonymous codons that are recognized by one single tRNA. ยง Codons ACU and ACG of Thr are decoded by 3 and 2 tRNAs, respectively. Codon UUG of Leu are also decoded by 2 tRNAs. # The relative amounts for the single tRNAs which decodes GUA (Val), AAG (Lys) and AAU (Asn) are high (> 0.6 according to Ikemura (1985) or > = 0.27 according to Dong et al, 1996).

needs further studies. However, the rare sense codons in Group I, especially Arg rare codons AGG and AGA, have been extensively studied, and most effects of RCs and RCCs as well as their underlying mechanisms are obtained from studies of this group of rare sense codons (Hackett and Reeves, 1983; Pedersen, 1984; Misra and Reeves, 1985; Fang et al, 1986; Garcia et al, 1986; Pohlner et al, 1986; Harms and Umbarger, 1987; Chen et al, 1990a,b, 1991; Gurskii et al, 1992a, b; Ivanov et al, 1992; Kane et al, 1992; Gursky et al, 1994; Hua et al, 1994, 1996; Vilbois et al, 1994; Curran, 1995; Del, Jr. et al, 1995; Kane, 1995; Bouquin et al, 1996; Calderone et al, 1996; Major et al, 1996; Saraffova et al, 1996; Zahn and Landy, 1996; Zahn, 1996; Babic et al, 1997; Ivanov et al, 1997; Schwartz and Curran, 1997; Tsai and Curran, 1998; Wakagi et al, 1998; Jiang et al, 1999; Imamura et al, 1999; Roche and Sauer, 1999; Sauer and Nygaard, 1999; KleberJanke et al, 2000; Zdanovsky and Zdanovskaia, 2000; Acosta-Rivero et al, 2002; Hayes et al, 2002; Kapust et al, 2002; Laine et al, 2002; Park et al, 2002; McNulty et al, 2003; Olivares-Trejo et al, 2003; Tan et al, 2003; Chen et al, 2004; Sakamoto et al, 2004; Shu et al, 2004; Gurvich et al, 2005). Codon optimization (a kind of nucleotide substitution which replaces the rare codons in a gene by synonymous optimal or other major codons) and rare tRNA supplementation (co-expression of rare-tRNA genes) are the 2 strategies to overcome the expression problems caused by rare sense codons or study the underlying mechanisms. In order to highly express a foreign gene in bacterium E. coli, either one or both of the 2 strategies may be adopted. Because mutant strains such as Rosetta 2(DE3) of E. coli (Chen et al, 2004) are commercially available for rare tRNA supplementation, it is recommended to first try this strategy when a foreign gene cannot be expressed to satisfaction in regular expression host such as BL21(DE3). Further, if rare tRNA supplementation cannot correct the expression problem(s), codon optimization to replace some or all of the E. coli RCs or their RCCs in a foreign gene is likely to be a must. The E. coli RCs that should be considered in codon optimization, based on the so far reports, at least include all the above 7 Group I RCs and probably the 6 Group IIa RCs.

Babic S, Hunter CN, Rakhlin NJ, Simons RW and Phillips-Jones MK (1997) Molecular characterisation of the pifC gene encoding translation initiation factor 3, which is required for normal photosynthetic complex formation in Rhodobacter sphaeroides NCIB 8253. Eur J Biochem 249, 564-575. Bouquin N, Chen MX, Kim S, Vannier F, Bernard S, Holland IB and Seror SJ (1996) Characterization of an Escherichia coli mutant, feeA, displaying resistance to the calmodulin inhibitor 48/80 and reduced expression of the rare tRNA3Leu. Mol Microbiol 20, 853-865. Bulmer M (1987) Coevolution of codon usage and transfer RNA abundance. Nature, 325 728-730. Calderone TL, Stevens RD and Oas TG (1996) High-level misincorporation of lysine for arginine at AGA codons in a fusion protein expressed in Escherichia coli. J Mol Biol 262, 407-412. Chen D, Duggan C, Ganley JP, Kooragayala LM, Reden TB, Texada DE and Langford MP (2004) Expression of enterovirus 70 capsid protein VP1 in Escherichia coli. Protein Expr Purif 37, 426-433. Chen GF and Inouye M (1990a) Suppression of the negative effect of minor arginine codons on gene expression; preferential usage of minor codons within the first 25 codons of the Escherichia coli genes. Nucleic Acids Res 18, 14651473. Chen KS, Peters TC and Walker JR (1990b) A minor arginine tRNA mutant limits translation preferentially of a protein dependent on the cognate codon. J Bacteriol 172, 25042510. Chen MX, Bouquin N, Norris V, Casaregola S, Seror SJ and Holland IB (1991) A single base change in the acceptor stem of tRNA (3Leu) confers resistance upon Escherichia coli to the calmodulin inhibitor, 48/80. EMBO J 10, 3113-3122. Choi AH, Basu M, McNeal MM, Bean JA, Clements JD and Ward RL (2004) Intranasal administration of an Escherichia coli-expressed codon-optimized rotavirus VP6 protein induces protection in mice. Protein Expr Purif 38, 205-216. Crick FH (1966) Codon--anticodon pairing: the wobble hypothesis. J Mol Biol 19, 548-555. Curran JF (1995) Decoding with the A:I wobble pair is inefficient. Nucleic Acids Res 23, 683-688. Del TB Jr, Ward JM, Hodgson J, Gershater CJ, Edwards H, Wysocki LA, Watson FA, Sathe G and Kane JF (1995) Effects of a minor isoleucyl tRNA on heterologous protein translation in Escherichia coli. J Bacteriol 177, 7086-7091. Dong H, Nilsson L and Kurland CG (1996) Co-variation of tRNA abundance and codon usage in Escherichia coli at different growth rates. J Mol Biol 260, 649-663.

References Acosta-Rivero N, Sanchez JC and Morales J (2002) Improvement of human interferon HUIFN!2 and HCV core protein expression levels in Escherichia coli but not of HUIFN!8 by using the tRNA (AGA/AGG). Biochem Biophys Res Commun 296, 1303-1309.

Emilsson V and Kurland CG (1990) Growth rate dependence of transfer RNA abundance in Escherichia coli. EMBO J 9, 4359-4366.

Chen and Texada: E. coli low-usage codons and rare codons Emilsson V, Naslund AK and Kurland CG (1993) Growth-ratedependent accumulation of twelve tRNA species in Escherichia coli. J Mol Biol 230, 483-491.

Harms E and Umbarger HE (1987) Role of codon choice in the leader region of the ilvGMEDA operon of Serratia marcescens. J Bacteriol 169, 5668-5677.

Fang GH, Kenigsberg P, Axley MJ, Nuell M and Hager LP (1986) Cloning and sequencing of chloroperoxidase cDNA. Nucleic Acids Res 14, 8061-8071.

Hayes CS, Bose B and Sauer RT (2002) Stop codons preceded by rare arginine codons are efficient determinants of SsrA tagging in Escherichia coli. Proc Natl Acad Sci U S A 99, 3440-3445.

Flick K, Ahuja S, Chene A, Bejarano MT and Chen Q (2004) Optimized expression of Plasmodium falciparum erythrocyte membrane protein 1 domains in Escherichia coli. Malar J 3, 50.

Hodgson J (1993) Expression systems: a user's guide. Emphasis has shifted from the vector construct to the host organism. Biotechnology (NY) 11, 887-893.

Garcia GM, Mar PK, Mullin DA, Walker JR and Prather NE (1986) The E. coli dnaY gene encodes an arginine transfer RNA. Cell 45, 453-459.

Hu X, Shi Q, Yang T and Jackowski G (1996) Specific replacement of consecutive AGG codons results in high-level expression of human cardiac troponin T in Escherichia coli. Protein Expr Purif 7, 289-293.

Garel JP (1974) Functional adaptation of tRNA population. J Theor Biol 43, 211-225.

Hua Z, Wang H, Chen D, Chen Y and Zhu D (1994) Enhancement of expression of human granulocytemacrophage colony stimulating factor by argU gene product in Escherichia coli. Biochem Mol Biol Int 32, 537-543.

Garel JP, Chavancy G, Chevallier A, Fournier A, Marbaix G and Huez G (1981) [tRNA adaptation and the optimization of translation]. Reprod Nutr Dev 21, 177-183.

Ikemura T (1980) [Measurement of relative amount of E. coli tRNAs: codon choice in E. coli genes is largely constrained by the concentration of anticodons (author's transl)]. Tanpakushitsu Kakusan Koso 25, 668-678.

Gold L (1990) Expression of heterologous proteins in Escherichia coli. Methods Enzymol 185, 11-14. Gouy M and Gautier C (1982) Codon usage in bacteria: correlation with gene expressivity. Nucleic Acids Res 10, 7055-7074.

Ikemura T (1981a) Correlation between the abundance of Escherichia coli transfer RNAs and the occurrence of the respective codons in its protein genes. J Mol Biol 146, 1-21.

Grantham R, Gautier C and Gouy M (1980a) Codon frequencies in 119 individual genes confirm consistent choices of degenerate bases according to genome type. Nucleic Acids Res 8, 1893-1912.

Ikemura T (1981b) Correlation between the abundance of Escherichia coli transfer RNAs and the occurrence of the respective codons in its protein genes: a proposal for a synonymous codon choice that is optimal for the E. coli translational system. J Mol Biol 151, 389-409.

Grantham R, Gautier C, Gouy M, Jacobzone M and Mercier R (1981) Codon catalog usage is a genome strategy modulated for gene expressivity. Nucleic Acids Res 9, 43-74.

Ikemura T (1982) Correlation between the abundance of yeast transfer RNAs and the occurrence of the respective codons in protein genes. Differences in synonymous codon choice patterns of yeast and Escherichia coli with reference to the abundance of isoaccepting transfer RNAs. J Mol Biol 158, 573-597.

Grantham R, Gautier C, Gouy M, Mercier R and Pave A (1980b) Codon catalog usage and the genome hypothesis. Nucleic Acids Res 8, 49-62. Grosjean H and Fiers W (1982) Preferential codon usage in prokaryotic genes: the optimal codon-anticodon interaction energy and the selective codon usage in efficiently expressed genes. Gene 18, 199-209.

Ikemura T (1985) Codon usage and tRNA content in unicellular and multicellular organisms. Mol Biol Evol 2, 13-34.

Grosjean H, Sankoff D, Jou WM, Fiers W and Cedergren RJ (1978) Bacteriophage MS2 RNA: a correlation between the stability of the codon: anticodon interaction and the choice of code words. J Mol Evol 12, 113-119.

Imamura H, Jeon B, Wakagi T and Matsuzawa H (1999) High level expression of Thermococcus litoralis 4-!glucanotransferase in a soluble form in Escherichia coli with a novel expression system involving minor arginine tRNAs and GroELS. FEBS Lett 457, 393-396.

Gurskii I, Marimont NI and Bibilashvili RS (1992a) [The effect of intracellular concentrations of tRNA, corresponding to the rare arginine codons AGG and AGA, on the gene expression in Escherichia coli]. Mol Biol (Mosk) 26, 1080-7.

Irwin B, Heck JD and Hatfield GW (1995) Codon pair utilization biases influence translational elongation step times. J Biol Chem 270, 22801-22806.

Gurskii I, Marimont NI, Shevelev AI, Iuzhakov AA and Bibilashvili RS (1992b) [Rare codons and gene expression in Escherichia coli]. Mol Biol (Mosk) 26, 1063-79.

Ivanov I, Alexandrova R, Dragulev B, Saraffova A and Abouhaidar MG (1992) Effect of tandemly repeated AGG triplets on the translation of CAT-mRNA in E. coli FEBS Lett 307, 173-176.

Gursky YG and Beabealashvilli RS (1994) The increase in gene expression induced by introduction of rare codons into the C terminus of the template. Gene 148, 15-21.

Ivanov IG, Saraffova AA and Abouhaidar MG (1997) Unusual effect of clusters of rare arginine (AGG) codons on the expression of human interferon ! 1 gene in Escherichia coli. Int J Biochem Cell Biol 29, 659-666.

Gurvich OL, Baranov PV, Gesteland RF and Atkins JF (2005) Expression levels influence ribosomal frameshifting at the tandem rare arginine codons AGG_AGG and AGA_AGA in Escherichia coli. J Bacteriol 187, 4023-4032.

Jiang L, Yang Y, Chatterjee S, Seidel B, Wolf G and Yang S (1999) The expression of proUK in Escherichia coli: the vgb promoter replaces IPTG and coexpression of argU compensates for rare codons in a hypoxic induction model. Biosci Biotechnol Biochem 63, 2097-2101.

Gutman GA and Hatfield GW (1989) Nonrandom utilization of codon pairs in Escherichia coli. Proc Natl Acad Sci U S A 86, 3699-3703.

Jonasson P, Liljeqvist S, Nygren PA and Stahl S (2002) Genetic design for facilitated production and recovery of recombinant

Hackett J and Reeves P (1983) Primary structure of the tolC gene that codes for an outer membrane protein of Escherichia coli K12. Nucleic Acids Res 11, 6487-6495.

Gene Therapy and Molecular Biology Vol 10, page 11 proteins in Escherichia coli. Biotechnol Appl Biochem 35, 91-105.

Park SJ, Lee SK and Lee BJ (2002) Effect of tandem rare codon substitution and vector-host combinations on the expression of the EBV gp110 C-terminal domain in Escherichia coli. Protein Expr Purif 24, 470-480.

Kane JF (1995) Effects of rare codon clusters on high-level expression of heterologous proteins in Escherichia coli. Curr Opin Biotechnol 6, 494-500.

Pedersen S (1984) Escherichia coli ribosomes translate in vivo with variable rate. EMBO J 3, 2895-2898.

Kane JF, Violand BN, Curran DF, Staten NR, Duffin KL and Bogosian G (1992) Novel in-frame two codon translational hop during synthesis of bovine placental lactogen in a recombinant strain of Escherichia coli. Nucleic Acids Res 20, 6707-6712.

Pedersen S, Bloch PL, Reeh S and Neidhardt FC (1978) Patterns of protein synthesis in E. coli: a catalog of the amount of 140 individual proteins at different growth rates Cell 14, 179190.

Kapust RB, Routzahn KM and Waugh DS (2002) Processive degradation of nascent polypeptides, triggered by tandem AGA codons, limits the accumulation of recombinant tobacco etch virus protease in Escherichia coli BL21 (DE3). Protein Expr Purif 24, 61-70.

Pohlner J, Meyer TF, Jalajakumari MB and Manning PA (1986) Nucleotide sequence of ompV, the gene for a major Vibrio cholerae outer membrane protein. Mol Gen Genet 205, 494500. Roche ED and Sauer RT (1999) SsrA-mediated peptide tagging caused by rare codons and tRNA scarcity. EMBO J 18, 4579-4589.

Kleber-Janke T and Becker WM (2000) Use of modified BL21 (DE3) Escherichia coli cells for high-level expression of recombinant peanut allergens affected by poor codon usage. Protein Expr Purif 19, 419-424.

Sakamoto K, Ishimaru S, Kobayashi T, Walker JR and Yokoyama S (2004) The Escherichia coli argU10 (Ts) phenotype is caused by a reduction in the cellular level of the argU tRNA for the rare codons AGA and AGG. J Bacteriol 186, 5899-5905.

Konigsberg W and Godson GN (1983) Evidence for use of rare codons in the dnaG gene and other regulatory genes of Escherichia coli. Proc Natl Acad Sci U S A 80, 687-691. Laine S, Salhi S and Rossignol JM (2002) Overexpression and purification of the hepatitis B e antigen precursor. J Virol Methods 103, 67-74. Lipman DJ and Wilbur WJ (1983) Contextual constraints on synonymous codon choice. J Mol Biol 163, 363-376.

Saraffova A, Maximova V, Ivanov IG and Abouhaidar MG (1996) Comparative study on the effect of signal peptide codons and arginine codons on the expression of human interferon-! 1 gene in Escherichia coli. J Interferon Cytokine Res 16, 745-749.

Ma HH, Yang L, Yang XY, Xu ZP and Li BL (2003) Bacterial expression, purification, and in vitro N-myristoylation of fusion hepatitis B virus preS1 with the native-type Nterminus. Protein Expr Purif 27, 49-54.

Sauer J and Nygaard P (1999) Expression of the Methanobacterium thermoautotrophicum hpt gene, encoding hypoxanthine (Guanine) phosphoribosyltransferase, in Escherichia coli. J Bacteriol 181, 1958-1962.

Major LL, Poole ES, Dalphin ME, Mannering SA and Tate WP (1996) Is the in-frame termination signal of the Escherichia coli release factor-2 frameshift site weakened by a particularly poor context? . Nucleic Acids Res 24, 26732678.

Schwartz R and Curran JF (1997) Analyses of frameshifting at UUU-pyrimidine sites. Nucleic Acids Res 25, 2005-2011.

Makrides SC (1996) Strategies for achieving high-level expression of genes in Escherichia coli. Microbiol Rev 60, 512-538.

Sharp PM, Cowe E, Higgins DG, Shields DC, Wolfe KH and Wright F (1988) Codon usage patterns in Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Drosophila melanogaster and Homo sapiens; a review of the considerable within-species diversity. Nucleic Acids Res 16, 8207-8211.

Sharp PM and Li WH (1986) Codon usage in regulatory genes in Escherichia coli does not reflect selection for 'rare' codons. Nucleic Acids Res 14, 7737-7749.

McNulty DE, Claffee BA, Huddleston MJ and Kane JF (2003) Mistranslational errors associated with the rare arginine codon CGG in Escherichia coli. Protein Expr Purif 27, 365374.

Shu P, Dai H, Mandecki W and Goldman E (2004) CCC CGA is a weak translational recoding site in Escherichia coli. Gene 343, 127-132.

Misra R and Reeves P (1985) Intermediates in the synthesis of TolC protein include an incomplete peptide stalled at a rare Arg codon. Eur J Biochem 152, 151-155.

Sorensen HP and Mortensen KK (2005a) Advanced genetic strategies for recombinant protein expression in Escherichia coli. J Biotechnol 115, 113-128.

Nakamura Y, Gojobori T and Ikemura T (2000) Codon usage tabulated from international DNA sequence databases: status for the year 2000. Nucleic Acids Res 28, 292.

Sorensen HP and Mortensen KK (2005b) Soluble expression of recombinant proteins in the cytoplasm of Escherichia coli. Microb Cell Fact 4, 1.

Nussinov R (1981) Eukaryotic dinucleotide preference rules and their implications for degenerate codon usage. J Mol Biol 149, 125-131.

Sorensen MA, Kurland CG and Pedersen S (1989) Codon usage determines translation rate in Escherichia coli. J Mol Biol 207, 365-377.

Olins PO and Lee SC (1993) Recent advances in heterologous gene expression in Escherichia coli. Curr Opin Biotechnol 4, 520-525.

Tan WS, Dyson MR and Murray K (2003) Hepatitis B virus core antigen: enhancement of its production in Escherichia coli, and interaction of the core particles with the viral surface antigen. Biol Chem 384, 363-371.

Olivares-Trejo JJ, Bueno-Martinez JG, Guarneros G and Hernandez-Sanchez J (2003) The pair of arginine codons AGA AGG close to the initiation codon of the lambda int gene inhibits cell growth and protein synthesis by accumulating peptidyl-tRNAArg4. Mol Microbiol 49, 10431049.

Tsai F and Curran JF (1998) tRNA (2Gln) mutants that translate the CGA arginine codon as glutamine in Escherichia coli. RNA 4, 1514-1522.

Chen and Texada: E. coli low-usage codons and rare codons Vilbois F, Caspers P, da Prada M, Lang G, Karrer C, Lahm HW and Cesura AM (1994) Mass spectrometric analysis of human soluble catechol O-methyltransferase expressed in Escherichia coli. Identification of a product of ribosomal frameshifting and of reactive cysteines involved in Sadenosyl-L-methionine binding Eur J Biochem 222, 377386.

Zhang SP, Zubay G and Goldman E (1991) Low-usage codons in Escherichia coli, yeast, fruit fly and primates. Gene 105, 6172. Zhou Z, Schnake P, Xiao L and Lal AA (2004) Enhanced expression of a recombinant malaria candidate vaccine in Escherichia coli by codon optimization. Protein Expr Purif 34, 87-94.

Wada K, Wada Y, Doi H, Ishibashi F, Gojobori T and Ikemura T (1991) Codon usage tabulated from the GenBank genetic sequence data. Nucleic Acids Res 19 Suppl, 1981-1986. Wakagi T, Oshima T, Imamura H and Matsuzawa H (1998) Cloning of the gene for inorganic pyrophosphatase from a thermoacidophilic archaeon, Sulfolobus sp. strain 7, and overproduction of the enzyme by coexpression of tRNA for arginine rare codon Biosci Biotechnol Biochem 62, 24082414. Zahn K (1996) Overexpression of an mRNA dependent on rare codons inhibits protein synthesis and cell growth. J Bacteriol 178, 2926-2933. Zahn K and Landy A (1996) Modulation of lambda integrase synthesis by rare arginine tRNA. Mol Microbiol 21, 69-76.

Dequan Chen

Zdanovsky AG and Zdanovskaia MV (2000) Simple and efficient method for heterologous expression of clostridial proteins. Appl Environ Microbiol 66, 3166-3173.

Gene Therapy and Molecular Biology Vol 10, page 147 Gene Ther Mol Biol Vol 10, 147-160, 2006

Characterization of the cytotoxic effect of a chimeric restriction enzyme, H1ยบ-FokI Research Article

Naved Alam and Donald B. Sittman* Department of Biochemistry, University of Mississippi Medical Center, 2500 North State Street, Jackson, MS 39216-4505, USA

__________________________________________________________________________________ *Correspondence: Donald B. Sittman, Dept. of Biochemistry, University of Mississippi Medical Center, 2500 N. State St., Jackson, MS 39216-4505, USA; Tel: 601-984-1848, Fax: 601-984-1501, E-mail: dsittman@biochem.umsmed.edu Key words: Chimeric nuclease, cytotoxic, apoptosis Abbreviations: calcein-AM, (CN-AM); diamidino-2-phenylindole dihydrochloride, (DAPI); Drosophila Ultrabithorax, (Ubx); ethidium homodimer, (ET-HD); Fluorescein isothiocyanate, (FITC); fluorescence activated cell sorter, (FACS); green fluorescent protein, (GFP); phosphate buffer saline, (PBS); Polymerase Chain Reaction, (PCR); post-transfection, (PT); propidium iodide, (PI)

This publication was made possible by NIH Grant Number RR016476 from the MFGN INBRE Program of the National Center for Research Resources. Received: 13 April 2006; Accepted: 19 April 2006; electronically published: May 2006

Summary Our primary goal was to create an efficient cytotoxic agent. To do this, we created a gene that expresses a chimeric hybrid of the linker histone, H10 and the nuclease domain of the type IIs restriction enzyme, FokI. The linkage of the FokI nuclease domain to a high affinity but low DNA-sequence-specificity binding protein is unique. It is highly cytotoxic. We demonstrate, by transiently transfecting 3T3 mouse fibroblasts, that 63% of the cells taking up the chimeric gene are killed. The chimeric protein is localized to the nucleus. An extract of the protein produced in E. coli degrades DNA, indicating that it is nucleolytically active. The ultimate mechanism through which the chimeric protein produces cell death is likely through the induction of apoptosis.

nucleus of a living cell could well prove to have sufficient cytotoxicity as to be of clinical usefulness. The nuclease domain of the type IIs FokI restrictionmodification enzyme has been used as a source of a nuclease for the construction of chimeric restriction enzymes (Kim and Chandrasegaran, 1994; Huang et al, 1996; Kim et al, 1996, 1997, 1998; Kim and Pabo, 1998). The type IIs FokI restriction-modification enzyme was originally characterized by Kita et al, in 1989. It is useful for the construction of chimeric restriction enzymes because its recognition domain is separate from its cleavage domain. Several chimeric restriction enzymes have been engineered in which the DNA recognition domain of one protein has been fused to the endonuclease domain of FokI. These reports include the linking of Drosophila Ultrabithorax (Ubx) homeodomain to the cleavage domain of FokI restriction endonuclease (Kim and Chandrasegaran, 1994). This group also reported the creation of a novel site-specific endonuclease by linking the N-terminal 147 amino acids of yeast Gal4 to the cleavage domain of FokI endonuclease (Kim et al, 1998). The fusion protein was found to be active and under

I. Introduction The H1, or linker, histones are a well characterized, multivariant family of small basic proteins that play a major role in chromatin organization (Ramakrishnan, 1997 and Widom, 1998). They bind to chromatin with a high affinity (Mamoon et al, 2002) and at a ratio of up to one or more per nucleosome (Widom, 1998; Simpson, 1978). Recently, it was demonstrated that H1 histone to which the large green fluorescent protein (GFP), is fused at its carboxy-terminal domain, can enter the nucleus, where it appears to bind nucleosomes normally (Lever et al, 2000; Misteli et al, 2000). Experiments conducted with the H1GFP revealed that H1-GFP binding to chromatin is quite dynamic with a residence time on the order of a minute. These observations suggest that the H1 linker histones would be ideal candidates for construction of fusion proteins that will enter cell nuclei. A potentially useful protein to deliver to the nucleus would be a nuclease to act as a cytotoxic agent. Due to the chromatin binding properties of H1 histone, using it to direct a nuclease to the

147

Alam and Sittman: H1º-FokI chimeric nuclease is cytotoxic Mississippi 39216, U.S.A). The primary constructs pertinent to this work are shown in Figure 1.

optimal conditions, bound to a 17 bp consensus DNA site and cleaved near this site. Subsequent reports described the engineering of a zinc-finger-FokI restriction endonuclease and characterization of its DNA cleavage specificities (Huang et al, 1996; Kim et al, 1996, 1997 and Kim and Pabo, 1998). These chimeric nucleases have also been used in several application related studies. For example, a zinc-finger-FokI nuclease was used to cause DNA cleavage and mediate homologous recombination between DNA sequences in Xenopus laevis oocyte nuclei (Bibikova et al, 2001). Similarly, the zinc-finger-FokI chimeric nuclease was also used to stimulate gene targeting in human cells (Porteus and Baltimore, 2003) and in Drosophila (Bibikova and Beumer, 2003). Beyond the use of FokI chimeras to stimulate homologous recombination, the cytotoxicity of these chimeras has yet to be evaluated. The linkage of the FokI nuclease domain to H1 would generate a potent nuclease with superior nuclear localization affinity and avid DNA binding potential. Furthermore, since the desired outcome is to generate lethal levels of DNA cleavage, the low sequence preference of H1 (Wellman et al, 1994; Wellman et al, 1999; Mamoon et al, 2002; Renz, 1975 and Marekov and Beltchev, 1978) with its relatively short residence time (Lever et al, 2000; Misteli et al, 2000) makes it an ideal candidate to reputably deliver a nuclease to the proximity of DNA. In this paper we demonstrate the efficacy of this idea by using a transient transfection system in which an H1 linker histone is used to deliver sufficient nuclease activity to cells, to be lethal.

B. Transient transfection of the mouse cells with DNA sequences Balb/c 3T3 mouse fibroblasts (clone A31) from American Type Cell Culture (Manassas, Virginia, U.S.A.) were grown and maintained as previously described (Brown et al, 1996). Approximately 5.5x105 cells plated in a 60 mm culture dish (Corning Inc., Corning, New York, U.S.A.) were grown to 70% confluence. 2 !g of plasmid DNA was suspended in Dulbecco’s Modified Eagle Medium (Invitrogen, Carlsbad, California, U.S.A) [without serum and antibiotics] to a total volume of 150 !l. 15 !l of the Polyfect transfection reagent (Qiagen Inc., Valencia, California, U.S.A.) was added to the DNA solution and the DNA-reagent solution was mixed by pipeting up and down 5 times. The mixture was incubated at room temperature for 10 minutes. During the incubation period, cells were washed twice with fresh media to remove dead cells. Three ml of the media was added to cells. After the incubation period, 1ml of media was added to the DNA-reagent solution and it was mixed by pipeting twice. The DNA solution was then added to the cells with gentle shaking of the culture dish. The cells were incubated for expression of the recombinant gene and the transfectants were analyzed between 24-72 hours post-transfection (PT).

C. Staining of the mouse fibroblasts with calcein-AM and ethidium-homodimer cell viability indicator dyes The cells transfected in single-well Lab-Tek II Chamber Side System (Nalgene Nunc Int., Rochester, New York, U.S.A.) were washed twice with PBS, 48 hours PT and the chamber well was removed to prepare the cells for dye staining. A combination of 2 !M calcein-AM (CN-AM) and 4 !M ethidium homodimer (ET-HD) viability-indicator dyes (Live/Dead Cell Viability Assay Kit from Promega, Madison, Wisconsin, U.S.A.) was used to stain the cells and they were covered with a cover-slip for observation. A fluorescence microscope equipped with a low magnification Nikon Zeiss (Melville, New York, U.S.A.) lens was used to visualize the cells within 5 minutes of staining them with the dyes. The CN-AM and ET-HD fluorescence was observed using a Fluorescein isothiocyanate (FITC) and a Texas Red filter respectively.

II. Materials and methods A. Cloning of the vector DNA constructs The 588 bp FokI endonuclease domain was amplified by Polymerase Chain Reaction (PCR) of the plasmid, pUC 19/FokI (ATCC) using two primers, UNcoIFokI (5’CCATGGGTGTGACTAAGCAAC-3’) and DBamHIFokI (5’GGATCCATTAAAGTTTATCTCGCC-3’) [all primers were from Integrated DNA Technologies, Coralville, Iowa, U.S.A.] carrying Nco I and BamH I sites respectively. The PCR cycle was [(95°C, 5 minutes; 95°C, 1 minute; 46°C, 1 minute; 72°C, 1 minute)x5 cycles and (95°C, 1 minute; 54°C, 1minute; 72°C, 1minute)x15cycles]. The Nco I and BamH I (all cloning enzymes were from New England Biolabs) digested PCR product and 4904 bp pBSIIKS(-)/H1° (kindly given by Brown, D.T., University of Mississippi Medical Center, Jackson, Mississippi 39216, U.S.A.) vector DNA were ligated to form the 4144 bp pBSIIKS(-)/H1°-FokI. Next, the cohesive and blunt ends generated by the sequential Stu I and BamH I digestion of the 3578 bp PBSIIKS (-)/H1° and the 4144 bp pBSIIKS(-)/H1°-FokI INT vectors were ligated in a two-step reaction. Using this scheme, the sequence of H1° was fused in frame (with the insertion of a GCC triplet coding for alanine between the junctions of the two sequences) to the cleavage domain of FokI, to form the 4184 bp pBSIIKS(-)/H1°-FokI. For the subcloning of FokI endonuclease, the 4184 bp pBSIIKS(-)/H1°-FokI was digested with Nco I and BamH I enzymes. This yielded the 2988 bp pBSIIKS(-) vector, 588 bp H1° and 602 bp FokI cleavage domain. The 2988 bp pBSIIKS(-) vector and 588 bp FokI insert DNA were ligated to form the 3596 bp pBSIIKS(-)/FokI. The construction of vector DNA sequences used for transfection, immunofluorescence, western blot and protein purification experiments was done by similar strategies (Dissertation, Alam Naved, University of Mississippi Medical Center, Jackson,

D. Immunofluorescence mammalian transfectants

staining

the

The cells transfected in single-well Lab-Tek II Chamber Side System (Nalgene Nunc Int., Rochester, New York, U.S.A.) were washed twice with phosphate buffer saline (PBS), 48 hours PT and the chamber wells were removed for further treatment. Following cell fixation in 4% formaldehyde/PBS for 10 minutes, the cells were treated with 0.5% Triton-PBS for 5 minutes to permeabilize the cell membranes. The cells were washed thrice with PBS and non-specific binding sites for the antibody were reduced by incubating the cells in 10% goat sera/PBS for 30 minutes at 37°C. The cells were then incubated with a 1:100 dilution of anti-myc antibody (c-Myc 9E10 from Santa Cruz Inc., Santa Cruz, California, U.S.A.) for 1hour at 37°C. Thereafter, the cells were washed twice with PBS and they were incubated with a 1:400 dilution of anti- mouse IgG 1-FITC antibody (Santa Cruz Inc., Santa Cruz, California, U.S.A.) from goat at 37°C. After 1 hour, the cells were washed thrice with PBS and treated with 300 nM solution of 4’6-diamidino-2-phenylindole dihydrochloride (DAPI) dye (Molecular Probes, Carlsbad, California, U.S.A.) for 5 minutes to stain the DNA of nuclei. A drop of anti-fade reagent (Molecular Probes, Carlsbad, California, U.S.A.) was added to

148

Gene Therapy and Molecular Biology Vol 10, page 149 the slide to preserve the fluorescence intensity and the cells were covered with a cover-slip. DAPI staining of the cells was observed with a DAPI filter using a fluorescence microscope while the fluorescence from the myc-tagged protein was observed with a FITC filter.

camptothecin (10 !M in dimethyl sulfoxide) [both reagents were from Invitrogen Inc., Carlsbad, California, U.S.A.] for 12 hours (inclusive of the 72 hours serum-starvation period) before the harvesting of cells for analysis.

H. In vitro assay for the cleavage of DNA by purified proteins

E. Western blot analysis of whole cell lysates from the mammalian transfectants

Rosetta DE3 plys S cells (Novagen, San Diego, California, U.S.A.) were co-transformed with various pET16b vector constructs along with pACYC/lig (kindly provided by Dr. S. Chandrasegaran, Department of Environmental Health Sciences, The John Hopkins University, Baltimore, Madison, 21205, U.S.A.). A single colony of transformed cells was used for the preparation of protein for a 1L culture. Production of the protein from bacteria and its purification using metal-chelate chromatography was performed according to instructions from the fifth edition of the Qiagen (Valencia, California, U.S.A.) manual. Plasmid pUC 18 DNA (New England Biolabs, Ipswich, Massachusetts, U.S.A.) was incubated with equal concentrations of E.coli produced proteins in DNA cleavage buffer [75 mM KCl, 10 mM MgCl2, 10 mM Tris-Cl; pH 8.0, 3 mM DTT, 5% glycerol, 100 µg/ml of E. coli tRNA and 50 !g/ml bovine serum albumin]. The digestion reaction was for 4 hours at 37°C followed by analysis of the products by electrophoresis on ethidium bromide (0.5 µg/ml) stained 0.7% agarose gel.

Cells were grown and transfected in 75 cm2 culture flasks and were washed thrice with PBS, 72 hours PT and harvested using a cell scraper. They were suspended in 1ml lysis buffer [50 mM Tris (pH 7.5), 150 mM NaCl, 1% NP-40, 1% deoxycholate, 0.1% SDS, 2 mM EDTA, complete EDTA-free protease inhibitor cocktail tablet] for lysate preparation. The cell lysate was sheared by passing through a 23G syringe, centrifuged at 10,000 g for 10 minutes and the protein-rich supernatant was collected. An aliquot of the lysate was resolved by electrophoresis on a 10% SDS-PAGE gel. The proteins were transferred to a nylon membrane (Biorad, Hercules, California, U.S.A.) and nonspecific binding sites for the antibody were reduced by incubating the membrane in 10% goat sera/PBS for 1 hour at room temperature. The membrane was then incubated with a 1:100 dilution of anti-myc antibody (c-Myc 9E10 from Santa Cruz. Inc., Santa Cruz, California, U.S.A.) for 1 hour at room temperature. After three washes with PBS, the membrane was further incubated with a 1:5000 dilution of anti-mouse IgG1-HRP antibody (Pierce Inc., Rockford, Illinois, U.S.A.) from goat at room temperature for 1 hour. Detection of the myc-tagged protein was performed using the recommended protocol of Pierce Inc. and the signal was recorded on Eastman Kodak (Rochester, New York, U.S.A.) Biomax ML X-ray film.

III. Results A. The introduction of H10-FokI chimeric DNA in mouse fibroblasts is cytotoxic We transiently transfected mouse 3T3 fibroblasts with the sequences coding for the H10-FokI hybrid (Figure 1, materials and methods) in order to drive abundant expression of the H10-FokI hybrid off of the strong CMV promoter. Viability was assessed by staining of the cells with a combination of calcein-AM and ethidium homo-dimer dyes. This dual color assay, which discriminates between live and dead cells, was used to observe differences in staining pattern of H1°-FokI transfected and control cells. As shown in Figure 2, it is evident that by 72 hours, cells that are transiently transfected with the H10-FokI hybrid construct show significantly more cell death than cells mock-transfected or transfected with control vectors carrying only the H10 or the FokI cleavage domain. The only cells showing significant cell death other than those transfected with the H10-FokI hybrid construct were the control cells killed with methanol.

F. Quantitative determination of the cell viability of transfectants by propidium iodide staining The cells transfected in 60 mm culture dishes were harvested 72 hours post transfection, washed twice with PBS and suspended in 1 ml of fresh PBS. The cells were stained with (100 !g/ml) propidium iodide (PI) dye [Sigma Aldrich Corp., St. Louis, Missouri, U.S.A] and analyzed by flow cytometry within 5-10 minutes of dye staining. 10,000 events were captured by a Coulter SC500 (Beckman Coulter, Fullerton, California, U.S.A.) flow cytometer. Staining was quantitated on a log scale with respect to forward light scatter of the cells. The background intensity of PI staining was substracted from the final calculation for the determination of cell viability for each transfectant. The necrotic control cells were prepared by treatment with methanol for 10 minutes at -20°C.

G. Annexin V and propidium iodide staining of the mammalian transfectants

B. The H1°-FokI protein re-localizes from the cytoplasm to the nucleus in the transfected cells

The cells transfected in 60 mm culture dishes were washed thrice with PBS, 72 hours post-transfection and harvested in the same solution with the aid of a cell scraper. They were collected by centrifugation at 10,000 g for 30 seconds at 4°C. The cell pellet was re-suspended at 1x106 cells/ml in 1X annexin-binding buffer (all assay reagents were from Molecular Probes, Carlsbad, California, U.S.A). Next, 5 !l of annexinV alexa fluor 488 dye and 1!l (final concentration of 100 !g/ml) of PI dye were added to a 100 !l aliquot of the cells. The cells were then incubated in dark for 15 minutes. 400 !l of 1X annexin binding buffer was added to the cells and they were mixed briefly and stored at 4°C. The cells were analyzed by flow cytometry within 10 minutes of the protocol’s final step. A population of cells was induced to undergo apoptotic death by a combination of serum-starvation for 72 hours and treatment with the apoptosis-inducing drug,

To verify that the H10-FokI hybrid localized to the nucleus as predicted and as indicated by the cytotoxic effect of transfection with an H10-FokI hybrid expressing vector, we subcloned the H10-FokI hybrid, the H10 and the FokI nuclease coding regions into a pcDNA3.1(-)mycHisA (Invitrogen Inc. Carlsbad, California, U.S.A) vector such that they would carry a myc tag on their carboxy termini upon expression (materials and methods). Mouse 3T3 fibroblasts were transiently transfected and the location of the myc-tagged proteins were visualized by

149

Alam and Sittman: H1º-FokI chimeric nuclease is cytotoxic immunofluorescent-staining to the myc antigen as described in materials and methods. These results are shown in Figure 3. As expected, H10 localizes strictly to the nucleus. The FokI nuclease domain by itself contains no DNA binding, recognition or nuclear localization capacity and accordingly remains in the cytoplasm. The H10-FokI hybrid is as predicted also found in the nucleus although some is also seen in the cytoplasm in some of the cells.

transiently expressed proteins are the expected full length (Figure 4) and the cell viability results are not due to the breakdown of any of the transfectant products. The myctagged H1° protein migrates with an apparent mobility of 37 kD although the protein has a calculated molecular weight of approximately 22 kD. This altered mobility on SDS-PAGE gels is well described (Welch and O’Rand, 1990; Kasinsky et al, 2001; Nicholson et al, 2004) and is due to the presence of highly positively charged lysine and arginine residues in the carboxy terminal tail. Likewise, the myc-H1°-FokI protein exhibits a mobility deviation from the predicted molecular weight of roughly 44 kD. The myc-FokI protein, lacking the H1° component, migrates as expected on the gel.

C. Western blot analysis of cell lysate from transfected mouse cells A western blot of extracts of these transfectants, using antibodies to the myc tag, demonstrates that the

Figure. 1. Cloning of the H1°-FokI restriction enzyme system. (A). Schematic of vector constructs and the DNA sequences of the crucial junctions of H1°, FokI and H1°-FokI. (B). Restriction analysis of plasmid constructs, resolved on a ethidium bromide (0.5!g/ml) stained 0.7% agarose gel. Lane 1. DNA Marker with sizes as indicated, Lane 2. pBSIIKS(-), Lane 3. XbaI + BamHI pBSIIKS(-), Lane 4. pBSIIKS(-)/ H1°, Lane 5. XbaI + BamHI pBSIIKS(-)/H1 °, Lane 6. pBSIIKS(-)/ FokI, Lane 7. XbaI + BamHI pBSIIKS(-)/ FokI, Lane 8. pBSIIKS(-)/ H1°-FokI, Lane 9. XbaI + BamHI pBSIIKS(-)/ H1°-FokI.

150

Gene Therapy and Molecular Biology Vol 10, page 151

Figure. 2. Staining of mammalian transfectants with cell viability indicator dyes for determination of viability by fluorescence microscopy. Live cell column shows cells, as labeled in rows, stained with the calcein-AM dye. Dead cell column shows cells stained with the ethidium homo-dimer dye.

151

Alam and Sittman: H1ยบ-FokI chimeric nuclease is cytotoxic

Figure. 3. Cellular localization of recombinant proteins after transient transfection. Column 1 (FITC): Recombinant proteins detected by immuno-detection with an anti-myc antibody and anti-mouse IgG1-FITC antibody in cells, 72 hours post transfection with recombinant clones as labeled for each row. Column 2 (DAPI): Nuclear DAPI staining of cells, as labeled, shown in column 1. Figure. 4. Western blot analysis of total cell lysates from mouse fibroblast transfectants. Cells were transfected with individual DNA contructs and total cell lysate was prepared from the transfected cells, 72 hours post-transfection. The protein sample was resolved by electrophoresis on a 10% SDSPAGE gel. The proteins were transferred to a nylon membrane and Western blot analysis of the proteins was done. Detection of the signal from myc-tagged proteins was done using a combination of anti-myc antibody and an antimouse IgG1-HRP antibody from goat at room temperature for 1 hour. The myc-tagged proteins were detected in the lysate and their mobility on the SDS-PAGE was examined as discussed in the text.

152

Gene Therapy and Molecular Biology Vol 10, page 153 to transfection with the H10-FokI hybrid is approximately 63%. These observed differences in the cell viability of H1°-FokI transfected cells and controls were not attributable to differences in the transfection efficiency of the cells with exogenous DNAs themselves. The transfection efficiency of cells with various plasmid constructs was roughly equal (± 5%) (data not shown). Moreover, the differences in cell viability of the transfectants were not due to any other accessory factors, such as differential culture growth conditions of cells; comparison of the FACS profiles of the H1°-FokI transfected cells with the controls in the absence of PI dye showed similar FACS scatter pattern. Differences were only observed upon the addition of the dye.

D. Quantitation of H1°-FokI’s effect on cell viability To quantify the efficiency of killing by transient transfection of cells with the H10-FokI hybrid, we performed fluorescence activated cell sorter (FACS) analysis (materials and methods) of cells transfected with the H10-FokI construct or with appropriate controls and stained with the cell viability indicator propidium iodide dye (Figure 5). Quantitation of these results is shown, both as a time series between 24-72 hours posttransfection, (Figure 5A) and as the average of three independent transfection experiments at 72 hours posttransfection (Figure 5B). Mock transient transfection of cells indicates that the procedure itself results in approximately 18% cell death. Controls of mocktransfected, vector alone, H10-expressing, or the FokInuclease-domain-expressing, each show a comparably low rate of cell death. Only cells transfected with the H10-FokI hybrid-expressing vector show a significant level of cell death beyond that of the transfection controls, 44%. Control cells killed with methanol show a high death rate of approximately 96%, confirming the assay’s ability to detect cell death. We demonstrated an approximately 70% transfection efficiency in the protocol used in these experiments (data not presented). Knowing that the procedural death rate is 18% (independent of transfection) and that, of the 10,000 cells measured in each FACS analysis, after 72 hours 70% are transfected, the death rate due to transfection can be calculated. The raw data indicates that 5,580 cells are alive and 4,420 cells are dead in the H10-FokI hybrid transfectants. The death due to expression of the H10-FokI hybrid can only arise from the 7,000 that are transfected, so the calculated death rate due

E. The H1°-FokI protein is functionally active and cleaves DNA in vitro Because in vivo detection of DNA cleavage in 3T3 cells may be problematic, especially if an apoptotic cell death is induced, which in itself leads to DNA cleavage (Arends et al, 1990; Wylie et al, 1992), we decided to see if bacterially produced H10-FokI hybrid protein had nuclease activity. The H10-FokI hybrid and the H10 and FokI cleavage domains were subcloned into the his-tag containing pET16b (Novagen, San Diego, California, U.S.A.) bacterial expression vector. The proteins were expressed and enriched over a nickel column as described in materials and methods. These enriched extracts were then incubated with plasmid DNA. As shown in Figure 6, only the extract containing the H10-FokI hybrid protein shows significant DNA degradation. Extract from non-

Figure. 5. The transfection of H1°-FokI DNA in mouse fibroblasts is deleterious and causes a reduction in cell viability. (A). Mouse cells were transfected with various DNA constructs. Cells were harvested between 24- 72 hours post-transfection, at intervals of 24 hours and stained with the cell viability indicator propidium iodide dye. They were analyzed by flow cytometry for determination of the cell viability. Transfection of cells with the H1°-FokI DNA causes a decrease in cell viability in a time-dependent manner as compared to the control cells. (B). Mouse cells were transfected with various DNA constructs. Cells were harvested, 72 hours post-transfection and stained with the cell viability indicator PI dye. They were analyzed by flow cytometry analysis for determination of cell viability. Transfection of the cells with H1°-FokI DNA causes a decrease in cell viability in 44% of the cell population as compared to the control cells. The results represent data drawn from at least three independent experiments.

153

Alam and Sittman: H1º-FokI chimeric nuclease is cytotoxic

Figure. 6. The H1º-FokI protein is functionally active and cleaves DNA in vitro. Plasmid pUC 18 DNA was incubated with varying concentrations of E.coli produced proteins in DNA cleavage buffer [75 mM KCl, 10 mM MgCl2, 10 mM Tris-Cl; pH 8.0, 3 mM DTT, 5% glycerol, 100 !g/ml of E. coli tRNA and 50 !g/ml bovine serum albumin]. The digestion reaction was performed for 4 hours at 37°C followed by analysis of the digestion products by electrophoresis on a ethidium bromide (0.5µg/ml) stained 0.7% agarose gel. Plasmid DNA degradation was specifically associated with purified H1°-FokI protein. pUC18 vector DNA was degraded to low molecular weight species by H1º-FokI proteim purified from E.coli but not by either H1º or FokI protein.

transformed bacteria and from bacteria transformed with pET16b vector alone, pET16b with H10, or pET16b with the FokI cleavage domain, showed no significant degradation. This suggests that the H1º-FokI protein is an effective nuclease in vitro. Because we saw little enrichment of these bacterially produced proteins after SDS gel electrophoreses and Coomassie staining, we confirmed their presence in the extracts by western blot analysis (Figure 7). The his-tagged proteins were detected and showed appropriate mobility on the SDS-PAGE gel.

microscopy which allowed us to discriminate between early apoptotic, late apoptotic and necrotic modes of cell death. Typical results obtained by studying the stained cells using fluorescence microscopy are shown in Figure 8. As expected, the un-transfected live cell population showed negligible annexin V or PI dye staining. This is because in viable cells, the membrane lipids to which annexin binds, are localized on the interior side of the plasma membrane, leading to negligible staining. Viable cells also stain negligibly with PI because the uncompromised nuclear membranes restrict access of the dye to DNA. This live cell staining pattern was also seen with other controls (vector, reagent, H1° or FokI transfected cells). Necrotic cells were generated by treatment with methanol. They stained positively with both the annexin V and PI dyes. The staining pattern of the H1°-FokI transfected cells was similar to the apoptotic, camptothecin treated control cells. The H10-FokI hybrid cells and the apoptotic control cells show a higher percentage of annexin V staining which is indicative of apoptosis.

F. Fluorescence microscopy visualization of features associated with cell death in the transfected fibroblasts - H1°-FokI, is cytotoxic via an apoptotic pathway The data indicate that the H10 component of the H10FokI hybrid can carry the FokI nuclease domain to the nucleus where nuclease activity of the H10-FokI hybrid leads to cell death. We studied the cells stained with the annexin V alexa fluor 488 and PI dyes using fluorescence

154

Gene Therapy and Molecular Biology Vol 10, page 155 Figure. 7. Western blot analysis of the bacterially expressed his-tagged proteins. Bacterially produced proteins were enriched for his-tagged proteins by metal-chelate chromatography. The protein sample was resolved by electrophoresis on a 10% SDS-PAGE gel. The proteins were transferred to a nylon membrane and Western blot analysis of the proteins was done. Detection of the signal from the his-tagged proteins was done using a combination of anti-his antibody and an anti-mouse IgG1-HRP antibody from goat at room temperature for 1 hour. The his-tagged proteins were detected in the sample and their mobility on the SDS-PAGE was examined as discussed in the text.

Figure. 8. The mechanism of cell death in H1째-FokI transfected cells proceeds via an apoptotic pathway. The H1째-FokI transfected cells exhibit pronounced surface labeling with annexin V alexa fluor 488 and PI dye staining reveals extensively condensed nuclear DNA characteristic of apoptotic cell death. Scale bar = 10 !m.

155

Alam and Sittman: H1º-FokI chimeric nuclease is cytotoxic A quantitative assessment of the percentage of cells in early apoptosis and late apoptosis or necrosis made at 72 hours post transient transfection was done by flow cytometry analysis of the annexin V alexa fluor 488 and propidium iodide stained cells (Figure 9, materials and methods). The percentage of cells in early apoptosis is high for live untransfected cells and all control transfections. Necrotic control cells show virtually no cells in early apoptosis. Camptothecin induced apoptotic controls show few cells in early apoptosis, but more in what is presumably late apoptosis. H1°-FokI transfected cells show more cells in early apoptosis than camptothecin treated cells but fewer than seen in live and control cells. Following the transition of apoptosis and cell death through time (between 24-72 hours post-transfection, at 24 hours interval) by FACS analysis (Figure 10) shows that all populations, including the apoptotic-positive control cells, go into early apoptosis prior to the 72 hour time point except for the necrotic controls. During the first 48 hours post-transfection, relatively more H1°-FokI transfected cells were undergoing early stages of apoptosis than were in late apoptosis. However, there was a transition such that the majority of the H1°-FokI

transfected cells experienced late stages of apoptosis 72 hours post-transfection. H1°-FokI transfected cells appear to progress from early (24-48 hours) to late (72 hours) apoptosis with no signs of necrotic death.

IV. Discussion We have demonstrated that an H10-FokI chimeric protein expressing gene can quite effectively kill cells into which it is transiently transfected. We created this gene, in part, to begin to establish the clinical potential of H1 to direct toxic agents, such as nucleases, to the nucleus in order to kill cells. Other toxic proteins have been created for this purpose, such as the caspases, to induce death by apoptosis (Yeh and Yen, 20005; Yakovlev and Faden, 2001; Moffatt et al, 2000). Because all linker histones localize predominately to the nucleus and bind to chromatin tightly (Mamoon et al, 2002) and abundantly (Widom, 1998; Simpson, 1978; Kornberg, 1974), we hypothesized that it could be used to deliver a sufficient amount of a toxic protein, such as a nuclease to efficiently kill cells. We know that the H1 histones

Figure. 9. Transfection of mouse cells with H1°-FokI DNA causes cell death via a late apoptotic event. Mouse cells were transfected with various DNA constructs. Cells were harvested 72 hours PT and stained with the cell viability indicator annexin V alexa flour 488 and PI dyes. They were analyzed by flow cytometry procedure for determination of cell viability. Transfection of cells with the H1°FokI DNA causes a decrease in cell viability in 63% of the cell population.

156

Gene Therapy and Molecular Biology Vol 10, page 157

Figure. 10. Time-course analysis of the mechanism of cell death in H1째-FokI transfected cells. Mouse cells were transfected with various DNA constructs. Cells were harvested between 24-72 hours post-transfection, at intervals of 24 hours post-transfection and stained with the cell viability indicator annexin V alexa flour 488 and propidium iodide dyes. They were analyzed by flow cytometry procedure for determination of cell viability. Transfection of cells with the H1째-FokI DNA caused a decrease in cell viability in a timedependent manner as compared to the control cells.

can carry the relatively large green fluorescent protein linked to their carboxyl terminal tail into the nucleus and bind to chromatin appropriately (Lever et al, 2000 and Misteli et al, 2000). We thought that it was also likely that the carboxyl tails, which lie along the linker DNA (Zhou et al, 1998; Pruss and Wolffe, 1993), would position the nuclease such that it could readily cut the linker DNA. The in vivo turnover of H1 binding (Lever et al, 2000; Misteli et al, 2000) is also such that it would continue to come off and rebind to chromatin to further enhance the cleavage of the nuclear DNA. It seemed likely that such a chimera could cleave a sufficient amount of DNA such that the cellular repair systems are overwhelmed and the cells would die even if they had become resistant to apoptotic triggers (Sellers and Fischer, 1999; Gatti and Zunino, 2005). Although we demonstrate that H10-FokI probably induces apoptosis, we have no reason to believe that the chimeric protein cannot still kill cells that have become resistant to apoptotic triggers; presumably it would

eventually kill all cells through persistent cleavage of the nuclear DNA. Because the experiments reported here were intended to be strictly a proof of principle, to see if H1 could be used to carry a nuclease into the cell and sufficiently fragment the nuclear DNA such that cell death would ensue, we chose transient transfection as the way to deliver the gene expressing the H1-nuclease chimera. Transient transfection is typically inefficient and its efficiency varies greatly, depending on cell type, vector and transfection protocol (Sambrook et al, 1989). We observed approximately 70% transfection efficiency and therefore did not expect to get 100% killing of the cells upon transient transfection with the H10-FokI expression construct. Also, not all of the cells that become transfected will necessarily express sufficient amounts of H10-FokI to result in cell death. We nevertheless, saw a killing efficiency of 63% (Figure 5) for the cells transfected with the H10-FokI expressing construct. With methods of gene

157

Alam and Sittman: H1Âş-FokI chimeric nuclease is cytotoxic Bibikova M, Carroll D and Segal DJ (2001) Stimulation of homologous recombination through targeted cleavage by chimeric nucleases. Mol Cell Biol 21, 289-297. Brown DT, Alexander BT and Sittman DB (1996) Differential effect of H1 variant overexpression on cell cycle progression and gene expression. Nucl Acids Res 24, 486-493. Brown DT, Gunjan A, Alexander BT and Sittman DB (1997) Differential effect of H1 variant overproduction on gene expression is due to differences in the central globular domain. Nucl Acids Res 25, 5003-5009. Gatti L and Zunino F (2005) Overview of tumor cell chemoresistance mechanisms. Methods Mol Med 111, 127148. Gunjan A, Alexander BT, Sittman DB and Brown DT (1990) Effects of H1 histone overexpression on chromatin structure. J Biol Chem 274, 37950-37956. Gunjan A and Brown DT (1999) Overproduction of histone H1 varaints in vivo increases basal and induced activity of the mouse mammary tumor virus promoter. Nucl Acids Res 27, 3355-3363. Huang B, Li CJQ and Tsai MW (1996) Sp1ase: A new class IIs zinc finger restriction endonuclease with specificity for Sp1 binding sites. J Prot Chem 15, 481-489. Kasinsky HE, Lewis JD, Dacks JB and Ausio J (2001) Origin of H1 linker histones. Faseb J 15, 34-42. Kim YG, Cha J and Chandrasegaran S (1996) Hybrid restriction enzymes: Zinc finger fusions to FokI cleavage domain. Proc Natl Acad Sci 93, 1156-1160. Kim YG and Chandrasegaran S (1994) Chimeric restriction endonuclease. Proc Natl Acad Sci 91, 883-887. Kim YG, Kim PS, Hebert A and Rich A (1997) Construction of a Z-DNA-specific restriction endonuclease. Proc Natl Acad Sci 94, 12875-12879. Kim JS and Pabo CS (1998) Getting a handhold on DNA: design of poly-zinc finger proteins with femtomolar dissociation constants. Proc Natl Acad Sci 95, 2812-2817. Kim YG, Smith SJ, Durgesha M and Chandrasegaran S (1998) Chimeric restriction enzyme: Gal4 fusion to FokI cleavage domain. Biol Chem 379, 489-495. Kita K, Kotani H, Sugisaki H and Takanami M (1989) The FokI restriction-modification system. J Biol Chem 264, 57515756. Konishi AM, Shimizun S, Hirota J, Takao T, Fan Y, Matsuoka Y, Zhang L, Yoneda Y, Fujii Y, Skoultchi AI and Tsujimoto Y (2003) Involvement of histone H1.2 in apoptosis induced by DNA double-strand breaks. Cell 114, 655-656. Lever MA, Thâ&#x20AC;&#x2122;ng JPH, Sun X and Hendzel M (2000) Rapid exchange of histone H1.1 on chromatin in living cells. Nature 408, 873-876. Mamoon N, Song Y and Wellman SE (2002) Histone H1(0) and its carboxyl-terminal domain bind in the major groove of DNA. Biochem 41, 9222-9228. Marekov LN and Beltchev B (1978) Preferential binding of phosphorylated histone H1 to AT rich DNA. Int J Biol Macromol 3, 145-147. Misteli T, Gunjan A, Hock R, Bustin M and Brown DT (2000) Dynamic binding of histone H1 to chromatin in living cells. Nature 408, 877-881. Moffatt J, Hashimoto M, Kojima A, Kennedy DO, Murakami A, Koshimizu K and Yuasa IM (2000) Apoptosis induced by 1'acetoxychavicol acetate in Ehrlich ascites tumor cells is associated with modulation of polyamine metabolism and caspase-3 activation. Carcinogenesis 21, 2151-2157. Nicholson JM, Wood CM, Reynolds CD, Brown A, Lambert SJ, Chantalat L and Baldwin JP (2004) Histone Structures: Targets for modifications by molecular assemblies. Ann N.Y. Acad Sci 1030, 644-655.

delivery that result in higher copy numbers of exogenous genes, H10-FokI will likely yield a 100% kill rate. Although our data indicate that H10-FokI transfected cells kill via an apoptotic mechanism, this does not mean that it would not kill cells that are resistant to apoptotic triggers. Except for the necrotic control cells generated by treatment with methanol, all of the cells that died probably did so by an apoptotic mechanism. It is known that transient transfection with plasmids in itself can kill cells and that this death in many cell lines is apoptotic (Rodriguez and Flemington, 1999). H1 histones themselves have recently been shown to be potentially lethal to cells, (Tsoneva et al, 2005). In this study, the H1 was abundantly delivered by electroporation and the mechanism of killing was believed due to effects on the mitochondria. When delivered via a gene expression system, we observe no lethality due to H1 alone. This is in agreement with previous studies that relied on overexpression of H1 histones (Brown et al, 1996, 1997; Gunjan et al, 1990; Gunjan and Brown, 1999). We cannot exclude the possibility that the effect of H1 alone on viability is cell-type specific; electroloaded H1 did not have the same killing effect on non-transformed cells as it did on transformed cells (Tsoneva et al, 2005). However, we have not seen a lethality that can be attributed to H1 alone (Brown et al, 1996, 1997; Gunjan et al, 1990; Gunjan and Brown, 1999). However, we typically select permanent transfectants and the selection process may eliminate or select for resistance to H1 toxicity. We also cannot eliminate the possibility that some H1 variants are lethal. We have been unsuccessful in the selection of some permanent transformants of H1 variants or mutants that can be induced to overproduce significant amounts of the particular H1 type (unpublished data). It has been recently demonstrated that upon induction of apoptosis with agents that generate double-stranded breaks in DNA, such as with X-rays or with etoposide, the histone variant H1.2 (H1c) may be the apoptotic inducer (Konishi et al, 2003). As with the electroloaded H1s (Tsoneva et al, 2005), it appears to elicit a response through an interaction with mitochondria causing the release of cytochrome C. Overall, it appears that transfection with an H1 chimeric nuclease is a much more controllable method of killing cells; in situ cell specificity can be obtained by incorporating the H1-FokI gene into a viral vector that has been engineered to be cell type selective.

Acknowledgments We thank Dr Susan Wellman for critical reading of the manuscript. We also thank Dr. Robert Lewis, Kevin Beason and Susan Touchstone for Fluorescent Activated Cell Sorter analysis.

References Arends MJ, Morris RG and Wylie AH (1990) Apoptosis: The role of endonuclease. Am J Pathol 136, 593-608. Bibikova M, Beumer K and Trautman JK (2003) Enhancing gene targeting with designed zinc finger nucleases. Science 300, 764.

158

Gene Therapy and Molecular Biology Vol 10, page 159 Porteus H and Baltimore D (2003) Chimeric nucleases stimulate gene targeting in human cells. Science 300, 763. Pruss D and Wolffe AP (1993) Histone-DNA contacts in a nucleosome core containing a Xenopus 5S rRNA gene. Biochem 32, 6810-6814. Ramakrishnan V (1997) Histone structure and the organization of the nucleosome. Annu Rev Biophys Biomol Struct 26, 83112. Renz M (1975) Preferential and cooperative binding of histone H1 to mammalian chromosomal DNA. Proc Natl Acad Sci 72, 733-736. Rodriguez A and Flemington EK (1999) Transfection-mediated cell-cycle signaling: considerations for transient transfectionbased cell-cycle studies. Anal Biochem 272, 171-181. Sambrook J, Fritsch EF and Maniatis T (1989) Molecular cloning: a laboratory manual, second edition. Cold Spring Harbor Laboratory Press, New York. Sellers WR and Fischer DE (1999) Apoptosis and cancer drug targeting. J Clin Inves 104, 1655-1661. Simpson R (1999) Structure of the chromatosome, a chromatin particle containing 160 bp of DNA and all histones. Biochemistry 17, 5524-5531. Tsoneva I, Nikolova B, Georgieva M, Guenova M, Tomov T, Rols MP and Berger MR (2005) Induction of apoptosis by electrotransfer of positively charged proteins as cytochrome C and histone H1 into cells. Biochim Biophys Acta 1721, 55-64.

Welch JE and Oâ&#x20AC;&#x2122;Rand MG (1990) Characterization of a spermspecific nuclear autoantigenic protein. II. Expression and localization in the testis. Biol Reprod 43, 569-578. Wellman SE, Sittman DB and Chaires JB (1994) Preferential binding of H1e histone to GC-rich DNA. Biochem 33, 384388. Wellman SE, Song Y and Mammon NM (1999) Sequence preference of mouse H1Â° and H1t. Biochem 38, 1311213118. Widom J (1998) Structure, dynamics and function of chromatin in vitro. Annu Rev Biophys Biomol Struct 27, 285-327. Wylie AH, Arends MJ, Morris RG, Walker SW and Evan G (1992) The apoptosis endonuclease and its regulation. Sem Immunol 4, 389-398. Yakovlev A.G and Faden AI (2001) Capsase-dependent apoptotic pathways in CNS injury. Mol Neurobiol 24, 131144. Yeh CT and Yen GC (2005) Effect of sulforaphane on metallothionein expression and induction of apoptosis in human hepatoma HepG2 cells. Carcinogenesis 26, 21382148. Zhou YB, Gerchman SE, Ramakrishnan V, Travers AA and Muyldermans SV (1998) Position and orientation of the globular domain of linker histone H5 on the nucleosome. Nature 395, 402-405.

159

Alam and Sittman: H1ยบ-FokI chimeric nuclease is cytotoxic

160

!"#"$%&"'()*$(#+$,-."/0.('$12-.-3*$4-.$567$)(3"$85$ ! !"#"$%&"'$()*$+,)*$-)*$./0$1.2340$5//6$

! "#$%&'!()!)*'+,%('-.!/#'/0%,%+!1(.23#0$!)(0! -11.%+-,%('!-$!/0*&!-'/!&#'#!/#.%4#02!$2$,#3$! 5#4%#6!70,%+.#! $

8%.%! 9%/#0-,(*:! ;#,(<7%=-,#0%'%! >?%4#.#=-:! @A0%$,%'-! B(',(2%-''%:! "%3%,0%$! >$%(*04-$:!@('$,-',%'($!CD!E-.#($F! 7#89,9:9"$);$<&=8,>?*$@&"A,89'=0$B@CD$EF"A)G',9)8H0$.IJ./$KL&,?$<?'?8G"M,0$K99,G,0$!'"">"$ NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN$ F@(00#$1('/#'+#O$ @)#89?#9,#)8$ (P$ <?*")80$ 7#89,9:9"$ );$ <&=8,>?*$ @&"A,89'=0$ B@CD$ QF"A)G',9)8QR$ .IJ./$ KL&,?$ <?'?8G"M,0$ K99,G,0$ !'"">"R$%"*PO$SJ/$5./$6I/J666R$T?UO$SJ/$5./$6I53135R$"2A?,*O$V?*")8W>&"APX"A)G',9)8PL' B#2!6(0/$O$F"#X',A"'80$Y=V"'Z'?#>&"X$<)*=A"'80$F"#X',9,>$<)*=A"'80$B?#)>?'',"'80$F':L$F"*,M"'=$C=89"A0$!"#"$F"*,M"'=$ 7GG0#4%-,%('$H! KX',?A=>,#0$ [KFD\R$ ?'L,#,#"2L'?;9"X2<K(K($ X"#X',A"'0$ [<K(K(2K'L\R$ K8,?*)2L*=>)V')9",#0$ [KC!<\R$ Z"9?A"9&?8)#"$ X,V')V,)#?9"0$ [+F\R$ Z"9?A"9&?8)#"$ M?*"'?9"0$ [+-\R$ +)')#$ B":9')#$ @?V9:'"$ %&"'?V=0$ [+B@%\R$ X,?A,#)Z:9?#"$ V)*=[V')V=*"#"$ ,A,#"\$ X"#X',A"'0$ [FK+\R$ X,?A,#)Z:9?#"$ V)*=[V')V=*"#"$ ,A,#"\$ ;):'9&$ L"#"'?9,)#$ X"#X',A"'$ ;:#>9,)#?*,]"X$ ^,9&$ 6$ L:?#,X,#,:A$L'):V80$[FK+2!6$\R$X,?A,#)Z:9?#"$V)*=[V')V=*"#"$,A,#"\$;):'9&$L"#"'?9,)#$X"#X',A"'$;:#>9,)#?*,]"X$^,9&$.5$L:?#,X,#,:A$ L'):V80$[FK+2!.5\R$F=#?A,>$_,L&9$C>?99"',#L0$[F_C\R$"V,X"'A?*$L')^9&$;?>9)'0$[`!T\R$L'""#$;*:)'"8>"#9$V')9",#0$[!T<\R$,#a">9"X$X)8"0$ [7F\R$ &=V"'Z'?#>&"X$ V)*=["9&=*"#"$ ,A,#"\0$ [<`7\R$ &=V"'Z'?#>&"X$ V)*=L*=>"')*0$ [<!\R$ 78)9&"'A?*$ %,9'?9,)#$ @?*)',A"9=0$ [7%@\R$ _2*=8,#"$ L'?;9"X2<K(K($ X"#X',A"'0$ [<K(K(2_=8\R$ A"9&)9'"U?9"0$ [(%b\R$ A"9&)U=V)*=["9&=*"#"$ L*=>)*\2,8)>=?#?9"0$ [<`!2,8)>=?#?9"\R$ <`!=*?9"X$ X,?A,#)Z:9?#"$ V)*=[V')V=*"#"$ ,A,#"\$ X"#X',A"'$ ^,9&$ 4$ <`!$ >&?,#80$ [FK+24<`!\R$ <`!=*?9"X$ X,?A,#)Z:9?#"$ V)*=[V')V=*"#"$ ,A,#"\$ X"#X',A"'$ ^,9&$ c$ <`!$ >&?,#80$ [FK+2c<`!\R$ <`!=*?9"X$ V)*=L*=>"')*0$ [<!2<`!\R$ <`!=*?9"X2T)*?9"$ V)*=L*=>"')*0$ [<!2<`!2T)*?9"\R$ <&)8V&?9"$ +:;;"'$ C?*,#"0$ [<+C\R$ V)*=[?A,X)?A,#"\$ X"#X',A"'0$ [<K(K(\R$ V)*=[?A,X)?A,#"\$ X"#X',A"'$ ^,9&$ 9"'A,#?*$ &=X')U=*$ L'):V80$ [<K(K(2dY\R$ V)*=["9&=*"#"$ ,A,#"\2V)*=["9&=*"#"$ L*=>)*\2;)*?9"0$ [<`72<`!2Td_\R$ V)*=["9&=*"#"$L*=>)*\0$[<`!\R$V)*=["9&=*"#"$L*=>)*\$A)#)A"9&=*$"9&"'0$[(2<`!\R$V)*=[V')V=*"#"$,A,#"\$X"#X',A"'0$[<<7\R$V',A?e:,#"$ V&)8V&?9"0$[<<\R$V='"#"0$[<f\R$e:?9"'#,]"X$V)*=[?A,X)?A,#"\$X"#X',A"'$^,9&$9"'A,#?*$&=X')U=*$L'):V80$[g<K(K(2dY\R$9?A)U,;"#0$ [%K(\$ ! 5#+#%4#/H!IJ!K(4#3G#0!ILLMN!7++#1,#/H!OL!P#G0*-02!ILLQN!#.#+,0('%+-..2!1*G.%$A#/H!C-0+A!ILLQ!

! 9*33-02! >A#! 10#$#',! 0#4%#6! /#-.$! 6%,A! ,A#! /#$%&'! -'/! 10#1-0-,%('! ()! )*'+,%('-.! -'/! 3*.,%)*'+,%('-.! /#'/0%3#0%+! -'/! A21#0G0-'+A#/! 1(.23#0$! R/#'/0%,%+! 1(.23#0$S:! %'! (0/#0! ,(! G#! #31.(2#/! -$! /0*&! -'/! &#'#! /#.%4#02! $2$,#3$D! T'! 1-0,%+*.-0:!*$%'&!-$!$,-0,%'&!3-,#0%-.$!='(6'!-'/!6#..<+A-0-+,#0%?#/!G-$%+!/#'/0%,%+!1(.23#0$:!,A#!0#4%#6!/%$+*$$#$! ,A#!=%'/!()!$,0*+,*0-.!3(/%)%+-,%('$!,A-,!,A#$#!1(.23#0$!6#0#!$*GU#+,#/!)(0!10#1-0%'&!'-'(+-00%#0$!()!.(6!,(V%+%,2:! A%&A! #'+-1$*.-,%'&! +-1-+%,2:! $1#+%)%+%,2! ,(! +#0,-%'! G%(.(&%+-.! +#..$! -'/! ,0-'$1(0,!-G%.%,2! ,A0(*&A! ,A#%0! 3#3G0-'#$D! "*#!,(!,A#!&0#-,!'*3G#0!()!#V,#0'-.!&0(*1$!()!/#'/0%,%+!1(.23#0$!#%,A#0!)*'+,%('-.%?-,%('!(0!3*.,%)*'+,%('-.%?-,%('! +-'! (++*0:! 10(4%/%'&! 10(/*+,$! ,A-,! )*.)%..! ('#! (0! 3(0#! ()! ,A#! 0#W*%0#3#',$! ,A-,! -'! #))#+,%4#! /0*&! +-00%#0! $A(*./! #VA%G%,D! 7! +(33('! )#-,*0#! ()! ,A#$#! /#'/0%,%+! 1(.23#0$! %$! ,A#! #VA%G%,%('! ()! ,A#! $(<+-..#/! 1(.24-.#',! %',#0-+,%('$:! 6A%.#!)(0!,A#!3*.,%)*'+,%('-.!/#0%4-,%4#$!-!'*3G#0!()!,-0&#,%'&!.%&-'/$!/#,#03%'#$!$1#+%)%+%,2:!(,A#0!&0(*1$!$#+*0#! $,-G%.%,2! %'! G%(.(&%+-.! 3%.%#*:! 6A%.#! (,A#0$! )-+%.%,-,#! ,A#%0! ,0-'$1(0,!,A0(*&A! +#..!3#3G0-'#$D! T'! -//%,%(':! )(0! &#'#! /#.%4#02!-11.%+-,%('$!,A#$#!3*.,%)*'+,%('-.!$2$,#3$!$A(*./!G#!(0!G#+(3#!+-,%('%+!%'!,A#!G%(.(&%+-.!#'4%0('3#',!)(0! ,A#!)(03-,%('!()!+(31.#V#$!6%,A!,A#!'#&-,%4#.2!+A-0&#/!&#'#,%+!3-,#0%-.D! ! ! ,#9"'#?*$ :#,98$ X"9"'A,#"$ 9&"$ "#M,')#A"#9$ );$ 9&"$ TD!T',0(/*+,%('! #?#)>?M,9,"8$ ?#X$ >)#8"e:"#9*=$ 9&",'$ 8)*:Z,*,],#L$ )'$ F"#X',A"'8$ ?'"$ V'"V?'"X$ Z=$ 9"X,):8$ 8=#9&"9,>$ "#>?V8:*?9,#L$ V')V"'9,"80$ ^&"'"?80$ 9&"$ "U9"'#?*$ L'):V8$ V')>"X:'"8$[+)8A?#$"9$?*0$.333R$C>&*h9"'$?#X$D?Z"0$5///R$ 9&",'$8)*:Z,*,9=$?#X$>&"A,>?*$Z"&?M,):'P$d#$9&"$)9&"'$&?#X0$ T'i>&"9$ ?#X$ %)A?*,?0$ 5//.R$ B"^G)A"$ "9$ ?*0$ 5//.\$ ?#X$ &=V"'Z'?#>&"X$ V)*=A"'8$ [7#):"0$ 5///\0$ ,#>*:X,#L$ 9&"$ 9&"=$ ?'"$ #?#)A"9"'28,]"X0$ &,L&*=$ Z'?#>&"X$ ?#X$ "U9"#8,M"*=$ ,#M"89,L?9"X$ &=V"'Z'?#>&"X$ V)*="9&"'$ V)*=)*8$ A)#)X,8V"'8"$ A?>')A)*">:*"8$ ^,9&$ 8=AA"9',>?*$ )'$ V)*=L*=>"')*8$ [C:#X"'$ "9$ ?*0$ .333?0$ ZR$ 5///?0ZR$ Y??L0$ ?'>&,9">9:'"P$ %&"=$ >)#8,89$ );$ ?$ >"#9'?*$ >)'"0$ Z'?#>&,#L$ 5//.R$ T'"=$ ?#X$ Y??L0$ 5//5R$ C,"L"'8$ "9$ ?*0$ 5//4\$ ?'"$ :#,98$ ?#X$ 9"'A,#?*$ ;:#>9,)#?*$ L'):V8P$ %&"$ >)'"$ ?#X$ 9&"$ >)#M"#,"#9*=$ V'"V?'"XP$ Y=V"'Z'?#>&"X$ V)*=A"'8$ ?'"$ #)#2 1.$

92+"'(:-0$":$(.;$<"#+'2:2/$)-.*="'>$?-'$()).2/(:2-#$(>$+'03$(#+$3"#"$+".2@"'*$>*>:"=>$ ! 8=AA"9',>?*0$ &,L&*=$ Z'?#>&"X$ ?#X$ V)*=X,8V"'8"X$ A?>')A)*">:*"80$ ^&,*"$ 9&",'$ A?,#$ 89':>9:'?*$ ;"?9:'"0$ ?*8)$ >)AA)#$ 9)$ X"#X',A"'80$ ,8$ 9&?9$ 9&"=$ "U&,Z,9$ #?#)>?M,9,"8P$ %&"8"$9^)$9=V"8$);$V)*=A"'8$?'"$>?**"X$X"#X',9,>$V)*=A"'8$ 9&"$#?#)>?M,9,"8$);$^&,>&0$X"V"#X,#L$)#$9&",'$V)*?',9=0$>?#$ "#>?V8:*?9"$ M?',):8$ A)*">:*"80$ ,#>*:X,#L$ ?>9,M"$ X':L$ ,#L'"X,"#98P$%&"$"U9"'#?*$L'):V8$);$X"#X',9,>$V)*=A"'8$>?#$ Z"$ A)X,;,"X$ V')M,X,#L$ ?$ X,M"'8,9=$ );$ ;:#>9,)#?*$ A?9"',?*8$ [-jL9*"$ "9$ ?*0$ 5///\$ 9&?9$ >?#$ Z"$ "AV*)="X$ ;)'$ M?',):8$ ?VV*,>?9,)#8P$ k,9&,#$ 9&,8$ >)#9"U90$ >)AA"'>,?**=$ ?M?,*?Z*"$ )'$ >:89)A2A?X"$X"#X',A"',>$)'$&=V"'Z'?#>&"X$V)*=A"'8$>?#$ Z"$ ;:#>9,)#?*,]"X$ ;)'$ Z",#L$ :8"X$ ?8$ ";;">9,M"$ 8=89"A8$ ;)'$ X':L$[_,:$?#X$T'i>&"90$.333R$F"$l"828$"9$?*0$5//5R$C9,',Z?$ "9$?*0$5//5R$+""]"'$"9$?*0$5//JR$!,**,"8$?#X$T'i>&"90$5//I\$ ?#X$L"#"$[+,"*,#8G?$"9$?*0$.333R$_:)$"9$?*0$5//5R$d&8?G,$"9$ ?*0$5//5\$X"*,M"'=P$C,#>"$A)'"$9&?#$)#"$9=V"$);$L'):V8$>?#$ Z"$ ,#9')X:>"X$ ?9$ 9&"$ 8:';?>"$ );$ 9&"$ X"#X',9,>$ V)*=A"'80$ 9&"8"$ 8=89"A8$ ?'"$ >&?'?>9"',]"X$ ?8$ A:*9,;:#>9,)#?*$ ?8$ 8&)^#$ ,#$ P%&*0#! OP$ `?>&$ 9=V"$ );$ L'):V8$ V*?=8$ ?$ 8V">,;,>$ ')*"$ ,#$ 9&"$ ?VV*,>?9,)#$ );$ A:*9,;:#>9,)#?*$ X"#X',9,>$ V)*=A"'8$ ?8$ X':L$ X"*,M"'=$ 8=89"A8P$ %&:80$ 8V">,;,>,9=$ ;)'$ >"'9?,#$ >"**8$ >?#$ Z"$ ?>>)AV*,8&"X$ Z=$ ?99?>&,#L$ 9?'L"9,#L$ *,L?#X8$ ?9$ 9&"$ 8:';?>"$ );$ X"#X',9,>$ V)*=A"'80$ ^&,*"$ "#&?#>"X$ 8)*:Z,*,9=0$ X">'"?8"X$ 9)U,>,9=0$ Z,)>)AV?9,Z,9=0$ 89?Z,*,9=$ ?#X$ V')9">9,)#$ ,#$ 9&"$ Z,)*)L,>?*$ A,*,":$ >?#$ Z"$ ?>&,"M"X$ Z=$ 9&"$ ;:#>9,)#?*,]?9,)#$ );$ 9&"$ "#X$ L'):V8$ );$ X"#X',9,>$ V)*=A"'80$ ;)'$ ,#89?#>"0$ ^,9&$ V)*=["9&=*"#"$ L*=>)*\$ >&?,#8$ [<`!\P$ %&"$ ;:#>9,)#$ );$ <`!2>&?,#8$ ,8$ >':>,?*$;)'$A)X,;=,#L$9&"$Z"&?M,):'$);$X':L$9&"A8"*M"8$)'$ );$ 9&",'$ >?'',"'8$ [B)VV*2C,A8)#$ ?#X$ B""X&?A0$ .336R$ 78&,^?9?$ "9$ ?*0$ .331R$ _,:$ "9$ ?*0$ .333R$ _,:$ "9$ ?*0$ 5///R$ -"')#"8"0$ 5//.R$ D)Z"'98$ "9$ ?*0$ 5//5R$ <?#9)8$ "9$ ?*0$ 5//4R$ -?#X"'A":*"#$?#X$m*)G0$5//4\P$ %?'L"9,#L$ *,L?#X8$ ?'"$ >)AV*"A"#9?'=$ 9)$ >"**$ '">"V9)'8$ [@))V"'0$ .331R$ _)X,8&$ "9$ ?*0$ 5///\$ ?#X$ ,#X:>"$ 9&"$?99?>&A"#9$);$9&"$#?#)>?'',"'$9)$9&"$>"**$8:';?>"P$%&,8$

Z,#X,#L$,8$;:'9&"'$"#&?#>"X$X:"$9)$9&"$8)2>?**"X$V)*=M?*"#9$ ,#9"'?>9,)#8$ [(?AA"#$ "9$ ?*0$ .33cR$ m,9)M$ ?#X$ +:#X*"0$ 5//J\$?99',Z:9"X$9)$9&"$>*)8"$V')U,A,9=$);$9&"$'">)L#,]?Z*"$ *,L?#X8$ )#$ 9&"$ *,A,9"X$ 8:';?>"$ ?'"?$ );$ 9&"$ X"#X',9,>$ A)*">:*"8P$ d#$ 9&"$ )9&"'$ &?#X0$ ?8$ ,9$ &?8$ *)#L$ Z""#$ "89?Z*,8&"X$ ^,9&$ *,V)8)A"8$ [_?8,>$ ?#X$ B""X&?A0$ .33IR$ @')8?88)$"9$?*0$5///R$B""X&?A$?#X$m,A0$5///R$C,*M?#X"'$ "9$ ?*0$ 5///\0$ <`!2>&?,#8$ A?=$ V')*)#L$ 9&"$ >,'>:*?9,)#$ );$ *,V)8)A"8$,#$Z,)*)L,>?*$A,*,":P$%'?#8V)'9$9&'):L&$9&"$>"**$ A"AZ'?#"$ >?#$ ?*8)$ Z"$ ;?>,*,9?9"X$ Z=$ 9&"$ ,#9')X:>9,)#$ );$ ?VV')V',?9"$ A),"9,"8$ ?9$ 9&"$ 8:';?>"$ );$ 9&"$ X"#X',9,>$ V)*=A"'8P$7#$?XX,9,)#0$A)X,;,>?9,)#$);$9&"$,#9"'#?*$L'):V8$ );$X"#X',A"'8$?;;">98$9&",'$8)*:Z,*,],#L$>&?'?>9"'0$A?G,#L0$ 9&"'";)'"0$ V)88,Z*"$ 9&"$ "#>?V8:*?9,)#$ );$ ?$ X,M"'8,9=$ );$ X':L8P$7#$9&,8$>)##">9,)#0$>?9,)#,]?9,)#$);$X"#X',A"'80$?#X$ V?'9,>:*?'*=$ );$ 9&",'$ "U9"'#?*$ L'):V80$ ;?>,*,9?9"8$ 9&",'$ ?VV*,>?9,)#$?8$L"#"$9'?#8;"'$?L"#98$[+,"*,#8G?$"9$?*0$.333R$ _:)$ "9$ ?*0$ 5//5R$ d&8?G,$ "9$ ?*0$ 5//5\$ X:"$ 9)$ ;)'A?9,)#$ );$ FBK2F"#X',9,>$<)*=A"'$>)AV*"U"8P$ ()#);:#>9,)#?*$ X"#X',9,>$ X':L$ >?'',"'8$ X)$ #)9$ 8,A:*9?#"):8*=$ 8&)^$ 9&"$ X"8,'"X$ V')V"'9,"8$ 9&?9$ A:*9,;:#>9,)#?*$ X"',M?9,M"8$ "U&,Z,9P$ %&:80$ ,#$ 9&,8$ '"M,"^0$ 89?'9,#L$ ;')A$ 8"*">9"X$ A)#);:#>9,)#?*$ 8=89"A8$ ?#X$ 8V">,;,>?**=$ ;')A$ 9&"$ X"#X',A"',>$ >)AV):#X8$ V)*=[?A,X)?A,#"\0$ <K(K(0$ ?#X$ X,?A,#)Z:9?#"$ V)*=[V')V=*"#"$ ,A,#"\0$ FK+0$ ?#X$ ?*8)$ ;')A$ 9&"$ &=V"'Z'?#>&"X$ V)*=A"'8$ V)*=L*=>"')*0$ <!$ ?#X$ V)*=["9&=*"#"$,A,#"\0$<`70$[P%&*0#!I\$?$89"V^,8"$X"8,L#$);$ A:*9,;:#>9,)#?*$ 8=89"A8$ ^,**$ Z"$ X,8>:88"X0$ ?,A,#L$ ?9$ )Z9?,#,#L$ ?VV')V',?9"$ #?#)>?'',"'8$ ;)'$ X':L$ X"*,M"'=$ ?#X$ L"#"$9'?#8;">9,)#P$%&,8$'"M,"^$,8$Z=$#)$A"?#8$"U&?:89,M"$ ?#X$)#*=$8"*">9"X$"U?AV*"8$^,**$Z"$X,8>:88"X$&,L&*,L&9,#L$ )#$ ^)'G$ V"';)'A"X$ '">"#9*=$ ,#$ ):'$ *?Z)'?9)'=P$ %&"$ )Za">9,M"$);$9&,8$'"M,"^$,8$9)$,**:89'?9"$9&"$";;">9,M"#"88$);$ 9&"$89'?9"L=$);$A)*">:*?'$"#L,#""',#L0$?VV*,"X$)#$X"#X',9,>$ 8:';?>"80$9)$V'"V?'"$X':L$>?'',"'8$^,9&$X"8,'"X$V')V"'9,"8P$$

B B

X %"'A,#?*$L'):V

X D">)L#,]?Z*"$L'):V

X +'?#>&,#L$V),#9

B B

X <')9">9,M"$>)?9,#L

B B

$ P%&*0#!OD$C>&"A?9,>$'"V'"8"#9?9,)#$);$?$A:*9,;:#>9,)#?*$X"#X',A"'P$

15$

!"#"$%&"'()*$(#+$,-."/0.('$12-.-3*$4-.$567$)(3"$8A$ ! "#% # " % "#% #%" " # "

#%" "#%

# "

# " #%"

#% "

# "

#% " #%"

# $

" # # #%"

# "

" #

#%"

#" "#%

" "

" #

#% "

" # "

" #

$ # "

" "#%

"#%

#%"

" "

"#%

#% "

"#%

#%"

"#%

" "

#%" #% "

"#%

"#% "#%

"#%

FK+

" #

" "#% #%"

#% "

"#%

"#% "#%

"#%

" #

"#%

"#% " #

# "

# $

" #

"#% " #

" #

#%" "#%

$ "

# " $

#%"

"#% "

" "

" $

# "

" #

#% "

"#%

# "

" $

$ # "

"#%

# %"

"#%

" "

" $

" "

#%"

# "

$ "

" #

"#%

#% "

" #

"#%

#%"

"#%

# "

" #

" $

#% "

" #

# "

"#% "

$ " # # "

#%"

" # "

#% "

# "

" ##

# "

"#%

<K(K(

"#%

"#% "

"#%

" "#% "

$ $

"#%

"#% #"

"#% " #

$ " " $

& $#

$ $

$# $#

"#% "

'()*

"#% "

$# $

"#% " #

"#%

# "

$# "#% $#

"#%

" #

# "

"#%

"#% "#%

"#%

<`7

! P%&*0#!ID$@&"A,>?*$89':>9:'"$);$X"#X',A"',>$>)AV):#X8P$

$ $

TTD! "0*&! 3('()*'+,%('-.! /#'/0%3#0$!

?#X$ ;,#?**=$ '"?>&"X$ ?$ V*?9"?:P$ F"V"#X,#L$ )#$ 9&"$ L"#"'?9,)#0$ 9&"$ A?U,A:A$ #:AZ"'$ );$ KFD$ A)*">:*"8$ "#>?V8:*?9"X$ V"'$ X"#X',A"'$ ,P"P$ Z=$ 9&"$ (2<`![II/\2!J0$ (2<`![5///\2!J0$ (2<`![II/\2!40$ ?#X$ (2<`![5///\2 !4$ X"#X',A"',>$ X"',M?9,M"8$ ?'"$ >?P$ .P50$ 5PJ0$ .P60$ ?#X$ 6PI0$ '"8V">9,M"*=0$ ?8$ 8&)^#$ ,#$ P%&*0#! MP$ %&:80$ 9&"$ "#>?V8:*?9,)#$?Z,*,9=$M?',"X$;)'$9&"8"$<`!2X"#X',A"'8$?#X$ ,9$ ^?8$ ;):#X$ 9)$ X"V"#X$)#$ 9&"$ A)*">:*?'$ ^",L&9$ );$<`!2 >&?,#8$?#X$?*8)$)#$X"#X',A"'8n$L"#"'?9,)#P$ <K(K($ &?8$ ?$ Z?8,>$ ,#9"',)'$ ?#X0$ 9&"'";)'"0$ ,9$ ,8$ V)88,Z*"$ 9)$ "#>?V8:*?9"$ (%b0$ ^&,>&$ ,8$ ?>,X,>0$ 8,#>"$ ,9$ Z"?'8$ 9^)$ >?'Z)U=*$ L'):V8P$ %&"$ #:AZ"'$ );$ (%b$ A)*">:*"8$ ?88)>,?9"X$ ^,9&$ )#"$ X"#X',A"'$ A)*">:*"0$ ?8$ ?$ ;:#>9,)#$ );$ 9&"$ (%boX"#X',A"'$ '?9,)$ X:',#L$ *)?X,#L$ ,8$ 8&)^#$ ,#$ P%&*0#! QP$ K8$ ,9$ ^?8$ )Z8"'M"X$ ,#$ 9&"$

+-00%#0$H! )0(3! ,(! 3*.,%)*'+,%('-.!

7#$?#$"U?AV*"$)#$A)*">:*?'$"#L,#""',#L$);$<K(K($ 8:';?>"0$ V)*=["9&=*"#"$ L*=>)*\$ A)#)A"9&=*$ "9&"'$ [(2 <`!\0$&?M,#L$?#$?M"'?L"$A)*">:*?'$^",L&9$);$II/$)'$5///0$ ^?8$?99?>&"X$?9$9&"$9"'A,#?*$?A,#)$L'):V8$);$9&"$9&,'X$?#X$ ;):'9&$ L"#"'?9,)#$ V)*=A"'8$ ?8$ 8&)^#$ ,#$ P%&*0#! YP$ 7#8,X"$ 9&"$#?#)>?M,9,"8$);$9&"$8)2V'"V?'"X$<`!=*?9"X$X"#X',A"'80$ KX',?A=>,#0$ KFD0$ )'$ ("9&)9'"U?9"0$ (%b0$ ?#9,>?#>"'$ X':L8$[P%&*0#!Z\$^"'"$"#>?V8:*?9"X$[m)a,A?$"9$?*0$5///\P$ K8$9&"$?A):#9$);$KFD$"AV*)="X$;)'$"#>?V8:*?9,)#$,#8,X"$ 9&"8"$ <`!=*?9"X$ X"#X',A"'8$ ,#>'"?8"X0$ 9&"$ #:AZ"'$ );$ KFD$ A)*">:*"8$ ?88)>,?9"X$ ^,9&$ 9&"$ X"#X',A"'$ ,#>'"?8"X$ 1J$

92+"'(:-0$":$(.;$<"#+'2:2/$)-.*="'>$?-'$()).2/(:2-#$(>$+'03$(#+$3"#"$+".2@"'*$>*>:"=>$ ! $ $# ,

"$%

$$$$$$$(2<`! [(k$II/0$5///\

"#% "#%#%"

# "

#%"

# "

" # $

# $

" # #

" #

$ # "

" "

" # "

"# %

" #

# "

" #

$ " # "

"#%

$$'#"

$ " # #

"$%

"#'$$ #" '$ $

"#%

" "

" # "

"# '$ $

#%"

#" '$ $

" #

# "

# $

$ " #

"# '$ $

"#'$ $ "# '$ $

$ #

" #

" " #

"# '$ $

"#% #%"

" # " $

" #

"# '$ $ " #

# "

" "

$ #

# " $

"# '$ $

" $

# "

" #

# "

$ $

# # "

" #

$ "

$ '$ "# '$ $ "#

# "

" "

" #

$ '$ #"

" "#%

$$'#"

"#% "#%

" #

$ '$ "# "

$ #

"#%

" #

# "

$$'#"

# " $$'#"

" #

" $

" #% "

$ '$ #"

$ "

# "

" #

# "

"#'$$

$ $

" "

$ #

"#%

# "

" $

$ "

"#%

# "

$$'#"

" #

$ "

$ '$ "# # "

# "

"#%

$ # "

"#%

# "

$ $ '$ '$ "# #"

"#% #%"

# " "

$ "

#%" #%"

" #

" # $

$ $

#%"

"#%

# "

"#%

# "

#%"

# "

"#% #%" # "

$ $ '$ '$ "# #"

#%" "

(2<`!$42#,9')V&"#=*$>?'Z)#?9"$$$$ $$$$$$$$$$$$$$$$$$$$$$[7\

# "

"#'$ $

"# '$ $

" #

" "# '$ $

#" '$ $

<K(K( (2<`!2<K(K(

P%&*0#!YD$<'"V?'?9,)#$?#X$89':>9:'"$);$(2<`!$<K(K($X"#X',A"'$);$9&"$9&,'X$L"#"'?9,)#P$D"V')X:>"X$;')A$m)a,A?$"9$?*0$5///$^,9&$ G,#X$V"'A,88,)#$;')A$9&"$?:9&)'8$?#X$KA"',>?#$@&"A,>?*$C)>,"9=P$ $ $ $

'#%$# "#%

" # " "

$'#-

KFD

#-' #% " $#

'$$#

#%"

'$$#

'#-

(%b

P%&*0#!ZD$@&"A,>?*$89':>9:'"$);$9&"$?#9,>?#>"'$X':L8$?X',?A=>,#0$KFD0$?#X$("9&)9'"U?9"0$(%b$

$ P%&*0#! MD$ `#>?V8:*?9,)#$ );$ KFD$ Z=$ (2<`![II/\2?99?>&"X$ [)V"#$ 8=AZ)*8\$ )'$ (2<`![5///\2 ?99?>&"X$ [>*)8"X$ 8=AZ)*8\$ <K(K($ !J$ [!0!\$ ?#X$ !4$ ["0!\$X"#X',A"'8P$%&"$#:AZ"'$);$ KFD$ "#>?V8:*?9"X$ V"'$ X"#X',A"'$ ,8$ 8&)^#$ ?8$ ?$ ;:#>9,)#$ );$ 9&"$ KFDoX"#X',A"'$A)*?'$'?9,)$X:',#L$ *)?X,#LP$ D"V')X:>"X$ ;')A$ m)a,A?$ "9$ ?*0$ 5///$ ^,9&$ G,#X$ V"'A,88,)#$ ;')A$KA"',>?#$@&"A,>?*$C)>,"9=P$

$ 14$

!"#"$%&"'()*$(#+$,-."/0.('$12-.-3*$4-.$567$)(3"$8B$ ! ! P%&*0#! QD$ `#>?V8:*?9,)#$ );$ (%b$ Z=$ (2<`![II/\2?99?>&"X$ [)V"#$ 8=AZ)*8\$ )'$ (2<`![5///\2 ?99?>&"X$ [>*)8"X$ 8=AZ)*8\$ <K(K($ !J$ [!0!\$ ?#X$ !4$ ["0$ !\$ X"#X',A"'8P$ %&"$ #:AZ"'$ );$ (%b$ "#>?V8:*?9"X$ V"'$ X"#X',A"'$ ,8$ 8&)^#$ ?8$ ?$ ;:#>9,)#$ );$ 9&"$ (%boX"#X',A"'$A)*?'$'?9,)$X:',#L$ *)?X,#LP$ D"V')X:>"X$ ;')A$ m)a,A?$ "9$ ?*0$ 5///$ ^,9&$ G,#X$ V"'A,88,)#$ ;')A$KA"',>?#$@&"A,>?*$C)>,"9=P$

$ "#>?V8:*?9,)#$ );$ KFD0$ 9&"$ #:AZ"'$ );$ (%b$ A)*">:*"8$ ?88)>,?9"X$ ^,9&$ 9&"$ A)X,;,"X$ X"#X',A"'$ ,#>'"?8"X$ ^,9&$ ,#>'"?8,#L$?A):#9$);$(%b$"AV*)="X$X:',#L$*)?X,#L0$?#X$ ;,#?**=$ '"?>&"X$ ?$ >)#89?#9$ M?*:"P$ %&"$ A?U,A:A$ #:AZ"'8$ );$ (%b$ A)*">:*"8$ ?88)>,?9"X$ ^,9&$ 9&"$ (2<`![II/\2!J0$ (2<`![5///\2!J0$ (2<`![II/\2!40$ ?#X$ (2<`![5///\2 !4$ X"#X',A"'8$ ?'"$ ?VV')U,A?9"*=$ ./0$ .J0$ 5/0$ ?#X$ 56$ A)*oA)*$ );$ X"#X',A"'0$ '"8V">9,M"*=P$ KVV?'"#9*=0$ 9&"$ #:AZ"'$ );$ 9&"$ "#>?V8:*?9"X$ X':L8$ Z=$ 9&"$ <`!=*?9"X$ X"#X',A"'8$ ,#>'"?8"X$ ^&"#$ (%b$ ^?8$ :8"X$ ,#89"?X$ );$ KFDP$ C,#>"$ 9&"8"$ X':L8$ &?M"$ 8,A,*?'$ A)*">:*?'$ ^",L&980$ 9&,8$ '"8:*9$ 8:LL"898$ 9&?9$ 9&"$ "*">9')89?9,>$ ,#9"'?>9,)#$ ;')A$ 9&"$?>,X2Z?8"$,#9"'?>9,)#$Z"9^""#$9&"$X"#X',A"'$?#X$(%b$ A)*">:*"8$ '"8:*98$ ,#$ ?#$ "#&?#>"X$ "#>?V8:*?9,)#$ );$ (%b$ Z=$ 9&"8"$ X"#X',A"'8P$ K8$ ,9$ ^?8$ 9&"$ >?8"$ ^,9&$ KFD$ "#>?V8:*?9,)#0$ 9&"$ #:AZ"'$ );$ (%b$ "#>?V8:*?9"X$ Z=$ 9&"$ X"#X',A"'$ ^?8$ ?;;">9"X$ Z)9&$ Z=$ L"#"'?9,)#$ );$ 9&"$ <K(K($?#X$Z=$9&"$>&?,#$*"#L9&$);$9&"$(2<`!P$ D"*"?8"$ "UV"',A"#98$ V"';)'A"X$ ,#$ <+C$ Z:;;"'$ [<&)8V&?9"$ +:;;"'$ C?*,#"\$ 8&)^"X$ 9&?9$ KFD$ ^?8$ '"?X,*=$ '"*"?8"X$ ;')A$ 9&"$ A)X,;,"X$ X"#X',A"'8P$ KVV?'"#9*=0$ &=X')V&)Z,>$,#9"'?>9,)#$Z"9^""#$KFD$?#X$9&"$X"#X',A"'$ ,8$#)9$89')#L$"#):L&$9)$'"9?,#$9&"$X':L$,#$9&"$,#9"',)'$);$9&"$ <K(K($ X"#X',A"',>$ A),"9=P$ %&"$ '"*"?8"$ );$ (%b$ ;')A$ 9&"$ (2<`!2;:#>9,)#?*,]"X$ X"#X',A"'8$ ^?8$ ?*8)$ ,#M"89,L?9"X$Z=$9&"$8?A"$A"9&)XP$%&"$9,A"$X"V"#X"#>=$);$ (%b$>)#>"#9'?9,)#$,#$9&"$):9"'$V&?8"$X:',#L$9&"$X,?*=8,8$ ,8$8&)^#$,#$P%&*0#![P$KVV?'"#9*=0$9&"$(%b$>)#>"#9'?9,)#$ ,#$ 9&"$ ):9"'$ V&?8"$ ,#>'"?8"X$ ?9$ ?$ 8*)^"'$ '?9"$ ^&"#$ (%b$ ^?8$ "#>?V8:*?9"X$ ,#$ 9&"$ (2<`!2?99?>&"X$ X"#X',A"'$ 9&?#$ ,#$ 9&"$ >?8"$ );$ ;'""$ (%bP$ %&,8$ ,#X,>?9"8$ 9&?9$ (%b$ ^?8$ L'?X:?**=$ '"*"?8"X$ ;')A$ 9&"$ A)X,;,"X$ X"#X',A"'P$ K8$ A"#9,)#"X$?Z)M"0$(%b$^?8$"*">9')89?9,>?**=$Z):#X$9)$9&"$ X"#X',A"',>$ ,#9"',)'$ ?#X0$ 9&"'";)'"0$ X,88)>,?9,)#$ );$ (%b$ ;')A$ 9&"$ X"#X',A"'$ ^?8$ 8:VV'"88"X$ 9)$ 8)A"$ "U9"#9P$ Y)^"M"'0$^&"#$9&"$X,?*=8,8$^?8$V"';)'A"X$,#$9&"$V'"8"#>"$ );$ .I/$ A($ B?@*0$ #)$ X,;;"'"#>"$ ,#$ 9&"$ '"*"?8"$ '?9"$ ^?8$

)Z8"'M"X$ Z"9^""#$ (%b$ "#>?V8:*?9"X$ ,#$ 9&"$ (2<`!2 ?99?>&"X$X"#X',A"'$?#X$;'""$(%bP$7#$9&,8$>?8"0$(%b$>?#$ X,88)>,?9"$ '"?X,*=$ ;')A$ 9&"$ X"#X',A"'$ Z">?:8"$ 9&"$ "*">9')89?9,>$ ,#9"'?>9,)#$ ,8$ ^"?G"#"X$ Z=$ 9&"$ 8&,"*X,#L$ ";;">9$);$B?S$?#X$@*2$[m)a,A?$"9$?*0$5///\P$ `;;">9,M"$ 8)*:Z,*,]?9,)#$ );$ &=X')V&)Z,>$ X':L8$ ^?80$ &)^"M"'0$ ?>&,"M"X$ ^,9&$ ?#)9&"'$ <`!=*?9"X$ X"#X',A"',>$ 8=89"A$ [C,X"'?9):$ "9$ ?*0$ 5//.\0$ ^&,>&$ ,8$ ?#?*)L):8$ 9)$ 9&"$ )#"$ V'"M,):8*=$ X,8>:88"XP$ <`!=*?9,)#$ );$ X"#X',A"'8$ ^?8$ V"';)'A"X$ :#X"'$ ;?>,*"$ "UV"',A"#9?*$ >)#X,9,)#8$ Z=$ 9&"$ ,#9"'?>9,)#$ );$ A"9&)U=V)*=["9&=*"#"$ L*=>)*\2,8)>=?#?9"$ [<`!2,8)>=?#?9"\$^,9&$9&"$"U9"'#?*$V',A?'=$?A,#)$L'):V8$ );$ FK+$ X"#X',A"'8$ );$ ;,;9&$ L"#"'?9,)#0$ ?8$ 8&)^#$ ,#$ P%&*0#$ JP$ %^)$ X,;;"'"#9$ <`!=*?9"X$ X"#X',A"',>$ X"',M?9,M"8$ ^"'"$ V'"V?'"X$ ,P"P$ 9&"$ FK+24<`!$ [^"?G*=$ <`!=*?9"X\$ ?#X$ FK+2c<`!$[X"#8"*=$ <`!=*?9"X\P$ 7#$ 9&,8$ A?##"'0$ 9&"$ ')*"$ );$ <`!2>)?9,#L$ )#$ "#>?V8:*?9,)#$ ?#X$ '"*"?8"$V')V"'9,"8$^?8$V)88,Z*"$9)$Z"$?88"88"XP$ @)AV?',8)#$ );$ 8)*:Z,*,],#L$ ?Z,*,9=$ );$ 9&"$ V?'"#9$ ?#X$ <`!=*?9"X$FK+$X"#X',A"'8$,8$8&)^#$,#$>-G.#!OP$T)'$9&,8$ V:'V)8"0$ Z"9?A"9&?8)#"$ M?*"'?9"0$ +-0$ ?#X$ Z"9?A"9&?8)#"$ X,V')V,)#?9"0$ +F0$ ^"'"$ :8"X$ ?8$ ?>9,M"$ X':L$ ,#L'"X,"#98$ [P%&*0#! \\P$ %&"8"$ ?#9,2,#;*?AA?9)'=$ >)'9,>)89"'),X8$ ?'"$ V'?>9,>?**=$^?9"'$,#8)*:Z*"$?#X$,9$,80$9&"'";)'"0$#">"88?'=$9)$ "#>?V8:*?9"$9&"8"$>)AV):#X8$,#$?$^?9"'28)*:Z*"$>?'',"'$;)'$ ;?>,*,9?9,#L$ 9&",'$ :8"$ ?8$ X':L8P$ %&"$ >)#>"#9'?9,)#$ );$ "#>?V8:*?9"X$ Z"9?A"9&?8)#"$ X"',M?9,M"8$ ^?8$ 8,L#,;,>?#9*=$ ,#>'"?8"X$,#$<`!=*?9"X$X"#X',A"'8P$%&:80$;)'$FK+2c<`!$ 9&"$*)?X,#L$^?8$.J$?#X$1$^9Pp$;)'$+-$?#X$+F0$^&,*"$;)'$ FK+24<`!$^?8$6$?#X$4$^9Pp0$'"8V">9,M"*=P$%&"$)Z8"'M"X$ 8)*:Z,*,9=$ ,#>'"?8"$ ^?8$ ?99',Z:9"X$ 9)$ ?#$ ?XX,9,)#?*$ 8)*:Z,*,]?9,)#$ );$ 9&"$ >)AV):#X8$ ,#$ <`!2>&?,#8$ Z=$ ^&,>&$ 9&"$X"#X',A"'8$?'"$>)?9"XP$%&,8$,8$?*8)$M"',;,"X$Z=$9&"$;?>9$ 9&?9$ :V)#$ V')9)#?9,)#$ 9&"=$ '"A?,#$ 8)*:Z,*,]"X$ ,#$ <`!2 >&?,#8$"#M,')#A"#9P$K8$"UV">9"X0$Z=$,#>'"?8,#L$X"#X',A"'$ >)#>"#9'?9,)#0$ 8)*:Z,*,]?9,)#$ );$ X':L8$ ?#?*)L):8*=$ ,#>'"?8"8$9)$?$>"'9?,#$*,A,9P$ 1I$

92+"'(:-0$":$(.;$<"#+'2:2/$)-.*="'>$?-'$()).2/(:2-#$(>$+'03$(#+$3"#"$+".2@"'*$>*>:"=>$ !

$ P%&*0#![D!D"*"?8"$);$(%b$;')A$ 9&"$ (2<`![5///\2?99?>&"X$ !4$ X"#X',A"'P$%&"$(%b2*)?X"X$(2 <`![5///\2!4$ X"#X',A"'$ [!0$ !\$ )'$ ;'""$ (%b$ ["0$ !\$ X,88)*M"X$ ,#$ .$ A($ %',82Y@*2 Z:;;"'"X$ 8)*:9,)#$ [VY$ 1P4\$ >)#9?,#,#L$[)V"#$8=AZ)*8\$)'$#)9$ >)#9?,#,#L$ [>*)8"X$ 8=AZ)*8\$ .I/$ A($ B?@*$ ?#X$ X,?*=]"X$ ?L?,#89$ 9&"$ 8?A"$ 8)*:9,)#P$ %&"$ 9,A"$ >):'8"$ );$ (%b$ >)#>"#9'?9,)#$ ,#$ 9&"$ ):9"'$ V&?8"$ X:',#L$ 9&"$ X,?*=8,8$ ,8$ 8&)^#$ ,#$ 9&"$ ;,L:'"P$ D"V')X:>"X$ ;')A$ m)a,A?$ "9$ ?*0$ 5///$ ^,9&$ G,#X$ V"'A,88,)#$ ;')A$ KA"',>?#$@&"A,>?*$C)>,"9=P$

$ $ $

"#%

$ ' "# "#%

(2<`!2,8)>=?#?9" $$$$$$[(k$I///\

./!()!0.

FK+64 $ FK+642<`!

1!()!2

P%&*0#!JP$<'"V?'?9,)#$?#X$89':>9:'"$);$<`!=*?9"X$FK+$X"#X',A"'$);$9&"$;,;9&$L"#"'?9,)#$;:#>9,)#?*,]"X$^,9&$4$)'$c$<`!$>&?,#8P$ $

$ T)'$?$X"9?,*"X$,#M"89,L?9,)#$);$9&"$8)*:Z,*,]?9,)#$8,9"$ ?#X$ '"*"?8"$V')V"'9,"8$ );$ 9&"8"$ <`!=*?9"X$ X"#X',A"'8$ 9&"$ &=X')V&)Z,>$ V='"#"$ ^?8$ "AV*)="XP$ %&,8$ ,8$ ?$ M"'=$ 8"#8,9,M"$V')Z"$?#X$,9$,8$:8"X$?8$?$A)X"*$>)AV):#X$^&"#$ X':L8$>?##)9$);;"'$9&,8$9=V"$);$,#;)'A?9,)#P$+=$"AV*)=,#L$ 9&"$ ^"**2G#)^#$ C5DCA$ ;*:)'"8>"#>"$ ,#9"#8,9=$ '?9,)0$ ^&,>&$ V')Z"8$9&"$V)*?',9=$);$9&"$A"X,:A$[%&)A?80$.3c/\0$,9$^?8$ ;):#X$ 9&?9$ V='"#"$ ,8$ 8)*:Z,*,]"X$ Z)9&$ ,#$ 9&"$ >)'"$ ?#X$ ,#$ <`!2>&?,#8P$ 7#$ ?XX,9,)#0$ :V)#$ V')9)#?9,)#$ );$ 9&"$ *)?X"X$ <`!=*?9"X$ X"#X',A"'0$ V='"#"$ ,8$ #)9$ '"*"?8"X$ ,#$ 9&"$ Z:*G$ ?e:"):8$ V&?8"$ ?8$ a:XL"X$ ?L?,#$ Z=$ 9&"$ C5DCA$ '?9,)$ ?#X$ ;*:)'"8>"#>"$ ,#9"#8,9=$ [EDE6\$ '"8:*98P$ %&,8$ ,8$ ?99',Z:9"X$ 9)$ 9&"$;?>9$9&?9$?8$V='"#"$,8$*"?M,#L$9&"$>)'"$,9$,8$V)88,Z*"$9)$ Z"$8)*:Z,*,]"X$,#8,X"$<`!2>&?,#80$?8$8&)^#$8>&"A?9,>?**=$ ,#$ T,L:'"$ ./P$ %&"$ '"8:*98$ );$ C5DCA$ ;*:)'"8>"#>"$ ,#9"#8,9=$ '?9,)$,#X,>?9"$9&?9$V='"#"$,8$#",9&"'$8)*:Z,*,]"X$,#$9&"$Z:*G$ ^?9"'$V&?8"$#)'$,#$9&"$,#9"',)'$);$9&"$X"#X',A"'P$B)'A?**=0$ )#"$^):*X$"UV">9$'"*"?8"$);$V='"#"$,#$^?9"'0$8,#>"0$X:"$9)$ V')9)#?9,)#0$9&"$"#M,')#A"#9$);$9&"$#?#)>?M,9,"8$Z">)A"8$ V)*?'$ ?#X0$ 9&"'";)'"0$ 9&"$ &=X')V&)Z,>$ V='"#"$ >?##)9$ '"A?,#$ 8)*:Z,*,]"XP$ 7#$ ?XX,9,)#0$ V')9)#?9"X$ 9"'9,?'=$ ?A,#)$ L'):V8$);$9&"$>)'"$X)$#)9$"U&,Z,9$?#=A)'"$9&"$V')V"'9=$9)$ ;)'A$>&?'L"29'?#8;"'$>)AV*"U"8$^,9&$V='"#"$[C,X"'?9):$"9$

?*0$5///\$?#X0$9&"'";)'"0$"#>?V8:*?9,)#$);$9&"$V='"#"$,8$#)$ *)#L"'$ ;?M):'"XP$ 79$ 8&):*X0$ &)^"M"'0$ Z"$ #)9"X$ 9&?9$ >)AV*"9"$ '"*"?8"$ );$ V='"#"$ >?#$ Z"$ ?>&,"M"X$ :V)#$ "U&?:89,M"$X,*:9,)#$);$9&"$<`!=*?9"X$X"#X',A"'P$%&"$8?A"$ Z"&?M,):'$ ^?8$ )Z8"'M"X$ ;)'$ 9&"$ &=X')V&)Z,>$ X':L8$ +-$ ?#X$ +FP$ 7#$ >)#>*:8,)#0$ 9&"$ "#&?#>"X$ 8)*:Z,*,]?9,)#$ );$ 9&"8"$ X':L8$ ,#$ <`!=*?9"X$ X"#X',A"'8$ 8">:'"8$ 9&",'$ ?VV*,>?9,)#$ ?8$ V')A,8,#L$ >)#9')**"X$ '"*"?8"$ X':L$ X"*,M"'=$ 8=89"A8P$ 7#$ ?#)9&"'$ '">"#9$ '"V)'90$ "U9"#X,#L$ 9&"$ V'"M,):8$ ^)'G0$ ?$ #)M"*$ A:*9,;:#>9,)#?*$ X"#X',A"',>$ >?'',"'$ ^?8$ X"8,L#"X$ [<?*")8$ "9$ ?*0$ 5//4\$ Z?8"X$ )#$ X,?A,#)Z:9?#"$ V)*=[V')V=*"#"$ ,A,#"\$ X"#X',A"'$ );$ 9&"$ ;,;9&$ L"#"'?9,)#P$ %&"$ 8=#9&"9,>$ V')>"X:'"$ );$ 9&,8$ X"',M?9,M"$ ,8$ 8&)^#$ ,#$ P%&*0#! OOP$ %&,8$ >?'',"'$ ,8$ ,#9"#X"X$ 9)$ 8,A:*9?#"):8*=$ ?XX'"88$ ,88:"8$ 8:>&$ ?8$ 89?Z,*,9=$ ,#$ 9&"$ Z,)*)L,>?*$ A,*,":0$ 9?'L"9,#L$ ?#X$ M"'=$ V)88,Z*=$ 9'?#8V)'9$ 9&'):L&$ >"**$ A"AZ'?#"8P$ T)'$ 9&,8$ V:'V)8"0$ ,#$ ?XX,9,)#$ 9)$ 8:';?>"$ V')9">9,M"$ V)*=["9&=*"#"$ L*=>)*\$ >&?,#80$ L:?#,X,#,:A$ A),"9,"8$^"'"$,#9')X:>"X$?8$9?'L"9,#L$*,L?#X8P$7#$?XX,9,)#0$ 9&"$?>>:A:*?9,)#$);$L:?#,X,#,:A$L'):V8$?9$9&"$8:';?>"$);$ 9&"$X"#X',A"'$A?=$?*8)$;?>,*,9?9"$,98$9'?#8V)'9$?Z,*,9=P$%&"$ ;:#>9,)#?*$ L'):V8$ ^"'"$ >)M?*"#9*=$ ?99?>&"X$ ?9$ 9&"$ 16$

!"#"$%&"'()*$(#+$,-."/0.('$12-.-3*$4-.$567$)(3"$88$ ! .335\0$>P$<)88,Z,*,9=$);$"#>?V8:*?9,)#$?#X$'"*"?8"$);$?>9,M"$ X"#X',A"',>$ 8:';?>"$ ?#X$ ,9$ ^?8$ V)88,Z*"$ 9)$ 8">:'"0$ ,#$ X':L$ ,#L'"X,"#98$ ;')A$ 9&"$ #?#)>?M,9,"80$ ^&,>&$ >?#$ Z"$ V',#>,V*"0$ X"8,'"X$ X':L$ X"*,M"'=$ V')V"'9,"8$ X:"$ 9)O$ ?P$ 9:#"X$Z=$"#M,')#A"#9?*$>&?#L"8$[C,X"'?9):$"9$?*0$5//.\0$XP$ <')9">9,)#$ );$ 9&"$ >?'',"'$ Z">?:8"$ );$ 9&"$ >)M"'?L"$ );$ 9&"$ @)AV*"U?9,)#$^,9&$FBK$;)'$L"#"$9&"'?V=$?VV*,>?9,)#80$"P$ X"#X',A"',>$ 8:';?>"$ ^,9&$ V)*=["9&=*"#"$ L*=>)*\$ >&?,#80$ ZP$ %&"$ )>>:''"#>"$ );$ V)*=M?*"#>=$ ,#9"'?>9,)#80$ ?88)>,?9"X$ D">)L#,9,)#$ ?Z,*,9=$ 9)^?'X8$ >)AV*"A"#9?'=$ A),"9,"8R$ ^,9&$ "#&?#>"X$ Z,#X,#L0$ X:"$ 9)$ 9&"$ ?>>:A:*?9,)#$ );$ 8:';?>"$ L:?#,X,#,:A$ L'):V8$ 8">:'"$ 9&"$ ;?>,*"$ ,#9"'?>9,)#$ '">)L#,]?Z*"$ A),"9,"8$ )#$ 9&"$ *,A,9"X$ 8:';?>"$ ?'"?$ );$ 9&"$ ^,9&$?>,X,>$'">"V9)'8$,#>*:X,#L$9&"$Z,)*)L,>?**=$8,L#,;,>?#9$ X"#X',A"'$?8$8>&"A?9,>?**=$,**:89'?9"X$,#$P%&*0#!OI0$;P$%&"$ >?'Z)U=*?9"$?#X$V&)8V&?9"$L'):V8P$@)AZ,#"X$"*">9')89?9,>$ "UV">9"X$ X">'"?8"$ );$ 9)U,>,9=$ X:"$ 9)$ 9&"$ ;?>,*"$ ;)'>"8$ ?#X$ &=X')L"#$ Z)#X,#L$ ?'"$ "U"'>,8"X$ A?G,#L$ 9&,8$ A)X,;,>?9,)#$);$9&"$9)U,>$?A,#)$L'):V8$[(?*,G$"9$?*0$5///\P$ ,#9"'?>9,)#$ 9&"'A)X=#?A,>?**=$ ;?M)'?Z*"$ [Y,'89$ "9$ ?*0$ ! ! >-G.#! OD$ @)AV?'?9,M"$ 8)*:Z,*,9=$ );$ V='"#"$ [<f\0$ Z"9?A"9&?8)#"$ M?*"'?9"$ [+-\$ ?#X$ Z"9?A"9&?8)#"$ X,V')V,)#?9"$ [+F\$ ,#$ V?'"#9$FK+$?#X$<`!=*?9"X$X"',M?9,M"8P$D"V')X:>"X$;')A$C,X"'?9):$"9$?*0$5//.$^,9&$G,#X$V"'A,88,)#$;')A$`*8"M,"'P$ $ @(31(*'/! ]/#'/0%3#0^_C! ]E`^_C! ]ab^_C! ]a"^_C! FK+$ I$U$./2I 5P.I$U$./26 5P3I$U$./2I .Pc4$U$./2I 2I 2I 24 FK+2c<`!$ I$U$./ IP4/$U$./ JPcI$U$./ 5PI6$U$./24 2I 2I 24 FK+24<`!$ I$U$./ 5P.4$U$./ 5P/I$U$./ .P5I$U$./24 24 2I 2J FK+2c<`!$ I$U$./ cP1I$U$./ JP6I$U$./ .Pc1$U$./2J 24 2I 2J FK+24<`!$ I$U$./ IP5I$U$./ .P1/$U$./ .P/3$U$./2J

'%#1 $#

$ $

'1#5

# #

'%#1

$ $

# $

4 $

P%&*0#!\D$@&"A,>?*$89':>9:'"$);$Z"9?A"9&?8)#"$M?*"'?9"0$+-0$?#X$Z"9?A"9&?8)#"$X,V')V,)#?9"0$+F$

P%&*0#!OLD!C>&"A?9,>$'"V'"8"#9?9,)#$);$9&"$8)*:Z,*,]?9,)#$);$V='"#"$,#$<`!=*?9"X$X"#X',A"'8P$D"V')X:>"X$;')A!C,X"'?9):$"9$?*0$5//.$ ^,9&$G,#X$V"'A,88,)#$;')A$`*8"M,"'$+-P$

$ 11$

92+"'(:-0$":$(.;$<"#+'2:2/$)-.*="'>$?-'$()).2/(:2-#$(>$+'03$(#+$3"#"$+".2@"'*$>*>:"=>$ !

" " " "

" "

d @ B

" " "

" "

" " " "

" "

" " "

" "

d @ B@Y 5 @YJ

" "

" " " "

" "

B B

" " "

" "

BY5

BY 5

" "

" " " "

" "

" " "

" "

^&"'"O q$BY5 q$<`! q$BY@BY@Y5@YJ d BY5 2 @* q$BY@ S BY5

$ $

P%&*0#!OOD!D"?>9,)#$8>&"A"$;)'$9&"$8=#9&"8,8$);$?$A:*9,;:#>9,)#?*$X"#X',A"',>$X"',M?9,M"P!D"V')X:>"X$;')A$<?*")8$"9$?*0$5//4$^,9&$G,#X$ V"'A,88,)#$;')A$KA"',>?#$@&"A,>?*$C)>,"9=P$

$ $ ! P%&*0#!OIP$C>&"A?9,>$'"V'"8"#9?9,)#$ );$?$X"#X',A"'$"U&,Z,9,#L$V)*=M?*"#9$ V')V"'9,"8$

T)'$ "M?*:?9,#L$ 9&"$ *)?X,#L$ >?V?>,9=$ ?#X$ '"*"?8"$ V')V"'9,"8$);$9&"$?Z)M"$A:*9,;:#>9,)#?*$X"#X',A"'0$V='"#"$ [<f\$ ?#X$ Z"9?A"9&?8)#"$ M?*"'?9"$ [+-\0$ ^"'"$ :8"X$ ?8$ A)X"*$ >)AV):#X8P$ %&"$ X"#X',A"',>$ X"',M?9,M"$ "#>?V8:*?9"X$ 8,L#,;,>?#9*=$ &,L&"'$ >)#>"#9'?9,)#8$ );$ 9&"$ ?Z)M"$ >)AV):#X8$ >)AV?'"X$ 9)$ 9&"$ V?'"#9$ X"#X',A"'0$ ?8$ X"9"'A,#"X$ Z=$ r-$ 8V">9')8>)V=$ ?#X$ 8&)^#$ ,#$ >-G.#! IP$ %&,8$,8$V?'9,>:*?'*=$8,L#,;,>?#9$;)'$Z"9?A"9&?8)#"$M?*"'?9"0$ );$^&,>&$8"M"#$A)*">:*"8$?'"$8)*:Z,*,]"X$V"'$X"#X',A"',>$ A)*">:*"P$ K8$ V'"M,):8*=$ A"#9,)#"X$ [C,X"'?9):$ "9$ ?*0$ 5//.\0$ 9&,8$ ^?8$ ?99',Z:9"X$ 9)$ 9&"$ V'"8"#>"$ <`!2>&?,#8P$ KXX,9,)#?**=0$ ,#$ 9&"$ >?8"$ );$ Z"9?A"9&?8)#"$ M?*"'?9"$ 9&"$ *)?X,#L$ >?V?>,9=$ ,8$ ..$ ^9p$ ;)'$ 9&"$ A:*9,;:#>9,)#?*$ X"#X',A"'0$ ,P"P$ ?*A)89$ X):Z*"$ >)AV?'"X$ 9)$ 9&"$ *)?X,#L$ >?V?>,9=$);$9&"$8,AV*=$<`!=*?9"X$X"#X',A"'$[6$^9p\$?#X$ A)'"$9&?#$;,M"$9,A"8$>)AV?'"X$9)$9&"$*)?X,#L$>?V?>,9=$);$ 9&"$V?'"#9$X"#X',A"',>$8)*:9,)#$[.P1$^9$p\$[C,X"'?9):$"9$?*0$ 5//.\P$%&,8$,8$e:,9"$Z"#";,>,?*$;)'$,98$:8"$?8$X':L$X"*,M"'=$ 8=89"A$ ?#X$ ,9$ >?#$ )#*=$ Z"$ ?99',Z:9"X$ 9)$ 9&"$ )9&"'$ 9^)$ ;:#>9,)#?*$ L'):V8$ ,#9')X:>"X$ ?9$ 9&"$ 8:';?>"$ );$ 9&"$ A:*9,;:#>9,)#?*$ X"',M?9,M"P$ K8$ ,9$ ^,**$ Z"$ X,8>:88"X$ Z"*)^0$

9&"=$ A?=$ ?>9$ 8=#"'L,89,>?**=$ "#&?#>,#L$ 8)*:Z,*,]?9,)#$ );$ Z"9?A"9&?8)#"$M?*"'?9"P$ <='"#"0$ ?8$ ,#$ 9&"$ V'"M,):8$ ^)'G$ [C,X"'?9):$ "9$ ?*0$ 5//.\0$^?8$,#$;,'89$V*?>"$"AV*)="X$?8$A)X"*$&=X')V&)Z,>$ >)AV):#X$;)'$V')Z,#L$9&"$8)*:Z,*,]?9,)#$V')V"'9,"8$);$9&"$ A:*9,;:#>9,)#?*$ X"#X',A"'P$ T)'$ 9&,8$ '"?8)#$ ;*:)'"8>"#>"$ ,#9"#8,9=$ [EDE6\$ >&?#L"8$ ?#X$ C5DCA$ '?9,)$ ^"'"$ A)#,9)'"X0$ ^&,>&$?'"$8"#8,9,M"$V?'?A"9"'8$?#X$9&",'$M?*:"8$X"V"#X$)#$ 9&"$ A"X,:A$ );$ 8)*:Z,*,]?9,)#$ );$ 9&"$ V')Z"P$ %&"8"$ V?'?A"9"'8$ ^"'"$ A)#,9)'"X$ Z=$ ?$ 9,9'?9,)#2*,G"$ ?XX,9,)#$ );$ 9&"$X"#X',A"'$9)$?#$?e:"):8$V='"#"$8)*:9,)#P$K$8,L#,;,>?#9$ e:"#>&,#L$ );$ ;*:)'"8>"#>"$ ,#9"#8,9=$ [EDE6\$ ^?8$ )Z8"'M"X$ ?#X$ 9&"$ C5DCA$ '?9,)$ X">'"?8"X$ [P%&*0#! OY\P$ T*:)'"8>"#>"$ e:"#>&,#L$ ^?8$ ?99',Z:9"X$ [C,X"'?9):$ "9$ ?*0$ 5//.\$ 9)$ 9&"$ ;)'A?9,)#$ );$ ?$ >&?'L"29'?#8;"'$ >)AV*"U$ Z"9^""#$ V='"#"$ ?#X$9"'9,?'=$?A,#)$L'):V80$?8$"M,X"#>"X$Z=$9&"$?VV"?'?#>"$ );$?$^"?G$"U>,V*"U$;*:)'"8>"#>"$>"#9"'"X$?9$?VV')U,A?9"*=$ 4cI$ #A$ [_?G)^,>]0$ .3cJ\P$ K8$ 9&"$ >)#>"#9'?9,)#$ );$ 9&"$ X"#X',A"'$,#>'"?8"80$9&"$C5DCA$'?9,)$X">'"?8"8$9)$?$M?*:"$);$ ?Z):9$ /P3/0$ ^&,>&$ ,8$ >*)8"$ 9)$ 9&"$ )#"$ )Z8"'M"X$ ,#$ 9&"$ &=X')V&)Z,>$ "#M,')#A"#9$ :8:?**=$ "#>):#9"'"X$ ,#$ 9&"$ 1c$

!"#"$%&"'()*$(#+$,-."/0.('$12-.-3*$4-.$567$)(3"$8F$ ! ;')A$ 9&"$ <`!$ V')9">9,M"$ >)?9$ ?#)9&"'$ A"9&)X$ &?80$ >)#M"#9,)#?*$ A,>"**"8P$ %&:80$ V='"#"$ ,8$ A?,#*=$ 9&"'";)'"0$ 9)$ Z"$ "UV*)'"XP$ k"$ ^"'"$ V')AV9"X$ 9)$ :8"$ ,#>)'V)'?9"X$ ,#8,X"$ 9&"$ #?#)>?M,9,"8$ );$ 9&"$ X"#X',A"'0$ ,#$ ?e:"):8$ 8)X,:A$ >&*)',X"$ 8)*:9,)#$ ;)'$ 9',LL"',#L$ V='"#"$ )'X"'$ 9)$ ?M),X$ >)#9?>9$ ^,9&$ 9&"$ &=X')V&,*,>$ "U9"'#?*$ '"*"?8"$ 8,#>"0$ ?8$ ,9$ &?8$ Z""#$ "89?Z*,8&"X$ ,#$ ,#X"V"#X"#9$ L'):V8P$ 89:X,"8$[k?#L$"9$?*0$5///R$+)L?#$?#X$KL#"80$5//5\0$,)#8$ %&"$ '"*"?8"$ );$ 9&"$ ?>9,M"$ ,#L'"X,"#9$ ;')A$ 9&"$ );$ ?*G?*,$ A"9?*8$ >?9,)#,]"$ V)*=["9&=*"#"$ L*=>)*\$ A),"9,"8$ X"#X',A"'$ ^&"#$ ,9$ '"?>&"8$ 9&"$ 9?'L"9$ 8,9"$ "#&?#>"8$ ,98$ 9&'):L&$ >)AV*"U?9,)#P$ %&"$ X"8,L#"X$ A:*9,;:#>9,)#?*$ Z,)?M?,*?Z,*,9=$?#X$";;,>?>=P$7#$?XX,9,)#0$X':L$'"*"?8"$;')A$ X"#X',A"'0$ X:"$ 9)$ 9&"$ ?99?>&A"#9$ );$ <`!$ >&?,#8$ ?9$ ,98$ "#X)8)A?*$ >)AV?'9A"#9$ ?VV"?'8$ ?$ *,A,9,#L$ ;?>9)'$ ;)'$ 8:';?>"0$ ,8$ 8:8>"V9,Z*"$ 9)$ ?#?*)L):8$ ,#9"'?>9,)#8$ ?#X0$ 8"M"'?*$9?'L"9"X$X':L$X"*,M"'=$;)'A:*?9,)#8$[+))A"'$"9$?*0$ 9&"'";)'"0$,9$>):*X$Z"$V)88,Z*"$;)'$A"9?*$>?9,)#8$9)$'"V*?>"$ 5//J\P$%&"8"$'"e:,'"A"#98$,AV)8"$9&"$#""X$;)'$X"M"*)V,#L$ 8)*:Z,*,]"X$V='"#"$'"*"?8,#L$,9$9)$9&"$Z:*G$?e:"):8$V&?8"P$ X':L$X"*,M"'=$8=89"A8$,#$^&,>&$9&"$'"*"?8"$);$X':L$>?#$Z"$ 7#X""X0$ Z=$ 9,9'?9,#L$ X"#X',A"',>$ 8)*:9,)#8$ ^,9&$ 8)X,:A$ 9',LL"'"X$ Z=$ ?VV')V',?9"$ 89,A:*:8P$ T)'$ 9&,8$ V:'V)8"$ VY2 >&*)',X"$8)*:9,)#0$V='"#"$^?8$'"*"?8"X$?#X$X,8V"'8"X$,#$9&"$ 9',LL"'"X0$ "#]=A?9,>0$ 9&"'A?*$ ?#X$ V&)9)>&"A,>?**=$ Z:*G$ 8)*:9,)#$ ,#$ 9&"$ ;)'A$ );$ >'=89?**,9"8P$ %&"$ ,8)*?9"X$ ,#X:>"X$ V')>"88"8$ &?M"$ Z""#$ '"V)'9"X$ [+))A"'$ "9$ ?*0$ >'=89?**,9"8$^"'"$,#X"#9,;,"X$Z=$ .Y$B(D$?#X$V')M"X$9)$Z"$ 5//J\P$ T)'$ ,#89?#>"$ *)^$ VG$ ^,9&,#$ "#X)8)A?*$ ?#X$ V:'"$V='"#"P$ ,8>&"A,>$ 9,88:"$ "#M,')#A"#98$ '"#X"'8$ ?>,X$ 9',LL"'?Z*"$ %&"$ 9^)289"V$ 9',LL"'"X$ '"*"?8"$ ;')A$ 9&"$ X"*,M"'=$8=89"A8$?99'?>9,M"$;)'$>)#9')**"X$'"*"?8"P$ A:*9,;:#>9,)#?*$X"#X',A"'$^?8$?*8)$,#M"89,L?9"X$:8,#L$9&"$ %&"$ A:*9,;:#>9,)#?*$ V)*=[V')V=*"#"$ ,A,#"\$ *,V)V&,*,>$ X':L$ Z"9?A"9&?8)#"$ M?*"'?9"P$ D"*"?8"$ );$ 9&"$ X"#X',A"'8$V'"V?'"X0$X:"$9)$9&"$V'"8"#>"$);$9"'9,?'=$?A,#)$ X':L$ ^,9&$ &=X')>&*)',>$ ?>,X$ &?8$ #)9$ Z""#$ )Z8"'M"X$ 8,#>"$ L'):V8$ ,#$ 9&",'$ >)'"$ ;:*;,**$ ?9$ *"?89$ )#"$ );$ 9&"8"$ Z"9?A"9&?8)#"$ M?*"'?9"$ '"A?,#"X$ 8)*:Z,*,]"X$ ^,9&,#$ 9&"$ '"e:,'"A"#980$ ,P"P$ Z",#L$ VG$ '"8V)#8,M"$ [C,X"'?9):$ "9$ ?*0$ X"#X',A"',>$ "#M,')#A"#9$ ?#X$ V'";"'?Z*=$ ^,9&,#$ 9&"$ 5///R$C,X"'?9):$"9$?*0$5//.R$<?*")8$"9$?*0$5//4\P$K8$;):#X$ V)*=["9&=*"#"$ L*=>)*\$ >&?,#8P$ +"9?A"9&?8)#"$ M?*"'?9"$ ,#$ 9&"$ V'"M,):8$ "UV"',A"#9$ V='"#"$ ,8$ 8)*:Z,*,]"X$ ,#$ 9&"$ "#>?V8:*?9"X$ ,#$ 9&"$ A:*9,;:#>9,)#?*$ X"#X',A"'$ ^?8$ ,#9"',)'$ );$ X"#X',A"'$ ?#X$ ?*8)$ ^,9&,#$ <`!$ >&?,#80$ ^&,*"$ >)AV*"9"*=$ '"*"?8"X$ :V)#$ ?XX,9,)#$ );$ 8)X,:A$ >&*)',X"$ ?8$ :V)#$ V')9)#?9,)#$ );$ 9"'9,?'=$ ?A,#"8$ );$ 9&"$ #?#)>?M,9,"8$ 8&)^#$ ,#$ P%&*0#! OZP$ Y)^"M"'0$ ^,9&,#$ 9&"$ >)#>"#9'?9,)# V='"#"$,8$'"V)8,9,)#"X$,#$9&"$<`!$>)?9P$ T)'$?>&,"M,#L$9&"$'"*"?8"$);$9&"$"#>?V8:*?9"X$V='"#"$ $ >-G.#!ID$@)AV?'?9,M"$8)*:Z,*,9=$);$V='"#"$[<f\$?#X$Z"9?A"9&?8)#"$M?*"'?9"$[+-\$,#$9&"$V?'"#9$;,;9&$L"#"'?9,)#$FK+$?#X$ A:*9,;:#>9,)#?*$X"#X',A"'P$D"V')X:>"X$;')A$<?*")8$"9$?*0$5//4$^,9&$G,#X$V"'A,88,)#$;')A$KA"',>?#$@&"A,>?*$C)>,"9=P$ $ ]/#'/0%3#0^! ]E`^!_C! E`_"#'/0%3#0! ]ab^!_C! ab_"#'/0%3#0! @(31(*'/! _C! ! 3(.-0!0-,%(! 3(.-0!0-,%(! FK+$ .P/$U$./2J 5P.s/P5$U$./2I /P/5.s/P//5 5PIs/P4$U$./24 /P5Is/P/4 (:*9,;:#>9,)#?*$ $ $ $ $ $ F"#X',A"'$ 5PI$U$./24 .P3s/P/c$U$./2I /P/16s/P//5 .Pc/s/P4$U$./2J 1P5/s/P/J

! 67/

67.

/72

671

/7. 67%

%#%

!"#!$

/71

67/ /7% /72 /7/ 6

89*:9);<*)=!>!6/ !3

P%&*0#!OYD!<*)9$);$EDE6$ ?#X$C5DCA$ '?9,)$?8$?$;:#>9,)#$);$9&"$>)#>"#9'?9,)#$);$9&"$A:*9,;:#>9,)#?*$X"#X',A"'P$E6$ ,8$9&"$9)9?*$;*:)'"8>"#>"$ ,#9"#8,9=$);$6Pc.$U$./21$ ($?e:"):8$8)*:9,)#$);$V='"#"$?#X$E$,8$9&"$A"?8:'"X$;*:)'"8>"#>"$,#9"#8,9=$?9$M?',):8$X"#X',A"'$>)#>"#9'?9,)#8P! D"V')X:>"X$;')A$<?*")8$"9$?*0$5//4$^,9&$G,#X$V"'A,88,)#$;')A$KA"',>?#$@&"A,>?*$C)>,"9=P$

$ 13$

92+"'(:-0$":$(.;$<"#+'2:2/$)-.*="'>$?-'$()).2/(:2-#$(>$+'03$(#+$3"#"$+".2@"'*$>*>:"=>$ ! ,8$ 8&)^#$ ,#$ P%&*0#! OMP$ FK+2!/$ X"#X',A"'0$ ^&,>&$ X)"8$ #)9$ >)#9?,#$ ?#=$ L:?#,X,#,:A$ L'):V$ ^?8$ :8"X$ ?8$ ?$ '";"'"#>"$ >)AV):#XP$ %&"$ 8)2V'"V?'"X$ X"#X',A"'8$ ^"'"$ *)?X"X$ ^,9&$ >)'9,>)89"'),X$ X':L80$ ,P"P$ Z"9?A"9&?8)#"$ X,V')V,)#?9"$?#X$Z"9?A"9&?8)#"$M?*"'?9"$;)'$,#M"89,L?9,#L$ 9&",'$9'?#8;"'$9)$*,V)8)A"8P$ (,>')8>)V,>0$ !2V)9"#9,?*0$ ?#X$ F=#?A,>$ _,L&9$ C>?99"',#L$ [F_C\$ 9">&#,e:"8$ &?M"$ 8&)^#$ 9&?9$ *,V)8)A"82 X"#X',A"'8$ A)*">:*?'$ '">)L#,9,)#$ )>>:'8$ *"?X,#L$ 9)$ 9&"$ ;)'A?9,)#$ );$ *?'L"$ ?LL'"L?9"8$ ?9$ X"#X',A"'oX,&"U?X">=*$ V&)8V&?9"$ A)*?'$ '?9,)8$ &,L&"'$ 9&?#$ .OJ/0$ ?8$ M,8:?**=$ )Z8"'M"X$^,9&$V&?8"$ >)#9'?89$ )V9,>?*$ A,>')8>)V=P$ @?*>",#$ *,V)8)A?*$ "#9'?VA"#9$ "UV"',A"#98$ X"A)#89'?9"$ ?$ *,A,9"X$ *"?G?L"0$ ,P"P$ *"88$ 9&?#$ .Jp0$ ;)**)^,#L$ *,V)8)A"8$ ,#9"'?>9,)#$ ^,9&$ 9&"$ A)X,;,"X$ X"#X',A"'8$ ?9$ .O5I$ X"#X',A"'o$ X,&"U?X">=*$ V&)8V&?9"$ A)*?'$ '?9,)P$ %&,8$ ,#X,>?9"8$ 9&?9$ 9&"$ A"AZ'?#"$ );$ 9&"$ *,V)8)A"8$ '"A?,#8$ ?*A)89$,#9?>9$X:',#L$9&",'$A)*">:*?'$'">)L#,9,)#$^,9&$9&"8"$ X"#X',A"'8P$ 78)9&"'A?*$ %,9'?9,)#$ @?*)',A"9=$ [7%@\$ ,#X,>?9"8$ 9&?9$ 9&"$ "#9&?*V=$);$ 9&"$ ,#9"'?>9,)#$ ,8$ X"V"#X"#9$ )#$ 9&"$ #:AZ"'$ );$ 9&"$ L:?#,X,#,:A$ L'):V8$ V'"8"#9$ ?9$ 9&"$ X"#X',A"',>$8:';?>"P$T:'9&"'A)'"0$9&"$V')>"88$,8$'"M"'8,Z*"$ ?#X$ '"X,8V"'8,)#$ );$ 9&"$ ?LL'"L?9"8$ )>>:'8$ Z=$ ?XX,#L$ >)#>"#9'?9"X$V&)8V&?9"$Z:;;"'P$ %&"$ ,#9"'?>9,)#$ Z"9^""#$ 9&"8"$ X':L2*)?X"X$ X"#X',A"'8$ ?#X$ A:*9,*?A"**?'$ *,V)8)A"8$ '"8:*98$ ,#$ 9&"$ 9'?#8V)'9$);$X':L8$;')A$9&"$X"#X',A"',>$X"',M?9,M"8$9)$9&"$ t"AV9=n$ *,V)8)A"8$ ?8$ 8:AA?',]"X$ ,#$ >-G.#! YP$ %&"$ "UV"',A"#98$ X"A)#89'?9"$ 9&?9$ ?Z):9$ 5Ip$ );$ +F$ )'$ +-$ ,8$ V'"8"#9$,#$9&"$V'">,V,9?9"X$?LL'"L?9"8$^&"#$FK+2!/$^?8$ :8"XP$ k&"#$ 9&"$ L:?#,X,#=*?9"X$ X"#X',A"'8$ FK+2!6$ ?#X$ FK+2!.5$ ^"'"$ :8"X0$ 9&"$ ?A):#9$ );$ X':L8$ ,#$ 9&"$ V'">,V,9?9"$ ,#>'"?8"8$ 8:Z89?#9,?**=$ Z">)A,#L$ ?Z):9$ 6/p$ ?#X$c/p0$'"8V">9,M"*=P$ $

'?#L"$);$9&"$8)X,:A$>?9,)#$V'"8"#9$,#$"U9'?>"**:*?'$;*:,X80$ ,P"P$/P.45$(0$[!:=9)#$?#X$Y?**0$5///\$9&"$Z"9?A"9&?8)#"$ M?*"'?9"$ ^?8$ '"*"?8"X$ ,#$ '"*?9,M"*=$ 8A?**$ e:?#9,9,"8P$ %&"$ L'?X:?**=$ '"*"?8"X$ Z"9?A"9&?8)#"$ M?*"'?9"$ ;')A$ 9&"$ A:*9,;:#>9,)#?*$ X"#X',A"'$ ;)'A"X$ >'=89?**,9"8$ ,#$ 9&"$ ?e:"):8$ A"X,:A$ ?8$ X"9"'A,#"X$ Z=$ *,L&9$ 8>?99"',#LP$ %&"$ V'">,V,9?9"X$ A?9"',?*$ ^?8$ ?#?*=]"X$ ^,9&$ .Y$ B(D$ ?#X$ ,98$ 8V">9':A$>)''"8V)#X"X$9)$9&?9$);$Z"9?A"9&?8)#"$M?*"'?9"P$ %&,8$ ;,#X,#L$ 8&):*X$ Z"$ >)#8,X"'"X$ ^&"#$ <`!=*?9"X$ X"#X',A"'8$ ?'"$ :8"X$ ?8$ X':L$ X"*,M"'=$ 8=89"A8$ ,#$ "UV"',A"#98$,#$M,9')$?#X$,#$M,M)0$8,#>"$8)X,:A$>&*)',X"$,#$ "U9'?>"**:*?'$;*:,X8$?#X$V)9?88,:A$>&*)',X"$,#$,#9'?>"**:*?'$ "#M,')#A"#9$>?#$Z"$>)AV*"U"X$^,9&$<`!$>&?,#8$[k?#L$"9$ ?*0$ 5///R$ +)L?#$ ?#X$ KL#"80$ 5//5\$ ?;;">9,#L$ 9&"$ )M"'?**$ '"*"?8"$ V');,*"$ );$ 9&"$ X':LP$ %&:80$ 9&"$ V)88,Z,*,9=$ );$ 9',LL"',#L$X':L$'"*"?8"$,#$9&"$"U9'?>"**:*?'$;*:,X0$,P"P$Z";)'"$ "#X)>=9)8,8$ 9)$ 9&"$ 9?'L"92>"**80$ 8&):*X$ Z"$ 9?G"#$ ,#9)$ ?>>):#9$ ^&"#$ X"8,L#,#L$ ?$ 9?'L"9"X$ <`!=*?9"X$ X':L$ X"*,M"'=$8=89"AP$ %&"$ X':L$ X"*,M"'=$ ";;">9,M"#"88$ );$ ?#?*)L):8$ A:*9,;:#>9,)#?*$ X"#X',A"'8$ ^?8$ A)X"*"X$ Z=$ ,#M"89,L?9,#L$ 9&",'$ ,#9"'?>9,)#$ ^,9&$ A:*9,*?A"**?'$ *,V)8)A"8$ >)#8,89,#L$ );$ V&)8V&?9,X=*>&)*,#"o>&)*"89"')*oX,&"U?X">=*$ V&)8V&?9"$ [.3O3PIO.\$ ?#X$ X,8V"'8"X$ ,#$ ?e:"):8$ )'$ V&)8V&?9"$ Z:;;"'$ 8)*:9,)#8$[<?#9)8$"9$?*0$5//I\P$%&"$A:*9,*?A"**?'$*,V)8)A"8$ Z"?'$9&"$V&)8V&?9"$A),"9=$?8$'">)L#,]?Z*"$L'):VP$ %&"=$^"'"$:8"X$?8$8,AV*"$A)X"*8$Z";)'"$)#"$'"8)'98$ 9)$9&"$:8"$);$>"**8R$?;9"'$?**$*,V)8)A"8$?'"$>)#8,X"'"X$?8$9&"$ >*)8"89$ ?#?*)L:"8$ 9)$ >"**8P$ d#$ 9&"$ )9&"'$ &?#X0$ V)*=[V')V=*"#"$ ,A,#"\$ ;):'9&$ L"#"'?9,)#$ X"#X',A"'8$ ^"'"$ ;:#>9,)#?*,]"X$ ^,9&$ 6$ [FK+2!6$ \$ )'$ .5$ [FK+2!.5\$ L:?#,X,#,:A$ L'):V8$ ?8$ 9?'L"9,#L$ *,L?#X80$ ^&,*"$ 9&"$ '"A?,#,#L$ 9)U,>0$ "U9"'#?*$ V',A?'=$ ?A,#)$ L'):V8$ );$ 9&"$ X"#X',A"'8$^"'"$?**)^"X$9)$,#9"'?>9$^,9&$V')V=*"#"$)U,X"$ ?;;)'X,#L$9&"$>)''"8V)#X,#L$&=X')U=*?9"X$X"',M?9,M"8P$%&"$ 8>&"A"$);$9&"$'"?>9,)#8$A)X,;=,#L$9&"$X"#X',A"',>$8:';?>"$ $

67. 671

!?1!

8@AB=!>6/ 3

67% 67/ /72 /7. /71 /7% /7/

/7%

/71

/7.

/72

8"C'+=!D!3 $

67/

67%

671 $

P%&*0#! OZD! <*)9$);$ 9&"$ >)#>"#9'?9,)#$ );! Z"9?A"9&?8)#"$ M?*"'?9"$ ,#$ ?$ 5PI/$ U$ ./2I$ ($ X"#X',A"',>$ 8)*:9,)#$ ?8$?$ ;:#>9,)#$ );$?XX"X$B?@*P$ D"V')X:>"X$;')A$<?*")8$"9$?*0$5//4$^,9&$G,#X$V"'A,88,)#$;')A$KA"',>?#$@&"A,>?*$C)>,"9=P$

c/$

!"#"$%&"'()*$(#+$,-."/0.('$12-.-3*$4-.$567$)(3"$H5$ ! %&"8"$ 8,L#,;,>?#9$ X,;;"'"#>"8$ )Z8"'M"X$ ,#$ 9&"$ 9'?#8V)'9$ );$ X':L8$ Z"9^""#$ L:?#,X,#=*?9"X$ ?#X$ #)#2 L:?#,X,#=*?9"X$ X"#X',A"'8$ >?#$ Z"$ ?99',Z:9"X$ 9)$ 9&"$ ;:#>9,)#?*,]?9,)#$ );$ 9&"$ X"#X',A"',>$ A)*">:*"8P$ %&"$ V'"8"#>"$);$L:?#,X,#,:A$L'):V8$?9$9&"$"U9"'#?*$8:';?>"$);$ 9&"$ X"#X',A"'8$ '"8:*98$ ,#$ ?#$ ";;">9,M"$ ?X&"8,)#$ 9)$ 9&"$ A:*9,*?A"**?'$*,V)8)A"8$?8$9&"$7%@$?#X$F_C$"UV"',A"#98$ X"A)#89'?9"XP$K8$"UV">9"X0$^&"#$9&"$,#9"'?>9,)#$,8$9?G,#L$ V*?>"$ ,#$ ./A($ V&)8V&?9"$ Z:;;"'$ 9&"$ X':L$ V'"8"#9$ ,#$ 9&"$ ?LL'"L?9"8$X">'"?8"8$8*,L&9*=P$7#$9&,8$>?8"0$9&"$X">'"?8"$);$ X':L$ 9'?#8V)'9$ >?#$ Z"$ '?9,)#?*,]"X$ Z=$ 9&"$ >)AV"9,9,M"$ ,#9"'?>9,)#$ );$ 9&"$ V&)8V&?9"$ L'):V8$ ,#$ Z:*G$ ^,9&$ 9&"$ L:?#,X,#,:A$ X"#X',A"',>$ L'):V8$ *"?X,#L$ 9)$ *"88$ ";;">9,M"$ ?X&"8,)#$^,9&$9&"$A:*9,*?A"**?'$*,V)8)A"8P$ rV)#$ 9&"$ ?XX,9,)#$ );$ >)#>"#9'?9"X$ V&)8V&?9"$ Z:;;"'$ ;)**)^"X$ Z=$ 9&"$ '"X,8V"'8,)#$ );$ 9&"$ ?LL'"L?9"8$ ,#$ 9&"$ A"X,:A$ ?#X$ 9&"$ 8"V?'?9,)#$ );$ 9&"$ #)2*)#L"'$ ,#9"'?>9,#L$ X"#X',A"'80$ X':L8$ ?'"$ 89,**$ V'"8"#9$ ,#$ 9&"$ )Z9?,#"X$ $

A:*9,*?A"**?'$ *,V)8)A"8P$ F"9"'A,#?9,)#$ );$ +F$ )'$ +-$ ,#$ 9&"$A:*9,*?A"**?'$*,V)8)A"8$,#X,>?9"8$9&?90$,#$?**$>?8"80$>?P$ I/p$ [>-G.#! Y\$ );$ 9&"$ ?A):#9$ );$ X':L8$ ;):#X$ ,#$ 9&"$ ?LL'"L?9"8$ Z";)'"$ '"X,8V"'8,)#$ ,8$ 89,**$ V'"8"#90$ 8:LL"89,#L$ 9&?9$ 9&"=$ ?'"$ *)>?9"X$ ,#$ 9&"$ *,V,X$ Z,*?="'0$ 8,#>"$ 9&",'$ 8)*:Z,*,9=$ ,#$ ^?9"'$ ,8$ "U9'"A"*=$ *)^P$ F':L$ 9'?#8V)'9$ ,8$ ,#X:>"X$ Z=$ 9&"$ :8"$ );$ L:?#,X,#=*?9"X$ X"#X',A"'8$ 8,#>"$ X':L$ 9'?#8V)'9$ M?*:"8$ );$ ?Z):9$ 4/24Ip$ ^"'"$ )Z9?,#"X$ ,#$ 9&"$>?8"$);$FK+2!.50$^&,*"$)#*=$.52.Ip$^?8$)Z8"'M"X$,#$ 9&"$>?8"$);$9&"$#)#2L:?#,X,#=*?9"X$X"',M?9,M"P$ @?'Z)&=X'?9"80$,#$L"#"'?*0$Z",#L$9?'L"9,#L$*,L?#X8$;)'$ 8"*">9,#8$ >?#$ Z"$ ,#9')X:>"X$ ?9$ 9&"$ "U9"'#?*$ 8:';?>"$ );$ X"#X',A"'8$ *"?X,#L$ 9)$ 9&"$ ;)'A?9,)#$ );$ 9?'L"9"X$ X':L$ X"*,M"'=$ 8=89"A8P$ 7#$ ?$ '">"#9$ 89:X=$ [+&?X'?$ "9$ ?*0$ 5//I\0$ L?*?>9)8"$ 8:';?>"2>)?9"X$ V)*=[V')V=*"#"$ ,A,#"\$ [<<7\$ X"#X',A"',>$ X"',M?9,M"8$ ^"'"$ V'"V?'"X$ ?#X$ *)?X"X$ ^,9&$ V',A?e:,#"$ V&)8V&?9"$ [<<\$ [P%&*0#! OQ\0$ ^&,>&$ ,8$ ?#$ ?#9,A?*?',?*$X':LP$!?*?>9)8"$;:#>9,)#?*,]?9,)#$^?8$>?'',"X

[BY@Y5@Y[@YJ\dY\J5

"7a<cL

@YJ [BY5\J5

Y5B

[BY5\6

BY5

F7`K

[BY@Y5@Y[@YJ\dY\56

"7a

@*2

"7a<KQ

BY5S @*2 BY5

[BY@Y5@Y[@YJ\dY\56

"7a<cQ B

[BY5\.5

Y5B

[BY@Y5@Y[@YJ\dY\5/

"7a<KOI

@*2

B BY5

F7`K

BY5S @*2 BY5

[BY@Y5@Y[@YJ\dY\5/

"7a<cOI ! ! P%&*0#! OMD! T:#>9,)#?*,]?9,)#$ );$ V)*=[V')V=*"#"$ ,A,#"\$ X"#X',A"'$ );$ 9&"$ ;):'9&$ L"#"'?9,)#$ ,#>*:X,#L$ L:?#,X,#=*?9,)#$ ?9$ 9&"$ ;,#?*$89"VP$ D"V')X:>"X$;')A$<?#9)8$"9$?*0$5//I$^,9&$G,#X$V"'A,88,)#$;')A$KA"',>?#$@&"A,>?*$C)>,"9=P$ $ $ >-G.#!YD!F':L$9'?#8;"'$[p\$;')A$X"#X',A"'8$9)$A:*9,*?A"**?'$*,V)8)A"8$,#$?\$?LL'"L?9"8$)Z9?,#"X$?;9"'$9&",'$,#9"'?>9,)#$,#$ ^?9"'$ )'$ ,#$ ./$ A($ V&)8V&?9"$ Z:;;"'$ [VG$ 1P4\$ ?#X$ Z\$ A:*9,*?A"**?'$ *,V)8)A"8$ )Z9?,#"X$ ;)**)^,#L$ '"X,8V"'8,)#$ );$ 9&"$ ?LL'"L?9"8P$D"V')X:>"X$;')A$<?*")8$"9$?*0$5//I$^,9&$G,#X$V"'A,88,)#$;')A$KA"',>?#$@&"A,>?*$C)>,"9=P$ $ "0*&!,0-'$)#0!RdS!%'!-&&0#&-,#$! "0*&!,0-'$)#0!RdS-),#0!0#/%$1#0$%('! "0*&! "#'/0%3#0! e-,#0! EA($1A-,#!a*))#0! e-,#0! EA($1A-,#!a*))#0! $ FK+2!/$ 54P4s5P4 .3Pcs.P5 .IPcs/P3 .5P.s.P. +F$ FK+2!6$ 65PIs.P3 4cPIs.P6 5cP.s.P1 54PIs.PJ $ FK+2!.5$ c4PIs5P. 6cP4s.PI 4IP.s.Pc 4/P/s.P4 $ FK+2!/$ J5P3s5P/ 51P.s.P/ .IP3s.P5 .4P.s/P3 +-$ FK+2!6$ I3P/s.PI J3PIs5P. 53P/s.P/ 56P.s.PI $ FK+2!.5$ 1cP.s5PJ I1PIs5P/ 45P/s.PI JcP5s.P5

c.$

92+"'(:-0$":$(.;$<"#+'2:2/$)-.*="'>$?-'$()).2/(:2-#$(>$+'03$(#+$3"#"$+".2@"'*$>*>:"=>$ ! '#-

P%&*0#! OQD$ @&"A,>?*$ 89':>9:'"$ );$ V',A?e:,#"$V&)8V&?9"P$ "#%!!"#-E$1

#-'$

$ $ ):9$ Z=$ ?$ ',#L$ )V"#,#L$ '"?>9,)#$ ;)**)^"X$ Z=$ C>&,;;n8$ Z?8"$ '"?>9,)#$ ?#X$ '"X:>9,)#$ 9)$ 8">)#X?'=$ ?A,#"$ ,#$ 8)X,:A$ ?>"9?9"$Z:;;"'$?8$8&)^#$,#$P%&*0#!O[P$ !?*?>9)8"$ &?X$ Z""#$ 8&)^#$ 9)$ Z"$ ?$ V')A,8,#L$ *,L?#X$ ;)'$&"V?9)>=9"$[*,M"'$V?'"#>&=A?*$>"**8\$9?'L"9,#L$Z">?:8"$ *,M"'$ >"**8$ V)88"88$ ?$ *?'L"$ #:AZ"'$ );$ 9&"$ K8,?*)2 L*=>)V')9",#$ [KC!<\$ '">"V9)'8$ 9&?9$ >?#$ '">)L#,]"$ 9&"$ L?*?>9)8"$ :#,98$ )#$ 9&"$ )*,L)8?>>&?',X"$ >&?,#8$ );$ L*=>)V')9",#80$ )'$ )#$ >&"A,>?**=$ L?*?>9)8=*?9"X$ X':L$ >?'',"'8$[K8&^"**$?#X$Y?';)'X0$.3c5\P$%&"$'">"V9)'2*,L?#X$ ,#9"'?>9,)#$ ^?8$ G#)^#$ 9)$ "U&,Z,9$ ?$ 8,L#,;,>?#9$ t>*:89"'$ $

";;">9n$ ,#$ ^&,>&$ ?$ V)*=M?*"#9$ ,#9"'?>9,)#$ '"8:*98$ ,#$ "U9'"A"*=$89')#L$Z,#X,#L$);$*,L?#X8$9)$9&"$'">"V9)'8P$ %&"$'"8:*98$)Z9?,#"X$,#X,>?9"X$9&?9$L?*?>9)8"$>)?9,#L$ );$ <<7$ 8=89"A8$ ,#>'"?8"8$ 9&"$ X':L$ "#9'?VA"#9$ ";;,>,"#>=$ Z=$ I2.I$ 9,A"8$ X"V"#X,#L$ :V)#$ X"#X',A"'8n$ L"#"'?9,)#P$ K*8)$L?*?>9)8"$>)?9,#L$V')*)#L"X$'"*"?8"$:V$9)$Iu6$X?=8$?8$ >)AV?'"X$ 9)$ .25$ X?=8$ ;)'$ :#>)?9"X$ <<7P$ %&"$ &"A)*=9,>$ 9)U,>,9=0$Z*))X$*"M"*$?#X$&"A?9)*)L,>?*$89:X,"8$V')M"X$9&?9$ 9&"8"$ >?'',"'8$ ?'"$ 8?;"'$ ?#X$ 8:,9?Z*"$ ;)'$ 8:89?,#"X$ X':L$ X"*,M"'=P$ +*))X$ *"M"*$ 89:X,"8$ V')M"X$ 9&"$ 8:,9?Z,*,9=$ );$ 9&"$ >?'',"'8$ ,#$ V')*)#L,#L$ 9&"$ >,'>:*?9,)#8$ ?#X$ X"*,M"'=$ );$ <<$ 9)$*,M"'P$

#$#%' # '#%$# # #$ #$ #$ # # # #$ #$ $# #$ $# # # # '#%$# # # # #$ $# #$ #$ #$ #$ # %' # # '#% # '#% # #$ '#%$# "# #$ #" $# #$ # # "# # # %' #$ # $# " "# #%' # #$ '#%$# ##$ " "# #$ # # #" ' $# " #% # " $# #$ # #$ # '#%$# " ' # # # $# % # " " " #% $# # $# $# # " '#%$# ' # $# # # " # $# # $#$# " ' #% '#%$# " # #$ " " " # # #% $# # # $# " ' $# # #$ '#%$# # " #% $# # " # $# " ' $# # # '#%$# #$ # # % " # $# " " ' # $# # $# # #" #$ '#% # '#%$# # $# "# "# #" #%' # # %' # # '#% # #$ $# #$ $# $# # $# #$ # $# # # # #$ # # # # $# '#%$# $# $# # # $# $# #$#%' $# # #$#%' '#%$# $ #$#%'

'#%$# $

#$ "#%

$# '

:F6.G!-%G!.1

H(9;I<!CJ*KCK*!LIMM*) !!!!!!!!!!!!N#!17/

EET

$ P%&*0#!O[D$!?*?>9)8=*?9,)#$);$V)*=[V')V=*"#"$,A,#"\$X"#X',A"'$);$9&"$9&,'X$9)$;,;9&$L"#"'?9,)#P$

c5$

!"#"$%&"'()*$(#+$,-."/0.('$12-.-3*$4-.$567$)(3"$HA$ ! <')>""X,#L$ ^,9&$ ;:'9&"'$ ;:#>9,)#?*,]?9,)#$ ?#X$ "AV*)=,#L$ ?$ 9&,'X$ L"#"'?9,)#$ <K(K($ X"#X',A"'$ ?8$ ?$ 89?'9,#L$ >)AV):#X0$ A:*9,;:#>9,)#?*$ X"#X',A"'8$ ^"'"$ V'"V?'"X$ [C&:G*?$ "9$ ?*0$ 5//J\P$ %&"8"$ X"',M?9,M"80$ ,#$ ?XX,9,)#$ 9)$ 9&"$ V')9">9,M"$ <`!2>&?,#8$ 9&"=$ ?*8)$ Z"?'$ 9&"$ ;)*?9"$ A),"9=$ ?9$ 9&"$ "#X$ );$ V)*=["9&=*"#"$ L*=>)*\$ >&?,#$ ^&,>&$>?#$,#X:>"$"#X)>=9)8,8$,#9)$;)*?9"$'">"V9)'2Z"?',#L$ >"**8$ [C:X,A?>G$ ?#X$ _""0$ 5///R$ Y);*?#X$ "9$ ?*0$ 5//5R$ K#9)#=0$5//4R$C?Z&?'?#a?G$?#X$(?=)'0$5//4\P$%&"$;)*?9"$ '">"V9)'$,8$G#)^#$9)$Z"$8,L#,;,>?#9*=$)M"'"UV'"88"X$)M"'$?$ ^,X"$ M?',"9=$ );$ &:A?#$ >?#>"'8$ ?#X0$ 9&"'";)'"0$ ;)*?9"2 A"X,?9"X$ 9?'L"9,#L$ &?8$ Z""#$ ^,X"*=$ ?VV*,"X$ ^,9&$ *,V)8)A"8$ [_""$ ?#X$ _)^0$ .33IR$ _""$ ?#X$ Y:?#L0$ .336R$ !?Z,])#$"9$?*0$5//4\0$X"#X',A"'8$[m)#)$"9$?*0$.333R$m)#X?$ "9$ ?*0$ 5//.R$ C&:G*?$ "9$ ?*0$ 5//J\0$ M?',):8$ V)*=A"'8$ ?#X$ V?'9,>*"8$ [F?:9=$ "9$ ?*0$ 5//5R$ F:Zi$ "9$ ?*0$ 5//5R$ K')#)M$ "9$ ?*0$5//JR$v:Z"'$"9$?*0$5//JR$f))$?#X$<?'G0$5//4R$m,A$"9$?*0$ 5//IZR$_,>>,?'X,$"9$?*0$5//IR$k?#L$?#X$Y8,:"0$5//I\$^&"#$ :8"X$ ?8$ X':L$ X"*,M"'=$ 8=89"A8P$ 7#$ ?XX,9,)#0$ ,#$ 9&"$ V'"M,):8*=$ ;:#>9,)#?*,]"X$ X"#X',A"'$ .5$ 9)$ .I$ X">?Z)'?9"$ >*:89"'8$ ^"'"$ >)M?*"#9*=$ ?99?>&"X0$ ^&,>&$ >?#$ Z"$ :8"X$ ;)'$ 9&"$ 9'"?9A"#9$ );$ >?#>"'$ ,#$ +)')#$ B":9')#$ @?V9:'"$ %&"'?V=[+B@%\$ '"e:,',#L$ 9&"$ 8"*">9,M"$ X"*,M"'=$ );$ ./+$ 9)$ >?#>"'):8$ >"**8$ ^,9&,#$ ?$ 9:A)'P$ -?'=,#L$ #:AZ"'$ );$ <`!$ >&?,#8$ );$ M?'=,#L$ *"#L9&$ ^"'"$ *,#G"X$ 9)$ 9&"8"$ Z)')#?9"X$ X"#X',A"'8$9)$'"X:>"$&"V?9,>$:V9?G"P$KA)#L$?**$V'"V?'"X$ >)AZ,#?9,)#80$ Z)')#?9"X$ X"#X',A"'8$ ^,9&$ .2.PI$ <`!5///$ :#,98$"U&,Z,9"X$9&"$*)^"89$&"V?9,>$:V9?G"$,#$@I1+_o6$A,>"$ [1P521P1p$,#a">9"X$X)8"$[7F\oL$*,M"'\P$ %^)$ ;)*?9"$ '">"V9)'29?'L"9"X$ Z)')#?9"X$ 9&,'X$ L"#"'?9,)#$ V)*=[?A,X)?A,#"\$ X"#X',A"'8$ ^"'"$ V'"V?'"X0$ 9&"$ )#"$ 8&)^#$ ,#$ P%&*0#! OJ0$ )#"$ >)#9?,#,#L$ w.I$ X">?Z)'?9"$ >*:89"'8$ ?#X$ w.$ <`!5///$ :#,9$ ^,9&$ ?$ ;)*,>$ ?>,X$ A),"9=$ ?99?>&"X$ 9)$ 9&"$ X,89?*$ "#X0$ ^&,*"$ 9&"$ )9&"'$ ^?8$ >)#9?,#,#L$ w.J$ X">?Z)'?9"$ >*:89"'80$ w.$ <`!5///$ :#,9$ ?#X$ w.$<`!c//$:#,9$^,9&$;)*,>$?>,X$?99?>&"X$9)$9&"$X,89?*$"#XP$7#$ M,9')$ 89:X,"8$ :8,#L$ ;)*?9"$ '">"V9)'$ [S\$ m+$ >"**8$ X"A)#89'?9"X$'">"V9)'2X"V"#X"#9$:V9?G"$);$9&"$*?99"'$;)*,>$ ?>,X2;:#>9,)#?*,]"X$X"',M?9,M"P$+,)X,89',Z:9,)#$89:X,"8$^,9&$ 9&,8$ X"',M?9,M"$ ,#$ @I1+_o6$ A,>"$ Z"?',#L$ ;)*?9"$ '">"V9)'$ [S\$A:',#"$54lm2T+<$8?'>)A?8$'"8:*9"X$,#$8"*">9,M"$9:A)'$ :V9?G"$ [6P/p$ 7FoL$ 9:A)'\0$ Z:9$ ?*8)$ &,L&$ &"V?9,>$ [JcPcp$ 7FoL\$?#X$'"#?*$[65Pcp$7FoL\$:V9?G"$[>-G.#!Z\0$,#X,>?9,#L$ 9&?9$ ?99?>&A"#9$ );$ ?$ 8">)#X$ <`!$ :#,9$ ?#Xo)'$ ;)*,>$ ?>,X$ A?=$ ?XM"'8"*=$ ?;;">9$ 9&"$ V&?'A?>)X=#?A,>8$ );$ 9&,8$ >)#a:L?9"P$ 7#$>)#>*:8,)#0$9&"$)V9,A?*$A)X,;,>?9,)#$);$+)')#?9"X$ X"#X',A"'8$?8$^"**$?8$);$X"#X',A"'8$,#$L"#"'?*$^,9&$<`!$ >&?,#8$ ;)'$ '"X:>,#L$ '"9,>:*)"#X)9&"*,?*$ 8=89"A$ ?;;,#,9=$ ?VV"?'8$9)$Z"$?$&,L&*=$>)AV*"U$V')>"88$9&?9$X"V"#X8$)#$?$ M?',"9=$);$;?>9)'8$'"e:,',#L$"U9"#8,M"$"M?*:?9,)#P$%&"$;)*,>$ ?>,X$ ;:#>9,)#?*,]"X$ <`!=*?9"X$ !J2+)')#?9"X$ F"#X',A"'$ 8&)^"X$8,L#,;,>?#9*=$,#>'"?8"X$9:A)'$8"*">9,M,9=$>)AV?'"X$ ^,9&$#)#2<`!=*?9"X$+)')#?9"X$F"#X',A"',>2?#9,Z)X=$?#X$ +)')#?9"X$ F"#X',A"'2`!T$ [`V,X"'A?*$ L')^9&$ ;?>9)'\$ >)#a:L?9"8$ V'"M,):8*=$ "M?*:?9"X$ ;)'$ V)9"#9,?*$ ?VV*,>?9,)#$ ,#$+B@%$[+?'9&$"9$?*0$.334R$f?#L$"9$?*0$.331\P$Y)^"M"'0$ 9&"$ &"V?9,>$ ?#X$ '"#?*$ :V9?G"$ );$ 9&,8$ >)#a:L?9"$ ^?8$ M"'=$ &,L&P$ $

TTTD! "0*&! +-00%#0$H! )0(3! 3('()*'+,%('-.! ,(! 3*.,%)*'+,%('-.! A21#0G0-'+A#/!1(.23#0$! +?8"X$ )#$ V)*=L*=>"')*$ [<!\$ ?#X$ ?*8)$ )#$ V)*=["9&=*"#"$ ,A,#"\$ [<`7\0$ VY2'"8V)#8,M"$ A)*">:*?'$ >?'',"'8$ ^"'"$ V'"V?'"X$ [m'xA"'$ "9$ ?*0$ 5//5\$ 9&'):L&$ ?VV')V',?9"$ ;:#>9,)#?*,]?9,)#P$ %&"$ >)#>"V9$ );$ VY2 '"8V)#8,M"$ >?'',"'8$ A?=$ &?M"$ V)9"#9,?*$ ?VV*,>?9,)#$ ;)'$ 8"*">9,M"$X':L$X"*,M"'=$,#$9,88:"8$);$?$*)^"'$VY$M?*:"$[;)'$ "U?AV*"0$ ,#;">9"X$ )'$ 9:A)'$ 9,88:"\P$ <)*=L*=>"')*$ ?#X$ V)*=["9&=*"#"$ ,A,#"\0$ ^&,>&$ ?'"$ >)AA"'>,?**=$ ?M?,*?Z*"0$ ?'"$ '?#X)A*=$ Z'?#>&"X$ Z:9$ &?M"$ X";,#"X$ X"#X',9,>$ 89':>9:'"8$ ^,9&$ ?$ X"L'""$ );$ Z'?#>&,#L$ 6/$ 9)$ 1IpP$ T:#>9,)#?*,]?9,)#$ );$ 9&"8"$ X"#X',9,>$ V)*=A"'8$ ^?8$ ?>&,"M"X$ 9&'):L&$ ?$ ;?>,*"$ >)#X"#8?9,)#$ '"?>9,)#$ Z"9^""#$ 9&"$ .052X,)*$ )'$ BY5$ A),"9,"8$ ?9$ 9&",'$ "U9"'#?*$ 8:';?>"$ ?#X$ M?',):8$ >?'Z)#=*$ >)AV):#X8$ ?8$ 8&)^#$ ,#$ P%&*0#! O\P$ C"M"'?*$ X"#X',9,>$ 89':>9:'"8$ )',L,#?9,#L$ ;')A$ 9&"8"! '"?>9,)#8$&?M"$Z""#$V'"V?'"X0$X,;;"',#L$,#$9&"$;)**)^,#LO$?P$ 9&"$9=V"$?#X$A)*">:*?'$^",L&9$);$9&"$>)'"$V)*=A"'0$ZP$9&"$ 89':>9:'"$);$9&"$?99?>&"X$V"',V&"'?*$8&"**$?#X$>P$9&"$X"L'""$ );$?*G=*?9,)#P$ %&"$ *)?X,#L$ >?V?>,9,"8$ [#:AZ"'$ );$ "#>?V8:*?9"X$ >)#L)$ '"X$ V"'$ V)*=A"',>$ #?#)>?'',"'\$ );$ X"#X',9,>$ V)*=A"'8$9)L"9&"'$^,9&$9&",'$89':>9:'?*$;"?9:'"8$?'"$8&)^#$ ,#$ >-G.#! MP$ 79$ ^?8$ ;):#X$ 9&?9$ ?$ A,#,A:A$ >)'"$ 8,]"$ [>?P$ J///$ LA)*2.\$ ?#X$ ?$ &,L&*=$ Z'?#>&"X$ ?'>&,9">9:'"$ ?'"$ '"e:,'"X$ ;)'$ 8:>>"88;:*$ "#>?V8:*?9,)#$ );$ 9&"$ L:"89$ A)*">:*"8P$ T)'$ ";;,>,"#9$ "#>?V8:*?9,)#$ 9&"$ X"L'""$ );$ ?*G=*?9,)#$ 8&):*X$ Z"$ ?Z):9$ 4I2I/p$ ?#X$ 9&"$ ?*G=*$ >&?,#8$ 8&):*X$ &?M"$ ?$ A,#,A:A$ *"#L9&$ [y@./\P$ T)'$ "U?AV*"0$ 9&"$ >)#M"'8,)#$);$9&"$9"'A,#?*$L'):V8$,#$V)*=L*=*>"')*0$<!$[5.$ ///$ LA)*2.\$ ^,9&$ ?$ @.6$ ?*X"&=X"$ [<!?\$ >)#9?,#,#L$ )#"$ ?*G=*$ >&?,#$ V"'$ X,)*$ :#,9$ '"8:*98$ ,#$ ?#$ ";;">9,M"$ X"L'""$ );$ ?*G=*$ ;:#>9,)#?*,]?9,)#$ );$ 5Ip$ [>-G.#! M\$ ?#X$ ?$ V))'$ "#>?V8:*?9,)#$ >?V?>,9=$ [/P.I$ >)#L)$ '"X$ A)*">:*"8\P$ k,9&$ 9&"$8?A"$<!$>)'"$[5.$///$LA)*2.\0$9&"$G"9?*$;:#>9,)#?*,]"X$ >?'',"'0$<!Z0$^,9&$9^)$?*G=*$>&?,#8$V"'$X,)*$:#,9$?#X$4Ip$ ";;">9,M"$?*G=*$;:#>9,)#?*,]?9,)#$[>-G.#!M\$>?#$"#>?V8:*?9"$ :V$ 9)$ .J$ >)#L)$ '"X$ A)*">:*"8P$ K$ &,L&"'$ X"L'""$ );$ G"9?*$ ;:#>9,)#?*,]?9,)#$ [<!>O$ IIp0$ >-G.#! M\$ ,#X,>?9"8$ ?#$ )V9,A?*$8&"**$X"#8,9=$);$4I2I/pP$%&"$"U?>9$X"9"'A,#?9,)#$ );$ 9&"$ "#>?V8:*?9,)#$ >?V?>,9,"8$ ;)'$ 9&"$ ?A,#"$ Z?8"X$ V)*=["9&=*"#"$ ,A,#"\$ >?'',"'8$^?8$ >)AV*,>?9"X$Z">?:8"$);$ 9&"$ &=X')*=9,>$ 8"#8,9,M,9=$ );$ 9&"$ ,A,#"2Z):#X$ V"',V&"'?*$ 8&"**$ ,#$ 9&"$ <`72Z?8"X$ 8=89"A80$ ;)'$ ,#89?#>"$ ,#$ <`7Z$ [>-G.#! M\P$ %)$ ?M),X$ &=X')*=8,8$ 9&"$ X="$ ^?8$ X,'">9*=$ "#>?V8:*?9"X$;')A$9&"$8)*,Xo)'L?#,>$8)*:9,)#$,#9"';?>"P$ %&"$ >)AV*"U?9,)#$ );$ ?#$ ?#9,9:A)'$ X':L0$ A"'>?V9)V:',#"0$ 8"M"'?*$ )*,L)#:>*")9,X"80$ ?8$ ^"**$ ?8$ Z?>9"',)89?9,>$ 8,*M"'$ >)AV):#X8$ [;)'$ "U?AV*"0$ KL7$ 8?*98$ ?#X$ KL/$ #?#)V?'9,>*"8\$ [Y??L$ "9$ ?*0$ 5//5\$ &?M"$ Z""#$ 89:X,"X$ ;)'$ 9&"$ V)9"#9,?*$ :8"$ );$ 9&"8"$ >?'',"'8$ ,#$ X':L$ ?#X$ L"#"$ X"*,M"'=P$ C:>>"88;:*$ "#>?V8:*?9,)#$ ^?8$ )Z8"'M"X$ ,#$ ?**$ >?8"8$ Z=$ 9&"$ <`72Z?8"X$ >?'',"'8$ ^&,*"$ >)AV*"U?9,)#$ ^?8$#)9$)Z8"'M"X$^,9&$9&"$<!2Z?8"X$>?'',"'8$;)'$9&"$8?A"$ L:"89$A)*">:*"8P$ %&"$ )Za">9,M"$ 9)$ X"M"*)V$ ?$ VY28"#8,9,M"$ >?'',"'$ ^?8$ 9"89"X$ :8,#L$ 8"M"'?*$ Z:;;"'$ 8)*:9,)#8$ ;)'$ Z)9&$ 9&"$ ?>"9?*2$ ?#X$,A,#"2Z):#X$8&"**8P$%&"$"#>?V8:*?9"X$>)#L)$'"X$,#$9&"$

cJ$

92+"'(:-0$":$(.;$<"#+'2:2/$)-.*="'>$?-'$()).2/(:2-#$(>$+'03$(#+$3"#"$+".2@"'*$>*>:"=>$ ! >?'',"'$ <!Z$ ^?8$ 89?Z*"$ ;)'$ 8"M"'?*$ A)#9&8$ ?9$ #":9'?*$ ?#X$ Z?8,>$ VY$ M?*:"8$ [VYy1\P$ Y)^"M"'0$ ?#$ ,AA"X,?9"$ '"*"?8"$ );$ 9&"$ L:"89$ A)*">:*"8$ )>>:''"X$ ,#$ ?>,X,>$ A"X,?$ [VYzJ\P$ %&"$ ,A,#"2Z?8"X$ >?'',"'8$ ^"'"$ "M"#$ A)'"$ 8"#8,9,M"$ 9)$ ?#$ "U9"'#?*$X">'"?8"$);$VYP$7#$9&"$>?8"$);$>?'',"'$<`7?$[>-G.#! M\$ 9&"$ &=X')*=8,8$ );$ 9&"$ 8&"**$ ?#X$ 9&"$ '"*"?8"$ );$ 9&"$ "#>?V8:*?9"X$ L:"89$ [#?A"*=0$ >)#L)$ '"X\$ )>>:'8$ )M"'$ ?$ V"',)X$ );$ ;):'$ X?=8$ ?9$ VY$ 6P$ Y)^"M"'0$ ,9$ ,8$ 89?Z*"$ )M"'$ 8"M"'?*$ ^""G8$ ?9$ #":9'?*$ VYP$ d#$ 9&"$ )9&"'$ &?#X0$ 9&"$ $

&=X')*=8,8$ );$ 9&"$ >?'',"'$ <`7Z$ ?#X$ 9&"$ '"*"?8"$ );$ 9&"$ "#>?V8:*?9"X$L:"89$)>>:'8$8V)#9?#"):8*=$"M"#$?9$VYz1P$7#$ 9&"$ >?8"$ );$ <`7Z0$ ?$ 8*)^$ '"*"?8"$ >?#$ Z"$ )Z8"'M"X$ ?;9"'$ 8"M"'?*$&):'8$[VY$c0$>?P$J$&0$5I$)@\$)'$X?=8$[VY$.50$5$X?=80$ 5I$ )@\$ "M"#$ ^,9&):9$ ?>,X,;,>?9,)#P$ T)'$ 9&"$ <`72Z?8"X$ >?'',"'0$ <`7Z0$ 9&"$ ?A):#9$ );$ X="$ X:"$ 9)$ ,A,#"$ &=X')*=8,8$ ^?8$ ;)**)^"X$ Z=$ 7D$ 8V">9')8>)V=$ 9&'):L&$ 9&"$ X,8?VV"?'?#>"$ );$ 9&"$ ,A,#"$ 8,L#?*$ [P%&*0#! IL\P

"#% 6.

(

# "

4O "P'#-Q-"C

(

( (!F!@#

#$$ '

4O!F #$$'

" #

" "

#%"

ERS!F

$ P%&*0#!OJD$+)')#?9"X$9&,'X$L"#"'?9,)#$<K(K($;:#>9,)#?*,]"X$^,9&$<`!2T)*?9"$A),"9=P$ $

>-G.#! ZP$ +,)X,89',Z:9,)#$ );$ #)#2V"L=*?9"X$ [7\0$ <`!=*?9"X$ [a\$ ?#X$ <`!=*?9"X$ ^,9&$ ?99?>&"X$ ;)*,>$ ?>,X$ [@\$ Z)')#?9"X$ V)*=[?A,X)?A,#"\$ X"#X',A"'8P{$ D"V')X:>"X$ ;')A$ CG:G*?$ "9$ ?*0$ 5//J$ ^,9&$ G,#X$ V"'A,88,)#$ ;')A$ KA"',>?#$ @&"A,>?*$ C)>,"9=P$ $ ,%$$*#! d!T"!()!7_!&!,%$$*#! d!T"!()!a_!&!,%$$*#! d!T"!()!@_&!,%$$*#! Z*))X$ .P.s.PJ #PAP$ #PAP$ *,M"'$ 5/P6sIP/ 1P.s4P/ JcPcsIP3 8V*""#$ .4P1sJP3 5/P5scPc 5IP/s1P4 G,X#"=$ ./4P5s5/P1 4IP/s.JP4 65Pcs.4PI A:8>*"$ #PAP$ #PAP$ #PAP$ 9:A)'$ #PAP$ #PAP$ 6P/s.P6 $ {$ 54lm2T+<$ 9:A)'$ Z"?',#L$ @I1+_o6$ A,>"$ ^"'"$ ,#a">9"X$ ,V$ ^,9&$ K0$ +0$ ?#X$ @P$ %&"$ p$ 7FoL$ ^"'"$ X"9"'A,#"X$ 6&$ V)89$ ,#a">9,)#P$ ("?#$ sCF8$?'"$Z?8"X$)#$;):'$?#,A?*8$V"'$L'):VP$#PAPO$#)9$A"?8:'?Z*"P$ $ $

3*$ $3* $

#GT

E>97!R+-,DS

,(.*#'#:!0#).*V !!!!!!<-+#,('#

$ $

TU T

Ec-:G:+ $

EhT

" #

#GT

"#%

TU <fIg

EhT

" #

TU T

EhT-:G $ $ P%&*0#! O\D$ T:#>9,)#?*,]?9,)#$ );$ <!$ ?#X$ <`7$ &=V"'Z'?#>&"X$ X"#X',9,>$ V)*=A"'8P$ D"V')X:>"X$ ;')A$ m'xA"'$ "9$ ?*0$ 5//5$ ^,9&$ G,#X$ V"'A,88,)#$;')A$9&"$?:9&)'8$?#X$k,*"=2-@YP$ EhT

c4$

!"#"$%&"'()*$(#+$,-."/0.('$12-.-3*$4-.$567$)(3"$HB$ !

$ >-G.#!MP$`#>?V8:*?9,)#$>?V?>,9,"8$);$>)#L)$'"X$,#$X"#X',9,>$#?#)>?'',"'8$Z?8"X$)#$<!$?#X$<`7P$D"V')X:>"X$;')A$m'xA"'$"9$ ?*0$5//5$^,9&$G,#X$V"'A,88,)#$;')A$k,*"=2-@YP$ $ C'! +(0#! "#&0##! ()! h'+-1$*.-,%('! 9,0*+,*0#! 9A#..! ]&3(.<O^! -.=2.-,%('! +-1-+%,2! Ec!

5.$///$

Ec-!

5.$///$

5Ip$

/P.Is/P/I

4Ip$

.Js4

IIp$

5s/PI

/P/5s/P//I

JJp$

/P6s/P.

IJp$

/P5s/P/I

$ #-6'60

$ $

EcG!

5.$///$

#--'6.

'6.#--

Ec+!

5.$///$

EhT!

5I$///$

EhT-!

5I$///$

#--'6.

'6.#--

$ #-6'60

$ $

EhTG!

5I$///$

#66'0

J0#66

$ $ $

P%&*0#! ILD! %,A"2X"V"#X"#>"$ );$ 9&"$8&"**$>*"?M?L"$);$<`72,A,#"$4Z$ )#$?$m+'$V*?9"P$7#8"'9O$%&"$7D$Z?#X$ );$ 9&"$ ,A,#"$ V"?G$ ?9$ .6II$ >A2.$ X">'"?8"8$ Z">?:8"$ );$ >*"?M?L"0$ ^&,*"$ 9&"$ B2Y$ ):92$ );2$ V*?#"$ M,Z'?9,)#$ ?9$ .I6I$ >A2.$ ,#>'"?8"8P! D"V')X:>"X$ ;')A$ m'xA"'$ "9$ ?*0$ 5//5$ ^,9&$ G,#X$ V"'A,88,)#$ ;')A$ 9&"$?:9&)'8$?#X$k,*"=2-@YP$

$ $ 7#$ ?#)9&"'$ '">"#9$ 89:X=0$ 9&"$ 8?A"$ ?8$ ?Z)M"$ V)*=L*=>"')*$"U&,Z,9,#L$*)^$9)U,>,9=$?#X$Z,)>)AV?9,Z,*,9=0$ ^?8$ ;:#>9,)#?*,]"X$ ;)'$ X"M"*)V,#L$ X':L$ #?#)>?'',"'8$ ^&)8"$ X':L$ '"*"?8"$ >?#$ Z"$ 8?*929',LL"'"XP$ %&"$ ):9A)89$ )Za">9,M"$);$9&,8$&=V"'Z'?#>&"X$V)*=A"'$;:#>9,)#?*,]?9,)#$ ,80$ ?8$ ,9$ ,8$ 9&"$ >?8"$ ^,9&$ X"#X',A"'80$ 9)$ 8,A:*9?#"):8*=$ ?XX'"88$ 9&"$ A?,#$ ,88:"8$ "#>):#9"'"X$ ^,9&$ X':L8$ 9&"A8"*M"80$ ?8$ ^"**$ ?8$ ^,9&$ 9&",'$ >?'',"'80$ ,P"P0$ ^?9"'$ 8)*:Z,*,9=0$89?Z,*,9=$,#$Z,)*)L,>?*$A,*,":$?#X$9?'L"9,#LP$

7#$ 9&,8$ >)#9"U90$ <`!=*?9"X$ ?#X$ <`!=*?9"X2T)*?9"$ ;:#>9,)#?*$ X"',M?9,M"8$ );$ V)*=L*=>"')*0$ ,P"P$ <!2<`!$ ?#X$ A:*9,;:#>9,)#?*$ <!2<`!2T)*?9"$ [P%&*0#! IO\$ ^"'"$ V'"V?'"X$ ?#X$ ,#M"89,L?9"X$ ?8$ V)9"#9,?*$ X':L$ X"*,M"'=$ 8=89"A8$ [%],M"*"G?$ "9$ ?*0$ 5//6\P$ T)'$ ,#M"89,L?9,#L$ 9&,8$ V)88,Z,*,9=0$ "UV"',A"#98$ &?M"$ Z""#$ V"';)'A"X$ "AV*)=,#L$ <f$ ?#X$ %?A)U,;"#$ [%K(\0$ [P%&*0#! II\0$ ?#$ ?#9,2>?#>"'$ &=X')V&)Z,>$ X':L0$ ;)'$ 89:X=,#L$ 9&",'$ "#>?V8:*?9,)#$ ?#X$ '"*"?8"$V')V"'9,"8P$

cI$

92+"'(:-0$":$(.;$<"#+'2:2/$)-.*="'>$?-'$()).2/(:2-#$(>$+'03$(#+$3"#"$+".2@"'*$>*>:"=>$ ! $

# " '#% '#% $ '#:

V $ $

Ec<Ehc

# " ERS

$ $

#$$ '

# " ' $

" #

" "

#%" -

Ec<Ehc<P(.-,# $

P%&*0#!IOD$T:#>9,)#?*,]"X$<!2<`!$?#X$<!2<`!2T)*?9"$&=V"'Z'?#>&"X$X"#X',9,>$V)*=A"'8P$

$ $ P%&*0#! IID! @&"A,>?*! 89':>9:'"$ );$ %?A)U,;"#$[%K(\P$

'#" $

'#-

%K(

C)*:Z,*,]"X$ A)*">:*"8$ >?#$ Z"$ '"V*?>"X$ Z=$ 9&"$ A"9?*$ ,)#$ ?#X$ ,9$ ,80$ 9&"'";)'"0$ #">"88?'=$ 9)$ ,#M"89,L?9"$ ^&"9&"'$ 8)X,:A$ >?9,)#$ >)AV*"U?9,)#$ >?#$ >?:8"$ V'"A?9:'"$ '"*"?8"$ );$ 9&"$ X':L$ ,#$ 9&"$ "U9'?>"**:*?'$ ;*:,X80$ Z";)'"$ 9&"$ #?#)>?'',"'$ *)?X"X$ ^,9&$ 9&"$ X':L$ '"?>&"8$ 9&"$ 9?'L"9$ >"**P$ +=$9,9'?9,#L$%K($*)?X"X$V)*=A"',>$8)*:9,)#8$^,9&$8)X,:A$ >&*)',X"$8)*:9,)#0$9&"$X':L$^?8$'"*"?8"X$?#X$8:8V"#X"X$,#$ 9&"$Z:*G$?e:"):8$V&?8"P$7#$9&"$V'"8"#>"$);$/P.45$($B?@*$ 8)*:9,)#0$ J3$ p$ ?#X$ 54$ p$ );$ 9&"$ 8)*:Z,*,]"X$ %K($ ,#$ <!$ ?#X$<!2<`!$[P%&*0#!IY\$^"'"$'"*"?8"X$'"8V">9,M"*=$,#$9&"$ ?e:"):8$ A"X,?P$ r#X"'$ 9&"$ 8?A"$ >)#X,9,)#8$ ?#X$ ,#$ 9&"$ V'"8"#>"$ );$ <!2<`!2T)*?9"0$ )#*=$ 6$ p$ );$ 9&"$ 8)*:Z,*,]"X$ %K($ ^?8$ '"*"?8"X$ [P%&*0#! IY\P$ 79$ 8&):*X0$ 9&"'";)'"0$ Z"$ #)9"X$ 9&?9$ ;)'$ 9&"$ A)89$ "*?Z)'?9"X$ X"',M?9,M"$ V'"V?'"X$ ,#$ 9&,8$89:X=0$,P"P$9&"$A:*9,;:#>9,)#?*$<!2<`!2T)*?9"0$A)89$);$ %K($ '"A?,#8$ "#>?V8:*?9"X$ ,#$ 9&"$ V)*=A"'$ ?#X$ ,9$ ,8$ #)9$ '"*"?8"X$ ,#$ 9&"$ "U9'?>"**:*?'$ ;*:,X$ ?9$ ?$ >)#>"#9'?9,)#$ );$ /P.45$ ($ B?@*$ 8)*:9,)#P$ %&"'";)'"0$ 9&,8$ #?#)>?'',"'$ >?#$ '"?>&$9?'L"9$>"**8$?VV'">,?Z*=$*)?X"X$^,9&$%K(P$ %&"8"$ '"8:*98$ &?M"$ 9)$ Z"$ 9?G"#$ ,#9)$ >)#8,X"'?9,)#$ Z";)'"$<`!=*?9"X$V)*=L*=>"')*8$?'"$9)$Z"$?VV*,"X$?8$X':L$ X"*,M"'=$ 8=89"A8$ ,#$ "UV"',A"#98$ 2#$ @2:'-$ ?#X$ 2#$ @2@-P$ C)X,:A$>?9,)#0$,#$"U9'?>"**:*?'$;*:,X8$>?#$;)'A$>)AV*"U"8$ ^,9&$<`!$>&?,#8$?;;">9,#L$9&"$)M"'?**$'"*"?8"$V');,*"$);$9&"$ X':LP$79$,8$9&"'";)'"$'"e:,'"X0$;)'$X"8,L#"X$<`!=*?9"X$X':L$ X"*,M"'=$ 8=89"A80$ 9)$ ,#M"89,L?9"$ ^&"9&"'$ X':L$ '"*"?8"$ )>>:'8$ ,#$ 9&"$ "U9'?>"**:*?'$ ;*:,X$ ?#X$ Z";)'"$ "#9"',#L$ 9&"$ 9?'L"9$>"**8P$

+?8"X$ )#$ V')A,8,#L$ '"8:*98$ )#$ V='"#"$ "#>?V8:*?9,)#$ ?#X$'"*"?8"0$9&"$*)?X,#L$>?V?>,9=$?#X$'"*"?8"$V')V"'9,"8$);$ 9&"$ V)*=L*=>"')*$ X"',M?9,M"8$ ;)'$ %K($ ^"'"$ ?*8)$ ,#M"89,L?9"XP$ %K($ ,8$ ?$ #)#289"'),X?*$ ?#9,"89')L"#$ X':L0$ ^&,>&$ ,8$ ^,X"*=$ :8"X$ ,#$ 9&"$ 9'"?9A"#9$ ?#X$ V'"M"#9,)#$ );$ Z'"?89$ >?#>"'$ [k,8"A?#0$ .334R$ ()>?#:$ ?#X$ Y?'',8)#0$ 5//4\P$ 798$ "#>?V8:*?9,)#$ ?#X$ '"*"?8"$ ^?8$ >)AV?'?9,M"*=$ ,#M"89,L?9"X$;)'$9&"$V?'"#9$V)*=L*=>"')*0$<!0$<!2<`!$?#X$ 9&"$ A:*9,;:#>9,)#?*$ <!2<`!2T)*?9"$ X"',M?9,M"P$ %&"$ 8)*:Z,*,9=$);$%K($,#$^?9"'$^?8$;):#X$9)$Z"$.P3$U$./26$(P$ 798$ 8)*:Z,*,9=0$ &)^"M"'0$ ,#>'"?8"8$ Z=$ ?$ ;?>9)'$ );$ I$ ^&"#$ 8)*:Z,*,]"X$ ,#$ <!$ 8)*:9,)#$ [>-G.#! Q\P$ %&"$ 8)*:Z,*,9=$ );$ %K($,8$>)#8,X"'?Z*=$;:'9&"'$"#&?#>"X$Z=$?$;?>9)'$);$6I$,#$ 9&"$ V'"8"#>"$ );$ <!2<`!P$ %&,8$ 8,L#,;,>?#9$ 8)*:Z,*,9=$ ,#>'"?8"$,#X,>?9"8$9&?9$%K($,8$#)9$)#*=$8)*:Z,*,]"X$,#8,X"$ 9&"$ &=V"'Z'?#>&"X$ ,#9"',)'$ Z:9$ ?*8)$ ,#8,X"$ 9&"$ >)M?*"#9*=$ Z):#X$ V)*=["9&=*"#"$ L*=>)*\$ >&?,#8P$ %&,8$ ,8$ ,#$ *,#"$ ^,9&$ V'"M,):8$ '"8:*98$ "AV*)=,#L$ <`!=*?9"X$ X"#X',A"',>$ X"',M?9,M"8$[C,X"'?9):$"9$?*0$5//.R$<?*")8$"9$?*P0$5//4\$?#X$ )9&"'$&=X')V&)Z,>$X':L80$"89?Z*,8&,#L$9&?9$9&"$,#9')X:>9,)#$ );$9&"$V)*=["9&=*"#"$L*=>)*\$>&?,#8$,#$L"#"'?*$"#&?#>"8$9&"$ 8)*:Z,*,]?9,)#$ ";;,>,"#>=$ );$ X"#X',9,>$ V)*=A"'8P$ 79$ ,8$ ,#9"'"89,#L$ 9)$ #)9"$ 9&?9$ ;)'$ <!2<`!2T)*?9"$ ?$ w.J//2;)*X$ ,#>'"?8"$);$%K($8)*:Z,*,9=$^?8$)Z8"'M"XP$ T)'$ 9',LL"',#L$ 9&"$ '"*"?8"$ );$ %K($ ;')A$ <!$ ?#X$ ,98$ X"',M?9,M"80$ ,#>'"?8,#L$ >)#>"#9'?9,)#8$ );$ B?@*$ 8)*:9,)#8$ ^"'"$ :8"X$ ,#$ ?#?*)L=$ ^,9&$ 9&"$ "UV"',A"#98$ ^,9&$ <`!=*?9"X$ X"#X',A"',>$ X"',M?9,M"8$ [<?*")8$ "9$ ?*P0$ 5//4\P$ $

c6$

!"#"$%&"'()*$(#+$,-."/0.('$12-.-3*$4-.$567$)(3"$H8$ ! >-G.#!QP$C)*:Z,*,9=$);$%?A)U,;"#$,#$<!0$<!2<`!$?#X$<!2<`!2T)*?9"$?e:"):8$8)*:9,)#8P$D"V')X:>"X$;')A$%],M"*"G?$"9$ ?*0$5//6$^,9&$G,#X$V"'A,88,)#$;')A$k,*"=2-@YP$ $ @>-3(V%)#'!]C^! f21#0G0-'+A#/!E(.23#0! @E(.23#0!]C^! <!$ .P/$U$./2J 3P6$U$./26 2J <!2<`!$ .P/$U$./ .P5J$U$./24 2J <!2<`!2T)*?9"$ .P/$U$./ 5P4c$U$./2J

!ES?ERS?4(+CK* !ES?ERS !ES

%0/

%?A)U,;"#$[./ $(\

%%0

%// 0 67/ 6W0 /70 /7/

60/ /7/

/7%

/71

/7.

B?@*$[(\

P%&*0#!IYD$D"*"?8"$);$%?A)U,;"#$;')A$<!$[!\0$<!2<`!$[#\$?#X$<!2<`!2T)*?9"$[!\$?e:"):8$8)*:9,)#8$[.U$./2J$(\$?8$?$;:#>9,)#$);$ ?XX"X$B?@*$8)*:9,)#8P$D"V')X:>"X$;')A$%],M"*"G?$"9$?*0$5//6$^,9&$G,#X$V"'A,88,)#$;')A$k,*"=2-@YP$

$ $ >,'>:AM"#9$ ?$ 8"',"8$ );$ "#X)2$ ?#X$ "U)2>"**$ )Z89?>*"8P$ KA)#L$ 9&"8"$ )Z89?>*"8$ ?'"$ ,#>*:X"X$ >"**$ 9?'L"9,#L0$ ";;">9,M"$ 9'?#8V)'9$ );$ 9&"$ >?'',"'8$ 9)L"9&"'$ ^,9&$ ?99?>&"X$ L"#"9,>$ A?9"',?*$ 9&'):L&$ >"**$ A"AZ'?#"8$ ?#X$ 9&"$ #""X$ );$ >?'',"'8$'"*"?8"$;')A$9&"$"#X)8)A"$;)**)^,#L$"#X)>=9)8,8P$ T)'$ 9&"$ 8=#9&"9,>$ >?'',"'8$ 9&?9$ &?M"$ Z""#$ X"8>',Z"X$ ,#$ 9&"$ *,9"'?9:'"0$ 8)A"$ )'$ ?**$ );$ 9&"8"$ X,;;,>:*9,"8$ &?M"$ Z""#$ ?XX'"88"X0$ ^,9&):90$ &)^"M"'0$ >)AV*"9"*=$ ?>&,"M,#L$ 9&,8$ )Za">9,M"$="9P$ %&"$ 89'?9"L=$ "AV*)="X$ ;)'$ 9&"$ X"*,M"'=$ );$ 9&"$ >)#M"#9,)#?*$ X':L8$ 9&'):L&$ 9&"$ V'"V?'?9,)#$ );$ ;:#>9,)#?*$ X"#X',9,>$V)*=A"'8$>?#$?*8)$Z"$?VV*,"X$;)'$9&"$X"*,M"'=$);$ L"#"9,>$ A?9"',?*P$ CV">,;,>?**=0$ 9&"$ A"9&)X$ ,#M)*M"8$ A)*">:*?'$"#L,#""',#L$);$X"#X',9,>$8:';?>"$?#Xo)'$9&"$>)'"$ ?,A,#L$?9$)Z9?,#,#L$V)*=A"'80$^&,>&$8&):*X$Z"$V)8,9,M"*=$ >&?'L"X0$ Z,)*)L,>?**=$ 89?Z*"0$ #)#29)U,>0$ "U&,Z,9$ 9?'L"9,#L$ ?Z,*,9=0$ ?#X$ &?M"$ 9&"$ ?Z,*,9=$ 9)$ Z"$ ";;">9,M"*=$ 9'?#8V)'9"X$ 9&'):L&$>"**$A"AZ'?#"8P$7#$?XX,9,)#0$9&"$X"#X',A"'2FBK$ >)AV*"U$ 8&):*X$ &?M"$ 9&"$ V)88,Z,*,9=$ );$ Z",#L$ '"*"?8"X$ ;')A$9&"$"#X)8)A"$;)**)^,#L$"#X)>=9)8,8P$ F"#X',A"'8$ ?#X$ &=V"'Z'?#>&"X$ V)*=A"'8$ ?'"$ 89?Z*"$ #?#)V?'9,>*"8$,#$>)#9'?89$9)$*,V)8)A"80$^&,>&0$?8$?$':*"0$?'"$ :#89?Z*"P$KXX,9,)#?**=0$9&"$X"V"#X"#>"$);$X"#X',A"'8n$8,]"$ )#$ 9&",'$ L"#"'?9,)#$ >?#$ ?;;">9$ 9'?#8;">9,)#$ ";;,>,"#>=P$ C"M"'?*$ 89:X,"8$ [+)?8$ ?#X$Y""L??'X0$5//4\$&?M"$ '"V)'9"X$ 9&"$:8"$);$:#A)X,;,"X$?A,#)29"'A,#?9"X$<K(K($)'$FK+$ X"#X',A"'8$ ?8$ #)#2M,'?*$ L"#"$ 9'?#8;"'$ ?L"#980$ "#&?#>,#L$ 9&"$ 9'?#8;">9,)#$ );$ FBK$ ,#9)$ 9&"$ >"**$ #:>*":8P$ %&"$ "U?>9$ 89':>9:'"$ );$ 9&"8"$ &)89uL:"89$ Z,#X,#L$ A)9,;8$ &?8$ #)9$ Z""#$

TbD! c#'#! +-00%#0$H! )0(3! 3('()*'+,%('-.! /#'/0%3#0$! ,(! 3*.,%)*'+,%('-.!/#'/0%,%+!1(.23#0$! B:A"'):8$ L"#"$ X"*,M"'=$ 8=89"A8$ Z?8"X$ )#$ M,'?*$ [-"'A?$?#X$C)A,?0$.331R$_)9]"$?#X$m)890$5//5\$?#X$#)#2 M,'?*$[_,$?#X$Y:?#L0$5///R$+')^#$"9$?*0$5//.R$B,8&,G?^?$ ?#X$Y:?#L0$5//.\$M">9)'8$&?M"$Z""#$X"M"*)V"X$?#X$9"89"X$ 8)$ ;?'P$ D">"#9*=0$ 8"M"'?*$ '">:'',#L$ ,88:"8$ ?Z):9$ 8?;"9=$ );$ M,'?*$M">9)'8$&?M"$*"X$9)$?$>?'";:*$'">)#8,X"'?9,)#$);$9&",'$ ?VV*,>?9,)#$ ,#$ &:A?#$ >*,#,>?*$ 9',?*8$ ?#X$ V')AV9"X$ 9&"$ :8"$ );$ 8=#9&"9,>$ 8=89"A8P$ ()'")M"'0$ M,'?*$ M">9)'8$ "UV"',"#>"$ 8,L#,;,>?#9$ *,A,9?9,)#$ ,#$ *?'L"28>?*"$ V')X:>9,)#$ ?#X$ 9&"$ ?M?,*?Z*"$8,]"$);$FBK$9&"=$>?#$>?''=P$T)'$?XX'"88,#L$9&"8"$ V')Z*"A80$#)#2M,'?*$L"#"$X"*,M"'=$8=89"A8$8:>&$?8$>?9,)#,>$ V)*=A"'8$ )'$ >?9,)#,>$ *,V,X80$ *,V)8)A"8$ )'$ >?9,)#,>$ X"#X',A"'8$ &?M"$ ?99'?>9"X$ L'"?9$ ?99"#9,)#$ ;)'$ ?>&,"M,#L$ ?$ Z'"?G9&'):L&$ ,#$ 9&"$ X"M"*)VA"#9$ );$ ?#$ ";;">9,M"$ L"#"$ >?'',"'P$CV">,;,>?**=0$8=#9&"9,>$#)#2M,'?*$>?'',"'8$);$L"#"9,>$ A?9"',?*$ V'"8"#9$ ,#8,L#,;,>?#9$ ',8G8$ );$ L"#"9,>$ '">)AZ,#?9,)#8$,#$9&"$L"#)A"P$%'?#8;">9,)#$^,9&$8=#9&"9,>$ M">9)'80$9&'):L&$?VV')V',?9"$9?,*)',#L0$A?=$"U&,Z,9$*)^$>"**$ 9)U,>,9=0$ &,L&$ '"V')X:>,Z,*,9=$ ?#X$ "?8"$ );$ ?VV*,>?9,)#P$ Y)^"M"'0$ 9&"$ >:''"#9*=$ G#)^#$ 8=#9&"9,>$ M">9)'8$ V'"8"#9$ X,8?XM?#9?L"80$ ^&,>&$ ?'"$ X:"$ 9)$ 9&",'$ L"#"'?**=$ *)^$ ";;">9,M"#"88$ >)AV?'"X$ 9)$ M,'?*$ M">9)'8$ ?#X$ 9)$ 9&",'$ ,#?Z,*,9=$ ;)'$ 9?'L"9"X$ L"#"$ "UV'"88,)#P$ T)'$ ?#$ ";;">9,M"$ L"#"$"UV'"88,)#0$L"#"8$A:89$ Z"$9'?#8;"''"X$,#$9&"$,#9"',)'$ );$ 9&"$ #:>*":8$ );$ 9&"$ >"**$ ?#X$ 9&,8$ V')>"X:'"$ &?8$ 9)$ c1$

92+"'(:-0$":$(.;$<"#+'2:2/$)-.*="'>$?-'$()).2/(:2-#$(>$+'03$(#+$3"#"$+".2@"'*$>*>:"=>$ ! 8:V"',)'$ 9'?#8;">9,)#$ ";;,>?>=$ ,#$ >)AV?',8)#$ ^,9&$ 9&"$ 8V&"',>?*$t,#9?>9n$X"#X',A"'8$[+)?8$?#X$Y""L??'X0$5//4\P$ 7#$ >)AV?',8)#$ 9)$ 9&"$ ,#9?>9$ X"#X',A"'80$ 9&"$ V?'9,?**=$ X"L'?X"X$X"#X',A"'8$&?M"$?$A)'"$;*"U,Z*"$89':>9:'"$[;"^"'$ ?A,X"$ Z)#X8\$ ?#X$ ;)'A$ ?$ A)'"$ >)AV?>9$ >)AV*"U$ ^,9&$ FBK0$ ^&,>&$ ,8$ V'";"'?Z*"$ ;)'$ L"#"$ X"*,M"'=$ Z=$ 9&"$ "#X)>=9)9,>$ V?9&^?=$ [F"##,L$ ?#X$ F:#>?#0$ 5//5\P$ 7#$ ?XX,9,)#0$ ,9$ ,8$ L"#"'?**=$ ;):#X$ 9&?9$ 9&"$ A?U,A:A$ 9'?#8;">9,)#$ ";;,>,"#>=$ [P%&*0#! IM\$ ,8$ )Z9?,#"X$ ^,9&$ ?#$ "U>"88$ );$ V',A?'=$ ?A,#"8$ 9)$ FBK$ V&)8V&?9"80$ =,"*X,#L$ ?$ V)8,9,M"$ #"9$ >&?'L"$ );$ 9&"$ >)AV*"U"8$ %&"$ A)'"$ ;*"U,Z*"$ &,L&"'$L"#"'?9,)#$FK+$X"#X',A"'8$[>)#9?,#,#L$#)$?A,X"8\$ ?'"$ ;):#X$ 9)$ Z"$ 9))$ >=9)9)U,>$ ;)'$ :8"$ ?8$ #)#2M,'?*$ L"#"$ M">9)'80$ &)^"M"'0$ 9&"$ *)^"'$ L"#"'?9,)#$ X"#X',A"'8$ ?'"$ ^"**28:,9"X$;)'$L"#"$X"*,M"'=$[v,#8"*A"="'$"9$?*0$5//5\P$

X"9"'A,#"X$ ,#$ X"9?,*0$ Z:9$ ,9$ ,8$ V'"8:A?Z*=$ Z?8"X$ )#$ ?>,X2Z?8"$ ,#9"'?>9,)#8$ Z"9^""#$ 9&"$ ?#,)#,>$ V&)8V&?9"$ A),"9,"8$ )#$ 9&"$ FBK$ Z?>GZ)#"$ ?#X$ 9&"$ V',A?'=$ ?#X$ 9"'9,?'=$ ?A,#"8$ );$ 9&"$ X"#X',A"'80$ ^&,>&$ ?'"$ V)8,9,M"*=$ >&?'L"X$ :#X"'$ V&=8,)*)L,>?*$ >)#X,9,)#8P$ 79$ &?8$ ?*8)$ Z""#$ ;):#X$ [%?#L$ "9$ ?*0$ .336\$ 9&?9$ V?'9,?**=$ X"L'?X"X$ [)'$ ;'?LA"#9"X\$ X"#X',A"'80$ ?'"$ A)'"$ ?VV')V',?9"$ ;)'$ L"#"$ X"*,M"'=$9&?#$9&"$,#9?>9$X"#X',A"'8$?#X$?$;'?LA"#9?9,)#$[)'$ ?>9,M?9,)#$ 89"V\$ >)#8,89,#L$ );$ &=X')*=9,>$ >*"?M?L"$ );$ 9&"$ ?A,X"$Z)#X8$,8$#""X"X$9)$"#&?#>"$9&"$9'?#8;">9,)#P$%&"8"$ X"#X',A"'8$?'"$>&?'?>9"',]"X$?8$?>9,M?9"X$?#X$?'"$8&)^#$,#$ P%&*0#! IZP$ 79$ &?8$ Z""#$ >)#>*:X"X$ ;')A$ 8"M"'?*$ ,#M"89,L?9,)#8$9&?9$9&"$8V&"',>?*$8&?V"$);$X"#X',A"'8$,8$#)9$ ?XM?#9?L"):8$ ,#$ L"#"$ X"*,M"'=P$ %&,8$ ?L'""8$ ^,9&$ "?'*,"'$ ^)'G0$ ^&"'"$ t;'?LA"#9"Xn$ <K(K($ X"#X',A"'8$ 8&)^$

#%"

"#% #%" "#% #%"

# "

#%" "#%

# "

#%" #%" #

#%" #%"

# "

#%" #%"

# "

$ " # # #%"

# "

#%"

$ # "

" $

#%"

" #

# "

" $

# "

$ " #

$ #

" #

"#%

" # #

"#% "#%

#%"

" #

# "

"#%

"#% $

" #

# $

$ $#

# "

" $

" $ "

" #

"#%

" "

# "

$ "#

# "

$ " #

$ #

"#%

# $ "

$ #$

" # "

#%"

# "

"#% " #

" #

$ "

# # " $

# "

"#%

# "

$ "

"#%

# "

#%"

"#%

#%"

# "

"#%

# "

" #

$ " #

" "

#%"

" "

#%"

# "

" #

" $

" "

"##

$ $ " # # "

$ "

# "

"#%

" #

"#%

" $

"#% #%"

# "

"#% #%"

"#%

P%&*0#!IZD$C9':>9:'?*$;"?9:'"8$);$,#9?>9$M8$?>9,M?9"X$<K(K($F"#X',A"'8P$

P%&*0#! IMD$ %'?#8;">9,)#$ ";;,>?>=$ );$ V)*=[V')V=*"#"$ ,A,#"\$ X"#X',A"'8$ );$ M?',):8$ L"#"'?9,)#8$ [!.2!I\$ '"*?9,M"$ 9)$ I2|.2[50J2 X,)*")=*)U=\V')V=*}2I0I0I29',A"9&=*?AA)#,:A$A"9&=*8:*V&?9"$[Fd%K<\$,#$9&"$K4J.$>"**$*,#"$89:X,"X$,#$362^"**$V*?9"8P$FK+$!.$?#X$ FK+$ !5$ ^"'"$ X)8"X$ ?9$ ?$ X"#X',A"'O$ FBK$ '?9,)$ );$ IO.0$ ?#X$ ?$ FBK$ X)8"$ );$ 5/$ "L$ V"'$ ^"**$ ^?8$ :8"XP$ FK+$ !J$ ^?8$ ?*8)$ X)8"X$ ?9$ ?$ X"#X',A"'O$FBK$'?9,)$);$IO.0$Z:9$?$FBK$X)8"$);$I$"L$V"'$^"**$FBK$^?8$:8"XR$FK+$!4$?#X$FK+$!I$^"'"$X)8"X$?9$?$X"#X',A"'O$FBK$ '?9,)$);$JO.$?#X$?$FBK$X)8"$);$5/$"L$V"'$^"**P$Fd%K<$^?8$X)8"X$?9$?$Fd%K<OFBK$'?9,)$);$IO.0$?#X$?$FBK$X)8"$);$5/$"L$V"'$^"**P$ F?9?$ '"V'"8"#9"X$ ?8$ 9&"$ A"?#$ sCF$ );$ ?9$ *"?89$ J$ '"V*,>?9"8P$ D"V')X:>"X$ ;')A$ v,#8"*A"="'$ "9$ ?*P0$ 5//5$ ^,9&$ G,#X$ V"'A,88,)#$ ;')A$ CV',#L"'P$

cc$

!"#"$%&"'()*$(#+$,-."/0.('$12-.-3*$4-.$567$)(3"$HF$ ! V?'9,>*"8$ ;)'A"X$ ?8$ 9&"$ >&?'L"$ '?9,)$ ,#>'"?8"XP$ K*9&):L&$ 9&"$ 9'?#8;">9,)#$ ";;,>,"#>=$ );$ ;:#>9,)#?*$ g<K(K(2dY$ X"',M?9,M"8$ ^?8$ *)^"'$ Z=$ )#"$ )'X"'$ );$ A?L#,9:X"$ 9&?#$ V?'"#9$ <K(K($ [P%&*0#! I[\0$ 9&"$ g<K(K(2dYoFBK$ V?'9,>*"8$ "U&,Z,9"X$ '"X:>"X$ >=9)U,>,9=$ >)AV?'"X$ ^,9&$ <K(K($ ?#X$ <`7P$ C&,"*X,#L$ );$ 9&"$ ,#9"',)'$ V)8,9,M"$ >&?'L"8$ Z=$ 8:';?>"$ &=X')U=*$ A?=$ Z"$ V)88,Z*=$ 9&"$ '"?8)#$ ;)'$9&,8$Z"&?M,):'P$ K8$ ?*'"?X=$ A"#9,)#"X0$ )#"$ );$ 9&"$ A?a)'$ V')Z*"A8$ ^,9&$ #)#2M,'?*$ L"#"$ X"*,M"'=$ 8=89"A8$ ,8$ 9&",'$ *)^"'$ ";;,>,"#>=$>)AV?'"X$9)$M,'?*$M">9)'8P$(?#=$A"9&)X8$&?M"$ 9',"X$ 9)$ )M"'>)A"$ 8:>&$ V')Z*"A80$ ,#>*:X,#L$ *,#G,#L$ )'$ >)#a:L?9,#L$ >"**29?'L"9,#L$ *,L?#X8$ )'$ >"**$ V"#"9'?9,#L$ V"V9,X"8$ ?8$ ";;,>,"#9$ M">9)'8$ ;)'$ ,#9'?>"**:*?'$ X"*,M"'=$ );$ Z,)?>9,M"$A)*">:*"8$[T:9?G,0$5//I\P$K'L,#,#"2',>&$V"V9,X"8$ &?M"$"U&,Z,9"X$"#&?#>"X$9'?#8*)>?9,)#?*$?Z,*,9=0$^&,>&$^?8$

7#$ 9&,8$ >)##">9,)#0$ <K(K(2dY$ X"#X',A"'80$ ^&,>&$ ?'"$ 89':>9:'?**=$ 8,A,*?'$ 9)$ <K(K(0$ "U>"V9$ 9&?9$ 8:';?>"$ ?A,#)$L'):V8$&?M"$Z""#$'"V*?>"X$Z=$&=X')U=*$L'):V8$[_""$ "9$ ?*0$ 5//J\$ &?M"$ Z""#$ V'"V?'"XP$ KZ8"#>"$ );$ 8:';?>"$ V',A?'=$ ?A,#)$ L'):V8$ ,#$ <K(K(2dY$ '"#X"'8$ 9&,8$ V)*=A"'$ #"?'*=$ #":9'?*0$ ^&,>&$ A,L&9$ Z"$ ?XM?#9?L"):8$ ,#$ 9"'A8$ );$ >=9)9)U,>,9=P$ Y)^"M"'0$ <K(K(2dY$ ,8$ #"?'*=$ :#?Z*"$9)$;)'A$FBK$V)*=V*"U$Z">?:8"$);$9&"$*)^$VJ?$);$ ,#9"',)'$ 9"'9,?'=$ ?A,#)$ L'):V8$ [%)A?*,?$ "9$ ?*0$ .3cI\P$ T)'$ 9&,8$ V:'V)8"0$ 9&"$ 8=#9&"8,8$ ?#X$ >&?'?>9"',]?9,)#$ );$ ,#9"'#?**=$e:?9"'#,]"X$<K(K(2dY$&?8$Z""#$'"V)'9"X0$?8$ 8&)^#$ ,#$ 9&"$ P%&*0#! IQP$ %&"$ ,#9"'#?*$ e:?9"'#?'=$ ?AA)#,:A$ L'):V8$ );$ g<K(K(2dY$ ^,**$ ,#9"'?>9$ ^,9&$ #"L?9,M"*=$ >&?'L"X$ FBK0$ ^&,*"$ V'"8"'M,#L$ ?$ #":9'?*$ V)*=A"'$?#Xo)'$?$V)*=V*"U$8:';?>"P$ 79$ ^?8$ ;):#X$ 9&?9$ g<K(K(2dYoFBK$ V)*=V*"U"8$ ^"'"$ '):#X28&?V"X$ ^,9&$ 9&"$ A)'"$ >)AV?>9$ ?#X$ 8A?**$

$ $ $ "

$# # # "

#$ #$

$ " # #

" "

# "

#$ $

$ "# # "

"# #

" $

" $ "#

$ # "

# "

" #

# "

# " $

@YJ7 5($B?@*$X,?*=8,8

$ " $

# "

#$ #$ $

" #

" # # "

$ " # #

$ " #

" "

# "

", '+?

# "

"# # "

"# #

$# "

", ? '+

#$ $

" #

? ", '+

'+?

#$ $# #

$ "

" # # "

$ ",

# "

$# $

# " #

" # # "

# #"

" $

# # "

$ "

#$ $#

$ "#

'+?

# "

" #

# # "

# "

'+? ", $

$ " # "

# $#

$ "#

<K(K(2dY ! P%&*0#!IQD$g:?9"'#,]?9,)#$);$<K(K(2dY$X"#X',A"'P$

g<K(K(2dY

$ P%&*0#!I[D$%'?#8;">9,)#$";;,>,"#>=$ );$ <`70$ <K(K($ ?#X$ g<K(K(2 dY$ X"#X',A"'8$ ^,9&$ I50$ 1c$ ?#X$ 31p$ e:?9"'#,]?9,)#$ X"L'""8$ ,#$ 53J%$>"**$?9$>&?'L"$'?9,)$[So2\$q$6P$ F?9?$ ?'"$ "UV'"88"X$ ?8$ ?$ D_r$ [D"*?9,M"$*,L&9$:#,9\$V"'$"L$V')9",#P$ D"V')X:>"X$ ;')A$ _""$ "9$ ?*P0$ 5//J$ ^,9&$ G,#X$ V"'A,88,)#$ ;')A$ KA"',>?#$ @&"A,>?*$ C)>,"9=P

! c3$

92+"'(:-0$":$(.;$<"#+'2:2/$)-.*="'>$?-'$()).2/(:2-#$(>$+'03$(#+$3"#"$+".2@"'*$>*>:"=>$ ! V)*=["9&=*"#"$ L*=>)*\2;)*?9"$ [<`72<`!2Td_\$ X"',M?9,M"$ ^&,>&$ ^?8$ '">"#9*=$ 8=#9&"8,]"X$ [P%&*0#! YL\$ ?#X$ ,98$ ";;,>,"#>=$ ?8$ L"#"$ >?'',"'$ ^?8$ 9"89"X$ [m,A$ "9$ ?*0$ 5//I?\P$ %&,8$ A:*9,;:#>9,)#?*,]?9,)#$ );$ <`7$ ?,A"X$ ?9$ 9&"$ V'"V?'?9,)#$ );$ ?$ #?#)>?'',"'$ 9&?9$ ^):*X$ 8,A:*9?#"):8*=$ >)AZ,#"$V')9">9,M"$?#X$9?'L"9,#L$V')V"'9,"8P$7#$9&,8$89:X=0$ 9&"$<`72<`!2Td_$#?#)>?'',"'0$^?8$9"89"X$;)'$,98$>?V?>,9=$ 9)$>)AV*"U$^,9&$V*?8A,X$FBK$?#X$Z"$9'?#8;">9"X$9)$;)*?9"$ '">"V9)'$ )M"'"UV'"88,#L$ >"**8$ 9&?9$ V')X:>"$ "U)L"#):8$ L'""#$;*:)'"8>"#9$V')9",#0$!T<0$[!T<2m+$>"**8\P$K$8V">,?*$ V*?8A,X$ 8=89"A$ [VCr<`D28,!T<\$ ^?8$ V'"V?'"X0$ 9&?9$ >?'',"X$ ?$ 8,DBK2"UV'"88,#L$ 8"e:"#>"0$ :8"X$ ;)'$ ,#&,Z,9,#L$ 9&"$"UV'"88,)#$);$"U)L"#):8$!T<$,#$A?AA?*,?#$>"**8P$%&"$ VCr<`D28,!T<o<`72<`!2Td_$ >)AV*"U"8$ ,#&,Z,9"X$ !T<$ "UV'"88,)#$ );$ m+$ >"**8$ A)'"$ ";;">9,M"*=$ 9&?#$ VCr<`D2 8,!T<o<`7$[P%&*0#!YO\P$%&"8"$'"8:*98$,#X,>?9"X$9&?9$;)*?9"$ '">"V9)'2A"X,?9"X$"#X)>=9)9)8,8$,8$?$A?a)'$V?9&^?=$,#$9&"$ V')>"88$);$>"**:*?'$:V9?G"P$

?99',Z:9"X$ 9)$ 9&"$ V'"8"#>"$ );$ 9&"$ L:?#,X,#,:A$ A),"9=$ [-,M"8$ "9$ ?*0$ .331R$ D)9&Z?'X$ "9$ ?*0$ 5///R$ k"#X"'$ "9$ ?*0$ 5///R$ T:9?G,$ "9$ ?*0$ 5//.R$ m,'8>&Z"'L$ "9$ ?*0$ 5//J\0$ ?$ 89':>9:'?*$ ;"?9:'"$ );$ _2?'L,#,#"0$ ^&,>&$ ,8$ >?V?Z*"$ );$ &=X')L"#2Z)#X,#L$ ?#X$ "*">9')89?9,>$ ,#9"'?>9,)#8$ [d#X?$ "9$ ?*0$.336\$^,9&$V&)8V&?9"$)'$>?'Z)U=*,>$L'):V$*)>?9"X$?9$9&"$ 8:';?>"$ );$ >"**$ A"AZ'?#"8P$ 7#$ ?$ '">"#9$ 89:X=$ [@&),$ "9$ ?*0$ 5//4\0$ ,9$ &?8$ Z""#$ '"V)'9"X$ ?$ #"^$ 9&'""$ X,A"#8,)#?*$ ?'9,;,>,?*$ V')9",#0$ _2?'L,#,#"2L'?;9"X2<K(K($ X"#X',A"'$ [<K(K(2K'L\0$?8$?$#)M"*$#)#2M,'?*$L"#"$X"*,M"'=$M">9)'0$ ^&,>&$ >)#8,89"X$ );$ ?$ <K(K($ 8>?;;)*X$ 9&"$ 8:';?>"$ );$ ^&,>&$,8$>)M"'"X$^,9&$_2?'L,#,#"$'"8,X:"8$[P%&*0#!IJ\P$ +=$ 9&"$ ,#9')X:>9,)#$ );$ ?'L,#,#"$ A),"9,"8$ )#$ 9&"$ <K(K($ 8:';?>"0$ L"#"$ X"*,M"'=$ ";;,>,"#>=$ ,8$ L'"?9*=$ ,#>'"?8"X$ ,#$ >)AV?',8)#$ 9)$ 9&?9$ );$ 89?'9,#L$ <K(K($ [P%&*0#! I\\P$ 79$ ^?8$ >)AV?'?Z*"$ 9)$ <`7$ ;)'$ Y"V!5$ ?#X$ V',A?'=$ '?9$ M?8>:*?'$ 8A))9&$ A:8>*"$ >"**80$ ?#X$ ^?8$ A)'"$ ";;,>,"#9$ ,#$ 9&"$ >?8"$ );$ B":')$ 5K$ >"**8$ 9&?#$ <`7$ ?#X$ _,V);">9?A,#"P$ K8$ ?$ >)#9')*0$ _2*=8,#"$ L'?;9"X2<K(K($ [<K(K(2_=8\$ ^?8$ V'"V?'"X$ ?#X$ 9"89"X$ 8&)^,#L$ 8*,L&9*=$ Z"99"'$ 9'?#8;">9,)#$ ";;,>,"#>=$ ,#$ Y"V!5$ >"**8$ 9&?#$ 9&?9$ );$ Z?8,>$<K(K(0$^&,*"$,#>'"?8"X$";;">9$^?8$#)9$)Z8"'M"X$,#$ V',A?'=$ >"**8P$ 7#$ >)#>*:8,)#0$ ?$ V)*=M?*"#9$ ?'L,#,#"$ ;:#>9,)#?*,]"X$ <K(K($ ,8$ "?8,*=$ V'"V?'"X0$ ^&,>&$ V)88"88"8$ ):989?#X,#L$ 9'?#8;">9,)#$ ";;,>,"#>=$ ^,9&$ '"*?9,M"*=$ *)^$ >=9)9)U,>,9=P$ %&"8"$ V')V"'9,"8$ ^):*X$ A?G"$ <K(K(2K'L$ ?$ V')A,8,#L$ #)#2M,'?*$ M">9)'$ ;)'$ Z)9&$ 2#$ @2:'-$ ?#X$ 2#$ @2@-$ :8"P$ <)9"#9,?**=0$ <K(K(2K'L$ >):*X$ Z"$ :8"X$ ?8$ ?$ X"#X',9,>$ #?#)>?'',"'$ "#>?V8:*?9,#L$ )'$ ,#>)'V)'?9,#L$ 8A?**$ A)*">:*"80$ V"V9,X"80$ V')9",#80$ )*,L)#:>*")9,X"80$ ?#X$ V*?8A,X8$ 9&?9$ ?'"$ X";,>,"#9$ ,#$ >"**2 V"#"9'?9,#LP$ %&"$ 89':>9:'?*$ ;"?9:'"8$ 8"9$ ;)'9&$ ;)'$ ?$ 8:>>"88;:*$ X"#X',9,>$ L"#"$ M">9)'$ ?'"$ V)88,Z*=$ 8?9,8;,"X$ ,#$ ?$ <`72 $

bD!@('+.*/%'&!0#3-0=$! ()*">:*?'$ "#L,#""',#L$ );$ Z?8,>$ X"#X',A"',>$ ?#X$ &=V"'Z'?#>&"X$ V)*=A"'$ 8>?;;)*X8$ '"8:*9"X$ ,#$ 9&"$ V'"V?'?9,)#$ );$ #?#)>?'',"'8$ );$ *)^$ 9)U,>,9=0$ ^,9&$ 8,L#,;,>?#9$ "#>?V8:*?9,#L$ >?V?>,9=0$ 8V">,;,>,9=$ 9)$ >"'9?,#$ Z,)*)L,>?*$ >"**8$ ?#X$ 9'?#8V)'9$ ?Z,*,9=$ 9&'):L&$ 9&",'$ A"AZ'?#"8P$ F"V"#X,#L$ )#$ 9&"$ X"L'""$ ?#X$ 9=V"$ );$ ;:#>9,)#?*,]?9,)#0$ V')X:>98$ 9&?9$ ;:*;,**$ )#"$ )'$ A)'"$ );$ 9&"$ ?Z)M"$ >&?'?>9"',89,>8$ ^"'"$ V'"V?'"XP$ %&"$ "U&,Z,9,)#$ );$ 9&"8"$ V')V"'9,"8$ ,8$ ;:'9&"'$ ,#X:>"X$ Z=$ 9&"$ 8)2>?**"X$ V)*=M?*"#9$ ,#9"'?>9,)#8$ ?99',Z:9"X$ 9)$ 9&"$ V*?>"A"#9$ );$ 9&"$ ;:#>9,)#?*$ L'):V8$ ,#$ >*)8"$ V')U,A,9=$ )#$ 9&"$ "U9"'#?*$ 8:';?>"$);$9&"$X"#X',9,>$V)*=A"'8P$

, ,

#%"

"#% "# #%"

#%"

"#% "#

"#%

#% "

"# #% " $

"#%

#% " " #

#% "

"#% $ "#

# #" "

"#%

"#% "# "#%,

#% " #"

" #

"#%

"# #" "#% # #" $ $ "# $ " $ $ # #%" "#% "#% " "# $ $ " " "# " # " # "# $ " $ " # $ #" $ # #" "#%, $ #% " $ " # " " #% " " # " $ "# , % #%" "#% # " $ " $ "# "# $ $ " $ " # $ # # " " #% " " " #" " " # "#%, # "# $ # $ " $ # " " $ # %" $ # " " # $ $ $ #" $ # $ " " " " #% " " # #%" $ " # "# , " #%" $ $ "# $ #" $ " #" "#%, " "# # $ # "#% "# "# #%" $ % " $ " " # #%" # " #% " " " #" # # #" $ , #% " #%" " #" $ $ "#%, #%" , "#% #% " #%" "# $ "# , #%" "#%

"#% <K(K(

#$@KG!#@AX 4<(J?O)YPNLMQ?$# ;:!Z34

() -/[!N;N*);9;:*! ;:!Z34P\D\Q

A4ODK);;H(N)(N]+H;+C:*D#%$ P50^%70^%70G!\D\Q

<K(K(2K'L ! P%&*0#!IJD!7#9')X:>9,)#$);$_2K'L,#,#"$?9$9&"$"U9"'#?*$8:';?>"$);$<K(K(P$

3/$

!"#"$%&"'()*$(#+$,-."/0.('$12-.-3*$4-.$567$)(3"$F5$ !

$ $ $ P%&*0#! I\D$ %'?#8;">9,)#$ ";;,>,"#>=$ ;)'$ B":')$ 5K$ >"**$ *,#"8$ [.U./I$ >"**8o^"**\P$ FBK$ ?A):#9$ V"'$ ^"**$ ^?8$ /P5$ "L$ [Z*?>G\$ ?#X$ .P/$ "L$ [L'?=\P$-?*:"8$,#$V?'"#9&"8"8$?'"$'"V'"8"#9,#L$9&"$>&?'L"$'?9,)$[Bo<\$);$X"#X',A"'oV*?8A,X$FBK$>)AV*"U"8P$%&"$*:>,;"'?8"$"UV'"88,)#$ A"X,?9"X$Z=$'"?L"#98$^?8$A"?8:'"X$?9$"?>&$)V9,A:A$>)#X,9,)#P$D"8:*98$?'"$"UV'"88"X$?8$A"?#$#CF$);$J$'"V*,>?9"8P$D"V')X:>"X$;')A$ @&),$"9$?*0$5//4$^,9&$G,#X$V"'A,88,)#$;')A$`*8"M,"'P$

$ # "

#$$ '

$ " #

ERS

# " ' $

$ " #

" #

" "

#%" <

EhT<Ehc<Pg; ! P%&*0#!YLP$@&"A,>?*$89':>9:'"$);$<`72<`!2Td_$

$ P%&*0#! YOD$ !T<$ L"#"$ ,#&,Z,9,)#$ ";;,>,"#>=$ );$ VCr<`D28,!T<o<`7$ ?#X$ VCr<`D28,!T<o<`72<`!2 Td_$ >)AV*"U"8$ ?8$ ?$ ;:#>9,)#$ );$ Bo<$ '?9,)$ ?L?,#89$ !T<2m+$ >"**8P$ D"V')X:>"X$;')A$m,A$"9$?*0$5//I?$ ^,9&$ G,#X$ V"'A,88,)#$ ;')A$ `*8"M,"'P$

3.$

92+"'(:-0$":$(.;$<"#+'2:2/$)-.*="'>$?-'$()).2/(:2-#$(>$+'03$(#+$3"#"$+".2@"'*$>*>:"=>$ ! T'i>&"9$ l(l$ ?#X$ %)A?*,?$ FK$ [ILLO\$ F"#X',A"'8$ ?#X$ d9&"'$ F"#X',9,>$ <)*=A"'8P$ lP$ k,*"=$ ~$ C)#80$ _9XP0$ @&,>&"89"'0$ rm$ ?#X$'";"'"#>"8$>,9"X$9&"'",#P$ T'"=$ Y$ ?#X$ Y??L$ D$ [ILLI\$ F"#X',9,>$ V)*=L*=>"')*O$ ?$ #"^$ M"'8?9,*"$ Z,)>)AV?9,Z*"$ A?9"',?*P! 5#4! C(.! a%(,#+A'(.$ 3/0$ 5I12561P$ T:9?G,$C$[ILLM\$("AZ'?#"2V"'A"?Z*"$?'L,#,#"2',>&$V"V9,X"8$?#X$ 9&"$9'?#8*)>?9,)#$A">&?#,8A8P$7/4!"0*&!"#.%4#02!5#4$I412 IIcP$ T:9?G,$C0$C:]:G,$%0$d&?8&,$k0$f?L?A,$%0$%?#?G?$C0$r"X?$m$?#X$ C:L,:'?$ f$ [ILLO\$ K'L,#,#"2',>&$ V"V9,X"8P$ K#$ ?Z:#X?#9$ 8):'>"$ );$ A"AZ'?#"2V"'A"?Z*"$V"V9,X"8$ &?M,#L$V)9"#9,?*$ ?8$ >?'',"'8$;)'$,#9'?>"**:*?'$V')9",#$X"*,M"'=P$i!a%(.!@A#3$5160$ IcJ62Ic4/P$ !?Z,])#$ K0$ C&A""X?$ Y0$ Y)')^,9]$ K%$ ?#X$ v?*,V8G=$ C$ [ILLZ\$ %:A)'$ >"**$ 9?'L"9,#L$ );$ *,V)8)A"2"#9'?VV"X$ X':L8$ ^,9&$ V&)8V&)*,V,X2?#>&)'"X$ ;)*,>$ ?>,X2<`!$ >)#a:L?9"8P$ "0*&! "#.%4#02!5#4$I60$..112..35P$ !,**,"8$ `D$ ?#X$ T'i>&"9$ l(l$ [ILLM\! F"#X',A"'8$ ?#X$ X"#X',9,>$ V)*=A"'8$ ,#$ X':L$ X"*,M"'=P$ "0*&! "%$+(4#02! >(/-2$ ./0$ JI2 4JP$ !:=9)#$ K@$ ?#X$ Y?**$ l`$ [ILLL\$ %&"$ Z)X=$ ;*:,X$ >)AV?'9A"#98O$ `U9'?>"**:*?'$ ?#X$ ,#9'?>"**:*?'$ ;*:,X8R$ 7#9"'89,9,?*$ ;*:,X$ ?#X$ "X"A?0$,#O$%"U9Z))G$);$("X,>?*$<&=8,)*)L=P$k$ +$C?:#X"'8$ @)AV?#=0$<&,*?X"*V&,?0$564P$ Y??L$D$[ILLO\$F"#X',A"'8$?#X$&=V"'Z'?#>&"X$V)*=A"'8$?8$&,L&2 *)?X,#L$8:VV)'98$;)'$)'L?#,>$8=#9&"8,8P$@A#3!h*0!i$10$J512 JJIP$ Y??L$ D0$ m'xA"'$ (0$ C9:AZi$ lT0$ m'?:8"$ C0$ m)AV$ K$ ?#X$ <')G&)')M?$ C$ [ILLI\$ F"#X',9,>$ V)*=A"'8$ ?8$ A:*9,;:#>9,)#?*$ 8:VV)'98$ ?#X$ #?#)>?'',"'8$ ;)'$ X':L8P$ E(.23! E0#10! R73! @A#3!9(+:!"%4!E(.23!@A#3!4J0$J5cP$ Y,'89$ C@0$ %">,**?$ <0$ !",Z$ Cl0$ T?#$ `$ ?#X$ Y?A,*9)#$ KF$ [O\\I\$ ()*">:*?'$ D">)L#,9,)#$ );$ <&)8V&?9"2"89"'82K$ +?*?#>"$ );$ Y=X')L"#2Z)#X,#L$ ?#X$ ')9)#2%'?#8;"'$ 7#9"'?>9,)#8P$ T$0-#.! i! @A#3$J50$./I2...P$ Y);*?#X$ Y`l0$ (?88)#$ @0$ 7L,#*?$ C0$ d8"9,#8G=$ 70$ D"XX=$ lK0$ _"?A)#$ @<0$ C>&"'A?#$ F0$ +"88)X"8$ ($ ?#X$ k,*8$ <$ [ILLI\$ T)*?9"29?'L"9"X$L"#"$9'?#8;"'$,#$M,M)P$C(.!>A#0$I0$1J32144P$ 7#):"$ m$ [ILLL\$ T:#>9,)#?*$ X"#X',A"'80$ &=V"'Z'?#>&"X$ ?#X$ 89?'$ V)*=A"'8P!E0(&!E(.23!9+%$5I0$4IJ2I1.P$ 78&,^?9?$Y0$C?9)$C+0$-"'9:92F),$K0$Y?A?8&,A?$f$?#X$(,=?a,A?$ m$ [O\\[\$ @&)*"89"')*$ X"',M?9,M"$ );$ V)*=["9&=*"#"$ L*=>)*\$ ,#&,Z,98$ >*?9&',#2,#X"V"#X"#90$ Z:9$ #)9$ >*?9&',#2X"V"#X"#9$ "#X)>=9)8,8P!a%(+A%3!a%(1A2$!7+,-$.JI30$.5J2.JIP$ m,A$ CY0$ l")#L$ lY0$ @&)$ m@0$ m,A$ Ck$ ?#X$ <?'G$ %!$ [ILLM-\$ %?'L"928V">,;,>$ L"#"$ 8,*"#>,#L$ Z=$ 8,DBK$ V*?8A,X$ FBK$ >)AV*"U"X$ ^,9&$ ;)*?9"2A)X,;,"X$ V)*=["9&=*"#,A,#"\P$ i! @(',0(..#/!5#.#-$#$./40!55J25J5P$ m,A$CY0$l")#L$lY0$l)"$@d$?#X$<?'G$%!$[ILLMG\$T)*?9"$'">"V9)'$ A"X,?9"X$,#9'?>"**:*?'$V')9",#$X"*,M"'=$:8,#L$<__2<`!2Td_$ >)#a:L?9"P$i!@(',0(..#/!5#.#-$#$./J0$65I26J4P$ m,'8>&Z"'L$ %K0$ -?#F":8"#$ @_0$ D)9&Z?'X$ l+0$ f?#L$ ($ ?#X$ k"#X"'$ <K$ [ILLY\$ K'L,#,#"2Z?8"X$ A)*">:*?'$ 9'?#8V)'9"'8O$ %&"$ 8=#9&"8,8$ ?#X$ >&"A,>?*$ "M?*:?9,)#$ );$ '"*"?8?Z*"$ 9?U)*2 9'?#8V)'9"'$>)#a:L?9"8P$g0&!;#,,$I0$J4I32J465P$ m,9)M$ <7$ ?#X$ +:#X*"$ FD$ [ILLY\$ d#$ 9&"$ #?9:'"$ );$ 9&"$ A:*9,M?*"#>=$ ";;">9O$ K$ 9&"'A)X=#?A,>$ A)X"*P$ i! 73! @A#3! 9(+!.5I0$.651.2.65c4P$ m)a,A?$ @0$ m)#)$ m0$ (?':=?A?$ m$ ?#X$ %?G?L,8&,$ %$ [ILLL\$ C=#9&"8,8$ );$ V)*=?A,X)?A,#"$ X"#X',A"'8$ &?M,#L$ V)*=["9&=*"#"$ L*=>)*\$ L'?;98$ ?#X$ 9&",'$ ?Z,*,9=$ 9)$ "#>?V8:*?9"$ ?#9,>?#>"'$X':L8P$a%(+('U*&-,#!@A#3$..0$3./23.1P$ m)#X?$CF0$K'";$(0$k?#L$C0$+'">&Z,"*$($?#X$k,"#"'$`@$[ILLO\$ CV">,;,>$9?'L"9,#L$);$;)*?9"2X"#X',A"'$(D7$>)#9'?89$?L"#98$9)$ 9&"$ &,L&$ ?;;,#,9=$ ;)*?9"$ '">"V9)'$ "UV'"88"X$ ,#$ )M?',?#$ 9:A)'$ U"#)L'?;98P$ C-&'! 5#$('! C-,#0! EA2$! a%(.! C#/$ .50$ ./42 ..JP$

5#)#0#'+#$! K#9)#=$ K@$ [ILLZ\$ T)*?9"$ '">"V9)'8O$ '";*">9,)#8$ )#$ ?$ V"'8)#?*$ )X=88"=$ ?#X$ ?$ V"'8V">9,M"$ )#$ :#;)*X,#L$ 9':9&P$ 7/4! "0*&! "#.%4#02!5#4$I60$./I32./66P$ K')#)M$ d0$ Y)')^,9]$ K%0$ !?Z,])#$ K$ ?#X$ !,Z8)#$ F$ [ILLY\$ T)*?9"29?'L"9"X$ <`!$ ?8$ ?$ V)9"#9,?*$ >?'',"'$ ;)'$ >?'Z)V*?9,#$ ?#?*)L8P$C=#9&"8,8$?#X$,#$M,9')$89:X,"8P$a%(+('U*&-,#!@A#3$ .40$I6J2I14P$ K8&^"**$!$?#X$Y?';)'X$l$[O\JI\$@?'Z)&=X'?9"28V">,;,>$'">"V9)'8$ );$9&"$*,M"'P$7''*!5#4!a%(+A#3$I.0$IJ.2II4P$ +?'9&$ DT0$ KX?A8$ F(0$ C)*)^?=$ KY0$ K*?A$ T$ ?#X$ F?'Z=$ (-$ [O\\Z\$ +)'?9"X$ 89?'Z:'89$ X"#X',A"'82A)#)>*)#?*$ ?#9,Z)X=$ ,AA:#)>)#a:L?9"8O$"M?*:?9,)#$?8$?$V)9"#9,?*$X"*,M"'=$8=89"A$ ;)'$#":9')#$>?V9:'"$9&"'?V=P$a%(+('U*&-,#!@A#3$I0$Ic266P$ +""]"'$K`0$m,#L$KCY0$(?'9,#$7m0$(,9>&"*$l@0$%^=A?#$_l$?#X$ k?,#$ @T$ [ILLY\$ F"#X',A"'8$ ?8$ V)9"#9,?*$ X':L$ >?'',"'8R$ "#>?V8:*?9,)#$ );$ ?>,X,>$ &=X')V&)Z"8$ ^,9&,#$ ^?9"'$ 8)*:Z*"$ <K(K($X"',M?9,M"8P$>#,0-A#/0('!I30$Jc1J2Jcc/P$ +&?X'?$ F0$ f?X?M$ Km0$ +&?X'?0$ C$ ?#X$ l?,#$ Bm$ [ILLM\$ !*=>)X"#X',A"',>$ #?#)V?'9,>:*?9"$ >?'',"'8$ );$ V',A?e:,#"$ V&)8V&?9"$;)'$*,M"'$9?'L"9,#LP$T',!i!EA-03$53I0$55.25JJP$ +,"*,#8G?$Kr0$@&"#$@_0$l)&#8)#$l$?#X$+?G"'$lD0$l'$[O\\\\$FBK$ >)AV*"U,#L$ ^,9&$ V)*=?A,X)?A,#"$ X"#X',A"'8O$ 7AV*,>?9,)#8$ ;)'$9'?#8;">9,)#P!a%(+('U*&-,#!@A#3!./0$c4J2cI/P$ +)?8$r$?#X$Y""L??'X$<(Y$[ILLZ\$F"#X',A"'8$,#$X':L$'"8"?'>&P$ @A#3!9(+!5#4$JJ0$4J26J$?#X$'";"'"#>"8$>,9"X$9&"'",#P$ +)L?#$ (l$ ?#X$ KL#"8$ !D$ [ILLI\$ <)*=["9&=*"#"$ L*=>)*\$ X):Z*=$ ?#X$8,#L*=$>?9,)#,]"X$Z=$X,;;"'"#9$?*G?*,$A"9?*$,)#8O$D"*?9,M"$ >?9,)#$ ?;;,#,9,"8$ ?#X$ >?9,)#2X"V"#X"#9$ '"8)*:9,)#$ ,#$ ?$ e:?X':V)*"$ ,)#$ 9'?V$ A?88$ 8V">9')A"9"'P$ i! 73! 9(+! C-$$! 91#+,0$.J0$.112.c6$?#X$'";"'"#>"8$>,9"X$9&"'",#P$ +))A"'$ lK0$ 7#"')^,>]$ YF0$ v&?#L$ vf0$ +"'L89'?#X$ B0$ `X^?'X8$ m0$m,A$l($?#X$%&)AV8)#$FY$[ILLY\$K>,X29',LL"'"X$'"*"?8"$ ;')A$ 89"',>?**=$ 89?Z,*,]"X$ ;:8)L"#,>$ *,V)8)A"8$ M,?$ ?$ &=X')*=9,>$X"<`!=*?9,)#$89'?9"L=P$;-'&3*%0$.30$64/c264.I$ ?#X$'";"'"#>"8$>,9"X$9&"'",#P$ +)8A?#$ Kk0$ l?#88"#$ Y($ ?#X$ (",a"'$ `k! [O\\\\! KZ):9$ F"#X',A"'8O$C9':>9:'"0$<&=8,>?*$<')V"'9,"80$?#X$KVV*,>?9,)#8P$ @A#3!5#4!330$.66I2.6ccP$ +')^#$ (F0$ C>&x9]*",#$ K!$ ?#X$ r>&"LZ:$ 7T$ [ILLO\$ !"#"$ X"*,M"'=$^,9&$8=#9&"9,>$[#)#$M,'?*\$>?'',"'8P$T',!i!EA-03$5530$ .25.P$ @&),$ lC0$ B?A$ m0$ <?'G$ l0$ m,A$ l+0$ _""$ lm$ ?#X$ <?'G$ l$ [ILLZ\$ `#&?#>"X$ 9'?#8;">9,)#$ ";;,>,"#>=$ );$ <K(K($ X"#X',A"'$ Z=$ 8:';?>"$ A)X,;,>?9,)#$ ^,9&$ _2?'L,#,#"P$ i! @(',0(..#/! 5#.#-$#$ 330!44I24I6P$ @))V"'$!($[O\\[\$%&"$@"**$C:';?>"0$,#O$%&"$@"**P$K$()*">:*?'$ KVV')?>&0$KC($<'"880$k?8&,#L9)#$F@0$411P$ @')8?88)$<0$@"':9,$(0$+':8?$<0$K'V,>>)$C0$F)8,)$T$?#X$@?99"*$_$ [ILLL\! <'"V?'?9,)#0$ >&?'?>9"',]?9,)#$ ?#X$ V')V"'9,"8$ );$ 89"',>?**=$ 89?Z,*,]"X$ V?>*,9?U"*2>)#9?,#,#L$ *,V)8)A"8P! i! @(',0(..#/!5#.#-$#!6J0$.32J/P$ F?:9=$ `0$ D"A=$ lC0$ v:Z"'$ !$ ?#X$ +"&'$ l<$ [ILLI\$ 7#9'?>"**:*?'$ X"*,M"'=$);$#?#)A"9',>$FBK$V?'9,>*"8$M,?$9&"$;)*?9"$'">"V9)'P$ a%(+('U*&-,#!@A#3$.J0$cJ.2cJ3P$ F"$l"828$d_<0$7&'"$YD0$!?L#"$_0$T'i>&"9$l(l$?#X$C])G?$T@0$l'$ [ILLI\$ <)*="89"'$ X"#X',9,>$ 8=89"A8$ ;)'$ X':L$ X"*,M"'=$ ?VV*,>?9,)#8O$ 7#$ M,9')$ ?#X$ ,#$ M,M)$ "M?*:?9,)#P$ a%(+('U*&-,#! @A#3$.J0!4IJ246.P$ F"##,L$ l$ ?#X$ F:#>?#$ `$ [ILLI\$ !"#"$ 9'?#8;"'$ ,#9)$ ":G?'=)9,>$ >"**8$ :8,#L$ ?>9,M?9"X$ V)*=?A,X)?A,#"$ X"#X',A"'8P$ 5#4! C(.! a%(,#+A'(.$3/0$JJ32J41P$ F:Zi$ F0$ T'?#>,8$ (0$ _"'):U$ l@$ ?#X$ k,##,G$ T($ [ILLI\$ <'"V?'?9,)#$ ?#X$ 9:A)'$ >"**$ :V9?G"$ );$ V)*=[B2 ,8)V')V=*?>'=*?A,X"\$;)*?9"$>)#a:L?9"8P$a%(+('U*&-,#!@A#3$ .J0$6cI2635P$

35$

!"#"$%&"'()*$(#+$,-."/0.('$12-.-3*$4-.$567$)(3"$FA$ ! m)#)$ m0$ _,:$ (l$ ?#X$ T'i>&"9$ l(l$ [O\\\\$ F"8,L#$ );$ X"#X',9,>$ A?>')A)*">:*"8$ >)#9?,#,#L$ ;)*?9"$ )'$ A"9&)9'"U?9"$ '"8,X:"8P$ a%(+('U*&-,#!@A#3$./0$...I2..5.P$ m'xA"'$(0$C9:AZi$l2T0$%h'G$Y0$m'?:8"$C0$m)AV$K0$F"*,#"?:$_0$ <')G&)')M?$ C0$ m?:9]$ Y$ ?#X$ Y??L$ D$ [ILLI\$ VY2D"8V)#8,M"$ A)*">:*?'$ #?#)>?'',"'8$ Z?8"X$ )#$ X"#X',9,>$ >)'"28&"**$ ?'>&,9">9:'"8P$7'&#6!@A#3:!T',!h/!4.045I5245I6P$ _?G)^,>]$lD$[.3cJ\$,#O$<',#>,V*"8$);$T*:)'"8>"#>"$CV">9')8>)V=P$ <*"#:A$<'"880$B"^$f)'G$?#X$_)#X)#0$cP$ _?8,>$ FF$ ?#X$ B""X&?A$ F$ [O\\M\$ %&"$ ••C9"?*9&••$ *,V)8)A"O$ K$ V')9)9=V,>?*$ Z,)A?9"',?*P$ @A#3! 5#4$ 3I0$ 56/.2565c$ ?#X$ '";"'"#>"8$>,9"X$9&"'",#P$ _""$Dl$?#X$_)^$<C$[O\\M\$T)*?9"2A"X,?9"X$9:A)'2>"**$9?'L"9,#L$ );$ *,V)8)A"2"#9'?VV"X$ X)U)':Z,>,#$ ,#$ M,9')P$ a%(+A%3! a%(1A2$!7+,-$.5JJ0$.J42.44P$ _""$ Dl$ ?#X$ Y:?#L$ _$ [O\\Q\$ T)*?9"29?'L"9"X0$ ?#,)#,>$ *,V)8)A"2 "#9'?VV"X$V)*=*=8,#"2>)#X"#8"X$FBK$;)'$9:A)'$>"**28V">,;,>$ L"#"$9'?#8;"'P$i!a%(.!@A#3$51.0$c4c.2c4c1P$ _""$ lY0$ _,A$ f+0$ @&),$ lC0$ _""$ f0$ m,A$ %70$ m,A$ Yl0$ f))#$ lm0$ m,A$ m$ ?#X$ <?'G$ lC$ [ILLY\$ <)*=V*"U"8$ ?88"AZ*"X$ ^,9&$ ,#9"'#?**=$ e:?9"'#,]"X$ <K(K(2dY$ X"#X',A"'$ ?#X$ V*?8A,X$ FBK$ &?M"$ ?$ #":9'?*$ 8:';?>"$ ?#X$ L"#"$ X"*,M"'=$ V)9"#>=P$ a%(+('U*&-,#!@A#3$.40$.5.42.55.P$ _,$ C$ ?#X$ Y:?#L$ _$ [ILLL\$ B)#M,'?*$ L"#"$ 9&"'?V=O$ V')A,8"8$ ?#X$ >&?**"#L"8P$c#'#!>A#0$10$J.2J4P$ _,>>,?'X,$ (0$ %?#L$ f0$ +,**,#L&?A$ B@$ ?#X$ K'A"8$ C<$ [ILLM\$ C=#9&"8,8$ );$ #)M"*$ ;)*,>$ ?>,X2;:#>9,)#?*,]"X$ Z,)>)AV?9,Z*"$ Z*)>G$>)V)*=A"'8$Z=$?9)A$9'?#8;"'$'?X,>?*$V)*=A"',]?9,)#$;)'$ L"#"$ X"*,M"'=$ ?#X$ "#>?V8:*?9,)#$ );$ &=X')V&)Z,>$ X':L8P$ a%(3-+0(3(.#+*.#$$60$./cI2./36P$ _,:$ (l$ ?#X$ T'i>&"9$ l(l$ [O\\\\$ F"8,L#,#L$ X"#X',A"'8$ ;)'$ X':L$ X"*,M"'=P!EA-03!9+%!>#+A'(.!>(/-2!50$J3J24/.P$ _,:$ (l0$ m)#)$ m$ ?#X$ T'i>&"9$ l(l$ [O\\\\! k?9"'28)*:Z*"$ X"#X',A"'2V)*=["9&=*"#"$ L*=>)*\$ 89?'*,G"$ >)#a:L?9"8$ ?8$ V)9"#9,?*$X':L$>?'',"'8P!i!E(.23!9+%:!E-0,!7H!E(.23!@A#3$ J10$J4352JI/JP$ _,:$(l0$m)#)$m$?#X$T'i>&"9$l(l$[ILLL\$k?9"'28)*:Z*"$X"#X',9,>$ :#,A)*">:*?'$ A,>"**"8O$ %&",'$ V)9"#9,?*$ ?8$ X':L$ X"*,M"'=$ ?L"#98P!i!@(',0(..#/!5#.#-$#$6I0$.5.2.J.P$ _)X,8&$Y0$+"'G$K0$v,V:'8G=$C_0$(?98:X?,'?$<0$+?*9,A)'"$F$?#X$ F?'#"**$l$[ILLL\$7#9"L'?9,#L$@"**8$,#9)$%,88:"80$,#O$_)X,8&$70$ Y?'M"=$TP$[`X8\P$()*">:*?'$@"**$+,)*)L=P!T'""A?#$kY$?#X$ @)AV?#=0$B"^$f)'G0$36cP$ _)9]"$(%$?#X$m)89$%K$[ILLI\$-,':8"8$?8$L"#"$X"*,M"'=$M">9)'8O$ KVV*,>?9,)#$ 9)$ L"#"$ ;:#>9,)#0$ 9?'L"9$ M?*,X?9,)#0$ ?#X$ ?88?=$ X"M"*)VA"#9P$@-'+#0!c#'#!>A#0$30$6352633P$ _:)$ F0$ Y?M"'89,>G$ m0$ +"*>&"M?$ B0$ Y?#$ `$ ?#X$ C?*9]A?#$ k($ [ILLI\$<)*=["9&=*"#"$L*=>)*\2>)#a:L?9"X$<K(K($X"#X',A"'$ ;)'$ Z,)>)AV?9,Z*"0$ &,L&2";;,>,"#>=$ FBK$ X"*,M"'=P$ C-+0(3(.#+*.#$$JI0$J4I62J465P$ (?*,G$ B0$ k,^?99?#?V?9?V""$ D0$ m*)V8>&$ D0$ _)'"#]$ m0$ T'"=$ Y0$ k""#"'$ lk0$ (",a"'$ `k0$ <?:*:8$ k$ ?#X$ F:#>?#$ D$ [ILLL\$ F"#X',A"'8O$ D"*?9,)#8&,V$ Z"9^""#$ 89':>9:'"$ ?#X$ Z,)>)AV?9,Z,*,9=$ ,#$ M,9')0$ ?#X$ V'"*,A,#?'=$ 89:X,"8$ )#$ 9&"$ Z,)X,89',Z:9,)#$ );$ .5I72*?Z"**"X$ V)*=?A,X)?A,#"$ X"#X',A"'8$ ,#$M,M)P$i!@(',0(..#/!5#.#-$#$6I0$.JJ2.4cP$ (?AA"#$ (0$ @&),$ C$ ?#X$ k&,9"8,X"8$ !($ [O\\J\$ <)*=M?*"#9$ 7#9"'?>9,)#8$ ,#$ +,)*)L,>?*$ C=89"A8O$ 7AV*,>?9,)#8$ ;)'$ F"8,L#$ ?#X$ r8"$ );$ (:*9,M?*"#9$ _,L?#X8$ ?#X$ 7#&,Z,9)'8P$ 7'&#6! @A#3:!T',!h/!J10$51I425134P$ ()>?#:$`-$?#X$Y?'',8)#$DT$[ILLZ\$%?A)U,;"#$,#$L=#?">)*)L=P$ 5#4!c2'-#+(.!E0-+,%+#$40$J124IP$ B""X&?A$ F$ ?#X$ m,A$ FY$ [ILLL\$ <`!2>)M"'"X$ *,V,X$ 8:';?>"8O$ Z,*?="'8$?#X$A)#)*?="'8P!@(..(%/$!9*0)!a$.c0$.cJ2.3IP$ B"^G)A"$!D0$())'";,"*X$@B$?#X$-jL9*"$T$[ILLO\$F"#X',A"'8$ ?#X$ F"#X')#8P$ @)#>"V980$ C=#9&"8"80$ <"'8V">9,M"8P$ k,*"=2 -@Y0$k",#&",A0$!"'A?#=0$?#X$'";"'"#>"8$>,9"X$9&"'",#P$

B,8&,G?^?$ ($ ?#X$ Y:?#L$ _$ [ILLO\$ B)#M,'?*$ M">9)'8$ ,#$ 9&"$ #"^$ A,**"##,:AO$ F"*,M"'=$ Z?'',"'8$ ,#$ L"#"$ 9'?#8;"'P$ f*3! c#'#! >A#0$.50$c6.2c1/P$ B)VV*2C,A8)#$ FK$ ?#X$ B""X&?A$ F$ [O\\Q\$ KM,X,#2Z,)9,#$ ,#9"'?>9,)#8$ ?9$ M"8,>*"$ 8:';?>"8O$ KX8)'V9,)#$ ?#X$ Z,#X,#L0$ >')882Z',XL"$ ;)'A?9,)#0$ ?#X$ *?9"'?*$ ,#9"'?>9,)#8P! a%(1A2$! i$ 1/0$.J3.2.4/.P$ d&8?G,$ (0$ dG:X?$ %0$ k?X?$ K0$ Y,'?=?A?$ %0$ B,,X)A"$ %$ ?#X$ K)=?L,$ Y$ [ILLI\$ 7#$ M,9')$ L"#"$ 9'?#8;">9,)#$ :8,#L$ X"#X',9,>$ V)*=[_2*=8,#"\P!a%(+('U*&-,#!@A#3$.J0$I./2I.1P$ d#X?$ (0$ f)8&,&?'?$ m0$ m)=?#)$ Y0$ K',L?$ m$ ?#X$ m:#,9?G"$ %$ [O\\Q\$ ()*">:*?'$ '">)L#,9,)#$ );$ #:>*")9,X"8$ Z=$ 9&"$ L:?#,X,#,:A$ :#,9$ ?9$ 9&"$ 8:';?>"$ );$ ?e:"):8$ A,>"**"8$ ?#X$ Z,*?="'8P$ K$ >)AV?',8)#$ );$ A,>')8>)V,>$ ?#X$ A?>')8>)V,>$ ,#9"';?>"8P!i!73!@A#3!9(+$..c0$cI542cIJ/P$ <?*")8$ @(0$ %8,):'M?8$ F0$ C,X"'?9):$ v$ ?#X$ %],M"*"G?$ _$ [ILLZ\$ K>,X2$ ?#X$ 8?*929',LL"'"X$ A:*9,;:#>9,)#?*$ V)*=[V')V=*"#"$ ,A,#"\$ X"#X',A"'$ ?8$ ?$ V')8V">9,M"$ X':L$ X"*,M"'=$ 8=89"AP! a%(3-+0(3(.#+*.#$$I0$I542I53P$ <?#9)8$ K0$ %8,):'M?8$ F0$ C,X"'?9):$ v$ ?#X$ <?*")8$ @($ [ILLZ\$ 7#9"'?>9,)#8$ );$ >)AV*"A"#9?'=$ <`!=*?9"X$ *,V)8)A"8$ ?#X$ >&?'?>9"',]?9,)#$ );$ 9&"$ '"8:*9,#L$ ?LL'"L?9"8P! ;-'&3*%0! 5/0$ 6.6I26.15P$ <?#9)8$ K0$ %8,):'M?8$ F0$ B):#"8,8$ !$ ?#X$ <?*")8$ @($ [ILLM\$ 7#9"'?>9,)#$ );$ T:#>9,)#?*$ F"#X',A"'8$ ^,9&$ (:*9,*?A"**?'$ _,V)8)A"8O$ F"8,L#$ );$ ?$ ()X"*$ C=89"A$ ;)'$ C9:X=,#L$ F':L$ F"*,M"'=P$;-'&3*%0$5.0$14cJ2143/P$ D)Z"'98$ (l0$ +"#9*"=$ (F$ ?#X$ Y?'',8$ l($ [ILLI\! @&"A,89'=$ ;)'$ V"V9,X"$?#X$V')9",#$<`!=*?9,)#P!7/4!"0*&!"#.%4#02!5#4$I40$ 4I32416P$ D)9&Z?'X$ l+0$ !?'*,#L9)#$ C0$ _,#$ g0$ m,'8>&Z"'L$ %0$ m'",X"'$ `0$ (>!'?#"$ <_0$ k"#X"'$ <K$ ?#X$ m&?M?',$ <K$ [ILLL\$ @)#a:L?9,)#$ );$ ?'L,#,#"$ )*,L)A"'8$ 9)$ >=>*)8V)',#$ K$ ;?>,*,9?9"8$ 9)V,>?*$ X"*,M"'=$ ?#X$ ,#&,Z,9,)#$ );$ ,#;*?AA?9,)#P$ K-,*0#!C#/$60$.5IJ2.5I1P$ C?Z&?'?#a?G$ C$ ?#X$ (?=)'$ C$ [ILLZ\$ T)*?9"$ '">"V9)'$ "#X)>=9)8,8$ ?#X$9'?;;,>G,#LP$7/4!"0*&!"#.%4#02!5#4$I60$./332../3P$ C>&*h9"'$ KF$ ?#X$ D?Z"$ l<$ [ILLL\$ F"#X')#,]"X$ <)*=A"'8O$ C=#9&"8,80$ @&?'?>9"',]?9,)#0$ K88"AZ*=$ ?9$ 7#9"';?>"80$ ?#X$ (?#,V:*?9,)#P$7'&#6!@A#3:!T',!h/$J30$c642ccJP$ C&:G*?$C0$k:$!0$@&?99"'a""$(0$f?#L$k_0$C"G,X)$(0$F,)V$_K0$ (:**"'$ D0$ C:X,A?>G$ ll0$ _""$ Dl0$ +?'9&$ DT$ ?#X$ %a?'G8$ k$ [ILLY\$C=#9&"8,8$?#X$Z,)*)L,>?*$"M?*:?9,)#$);$;)*?9"$'">"V9)'2 9?'L"9"X$ Z)')#?9"X$ <K(K($ X"#X',A"'8$ ?8$ V)9"#9,?*$ ?L"#98$ ;)'$ #":9')#$ >?V9:'"$ 9&"'?V=P$ a%(+('U*&-,#! @A#3$ .40! .Ic2 .61P$ C,X"'?9):$ v0$ %8,):'M?8$ F$ ?#X$ <?*")8$ @($ [ILLL\$ g:?9"'#,]"X$ V)*=[V')V=*"#"$ ,A,#"\$ X"#X',A"'8$ ?8$ #)M"*$ VY28"#8,9,M"$ >)#9')**"X2'"*"?8"$8=89"A8P$;-'&3*%0$.60$.1662.163P$ C,X"'?9):$ v0$ %8,):'M?8$ F$ ?#X$ <?*")8$ @($ [ILLO\$ C)*:Z,*,]?9,)#$ ?#X$ '"*"?8"$ V')V"'9,"8$ );$ <`!=*?9"X$ X,?A,#)Z:9?#"$ V)*=[V')V=*"#"$ ,A,#"\$ X"#X',A"'8P$ i! @(..(%/! T',#0)-+#! 9+%$ 5450$5152516P$ C,"L"'8$ @0$ +,"8?*8G,$ ($ ?#X$ Y??L$ D$ [ILLZ\$ C"*;2?88"AZ*"X$ A)#)*?="'8$);$X"#X',9,>$V)*=L*=>"')*$X"',M?9,M"8$)#$L)*X$9&?9$ '"8,89$9&"$?X8)'V9,)#$);$V')9",#8P$@A#3!h*0!i!./0$5cJ.25cJcP$ C,*M?#X"'$ (0$ Y?#88)#$ <$ ?#X$ `X^?'X8$ m$ [ILLL\$ _,V)8)A?*$ 8:';?>"$ V)9"#9,?*$ ?#X$ Z,*?="'$ V?>G,#L$ ?8$ ?;;">9"X$ Z=$ <`!2 *,V,X$,#>*:8,)#P$;-'&3*%0$.60$J6362J1/5P$ C9,',Z?$ C2`0$ T'"=$ Y$ ?#X$ Y??L$ D$ [ILLI\$ F"#X',9,>$ <)*=A"'8$ ,#$ +,)A"X,>?*$ KVV*,>?9,)#8O$ T')A$ <)9"#9,?*$ 9)$ @*,#,>?*$ r8"$ ,#$ F,?L#)89,>8$ ?#X$ %&"'?V=P$ 7'&#6! @A#3:! T',! h/$ 4.0! .J532 .JJ4P$ C:X,A?>G$ l$ ?#X$ _""$ Dl$ [ILLL\$ %?'L"9"X$ X':L$ X"*,M"'=$ M,?$ 9&"$ ;)*?9"$'">"V9)'P$7/4!"0*&!"#.%4#02!5#4!4.0$.412.65P$ C:#X"'$ K0$ m'xA"'$ (0$ Y?#8"*A?##$ D0$ (h&*?:V9$ D$ ?#X$ T'"=$ Y$ [O\\\-\$ ()*">:*?'$ B?#)>?V8:*"8$ +?8"X$ )#$ KAV&,V&,*,>$

3J$

92+"'(:-0$":$(.;$<"#+'2:2/$)-.*="'>$?-'$()).2/(:2-#$(>$+'03$(#+$3"#"$+".2@"'*$>*>:"=>$ ! k?#L$ @Y$ ?#X$ Y8,:"$ !Y$ [ILLM\$ <)*=A"'2FBK$ &=Z',X$ #?#)V?'9,>*"8$ Z?8"X$ )#$ ;)*?9"2V)*="9&=*"#,A,#"2Z*)>G2 V)*=[_2*?>9,X"\P$a%(+('U*&-,#!@A#3$.60$J3.2J36P$ k"#X"'$<K0$(,9>&"**$Fl0$<?99?Z,'?A?#$m0$<"*G"=$`%0$C9",#A?#$ _$ ?#X$ D)9&Z?'X$ l+$ [ILLL\$ %&"$ X"8,L#0$ 8=#9&"8,80$ ?#X$ "M?*:?9,)#$ );$ A)*">:*"8$ 9&?9$ "#?Z*"$ )'$ "#&?#>"$ >"**:*?'$ :V9?G"O$<"V9),X$A)*">:*?'$9'?#8V)'9"'8P$E0(+!K-,.!7+-/!9+%! j97$310$.J//J2.J//cP$ k,8"A?#$ Y$ [O\\Z\$ %?A)U,;"#2#"^$ A"AZ'?#"2A"X,?9"X$ A">&?#,8A8$ );$ ?>9,)#$ ?#X$ 9&"'?V":9,>$ ?XM?#>"8P$ >0#'/$! EA-03-+(.!9+%!.I0$cJ2c3P$ f?#L$ k_0$ +?'9&$ DT0$ KX?A8$ F($ ?#X$ C)*)^?=$ KY$ [O\\[\$ 7#9'?9:A)'?*$ X"*,M"'=$ );$ Z)')#?9"X$ "V,X"'A?*$ L')^9&$ ;?>9)'$ ;)'$#":9')#$>?V9:'"$9&"'?V=$);$Z'?,#$9:A)'8P$@-'+#0!5#$$I10$ 4JJJ24JJ3P$ f))$ YC$ ?#X$ <?'G$ %!$ [ILLZ\$ T)*?9"$ '">"V9)'$ 9?'L"9"X$ Z,)X"L'?X?Z*"$V)*=A"',>$X)U)':Z,>,#$A,>"**"8P$i!@(',0(..#/! 5#.#-$#$360$51J25cJP$ v,#8"*A"="'$ +Y0$ (?>G?=$ C<0$ C>&?9]*",#$ K!$ ?#X$ r>&"LZ:$ 7T$ [ILLI\$ %&"$ *)^"'2L"#"'?9,)#$ V)*=V')V=*"#,A,#"$ X"#X',A"'8$ ?'"$";;">9,M"$L"#"29'?#8;"'$?L"#98P$EA-03!5#$$.30$36/2361P$ v:Z"'$ !0$ v?AA:9279?*,?#)$ _0$ F?:9=$ `$ ?#X$ +"&'$ l<$ RILLYS$ %?'L"9"X$!"#"$F"*,M"'=$9)$@?#>"'$@"**8O$F,'">9"X$K88"AZ*=$ );$ B?#)A"9',>$ FBK$ <?'9,>*"8$ @)?9"X$ ^,9&$ T)*,>$ K>,XP$ 7'&#6!@A#3:$T',!h/$450$566625663P$ $

Y=V"'Z'?#>&"X$ <)*=L*=>"')*8P$ 7'&#6! @A#3:! T',! h/! Jc0$ JII52JIIIP$ C:#X"'$ K0$ g:,#>=$ (2T0$ (h*&?:V9$ D$ ?#X$ T'"=$ Y$ [O\\\G\$ Y=V"'Z'?#>&"X$ <)*="9&"'$ <)*=)*8$ ^,9&$ _,e:,X$ @'=89?**,#"$ <')V"'9,"8P$7'&#6!@A#3:!T',!h/$Jc0$535c253J/P$ C:#X"'$ K0$ (h*&?:V9$ D$ ?#X$ T'"=$ Y$ [ILLL-\$ Y=V"'Z'?#>&"X$ <)*="9&"'2<)*=)*8$+?8"X$)#$<)*=L*=>"')*O$<)*?',9=$F"8,L&$Z=$ +*)>G$ @)V)*=A"',8?9,)#$ ^,9&$ <')V=*"#"$ dU,X"P$ C-+0(3(.#+*.#$$JJ0$J/32J.4P$ C:#X"'$ K0$ (h*&?:V9$ D0$ Y??L$ D$ ?#X$ T'"=$ Y$ [ILLLG\$ Y=V"'Z'?#>&"X$ V)*="9&"'$ V)*=)*8O$ K$ A)X:*?'$ ?VV')?>&$ 9)$ >)AV*"U$V)*=A"'$?'>&,9">9:'"8P!7/4!C-,#0!.50$5JI25J3P$ %?#L$(b0$D"X"A?##$@%$?#X$C])G?$T@0$l'$[O\\Q\$7#$M,9')$L"#"$ X"*,M"'=$ Z=$ X"L'?X"X$ V)*=?A,X)?A,#"$ X"#X',A"'8P$ a%(+('U*&-,#!@A#3$10$1/J21.4P$ %&)A?8$ lm$ [O\JL\$ D?X,?9,)#2,#X:>"X$ D"?>9,)#8$ ,#$ d'L?#,]"X$ K88"AZ*,"8P$@A#3!5#4$c/0$5cJ2533P$ %)A?*,?$ FK0$ +?G"'$ Y0$ F"^?*X$ l0$ Y?**$ (0$ m?**)8$ !0$ (?'9,#$ C0$ D)">G$ l0$ D=X"'$ l$ ?#X$ CA,9&$ <$ [O\JM\$ K$ #"^$ >*?88$ );$ V)*=A"'8$2$89?'Z:'892X"#X',9,>$A?>')A)*">:*"8P$E(.23!i$.10$ ..12.J5P$ %],M"*"G?$ _2K0$ m)#9)=,?##,$ @0$ C,X"'?9):$ v0$ %8,):'M?8$ F$ ?#X$ <?*")8$ @($ [ILLQ\$ B)M"*$ ;:#>9,)#?*$ Y=V"'Z'?#>&"X$ <)*="9&"'$ <)*=)*8$ ?8$ <')8V">9"X$ F':L$ F"*,M"'=$ C=89"A8P$ C-+0(3(.!a%($+%!60$.6.2.63P$ -?#X"'A":*"#$ !k($ ?#X$ m*)G$ Y2K$ [ILLZ\! <"V9,X"oV')9",#$ &=Z',X$ A?9"',?*8O$ `#&?#>"X$ >)#9')*$ );$ 89':>9:'"$ ?#X$ ,AV')M"X$V"';)'A?#>"$9&'):L&$>)#a:L?9,)#$);$Z,)*)L,>?*$?#X$ 8=#9&"9,>$V)*=A"'8P$C-+0(3(.!a%($+%$40$JcJ2J3cP$ -"'A?$ 7($ ?#X$ C)A,?$ B$ [O\\[\$ !"#"$ 9&"'?V=2V')A,8"80$ V')Z*"A8$?#X$V')8V">98P$K-,*0#$Jc30$5J32545P$ -"')#"8"$ T($ [ILLO\$ <"V9,X"$ ?#X$ V')9",#$ <`!=*?9,)#O$ ?$ '"M,"^$ );$V')Z*"A8$?#X$8)*:9,)#8P$a%(3-,#0%-.$$550$4/I24.1P$ -,M"8$`0$+')X,#$<$?#X$_"Z*":$+$[O\\[\$K$9':#>?9"X$Y7-2.$%?9$ V')9",#$Z?8,>$X)A?,#$'?V,X*=$9'?#8*)>?9"8$9&'):L&$9&"$V*?8A?$ A"AZ'?#"$?#X$?>>:A:*?9"8$,#$9&"$>"**$#:>*":8P$i!a%(.!@A#3! 5150$.6/./2.6/.1P$ -jL9*"$T0$!"89"'A?##$C0$Y"88"$D0$C>&^,"']$Y$?#X$k,#X,8>&P$+$ [ILLL\$ T:#>9,)#?*$ X"#X',A"'8P$ E0(&! E(.23! 9+%$ 5I0$ 3c12 ./4.P$ k?#L$fg0$D?8&,X]?X"&$Y$?#X$!:)$+@$[ILLL\$C9':>9:'?*$";;">98$ )#$ V)*="9&"'$ >?9,)#,]?9,)#$ Z=$ ?*G?*,$ A"9?*$ ,)#8$ ,#$ A?9',U2 ?88,89"X$*?8"'$X"8)'V9,)#o,)#,]?9,)#P$i!73!9(+!C-$$!91#+,0$ ..0$6J3264JP$$

$ @)#89?#9,#)8$(P$<?*")8$ $

34$

Gene Therapy and Molecular Biology Vol 10, page 31 Gene Ther Mol Biol Vol 10, 31-40, 2006

Naturally occurring translational models for development of cancer gene therapy# Review Article

Jaime F. Modiano1,2,3,4,*, Matthew Breen5,11, Susan E. Lana6,7, Nicole Ehrhart6,7, Susan P. Fosmire2,3, Rachael Thomas5, Cristan M. Jubala2,3, Angela R. LameratoKozicki2,3,â&#x20AC; , Eugene J. Ehrhart7,8, Jerome Schaack4,9, Richard C. Duke1,2,4, Gary C. Cutter10 and Donald Bellgrau1,2,4 1

Apoplogic, Inc., Denver, CO, USA Integrated Department of Immunology, University of Colorado at Denver and Health Sciences Center, Denver, CO, USA 3 AMC Cancer Research Center, University of Colorado Cancer Center, Denver, CO, USA 4 Program in Immunology and Immunotherapy, University of Colorado Cancer Center, Denver, CO, USA 5 Department of Molecular Biosciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA 6 Department of Clinical Sciences, Colorado State University, Fort Collins, CO, USA 7 Robert H. and Mary G. Flint Animal Cancer Center, Colorado State University, Fort Collins, CO, USA 8 Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO, USA 9 Department of Microbiology, University of Colorado at Denver and Health Sciences Center, Denver, CO, USA 10 Department of Biostatistics, University of Alabama at Birmingham, Birmingham, AL, USA 11 Center for Comparative Medicine and Translational Research, North Carolina, State Univerisity, Raleigh, NC, USA â&#x20AC; Current address: Department of Medical Sciences, University of Wisconsin, Madison, WI 2

__________________________________________________________________________________ *Correspondence: Jaime F. Modiano, VMD, PhD, Integrated Department of Immunology, University of Colorado at Denver and Health Sciences Center, Diamond Research Bldg., 1600 Pierce Street, Denver CO 80214, USA; Phone: 303-239-3408, Fax: 303-239-3560; Email: Jaime.Modiano@UCHSC.edu Key words: Gene Therapy, Immunotherapy, Fas Ligand, Osteosarcoma, Canine Abbreviations: adenovirus-based Fas ligand, (Ad-FasL); event-free survival, (EFS); Fas ligand, (FasL); insulin growth factor-I, (IGF-I); osteosarcoma, (OS) #

Supported in part by grant P30CA46934 from the National Institutes of Health, and by grants from the Cancer League of Colorado, Inc., the AKC Canine Health Foundation, the Kate Koogler Canine Cancer Fund, Inc., the Starlight Foundation, and the Monfort Family Foundation. Received: 4 October 2005; Accepted: 3 February 2006; electronically published: February 2006

Summary Most cancer deaths occur from metastatic spread of cancer cells. Immunotherapy and gene therapy are appealing modalities to treat cancer, not only because tumors that are resistant to conventional treatment such as radiation and chemotherapy can be treated using immunologic and genetic approaches, but also because these modalities can reach distant metastases and tumors that are inaccessible for conventional treatment. One gene therapy-based immunologic approach that has shown preclinical promise in laboratory animals is the use of Fas ligand (FasL) gene transfer. FasL promotes tumor cell killing directly and indirectly, and it induces reliable antitumor immune responses that protect animals against subsequent tumor challenge. Yet, despite the unquestioned benefits to study mechanistic questions, factors such as size, pharmacokinetic distribution, and route of administration preclude precise extrapolation of safety data from laboratory mice to humans. We have used spontaneous cancers of dogs as intermediaries for translational studies because the size and physiology of dogs, as well as the natural history of homologous tumors in this species resemble those of humans more closely than rodent models created in the laboratory. Here, we use appendicular osteosarcoma (OS) as an example to document clinical and biological

Modiano et al: Canine models for cancer gene therapy similarities between the disease in dogs and humans. Specifically, we underscore the unique properties of this model to develop therapy approaches prior to translation into clinical trials of human cancer patients. Shimizu et al, 2001), which in turn perpetuates the inflammatory response by recruiting additional leukocytes. The adenovirus-mediated expression of FasL is extinguished in <2 weeks because transduced cells are killed as a consequence of the inflammatory response (Regardsoe et al, 2004). Therefore, both mechanisms (Fasmediated apoptosis and inflammation leading to tumor cell death) minimize persistence of FasL in the system, but they also promote specific, protective antitumor immune responses (Modiano et al, 2004). We have thus proposed that FasL gene transfer can be used as a â&#x20AC;&#x153;tumor vaccineâ&#x20AC;? without the need to identify or enrich specific tumor antigens, and have reached a feasibility stage where it is essential to determine the risk-benefit relationships of FasL gene transfer used in an adjuvant therapy setting to treat solid tumors. Among other targets, we propose that adjuvant Ad-FasL therapy has vast potential to improve outcomes of pediatric patients with OS. Dogs with the same disease offer a clinically and biologically relevant model for development.

I. Introduction The utility of preclinical animal models for therapeutic development is dependent on how well they approximate the human disease in question. In the realm of cancer, rodent models are especially powerful to define the impact of single gene abnormalities in disease pathogenesis, and strains that are susceptible to chemical carcinogens are well suited to explore the benefit of interventions for cancer prevention. Conversely, the accelerated growth rate exhibited by many transplantable and inducible tumors in laboratory rodents can make evaluation of therapeutic strategies for pre-existing disease problematic. Cancer in dogs occurs spontaneously. The relative lifetime cancer risk is similar in dogs and in humans, and the shared environment between people and their pet dogs offers opportunities to examine cancer etiology and response to treatment under more realistic conditions. Nevertheless, canine models for therapy development must be chosen with care, not only to properly frame the hypothesis to be tested, but also to reflect the disease under study. Here, we review the strengths of naturally occurring canine osteosarcoma (OS) as a model for preclinical development of Fas ligand (FasL) gene therapy in the adjuvant setting.

III. Comparative aspects of human and canine osteosarcoma OS is an exceptional model for novel therapeutic development, as it meets the following criteria. It is a highly metastatic tumor and patients would benefit from improved treatment options; the disease is relatively common, the tumors can be visualized externally or using imaging, the tumor is responsive to immunotherapy, and both Fas-sensitive and Fas-resistant forms of the tumor occur spontaneously. According to the American Cancer Society, about 2,570 new cases of cancer of the bones and joints will be diagnosed in 2005, and about 1,200 deaths from these cancers are expected (Jemal et al, 2005). OS is the most common among these tumors; it also is the most common type of primary bone cancer in dogs, accounting for up to 85% of skeletal tumors (Dernell et al, 2001) with an annual incidence of 6,000 - >8,000 new cases per year (Withrow et al, 1991; Hansen and Khanna, 2004). Except for the age of clinical onset, the natural history of the disease is similar in people and in dogs (Table 1). The standard-of-care for appendicular OS includes amputation or limb-sparing surgery, followed by adjuvant chemotherapy. In children, this treatment produces an overall survival rate of ~80%, but event-free survival (EFS) is lower, with only ~60% reaching five years and barely 50% reaching 10 years (Bielack et al, 2002). Despite these encouraging facts, 20% of children diagnosed with OS will not survive five years, as many as 50% may not see the tenth anniversary of their diagnosis, and most will have significant morbidity associated with the disease. Clearly, there is need for options that will improve the outcomes of patients with this disease. The timeframe bracketed by these hallmarks in children represents ~10% of an average adult lifetime, which provides a reasonable basis on which to compare clinical outcome with dogs that have bone tumors, where the

II. Fas ligand gene transfer for cancer therapy We recently reviewed mechanistic basis and preclinical data supporting the use of adenovirus-based Fas ligand (Ad-FasL) gene transfer for cancer therapy (Modiano et al, 2004). The fundamental rationale to develop this approach is based on its potential as an adjuvant treatment: the gene is delivered into the tumor environment, where it primes immune effector cells that mediate systemic antitumor immunity. This then leads to destruction of metastatic cells, increasing the likelihood of durable remissions with reduced morbidity of cancer patients. It is especially important to note that Ad-FasL can promote antitumor immunity by two distinct mechanisms, depending on whether or not tumors express Fas receptors and are susceptible to FasL-mediated apoptosis. Specifically, in the context of cancer gene therapy, ectopic FasL promotes Fas-dependent apoptosis of susceptible tumors. In the tumor environment, scavenging of apoptotic cells by antigen presenting cells can lead to cross priming that enhances cytokine production and killing by tumor-specific T cells (Bianco et al, 2003). On the other hand, when expressed in tumors that are resistant to Fas-dependent apoptosis, the ectopic FasL (and possibly the response to the adenovirus vector) initiates robust inflammatory responses that result in tumor cell death. Unmitigated inflammation is seen with transduction of Ad-FasL, probably because of the high levels of local expression achieved with this method. In these conditions, there is extensive apoptosis of neutrophils and macrophages (Hohlbaum et al, 2001; 32

Gene Therapy and Molecular Biology Vol 10, page 33 Table 1. Comparative aspects of human and canine OSa Common recurrent abnormalities are shown in bold, those with prognostic or predictive value shown in red. Clinical Features Age at diagnosis

Human Adolescent (peak at ~15 yr) (Gurney et al, 1999)

Gender-based prevalence Site Phenotype Standard-of-care Median event-free survival Pathogenetic Features Cytogenetics Karyotype

Male ~1.2X

Dog Adult (peak at ~8 yr) (Gorlick et al, 2003; Hansen and Khanna 2004)b Male ~1.5X

Long bones of limb (78%) Aggressive, metastatic (lungs most common) Surgery + adjuvant chemotherapy ~5 yr (<10% of a lifetime)

Long bones of limb (85%) Aggressive, metastatic (lungs most common) Surgery + adjuvant chemotherapy ~9.6 months (<10% of a lifetime)

Numerical abnormalities

• • • • •

Structural abnormalities

• •

Oncogenes MYC, RAS, HDM2/MDM2, CDK4, MDR-1

SIS/PDGFR

• •

•

MET/HGF

• •

HER2/Neu B2)

(ERB-

• • •

IGF1/IGF1R

•

Aneuploid Complex to chaotic (Ozisik et al, 1994; Batanian et al, 2002; Bayani et al, 2003; Gorlick et al, 2003; Lopez-Guerrero et al, 2004) Gains and losses identified in all autosomes and X chromosome Chromosome gains outnumber losses by 20-30% Gain of HSA 19 or loss of HSA 9 predict poor therapy response (Sztan et al, 1997; Friedmann et al, 2002; Gisselsson et al, 2002; Ozaki et al, 2002; Overholtzer et al, 2003; Squire et al, 2003; Lau et al, 2004; Lopez-Guerrero et al, 2004; Man et al, 2004; van Dartel and Hulsebos, 2004; van Dartel et al, 2004; Zielenska et al, 2004) Many chromosomes involved, but disproportionately more frequent with HSA 20 Many centromeric rearrangements (Ozisik et al, 1994; Miller et al, 1996; Lonardo et al, 1997; Pellin et al, 1997; Kanoe et al, 1998; Yokoyama et al, 1998; Gisselsson et al, 2002; Bayani et al, 2003; Overholtzer et al,; Lau et al,)

•

Various rearrangements and centromeric translocations (Thomas et al, 2005)

Amplified, mutated, or overexpressed in small number of OS cases Unknown predictive value or prognostic significance (Nardeux et al, 1987; Ikeda et al, 1989; Barrios et al, 1993; Ladanyi et al, 1993; Antillon-Klussmann et al, 1995; Gamberi et al, 1998; Kanoe et al, 1998; Yokoyama et al, 1998; Ferrari et al, 2004) Expression of PDGF AA (c-sis) and PDGFR associated with progression and decreased DFI (Sulzbacher et al, 2003)

•

Amplified, mutated, or overexpressed in small number of OS cases Unknown predictive value or prognostic significance (Kochevar et al, 1990; Mealey et al, 1998; Mendoza et al, 1998)

Met overexpression associated with metastatic phenotype Allelic imbalance at HSA 7q31 is an independent indicator of poor prognosis (Ferracini et al, 1995; Scotlandi et al, 1996; Naka et al, 1997; Oda et al, 2000; Coltella et al, 2003; Entz-Werle et al, 2003) Conflicting data Amplification/overexpression detectable in 100% of cases using laser microdissection Overexpression associated alternatively with higher metastatic potential and decreased DFI, or with increased DFI in different studies (Akatsuka et al, 2002; Anninga et al, 2004; Fellenberg et al, 2004; Ferrari et al, 2004) IGF-1/IGF-1R co-expressed in ~50% of primary

•

• •

•

• •

•

Aneuploid (Fox et al,; Setoguchi et al,) Complex to chaotic (Thomas et al, 2005) Gains and losses identified in many autosomes (Thomas et al, 2005)

PDGF production, PDGFR expression detected in OS cell lines Low level amplification of c-sis in primary OS cases (Kochevar et al, 1990; Levine, 2002) Met amplification and HGF coexpression; greater in a pulmonary metastasis (Ferracini et al, 1995; MacEwen et al, 2003) MET and HGF BACs involved in structural rearrangements

•

Overexpressed in 4/10 cases of OS and in 6/7 OS cell lines Overexpression showed trend to decreased overall survival (371 days vs. 487 days) (Flint et al, 2004)

•

OncoLAR IGF-1 antagonist reduces

•

Modiano et al: Canine models for cancer gene therapy

• • CTNNB1 catenin)

(ß-

• •

Ezrin

Tumor suppressor genes RB1

•

• • •

OS Inhibition of IGF-1R pathway ineffective to slow growth or induce apoptosis, probably due to other autocrine growth loops OncoLAR IGF-1 antagonist reduces IGF-1 levels but provides no clinical benefit (Burrow et al, 1998; Benini et al, 1999; Mansky et al, 2002) Accumulation of !-catenin in cytoplasm of 33/47 primary OS (Haydon et al,) ß-catenin-induced activation of LEF-1 inhibits Runx2-mediated osteocalcin expression (Kahler and Westendorf, 2003) High Ezrin expression associated with metastatic phenotype and poor prognosis (shorter DFI)(Leonard et al, 2003; Khanna et al, 2004)

Associated with heritable OS In sporadic OS, LOH, allelic imbalance, or mutations in 20-70% of cases Abnormal RB or loss of HSA 13q14 are indicators of poor prognosis (Araki et al, 1991; Scholz et al, 1992; Entz-Werle et al, 2003; Lopez-Guerrero et al, 2004)

IGF-1 levels but provides no clinical benefit (Khanna et al, 2002)

•

Unknown, but osteocalcin is frequently undetectable in our samples of primary OS and OS cell lines

•

High Ezrin expression associated with metastatic phenotype and poor prognosis (shorter DFI) (Khanna et al, 2004)

• •

Variable results Inactivation of Rb, p107, p130 in 1/4 OS lines (Levine and Fleischli, 2000) Expressed in 21/21 primary OS with no detectable structural abnormalities (Mendoza et al, 1998) Undetectable in 12/14 OS lines tested by our group Inactivating mutations in 5/5 OS cell lines and in 8/21 primary OS cases (Mendoza et al, 1998; Levine and Fleischli, 2000)

• •

TP53

CDKN2A (p16, INK4A), PTEN

Death receptors FAS

Associated with heritable risk (Li Fraumeni syndrome) • In sporadic OS, LOH, allelic imbalance, or mutations in 10-80% of cases • Tumors with mutant TP53 have higher level of genomic instability • Abnormal TP53 or loss of HSA17p13 are indicators of poor prognosis (Scholz et al, 1992; Al-Romaih et al, 2003; Entz-Werle et al, 2003; Overholtzer et al, 2003; Squire et al, 2003; Ferrari et al, 2004; Lopez-Guerrero et al, 2004) • Inactivated in 30-100% of OS lines or cases • Unknown predictive value or prognostic significance (Nielsen et al, 1998; Ozaki et al, 2002; Park et al, 2002; Entz-Werle et al, 2003; Nielsen-Preiss et al, 2003)

•

Loss of expression associated with aggressive metastatic phenotype in xenogeneic transplant model (Worth et al, 2002)

•

• •

Inactivated in 5-100% of OS lines or cases Unknown predictive value or prognostic significance (Levine and Fleischli 2000; Levine et al, 2002; Thomas et al, 2005) Loss of expression in ~50% of cases with acquired insensitivity to FasLmediated apoptosis

Only some representative aspects or genes where canine counterparts are known to be affected are shown In an ongoing study including 65 dogs with primary appendicular osteosarcoma, the peak age at diagnosis was 8-9 years (34/65 cases with known age), the 95% confidence interval of the mean was 7.25 – 8.75 years, and the range was 2-14 years. This is similar to previously reported values (Dernell et al, 2001) b

median overall survival in different studies ranged from ~six to ~11 months, with <30% of dogs surviving two years and <10% of dogs surviving three years (Dernell et al, 2001). Since extraneous factors independent of disease can influence overall survival in dogs with OS, a better indicator may be EFS. A recently completed study from one of our research groups (S. Lana et al, unpublished) showed the mean (median) EFS in dogs treated with standard-of-care was 287 (169) days (about 10% of a lifetime). The efficiency of naturally occurring OS in dogs as a model platform for controlled preclinical study is not only

due to higher incidence of the disease in dogs, but also to more rapid progression and apparent similarities in molecular pathogenesis (Table 1). Most OS cases in dogs are stage 2b (they present outside the periosteum, have high grade histologic appearance and no detectable metastases). Metastatic disease occurs in >50% of treated animals within one year and in >90% within three years, and it is greater in the lungs than bone. Predictive factors are similar in dogs and people, including age at diagnosis, anatomic location and size of the tumor, histologic grade, serum alkaline phosphatase concentrations, and initial response to therapy (Ehrhart et al, 1998; Dernell et al, 34

Gene Therapy and Molecular Biology Vol 10, page 35 2001; Malawer et al, 2001; Gorlick et al, 2003). Finally, accrual of dogs into clinical studies is rapid, and autopsy compliance is high. For example, a protocol to examine the role of limb-sparing surgery, chemotherapy, and radiation included eligibility criteria of “localized” disease and <50% bone length involvement (Withrow et al, 1993). Forty-nine dogs were accrued, allowing rapid confirmation that, with appropriate candidate selection, this was a suitable treatment option. Interestingly, dogs with infected limb repairs lived twice as long as dogs without infection, suggesting that inflammation at the tumor site with the consequent activation of the immune system has therapeutic benefit. Another randomized study using the insulin growth factor-I (IGF-I) inhibitor, OncoLar, accrued 64 dogs in just eight months (Khanna et al, 2002). In this case, lack of therapeutic benefit of this compound could be confirmed in less than two years. For comparison, 21 people aged between 16 and 35 years old with advanced OS were recruited into a Phase-I multi-institutional study in three years (Mansky et al, 2002). This dose escalation study was stopped due to lack of drug availability when the manufacturer decided toxicities seemed to outweigh clinical benefit. When one considers the accrual rate and the course of disease progression, it might have taken >10 years to show similar negative results in a clinical trial of newly diagnosed (virgin) OS patients.

studies are also designed to identify dose-limiting toxicity or untoward side effects, dog owners recognize there are risks involved (as is true for any clinical study). If toxic events were to occur, this process makes translation more honest and cost-effective because it allows those to be addressed before a Phase-I clinical trial is instituted in human patients (for example, see the case of OncoLar described above). We have completed preliminary assessments of the suitability to use FasL gene therapy in dogs in vitro and in vivo. We have established >60 cell lines derived from primary canine OS. These cells grow autonomously in tissue culture, and morphologically they resemble other established canine OS cells lines (Levine and Fleischli, 2000; Liao et al, 2005). The primary tumors and OS cell lines show similar molecular profiles to those seen in humans. For example, they tend to be genetically unstable and have “chaotic” karyotypes (Figure 1). We have confirmed the presence of a variety of numerical and structural cytogenetic abnormalities in these tumors, many of which localize to regions that harbor potential oncogenes and tumor suppressor genes (Thomas et al, 2005). In addition, similar gene families seem to be targeted for aberrant expression (activation or silencing) in OS of humans and dogs (Table 1). It is important to remember that a suitable model for FasL gene therapy must provide samples that are susceptible to FasL-mediated apoptosis, as well as samples that are resistant to FasL-mediated apoptosis in order to provide the means to determine if both mechanisms of FasL-induced immune activation provide equivalent clinical benefit, or if case selection would be necessary a priori (Bianco et al, 2003). For this reason, we first examined Fas expression in canine OS cells. As was true for melanoma (Bianco et al, 2003), approximately 50% of canine OS expressed Fas (for example see Figure 2), and in some tumors, we detected anomalous transcripts. Intriguingly, spontaneous metastases of some of the dogs showed loss of Fas expression, suggesting that, as is true in humans with OS (Worth et al, 2002), loss of this pathway might participate in tumor progression and metastasis. Previously, we showed that Fas expression by canine melanoma cells correlated with susceptibility to death mediated by transduction with Ad-FasL (Bianco et al, 2003). To verify if this was also true for canine OS, we examined cell viability in culture after transduction with Ad-FasL or Ad-GFP. Figure 3 shows representative Fas receptor-positive cells (OSCA.36.1) that were susceptible to FasL-mediated cell death, and Fas receptor-negative cells (OSCA2) that were not. The distribution of FasLsensitive and FasL-resistant OS cells from the lines tested so far is almost exactly 50:50. It is therefore crucial to reiterate the importance of this observation, as it establishes canine OS as a suitable model to confirm the findings in mouse models where tumors that are resistant to FasL-mediated apoptosis in vitro are still killed (indirectly) by the inflammation induced by FasL in vivo. Also significant is that canine endothelial cells are highly susceptible to adenovirus infection and are killed by AdFasL. This minimizes concerns of systemic distribution by

IV. Molecular features of canine OS and suitability for FasL gene therapy As noted above, laboratory animal models have a number of limitations that can make translation to humans difficult. Specifically, transplantable tumors or tumors induced by genetic modifications in mice are not always representative of natural tumors. In addition, the homogeneous genetic background in mice strains that can accept tumors (or that develop tumors when exposed to chemicals or when genetic modifications are introduced) do not account for the heterogeneous genetic backgrounds of humans, which can significantly influence tumor progression and response to therapy. Development of better translational models could improve decision-making algorithms to move new therapeutic agents along the development process into clinical trials for human patients. Among all the models available, naturally occurring tumors of dogs present an unparalleled opportunity for use as intermediate steps in the drug development process. Dogs are extensively used in the laboratory setting to define compound safety. However, these controlled conditions still do not approximate the effects that a compound (or a gene) might have in patients that may be debilitated and who may respond differently than healthy individuals. More importantly, cancers of dogs recapitulate the clinical progression of homologous diseases of people, and these animals benefit from participation in clinical studies that can improve their outcome. For studies using canine cancer patients for drug development, safety of the animal “patient” is a major consideration, as the intent is to help these animals in the process of defining a safe (and effective) dose range for the gene therapy that can be translated to humans. Since

Modiano et al: Canine models for cancer gene therapy

Figure 1. “Chaotic” Karyotypes in Canine OS Cells. The images on the left show DAPI stained metaphase spreads and the images on the right show the corresponding inverted DAPI banded preparations. The modal chromosome number in these cells is significantly reduced (2n=34) compared to normal dog cells (2n=78), and most chromosomes are metacentric, compared to the usual acrocentric morphology of normal canine chromosomes. This 'chaotic' cytogenetic appearance is typical for the canine OS samples we have analyzed (Thomas et al, 2005).

Figure 2. Expression of Fas mRNA by Canine OS Cell Lines. Fas expression was examined by RT-PCR in representative canine OS cell lines established from primary tumor explants. Primers were designed to amplify a 146 bp canine Fas mRNA product. Fas-positive TLM-1 canine melanoma cells and Kit-225 human leukemia cells were used as positive controls; dH2O without input RNA (in the PCR reaction) was used as a negative control. Expression of ß-actin was used to verify the integrity of the RNA samples and to control for loading differences. (OSCA = osteosarcoma cell line-AMC).

Gene Therapy and Molecular Biology Vol 10, page 37

Figure 3. Susceptibility of OS cells to Fas-mediated death. OSCA2 (Fas receptor-negative, top) and OSCA36.1 (Fas receptor-positive, bottom) cell lines are shown to represent, respectively, Fas-resistant cells and Fas-sensitive cells. Subconfluent cultures were transduced using 2,000 pfu of Ad-GFP (left) or Ad-FasL (right). After 6 hr, cultures were photographed under phase-contrast microscopy. While OSCA-2 cells showed virtually no effects of transduction with either adenovirus, more than 90% of OSCA-36 cells showed characteristic apoptotic changes (condensed chromatin, rounded morphology, and detachment from the plastic substrate). OSCA-2 cells continued to grow unhindered in the presence of either adenovirus, as did OSCA-36 cells transduced with Ad-GFP. In contrast, no live cells remained after 24 hr from OSCA-36 cells transduced with Ad-FasL.

the adenovirus after intratumoral administration, as it is likely to remain within the tumor environment where reduced blood flow and increased interstitial pressure at the tumor site (Zachos et al, 2001) will retain the Ad-FasL at or near the injection (within the tumor), promoting transduction of malignant osteoblasts, endothelial cells, and tumor stroma. As also noted previously, we conducted a preliminary study to determine the safety of FasL gene therapy in tumor-bearing dogs using naked DNA (Bianco et al, 2003). No local or systemic toxicity was seen in any of the five dogs in that study. However, based on the preclinical data described above, we are more likely to achieve therapeutic efficacy with Ad-FasL. The safety and toxicity benchmarks for this product will use a more refined method of development that will allow for examination of possible efficacy/toxicity trade-offs if any local (or systemic) toxic events were identified due to the greater levels of FasL expression achieved using the adenovirus delivery system.

preclinical drug development. The strength of these models is the spontaneous occurrence of tumors with similar etiology in large animals that (1) are physiologically similar to humans, (2) share our environment, (3) can tolerate repeated sampling, and (4) largely show comparable responses to conventional treatments. The recent completion of the canine genome sequence (Lindblad-Toh et al, 2005) provides the resources needed to assess the conservation of genes and proteins that can serve as targets for tailored or molecular approaches to treat cancer. We predict that increasingly, studies in pet dogs will become a standard component in the development process of novel therapies for cancer and other chronic diseases, and that these studies will streamline the selection process to determine compounds that have higher a likelihood of success for treatment of human patients. Unquestionably, these studies will also benefit the pet population and provide potential new markets for manufacturers of novel drug and gene-based therapeutics.

V. Conclusions Naturally occurring tumors of dogs offer unique models that can complement traditional laboratory rodent models for studies of cancer pathogenesis and for 37

Modiano et al: Canine models for cancer gene therapy Entz-Werle N, Schneider A, Kalifa C, Voegeli AC, Tabone MD, Marec-Berard P, Marcellin L, Pacquement H, Terrier P, Boutard P, Meyer N, Gaub MP, Lutz P, Babin A Oudet P (2003) Genetic alterations in primary osteosarcoma from 54 children and adolescents by targeted allelotyping. Br J Cancer 88, 1925-1931. Fellenberg J, Krauthoff A, Pollandt K, Delling G Parsch D (2004) Evaluation of the predictive value of Her-2/neu gene expression on osteosarcoma therapy in laser-microdissected paraffin-embedded tissue. Lab Invest 84, 113-121. Ferracini R, Angelini P, Cagliero E, Linari A, Martano M, Wunder J Buracco P (2000) MET oncogene aberrant expression in canine osteosarcoma. J Orthop Res 18, 253256. Ferracini R, Di Renzo MF, Scotlandi K, Baldini N, Olivero M, Lollini P, Cremona O, Campanacci M Comoglio PM (1995) The Met/HGF receptor is over-expressed in human osteosarcomas and is activated by either a paracrine or an autocrine circuit. Oncogene 10, 739-749. Ferrari S, Bertoni F, Zanella L, Setola E, Bacchini P, Alberghini M, Versari M Bacci G (2004) Evaluation of P-glycoprotein, HER-2/ErbB-2, p53, and Bcl-2 in primary tumor and metachronous lung metastases in patients with high-grade osteosarcoma. Cancer 100, 1936-1942. Flint AF, U'Ren L, Legare ME, Withrow SJ, Dernell W Hanneman WH (2004) Overexpression of the erbB-2 protooncogene in canine osteosarcoma cell lines and tumors. Vet Pathol 41, 291-296. Fox MH, Armstrong LW, Withrow SJ, Powers BE, LaRue SM, Straw RC Gillette EL (1990) Comparison of DNA aneuploidy of primary and metastatic spontaneous canine osteosarcomas. Cancer Res 50, 6176-6178. Friedmann E, Salzberg Y, Weinberger A, Shaltiel S Gerst JE (2002) YOS9, the putative yeast homolog of a gene amplified in osteosarcomas, is involved in the endoplasmic reticulum (ER)-Golgi transport of GPI-anchored proteins. J Biol Chem 277, 35274-35281. Gamberi G, Benassi MS, Bohling T, Ragazzini P, Molendini L, Sollazzo MR, Pompetti F, Merli M, Magagnoli G, Balladelli A Picci P (1998) C-myc and c-fos in human osteosarcoma: prognostic value of mRNA and protein expression. Oncology 55, 556-563. Gisselsson D, Palsson E, Hoglund M, Domanski H, Mertens F, Pandis N, Sciot R, Dal Cin P, Bridge JA Mandahl N (2002) Differentially amplified chromosome 12 sequences in lowand high-grade osteosarcoma. Genes Chromosomes Cancer 33, 133-140. Gorlick R, Anderson P, Andrulis I, Arndt C, Beardsley GP, Bernstein M, Bridge J, Cheung NK, Dome JS, Ebb D, Gardner T, Gebhardt M, Grier H, Hansen M, Healey J, Helman L, Hock J, Houghton J, Houghton P, Huvos A, Khanna C, Kieran M, Kleinerman E, Ladanyi M, Lau C, Malkin D, Marina N, Meltzer P, Meyers P, Schofield D, Schwartz C, Smith MA, Toretsky J, Tsokos M, Wexler L, Wigginton J, Withrow S, Schoenfeldt M Anderson B (2003) Biology of childhood osteogenic sarcoma and potential targets for therapeutic development: meeting summary. Clin Cancer Res 9, 5442-5453. Gurney JG, Swensen AR Bulterys M (1999). Malignant Bone Tumors. Int Classif Childhood Cancer. NCI SEER Pediatric Monograph. Washington D.C., National Institutes of Health. 8, 1-12. Hansen K Khanna C (2004) Spontaneous and genetically engineered animal models; use in preclinical cancer drug development. Eur J Cancer 40, 858-880. Haydon RC, Deyrup A, Ishikawa A, Heck R, Jiang W, Zhou L, Feng T, King D, Cheng H, Breyer B, Peabody T, Simon MA, Montag AG He TC (2002) Cytoplasmic and/or nuclear

References Akatsuka T, Wada T, Kokai Y, Kawaguchi S, Isu K, Yamashiro K, Yamashita T, Sawada N, Yamawaki S Ishii S (2002) ErbB2 expression is correlated with increased survival of patients with osteosarcoma. Cancer 94, 1397-1404. Al-Romaih K, Bayani J, Vorobyova J, Karaskova J, Park PC, Zielenska M Squire JA (2003) Chromosomal instability in osteosarcoma and its association with centrosome abnormalities. Cancer Genet Cytogenet 144, 91-99. Anninga JK, van de Vijver MJ, Cleton-Jansen AM, Kristel PM, Taminiau AH, Nooij M, Egeler RM Hogendoorn PC (2004) Overexpression of the HER-2 oncogene does not play a role in high-grade osteosarcomas. Eur J Cancer 40, 963-970. Antillon-Klussmann F, Garcia-Delgado M, Villa-Elizaga I Sierrasesumaga L (1995) Mutational activation of ras genes is absent in pediatric osteosarcoma. Cancer Genet Cytogenet 79, 49-53. Araki N, Uchida A, Kimura T, Yoshikawa H, Aoki Y, Ueda T, Takai S, Miki T Ono K (1991) Involvement of the retinoblastoma gene in primary osteosarcomas and other bone and soft-tissue tumors. Clin Orthop 270, 271-277. Barrios C, Castresana JS, Ruiz J Kreicbergs A (1993) Amplification of c-myc oncogene and absence of c-Ha-ras point mutation in human bone sarcoma. J Orthop Res 11, 556-563. Batanian JR, Cavalli LR, Aldosari NM, Ma E, Sotelo-Avila C, Ramos MB, Rone JD, Thorpe CM Haddad BR (2002) Evaluation of paediatric osteosarcomas by classic cytogenetic and CGH analyses. Mol Pathol 55, 389-393. Bayani J, Zielenska M, Pandita A, Al-Romaih K, Karaskova J, Harrison K, Bridge JA, Sorensen P, Thorner P Squire JA (2003) Spectral karyotyping identifies recurrent complex rearrangements of chromosomes 8, 17, and 20 in osteosarcomas. Genes Chromosomes Cancer 36, 7-16. Benini S, Baldini N, Manara MC, Chano T, Serra M, Rizzi S, Lollini PL, Picci P Scotlandi K (1999) Redundancy of autocrine loops in human osteosarcoma cells. Int J Cancer 80, 581-588. Bianco SR, Sun J, Fosmire SP, Hance K, Padilla ML, Ritt MG, Getzy DM, Duke RC, Withrow SJ, Lana S, Matthiesen DT, Dow SW, Bellgrau D, Cutter GR, Helfand SC Modiano JF (2003) Enhancing anti-melanoma immune responses through apoptosis. Cancer Gene Ther 10, 726-736. Bielack SS, Kempf-Bielack B, Delling G, Exner GU, Flege S, Helmke K, Kotz R, Salzer-Kuntschik M, Werner M, Winkelmann W, Zoubek A, Jurgens H Winkler K (2002) Prognostic factors in high-grade osteosarcoma of the extremities or trunk: an analysis of 1,702 patients treated on neoadjuvant cooperative osteosarcoma study group protocols. J Clin Oncol 20, 776-790. Burrow S, Andrulis IL, Pollak M Bell RS (1998) Expression of insulin-like growth factor receptor, IGF-1, and IGF-2 in primary and metastatic osteosarcoma. J Surg Oncol 69, 2127. Coltella N, Manara MC, Cerisano V, Trusolino L, Di Renzo MF, Scotlandi K Ferracini R (2003) Role of the MET/HGF receptor in proliferation and invasive behavior of osteosarcoma. Faseb J 17, 1162-1164. Dernell WS, Straw RC Withrow SJ (2001). Tumors of the skeletal system. Small Animal Clinical Oncology. Withrow SJ and MacEwen EG. Philadelphia, Lippincott Williams & Wilkins,, 378-417. Ehrhart N, Dernell WS, Hoffmann WE, Weigel RM, Powers BE Withrow SJ (1998) Prognostic importance of alkaline phosphatase activity in serum from dogs with appendicular osteosarcoma: 75 cases (1990-1996). J Am Vet Med Assoc 213, 1002-1006.

Gene Therapy and Molecular Biology Vol 10, page 39 accumulation of the beta-catenin protein is a frequent event in human osteosarcoma. Int J Cancer 102, 338-342. Hohlbaum AM, Gregory MS, Ju ST Marshak-Rothstein A (2001) Fas ligand engagement of resident peritoneal macrophages in vivo induces apoptosis and the production of neutrophil chemotactic factors. J Immunol 167, 6217-6224. Ikeda S, Sumii H, Akiyama K, Watanabe S, Ito S, Inoue H, Takechi H, Tanabe G Oda T (1989) Amplification of both cmyc and c-raf-1 oncogenes in a human osteosarcoma. Jpn J Cancer Res 80, 6-9. Jemal A, Murray T, Ward E, Samuels A, Tiwari RC, Ghafoor A, Feuer EJ Thun MJ (2005) Cancer statistics, 2005. CA Cancer J Clin 55, 10-30. Kahler RA Westendorf JJ (2003) Lymphoid enhancer factor-1 and beta-catenin inhibit Runx2-dependent transcriptional activation of the osteocalcin promoter. J Biol Chem 278, 11937-11944. Kanoe H, Nakayama T, Murakami H, Hosaka T, Yamamoto H, Nakashima Y, Tsuboyama T, Nakamura T, Sasaki MS Toguchida J (1998) Amplification of the CDK4 gene in sarcomas: tumor specificity and relationship with the RB gene mutation. Anticancer Res 18, 2317-2321. Khanna C, Prehn J, Hayden D, Cassaday RD, Caylor J, Jacob S, Bose SM, Hong SH, Hewitt SM Helman LJ (2002) A randomized controlled trial of octreotide pamoate long-acting release and carboplatin versus carboplatin alone in dogs with naturally occurring osteosarcoma: evaluation of insulin-like growth factor suppression and chemotherapy. Clin Cancer Res 8, 2406-2412. Khanna C, Wan X, Bose S, Cassaday R, Olomu O, Mendoza A, Yeung C, Gorlick R, Hewitt SM Helman LJ (2004) The membrane-cytoskeleton linker ezrin is necessary for osteosarcoma metastasis. Nat Med 10, 182-186. Kochevar DT, Kochevar J Garrett L (1990) Low level amplification of c-sis and c-myc in a spontaneous osteosarcoma model. Cancer Lett 53, 213-222. Ladanyi M, Park CK, Lewis R, Jhanwar SC, Healey JH Huvos AG (1993) Sporadic amplification of the MYC gene in human osteosarcomas. Diagn Mol Pathol 2, 163-167. Lau CC, Harris CP, Lu XY, Perlaky L, Gogineni S, Chintagumpala M, Hicks J, Johnson ME, Davino NA, Huvos AG, Meyers PA, Healy JH, Gorlick R Rao PH (2004) Frequent amplification and rearrangement of chromosomal bands 6p12-p21 and 17p11.2 in osteosarcoma. Genes Chromosomes Cancer 39, 11-21. Leonard P, Sharp T, Henderson S, Hewitt D, Pringle J, Sandison A, Goodship A, Whelan J Boshoff C ( 2003) Gene expression array profile of human osteosarcoma. Br J Cancer 89, 22842288. Levine RA (2002) Overexpression of the sis oncogene in a canine osteosarcoma cell line. Vet Pathol 39, 411-412. Levine RA Fleischli MA (2000) Inactivation of p53 and retinoblastoma family pathways in canine osteosarcoma cell lines. Vet Pathol 37, 54-61. Levine RA, Forest T Smith C (2002) Tumor suppressor PTEN is mutated in canine osteosarcoma cell lines and tumors. Vet Pathol 39, 372-378. Liao AT, McMahon M London C (2005) Characterization, expression and function of c-Met in canine spontaneous cancers. Vet Comp Oncol 3, 6172. Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe DB, Kamal M, Clamp M, Chang JL, Kulbokas III EJ, Zody MC, Mauceli E, Xie X, Breen M, Wayne RK, Ostrander EA, Ponting CP, Galibert F, Smith DR, deJong PJ, Kirkness E, Alvarez P, Biagi T, Brockman W, Butler J, Chin C-W, Cook A, Cuff J, Daly MJ, DeCaprio D, Gnerre S, Grabherr M, Kleber M, Bardeleben C, Goodstadt L, Heger A, Hitte C,

Kim L, Koepfli K-P, Parker HG, Pollinger J, Searle SMJ, Sutter NB, Thomas R, Webber C et al (2005) Genome sequence, comparative analysis and haplotype structure of the domestic dog. Nature, 438, 803-819. Lonardo F, Ueda T, Huvos AG, Healey J Ladanyi M (1997) p53 and MDM2 alterations in osteosarcomas: correlation with clinicopathologic features and proliferative rate. Cancer 79, 1541-1547. Lopez-Guerrero JA, Lopez-Gines C, Pellin A, Carda C Llombart-Bosch A (2004) Deregulation of the G1 to S-phase cell cycle checkpoint is involved in the pathogenesis of human osteosarcoma. Diagn Mol Pathol 13, 81-91. MacEwen EG, Kutzke J, Carew J, Pastor J, Schmidt JA, Tsan R, Thamm DH Radinsky R (2003) c-Met tyrosine kinase receptor expression and function in human and canine osteosarcoma cells. Clin Exp Metastasis 20, 421-430. Malawer MM, Link MP Donaldson SS (2001). Sarcomas of the soft tissue and bone. Cancer: Principles and Practice of Oncology. DeVita VT, Jr., Hellman S, et al, Philadelphia, Lippincott Williams & Wilkins. 2, 1891-1935. Man TK, Lu XY, Jaeweon K, Perlaky L, Harris CP, Shah S, Ladanyi M, Gorlick R, Lau CC Rao PH (2004) Genomewide array comparative genomic hybridization analysis reveals distinct amplifications in osteosarcoma. BMC Cancer 4, 45. Mansky PJ, Liewehr DJ, Steinberg SM, Chrousos GP, Avila NA, Long L, Bernstein D, Mackall CL, Hawkins DS Helman LJ (2002) Treatment of metastatic osteosarcoma with the somatostatin analog OncoLar: significant reduction of insulin-like growth factor-1 serum levels. J Pediatr Hematol Oncol 24, 440-446. Mealey KL, Barhoumi R, Rogers K Kochevar DT (1998) Doxorubicin induced expression of P-glycoprotein in a canine osteosarcoma cell line. Cancer Lett 126, 187-192. Mendoza S, Konishi T, Dernell WS, Withrow SJ Miller CW (1998) Status of the p53, Rb and MDM2 genes in canine osteosarcoma. Anticancer Res 18, 4449-4453. Miller CW, Aslo A, Won A, Tan M, Lampkin B Koeffler HP (1996) Alterations of the p53, Rb and MDM2 genes in osteosarcoma. J Cancer Res Clin Oncol 122, 559-565. Modiano JF, Lamerato-Kozicki AR, Jubala CM, Coffey D, Borakove M, Schaack J Bellgrau D (2004) Fas ligand gene transfer for cancer therapy. Cancer Ther 2: 561-570. Naka T, Iwamoto Y, Shinohara N, Ushijima M, Chuman H Tsuneyoshi M (1997) Expression of c-met proto-oncogene product (c-MET) in benign and malignant bone tumors. Mod Pathol 10, 832-838. Nardeux PC, Daya-Grosjean L, Landin RM, Andeol Y Suarez HG (1987) A c-ras-Ki oncogene is activated, amplified and overexpressed in a human osteosarcoma cell line. Biochem Biophys Res Commun 146, 395-402. Nielsen GP, Burns KL, Rosenberg AE Louis DN (1998) CDKN2A gene deletions and loss of p16 expression occur in osteosarcomas that lack RB alterations. Am J Pathol 153, 159-163. Nielsen-Preiss SM, Silva SR Gillette JM (2003) Role of PTEN and Akt in the regulation of growth and apoptosis in human osteoblastic cells. J Cell Biochem 90, 964-975. Oda Y, Naka T, Takeshita M, Iwamoto Y Tsuneyoshi M (2000) Comparison of histological changes and changes in nm23 and c-MET expression between primary and metastatic sites in osteosarcoma: a clinicopathologic and immunohistochemical study. Hum Pathol 31, 709-716. Overholtzer M, Rao PH, Favis R, Lu XY, Elowitz MB, Barany F, Ladanyi M, Gorlick R Levine AJ (2003) The presence of p53 mutations in human osteosarcomas correlates with high levels of genomic instability. Proc Natl Acad Sci U S A 100, 11547-11552.

Modiano et al: Canine models for cancer gene therapy Ozaki T, Schaefer KL, Wai D, Buerger H, Flege S, Lindner N, Kevric M, Diallo R, Bankfalvi A, Brinkschmidt C, Juergens H, Winkelmann W, Dockhorn-Dworniczak B, Bielack SS Poremba C (2002) Genetic imbalances revealed by comparative genomic hybridization in osteosarcomas. Int J Cancer 102, 355-365. Ozisik YY, Meloni AM, Peier A, Altungoz O, Spanier SS, Zalupski MM, Leong SP Sandberg AA (1994) Cytogenetic findings in 19 malignant bone tumors. Cancer 74, 22682275. Park YB, Park MJ, Kimura K, Shimizu K, Lee SH Yokota J (2002) Alterations in the INK4a/ARF locus and their effects on the growth of human osteosarcoma cell lines. Cancer Genet Cytogenet 133, 105-111. Pellin A, Boix-Ferrero J, Carpio D, Lopez-Terrada D, Carda C, Navarro S, Peydro-Olaya A, Triche TJ Llombart-Bosch A (1997) Molecular alterations of the RB1, TP53, and MDM2 genes in primary and xenografted human osteosarcomas. Diagn Mol Pathol 6, 333-341. Regardsoe EL, McMenamin MM, Charlton HM Wood MJ (2004) Local adenoviral expression of Fas ligand upregulates pro-inflammatory immune responses in the CNS. Gene Ther 11, 1462-1474. Scholz RB, Kabisch H, Weber B, Roser K, Delling G Winkler K (1992) Studies of the RB1 gene and the p53 gene in human osteosarcomas. Pediatr Hematol Oncol 9, 125-137. Scotlandi K, Baldini N, Oliviero M, Di Renzo MF, Martano M, Serra M, Manara MC, Comoglio PM Ferracini R (1996) Expression of Met/hepatocyte growth factor receptor gene and malignant behavior of musculoskeletal tumors. Am J Pathol 149, 1209-1219. Setoguchi A, Okuda M, Nishida E, Yazawa M, Ishizaka T, Hong SH, Hisasue M, Nishimura R, Sasaki N, Yoshikawa Y, Masuda K, Ohno K Tsujimoto H (2001) Results of hyperamplification of centrosomes in naturally developing tumors of dogs. Am J Vet Res 62, 1134-1141. Shimizu M, Fontana A, Takeda Y, Yoshimoto T, Tsubura A Matsuzawa A (2001) Fas/Apo-1 (CD95)-mediated apoptosis of neutrophils with Fas ligand (CD95L)-expressing tumors is crucial for induction of inflammation by neutrophilic polymorphonuclear leukocytes associated with antitumor immunity. Cell Immunol 207, 41-48. Squire JA, Pei J, Marrano P, Beheshti B, Bayani J, Lim G, Moldovan L Zielenska M (2003) High-resolution mapping of amplifications and deletions in pediatric osteosarcoma by use of CGH analysis of cDNA microarrays. Genes Chromosomes Cancer 38, 215-225.

Sulzbacher I, Birner P, Trieb K, Traxler M, Lang S Chott A (2003) Expression of platelet-derived growth factor-AA is associated with tumor progression in osteosarcoma. Mod Pathol 16, 66-71. Sztan M, Papai Z, Szendroi M, Looij M Olah E (1997) Allelic Losses from Chromosome 17 in Human Osteosarcomas. Pathol Oncol Res 3, 115-120. Thomas R, Scott A, Langford C, Fosmire SP, Jubala CM, Lorentzen TD, Hitte C, Karlsson EK, Kirkness E, Ostrander EA, Galibert F, Lindblad-Toh K, Modiano JF Breen M (2005) Construction of a 2Mb resolution BAC-microarray for CGH analysis of canine tumors. Genome Res 15, 18311837. van Dartel M Hulsebos TJ (2004) Amplification and overexpression of genes in 17p11.2 ~ p12 in osteosarcoma. Cancer Genet Cytogenet 153, 77-80. van Dartel M, Redeker S, Bras J, Kool M Hulsebos TJ (2004) Overexpression through amplification of genes in chromosome region 17p11.2 approximately p12 in highgrade osteosarcoma. Cancer Genet Cytogenet 152, 8-14. Withrow SJ, Powers BE, Straw RC Wilkins RM (1991) Comparative aspects of osteosarcoma. Dog versus man. Clin Orthop 270 Withrow SJ, Thrall DE, Straw RC, Powers BE, Wrigley RH, Larue SM, Page RL, Richardson DC, Bissonette KW, Betts CW et al, (1993) Intra-arterial cisplatin with or without radiation in limb-sparing for canine osteosarcoma. Cancer 71, 2484-2490. Worth LL, Lafleur EA, Jia SF Kleinerman ES (2002) Fas expression inversely correlates with metastatic potential in osteosarcoma cells. Oncol Rep 9, 823-827. Yokoyama R, Schneider-Stock R, Radig K, Wex T Roessner A (1998) Clinicopathologic implications of MDM2, p53 and Kras gene alterations in osteosarcomas: MDM2 amplification and p53 mutations found in progressive tumors. Pathol Res Pract 194, 615-621. Zachos TA, Aiken SW, DiResta GR Healey JH (2001) Interstitial fluid pressure and blood flow in canine osteosarcoma and other tumors. Clin Orthop 385 Zielenska M, Marrano P, Thorner P, Pei J, Beheshti B, Ho M, Bayani J, Liu Y, Sun BC, Squire JA Hao XS (2004) Highresolution cDNA microarray CGH mapping of genomic imbalances in osteosarcoma using formalin-fixed paraffinembedded tissue. Cytogenet Genome Res 107, 77-82.

Gene Therapy and Molecular Biology Vol 10, page 109 Gene Ther Mol Biol Vol 10, 109-112, 2006

The isolation of chlamydia pneumoniae in atherosclerosis patients in Iran by PCR method Research Article

Fatemeh Fallah*, Gita Eslami, Mehdi Bootorabi, Bahram Kazemi, Hossein Goudarzi, Elham Mazaheri Microbiology Department, Medical Faculty Shaheed Beheshti University of Medical Science & Pediatric Infectious Research Center Tehran-Iran

__________________________________________________________________________________ *Correspondence: Fatemeh, Fallah, PhD, Associate Professor, Medical Faculty Shaheed Behesti University, Pediatric Infectious Research Center, Evin Street, Charman High Way Tehran-Iran; Tel: 0098-21-2413042; Fax: 0098-21-2226941; E-mail: dr_fallah@yahoo.com Key words: Chlamydia Pneumoniae, atherosclerosis, PCR amplification, Cardiovascular disease Abbreviations: Cardiovascular disease, (CAD); left anterior decending artery, (LAD) Received: 2 September 2005; Revised: 19 October 2005 Accepted: 25 October 2005; electronically published: March 2006

Summary Cardiovascular disease (CAD) is the leading cause of death in developed countries. The cause is multifactorial. A substantial proportion of patients with CAD do not have traditional risk factors. Infectious diseases may play a role in these cases, or they may intensify the effect of the risk factors. The association of CAD and Chlamydia pneumoniae infection is firmly established, but causality is yet to be proven. We investigated their presence in carotid atherosclerotic plaques. 102 plaque atherosclerotic in dead patients were available for examination in Tehran, Iran. The highly sensitive polymerase chain reaction method was employed with primers specific for this agent. The presence of Chlamydia DNA was detected in 23 (22%) out of 102 examined samples. The presence of Chlamydia DNA in these patients supports the hypothesis that this agent has an association with atherosclerosis. the contribution of C. pneumoniae to the pathogenesis of atherosclerosis remains unknown (Cagli et al, 2003). Similarly, there is increasing evidence that Chlamydia pneumoniae, a common respiratory tract pathogen, may play a role in atherosclerosis. C. pneumoniae has been associated with coronary and carotid artery disease in seroprevalence epidemiological studies, and in one prospective cohort study C. pneumoniae elementary bodies have been detected in the atherosclerotic plaques and fatty streaks of the aorta and coronary arteries of autopsy cases. From atherectomy specimens of coronary arteries, and from endarterectomy specimens of carotid arteries (Fong, 2000). In the present study, the presence of C. pneumoniae was investigated by PCR in arterial plaque, as was the correlation between the clinical status and DNA positivity of these bacteria.

I. Introduction Only half of coronary artery disease, and half of carotid plaque measured by ultrasound, can be explained by the usual risk factors: age, sex, hypertension, hyperlipidemia, smoking, and diabetes. It is likely that much of unexplained atherosclerosis is genetic: a Swedish twin study showed that myocardial infarction heritable this suggests that few environmental factors remain to be discolved that would make a major contribution to atherosclerosis.Recently, the notion that infection may be important in atherosclerosis has been of interest.(Spence and Norris, 2003). Recently, a potential link between infectious agents and atherosclerosis has been suggested. Data obtained from several seroepidemological studies has given rise to the hypothesis that an infection can initiate or maintain the atherosclerotic process (Farsak et al, 2000). Chlamydia pneumoniae is a common cause of a usually mild, community acquired pneumonia. This organism, however, can spread from the respiratory tract into other parts of the body and has been detected in up to 70% of atheromatous lesions in blood vessels. Although the exact mechanism of

II. Materials and methods A. Study design The research in this study has been done by descriptive methods. Samples were obtained in 2002 from 102 dead cases with infarction due to Atherosclerosis. Basic demographic data

109

Fallah et al: The study of association between Chlamydia Pneumoniae and atherosclerosis by PCR and clinical information such sex, smoking, familiar heart problem history coronary artery diseases, diabetes, blood pressures and level of blood cholesterol (LDL & HDL) in sera were extracted either from the files

premature cardiovascular disease identified with DNA C.pneumoniae (Figure 1).

IV. Discussion Human atherogenesis appears to be of multifactorial etiology, and no single entity can fully explain the pathogenesis. There is little doubt that risk factors such as genetic predisposition, hypercholesterolemia, hypertension, smoking, and diabetes mellitus are major predisposing conditions for atherosclerosis. There is substantial evidence, albeit circumstantial, those infectious agents are associated with atherosclerosis, but their exact role in the pathogenesis of atherosclerosis is unknown. The most compelling evidence to date is the presence of infectious agents in the arterial wall, particularly in diseased vessels or within atherosclerotic plaques (Chiu et al, 1997).

B. DNA extraction for chlamydia DNA from 50 µl of homogenized tissues was isolated by proteinase K digestion (100 µg/ml for 1 to 2 h at 65°C) followed by phenol-chloroform extraction and ethanol precipitation.The DNA was then resuspended in 50 µl of Tris-EDTA buffer. For PCR, 10 µl of DNA solution, was added per 50 µl of reaction mixture (Skowronski et al, 1993).

C. PCR amplification PCR targeting the 16S rRNA gene and a nested PCR targeting the ompA gene were performed to detect C pneumoniae DNA. All amplification reactions were done in a volume of 50 µl containing 200 µM of four deoxynucleoside triphosphates. PCR primers tested were CPN90 5' GGT CTC AAC CCC ATC CGT GTC GG 3', CPN91 5' TGC GGA AAG CTG TAT TTC TAC AGT T 3', CP1 5' TTA CAA GCC TTG CCT GTA GG 3', CP2 5' GCG ATC CCA AAT GTT TAA GGC 3' (Cagli et al, 2003). Briefly PCR was performed using CPN90-CPN91 primer pair with a 0.25 µM concentration of each primer, 2.5 mM MgCl2 and 20 µl of the extracted DNA. Cycling protocol was 75 seconds at 95°C, followed by 60 cycles of denaturation at 94°C for 45 seconds, annealing beginning at 64°C and ending at 52°C for 45 seconds, and extension at 72°C for one minute. The annealing temperature was lowered 10°C every four cycles until 52°C and this temperature was kept until the end of the cycling process. CP1-CP2 primers with nested pair CPC-CPD were used for the ompA nested PCR. The first round of amplification used 1.5 mM MgCl2, 0.4 µM of each primer and 20 µl of the extracted DNA. Cycling consisted of nine minutes at 95°C for Taq polymerase activation, 20 cycles of one minute at 94°C, one minutes at 65°C (temperature was decreased 0.5°C for each cycle) and one minute at 72°C plus an additional 20 cycles of one minute at 94°C, one minute at 55°C and one minute at 72°C. The PCR products amplified by the outer primer pair were diluted 1:5 and 5 µl was added to a new PCR mixture containing 1 µM of each primer and 3 mM of MgCls . Cycling protocol entailed nine minutes at 95°C for Taq DNA polymerase activation, 30 cycles of one minute at 94°C, one minute at 50°C and one minute at 72°C.

Figure 1. The frequency of risk factors in Atherosclerosis patients with Chlamydia Pneumoniae (1-DNA Chlamydia Positive and 2 –DNA Chlamydia negative).

Figure 2. The frequency Atherosclerosis patients.

III. Results In Total, 102 patients (20 to 79 years old) Figure 2 from 75 males and 27 females had been identified and died from atherosclerosis. Of these patients Chlamydia DNA was detected in 23(22%) (Figure 1). 100(98%) of 102 atherosclerosis patients had the primary obstruction and the rest (2%), the secondary obstruction. on the other hand majority of obstruction (91%) were been displayed in left anterior decending artery (LAD). Among of the Chlamydia DNA positive patients (Picture 1 and 2), some risk factors (sex, hyperlipidemia, blood pressure, diabetes, smoking and family history of premature cardiovascular disease) were established. Out of 102 patients with atherosclerosis, 20 (36.30%) increasing of LDL, 18 (47.30%) decreasing of HDL, 6 (24%) increasing of blood pressure, 7 (38.80%) diabetes, 12 (24%) smoking and 8 (29.90%) family history of

Chlamydia

positive

Figure 3. The frequency of age in Atherosclerosis patients.

C. pneumoniae, an obligate intracellular gramnegative bacterium, has been associated with atherosclerotic cardiovascular disease both by seroepidemiological studies, indicating a significantly higher prevalence of circulating C. pneumoniae antibody

110

Gene Therapy and Molecular Biology Vol 10, page 111 or immune complexes among persons with clinical or radiographic evidence of atherosclerotic disease. C pneumoniae has now been detected in atherosclerotic plaques in several different arterial sites (coronary arteries, aorta, and carotid arteries) and in early lesions (fatty streaks) and through the use of various independent techniques. The organism has been detected by electron microscopy, immunocytochemisty, direct immunofluorescence, and the PCR in coronary artery and carotid artery plaque specimens (Shor et al, 1992; Kuo et al, 1993a, b; Chiu et al, 1997; Farsak et al, 2000). Some study was about comparison trial of DNA extraction methods and PCR assay for detection of Chlamydia pneumoniae in endarterectomy specimens. There was no consistent pattern of positive results among the various laboratories, and there was no correlation between the detection rates and the sensitivity of the assay used (Apfalter et al 2001). Bartels et al, even found that occluded aorta-coronary venous grafts harbour C pneumoniae (Bartels et al, 2000). Using PCR and immunohistochemistry, C pneumoniae was detected in arterial biopsies from femoral, popliteal, and coronary arteries, as well as in the aorta, indicating that the organism is widespread in atherosclerosis of the vascular system (Kuo et al, 1993a; Davidson et al, 1998). Some studies found Between individuals, the percentage of arteries with immunoreactivity to C pneumoniae was associated with the average area stenosis throughout the arterial system. Their conclusion displayed C pneumoniae was mostly observed at locations that are related to clinically relevant features. Within the individual, the distribution of C pneumoniae is associated with the distribution of atherosclerosis (Vinik et al,2001). On the other hand, Andreasen et al, could not detect C pneumoniae in calcific or degenerative atherosclerotic aortic heart valve disease and Nystromrosander et al did detect C pneumoniae in aortic valves using electron microscopy (Nystrom-Rosander et al, 1997; Andreasen et al, 1998). Furthermore, it is unclear whether C pneumoniae initiates the process of atherosclerosis, facilitates progression of existing plaques, or merely colonises the lesions. Some study Shown that the adventitia of atherosclerotic coronary arteries frequently contains C. pneumoniae that seems to be located within macrophages. These results might indicate a possible route for infected circulating macrophages to home into atherosclerotic lesions in the artery via vasa vasorum (Vink et al, 2001a). Another study was to determine the presence of C. pneumoniae in coronary artery plaques, carotid artery plaques and old vein grafts that were harvested at the time of surgery. But it failed to find C. pneumoniae in any of the vascular tissue. So was concluded that a large cooperative study involving surgical specimen analysis is needed to assess the role of C. pneumoniae in the etiology of atherosclerosis (Johnson et al,2001). In our study C. pnemoniae was detected in 22 (23%) out of 102 tissue plaques from dead atherosclerosis patients. Also, there were so many risk factors in that patients. Therefore, In a condition with so many risk

factors and genetic influences it seems unlikely that infection will be the only or main cause of atherosclerosis and events. The role of these newly emerging risk factors and their relationship with traditional risk factors such as hypertension or lipids, remains unexplored. The uncertainty of their role and the types of infection or types of patients that should be treated must be explored in properly conducted, prospective studies. However, the findings to date are intriguing, and the hope that antiinfective therapy may reduce the burden of stroke is worth pursuing.

References Andreasen JJ, Farholt S, Jensen JS. (1998) Failure to detect Chlamydia pneumoniae in calcific and degenerative arteriosclerotic aortic valves excised during open heart surgery. APMIS 106, 717-20. Apfalter P, Blasi F, Boman J, Gaydos CA, Kundi M, Maass M, Makristathis A, Meijer A, Nadrchal R, Persson K, Rotter ML, Tong CY (2001) Multicenter comparison trial of DNA extraction methods and PCR assay for detection of Chlamydia pneumoniae in endarterectomy specimens J Clin Microbiol 39, 519-24. Bartels C, Maass M, Bein G, Brill N, Bechtel JF, Leyh R, Sievers HH (2000) Association of serology with the endovascular presence of Chlamydia pneumoniae and cytomegalovirus in coronary artery and vein graft disease. Circulation 99, 87982. Cagli S, Oktar N, Dalbasti T, Erensoy S, Ozdamar N, Goksel S, Sayiner A, Bilgic A (2003) Failure to detect Chlamydia pneumoniae DNA in cerebral aneurysmal sac tissue with two different polymerase chain reaction methods. J Neurol Neurosurg Psychiatry 74, 756-9. Chiu B, Viira E, Tucker W, Fong IW (1997) Chlamydia pneumoniae, cytomegalovirus, and herpes simplex virus in atherosclerosis of the carotid artery. Circulation 96, 2144-8. Davidson M, Kuo CC, Middaugh JP, Campbell LA, Wang SP, Newman WP 3rd, Finley JC, Grayston JT (1998) Confirmed previous infection with Chlamydia pneumoniae (TWAR) and its presence in early coronary atherosclerosis. Circulation 98, 628-33. Farsak B, Yildirir A, Akyon Y, Pinar A, Oc M, Boke E, Kes S, Tokgozoglu L (2000) Detection of Chlamydia pneumoniae and Helicobacter pylori DNA in human atherosclerotic plaques by PCR. J Clin Microbiol 38, 4408-4411. Fong IW (2000) Emerging relations between infectious diseases and coronary artery disease and atherosclerosis. CMAJ 163, 49-56. Johnson WD, Moses J, Kipshidze N (2001) Absence of Chlamydia pneumoniae in surgical specimens of coronary and carotid arteries by polymerase Chain Reaction Cardivascular Radiat Med 2, 221-4. Kuo CC, Gown AM, Benditt EP, Grayston JT (1993a) Detection of Chlamydia pneumoniae in aortic lesions of atherosclerosis by immunocytochemical stain. Arterioscler Thromb 13, 1501-1504. Kuo CC, Shor A, Campbell LA, Fukushi H, Patton DL, Grayston JT (1993b) Demonstration of Chlamydia pneumoniae in atherosclerotic lesions of coronary arteries. J Infect Dis 167, 841-849. Nystrom-Rosander C, Thelin S, Hjelm E, Lindquist O, Pahlson C, Friman G (1997) High incidence of Chlamydia pneumoniae in sclerotic heart valves of patients undergoing aortic valve replacement. Scand J Infect Dis 29, 361-5.

111

Fallah et al: The study of association between Chlamydia Pneumoniae and atherosclerosis by PCR Shor A, Kuo CC, Patton DL (1992) Detection of Chlamydia pneumoniae in coronary artery fatty streaks and atheromatous plaques. S Afr Med J 82, 158-61. Skowronski EW, Mendoza A, Smith SC Jr, Jaski BE (1993) Detection of cytomegalovirus in paraffin-embedded postmortem coronary artery specimens of heart transplant recipients by the polymerase chain reaction: implications of cytomegalovirus association with graft atherosclerosis. J Heart Lung Transplant 12, 717-23. Spence JD, Norris J (2003) Infection, inflammation, and atherosclerosis Stroke 34, 34:333. Vink A, Poppen M, Schoneveld AH ,Roholl PJ, de Kleijn DP, Borst C, Pastercamp G (2001) Distribution of Chlamydia pneumoniae in the human arterial system and its relation to the local amount of atherosclerosis within the individual Circulation 103, 1613-7 Vink A, Pastercamp G, Poppen M, Schoneveld AH, de Kleijn DP, Roholl PJ, Fontijn J, Plomp S, Borst C (2001a) The adventitia of atherosclerotic coronary arteries frequently contains Chlamydia pneumoniae Atherosclerosis 157,117-

22.

Fatemeh Fallah

112

Gene Therapy and Molecular Biology Vol 10, page 13 Gene Ther Mol Biol Vol 10, 13-16, 2006

Structural analysis of the elongated part of an abnormal hemoglobin “Hemoglobin Cranston” Research Article

Viroj Wiwanitkit Department of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok Thailand 10330

__________________________________________________________________________________ *Correspondence: Viroj Wiwanitkit, M.D., Department of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand 10330; Tel: 662 256 4136; Fax: 662 218 3640; e-mail: Viroj.W@Chula.ac.th Key words: Hb Cranston, structure Abbreviations: Haemoglobin Cranston, (HbCranston) Received: 5 July 2005; Revised: 28 September 2005 Accepted: 22 November 2005; electronically published: February 2006

Summary Haemoglobin variants in which a frameshift results in chain elongation are unusual. Haemoglobin Cranston (HbCranston) is an unstable haemologin firstly with abnormal elongation. Concerning the pathogenesis of HbCranston, the insertion of the repeated pair nucleotide pair AG into ! mRNA between the triplet codon of 144 Lysine (AAG) and 145 Tyrosine (UAU) is the main abnormality. It is assumed to be due to an insertion of the dinucleotide CA into codon 146 [CACCA(CA)C] which abolishes the normal stop codon at position 147 (Bunn et al, 1975). This abnormality causes a frameshift, which results in elongation of the ! chain amino acids. Here, the author performs a bioinformatic analysis to study the secondary and tertiary structures of those elongated amino acid sequences. Answering this question, a computer-based study for protein structure modeling is performed. According to this study, the secondary structure analysis of the elongated part of Hb Cranston showed eleven additional helices to the normal ! globin chains. Based on this information, the main alteration in the Hb Cranston might be due to the additional helices in the elongated part. Concerning the tertiary structure, the increase of folds, accompanied with the aberration in secondary structure of globin in Hb Cranston can be identified. Although the primary structure of Hb Cranston disorder is well known the secondary and tertiary structure of Hb Cranston is not well documented. The study on the secondary and tertiary structures of the elongated part in hemoglobin Cranston can help explain more in the pathogenesis of the Hb Cranston disorder is needed. Here, the author performs a bioinformatic analysis to study the secondary and tertiary structures of those elongated amino acid sequence. Answering this question, a computer-based study for protein structure modelling is performed.

I. Introduction Haemoglobin variants in which a frameshift results in chain elongation are unusual (Bunn et al, 1975; Wiwanitkit, 2004). The two well-known disorders are haemoglobin Tak1 and haemoglobin Cranston2. Haemoglobin Cranston (HbCranston) is an unstable haemologin firstly described in 1975 (Bunn et al, 1975). Concerning the pathogenesis of HbCranston, this hemoglobinopathy is an unstable variant having an elongated ! chain due to nonhomologous crossover between two normal ! chain genes (Bunn et al, 1975). Pathophysiologically, peptide maps of tryptic digests of the abnormal ! chain is identical to those of !. An except that tryptic peptide 15 (Tyr-His-COOH) was absent and a new peptide was detected, containing equivalent amounts of Ser, Ile, Thr, and Lys. This abnormality results in elongation of the ! chain by the set on amino acids including Asn, Ser, Ala, Tyr, 2 Phe, and 3 Leu (Bunn et al, 1975). The elongated part of the ! chain is believed to be the causal factor for the instability of haemoglobin Cranston (Bunn et al, 1975).

II. Material and Methods The author used the bioinformatics techniques to perform structure modeling. The primary amino acid sequence of the elongated part in Hb Cranston is “Asn-Ser-Ala-Tyr-Phe- Phe-Leu-Leu-Leu.” Concerning secondary structure modelling, the author performs protein secondary structure predictions from its primary sequence using NNPREDICT server (Kneller et al, 1990). Concerning tertiary structure modelling, the author performs protein tertiary structure predictions of from its primary sequence

Wiwanitkit: Structural analysis of â&#x20AC;&#x153;Hemoglobin Cranstonâ&#x20AC;? using CPHmodels 2.0 Server (Lund et al, 2002). The calculated secondary and tertiary structures were presented.

in USA (Bunn et al, 1975). The clinical significance of this unstable hemoglobin is the relationship with a compensated hemolytic state due to an unstable hemoglobin variant (Bunn et al, 1975). The main pathogenesis is believed to due to the nature of this abnormal hemoglobin, resulting from the elongation. Here, the author performed a structural analysis for the elongated part of Hb Cranston (Figures 1, 2). According to this study, the secondary structure analysis of the elongated part of Hb Cranston showed eleven additional helices to the normal ! globin chains. Based on this information, the main alteration in the Hb Cranston might be due to the additional helices in the elongated part. Indeed, the structural aberration relating to the helix part of the globin chain seems to show some possible correlation to hemolysis. Coleman et al (1995) studied the molecular basis of transfusion-dependent hemolytic anemia in Hb Medicine Lake and noted that the potentially

III. Results Calculated secondary and tertiary structures of the elongated part of hemoglobin Cranston are presented in Figure 1 and 2, respectively.

IV. Discussion Hb Cranston results from an aberration in ! globin gene. The chain elongation in Hb Cranston can be explained by the insertion of the repeated pair nucleotide pair AG into ! mRNA between the triplet codon of 144 Lysine (AAG) and 145 Tyrosine (UAU) (Bunn et al, 1975). The frameshift mutation is the result leading to an abnormal elongation of the ! chain by amino acids- (144) Lys-Ser-Ile-Thr-Lys-Leu-Ala-Phe-Leu-Leu-Ser-Asn-Phe(157)Tyr- COOH 2. This variant has firstly been described

Figure 1. Calculated secondary structures of the elongated part of hemoglobin Cranston (Secondary structure prediction: H = helix, E = strand, - = no prediction). A. whole secondary structure of ! globin in normal. B. whole secondary structure of ! globin in Hb Cranston, elongated part is indicated in red

Figure 2. Calculated teritary structures of the elongated part of hemoglobin Cranston. A. whole tertiary structure of ! globin in normal. B. whole tertiary structure of ! globin in Hb Cranston, yellow area indicate the elongated part.

Gene Therapy and Molecular Biology Vol 10, page 15 distorted B helix might provoke further molecular instability including the presentation of mild hemolytic anaemia (McDonald et al, 1980). Although there are some previous studies on kinetic as well as structural properties of Hb Cranston (Shaeffer et al, 1980) and to synthesize of Hb Cranston (Shaeffer et al, 1980) there is no previous study to produce the threedimensional model of Hb Craston. Concerning the tertiary structure analysis, the author hereby first generates the model of ! glodin chain in Hb Cranston using CPHmodels 2.0 Server. Predicted models of ! globin chain in normal and Hb Cranston are shown. The increase of folds, accompanied with the aberration in secondary structure of globin in Hb Cranston can be identified. The developed structure can be useful in further study on the molecular and molecular action in this disorder. Although the direct link between structure and gene therapy at the moment is not described knowing more about the basics of this disease may be helpful for the development of future therapies. In conclusion, the secondary structure analysis of the elongated part of Hb Cranston showed eleven additional helices to the normal ! globin chains. Based on this information, the main alteration in the Hb Cranston might be due to the additional helices in the elongated part. Concerning the tertiary structure, the increase of folds, accompanied with the aberration in secondary structure of globin in Hb Cranston can be identified.

References Bunn HF, Schmidt GJ, Haney DN, Dluhy RG (1975) Hemoglobin Cranston, an unstable variant having an elongated ! chain due to nonhomologous crossover between two normal ! chain genes. Proc Natl Acad Sci USA 72, 3609-3613. Coleman MB, Lu ZH, Smith CM 2nd, Adams JG 3rd, Harrell A, Plonczynski M, Steinberg MH (1995) Two missense mutations in the !-globin gene can cause severe ! thalassemia. Hemoglobin Medicine Lake (! 32[B14]leucine->glutamine; 98 [FG5] valine-->methionine). J Clin Invest 95, 503-9. Kneller DG, Cohen FE, Langridge R (1990) Improvements in Protein Secondary Structure Prediction by an Enhanced Neural Network. J Mol Biol 214, 171-182. Lund O, Nielsen M, Lundegaard C, Worning P (2002) CPHmodels 2.0: X3M a Computer Program to Extract 3D Models. Abstract at the CASP5 conference A102. McDonald MJ, Lund DP, Bleichman M, Bunn HF, De Young A, Noble RW, Foster B, Arnone A (1980) Equilibrium, kinetic and structural properties of hemoglobin Cranston, an elongated ! chain variant. J Mol Biol 140, 357-75. Shaeffer JR, Schmidt GJ, Kingston RE, Bunn HF (1980) Synthesis of hemoglobin Cranston, and elongated ! chain variant. J Mol Biol 140, 377-89. Wiwanitkit V (2004) Haemoglobin Tak, an unstable haemoglobin from Thailand. Haema 7, 310 â&#x20AC;&#x201C; 312.

Wiwanitkit: Structural analysis of â&#x20AC;&#x153;Hemoglobin Cranstonâ&#x20AC;?

Gene Therapy and Molecular Biology Vol 10, page 123 Gene Ther Mol Biol Vol 10, 123-132, 2006

Epstein-Barr Virus downregulates expression of DNA-Double strand break repair proteins in nasopharyngeal cancer Research Article

Prabha Balaram1,*, Smriti M Krishna1, Susan James2, Vino. T. Cheriyan1, Sreelekha Therakathinal Thankappan1, Aleyamma Mathew3 1

Division of Cancer Research, Regional Cancer Centre, Medical College. P.O, Trivandrum 695 011, Kerala, India. Department of ENT, Medical College, Trivandrum 695-011, Kerala, India 3 Department of Statistics, Regional Cancer Centre, Trivandrum, Kerala, India 2

__________________________________________________________________________________ *Correspondence: Dr. Prabha Balaram, Professor and Head, Division of Cancer Research, Regional Cancer Centre, Trivandrum 695 011, Kerala, India; Phone: 91-0471-2522203; Fax: 91-0471-2447454; E-mail: prabhabalaram@yahoo.co.in Key words: DNA-PKcs, ATM, Nasopharyngeal carcinoma, EBV, HPV, Radiotherapy, DNA-double-strand break (DSB) repair proteins. Abbreviations: 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium, (BCIP/NBT); bovine serum albumin, (BSA); Epstein Barr Virus, (EBV); Epstein-Barr nuclear antigen-1, (EBNA-1); head and neck squamous cell carcinoma, (HNSCC); ionizing radiation, (IR); Nasopharyngeal carcinoma, (NPC); Radiotherapy, (RT); severe combined immunodeficiency, (SCID); sodium dodecyl sulfatepolyacrylamide gels, (SDS-PAGE) Received: 15 December 2005; Revised: 13 March 2006 Accepted: 27 March 2006; electronically published: April 2006

Summary Nasopharyngeal carcinoma (NPC) is a unique cancer due to its etiology, and incidence and viral infection pattern. Radiotherapy (RT) is the main treatment modality and these lesions vary considerably in treatment response. In the present study, the effect of EBV and HPV infection on response to treatment based on the expression of DNA-repair proteins, ATM and DNA-PKcs was assessed in NPC based on the rationale that the expression of these proteins play important roles in the response to RT in NPC. 103 NPC biopsies and 26 benign adenoid lesions of the Nasopharynx were collected before treatment and graded according to WHO classification. Response to treatment(radiation) was evaluated clinically. Western blotting and immuno histochemical analysis were used for evaluating the expression of DNA-PKcs and ATM and PCR using specific primers was used for detection of EBV and HPV. EBV presence was also confirmed by EBER-ISH. 63% of NPC were EBV+ve and 30% HPV+ve in the samples studied. Expression of ATM and DNA-PKcs was significantly increased in NPC when compared to benign samples (p<0.001). However, NPC showing EBV infection showed downregulation of ATM and DNA-PKcs expression (p=0.009 and p=0.011), in comparison to HPV infected NPCâ&#x20AC;&#x2122;s (p=0.001 and p=0.003). NPC patients with HPV positivity also showed a significantly poor response to treatment (p=0.002)with a higher rate of recurrence and lower disease free survival. The study indicates that EBV infection down regulates the expression of DNA-repair proteins and renders NPC sensitive to RT while HPV infection up regulates their expression making the tumors resistant to therapy. The results of the study also indicate that assessment of expression of DNA-PKcs and ATM in biopsy specimens can be used as criteria to identify radio-resistant NPCâ&#x20AC;&#x2122;s and selection of appropriate therapy regimens.

Grassman, 2000) thus leading to enhanced susceptibility to carcinogenesis in tissue cells persistently infected with viruses. DNA-PKcs and ATM are two crucial proteins in the DNA-damage repair pathway. Cells lacking DNA-PK activity as a result of a mutation in any of the subunits are radiosensitive and deficient in the rejoining of radiation

I. Introduction Recent research provides ample evidence that viruses affect response of tumour cells toward anti-cancer drugs and irradiation. Viruses interfere with specific cellular genes, and their interaction with the tumor suppressor genes abrogate cell cycle arrest and disturb repair of radiation and drug-induced DNA lesions (Efferth and 123

Balaram et al: DNA damage repair proteins and viruses in NPC 71 months, the median being 18.5 months. We considered in particular, the amount of tumor mass reduction at the end of primary treatment with no evidence of residual disease as a good response to treatment. Loco-regional failures, recurrence, distant metastasis etc. were considered as signs of radio-resistance (poor response). Majority of the lesions with poor response had recurrence of the disease and hence recurrence was taken as the criteria of a poor treatment response for analysis. The benign lesions included cases of adenoids of the nasopharynx.

induced DNA-DSBs and reduced activity in mice leads to ‘severe combined immunodeficiency (SCID), which is coupled with extreme hypersensitivity to ionizing radiation (IR). Complete loss increases the risk of developing lymphomas and impaired V(D)J recombination (Smith and Jackson 1999). Up regulation, on the other hand, was recently reported to correlate with radiation resistance and suggests its potential as a molecular target for novel radiation sensitization therapy for oral squamous cell carcinomas (Shintani et al, 2003). At the cellular level, ATM deficiency is manifested by increased sensitivity to IR or other agents that yield DSBs, chromosomal instability, cellular and humoral immunodeficiency, developmental defects in various organ systems and predisposition to cancer (Khanna, 2000; Becker-catania and Gatti, 2001). A-T carriers also represent a large proportion of patients with enhanced radiation sensitivity (Oppitz et al, 1999). AT deficient cells are impaired in IR induced G1, intra-S, and G2-M cell cycle check points and DNA damage repair capacity. Thus it has a surveillance role in maintaining genomic integrity. NPC is a unique subset of head and neck squamous cell carcinoma (HNSCC) and is a rare malignancy in most parts of the world (Fandi et al, 1994). Geographical variation in incidence rates, rare occurrence of this tumor and the persistent association with Epstein Barr Virus (EBV), suggest that environmental factors and genetic susceptibility play crucial roles in the etiology of the disease (Vokes et al, 1997). Sporadically occurring NPC in the West usually belong to the WHO Type I histology and is associated with alcohol and smoking habits (Vokes et al, 1993). In many parts of Asia, including Southern China and South East Asia, NPC occurs as an endemic disease, and histologically, majority of cases belong to WHO Types II and III (Nonkeratinising and Undifferentiated types) with persistent association with EBV (Hui et al, 2002). Radiotherapy (RT) is the mainstay of treatment for NPC. However, biological aggressiveness and the radiation sensitivity of tumors within the same stage varies considerably and cannot be predicted by conventional histopathological evaluation. These facts indicate that there is a strong need for additional predictive and prognostic factors in order to improve therapy results of these patients. This study addresses the influence of the viruses on overall treatment response of NPC and the potential use of crucial DNA-DSB repair proteins, namely DNA-PKcs and ATM as biological tumor markers in predicting clinical outcome, mainly response to RT.

B. Western blotting Extraction of total protein was done from biopsy samples snap frozen and stored in liquid nitrogen. Protein extracts were prepared in 1ml of lysis buffer [50mM Tris (pH 7.5), 0.1mM EDTA, 150mM NaCl, 1% Triton-X-100, 0.5mM PMSF, 200U/ml aprotonin, 10µg/ml leupeptin, 0.5% NP-40] for 30 minutes on ice. Protein lysates were quantified using Bradford assay with bovine serum albumin (BSA) as a reference standard and resolved by 12% SDS-PAGE (sodium dodecyl sulfatepolyacrylamide gels). The proteins were transferred to nitrocellulose membrane (Millipore Co. USA) and the membrane blocked with TBST (20mM Tris base, 135 mM NaCl, 0.1%Tween-20, pH 7.6) plus 3% powdered non-fat milk. After incubation with primary antibodies against DNA-PKcs (N-20), ATM (H-248) and !-actin (Santacruz Biotech, USA), in optimal concentrations, the membranes were incubated successively with alkaline phosphatase conjugated secondary antibody and visualized with alkaline phosphatase specific chromogens BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium).

C. Immuno histochemistry Indirect immuno histochemical staining for assessing the subcellular localization of DNA-PKcs and ATM proteins was performed using monoclonal antibodies N-20 and H-248 respectively (Santacruz Biotech). Paraffin sections (5µm) from tumor tissue were deparaffinized and rehydrated through a series of graded ethanol. For antigen unmasking, sections were incubated in 10mM citrate buffer; pH6 and heat treatment given for 5 min. in a microwave oven. Inactivation of endogenous peroxidase activity was done with H2O 2 and blocking of nonspecific binding by normal mouse serum and BSA. This was followed by incubation with the primary antibody, linking antibody and development of the reaction with H2O 2 as substrate and DAB (diaminobenzidine) as chromogen. As negative controls, sections treated similarly with PBS substitution instead of the primary antibodies were included. The sections were evaluated using a visible microscope and the number of positive nuclei was expressed as percentage and graded as follows; 0=score1, 1-25%=score 2, 26-50%=score 3, 51-75%=score 4 and >75%=score 5.

D. DNA extraction Paraffin embedded tissues were used for DNA extraction. The first and last sections (5 µm) of paraffin embedded tissues were stained with haematoxylin and eosin and histologically examined for confirmation of diagnosis and estimation of percentage of normal and neoplastic cells and inflammatory infiltrate. 10 µm sections from paraffin blocks were collected and dewaxed by xylene immersion, followed by graded alcohol and sterile distilled water washes. DNA was extracted using the standard phenol-chloroform method. 100 ng of template DNA was used for each set of PCR amplification.

II. Materials and methods A. Samples Nasopharyngeal carcinoma samples (103) were collected from the ENT department, Medical College Hospital, and Regional Cancer Centre, Trivandrum, Kerala, India, with the approval of local ethical committees before start of any treatment. The histological diagnosis was confirmed by a pathologist and grading was performed according to WHO classification. One part of the biopsy sample was snap frozen for protein extraction and the other part processed for routine paraffin embedding. Radiation therapy was the sole treatment given to these patients. Clinical follow up period was from 1 to

124

Gene Therapy and Molecular Biology Vol 10, page 125 different variables. All p values were two-sided and considered significant at p<0.05. Kaplan Meier survival analysis was carried out to evaluate the influence of various DNA-DSB repair proteins and viruses on survival.

E. Detection of viruses All samples were amplified with !-globin primers to assess DNA integrity and only samples that tested positive for !-globin were further analyzed. Primer pairs were constructed that amplified the non-polymorphic Epstein-Barr nuclear antigen-1 (EBNA-1) gene and the presence of EBV was evident by a 262 bp product. EBV positivity was further confirmed by EBER ISH assay (Novocastra,UK) carried out as per the kit instructions. Presence of HPV DNA was identified with highly conserved Late-1 gene of HPV, which encoded a viral capsid protein (HPV L1) using consensus primers MY09 and MY11. The cases scored as HPV positive using consensus primers were subjected to two multiplex PCR reactions (TS1-PCR and TS2-PCR) for the determination of types of HPV infection. After electrophoresis in 3 % agarose gels along with marker, the HPV types were scored according to the length of the amplified fragment (450 bp for consensus HPV, 280bp for HPV 6, 152 bp for HPV16, 216 bp for HPV 18 and 360 bp for HPV 11). Negative controls consisted of a mixture of all the reagents used in the PCR mixture preparation, adding 1µl of sterile distilled water instead of the DNA and also a known EBV and HPV negative sample. The positive control was a previously known EBV positive Hodgkins lymphoma sample and HPV positive Condyloma tissue. These samples were processed in parallel to patient samples to exclude the detection of contamination.

III. Results A. Patient details Briefly, the study samples included patients with a mean age of 40.4 (range 9-79). Majority of the patients were males (68%) and stage III and IV patients (64%), followed by early disease stages, I and II (36%). 67% Patients showed presence of cervical lymph node involvement. Local or regional recurrence of the disease was observed in 35.6% of the NPC cases (Table 1). Follow up was available in 91 patients (6-71 months) and of these, 66% patients were alive and 34% died of the disease during the study period.

1. Histology Formalin fixed, paraffin embedded biopsy tissues were used for histopathological exmination. Based on the WHO classification, the distribution of cases were as follows; KSCC (WHO Type I)-8, differentiated NKSCC (WHO Type II)-56, and UDC (WHO Type III)-39 (Table 1). KSCC’s were moderately to well differentiated squamous cell carcinoma.

F. Statistical analysis The statistical analysis of the protein status in relation to clinical and pathological data was performed by Chi-square test for trend analysis. Students t test was used to analyze the difference in mean staining scores of the proteins among the

Table 1. Expression of DNA damage proteins in relation to malignancy and Stage, histology and viral status of the lesions

Benign Cancer Histological Classification WHO I WHO II WHO III Stage Classification Stage I Stage II Stage III Stage IV Recurrence Nil Present Node status Negative Positive EBV Negative Positive PV Negative Positive

No. of cases

DNA-PKcs

ATM

26 103

6.34 ± 1.6 15.20 ± 2.9 *

1.00 ± 0.01 9.32 ± 2.1**

8 56 39

14.12 ± 9.32 15.32 ± 4.10 15.25 ± 4.66

6.25 ± 6.25 10.26 ± 3.24** 8.58 ± 3.06 *

5 33 25 40

55.75 ± 16.52** 9.33 ± 4.10 14.72 ± 6.18 21.38 ± 5.90*

30.00 ±19.14* 5.75 ± 2.9 8.05 ± 3.94* 12.63 ± 4.40*

46 57

5.74±4.08 31.30±5.61

1.85±0.85 20.47±4.51

30 73

19.00±6.54 15.00±3.44

11.40±4.36 9.31±2.68

38 65

24.84 ± 5.80 9.56 ± 2.90

16.57 ± 4.5 5.07 ± 1.90

72 31

8.12 ± 2.50 31.64 ± 6.8

3.23 ± 1.40 23.45 ± 5.5

*p value <0.05 – comparison with benign lesions ** p value <0.001 – comparison with benign lesions p value <0.05 - comparison between positive and negative lesions p value <0.001 – comparison between positive and negative groups 125

Balaram et al: DNA damage repair proteins and viruses in NPC iii. EBV and HPV co-infection A total of 11 NPC cases (13%) showed co-infection of EBV and HPV. Highest number of co-infected samples was seen in WHO Type II with 19.5% (8/56) followed by that in WHO III (8%, 3/39) and no co-positive sample in WHO I Type lesions (Table 2). Percentage of samples showing co-infection was higher in node positive cases (82%), advanced stage of disease (73%), and among group showing recurrence (71.4%), which indicates an aggressive clinical course. Majority of cases showed single infection by either EBV or HPV and the mutually exclusive pattern of EBV and HPV infection in NPC is further evident from the significant negative bivariate correlation (r=-0.376, p=0.009) between the positivity for the two viruses.

2. Detection of viruses i. EBV detection Among the 103 NPC tissues and 26 benign nasopharyngeal tissues analyzed, 65 NPC samples (63%) and 7 (27%) benign samples showed EBV positivity (Table 2) in both PCR and EBER ISH assays. The EBV positivity of the benign lesions was restricted to the lymphoid cells except in one case which showed mild positivity of epithelial cells along with lymphoid cells in EBER-ISH. 2 cases (25%), 30 cases (53%) and 33 cases (85%) were positive for EBV in WHO Type I, WHO Type II and WHO Type III respectively (Table 2). EBV positivity was found to be highest in the WHO III tumours and Chi-square analysis showed this association to be highly significant (p<0.001). No significant difference was noticed in EBV positivity in the different stages of the disease. EBV positivity was associated with a statistically higher rate of recurrence (45% cases in EBV negative vs 60% in EBV positive cases p=0.045) and did not show any statistical significance with nodal status. In the EBV positive group, the recurrence was independent of the WHO type with similar distribution in WHOII and WHO III. The number of EBV+ patients in WHOI group was very low.

C. Expression of DNA-damage repair proteins 1. Immunohistochemistry i. Expression of DNA-PKcs a. Benign vs NPC

Staining pattern to anti-DNA-PKcs antibody was mostly nuclear with occassional lesions showing cytoplasmic staining. Benign nasopharyngeal epithelium expressed predominantly moderate to intense nuclear expression of DNA-PKcs with few samples showing cytoplasmic staining (Plate 1A-F). The malignant lesions also showed moderate to intense nuclear positivity with diffuse staining throughout the nucleus. Lesions showing higher expression than the mean value in benign lesions +1 SD (14% in this case, the arbitrary cut off for normal expression) were taken as cases of over expression. Based on this cut off, Chi-square analysis did not yield any significant difference in the number of lesions over expressing the protein in cancer lesions taken as a whole (23% in benign lesions vs 24% in Cancer). The percentage of positive cells were, however, higher in the cancer lesions than that in the benign lesions (range: 20-100%, p=0.01). Detectable levels of DNA-PKcs were also detected in 28% cancer cases by western blot (Figure 1).

ii. HPV detection With the consensus primers, 31 of 103 (30%) NPC samples and 4% (1/26) of the benign lesions were positive for HPV (Table 2). Upon further typing by TS1-PCR for HPV 6 and HPV 16 and TS2-PCR for HPV 11 and HPV 18, it was found that the separate infection rate of the nasopharyngeal lesions with HPV 6, HPV 16, HPV 11 and HPV 18 was 2%(2/103), 19.4%(20/103), nil, and 9% (9/103) respectively. Highest frequency of HPV infection was seen in WHOI (62.5%, 5/8) followed by 34% (19/56) in WHO II and 18% (7/39) in WHO III (Table 2) ( Chisquare significance p=0.031). HPV 16 was the most common type with 62.5% in WHO I, 16% (9/56) in WHO II and 15.4% (6/39) in WHO III. HPV 18 infection was found in 14.3% (8/56) in WHO II and 2.6% (1/39) in WHO III and absent in WHO I. 3.5% (2/56) of WHO II cases were found to be positive for HPV 6. None of the nasopharyngeal lesions showed presence of HPV 11 and no double or multiple infections was observed in any of the lesions. HPV positivity was associated with a higher rate of recurrence (78.3% in HPV+ vs 57.1% in HPV-ve. p=0.04) while no relation was seen to nodal involvement or stage of the disease.

b. Effect of viral involvement

Opposite effects on expression of this protein were noticed in the lesions infected by HPV and EBV. The percentage over expression was seen in 45.2% cases in HPV positive lesions in contrast to 16.9% cases in the EBV positive lesions. The percentage of positive cells was higher (p<0.001) in the HPV+ve lesions when compared to HPVâ&#x20AC;&#x201C;ve lesions while a lower percentage cellular positivity was observed in the EBV+ve lesions when compared to EBV-ve lesions (p=0.047) (Table 1).

Table 2. Summary of Virus infection in NPC patients Groups NPC WHO Type I WHO Type II WHOType III Controls

(103) (8) (56) (39) (26)

EBV + (%) 65 (63) 2 (25) 30 (53.5) 33 (85) 7 (27)

HPV + (%) 31 (30) 5 (62.5) 19 (34) 7 (18) 1 (4)

126

HPV+/EBV+ (%) 85 (82.5) 7 (87.5) 41 (73.2) 37 (95) 8 (31)

Co-infection (%) 11 (13) 0 8 (14.3) 3 (8) 0

Gene Therapy and Molecular Biology Vol 10, page 127

Plate 1. Immunohistochemical staining of NPC lesions showing staining with anti- DNA-PKcs antibody (Santa Cruz) X 400. A. Benign Nasopharyngeal epithelium showing low nuclear positivity B. WHO type I lesion showing nuclear positivity (400X) C. WHO type II lesion showing nuclear positivity (400X) D. WHO type III lesions showing decreased nuclear positivity (400X) E. EBV+ WHO type II lesion with low percentage of nuclear positivity (400X) F. HPV+ WHO type II lesion showng high nuclear positivity (400X

Figure 1. Western Blots of study samples showing expressions of (a) DNA-PKcs, (b) ATM and (c) !Actin proteins. Samples 1, 2, 3& 7 – HPV+ NPC lesions, 4 & 8 – EBV+ NPC lesions, 5 & 6 – Adenoid (benign) lesions .

c. Correlation with clinico-pathological variables

and poor treatment response (Table 3). Most HPV+ve lesions showed high expression while majority of the EBV+ve lesions showed low expression of this protein correlating very well with recurrence pattern (80% of HPV+ve tumours in contrast to 40% of EBV+ve tumours showing recurrence) Kaplan Meyer survival analysis showed that the expression of DNA-PKcs was closely associated with disease free survival with majority of the EBV positive lesions showing a lower expression (Table 4, Figure 2) having a better overall survival. These observations point towards the potential use of DNA-PKcs expression levels along with the viral status as a marker for radiation response and disease free survival in NPCs.

The expression of DNA-PKcs were lower in the advanced stages of the disease when compared to stage I disease but no difference in expression was noticed between the different histological grades (Table 1). This observation is to be confirmed further as the number of samples in WHO I type is very small. However, this goes with the finding that DNA-PKcs is over expressed in HPV +ve lesions and 4 of the five lesions in WHO I are HPV +ve. d. Correlation with recurrence and response to treatment

Expression of DNA-PKcs was lower in lesions (p=0.006) showing no recurrence and good overall response (no residual disease, metastasis or recurrence) to radiation treatment in comparison to that in the lesions showing recurrence and poor treatment response (Table 3). High expression of DNA-PKcs, on the other hand, was positively associated with recurrence (r=0.402, p=0.001)

ii. Expression of ATM a. Benign vs NPC

The benign lesions showed very low levels of ATM expression in contrast to higher levels in the malignant lesions (p<0.001, Table 1 Plate 2 A-F). Most of the benign lesions expressed cytoplasmic positivity. In NPC

127

Balaram et al: DNA damage repair proteins and viruses in NPC b. Effect of viral involvement

lesions, the expression of ATM protein was mainly nuclear with some cases showing both intense nuclear and mild to moderate cytoplasmic positivity. Increased expression of this protein was observed in all the less differentiated histological grade lesions and different stages of the disease (Table 1). No significant difference was observed in ATM protein expression in node positive and negative lesions suggesting that the expression of this protein is not directly related to invasion process.

Lesions showing higher expression than the arbitrarily fixed cut off of mean value in benign lesions +1 SD (1.84% in this case) were taken as cases of over expression. Accordingly, Chi-square analysis show EBV infection to be associated with a lower expression of this protein (84.5% of the lesions showing <1.84% positive cells being EBV+ve. p<0.001).

Figure 2. Survival graph showing

the difference in survival in DNAPKcs over expressing and those with low or normal expression group among NPC patients.

Table 3. Expression of proteins in relation to treatment response Variables

Treatment Response

ATM(total)

-Poor (Mean ± S.E). 16.60 ± 5.60

-Good (Mean ± S.E). 1.42 ± 1.40*

Virus – ve EBV alone + ve HPV alone +ve DNA-Pkcs (total)

2.00 ± 2.00 1.50 ± 1.50 43.75 ± 12.38*§ 23.96 ± 6.70

0.00# 0.00# 25.00 ± 25.00*§ 2.85 ± 2.03**

Virus – ve EBV alone + ve HPV alone +ve

6.00 ± 6.00 12.60 ± 7.03 46.25 ± 14.99*§ Recurrence +ve (Mean ± S.E).

12.50 ± 8.39 0.00# 0.00# Recurrence –ve (Mean ± S.E).

36.47 ± 9.07 27.04 ± 7.06

25.83 ± 16.9 0.0#

17.87 ± 6.38 49.22 ± 8.43**

3.00 ± 3.00 19.00 ± 19.00

27.89 ± 7.59 14.34 ± 5.16 0.0 34.83 ± 7.8**

8.33 ± 8.00 0.0# 9.70 ± 4.24 10.00 ± 10.00

DNA-PKcs(total) EBV-ve EBV+ve HPV-ve HPV+ve ATM(total) EBV-ve EBV+ve HPV-ve HPV+ve

128

Gene Therapy and Molecular Biology Vol 10, page 129 Table 4. Details of survival analysis of DNA-PKcs showing relation to disease-free survival and viral status. Variables

Protein Status

Mean survival time ± S.E.

95% CI

%Censor ed

p value (Log-rank test)

Total DNA-PKcs

48.57 ± 3.71 26.60 ± 4.66

41.30, 55.84 17.46, 35.73

76.74 52.94

0.0180

Stage 1 DNAPKcs Stage II DNAPKcs

+ +

45.84± 4.04 19.00± 1.04 41.25± 6.71 24.84± 5.64

37.92, 53.77 17.04, 20.96 28.10, 54.40 22.40, 28.75

75.00 78.00 80.00 75.00

Stage III DNAPKcs

34.57± 2.64

19.40, 29.75

57.14

13.50± 1.25

11.05, 15.95

50.00

Stage IV DNAPKcs

39.31± 5.86

27.81, 50.80

73.30

+ Virus -ve

24.37± 1.61 40.96 ± 4.94

21.23,27.52 31.27, 50.65

55.56 80.00

Viral Status

EBV- HPV+

40.93 ± 7.06

27.10, 54.77

64.29

EBV+ HPVEBV+HPV+

40.64 ± 3.59 26.83 ± 7.22

33.61, 47.68 12.67, 40.99

72.41 50.00

DNA-PKCs -ve

45.81 ± 3.39

39.17, 52.44

83.33

DNA-PKcs +ve

19.50 ± 2.96

13.20, 25.30

EBV+ve •

0.024

<0.001

Comparison between virus positive and negative groups

Plate 2. Immunohistochemical staining of NPC lesions showing staining with anti- ATM antibody (Santa Cruz) X 400. A. Benign Nasopharyngeal epithelium showing low nuclear positivity B. WHO type I lesion showing nuclear positivity (400X) C. WHO type II lesion showing nuclear positivity (400X) D. WHO type III lesions showing decreased nuclear positivity (400X) E. EBV+ WHO type II lesion with low percentage of nuclear positivity (400X) F. HPV+ WHO type II lesion showng high nuclear positivity (400X)

c. Correlation with clinico-pathological variables

d. Correlation with recurrence and response to treatment

Expression of ATM was observed to have no relation to the grade or stage of the disease or nodal status (Table 1).

Expression of ATM was lower in lesions (p=0.003) showing no recurrence and good response to treatment in

129

Balaram et al: DNA damage repair proteins and viruses in NPC comparison to that in the lesions showing recurrence and poor treatment response (Table 3). High expression of ATM, on the other hand, was associated with recurrence (r=0.389, p=0.001) (Table 3). Most HPV+ve lesions (69%) showed high expression of ATM while majority (84.5%) of the EBV+ve lesions showed low expression of this protein, the difference in the expression of this protein in relation to EBV and HPV being significantly different (Chi square p value <0.001) correlating very well with recurrence pattern (80%HPV+ve tumours vs 40% EBV +ve tumours showing recurrence) and the response to treatment (20% HPV+ve tumours vs 69.7% EBV+ve tumours showing good response to treatment). Expression of ATM, however, had no influence on the disease free survival of the patient (Kaplan Meier survival analysis p=0.608).

NPC cell lines and Glioblastoma multiforme tumors show a significant link between ATM expression and radiosensitivity (Hosoi et al, 1998; Vaganay-Juery et al, 2000; Wang et al, 2003). DNA-PKcs and ATM have been shown to play important roles in the life cycle of many viruses including HSV-1, adeno-associated virus and for viral integration to the host DNA (Parkinson et al, 1999; Graham et al, 2004; Somg et al, 2004). Many of the proteins of EBV and HPV viruses bind to the repair proteins and disrupt the repair mechanism (Han et al, 2001; Liu et al, 2004). LMP-1 and EBNA-LP of EBV inactivate p53 and downstream proteins while, and E6 and E7 of HPV inactivate p53 in addition to inhibitory effect on XRCC1, a protein central to DNA-single strand breaks. E6 HPV protein is also reported to increase the expression of N-methyl purine-DNA glycosylate, another DNA repair enzyme (Sohn et al, 2001; Iftner et al, 2002). This points towards the differential action of HPV proteins on various repair proteins. Recent studies show that cells over expressing HPV E6 can overcome G1 cell cycle check point induced by unrepaired DNA and also that transplantation of E6 and E7 cDNAs into SCID mice gives rise to aggressive radio-resistant tumours (Hampson, 2001). Interaction of ATM with viral proteins have not been studied in detail. Reyes et al, 2002 reported an association between ATM and EBV in laryngeal liomyosarcoma and jejunal leiomyoma in AT patients while Hirai et al, 2004 suggested alterations in ATM along with HPV 18 to be closely associated with oncogenesis in glassy cell carcinoma of the cervix. However, Hashiguchi et al, 2004 observed no relation between HPV and ATM in cervix cancer. In this study, EBV and HPV infections appeared to have opposing effect on the expression of DNA-PKcs and ATM. Majority of the EBV+ lesions had very low expression of DNA-PKcs and ATM and these had good response to therapy. This was in contrast to majority of the HPV lesions expressing high levels of these proteins and having poor prognosis. However, some of the HPV+cases with low levels of these proteins showed good response to therapy. Further, a positive correlation of DNA-PKcs expression (r=0.425, p<0.001) and ATM (r=0.433, p<0.001) was observed with poor treatment response. A similar effect of these proteins was also noticed with recurrence (DNA-PKcs vs recurrence r=0.402, p<0.001 and ATM vs recurrence r=0.389, p<0.001) and disease free survival (Table 4). Even though DNA-PKcs and ATM behaved similarly with respect to their expression and effect on recurrence and survival, expression DNAPKcs emerged out as an independent predictor of poor survival. The findings of this study thus suggest that downregulation of DNA-PKcs and ATM provides a therapeutic advantage to the patient and these are potential predictors of response to treatment, recurrence and disease free survival.

IV. Discussion NPC is considered a radio-sensitive tumour, the biologic reasons for which are not yet clear. The present study, however, observed only 58.3% patients to show a good response to therapy. DNA damage repair proteins are considered crucial in the response to radiation and reports on expression of DNA-PKcs and ATM, two crucial DNA damage repairing proteins, in cancers in relation to treatment response are varied. This study, to our knowledge, is the first study of expression pattern of DNA-PKcs and ATM in NPC. Studies using cell lines indicate the proficiency of DSB joining to be associated with expression of DNA-PKcs (Hashiguchi et al, 2004). It is also noticed that DNA-PKcs mutant cells exhibit higher sensitivity to ionizing radiation (Britten et al, 1999; Frit et al, 1999) and that higher levels of DNA-PKcs was associated with radio-resistance (Shen et al, 1997). Collis et al, 2003 demonstrated induction of radiosensitivity in cells administered siRNA targeted to DNA-PKcs. Studies conducted in tumours have, however, not been equivocal in the relation between expression of DNA-PKcs and response to radiotherapy. Reports in head and neck cancers, colon cancer, and esophageal cancers show no relationship of the protein to clinical presentation or the characteristics of the tumour (Bjork-Erikksson et al, 1999; Rigas et al, 2001; Noguchi et al, 2002). These studies support the results of the present study which showed a higher but statistically insignificant expression of DNAPKcs in NPC when taken as a group in comparison to benign epithelium. Down regulation/ upregulation of this protein was observed in some of the subgroups. Reports on expression pattern of ATM in HNSCCâ&#x20AC;&#x2122;s are scanty and this is the first study assessing the expression pattern of ATM in NPC. A recent study determined the expression of ATM protein in two NPC cell lines and observed that ATM protein was located in both karyon and cytoplasm, especially strongly expressed in karyon (Shen et al, 1997). Even though expression of ATM was higher in NPC tissues compared to benign lesions, in this study, no significant difference in expression was noticed in relation to the clinicopathological features. NPC lesions, however, showed a high rate of inactivation of ATM, with only 19% of the cancer lesions showing its presence. Previous studies in

Acknowledgments The authors wish to thank Indian Council of Medical Research (ICMR) and Science Technology and 130

Gene Therapy and Molecular Biology Vol 10, page 131 protein with single-strand break repair by interaction with XRCC1. EMBO J 21, 4741-8. Khanna KK (2000) Cancer risk and the ATM gene: a continuing debate. J Natl Cancer Inst 92, 795-802. Liu MT, Chen YR, Chen SC, Hu CY, Lin CS, Chang YT, Wang WB, Chen JY (2004) Epstein-Barr virus latent membrane protein 1 induces micronucleus formation, represses DNA repair and enhances sensitivity to DNA-damaging agents in human epithelial cells. Oncogene 23, 2531-9. Noguchi T, Shibata T, Fumoto S, Uchida Y, Mueller W, Takeno S (2002) DNA-PKcs expression in esophageal cancer as a predictor for chemoradiation therapeutic sensitivity. Ann Surg Oncol 9, 1017-22. Oppitz U, Bernthaler U, Schindler D, Sobeck A, Hoehn H, Platzer M, Rosenthal A, Flentje M (1999) Sequence analysis of the ATM gene in 20 patients with RTOG grade 3 or 4 acute and/or late tissue radiation side effects. Int J Radiat Oncol Biol Phys 44, 981-8. Parkinson J, Lees-Miller SP, Everett RD (1999) Herpes simplex virus type 1 immediate-early Protein vmw110 induces the proteasome-dependent degradation of the catalytic subunit of DNA-dependent protein kinase. J Virol 73, 650-7. Polischouk AG, Cedervall B, Ljungquist S, Flygare J, Hellgren D, Grenman R, Lewensohn R (1999) DNA double-strand break repair, DNA-PK, and DNA ligases in two human squamous carcinoma cell lines with different radiosensitivity. Int J Radiat Oncol Biol Phys 43, 191-8. Reyes C, Abuzaitoun O, De Jong A, Hanson C, Langston C (2002) Epstein-Barr virus-associated smooth muscle tumors in ataxia-telangiectasia: a case report and review. Hum Pathol 33, 133-6. Rigas B, Borgo S, Elhosseiny A, Balatsos V, Manika Z, Shinya H, Kurihara N, Go M, Lipkin M (2001) Decreased expression of DNA-dependent protein kinase, a DNA repair protein, during human colon carcinogenesis. Cancer Res 61, 8381-4. Shen H, Kauvar L, Tew KD (1997) Importance of glutathione and associated enzymes in drug response. Oncol Res 9, 295302. Shintani S, Mihara M, Li C, Nakahara Y, Hino S, Nakashiro K, Hamakawa H (2003) Up-regulation of DNA-dependent protein kinase correlates with radiation resistance in oral squamous cellcarcinoma. Cancer Sci 94, 894-900. Smith GC, Jackson SP (1999) The DNA-dependent protein kinase. Genes Dev 13, 916- 34. Sohn TJ, Kim NK, An HJ, Ko JJ, Hahn TR, Oh D, Lee SG, Roy R, Cha KY, Oh YK (2001) Gene amplification and expression of the DNA repair enzyme, N-methylpurine-DNA glycosylase. (MPG). in HPV-infected cervical neoplasias Anticancer Res 21, 2405-11. Song S, Lu Y, Choi YK, Han Y, Tang Q, Zhao G, Berns KI, Flotte TR (2004) DNA-dependent PK inhibits adenoassociated virus DNA integration. Proc Natl Acad Sci U S A 101, 2112-6. Vaganay-Juery S, Muller C, Marangoni E, Abdulkarim B, Deutsch E, Lambin P, Calsou P, Eschwege F, Salles B, Joiner M, Bourhis J (2000) Decreased DNA-PK activity in human cancer Cells exhibiting hypersensitivity to low-dose irradiation. Br J Cancer 83, 514-8. Vokes EE, Liebowitz DN, Weichselbaum RR (1997) Nasopharyngeal carcinoma. Lancet 350, 1087-91. Vokes EE, Weichselbaum RR, Lippman SM and Hong WK (1993) Medical progress in head and neck cancer. N Eng J Med 383, 184-94. Wang HM, Wu XY, Xia YF, Qian JY (2003) Expression of ATM protein in nasopharyngeal carcinoma cell lines with different radiosensitivity. Ai Zheng 22, 579-81.

Environment Committee (STEC) for providing financial support for this work.

References Becker-Catania SG, Gatti RA (2001) Ataxia-telangiectasia. Adv Exp Med Biol 495, 191-198. Bjork-Eriksson T, West C, Nilsson A, Magnusson B, Svensson M, Karlsson E, Slevin N, Lewensohn R, Mercke C (1999) The immunohistochemical expression of DNA-PKCS and Ku. (p70/p80). in head and neck cancers: relationships with radiosensitivity Int J Radiat Oncol Biol Phys 45, 1005-10. Britten RA, Kuny S, Perdue S (1999) Modification of nonconservative double-strand break. (DSB). rejoining activity after the induction of cisplatin resistance in human tumour cells Br J Cancer 79, 843-9. Collis SJ, Swartz MJ, Nelson WG, DeWeese TL (2003) Enhanced radiation and chemotherapy-mediated cell killing of human cancer cells by small inhibitory RNA silencing of DNA repair factors. Cancer Res 63, 1550-4. Efferth T, Grassmann R (2000) Impact of viral oncogenesis on responses to anti-cancer drugs and irradiation. Crit Rev Oncog 11, 165-87. Fandi A, Yanes B, Taamma A, Azli N, Armand JP, Dupuis O, Eschwege F, Schwaab G, Cvitkovic E (1994) Undifferentiated carcinoma of the nasopharynx: epidemiological, clinical and therapeutic aspects. Bull Cancer 81, 571-86. Frit P, Canitrot Y, Muller C, Foray N, Calsou P, Marangoni E, Bourhis J, Salles B (1999) Cross-resistance to ionizing radiation in a murine leukemic cell line resistant to cisdichlorodiammineplatinum(II): role of Ku autoantigen. Mol Pharmacol 56, 141-6. Graham KL, Gustin KE, Rivera C, Kuyumcu-Martinez NM, Choe SS, Lloyd RE, Sarnow P, Utz PJ (2004) Proteolytic cleavage of the catalytic subunit of DNA-dependent protein kinase during poliovirus infection. J Virol 78, 6313-21. Hampson L, El Hady ES, Moore JV, Kitchener H, Hampson IN (2001) The HPV16 E6 and E7 proteins and the radiation resistance of cervical carcinoma. FASEB J 15, 1445-7. Han I, Harada S, Weaver D, Xue Y, Lane W, Orstavik S, Skalhegg B, Kieff E (2001) EBNA-LP associates with cellular proteins including DNA-PK and HA95. J Virol 75, 2475-81. Hirai Y, Kawamata Y, Takeshima N, Furuta R, Kitagawa T, Kawaguchi T, Hasumi K, Sugai S, Noda T (2004) Conventional and array-based comparative genomic hybridization analyses of novel cell lines harboring HPV18 from glassy cell carcinoma of the uterine cervix. Int J Oncol 24, 977-86. Hashiguchi Y, Tsuda H, Nishimura S, Inoue T, Kawamura N, Yamamoto K (2004) Relationship between HPV typing and the status of G2 cell cycle regulators in cervical neoplasia. Oncol Rep 12, 587-91. Hosoi Y, Miyachi H, Matsumoto Y, Ikehata H, Komura J, Ishii K, Zhao HJ, Yoshida M, Takai Y, Yamada S, Suzuki N, Ono T (1998) A phosphatidylinositol 3-kinase inhibitor wortmannin induces radioresistant DNA synthesis and sensitizes cells to bleomycin and ionizing radiation. Int J Cancer 78, 642-7. Hui EP, Chan ATC, Pezzella F, Turley H, To Ka-Fai, Poon TCW, Zee B (2002) Co-expression of hypoxia-inducible factors 1" and 2 ", Carbonic Anhydrase IX, and Vascular Endothelial Growth Factor in Nasopharyngeal Carcinoma and Relationship to Survival. Clin Cancer Res 8, 25952604. Iftner T, Elbel M, Schopp B, Hiller T, Loizou JI, Caldecott KW, Stubenrauch F (2002) Interference of papillomavirus E6

131

Balaram et al: DNA damage repair proteins and viruses in NPC

132

Gene Therapy and Molecular Biology Vol 10, page 161 Gene Ther Mol Biol Vol 10, 161-164, 2006

The study of 16S rRNA in meningitis by molecular biology assay Review Article

Hossein Goudarzi*, Gita Eslami, Fatemeh Fallah, Bahram Kazemi Medicine faculty of Shaheed Beheshti Medical sciences of IRAN & Infectious Diseases & Tropical Medicine Research Center of SBMU of Iran

__________________________________________________________________________________ *Correspondence: Hossein Goudarzi, School of Microbiology, Modif Hospital, Shaheed, Beheshti, University, Tehran-Iran; e-mail: hgod100@yahoo.com Key words: 16srRNA, meningitis Abbreviations: cerebrospinal fluid, (CSF) Received: 20 July 2005; Revised: 12 December 2005 Accepted: 28 March 2006; electronically published: May 2006

Summary In order to treatment of patients with meningitis rapid diagnosis of agent is very important. Now all of researchers have approved qualification and efficiency of molecular tests. Detection of bacteria from cerebrospinal fluid (CSF) and blood is big cumbersome as atmosphere condition and usage of antibiotics by patients. We explored on CSF samples by PCR test and used DG74 and RDR80 primers for 16S rDNA sequence. Our cases are children with meningitis symptoms that had referred to hospitals at Tehran. This samples are different from culture, cell counter and protein glucose amounts. After researching we reached to these results that 23.5% of case were positive as bacterial culture and 41.1% of them were positive as PCR test. So sensitivity of PCR was95.23%, specificity of PCR was 96.66% and efficiency of PCR was 96%. drowziness, Vomiting, poor feeding, crying when handled, bulging fontanels (due to increased intravascular pressure) and febrile seizures. So, rapid identification is very impotant. Chemical tests and cell count of CSF in bacterial and viral meningitis is not 100% specific. The molecular methods in identification of microorganisms in clinical specimens have developed. One of these methods is PCR, we can use aseptic primer to multiply of unknown DNA. In our research we used 16S rDNA gene sequence for PCR. As 16srRNA sequence was constant during the evolution than to 23s and 5srRNA and approximately is identical in all of prokaryotes.

I. Introduction Rapid identification of bacterial meningitis is very important. Now, Isolation of bacteria from CSF or blood in 24 hours incubation is routine method, but some bacteria are fastidious, some patients have received antibiotic before sampling, so culture will be negative. Growth of bacteria depends on sampling and transfer condition too. Treatment of cell culture for identifying of viruses in some sample is very troublesome, expensive and requires to long time. Therefore we need a sensitive method to solve above problems. Meningitis is an acute lifeâ&#x20AC;&#x201C;threatening infection. The mortality rate is approximately 10-15% (depending on the bacteria involved), even with appropriate anti microbial therapy. The incidence of disease decreases with age. The prevalence of a particular etiologic agent is also related to patients ago. Clinical manifestations vary considerably depending on the virolence of the organism and the age of patient. In neonates the signs of meningeal irritation (neckal rigidity and Brudzinski and Kernigs signs are infrequent and often minimal when found early signs include temperature instability, poor feeding and vomiting. In children 1-18 month of age signs and symptoms are often nonspecific and include fever, irritability,

II. Material and Methods This research is descriptive. Sampling is done in Tehran pediatric hospitals from children with meningitis. Sampling method was lumbar puncture. All of tests such as bacteriologic, biochemistry cell count and PCR was done on sample in sterile condition. 200 Âľl of each sample in a micro tube is kept in 20!C. On remaining of CSF, the first is done gram staining, bacterial culture, cell count with hematocytometer, cell typing, considering protein and Glucose. Bacteriologic culture is blood agar, EMB and chocolate agar In PCR we use 2 type primers that are specific for 16S rRNASequence:

161

Goudarzi et al: The study of 16srRNA in meningitis by molecular biology assay DG 74: AGGAGGTATCCAACCGCA RDR 80: AACTGGAGGAAGGTGGGGAG PCR is done in Automatic Thermocycler. PCR has 3 process: i. Denaturation in 94!C ii. Annealing in 60!C iii. Extension in 72 !C These processes are repeated 30- 35 times. For each sample in micro tube, we use dNTP mixture, PCR buffer, MgCl2, 2pair primers, Taq polymerase and production of PCR electrophoresis on 2% gel.

IV. Discussion In this research, we use 16srRNA gene sequences of bacterial to identify bacterial infection on CSF specimens from children who refer to Tehrans hospitals. David Fredrics in 1999, used PCR method and 16srRNA sequence in sterile specimens such as blood, spinal fluid, specificity and sensitivity was more than 97% In 1998 Dagan et al, used PCR for identifying DNA of pneumococci in children and sera. Blood culture was positive 30% and sensitivity of PCR was 100%. In 1997 Tang et al, used this method for identifying of infectious disease such as gold standard. In 1996 Newcombe et al, used PCR for identifying meningococci in peripheral blood. In 1993 Greisen et al, used PCR for identifying of 102 bacteria species. Specificity and sensitivity was more than 96%. It is important to know that sterile fluid such as patient speciment that treatment with antibiotic, number of bacteria were low, some of bacteria were fastidious and need to an enrichment media and specific atmosphere, (for example CO2 or anaerobic) and some of this bacteria Sensitive to transport conditions. Therefore, we can t identify all of bacteria by culture and isolation of bacteria and we can t reach to desire results. In first group 8 speciment were positive PCR (88.8%). In second group, all of 12 specimens were positive PCR (100%).

III. Results Finding a rapid and specific test for identifying of bacterial meningitis, 51 CSF samples from children under 6 years in Mofid hospital from July to March were received 44.7%. Patients with meningitis were suspected to meningitis, 55.3% were negative for PCR. 34.2% of 44.7% suspected to bacterial meningitis and 10.5% suspected to viral meningitis. We studied about culture, cell count of CSF in children with meningitis that has been shown in Table 1.We found the positive culture of CSF in children with meningitis was 23.5%, Table 2.We resulted the frequency of positive PCR in CSF of children with meningitis 41.1%, Table 3.

Table 1. Result of culture, cell count in children with meningitis that refer to Mofid hospital in 2000 Method (%) 9 10.7 12 23.5

Cell count in LP

Culture

Manifestation of meningitis

N>L N>L

---Meningococcus Pneumococcus Haemophilus influenza

+ +

10.5

L>N

55.3

----

100

----

---N: Neutrophil, L: Lymphocyte

Table 2. The frequence of positive calture in children with meningitis refer to Mofid hospital in 2000. Frequent Culture Positive Negative Total

Number

Percent

12 39 51

23.5 46.5 100

23.5% of 51 specimens suspected to bacterial meningitis.

Table 3. The frequency of positive PCR in CSF of children with meningitis refer to Mofid hospital PCR Positive Negative Total

Number 21 30 51

162

Percent 41.1 58.9 100

Gene Therapy and Molecular Biology Vol 10, page 163 Greisen K, Loeffelholz M, Purohit A, Leong D (1994) PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J Clin Microbiol 32, 335-351. Harrisonn S (1998) Principal of internal medicine, 14ed. Vol 2 MC Grow. Hill company, 2419-2426. Newcombe J, Cartwright K, Palmer WH, McFadden J (1996) PCR of peripheral blood for diagnosis of meningococcal disease. J Clin Microbiol 34,1637-40. Read SJ, Jeffery KJ, Bangham CR (1997) Aseptic meningitis and encephalitis: the role of PCR in the diagnostic laboratory. J Clin Microbiol 35, 691-6. Snyder L, Champness W (1997) Molecular genetics of bacteria ASM, Washington DC. Stein JH (1998) Stein's Internal Medicine, 3th ed., John J. Hutton, John H. Klippel, Peter O. Kohler, Nicholas F. Larusso, John M. Eisenberg (Editor), 1281-1291. Tang YW, Procop GW, Persing DH (1997) Molecular diagnostics of infectious diseases. Clin Chem 43,2021-2038. Wiffiam J, Hauster Jr (1998) Max Sussman, Microbiology and Microbial infections, 9ed.

In third, 8 specimens suspected to viral meningitis, only one case was positive PCR, so it had bacterial agent. In fourth group, all of 22 specimens were negative PCR. There fore sensitivity and spesitivity of PCR test with 16S rDNA A gene sequence in identification of bacterial agent in CSF was 95.23% and 96.66%.

References Dagan R, Shriker O, Hazan I, Leibovitz E, Greenberg D, Schlaeffer F, Levy R (1998) Prospective study to determine clinical relevance of detection of pneumococcal DNA in sera of children by PCR. J Clin Microbiol 36, 669-73. Fredricks DN, Relman DA (1998) Improved amplification of microbial DNA from blood cultures by removal of the PCR inhibitor sodium polyanetholesulfonate. J Clin Microbiol 36, 2810-6. Fredricks DN, Relman DA (1999) Application of polymerase chain reaction to the diagnosis of infectious diseases. Clin Infect Dis 29, 475-86. Gelfand DH and White TJ (1998) In: PCR Protocols: A Guide to Methods and Applications, Innis MA, Gelfand DH, Sninsky JJ and White TJ, eds, Academic Press, San Diego, CA,

163

Goudarzi et al: The study of 16srRNA in meningitis by molecular biology assay

164

Gene Therapy and Molecular Biology Vol 10, page 41 Gene Ther Mol Biol Vol 10, 41-54, 2006

CDK inhibitors in 3D: Problems with the drugs, their development plans or their linkage to disease? Review Article

Andrew Hughes AstraZeneca, Alderley Park, Cheshire, UK

__________________________________________________________________________________ *Correspondence: Dr Andrew Hughes, AstraZeneca, Alderley Park, Macclesfield, Cheshire, UK; Tel: +44 (0)1625 512092; Fax: +44 (0)1625 590913; E-mail: andrew.hughes@astrazeneca.com Key words: CDK, CDK inhibitor, cell cycle, pRb, flavopiridol, UCN-01, CYC202, E7070, BMS 387032 Abbreviations: area under the curve, (AUC); chronic lymphocyctic leukaemia, (CLL); confidence interval, (CI); cyclin-dependent kinase, (CDK); dose-limiting toxicity, (DLT); maximum concentration, (Cmax); maximum tolerated dose, (MTD); non-small-cell lung cancer, (NSCLC); protein kinase C, (PKC); protein product, (p); Retinoblastoma, (Rb); steady-state concentration, (Css) Received: 12 May 2005; Accepted: 20 October 2005; electronically published: February 2006

Summary Targeting the cell cycle is an attractive anticancer strategy, as its dysregulation is a common, if not ubiquitous, occurrence in tumour development. Cell-cycle control is achieved by the interaction of a complex set of enzymes and other proteins, including the family of protein kinases known as cyclin-dependent kinases (CDKs) and the protein product of the tumour suppressor gene Retinoblastoma. CDKs are required for the orderly progression of cells through the cell cycle and hyperactivation of the CDKs in tumour development, as well as mutation and overexpression of these proteins, is common. Several compounds collectively known as ‘CDK inhibitors’ have been in clinical trials for a number of years. Although often grouped together, they differ in their molecular and cellular modes of action. Several agents in this group, such as flavopiridol, E7070 and UCN-01, have multiple CDK and nonCDK targets or inhibit upstream regulators of the CDKs, whereas other CDK inhibitors, such as CYC-202, appear to target CDK1 and CDK2 more specifically. Most CDK inhibitors are administered intravenously and various schedules have been explored in the clinic. Although generally well tolerated, CDK inhibitors as monotherapy have given mixed efficacy results, possibly due to problems related to specificity or in dosing/scheduling leading to suboptimal exposure. A lack of pharmacodynamic end points, together with the multiple cellular targets of some agents, has made the assessment of ‘CDK inhibition’ and its contribution to antitumour effect in the clinic difficult. However, recent pharmacokinetic studies are examining dosing and scheduling regimens, and novel markers of drug activity and patient suitability are being developed. In addition, newer, specifically targeted oral agents may prove more effective, less toxic and more amenable to optimisation in clinical trials.

regulatory checkpoint in the cell cycle is the G1/S transition and cell-cycle defects at this point are common in cancer. In contrast to G1, the length of the S, G2 and M phases in mammalian cells are relatively constant and transitions between these phases are principally controlled by intracellular regulatory pathways.

I. The cell cycle The cell cycle can be divided into four phases: synthesis (S phase) and mitosis (M phase) preceded by two preparatory or gap phases, G1 and G2 (Figure 1). DNA is replicated during the S phase and the fully replicated chromosomes are segregated to each of the two daughter nuclei in the M phase. During G1 and G2, the synthesis of cellular constituents needed to support the subsequent phases, and ultimately to complete cell division, occurs. In mammalian cells, the length of the G1 phase is highly variable and can range from about 6 hours to several days or longer. Cells that persist in G1 can enter a distinct state called G0, in which they are metabolically active but not actively proliferating, and can re-enter the cell cycle or remain in G0 indefinitely. The major

A. Cell-cycle regulation A complex set of enzymes and other proteins, including the family of cyclin-dependent kinases (CDKs) and the protein product (p) of the tumour suppressor Retinoblastoma susceptibility gene (Rb), regulates progression through the cell cycle. To make the transition from G 1 to S phase, normal cells require mitogenic growth signals such as diffusible growth factors, extracellular

Hughes: CDK inhibitors in 3D matrix components or cell-cell interaction/adhesion molecules. Many growth signalling pathways are channelled though pRb, which, in its unphosphorylated state, sequesters and inactivates E2F, which is required for activation of multiple cell-cycle related transcription factors (Hanahan and Weinberg, 2000; Harbour et al, 1999; Sherr, 2000). When pRb is phosphorylated, E2F is released; thus, pRb plays a central role in G1/S transition. Phosphorylation of pRb during G1 requires the activation of CDKs: first CDK4, 6/cyclin D, then by CDK2/cyclin E (Figure 2) (Swanton, 2004). Hyperphosphorylated pRb can no longer repress E2F, which is then able to activate

genes required for the S phase. Once in S phase, cells are able to continue the cell division process without extracellular mitogens, although it has been proposed that regulatory checkpoints are still enforced by the requirement for activated CDK2/cyclin A and CDK1/cyclin B complexes in the S/G2 and G2/M transitions, respectively (Figure 2), although the need for activated CDK2 in this process is unclear: tumour cells deficient in CDK2 protein and kinase activity have recently been shown to proliferate normally (Gladden and Diehl, 2003; Hinds, 2003).

Figure 1. The cell cycle. Figure 2. Key drivers of the cell cycle and points at which CDK inhibitors are active. Growth-factor-mediated activation of CDK4, 6/cyclin D and the subsequent phosphorylation of pRb are major events in progressing the cell from G1 to S, via the restriction checkpoint R.

Gene Therapy and Molecular Biology Vol 10, page 43 Synthesis of cyclins occurs at specific times during the cell cycle or, in the case of cyclin D1, in response to certain growth factors. CDKs depend on cyclins for their activity: the active CDK holoenzyme is composed of a catalytic subunit and the cyclin regulatory subunit. Since each cyclin is synthesised at a particular stage of the cell cycle, it in turn directs the appropriate activation of its specific catalytic subunit (Harbour et al, 1999). Another level of regulation is conferred by endogenous â&#x20AC;&#x2DC;CDK inhibitorsâ&#x20AC;&#x2122;, which can inhibit assembly or activation of the cyclin/CDK complex. Endogenous CDK inhibitors are primarily involved in the control of the G1 and S phases, and fall into two distinct classes: one class specifically inhibits CDK4/cyclin D or CDK6/cyclin D and includes p16INK4A, p15INK4B, p18INK4C and p19INK4D, and the other class inhibits multiple CDKs and includes p21CIP1, p27 KIP1 and p57KIP2 (Sherr, 2000). Mutations that disable key regulators of G1 phase progression are common in cancer, and loss of regulation of the G1/S transition occurs in most types of human tumour (Sherr, 2000; Senderowicz, 2002). The CDK/pRb pathway, crucial in regulating G1 progression, can be seen as comprising two oncogenes (cyclins D and E) and two tumour suppressor genes (Rb and p16). Disruption of the CDK/pRb pathway can result from direct mutational inactivation of pRb function, overexpression of CDKs, via mutations in CDKs that render them unresponsive to negative regulators such as p14INK4A, through dysregulation of CDK inhibitors, or through loss or methylation of p16INK4B (Hanahan and Weinberg, 2000; Sherr, 2000). Lesions in the CDK/pRb pathway occur frequently, and increased expression of cyclin E and/or loss of p16 carry a poor prognostic significance in many common forms of cancer (Sherr, 2000).

II. CDK development

inhibitors

which leads to inhibition of transcription and the induction of apoptosis (Senderowicz, 2003a; White et al, 2004; McClue et al, 2002). BMS-387032 is an inhibitor of CDK2/cyclin E, with modest potency against CDK1/cyclin E and CDK4/cyclin D (Senderowicz, 2003b; Shapiro et al, 2003). UCN-01, a hydroxylated derivative of staurosporine, is a non-specific inhibitor of protein kinases with activity against protein kinase C (PKC) and CDKs. UCN-01 causes inhibition or inappropriate activation of CDK1/cdc2, G1 arrest, abrogation of the G2 and S checkpoints, inhibition of PDK1/Akt (phosphoinositidedependent kinase 1/Akt, a pathway that plays a pivotal role in malignant transformation) and PKC-independent induction of apoptosis (Senderowicz, 2003a; Senderowicz, 2003b). E7070 is a synthetic sulphonamide compound that does not directly inhibit CDKs but causes G 1 arrest in vitro by inducing depletion of CDK2/cyclin E and repressing transcription of cyclin H, leading to reduced CDK7/CDK activating kinase activity and hypophosphorylation of pRb (Senderowicz, 2003b; Terret et al, 2003; Haddad et al, 2004).

III. CDK inhibitors in the clinic: the data and the drawbacks Flavopiridol, UCN-01, E7070, CYC202 and BMS387032 are currently under clinical evaluation.

A. Flavopiridol Flavopiridol entered clinical trials in 1996 and is the most intensively studied of the CDK inhibitors in the clinic. It is administered intravenously and various schedules have been investigated in clinical trials (Table 2).

clinical 1. 72-hour infusion Q14d Phase I trials identified a maximum tolerated dose (MTD) of 40-50 mg/m2/day when flavopiridol was administered as a 72-hour continuous intravenous infusion every 2 weeks (Table 2) (Thomas et al, 1997; Senderowicz et al, 1998; Thomas et al, 2002). The doselimiting toxicity (DLT) in these trials was secretory diarrhoea, and some antitumour activity was seen in patients with renal cancer (one partial response) and metastatic gastric cancer (one complete response). Phase II trials of flavopiridol have further defined the safety profile of this schedule but have failed to demonstrate significant single-agent activity in any tumour setting investigated. Trials have explored the 72-hour continuous intravenous infusion regimen using a dose of 50 mg/m2/day in patients with a variety of tumours, including previously untreated stage IV non-small-cell lung cancer (NSCLC), advanced gastric carcinoma and metastatic renal cancer (Stadler et al, 2000; Schwartz et al, 2001; Shapiro et al, 2001). However, response rates were low: objective responses were seen in only 2 of 35 (6%) patients with renal cancer (Stadler et al, 2000), although protracted stable disease (!12 weeks) was seen in 6 (30%) of the patients with NSCLC. The median overall survival for the 20 patients who received treatment was 7.5 months

The identification of CDKs as targets for cancer therapy has led to the development of many inhibitors of CDK activity (Senderowicz, 2003a; Senderowicz, 2003b; Dai and Grant, 2003), several of which are in clinical trials (Table 1). These agents differ markedly in their modes of action and several agents that are classed as CDK inhibitors have additional effects on other cellular processes. Examples of direct CDK inhibitors that target the adenosine triphosphate binding site of CDKs (among other reported effects) include flavopiridol (NSC-649890) and CYC202 (NSC-701554; roscovitine). In contrast, indirect CDK inhibitors, including UCN-01 and E7070 (Indisulam), affect CDK function due to inhibition of upstream pathways required for CDK activation. Flavopiridol exerts a number of effects on tumour cells. In addition to inhibiting multiple CDKs, principally 4 and 6 or 1 and 2, causing G1/S or G2/M arrest, respectively, flavopiridol causes transcriptional inhibition following disruption of P-TEFb (the CDK9/cyclin T complex), induction of apoptosis (possibly a consequence of downregulation of various anti-apoptotic proteins) and anti-angiogenic effects (Senderowicz, 2002). CYC202 is an orally active inhibitor of CDK1 and CDK2/cyclin E,

Hughes: CDK inhibitors in 3D Table 1. CDK inhibitors in clinical development Agent

Company/ collaborator

Target

Effect

Flavopiridol (NSC-649890) UCN-01

Aventis/NCI

Multiple CDKs including CDKs 1/2/4/6 PKC and CDKs including CDK1/cdc2, PDK1/Akt Depletion of CDK2/cyclin E; transcriptional repression of cyclin H CDKs 1/2; also activity against CDKs 5/7/9

Cell-cycle arrest in G1 and G2 Abrogation of G2 and S checkpoints; apoptosis G1 arrest

CDK2/cyclinE; also activity against CDK1/cyclin E + CDK4/cyclin D

E7070 (Indisulam) CYC202 (NSC-701554, roscovitine) BMS-387032

Kyowa Hakko Kogyo/NCI Eisai/EORTC Cyclacel Bristol Myers Squibb

Entered clinical trials 1996

Current development phase II

1997

1998

Cell-cycle stageindependent apoptosis

2000

G1 arrest

2003

NCI, National Cancer Institute; EORTC, European Organisation for Research and Treatment of Cancer

Table 2. Results from Phase I dose-escalation trials of flavopiridol Schedule

Dose, mg/m2/day

Pts, n

DLT

72-hour CII

Every 2 weeks

Unknown

Secretory diarrhoea

RD, mg/m2/day 50 78a

Reference

72-hour CII

Every 2 weeks

Diarrhoea

1-hour infusion 1-hour infusion 1-hour infusion

Once every 3 weeks 3 days every 3 weeks 3 days every 3 weeks

8, 16, 26.6, 40, 50, 56 62.5 or 78

Neutropenia

62.5

Senderowicz et al, 1998; Rudek et al, 2003 Thomas et al, 2002 Tan et al, 2002

50 or 62.5

Neutropenia

Tan et al, 2002

50 or 62.5

Senderowicz et al, 2000

1-hour infusion

5 days every 3 weeks

12-52.5

37.5

Senderowicz et al, 2000

1-hour infusion

5 days every 3 weeks

12-52.5

37.5

Tan et al, 2002

24-hour infusion

1 day/week for 4 weeks

40-100

Sasaki et al, 2002

30-minute iv infusion + 4hour infusion

1 day/week for 4 weeks every 6 weeks

60 (30+30)80 (40+40)

Nausea/vomiting,b neutropenia, fatigue, hepatotoxicity Nausea/vomiting,b neutropenia, fatigue Neutropenia, fatigue, hypotension, hypoalbuminaemi a Multiple colon ulcers, abdominal pain, abdominal distention Acute tumour lysis syndrome

60 (30+30)

Byrd et 2004b

al,

With antidiarrhoeal prophylaxis using loperamide and cholestyramine bAvoided subsequently with metoclopramide/granisetron iv, intravenous; RD, recommended dose for Phase II trials; CII, continuous intravenous infusion

(Shapiro et al, 2001), which may indicate a possible survival advantage in advanced NSCLC, although further

trials are needed to confirm this. An unexpectedly high

Gene Therapy and Molecular Biology Vol 10, page 45 treated with flavopiridol at doses of 12-52.5 mg/m 2/day for 5 days, 50 and 62.5 mg/m 2/day for 3 days, and 62.5 and 78 mg/m2/day for 1 day (Tan et al, 2002). Of 50 assessable patients, 12 had stable disease for !3 months with a median duration of 6 months. The recommended doses of flavopiridol as a 1-hour infusion were 37.5 mg/m2/day for 5 days, 50 mg/m 2/day for 3 days and 62.5 mg/m2/day for 1 day (Table 2). Another Phase I study with 12-62.5 mg/m2/day for 3 or 5 days every 3 weeks in patients with advanced neoplasms obtained similar results (Table 2); stable disease for >6 months was seen in 3/36 patients (Senderowicz et al, 2000). On the basis of these data, several Phase II trials (some still ongoing) have been started using a 1-hour infusion for 3 or 5 days every 3 weeks. Seventeen patients with incurable malignant melanoma were administered flavopiridol 50 mg/m2 over 1 hour daily for 3 consecutive days every 3 weeks. The schedule was well tolerated, with the most common treatment-related non-haematological toxicities being diarrhoea (82%), nausea (47%) and fatigue (41%) (Burdette-Radoux et al, 2004). Haematological toxicities were minor (grade 1 or 2). However, in 16 evaluable patients, no objective responses were documented, although 7 patients (44%) had stable disease after 2 cycles, with a median duration of 2.8 months (range 1.8-9.2). In another Phase II trial, 18 patients with refractory multiple myeloma were treated on a 3 days/21day cycle; however, the trial was stopped at interim analysis when 15 patients had progressed and 3 patients had discontinued due to toxicity (Dispenzieri et al, 2004). The authors considered that, on this schedule and in this setting, flavopiridol as a single agent lacked activity. Other trials are ongoing but so far, in solid tumours, 1-hour infusion schedules have failed to improve on the poor efficacy rates seen with the 72-hour continuous intravenous infusion schedules. Recent data have demonstrated, in a haematological tumour, that scheduling can make a difference to both efficacy and toxicity (Byrd et al, 2004a). Sequential Phase II studies in CLL compared schedules of 72 hours (reported above) versus 1 hour in previously treated patients. Patients in the second trial received up to eight cycles of flavopiridol 50 mg/m2 as a 1-hour intravenous infusion daily for 3 days every 3 weeks. Of 36 patients, 13 (36%) had intermediate- and 23 (64%) had high-risk disease. Four patients (11%) had partial responses, 19 (53%) had stable disease and 13 (36%) progressed on treatment. Progression-free survival ranged from 2.9-19.3 months in responders, with a median of 3.2 months (95% CI 2.5-7.4); median overall survival was 24 months (95% CI 18-31). Toxicity was manageable and included mainly myelosuppression (granulocytopenia and thrombocytopenia), infections, diarrhoea and fatigue. Grade 3 and 4 toxicities were 39% and 33%, respectively. The authors concluded that flavopiridol has modest, schedule-dependent clinical activity in relapsed CLL and warrants future investigation using alternative schedules of administration.

frequency of thrombotic events was seen in two of these trials (Schwartz et al, 2001). In 36 patients with metastatic hormone-refractory prostate cancer, receiving treatment every 14 days at the starting dose of 40 mg/m2/day, dose escalation up to 60 mg/m2/day was permitted if no significant toxicity was observed (Sumitomo et al, 2004). In 22 evaluable patients there were no objective responses and evidence of stable disease in only 4 patients (16-48 weeks). The most common toxicities were diarrhoea (predominantly grades 1 and 2) and nausea. The authors concluded that, in light of disappointing single-agent activity, the use of flavopiridol in prostate cancer should be reserved for evaluation in combination therapies or alternative schedules. Twenty chemotherapy-na誰ve patients with previously untreated advanced colorectal cancer received flavopiridol at a dose of 50 mg/m2/day every 14 days (Aklilu et al, 2003). The most common grade 3/4 toxicities were diarrhoea, fatigue and hyperglycaemia, occurring in 21%, 11% and 11% of patients, respectively; other common toxicities included anaemia, anorexia and nausea/vomiting. Again, single-agent activity was disappointing, with no objective responses, a median time to progression of 8 weeks and median survival of 65 weeks, leading the authors to conclude that flavopiridol in this dose and schedule does not have single-agent activity in patients with advanced colorectal cancer. Cyclin D1 is overexpressed in 95-100% of cases of mantle cell lymphoma. In a small study, 10 patients with relapsed or refractory mantle cell lymphoma were treated with flavopiridol 50 mg/m2/day (Lin et al, 2002). One patient developed grade 3/4 non-haematological toxicity. There were no clinical responses. Three patients maintained stable disease and disease progressed within 2 months in seven patients. The authors concluded that flavopiridol was ineffective as a single agent with this schedule in this setting (Byrd et al, 2004a). Sequential Phase II studies in chronic lymphocytic leukaemia (CLL) have compared bolus schedules in previously treated patients (Byrd et al, 2004a). Patients received up to six cycles of flavopiridol (50 mg/m2 daily) as a continuous intravenous infusion over 72 hours every 2 weeks. Of 15 patients, 6 (40%) had intermediate- (Rai stage I or II) and 9 (60%) had high-risk (Rai stage III and IV) stages. No responses were noted in this group but 27% had stable disease and 73% had progressive disease. The median progression-free survival was 2.1 months (95% confidence interval [CI] 1.8-3.8) and the median overall survival was 27 months (95% CI 20-42). Grade 3 and 4 toxicities were 20% and 27%, respectively. This 72-hour schedule proved to have only moderate efficacy compared with a 1-hour schedule (Byrd et al, 2004a) reported below.

2. 1-hour infusion schedules: daily 1, 3 or 5 Q21d In an attempt to achieve high peak plasma concentrations, flavopiridol has been given as a 1-hour infusion for 1, 3 or 5 consecutive days every 3 weeks (Table 2) (Senderowicz et al, 2000; Tan et al, 2002). In a Phase I study, 55 patients with advanced cancer were 45

Hughes: CDK inhibitors in 3D

3. 24-hour infusion continuous infusion Q7d

schedules:

24-hour

curves show a marked reduction in plasma concentration after the 72-hour infusion period, to <10% of steady-state levels at 120 hours. Thus, for this regimen given every 2 weeks, putative efficacious concentrations (from in vitro predictions) of drug are only obtained for approximately 21% of the time. For the 1-hour infusion regimens, pharmacokinetic assays showed that, at the doses of 37.5 mg/m2/day for 5 days and 50 mg/m2/day for 3 days, mean plasma concentrations reached the micromolar range (Tan et al, 2002). However, following infusion, plasma concentrations fell rapidly and were at the submicromolar level within a further 2 hours. Therefore, efficacious concentrations of drug are only obtained for a fraction of the 3 or 5 days of administration, which, in the 3-week scheduling period, cover 14% and 24% of the time spent on drug, respectively. Thus, exposure to flavopiridol has been markedly transient in all reported trials, which may account for the limited antitumour effects observed. Given the frequency of thrombotic events seen with the 72-hour continuous intravenous infusion regimen at the recommended dose, there would appear to be limited room for improving the therapeutic index for this agent when administered intravenously. In addition, flavopiridol is highly protein-bound in serum (a mean unbound fraction of 6% across the concentration range [622-4977 nM]; data not given for lower concentrations) (Rudek et al, 2003). This factor may further accentuate variability in pharmacokinetic exposure to free concentrations of flavopiridol in patients with altered serum protein concentrations.

Flavopiridol is also being investigated in Phase II trials with a 24-hour infusion schedule. A rising-doseescalation Phase I study established an MTD of 80 mg/m2/day with abdominal pain and distension as the DLTs (Sasaki et al, 2002). Of 20 evaluable patients, 5 showed durable stable disease (>90 days) and 4 a reduction in tumour markers, although no patient had an objective response. The authors considered these data to be encouraging.

4. Loading dose plus infusion scheduling Recently reported data have suggested that, at least in a haematological malignancy, a pharmacokinetically modelled schedule in which a dose split equally between a 30-minute loading dose and a following 4-hour continuous intravenous infusion has significant clinical activity (Byrd et al, 2004b). Due to the high plasma protein binding of flavopiridol (approximately 95%), a 30-minute â&#x20AC;&#x2DC;loading doseâ&#x20AC;&#x2122; that achieves saturation of protein binding followed by a 4-hour infusion designed to achieve free drug concentrations above those active in vitro is being used. A Phase I study in genetically high-risk patients with refractory CLL reached DLT of tumour lysis syndrome at 80 mg/m2 with one treatment-associated death. Twentytwo patients were evaluable for response. Nine patients (41%) achieved a partial response; of these, seven remain in remission (3-11+ months) and two relapsed at 7 and 12 months, respectively; eight of the nine patients were refractory to fludarabine. The authors suggested that their data support the hypothesis that efficacy and toxicity are maximum concentration (Cmax)-, area under the curve (AUC)- and steady-state concentration (Css)-related and that this schedule provides clinically relevant activity. These results support the intriguing hypothesis that the lack of efficacy previously seen with flavopiridol monotherapy is due to inadequate free drug concentrations, rather than CDK inhibition having no effect on tumour growth. Further exploration of this schedule in non-haematological malignancies is eagerly awaited.

B. UCN-01 1. Continuous infusion schedules: 72 hours Q14 days; 36 hours Q28 days In the first clinical trial with UCN-01, the initial schedule was a 72-hour continuous intravenous infusion every 2 weeks, starting at a dose of 1.8 mg/m2/day. Surprisingly, in the first nine patients, the half-life of UCN-01 appeared to be 100-fold longer than that observed in preclinical models (Sausville et al, 2001). Therefore, the treatment schedule was altered to a 36-hour continuous intravenous infusion of 12 mg/m2/day every 4 weeks, received by a further 38 patients (Sausville et al, 2001). DLTs at 53 mg/m2/day included nausea/vomiting, symptomatic hyperglycaemia and pulmonary toxicity. Findings included a very long mean half-life (approximately 588 hours), a result that was supported in a preliminary report of a Phase I study in Japanese patients (Tamura et al, 1999). A partial response was observed in a patient with melanoma, and a long period of stable disease (>2.5 years) was seen in a patient with refractory anaplastic large-cell lymphoma (Sausville et al, 2001). Target modulation by UCN-01 was assessed by the level of phosphorylation of the PKC substrate adducin in bone marrow and tumour samples taken during UCN-01 treatment: this was significantly reduced compared with pretreatment samples. The authors concluded that UCN-01 can be administered safely and effectively, with a recommended dose of 42.5 mg/m2/day for an initial 72-

5. Exposure to flavopiridol in the various schedules Rudek and colleagues analysed the clinical pharmacology data for flavopiridol from one of the Phase I trials (Thomas et al, 1997; Senderowicz et al, 1998) in which 76 patients were treated with a 72-hour infusion of flavopiridol at 13 dose levels for a total of 504 cycles of treatment (Rudek et al, 2003). Serial plasma samples were collected and analysed by high-performance liquid chromatography. The average Css was 26.5 and 253 nM at 4 and 122.5 mg/m2, respectively. No clear relationship was identified between dose or concentration of flavopiridol and the DLT, secretory diarrhoea. At 50 and 78 mg/m2/day, the mean plasma Css was 278 and 390 nM; concentrations that are well above those noted for in vitro antiproliferative activity. However, samples were collected for only 2 days post-infusion, and concentration/time

Gene Therapy and Molecular Biology Vol 10, page 47 hour continuous intravenous infusion with subsequent monthly doses administered as 36-hour infusions.

results as truly reflecting the effects of CDK inhibition in humans (Sausville et al, 2001). Preclinical models failed to predict the hyperglycaemia seen in patients receiving UCN-01. This may be an effect of Akt or CDK5 blockade and is considered to be related to the development of tissue insulin resistance. In the affected patient, hyperosmolar, non-ketoic rises in blood glucose can often require 2 days of insulin infusion to reverse and an expert endocrinologist is required to monitor the patient.

2. Short infusion schedules: 1 hour Q28 days; 3 hours Q28 days; 3 hours Q21 days In view of the extended half-life of UCN-01, a Phase I study was conducted to evaluate a short infusion time (13 hours) every 28 days. Preliminary data from this trial reported on 6 dose levels ranging from 3 mg/m2 over 3 hours to 95 mg/m2 over 1 hour in 15 patients with various tumour types (Dees et al, 2000). At doses "68 mg/m2 over 1 hour, toxicity was mild and reversible; however, at 95 mg/m2 over 1 hour, dose-limiting hypotension with syncope and reversible respiratory arrest occurred in one patient. This was considered to be related to rapid infusion; therefore, the duration of infusion was lengthened to 3 hours at that dose level. There had been no responses at the time of reporting. In a Phase II trial in metastatic renal-cell carcinoma, patients received UCN-01 intravenously every 3 weeks, and, because of the cytostatic mechanism of UCN-01, time to disease progression was adopted as the primary end point (Shaw et al, 2003). Therapy was well tolerated, with infusional reactions including nausea, headache and hyperglycaemia (all grade 2 or below) observed within 48 hours after treatment. At the time of a preliminary report, 15 patients (median of 1 prior systemic treatment) had been treated; median time to progression was 80 days and no patient had achieved an objective response. Therefore, UCN-01 appears to have limited activity in metastatic renal-cell carcinoma. A Phase II study of UCN-01 monotherapy (3-hour Q21d) in patients with metastatic melanoma is ongoing, as are several trials in combination with cisplatin and other DNA-damaging agents, seeking to exploit the activity of UCN-01as an inhibitor of the G2 DNA damage checkpoint kinase Chk1. The attributes of UCN-01 as an inhibitor of several cellular proteins, including Akt, Chk1, CDKs and PKC, make it an interesting agent for study but lead to difficulties in its clinical optimisation. These additional activities confound the interpretation of clinical trial

3. Exposure to UCN-01 Surprisingly, in the first patients exposed over 72 hours, the half-life of UCN-01 (approximately 588 hours) appeared to be 100-fold longer than that observed in preclinical models, and high total drug plasma concentration (30-40 ÂľM) (Sausville et al, 2001). In addition, the initial concentrations achieved in plasma were high (approximately 4-7 mM), well above those found to be lethal in animal models (Fuse et al, 2000). A preliminary pharmacokinetic analysis (n=14) of the 1-3hour schedule also showed a long mean half-life (approximately 550 hours), and that exposure increased roughly proportionally with dose (Dees et al, 2000). However, the extended half-life and high plasma concentrations are thought to be due largely to strong binding of UCN-01 to plasma 1-acidic glycoprotein, which may render the agent inactive. Indeed, at the end of 72-hour infusions of doses of 25-55 mg/m2/day, plasma concentrations of 20-60 ÂľM were observed; however, saliva concentrations, used as a surrogate measure of effective free drug, were !100-fold lower (Senderowicz, 2002).

C. E7070 Four Phase I dose-escalating clinical trials (summarised in Table 3) using different infusion schedules in patients with advanced solid tumours have been appraised.

Table 3. Results from Phase I dose-escalation trials of E7070 Schedule 5-day CII every 3 weeks 5-day CII every 3 weeks

Dose 6-200 mg/m2/day

Pts, n 27

10-160 mg/m2/day

1 hour/week for 4 consecutive weeks 1 hour every 3 weeks

80-500 mg/m2/week

501000 mg/m2/week

DLT Neutropenia, thrombocytopenia Febrile neutropenia, thrombocytopenia, diarrhoea, skin folliculitis, asthenia, stomatitis Neutropenia, thrombocytopenia Neutropenia, thrombocytopenia, anaemia

RD, recommended dose for Phase II trials; CII, continuous intravenous infusion

RD 96 mg/m2/day 130 mg/m2/day

400 mg/m2/week 700 mg/m2/week

Reference Terret et al, 2003 Punt et al, 2001 Dittrich et al, 2003 Raymond et al, 2000

Hughes: CDK inhibitors in 3D

1. Continuous infusion schedule: continuous intravenous infusion 5d Q21d

seen, although there was one durable minor response. The recommended Phase II dose was 800 mg/m2. A Phase II study with this schedule has recently been reported: patients with advanced head-and-neck cancer received 700 mg/m2 over 1 hour every 3 weeks (Haddad et al, 2004). Thirty-nine cycles of E7070 were delivered (median 2.6 cycles/patient), six patients had stable disease after two cycles, and two patients each subsequently received one, two and three additional cycles, respectively, before experiencing progression. However, none of the first 15 patients achieved progression-free survival of >4 months and the trial was stopped prematurely. Nevertheless, immunohistochemistry of tumour cell aspirates from three patients demonstrated reduced posttreatment pRb phosphorylation, suggesting that CDK activity can be inhibited by E7070 in tumour cells. The authors suggested that more frequent administration of E7070 may be required to sustain pRb hypophosphorylation and cytostatic growth arrest.

A Phase I study in 27 patients given doses ranging from 6-200 mg/m 2/day by continuous intravenous infusion for 5 days every 3 weeks showed that E7070 has a nonlinear pharmacokinetic profile, particularly at dose levels >24 mg/m2/day, with a reduction in clearance and an increase in half-life (Terret et al, 2003). This was associated with toxicity, and the risk of myelosuppression became significant at AUC levels >4000 Âľg h/mL. DLTs were dose-dependent reversible neutropenia and thrombocytopenia, and the recommended dose for further studies was 96 mg/m2/day when administered in this schedule. However, no objective responses were observed.

2. 1-hour infusion schedules: daily 5 Q21d; weekly 4 Q6weeks; 1 Q21d E7070 has been administered to 33 patients with advanced cancer as a 1-hour intravenous daily infusion for 5 days once every 3 weeks (dose escalation from 10 mg/m2/day) (Punt et al, 2001). DLTs occurred at doses of 160 and 200 mg/m2/day, consisting of febrile neutropenia, thrombocytopenia, diarrhoea, skin folliculitis, asthenia and stomatitis. A partial response was observed in a patient with heavily pretreated breast cancer, and stable disease and some minor responses were also documented. The recommended dose for further studies at this dailytimes-five schedule was 130 mg/m2/day. In an alternative schedule, two cohorts of patients with different prognoses and different degrees of hepatic involvement received 1-hour intravenous E7070 at weekly intervals for 4 consecutive weeks every 6 weeks (Dittrich et al, 2003). The MTD was 500 mg/m2/week for both groups, with reversible neutropenia and thrombocytopenia being the most common DLTs. The pharmacokinetics of E7070 were non-linear over the dose range 160-500 mg/m2. A partial response was observed in a patient with an endometrial adenocarcinoma, and 12 other patients (27%) had stable disease (median duration 5.3 months [range 1.9-30.6]), including one patient with metastatic melanoma. The recommended dose for further study of E7070 using this schedule is 400 mg/m2/week. A further schedule comprising a 1-hour infusion given every 3 weeks has been reported. In a doseescalating Phase I study patients (n=30) with advanced cancer received E7070 from a dose of 50 mg/m2 (Raymond et al, 2000). Pharmacokinetic parameters were again found to be non-linear. Antitumour activity was seen in patients with adenocarcinoma of unknown origin, renal and breast cancers. The MTD was 800 mg/m2, with haematological DLTs. However, this dose was recommended for less heavily pretreated patients with lower tumour burden and hepatic involvement, while 700 mg/m2 was recommended for more heavily pretreated patients. The same schedule has been reported in 21 Japanese patients (Yamada et al, 2004). In this study, an MTD of 900 mg/m2 was established and DLT was myelosuppression. The severity of myelosuppression correlated with exposure, which was in turn related to mutational status of CYP2C19, commonly polymorphic in the Japanese population. No objective responses were

3. Exposure to E7070 in the various schedules Van Kesteren and colleagues (2002) have summarised population pharmacokinetic analyses of the four Phase I studies described. Data show that, following a 1-hour infusion of 700 mg/m2, plasma concentrations of E7070 remain well above 1 mg/L for >100 hours postdose. With daily-times-five 1-hour infusion or with 120hour continuous intravenous infusion at 160 mg/m2/day, this also applies, giving a period of 10 days in the 3-week schedule where plasma E7070 is in the mg/L range. Plasma concentration-time data of patients from all four studies (n=143) were best described using a threecompartment model with non-linear distribution to a peripheral compartment and two parallel pathways of elimination from the central compartment: a linear and a saturable pathway. Unusually for an anticancer agent, body-surface area was significantly correlated to both the volume of distribution of the central compartment and to the maximum elimination capacity, and these authors recommend body-surface-area-guided dosing for E7070. In summary, E7070 has shown some antitumour activity but limited Phase II data in patients with squamous-cell carcinoma of the head and neck have not supported Phase I results. Dosing, typically by 1 hour daily or continuous intravenous infusion over 3-5 days every 3 weeks, has led to plasma concentrations in the ÂľM or mg/L range, but intermittent dosing has led to transient exposure (Van Kesteren et al, 2002), in common with flavopiridol. However, E7070 has a long half-life compared with other agents, and as its activity at low concentrations in preclinical models is dependent on exposure time, it is possible that these concentrations may also be of sufficient duration to be effective in humans. This is supported by the limited data from pRb phosphorylation assays indicating G1 arrest in tumours. However, like UCN-01, the activity of E7070 may not reflect CDK inhibition since it also has multiple targets and its mode of action remains uncertain.

Gene Therapy and Molecular Biology Vol 10, page 49 hypokalaemia) at 1600 mg/day. Pharmacokinetic parameters showed an increase in AUC with dose. CYC202 was widely distributed and cleared rapidly from the circulation with a mean half-life of 4.02 hours (95% CI 2.8, 5.2). A third Phase I trial (n=21) has examined CYC202 given twice-daily for 7 days every 3 weeks, with a starting dose of 200 mg/day divided in two doses, in patients with advanced malignancy. At a dose level of 1600 mg/day, DLTs were grade 3 rash and grade 4 hypokalaemia. There was a trend to linear increase in AUC with dose (r2=0.5) (White et al, 2004). In summary, CYC202 has shown evidence for doserelated exposure, and its oral availability is likely to be advantageous in optimising scheduling. However, response or other efficacy data are poor or lacking in monotherapy. CYC202 is currently being studied in Phase II trials for breast and lung cancer in combination therapy.

D. BMS-387032 1. 1-hour infusion schedules: 1 Q21d; 1 Q7d In a 3-weekly schedule, 1-hour infusion of 9.6-59 mg/m2 BMS-387032, the C max and exposure increased with dose, and common adverse events possibly related to BMS-387032 included grade 1/2 fatigue (52%) and various gastrointestinal toxicities (16-32%) (Jones et al, 2003). Transient transaminase elevations (grade 1-3) occurred in six patients receiving doses from 17.5-59 mg/m2. Prolonged stable disease has been seen in patients with renal-cell carcinoma (10 and 15+ months), NSCLC (6 months), oral cavity carcinoma (8+ months) and leiomyosarcoma (7 months), and dose escalation was continuing at the time of reporting. Early data from another Phase I dose-escalation study in patients with advanced solid tumours or lymphoma refractory to standard therapy has been reported, with BMS-387032 administered weekly as a 1-hourly infusion (McCormick et al, 2003). Nine patients had been treated at three dose levels (4, 6.7 and 10 mg/m2), and cycle 1 pharmacokinetic data indicated that, at these dose levels, the systemic exposure appeared to be dose proportional. The MTD had not been reached and accrual to the study was ongoing.

IV. Why has monotherapy with CDK inhibitors shown poor clinical efficacy? The efficacy of CDK inhibitors as monotherapy in the clinic has not been commensurate with expectations based on preclinical data. The factors that have contributed to the disappointing efficacy data, to varying degrees for each agent, are discussed in turn.

2. 24-hour continuous intravenous infusion Q21d In a third Phase I trial of BMS-387032, with a 24hour infusion given every 3 weeks, 17 patients have been treated at 5 dose levels ranging from 4.8-17 mg/m2 (Shapiro et al, 2003). Diarrhoea was the most common toxicity considered to be treatment related (22%; grades 12). One patient with a history of childhood Rb and leiomyosarcoma of the bladder previously treated with doxorubicin, gemcitabine and vinorelbine had a minor response, and dose escalation was continuing.

A. Trial end points Trial designs that assess efficacy by tumour response rate may underestimate the value of CDK inhibitors, which, based on preclinical in vivo models, are expected to be more likely cytostatic as monotherapy. Relatively higher rates of stable disease than objective response have been a feature of clinical results so far (Shapiro, 2004), although many trials have not been designed to assess prolonged disease stabilisation as an efficacy end point. Randomised controlled designs do use progression end points rather than the objective response end points seen in uncontrolled trials. An exception has been a Phase II study of UCN-01 in patients with metastatic renal-cell carcinoma, which defined time to disease progression as its primary end point (Shaw et al, 2003). This trial reported preliminary data showing a median time to progression of 80 days (n=15), which underestimated the true time to progression, as seven patients were still on therapy at the time of reporting. The design of future trials should take into account the cytostatic mechanism of CDK inhibitors as monotherapy; although if TTP is the primary endpoint, randomized controlled trials are recommended to determine efficacy.

E. CYC202 1. Bid for 5, 7 or 10d Q21d CYC202 is orally available. In a Phase I trial of CYC202 in heavily pretreated patients with advanced solid tumours, patients received twice-daily CYC202 for 5 days every 3 weeks (Pierga et al, 2003). In the first part of this dose-escalation study (n=25), MTD was reached at 3200 mg/day, with vomiting as the DLT; other adverse events at this dose included hypokalaemia and increased creatinine. No objective responses were seen, although stable disease for > 6 months was observed in three patients with adrenocortical carcinoma and cylindroma, and the recommended dose for this schedule is 2500 mg/day. In the second part of the study, four patients received 2000 mg/day for 10 days every 3 weeks. DLTs at this dose were hypokalaemia and skin rash (both grade 3). No responses had been noted and exploration of the second schedule at a reduced dose of 1600 mg/day was ongoing at the time of reporting. Another Phase I dose-escalation study has also reported preliminary data: CYC202 was given at a starting dose of 200 mg/day twice daily for 7 days every 3 weeks, with the patient fasting for 2 hours before and after drug administration (Benson et al, 2003). Data from 19 patients showed DLTs (grade 3 skin rash and grade 4

B. Multiple drug targets Some agents that are classed as CDK inhibitors appear to act primarily by several non-specific pharmacological mechanisms. For instance, flavopiridolâ&#x20AC;&#x2122;s arrest of the cell cycle in G1 and G2 could be a result of inhibition of all, or a subset of, its targets, including CDK1, CDK2 and CDK4 (by direct inhibition) and cyclins D1, D3 and B (by downregulation). For CYC202, the effect of inhibiting a range of CDKs, including CDK1 and CDK2, has similar drawbacks. E7070 has the widely 49

Hughes: CDK inhibitors in 3D different effects of depleting CDK2/cyclin E and transcriptionally repressing cyclin H. Similarly, the nonspecific protein kinase activity of UCN-01 affects a number of cell-cycle associated control proteins in addition to CDKs. On top of this, the relative importance of CDK and cyclin targets may vary between individual tumours and tumour types. Furthermore, the mechanisms responsible for resistance to cell-cycle inhibitors, both innate and acquired, have yet to be determined. Therefore, it may be difficult to infer the cause of tumour control/regression seen in any patient benefiting from treatment, or the cause of treatment failure in nonresponding or progressing patients.

identified as having some utility in one tumour type may not be sufficient for a different tumour type, and that each tumour type will require dose/scheduling optimisation in separate Phase I dose-escalation studies.

D. Biomarkers of CDK inhibition Reliable, validated pharmacodynamic assays to confirm target inhibition are badly needed for trials of CDK inhibitors and the absence of discrete pharmacodynamic end points to confirm target inhibition has hampered clinical development. Several candidate markers that may stratify patients into responders versus non-responders are under investigation. Candidate immunohistochemical markers for testing of tumour samples include phosphorylated/unphosphorylated Rb, p27KIP1, E2F-1 and survivin (Shapiro, 2004). A study has reported reduced tumour Rb phosphorylation in two out of two patients (from whom tumour material was available and fully informative) with squamous-cell carcinoma of the head and neck in a Phase II trial of E7070; however, only one of the patients had stable disease, while the other had progressive disease (Haddad et al, 2004). Other potentially useful markers include p16, p53 and cyclin D. The CDK inhibitor p16 is thought to be responsible for G1 arrest in senescing cells and overexpression of p16 can lead to G 1 arrest in tumour cells, both effects being due to inhibition of CDK2 activity (Calb贸 et al, 2004; Stein et al, 1999). Flavopiridol has been shown to mimic, in part, the effect of p16 in that exposure of cells to high flavopiridol concentrations (>100 nM) resulted in decreased expression of genes downstream in the normal p16 cell-cycle control pathway, including Rb and E2F (Robinson et al, 2003). The authors pointed out that p16 is frequently lost or mutated in malignant melanoma, making CDK2 inhibition an ideal candidate for targeted therapy in this disease. Indeed, this principle may be applicable to any tumour deficient in p16 expression. The p53 family (p53, p63 and p73) function as transcription factors that play a major role in regulating responses to stress and damage, in part through the transcriptional activation of genes involved in controlling CDKs, and may therefore also be useful markers of tumours deficient in CDK inhibition.

C. Dosing schedules and exposure Of the CDK inhibitors, flavopiridol has been longest in clinical development. However, as trials have shown, intravenous administration has been problematic and studies examining revised schedules have been necessary. Initial schedules of flavopiridol used prolonged continuous intravenous infusions that produced nanomolar levels of drug, based on effective concentrations used in tumour cell lines: exposure to 200-300 nM flavopiridol is sufficient to cause cell-cycle arrest in most tumour cell lines (Shapiro, 2004), and only slightly higher concentrations are needed to induce apoptosis (Dai and Grant, 2003; Shapiro, 2004). However, to achieve effective concentrations in human tumours, micromolar serum concentrations are likely to be effective and the investigation of shorter infusions that achieve a higher Cmax, and of loading followed by maintenance infusion, have been designed with this in mind. Revised schedules were, initially at least, ineffective in sustaining exposure over the entire period of drug administration, and estimates of the duration of drug coverage (ie, the proportion of time at or above an effective concentration) for flavopiridol are in the range of 14-24%, based on data from Phase I trials (Tan et al, 2002; Rudek et al, 2003). However, recent data in a haematological malignancy have been promising, showing that a pharmacokinetically modelled schedule, comprising a 30-minute bolus followed by a 4-hour continuous intravenous infusion, has significant clinical activity (Byrd et al, 2004b). For CYC202, which has also displayed limited efficacy in the clinic, suboptimal plasma exposure may have resulted from the 11-fold variation in human AUCs observed. Several agents have failed to demonstrate efficacy across tumour types at the same dose. For instance, in Phase I and Phase II trials, flavopiridol has shown a modest response rate, at 50 mg/m2/day continuous intravenous infusion every 2 weeks, in metastatic renal cancer but not in NSCLC or gastric cancer (Senderowicz et al, 1998; Stadler et al, 2000; Shapiro et al, 2001; Schwartz et al, 2001). E7070, shown to have antitumour activity in a Phase I trial against adenocarcinoma of unknown origin, renal and breast cancer at a dose of 700 mg/m2 in a 1-hour infusion every 3 weeks (Raymond et al, 2000), did not have a disease-stabilising effect in a Phase II trial in squamous-cell carcinoma of the head and neck (Haddad et al, 2004). These data imply that often the dose

V. Conclusions It is recognised that cell-cycle dysregulation is a hallmark of cancer, with G1/S dysregulation occurring among virtually all types of human tumour, often via overexpression of CDKs, mutations in CDKs or loss of normal CDK inhibitor activity. Therefore, CDK inhibition forms a valid approach to tumour therapy (Sherr, 2000; Senderowicz, 2002, 2003b). However, the novel smallmolecule CDK modulators that are being tested in the clinic have given interesting but so far rather disappointing results as monotherapy. Flavopiridol is the CDK inhibitor furthest into clinical development. However, intravenous administration has proven difficult to optimise and scheduling studies continue to address this problem. A regimen using 72-hour continuous intravenous infusion every 2 weeks has been most extensively applied in

Gene Therapy and Molecular Biology Vol 10, page 51 clinical trials but efficacy rates have been poor; 1-hour infusion has also been explored to achieve higher peak concentrations. However, a pharmacokinetically modelled schedule, comprising a 30-minute bolus followed by a 4hour continuous intravenous infusion, recently showed significant clinical activity in haematological malignancies. For flavopiridol and E7070, there are subsets of patients with prolonged stable disease in several Phase II trials, although few responses have been observed. Further Phase I and II trials are ongoing to determine the effectiveness of these agents as monotherapy and in combination with standard chemotherapeutic regimens and various tumour types. UCN-01 and CYC202 have shown dose-proportional exposure in Phase I trials but efficacy rates have been low and it is unclear from current data whether serum concentrations are adequate or sustained enough to give an antitumour effect. In addition, the multiple molecular effects of UCN-01 are likely to hamper optimisation of its administration, and its association with hyperglycaemia is a significant drawback in the clinic. In comparison, the relative selectivity of CYC202, combined with its oral availability and flexibility in dosing/scheduling, may be advantageous in attempts to improve efficacy rates with this agent. Three proposals are presented to address the information from the first four CDK inhibitors that have entered clinical trials. Firstly, careful clinical trial design with trial end points that assess disease stability will be needed to evaluate this class of agents fully. For instance, in patients with NSCLC treated with flavopiridol (Shapiro et al, 2001), the objective response rate was low but overall survival was similar to that obtained in a randomised trial of four platinum-based chemotherapy regimens containing platinum analogues in combination with taxanes or gemcitabine (Schiller et al, 2002). However, randomised clinical trials that assess survival as an end point are needed to confirm whether this is a real effect. Secondly, the use of biomarkers that demonstrate the drug has achieved CDK inhibition in humans is warranted to ensure that biologically active free drug concentrations are achieved. Delineation of an optimum schedule based on data from humans, rather then empirically based schedules, will provide confidence that any failure of clinical efficacy is potentially due to relevance of target rather than simply a failure to achieve biologically active concentrations of drug. Candidate markers, including Rb, p16 and p53, are being developed and increasingly introduced into clinical trials. Finally, combining CDK inhibitors with either conventional cytotoxic drugs or novel agents targeting signal transduction pathways has shown promising antitumour activity in preclinical models, particularly in the induction of apoptosis. The introduction of novel combination regimens into clinical trials is progressing even in the absence of proven clinical activity for CDK monotherapy, and a Phase III trial comparing standard combination chemotherapy versus combination chemotherapy plus flavopiridol is currently under investigation (Senderowicz, 2003a). It remains to be seen whether existing CDK inhibitors will be effectively deployed in this way.

Acknowledgement Editorial assistance was provided by John H Bull with financial support from AstraZeneca.

References Aklilu M, Kindler HL, Donehower RC, Mani S and Vokes EE (2003) Phase II study of flavopiridol in patients with advanced colorectal cancer. Ann Oncol 14, 1270-1273. Benson C, White J, Twelves C, O’Donnell A, Cruickshank C, Tan S, Gianella-Borradori A and Judson I (2003) A phase I trial of the oral cyclin dependent kinase inhibitor CYC202 in patients with advanced malignancy. Proc Am Soc Clin Oncol 22, 209, abs 838. Burdette-Radoux S, Tozer RG, Lohmann RC, Quirt I, Ernst DS, Walsh W, Wainman N, Colevas AD and Eisenhauer EA (2004) Phase II trial of flavopiridol, a cyclin dependent kinase inhibitor, in untreated metastatic malignant melanoma. Invest New Drugs 22, 315-322. Byrd JC, Peterson BL, Gabrilove JL, Odenike OM, Grever MR, Rai KR, Vardiman JW and Larson RA (2004a) Sequential phase II studies of flavopiridol by 72-hour continuous infusion and 1-hour intravenous bolus for the treatment of relapsed B-cell chronic lymphocytic leukemia: results from CALGB Study 19805. Blood 104, abs 3485. Byrd JC, Lin TS, Dalton JT, Wu D, Fischer B, Moran ME, Blum KA, Shank RS, Lucas DM, Lucas MS, Suarez J-R, Colevas AD and Grever MR (2004b) Flavopiridol administered as a pharmacologically-derived schedule demonstrates marked clinical activity in refractory, genetically high risk, chronic lymphocytic leukemia (CLL). Blood 104, abs 341. Calbó J, Serna C, Garriga J, Graña X and Mazo A (2004) The fate of pancreatic tumor cell lines following p16 overexpression depends on the modulation of CDK2 activity. Cell Death Differ 11, 1055-1065. Dai Y and Grant S (2003) Cyclin-dependent kinase inhibitors. Curr Opin Pharmacol 3, 362-370. Dees EC, O’Reilly S, Figg WD, Elza-Brown K, Aylesworth C, Carducci M, Byrd J, Grever M and Donehower RC (2000) A phase I and pharmacologic study of UCN-01, a protein kinase C inhibitor. Proc Am Soc Clin Oncol 19, 205a, abs 797. Dispenzieri A, Bible KC, Lacy MQ, Fitch TR, Geyer SM, Fenton R, Fonseca R, Getman CR, Zeismer SC, Erlichman C and Gertz MA (2004) The lack of clinical efficacy of flavopiridol in patients with relapsed refractory myeloma. Blood 104, abs 3461. Dittrich C, Dumez H, Calvert H, Hanauske A, Faber M, Wanders J, Yule M, Ravic M and Fumoleau P (2003) Phase I and pharmacokinetic study of E7070, a chloroindolylsulfonamide anticancer agent, administered on a weekly schedule to patients with solid tumors. Clin Cancer Res 9, 5195-5204. Fuse E, Hashimoto A, Sato N, Tanii H, Kuwabara T, Kobayashi S and Sugiyama Y (2000) Physiological modeling of altered pharmacokinetics of a novel anticancer drug, UCN-01 (7hydroxystaurosporine), caused by slow dissociation of UCN01 from human #1-acid glycoprotein. Pharm Res 17, 553564. Gladden AB and Diehl JA (2003) Cell cycle progression without cyclin E/CDK2: Breaking down the walls of dogma. Cancer Cell 4, 160-162. Haddad RI, Weinstein LJ, Wieczorek TJ, Bhattacharya N, Raftopoulos H, Oster MW, Zhang X, Latham Jr VM,

Hughes: CDK inhibitors in 3D Costello R, Faucher J, DeRosa C, Yule M, Miller LP, Loda M, Posner MR and Shapiro GI (2004) A Phase II clinical and pharmacodynamic study of E7070 in patients with metastatic, recurrent, or refractory squamous cell carcinoma of the head and neck: modulation of retinoblastoma protein phosphorylation by a novel chloroindolyl sulfonamide cell cycle inhibitor. Clin Cancer Res 10, 4680-4687. Hanahan D and Weinberg RA (2000) The hallmarks of cancer. Cell 100, 57-70. Harbour JW, Luo RX, Dei Santi A, Postigo AA and Dean DC (1999) Cdk phosphorylation triggers sequential intramolecular interactions that progressively block Rb functions as cells move through G1. Cell 98, 859-869. Hinds PW (2003) Cdk2 dethroned as master of S phase entry. Cancer Cell 3, 305-307. Jones SF, Burris HA, Kies M, Willcutt N, Degen P, Bai S, Mauro D, Decillis A, Youssoufian H and Papadimitrakopoulou V (2003) A phase I study to determine the safety and pharmacokinetics (PK) of BMS-387032 given intravenously every three weeks in patients with metastatic refractory solid tumors. Proc Am Soc Clin Oncol 22, 199, abs 798. Lin TS, Howard OM, Neuberg DS, Kim HH and Shipp MA (2002) Seventy-two hour continuous infusion flavopiridol in relapsed and refractory mantle cell lymphoma. Leuk Lymphoma 43, 793-797. McClue SJ, Blake D, Clarke R, Cowan A, Cummings L, Fischer PM, MacKenzie M, Melville J, Stewart K, Wang S, Zhelev N, Zheleva D and Lane DP (2002) In vitro and in vivo antitumor properties of the cyclin dependent kinase inhibitor CYC202 (R-roscovitine). Int J Cancer 102, 463-468. McCormick J, Gadgeel SM, Helmke W, Chaplen R, Van Leeuwen B, Mauro D, Youssoufian H, Decillis A, Bai S and Lorusso PM (2003) Phase I study of BMS-387032, a cyclin dependent kinase (CDK) 2 inhibitor. Proc Am Soc Clin Oncol 22, 208, abs 835. Pierga J-Y, Faivre S, Vera K, Laurence V, Delbaldo C, Bekradda M, Armand J-P, Gianella-Borradori A, Dieras V and Raymond E (2003) A phase I and pharmacokinetic (PK) trial of CYC202, a novel oral cyclin-dependent kinase (CDK) inhibitor, in patients (pts) with advanced solid tumors. Proc Am Soc Clin Oncol 22, 210, abs 840. Punt CJ, Fumoleau P, van de Walle B, Faber MN, Ravic M and Campone M (2001) Phase I and pharmacokinetic study of E7070, a novel sulfonamide, given at a daily times five schedule in patients with solid tumors. A study by the EORTC-early clinical studies group (ECSG). Ann Oncol 12, 1289-1293. Raymond E, Ten Bokkel Huinink WW, Taieb J, Beijnen JH, Mekhaldi S, Kroon K, Wanders J, Ravic M, Fumoleau P, Ducreux M, Escudier B and Armand JP (2000) Phase I and pharmacokinetic (PK) study of E7070, a new chloroindolylsulfonamide, given as a 1-hour infusion every 3 weeks in patients (pts) with advanced solid tumors. Proc Am Assoc Cancer Res 41, 611-612. Robinson WA, Miller TL, Harrold EA, Bemis LT, Brady BMR and Nelson RP (2003) The effect of flavopiridol on the growth of p16+ and p16â&#x20AC;&#x201C; melanoma cell lines. Melanoma Res 13, 231-238. Rudek MA, Bauer Jr KS, Lush III RM, Stinson SF, Senderowicz AM, Headlee DJ, Arbuck SG, Cox MC, Murgo AJ, Sausville EA and Figg WD (2003) Clinical pharmacology of flavopiridol following a 72-hour continuous infusion. Ann Pharmacother 37, 1369-1374. Sasaki Y, Sasaki T, Minami H, Kawada K, Fujii H, Igarashi T, Ishizawa K, Ito K, Usubuchi N, Evi H, Saeki T, Shigeoka Y, Hatake K, Aiba K, Ito Y, Takahashi S, Mizunuma N, Irie T, Maeda Y, Kobayashi T, Omuro Y, Okamoto R and Horikoshi N (2002) A phase I pharmacokinetic (PK)-

pharmacodynamic (PD) study of flavopiridol by 24 hours continuous infusion (CI) repeating every week. Proc Am Soc Clin Oncol 21, 93a, abs 371. Sausville EA, Arbuck SG, Messmann R, Headlee D, Bauer KS, Lush RM, Murgo A, Figg WD, Lahusen T, Jaken S, Jing X, Roberge M, Fuse E, Kuwabara T and Senderowicz AM (2001) Phase I trial of 72-hour continuous infusion UCN-01 in patients with refractory neoplasms. J Clin Oncol 19, 2319-2333. Schiller JH, Harrington D, Belani CP, Langer C, Sandler A, Krook J, Zhu J, Johnson DH and The Eastern Cooperative Oncology Group (2002) Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N Engl J Med 346, 92-98. Schwartz GK, Ilson D, Saltz L, Oâ&#x20AC;&#x2122;Reilly E, Tong W, Maslak P, Werner J, Perkins P, Stoltz M and Kelsen D (2001) Phase II study of the cyclin-dependent kinase inhibitor flavopiridol administered to patients with advanced gastric carcinoma. J Clin Oncol 19, 1985-1992. Senderowicz AM (2002) The cell cycle as a target for cancer therapy: basic and clinical findings with the small molecule inhibitors flavopiridol and UCN-01. Oncologist 7 (Suppl 3), 12-19. Senderowicz AM (2003a) Novel small molecule cyclindependent kinases modulators in human clinical trials. Cancer Biol Ther 2 (Suppl 1), S84-S95. Senderowicz AM (2003b) Small-molecule cyclin-dependent kinase modulators. Oncogene 22, 6609-6620. Senderowicz AM, Headlee D, Stinson SF, Lush RM, Kalil N, Villalba L, Hill K, Steinberg SM, Figg WD, Tompkins A, Arbuck SG and Sausville EA (1998) Phase I trial of continuous infusion flavopiridol, a novel cyclin-dependent kinase inhibitor, in patients with refractory neoplasms. J Clin Oncol 16, 2986-2999. Senderowicz AM, Messmann R, Arbuck S, Headlee D, Zhai S, Murgo A, Melillo G, Figg WD and Sausville EA (2000) A phase I trial of 1 hour infusion of flavopiridol (FLA), a novel cyclin-dependent kinase inhibitor, in patients with advanced neoplasms. Proc Am Soc Clin Oncol 19, 204a, abs 796. Shapiro G, Lewis N, Bai S, Van Leeuwen B, Mauro D, Youssoufian H, Decillis A and Cohen RB (2003) A phase I study to determine the safety and pharmacokinetics (PK) of BMS-387032 with a 24-hr infusion given every three weeks in patients with metastatic refractory solid tumors. Proc Am Soc Clin Oncol 22, 199, abs 799. Shapiro GI (2004) Preclinical and clinical development of the cyclin-dependent kinase inhibitor flavopiridol. Clin Cancer Res 10 (Suppl), 4270s-4275s. Shapiro GI, Supko JG, Patterson A, Lynch C, Lucca J, Zacarola PF, Muzikansky A, Wright JJ, Lynch Jr TJ and Rollins BJ (2001) A Phase II trial of the cyclin-dependent kinase inhibitor flavopiridol in patients with previously untreated stage IV non-small cell lung cancer. Clin Cancer Res 7, 1590-1599. Shaw VA, Rini BI, Park JW and Small EJ (2003) A phase 2 study of UCN-01 in advanced renal cell carcinoma. Proc Am Soc Clin Oncol 22, 442, abs 1775. Sherr CJ (2000) The Pezcoller Lecture: cancer cell cycles revisited. Cancer Res 60, 3689-3695. Stadler WM, Vogelzang NJ, Amato R, Sosman J, Taber D, Liebowitz D and Vokes EE (2000) Flavopiridol, a novel cyclin-dependent kinase inhibitor, in metastatic renal cancer: a University of Chicago Phase II Consortium study. J Clin Oncol 18, 371-375. Stein GH, Drullinger LF, Soulard A and Dulic V (1999) Differential roles for cyclin-dependent kinase inhibitors p21 and p16 in the mechanisms of senescence and differentiation in human fibroblasts. Mol Cell Biol 19, 2109-2117.

Gene Therapy and Molecular Biology Vol 10, page 53 Sumitomo M, Asano T, Asakuma J, Asano T, Horiguchi A and Hayakawa M (2004) ZD1839 modulates paclitaxel response in renal cancer by blocking paclitaxel-induced activation of the epidermal growth factor receptorâ&#x20AC;&#x201C;extracellular signalregulated kinase pathway. Clin Cancer Res 10, 794-801. Swanton C (2004) Cell-cycle targeted therapies. Lancet Oncol 5, 27-36. Tamura T, Sasaki Y, Minami H, Fujii H, Ito K, Igarashi T, Kamiya Y, Kurata T, Ohtsu T, Onozawa Y, Yamamoto N, Yamamoto N, Watanabe Y, Tanigawara Y, Fuse E, Kuwabara T, Kobayashi S and Shimada Y (1999) Phase I study of UCN-01 by 3-hour infusion. Proc Am Soc Clin Oncol 18, 159a, abs 611. Tan AR, Headlee D, Messmann R, Sausville EA, Arbuck SG, Murgo AJ, Melillo G, Zhai S, Figg WD, Swain SM and Senderowicz AM (2002) Phase I clinical and pharmacokinetic study of flavopiridol administered as a daily 1-hour infusion in patients with advanced neoplasms. J Clin Oncol 20, 4074-4082. Terret C, Zanetta S, Roche H, Schellens JH, Faber MN, Wanders J, Ravic M, Droz JP and EORTC Early Clinical Study Group (2003) Phase I clinical and pharmacokinetic study of E7070, a novel sulfonamide given as a 5-day continuous infusion repeated every 3 weeks in patients with solid tumours. A study by the EORTC Early Clinical Study Group (ECSG). Eur J Cancer 39, 1097-1104. Thomas J, Cleary J, Tutsch K, Arzoomanian R, Alberti D, Simon K, Feierabend C, Morgan K and Wilding G (1997) Phase I clinical and pharmacokinetic trial of flavopiridol. Proc Am Assoc Cancer Res 38, 222, abs 1496. Thomas JP, Tutsch KD, Cleary JF, Bailey HH, Arzoomanian R, Alberti D, Simon K, Feierabend C, Binger K, Marnocha R, Dresen A and Wilding G (2002) Phase I clinical and pharmacokinetic trial of the cyclin-dependent kinase

inhibitor flavopiridol. Cancer Chemother Pharmacol 50, 465-472. Van Kesteren Ch, Mathot RA, Raymond E, Armand JP, Dittrich Ch, Dumez H, Roche H, Droz JP, Punt C, Ravic M, Wanders J, Beijnen JH, Fumoleau P and Schellens JH (2002) Population pharmacokinetics of the novel anticancer agent E7070 during four phase I studies: model building and validation. J Clin Oncol 20, 4065-4073. White JD, Cassidy J, Twelves C, Benson C, Pacey S, Judson I, McGrath H, Rose F and Frenz L (2004) A phase I trial of the oral cyclin dependent kinase inhibitor CYC202 in patients with advanced malignancy. Proc Am Soc Clin Oncol 23, 205, abs 3042. Yamada Y, Yamamoto N, Shimoyama T, Horiike A, Fujisaka Y, Takayama K, Sakamoto T, Nishioka Y, Yasuda S and Tamura T (2004) A phase I pharmacokinetic and pharmacogenomic study of E7070 administered once every 21 days. Proc Am Soc Clin Oncol 23, 134, abs 2030.

Andrew Hughes

Hughes: CDK inhibitors in 3D

Gene Therapy and Molecular Biology Vol 10, page 133 Gene Ther Mol Biol Vol 10, 133-146, 2006

Mechanisms of malignant glioma immune resistance and sources of immunosuppression Review Article

German G. Gomez1 and Carol A. Kruse2,* 1

Department of Pathology, University of Colorado Health Sciences Center, Denver, CO 80262, USA

Division of Cancer Biology and Brain Tumor Research Program, La Jolla Institute for Molecular Medicine, San Diego, CA 92121, USA

__________________________________________________________________________________ *Correspondence: Carol A. Kruse, Ph.D, Professor of Cancer Biology, The La Jolla Institute for Molecular Medicine, 4570 Executive Drive, Suite 100, San Diego, CA 92121; Tel: 858-587-8788 ext 142; Fax: 858-587-6742; e-mail: ckruse@ljimm.org Key words: T regulatory cells, cellular immunotherapy, immunotherapy, brain tumors, CTL resistance, effector T lymphocytes, FasL, immunosuppressive mechanisms, apoptosis, adhesion molecules, extracellular matrix proteins, cytokines Abbreviations: alloreactive cytotoxic T lymphocytes, (aCTL); antigen presenting cells, (APC); blood brain barrier, (BBB); central nervous system, (CNS); cyclooxygenase, (COX); dendritic cells, (DCs); extracellular matrix, (ECM); Fas-associated death domain-like IL-1b-converting enzyme inhibitory protein c, (cFLIP); Glioblastoma multiforme, (GBM); Glioma associated antigens, (GAA); Human leukocyte antigens, (HLA); Immunotherapy resistant, (ITR); Indoleamine 2,3-dioxygenase, (IDO); Inhibitors of apoptosis proteins, (IAP); Interferon, (IFN); Interleukin, (IL); Intercellular adhesion molecule-1, (ICAM-1); Killer immunoglobulin-like receptors, (KIRs); Leukocyte function antigen-1, (LFA-1); Major histocompatibility complex, (MHC); MHC class I-related, (MIC); Mixed lymphocyte reaction, (MLR); Natural killer, (NK); Peripheral blood mononuclear cells (PBMNC); Prostaglandin E2, (PGE2); Signal transducer and activator of transcription-3 (STAT-3); T cell receptor, (TCR); T helper, (Th); T regulatory cell, (Treg); Transforming growth factor, (TGF); Tumor associated antigens, (TAA); Tumor infiltrating lymphocytes, (TIL); Tumor necrosis factor, (TNF) Received: 24 March 2006; Accepted: 7 April 2006; electronically published: April 2006

Summary High grade malignant gliomas are genetically unstable, heterogeneous and highly infiltrative; all characteristics that lend glioma cells superior advantages in resisting conventional therapies. Unfortunately, the median survival time for patients with glioblastoma multiforme remains discouraging at 12-15 months from diagnosis. Neuroimmunologists/oncologists have focused their research efforts to harness the power of the immune system to improve brain tumor patient survival. In the past 30 years, small numbers of patients have been enrolled in a plethora of experimental immunotherapy Phase I and II trials. Some remarkable anecdotal responses to immune therapy are evident. Yet, the reasons for the mixed responses remain an enigma. The inability of the devised immunotherapies to consistently increase survival may be due, in part, to intrinsically-resistant glioma cells. It is also probable that the tumor compartment of the tumor-bearing host has mechanisms or produces factors that promote tumor tolerance and immune suppression. Finally, with adoptive immunotherapy of ex vivo activated effector cell preparations, the existence of suppressor T cells within them theoretically may contribute to immunotherapeutic failure. In this review, we will summarize our own studies with immunotherapy resistant glioma cell models, as well as cover other examined immunosuppressive factors in the tumor microenvironment and immune effector cell suppressor populations that may contribute to the overall immune suppression. An in-depth understanding of the obstacles will be necessary to appropriately develop strategies to overcome the resistance and improve survival in this select population of cancer patients.

approximating 12-15 months even with aggressive upfront treatment (Stupp et al, 2005). Several obstacles prevent the complete eradication of GBM by conventional therapies. GBMs locally but diffusely infiltrate neighboring brain tissue through white matter tracts, perivascular, and periventricular spaces, and often invading cells are found centimeters away from the primary tumor mass (Hochberg

I. Introduction The majority of primary tumors of the central nervous system (CNS) are of astrocytic lineage (CBTRUS, 2005). Of the astrocytomas, the most malignant form, glioblastoma multiforme (GBM), is diagnosed at a much higher frequency than lower grade astrocytomas. The median survival time for GBM patients is poor, 133

Gomez and Kruse: Glioma immunoresistance and Pruitt, 1980). As a consequence, GBM patients are rarely cured of their tumors by surgical intervention. The significant degree of genetic instability (Louis and Gusella, 1995) and cellular heterogeneity within GBM ensures that not all cellular variants will respond to radiation or chemotherapy. For example, glioblastoma cells downregulate p53 (Shu et al, 1998) or upregulate DNA repair enzymes such as O6-methylguanine-DNA methyltransferase (Bandres et al, 2005) as a means to avoid radiation and chemotherapy induced-cell death, respectively. In addition, the physical isolation of brain tumors by the bloodâ&#x20AC;&#x201C;brain barrier (BBB) and drug efflux pumps integrated into the membranes of endothelial cells at the BBB interface prevents efficient delivery of systemically administered chemotherapeutic agents (Doolittle et al, 2005). To circumvent these limitations, researchers have tried to make the tumor cells more visible to the immune system (Paul and Kruse, 2001). To date, knowledge of the complex coordination of anti-tumor immune responses within the brain remains limited. Often translation of brain tumor immunotherapies is partially based upon knowledge of anti-tumor immune responses from tissues outside the brain or in xenograft models with defective endogenous immune compartments. Despite these restrictions, promising results have been observed in brain tumor patients treated with a variety of immunotherapeutic approaches (Kruse et al, 1997; Quattrocchi et al, 1999; Kruse and Rubinstein, 2001; Yu et al, 2004; Liau et al, 2005). Unfortunately, as is often the case with radiation and chemotherapy, patients might initially respond to a biologic therapy but then fail to respond to subsequent administrations of the immune therapeutic agent (Restifo et al, 1996; Rosenberg et al, 2003). Indeed, tumors have employed multiple mechanisms of immune evasion both in vitro and in vivo (Walker et al, 1997; Medema et al, 1999, 2001; Teitz et al, 2000; Wiendl et al, 2002). Here, we review the unique immunologic aspects of the brain, intrinsic tumor tolerance mechanisms, and glioma-associated immune suppression and evasion. The generation and characterization of immunotherapy resistant (ITR) glioma models may allow for the development of strategies to overcome the resistance. Last, extensive characterization of immune infiltrates or immune effector cell populations for the presence of significant numbers of suppressor T cells may indicate that selective depletion of the suppressor T cell compartment is warranted before adoptive transfer into brain tumor patients, or before ex vivo activated cytotoxic effectors are generated.

isolation of brain parenchyma from systemic circulation by the BBB (Doolittle et al, 2005), low or absent expression of human leukocyte antigens (HLA) on brain cells (Lampson and Hickey, 1986; Read et al, 2003), absence of lymphatic drainage (Walker et al, 2002) and resident dendritic cells (DCs) (Hickey, 2001), all suggest that the requirements for initiation of immune responses within the brain are significantly more stringent. Collectively, these observations led many to accept the idea that immune surveillance does not occur within the brain. Other studies have demonstrated that the brain is not as completely immunologically silent as was once thought. The induction of CNS autoimmune diseases (De Simone et al, 1995) and anti-viral immune reactions to neurotropic viruses (Klein et al, 2005) were reported. Although nonactivated T lymphocytes are incapable of penetrating the BBB, activated T lymphocytes are capable of traversing the BBB. The presence of tumor infiltrating lymphocytes (TIL) suggests that anti-tumor responses are engendered in response to malignant lesions within the brain (Quattrocchi et al, 1999). Controversy exists with respect to the ability of microglia, CNS macrophage, to initiate immune responses. Recent studies have shown that brain resident microglia process antigen (Aloisi et al, 1998), and express class II major histocompatibility complex (MHC) and costimulatory molecules (De Simone et al, 1995; Aloisi et al, 1998). In addition, our laboratory showed that microglia ingest T cell damaged glioma cells in vitro and in vivo (Kulprathipanja and Kruse, 2004). They can stimulate T cell proliferation, maturation (Carson et al, 1999) and cytokine secretion (Aloisi et al, 1998). Microglia can also produce anti-inflammatory molecules such as IL-10 (Seo et al, 2004) and prostaglandin E2 (Watters et al, 2005), both of which may inhibit antigen presentation by microglial cells. Schartner and colleagues have shown that tumor-associated microglia display an impaired capacity to upregulate class II MHC antigens relative to normal brain microglia, even upon stimulation with potent microglial activators (Schartner et al, 2005). It has been postulated that cervical lymph nodes act as the drainage site of the brain interstitial fluid, thus constituting the afferent arm of immune responses within the CNS (Karman et al, 2004). In agreement with this notion, Tsugawa and colleagues demonstrated that DCs injected into intracerebral tumors localized to cervical lymph nodes in animal models (Tsugawa et al, 2004). Migration of DCs to the cervical lymph nodes may facilitate the activation of peripheral anti-tumor T cell responses. It has become clear that the brain is more immunologically active than originally thought.

II. Immunologic aspects of the brain The brain was defined long ago as an immune privileged organ (Medewar, 1948). This term was coined to describe the observed higher degree of tolerance to allografts exhibited by the brain relative to those placed in other anatomical sites. The concept appeared to be logically based since the brain would require protection from uncontrolled and/or severe inflammatory events that would raise intracranial pressure and lead to death of neurons within vital CNS structures. The physical

III. Intrinsic mechanisms of tumor tolerance Given the ability of T lymphocytes and natural killer (NK) cells to injure tumor cells, it is surprising that cancers are prevalent in the human population. So what prevents an immunocompetent animal from rejecting brain tumors? Immunological tolerance to cancer, in part, is mediated by the expression and presentation of self134

Gene Therapy and Molecular Biology Vol 10, page 135 antigens by neoplastic cells. The tolerance mechanisms designed to inhibit autoimmunity also protect tumors from their rejection.

and T cell activation and proliferation (Sakaguchi et al, 1995; Misra et al, 2004). The mechanism of T cell suppression is contact-dependent and often mediated by IL-10 and TGF-" (Sakaguchi et al, 1995).

A. Central tolerance

2. CD8+/CD25+ & CCR7+/CD45RO+/CD8+ T

Central tolerance is mediated by macrophages, DCs, and epithelial cells of the thymus, all of which participate in the processing and display of self-antigens to immature T cells within the thymus (Gallegos and Bevan, 2004). Self-peptide is expressed and displayed in the thymus, an activity that plays an essential role in shaping the T cell repertoire of the host. Immature T cells expressing T cell receptors (TCRs) with extremely low avidity to MHC: self antigen complexes survive the process of positive selection while those with high avidity are signaled to undergo apoptosis during the process of negative selection (Gett et al, 2003; Gallegos and Bevan, 2004; Gronski et al, 2004; Mathis and Benoist, 2004). In this way, the thymus purges the host of autoreactive T cells. Under experimental conditions, the frequency of CD8+ T cells recognizing gp100, tyrosinase and MAGE, all self derived peptides that are also expressed by malignant gliomas, was less than 1 in 10,000 (Zippelius et al, 2002). With the exception of high thymic output of MART-1 melanoma antigen-specific T cells (Gallegos and Bevan, 2004), the result of this selective process is a population of T cells with only low to intermediate reactivity to self-tumor antigens. Thus, autoreactive T cells of sufficiently low avidity to survive negative selection are incapable of responding to tumor antigens with high avidity.

cells Recently identified human CD8+CD25+ lymphocytes were capable of suppressing allogeneic and autologous T cell proliferation in a cell contact-dependent manner. TCRs on CD8+CD25+ cells are thought to bind to HLAE/self peptide complexes displayed on the cell surface of self-antigen activated T cells (Maggi et al, 2005; Jiang and Chess, 2006). The TCR/HLA-E/peptide interactions bring the Treg and autoreactive T cells in direct physical contact and subsequently autoreactive T cell activity is downregulated. Breakdown of this peripheral tolerance mechanism is thought to contribute to the pathogenesis of various autoimmune diseases. Another type of suppressor CD8+ Treg cell was identified in the tumor environment in patients with ovarian carcinoma. Plasmacytoid DCs in tumor ascites induced IL-10+/CCR7+/CD45RO+/CD8+ cells that were found to significantly inhibit mature myeloid DC-mediated tumor associated antigen (TAA)specific CTL effector function through IL-10 production (Wei et al, 2005). Recent studies have shown that in vivo depletion of T reg cells mediates regression of tolerogenic tumors (Liyanage et al, 2002; Ghiringhelli et al, 2004). In humans, Treg cells are elevated in the peripheral blood and tumor microenvironment of cancer patients, suggesting that Treg cells may prevent the initiation of anti-tumor responses directed towards shared self-antigens (Woo et al, 2001). Preliminary results of a phase I/II immunotherapy trial employing Ontak (IL-2 fused to diphtheria toxin) to deplete Treg cells in ovarian cancer patients are promising (Curiel et al, 2006). Ontak therapy significantly depleted Treg cells in peripheral blood and increased the percentage of IFN-# expressing CTL without inducing autoimmune reactions.

B. T cell anergy Cells surviving thymic selection are subjected to peripheral tolerance mechanisms. Tumor cells, including glioma cells, express MHC:self-peptide ligands, but do not express the necessary co-stimulatory molecules to effectively activate naive T cells (Wintterle et al, 2003). T cells can become anergic if they bind to MHC:self antigen ligands in the absence of costimulatory signals. Anergic T cells do not proliferate or differentiate into armed effector cells upon re-encounter of self antigen even if they receive costimulatory signals. These interactions lead to tumor specific T cell ignorance. Two additional mechanisms used to maintain tumor tolerance are T cell anergy induced by tumor-associated immature DCs (Kusmartsev et al, 2005) and activation-induced T cell death due to repeated tumor antigen stimulation (Saff et al, 2004). Recent data suggest that DCs loaded with self-antigen migrate into the thymus to induce tolerance to self antigens expressed in peripheral organs (Gallegos and Bevan, 2004).

IV. Mechanisms of glioma immune suppression and resistance It is clear that intrinsic tumor tolerance mechanisms represent a significant obstacle to the induction of potent and persistent anti-tumor immune responses in immunocompetent hosts. There is evidence however that high avidity tumor-antigen-specific T cells do exist (Zippelius et al, 2002) and furthermore that immunogenic tumors are efficiently rejected in immunocompetent hosts (Rubinstein et al, 2004). Failure of the intrinsic tumor tolerance mechanisms allows for potent immunoselective pressure to nascent transformed cells. The genetic instability of tumors and their repeated exposure to immune selective pressures increase the potential for selection of tumor cell variants with an enhanced capacity to evade immune attack. Many studies have demonstrated that tumor cells utilize multiple immune evasion strategies and the strategies are described below.

C. T regulatory (Treg) cells 1. CD4+/CD25+ T cells Sakaguchi and colleagues were the first to identify a subset of CD4+ T cells expressing the CD25 activation marker, IL-2 receptor !-chain, that when depleted in vivo, resulted in severe autoimmune diseases (Sakaguchi et al, 1995). Reconstitution with CD4+CD25+ T cells reversed the autoimmunity. Treg cells also inhibit DC maturation and their antigen presentation function (Misra et al, 2004),

135

Gomez and Kruse: Glioma immunoresistance Alternatively, TGF-" may recruit Tregs towards the primary tumor site as a means of immune evasion.

A. Secreted immunosuppressive factors 1. PGE2 The non-steroidal anti-inflammatory drugs target the cyclooxygenase enzymes, COX-1 and COX-2, which convert arachidonic acid to prostaglandins and thromboxane (Wang and Dubois, 2006). COX-2 derived prostaglandin E2 (PGE2) promotes tumor cell invasion, motility and angiogensis upon binding to its receptor, EPI4. In addition, PGE2 induces immunosuppression by downregulating the production of T helper (Th) 1 cytokines (IL-2, IFN-# and TNF-!) and upregulating Th2 cytokines (IL-4, IL-10 and IL-6) (Wang and Dubois, 2006). As well, PGE2 inhibits T cell activation and suppresses the anti-tumor activity of NK cells (Baxevanis et al, 1993; Chemnitz et al, 2006). A recent report indicates that tumor derived supernatants containing abundant levels of PGE2 enhanced the suppressive activity of Treg cells, induced expression of the Treg specific transcription factor, Foxp3, in non-Treg cells, and COX-2 inhibition reduced Treg activity and tumor burden in vivo (Sharma et al, 2005). Coculture of human primary glioma cells overexpressing COX-2 with mature DCs, induced mature DCs to overexpress IL-10. IL-10 overexpressing DCs then induced a CD4+ Treg type anti-tumor response that was abrogated with COX-2 inhibition (Akasaki et al, 2004).

3. Interleukin-10 (IL-10) IL-10, originally named cytokine synthesis inhibitory factor, is similar to TGF-" in many respects (Grutz, 2005). IL-10 inhibits IL-2 induced T cell proliferation (Grutz, 2005), the DC and macrophage activation of T cells (Hishii et al, 1995), downmodulates class II MHC on APCs (Hishii et al, 1995), and is expressed by Treg cells (Sakaguchi, 2005) and human gliomas (Hishii et al, 1995). Other studies suggest that IL-10 is not always immunosuppressive but acts by promoting brain tumor growth inhibition in vivo (Book et al, 1998).

B. Impairment of adhesive effector: tumor cell interactions and protective tumor cloaks 1. Extracellular Matrix (ECM) Proteins Adhesive interactions and membrane triggered signals induced upon cell-cell contact play an important role in immune cell function. One interaction required for efficient effector cell lysis of tumor cells is effector binding to tumor cell surfaces. Tumor cells have developed strategies to prevent their adhesion by immune effector cells. ECM proteins have recently been recognized to participate in T cell activation (Hemesath et al, 1994). In particular, tenascin-C extracts from the U251 glioma cell line were shown to inhibit T lymphocyte proliferation and cytokine production (Hemesath et al, 1994; Puente Navazo et al, 2001). In addition, TIL proliferation and IFN-# production was inhibited by tenascin C (Parekh et al, 2005). Other studies convincingly established that glioma cells producing thick glycosaminoglycan coats, composed predominately of hylauronic acid, are protected from allogeneic CTL responses (Gately et al, 1982; Dick et al, 1983; ObercGreenwood et al, 1986).

2. TGF-! There are three closely related mammalian TGF-" isoforms (TGF-"1, 2, and 3), all of which signal through transmembrane serine/threonine kinase receptors (Govinden and Bhoola, 2003). Upon receptor binding, Smad 2 is phosphorylated and associates with Smad 4. The resulting Smad2/4 complexes then enter the nucleus and mediate the transcription of target genes. TGF-" is involved in regulating inflammation, angiogenesis and proliferation (Govinden and Bhoola, 2003). In addition, TGF-" is expressed by a variety of cancers including astrocytomas (Bodmer et al, 1989). TGF-"2 appears to be the major isoform expressed by glioblastomas, although more recent studies indicate that TGF-"1 expression is predominately restricted to glioblastomas (Constam et al, 1992; Kjellman et al, 2000). Rarely do gliomas express TGF-"3 (Constam et al, 1992). Unlike gliomas, normal glial cells secrete TGF-"1 and -"2 in a latent form that must be proteolytically cleaved to have biological activity (Constam et al, 1992; Kjellman et al, 2000). TGF-" inhibits T cell activation, proliferation (Ranges et al, 1987; Gorelik and Flavell, 2000), and the maturation and function of professional antigen presenting cells (APCs) (Letterio and Roberts, 1998; Smyth et al, 1991; Thomas and Massague, 2005). As well, TGF-" inhibits the synthesis of cytotoxic molecules including perforin, granzymes A and B, IFN-#, and FasL in activated CTL (Smyth et al, 1991; Thomas and Massague, 2005). Recently it has been shown that TGF-"1 deficient mice develop lethal autoimmunity due to a lack of sustained Treg function (Marie et al, 2005). It is likely that TGF-" plays a role in tumor tolerance by facilitating the conversion of naive T cells to a Treg phenotype.

2. Intercellular adhesion molecule-1 (CD54) Adhesion molecules are known to mediate cell-cell interactions, particularly those between T cells and antigen-presenting or target cells. Intercellular adhesion molecule-1 (ICAM-1) functions as a cell surface receptor for leukocyte function antigen-1 (LFA-1) present on CTL and NK cells. LFA-1/ICAM-1 interactions facilitate T cell recognition of TAA presented class I MHC (Kikuchi et al, 2004; Fiore et al, 2002). Multiple studies have shown that ICAM-1 expression is required for tumor rejection in vivo (Kikuchi et al, 2004) and in vitro tumor cell lysis by multiple effector cell types (Kikuchi et al, 2004; Fiore et al, 2002; Schiltz et al, 2002). Disruption of LFA-1/ICAM1 interactions inhibits target cell lysis and consequently constitutes one mechanism of evasion from tumor specific T and NK cell lysis (Schiltz et al, 2002; Fiore et al, 2002).

3. HLA class I defects MHC class I molecules, also known as human leukocyte antigens (HLA), are required for presentation of endogenous or foreign antigenic peptides to cytotoxic T

136

Gene Therapy and Molecular Biology Vol 10, page 137 lymphocytes (Slingluff et al, 2000; Read et al, 2003) and for the engagement of receptors that regulate NK cell activity (O'Connor et al, 2006). In humans, MHC class I molecules comprise the classical HLA-A,B,C (class Ia) and several non-classical HLA molecules (class Ib) that include HLA-E, -F, -G and -H, MHC class I-related (MIC)-A and â&#x20AC;&#x201C;B and CD1 (Bjorkman and Parham, 1990; Braud et al, 1999). Classical HLA class I genes code for a 45 kDa ! chain that folds into three domains (!1, !2 and !3). The ! chain binds to proteolytically processed peptides (8-10 amino acids) and establishes noncovalent bonds with the 12 kDa "2-microglobulin ("2-m) protein to form a trimolecular complex displayed at the plasma membrane (Restifo et al, 1996). Cells presenting immunogenic peptides in the context of classical HLA class I molecules are susceptible to CTL-mediated lysis. All classical HLAA,-B and -C and a significant proportion of non-classical HLA class I genes are located on chromosome 6 while "2m is encoded by a gene mapped to chromosome 15 (Braud et al, 1999). Detailed studies of human tissues revealed that the majority of nucleated cells express classical HLA class I molecules (Daar et al, 1984). Some tissues such as cornea, testis, thyroid and parathyroid glands and the brain, display low or absent levels of class I HLA (Daar et al, 1984; Lampson and Hickey, 1986; Read et al, 2003). In contrast to classical HLA genes, non-classical HLA genes are less widely expressed and polymorphic (Braud et al, 1999). Much like the classical HLA class I molecules, HLA-E, -F, -G, and â&#x20AC;&#x201C;H molecules all noncovalently associate with "2-m and antigenic peptides. With the exception of HLA-F, the functions of the class Ib molecules were recently clarified, as detailed in the comprehensive review by Braud and colleagues (Braud et

al, 1999). Tumor cells displaying aberrant HLA class I expression may evade T cell detection and subsequently induced cytotoxicity. There are several molecular or genotypic phenotypes to describe abnormal HLA class I presentation in transformed cells (Figure 1). A complete HLA class I loss may be caused by mutations of both "2-m alleles. This would inhibit translation of "2-m mRNA (Restifo et al, 1996; Rosenberg et al, 2003). In the absence of "2-m expression, HLA class I heavy chain/"2-m/peptide complexes will not form nor be transported to the cell surface (Figure 1B). "2-m mutations leading to total loss of HLA class I expression have been identified in melanomas obtained from recurrent patients who initially experienced clinical responses to T cell-based immunotherapy (Rosenberg et al, 2003; Restifo et al, 1996; Jager et al, 1997; Chang et al, 2005). In HLA class I allelic loss, such as the loss of one HLA-A allele (Figure 1C), the phenotype produced may result from loss of a gene(s) encoding for the heavy chain of the lost HLA class I allele(s) or by mutations that inhibit their transcription or translation (Marincola et al, 1994; Wang et al, 1999; Facoetti et al, 2005; Demanet et al, 2004). Immunotherapy refractory tumors often demonstrate selective HLA class I allelic loss (Chang et al, 2003; Jager et al, 2002), indicating that the HLA defects contributed to the lack of response in the patients. In contrast to these findings, Hiraki and colleagues recently demonstrated that chondrosarcoma cells with HLA-A11 loss were lysed by autologous CTL thus indicating that the tumor was able to present antigenic peptides with the remaining HLA-A24 allele (Hiraki et al, 2001).

Figure 1. Depiction of normal class I HLA presentation and other aberrant HLA phenotypic defects in tumors. (A) Normal HLA class I allele presentation is shown on a tumor cell. The heavy HLA class I ! chains associate with the invariant "2-m chain (black circle) and antigenic peptide (open circle) at the plasma membrane surface. (B) Loss of HLA antigen expression at the tumor cell surface is shown. Inactivating mutations of the "2-m genes may prevent "2-m expression, leading to a total loss of HLA class I. (C) Specific HLA allelic dropout is demonstrated. In this instance we show HLA class I A allelic downregulation that decreases the number of HLA/peptide complexes at the cell surface. (D) HLA haplotype loss is shown. As a result of loss of portions of chromosome 6, a complete loss of maternal or paternal HLA would be displayed as a HLA class I downregulation that would more drastically decrease the number of HLA/peptide complexes at the cell surface than what is depicted in C.

137

Gomez and Kruse: Glioma immunoresistance Loss of a HLA class I haplotype (Figure 1D) may be caused by loss of portions of the short arm of chromosome 6 (Maeurer et al, 1996; Chang et al, 2003). In the phenotypes presented (Figure 1), it is more reasonable to assume that with the phenotype shown in Figure 1B the CTL susceptibility may be lost, with little possibility that it could be restored with exogenous IFN-# treatment (Read et al, 2003); whereas the CTL susceptiblity would be reduced with the phenotypes presented in Figures 1C and 1D. Finally, other defects have been implicated as providing mechanisms of T cell evasion in animal models (Mukherjee et al, 2003): 1) total HLA class I downregulation may be the result of epigenetic gene silencing, e.g. hypermethylation (Coral et al, 1999), 2) altered chromatin structure of the HLA class I promoter may occur (Nie et al, 2001), or 3) loss of antigen processing machinery components such as transporter associated with antigen processing-1 may cause aberrancy (Facoetti et al, 2005). In some cases, alteration or absence of one of the components of the trimolecular structure, such as the loss of TAA peptides, rather than HLA class I loss, might also occur (Slingluff et al, 2000).

D. Mechanisms of protection to Fas induced apoptosis The Fas receptor and its ligand, FasL, are members of the tumor necrosis factor (TNF) family of receptors and ligands (Ozoren and El-Deiry, 2003). Binding of FasL to Fas initiates a signaling cascade resulting in apoptosis of cells expressing Fas. The Fas apoptosis pathway constitutes one mechanism by which NK and activated T cells regulate tumor growth. Tumor cells may disrupt the Fas pathway at many levels within this signaling cascade (Figure 2). At the receptor level, downregulation of Fas surface expression (Leithauser et al, 1993) or secretion of the soluble decoy for FasL, decoy receptor 3 (DcR3), lacking a transmembrane region may inhibit Fas-induced apoptosis (Pitti et al, 1998; Roth et al, 2001). DcR3 is expressed by lung, colon and brain tumors (Pitti et al, 1998, Roth et al, 2001). In 9L experimental gliomas, DcR3-expressing tumors displayed reduced numbers of tumor infiltrating CD4 and CD8 T cells (Roth et al, 2001). During signal transduction, expression of Fasassociated death domain-like IL-1b-converting enzyme inhibitory protein (cFLIP) inhibits the activation of caspase-8, rendering tumor cells resistant to apoptotic signals transduced by Fas and other death receptors (Medema et al, 1999; Kamarajan et al, 2003). Inhibition of Fas-induced glioma cell apoptosis can also be mediated by the family of apoptosis inhibitory proteins (IAPs). IAPs can inhibit caspase activity (French and Tschopp, 2002).

C. How do HLA class I deficient tumor cells evade NK cell killing? NK cells are capable of killing cancer and virallyinfected cells without prior sensitization (O'Connor et al, 2006). NK cells are responsible for the direct killing of HLA class I deficient tumor cells (O'Connor et al, 2006). The binding of inhibitory killer immunoglobulin-like receptors (KIRs) expressed by NK cells to class I HLA molecules on normal cells maintains NK cell tolerance. Under pathological conditions including viral infections or neoplasms, HLA class I expression is often altered, thus breaking NK cell tolerance. As such, the rapid growth of HLA class I defective tumors in the face of NK cell immune selective pressure seems contradictory to the established anti-tumor function of NK cells. Ectopic HLA-G expression is a recently described mechanism of tumor evasion of T and NK cell lysis (Wiendl et al, 2002). HLA-G was initially believed to display antigenic peptides to T cells at the materno-fetal interface since placental trophoblasts do not express classical HLA class I antigens (Rouas-Freiss et al, 1999). It is now thought that HLA-G protects the fetus from allorejection by the maternal NK and T cells. HLA-G binds to the NK and T cell inhibitory receptor, ILT2 to mediate its immunotolerant function (Hofmeister and Weiss, 2003). Not surprisingly, HLA-G is expressed by several tumors including primary glioblastomas, and as well, by established glioma cell lines (Wiendl et al, 2002). HLA-G expression rendered glioma cells resistant to alloreactive CTL lysis (Wiendl et al, 2002). HLA-Gmediated inhibitory signals are strong enough to counteract NK activating signals. It is conceivable that ectopic tumor HLA-G expression may provide concurrent protection to T and NK cell lysis.

E. Tumors expressing FasL may counterattack activated effector T lymphocytes The observation of tolerance to FasL+ testis grafts bolstered the hypothesis that FasL could grant tissues an immune privileged status (Bellgrau et al, 1995). Researchers in the transplantation field sought to capitalize on this finding by introducing the FasL gene into cells or tissues prior to their transplantation (Duke et al, 1999; Nelson et al, 2000). Tumor immunologists focused their attention on the role of FasL as a mechanism of immunoresistance. In several studies FasL was detected on a variety of tumor cell types both in vitro and in vivo (Saas et al, 1997; Walker et al, 1997; Husain et al, 1998; Gastman et al, 1999). Primary tumor explants and tumor cell lines expressing FasL induced apoptosis of Fas+ target cells including T lymphocytes (Saas et al, 1997; Walker et al, 1997; Husain et al, 1998; Gastman et al, 1999). A similar counterattack mechanism involving CD70, also a TNF family member, on gliomas and its receptor, CD27 on activated T cells, was recently described (Chahlavi et al, 2005). Controversy exists as to the role of FasL in suppressing immune reactions. Allison and colleagues documented a rapid rejection of transplanted islet " cells that was accompanied by granulocytic infiltrates (Allison et al, 1997). Other researchers also found that FasL genemodified tumors were rapidly rejected by what appeared to be a granulocyte-dependent mechanism. Some malignant glioma cells were observed to coexpress Fas

138

Gene Therapy and Molecular Biology Vol 10, page 139

Figure 2. Disruption of Fas-induced apoptosis or upregulation of FasL may provide tumor cell protection to T lymphocyte induced cell injury. Decreased Fas expression by the glioma cells or their secretion of the FasL decoy receptor, DcR3, can inhibit death receptor induced apoptosis. The transduction of apoptotic signals by way of the Fas receptor is inhibited when tumor cells express cFLIP or IAPs. The cFLIP protein inhibits caspase 8 activity. The IAP family members suppress caspase 3 and caspase 9 activity. Tumor cells may counterattack T cells by expressing FasL, which can engage Fas on the T cell plasma membrane to initiate T cell apoptosis.

and FasL, suggesting the possibility that Fas/FasL interactions may induce tumor cell apoptosis as well (Arai et al, 1997; Husain et al, 1998).

F. Novel mechanisms

tumor

Multiple tumor cell types display a persistent activation of STAT-3 (Kortylewski et al, 2005; Rahaman et al, 2005; Wang et al, 2004). Constitutive STAT-3 activation in tumor cells suppresses proinflammatory cytokine and chemokine release (Wang et al, 2004). As a result, the induction of tumor-specific T cell responses is inhibited. Blockade of STAT-3 signaling leads to the release of cytokines such as TNF-!, IL-6, IFN-", chemokine related proteins such as RANTES and interferon-gamma-inducible 10 kD protein or IP10, and the activation of innate immunity and DCs. In addition to regulating the expression of immunomodulatory factors, STAT-3 positively regulates the expression of anti-apoptotic proteins such as Bcl-2, Bcl-XL, Mcl-1, survivin and cFLIP in glioma cells (Rahaman et al, 2005; Konnikova et al, 2003; Akasaki et al, 2006). Silencing of STAT-3 expression in glioma cells induced their apoptosis in the absence of an apoptotic stimulus, but did not in normal human astrocytes (Konnikova et al, 2003). As expected, STAT-3 knockdown led to the downregulation of the pro-apoptotic proteins. It is plausible that the upregulation of pro-apoptotic proteins as a result of constitutive STAT-3 activation may contribute to glioma cell resistance to radiation, chemotherapy, and CTL-based immunotherapies. The use

immunosuppressive

1. B7-H1 The recently identified B7 homologue 1, B7-H1, possesses costimulatory and immunomodulatory activity (Wintterle et al, 2003). B7-H1 binds PD-1 to exert its immune modulation. Glioma cell lines and primary glioma specimens but not normal brain tissue exhibit B7-H1 expression (Wintterle et al, 2003; Wilmotte et al, 2005). In gliomas, it appears that B7-H1 inhibits allogeneic T cell activation and cytokine secretion (Wintterle et al, 2003; Wilmotte et al, 2005). Interestingly, under inflammatory conditions such as experimental allergic encephalomyelitis, microglial cells upregulate B7-H1 expression, suggesting that microglial associated B7-H1 plays a role in limiting autoimmune-induced tissue damage (Wintterle et al, 2003; Magnus et al, 2005).

2. Signal transducer transcription-3 (STAT-3)

and

activator

139

Gomez and Kruse: Glioma immunoresistance of STAT-3 inhibitors would clarify the role of STAT-3 in providing gliomas with protection to the cytotoxic therapies. Interpretations of such experiments require careful consideration of the fact that STAT-3 inhibitors may also have inhibitory effects on other pathways, such as that dealing with epidermal growth factor receptor signaling (Gazit et al, 1991). In addition, the tyrosine kinase inhibitor, AG-490, once thought to be a STAT-3 pathway specific inhibitor, was recently shown to suppress T cell proliferation (Wang et al, 1999).

T lymphocytes (Restifo et al, 1996; Rosenberg et al, 2003). As well, brain tumor patients receiving immunotherapy often fail to respond to subsequent administrations of the immunotherapeutic agent or biologic (Kruse et al, 1997; Quattrocchi et al, 1999; Kruse and Rubinstein, 2001; Yu et al, 2004). It is important to develop strategies to circumvent the resistance if an improvement in survival is to occur. Our understanding of the obstacles can be enhanced with the generation and use of glioma cell models of immunotherapy resistance (ITR). The ITR models would allow for the determination of the reasons why not all brain tumor cells succumb to the therapy. With such knowledge the therapy may be improved upon. In cases involving adoptive T cell immunotherapy, the presence of immunosuppressive T cells such as Tregs within the starting effector cell populations may limit the efficacy of the therapy. In theory, selective depletion of the suppressor T cell compartment in ex vivo activated effector cell preparations might improve the T cell therapy.

3. Indoleamine 2,3-dioxygenase (IDO) IDO is required for degradation of the essential amino acid, tryptophan. In conditions of tryptophan shortage, T cells undergo cell cycle arrest. Interestingly, expression of IDO in the placenta plays an essential role in preventing rejection of semi-allogeneic fetuses (Munn and Mellor, 1999, 2004). Based upon these observations, Uytennhove and colleagues postulated that IDO expression may create a local tryptophan shortage that could starve T cells and thus induce tumor tolerance (Uyttenhove et al, 2003). IDO expression was detected in multiple primary human tumors including glioblastomas. In immunocompetent syngeneic animals, local tryptophan degradation by IDO+ tumors provided a mechanism of immune resistance. In turn, the pharmacologic inhibition of IDO expression resulted in the rejection of IDO+ tumors. As predicted, IDO+ tumor-bearing mice display a reduced number of TAA specific CTL (Uyttenhove et al, 2003). Treatment of tumor cells with exogenous IFN-# results in increased IDO activity. Conceivably, T cell secretion of IFN-# may inadvertently stimulate glioma cells to upregulate their IDO activity thus creating a local tryptophan shortage (Shirey et al, 2006).

A. Glioma cell models resistant to alloreactive CTL The observation that glioma cells, unlike normal neurons and glia, express relatively abundant levels of class I HLA indicated that gliomas might be amenable to local adoptive immunotherapy with HLA-restricted alloreactive cytotoxic T lymphocytes (aCTL) (Read et al, 2003; Lampson and Hickey, 1986). In a pilot clinical trial, six recurrent malignant glioma patients were treated over a ten-month period with multiple intracranial infusions of recombinant human interleukin-2 and aCTL, sensitized to patient HLA antigens (Kruse et al, 1997; Kruse and Rubinstein, 2001). One patient survived 40 months, and the remaining two are >11 years from the start of immune therapy and entrance into protocol. Although the results of this study were promising, we wanted to explore the reason(s) why not all patients responded well to the therapy. One possibility was the existence of intrinsically ITR cells within the heterogeneous primary glioblastoma cell mass. We generated aCTL resistant glioma cell models for study using in vitro immunoselection. Immunoselective pressure was applied with multiple aCTL populations to 13-06-MG glioblastoma cells obtained from a patient at initial diagnosis (Gomez et al, 2006). Two glioma cell clones, 13-06-IR29 and 13-06-IR30, were isolated from continuously immunoselected 13-06-MG cell populations. Compared to the immunosensitive 13-06-MG parental cells, the ITR clones resisted aCTL lysis for some time in the absence of selective pressure (Gomez et al, 2006). Relative chromosomal imbalances and structural abnormalities were identified that were associated with the ITR phenotype (Gomez et al, 2006). Additional studies showed no impairment of aCTL adhesion to ITR derived ECM proteins and ITR cells (Gomez and Kruse, 2006b). Downregulation of HLA class I or ICAM-1 molecules that would inhibit aCTL recognition also was not detected in the ITR clones. Changes in HLA-G and FasL expression also were not observed. Statistically significant upregulation of the

4. Galectin-1 (Gal-1) Gal-1 is a secreted "-galactoside binding protein with wide tissue distribution and immunomodulatory functions (Liu, 2000; Yamaoka et al, 2000). A role for Gal-1 in establishing tumor tolerance was recently reported by Rubinstein and colleagues in a B16 melanoma tumor model (Rubinstein et al, 2004). Gal-1 expressing melanomas evaded immune-mediated rejection by inducing T cell apoptosis. Established human and rat glioma cell lines express Gal-1 and Gal-1 mRNA levels correlated with the tumor grade (Rubinstein et al, 2004; Camby et al, 2002). The role of Gal-1 in suppressing glioma specific T cell responses has yet to be determined. Thus far, it appears that Gal-1 promotes glioma growth, migration, and invasion (Camby et al, 2002).

V. Know your enemy: immunotherapy resistant glioma variants and Treg cells The same mechanisms in place that protect gliomas from rejection by the host immune system may also impede the ability of brain tumor immunotherapies to eradicate the tumors or to suppress their growth. In agreement with this notion, the emergence of immunotherapy refractory melanoma cells has been observed among patients treated with activated autologous

140

Gene Therapy and Molecular Biology Vol 10, page 141 immunosuppressive cytokine TGF-" was associated with the ITR phenotype and corresponded to ITR clone gains (based upon triploid as the reference ploidy) of chromosome 1 and arm 19q where encoding of TGF-"2 and "1 lies, respectively. This finding is intriguing since TGF-" inhibits the synthesis of the cytotoxic molecules perforin, granzymes A and B, IFN-# and FasL in activated CTL (Smyth et al, 1991; Thomas and Massague, 2005). The ITR variants exhibited cross resistance to two other allogeneic, non-HLA-restricted effector cells (Gomez and Kruse, 2006b). After noting an inhibition in ITR clone apoptosis induction, stimulated by their coincubation with aCTL, we performed pathway specific cDNA array analysis to detect gene expression changes of apoptosis-related genes between the aCTL sensitive parental cells and the two ITR clones (Gomez and Kruse, 2006a). Downregulations of key proapoptotic genes involved in apoptosis such as Apaf-1, ATM, Asc, Caspases 3 and 8 were observed. The downregulation of the majority of the genes correlated with the chromosome losses observed in the ITR clones. The downregulation of Apaf-1 at the protein level was verified in clone 13-06IR29 (Gomez and Kruse, 2006a), which makes it valuable for ascertaining the role that Apaf-1 might play in the ITR phenotype by knock-in experiments. The isolation of these and more ITR glioma cell models will act as tools for further examining the factors and mechanisms by which glioma cells may resist immunotherapy with aCTL. Thus far the data indicate that disruption of the TGF-" signaling pathway, or perhaps upregulation of proapoptotic proteins using gene therapy may circumvent the resistance. The generation of more ITR glioma cell models from recurrent gliomas previously subjected to in situ radiation and chemotherapy selective pressures, and those derived from patients at initial diagnosis, would help us more comprehensively understand the factors involved in determining the sensitivity of glioma cells to adoptive T cell immunotherapy. Moreover, such models would also be useful in improving immunotherapies aimed at activating glioma specific T cell responses.

(Curiel et al, 2006). Alternatively, selective depletion of the suppressor T cell compartment may be achieved with cyclophosphamide (CPA). CPA depletion of Treg cells allowed adoptive T cell immunotherapy to be curative of established tumors in mice (Kruse et al, 1993; Ghiringhelli et al, 2004). Treg cells constitute a fairly low percentage (approximately 5 to 15%) of peripheral blood mononuclear cells (PBMNC) and variable numbers have also been detected in a wide variety of tumors (Powell et al, 2005). Upon ex-vivo expansion of TIL with exogenous IL-2, or activation of precursor allogeneic T lymphocytes in one-way mixed lymphocyte reactions (MLR), the proliferation of Treg cells may ensue. The expansion of Treg cell numbers may dampen the activation and proliferation of tumor sensitized T cells or precursor alloreactive CTL. Therefore, we plan to determine the frequency of Treg cells present in the donor PBMNC before and after stimulation of the PBMNC in one-way MLR. In addition, we are currently exploring whether selective Treg cell depletion, prior to the activation of precursor aCTL will increase the number of aCTL generated in the MLR, and whether an improvement in their cytolytic activity is achieved.

VI. Concluding remarks Significant advances in the field of immunology have paved the way for the development of immune therapeutic strategies to combat primary intracranial neoplasms. Malignant gliomas are adept at evading the host immune system. The various immunotherapeutic regimens tested thus far have resulted in mixed responses. To overcome the immunoresistance it is necessary to determine the ways in which gliomas resist the immunotherapies. The creation and characterization of ITR glioma models should allow for the formulation of strategies to enhance the current therapies. Analysis of tumor cells and the tumor microenvironment may shed some light on two compartments that participate in tumor tolerance and the immune suppression. For cellular therapy strategies, however, investigating the immune effector cell compartment for the presence of suppressor T cells may also yield important information leading to modification of experimental procedures to eliminate suppressor cells. If an improvement in survival is to materialize for this select population of cancer patients, we need to understand the obstacles present in all three compartments to appropriately develop strategies to overcome immune resistance.

B. Selective depletion of Treg cells to improve cellular immunotherapy of brain tumors Given the ability of Treg cells in maintaining tolerance to self-antigens displayed by normal and neoplastic cells, it is conceivable that selective Treg cell depletion of the tumor host prior to treatment with exvivo-sensitized autologous T lymphocytes to glioma associated antigens (GAA) (Powell et al, 2005), or to vaccination with GAA-pulsed autologous DCs could extend survival of glioma patients (Yajima et al, 2005; Zhang et al, 2006). Both approaches have mediated tumor regressions in animal models. Preliminary results of a phase I/II immunotherapy trial employing Ontak (IL-2 fused to diphtheria toxin) significantly depleted the number of Treg cells in the peripheral blood of ovarian carcinoma patients and increased the percentage of IFN-# expressing CTL without inducing autoimmune reactions

Acknowledgements This work was supported by National Institutes of Health grants F31 CA94834 to GGG, NS-046463 and NS056300 to CAK, The R. Herbert & Alma S. Manweiler Memorial Research Fund at the University of Colorado Foundation, and The La Jolla Foundation for Molecular Medicine Research. L.E. Gerschenson critically read the manuscript and provided helpful comments.

141

Gomez and Kruse: Glioma immunoresistance Chang CC, Campoli M and Ferrone S (2003) HLA class I defects in malignant lesions: what have we learned? Keio J Med 52, 220-9. Chang CC, Campoli M, Restifo NP, Wang X and Ferrone S (2005) Immune selection of hot-spot " 2-microglobulin gene mutations, HLA-A2 allospecificity loss, and antigenprocessing machinery component down-regulation in melanoma cells derived from recurrent metastases following immunotherapy. J Immunol 174, 1462-71. Chemnitz JM, Driesen J, Classen S, Riley JL, Debey S, Beyer M, Popov A, Zander T and Schultze JL (2006) Prostaglandin E2 impairs CD4+ T cell activation by inhibition of lck: implications in Hodgkin's lymphoma. Cancer Res 66, 111422. Constam DB, Philipp J, Malipiero UV, ten Dijke P, Schachner M and Fontana A (1992) Differential expression of transforming growth factor-" 1, -" 2, and -" 3 by glioblastoma cells, astrocytes, and microglia. J Immunol 148, 1404-10. Coral S, Sigalotti L, Gasparollo A, Cattarossi I, Visintin A, Cattelan A, Altomonte M and Maio M (1999) Prolonged upregulation of the expression of HLA class I antigens and costimulatory molecules on melanoma cells treated with 5aza-2'-deoxycytidine (5-AZA-CdR). J Immunother 22, 1624. Curiel TJ, Barnett B, Kryczek I, Cheng P and Zou W (2006) Regulatory T cells in ovarian cancer: biology and therapeutic potential. Cancer Immunity 6 Suppl 1, 20 Daar AS, Fuggle SV, Fabre JW, Ting A and Morris PJ (1984) The detailed distribution of HLA-A, B, C antigens in normal human organs. Transplantation 38, 287-92. De Simone R, Giampaolo A, Giometto B, Gallo P, Levi G, Peschle C and Aloisi F (1995) The costimulatory molecule B7 is expressed on human microglia in culture and in multiple sclerosis acute lesions. J Neuropathol Exp Neurol 54, 175-87. Demanet C, Mulder A, Deneys V, Worsham MJ, Maes P, Claas FH and Ferrone S (2004) Down-regulation of HLA-A and HLA-Bw6, but not HLA-Bw4, allospecificities in leukemic cells: an escape mechanism from CTL and NK attack? Blood 103, 3122-30. Dick SJ, Macchi B, Papazoglou S, Oldfield EH, Kornblith PL, Smith BH and Gately MK (1983) Lymphoid cell-glioma cell interaction enhances cell coat production by human gliomas: novel suppressor mechanism. Science 220, 739-42. Doolittle ND, Abrey LE, Bleyer WA, Brem S, Davis TP, DoreDuffy P, Drewes LR, Hall WA, Hoffman JM, Korfel A, Martuza R, Muldoon LL, Peereboom D, Peterson DR, Rabkin SD, Smith Q, Stevens GH and Neuwelt EA (2005) New frontiers in translational research in neuro-oncology and the blood-brain barrier: report of the tenth annual BloodBrain Barrier Disruption Consortium Meeting. Clin Cancer Res 11, 421-8. Duke RC, Newell E, Schleicher M, Meech S and Bellgrau D (1999) Transplantation of cells and tissues expressing Fas ligand. Transplant Proc 31, 1479-81. Facoetti A, Nano R, Zelini P, Morbini P, Benericetti E, Ceroni M, Campoli M and Ferrone S (2005) Human leukocyte antigen and antigen processing machinery component defects in astrocytic tumors. Clin Cancer Res 11, 8304-11. Fiore E, Fusco C, Romero P and Stamenkovic I (2002) Matrix metalloproteinase 9 (MMP-9/gelatinase B) proteolytically cleaves ICAM-1 and participates in tumor cell resistance to natural killer cell-mediated cytotoxicity. Oncogene 21, 521323. French LE and Tschopp J (2002) Defective death receptor signaling as a cause of tumor immune escape. Semin Cancer Biol 12, 51-5.

References Akasaki Y, Liu G, Chung NH, Ehtesham M, Black KL and Yu JS (2004) Induction of a CD4+ T regulatory type 1 response by cyclooxygenase-2-overexpressing glioma. J Immunol 173, 4352-59. Akasaki Y, Liu G, Matundan HH, Ng H, Yuan X, Zeng Z, Black KL, Yu JS (2006) A peroxisome proliferator-activated receptor-gamma agonist, troglitazone, facilitates caspase-8 and -9 activities by increasing the enzymatic activity of protein-tyrosine phosphatase-1B on human glioma cells. J Biol Chem 281, 6165-74. Allison J, Georgiou HM, Strasser A and Vaux DL (1997) Transgenic expression of CD95 ligand on islet " cells induces a granulocytic infiltration but does not confer immune privilege upon islet allografts. Proc Nat Acad Sci USA 94, 3943-7. Aloisi F, Ria F, Penna G and Adorini L (1998) Microglia are more efficient than astrocytes in antigen processing and in Th1 but not Th2 cell activation. J Immunol 160, 4671-80. Arai H, Gordon D, Nabel EG and Nabel GJ (1997) Gene transfer of Fas ligand induces tumor regression in vivo. Proc Nat Acad Sci USA 94, 13862-7. Bandres E, Andion E, Escalada A, Honorato B, Catalan V, Cubedo E, Cordeu L, Garcia F, Zarate R, Zabalegui N and Garcia-Foncillas J (2005) Gene expression profile induced by BCNU in human glioma cell lines with differential MGMT expression. J Neurooncol 73, 189-98. Baxevanis CN, Reclos GJ, Gritzapis AD, Dedousis GV, Missitzis I and Papamichail M (1993) Elevated prostaglandin E2 production by monocytes is responsible for the depressed levels of natural killer and lymphokine-activated killer cell function in patients with breast cancer. Cancer 72, 491-501. Bellgrau D, Gold D, Selawry H, Moore J, Franzusoff A and Duke RC (1995) A role for CD95 ligand in preventing graft rejection. Nature 377, 630-2. Bjorkman PJ and Parham P (1990) Structure, function, and diversity of class I major histocompatibility complex molecules. Annu Rev Biochem 59, 253-88. Bodmer S, Strommer K, Frei K, Siepl C, de Tribolet N, Heid I and Fontana A (1989) Immunosuppression and transforming growth factor-" in glioblastoma. Preferential production of transforming growth factor-" 2. J Immunol 143, 3222-9. Book AA, Fielding KE, Kundu N, Wilson MA, Fulton AM and Laterra J (1998) IL-10 gene transfer to intracranial 9L glioma: tumor inhibition and cooperation with IL-2. J Neuroimmunol 92, 50-9. Braud VM, Allan DS and McMichael AJ (1999) Functions of nonclassical MHC and non-MHC-encoded class I molecules. Curr Opin Immunol 11, 100-8. Camby I, Belot N, Lefranc F, Sadeghi N, de Launoit Y, Kaltner H, Musette S, Darro F, Danguy A, Salmon I, Gabius HJ and Kiss R (2002) Galectin-1 modulates human glioblastoma cell migration into the brain through modifications to the actin cytoskeleton and levels of expression of small GTPases. J Neuropathol Exp Neurol 61, 585-96. Carson MJ, Sutcliffe JG and Campbell IL (1999) Microglia stimulate naive T-cell differentiation without stimulating Tcell proliferation. J Neurosci Res 55, 127-34. CBTRUS (2005) Statistical Report: Primary Brain Tumors in the United States 1998-2002, Published by the Central Brain Tumor Registry of the United States, Hinsdale, IL. Chahlavi A, Rayman P, Richmond AL, Biswas K, Zhang R, Vogelbaum M, Tannenbaum C, Barnett G and Finke JH (2005) Glioblastomas induce T-lymphocyte death by two distinct pathways involving gangliosides and CD70. Cancer Res 65, 5428-38.

142

Gene Therapy and Molecular Biology Vol 10, page 143 Gallegos AM and Bevan MJ (2004) Central tolerance to tissuespecific antigens mediated by direct and indirect antigen presentation. J Exp Med 200, 1039-49. Gastman BR, Atarashi Y, Reichert TE, Saito T, Balkir L, Rabinowich H and Whiteside TL (1999) Fas ligand is expressed on human squamous cell carcinomas of the head and neck, and it promotes apoptosis of T lymphocytes. Cancer Res 59, 5356-64. Gately MK, Glaser M, McCarron RM, Dick SJ, Dick MD, Mettetal RW Jr and Kornblith PL (1982) Mechanisms by which human gliomas may escape cellular immune attack. Acta Neurochir (Wien) 64, 175-97. Gazit A, Osherov N, Posner I, Yaish P, Poradosu E, Gilon C and Levitzki A (1991) Tyrphostins. 2. Heterocyclic and alphasubstituted benzylidenemalononitrile tyrphostins as potent inhibitors of EGF receptor and ErbB2/neu tyrosine kinases. J Med Chem 34,1896-1907. Gett AV, Sallusto F, Lanzavecchia A and Geginat J (2003) T cell fitness determined by signal strength. Nat Immunol 4, 35560. Ghiringhelli F, Larmonier N, Schmitt E, Parcellier A, Cathelin D, Garrido C, Chauffert B, Solary E, Bonnotte B and Martin F (2004) CD4+CD25+ regulatory T cells suppress tumor immunity but are sensitive to cyclophosphamide which allows immunotherapy of established tumors to be curative. Eur J Immunol 34, 336-44. Gomez GG, Kruse, C.A. (2006a) Immunoresistant human glioma cell clones selected with alloreactive cytotoxic T lymphocytes: Apoptosis-pathway specific microarrays show downregulation of multiple proapoptotic factors. submitted.. Gomez GG, Kruse, C.A. (2006b) Cellular and functional characterization of immunoresistant human glioma cell clones selected with alloreactive cytotoxic T lymphocytes. submitted. Gomez GG, Varella-Garcia M and Kruse CA (2006) Isolation of immunoresistant human glioma cell clones after selection with alloreactive cytotoxic T lymphocytes: cytogenetic and molecular cytogenetic characterization. Cancer Genet Cytogenet 165, 121-34. Gorelik L and Flavell RA (2000) Abrogation of TGF" signaling in T cells leads to spontaneous T cell differentiation and autoimmune disease. Immunity 12, 171-81. Govinden R and Bhoola KD (2003) Genealogy, expression, and cellular function of transforming growth factor-". Pharmacol Ther 98, 257-65. Gronski MA, Boulter JM, Moskophidis D, Nguyen LT, Holmberg K, Elford AR, Deenick EK, Kim HO, Penninger JM, Odermatt B, Gallimore A, Gascoigne NR and Ohashi PS (2004) TCR affinity and negative regulation limit autoimmunity. Nat Med 10, 1234-9. Grutz G (2005) New insights into the molecular mechanism of interleukin-10-mediated immunosuppression. J Leuk Biol 77, 3-15. Hemesath TJ, Marton LS and Stefansson K (1994) Inhibition of T cell activation by the extracellular matrix protein tenascin. J Immunol 152, 5199-207. Hickey WF (2001) Basic principles of immunological surveillance of the normal central nervous system. Glia 36, 118-24. Hiraki A, Ikeda K, Yoshino T, Kaneshige T, Kiura K, Kunisada T, Fujiwara K, Tanimoto M and Harada M (2001) Tumorspecific cytotoxic T lymphocyte responses against chondrosarcoma with HLA haplotype loss restricted by the remaining HLA class I allele. Biochem Biophys Res Commun 286, 786-91. Hishii M, Nitta T, Ishida H, Ebato M, Kurosu A, Yagita H, Sato K and Okumura K (1995) Human glioma-derived

interleukin-10 inhibits antitumor immune responses in vitro. Neurosurg 37, 1160-6 Hochberg FH and Pruitt A (1980) Assumptions in the radiotherapy of glioblastoma. Neurol 30, 907-11. Hofmeister V and Weiss EH (2003) HLA-G modulates immune responses by diverse receptor interactions. Semin Cancer Biol 13, 317-23. Husain N, Chiocca EA, Rainov N, Louis DN and Zervas NT (1998) Co-expression of Fas and Fas ligand in malignant glial tumors and cell lines. Acta Neuropathol (Berl) 95, 287-95. Jager E, Ringhoffer M, Altmannsberger M, Arand M, Karbach J, Jager D, Oesch F and Knuth A (1997) Immunoselection in vivo: independent loss of MHC class I and melanocyte differentiation antigen expression in metastatic melanoma. Int J Cancer 71, 142-7. Jager MJ, Hurks HM, Levitskaya J and Kiessling R (2002) HLA expression in uveal melanoma: there is no rule without some exception. Hum Immunol 63, 444-51. Jiang H and Chess L (2006) Regulation of immune responses by T cells. N Engl J Med 354, 1166-76. Kamarajan P, Sun NK and Chao CC (2003) Up-regulation of FLIP in cisplatin-selected HeLa cells causes cross-resistance to CD95/Fas death signalling. Biochem J 376, 253-60. Karman J, Ling C, Sandor M and Fabry Z (2004) Initiation of immune responses in brain is promoted by local dendritic cells. J Immunol 173, 2353-61. Kikuchi T, Akasaki Y, Abe T, Fukuda T, Saotome H, Ryan JL, Kufe DW and Ohno T (2004) Vaccination of glioma patients with fusions of dendritic and glioma cells and recombinant human interleukin 12. J Immunother 27, 452-9. Kjellman C, Olofsson SP, Hansson O, Von Schantz T, Lindvall M, Nilsson I, Salford LG, Sjogren HO and Widegren B (2000) Expression of TGF-" isoforms, TGF-" receptors, and SMAD molecules at different stages of human glioma. Int J Cancer 89, 251-8. Klein RS, Lin E, Zhang B, Luster AD, Tollett J, Samuel MA, Engle M and Diamond MS (2005) Neuronal CXCL10 directs CD8+ T-cell recruitment and control of West Nile virus encephalitis. J Virol 79, 11457-66. Konnikova L, Kotecki M, Kruger MM and Cochran BH (2003) Knockdown of STAT3 expression by RNAi induces apoptosis in astrocytoma cells. BMC Cancer 3, 23 Kortylewski M, Jove R and Yu H (2005) Targeting STAT3 affects melanoma on multiple fronts. Cancer Metastasis Rev 24, 315-327. Kruse CA and Rubinstein D (2001) In Brain Tumor Immunotherapy (Eds, Liau LM, Becker DP, Cloughesy TF, and Bigner DD), Humana Press, 149-70. Kruse CA, Cepeda L, Owens B, Johnson SD, Stears J and Lillehei KO (1997) Treatment of recurrent glioma with intracavitary alloreactive cytotoxic T lymphocytes and interleukin-2. Cancer Immunol Immunother 45, 77-87. Kruse CA, Mitchell DH, Kleinschmidt-DeMasters BK,Bellgrau D, Eule JM, Parra JR, Kong Q and Lillehei KO (1993) Systemic chemotherapy combined with local adoptive immunotherapy cures rats bearing 9L gliosarcoma. J NeuroOncol 15, 97-112. Kulprathipanja NV and Kruse CA (2004) Microglia phagocytose alloreactive CTL-damaged 9L gliosarcoma cells. J Neuroimmunol 153, 76-82. Kusmartsev S, Nagaraj S and Gabrilovich DI (2005) Tumorassociated CD8+ T cell tolerance induced by bone marrowderived immature myeloid cells. J Immunol 175, 4583-92. Lampson LA and Hickey WF (1986) Monoclonal antibody analysis of MHC expression in human brain biopsies: tissue ranging from "histologically normal" to that showing

143

Gomez and Kruse: Glioma immunoresistance different levels of glial tumor involvement. J Immunol 136, 4054-62. Leithauser F, Dhein J, Mechtersheimer G, Koretz K, Bruderlein S, Henne C, Schmidt A, Debatin KM, Krammer PH and Moller P (1993) Constitutive and induced expression of APO-1, a new member of the nerve growth factor/tumor necrosis factor receptor superfamily, in normal and neoplastic cells. Lab Invest 69, 415-29. Letterio JJ and Roberts AB (1998) Regulation of immune responses by TGF-". Ann Rev Immunol 16, 137-61. Liau LM, Prins RM, Kiertscher SM, Odesa SK, Kremen TJ, Giovannone AJ, Lin JW, Chute DJ, Mischel PS, Cloughesy TF and Roth MD (2005) Dendritic cell vaccination in glioblastoma patients induces systemic and intracranial Tcell responses modulated by the local central nervous system tumor microenvironment. Clin Cancer Res 11, 5515-25. Liu FT (2000) Galectins: a new family of regulators of inflammation. Clin Immunol 97, 79-88. Liyanage UK, Moore TT, Joo HG, Tanaka Y, Herrmann V, Doherty G, Drebin JA, Strasberg SM, Eberlein TJ, Goedegebuure PS and Linehan DC (2002) Prevalence of regulatory T cells is increased in peripheral blood and tumor microenvironment of patients with pancreas or breast adenocarcinoma. J Immunol 169, 2756-61. Louis DN and Gusella JF (1995) A tiger behind many doors: multiple genetic pathways to malignant glioma. Trends Genet 11, 412-5. Maeurer MJ, Gollin SM, Storkus WJ, Swaney W, Karbach J, Martin D, Castelli C, Salter R, Knuth A and Lotze MT (1996) Tumor escape from immune recognition: loss of HLA-A2 melanoma cell surface expression is associated with a complex rearrangement of the short arm of chromosome 6. Clin Cancer Res 2, 641-52. Maggi E, Cosmi L, Liotta F, Romagnani P, Romagnani S and Annunziato F (2005) Thymic regulatory T cells. Autoimmun Rev 4, 579-86. Magnus T, Schreiner B, Korn T, Jack C, Guo H, Antel J, Ifergan I, Chen L, Bischof F, Bar-Or A and Wiendl H (2005) Microglial expression of the B7 family member B7 homolog 1 confers strong immune inhibition: implications for immune responses and autoimmunity in the CNS. J Neurosci 25, 2537-46. Marie JC, Letterio JJ, Gavin M and Rudensky AY (2005) TGF"1 maintains suppressor function and Foxp3 expression in CD4+CD25+ regulatory T cells. J Exp Med 201, 1061-67. Marincola FM, Shamamian P, Alexander RB, Gnarra JR, Turetskaya RL, Nedospasov SA, Simonis TB, Taubenberger JK, Yannelli J, Mixon A and et al. (1994) Loss of HLA haplotype and B locus down-regulation in melanoma cell lines. J Immunol 153, 1225-37. Mathis D and Benoist C (2004) Back to central tolerance. Immunity 20, 509-16. Medema JP, de Jong J, Peltenburg LTC, Verdegaal EM, Gorter A, Bres SA, Franken KL, Hahne M, Albar JP, Melief CJ and Offringa R (2001) Blockade of the granzyme B/perforin pathway through overexpression of the serine protease inhibitor PI-9/SPI-6 constitutes a mechanism for immune escape by tumors. Proc Nat Acad Sci USA 98, 11515-20. Medema JP, de Jong J, van Hall T, Melief CJ and Offringa R (1999) Immune escape of tumors in vivo by expression of cellular FLICE-inhibitory protein. J Exp Med 190, 1033-8. Medewar P (1948) Immunity to homologous grafted skin. III. The fate of skin homografts transplanted to the brain, to subcutaneous tissue and to the anterior chamber of the eye. Br J Exp Pathol 29, 58-69. Mellor AL and Munn DH (1999) Tryptophan catabolism and Tcell tolerance: immunosuppression by starvation? Immunol Today 20, 469-73.

Misra N, Bayry J, Lacroix-Desmazes S, Kazatchkine MD and Kaveri SV (2004) Cutting edge: human CD4+CD25+ T cells restrain the maturation and antigen-presenting function of dendritic cells. J Immunol 172, 4676-80. Mukherjee P, Madsen CS, Ginardi AR, Tinder TL, Jacobs F, Parker J, Agrawal B, Longenecker BM and Gendler SJ (2003) Mucin 1-specific immunotherapy in a mouse model of spontaneous breast cancer. J Immunother 26, 47-62. Munn DH and Mellor AL (2004) IDO and tolerance to tumors. Trends Mol Med 10, 15-8. Nelson DP, Setser E, Hall DG, Schwartz SM, Hewitt T, Klevitsky R, Osinska H, Bellgrau D, Duke RC and Robbins J (2000) Proinflammatory consequences of transgenic fas ligand expression in the heart. J Clin Invest 105, 1199-208. Nie Y, Yang G, Song Y, Zhao X, So C, Liao J, Wang LD and Yang CS (2001) DNA hypermethylation is a mechanism for loss of expression of the HLA class I genes in human esophageal squamous cell carcinomas. Carcinogenesis 22, 1615-23. Oberc-Greenwood MA, Muul LM, Gately MK, Kornblith PL and Smith BH (1986) Ultrastructural features of the lymphocytestimulated halos produced by human glioma-derived cells in vitro. J Neurooncol 3, 387-96. O'Connor GM, Hart OM and Gardiner CM (2006) Putting the natural killer cell in its place. Immunol 117, 1-10. Ozoren N and El-Deiry WS (2003) Cell surface Death Receptor signaling in normal and cancer cells. Semin Cancer Biol 13, 135-47. Parekh K, Ramachandran S, Cooper J, Bigner D, Patterson A and Mohanakumar T (2005) Tenascin-C, over expressed in lung cancer down regulates effector functions of tumor infiltrating lymphocytes. Lung Cancer 47, 17-29. Paul DB and Kruse CA (2001) Immunologic approaches to therapy for brain tumors. Current Neurol Neurosci Reports 1, 238-44. Pitti RM, Marsters SA, Lawrence DA, Roy M, Kischkel FC, Dowd P, Huang A, Donahue CJ, Sherwood SW, Baldwin DT, Godowski PJ, Wood WI, Gurney AL, Hillan KJ, Cohen RL, Goddard AD, Botstein D and Ashkenazi A (1998) Genomic amplification of a decoy receptor for Fas ligand in lung and colon cancer. Nature 396, 699-703. Powell DJ, Jr., Parker LL and Rosenberg SA (2005) Large-scale depletion of CD25+ regulatory T cells from patient leukapheresis samples. J Immunother 28, 403-11. Puente Navazo MD, Valmori D and Ruegg C (2001) The alternatively spliced domain TnFnIII A1A2 of the extracellular matrix protein tenascin-C suppresses activationinduced T lymphocyte proliferation and cytokine production. J Immunol, 167 Quattrocchi KB, Miller CH, Cush S, Bernard SA, Dull ST, Smith M, Gudeman S and Varia MA (1999) Pilot study of local autologous tumor infiltrating lymphocytes for the treatment of recurrent malignant gliomas. J Neurooncol 45, 141-57. Rahaman SO, Vogelbaum MA and Haque SJ (2005) Aberrant Stat3 signaling by interleukin-4 in malignant glioma cells: involvement of IL-13Ralpha2. Cancer Res 65, 2956-63 Ranges GE, Figari IS, Espevik T and Palladino MA, Jr. (1987) Inhibition of cytotoxic T cell development by transforming growth factor " and reversal by recombinant tumor necrosis factor !. J Exp Med 166, 991-8. Read SB, Kulprathipanja NV, Gomez GG, Paul DB, Winston KR, Robbins JM and Kruse CA (2003) Human alloreactive CTL interactions with gliomas and with those having upregulated HLA expression from exogenous IFN-#or IFN#gene modification. J Int Cyt Res 23, 379-93. Restifo NP, Marincola FM, Kawakami Y, Taubenberger J, Yannelli JR and Rosenberg SA (1996) Loss of functional "

144

Gene Therapy and Molecular Biology Vol 10, page 145 2-microglobulin in metastatic melanomas from five patients receiving immunotherapy. J Nat Cancer Inst 88, 100-8. Rosenberg SA, Yang JC, Robbins PF, Wunderlich JR, Hwu P, Sherry RM, Schwartzentruber DJ, Topalian SL, Restifo NP, Filie A, Chang R and Dudley ME (2003) Cell transfer therapy for cancer: lessons from sequential treatments of a patient with metastatic melanoma. J Immunother 26, 38593. Roth W, Isenmann S, Nakamura M, Platten M, Wick W, Kleihues P, Bahr M, Ohgaki H, Ashkenazi A and Weller M (2001) Soluble decoy receptor 3 is expressed by malignant gliomas and suppresses CD95 ligand-induced apoptosis and chemotaxis. Cancer Res 61, 2759-65. Rouas-Freiss N, Khalil-Daher I, Riteau B, Menier C, Paul P, Dausset J and Carosella ED (1999) The immunotolerance role of HLA-G. Semin Cancer Biol 9, 3-12. Rubinstein N, Alvarez M, Zwirner NW, Toscano MA, Ilarregui JM, Bravo A, Mordoh J, Fainboim L, Podhajcer OL and Rabinovich GA (2004) Targeted inhibition of galectin-1 gene expression in tumor cells results in heightened T cellmediated rejection; A potential mechanism of tumor-immune privilege. Cancer Cell 5, 241-51. Saas P, Walker PR, Hahne M, Quiquerez AL, Schnuriger V, Perrin G, French L, Van Meir EG, de Tribolet N, Tschopp J and Dietrich PY (1997) Fas ligand expression by astrocytoma in vivo: maintaining immune privilege in the brain? J Clin Invest 99, 1173-78. Saff RR, Spanjaard ES, Hohlbaum AM and Marshak-Rothstein A (2004) Activation-induced cell death limits effector function of CD4 tumor-specific T cells. J Immunol 172, 6598-606. Sakaguchi S (2005) Naturally arising Foxp3-expressing CD25+CD4+ regulatory T cells in immunological tolerance to self and non-self. Nat Immunol 6, 345-52. Sakaguchi S, Sakaguchi N, Asano M, Itoh M and Toda M (1995) Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor !-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155, 1551-64. Schartner JM, Hagar AR, Van Handel M, Zhang L, Nadkarni N and Badie B (2005) Impaired capacity for upregulation of MHC class II in tumor-associated microglia. Glia 51, 27985. Schiltz PM, Gomez GG, Read SB, Kulprathipanja NV and Kruse CA (2002) Effects of IFN-# and interleukin-1" on major histocompatibility complex antigen and intercellular adhesion molecule-1 expression by 9L gliosarcoma: relevance to its cytolysis by alloreactive cytotoxic T lymphocytes. J Int Cyt Res 22, 1209-16. Seo DR, Kim KY and Lee YB (2004) Interleukin-10 expression in lipopolysaccharide-activated microglia is mediated by extracellular ATP in an autocrine fashion. Neuroreport 15, 1157-61. Sharma S, Yang SC, Zhu L, Reckamp K, Gardner B, Baratelli F, Huang M, Batra RK and Dubinett SM (2005) Tumor cyclooxygenase-2/prostaglandin E2-dependent promotion of FOXP3 expression and CD4+ CD25+ T regulatory cell activities in lung cancer. Cancer Res 65, 5211-20. Shirey KA, Jung JY, Maeder GS and Carlin JM (2006) Upregulation of IFN-gamma receptor expression by proinflammatory cytokines influences IDO activation in epithelial cells. J Int Cyt Res 26, 53-62. Shu HK, Kim MM, Chen P, Furman F, Julin CM and Israel MA (1998) The intrinsic radioresistance of glioblastoma-derived cell lines is associated with a failure of p53 to induce p21(BAX) expression. Proc Nat Acad Sci USA 95, 14453-8. Slingluff CL, Jr., Colella TA, Thompson L, Graham DD, Skipper JC, Caldwell J, Brinckerhoff L, Kittlesen DJ, Deacon DH,

Oei C, Harthun NL, Huczko EL, Hunt DF, Darrow TL and Engelhard VH (2000) Melanomas with concordant loss of multiple melanocytic differentiation proteins: immune escape that may be overcome by targeting unique or undefined antigens. Cancer Immunol Immunother 48, 661-72. Smyth MJ, Strobl SL, Young HA, Ortaldo JR and Ochoa AC (1991) Regulation of lymphokine-activated killer activity and pore-forming protein gene expression in human peripheral blood CD8+ T lymphocytes. Inhibition by transforming growth factor-". Inhibition by transforming growth factor-". J Immunol 146, 3289-97. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJ, Belanger K, Brandes AA, Marosi C, Bogdahn U, Curschmann J, Janzer RC, Ludwin SK, Gorlia T, Allgeier A, Lacombe D, Cairncross JG, Eisenhauer E and Mirimanoff RO (2005) Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 352, 987-96. Teitz T, Wei T, Valentine MB, Vanin EF, Grenet J, Valentine VA, Behm FG, Look AT, Lahti JM and Kidd VJ (2000) Caspase 8 is deleted or silenced preferentially in childhood neuroblastomas with amplification of MYCN. Nat Med 6, 529-35. Thomas DA and Massague J (2005) TGF-" directly targets cytotoxic T cell functions during tumor evasion of immune surveillance. Cancer Cell 8, 369-80. Tsugawa T, Kuwashima N, Sato H, Fellows-Mayle WK, Dusak JE, Okada K, Papworth GD, Watkins SC, Gambotto A, Yoshida J, Pollack IF and Okada H (2004) Sequential delivery of interferon-! gene and DCs to intracranial gliomas promotes an effective antitumor response. Gene Ther 11, 1551-8. Uyttenhove C, Pilotte L, Theate I, Stroobant V, Colau D, Parmentier N, Boon T and Van den Eynde BJ (2003) Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2, 3-dioxygenase. Nat Med 9, 1269-74. Walker PR, Calzascia T and Dietrich PY (2002) All in the head: obstacles for immune rejection of brain tumours. Immunol 107, 28-38. Walker PR, Saas P and Dietrich PY (1997) Role of Fas ligand (CD95L) in immune escape: the tumor cell strikes back. J Immunol 158, 4521-4. Wang D and Dubois RN (2006) Prostaglandins and cancer. Gut 55, 115-22. Wang LH, Kirken RA, Erwin RA, Yu CR and Farrar WL (1999) JAK3, STAT, and MAPK signaling pathways as novel molecular targets for the tyrphostin AG-490 regulation of IL2-mediated T cell response. J Immunol 162, 3897-904. Wang T, Niu G, Kortylewski M, Burdelya L, Shain K, Zhang S, Bhattacharya R, Gabrilovich D, Heller R, Coppola D, Dalton W, Jove R, Pardoll D, Yu H (2004) Regulation of the innate and adaptive immune responses by Stat-3 signaling in tumor cells. Nat Med 10, 48-54. Wang Z, Marincola FM, Rivoltini L, Parmiani G and Ferrone S (1999) Selective histocompatibility leukocyte antigen (HLA)-A2 loss caused by aberrant pre-mRNA splicing in 624MEL28 melanoma cells. J Exp Med 190, 205-15. Watters JJ, Schartner JM and Badie B (2005) Microglia function in brain tumors. J Neurosci Res 81, 447-55. Wei S, Kryczek I, Zou L, Daniel B, Cheng P, Mottram P, Curiel T, Lange A and Zou W (2005) Plasmacytoid dendritic cells induce CD8+ regulatory T cells in human ovarian carcinoma. Cancer Res 65, 5020-6 Wiendl H, Mitsdoerffer M, Hofmeister V, Wischhusen J, Bornemann A, Meyermann R, Weiss EH, Melms A and Weller M (2002) A functional role of HLA-G expression in human gliomas: an alternative strategy of immune escape. J Immunol 168, 4772-80.

145

Gomez and Kruse: Glioma immunoresistance Wilmotte R, Burkhardt K, Kindler V, Belkouch MC, Dussex G, Tribolet N, Walker PR and Dietrich PY (2005) B7-homolog 1 expression by human glioma: a new mechanism of immune evasion. Neuroreport 16, 1081-5. Wintterle S, Schreiner B, Mitsdoerffer M, Schneider D, Chen L, Meyermann R, Weller M and Wiendl H (2003) Expression of the B7-related molecule B7-H1 by glioma cells: a potential mechanism of immune paralysis. Cancer Res 63, 7462-7. Woo EY, Chu CS, Goletz TJ, Schlienger K, Yeh H, Coukos G, Rubin SC, Kaiser LR and June CH (2001) Regulatory CD4(+)CD25(+) T cells in tumors from patients with earlystage non-small cell lung cancer and late-stage ovarian cancer. Cancer Res 61, 4766-72. Yajima N, Yamanaka R, Mine T, Tsuchiya N, Homma J, Sano M, Kuramoto T, Obata Y, Komatsu N, Arima Y, Yamada A, Shigemori M, Itoh K and Tanaka R (2005) Immunologic evaluation of personalized peptide vaccination for patients with advanced malignant glioma. Clin Cancer Res 11, 590011. Yamaoka K, Mishima K, Nagashima Y, Asai A, Sanai Y and Kirino T (2000) Expression of galectin-1 mRNA correlates with the malignant potential of human gliomas and expression of antisense galectin-1 inhibits the growth of 9 glioma cells. J Neurosci Res 59, 722-30. Yu JS, Liu G, Ying H, Yong WH, Black KL and Wheeler CJ (2004) Vaccination with tumor lysate-pulsed dendritic cells elicits antigen-specific, cytotoxic T-cells in patients with malignant glioma. Cancer Res 64, 4973-9. Zhang JG, Eguchi J, Kruse CA, Gomez GG, Fakhrai H, Schroter S, Ma W, Hoa N, Minev G, Delgado C, Wespic HT, Okada

H and Jadus MR (2006) Antigenic profiles of human glioma cell lines: Implications for patient CTL targeting of tumor associated antigens with allogeneic tumor cell-based vaccine or other immune-cell based therapies. submitted. Zippelius A, Pittet MJ, Batard P, Rufer N, de Smedt M, Guillaume P, Ellefsen K, Valmori D, Lienard D, Plum J, MacDonald HR, Speiser DE, Cerottini JC and Romero P (2002) Thymic selection generates a large T cell pool recognizing a self-peptide in humans. J Exp Med 195, 48594.

German G. Gomez and Carol A. Kruse

146

Gene Therapy and Molecular Biology Vol 10, page 17 Gene Ther Mol Biol Vol 10, 17-30, 2006

Delivery of human apolipoprotein (apo) E to liver by an [E1–, E3–, polymerase–, pTP–] adenovirus vector containing a liver-specific promoter inhibits atherogenesis in immunocompetent apoE-deficient mice Research Article

Julian D. Harris1, Ian R. Graham1 Andrea Amalfitano2, James S Owen3, George Dickson1,* 1

School of Biological Sciences, Royal Holloway University of London, Egham, UK Department of Paediatrics, Duke University Medical Centre, Durham, North Carolina, USA 3 The UCL Institute of Hepatology, Royal Free & University College Medical School, London, UK 2

__________________________________________________________________________________ *Correspondence: George Dickson, PhD, School of Biological Sciences, Royal Holloway University of London, Egham, Surrey TW20 0EX, UK. Telephone: +44-1784-443545; fax: +44-1784-434326; e-mail: g.dickson@rhul.ac.uk Key words: Atherosclerosis; Apolipoprotein E; Gene Therapy; Adenovirus Abbreviations: apoE-deficient, (apoE-/-); apolipoprotein E, (apoE); ATP-binding cassette transporter A1, (ABCA1); CD8+ T lymphocytes, (CTLs); cytomegalovirus, (CMV); fetal bovine serum, (FBS); glyceraldehydes-3-phosphate dehydrogenase, (GAPDH); hepatic nuclear factors, (HNF); liver-specific promoter, (LSP); multiplicity of infections, (MOI); recombinant adenovirus, (rAd); scavenger receptor-B1, (SR-B1); virus particle, (vp) Received: 31 August 2005; Accepted: 31 January 2006; electronically published: February 2006

Summary Recombinant adenovirus (rAd)-mediated apoE gene transfer to the liver of apoE-/- mice is anti-atherogenic. However, first generation rAd vectors were associated with immune clearance of transduced hepatocytes, while an improved [E1-, E3- polymerase-] adenovirus vector that persisted in the liver, had transient effects due to cellular shutdown of the cytomegalovirus (CMV) promoter (Ad-CMV-apoE). Here, we utilise an improved class of rAd vector with multiple deletions in the E1, E3, polymerase and pTP (pre-terminal protein) genes, which contains a modular synthetic liver-specific promoter (LSP) to drive expression of the human apoE cDNA (Ad-LSP-apoE) for hepatic gene transfer. Approximately 1 year old apoE-/- mice were injected intravenously with 4x1010 virus particles of either Ad-LSP-apoE or Ad-CMV-apoE. Animals were monitored for plasma apoE, total plasma cholesterol and plasma lipoprotein distribution. The effect of Ad-LSP-apoE on atheroma progression was assessed in animals killed at 8 and 28 weeks after the injections. Ad-LSP-apoE vector administration gave sustained, though low, levels of plasma apoE throughout the study period without inducing a humoral immune response, but failed to reduce plasma cholesterol or normalize the adverse lipoprotein profile. Animals killed 8 weeks after the injections, demonstrated no significant retardation of atherosclerosis, whereas aortic lesions in those killed at 28 weeks were significantly reduced by 30% (P<0.006) compared to untreated animals. In summary, the combination of a multiply deleted rAd vector with a liver-specific promoter provided sustained low levels of plasma apoE, resulting in significant retardation of aortic atherosclerotic lesions. and is involved in reverse cholesterol transport, where excess cholesterol from arterial and other peripheral tissues is transported to the liver for excretion (Fielding and Fielding, 1995). The apoE-deficient (apoE-/-) mouse has severe hypercholesterolaemia and spontaneously develops the full

I. Introduction Apolipoprotein E (apoE) is a 34 kDa plasma glycoprotein and is a major component in lipoprotein homeostasis and in the protection against the development of atherosclerosis. It mediates the hepatic clearance of atherogenic remnant lipoproteins (Mahley and Rall, 2000) 17

Harris et al: Liver-directed gene transfer of human apoE inhibits atherogenesis range of atherosclerotic lesions (Piedrahita et al, 1992; Nakashima et al, 1994). First generation rAd vectors for liver-directed apoE gene transfer, resulted in transient correction of the hypercholesterolaemia and protection against atherosclerosis in the apoE-/- mouse (Kashyap et al, 1995; Stevenson et al, 1995). However, low level expression of viral genes still present in the adenovirus vector (Yang et al, 1994a,b, 1995, 1996a; Dai et al, 1995) and expression of a foreign transgene (Tripathy et al, 1996; Morral et al, 1997; Song et al, 1997) resulted in an immune response against adenovirus-transduced hepatocytes, causing rapid loss of transgene expression. Improvements in rAd vector design, including removal of certain sequences in the vector genome, reduced hepatotoxicity and allowed longer apoE transgene expression in apoE-/- mice (Tsukamoto et al, 1997, 1999; Harris et al, 2002a). This work included our own study on intravenous (liver-directed) injections of a [E1!, E3!, polymerase!] rAd vector containing the CMV promoter driving expression of human apoE, resulting in acute regression of advanced and retardation of early aortic atheroma with normalization of the hyperlipidaemic phenotype (Harris et al, 2002a). However, apoE transgene expression was transient due to CMV promoter shutdown reflected in the rebound of plasma cholesterol and the reaccumulation of atherogenic remnant lipoprotein particles to pretreatment levels. CMV promoter shutdown is a recognised feature of transgene expression driven by virus-derived promoters such as CMV or Rous sarcoma virus (RSV) promoters, particularly in the liver (Kay et al, 1992; Guo et al, 1996; Qin et al, 1997; Loser et al, 1998). To avoid promoter shutdown, we have constructed a [E1–, E3 –, polymerase–, pTP–] rAd vector, containing a modular liver-specific promoter (LSP) (Ill et al, 1997; Wang et al, 1999, 2000), driving expression of human apoE and have performed intravenous (liver-directed) injections into ~1 year old apoE-/- mice. Despite low levels of plasma apoE that were unable to correct the hypercholesterolaemia, animals sacrificed 7 months after treatment demonstrated significant retardation of atherosclerosis (30%, P <0.006), compared to untreated endpoint control animals.

B. Ad-LSP-apoE transduction of hepatic and non-hepatic cell lines The human hepatic carcinoma cell line HepG2 and the non-hepatic cell lines (NIH3T3, HeLa, C2C12) were maintained in DMEM containing 10% fetal bovine serum (FBS), 2 mM Lglutamine, 100 U/ml penicillin, 100 µg/ml streptomycin and 250 ng/ml amphotericin B at 37°C and 8% CO 2. The HepG2, NIH3T3, HeLa and C2C12 cell lines were seeded into 6-well plates at densities of 2x106, 1.5x105, 3x105 and 1.5x105 per well, respectively. The following day the near-confluent monolayers were infected with the same dilutions of Ad-LSP-apoE at the virus particle (vp) multiplicity of infections (MOI) indicated in Figure 2, as previously described (Harris et al, 2002a). Two days after the infections the medium was harvested and analysed by Western blotting for secreted apoE (Harris et al, 2002a).

C. Intravenous administration of adenovirus vectors Female C57BL/6 apoE-/- mice (Piedrahita et al, 1992) were provided by GlaxoSmithKline (Stevenage, UK) and were maintained on a normal chow diet. The Ad-LSP-apoE and AdCMV-apoE vector stocks were diluted appropriately for intravenous injection using diluent containing 10 mM Tris HCl pH 8.0, 2 mM MgCl2 and 0.9% (w/v) NaCl. Blood (~50 µl) was taken from the tail-vein following 4 h fasts, anti-coagulated with sodium citrate and the plasma stored at -80 °C. To determine the effect of liver-restricted apoE expression upon the hyperlipidaemic phenotype and atheroma progression over a 2 month study period, animals at 15 months of age (n=6) were each administered intravenously with Ad-LSP-apoE at 4x1010 vp in 200 µl. Blood (~50 µl) was taken from the tail-vein following 4 h fasts at 1, 6 and 8 weeks after the injections when animals were killed to examine the effect of apoE gene transfer upon aortic atherosclerotic lesion progression. Groups of untreated baseline (n=7) and endpoint (n=6) animals were also included. To assess whether the Ad-LSP-apoE vector is capable of sustained apoE expression over an extended period, providing continual protection against the development of atherosclerosis, animals at 12 months of age were injected intravenously with either Ad-LSP-apoE (n=5) or Ad-CMV-apoE (n=6) at 4x1010 vp in 200 µl and bloods taken at 7 weeks after the injections then all animals were sacrificed at 28 weeks to examine the extent of atheroma progression. Untreated baseline (n=8) and endpoint (n=7) mice were also included. As to the difference in the age of the animals in the 2 month and 7 month studies at the time of vector administration, apoE-/- mice at 12 months of age have established advanced/complex atherosclerotic lesions which do not differ significantly in animals at 15 months of age (Reddick et al, 1994).

II. Materials and Methods A. Recombinant adenovirus construction Construction of pShuttle-LSP-pA has been described (Ding et al, 2002). The HindIII and EcoRV subfragment containing the apoE cDNA from pShuttle-CMV-apoE (Harris et al, 2002a) was ligated into the Sal1 (blunt-end filled)-HindIII digested pShuttleLSP-pA to yield pShuttle-LSP-apoE-pA. The [E1–, E3–, polymerase–] Ad-CMV-apoE vector was generated as previously described (Harris et al, 2002a). The pShuttle-LSP-apoE-pA construct was linearised with Pme1 and homologously recombined with the adenoviral plasmid containing deletions in the E1, E3, polymerase and pTP genes (Everett et al, 2003), to generate the recombinant [E1 –, E3–, polymerase–, pTP–] adenoviral plasmid pAd-LSP-pA. The rAd plasmids were linearised with Pac1 and transfected into C7 cells (a derivative of human 293 cells that have been engineered to express both the adenovirus polymerase and pre-terminal protein genes), to generate the rAd vectors and high titre virus stocks were prepared using routine procedures (Graham and Prevec, 1995).

D. RT-PCR of apoE transcription To determine the presence of human apoE gene transcription in apoE-/- mice injected intravenously with the adenovirus vector Ad-LSP/apoE, total RNA was isolated from the livers of animals sacrificed at 8 weeks (n=6) and 28 weeks (n=5) after the injections. Total RNAs were isolated from livers using Trizol Reagent (Invitrogen, Paisley, UK), according to the manufacturer’s instructions. DNaseI-treated RNAs (5 µg) were reverse transcribed in a 50 µl reaction containing 62.5 U GeneScript Reverse Transcriptase, 2.5 µM oligo dT(15)-Y-N primer, 0.4 U/µl RNase inhibitor, 0.5 mM dNTPs, 5mM MgCl2 and 1x Excite" reaction buffer (GeneSys Ltd, Farnborough, UK). The reaction conditions were 25°C for 10 min, 48°C for 40 min, then 95°C for 5 min. The derived cDNAs were used to

Gene Therapy and Molecular Biology Vol 10, page 19 amplify a 155 bp product using a primer set specific for the human apoE sequence (apoE primer 1, 5’CTGGGAACTGGCACTGGG-3’; apoE primer 2, 5’CCGATTTGTAGGCCTTCAAC-3’). Also, amplification of a 68 bp product derived from the housekeeping gene glyceraldehydes3-phosphate dehydrogenase (GAPDH) using a published primer set was performed (DeGeest et al, 2001), to demonstrate the presence of equivalent copies of GAPDH transcripts between the RNA preparations. For the apoE and GAPDH amplifications, each 50 µl reaction contained 45 µl Accurase PCR Master Mix (GeneSys Ltd) and the remaining 5 µl contained 3 µl cDNA and 10 pmol of each primer of the appropriate primer set. The reaction conditions were 92°C for 2 min, then 25 cycles of 92°C for 20 s, 62°C (for apoE) or 60°C (for GADPH) for 20 s, then 72°C for 20s, followed by a final extension of 72°C for 10 min. The PCR reactions were subjected to 2% agarose gel electrophoresis and the products visualised by ethidium bromide staining.

microscope with fibre optic light illumination, and the lesion areas analysed as previously described (Harris et al, 2002a).

E. Quantification of plasma apoE and cholesterol and analysis of lipoprotein distribution

Results are expressed as the mean ± S.E. Student’s unpaired 2-tailed t-test was used to compare total plasma cholesterol levels and aortic lesion areas in mice treated with AdLSP-apoE or Ad-CMV-apoE, against the untreated baseline and endpoint control groups; P<0.05 was considered significant.

G. Detection of anti-human apoE and antiadenovirus antibodies by Western blotting analysis For the detection of anti-human apoE and anti-adenovirus antibodies, mouse plasmas were pooled in each of the animal groups and 3 µl was diluted in 600 µl of incubation buffer (Trisbuffered saline containing 2.5% (w/v) milk powder, 0.05% (v/v) Tween-20 and 0.2% (w/v) 2-chloracetamide). Hybond-PVDF Western blots of either partially purified human apoE (~1µg) or Ad-LSP-apoE virus stock (1.88x1010 vp) were used to screen the plasmas for the respective anti-human apoE and anti-adenovirus capsid antibodies, using the Mini-Protean® II Multi-Screen apparatus as described previously (Harris et al, 2002a).

H. Statistical analysis

Levels of human apoE in mouse plasma were monitored by Western blotting as previously described (Harris et al, 2002a) and quantified by a two-antibody sandwich ELISA kit (Stratech Scientific Ltd, Cambridge, UK). Plasma samples for ELISA were diluted 1/10 in assay diluent solution and apoE concentrations were determined according to the manufacturer’s instructions; the sensitivity for detection of apoE was 4 ng/ml. Total cholesterol was measured in plasma diluted 1/10 in PBS (10 µl) using a commercial enzymatic kit (Infinity™ cholesterol reagent, Sigma-Aldrich, Poole, UK) and microtitre plates. Lipoprotein profiles were evaluated by electrophoresis of individual plasma samples (10 µl) on pre-cast alkaline-buffered (pH 8.8) 0.8% agarose gels (YSI, Farnborough, UK), followed by staining with Sudan black, as previously described (Harris et al, 2002a).

III. Results A. Ad-LSP-apoE transduction of hepatic and non-hepatic cell lines To assess the liver specificity of LSP driving expression of human apoE, serial dilutions of the [E1–, E3– , polymerase–, pTP–] rAd vector Ad-LSP-apoE (Figure 1) were used to infect and engineer human hepatoblastoma HepG2 cells and the non-hepatic cell lines NIH3T3, HeLa and C2C12 to secrete human apoE into the culture supernatant. Two days after the infection culture supernatants from the infected HepG2 cells contained apoE above endogenous levels (as indicated by culture supernatants from the mock-infected and untreated HepG2 cultures) in a virus dose-dependent manner (Figure 2). Furthermore, apoE was absent in culture supernatants from the Ad-LSP-apoE-infected cultures of the nonhepatic cell lines NIH3T3, HeLa and C2C12 cells.

F. Dissection and examination of the aortic arch for atherosclerotic lesions Animals in the short-term (8 week) and long-term (28 week) studies of rAd-mediated apoE gene transfer were killed and their aortae were removed, pinned out en face onto cork beds and stained with Oil-Red-O. Images of the aortae were captured with a Nikon digital camera fitted to a stereoscopic zoom

Figure 1. Schematic representation of the adenovirus vectors Ad-CMV-apoE and Ad-LSP-apoE. Both transgene cassettes drive expression of the human apoE3 cDNA and are located at the 5’ end of the [E1-, E2b-, E3-] Ad vector genome replacing the E1-deleted region. Ad-CMV-apoE contains the full human CMV early enhancer/promoter, whereas Ad-LSP-apoE contains the modular synthetic liver-specific promoter (LSP) comprised of two copies of the #1-microglobulin/bikunin enhancer and the thyroid hormone-binding globulin promoter. pA, SV40 polyadenylation signal; ITR, inverted terminal repeat. SD/SA, SV40 intron.

Harris et al: Liver-directed gene transfer of human apoE inhibits atherogenesis

Figure 2. Ad-LSP-apoE infection of hepatic (HepG2) and non-hepatic (NIH3T3, HeLa, C2C12) cell lines followed by analysis for secretion of recombinant human apoE (34 kDa). The cell lines were infected at the indicated MOIs with the same virus dilutions. and analysed by Western blotting to detect secreted human apoE. Two days after the infections culture medium was harvested and analysed by Western blotting for the presence of apoE. HepG2 cells show apoE secretion above endogenous levels in a virus dose-dependent manner. Infection of HeLa, NIH3T3 and C2C12 cells resulted in no secretion of apoE following the Ad-LSP-apoE infections. HepG2, culture medium harvested from a HepG2 culture was used as a positive control for the NIH3T3, HeLa and C2C12 Western blots. C7 + Ad, culture supernatant harvested during propagation of Ad-LSP-apoE vector in C7 cells demonstrating 100% cytopathic effect.

analysis, which has a detection limit of !1pg of antigen, demonstrated that plasma apoE was present throughout the study period in individual animals (Figure 4a). Additionally, a slight increase in the accumulation of plasma apoE was observed between tail bleeds at 1 week and those at 6 and 8 weeks after the injections. In order for apoE to impact on the hyperlipidaemia in the apoE-/mouse, the plasma levels of apoE need to exceed 0.4 Âľg/ml (Hasty et al, 1999a). Therefore, in animals treated with Ad-LSP-apoE, no alteration in total plasma cholesterol levels or lipoprotein distributions were observed (Figure 5). To investigate liver-specific apoE expression over an extended study period, animals were treated with either Ad-LSP-apoE (n=5) or Ad-CMV-apoE (n=6) and tail vein bleeds taken at 7 and 28 weeks post-injection, with all animals being killed at 28 weeks. Following treatment with Ad-LSP-apoE plasma apoE levels were below the detection limit of the apoE ELISA, whereas following treatment with Ad-CMV-apoE, plasma from one animal at 7 weeks and another animal at 28 weeks contained plasma apoE levels of 47 ng/ml and 69 ng/ml, respectively. Upon Western blotting analysis plasma from animals treated with Ad-LSP-apoE, demonstrated sustained but low levels

B. Secretion of plasma apoE following intravenous injection of Ad-LSP-apoE and the effect on total plasma cholesterol and lipoprotein distribution Over the course of the study, human apoE transcription was readily detectable in all animals sacrificed at 8 weeks and 4 out of 5 animals sacrificed at 28 weeks after administration of Ad-LSP-apoE (Figure 3). In contrast, our previous studies involving intravenous administration of Ad-CMV-apoE readily detected apoEspecific transcripts at 8 and 16 days post-injection, with a marked decline in apoE cDNAs at 70 days after vector administration (Harris et al, 2002a). The ability of liver-directed (intravenous) injection of Ad-LSP-apoE to achieve sustained hepatic secretion of human apoE into the circulation with subsequent alteration of total plasma cholesterol levels and lipoprotein distribution, was assessed over a 8 week study period. Following intravenous vector administration, tail-vein bleeds were taken at 1, 6 and 8 weeks after the injections, with all animals being killed at 8 weeks. At all time points the plasma levels of apoE were below the sensitivity limit of the apoE ELISA (<4 ng/ml). However, Western blotting

Gene Therapy and Molecular Biology Vol 10, page 21 of apoE (Figure 4b). In the case of Ad-CMV/apoE-treated animals, residual apoE levels were still evident at 28 weeks after the injections, compared to the higher

systemic levels observed in plasmas harvested 7 weeks post-injection (Figure 4b).

Figure 3. RT-PCR analysis of human apoE transcription in the livers of apoE-/- mice following intravenous injection of Ad-LSP/apoE (dose, 4x1010 vp). Total RNAs were isolated from the livers of animals at 2 months (n=6) and 7 months (n=5) after intravenous administration. The RNAs were subjected to reverse transcription followed by PCR amplification using primer sets specific for either the human apoE cDNA (155 bp product) or the housekeeping gene GAPDH (68 bp product). The positive control (+) is the plasmid pAd-CMV/apoE. DL, 1 kb DNA ladder with fragment sizes indicated on the left-hand side of the gel.

Figure 4. Immunodetection of human apoE (34 kDa) in the plasmas of apoE-/- mice treated with either Ad-LSP-apoE or Ad-CMV-apoE. Mice were injected intravenously with 4x1010 vp of rAd vector and tail-vein bleeds were taken as indicated and the presence of human apoE in plasmas samples (4 Âľl) was determined for individual animals by Western blotting analysis. A. Animals were treated with AdLSP-apoE (n=6) and tail-vein bleeds were taken 1 and 6 weeks, with all animals sacrificed at 8 weeks. B. Animals were treated with either Ad-LSP-apoE (n=5) or Ad-CMV-apoE (n=6) and tail vein bleeds were taken at 7 weeks, with all animals sacrificed at 28 weeks after the injections. Three representative plasmas from each group are shown. U, plasma from an untreated apoE-/- mouse.

Harris et al: Liver-directed gene transfer of human apoE inhibits atherogenesis

Figure 5. Analysis of total plasma cholesterol and lipoprotein distribution of 15 month old apoE-/- mice 8 weeks after intravenous administration with 4x1010 vp of Ad-LSP-apoE. (A) Total plasma cholesterol levels were determined for individual animals following tail-vein injections of Ad-LSP-apoE (n=6). Values are means ± S.E. and data from untreated baseline (n=7) and endpoint (n=5) animal groups are also shown. (B) Lipoprotein distribution in representative plasmas from the Ad-LSP-apoE-treated and untreated baseline and endpoint control groups. Plasma samples (10 µl) were separated by 0.8% native agarose gel electrophoresis, followed by staining with Sudan black to reveal lipoprotein mobilities and estimate relative amounts.

aortic lesion area of the Ad-LSP-apoE-treated animals compared to the untreated control groups was insignificant (baseline, P=0.8. endpoint, P=0.2), two of the Ad-LSPapoE-treated animals had strikingly reduced lesion areas of 33.3% and 27.1% compared to lesion areas of the remaining treated animals (i.e. 47.0%, 40.2%, 48.0% and 40.3%). Analysis of aortic lesions in animals treated at 12 months of age with either Ad-LSP-apoE or Ad-CMVapoE and sacrificed 28 weeks later, had mean aortic lesion areas of 34.3±4.3% (n=5) and 29.7±3.3% (n=6), respectively (Figure 7a and 7b). Moreover, compared to the endpoint untreated control group (n=7), treatment with Ad-LSP/apoE or Ad-CMV/apoE resulted in clear retardation of atherosclerosis of 30% (P<0.006) and 39% (P<0.0002), respectively.

C. Analysis of atherosclerotic lesion progression following intravenous injection of Ad-LSP-apoE The effect of Ad-LSP-apoE on atherosclerotic lesion progression was assessed in animals sacrificed at 8 and 28 weeks after the injections. The aortae were removed and the percentage of luminal area containing atheroma from the aortic arch down to the diaphragm which stained with Oil-Red-O was measured. Upon examination of the aortae from the animal group treated at 15 months of age with Ad-LSP-apoE and sacrificed 8 weeks later, a mean aortic lesion area of 39.3±3.3% (n=6) was observed, whereas untreated baseline and endpoint control groups had lesion areas of 40.4±2.7% (n=7) and 47.6±5.4% (n=5), respectively (Figure 6a and 6b). Although the reduced

Gene Therapy and Molecular Biology Vol 10, page 23

Figure 6. Quantification of atherosclerotic lesion areas in the aortae of apoE-/- mice 8 weeks after intravenous administration with 4x1010 vp of Ad-LSP-apoE. Animals were treated at 15 months of age and sacrificed 8 weeks later. The aortae were removed, dissected en face onto cork beds and stained with Oil-Red-O. (A) Mean percentage aortic lesion areas of the Ad-LSP-apoE (n=6) and the untreated baseline (n=7) and endpoint (n=5) animal groups. Values are shown as mean Âą S.E. P values, 2-tailed unpaired t-test. (B) Representative aortae from each of the animal groups stained with Oil-Red-O.

Figure 7. Retardation of advanced atherosclerotic aortic lesions in apoE-/- mice 28 weeks after intravenous administration with either Ad-LSP-apoE or Ad-CMV-apoE. Animals at 12 months of age were injected intravenously with either Ad-LSP-apoE or Ad-CMV-apoE at a dose of 4x1010 vp. Animals were sacrificed 28 weeks later and the aortae removed, dissected en face onto cork beds and stained with Oil-Red-O. (A) Mean percentage aortic lesion areas of the Ad-LSP-apoE- (n=5) and Ad-CMV-apoE- (n=6) treated groups and the untreated baseline (n=8) and endpoint (n=7) control groups. Values are shown as Âą S.E. P values, 2-tailed unpaired t-test. (B) Representative aortae from each of the animal groups.

against the transgene product. However, administration of both vectors resulted in the appearance of antibodies against the adenovirus hexon capsid protein at weeks 6 and 7 respectively and persisted throughout the study period (Figure 8).

D. Humoral immune responses against the apoE transgene product and adenovirus vector Throughout the course of the study, intravenous injection of either Ad-LSP-apoE or Ad-CMV-apoE did not result in the stimulation of a humoral immune response 23

Harris et al: Liver-directed gene transfer of human apoE inhibits atherogenesis

Figure 8. Analysis of humoral immune responses against the apoE (34 kDa) transgene product and the hexon (105 kDa) capsid protein of the rAd particle in transduced apoE-/- mice. Western blots of partially purified human apoE or adenovirus protein preparations were used to screen plasmas from animals injected intravenously with 4x1010 vp of either Ad-LSP-apoE or Ad-CMV-apoE. U, plasma from an untreated apoE-/- mouse. +, mouse monoclonal anti-human apoE antibody.

that imparts strong liver-specific transcriptional activity (Hayashi et al, 1993). In this study, intravenous administration of Ad-LSPapoE into apoE-/- mice resulted in sustained, albeit low, levels of plasma apoE throughout the study period (7 months) and resulted in significant retardation of aortic atherosclerotic lesion progression (30%, P<0.006). This is consistent with our previous investigations whereby intramuscular injection of apoE-/- mice, with either a plasmid or recombinant adeno-associated virus vector expressing human apoE, gave low levels of plasma apoE that were atheroprotective without correcting the hypercholesterolaemia (Athanasopoulos et al, 2000; Harris et al, 2002b). Similarly, transgenic mice in which apoE expression is restricted to adrenal glands or macrophages have low plasma apoE (<1-7% of wild-type levels), but are atheroprotected whilst remaining hyperlipidaemic (Thorngate et al, 2000; Hasty et al, 1999b; Bellosta et al, 1995). Intriguingly, studies in which apoE+/+ bone marrow was mixed with apoE-/- marrow in increasing amounts and transplanted into apoE-/- recipient mice, indicated that a threshold of 0.4 Âľg apoE/ml plasma is required for the hepatic clearance of remnant lipoproteins (Hasty et al, 1999a). These investigations suggest that apoE can be atheroprotective by mechanisms other than its ability to lower plasma cholesterol levels. Recombinant apoE is known to localise to the arterial intima following rAd-mediated liver transduction (Tsukamoto et al, 1999; Tangirala et al, 2001). This may explain why treatment with Ad-LSP-apoE inhibits atherosclerotic lesion progression in the presence of high levels of atherogenic lipoproteins, since atheroprotection is also seen when apoE expression in transgenic apoE-/- mice is restricted to the artery wall or to macrophages (Bellosta et al, 1995; Shimano et al, 1995; Hasty et al, 1999b). One proposed mechanism is that apoE promotes cholesterol efflux from the arterial wall and its transport to the liver

IV. Discussion Nearly all apoE circulating in plasma is derived from the liver (Mahley, 1988) and therefore this organ is the natural target for apoE gene transfer in the apoE-/- mouse. Indeed, the liver synthesises a great variety of essential proteins, where many undergo post-translational modifications necessary for full functional activity. The human apoE gene is a member of the 44 kb apoE gene cluster located on chromosome 19 that also includes apoCI, apoCII and apoCIV and two distinct hepatic control regions (HCR1 and HCR2), that are responsible for the hepatocyte-restricted expression of these genes (Allen et al, 1997). This indicates that there are regulatory elements that provide liver-restricted expression of genes such as apoE. In this study, liver-restricted production of human apoE in apoE-/- mice was achieved by intravenous injection of a [E1!, E3!, polymerase!, pTP!] rAd vector containing the LSP driving expression of the human apoE cDNA. The LSP is a modular synthetic promoter composed of two copies of the enhancer sequence from the #1-microglobulin/bikunin gene (Rouet et al, 1992) and the promoter sequence from the thyroxine-binding globulin gene (Hayashi et al, 1993). The #1microglobulin/bikunin gene contains a weak promoter with the potential for ubiquitous expression and the presence of the upstream enhancer, which contains a cluster of liver-specific elements for hepatic nuclear factors (HNF), confers full hepatocyte-restricted #1microglobulin/bikunin expression (Rouet et al, 1992). Indeed, such multiple cis-acting regulatory DNA sequences that bind these transcription factors are a common feature of genes that demonstrate strong hepatocyte-restricted expression, such as albumin and #1antitrypsin (Lai et al, 1991). The promoter from the thyroxine-binding globulin gene was chosen as it has been fully characterised and contains a HNF-1 binding motif

Gene Therapy and Molecular Biology Vol 10, page 25 for excretion (Bellosta et al, 1995; Shimano et al, 1995; Hasty et al, 1999b). In support, there is evidence that macrophage-derived apoE can restore the capacity of apoE-deficient plasma to efflux cholesterol from cultured fibroblasts (Zhu et al, 1998) and that apoE facilitates interaction of apoA1 in HDL particles with scavenger receptor-B1 (SR-B1), which selectively extracts cholesteryl esters from HDL into liver (Arai et al, 1999; Owen and Mulcahy, 2002). The ATP-binding cassette transporter A1 (ABCA1) mediates the first step in reverse cholesterol transport where free cholesterol is released from peripheral cells to lipid-poor apolipoproteins (Owen and Mulcahy, 2002). However, inhibiting ABCA1 activity does not attenuate apoE-mediated cholesterol efflux (Huang et al, 2001), while ABCA1-mediated cholesterol efflux in apoE-/- and apoA-I-/-/apoE-/- mice is not restored by low level expression of apoE (Thorngate et al, 2003). These findings suggest that apoE can be atheroprotective at the arterial wall by mechanisms that are independent of its involvement in reverse cholesterol transport. These may include apoE inhibition of platelet aggregation (Riddell et al, 1997) and smooth muscle cell migration and proliferation (Ishigami et al, 1998), the prevention of LDL retention in the subendothelial matrix (Saxena et al, 1993), and antioxidant (Mabile et al, 2003) and anti-inflammatory activities (Stannard et al, 2001). Recently, Raffai et al, (2005) demonstrated for the first time that apoE promotes regression of atherosclerosis independently of lowering plasma cholesterol. They utilized hypomorphic apoE mice that express an apoE4-like variant of mouse apoE at plasma levels that are ~2% to 5% of normal and carry the inducible Mx1-Cre apoE transgene, which allows for induction of physiological levels of apoE. After 18 weeks on a hypercholesterolaemic diet to promote a high atherosclerotic burden, animals were placed on a normal chow diet for 16 weeks, with half the animals induced to express physiological levels of apoE. Although cholesterol levels between the non-induced and induced animal groups were insignificant, the induced animals demonstrated an enhanced regression of aortic atheroma (Raffai et al, 2005). Following systemic administration of rAd vectors, the majority of virus is rapidly cleared from the circulation by the liver (Alemany et al, 2000; Jaffe et al, 1992; Herz et al, 1993; Kay et al, 1994). The virus (which has an average diameter of ~80 nm) enters the liver sinusoids via the portal vein and passes unhindered through the ~100 nm fenestrae of the sinusoidal endothelium into the space of Disse, which is in direct contact with hepatocytes (Fechner et al, 1999). Here, adenovirus is initially taken up by Kupffer cells, the resident macrophages of the liver, which act as a barrier to hepatocyte transduction, where the vector dose has to be sufficient to saturate this cell population before hepatocytes are efficiently transduced (Tao et al, 2001). Uptake of adenovirus by Kupffer cells activates these cells to release proinflammatory cytokines and chemokines that lead to leukocyte recruitment and acute hepatic inflammation, resulting in the elimination of >90% of vector genome within 24 h of vector administration (Lieber et al, 1997; Worgall et al, 1997; Muruve et al, 1999; Schnell et al, 2001; Zhang et al,

2001). This innate immune response is triggered by the viral capsid and in the absence of viral gene expression does not proceed beyond 24 h (Lieber et al, 1997; Muruve et al, 1999; Borgland et al, 2000; Liu et al, 2003). Hence, multiply deleted (Lieber et al, 1997) and helper-dependent (Muruve et al, 2004) adenovirus vectors cause this inflammatory response to similar levels to those observed with first generation adenovirus vectors, as they are packaged in a common intact viral particle. Following administration of first generation adenovirus vectors, the innate immune response is proceeded by an adaptive immune response 5 to 7 days after vector administration (Liu et al, 2003). This is directed against newly synthesised viral proteins and transgene product, where activated Kupffer cells present de novo synthesised viral proteins and/or transgene product to MHC class Irestricted CD8+ T lymphocytes (CTLs). The adaptive immune response together with direct toxicity of the virus, go on to eliminate the remainder of transduced hepatocytes by 3 weeks after vector administration, thus resulting in the loss of transgene expression (Yang et al, 1994a,b, 1995, 1996a; Tripathy et al, 1996; Morral et al, 1997; Song et al, 1997; Worgall et al, 1997). Additionally, Kupffer cells express MHC class II molecules and therefore the presentation of input viral capsid proteins to CD4+ T helper cells, may lead to the formation of neutralizing anti-Ad antibodies preventing successful readministration of Ad vector (Yang et al, 1996b). In relation to the distribution of CTL targets in an adaptive immune response against systemic Ad vector administration, the level of CTL response and whether it is directed against adenovirus antigens and/or the transgene product is dependent on the MHC haplotype of the host. Indeed, the variation in CTL response to Ad vector between mouse strains is due to differences in the H-2 haplotype (Sparer et al, 1997; Jooss et al, 1998). Kupffer cells are an integral component of the immune response against Ad vectors. Selective Kupffer cell depletion followed by injection of a low dose of Ad vector (! 1x109 pfu/mouse), results in decreased plasma cytokine levels, with increased and prolonged transgene expression (Kuzmin et al, 1997; Wolff et al, 1997; Worgall et al, 1997; Schiedner et al, 2003). Thus, hepatocyte-restricted expression of an adenoviral transgene may prevent immune clearance of transduced cells. Hepatocytes express MHC Class I molecules that are upregulated by activated CD8+ T cells releasing interferon$, sensitizing the hepatocytes to CTL-mediated cytolysis (Yang et al, 1995). However, hepatocytes do not express co-stimulatory molecules and therefore MHC Class Irestricted presentation of antigenic peptides to na誰ve T cells does not result in T cell activation, but may lead to anergy or immune tolerance against the epitope (Guerder et al, 1995). Hence, in this study, the utilisation of a polymerase/pTP-deleted Ad vector, in combination with hepatocyte-specific transgene expression, may have contributed to the sustained expression of recombinant apoE. The removal of the polymerase and pTP genes from the Ad vector backbone virtually eliminates adenoviral late gene expression, which significantly reduces hepatotoxicity, as well as removing the trigger for the

Harris et al: Liver-directed gene transfer of human apoE inhibits atherogenesis cholesteryl esters in apolipoprotein E knockout mice. Proc Natl Acad Sci USA 96, 12050-12055. Athanasopoulos T, Owen JS, Hassall D, Dunckley MG, Drew J, Goodman J, Tagalakis AD, Riddell DR and Dickson G (2000) Intramuscular injection of a plasmid vector expressing human apolipoprotein E limits progression of xanthoma and aortic atheroma in apoE-deficient mice. Hum Mol Genet 9, 2545-2551. Aurisicchio L, Delmastro P, Salucci V, Paz OG, Rovere P, Ciliberto G, La Monica N and Palombo F (2000) Liverspecific #2 interferon gene expression results in protection from induced hepatitis. J Virol 74, 4816-4823. Bellosta S, Mahley RW, Sanan DA, Murata J, Newland DL, Taylor JM and Pitas RE (1995) Macrophage-specific expression of human apolipoprotein E reduces atherosclerosis in hypercholesterolemic apolipoprotein E-null mice. J Clin Invest 96, 2170-2179. Borgland SL, Bowen GP, Wong NCW, Libermann TA and Muruve DA (2000) Adenovirus vector induced expression of the C-X-C chemokine IP-10 is mediated through capsiddependent activation of NF-%B. J Virol 74, 3941-3947. Dai Y, Schwarz EM, Gu D, Zhang WW, Sarvetnick N and Verma IM (1995) Cellular and humoral responses to adenoviral vectors containing factor IX gene: tolerization of factor IX and vector antigens allows for long-term expression. Proc Natl Acad Sci USA 92, 1401-1405. De Geest B, Van Linthout S and Collen D (2001) Sustained expression of human apo A1 following adenoviral gene transfer in mice. Gene Ther 8, 121-127. Ding E, Hu H, Hodges BL, Migone F, Serra D, Xu F, Chen Y-T and Amalfitano A (2002) Efficacy of gene therapy for a prototypical lysosomal storage disease (GSD-II) is critically dependent on vector dose, transgene promoter and the tissues targeted for vector transduction. Mol Ther 5, 436-446. Everett RS, Hodges BL, Ding EY, Xu F, Serra D and Amalfitano A (2003) Liver toxicities typically induced by first generation adenoviral vectors can be reduced by use of E1, E2b-deleted adenoviral vectors. Hum Gene Ther 14, 17151726. Fielding CJ and Fielding PE (1995) Molecular physiology of reverse cholesterol transport. J Lipid Res 36, 211-228. Graham FL and Prevec L (1995) Methods for construction of adenovirus vectors. Mol Biotech 3, 207-220. Guerder S and Flavell RA (1995) Costimulation in tolerance and autoimmunity. Int Rev Immunol 13, 135-146. Guo ZS, Wang L-H, Eisensmith RC and Woo SLC (1996) Evaluation of promoter strength for hepatic gene expression in vivo following adenovirus-mediated gene transfer. Gene Ther 3, 802-810. Fechner H, Haack A, Wang H, Wang X, Eizema K, Pauschinger M, Schoemaker R, Veghel R, Houtsmuller A, Schultheiss HP, Lamers J and Poller W (1999) Expression of coxsackie adenovirus receptor and #v-integrin does not correlate with adenovector targeting in vivo indicating anatomical vector barriers. Gene Ther 6, 1520-1535. Jaffe HA, Danel C, Longenecker G, Metzger M, Setoguchi Y, Rosenfeld MA, Gant TW, Thorgeirsson SS, StratfordPerricaudet LD, Perricaudet M, Pavirani A, Lecocq JP and Crystal RG (1992) Adenovirus-mediated in vivo gene transfer and expression in normal rat liver. Nat Genet 1, 372-378. Harris JD, Graham IR, Schepelmann S, Stannard AK, Roberts ML, Hodges BL, Hill V, Amalfitano A, Hassall DG, Owen JS and Dickson G (2002a) Acute regression of advanced and retardation of early aortic atheroma in immunocompetent apolipoprotein-E (apoE) deficient mice by administration of a

adaptive immune response that would otherwise lead to the immune clearance of the remainder of adenovirustransduced cells (Everett et al, 2003; Amalfitano et al, 1998; Hu et al, 1999). Indeed, rAd vectors devoid of all viral coding sequences, referred to as helper-dependent Ad vectors, and containing liver-specific promoters driving transgene expression, provide long lasting levels of transgene product (Morral et al, 1998; Aurisicchio et al, 2000). In support of our findings, is the observation that a humoral immune response against the transgene product was absent in animals treated with Ad-LSP-apoE, as well as Ad-CMV-apoE, which confirms our previous findings (Harris et al, 2002a). Hepatocyte-restricted transgene expression may be preferable to selective Kupffer cell depletion, as the injection of higher vector doses, in combination with Kupffer cell depletion, caused a greater inflammatory response and decreased transgene expression in hepatocytes (Kuzmin et al, 1997; Lieber et al, 1997). In fact, the reticuloendothelial system in the liver is primarily composed of Kupffer cells and may prevent the development of a systemic inflammatory response by sequestering an infectious agent, thus limiting its dissemination to lymphoid organs such as draining lymph nodes and the spleen (Jooss et al, 2003). In conclusion, we have demonstrated that liverdirected administration of a [E1!, E3!, polymerase! , pTP!] rAd vector containing the LSP driving human apoE expression in apoE-/- mice, resulted in sustained, albeit low, levels of circulating apoE throughout the course of the study (7 months) and a significant retardation of atherosclerosis (30%, P<0.006) without correcting the hypercholesterolaemia. As well as providing sustained transgene expression, rAd vectors containing liver-specific promoters provide a safer therapeutic profile in terms of minimising the immune response against the adenovirus and transgene product.

Acknowledgements Parts of this work were supported by grants from the British Heart Foundation (PG/99032), Sir Jules Thorn Charitable Trust (R2468-88-7), National Heart Research Fund (RG2447) and Wellcome Trust (054413 and GR066327FR). We thank Dr Amanda Harvey for critical reading of the manuscript.

References Alemany R, Suzuki K and Curiel DT (2000) Blood clearance rates of adenovirus type 5 in mice. J Gen Virol 81, 26052609. Allan CM, Taylor S and Taylor JM (1997) Two hepatic enhancers, HCR.1 and HCR.2, coordinate the liver expression of the entire human apolipoprotein E/C-I/C-IV/CII gene cluster. J Biol Chem 272, 29113-29119. Amalfitano A, Hauser MA, Hu H, Serra D, Begy CR and Chamberlain JS (1998) Production and characterization of improved adenovirus vectors with the E1, E2b and E3 genes deleted. J Virol 72, 926-933. Arai T, Rinninger F, Varban L, Fairchild-Huntress V, Liang CP, Chen W, Seo T, Deckelbaum R, Huszar D and Tall AR (1999) Decreased selective uptake of high density lipoprotein

Gene Therapy and Molecular Biology Vol 10, page 27 -

91, 2353-2357. Kuzmin AI, Finegold MJ and Eisensmith RC (1997) Macrophage depletion increases the safety, efficacy and persistence of adenovirus-mediated gene transfer in vivo. Gene Ther 4, 309-316. Lai E and Darnell Jr JE (1991) Transcriptional control in hepatocytes: a window on development. TIBS 16, 427-430. Lieber A, He CY, Meuse L, Schowalter D, Kirillova I, Winther B and Kay MA (1997) The role of Kupffer cell activation and viral gene expression in early liver toxicity after infusion of recombinant adenovirus vectors. J Virol 71, 8798-8807. Liu Q, Zaiss AK, Colarusso P, Patel K, Haljan G, Wickham TJ, Muruve DA (2003) The role of capsid-endothelial interactions in the innate immune response to adenovirus vectors. Hum Gene Ther 14, 627-643. Loser P, Jennings GS, Strauss M and Sandig V (1998) Reactivation of the previously silenced cytomegalovirus major immediate-early promoter in the mouse liver: involvement of NF%B. J Virol 72, 180-190. Mabile L, Lefebvre C, Lavigne J, Boulet L, Davignon J, LussierCacan S and Bernier L (2003) Secreted macrophage apolipoprotein E reduces macrophage-mediated LDL oxidation in an isoform-dependent way. J Cell Biochem 90, 766-776. Mahley RW and Rall Jr SC (2000) Apolipoprotein E: far more than a lipid transport protein. Annu Rev Genomics Hum Genet 1, 507-537. Mahley RW (1988) Apolipoprotein E: Cholesterol transport protein with expanding role in cell biology. Science 240, 622-630. Morral N, Oâ&#x20AC;&#x2122;Neal W, Zhou H, Langston C and Beaudet A (1997) Immune responses to reporter proteins and high viral dose limit duration of expression with adenoviral vectors: comparison of E2a wild type and E2a deleted vectors. Hum Gene Ther 8, 1275-1286. Morral N, Parks RJ, Zhou H, Langston C, Schiedner G, Quinones J, Graham FL, Kochanek S and Beaudet AL (1998) High doses of a helper-dependent adenoviral vector yield supraphysiological levels of #1-antitrypsin with negligible toxicity. Hum Gene Ther 10, 2709-2716. Muruve DA, Barnes MJ, Stillman IE and Libermann TA (1999) Adenoviral gene therapy leads to rapid induction of multiple chemokines and acute neutrophil-dependent hepatic injury in vivo. Hum Gene Ther 10, 965-976. Muruve DA, Cotter MJ, Zaiss AK, White LR, Liu Q, Chan T, Clark SA, Ross PJ, Meulenbroek RA, Maelandsmo GM and Parks RJ (2004) Helper-dependent adenovirus vectors elicit intact innate but attenuated adaptive host immune responses in vivo. J Virol 78, 5966-5972. Nakashima Y, Plump AS, Raines EW, Breslow JL and Ross R (1994) ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree. Arterioscler Thromb Vasc Biol 14, 133-140. Owen JS and Mulcahy JV (2002) ATP-binding cassette A1 protein and HDL homeostasis. Atheroscler Suppl 3, 13-22. Piedrahita JA, Zhang SH, Hagaman JR, Oliver PM and Maeda N (1992) Generation of mice carrying a mutant apolipoprotein E gene inactivated by gene targeting in embryonic stem cells. Proc Natl Acad Sci USA 89, 4471-4475. Qin L, Ding Y, Pahud DR, Chang E, Imperiale MJ and Bromberg JS (1997) Promoter attenuation in gene therapy: interferon-$ and tumor necrosis-# transgene expression. Hum Gene Ther 8, 2019-2029. Raffai RL, Loeb SM and Weisgraber KH (2005) Apolipoprotein E promotes the regression of atherosclerosis independently

second generation [E1 , E3 , polymerase ] adenovirus vector expressing human apoE. Hum Mol Genet 11, 43-58. Harris JD, Schepelmann S, Athanasopoulos T, Graham IR, Stannard AK, Mohri Z, Hill V, Hassall DG, Owen JS and Dickson G (2002b) Inhibition of atherosclerosis in apolipoprotein-E deficient mice following muscle transduction with adeno-associated virus vectors encoding human apolipoprotein-E. Gene Ther 9, 21-29. Hasty AH, Linton MF, Swift LL and Fazio S (1999a) Determination of the lower threshold of apolipoprotein E resulting in remnant lipoprotein clearance. J Lipid Res 40, 1529-1538. Hasty AH, Linton MF, Brandt SJ, Babaev VR, Gleaves LA and Fazio S (1999b) Retroviral gene therapy in apoE-deficient mice: apoE expression in the artery wall reduces early foam cell lesion formation. Circulation 99, 2571-2576. Hayashi Y, Mori Y, Janssen OE, Sunthornthepvarakul T, Weiss RE, Takeda K, Weinberg M, Seo H, Bell GI, Refetoff ST (1993) Human thyroxine-binding globulin gene: Complete sequence and transcriptional regulation. Mol Endocrinol 7, 1049-1060. Herz J and Gerard RD (1993) Adenovirus-mediated transfer of low density lipoprotein receptor gene acutely accelerates cholesterol clearance in normal mice. Proc Natl Acad Sci USA 90, 2812â&#x20AC;&#x201C;2816. Hu H, Serra D and Amalfitano A (1999) Persistence of an [E1-, polymerase-] adenovirus vector despite transduction of a neoantigen into immune-competent mice. Hum Gene Ther 10, 355-364. Huang ZH, Lin CY, Oram JF and Mazzone T (2001) Sterol efflux mediated by endogenous macrophage apoE expression is independent of ABCA1. Arterioscler Thromb Vasc Biol 21, 2019-2025. Ill CR, Yang CQ, Bidlingmaier SM, Gonzales JN, Burns DS, Bartholomew RM and Scuderi P (1997) Optimization of the human factor VIII complementary DNA expression plasmid for gene therapy of hemophilia. Blood Coagul Fibrinolysis 8 (Suppl 2), S23-S30. Ishigami M, Swertfeger DK, Granholm NA and Hui DY (1998) Apolipoprotein E inhibits platelet derived growth factorinduced vascular smooth muscle cell migration and proliferation by suppressing signal transduction and preventing cell entry to G1 phase. J Biol Chem 273, 2015620161. Jooss K and Chirmule N (2003) Immunity to adenovirus and adeno-associated viral vectors: implications for gene therapy. Gene Ther 10, 955-963. Jooss K, Ertl HCJ and Wilson JM (1998) Cytotoxic Tlymphocyte target proteins and their major histocompatibility complex class I restriction in response to adenovirus vectors delivered to mouse liver. J Virol 72, 2945-2954. Kashyap VS, Santamarina-Fojo S, Brown DR, Parrott CL, Applebaum-Bowden D, Meyn S, Talley G, Paigen B, Maeda N and Brewer HB (1995) Apolipoprotein E deficiency in mice: gene replacement and prevention of atherosclerosis using adenovirus vectors. J Clin Invest 96, 1612-1620. Kay M, Li Q, Liu T-J, Leland F, Toman C, Finegold M and Woo SLC (1992) Hepatic gene therapy: persistent expression of human #1-antitrypsin in mice after direct gene delivery in vivo. Hum Gene Ther 3, 641-647. Kay MA, Landen CN, Rothenberg SR, Taylor LA, Leland F, Wiehle S, Fang B, Bellinger D, Finegold M, Thompson AR, Read M, Brinkhous KM, Woo SLC (1994) In vivo hepatic gene therapy: complete albeit transient correction of factor IX deficiency in hemophilia dogs. Proc Natl Acad Sci USA

Harris et al: Liver-directed gene transfer of human apoE inhibits atherogenesis of lowering plasma cholesterol levels. Arterioscler Thromb Vasc Biol 25, 436-441. Reddick RL, Zhang SH and Maeda N (1994) Atherosclerosis in mice lacking apoE. Evaluation of lesional development and progression. Arterioscler Thromb 14, 141-147. Riddell DR, Graham A and Owen JS (1997) Apolipoprotein E inhibits platelet aggregation by stimulation of the Larginine:nitric oxide pathway. Implications for vascular disease. J Biol Chem 272, 89-95. Rouet P, Rauenez G, Tronche F, Yaniv M, N'Guyen C and Salier JP (1992) A potent enhancer made of clustered liver-specific elements in the transcription control sequences of human "1 microglobulin/bikunin gene. J Biol Chem 267, 2076520773. Saxena U, Ferguson E and Bisgaier CL (1993). Apolipoprotein E modulates low density lipoprotein retention by lipoprotein lipase anchored to the subendothelial matrix. J Biol Chem 268, 14812-14819. Saxena U, Ferguson E and B™sga™er CL. Apolipoprotein E modulates low density lipoprotein retention by lipoprotein lipase anchored to the subendothelial matrix. J Biol Chem 268, 14812-14819. Schiedner G, Hertel S, Johnston M, Dries V, Van Rooijen N and Kochanek S (2003) Selective depletion or blockade of Kupffer cells leads to enhanced and prolonged hepatic transgene expression using high-capacity adenoviral vectors. Mol Ther 7, 35-43. Schnell MA, Zhang Y, Tazelaar J, Gao GP, Yu QC, Qian R, Chen SJ, Varnavski AN, LeClair C, Raper SE and Wilson JM (2001) Activation of innate immunity in nonhuman primates following intraportal administration of adenoviral vector. Mol Ther 3, 708-722. Shimano H, Ohsuga J, Shimada M, Namba Y, Gotoda T, Harada K, Katsuki M, Yazaki Y and Yamada N (1995) Inhibition of diet-induced atheroma formation in transgenic mice expressing apolipoprotein E in the arterial wall. J Clin Invest 95, 469-476. Song W, Kong H-L, Traktman P and Crystal RG (1997) Cytotoxic lymphocyte responses encoded by heterologous transgenes transferred in vivo by adenoviral vectors. Hum Gene Ther 8, 1207-1217. Sparer TE, Wynn SG, Clark DJ, Kaplan JM, Cardoza LM, Wadsworth SC, Smith AE and Gooding LR (1997) Generation of cytotoxic T lymphocytes against immunorecessive epitopes after multiple immunizations with adenovirus vectors is dependent on haplotype. J Virol 71, 2277-2284. Stannard AK, Riddell DR, Sacre SM, Tagalakis AD, Langer C, von Eckardstein A, Cullen, P, Athanasopoulos T, Dickson G and Owen JS (2001) Cell-derived apolipoprotein E particles inhibit cytokine-induced vascular cell adhesion molecule-1 expression in endothelial cells. J Biol Chem 276, 4601146016. Stevenson SC, Marshall-Neff J, Teng B, Lee CB, Roy S and McClelland A (1995) Phenotypic correction of hypercholesterolemia in apoE-deficient mice by adenovirusmediated in vivo gene transfer. Arterioscler Thromb Vasc Biol 15, 479-484. Tangirala RK, Pratico D, FitzGerald GA, Chun S, Tsukamoto K, Maugeais C, Usher DC, Pure E and Rader DJ (2001) Reduction of isoprostanes and regression of advanced atherosclerosis by apolipoprotein E. J Biol Chem 276, 261266. Tao N, Gao GP, Parr M, Johnston J, Baradet T, Wilson JM, Barsoum J and Fawell SE (2001) Sequestration of adenoviral

vector by kupffer cells leads to a nonlinear dose response of transduction. Mol Ther 3, 28-35. Thorngate FE, Rudel LL, Walzem RL and Williams DL (2000) Low levels of extrahepatic nonmacrophage apoE inhibit atherosclerosis without correcting hypercholesterolemia in ApoE-deficient mice. Arterioscler Thromb Vasc Biol 20, 1939-1945. Thorngate, FE, Yancey PG, Kellner-Weibel G, Rudel LL, Rothblat GH and Williams DL (2003) Testing the role of apoA-I, HDL and cholesterol efflux in the atheroprotective action of low-level apoE expression. J Lipid Res 44, 23312338. Tripathy SK, Black HB, Goldwasser E and Leiden JM (1996) Immune responses to transgene encoded proteins limit the stability of gene expression after injection of replicationdefective adenovirus vectors. Nat Med 2, 545-551. Tsukamoto K, Smith P, Glick JM and Rader DJ (1997) Liverdirected gene transfer and prolonged expression of three major human apoE isoforms in apoE-deficient mice. J Clin Invest 100, 107-114. Tsukamoto K, Tangirala R, Chun SH, Puré E and Rader DJ (1999) Rapid regression of atherosclerosis induced by liverdirected gene transfer of apoE in apoE-deficient mice. Arterioscler Thromb Vasc Biol 19, 2162-2170. Wang L, Nichols TC, Read MS, Bidlingmaier CR and Verma IM (2000) Sustained expression of therapeutic level of factor IX in hemophilia B dogs by AAV-mediated gene therapy in liver. Mol Ther 1, 154-158. Wang L, Takabe K, Bidlingmaier SM, Ill CR and Verma IM (1999) Sustained correction of bleeding disorder in hemophilia B mice by gene therapy. Proc Natl Acad Sci USA 96, 3906-3910. Wolff G, Worgall S, van Rooijen N, Song WR, Harvey BG and Crystal RG (1997) Enhancement of in vivo adenovirusmediated gene transfer and expression by prior depletion of tissue macrophages in the target organ. J Virol 71, 624-629. Worgall S, Wolf G, Falck-Pedersen E and Crystal RG (1997) Innate immune mechanisms dominate elimination of adenoviral vectors following in vivo administration. Hum Gene Ther 8, 37-44. Yang Y, Nunes FA, Berensci K, Furth EE, Gonczol E and Wilson JM (1994a) Cellular immunity to viral antigens limits E1-deleted adenoviruses for gene therapy. Proc Natl Acad Sci USA 91, 4407-4411. Yang Y, Ertl HCJ and Wilson JM (1994b) MHC Class Irestricted cytotoxic T lymphocytes to viral antigens destroy hepatocytes in mice infected with E1-deleted recombinant adenoviruses. Immunity 1, 433-442. Yang Y, Xiang Z, Ertl HCJ and Wilson JM (1995) Upregulation of class I major histocompatibility complex antigens by interferon $ is necessary for T-cell-mediated elimination of recombinant adenovirus-infected hepatocytes in vivo. Proc Natl Acad Sci USA 92, 7257-7361. Yang Y, Jooss KU, Su Q, Ertl HC and Wilson JM (1996a) Immune responses to viral antigens versus transgene product in the elimination of recombinant adenovirus-infected hepatocytes in vivo. Gene Ther 3, 137-144. Yang Y, Greenough K and Wilson JM (1996b) Transient immune blockade prevents formation of neutralizing antibody to recombinant adenovirus and allows repeated gene transfer to mouse liver. Gene Ther 3, 412-420. Zhang Y, Chirmule N, Gao GP, Qian R, Croyle M, Joshi B, Tazelaar J and Wilson JM (2001) Acute cytokine response to systemic adenoviral vectors in mice is mediated by dendritic cells and macrophages. Mol Ther 3, 697-707.

Gene Therapy and Molecular Biology Vol 10, page 29 Zhu Y, Bellosta S, Langer C, Bernini F, Pitas RE, Mahley RW, Assmann G and von Eckardstein A (1998) Low-dose expression of a human apolipoprotein E transgene in macrophages restores cholesterol efflux capacity of apolipoprotein E-deficient mouse plasma. Proc Natl Acad Sci USA 95, 7585-7590.

Julian D. Harris

Harris et al: Liver-directed gene transfer of human apoE inhibits atherogenesis