Gene Therapy & Molecular Biology Volume 11 Issue B

! ! !

"#$#!%&#'()*!+! ,-.#/0.('!12-.-"*! !

3'-,!1(42/!,#/&($24,4!%-! /.2$2/(.!()).2/(%2-$4!

!

56789:!;;! $89<:=!>! ! ?:@:9<:=!>AAB! ! )8<7CDE:F!<G!":H:!%E:=IJG!)=:DD!! ! ! ! ! ! ! ! ! ! ! ! ! ! !

!"#"$%&"'()*$+$,-."/0.('$12-.-!*$ "34567489$16873$,:;<:7=!

-)"#$(//">>$???@A5;<@67A$ "#$$%&!'()*+*'),-$

$

!!!!!!!!!!!!!!!!!!!!!!!! $ "34567$

%:B4$16C94D8=$)E@$F@.!! /01.!2345678!K0:!

KGP38=?75!;!

K6?Q7S.!K=>38S.!';H((!!

T<3393!

L36&!UI,+)',+*N(INH*!!

ODP&!UI,+)',+*N(NH(I!!

0+QD?6&!=38?R<345678:7<4

%:B4$16C94D8=$)E@$F@.!! /01!2345678!#89:! ;'(!%7<=>!$>7<36?83!@6AB:!!

C758=D?8!E?3F.!/D6?G7<8?D.!*H,HI! J$K! L36&!M(,+*MN+'')*!

ODP&!M(,+(M;+*,N)!

0+QD?6&!=38?R<345678:7<4! !

!!!!!!!!!!!!!!!!!!!!!!!! $ (==4=58B5$"34567 ,8748$G6CA46CD8$1@>H@I$$ KGP38=?75!;!

K6?Q7S.!K=>38S.!';H((!

T<3393!

L36&!UI,+)',+*N(NH(H! ODP&!UI,+)',+*N(NH(I!!

QD<?DR9D893<+=>3<DVW:7<4! !

J6C56C34$,8748$,(I$ KGP38=?75!;!

K6?Q7S.!K=>38S.!';H((!

T<3393!

L36&!UI,+)',+*N(NH(H! ODP&!UI,+)',+*N(NH(I! QD<?D:X75=75B?R9D893<+=>3<DVW:7<4! $

"994B8=$%4;4$1@>H@I$ KGP38=?75!;!

K6?Q7S.!K=>38S.!';H((!

T<3393!

L36&!UI,+)',+*N(NH(H! ODP&!UI,+)',+*N(NH(I! =?Q?:366?8DSR9D893<+=>3<DVW:7<4!

!!!!!!!!!!!!!!!!!!!!!!!!$ (==6H485:$"34567=$

(AC4987K/6736L8I$"=5C8736.!)E@F@I!KBAD8=DT383.!#89:.!J$K$ 1:7:MB:NI$'6B893.!)E@F@I!$=D=3!J8?A3<S?=W!7G!%3F!Y7<X!D=!@5GGD67.!J$K$ /766D:I$>58B9:N.!,@F@I$)E@F@.!#$#$!Z>D<QD935=?9D6S.!#89.!J$K$ /76CM:5I$O6P9I!)E@F@!%35<7=39>!$:K.!O<D893$ !76B:;:N:7I$&4B74HE.!)E@F@!#:%:$:0:2:C:.!#T@C/.!O<D893!

'6<:75=I$,4HE8:9I$)E@F@I$2345678!K:0:.!K=>38S!T<3393!

'6==4I$O6EB.!)E@F@.!@39XQD8!23S3D<9>!#8S=?=5=3!7G!=>3!/?=W!7G![7V3.!J$K! >E:BI$ O8;:=.! )E@F@.! #8S=?=5=3! 7G! C763956D<! @?7674W.! K9DB3Q?D! $?8?9D.! LD?V3?.! LD?FD8.! 23V5\6?9! 7G! />?8D! ]! J8?A3<S?=W! 7G! /D6?G7<8?D!D=!^DA?S.!J$K:$ Q:<<I$F8L43.!)E@F@.!/364383!/7<V7<D=?78.!J$K! Q69RRI$O6B.!)E@F@.!J8?A3<S?=W!7G!_?S978S?8.!J$K$

!!!!!!!!!!!!!!!!!!!!!!!!$ $

"34567489$16873$ !

O7<S9>584!Q:\:[:.!T3<QD8W!!

16EBI$,875E8$/@I$)E@F@I$L>3!O3?8\3<4!$9>776!7G! C3B?9?83.!%7<=>F3S=3<8!J8?A3<S?=W.!J$K!$ 17:=B4HDI$";:7NI$)E@F@I$J8?A3<S?=W!7G!_?S978S?8!

C3B?9D6!$9>776.!J$K!$ /848R8I$)8698I$)E@F@I!J8?A3<S?=d!B?!27QD!efD! $DV?38`Dg.!#=D6W! /E86I$.::.!)E@F@I$C3B?9D6!J8?A3<S?=W!7G!$75=>! /D<76?8D.!J$K!! /E:BAI$>:BA$&@$)E@F@I$T38`WQ3!/7<V7<D=?78.!J$K!! /9:;:B5=I$187D94:I$)E@F@.!J8?A3<S?=W!7G!T6DS47F.!

J$K!$ /69:I$F8L43$O@$,@F@I$C3B?9D6!J8?A3<S?=W!7G!$75=>! /D<76?8D.!J$K!! /E4=E54I$(5E87$&@I$)E@F@I$J8?A3<S?=W!7G!#66?87?S!

(DS6748N:I$";;8BC:9I$)E@F@.!K<?`78D!/D893<! /38=3<.!J$K!$ (B=6BI$F6B893$>@I$)E@F@I$_7Q38aS!D8B!/>?6B<38aS! [7SV?=D6.!K5S=<D6?D$ (74A8I$&476N6=E4.!)E@F@.![7XXD?B7!J8?A3<S?=W.! bDVD8$ 1893?4BI$&@$>H655.!,@F!ED8B3<\?6=!J8?A3<S?=W! C3B?9D6!/38=3<.!J$K$ 18778BA:7I$O6EB.!,FI$)E@F@I$J8?A3<S?=W!7G! Z?==S\5<4>.!J$K!$ 198HDI$J:45E$.@$,@F@I$CDP?83!^58?=`!%35<7S5<4?9D6! #8S=?=5=3.!/3BD<S+$?8D?!C3B?9D6!/38=3<.!J$K!$ 19C;I$J:BB:5EI$)E@F@I!_DX3!O7<3S=!J8?A3<S?=W! $9>776!7G!C3B?9?83.!J$K$ 163:I$OT7A:B.!T3S366S9>DG=!Gc<!@?7=39>87674?S9>3!

!

!"##$%$&"'&($)*+*,$-&./0& !"#$%&'(")%*'+&',-.!.&'(1,*2"31&4,52*262$&"'&!$##& 7*"#"%8-&./0&& !%,")/-$0$*&'1%0#$2'3&',-.!.&'912*",1#&4,52*262$&"'& !:*#)&;$1#2:&1,)&;6<1,-&912*",1#&4,52*262$5&"'&;$1#2:-& ./0&& !4245-6%&'!"2$%0'(.&',-.!.&'!$,2$=&'"=&("#$+6#1=& >$,$2*+5-&.,*?$=5*28&"'&!1#*'"=,*1-&/1,&@*$%"-&./0&& 789*:%$2&'(%2*';.&',-.!.&'0A*A"1&B:1=<1+$62*+1#5& 4,+-&./0&' <$*-%=&',"60'>.',-.!.&'/212$&.,*?$=5*28&"'&9$C&D"=A-& ./0&' ?"0"2$*&'7#"2:-$"&'1.!.&'(18"&!#*,*+-&./0&' ?"=@2%=&'A-4)"*'>&'1.!.&'4,)*1,1&.,*?$=5*28& !1,+$=&!$,2$=-&./0&' ?%4=5$%#&'?%4=5$$-&,-.!.&'E655*1,&0+1)$<8&"'& /+*$,+$5-&./0&' ?%:B%2C%=5&'+4C%=:&',-.!.&'4,52*262$&/:1)85*)$& ($)*+1#&!$,2$=-&./0&' ?-4*-&'D"29"=',-.!.&'D1#$&.,*?$=5*28&/+:""#&"'& ($)*+*,$-&./0&& ?4E4C4=$&'A"9"*-$&',-.!.&&!$,2$=&'"=&4,'"=<12*",& 7*"#"%8-&912*",1#&4,52*262$&"'&>$,$2*+5-&F1G1,' F"==$*'!"#$@'A.&',-.!.&'!"=)&7#"")&71,A-&.,*?$=5*28& "'&0=*H",1-&./0' F%0@$2&' ,"="*9%#$' ,-.!.&' .GG51#1& .,*?$=5*2$2-& /C$)$,& F%*@4=GG%=&'H-"=0%*'D.&'1.!.&'!"#6<3*1&.,*?$=5*28-& ./0&&& F4%9*:="&'1%=0'<&',-.!.&'IG"+:&7*"5+*$,+$5-&4,+J-& ./0&& F625&'1$%2IH-$%&',-.!.&'K:$&.,*?$=5*28&"'&K$L15-& ./0&' (4-2*:42&'J=$"2&',-.!.&'/"<1%$,*+5-&4,+-&./0&& (400K&'!4650"*'(&',-.!.&'0)?1,21%$,$-&4,+J-./0&& (4*-$&'D"@-2"-&,-.!.&'!.D8.-&.,*?$=5*28&"'&K"=",2"& !1,1)1& L"0:*8-)$@:&'H-=$*:$"2-&,-.!.-&.,*?$=5*2M2& N*22$,O;$=)$+A$-&>$=<1,8' L$K")"&'+K4$:$&',-.!.&'912*",1#&4,52*262$&"'& 7*"5+*$,+$&1,)&;6<1,PK$+:,"#"%8-&F1G1,&& L="M%:B&'D:%/-%2'>.&',-.!.&'N18,$&/212$& .,*?$=5*28&/+:""#&"'&($)*+*,$-&./0' L=6*%&'H"=40'>.&',-.!.&&Q1&F"##1&4,52*262$&'"=& ("#$+6#1=&($)*+*,$-&./0' L64&'A$%2&',-.!.&&K:$&.,*?$=5*28&"'&K$L15&(J&@J& 0,)$=5",&!1,+$=&./0& L6="8-$'L4:496&',-.!.&'.,*?$=5*28&"'&(*+:*%1,& ($)*+1#&/+:""#-&./0&& L6=49$&'1"*"-$@%&'1.!.&',-.!.&'R6A6"A1& .,*?$=5*28&/+:""#&"'&($)*+*,$-&F1G1,' 3"$&'1%$'A.',-.!.&'Q*##8&E$5$1=+:&Q13"=12"=*$5&./0& 3":8-)"2&'!"#$@&D.&',-!&'!*8&'1+H,":-& .,*?$=5*28&"'&Q",)",-&.S& 3"#$2&'1"=:$2'<-&,-.!.&'K:$&T6$$,5#1,)&!1,+$=& R6,)&E$5$1=+:&.,*2-&K:$&T6$$,5#1,)&4,52*262$&"'& ($)*+1#&E$5$1=+:-&0652=1#*1' 3%C94M*9$&'("2%'D.&',-.!.&'>IEU9&!"=G"=12*",-& ./0&& 3$&'($"2'($"2&',-.!.&'!*28&"'&;"G$&912*",1#&($)*+1#& !$,2$=-&./0' 3$&'3$"25/$25',-.!.&'(1LP@$#3=V+AP!$,2$=&'"=& ("#$+6#1=&($)*+*,$-&>$=<1,8&&

36&'N$&',-.!.&'.,*?$=5*28&"'&K$,,$55$$&;$1#2:&/+*$,+$& !$,2$=-&./0' 362@*:=4)'L%22%:-&',-.!.'-&7*"L21#OE$%6#",-&4,+J&& /C*2H$=#1,)' 1"8!465"0@&'O=)42@'>&',-.!.&'.,*?$=5*28&"'& (*+:*%1,&($)*+1#&/+:""#-&./0' 1"042%&'+4C%=:';.&'1.!.&'0$=15&>#"31#&K7&W1++*,$& R"6,)12*",&'./0& 1"B"="9$*&'P$8-40"*'!.',-.!.&'4<G$=*1#&!"##$%$& Q",)",-&.S' 1$=9$2&'D%=5%$-&1.',-.!.&'.,*?$=5*28&"'&4##*,"*5&12& !:*+1%"-&./0&& 14=4$"26&'(6242"-&,-.!.&'7"52",&!"##$%$-&./0&& 1Q00%=&'+40G-&,-.!.&'4,52*262&'V=&("#$A6#1=3*"#"%*$& 6,)&K6<"='"=5+:6,%-&B:*##*G5P.,*?$=5*2M2&(1=36=%-& ./0&& P4:%C4=2&'1":-$%6-&,-.!.&'Q$*)$,&.,*?$=5*28-&K:$& 9$2:$=#1,)5' ,"/")":-%"9$*&'(4*%/-'RD$G$*S-',-.!.&'4,52*262$&"'& ("#$+6#1=&7*"#"%8&1,)&7*"2$+:,"#"%8& R"6,)12*",&'"=&E$5$1=+:&1,)&K$+:,"#"%8&;$##15-&./0&& ,0":*468"*&'H-=$*&'!.&',-.!.&'K$<G#$&.,*?$=5*28& /+:""#&"'&($)*+*,$-&./0&& +489*42&'D:"20%K'?.&'1.!.&&/21,'"=)&.,*?$=5*28& /+:""#&"'&($)*+*,$-&./0' ,4%*8-0"&'7=$8&'1.!.&'(18"&!#*,*+-&./0&& ,4)%="2:B&'+45%=-'(.&'1.!.&'K*3"2$+-&4,+J-&./0&' +"$B"@"&'14-"2'L.&',-.!.&'.,*?$=5*28&"'&R#"=*)1-& ./0&& +"B$2&'D%=5%K&',-.!.&'4,52*262$&"'&>$,$&7*"#"%8& E655*1,&0+1)$<8&"'&/+*$,+$5-&./0&& +4CC$2*&',"60&&!&',-.!.&'.,*?$=5*28&"'&B*22536=%:-& ./0&' +4*%2C0"::&'(4*%/-&'!.&'1.!-&.,*?$=5*28&"'&(*1<*& /+:""#&"'&($)*+*,$-&./0& +4*2%=&'1"=*-"-&+.&',-.!.&'7$,&(18&4,52*262$&'"=& !1,+$=&E$5$1=+:-&.,*?$=5*28&"'&!:*+1%"-&./0&& +4K%=&'F"2*I!$%:%=-&1.!.&'X!0I/0EY-&>$=<1,8& +6C$2&'(4*%/--&1.!.&'(18"&($)*+1#&/+:""#&& (18"&!#*,*+-&./0' D"%294' 7#56%2$' 3.&' ,-.!.&' .,*?$=5*28& "'& (1=8#1,)& /+:""#& "'& ($)*+*,$& !$,2$=& '"=& W15+6#1=& 1,)& 4,'#1<<12"=8&@*5$15$5-&./0' D"0)42*&'J=$"2&',-.!.&'XR/>P7*"2$+:,"#"%*$&><3;Y-& 0652=*1&& D"2:4=4&'1.'?"C=$%00"-&,-.!.&'.,*?$=5*28&"'&E"<$& K"=&W$=%121-&./0&' D-"==489*&'>2@=%M&'!.&',-.!.&'.,*?$=5*28&"'& (1,+:$52$=-&./0&' D-$&'N"25-&,-.!.&';1=?1=)&($)*+1#&/+:""#-&./0&' D)K:-%'+4K';.&'1.!.&&K$L15&0Z(&.,*?$=5*28& ;$1#2:&/+*$,+$5&!$,2$=-&./0' D=$#"*:"#"&'>=62',-.!.&'.,*?$=5*28&"'&R#"=*)1& !"##$%$&"'&($)*+*,$-&./0&' D:%$2%=&'1$:8-%00&'1.!.&&.,*?$=5*28&"'&K$,,$55$$-& ./0&' A"$2*9K&'1$8-"%0'>.&',-.!.&'S1=<1,"5&!1,+$=& 4,52*262$-&N18,$&/212$&.,*?$=5*28-&./0' D625&'N4625IH-60&',-.!.&'B":1,%&.,*?$=5*28&"'& /+*$,+$&Z&K$+:,"#"%8-&S"=$1' A"$="&'L"B62"=$&',-.!.-&K:$&.,*?$=5*28&"'&K"A8"-& F1G1,&

;0%>"'(?5@"#>/!A-'(0)(<+57(4$!%-!D'#7,%E/!0F! ;0%>"BC&03#4'(,3#1'(/0-.-'(>(%45#)7G'#)4/!6)*B/!012!! ;%D%*>5*'(.3*'()-'(/0-.-'(&:('.5+)H7!9%7G(4#'!

I+7+#5*:!;%8).#4(%)/!&9I;!/!012!!

EF*D'()24#"+'(,-.-'(0)(<+57(4$!%-!@+A#7/!012!( G3**%HBI3+J5K5F25H/!,3#%3(/0-.-'("*D(''!&#)*+5! &+)45+/!&#)#.#!

G5#@3H'(I3#323@5H/(/0-.-'(>(%"!2D!@+#?/!D+5?#)$!!

!"#$%&'()*+#"'(,-.-'(/0-.-'("#$%!&'()(*!&%''+,+!%-! "+.(*()+/!012( !0%"##1'()23%*/(/0-.-'(3#4(%)#'!&#)*+5!6)74(484+/!

3#4(%)#'!6)74(484+7!%-!9+#'4:/!;5#)*+( !#%45*56'(7+83#+/!9-(/0-.-'(0)(<+57(4$!%-!9#(-#/!

675#+'!! :3*(+"(:"*'(;%</!/0-.-'(0)(<+57(4$!%-!=+8<+)/! >+',(8?! :3*(.1="'(,%&03"2/!;-'(/0-.-'(@:+!0)(<+57(4$!%-! @+A#7!"B!CB!2).+57%)!&#)*+5!&+)4+5/!012!! !

!!!!!!!!!!!!!!!!!!!!!!!! ( )HH5&%3>"(L53#+(,"<@"#H( ( 012!

Q#3R3'(O36%"#'(/0-.-'!@+?G'+!0)(<+57(4$!1*:%%'!%-! "+.(*()+/!012( QF'(L350F3'!/0-.-'!@:+!K+--+57%)!&+)4+5/!012( I%#5=%'(,3#F13<3'(,-.-'(/0-.-'!3((,#4#!0)(<+57(4$!

D5#.8#4+!1*:%%'!%-!"+.(*#'!#).!C+)4#'!1*(+)*+7/!K#G#)! ?%D5F>H5H'(SH%+5#"'(/0-.-'!@:%?#7!KB!M#47%)!I+7+#5*:! &+)4+5/!012( !

)DD3#832'(/#%13'(/0-.-'!0)(<+57(4$!%-!J+))7$'<#)(#/!

012( )5=%'(M3$F*5#%'!,-.-'(/0-.-/!3#4(%)#'!&#)*+5!&+)4+5!

I+7+#5*:!6)74(484+/!K#G#)!

N35'(O%*<%*'(/0-.-'!6)74(484+!%-!"%'+*8'#5!#).!&+''! >(%'%,$/!1(),#G%5+!

P323H&3'(,3#&5'(,-.-'!0)(<+57(4$!&%''+,+!=%).%)'( 0F! Q35'(C05FBA%3*D'(/0-.-'!@:+!0)(<+57(4$!%-!@+A#7!

9+#'4:!1*(+)*+!&+)4+5!#4!1#)!2)4%)(%/!012( Q%@H5*'(CK"*&"#(L#F&"'(/0-.-'!0)(<+57(4$!%-!"#)(4%L#/! ! ;%5!78L?(77(%)!%-!?#)87*5(G47!#).!()N8(5(+7O!!

P.(4%5(#'!Q--(*+!! !"*%(L5F2%=3H'(/0-.-T(,3#%3(M5F>5F+%(,)-( D5+,%5(%8!2-A+)4(%8!R! 2'(?%7/!24:+)7!SRTUU!())%<#4%5$!!

D5++*+!!G5%G5(+4#5$!+<%'84(%)#5$!! @+'O!VWXYZSXY[\UY\TUT! ;#AO!VWXYZSXY[\UY\TUW! P?#('O!?#5(#B]%84%8.(^*#)*+5Y4:+5#G$B%5,/!

4+)(BL%8'(]#7^*#)*+5Y4:+5#G$B%5,!!

!

!"#$%&'$()"#*$)*+&$,)%#-* ./"/*0,/%+12*+"3*4)5/'&5+%*6()5)72*8.0469* :;<<*=>><??*@@@A7$BCA)%7*

* ?')1/! ! "#$#!%&#'()*!($+!,-.#/0.('!12-.-3*4!5'2+32$3!6('2-07!82#.+7!27!-$#!-8!9&#!:-79!'()2+!;29&!8'##!(//#77!

(9!39:5<-'3<!! ! %&#!7/-)#!-8*"#$#!%&#'()*!($+!,-.#/0.('!12-.-3*!27!9-!)'-:-9#!2$9#'(/92-$!5#9;##$!'#7#('/&#'7!2$!

9&#!82#.+7!-8!"#$#!%&#'()*!($+!,-.#/0.('!12-.-3*!)'-62+2$3!'()2+!)05.2/(92-$!-8!'#62#;!('92/.#7!($+! '#7#('/&!)()#'7<!='92/.#7!>5-9&!2$629#+!($+!705:299#+?!'#62#;!-'!'#)-'9!$-6#.!82$+2$37!-8!2:)-'9($/#!9-! (!3#$#'(.!(0+2#$/#!2$!3#$#!9&#'()*4!:-.#/0.('!:#+2/2$#4!3#$#!+27/-6#'*4!($+!:-.#/0.('!52-.-3*!;29&! #:)&(727! 9-! :-.#/0.('! :#/&($27:7<! %&#! @-0'$(.! ;2..! (//#)9! )()#'7! -$! (..! (7)#/97! -8! 3#$#! 9&#'()*4!

2$/.0+2$3!3#$#!+#.26#'*!7*79#:74!3#$#!9&#'()*!-8!/($/#'!($+!-9&#'!+27#(7#7!>#<3<!AB%C4!&#:-)&2.2(4! =DEF4! '#79#$-727?! (9! 9&#! /.2$2/(.4! )'#/.2$2/(.! -'! /#..! /0.90'#! 79(3#4! 3#$#! +27/-6#'*4! /($/#'!

2::0$-9&#'()*4! EG=! 6(//2$#74! 07#! -8! EG=! '#30.(9-'*! #.#:#$97! 2$! 3#$#! 9'($78#'4! /#..! 9&#'()*! ($+!

9'($7).($9(92-$4! (''(*2$3! 9#/&$-.-32#7! H! EG=! /&2)74! )#)92+#! .25'('2#7! ($+! +'03! +27/-6#'*! '#.(9#+! 9-!

3#$#! 9&#'()*4! /#..! 9('3#92$34! 3#$#! 9('3#92$34! 9&#'()*! ;29&! -.23-$0/.#-92+#7! >($927#$7#4! '25-I*:#74!

9'2).#J?<! %&#! (09&-'7! ('#! #$/-0'(3#+! 9-! #.(5-'(9#! -$! 9&#! :-.#/0.('! :#/&($27:7! 9&(9! 3-6#'$! (! 3#$#!

9&#'()*! ())'-(/&<! "#$#! %&#'()*! ($+! ,-.#/0.('! 12-.-3*! ;2..! (.7-! )05.27&! ('92/.#7! -$4! 9'($7/'2)92-$!

8(/9-'74!EG=!'#).2/(92-$4!'#/-:52$(92-$4!'#)(2'4!/&'-:(92$4!$0/.#('!:(9'2J4!EG=!'#30.(9-'*!'#32-$74! .-/07! /-$9'-.! '#32-$74! )'-9#2$! )&-7)&-'*.(92-$4! 723$(.! 9'($7+0/92-$4! +#6#.-):#$94! ($+! -$! :-.#/0.('! :#/&($27:! -8! &0:($! +27#(7#<! 0)* B+D/* $,/* 1&C5('+$()"* +$$%+'$(E/* +&$,)%#* +%/* /"')&%+7/3* $)* ("'5&3/*')5)%*F(7&%/#<! ! !! !

021/*)F*+%$('5/#! !

1-9&!'#62#;!('92/.#7!($+!-'232$(.!'#7#('/&!('92/.#7!;2..!5#!/-$72+#'#+<!D$!(++292-$4!7&-'9!KLM!)(3#!$#;7!

H!62#;7!;2..!(.7-!5#!/-$72+#'#+!8-'!)05.2/(92-$<!N'232$(.!'#7#('/&!('92/.#7!7&-0.+!/-$9(2$!(!3#$#'-07!

2$9'-+0/92-$!2$!(++292-$!9-!#J)#'2:#$9(.!+(9(<!%&#!('92/.#7!/-$9(2$!2$8-':(92-$!2:)-'9($9!9-!(!3#$#'(.!

(0+2#$/#!(7!9&#!6-.0:#!27!(.7-!(++'#77#+!9-!'#7#('/&#7!-0972+#!9&#!82#.+<!%&#'#!27!$-!.2:29!-$!9&#!.#$39&!

-8!9&#!('92/.#7!)'-62+#+!9&(9!9&#!705@#/9!27!2$9#'#792$3!9-!(!3#$#'(.!(0+2#$/#!($+!/-6#'7!#J&(07926#.*!(!

82#.+<!%&#!9*)2/(.!5/"7$,*)F*/+',*B+"&#'%(1$!27!(!())'-J2:(9#.*!OLMP!)'2$9#+!)(3#!2$/.0+2$3!B230'#7! ($+!%(5.#7<!%&27!27!KMLQP!:($07/'2)9!)(3#7<!! ! >,+%7/#*G*>)B15(B/"$+%2*%/1%("$#** * %&#'#! ('#! $-! /&('3#7! 8-'! /-.-'! 8230'#7! -'! )(3#! $0:5#'7<! A-''#7)-$+2$3! (09&-'7! '#/#26#! (! &('+/-)*!

2770#! -8! 9&#! 6-.0:#! 2$! ;&2/&! 9&#2'! ('92/.#! 27! )05.27&#+! ).07! MR! '#)'2$97! 8'##! -8! /&('3#<! D$! (++292-$4! #.#/9'-$2/! /-)2#7! -8! 82$(.! ($+! 8-':(99#+! +'(897! ('#! 326#$<! ! =09&-'7! (.7-! &(6#! 9&#! 80..! 8'##+-:! 9-! /-::0$2/(9#! -'! 092.2I#! 9&#2'! ('92/.#! 2$! )'-8#772-$(.! /2'/0:79($/#7<! %&27! :(*! 5#! +-$#! -$.*! ;29&! 9&#! (/S$-;.#+3:#$9!-8!9&#!-'232$(.!)05.2/(92-$<!! ! ! ?/'$()"#*)F*$,/*B+"&#'%(1$! !

T(/&!:($07/'2)9!7&-0.+!&(6#!(!%29.#4!=09&-'74!=882.2(92-$4!A-''#7)-$+2$3!=09&-'!>;29&!%#.4!B(J4!($+!

TL:(2.?4!?&BB+%24!D/2*@)%3#4!%&""("7*$($5/!($+!!"$%)3&'$()"U!'#62#;!('92/.#7!('#!705+262+#+!2$9-!

"#$%&'()!*+!**+!***+!#,-.!/),$0,&'(!1&,"!*.!*',02%3-,&2'4!)35%&6&%#%!&',2!7+!8+!9+!$'%!:30,"#0!)35%&6&%#%!

3)&'(! ;+! <+! =+! #,-.! >23! -$'! :30,"#0! )35%&6&%#! &',2! ;+! <+! =+! #,-.! ?#)#$0-"! $0,&-@#)! $0#! %&6&%#%! &',2!

A3BB$0CD!*.!*',02%3-,&2'D!**.!E$,#0&$@)!$'%!E#,"2%)!***.!?#)3@,)D!*F.!G&)-3))&2'D!7-H'21@#%(B#',)D! $'%!?#:#0#'-#).!I@#$)#!&'-@3%#!&'!C230!,#J,!-&,$,&2')!,"#!'$B#!2:!$3,"20)!$'%!C#$0!&'!K$0#',"#)&)D!:20! ,"0##! 20! B20#! $3,"20)! 3)#L! /'$B#! 2:! :&0),! $3,"20! #,! $@+! 1&,"! C#$04D! :20! ,12! $3,"20)! K@#$)#! 3)#! 52,"! '$B#).!I@#$)#!%#@#,#!"&%%#'!,#J,!:20!0#:#0#'-#).!*'!,"#!0#:#0#'-#!@&),+!K@#$)#+!,CK#!0#:#0#'-#)!1&,"!C#$0! $'%!M230'$@!&'!52@%:$-#!$'%!K026&%#!:3@@!,&,@#!2:!,"#!$0,&-@#!)3-"!$)L! !

83)-"@#! E+! A-"B&%,! N+! 8#0(#0! E+! A-"$::'#0! O+! P30Q5$3#0! ?+! P&@@&)-"! *+! R&#%#B$''! MSP+! R0)H$! 8+!

P&0@$KK2)!T+!E#-",@#0!P+!A-"&@-"#0!U+!O$5@#0!9+!$'%!8&0'),&#@!EV!/!""#4$9"#B&-$@@C!%#:&'#%+!-#@@S :0##! -$'-#0! 6$--&'#)L! 3)#! 2:! ,3B20! $',&(#'S%#0&6#%! K#K,&%#)! 20! K2@C#K&,2K#! K02,#&')! :20! 6$--&'$,&2'.! %&'&$()&*$+,-$./,-!;+!=WXS=<;.! !

R2!$62&%!%#@$C)!&,!&)!#))#',&$@!,2!)35B&,!$'!#@#-,02'&-!$'%!$!"$0%!-2KC!6#0)&2'!2:!C230!B$'3)-0&K,!6&$! #SB$&@!$'%!B$&@!&'!0$1-,2234$56789+$,*$:;<4$-2',$&'&'(!,"#!B$'3)-0&K,!,"$,!1&@@!5#!3)#%!,2!,CK#)#,! ,"#!K$K#0.!I@#$)#!&'-@3%#!&'!,"#!%&(&,$@!B#%&$L!R$5@#)+!&:!$'C+!/K0#:#0$5@C!$)!$!E&-02)2:,!N20%!,#J,4!$'%!

U&(30#!@#(#'%).!I@#$)#!3)#!E&-02)2:,!N20%+!:2',!Y(/=&>Z!/E$-!3)#0)4!20!YR&B#)![#1!?2B$'Z!/I9!

3)#0)4!$'%!&')#0,!O0##H!20!2,"#0!-"$0$-,#0)!3)&'(!,"#!Y;'>&*?@A3=B,-Z!:3'-,&2'!&'!,"#!E&-02)2:,!N20%!

0$,"#0!,"$'!)&BK@#!-2'6#0)&2'!,2!:2',!YACB52@Z.!I@#$)#!52@%:$-#!U&(30#!;+!<+!=!#,-.!$)!1#@@!$)!R$5@#!;+! <+! #,-.! ,"023("23,! ,"#! ,#J,.! I@#$)#! K026&%#! ,"#! "&("#),! \3$@&,C! 2:! K0&',)! 2:! C230! C/DE*&>D! 1"#'#6#0!

K2))&5@#+!K@#$)#!K026&%#!&'!$%%&,&2'!$'!#@#-,02'&-!6#0)&2'!2:!C230!:&(30#).! !

70,&-@#! -2',0&53,20)! $0#! H&'%@C! 0#\3#),#%! ,2! K026&%#! $! -2@20! /20! 5@$-H]1"&,#4! K"2,2! 2:! ,"#B)#@6#)! /K0#:#0$5@C! ^J_! -B! 20! $'C! )&Q#4! 20! $! (023K! K"2,2! 2:! ,"#! $3,"20)+! $)! 1#! )"$@@! &'-@3%#! ,"#)#! &'! ,"#!

K35@&-$,&2'! ! $ AEB=/>>/,'$0'F$*&G/&H/'D$!

I##0! 0#6&#1&'(! &)! 5C! B#B5#0)! 2:! ,"#! `%&,20&$@! 82$0%! $'%! #J,#0'$@! 0#:#0##).! I@#$)#! )3((#),! <S=!

0#6&#1#0)!K026&%&'(!,"#&0!#@#-,02'&-!$%%0#))#)+!B$&@&'(!$%%0#))#)!$'%!,#@#K"2'#]:$J!'3B5#0).!73,"20)! $0#!)#',!K$(#!K022:).! !

O#'#! R"#0$KC! $'%! E2@#-3@$0! 8&2@2(C! &)! K35@&)"#%! &'! 2'! "&("! \3$@&,C! K$K#0+! "$0%523'%+! $'%! 1&,"! #J-#@@#',!0#K02%3-,&2'!2:!-2@20!:&(30#).!! !! !! ?#6&#1&'(!&)!-2BK@#,#%!1&,"&'!_S;_!%$C)!:02B!0#-#&6&'(!,"#!B$'3)-0&K,.!!

70,&-@#)!$--#K,#%!1&,"23,!0#6&)&2')!/&.#.+!0#6&#1!$0,&-@#)4!1&@@!5#!K35@&)"#%!2'@&'#!/111.(,B5.20(4!&'! $KK02J&B$,#@C!;!B2',"!:2@@21&'(!)35B&))&2'.!! !

I@#$)#!)35B&,!$'!#@#-,02'&-!6#0)&2'!2:!:3@@!,#J,!$'%!:&(30#)!K0#:#0$5@C!&'!aK#(!:20B$,.!R"#!#@#-,02'&-!

6#0)&2'!2:!,"#!:&(30#)!1&@@!5#!3)#%!:20!,"#!0$K&%!0#6&#1&'(!K02-#)).!T&("!\3$@&,C!K0&',)!20!K"2,2(0$K"!

2:!,"#!:&(30#)!$'%!,"#!20&(&'$@!1&,"!2'#!-2KC!)"23@%!5#!)#',!6&$!#JK0#))!B$&@!,2!,"#!`%&,20&$@!b::&-#I$! !

5/?0?/,'$/'$+&FJ/'&$ 70,&-@#)!$--#K,#%!:20!K35@&-$,&2'!5C!ORE8!20!9$'-#0!R"#0$KC!-$'!5#!&'-@3%#%!&'!E#%V&'#!/I35E#%4! $)!:3@@!$0,&-@#)!3K2'!,"#!0#\3#),!2:!$3,"20)!K026&%#%!,"$,!,"#!$3,"20)!"$6#!-2BK@#,#%!,"#&0!K35@&)"#%!

120H!3'%#0!$!(26#0'B#',!(0$',!5C![*T!/20!`c]M$K$'!(26#0'B#',!(0$',4.!*:!,"&)!&)!C23!-$)#+!K@#$)#!

-2')3@,!,"#![*T!E$'3)-0&K,!A35B&))&2'!AC),#B!",,KL]]111.'&"B).'&".(26].! ! ! ! ! !

!"#$%&#'()*++#,-)) ) .-/#)0%1(#2'34)567874)!"#$%&"'()*#+*&', 9#,6'-():%;-&$34)567874)-$./0")+&*1"&!2%.0#."&3!/"&045+*&', <$-((')8%12-((#4)97874)!"#$+1*()$602%.0#."&3!/"&045+*&') 9'&#')=%1$%1"#4)9>74)-0&$0+6*(!*(7$%.0#."&3!/"&045+*&') 9'&#')?%1@#%12'4)07<,74)-0&$0%.0#."&3!/"&045+*&', A-//B)='$3%1C#4)9756#(74)8"##59%.0#."&3!/"&045+*&', .#D#)!((#/'34)07<,74)!$-$+"))$#02%.0#."&3!/"&045+*&':,!"#$+1*()$602%&"'()*#+*&', ;&"'*&$*(,<=>"#!$*(,9, <)$-*2:,<!/"#2,?9@AA, ;&"".", B")C,DEF3G?F3HIA3I@A@, J0>C,DEF3G?F3HIA3I@AE, , B/", =&"", ")".!&*#$., 0.."22, !*, 0&!$.)"2, 4(1)$2/"7, $#, K;BLMK, !*, 0, 1$', '"#"&0), 0(7$"#.":, !/", 0!!&0.!$N", 8*(&#0), !$!)":, !/", 24""7, *=, !/", &"N$"O$#', 4&*."22:, !/", #*3./0&'"2, =*&, 40'", #(-1"&2, *&, .*)*&, =$'(&", &"4&*7(.!$*#:,!/",GA,.*-4)$-"#!0&5,&"4&$#!2:,!/",&04$7,")".!&*#$.,4(1)$.0!$*#:,!/","-1&0.$#',*=,-0#5, =$")72,$#,.0#."&:,!/",0#!$.$40!"7,/$'/,P(0)$!5,$#,7"4!/,&"N$"O2,0#7,=$&2!,&0!",&"2"0&./,0&!$.)"2,0#7,-*2!, $-4*&!0#!:,!/","-$#"#!,-"-1"&2,*=,!/",Q7$!*&$0),M*0&7,1"$#',022"-1)"7,0&",4&*'#*2!$.,=0.!*&2,*=,0,1$', 2(.."22,=*&,!/",#"O)5,"2!01)$2/"7,8*(&#0)+, ,

! ! ! ! ! ! ! "#$#!%&#'()*!($+!,-.#/0.('!12-.-3*!4"%,15!26! /-7#'#+!2$!8&#!9-..-:2$3!%&-;6-$!</2#$8292/!

6#'72/#6=! ! ! !!</2#$/#!>28(82-$!?$+#@!A@)($+#+!4(.6-!B$-:$!(6! </2<#('/&" 5! ! !!12-8#/&$-.-3*!>28(82-$!?$+#@" ! ! !!C-0'$(.6!>28(82-$!D#)-'86E</2#$/#!A+282-$!

!

!"#$%&'(&)'*+%*+,&

-%*%&!.%/"01&"*2&3'$%)4$"/&56'$'71& &8'$&99&:4;#%/&<=&>%)%;#%/&<??@& !

A"7%,&

!10%&'(& B/+6)$%&

B/+6)$%&+6+$%&

B4+.'/,&C)'//%,0'*26*7&"4+.'/&6,&6*& #'$2(")%D&

9?EF99<&

G%H6%I& B/+6)$%&

!"K%'&:';4/""!#$%&'()&!*+,(-"! .$,/$/-&!0+%+/+1&"!2&)(%&,/$!.&%+,+!

99EF99L&

G%,%"/).& B/+6)$%&

99@F9E<&

G%H6%I& B/+6)$%&

9EEF9M<&

G%,%"/).& B/+6)$%&

9MEF9T?&

G%,%"/).& B/+6)$%&

9T9F9L?&

G%,%"/).& B/+6)$%&

9L9F9@?&

G%,%"/).& B/+6)$%&

JBA&",&"&*%I&26"7*',+6)&"*2&%((%)+6H%& +.%/"0%4+6)&+"/7%+&;'$%)4$%&('/&0/',+"+%& )"*)%/& -%*%&)$'*6*7&'(&AME&,4/(")%&0/'+%6*&'(& +'N'0$",;"&7'*266&+").1O'6+%&"*2& #/"21O'6+%&CPB-ED& >%H%$'06*7&"*2&"00$16*7&"&2/47& 2%$6H%/1&;'2%$&('/&$60',';"$&"*2& 2%*2/6+6)&;4$+6(4*)+6'*"$&*"*'0"/+6)$%,& J*&H6+/'&"*+6)"/)6*'7%*6)&%((%)+&'(&"& *4+/6%*+&;6N+4/%&'*&.4;"*& /."#2';1',"/)';"&)%$$,& !/"*,(%)+6'*&I6+.&7$4+"+.6'*%F 2%0%*2%*+&2%.12/'",)'/#"+%&/%24)+",%& 7%*%,&%N%/+,&)1+'0/'+%)+6H%&%((%)+,& "7"6*,+&.12/'0%/'N62%F6*24)%2&)%$$& 6*U4/1&+./'47.&H6+";6*&R&/%7%*%/"+6'*& "*2&'N62"+6H%F,+/%,,&26;6*6,.;%*+&& B2%*'H6/4,F;%26"+%2&VN0/%,,6'*&'(& #'+.&B*+6,%*,%&W/*6+.6*%& >%)"/#'N1$",%&CW>RD&"*2&PF& "2%*',1$;%+.6'*6*%&>%)"/#'N1$",%& CB2'3%+>RD&6*.6#6+,&.4;"*& %,'0."7%"$&,X4";'4,&)"/)6*';"&)%$$& 7/'I+.& R./';64;&A6)'$6*"+%&CR/AD&"&04+"+6H%& "*+6F'#%,6+1&*4+/6%*+&6*24)%,&)."*7%,&6*& #'21&)';0',6+6'*&",&"&(4*)+6'*&'(&+.%& !"X9&2'0";6*%&><&/%)%0+'/& 0'$1;'/0.6,;,&6*&"&/"*2';6O%2& 2'4#$%F#$6*2&0$")%#'&)'*+/'$$%2&,+421&

9@9F9@L&

G%,%"/).& B/+6)$%&

9@@F9[M&

G%H6%I& B/+6)$%&

P+/6*7%*+&)'*+/'$&'(&:ZB!)9&*4)$%"/& '))40"*)1&6,&)/6+6)"$&('/&;"6*+"6*6*7& #"$"*)%2&6;;4*%&/%,0'*,%& B,,%,,;%*+&'(&)1+'7%*%+6)&%((%)+&'(& "*+6#$",+6)&+.%/"01&#1&;%"*,&'(& ;6)/'*4)$%4,&",,"1&6*&%N('$6"+%2& %06+.%$6"$&)%$$,&&

5"./";&Q"O%;6"!34&5+!.+6-4'"! .(76+'!8+'94-:($)"!*+49!*-+-+;&"!<5&!

2+6-&6-&!

R'*,+"*+6*',&3S&A"$%',"!=&%&,)&/! >/&($)?+/"!@&5&!*&94)+,($! .A!B+-449!C((%&"!D+9&%!E?+'(?"! >+,&+'+!F+5&'(?/1G"!B$%K,"*2/"& :6%2OI6%)K6"!.+,,-&+/!C+,-!

0+/$1+H$!*+&,(-"!0$)&1(!#$1$(1+"! .()&%&,/$!I&/-&1&%&"!:'#4.6K'&36I"!

Y46&!6"*"!J&+'KJ&!3&$"!8&'6!@-+'6"!L&K #4'6!*$'"!=('6K#4'6!*$'!

>-(%+/!M2!N-4'"!Q%**%+.&5$4;"!

O&5;4),!F++,/"!P)&Q!CA!8)+?4)%+'"!<),-$)!

P&/4';4)6"!.+)1!*-4)%+'"!F+,-+)&'4! =+?&/"!=+?&9!PA!N(%&'6/"!C(;4),!B((9"! =4''&/!R$55&'"!D+'4//+!<)Q$)&"!.&Q-+45!

D+)/-+?/1&"!M$5&4!#A!.4'6$QQ&"!*4,-!2A! 85$%"!84)'+)9!BA!=(S'/"!8)&+'! .4/-1&'"!C(64)!3A!B+&,4"!3(''+!

B&55&+%/"!M(-'!*Q-((5T&459"!>-(%+/!M! R)&-(9+"!3&/+!B-&,4!

36*7746&A"*"!.(',4!.A!B&'/5(S"!M((! *4(;!F4$%"!O4)+59!CA!N)+;,)44!

B/;%*&QS&:%/,%,1"*&

!"#$%&%'

()*)+,-.' /,01-2)'

340)5,+0164'67'.89+4':;/'7,+59)40*' 1406'0.)'-)22'5)469)*'67'-),0+14'01**8)*' 7,69'+<820'91-)'0,)+0)<'=10.'->06*0+01-' ->-26?.6*?.+91<)'14'-69@14+0164'=10.' .89+4':;/'

%&E$%!F'

()*)+,-.' /,01-2)'

G)4)')H?,)**164'?,6712145'76,'+<820' .89+4'627+-06,>'4)8,6)?10.)21+2$ <),1D)<'?,65)4106,*'

%!J$%%"'

()*)+,-.' /,01-2)'

%%J$%N%'

()D1)=' /,01-2)'

%NE$%N"'

()*)+,-.' /,01-2)'

%NJ$%FS'

()D1)=' /,01-2)'

%F#$%""'

()*)+,-.' /,01-2)'

%"J$%J"'

()*)+,-.' /,01-2)'

%JJ$E&S'

()*)+,-.' /,01-2)'

K64106,145'5,))4'7286,)*-)40'?,60)14' 76,'784-0164+2'<)21D),>'67'LB'-621' ->06*14)'<)+914+*)'*81-1<)'5)4)'+4<'0.)' )77)-0'67'-8,-8914'14'D10,6' G)4)01-'96<)2*'67',)014+2'<)5)4),+0164' +4<'0+,5)0*'76,'5)4)'0.),+?>' LD+28+0164'67'-,6**'19984)',)*?64*)'14' :;/'@+*)<'D+--14+0)<'91-)'+5+14*0' OAQ$!'+4<'OAQ$%' 39?,6D145'?,6@1601-'784-0164'8*145'+' ?+0.6$@160)-.46265>'+??,6+-.' /?6?06*1*'?,)D)40164'14'4)8,64+22>' <177),)401+0)<'TU!%'-)22*V'@>'@-2$%'5)4)' 0,+4*7)-0164'14'0.)'464$?,6217),+01D)' +4<'<177),)401+0)<'*0+0)V'=10.',)0)40164' 67'4)8,64$*?)-171-'?,60)14*'+4<' @26-M+5)'67'9106-64<,164$,)2+>)<' +?6?0601-'?+0.=+>' (62)'67'.69626568*',)-69@14+0164' ,)?+1,'+4<'464$.69626568*')4<'R614145' 14'0.),+?)801-',)*1*0+4-)'67'CU(W/CX$ )H?,)**145'2)8M)91+'-)22*' Q10+914':',)-)?06,'5)4)' ?62>96,?.1*9*'14'?+01)40*'=10.'0.>,61<' -+4-),'

E&#$E!S'

()*)+,-.' /,01-2)'

LH65)468*':;/'-+4'@)'-+?08,)<'@>' *0)9'-)22*'+4<'@)'14D62D)<'14'0.)1,' ,)*-8)'7,69'<)+0.'+70),'2)0.+2$<6*)'!$ ,+<1+0164'

E!#$E%&'

()D1)=' /,01-2)'

E%!$E%"'

()*)+,-.' /,01-2)'

C160),,6,1*9Z'=+,7+,)'67'0.)'%!*0' -)408,>' G)460>?1-'<)0),914+0164'67'O)?+0101*'U' D1,8*'14'P).,+4'8*145'TU($([XT' +4+2>*1*'

! !

!

"#$%&$%'$!()!*'+,$-,./$0!1$2.3'4!5)!

6'+72'#0!6.224!")!5787/$0!9$&'$#$!:)! :;<$&727/$0!:='&3'4!6)!(&3;#+'#0!

12$>'='3!")!?7@$-,./0!9$=$3$!A)! (.<.2./$0!B/$#!()!A37C../0!A),5)1'AB' C65+-.)D0!*.7#'>!")!D$+;<7/0!E'+,$'2! ")!(,;3>7/! /@<)24+@>'I.+2>7+0!E7,$=.>!F;$GG$0!

H.!I'$#@0!E'#!J;0!K,$32.%!9$42730!

E$3%,$220!L3.>!M)!?7'%.#0!N$&,2..#!E)!

N2;.<.30!6'@.2!OL!K778.3!

5)!O78'#$&,0!A1<<.+,0.+'A+4M+,'G.6*.!

F3'$#!M)!(7#@0!A0)?.)4'OB'P*+450!

K,4;$#P(,.#@!*'#!

E7,$==$>!M$G$4.3'0!O66,1).'

A62)19+4R+.10!L$&.=.,!L7&7;,'0!9$3$/$&!

F$=>$>0!"<<$%!M$=$2'! ?74!:)!(2.$&730!K72'#!H'22!

D$%;+$G;!($'&7,0!(,7Q'!E$%;=7&70! (,'#7<;!D$#$>$0!;6@8.1M6'K1=+!

:$3';%G!54&.20!5$R.2!?;%'#0!"@#'.%G+$!

(2'R'#%+$0!"2'#$!E73$R'.-PF$Q>$0!M7G.C! :3G.R7%+'0!3,)4)8*Y'K+R*0),)M! 1$,'>!H$@,8$#$,0!A)>)<'OB'G.+77+,10!

5$3'%$!?$,'=87;30!"/'%$!"<<$%'0!E$3Q$#! ($..>'0!H$2.!5$+0!L7377@,!"2<73G'0! (,$@,$4.@,!F$3G.@$30!?$='#!H.%,=$&0!

N$=3$#!"2'=7@,$>$=0!5.'=$#! (,7;%,&$3'G$>.,0!(.4.>!E7,$==$>!

9$/$#@$30!"3>.%,'3!O,$/$=G$>.,0!

F$@,.3!*$3'Q$#'! "#$%&$%'$!()!*'+,$-,./$0!1$2.3'4!5)!

6'+72'#0!6.224!")!5787/$0!12$>'='3!")! ?7@$-,./0!E$3'$!")!537+,737/'-,0!

9$=$3$!A)!(.<.2./$S0!A),5)1'AB' C65+-.)D0!E'+,$'2!")!(,;3>7/!

L<10';+<+*10!9'=.$!1$3Q$%0!B>$!53$#&#.30!

1'+&73'$!1'3$@0!B%&/$#!A=<.3!

C+.,+9'I+Y)910!(,$'24!1$3$%&.,P! E73$>'0!E7Q@$#!F$#>.,87;30!6.@$3! (.4.>0!5$3/'G!5$+G$>0!L$3G$#.,!9$C/'G'!

Gene Therapy and Molecular Biology Vol 11, page 103 Gene Ther Mol Biol Vol 11, 103-112, 2007

IAP as a new diagnostic and effective therapeutic target molecule for prostate cancer Review Article

Takeo Nomura*, Fuminori Satoh, Mutsushi Yamasaki, Hiromitsu Mimata Department of Oncological Science (Urology), Oita University Faculty of Medicine, Japan

__________________________________________________________________________________ *Correspondence: Takeo Nomura, Department of Oncological Science (Urology), Oita University Faculty of Medicine, 1-1 Idaigaoka, Hasama-machi, Yufu, Oita 879-5593, Japan; Phone: 81975865893; Fax: 81975865899; e-mail: TAKE@med.oita-u.ac.jp Key words: Prostate cancer, Inhibitor of apoptosis protein Abbreviations: androgen-independent prostate cancer, (AIPC); androgen receptor, (AR); B-cell lymphoma-2, (Bcl-2); Bcell lymphoma-x long, (Bcl-xL); baculoviral IAP repeat, (BIR); caspase activation and recruitment domain, (CARD); cellular IAP, (cIAP); dihydrotestosterone, (DHT); epidermal growth factor, (EGF); human IAP, (hIAP); heat shock protein, (Hsp); high temperature requirement A2, (HtrA2); inhibitor of apoptosis protein, (IAP); immunohistochemistry, (IHC); insulin-like growth factor, (IGF); IGF binding protein, (IGFBP); c-jun N-terminal kinase, (JNK); keratinocyte growth factor, (KGF); mitogen-activated protein kinase, (MAPK); neuronal apoptosis inhibitory protein, (NAIP); nuclear factor kappa B, (NF-!B); phosphatidylinositol 3-kinase, (PI3K); prostate-specific antigen, (PSA); really interesting new gene, (RING); second mitochondrial derived activation of caspase/direct IAP binding protein with low pI, (Smac/DIABLO); sex hormone-binding globulin, (SHBG); small-interesting RNA, (siRNA), TGF !activated kinase, (TAK); transforming growth factor !, (TGF !); tumor necrosis factor, (TNF); TNF receptor-associated factor, (TRAF); TNF-related apoptosis-inducing ligand, (TRAIL); XIAP-associated factor 1, (XAF1); X-chromosome-linked IAP, (XIAP) Received: 30 January 2007; Accepted: 26 February 2007; electronically published: June 2007

Summary Prostate cancer is the second most common cause of cancer-related death among men in the United States. The conversion from androgen-dependent to androgen-independent state constitutes an important event in prostate cancer progression and is the main obstacle to improving the survival and quality of life in patients with advanced prostate cancer. Considerable progress has been made in the understanding of the molecular basis of prostate cancer. Prostate cancer progression and the development of the androgen-independent characteristics have been largely related to genetic abnormalities that not only androgen receptor (AR) but also crucial molecules involved in the regulation of survival or apoptotic pathways. One of these molecules including p53 and the B-cell lymphoma-2 (Bcl-2) family, the antiapoptotic protein, the inhibitor of apoptosis proteins (IAPs) have been associated with the promotion of tumorigenesis and drug sensitivity in prostate cancer due to their overexpression in prostate cancer cells treated with androgen ablation or chemotherapeutic agents. Therefore, IAPs may be of great value in clinical and prognostic markers in patients with prostate cancer and therapies that target IAPs may have the potential to improve outcomes for patients. In this review, we focus on the experimental evidence that associates IAPs expression with prostate carcinogenesis and cancer progression, and summarize the roles of IAPs in chemotherapy to develop a new target for the diagnosis and treatment of prostate cancer.

and mortality rates in the world, however, prostate cancer incidence and mortality in Japan have increased gradually as the country has become Westernized since 1990s (Landis et al, 1998). Since the early 1990s around the time a new screening prostate-specific antigen (PSA) test has been introduced and in widespread use among the world, prostate cancer incidence raised dramatically with a true increase in the number of patients with clinical prostate cancer rather than a simple result of increased detection (Brasso and Iverson, 1999; Hankey et al, 1999). In general, prostate cancer is a relatively slow growing and indolent malignancy with doubling times for local tumors

I. Introduction Prostate cancer is the most frequently diagnosed disease and the second leading cause of cancer-related death in men in the United States (Greenlee et al, 2001).

An estimated 240,000 newly diagnosed cases are expected to occur and close to 30,000 patients die from this disease in the United States in 2006. Worldwide, prostate cancer is the fourth most common male cancer with incidence and mortality rates that vary tremendously among countries or ethnic groups. Incidence and mortality rates are higher in Western countries than in Asian countries. Among Asian countries, Japan has the lowest prostate cancer incidence 103

Nomura et al: IAP as a new diagnostic and effective therapeutic target molecule for prostate cancer estimated at 2 to 4 years. Although localized prostate cancer can be controlled successfully with surgery or radiation therapy, 15% of patients relapse after apparently successful treatment, eventually progress and metastasize (Hull et al, 2002). Prostate cancer is characterized by an initial stage during which the tumor growth is dependent on androgen receptor (AR) signaling triggered by dihydrotestosterone (DHT). Therefore, in addition to surgical resection (prostatectomy) and radiation therapy in localized prostate cancer, the main effective treatment for local recurrence after surgery or after radiation therapy or advanced prostate cancer with distant metastasis is androgen deprivation procedures surgically with orchiectomy or medically with estrogens or luteinizing hormone-releasing hormone analogues and by blocking the effects of residual androgen with competitive AR antagonists like flutamide, bicalutamide, and nilutamide.

Since 1940s, hormone therapy has been the mainstay of treatment for advanced prostate cancer. The androgen withdrawal could produce a response rate of 70-80% with a median progression-free survival of 12-33 months and a median overall survival of 23-37 months (Hurtado-Coll et al, 2002). Androgen ablation induces rapid and dramatic responses with symptomatic relief by inducing apoptosis, but the effect is usually palliative and temporary. Despite the initial response to anti-androgen therapy, the disease recurs in androgen-independent state that is unresponsive to the existing treatments including additional androgen withdrawal and chemotherapy, as well as a combination of these therapies, within 12-18 months (Petrylak, 1999). The management of androgen-independent prostate cancer (AIPC) by current chemotherapeutic regimens can temporarily eliminate androgen-independent cells by inducing apoptosis, however, these chemotherapeutic agents are generally less effective. Overall median survival from first metastasis is typically 3 years from the time of diagnosis and is 2 years from androgen independence. Thus, AIPC constitutes potentially a serious life threat that accounts for the gross part of prostate cancer mortality. Therefore, to develop rationale alternative therapies and preventive treatments for AIPC, much attention has been directed to understanding the molecular basis for the progression to androgen independence in this process.

Although the specific causes of prostate cancer initiation and progression are unknown, it seems valid that both genetics and environment play an important role in the evolution of this disease. Two main potential mechanisms have been identified during the process of the development of AIPC. The first mechanism is hypersensitivity of AR signaling during the development of AIPC. This hypersensitive signaling may be caused by a variety of AR gene mutations (Taplin et al, 1995; Marcelli et al, 2000) or increased AR copy number (Koivisto et al, 1997) that result in a functionally altered expression of the AR. The second mechanism is based on the induction of a positive survival signaling independent of AR signaling pathway that can overcome the apoptosis induced by androgen ablation (Ruiter et al, 1999; Feldman and Feldman, 2001). It has been reported that insufficient apoptosis represents the explanation for the accumulation

of prostate cancer cells (Carson and Ribeiro, 1993; Kerr et al, 1994). That is to say, progression of androgendependent tumor to hormone-refractory disease is related to genetic abnormalities that influence not only the AR but also crucial molecules involved in apoptosis. This aggressive stage of cancer is characterized by the appearance of apoptosis-resistant cells.

As previously mentioned, apoptosis is induced in prostate cancer responding to androgen ablation, radiation therapy, and chemotherapy. Molecularly, apoptosis is executed by the activation of caspases, a family of intracellular cysteine proteases that cleave substrates at aspartic acid residues (Cryns and Yuan, 1998; Stennicke and Salvesen, 1998). Unfortunately, cancer fails to respond to treatment in varying degrees. In part, the failure of cell death is caused by failure of the apoptosis and caspase activation pathways. The inhibitor of apoptosis proteins (IAPs) are a family of antiapoptotic mediator that blocks cell death by inhibiting the downstream of the caspase activation pathway (Roy et al, 1997; Deveraux et al, 1999; Deveraux and Reed, 1999; Wright and Duckett, 2005). IAPs have been found to be involved in the molecular biology of a wide range of human cancers since their discovery as direct endogenous caspase inhibitors in baculovirus. It has been reported that there is a positive correlation between IAP expression and tumor progression in prostate cancer (Krajewska et al, 2003; Kishi et al, 2004). IAPs may play an important role in cancer progression, acquisition of androgen independency, and drug-sensitivity in prostate cancer.

Understanding the machinery of IAPs function can potentially allow for the development of novel therapeutic strategies targeting caspases and IAPs for prostate cancer.

Reviews of the actions of IAPs and their mechanism have already been well published. In this review, we will focus on the experimental evidence of the roles of caspases and their negative regulators, IAPs in prostate cancer, and discuss how this evidence is being translated into the clinical field as the development of new diagnostic and prognostic markers and therapeutic target.

II. Prostate cancer and androgenandrogen receptor (AR) signaling Because prostate cancer develops in aged men with low levels of androgen, a large number of studies have reported whether elevated levels of androgen are associated with an increased risk of prostate cancer. To date, the degree to which androgen or androgen metabolites such as DHT, contribute to risk of prostate cancer remains under discussion. Guess and colleagues reported in 1997 that there is no relationship between testosterone, sex hormone-binding globulin (SHBG), or 5"-reductatse activity and risk of prostate cancer (Guess et al, 1997). In contrast, Gann et al observed increased testosterone levels, low levels of SHBG, and high levels of 5"-reductatse activity as risk factors of prostate cancer (Gann et al, 1996). Although even well-designed clinical studies have presented conflicting views concerning the association of androgen with an increased risk of prostate cancer, it seems valid that prostate cancer initiation and

104

Gene Therapy and Molecular Biology Vol 11, page 105 progression are strongly influenced by androgens in view of prostate cancer regression after surgical or medical castration. Androgen is a necessary growth factor for early-stage prostate cancer cells. The circulating androgen on male is composed of testosterone derived from testis and adrenal glands. Once inside prostate cells, 5"reductatse converts androgen to DHT that is metabolically more active. The action of androgen is mediated by a specific receptor protein, AR, which is located on the human X-chromosome of epithelial and adjacent stromal prostate cells. DHT acts as the main ligand of AR and it is much more active than testosterone, having higher affinity for the AR. The AR, a transcription factor belonging to a classical nuclear receptor superfamily, consists of a ligand-binding domain, an amino terminal activating domain, and DNA-binding domain (Gao et al, 2005). After activation of AR by phosphorylation, this activation promotes nuclear localization and binding of the steroidAR complex to specific DNA target sequences located on androgen response elements of the androgen dependent genes such as PSA, leading to the initiation of transcription (Berger and Watson, 1989). Without AR binding, steroid hormones cannot exert their effects on prostate cancer growth.

In addition to androgens, AR also plays a crucial role in several stages of the progression of prostate cancer (Avila et al, 2001; Montgomery et al, 2001). The increased copy number of AR gene contributes to androgenindependent tumor progression (Koivisto et al, 1997).

Likewise, mutations in the AR gene are identified in AIPC (Marcelli et al, 2000). These mutations in the AR gene have been found to make the AR responsive to different non-androgenic ligands, and may also contribute to the development of androgen independency. For this reason, urologists experience that AR antagonist, such as bicalutamide and flutamide, works like AR agonist suggesting that AR is stimulated by AR antagonist.

Strong evidence supports the relationship between prostate cancer progression and various peptide growth factors such as insulin-like growth factor (IGF), epidermal growth factor (EGF), and keratinocyte growth factor (KGF) (Culig et al, 1994). These growth factors released primarily by stromal cells can activate AR-related transcription on upstream of AR signaling. The cross talk between Her2/neu oncogene and AR signaling also results in the phosphorylation of AR, suggesting a mechanism whereby the pathways triggered by tyrosine kinase receptors could play a role in prostate cancer progression (Craft et al, 1999). In addition, Her2/neu also activates phosphatidylinositol 3-kinase (PI3K)/Akt survival pathway (Lin et al, 2001, Yakes et al, 2002). Although androgen is responsible for proliferative effects on prostate cancer and AR signaling, various complicated cellular regulation mechanisms that affect AR signaling are linked with the development of AIPC.

proliferation of prostate cancer cells comes to a halt and cells fall into apoptotic cell death (Isaacs et al, 1992). The irreversible genomic DNA fragmentation takes place following activation of Ca2+/Mg2+ dependent endonuclease activity in the nucleus of apoptotic cells. However, for reasons that are only partly defined, the apoptotic process induced by androgen ablation fails to eliminate the entire cancer cells, because the threshold of apoptosis progressively drops to a point at which cell proliferation exceeds apoptosis as cancer progresses (Berges et al, 1995). This increase of proliferating cells is caused by the accumulation of androgen-independent cells that eventually relapse and metastasize. As previously mentioned, progression to androgen independence is multifactorial process by which cancer cells acquire the ability to both survive in the absence of androgens and proliferate with the use of androgen non-related stimuli for mitogenesis. In addition to the hypersensitivity of AR, inappropriate activation of AR, and alterations in the regulators of the cell survival pathway, this stage of cancer is also characterized by the emergence of apoptosisresistant cells resulting from various genetic mutations and upregulation of antiapoptotic genes. In general, clusterin, AR, B-cell lymphoma-2 (Bcl-2), B-cell lymphoma-x long (Bcl-xL), heat shock protein 27 (Hsp27), IGF binding protein-2 (IGFBP-2), and IGFBP-5 are upregulated by androgen ablation and remain overexpressed in AIPC (Gleave et al, 2005). We previously reported the overexpression of cellular IAP-1 (cIAP-1) and cIAP-2 in prostate cancer tissue specimens treated with androgen ablation (Mimata et al, 2000), besides, it has been reported that AIPC cell lines PC3 and DU145 cells are highly resistant to drug-induced apoptosis due to the overexpression of cIAP-1, cIAP-2, X-chromosome-linked IAP (XIAP), and neuronal apoptosis inhibitory protein (NAIP) (McEleny et al, 2002). The aspect of AIPC cell biology of these antiapoptotic genes is developing rapidly, and IAPs may prove to be the importance of antiapoptotic action in prostate cancer progression.

IV. IAP: Cell survival gene The IAPs have been identified as one of the most potent inhibitors of endogenous caspases and apoptosis.

Unlike Bcl-2 protein, which blocks the mitochondrial pathway of apoptosis, the antiapoptotic function of IAPs is due to its ability to inhibit both intrinsic mitochondriamediated and extrinsic death receptor-mediated pathways by directly binding to and inhibiting both initiator and effector caspases (Deveraux et al, 1997, 1998; Roy et al, 1997; Devi, 2004). To date, at least eight IAP-encoding genes have been recognized and reported in the human genome, including XIAP, human IAP-1 (hIAP-1, cIAP-2), hIAP-2 (cIAP-1), survivin, NAIP, apollon (BRUCE), livin (ML-IAP, KIAP), and IAP-like protein-2 (ILP-2), which are evolutionarily conserved with apparent homologies identified in flies, worms, yeast and several mammalian species including mice, rats, chickens, pigs, and humans (Roy et al, 1997; Deveraux et al, 1998; Tamm et al, 1998; Chen et al, 1999; Kasof and Gomes, 2001; Richter et al, 2001). All the IAPs show varying degrees of antiapoptotic effect, depending on the different mechanisms of action

III. Regulation of apoptosis of prostate cancer cells Even the patients with advanced prostate cancer potentially respond to androgen ablation, and serum PSA levels decrease in almost all patients. After treatment, 105

Nomura et al: IAP as a new diagnostic and effective therapeutic target molecule for prostate cancer for each IAP homology. The IAPs are characterized and grouped together based on the presence of a highly conserved domain of ~70 amino acid motif termed the baculoviral IAP repeat (BIR) domain (Verhagen et al, 2001). In addition to BIR domains, IAPs possess caspase activation and recruitment domain (CARD) and really interesting new gene (RING)-zinc binding domains (Deveraux and Reed, 1999; Yang et al, 2000). IAPs can bind to and potently inhibit activated caspase-3, -7, and -9 through some of BIR domains, suggesting that the majority of IAPs activities are dependent on BIR domains (Deveraux and Reed, 1999). Both hIAP-1 and hIAP-2 inhibit caspase-3, -7, and -9, but they are less potent than XIAP (Zhivotovsky and Orrenius, 2003). A RING domain has ubiquitin protease activity; it can bind to ubiquitinconjugating enzymes that promote autoubiquitination and degradation of IAP-caspase complexes after apoptosis stimulus, suggesting that RING domain-dependent proteasomic caspase degradation may be another mechanism of the IAPsâ&#x20AC;&#x2122; antiapoptotic activity (Yang et al, 2000). The requirement of RING domain for inhibition of apoptotic pathway seems to be dependent on the type of cells. The function of the CARD domain in hIAP-1 and hIAP-2 remains unknown. IAPs can protect cells from various triggers of intrinsic and extrinsic pathways. All the IAPs except NAIP can bind to and inhibit caspase-3 and -7 (Roy et al, 1997; Deveraux et al, 1998). XIAP, hIAP-1, hIAP-2, and survivin were also shown to bind to and inhibit caspase-9, but not caspase-1, -6, -8, or -10 (Roy et al, 1997). Although IAPs cannot bind to or inhibit caspase8, they bind to and inhibit its substrate caspase-3, thus providing protection from death receptor-mediated apoptosis, because both death receptor-mediated and mitochondria-mediated pathways converge finally at the level of activation of caspase-3 (Roy et al, 1997; Deveraux et al, 1998). In contrast, XIAP, hIAP-1, and hIAP-2 bind to directly pro-caspase-9, and prevent its processing and activation induced by cytochrome c released from mitochondria, thus they can prevent the proteolytic processing of pro-caspase-3, -6, and -9 (Deveraux et al, 1998). It has been reported that XIAP mainly binds to active caspase-3, but also partially to the unprocessed procaspase-3 (Deveraux et al, 1997). We transiently cotransfected with XIAP and pro-caspase-3 cDNAs into LNCaP cells, and observed the strong interaction between XIAP and pro-caspase-3 by immunoprecipitation and immunoblot analysis (Nomura et al, 2003). XIAP may block a common downstream by directly inhibiting proand active caspase-9, and by interfering with caspase-3 activity and/or processing of pro-caspase-3. Interestingly, the activity of IAPs are controlled at various levels by the transcriptional factor, nuclear factor kappa B (NF-!B) and mitogen-activated protein kinase (MAPK) signaling pathway. The hIAP-1 and hIAP-2 also bind to tumor necrosis factor receptor-associated factor (TRAF) heterocomplexes through their N-terminal BIR domain, interfering with the upstream activation of caspase-8 (Rothe et al, 1995; Wang et al, 1998). TRAF-1, TRAF-2, XIAP, hIAP-1, and hIAP-2 are identified as gene targets of NF-!B transcription activity (Stehlik et al, 1998; Wang et al, 1998). The activation of NF-!B and the induction of

IAPs are an essential part in the process that protects cells from apoptotic signals caused by tumor necrosis factor-" (TNF- "). In addition, XIAP, NAIP, and ML-IAP bind to transforming growth factor ! (TGF !)-activated kinase (TAK-1) and activate TAK-1/c-Jun N-terminal kinase (JNK) signaling cascade, with resulting inhibition of apoptosis (Sanna et al, 2002). TAK-1 dependent JNK activation also plays an important role in antiapoptotic efficacy of IAPs. In addition to regulation of apoptosis, IAP members such as survivin have been found to be a potent regulator of cell cycle progression and mitosis (Reed and Bischoff, 2000). Survivin was found in cytosolic fraction but it is also associated with chromatin expressed in G2/M phase and downregulated after cell cycle arrest, suggesting that survivin plays a role in monitoring chromosome replication and the inhibition of caspase activity in the nucleus (Ambrosini et al, 1997; Li et al, 1998). The evidence that survivin regulates apoptosis through a cyclin-dependent kinase inhibitor p21WAF1/Cip1 pathway is well documented (Beltrami et al, 2004; Fukuda et al, 2004). Interestingly, it has been also reported that survivin may contribute to tumor angiogenesis via angiopoietin-1 stabilization (Papapetropoulos et al, 2000).

Survivin may regulate cell death by not only an antiapoptotic mechanism but also a caspase cascadeindependent mechanism. Taken together, IAPs are classically regarded as caspase inhibitors, but the possibility exist that IAPs have multiple mechanisms of cancer growth and protection from cell death beyond the role as the direct inhibitors of caspases.

V. Endogenous IAP inhibitors Currently, the following three endogenous regulatory proteins are known as blockers of IAPs; second mitochondrial derived activation of caspase/direct IAP binding protein with low pI (Smac/DIABLO), high temperature requirement A (HtrA2/Omi), and XIAPassociated factor 1 (XAF1). Smac/DIABLO and HtrA2/Omi are mitochondrial proteins first identified in Drosophila and subsequently recognized in humans (Srinivasula et al, 2002). Smac/DIABLO is released into the cytosol together with cytochrome c during mitochondrial disruption. Cleaved active form of Smac/DIABLO can inhibit IAPs through binding to some BIR domains of IAPs, resulting in degradation of IAPs protein by ubiquitin/proteasome pathway (Ekert et al, 2001). HtrA2/Omi, which belongs to the shock response serine protease-chaperone HtrA family, is released along with Smac/DIABLO from mitochondria (Gray et al, 2000; Hegde et al, 2002). XAF1 is known as the other endogenous antagonist of XIAP, which has the ability to directly interact with XIAP and exclusively blocks its antiapoptotic activity (Byun et al, 2003). Unlike Smac/DIABLO and HtrA2/Omi, XAF1 is located in the nucleus and affect a redistribution of XIAP from cytosol to the nucleus, resulting in inactivation of XIAP (Liston et al, 2001). Interestingly, XAF1 is mainly expressed in normal tissues but is low or missing in most cancer cells, which implies a tumor-suppressing function in the tumorigenic process. Taken together, these endogenous IAP inhibitors may play an important role as a potent tumor suppressor, 106

Gene Therapy and Molecular Biology Vol 11, page 107 therefore, molecules that mimic the actions of IAPs inhibitors could be therapeutically useful.

hIAP-1, hIAP-2, and XIAP (Tamm et al, 2000), suggesting that these proteins are post-transcriptionally regulated. We previously showed that the expression of cIAP-1 and cIAP-2 was upregulated in patients treated with androgen ablation by IHC, suggesting that the advent of residual cancer cells after androgen ablation was due to the induction of these IAPs (Mimata et al, 2000).

Upregulation of IAPs may develop androgen independency. Zhang et al indicated that androgen stimulation with DHT increased survivin expression and antiandrogen therapy with flutamide decreased its expression in LNCaP cells, suggesting that survivin played a potentially important role in androgen sensitivity and resistance to androgen ablation (Zhang et al, 2005). These results, therefore, indicated that prostate cancer cells induce IAPs expression during the progression under an androgen environment. In contrast, another study indicated that IAP expression in LNCaP cells was unaffected by charcoal-stripped medium (McEleny et al, 2002). They also confirmed that androgen-supplemented medium did not influence IAP expression in LNCaP cells (McEleny et al, 2002). These results suggest that IAP expression is unrelated to an androgen environment, then androgen ablation does not affect IAP expression and the acquisition of androgen independence is not due to the expression of IAP in prostate cancer. To show whether upregulation of IAPs expression results in androgen independence or not, the fact that IAPs belong to target genes of AR signaling needs to be explained.

Taken together, IAPs, particularly survivin, are thought to be important biomarkers for diagnosis, staging, and prognosis of prostate cancer, and may be useful as therapeutic response inducer for prostate cancer patients, but a relationship between IAP and androgen response remains to be elucidated.

VI. IAP expression in prostate cancer The upregulation of IAPs expression has been considered one of mechanisms for escape from elimination by apoptosis. Therefore, to investigate the IAPs expression in prostate cancer is essential for the development of novel therapeutic strategies targeting IAPs for prostate cancer.

Overexpression of IAPs was observed in all the most common cancers by analysis of its transcript and protein.

Evidence is accumulating that the levels of IAPs expression are related to progression and poor prognosis, including breast cancer (Tanaka et al, 2000), esophageal cancer (Kato et al, 2001), gastric cancer (Lu et al, 1998), colorectal cancer (Kawasaki et al, 1998), neuroblastma (Adida et al, 1998), non-small cell lung cancer (Monzo et al, 1999), urinary bladder cancer (Swana et al, 1999), epithelial ovarian cancer (Sui et al, 2002), liver cancer (Ito et al, 2000), uterine cancer (Saitoh et al, 1999), skin cancer (Grossman et al, 1999), and leukemia (Nakagawa et al, 2005), etc. These results suggest that IAPs may contribute to tumor progression and that detection of IAPs provides a specific and sensitive diagnostic marker. However, there have been few reports on the expression of IAPs in prostate cancer. Kishi and colleagues reported in 2004 that survivin mRNA expression was positively correlated with the progression (T-stage, lymph node metastasis, vessel invasion, surgical margin, and Gleason score) and aggressiveness (proliferative activity) in prostate cancer tissue specimens obtained from prostatectomy (Kishi et al, 2004). Shariat et al showed that survivin expression was associated with higher Gleason score and positive lymph node metastasis (Shariat et al, 2004). In contrast, Krajewska and colleagues reported in 2003 that expression levels of survivin, hIAP-1, hIAP-2, and XIAP by immunohistochemistry (IHC) on the microarrays elevated in prostate cancer, but the levels of these IAPs expression did not correlate with Gleason score and PSA levels (Krajewska et al, 2003). As previous reports on IAPs expression of many kinds of cancer have described, IAPs expression is thought to be a common event in prostate cancer.

The role of IAPs in the development of androgen independency has been controversial. IAPs overexpression in commonly used prostate cancer cell lines, including androgen-dependent LNCaP cells, androgen-independent DU145 and PC3 cells was observed (Tamm et al, 2000; McEleny et al, 2002). McEleny et al confirmed the expression of NAIP, hIAP-1, hIAP-2, XIAP, and survivin in LNCaP, DU145, and PC3 cells at the level of the mRNA and the protein. They also showed an increased expression of hIAP-1, hIAP-2, and XIAP in DU145 and PC3 cells compared with LNCaP cells, and this expression is correlated with resistance to apoptosis (McEleny et al, 2002). Another study identified the expression of hIAP-2 and XIAP in DU145 and PC3 cells, but identified hIAP-1 expression only in DU145 cells, and did not identify the expression of NAIP in these cell lines (Tamm et al, 2000).

Interestingly, there are poor relationships between mRNA and protein expression for survivin (McEleny et al, 2002),

VII. Rationale for IAPs as therapeutic targets There appear to be more studies in the recent literature focusing on survivin and XIAP as potential therapeutic targets. The reason for this is that among IAPs, XIAP is the most potent inhibitor of caspases and apoptosis (Roy et al, 1997), and that survivin plays an important role in mitosis and angiogenesis as well as an inhibitor of caspases (Papapetropoulos et al, 2000; Reed and Bischoff, 2000; Adams et al, 2001). In addition, the most important feature of these two molecules is that there are upregulated in various cancers and high levels of survivin and/or XIAP are associated with poor prognosis.

The antiapoptotic effects of survivin and XIAP on response to irradiation and chemotherapeutic agents have been extensively documented.

Radiation triggers the mitochondria-mediated pathway, resulting in apoptotic cell death in cancer (Zhivotovsky et al, 1999). It is reported that a low dose of "-irradiation in non-small cell lung cancer resulted in upregulation of XIAP, and cancer cells acquired the resistance to "-irradiation (Holcik et al, 2000). Another study showed that an inverse relationship between survivin expression and radiosensitivity in pancreatic cancer (Asanuma et al, 2000). Although radiation therapy is an 107

Nomura et al: IAP as a new diagnostic and effective therapeutic target molecule for prostate cancer effective treatment for localized prostate cancer, the development of radioresistance may occur in some cases with advanced prostate cancer. Since there are no reports on the expression of IAPs in prostate cancer patients after radiation therapy, studies explaining the elusive mechanisms following radiation are expected to constitute a rational approach for molecular targeting treatment.

There have been no satisfactory chemotherapeutic strategies for the treatment of both hormone-sensitive and hormone-resistant prostate cancer. Recently, docetaxel (taxotere) or paclitaxel (taxol) based combination chemotherapy demonstrated significant antitumor activity and improvement in overall survival in advanced prostate cancer (Trivedi et al, 2000; Tannock et al, 2004).

Although the relationship between IAPs expression and chemosensitivity is still unknown in prostate cancer, several experimental studies showed inhibition of apoptosis by IAPs in response to chemotherapeutic agents in various cancers (Tamm et al, 2000; Li et al, 2001; Nomura et al, 2003, 2004; Chandele et al, 2004).

Overexpression of IAPs such as XIAP and survivin confers resistance to chemotherapy and stimuli that trigger the intrinsic and extrinsic pathways of caspase cascade.

We previously showed that overexpression of XIAP by stable transfection in LNCaP cells inhibited taxol- and cisplatin-induced apoptosis (Nomura et al, 2003, 2004).

Another study reported that XIAP suppressed apoptosis following treatment with some genotoxic agents or after irradiation in myeloid leukemia cells (Datta et al, 2000). In addition to experimental studies, the relationship between increased IAPs expression and chemosensitivity was clinically reported in several cancers (Kato et al, 2001; Schlette et al, 2004). Survivin expression is a useful as a prognostic and therapeutic response indicator for esophageal cancer (Kato et al, 2001) and lymphoma patients (Schlette et al, 2004). These results also suggest that IAPs have the potential as a novel determinant of chemosensitivity and therapeutic target.

Cisplatin, a most effective and widely used chemotherapeutic agent, is reported as a negative regulator of XIAP in several cancers including ovarian cancer (Sasaki et al, 2000; Li et al, 2001), oral cancer (Matsumiya et al, 2001), hepatic cancer (Notarbartolo et al, 2005), and glioblastoma (Roa et al, 2003). We reported that cisplatin induced apoptosis by the inhibition of XIAP expression and cisplatin sensitivity was dependent on the levels of XIAP protein expression in LNCaP cells (Nomura et al, 2004). We also reported that cisplatin-resistant LNCaP cells overexpressed hIAP-2, XIAP, and survivin, resulting in cross-resistance to several chemotherapeutic agents (Nomura et al, 2005). The most common reason for acquisition of resistance to a broad range of anticancer agents is expression of energy-dependent transporters that eject anticancer agents from cancer cells, but other mechanisms of resistance including insensitivity to druginduced apoptosis by overexpression of IAPs probably play an important role in acquisition of chemo-resistance.

Although the current regimens of chemotherapy for prostate cancer have no satisfactory advantage, therapeutic strategies interfering with XIAP expression by cisplatin

may confer a novel insight to develop a XIAP-targeted therapy.

VIII. Future direction Although the research works have revealed a molecular biology of IAPs, yet it is far from being satisfactory. Currently, two approaches to the management of IAPs activity are being investigated; antisense oligonucleotides and small molecule inhibitors. Antisense oligonucleotides against XIAP and survivin are in clinical phase I trials, but small molecule inhibitors are now under way in the laboratory. The antisense molecule in clinical trial is a mixture of DNA and RNA oligonucleotides.

Antisense oligonucletide can inhibit the protein expression by promoting the degradation of mRNA, therefore, this approach is more effective than by directly inhibiting translation from mRNA to protein. It has been reported that downregulation of XIAP expression by XIAP antisense induced apoptosis and enhanced sensitivity to cisplatin and tumor necrosis factor-related apoptosisinducing ligand (TRAIL) in DU145 cells (Amantana et al, 2004). Another study showed that an antisense to cIAP-1 sensitized PC3 cells to Fas antibody and TNF-mediated apoptosis (McEleny et al, 2004). Adenoviral vector of survivin antisense fragment induced apoptosis in DU145 cells and sensitized cancer cells to chemotherapeutic agents docetaxel and etoposide in vitro and in vivo (Hayashi et al, 2005). These results suggest that antisense strategy to downregulate IAPs provides an effective therapeutic approach to hormone refractory prostate cancer.

RNA interference (RNAi) refers to a group of related post-transcriptional gene silencing mechanisms whereby double-stranded short antisense RNA posttranscriptionally silences a specific gene. The smallinterfering RNA (siRNA) technique has been broadly used to investigate gene function, gene regulation, and genespecific therapeutics because of its marked efficacy and specificity (Elbashir et al, 2001). Paduano and colleagues reported that silencing of survivin gene by siRNA induced apoptosis and enhanced the sensitivity to the heat shock protein 90 (Hsp90) inhibitor in DU145 cells (Paduano et al, 2006). We confirmed that LNCaP cells transfected with synthetic double-stranded siRNA against XIAP are enhanced to suppress cell growth by inducing apoptosis and sensitized to taxol (unpublished observation). It may be proven that the application of siRNA technique to gene therapy is effective.

Several novel approaches to interference of IAP expression have not only the potential for overcoming the antiapoptotic mechanism of IAP in prostate cancer but also an insight into the function of IAP in tumor progression and drug-resistance. However, before using these technologies in human, much work remains to be done to guarantee the specificity and to optimize safe and efficacious delivery system.

IX. Conclusions In this review, we described the molecular mechanisms of androgen independence and discussed the regulators of apoptotic pathway including IAP family 108

Gene Therapy and Molecular Biology Vol 11, page 109 Carson DA, Ribeiro JM (1993) Apoptosis and disease. Lancet 341,1251-1254.

Chandele A, Prasad V, Jagtap JC, Shukla R, Shastry PR (2004) Upregulation of survivin in G2/M cells and inhibition of caspase 9 activity enhances resistance in staurosporineinduced apoptosis. Neoplasia 6, 29-40.

Chen Z, Naito M, Hori S, Mashima T, Yamori T, Tsuruo T (1999) A human IAP-family gene, apollon, expressed in human brain cancer cells. Biochem Biophys Res Commun 264, 847-854.

Craft N, Shostak Y, Carey M, Sawyers CL (1999) A mechanism for hormone-independent prostate cancer through modulation of androgen receptor signaling by the HER-2/neu tyrosine kinase. Nat Med 5, 280-285.

Cryns V, Yuan J (1998) Proteases to die for. Genes Dev 12, 1551-1570.

Culig Z, Hobisch A, Cronauer MV, Radmayr C, Trapman J, Hittmair A, Bartsch G, Klocker H (1994) Androgen receptor activation in prostatic tumor cell lines by insulin-like growth factor-I, keratinocyte growth factor, and epidermal growth factor. Cancer Res 54, 5474-5478.

Datta R, Oki E, Endo K, Biedermann V, Ren J, Kufe D (2000) XIAP regulates DNA damage-induced apoptosis downstream of caspase-9 cleavage. J Biol Chem 275, 31733-31738.

Deveraux QL, Reed JC (1999) IAP family proteins--suppressors of apoptosis. Genes Dev 13, 239-252.

Deveraux QL, Roy N, Stennicke HR, Van Arsdale T, Zhou Q, Srinivasula SM, Alnemri ES, Salvesen GS, Reed JC (1998) IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases.

EMBO J 17, 2215-2223.

Deveraux QL, Stennicke HR, Salvesen GS, Reed JC (1999) Endogenous inhibitors of caspases. J Clin Immunol 19, 388398.

Deveraux QL, Takahashi R, Salvesen GS, Reed JC (1997) Xlinked IAP is a direct inhibitor of cell-death proteases.

Nature 388, 300-304.

Devi GR (2004) XIAP as target for therapeutic apoptosis in prostate cancer. Drug News Perspect 17, 127-134.

Ekert PG, Silke J, Hawkins CJ, Verhagen AM, Vaux DL (2001) DIABLO promotes apoptosis by removing MIHA/XIAP from processed caspase 9. J Cell Biol 152, 483-490.

Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-498.

Feldman BJ, Feldman D (2001) The development of androgenindependent prostate cancer. Nat Rev Cancer 1, 34-45.

Fukuda S, Mantel CR, Pelus LM (2004) Survivin regulates hematopoietic progenitor cell proliferation through p21WAF1/Cip1-dependent and -independent pathways.

Blood 103, 120-127.

Gann PH, Hennekens CH, Ma J, Longcope C, Stampfer MJ (1996) Prospective study of sex hormone levels and risk of prostate cancer. J Natl Cancer Inst 88, 1118-1126.

Gao W, Bohl CE, Dalton JT (2005) Chemistry and structural biology of androgen. Chem Rev 105, 3352-3370.

Gleave M, Miyake H, Chi K (2005) Beyond simple castration: targeting the molecular basis of treatment resistance in advanced prostate cancer. Cancer Chemother Pharmacol 56 Suppl 1, 47-57.

Gray CW, Ward RV, Karran E, Turconi S, Rowles A, Viglienghi D, Southan C, Barton A, Fantom KG, West A, Savopoulos J, Hassan NJ, Clinkenbeard H, Hanning C, Amegadzie B, Davis JB, Dingwall C, Livi GP, Creasy CL (2000) Characterization of human HtrA2, a novel serine protease involved in the mammalian cellular stress response. Eur J Biochem 267, 5699-5710.

proteins in prostate cancer cells. IAP overexpression occurs commonly in prostate cancer as an early event but it may cause progression and androgen independency.

Thus, IAP may play an important role as a new diagnostic and prognostic marker of prostate cancer. Involvement of IAP in prostate cancer resistance to chemotherapeutic agents and other apoptotic maneuver has been investigated by use of IAP gene downregulation technique, supporting to validate IAP as potent therapeutic targets for prostate cancer. Various strategies to downregulate IAP including antisense, small molecules, and siRNA etc in cancer cells are currently under investigation with promising results.

IAP family proteins thus may be candidate drug discovery target molecules for restoration of apoptosis sensitivity in prostate cancer. Besides targeting IAP, antagosists of IAPs may be also of great value as novel target genes. Overall, a better molecular knowledge of mechanisms that regulate IAP expression in prostate cancer contribute to developing a promising new approach for the treatment of prostate cancer.

Acknowledgements We thank Ms. N. Hamamatsu, Ms. Y. Ayaki and numerous members of our laboratory for their stimulating comments.

References Adams RR, Carmena M, Earnshaw WC (2001) Chromosomal passengers and the (aurora) ABCs of mitosis. Trends Cell Biol 11, 49-54.

Adida C, Berrebi D, Peuchmaur M, Reyes-Mugica M, Altieri DC (1998) Anti-apoptosis gene, survivin, and prognosis of neuroblastoma. Lancet 351, 882-883.

Amantana A, London CA, Iversen PL, Devi GR (2004) X-linked inhibitor of apoptosis protein inhibition induces apoptosis and enhances chemotherapy sensitivity in human prostate cancer cells. Mol Cancer Ther 3, 699-707.

Ambrosini G, Adida C, Altieri DC (1997) Anovel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med 3, 917-921.

Asanuma K, Moriai R, Yajima T, Yagihashi A, Yamada M, Kobayashi D, Watanabe N (2000) Survivin as a radioresistance factor in pancreatic cancer. Jpn J Cancer Res 91, 1204-1209.

Avila DM, Zoppi S, McPhaul MJ (2001) The androgen receptor (AR) in syndromes of androgen insensitivity and in prostate cancer. J Steroid Biochem Mol Biol 76, 135-142.

Beltrami E, Plescia J, Wilkinson JC, Duckett CS, Altieri DC (2004) Acute ablation of survivin uncovers p53-dependent mitotic checkpoint functions and control of mitochondrial apoptosis. J Biol Chem 279, 2077-2084.

Berger FG, Watson G (1989) Androgen-regulated gene expression. Annu Rev Physiol 51, 51-65.

Berges RR, Vukanovic J, Epstein JI, CarMichel M, Cisek L, Johnson DE, Veltri RW, Walsh PC, Isaacs JT (1995) Implication of cell kinetic changes during the progression of human prostatic cancer. Clin Cancer Res 1, 473-480.

Brasso K, Iverson P (1999) Prostate cancer in Denmark.

Incidence, morbidity and mortality. Scand J Urol Nephrol Suppl 203, 29-33.

Byun DS, Cho K, Ryu BK, Lee MG, Kang MJ, Kim HR, Chi SG (2003) Hypermethylation of XIAP-associated factor 1, a putative tumor suppressor gene from the 17p13.2 locus, in human gastric adenocarcinomas. Cancer Res 63, 7068-7075.

109

Nomura et al: IAP as a new diagnostic and effective therapeutic target molecule for prostate cancer Greenlee IT, Hill-Harmon MB, Murray T, Thun M (2001) Cancer statistics, 2001. CA Cancer J Clin 51, 15-36.

Grossman D, McNiff JM, Li F, Altieri DC (1999) Expression of the apoptosis inhibitor, survivin, in nonmelanoma skin cancer and gene targeting in a keratinocyte cell line. Lab Invest 79, 1121-1126.

Guess HA, Friedman GD, Sadler MC, Stanczyk FZ, Vogelman JH, Imperato-McGinley J, Lobo RA, Orentreich N (1997) 5 alpha-reductase activity and prostate cancer: a case-control study using stored sera. Cancer Epidemiol Biomarkers Prev 6, 21-24.

Hankey BF, Feuer EJ, Clegg LX, Hayes RB, Legler JM, Prorok PC, Ries LA, Merrill RM,Kaplan RS (1999) Cancer surveillance series: interpreting trends in prostate cancer-part I: Evidence of the effects of screening in recent prostate cancer incidence, mortality, and survival rates. J Natl Cancer Inst 91 1017-1024.

Hayashi N, Asano K, Suzuki H, Yamamoto T, Tanigawa N, Egawa S, Manome Y (2005) Adenoviral infection of survivin antisense sensitizes prostate cancer cells to etoposide in vivo.

Prostate 65, 10-19.

Hegde R, Srinivasula SM, Zhang Z, Wassell R, Mukattash R, Cilenti L, DuBois G, Lazebnik Y, Zervos AS, FernandesAlnemri T, Alnemri ES (2002) Identification of Omi/HtrA2 as a mitochondrial apoptotic serine protease that disrupts inhibitor of apoptosis protein-caspase interaction. J Biol Chem 277, 432-438.

Holcik M, Yeh C, Korneluk RG, Chow T (2000) Translational upregulation of X-linked inhibitor of apoptosis (XIAP) increases resistance to radiation induced cell death.

Oncogene 19, 4174-4177.

Hull GW, Rabbani F, Abbas F, Wheeler TM, Kattan MW, Scardino PT (2002) Cancer control with radical prostatectomy alone in 1,000 consecutive patients. J Urol 167, 528-534.

Hurtado-Coll A, Goldenberg SL, Gleave ME, Klotz L (2002) Intermittent androgen suppression in prostate cancer: the Canadian experience. Urology 60, 52-56.

Isaacs JT, Lundmo PI, Berges R, Martikainen P, Kyprianou N, English HF (1992) Androgen regulation of programmed death of normal and malignant prostatic cells. J Androl 13, 457-464.

Ito T, Shiraki K, Sugimoto K, Yamanaka T, Fujikawa K, Ito M, Takase K, Moriyama M, Kawano H, Hayashida M, Nakano T, Suzuki A (2000) Survivin promotes cell proliferation in human hepatocellular carcinoma. Hepatology 31, 10801085.

Kasof GM, Gomes BC (2001) Livin, a novel inhibitor of apoptosis protein family member. J Biol Chem 276, 32383246.

Kato J, Kuwabara Y, Mitani M, Shinoda N, Sato A, Toyama T, Mitsui A, Nishiwaki T, Moriyama S, Kudo J, Fujii Y (2001) Expression of survivin in esophageal cancer: correlation with the prognosis and response to chemotherapy. Int J Cancer 95, 92-95.

Kawasaki H, Altieri DC, Lu CD, Toyoda M, Tenjo T, Tanigawa N (1998) Inhibition of apoptosis by survivin predicts shorter survival rates in colorectal cancer. Cancer Res 58, 50715074.

Kerr JF, Winterford CM, Harmon BV (1994) Apoptosis. Its significance in cancer and cancer therapy. Cancer 73, 20132026.

Kishi H, Igawa M, Kikuno N, Yoshino T, Urakami S, Shiina H (2004) Expression of the survivin gene in prostate cancer: correlation with clinicopathological characteristics, proliferative activity and apoptosis. J Urol 171, 1855-1860.

Koivisto P, Kononen J, Palmberg C, Tammela T, Hyytinen E, Isola J, Trapman J, Cleutjens K, Noordzij A, Visakorpi T,

Kallioniemi OP (1997) Androgen receptor gene amplification: a possible molecular mechanism for androgen deprivation therapy failure in prostate cancer. Cancer Res 57, 314-319.

Krajewska M, Krajewski S, Banares S, Huang X, Turner B, Bubendorf L, Kallioniemi OP, Shabaik A, Vitiello A, Peehl D, Gao GJ, Reed JC (2003) Elevated expression of inhibitor of apoptosis proteins in prostate cancer. Clin Cancer Res 9, 4914-4925.

Landis SH, Murray T, Bolden S, Wingo PA (1998) Cancer statistics, 1998. CA Cancer J Clin 48, 6-29.

Li F, Ambrosini G, Chu EY, Plescia J, Tognin S, Marchisio PC, Altieri DC (1998) Control of apoptosis and mitotic spindle checkpoint by survivin. Nature 396, 580-584.

Li J, Feng Q, Kim JM, Schneiderman D, Liston P, Li M, Vanderhyden B, Faught W, Fung MF, Senterman M, Korneluk RG, Tsang BK (2001) Human ovarian cancer and cisplatin resistance: possible role of inhibitor of apoptosis proteins. Endocrinology 142, 370-380.

Lin HK, Yeh S, Kang HY, Chang C (2001) Akt suppresses androgen-induced apoptosis by phosphorylating and inhibiting androgen receptor. Proc Natl Acad Sci USA 98, 7200-7205.

Liston P, Fong WG, Kelly NL, Toji S, Miyazaki T, Conte D, Tamai K, Craig CG, McBurney MW, Korneluk RG (2001) Identification of XAF1 as an antagonist of XIAP antiCaspase activity. Nat Cell Biol 3, 128-133.

Lu CD, Altieri DC, Tanigawa N (1998) Expression of a novel antiapoptosis gene, survivin, correlated with tumor cell apoptosis and p53 accumulation in gastric carcinomas.

Cancer Res 58, 1808-1812.

Marcelli M, Ittmann M, Mariani S, Sutherland R, Nigam R, Murthy L, Zhao Y, DiConcini D, Puxeddu E, Esen A, Eastham J, Weigel NL, Lamb DJ (2000) Androgen receptor mutations in prostate cancer. Cancer Res 60, 944-999.

Matsumiya T, Imaizumi T, Yoshida H, Kimura H, Satoh K (2001) Cisplatin inhibits the expression of X-chromosomelinked inhibitor of apoptosis protein in an oral carcinoma cell line. Oral Oncol 37, 296-300.

McEleny K, Coffey R, Morrissey C, Williamson K, Zangemeister-Wittke U, Fitzpatrick JM, Watson RW (2004) An antisense oligonucleotide to cIAP-1 sensitizes prostate cancer cells to fas and TNFalpha mediated apoptosis.

Prostate 59, 419-425.

McEleny KR, Watson RW, Coffey RN, O'Neill AJ, Fitzpatrick JM (2002) Inhibitors of apoptosis proteins in prostate cancer cell lines. Prostate 51, 133-140.

Mimata H, Satoh F, Hanada T, Kasagi Y, Sakamoto S, Hamada Y, Nomura Y (2000) Expression of the IAP gene family in prostate cancer. Eur Urol 37 Suppl 2: 104.

Montgomery JS, Price DK, Figg WD (2001) The androgen receptor gene and its influence on the development and progression of prostate cancer. J Pathol 195, 138-146.

Monzo M, Rosell R, Felip E, Astudillo J, Sanchez JJ, Maestre J, Martin C, Font A, Barnadas A, Abad A (1999) A novel antiapoptosis gene: Re-expression of survivin messenger RNA as a prognosis marker in non-small-cell lung cancers. J Clin Oncol 17, 2100-2104.

Nakagawa Y, Hasegawa M, Kurata M, Yamamoto K, Abe S, Inoue M, Takemura T, Hirokawa K, Suzuki K, Kitagawa M (2005) Expression of IAP-family proteins in adult acute mixed lineage leukemia (AMLL). Am J Hematol 78, 173180.

Nomura T, Mimata H, Takeuchi Y, Yamamoto H, Miyamoto E, Nomura Y (2003) The X-linked inhibitor of apoptosis protein inhibits taxol-induced apoptosis in LNCaP cells. Urol Res 31, 37-44.

110

Gene Therapy and Molecular Biology Vol 11, page 111 Nomura T, Mimata H, Yamasaki M, Nomura Y (2004) Cisplatin inhibits the expression of X-linked inhibitor of apoptosis protein in human LNCaP cells. Urol Oncol 22, 453-460.

Nomura T, Yamasaki M, Nomura Y, Mimata H (2005) Expression of the inhibitors of apoptosis proteins in cisplatinresistant prostate cancer cells. Oncol Rep 14, 993-997.

Notarbartolo M, Poma P, Perri D, Dusonchet L, Cervello M, D'Alessandro N (2005) Antitumor effects of curcumin, alone or in combination with cisplatin or doxorubicin, on human hepatic cancer cells. Analysis of their possible relationship to changes in NF-kB activation levels and in IAP gene expression. Cancer Lett 224, 53-65.

Paduano F, Villa R, Pennati M, Folini M, Binda M, Daidone MG, Zaffaroni N (2006) Silencing of survivin gene by small interfering RNAs produces supra-additive growth suppression in combination with 17-allylamino-17demethoxygeldanamycin in human prostate cancer cells. Mol Cancer Ther 5, 179-186.

Papapetropoulos A, Fulton D, Mahboubi K, Kalb RG, O'Connor DS, Li F, Altieri DC, Sessa WC (2000) Angiopoietin-1 inhibits endothelial cell apoptosis via the Akt/survivin pathway. J Biol Chem 275, 9102-9105.

Petrylak DP (1999) Chemotherapy for advanced hormone refractory prostate cancer. Urology 54, 30-35.

Reed JC, Bischoff JR (2000) BIRinging chromosomes through cell division--and survivin' the experience. Cell 102, 545548.

Richter BW, Mir SS, Eiben LJ, Lewis J, Reffey SB, Frattini A, Tian L, Frank S, Youle RJ, Nelson DL, Notarangelo LD, Vezzoni P, Fearnhead HO, Duckett CS (2001) Molecular cloning of ILP-2, a novel member of the inhibitor of apoptosis protein family. Mol Cell Biol 21, 4292-4301.

Roa WH, Chen H, Fulton D, Gulavita S, Shaw A, Th'ng J, FarrJones M, Moore R, Petruk K (2003) X-linked inhibitor regulating TRAIL-induced apoptosis in chemoresistant human primary glioblastoma cells. Clin Invest Med 26, 231242.

Rothe M, Pan MG, Henzel WJ, Ayres TM, Goeddel DV (1995) The TNFR2-TRAF signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins.

Cell 83, 1243-1252.

Roy N, Deveraux QL, Takahashi R, Salvesen GS, Reed JC (1997) The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J, 16, 6914-6925.

Ruijter E, van de Kaa C, Miller G, Ruiter D, Debruyne F, Schalken J (1999) Molecular genetics and epidemiology of prostate carcinoma. Endocr Rev 20, 22-45.

Saitoh Y, Yaginuma Y, Ishikawa M (1999) Analysis of Bcl-2, Bax and survivin genes in uterine cancer. Int J Oncol 15, 137-141.

Sanna MG, da Silva Correia J, Ducrey O, Lee J, Nomoto K, Schrantz N, Deveraux QL, Ulevitch RJ (2002) IAP suppression of apoptosis involves distinct mechanisms: the TAK1/JNK1 signaling cascade and caspase inhibition. Mol Cell Biol 22, 1754-1766.

Sasaki H, Sheng Y, Kotsuji F, Tsang BK (2000) Downregulation of X-linked inhibitor of apoptosis protein induces apoptosis in chemoresistant human ovarian cancer cells.

Cancer Res 60, 5659-5666.

Schlette EJ, Medeiros LJ, Goy A, Lai R, Rassidakis GZ (2004) Survivin expression predicts poorer prognosis in anaplastic large-cell lymphoma. J Clin Oncol 22, 1682-1688.

Shariat SF, Lotan Y, Saboorian H, Khoddami SM, Roehrborn CG, Slawin KM, Ashfaq R (2004) Survivin expression is associated with features of biologically aggressive prostate carcinoma. Cancer 100, 751-757.

Srinivasula SM, Datta P, Kobayashi M, Wu JW, Fujioka M, Hegde R, Zhang Z, Mukattash R, Fernandes-Alnemri T, Shi

Y, Jaynes JB, Alnemri ES (2002) Sickle, a novel Drosophila death gene in the reaper/hid/grim region, encodes an IAPinhibitory protein. Curr Biol 12, 125-130.

Stehlik C, de Martin R, Kumabashiri I, Schmid JA, Binder BR, Lipp J (1998) Nuclear factor (NF)-kappaB-regulated Xchromosome-linked iap gene expression protects endothelial cells from tumor necrosis factor alpha-induced apoptosis. J Exp Med 188, 211-216.

Stennicke HR, Salvesen GS (1998) Properties of the caspases.

Biochim Biophys Acta 1387, 17-31.

Sui L, Dong Y, Ohno M, Watanabe Y, Sugimoto K, Tokuda M (2002) Survivin expression and its correlation with cell proliferation and prognosis in epithelial ovarian tumors. Int J Oncol 21, 315-320.

Swana HS, Grossman D, Anthony JN, Weiss RM, Altieri DC (1999) Tumor content of the antiapoptosis molecule survivin and recurrence of bladder cancer. N Engl J Med 341, 452453.

Tamm I, Kornblau SM, Segall H, Krajewski S, Welsh K, Kitada S, Scudiero DA, Tudor G, Qui YH, Monks A, Andreeff M, Reed JC (2000) Expression and prognostic significance of IAP-family genes in human cancers and myeloid leukemias.

Clin Cancer Res 6, 1796-1803.

Tamm I, Wang Y, Sausville E, Scudiero DA, Vigna N, Oltersdorf T, Reed JC (1998) IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases, and anticancer drugs. Cancer Res 58, 5315-5320.

Tanaka K, Iwamoto S, Gon G, Nohara T, Iwamoto M, Tanigawa N (2000) Expression of survivin and its relationship to loss of apoptosis in breast carcinomas. Clin Cancer Res 6, 127134.

Tannock IF, de Wit R, Berry WR, Horti J, Pluzanska A, Chi KN, Oudard S, Theodore C, James ND, Turesson I, Rosenthal MA, Eisenberger MA (2004) Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer.

N Engl J Med 351, 1502-1512.

Taplin ME, Bubley GJ, Shuster TD, Frantz ME, Spooner AE, Ogata GK, Keer HN, Balk S P (1995) Mutation of the androgen-receptor gene in metastatic androgen-independent prostate cancer. N Engl J Med 332, 1393-1398.

Trivedi C, Redman B, Flaherty LE, Kucuk O, Du W, Heilbrun LK, Hussain M (2000) Weekly 1-hour infusion of paclitaxel.

Clinical feasibility and efficacy in patients with hormonerefractory prostate carcinoma. Cancer 89, 431-436.

Verhagen AM, Coulson EJ, Vaux DL (2001) Inhibitor of apoptosis proteins and their relatives: IAPs and other BIRPs. Genome Biol 2, 3009.

Wang CY, Mayo MW, Korneluk RG, Goeddel DV, Baldwin AS Jr (1998) NF-kappaB antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation. Science 281, 1680-1683.

Wright CW, Duckett CS (2005) Reawakening the cellular death program in neoplasia through the therapeutic blockade of IAP function. J Clin Invest 115, 2673-2678.

Yakes FM, Chinratanalab W, Ritter CA, King W, Seelig S, Arteaga CL (2002) Herceptin-induced inhibition of phosphatidylinositol-3 kinase and Akt is required for antibody-mediated effects on p27, cyclin D1, and antitumor action. Cancer Res 62, 4132-4141.

Yang Y, Fang S, Jensen JP, Weissman AM, Ashwell JD (2000) Ubiquitin protein ligase activity of IAPs and their degradation in proteasomes in response to apoptotic stimuli.

Science 288, 874-877.

Zhang M, Latham DE, Delaney MA, Chakravarti A (2005) Survivin mediates resistance to antiandrogen therapy in prostate cancer. Oncogene 24, 2474-2482.

111

Nomura et al: IAP as a new diagnostic and effective therapeutic target molecule for prostate cancer Zhivotovsky B, Joseph B, Orrenius S (1999) Tumor radiosensitivity and apoptosis. Exp Cell Res 248, 10-17.

Zhivotovsky B, Orrenius S (2003) Defects in the apoptotic machinery of cancer cells: role in drug resistance. Semi Cancer Biol 13, 125-134.

Takeo Nomura

112

Gene Therapy and Molecular Biology Vol 11, page 113 Gene Ther Mol Biol Vol 11, 113-116, 2007

Gene cloning of P43 surface protein of toxoplasma gondii tachyzoite and bradyzoite (SAG3) Research Article

Bahram Kazemi1,2,*, Leila Maghen3, Mojgan Bandehpour1,4, Saed Shahabi2, Ali Haghighi2 1

Cellular and Molecular Biology Research Center, Shaheed Beheshti Medical University, Tehran I.R. Iran.

Parasitology Department- Shaheed Beheshti Medical University, Tehran I.R. Iran.

3 Islamic Azad University of Iran, Science and Research Campus, Tehran I.R. Iran 4 National Research Center for Genetic Engineering and Biotechnology, Tehran I.R. Iran 2

__________________________________________________________________________________ *Correspondence: Bahram Kazemi, Cellular and Molecular Biology Research Center, Shaheed Beheshti Medical University, Tehran I.R. Iran; Telefax: 009821 22428432; Email: bahram14@gmail.com, kazemi@sbmu.ac.ir Key words: Toxoplasma, tachyzoite, bradyzoite, surface antigen, cloning Abbreviations: glycosyl phosphatydyl inositol, (GPI); low melting point, (LMP); P43 surface antigen, (SAG3) Received: 11 September 2006; Revised: 20 September 2006 Accepted: 18 December 2006; electronically published: June 2007

Summary Toxoplasma gondii is an obligate intracellular parasite which its sexual and asexual cycle respectively takes place in the intestinal epithelial of definitive host and tissue of intermediate hosts. Congenital toxoplasmosis is more important when the mother acquired the infection during pregnancy period for the first time. Having a specific antigen is an important element in prevention and detection of parasite. This study has designed and performed in the aim of cloning a specific toxoplasma antigen for further studies. We have amplified gene of P43 of toxoplasma tachyzoite and bradyzoite surface antigen. PCR product was cloned in pGEMEX1 expression vector (named pGEM43) and is ready to make the recombinant protein for using as antigen.

and bradyzoite have covered with antigens which is linked to GPI (glycosyl phosphatydyl inositol) (Nagel and Boothroyd 1989; Tomavo et al, 1989) that are known as SAG (surface antigens) (Boothroyd et al, 1998; Lekutis et al, 2000). Some of these specific molecules are specified stage of parasite life cycle: 30KD (SAG1), 22KDa (SAG2) and 35KDa (SRS3) proteins are only in the surface of tachyzoite and are not in the surface of bradyzoite, meanwhile some other proteins such as 43KD (SAG3) and 23KDa are in the surface of both tachyzoite and bradyzoite (Burg et al, 1988; Prince et al, 1990; Manger et al, 1998; Lekutis et al, 2001). More studies are done about the cloning and expression of genes of toxoplasma surface proteins (Burg et al, 1988; Prince et al, 1990; CesbronDelauw et al, 1994). The toxoplasma P43 have been cloned and sequenced first by Cesbron-Delauw and colleqagues in 1994 and additionaly by Fux and colleqagues in 2003. The aim of this study was cloning the gene of P43 surface antigen (SAG3) of toxoplasma tachyzoite and bradyzoite as a recombinant protein.

I. Introduction Toxoplasma gondii is an obligate intracellular parasite and its life cycle includes definitive and intermediate hosts. The sexual and asexual cycle of parasite respectively takes place in the intestinal epithelial of the cat (as definitive host) and any warm blooded, like mammals and birds (as intermediate hosts) (Frankel et al, 1970). Previous studies have showed that the main human infection can result by ingestion of material contaminated with infected cat feces, from eating raw or partially cooked beef and transplacental transmission from mother to children (Miller et al, 1972). Congenital toxoplasmosis is more important in the pregnant women who acquired the infection for the first one (Guerina 994)). Human infection takes place in two forms: acute infection and chronic infection. After beginning of the infection with initial immune response, tachyzoite (multiply fast) escape to different tissue via blood and lymph, then invert to bradyzoite (multiply slowly) inside tissue cyst (Hutchison 1970).

Recently, main attention has been attracting to surface molecules of parasite. The surface of tachyzoite

113

Kazemi et al: Gene cloning of P43 surface protein using dTTP by terminal deoxy nucleotidyl transferase (Gaastra and Klemm, 1984; Eun, 1996) and 3` A tailed PCR product was ligated to it (Gaastra and Hansen, 1984). The ligation reaction was transformed in Ecoli XLI-blue strain competent cells (Hanaham, 1983) and dispensed on LB agar plate containing 50 µg/ml ampicillin. Colonies were screened by X-gal and IPTG and white colonies containing recombinant plasmid were selected (Bothwell et al 1990).

Recombinant plasmid was digested by SacI and BamHI and released expected DNA band was recovered by DNA purification kit (Fermentas Cat. No k0513) and subcloned in SacI and BamHI digested pGEMEX 1 expression vector. Reaction was transformed and colonies contained recombinant plasmids were mass cultured on LB medium. Recombinant plasmids were extracted and confirmed by restriction analysis.

II. Materials and Methods A. Parasite Toxoplasma RH strain, kindly provided by Professor Dalimi Tarbiat Modarres University, Tehran, Iran and was maintained by twice-weekly passages of peritoneal fluid into mice. Toxoplasma tachyzoites were isolated from peritoneum puncture of infected mice and were rinsed by PBS buffer many times. Toxoplasma DNA was extracted as previously described (Zia-Ali, 2005).

B. PCR reaction We designed a set of primer for amplification of P43 gene with SacI and BamHI restriction sites at 5` end of forward and reverse primers respectively (Tox43 F 5`GAGCTCATATGCAGCTGT GGCGGC GC–3` and Tox43 R 5`-GGA TCCTTA GGCAGC CACATGCAC–3). PCR reaction contained 0.5 µg DNA, 40 pico mol each of forward and reverse primers, 1.5 mM MgCl2, 0.2 mM dNTPs, 1X PCR buffer, 1.5 unit of Taq DNA polymerase (CinnaGen, Iran) and dH2O up to 50 µL. PCR amplification was carried out with 30 cycles of denaturation at 94 °C for 40 seconds, annealing at 65°C for 60 seconds and extension at 72 °C for 60 seconds. PCR reaction was incubated at 94 °C and 72 °C for 5 min before and after the PCR cycling respectively (Pherson et al 2000).

III. Results Toxoplasma tachyzoites were isolated by peritoneum punction of infected mice and rinsed by PBS buffer. DNA was extracted and PCR reaction was carried out. Figure 1 shows 1158 bp as PCR product of toxoplasma P43 gene.

PCR product was ligated in pBluescript via T/A cloning method and recombinant plasmid digested with SacI and BamHI restriction enzyme, Figure 2 shows digested recombinant plasmid.

Digestion reaction was electrophoresed on LMP agars gel, released DNA band was purified by DNA purification kit and subcloned in SacI and BamHI digested pGEMEX1 expression vector and named pGEM43. PstI enzyme has a restriction site at position 748 on P43 sequense but pGEMEX1 don't cut by this enzyme. For confirmation of recombinant pGEM43 we digested recombinant plasmid by PstI and lineared plasmid is shown in Figure 3.

Gene was sequenced and deposited in GeneBank at accession no. EF445545

C. Electrophoresis PCR product was submitted to electrophoresis using 1% agarose gel and stained by ethidium bromide. The DNA band was visualized under ultraviolet light (UV transilluminator) (Boffey 1984).

D. Gene cloning PCR product was electrophoresed on 1% low melting point (LMP) agarose gel (Gaastra and Jorgensen, 1984) and DNA band was sliced under long wave UV and recovered by DNA purification kit (Fermentas, Cat. No k0513). Recovered DNA was cloned in pBluescript cloning vector via T/A cloning method. Briefly, EcoRV blunt digested pBluescript was 3` tailed

Figure 1.

1% agarose gel electrophoresis. Lane 1: 1158 bp as PCR product of P43. Lane 2: 100 bp DNA ladder marker.

Figure 2.

1% agarose gel electrophoresis. Lane 1: 100 bp DNA ladder marker. Lane 2: Digested recombinant plasmid by SacI and BamHI restriction enzymes.

114

Figure 3.

Confirmation of recombinant plasmid.

Lane 1: Recombinant plasmid (digested by PstI). Lane 2: No recombinant plasmid (not digested by PstI).

Gene Therapy and Molecular Biology Vol 11, page 115 Dunn D, Wallon M, Peyron F, Petersen E, Peckham C, Gilbert R (1999) Mother-to-child transmission of toxoplasmosis: risk estimates for clinical counselling. Lancet 353, 1829-33.

Dzierszinski F, Mortuaire M, Cesbron-Delauw MF, Tomavo S (2000) Targeted disruption of the glycosylphosphatidylinositol-anchored surface antigen SAG3 gene in Toxoplasma gondii decreases host cell adhesion and drastically reduces virulence in mice. Mol Microbiology 37, 574-582.

Eun HM (1996) Enzymology primer for Recombinant DNA Technology. Academic Press. Chapter 6 DNA polymerases pp 345-489.

Frankel JK, Dubey JP, Miller NL (1970) Toxoplasma gondii in cats: fecal stages identified as coccidian oocyst. Science 167, 893-6.

Freeman K, Oakley L, Pollak A, Buffolano W, Petersen E, Semprini AE, Salt A, Gilbert R; European Multicentre Study on Congenital Toxoplasmosis (2005) Association between congenital toxoplasmosis and preterm birth, low birthweight and small for gestational age birth. BJOG 112, 31-7.

Fux B, Rodrigues CV, Portela RW, Silva NM, Su C, Sibley D, Vitor RW, Gazzinelli RT (2003) Role of cytokines and major histocompatibility complex restriction in mouse resistance to infection with a natural recombinant strain (type I-III) of Toxoplasma gondii. Infect Immun 71, 6392-401.

Gaastra W, Hansen K (1984) Ligation of DNA with T4 DNA ligase. In methods in Molecular Biology vol 2 Nucleic Acids.

Edited by John M.Walker; Chapter 32: pp 225-230.

Gaastra W, Jorgensen PL (1984) The extraction and isolation of DNA from gels. in methods in Molecular Biology vol 2 Nucleic Acids. Edited by John M.Walker.Chapter 10 pp 6776.

Gaastra W, Klemm P (1984) Radiolabeling of DNA with 3` terminal transferase. in methods in Molecular Biology vol 2 Nucleic Acids. Edited by John M.Walker.Chapter 40 pp 269271.

Guerina NG (1994) Congenital infection with Toxoplasma gondii. Pediatric Ann 23, 138-142,147-151.

Hanaham D (1983) Studies on transformation on E.coli with plasmids. J Mol Biol 98, 503-517.

Hutchison WM, Dunachie JF, Siim JC, Work K (1970) Coccidian like nature of Toxoplasma gondii. Br Med J 1, 142-4.

Jacque A, Coulon L, Nève JD, Daminet V, Haumont M, Garcia L, Bollen A, Jurado M, Biemans R (2001) The surface antigen SAG3 mediates the attachment of Toxoplasma gondii to cell-surface proteoglycans. Mol Biochem Parasitol 116, 35-44.

Lekutis C, Ferguson DJP, Boothroyd JC (2000) Identification of developmentally regulated family of gene related to SAG2.

Exp Parasitol 96, 89-96.

Lekutis C, Ferguson DJP, Grigg ME, Camps M, Boothroyd JC (2001) Surface antigen of Toxoplasma gondii : variation of a theme. Int J Parasitol 31, 1285-92.

Manger ID, Hehl AB, Boothroyd JC (1998) The surface of Toxoplasma tachyzoites is dominated by a family of glycosyl phosphatidyl inositol-anchored antigen related to SAG1 dominates the surface of toxoplasma tachyzoites. Infect Immunol 66, 2237-44.

Miller NL, Frenkel JK, Dubey JP (1972) Oral infections with Toxoplasma gondii cyst and oocyst in felines, other mammals and in birds. J Parasitol 58, 928-37.

Nagel SD, Boothroyd JC (1989) The major surface antigen, P30, of Toxoplasma gondii is anchored by glycolipid. J Biol Chem 264, 5569-74.

McPherson MJ, Moller SG (2000) PCR. The Basics from Background to Bench. Bios Scientific publishers. Chapter 2; Undrestanding PCR.,pp: 9-21.

IV. Discussion Toxoplasma gondii is an obligatory intracellular parasite which has complicated life cycle. Sexual and asexual cycle respectively takes place in intestinal epithelial cells of cat and tissues of mammals and birds (Frankel et al, 1970). This parasite almost attacks to all host nucleated cells (Sibley, 1995). Toxoplasma gondii leads to dangerous manifestation in fetus. The most dangerous effect of congenital toxoplasmosis some times is abortion and premature delivery (Dunn, 1999; Freeman, 2005).

The congenital infection according to the intensity and variety of the organs contamination has different symptoms. Difference in the intensity of the disease depends on the stage of the pregnancy period which the infection occurs (Zhao 1992; Wallon et al, 2002). This parasite will be detected in human beings by serological tests only, and specific antigen is very essential in diagnosis system. P43 (SAG3) is one member of the redundant system of T. gondii receptors that act as ligands mediating host cell recognition and involved in the parasite attachment to target cells (Jacque 2001, Dzierszinski, 2000). In this study for availability of parasite stage specific antigen, the gene of p43, the tachyzoite and bradyzoite surface antigen was cloned and became ready to make recombinant proteins. It can be used as antigen for detection or prevention of parasite in men.

V. Conclusion In this study, the gene of P43 toxoplasma tachyzoite and bradyzoite surface antigen was cloned in expression vector and confirmed. It can be used for either diagnosis or prevention of parasite in men.

Acknowledgement This study has supported by the Iranian Biotechnology Network and was performed in Cellular and Molecular Biology Research Center of the Shaheed Beheshti Medical University. By this way the authors of this article thanks directors.

References Boffey SA (1984) Agarose gel electrophoresis of DNA. In methods in Molecular Biology vol 2 Nucleic Acids. Edited

by John M.Walker; Chapter 32: pp 43-50.

Boothroyd JC, Hehl A, Knoll LJ, Manger ID (1998) The surface of Toxoplasma gondii: more and lees. Int J Parasitol 28, 39.

Bothwell AL, Yancopulos GD, Alt FW (1990) Methods for cloning and analysis of eukaryotic genes. Jones and Bartlett Publishers; section 10: pp 247-260.

Burg JL, Perelman D, Kasper LH, Ware PL, Boothroyd JC (1988) Molecular analysis for gene encoding the major surface antigens of Toxoplasma gondii. J Immunol 141, 3584-91.

Cesbron-Delauw MF, Tomavo S, Beauchamps P, Fourmaux MP, Camus D, Capron A, Dubermetz JF (1994) Similarities between the primary structures of two distinct major surface protein of Toxoplasma gondii. J Biol Chem 269, 1621716222.

115

Kazemi et al: Gene cloning of P43 surface protein Prince JB, Auver KL, Huskinson J, Parmely SF, Araujo FG, Remington JS (1990) Cloning, expression and cDNA sequence of surface antigen P22 from Toxoplasma gondii.

Mol Biochem Parasitol 43, 97-106.

Sibley LD (1995) Invasion of vertebrate cells by Toxoplasma gondii. Trend Cell Biol 5, 129-132.

Tomavo S, Schwartz RT, Dubermetz JF (1989) Evidence for glycosyl phosphatidyl inositol anchoring of Toxoplasma gondii major surface antigens. Mol Cell Biol 9, 4576-80.

Wallon M, Gaucherand P, Al Kurdi M, Peyron F (2002) Toxoplasma infections in early pregnancy: consequences and management. J Gynecol Obstet Biol Reprod 31, 478-84.

Zhao Z (1992) A prospective study on the relationship between abnormal pregnant outcome and Toxoplasma gondii infection. Zhonghua Liu Xing Bing Xue Za Zhi 13, 154-7.

Zia-Ali N, Keshavarz-Valian H, Rezaian M, Khorramizadeh MR, Kazemi B, Fazaeli A, Darde M (2005) Molecular Characterization of Toxoplasma gondii from BirdHosts.

Iranian J Publ Health 34, 27-30.

116

Gene Therapy and Molecular Biology Vol 11, page 117 Gene Ther Mol Biol Vol 11, 117-132, 2007

Developing and applying a drug delivery model for liposomal and dendritic multifunctional nanoparticles Review Article

Constantinos M. Paleos*, Dimitris Tsiourvas, Zili Sideratou Institute of Physical Chemistry, NCRC â&#x20AC;&#x153;Demokritos, 15310 Aghia Paraskevi, Attiki, Greece

__________________________________________________________________________________ *Correspondence: Constantinos M. Paleos, Institute of Physical Chemistry, NCSR "Demokritos"; 15310 Aghia Paraskevi, Attiki, Greece; Tel.: +30 210 6503666; Fax: +30 210 6529792; e-mail: paleos@chem.demokritos.gr Key words: Drug Delivery Systems, Liposomes, Dendrimers, Hyperbranched Polymers Abbreviations: Adriamycin, (ADR); barbituric acid, (BAR); betamethasone dipropionate, (BD); betamethasone valerate, (BV); cholesterol, (CHOL); diaminobutane poly(propylene imine) dendrimer, (DAB); 5,5-didodecylbarbituric acid, (DBA); 1-(4(dihexadecylcarbamoyl)butyl)guanidinium p-toluenesulfonate, (DBG); di-n-hexadecylphosphate, (DHP); N-[3(dioctadecylamino)propyl] guanidine hydrochloride, (DOPG); doxorubicin, (DXR); dynamic light scattering, (DLS); giant unilamellar vesicles, (GUV); 9-hexadecyladenine, (HA); hyperbranched polyglycerol, (PG); Isothermal Titration Microcalorimetry, (ITC); large unilamellar vesicles, (LUV); monomethyl ether polyethylene glycol, (M-PEG); N-[3-(octadecylamino)propyl] guanidine hydrochloride, (ODPG); octadecylguanidine hydrochloride, (ODG); phosphatidylcholine, (PC); poly(amidoamine) dendrimer, (PAMAM); poly(propylene imine) dendrimers of the fourth generation functionalized with n guanidinium groups, (DAB-Gn); polyethylene glycol, (PEG); tamoxiphen, (TMX); 2,4,6 triaminopyrimidine, (TAP) Received: 8 November 2006; Revised: 8 June 2007 Accepted: 11 June 2007; electronically published: June 2007

Summary This account deals with a strategy for designing multifunctional liposomes and dendritic polymers. Such nanoparticles, although quite different in size and structure, both fulfill properties that drug carriers should exhibit, i.e. specificity or targeting ability, extended time of circulation in biological fluids and ability to be transported through cell membranes. Furthermore, having developed these multifunctional liposomal and dendritic carriers, a drug delivery model is presented that employs instead of cells multilamellar liposomes, which interact with the above mentioned multifunctional carriers. This interaction should primitively mimic the processes which occur in living cells when they interact with loaded or unloaded liposomal and dendritic nanoparticles.

Multifunctionality and multivalency coupled with molecular recognition between the interacting pairs render the loaded nanoparticles effective drug delivery vehicles.

phagocytosis and prolong their circulation in biological fluids. The latter property is almost exclusively achieved by coating the surface of the carriers with polyethyleneglycol (PEG) chains applying the well-known strategy of PEGylation (Allen, 1994; Lasic and Needham, 1995; Needham and Kim, 2000; Liu et al, 2000; Gabizon et al, 2003). Another crucial parameter of effective drug delivery systems is their transport through cell membranes, which can be achieved by the introduction of translocating agents on the surface of the nanocarriers. The application of cell penetrating peptides (Prochiantz, 2000; Futaki et al, 2003; Wright et al, 2003; Gorodetsky et al 2004; Futaki, 2005a; Kim, 2006; Maeda and Fujimoto, 2006) and specifically of arginine-rich derivatives which have been extensively studied and found to exhibit enhanced membrane translocation ability, can be

I. Introduction A significant number of bioactive molecules fail to be commercialized as drugs due to lack of tissue specificity, blood solubility, metabolic stability or bioavailability. In order to address these issues effective drug delivery systems, including liposomes and dendritic polymers (comprising of dendrimers and hyperbranched polymers) are being developed.

Liposomal and dendritic nanoparticles although quite different in size, structural features and consequently in loading properties, both are susceptible to surface functionalization by analogous strategies. In this manner, nanoparticles sharing common functional groups can be obtained. In fact, liposomes and dendritic polymers have been developed bearing ligands which target to cell receptors or protective groups that prevent their 117

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles employed as the basis for preparing efficient molecular transporting liposomal and dendritic nanoparticles. Hence, by employing oligo- and poly- arginine derivatives the overall molecular transporting process is facilitated; this is attributed to the presence of the guanidinium moiety which interacts with the phosphate and carboxylate groups of the cells surface (Vivès et al, 1997; Wender et al, 2000; Futaki et al, 2001, 2005b; Kirschberg et al, 2003;).

The strategy for the preparation of typical multifunctional liposomes and dendritic polymers is described in this account. These nanoparticles, Figure 1, differing in size and structural features in principle fulfill the above mentioned properties for drug carriers, i.e. specificity or targeting ability, long circulation in biological fluids and transport properties through cell membranes. Furthermore having developed these multifunctional liposomal and dendritic carriers, a drug delivery model is presented employing, instead of cells, multilamellar liposomes. The latter primitively mimic the processes involved in biological cells during their interaction with loaded or unloaded liposomal and dendritic nanoparticles.

functional groups. Recently, a step-wise strategy was adopted for the preparation of multifunctional liposomes as will be briefly discussed below. Complementary liposomes interact mimicking in a way the recognition of cells with liposomes.

Molecular engineering of liposomal surfaces, by the introduction of functional groups having the ability to form hydrogen bonds with complementary moieties introduced to other liposomes, leads to the formation of large aggregates when this pair of liposomes is allowed to interact. During this interaction the following processes take place (Cerv and Richardsen, 1999): a. Adhesion during which the liposomes are simply conjoined but retain separate inner compartments and b. Fusion during which the liposomes merge sharing a common inner compartment. In this second process a sequence of events occurs, giving rise to the mixing of the aqueous content of liposomes with or without leakage or rupturing of the fused vesicles.

With regard to the mechanism of membrane fusion, two processes have been investigated, i.e. the conventional one involving non-lamellar fusion and that of restructuring and ultimately merging of the membrane on a less ordered basis. It has been supported that both mechanisms are energetically favoured at least for small-scale fusion.

However, it has to be noted that small liposomes, i.e. with diameters of about 45nm comprising of less than 10000 molecules, do not have the sufficient number of amphiphiles to form a non-lamellar phase without disintegrating; these liposomes are however known to fuse extensively, apparently through membrane restructuring (Cerv and Richardsen, 1999). Taking into account the above mentioned associative mechanisms, processes such as the exchange of amphiphiles or the effect of liposomal size on the efficiency of interaction should also play an important role in the binding of liposomes. Bearing these considerations in mind and with the understanding that fusion of phospholipids liposomes has been used as a model for simulating biological membrane fusion, the cited examples on liposomal interactions will be discussed.

II. Interaction between complementary liposomes Conventional liposomes have long been employed as drug delivery systems for a diversity of polar and lipophilic bioactive compounds (Gregoriadis, 1995; Barenholz, 2001; Guo and Szoka, 2003). These liposomes, however, are in general unstable in biological media and do not exhibit specificity for certain cell types. These issues were satisfactorily addressed through appropriate functionalization of the liposome surface achieved by a selective choice of the lipids. Specifically, the preparation of these functional liposomes was realized by using the socalled bottom-up strategy in which functional surfactants are used as building blocks for their bilayer formation. The development of multifunctional liposomal nanoparticles should be the ultimate objective for obtaining highly effective drug delivery systems. In fact, in the early stage of these investigations, mono-functional liposomes were prepared which were not bearing all the required

Figure 1. Schematic representation of a multifunctional liposome (left) and dendrimer (right).

118

Gene Therapy and Molecular Biology Vol 11, page 119 As previously mentioned, the functionalization of the external surface of liposomes was achieved through the preparation of mixed liposomes. In this manner, the functional moieties on the external surface, originate from the amphiphilic components, which were incorporated into these liposomes. It is thus possible to monitor the reactivity of liposomes by changing the type and concentration of the incorporated recognizable lipid. In this context, early work (Paleos et al, 1996; MarchiArtzner et al, 1997) triggered the interest in investigating molecular recognition between complementary liposomes.

In the following years Lehn et al (Marchi-Artzner et al, 2001) further investigating their previously employed complementary pair, established the supramolecular chemistry of interacting liposomes. This pair of liposomes consisted basically of egg phosphatidylcholine also containing amphiphilic derivatives of barbituric acid (BAR) or triaminopyrimidine (TAP) (Figure 2), each up to 10% molar ratio. The recognition of the complementary moieties was facilitated by the insertion of a suitable spacer in between the recognizable and polar groups. The main conclusions of this study are summarized below: a. Rapid and selective aggregation (in less than 30 s) occurs between the complementary liposomes, followed by lipid exchange (within 30 min after mixing). The lipid exchange, which takes place when the membranes are in contact, results either in fusion or, if fusion does not occur, to a redispersion of the liposomes within 17 hours. b. The aggregation process of the system under investigation can be weakened by decreasing the ionic strength, through the addition of a soluble barbituric competitor or by decreasing the concentration of the recognizable amphiphiles. The effect of ionic strength underlines the basic role of electrostatic interaction in the initial aggregation step. On the other hand, the effect of the recognizable amphiphiles supports the view according to which the recognizable system stabilizes the adhesion state. c. The fusion process was observed by electron microscopy and remained at a low level not resulting in an intermixing of the aqueous pools of the liposomes to a significant degree. It seems that fusion resulted from the collapse of mixed triaminopyridine/barbituric acid liposomes with neighbouring liposomes.

d. The size of the liposomes has a crucial effect on the recognition phenomena. Thus aggregation was not observed when giant liposomes were encountered. The interaction between recognizable groups is not sufficiently strong to establish a stable contact between giant liposomes. A rapid adhesion however occurs between complementary large and giant unilamellar liposomes.

Continuing the investigation on the reactivity of complementary liposomes (Sideratou et al, 2000), unilamellar liposomes of about 100 nm diameter were prepared consisting basically of phosphatidylcholine (PC), and cholesterol (CHOL). For accomplishing molecular recognition of these liposomes, one part of them incorporated di-n-hexadecylphosphate (DHP), while the other part 1-(4-(dihexadecylcarbamoyl)butyl)guanidinium p-toluenesulfonate (DBG) as recognizable lipids (Figure 3). Cholesterol was incorporated in the liposomal membrane at various concentrations starting from 10% and up to 50% molar with respect to PC simulating in this way cell membrane composition. The so-prepared complementary liposomes were allowed to interact at ambient temperature. The complementary guanidinium and phosphate groups, located on liposomal surfaces, interact strongly due to electrostatic and hydrogenbonding forces promoting, by their combined action, noncovalent bonding (Onda et al, 1996) between these liposomes (Figure 3). This strong interaction between DHP and DBG lipids allowed experiments to be performed at low molar ratios of these lipids relative to PC (molar ratio PC/DGB and PC/DHP=19:1). Due to molecular recognition of these liposomes, interaction did occur and large aggregates were obtained which were large enough to be observed even by optical microscopy.

As concluded from their dimensions, fusion follows initial adhesion leading to large multicompartment aggregates, which in certain cases encapsulate smaller ones.

These structures, shown in Figure 4, exhibit a form of compartmentalization, which represents a simplistic analogue of subcellular compartments. The formation of these multicompartment systems was recently presented elsewhere (Paleos and Tsiourvas, 2006) and it is further discussed below.

Figure 2. Chemical structures of amphiphilic derivatives of barbituric acid (BAR) and triaminopyrimidine (TAP).

119

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles

Figure 3. Chemical structures of di-n-hexadecylphosphate (DHP) and 1-(4-(dihexadecylcarbamoyl)butyl) guanidinium ptoluenesulfonate (DBG) and the interaction scheme between the complementary phosphate and guanidinium groups.

Figure 4. Multicompartment aggregates obtained following molecular recognition of complementary liposomes incorporating DHP and DBG. The bar in the lower left corner indicates 5!m.

A significant, yet unexpected, outcome of this work (Sideratou et al, 2000) is that the cholesterol incorporated in these liposomes appreciably enhances their molecular recognition effectiveness. The molecular recognition enhancement, which was observed at cholesterol concentrations ranging from 10% to 50% molar with respect to phosphatidylcholine, was attributed to the structural features of lipid-cholesterol bilayers. This finding was explained on the basis of effect of cholesterol on the molecular ordering in the lipid bilayer according to a widely accepted phase diagram (Ipsen et al, 1987; Mouritsen and Jørgensen, 1992, 1994; Thewalt and Bloom, 1992; Trandum et al, 2000). According to this diagram, within the experimental temperature range in which these experiments were performed and at cholesterol concentrations higher than 25% molar with respect to PC, the liquidâ&#x20AC;&#x201C;ordered phase is formed. The fact that this phase is fluid, from the viewpoint of lateral disorder and diffusion, is significant for the molecular

mobility of the recognizable molecules. On the other hand, since the recognizable lipids are incorporated at a low molar ratio (1:19), their presence does not appreciably perturb the molecular organization of the PC-CHOL bilayer and therefore, the interacting moieties encounter the previously mentioned organized environment allowing their mobility. Apparently, molecular organization combined with fluid lateral mobility of the recognizable lipids in the liquidâ&#x20AC;&#x201C;ordered phase, results in a more enhanced association of the liposomes.

The role of encapsulated cholesterol in liposomal membrane, for enhancing liposomal association, as observed by microscopic and light scattering studies, was further established (Sideratou et al, 2000) by isothermal microcalorimetry. The heat released by the interaction of the complementary liposomes was maximum for the system [PC:CHOL:DBG]/[PC:CHOL:DHP] and negligible for all the control experiments. Thus, the binding enthalpy was found to be 1.113 kJ mol-1, when 120

Gene Therapy and Molecular Biology Vol 11, page 121 cholesterol (50%) was present and 0.576 kJ mol-1 in its absence, i.e. in the control experiment. The role of cholesterol in liposomal recognition is also evident from the reaction rates, which were determined by Isothermal Titration Microcalorimetry (ITC) experiments. Assuming single-exponential kinetics, the reaction rates (k) become approximately 4 times faster in the presence of cholesterol.

It is therefore evident that cholesterol should be incorporated in liposomes for both stabilizing their membrane and also for enhancing their association ability.

Based on the above findings on the role of cholesterol in liposomal membrane an analogous system was prepared (Sideratou et al, 2002a), in which the recognizable amphiphiles 5,5-didodecylbarbituric acid (DBA) and 9-hexadecyladenine (HA) (Figure 5) were incorporated in liposomes based on hydrogenated phosphatidylcholine and cholesterol in a PC:CHOL 2:1 molar ratio. Hydrogen-bonding interactions between these complementary lipid moieties (Figure 5) were relatively weak, and therefore the recognizable lipids were incorporated at a high molar content relative to PC (i.e.

Recognizable Lipid:PC 1:4). In this manner, relatively strong binding between the liposomes was obtained and accurate determination of the thermodynamic parameters was achieved. Molecular recognition of liposomes becomes most effective at 1:1 molar ratio of the recognizable molecules. Following mixing of the complementary liposomes multicompartment aggregates were obtained, which have structural analogies to the ones previously observed. These aggregates were apparently obtained following fusion of the initially adhering

liposomes under non-leaking conditions. Investigation of molecular recognition between this pair of liposomes was also investigated by ITC and one-to-one binding between the adenine and barbituric acid moieties in the lipid/water/lipid interface was observed (Sideratou et al, 2002a). The effect of cholesterol on the mechanism of binding between DBA and HA at the lipid-water interface was found to be in concord with a previous study (Sideratou et al, 2000). Thus, in analogy with the previous experiment, the presence of cholesterol rendered the binding process faster, at least at low DBA/HA molar ratios.

In recent studies on liposomal interactions (Pantos et al, 2002, 2004) the inhibitory role of the protective polyethylene glycol (PEG) coating on molecular recognition was investigated. In this sense, liposomes consisting of hydrogenated PC and cholesterol were prepared, incorporating recognizable moieties on their surface. One type of liposomes incorporated DHP, whereas their complementary liposomes contained either octadecylguanidine hydrochloride (ODG), or N-[3(octadecylamino)propyl] guanidine hydrochloride (ODPG), or N-[3-(dioctadecylamino)propyl] guanidine hydrochloride (DOPG) (Figure 6). With the application of the two latter guanidinylated lipids, the role of the propylene spacer on the recognition effectiveness of liposomes was evaluated. Due to this spacer, the guanidinium group protrudes from the liposomal interface and therefore its probability of interaction with the complementary phosphate group is enhanced.

Figure 5. Chemical structures of 5,5-didodecylbarbituric acid (DBA) and 9-hexadecyladenine (HA) and the interaction scheme between the complementary barbituric and adenine groups.

121

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles

Figure 6. Chemical structures of octadecylguanidine hydrochloride (ODG), N-[3-(octadecylamino)propyl] guanidine hydrochloride (ODPG) and N-[3-(dioctadecylamino)propyl] guanidine hydrochloride (DOPG).

PEG coating of molecular weight 5000 was introduced to the interface of liposomes through the incorporation of varying amounts of PEGylated cholesterol in the liposomal membrane. This is a convenient method of attaching PEG to the liposomal surface since the end of the polymer chain bearing the cholesterol moiety is effectively anchored inside the liposomal membrane. One of the highlights of this study is that molecular recognition of the complementary liposomes leads to the formation of either large aggregates, which precipitate, or to fused multicompartment aggregates, as measured by dynamic light scattering (DLS) and observed by phase-contrast microscopy (Figure 7). The results obtained by the two methods were in good agreement. The size increase during

the interaction of PC:CHOL:DOPG with PC:CHOL:DHP liposomes in water is shown in Figure 8.

Fusion of complementary liposomes takes place under a non-leaking process involving lipid mixing as it was established by calcein entrapment and Resonance Energy Transfer experiments (Pantos et al, 2004). The thermodynamic parameters indicate the processes of aggregation and fusion. The interactions of non-PEGylated liposomes consistently involve exothermic processes of much higher enthalpy compared to the PEGylated counterparts.

Thus, for the pairs [PC:CHOL:ODPG]/[PC:CHOL:DHP] and [PC:CHOL:ODG]/[PC:CHOL:DHP], the !" values are –5.7 and –3.0 Kcal/mol respectively, while for the PEGylated liposomes (5% PEG relative to cholesterol) the !" values are –3.8 and –1.1 Kcal/mol respectively.

Figure 7.

Multicompartment aggregates obtained following molecular recognition of complementary liposomes incorporating DHP and ODPG. The bar in the lower left corner indicates 5!m.

122

Gene Therapy and Molecular Biology Vol 11, page 123

Figure 9. Phase contrast optical microscopy images of liposomal aggregates obtained following the mixing of multilamellar PC:CHOL:DHP liposomes with complementary unilamellar PC:CHOL:ODPG liposomes. The bar in the lower right corner indicates 5 !m.

Figure 8. Particle size distribution of unilamellar PC:CHOL:DOPG liposomes (dotted line) and of the resulting aggregates following their interaction with unilamellar PC:CHOL:DHP liposomes (PEGylated or not) in water.

Reproduced from Paleos and Tsiourvas, 2006 with kind permission from Wiley-VCH.

On the basis of the results obtained from liposomeliposome interactions, a model for the interaction of drugloaded liposomes with cells was constructed. This was simulated by the interaction of drug-loaded unilamellar liposomes with multilamellar liposomes in which the latter play the role of cells (Paleos et al, 2001). In these experiments the same lipids, as in previous work (Pantos et al, 2004) were used. The interaction of unilamellar with multilamellar liposomes was investigated by optical microscopy, DLS, #-potential, high-precision differential scanning calorimetry, and ITC experiments (Pantos et al, 2005a). Multicompartment systems were observed by means of optical microscopy as shown in Figure 9, consistent, in size with that determined by DLS experiments, Figure 10. This further supports the hypothesis that molecular recognition induces multicompartment system formation. The aggregates observed are analogous to the ones obtained when unilamellar recognizable liposomes were allowed to interact as previously discussed.

Figure 10. Particle size distribution of PEGylated (upper part) and non-PEGylated (lower part) unilamellar (dotted line) PC:CHOL:ODPG liposomes and of the resulting aggregates (solid line) following interaction with PC:CHOL:DHP multilamellar liposomes (dashed-dotted line) at a 2:1 DHP:ODPG molar ratio. Reproduced from Paleos and Tsiourvas, 2006 with kind permission from Wiley-VCH.

123

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles By a closer examination of multicompartment system formation, as an outcome of molecular recognition between liposomes, the following mechanism may be envisaged: Fusion between liposomes is facilitated by their recognizable functional groups affording liposomes of various sizes (interaction steps A and B in Figure 11), which are in general characterized as large unilamellar vesicles (LUV) and giant unilamellar vesicles (GUV).

According to Lehn et al, (Marchi-Artzner et al, 2001) who employed a similar complementary pair of liposomes, adhesion leading to fusion does not take place between giant liposomes, while a selective LUV-GUV adhesion can take place leading to fusion (interaction step C in Figure 11). This last step can rationalize the formation of multicompartment systems, during which large liposomes are recognized, engulfed and internalised by giant liposomes, in a fashion analogous to endocytosis.

Aggregates, analogous to the ones presented in this review, were obtained while a mechanism of membrane fusion was proposed elsewhere (Tanaka and Yamazaki, 2004) explaining the incorporation of smaller liposomes into the larger ones.

Coming to the issue of simulating the interaction of cells with liposomes loaded with drugs, unilamellar liposomes were loaded either with the hydrophilic drug doxorubicin (DXR) or with the hydrophobic drug tamoxiphen (TMX) (Figure 12) and allowed to interact with multilamellar liposomes (Pantos et al, 2005a). It should be noted that all the experiments were carried out in phosphate buffer saline (PBS) in order to approximate physiological conditions. The interaction of the complementary non-PEGylated unilamellar liposomes loaded with DXR or TMX with multilamellar liposomes, at 1:2 molar ratio with respect to PC, occurred spontaneously. Large aggregate precipitates were obtained as imaged by phase contrast optical microscopy. A few giant fused liposomes were also observed which, in some cases, encapsulated smaller aggregates. When PEGylated unilamellar liposomes were used, precipitation was reduced while the occurrence of fused species was increased.

Figure 11. Schematic diagram of multicompartment aggregates formation steps by the interaction of complementary liposomes.

Reproduced from Paleos and Tsiourvas, 2006 with kind permission from Wiley-VCH.

Figure 12. Chemical structure of the drugs doxorubicin, ADR, methotrexate, MTX, betamethasone valerate, BV, and betamethasone dipropionate, BD.

124

Gene Therapy and Molecular Biology Vol 11, page 125 The results of the DXR transport from drug loaded unilamellar liposomes to the ‘empty’ complementary multilamellar liposomes during their interaction are summarized in Table 1. The control experiments demonstrate a rather minor drug transport, not higher than 17%, in the case of simple, PEGylated or non-PEGylated, unilamellar liposomes. In contrast, when PEGylated or non-PEGylated unilamellar liposomes bearing the recognizable ODPG lipid were used, drug transfer increased by a factor of 4 and 4.5 respectively compared to the control experiments, i.e, liposomes without any recognizable moieties on their surface. This was attributed to the formation of aggregates or giant liposomes as a result of molecular recognition between the complementary moieties of the unilamellar and multilamellar liposomes. The observed variation between the PEGylated and non-PEGylated unilamellar liposomes can be attributed to the presence of polymer chains at the external liposomal surface hindering adhesion as also previously established in the case of unilamellar interacting liposomes (Pantos et al, 2002, 2004).

Drug transport experiments were also performed with the TMX loaded unilamellar liposomes, demonstrating analogous results as summarized in Table 1. In this case drug transport is even higher, by 85% and 90 %, when PEGylated and non-PEGylated unilamellar liposomes incorporating ODPG were used respectively. In contrast, control experiments clearly show that drug transfer for unilamellar liposomes non-incorporating ODPG is insignificant, i.e. less than 2%.

The observed differences in the transport efficacy of TMX and DXR, can be attributed to their different mode of incorporation into the unilamellar liposomes.

Specifically, the hydrophilic DXR is encapsulated into the liposomal aqueous core while the hydrophobic TMX is incorporated into the liposomal bilayer. In control experiments DXR transfer is not negligible, in contrast to TMX. This is attributed to its higher water solubility and diffusion through the aqueous phase to the multilamellar liposomes. Nevertheless, during interaction of the complementary liposomes drug transfer of DXR into the multilamellar liposomes is less than that of TMX due to its release and solubilization in the aqueous phase.

Conversely since TMX is solubilized in the bilayer, its transport does not involve leakage or diffusion through the aqueous medium, and therefore it is higher than DXR in the case of complementary liposomes and insignificant in the case of non-functionalized ones.

III. Interaction of functional dendritic polymers with complementary liposomes Dendrimers (Bosman et al, 1999; Schlüter and Rabe, 2000; Fréchet and Tomalia, 2001; Newkome et al, 2001; Jiang and Aida, 2005; Tomalia, 2005) are nanoscale, highly branched and monodispersed macromolecules with symmetrical architecture. They consist of a central core, branching units and terminal functional groups. The core and the internal units determine the nanocavity environment and consequently the dendrimer solubilizing or encapsulating properties, whereas, the external groups influence their solubility and chemical behaviour. On the other hand, hyperbranched polymers (Inoue, 2000; Muscat and van Benthem, 2001; Voit, 2003), including the extensively studied hyperbranched polyether polyols or polyglycerols (Sunder et al, 1999a,b, 2000a,b; Haag, 2001; Frey and Haag, 2002; Siegers et al, 2004) are readily prepared but are non-symmetrical, highly branched and polydispersed. Their main structural feature, also common to dendrimers, is the formation of nanocavities able to encapsulate bioactive molecules, among others.

In this context, commercially available or custommade dendrimeric or hyperbranched polymers have been functionalized (Vögtle et al, 2000) for their application as effective drug delivery systems (Liu and Fréchet, 1999; Sideratou et al, 2001; Stiriba et al, 2002; Beezer et al, 2003; Kolhe et al, 2003; Ambade et al, 2005; D' Emanuele and Attwood, 2005; Gillies and Fréchet, 2005; Lim and Simanek, 2005; Dhanikula and Hildgen, 2006; Tziveleka et al, 2006; Paleos et al, 2007) or gene vectors (Bielinska et al, 1999; Luo et al, 2002; Ohsaki et al, 2002; Dufès et al, 2005; Lee et al, 2005; Svenson and Tomalia, 2005; Liu and Reineke, 2006; Tziveleka et al, 2007). When more than one type of groups is introduced to the surface of dendritic polymers, these systems are characterized as multifunctional as shown in Figure 1. Each group serves a specific function when these multifunctional dendritic polymers are employed as drug delivery systems. Thus, specificity for certain cell types can be accomplished by attaching targeting ligands to the surface of dendritic polymers, while enhanced solubility, decreased toxicity, biocompatibity, stability and protection from degradation in the biological milieu can be achieved by the functionalization of the end groups of dendritic polymers, e.g. with poly(ethylene glycol) chains (PEG).

Table 1. Drug transport from the unilamellar to the multilamellar liposomes. Reproduced from Pantos et al, 2005a with kind permission from American Chemical Society.

Composition of

DXR

!"#

unilamellar liposomes

% transfer

% transfer

PC-CHOL

17.1±2.9

<2

PC-CHOL-PEG

12.5±3.4

<1

PC-CHOL-ODPG

70.5±3.9

94.9±3.1

PC-CHOL-ODPG-PEG

60.9±2.3

82.5±3.9

125

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles The function of PEG-chains is crucial for modifying the behaviour of drug themselves or their carriers (NopplSimson and Needham, 1996; Ishiwata et al, 1997; Liu et al, 1999, 2000; Veronese, 2001; Roberts et al, 2002; Pantos et al, 2004; Vandermeulen and Klok, 2004; Vonarbourg et al, 2006; Gajbhiye et al, 2007).

Targeting ligands attached to the dendritic surface are complementary to cell receptors (Cooper, 1997; Lodish et al, 2000) in order to induce binding of the dendritic carrier to the cell surface and efficient internalisation. This binding is further enhanced by the socalled polyvalent interactions (Mammen et al, 1998; Kitov and Bundle, 2003; Badjic et al, 2005) attributed to the close proximity of the recognizable ligands situated on the limited surface area of the dendritic molecules. Transport through the cell membrane can also be enhanced by the introduction of appropriate moieties to the surface of the dendritic polymers. Moreover, modification of the internal groups of dendrimers affects their solubilizing character, making therefore the encapsulation of a pleiad of drugs possible. In this connection, cationization of dendrimers, and particularly of their external groups, facilitates their application as gene transfer agents (Bielinska et al, 1999; Luo et al, 2002; Ohsaki et al, 2002) through the formation of DNA-Dendritic Polymer complexes.

As expected monofunctional dendritic drug carriers cannot compete with their multifunctional counterparts.

Thus selected monofunctional dendrimeric polymers such as poly(amidoamine), PAMAM, diaminobutane poly(propylene imine), DAB, or the hyperbranched polyglycerol, PG (Figure 13) have been step-wise multifunctionalized. In order to illustrate dendrimeric encapsulation, a few typical examples are given below: PAMAM functionalized with monomethyl ether poly(ethylene glycol) (M-PEG), having an average molecular weight of 550 or 2000, was employed for encapsulating the anticancer drugs Adriamycin, ADR (Doxorubicin hydrochloride), or Methotrexate, MTX, (Figure 12) (Kojima et al, 2000), while PEGylated DAB dendrimers were used to encapsulate betamethasone valerate (BV) and betamethasone dipropionate (BD) (Figure 12) (Sideratou et al, 2001). It should be noted that BV loading capacity was found to be of the order of 11 wt% in multi-functional dendrimers, i.e. in PEGylated and Guanidinylated derivative (Paleos et al, 2004), which is almost double the loading capacity of the simply PEGylated dendrimer (6 wt%) (Sideratou et al, 2001) and more than 5fold the loading capacity of the parent dendrimeric solution (1.7 wt%). The encapsulation of a diversity of conventional drugs in functional dendritic polymers and the formation of Dendritic-DNA complexes constitute a prospective and very promising new field in drug delivery. The progress in this field has been recently reviewed (Sideratou et al, 2006). In the present review however, the interaction of dendritic polymers with their complementary liposomes is proposed as a drug delivery model mimicking the interaction of functional dendritic polymers with cells. As previously discussed, multilamellar liposomes interacting with multifunctional dendritic polymers were used instead of cells.

Figure 13. Chemical structure of dendritic polymers.

126

Gene Therapy and Molecular Biology Vol 11, page 127 Guanidinylated diaminobutane poly(propylene imine) dendrimers of the fourth and fifth generation acted as a â&#x20AC;&#x153;glueâ&#x20AC;? causing the aggregation of phosphatidylcholine-cholesterol liposomes incorporating dihexadecylphosphate as the recognizable lipid; these aggregates were readily redispersed by the addition of an excess of a phosphate buffer (Sideratou et al, 2002b).

These initial results on molecular recognition of DHP bearing liposomes with guanidinylated dendrimers prompted the development of an elaborated multifunctional dendrimer (Paleos et al, 2004) based on a fifth generation DAB (Figure 14). The design of this dendrimeric carrier was intended to simultaneously address issues such as stability in the biological milieu, targeting and transport through cell membranes. For this purpose, in addition to protective poly(ethylene glycol) chains, guanidinium moieties were also introduced to the dendrimer surface, acting both as targeting and transport ligands. In this manner it was possible to achieve, the key features of an efficient drug delivery system: a. Protection of the carrier through coverage of the dendrimeric surface with poly(ethylene glycol) chains, b. Recognition ability towards complementary moieties as surface guanidinium groups secure the facile interaction with acidic receptors, including the biologically significant carboxylate and phosphate groups. The combination of electrostatic forces and hydrogen bonding that occur make this interaction thermodynamically favorable (Hirst et al, 1992), c.

Potential of encapsulation of various drugs in the dendrimer nanocavities and subsequent release from them, possibly in a controlled fashion which can be tuned by environmental changes (Sideratou et al, 2001), d.

Complexation with DNA for gene therapy applications, e.

Capability of polyvalency interactions, associated with enhanced binding, due to the high density of recognizable moieties on the confined surface area of the dendrimer, which can significantly enhance translocation through a bilayer membrane. f. An anticipated decrease in toxicity due to the modification of the toxic amino groups (Malik et al, 2000).

In order to investigate the translocation ability of DAB dendrimers across liposomal bilayers, a series of derivatives bearing varying numbers of guanidinium groups on their surfaces were prepared. At low guanidinium/phosphate molar ratios, i.e. when weakly guanidinylated dendrimeric derivatives were employed, the aggregate formation was imaged with AFM microscopy while liposomal fusion occured to a certain extent at high guanidinium/phosphate molar ratios or when highly guanidinylated dendrimeric derivatives were employed (Tsogas et al, 2006). Furthermore, optimal translocation of these dendrimeric derivatives to the liposomal core was shown through fluorescence for low to medium guanidinylation and at low guanidinium/phosphate molar ratios; translocation was further enhanced when the lipid bilayer was in the fluid liquid crystalline phase. In conclusion, an optimum balance is required between the recognition effectiveness as expressed by the number of guanidinium groups interacting with the phosphate groups and the degree of hydrophilicity of the guanidinylated dendrimers for

optimum transport of the latter to the liposomal core (Tsogas et al, 2006).

Having discussed the processes involved in the interaction of liposomes with complementary dendrimers their interaction with cells needs to be modelled next.

Multilamellar liposomes consisting of PC:CHOL:DHP (19:9.5:1) and dispersed in aqueous or phosphate buffer solutions (Pantos et al, 2005b) were employed to simulate cells interacting with multifunctional dendrimers.

Specifically, poly(propylene imine) dendrimers of the fourth generation were functionalized with 6 (DAB-G6) or 12 (DAB-G12) guanidinium groups as targeting ligands, while, the remaining toxic, external primary amino groups of the dendrimers reacted with propylene oxide affording the corresponding hydroxylated derivatives (Figure 15).

The fully hydroxylated dendrimer DAB-G0 not containing any guanidinium groups was used as a reference compound. All dendrimers were loaded with corticosteroid drugs, i.e. betamethasone dipropionate and betamethasone valerate in order to evaluate their drug transfer efficiency to liposomes.

Microscopy, #-potential, and Dynamic Light Scattering (DLS) revealed liposome-dendrimer molecular recognition leading to the formation of large aggregates at dendrimer/DHP molar ratios higher than 1:30. Calcein liposomal entrapment experiments demonstrate limited leakage (less than 13%) following liposome interaction with modified dendrimers at 1:25 dendrimer/DHP molar ratio. This indicates that liposomal membranes remain almost intact during their molecular recognition with these dendrimers. Isothermal Titration Calorimetry (ITC) indicates that the enthalpy of the interaction is dependent on the number of the guanidinium groups present on the dendrimeric surface. Furthermore, the process is reversible and redispersion of the aggregates occurs by adding a high concentration of phosphate anions.

Figure 14. Reaction scheme for multifunctional dendrimeric derivative.

127

the

synthesis

of

a

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles multilamellar liposomes as the ITC and DLS experiments demonstrated. As expected, when the interaction is performed in 10mM phosphate buffer the amount of drug present in the aggregates slightly decreases. This decrease can be explained by the competitive interaction of the phosphate groups in the bulk water phase with the dendrimeric guanidinium groups, leading to less effective adhesion to the multilamellar liposomes.

Upon addition of concentrated phosphate buffer followed by the redispersion of the aggregates in the medium and the separation of the no-longer interacting dendrimers, there is still some drug present in the detached multilamellar liposomes. Measurements of BD or BV found in multilamellar liposomes indicate that, in all cases, ca. 50% (Table 2) of the amount of drugs found in the aggregates before redispersion is still present, suggesting that both drugs are incorporated in the liposomal lipid bilayer, since their solubility in water is extremely low.

Drug transport is highly enhanced by the use of guanidinylated dendrimers since drug transfer of 40-45% was obtained in the case of DAB-G12 while the corresponding transfer for the non-guanidinylated derivative was merely 12-15%.

IV. Concluding remarks The preparation and physicochemical characterization of multifunctional liposomal and dendritic nanoparticles intended for application as drug delivery systems was presented. The multifunctionality together with the multivalency capability of both categories of nanoparticles gives these systems increased potential as effective drug delivery systems. In view of these features and employing multilamellar liposomes, to simulate cells, it was possible to model the processes occurring during the interaction of liposomal and dendritic nanoparticles with cells. A key feature of this model is molecular recognition of the nanoparticles involved leading to adhesion, which is expected to enhance drug transport.

Figure 15. Multi-functionalization reaction scheme of fourth generation poly(propylene imine) dendrimer.

The interaction between drug-loaded dendrimers and multilamellar liposomes results in drug transport from the dendrimeric derivatives to the ‘void’ multilamellar liposomes as summarized in Table 2. These experiments showed that about 25% of BD or BV was present in the precipitated aggregates when DAB-G0 was used. When the guanidinylated dendrimers DAB-G6 and DAB-G12 were used, the amount of drugs in the precipitate profoundly increases to about 60% and 80%, respectively.

These significant differences observed in the transport of drugs between guanidinylated and nonguanidinylated dendrimers can be attributed to the functionalization of the dendrimeric molecules. The presence of guanidinium groups at the external surface of the dendrimers results in effective adhesion to the

Acknowledgements The work was partially supported by Dendrigen SA, Athens, Greece.

Table 2. Drug transfer (%) from dendrimers to multilamellar liposomes in a) aggregates obtained after their interaction in water or in 10 mM phosphate buffer (pH 7.4) and b) multilamellar liposomes obtained following redispersion of the aggregates. Reproduced from Pantos et al, 2005b with kind permission from American Chemical Society.

Drug

BD

BV

Dendrimer DAB-G0 DAB-G6 DAB-G12 DAB-G0 DAB-G6 DAB-G12

Drug transfer (%) in aggregates Phosphate Water Buffer 24.4±2.4 19.8±1.2 62.5±1.9 48.5±1.6 84.5±2.1 68.4±1.5 32.9±2.0 27.1±1.0 59.0±1.5 39.5±2.1 78.1±2.3 57.5±2.0

128

Drug transfer (%) after redispersion Phosphate Water Buffer 15.8±0.9 12.1±1.1 28.1±1.7 24.5±1.3 45.1±1.8 40.0±1.4 15.9±1.2 14.1±0.9 29.0±1.0 26.1±1.5 42.0±1.5 38.2±1.2

Gene Therapy and Molecular Biology Vol 11, page 129 transduction into cells enhanced by haptotactic peptides (Haptides) homologous to fibrinogen C-chain termini. J Controlled Release 95, 477-488.

Gregoriadis G (1995) Engineering liposomes for drug delivery: progress and problems. Trends Biotechnol 13, 527-537.

Guo X and Szoka FC, Jr (2003) Chemical approaches to triggerable lipid vesicles for drug and gene delivery. Acc Chem Res 36, 335-341.

Haag R (2001) Dendrimers and hyperbranched polymers as highloading supports for organic synthesis. Chem Eur J 7, 327335.

Hirst SC, Tecilla P, Geib SJ, Fan E and Hamilton AD (1992) Molecular Recognition of Phosphate-esters - A Balance of Hydrogen-bonding and roton-Transfer Interactions. Israel J Chem 32, 105-111.

Inoue K (2000) Functional dendrimers, hyperbranched and star polymers. Prog Polym Sci 25, 453-571.

Ipsen JH, Karlström G, Mouritsen OG, Wennerström H and Zuckermann MJ (1987) Phase-equilibria in the phosphatidylcholine-cholesterol system. J Biochim Biophys Acta 905, 162-172.

Ishiwata H, Sato SB, Vertut-Doi A, Hamashima Y and Miyajima K (1997) Cholesterol derivative of poly(ethylene glycol) inhibits clathrin-independent, but not clathrin-dependent endocytosis. Biochim Biophys Acta 1359, 123-135.

Jiang D-L and Aida T (2005) Bioinspired molecular design of functional dendrimers. Prog Polym Sci 30, 403-422.

Kim RB (2006) Transporters and Drug Discovery: Why, When, and How. Mol Pharm 3, 26-32.

Kirschberg TA, VanDeusen CL, Rothbard JB, Yang M and Wender PA (2003) Arginine-based molecular transporters: The synthesis and chemical evaluation of releasable taxoltransporter conjugates. Org Lett 5, 3459-3462.

Kitov PI and Bundle DR (2003) On the nature of the multivalency effect: A thermodynamic model. J Am Chem Soc 125, 16271-16284.

Kojima C, Kono K, Maruyama K and Takagishi T (2000) Synthesis of polyamidoamine dendrimers having poly(ethylene glycol) grafts and their ability to encapsulate anticancer drugs. Bioconjugate Chem 11, 910-917.

Kolhe P, Misra E, Kannan RM, Kannan S and Lieh-Lai M (2003) Drug complexation, in vitro release and cellular entry of dendrimers and hyperbranched polymers. Int J Pharm 259, 143-160.

Lasic DD and Needham D (1995) The ''Stealth'' liposome: A prototypical biomaterial. Chem Rev 95, 2601-2628 and references cited therein.

Lee CC, MacKay JA, Fréchet JMJ and Szoka FC (2005) Designing dendrimers for biological applications. Nat Biotechnol 23, 1517-1526.

Lim J and Simanek EE (2005) Toward the next-generation drug delivery vehicle: Synthesis of a dendrimer with four orthogonally reactive groups. Mol Pharm 2, 273-277.

Liu MJ and Fréchet JMJ (1999) Designing dendrimers for drug delivery. Pharm Sci Technol Today 2, 393-401.

Liu MJ, Kono K and Fréchet JMJ (1999) Water-soluble dendrimer-poly(ethylene glycol) starlike conjugates as potential drug carriers. J Polym Sci, Part A: Polym Chem 37, 3492-3503.

Liu MJ, Kono K and Fréchet JMJ (2000) Water-soluble dendritic unimolecular micelles: Their potential as drug delivery agents. J Controlled Release 65, 121-131.

Liu YM and Reineke TM (2006) Poly(glycoamidoamine)s for gene delivery: Stability of polyplexes and efficacy with cardiomyoblast cells. Bioconjugate Chem 17, 101-108.

Lodish H, Berk A, Zipursky SL, Matsudaira P, Baltimore D and Darnell J (2000) Integrating Cells into Tissues, in: Lodish I, Harvey F. (Eds). Molecular Cell Biology. Freeman WH and

References Allen TM (1994) Long-Circulating (Sterically Stabilized) Liposomes For Targeted Drug-Delivery. Trends Pharmacol Sci 15, 215-220.

Ambade AV, Savariar EN and Thayumanavan S (2005) Dendrimeric micelles for controlled drug release and targeted delivery. Mol Pharm 2, 264-272.

Badjic JD, Nelson A, Cantrill SJ, Turnbull WB and Stoddart JF (2005) Multivalency and cooperativity in supramolecular chemistry. Acc Chem Res 38, 723-732.

Barenholz Y (2001) Liposome application: problems and prospects. Curr Opin Colloid Interface Sci 6, 66-77.

Beezer AE, King ASH, Martin IK, Mitchel JC, Twyman LJ and Wain CF (2003) Dendrimers as potential drug carriers; encapsulation of acidic hydrophobes within water soluble PAMAM derivatives. Tetrahedron 59, 3873-3880.

Bielinska AU, Chen CL, Johnson J and Baker JR, Jr (1999) DNA complexing with polyamidoamine dendrimers: Implications for transfection. Bioconjugate Chem 10, 843-850.

Bosman AW, Janssen HM and Meijer EW (1999) About Dendrimers: Structure, Physical Properties, and Applications.

Chem Rev 99, 1665-1688.

Cevc G and Richardsen H. (1999) Lipid vesicles and membrane fusion. Adv Drug Delivery Rev 38, 207-232.

Cooper GM (1997) The Cell Surface, in: The Cell. A Molecular Approach, ASM Press, Washington DC, 477.

D' Emanuele A and Attwood D (2005) Dendrimer-drug interactions. Adv Drug Delivery Rev 57, 2147-2162.

Dhanikula RS and Hildgen P (2006) Synthesis and Evaluation of Novel Dendrimers with a Hydrophilic Interior as Nanocarriers for Drug Delivery. Bioconjugate Chem 17, 2941.

Dufès C, Uchegbu IF and Schätzlein AG (2005) Dendrimers in gene delivery. Adv Drug Delivery Rev 57, 2177-2202.

Fréchet JMJ and Tomalia DA (2001) Dendrimers and Other Dendritic Polymers. J. Wiley & Sons, Ltd., Chichester, UK and references cited therein.

Frey H and Haag R (2002) Dendritic polyglycerol: a new versatile biocompatible material. Rev Mol Biotechnol 90, 257-267.

Futaki S, Suzuki T, Ohashi W, Yagami T, Tanaka S, Ueda K and Sugiura Y (2001) Arginine-rich peptides. An abundant source of membrane-permeable peptides having potential as carriers for intracellular protein delivery. J Biol Chem 276, 5836-5840.

Futaki S, Goto S and Sugiura Y (2003) Membrane permeability commonly shared among arginine-rich peptides. J. Molecul.

Recognition 16, 260-264.

Futaki S (2005a) Membrane-permeable arginine-rich peptides and the translocation mechanisms. Adv Drug Delivery Rev 547-558.

Futaki S, Nakase I, Suzuki T, Nameki D, Kodama EI, Matsuoka M and Sugiura Y (2005b) RNase S complex bearing arginine-rich peptide and anti-HIV activity. J Mol Recognit 18, 169-174.

Gabizon A, Shmeeda H and Barenholz Y (2003) Pharmacokinetics of pegylated liposomal doxorubicin: review of animal and human studies. Clin Pharmacokinet 42, 419-36.

Gajbhiye V, Kumar PV, Tekade RK and Jain NK (2007) Pharmaceutical and biomedical potential of PEGylated dendrimers. Curr. Pharm. Des. 13, 415-429.

Gillies ER and Fréchet JMJ (2005) Dendrimers and dendritic polymers in drug delivery. Drug Discovery Today 10, 3543.

Gorodetsky R, Levdansky L, Vexler A, Shimeliovich I, Kassis I, Ben-Moshe M, Magdassi S and Marx G (2004) Liposome

129

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles Company, New York, 968.

Luo D, Haverstick K, Belcheva N, Han E and Saltzman WM (2002) Poly(ethylene glycol)-conjugated PAMAM dendrimer for biocompatible, high-efficiency DNA delivery.

Macromolecules 35, 3456-3462.

Maeda T and Fujimoto K (2006) A reduction-triggered delivery by a liposomal carrier possessing membrane-permeable ligands and a detachable coating. Colloid Surf B 49, 15-21.

Malik N, Wiwattanapatapee R, Klopsch R, Lorenz K, Frey H, Weener JW, Meijer EW, Paulus W and Duncan R (2000) Dendrimers: Relationship between structure and biocompatibility in vitro, and preliminary studies on the biodistribution of 125I-labelled polyamidoamine dendrimers in vivo. J Controlled Release 65, 133-148.

Mammen M, Choi S and Whitesides GM (1998) Polyvalent Interactions in Biological Systems: Implications for Design and Use of Multivalent Ligands and Inhibitors. Angew Chem, Int Ed 37, 2754-2794.

Marchi-Artzner V, Jullien L, Gulik-Krzywicki T and Lehn J-M (1997) Molecular recognition induced aggregation and fusion between vesicles containing lipids bearing complementary hydrogen bonding head groups. Chem Commun (Cambridge) 1, 117-118.

Marchi-Artzner V, Gulik-Krzywicki T, Guedeau-Boudeville MA, Gosse C, Sanderson JM, Dedieu JC and Lehn JM (2001) Selective adhesion, lipid exchange and membrane-fusion processes between vesicles of various sizes bearing complementary molecular recognition groups.

ChemPhysChem 2, 367-376.

Mouritsen OG and Jørgensen K (1992) Dynamic lipid-bilayer heterogeneity - a mesoscopic vehicle for membrane-function.

BioEssays 14, 129-136.

Mouritsen OG and Jørgensen K (1994) Dynamical order and disorder in lipid bilayers. Chem Phys Lipids 73, 3-25.

Muscat D and van Benthem RATM (2001) Hyperbranched polyesteramides - New dendritic polymers. Top Curr Chem 212, 41-80.

Needham D and Kim DH (2000) PEG-covered lipid surfaces: bilayers and monolayers. Colloids Surf B 18, 183-195.

Newkome GR, Moorefield CN and Vögtle F (2001) Dendrimers and Dendrons. Concepts, Syntheses, Perspectives. WileyVCH, Weinheim, Germany, and references cited therein.

Noppl-Simson DA and Needham D (1996) Avidin-biotin interactions at vesicle surfaces: Adsorption and binding, cross-bridge formation, and lateral interactions. Biophys J 70, 1391-1401.

Ohsaki M, Okuda T, Wada A, Hirayama T, Niidome T and Aoyagi H (2002) In vitro gene transfection using dendritic poly(L-lysine). Bioconjugate Chem 13, 510-517.

Onda M, Yoshihara K, Koyano H, Ariga K and Kunitake T (1996) Molecular recognition of nucleotides by the guanidinium unit at the surface of aqueous micelles and bilayers. A comparison of microscopic and macroscopic interfaces. J Am Chem Soc 118, 8524-8530.

Paleos CM, Sideratou Z and Tsiourvas D (1996) Mixed vesicles of didodecyldimethylammonium bromide with recognizable moieties at the interface. J Phys Chem 100, 13898-13900.

Paleos CM, Sideratou Z and Tsiourvas D (2001) Molecular recognition of complementary liposomes in modeling cellcell recognition. ChemBioChem 2, 305-310.

Paleos CM, Tsiourvas D, Sideratou Z and Tziveleka L (2004) Acid- and salt-triggered multifunctional poly(propylene imine) dendrimer as a prospective drug delivery system.

Biomacromolecules 5, 524-529.

Paleos CM and Tsiourvas D (2006) Interaction between complementary liposomes: a process leading to multicompartment systems formation. J Mol Recognit 19,

60-67.

Paleos CM, Tsiourvas D and Sideratou Z (2007) Molecular engineering of dendritic polymers and their application as drug and gene delivery systems. Mol. Pharmaceutics 4, 169-188.

Pantos A, Sideratou Z and Paleos CM (2002) Complementary liposomes based on phosphatidylcholine: Interaction effectiveness vs protective coating. J Colloid Interface Sci 253, 435-442.

Pantos A, Tsiourvas D, Sideratou Z and Paleos CM (2004) Interactions of complementary PEGylated liposomes and characterization of the resulting aggregates. Langmuir 20, 6165-6172.

Pantos A, Tsiourvas D, Paleos CM and Nounesis G (2005a) Enhanced drug transport from unilamellar to multilamellar liposomes induced by molecular recognition of their lipid membranes. Langmuir 21, 6696-6702.

Pantos A, Tsiourvas D, Nounesis G and Paleos CM (2005b) Interaction of Functional Dendrimers with Multilamellar Liposomes: Design of a Model System for Studying Drug Delivery. Langmuir 21, 7483-7490.

Prochiantz, A. (2000) Messenger proteins: homeoproteins, TAT and others. Curr Opin Cell Biol 12, 400-406.

Roberts MJ, Bentley MD and Harris JM (2002) Chemistry for peptide and protein PEGylation. Adv Drug Delivery Rev 54, 459-476.

Schlüter AD and Rabe JP (2000) Dendronized Polymers: Synthesis, Characterization, Assembly at Interfaces, and Manipulation. Angew Chem, Int Ed 39, 864-883.

Sideratou Z, Tsiourvas D, Paleos CM, Tsortos A and Nounesis G (2000) Molecular recognition of complementary liposomes: The enhancing role of cholesterol. Langmuir 16, 9186-9191.

Sideratou Z, Tsiourvas D and Paleos CM (2001) Solubilization and release properties of PEGylated diaminobutane poly(propylene imine) dendrimers. J Colloid Interface Sci 242, 272-276.

Sideratou Z, Tsiourvas D, Paleos CM, Tsortos A, Pyrpassopoulos S and Nounesis G (2002a) Interaction of phosphatidyl choline based liposomes functionalized at the interface with adenine and barbituric acid moieties. Langmuir 18, 829-835.

Sideratou Z, Foundis J, Tsiourvas D, Nezis IP, Papadimas G and Paleos CM (2002b) A novel dendrimeric "glue" for adhesion of phosphatidyl choline-based liposomes. Langmuir 18, 5036-5039.

Sideratou Z, Tziveleka LA, Kontoyianni C, Tsiourvas D and Paleos CM (2006) Design of functional dendritic polymers for application as drug and gene delivery systems. Gene Ther Mol Biol 10, 71-94.

Siegers C, Biesalski M and Haag R (2004) Self-assembled monolayers of dendritic polyglycerol derivatives on gold that resist the adsorption of proteins. Chem Eur J 10, 2831-2838.

Stiriba S-E, Frey H and Haag R (2002) Dendritic Polymers in Biomedical Applications: From Potential to Clinical Use in Diagnostics and Therapy. Angew Chem, Int Ed 41, 13291334.

Sunder A, Krämer M, Hanselmann R, Mühlaupt R and Frey H (1999a) Molecular Nanocapsules Based on Amphiphilic Hyperbranched Polyglycerols. Angew Chem, Int Ed 38, 3552-3555.

Sunder A, Quincy M-F, Mülhaupt R and Frey H (1999b) Hyperbranched Polyether Polyols with Liquid Crystalline Properties. Angew Chem, Int Ed 38, 2928-2930.

Sunder A, Mülhaupt R and Frey H (2000a) Hyperbranched Polyether-Polyols Based on Polyglycerol: Polarity Desigh by Block Copolymerisation with Propylene Oxide.

Macromolecules 33, 309-314.

Sunder A, Mülhaupt R, Haag R and Frey H (2000b)

130

Gene Therapy and Molecular Biology Vol 11, page 131 Hyperbranched polyether polyols: A modular approach to complex polymer architectures. Adv Mater 12, 235-239.

Svenson S and Tomalia DA (2005) Dendrimers in biomedical applications—reflections on the field. Adv Drug Delivery Rev 57, 2106- 2129.

Tanaka T and Yamazaki M (2004) Membrane fusion of giant unilamellar vesicles of neutral phospholipid membranes induced by La3+. Langmuir 20, 5160-5164.

Thewalt JL and Bloom M (1992) Phosphatidylcholine cholesterol phase-diagrams. Biophys J 63, 1176-1181.

Tomalia DA (2005) The dendritic state. Mater Today 8, 34-36.

Trandum C, Westh P, Jørgensen K and Mouritsen OG (2000) A thermodynamic study of the effects of cholesterol on the interaction between liposomes and ethanol. Biophys J 78, 2486-2492.

Tsogas I, Tsiourvas D, Nounesis G and Paleos CM (2006) Modelling cell membrane transport: Interaction of guanidylated poly(propylene imine) dendrimers with a liposomal membrane consisting of phosphate based lipids, Accepted.

Tziveleka L-A, Kontoyianni C, Sideratou Z, Tsiourvas D and Paleos CM (2006) Novel functional hyperbranched polyether polyols as prospected drug delivery systems. Macromol Biosci 6, 161-169.

Tziveleka L-A, Psarra AMG, Tsiourvas D and Paleos CM (2007) Synthesis and characterization of guanidinylated

poly(propylene imine) dendrimers as gene transfection agents. J Controlled Release 117, 137-146.

Veronese FM (2001) Peptide and protein PEGylation: a review of problems and solutions. Biomaterials 22, 405-417.

Vivès E, Brodin P and Lebleu B (1997) A truncated HIV-1 Tat protein basic domain rapidly translocates through the plasma membrane and accumulates in the cell nucleus. J Biol Chem 272, 16010-16017.

Vögtle F, Gestermann S, Hesse R, Schwierz H and Windisch. B (2000) Functional dendrimers. Prog Polym Sci 25, 9871041.

Voit BI (2003) Hyperbranched polymers: a chance and a challenge. C R Chim 6, 821-832.

Vonarbourg A, Passirani C, Saulnier P, Benoit J-P (2006) Parameters influencing the stealthiness of colloidal drug delivery systems. Biomaterials 27, 4356-4373.

Wender PA, Mitchell DJ, Pattabiraman K, Pelkey ET, Steinman L and Rothbard JB (2000) The design, synthesis, and evaluation of molecules that enable or enhance cellular uptake: Peptoid molecular transporters. Proc Natl Acad Sci USA 97, 13003-13008.

Wright LR, Rothbard JB and Wender PA (2003) Guanidinium rich peptide transporters and drug delivery. Curr Prot Pept Sci 4, 105-124.

131

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles

132

Gene Therapy and Molecular Biology Vol 11, page 133 Gene Ther Mol Biol Vol 11, 133-142, 2007

In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells Research Article

M. Waheed Roomi, Vadim Ivanov, Tatiana Kalinovsky, Aleksandra Niedzwiecki*, Matthias Rath Dr. Rath Research Institute, Oncology, 1260 Memorex Drive, Santa Clara, CA 95050

__________________________________________________________________________________ *Correspondence: Aleksandra Niedzwiecki, Dr. Rath Research Institute, Oncology, 1260 Memorex Drive, Santa Clara, CA 95050, USA; Tel: 408-807-5564; Fax: 408-567-5030; E-mail: author@drrath.com Key words: rhabdomyosarcoma, apoptosis, MMPs, Matrigel invasion, nutrients, green tea extract, ascorbic acid, lysine Abbreviations: Matrix metalloproteinases, (MMPs); nitric oxide, (NO); phosphate buffered saline, (PBS); Rhabdomyosarcoma, (RMS) Received: 29 March 2007; Revised: 16 May 2007 Accepted: 22 May 2007; electronically published: June 2007

Summary Rhabdomyosarcoma, the most common pediatric soft tissue sarcoma of mesenchymal origin, has metastasized in ~25% of all patients at time of diagnosis. Though current treatment strategies have achieved some success, they are associated with severe adverse effects. We investigated the effect of a nutrient mixture (NM), which has shown antitumor effects on various cancer cell lines, on rhabdomyosarcoma cell growth, apoptosis, MMP secretion, and invasion. Human rhabdomyosarcoma cells, grown in DME, were treated at near confluence with NM at 0, 10, 50, 100, 500 and 1000 µg/ml in triplicate at each dose. MMP secretion was studied by zymography, viability by MTT assay, cell invasion through Matrigel, and morphology and apoptosis by H&E staining and live green caspase kit.

Zymography demonstrated MMP-2 secretion and PMA-induced MMP-9 secretion. NM inhibited the secretion of both MMPs in a dose-dependent fashion, with virtual total inhibition at 500 µg/ml NM. Cell invasion through Matrigel was inhibited at 10, 50, 100 and 500 µg/ml by 75%, 80%, 92% and 100% (p=0.02) respectively. NM was slightly toxic at 1000 µg/ml (20% over control, p=0.016) to rhabdomyosarcoma cells. Cells exposed to NM showed dose-dependent apoptosis with 90% of cells in late apoptosis at 1000 µg/ml. These results suggest that NM has potential in the treatment of rhabdomyosarcoma by inducing cell apoptosis and inhibiting cell invasion and MMP secretion without toxic effects.

in infants (Mandell et al, 1990). Pleomorphic RMS is usually seen in adults and arises in the muscles of the extremities. At diagnosis, roughly 50% of cases consist of patients aged five and younger and 25% of all patients have metastatic disease (Koscielniak et al, 1992).

Standard multimodality treatment approaches developed through such trials as the Intergroup Rhabdomyosarcoma Study Group (IRSG) include surgery, radiation therapy, and chemotherapy. The use of neoadjunctive therapy has increased survival in patients with localized disease to 60% five-year survival (Stevens et al, 2005); however, complications resulting from therapy are serious and can be life threatening.

Additionally, clinical trials focused on three or five-year event-free survival does not adequately address the needs of pediatric cancer patients. Toxicities and delayed effects of treatment not present during treatment can manifest later as a result of growth and development. Patients with

I. Introduction Rhabdomyosarcoma (RMS), a soft tissue tumor of skeletal muscle origin is the third most common extracranial solid childhood neoplasm with approximately 250 new cases diagnosed each year in the United Sates (Kramer, 1983). While tumors can appear at numerous locations, the primary sites are: the head and neck (35%), the genitourinary tract (22%), and the extremities (18%) (Barr, 1997). There are two main histological types of pediatric RMS: embryonic RMS and alveolar RMS. Embryonal RMS is more prevalent, contributing to roughly 53% of all diagnosed cases; it generally presents in children under fifteen in either the head and neck region or the genitourinary tract (Parham, 2001). Alveolar RMS generally affects the muscles of the extremities or trunk and has been found to be more resistant to treatment and more likely to spread to regional lymph nodes than embryonal RMS and the botryoid variant commonly found 133

Roomi et al: In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells primary tumor sites at the bladder or prostate treated with radiation have been found to be at an increased risk of developing bowel complications, poor bladder function, hemorrhagic cystitis, and sex hormone deficiency (Raney et al, 1993). Ifosfamide (high dose) can lead to renal Fanconiâ&#x20AC;&#x2122;s syndrome with glycosuria, phosphaturia and aminoaciduria (Skinner, 2003). Cyclophosphamide can increase the risk of hepatic dysfunction and lead to early menopause in young women (Sklar, 2005). Anthracyclines cause myocardial cell death and have been implicated in cardiac failure and fatal arrhythmia ten to twenty years after administration (Iarussi et al, 2005). Adriamycin can increase the risk of "late" cardiomyopathy (Lipshultz et al, 1991). Cisplatin is known to cause glomerular and tubular injury (Taguchi et al, 2005). Radiation therapy contributes to tubular damage and hypertension associated with renal artery stenosis (Moulder and Cohen, 2005). Localized radiotherapy is associated with hypoplasia with asymmetry most apparent during pubertal development (Denys et al, 1998). Cranial irradiation affects the hypothalamic-pituitary axis leading to the early onset of puberty and subsequently thwarts ultimate height (Darzy and Shalet, 2005). Children under age five are particularly sensitive to central nervous system irradiation and chemotherapy, which can impair their attention, memory and motor skills, having a profound effect on their educational and occupational success (Monje and Palmer, 2003).

The most serious late effect of current treatment is the development of a second malignant neoplasm; childhood cancer survivors have an 8-10% risk within 20 years (Sung et al, 2004) and the risk of developing second malignancies is particularly high among patients who received combined modality therapy (Cohen et al, 2005).

Given this data, it is clear that current treatment brings limited benefit to patients, which compels the need for new agents aimed at specific targets involved in metastatic behavior, that are not injurious to the health of the patient.

It is now well documented that the family of zincdependent endoproteinases, matrix metalloproteinases (MMPs), facilitate tumor cell invasion and metastasis through: removal of physical barriers to invasion, degradation of extracellular matrix (ECM) macromolecules, and modulation of cell adhesion and activation of ECM components to expose hidden biologic activities. Such has prompted researchers to design therapies that inhibit MMP activity to prevent metastasis.

Rath and Pauling proposed that natural inhibitors, such as lysine and ascorbic acid, have the potential to inhibit tumor growth and expansion through the modulation of ECM proteolysis and optimization of connective tissue integrity (Rath and Pauling, 1992). Our previous studies have demonstrated significant antitumoral activity of the nutrient mixture containing lysine, proline, ascorbic acid and green tea extract against a large number of cancer cell lines in vitro (Roomi et al, 2005a,b,c) and in vivo (Roomi et al, 2005d,e,f).

In the current study, we investigated the effect of NM on human rhabdomyosarcoma cells by measuring cell proliferation, apoptosis, modulation of MMP-2 and MMP9 secretion, and cancer cell invasive potential.

II. Materials and methods A. Cell Culture Embryonal rhabdomyosarcoma cells (CCL-136RD) obtained from ATCC (American Type Culture Collection, Rockville, MD), were grown in DME media, supplemented with 10% fetal bovine serum, penicillin (100 U/ml) and streptomycin (100 mg/ml) in 24-well tissue culture plates (Costar, Cambridge, MA). Cells were incubated with 1 ml of media at 370 C in a tissue culture incubator equilibrated with 95% air and 5% CO2.

At near confluence, the cells were treated with the nutrient mixture, dissolved in media and tested at 0, 10, 50, 100, 500, and 1000 Âľg/ml in triplicate at each dose. Cells were also treated with phorbol 12-myristate 13-acetate (PMA) 200ng/ml to induce MMP-9 secretion. The plates were then returned to the incubator.

B. MTT Assay Cell viability was evaluated by [3-(4,5-dimethylthiazol-2yl) 2,5-diphenyl tetrazolium bromide] (MTT) assay, a colorimetric assay based on the ability of viable cells to reduce a soluble yellow tetrazolium salt MTT to a blue formazan crystal by mitochondrial succinate dehydrogenase activity of viable cells. This test is a good index of mitochondrial activity and thus of cell viability. After 24 h incubation, the cells were washed with phosphate buffered saline (PBS) and 500 !l of MTT (Sigma #M-2128) 0.5 mg/ml in media was added to each well. After MTT addition (0.5mg/ml) the plates were covered and returned to the 370C incubator for 2h, the optimal time for formazan product formation. Following incubation, the supernatant was carefully removed from the wells, the formazan product was dissolved in 1ml DMSO, and absorbance was measured at 570 nm in Bio Spec 1601, Shimadzu spectrometer. The OD570 of the DMSO solution in each well was considered to be proportional to the number of cells. The OD570 of the control (treatment without supplement) was considered 100%.

C. Gelatinase zymography MMP activity in conditioned media was determined by gelatinase zymography. Gelatinase zymography was performed in 10% Novex precast SDS-polyacrylamide gel (Invitrogen Corporation) in the presence of 0.1% gelatin under non-reduced conditions. Culture media (20 !l) mixed with sample buffer was loaded and SDS-PAGE was performed with tris glycine SDS buffer as described by the manufacturer (Novex). Samples were not boiled before electrophoresis. Following electrophoresis the gels were washed twice in 2.5% Triton X-100 for 30 minutes at room temperature to remove SDS. The gels were then incubated at 370 C overnight in substrate buffer containing 50 mM TrisHCl and 10 mM CaCl2 at pH 8.0 and stained with 0.5% Coomassie Blue R250 in 50% methanol and 10% glacial acetic acid for 30 minutes and destained. Protein standards were run concurrently and approximate molecular weights were determined by plotting the relative mobilities of known proteins.

Gelatinase zymograms were scanned using CanoScan 9950F Canon scanner at 1200 dpi. The intensity of the bands was evaluated using a pixel-based densitometer program Un-Scan-It, Version 5.1, 32-bit, by Silk Scientific Corporation (Orem, UT, USA), at a resolution of 1 Scanner Unit (1/100 of an inch for an image that was scanned at 100 dpi), and expressed as a percentage of control. The R2 value (0 to 1), which represents how well the line of best fit falls on the dependent data, with R2 = 1.0 being the best possible fit, was determined.

D. Matrigel invasion Invasion studies were conducted using Matrigel (Becton Dickinson) inserts in 24-well plates. Suspended in medium, rhabdomyosarcoma cells were supplemented with nutrients, as specified in the design of the experiment and seeded on the insert

134

Gene Therapy and Molecular Biology Vol 11, page 135 in the well. Thus both the medium on the insert and in the well contained the same supplements. The plates with the inserts were then incubated in a culture incubator equilibrated with 95% air and 5% CO2 for 24 hours. After incubation, the media from the wells were withdrawn. The cells on the upper surface of the inserts were gently scrubbed away with cotton swabs. The cells that had penetrated the Matrigel membrane and migrated onto the lower surface of the Matrigel were stained with Hematoxylin and Eosin and visually counted under the microscope.

slight significant toxicity (20% over control, p=0.016) to RMS cells, as shown in Figure 1.

B. Gelatinase zymography study Zymography demonstrated secretion of MMP-2 by unstimulated cells. Treatment of rhabdomyosarcoma cells with PMA (200 ng/ml) induced MMP-9 activity. NM inhibited secretion of both MMPs in a dose-dependent fashion with virtual total inhibition at 500 µg/ml, as shown in Figures 2A and 2B. Densitometry analysis on relative activity of MMP-2 showed 18% inhibition at 50 µg/ml, 45% at 100 µg/ml and 99% at 500 µg/ml NM, with R2 = 0.8443 (Figure 2C). For MMP-9, relative activity per densitometry revealed 20% inhibition at 50 µg/ml, 46% at 100 µg/ml and 98% at 500 µg/ml NM, with R2 = 0.8875 (Figure 2D).

E. Morphology and apoptosis Morphology of cells cultured for 24h in test concentrations of NM were evaluated by H&E staining and observed and photographed by microscopy.

At near confluence, rhabdomyosarcoma cells were challenged with NM dissolved in media at 0, 100, 500, and 1000 µg/ml and incubated for 24 h.

The cell culture was washed with PBS and treated with the caspase reagent as specified in the manufacturer’s protocol (Molecular Probes Image-IT™ Live Green Poly Caspases Detection Kit 135104, Invitrogen). The cells were photographed under a fluorescence microscope and counted. Green-colored cells represent viable cells, while yellow orange represents early apoptosis and red late apoptosis.

C. Invasion study NM significantly reduced the invasion of rhabdomyosarcoma cells through Matrigel in a dosedependent fashion, with 75% inhibition at 10 µg/ml, 80% at 50 µg/ml, 92% at 100 µg/ml, and 100% at 500 µg/ml NM (p=0.02), as shown in Figure 3.

F. Composition of NM Stock solution of the nutrient mixture prepared for testing was composed of the following in the ratio indicated: Vitamin C (as ascorbic acid and as Mg, Ca, and palmitate ascorbate) 700 mg; L-lysine 1000 mg; L-proline 750 mg; L-arginine 500 mg; Nacetyl cysteine 200 mg; standardized green tea extract 1000 mg (green tea extract derived from green tea leaves was obtained from US Pharma Lab. The certificate of analysis indicates the following characteristics: total polyphenol 80%, catechins 60%, EGCG 35%, and caffeine 1.0%); selenium 30 !g; copper 2 mg; manganese 1mg.

D. Morphology (H&E staining) and apoptosis (live green caspases detection kit) H&E staining showed no morphological changes at 100 µg/ml NM, but apoptotic cells were evident at 500 and 1000 µg/ml, as shown in Figures 4A-F. The apoptotic cells showed shrinkage with condensed and darkly stained nuclei and strongly acidophilic cytoplasm. Using the live green caspase kit, dose-dependent apoptosis of pediatric rhabdomyosarcoma cells was evident with NM challenge, as shown in Figures 5A-E. Few apoptotic cells were observed in those cells exposed to 100 µg/ml NM; the number of apoptotic cells increased significantly in a dosedependent manner at 250 µg/ml - 1000 µg/ml NM.

G. Statistical analysis The results were expressed as means + SD for the groups.

Data was analyzed by independent sample “t” test.

III. Results A. Cell viability study NM demonstrated insignificant effect on RMS cells at 10 µg/ml – 500 µg/ml. At 1000 µg/ml NM showed

Figure 1. Effect of the NM on growth of rhabdomyosarcoma cells: 24h MTT assay. NM demonstrated insignificant effect on RMS cells at 10 µg/ml – 500 µg/ml. At 1000 µg/ml NM showed slight significant toxicity (20% over control, p=0.016) to RMS cells.

135

Roomi et al: In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells

Figure 2. Effect of NM on MMP-2 and MMP-9 secretion by untreated rhabdomyosarcoma cells (A) and

by PMA (200 ng/ml)-treated cells (B). Legend 1 – Markers, 2Control, 3-7 NM 10, 50, 100, 500, 1000 µg/ml.

Zymography demonstrated secretion of MMP-2 and PMA - induced MMP-9 activity. Densitometry Analysis.

Densitometry analysis on relative activity of MMP-2 showed 18% inhibition at 50 µg/ml, 45% at 100 µg/ml and 99% at 500 µg/ml NM, with R 2 = 0.8443 (C). For MMP-9, relative activity per densitometry revealed 20% inhibition at 50 µg/ml, 46% at 100 µg/ml and 98% at 500 µg/ml NM, with R 2 = 0.8875 (D).

Figure 3. Effect of NM on rhabdomyosarcoma Matrigel invasion. NM significantly reduced the invasion of rhabdomyosarcoma cells through Matrigel in a dosedependent fashion, with 75% inhibition at 10 µg/ml, 80% at 50 µg/ml, 92% at 100 µg/ml, and 100% at 500 µg/ml NM (p=0.02).

136

Gene Therapy and Molecular Biology Vol 11, page 137

Figure 4. Effect of NM on rhabdomyosarcoma morphology (H&E staining): A – Control, B – NM 10 µg/ml, C – NM 50 µg/ml, D - 100 µg/ml, E - 500 µg/ml, F – 1000 µg/ml. H&E staining showed no morphological changes at 100 µg/ml NM, but apoptotic cells were evident at 500 and 1000 µg/ml. The apoptotic cells showed shrinkage with condensed and darkly stained nuclei and strongly acidophilic cytoplasm. Typical apoptotic cells indicated with arrows in E and F.

137

Roomi et al: In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells

Figure 5. Effect of NM on rhabdomyosarcoma apoptosis (live green caspase detection kit): A – Control, B – NM 50 µg/ml, C – NM 100 µg/ml, D – NM 250 µg/ml, E – NM 500 µg/ml, 5F – NM 1000 µg/ml. Slight apoptosis of rhabdomyosarcoma cells was observed in cells exposed to 100 µg/ml, moderate at 250 µg/ml and profound at 500 and 1000 µg/ml NM.

Quantitative analysis of live, early and late apoptotic cells is shown in Figure 6. At 100 µg/ml NM, 95% of cells are viable and 5% apoptotic and at 250µg/ml NM 45% of cells are viable, 12% in early apoptosis, and 40% in late apoptosis. RMS cell apoptosis was further increased in

cells exposed to 500 µg/ml NM: 28% viable, 16% early apoptosis, and 60% late apoptosis. Virtually all cells exposed to 1000 µg/ml NM were in late apoptosis: 10% early apoptosis and 90% late apoptosis.

138

Gene Therapy and Molecular Biology Vol 11, page 139

Figure 6. Effect of NM on rhabdomyosarcoma apoptosis (live green caspase detection kit): % of cells in various stages of apoptosis at NM 0, 50, 100, 250, 500, and 1000 µg/ml. At 100 µg/ml NM, 95% of cells are viable and 5% apoptotic and at 250µg/ml NM 46% of cells are viable, 13% in early apoptosis, and 41% in late apoptosis. RMS cell apoptosis was further increased in cells exposed to 500 µg/ml NM: 28% viable, 14% early apoptosis, and 58% late apoptosis. Virtually all cells exposed to 1000 µg/ml NM were in late apoptosis: 10% early apoptosis and 90% late apoptosis.

and optimum structure of collagen fibers. Manganese and copper are also essential cofactors in collagen formation process. Collagen stability can be controlled by lysine (Rath and Pauling, 1992) and also by N-acetyl cysteine through its inhibitory effect on MMP-9 activity (Kawakami et al, 2001) and invasive activities of tumor cells (Morini et al, 1999). Also, selenium has been shown to interfere with MMP expression and tumor invasion (Yoon et al, 2001), as well as migration of endothelial cells through ECM (Morini et al, 1999). Ascorbic acid has been shown to inhibit cell division and growth through production of hydrogen peroxide (Chen et al, 2005). Green tea extract has shown to be a promising agent in controlling angiogenesis, metastasis, and other aspects of cancer progression (Hare, 2001; Landau, 1998; Yang, 1998). Since arginine is a precursor of nitric oxide (NO), any deficiency of arginine can limit the production of NO, which has been shown to predominantly act as an inducer of apoptosis, as in the case of breast cancer cells (Cooke and Dzau, 1997).

Based on the evidence available in literature and our own research, we have postulated that metabolic effects of a combination of ascorbic acid, lysine, proline, green tea extract, arginine, N-acetyl cysteine, selenium, copper and manganese would result from their synergy. For example, we found that a combination of ascorbic acid, lysine and proline used with EGCG enhanced the anti-invasive activity of 20 µg/ml EGCG to that of 50 µg/ml (Roomi et al, 2004). Thus by including nutrients like N-acetyl cysteine, arginine, selenium, manganese and copper in addition to ascorbic acid, proline, lysine and EGCG we could obtain significant reduction in cell invasion at a much lower concentration of EGCG. Clearly, while five-year survival has improved with current multimodality pediatric rhabdomyosarcoma treatment, the associated toxicities are significant and can be fatal to the patient in later life. Likewise mutagenic

IV. Discussion The nutrient mixture demonstrated significant inhibition of human rhabdomyosarcoma cell invasive parameters in vitro. Matrigel invasion and MMP-2 and MMP-9 secretion of rhabdomyosarcoma cells decreased in a dose-dependent fashion with complete inhibition of MMP-2 and -9 at 500 µg/ml, and of Matrigel invasion at 500 µg/ml, demonstrating strong antimetastatic potential.

In addition NM demonstrated dose-dependent proapoptotic effects on rhabdomyosarcoma cells and profound induction of apoptosis and morphological changes at 500 µg/ml.

Matrix metalloproteinases (MMPs) have been implicated in the destruction of the extracellular matrix, neovascularization, tumor spread and metastases, and recent studies have shown overexpression of MMPs is associated with poor prognosis in cancer patients. Due to this, new treatment approaches have targeted universal pathomechanisms involved in cancer progression, such as control of proteolytic activity of the ECM as a potential strategy against cancer progression. A recent study reported that a high level of MMP-2 protein may contribute to the metastatic phenotype of aRMS showing potential for MMP-2 inhibition in the treatment of the aggressive alveolar subtype of rhabdomyosarcoma (Diomedi-Carnassei, 2004). While our study did not examine the effect of the nutrient mixture on inhibition of MMP-2 expression on the aRMS, MMP-2 secretion in the embryonal RMS cells was completely abolished at 500 µg/ml NM. The nutrient mixture was formulated based on targeting different physiological processes involved in cancer progression and metastasis. For example, the ECM integrity is dependent upon adequate collagen formation and its stability. In this aspect, ascorbic acid and the amino acids lysine and proline are necessary for the formation

139

Roomi et al: In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells Mandell L, Ghavimi F, LaQuaglia M, Exelby P (1990) Prognostic significance of regional lymph node involvement in childhood extremity rhabdomyosarcoma. Med Pediatr Oncol 18, 466-71.

Monje ML, Palmer T (2003) Radiation injury and neurogenesis.

Curr Opin Neurol 16, 129-34.

Morini M, Cai T, Aluigi MG, Noonan DM, Masiello L, De For a S, D’Agostini F, Albini A, Fassina G (1999) The role of the thiol N-acetyl cysteine in the prevention of tumor invasion and angiogenesis. Int J Biol Markers 14, 268-271.

Moulder JE, Cohen EP (2005) Radiation-induced multi-organ involvement and failure: the contribution of radiation effects on the renal system. BJR Suppl 27, 82-8.

Parham DM (2001) Pathologic classification of rhabdomyosarcomas and correlations with molecular studies.

Mod Pathol 14, 506-14.

Raney B, Heyn R, Hays DM, Tefft M, Newton WA Jr, Wharam M Vassilopoulou-Sellin R, Maurer HM (1993) Sequelae of treatment in 109 patients followed for 5 to 15 years after diagnosis of sarcoma of the bladder and prostate. A report from the Intergroup Rhabdomyosarcoma Study Committee.

Cancer 71, 2387-2394.

Rath M and Pauling L (1992) Plasmin-induced proteolysis and the role of apoprotein, lysine and synthetic analogs.

Orthomolecular Medicine 7, 17-23.

Roomi MW Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2004) Synergistic antitumor effect of ascorbic acid, lysine, proline, and epigallocatechin gallate on human fibrosarcoma cells HT-1080. Annals of Cancer Research and Therapy 12, 148-157.

Roomi MW, Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2005) Antitumor effect of nutrient synergy on human osteosarcoma cells U-2OS, MNNG-HOS and Ewing's sarcoma SK-ES.1. Oncol Rep 13, 253-7.

Roomi MW, Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2005) In vitro and in vivo antitumorigenic activity of a mixture of lysine, proline, ascorbic acid, and green tea extract on human breast cancer lines MDA-MB-231 and MCF-7. Med Oncol 22, 129-38.

Roomi MW, Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2005) Antitumor effect of a combination of lysine, proline, arginine, ascorbic acid, and green tea extract on pancreatic cancer cell line MIA PaCa-2. Int J Gastrointest Cancer 35, 97-102.

Roomi MW, Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2005) In vivo antitumor effect of ascorbic acid, lysine, proline and green tea extract on human colon cancer cell HCT 116 xenografts in nude mice: evaluation of tumor growth and immunohistochemistry. Oncol Rep 13, 421-5.

Roomi MW, Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2005) In vivo antitumor effect of ascorbic acid, lysine, proline and green tea extract on human prostate cancer PC-3 xenografts in nude mice: evaluation of tumor growth and immunohistochemistry. In Vivo 19, 179-83.

Roomi MW, Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2005) Modulation of N-methyl-N-nitrosourea induced mammary tumors in Sprague–Dawley rats by combination of lysine, proline, arginine, ascorbic acid and green tea extract.

Breast Cancer Research 7, R291-R295.

Skinner R (2003) Chronic ifosfamide nephrotoxicity in children.

Med Pediatr Oncol 41, 190-7.

Sklar C (2005) Maintenance of ovarian function and risk of premature menopause related to cancer treatment. J Natl Cancer Inst Monogr 34, 25-7.

Stevens MC, Rey A, Bouvet N, Ellershaw C, Flamant F, Habrand JL, Marsden HB, Martelli H, de Toledo JS, Spicer RD, Spooner D, Terrier-Lacombe MJ, van Unnik A, Oberlin O (2005) Treatment of nonmetastatic rhabdomyosarcoma in

risks of radiation therapy and chemotherapy that lead to secondary malignancies necessitate clinical evaluation of novel agents aimed at specific targets involved in metastatic behavior. The nutrient mixture studied induced apoptosis and exerted a strong inhibitory effect on cell invasion and MMP-2 and MMP-9 secretion in human rhabdomyosarcoma cells. These results combined with our previous findings demonstrate significant anticancer potential of the specific nutrients tested, indicating further investigation in vivo.

Acknowledgments The research was funded by Dr. Rath Health Foundation, a non-profit organization.

References Barr FG (1997) Molecular genetics and pathogenesis of rhabdomyosarcoma. J Pediatr Hematol Oncol 19, 483-91.

Chen Q, Espey MG, Krishna MC, Mitchell JB, Corpe CP, Buettner GR, Shacter E, Levine M (2005) Pharmacologic ascorbic acid concentrations selectively kill cancer cells: action as a pro-drug to deliver hydrogen peroxide to tissues.

Proc Natl Acad Sci U S A 102, 13604-9.

Cohen RJ, Curtis RE, Inskip PD, Fraumeni JF Jr (2005) The risk of developing second cancers among survivors of childhood soft tissue sarcoma. Cancer 103, 2391-6.

Cooke JP, Dzau VJ (1997) Nitric oxide synthase: Role in the genesis of vascular disease. Annu Rev Med 48, 489-509.

Darzy KH, Shalet SM (2005) Hypopituitarism after cranial irradiation. J Endocrinol Invest 28, 78-87.

Denys D, Kaste SC, Kun LE, Chadhary MA, Bowman LC, Robbins KT (1998) The effects of radiation on craniofacial skeletal growth: a quantitative study. Int J Pediatr Otorhinolaryngol 45, 7-13.

Diomedi-Camassei F, Boldrini R, Rava L, Donfancesco A, Boglino C, Messina E, Dominici C, Callea F (2004) Different pattern of matrix metalloproteinases expression in alveolar versus embryonal rhabdomyosarcoma. J Pediatr Surg 39, 1673-9.

Hare Y (2001) Green tea: Health Benefits and Applications, Marcel Dekker, New York, Basel.

Iarussi D, Indolfi P, Casale F, Martino V, Di Tullio MT; Calabrò R (2005) Anthracycline-induced cardiotoxicity in children with cancer: strategies for prevention and management.

Pediatr Drugs 7, 67-76.

Kawakami S, Kageyama Y, Fujii Y, Oshima H (2001) Inhibitory effects of N-acetyl cysteine on invasion and MMP 9 production of T24 human bladder cancer cells. Anticancer Res 21, 213-219.

Koscielniak E, Rodary C, Flamant F Carli M, Treuner J, Pinkerton CR, Grotto P (1992) Metastatic rhabdomyosarcoma and histologically similar tumors in childhood: a retrospective European multi-center analysis.

Med Pediatr Oncol 20, 209-14.

Kramer S, Meadows AT, Jarrett P, Evans AE (1983) Incidence of childhood cancer: experience of a decade in a populationbased registry. J Natl Cancer Inst 70, 49-55.

Landau JM, Wang ZY, Yang GY, Ding W, Yang CS (1998) Inhibition of spontaneous formation of lung tumors and rhabdomyosarcomas in A/J mice by black and green tea.

Carcinogenesis 19, 501-7.

Lipshultz SE, Colan SD, Gelber RD, Perez-Atayde AR, Sallan SE, Sanders SP (1991) Late cardiac effects of doxorubicin therapy for acute lymphoblastic leukemia in childhood. N Engl J Med 324, 80815.

140

Gene Therapy and Molecular Biology Vol 11, page 141 childhood and adolescence: third study of the International Society of Paediatric Oncology--SIOP Malignant Mesenchymal Tumor 89. J Clin Oncol. 23, 2618-28.

Sung L, Anderson JR, Donaldson SS, Spunt SL, Crist WM Pappo AS (2004) Soft Tissue Sarcoma Committee of the Children's Oncology Group. Late events occurring five years or more after successful therapy for childhood rhabdomyosarcoma: a report from the Soft Tissue Sarcoma Committee of the Children's Oncology Group. Eur J Cancer 40, 1878-85.

Taguchi T, Nazneen A, Abid MR, Razzaque MS (2005) Cisplatin-associated nephrotoxicity and pathological events.

Contrib Nephrol 148, 107-21.

Yang CS, Yang GY, Landau JM, Kim S, Liao J (1998) Tea and tea polyphenols inhibit cell hyperproliferation, lung tumorigenesis, and tumor progression. Exp Lung Res 24, 629-39.

Yoon SO, Kim MM, Chung AS (2001) Inhibitory effects of selenite on invasion of HT 1080 tumor cells. J Biol Chem 276, 20085-92.

141

Roomi et al: In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells

142

Gene Therapy and Molecular Biology Vol 11, page 143 Gene Ther Mol Biol Vol 11, 143-150, 2007

Transfection with glutathione-dependent dehydroascorbate reductase genes exerts cytoprotective effects against hydroperoxideinduced cell injury through vitamin C regeneration and oxidative-stress diminishment Research Article

Yasukazu Saitoh1, Yuriko Fukuoka1, Morimitsu Nishikimi2, Nobuhiko Miwa1,* 1

Laboratory of Cell-Death Control BioTechnology, Department of Life Sciences , Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, Shobara, Hiroshima 727-0023, Japan 2 Department of Biochemistry, Wakayama Medical University, Kimiidera, Wakayama 641-8509, Japan.

__________________________________________________________________________________ *Correspondence: Nobuhiko Miwa, Ph.D., Laboratory of Cell-Death Control BioTechnology Department of Life Sciences, Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, Nanatsuka 562, Shobara, Hiroshima 727-0023, Japan. Tel: +81824-74-1754; Fax: +81-824-74-0191; E-mail: miwa-nob@pu-hiroshima.ac.jp Key words: glutathione-dependent dehydroascorbate reductase, dehydroascorbic acid, ascorbic acid, reactive oxygen species, oxidative stress, cell death Abbreviations: 6-carboxy-2', 7'- dichlorodihydrofluorescein diacetate, di (acetoxymethyl ester), (CDCFH-DA); Chinese hamster ovary, (CHO); dehydroascorbic acid, (DehAsc); Dithiothreitol, (DTT); fluorescein isothiocyanate, (FITC); Glutathionee, (GSH); L-ascorbic acid, (Asc); MDA reductase, (MDAR); Monodehydroascorbate, (MDA); tert-butyl hydroperoxide, (t-BuOOH) Received: 7 May 2007; Revised: 25 May 2007 Accepted: 29 May 2007; electronically published: July 2007

Summary To evaluate the potential for utilization of overexpression of glutathione (GSH)-dependent dehydroascorbate (DehAsc) reductase (DHAR) as a tool to alleviate deleterious effects induced by an oxidative stress, the effect of overexpressed DHAR on tert-butylhydroperoxide (t-BuOOH)-induced cell injury was examined using DHAR gene (dhar)-transfected Chinese hamster ovary (CHO) cells. The transfected dhar products-derived DHAR was shown to be expressed all over the cytoplasm rather than in the nucleus, and repressed t-BuOOH-induced cell death, DNA strand cleavages, and intracellular reactive oxygen species (ROS)-generation in cells pretreated with DehAsc plus GSH isopropylester, but not without such pretreatment in contrast to no repression in their vector-transfected counterparts with such pretreatment. Upon the similar pretreatment, the intracellular levels of both ascorbic acid (Asc) and total vitamin C (Asc plus DehAsc) were 1.4- to 1.7-fold higher in dhar-transfected cells than in the vectortransfectants. Thus, our results suggest that overexpressed DHAR exerts cytoprotective effects against hydroperoxide-induced cell injury, and that more abundant intracellular Asc accumulation induced by expression of exogenous dhar may be involved in the mechanism.

regeneration of alpha-tocopheroxyl radicals to alphatocopherol at the membrane interface (Niki, 1991). These antioxidant properties of Asc are based on its univalent or divalent oxidation (Figure 1). The univalent oxidation of Asc produces the short-lived radical to Asc and dehydroascorbic acid (DehAsc). The divalent oxidation of Asc leads to the formation of DehAsc, which readily undergoes irreversible hydrolysis to 2, 3-

I. Introduction L-ascorbic acid (Asc) plays an important role in cellular defense mechanisms against oxidative stress. Asc not only scavenges a variety of aqueous reactive oxygen species (ROS) including superoxide anion radical, singlet oxygen, hydroxyl radical, and water-soluble peroxyl radicals (Halliwell and Gutteridge, 1990), but also takes part in the prevention of lipid peroxidation by reductive

143

Saitoh et al: Repressive effect of DHAR on t-BuOOH-induced cell death novel GSH-dependent dehydroascorbate reductase (DHAR) was purified from rat liver cytosol (Maellaro et al, 1994) and human red cells (Xu et al, 1996). Ishikawa et al. cloned the corresponding gene (dhar) from a rat liver cDNA library and achieved the functional expression of DHAR in Chinese hamster ovary (CHO) cells (Ishikawa et al, 1998). They demonstrated that the DHAR-expressing cells accumulated 1.7-fold more total vitamin C than nontransfected cells.

Based on these results, we speculated that overexpressed DHAR can suppress ROS generation and oxidative stress-induced cellular damages by increasing of intracellular Asc. In the present study, we used dhartransfected CHO cells to investigate the repressive effects of DHAR on oxidative stress-induced cellular injuries resulting from the chemical oxidant tert-butyl hydroperoxide (t-BuOOH), an analogue of short-chain lipid hydroperoxide.

ROS, oxidase, peroxidase, Fe3+, Cu2+ etc.

Oxidation

Asc

MDA

MDAR NAD(P) +

NAD(P)H

GSSG

Oxidation

DHAR 2GSH

DehAsc

II. Materials and Methods

2, 3-diketogulonic acid

A. Cell culture Rat liver glutathione-dependent dehydroascorbate reductase gene (dhar) in a pRC/CMV vector-transfected CHO cells (DHAR (+)) and the corresponding nontransfectant (transfected with pRc/CMV only) CHO cells (DHAR (-)) were obtained by electroporation and the subsequent colony selection (Ishikawa et al, 1998). DHAR (+) cells were cultured in Dulbecco's modified Eagle's medium (DMEM, GIBCO BRL, Grand Island, NY, USA) containing 10% heat-inactivated fetal calf serum (FBS, GIBCO BRL), 50 units/mL penicillin, 50 Âľg/mL streptomycin, and 400 Âľg/mL geneticin disulfate (Wako Pure Chemical Industries, Osaka, Japan) at 37 oC in a humidified atmosphere of 95% air and 5% CO 2. DHAR (-) cells were cultured in the same medium without geneticin disulfate.

Figure 1. Metabolism of ascorbic acid in mammalian cells.

Ascorbic acid (Asc) is oxidized to monodehydroascorbic acid (MDA) by various types of oxidative stress, such as ROS. MDA is reversibly converted to Asc by MDA reductase (MDAR), localized mainly in the outer mitochondrial membrane, microsomes, and the Golgi apparatus. MDA is further oxidized to dehydroascorbic acid (DehAsc), or, alternatively, nonenzymatically converted to Asc and DehAsc through a disproportionation reaction. DehAsc is easily and irreversibly hydrolyzed to 2, 3-diketogulonic acid unless reduced to Asc by DehAsc reductase (DHAR) using glutathione as the reductant.

B. Evaluation of cell-growth ratio

diketogulonic acid. Although Asc and its oxidized forms are generally unstable in physiological environments, it is known that plants and animals possess an Asc regeneration system. Humans and other primates cannot synthesize Asc due to lack of L-gulono-1, 4-lactone oxidoreductase, which is required for the final step in Asc synthesis. Therefore, for humans and primates who can get Asc only from dietary sources, systems for regeneration of Asc from its oxidized forms would be quite important to protect cells from harmful ROS-induced oxidation.

The regeneration system for Asc mainly consists of two pathways associated with MDA or DehAsc reduction.

MDA is converted to Asc through spontaneous disproportionation or enzymatic reduction by MDA reductase (MDAR), which is an NAD(P)H-dependent enzyme localized at subcellular membranes of mitochondria (Ito et al, 1981), microsomes, and the Golgi apparatus (Hara and Minakami, 1971; Green and O'Brien, 1973). On the other hand, DehAsc is converted to Asc through nonenzymatic reduction by glutathione (GSH) or diverse enzymes such as with glutaredoxin (Wells et al, 1990; Park and Levine, 1996), protein disulphide disulfide isomerase (Wells et al, 1990), 3!-hydroxysteroid dehydrogenase (Del et al, 1994) and thioredoxin reductase (May et al, 1997). Because of the slowness in the nonenzymatic reducing reaction, much attention has been directed to enzymatic reduction of DehAsc. Recently, a

Cell-growth ratio was assessed based on mitochondrial enzymatic conversion of WST-1 [2-(4-iodophenyl)-3-(4nitrophenyl)-5-(2.4-disulfophenyl)-2H-tetrazolium, sodium salt] (Dojindo, Kumamoto, Japan) to yellowish formazan, which is indicative of the number of viable cells. After t-BuOOH treatment, cells were rinsed with phenol red (PR)-free DMEM and then incubated for 3 hr in PR-free DMEM containing 10% WST-1 at 37 oC. The absorbance at 450 nm was measured with a microplate reader (model 3550, Bio-Rad, Hercules, CA, USA).

C. Immunocytochemical staining of DHAR Cells were grown on poly-L-lysine-coated chamber slides (ASAHI TECHNO GLASS, Chiba, Japan) and washed with phosphate-buffered saline (PBS) and fixed in a freshly prepared solution of 4% paraformaldehyde in PBS for 30 min at room temperature. The cells were permeabilized in PBS containing 0.5% Triton X-100 for 5 min on ice, and then incubated with primary antibody against rat DHAR diluted 1 : 100 in PBS containing 1% bovine serum albumin for 1 hr at 37 oC. The cells were then washed three times with PBS and incubated with a secondary antibody, fluorescein isothiocyanate (FITC)-labeled anti-rabbit IgG, for 30 min at 37 oC. The slides were washed with PBS, mounted with anti-fading solution, and observed with a laser scanning confocal fluorescence microscope MRC-600 (BioRad).

D. TUNEL staining Apoptotic nuclei were detected in situ by the TUNEL (Terminal deoxyribonucleotidyl transferase-mediated dUTP nick

144

Gene Therapy and Molecular Biology Vol 11, page 145 end labeling) assay with an In situ Apoptosis Detection Kit (Takara, Kyoto, Japan). Cells were grown on poly-L-lysinecoated chamber slides (ASAHI TECHNO GLASS). After tBuOOH treatment, cells were washed three times with PBS and fixed in a freshly prepared solution of 4% paraformaldehyde in PBS for 30 min at room temperature. For blocking endogenous peroxide, cells were treated with methanol containing 0.3% hydrogen peroxide for 15 min at room temperature. Then, the cells were permeabilized with permeabilization buffer for 5 min on ice. To label DNA strand cleavage termini, cells were incubated with TUNEL reaction mixture containing TdT and FITC-labeled dUTP in the binding buffer and incubated for 90 min at 37 oC in a humidified atmosphere. Thereafter, the slides were washed three times with PBS and mounted with anti-fading solution. The slides were observed with a laser scanning confocal fluorescence microscope ECLIPSE E600 (Nikon, Tokyo, Japan), and pseudo-color images were produced using AQUACOSMOS software (HAMAMATSU Photonics, Shizuoka, Japan). All of the TUNEL stains were done at the same time and photographed under the same conditions.

III. Results A. Expression and distribution of DHAR in dhar-transfected DHAR (+) cells To confirm the expression of DHAR proteins, we conducted immunocytochemical staining and observed the distribution of DHAR. In DHAR (+) cells, DHAR was abundantly expressed and widely scattered in the cytoplasm, but not present in the nucleus (Figure 2). In contrast, DHAR was scarcely detected in DHAR (-) cells.

B. Preventive effect of DHAR on tBuOOH-induced cell death The effect of DHAR overexpression and administration with DehAsc and/or GSH-iPr on cells exposed to t-BuOOH was examined by the WST-1 assay.

DehAsc is transported into cells via glucose transporters (Vera et al, 1993; Welch et al, 1995; Wilson, 2005), and GSH-iPr readily diffuses into cells and is hydrolyzed by intracellular esterases to GSH. The cell-growth ratio of both DHAR (+) and DHAR (-) cells was notably decreased in a dose-dependent manner by treatment with tBuOOH (0, 150, or 200 µM) for 27 hr (Figure 3). Thus, the decrease of cell-growth ratio was not alleviated only by overexpressin of DHAR without supplied enzymatic substrates. And the recovery of cell-growth ratio was not observed by previous administration with either DehAsc or GSH-iPr alone in DHAR (-) cells, either. However, previous administration with DehAsc and GSH-iPr significantly attenuated the decrease of cell-growth ratio in DHAR (+) cells as compared with DHAR (-) cells.

E. Measurement of intracellular ROS Intracellular ROS production was determined based on oxidative conversion of 6-carboxy-2', 7'dichlorodihydrofluorescein diacetate, di (acetoxymethyl ester) (CDCFH-DA) (Molecular Probes, Eugene, OR, USA) to CDCF, which is indicative of the amount of intracellular peroxide production. Cells were rinsed with PR-free DMEM and incubated for 45 min in PR-free DMEM containing 100 µM CDCFH-DA at 37oC. After they were rinsed with PR-free DMEM again, the cells were treated with t-BuOOH. Then, the cells were rinsed three times with PR-free DMEM and the fluorescence intensity was measured with a fluorescence microplate reader (CytoFluor 2350, Millipore, Bedford, MA, USA) with excitation and emission wavelengths of 485 nm and 530 nm, respectively. Finally, the cells were observed with a fluorescence microscope ECLIPSE E600 (Nikon).

F. Determination of intracellular Asc and total Asc Cells were washed with PBS and collected by trypsinization. The cell number was measured using a particle analyzer CDA-500 (Sysmex, Hyogo, Japan). Then, the cells were centrifuged at 500!g for 5 min at 4 oC and resuspended in HPLC mobile phase (99% 0.1 M KH 2PO4-H3PO 4-1% methanol buffer (pH 2.5) containing 50 mg/L octanesulfonic acid and 5 mg/L EDTA-2Na) containing 50 µM dithiothreitol (DTT). The cells were lysed by sonication and the freeze-thaw method, the lysate was centrifuged at 500!g for 5 min at 4 oC and the supernatant was collected. After removal of proteins with an ULTRA FILTER UNIT USY-1 (ADVANTEC, Tokyo, Japan), a 20 µL aliquot was injected on an Eicompak SC-5DS column of 3.0!150 mm (Eicom, Kyoto, Japan) connected to an HPLC pump (Shimazu LC-10AT ; Shimazu; Kyoto, Japan), and developed with a mobile phase at a flow rate of 0.5 mL/min at 25 oC. Asc was detected with an amperometric electrochemical detector (ECD) Eicom ECD-300 (Eicom) operated at 600 mV. For the measurement of total Asc, DTT was added to an aliquot of the same sample for Asc measurement (final 12.5 mM) for reduction of DehAsc to Asc. Standard Asc solutions of 0-500 nM were prepared in the HPLC buffer and freshly diluted just before use.

Figure 2. Immunocytochemical detection of DHAR in dhartransfected (DHAR (+)) or non-transfected (DHAR (-)) Chinese hamster ovary (CHO) cells. Cells were plated at a density of 1.0 x 104 cell/cm2 on a chamber slide. After preincubation for 18-21 hr, the cells were subjected to immunocytochemical staining, and the FITC-derived fluorescence was detected by fluorescence microscopy. The “nucleus”- and “cytoplasm”- photographs were obtained by focusing on the nucleus and cytoplasmic areas, respectively. The scale bar indicates 10 µm.

G. Statistical analysis The unpaired Student’s t-test was used to evaluate the significance of differences between groups, and the criterion of statistical significance was taken as P < 0.05.

145

Saitoh et al: Repressive effect of DHAR on t-BuOOH-induced cell death

Figure 3. Preventive effect of dhar transfection and administration with DehAsc and/or GSH-iPr as DHAR substrates on t4 2 BuOOH-induced cell death. DHAR (+) or DHAR (-) cells were seeded at a density of 1.0 ! 10 cells/cm in 24-well plates, and preincubated for 21 hr. The cells were treated with 100 µM DehAsc and/or 50 µM GSH-iPr for 2 hr, and then treated with various concentrations of t-BuOOH (0, 150, or 200 µM) for 27 hr. Cell-growth ratio was assessed by the WST-1 assay. The bar represents the S.D. of triplicate wells. Significantly different from DHAR (-) cells: *P < 0.05.

Therefore, administration with DehAsc plus GSH-iPr induced a cytoprotective effect against the cytotoxic response to t-BuOOH, and this effect was more notable in DHAR (+) cells than in DHAR (-) cells.

intracellular ROS levels using fluorometry and the fluorescein derivative CDCFH-DA as a redox indicator.

C. Inhibitory effect of administration with DehAsc plus GSH-iPr on t-BuOOHinduced nuclear DNA strand cleavages in DHAR (+) cells The effect of administration with DehAsc plus GSHiPr on t-BuOOH-induced nuclear DNA strand cleavages was investigated by the TUNEL staining assay. Cells that were treated with t-BuOOH showed an intensely red pseudo-color corresponding to brightly fluorescent staining in the nuclei (Figure 4A, center) and an increase in the frequency of DNA cleavages (Figure 4B, center), indicating the incorporation of fluorescein dUTP onto nicked DNA strand terminals. The nuclear DNA strand cleavages were strongly suppressed by administration with DehAsc plus GSH-iPr, but not in their absence (Figure 4A, B). These results suggest that administration with DehAsc plus GSH-iPr exerted protective effects against tBuOOH-induced nuclear DNA strand cleavages in DHAR (+) cells.

Figure 4. Preventive effect of dhar transfection and administration with DehAsc plus GSH-iPr as DHAR substrates on t-BuOOH-induced nuclear DNA strand cleavages in DHAR (+) cells. (A) Cells were seeded as in Figure 2 and preincubated for 21 hr. The cells were treated with 100 µM DehAsc plus 50 µM GSH-iPr for 2 hr before exposure to tBuOOH at 400 µM for 1 hr, the maximum period for DNA cleavages, followed by TUNEL stain and the subsequent fluorography. (B) The histograms represent the fluorescence distribution, which reflects the degree of DNA cleavages and its frequency. The scale bar indicates 15 µm.

D. Preventive effect of DHAR and administration with DehAsc plus GSH-iPr on t-BuOOH-induced intracellular oxidative stress To examine whether DHAR and administration with DehAsc plus GSH-iPr could prevent t-BuOOH-induced intracellular ROS production, we quantified the

146

Gene Therapy and Molecular Biology Vol 11, page 147 After permeation into cells, CDCFH-DA is esterolyzed to CDCFH, being made membrane-impermeable, and oxidized to highly fluorescent CDCF primarily by H2O2, hydroperoxides, and diverse peroxides (Sejda et al, 1984).

Treatment with t-BuOOH significantly increased the intracellular ROS levels in both DHAR (+) and DHAR (-) cells (Figure 5(A)). However, previous administration with DehAsc plus GSH-iPr markedly suppressed the increase in intracellular ROS in DHAR (+) cells, but not in DHAR (-) cells. Similar results were also observed using fluorescence microscopy (Figure 5(B)). Previous administration with DehAsc plus GSH-iPr strongly inhibited the irradiance of intracellular fluorescence from the redox indicator CDCFH.

E. Accumulation of intracellular vitamin C in DHAR (+) cells To examine the changes of intracellular total vitamin C (Asc plus DehAsc) and Asc levels after administration with DehAsc plus GSH-iPr, we quantified the intracellular amounts of both total vitamin C and Asc by HPLC and amperometric ECD detection. Intracellular levels of both total vitamin C and Asc increased for 2 hr after administration with DehAsc plus GSH-iPr in either DHAR (+) or DHAR (-) cells (Figures 6(A), (B)). The intracellular amounts of both total vitamin C and Asc in DHAR (+) cells were approximately 1.5- to 1.7-fold higher than those in DHAR (-) cells, respectively. These results suggested that the capacities to accumulate total vitamin C and Asc in DHAR (+) cells were superior to those in DHAR (-) cells.

Figure 5. Preventive effect of dhar-transfection and administration with DehAsc plus GSH-iPr as DHAR substrates on t-BuOOH-induced intracellular reactive oxygen species (ROS) production.(A) Cells were seeded as in Figure 3 and preincubated for 18 hr. The cells were treated with 100 µM DehAsc plus 50 µM GSH-iPr for 2 hr, and then incubated with CDCFH-DA for 45 min. Thereafter, the cells were incubated with or without 150 µM t-BuOOH for 0.5 hr, and intracellular fluorescence was measured with a fluorescence microplate reader (ex: 485 nm; em: 530 nm). The bar represents the S.D. of triplicate wells. Significantly different from 0-µM t-BuOOH group with respective treatment: *P < 0.01; **P < 0.01; N.S.: not significant. (B) Cells were treated in the same manner as in (A).

After t-BuOOH exposure, the fluorescence intensity was detected by fluorescence microscopy. The scale bar indicates 15 µm.

Figure 6. Intracellular total vitamin C (Asc + DehAsc) and Asc levels after administration with DehAsc plus GSH-iPr in DHAR (+) and DHAR (-) cells. (A) Cells were seeded at a 4 2 density of 1.0x10 cells/cm on a 60-mm dish and preincubated for 18 hr. Cells were treated with 100 µM DehAsc plus 50 µM GSH-iPr for 0 or 2 hr, and then intracellular total vitamin C and Asc were measured by HPLC and amperometric ECD detection.

Error bars are S.D. of 4 dishes. Significantly different from 0 hr: *P < 0.05. (B) Typical chromatograms of no additive (0 hr in DHAR (+) cells), DHAR(-) (2hr in DHAR(-) cells), and DHAR(+) (2hr in DHAR(+) cells) are shown. The first and second peaks at approximately 3 and 15 min are assigned to Asc and DTT, respectively.

147

Saitoh et al: Repressive effect of DHAR on t-BuOOH-induced cell death because overexpressed DHAR was more effective against t-BuOOH-induced cell injury.

In summary, our results suggest that overexpressed DHAR exerts cytoprotective effects against hydroperoxide-induced cell injury, and that overexpressed DHAR-induced more abundant intracellular Asc accumulation may contribute its cytoprotective mechanism. Thus, DHAR is suggested to be one of the possible candidates for controlling of oxidative stressinduced cell injury.

IV. Discussion In the present study, we paid attention to DHAR, which enables recycling of Asc by reduction of DehAsc to Asc, and tried to determine the possibility of utilization of overexpressed DHAR as a tool to alleviate deleterious effects induced by an oxidative stress. Our results showed that t-BuOOH-induced cell death was suppressed only by administration with DehAsc plus GSH-iPr in DHAR (+) cells (Figure 3), and not by administration with either DehAsc or GSH-iPr alone. Thus, coexistence of both DehAsc and the GSH derivative is necessary to exert protective effects against oxidative stress in DHAR (+) cells. These results suggest that the cytoprotective effects are due to the reductive reaction by DHAR, which reduces DehAsc to Asc by using GSH as the reductive cofactor.

Our results also showed that t-BuOOH-induced DNA strand cleavages, and ROS generation were suppressed by administration with DehAsc plus GSH-iPr in DHAR (+) cells (Figures 4, 5). Because it is known that excessive ROS induces DNA strand cleavages and subsequently cell death (Saitoh et al, 2003; Saitoh and Miwa, 2004), the suppression of ROS generation in DHAR (+) cells seems to be a most critical point for the prevention of cell death.

Our results also demonstrated that the intracellular amounts of both Asc and total vitamin C (Asc plus DehAsc) were 1.4- to 1.7-fold higher in DHAR (+) cells than DHAR (-) cells upon administration with DehAsc plus GSH-iPr (Figures 6). It was previously demonstrated that DHAR-transfected CHO cells could accumulate a 1.7fold higher amount of total vitamin C compared with that of nontransfected cells (Ishikawa et al, 1998), but it was not clear about intracellular amounts of Asc. Asc, one of the major intracellular water-soluble antioxidant substances (Halliwell and Gutteridge, 1990), promptly scavenges ROS at an initial stage of ROS generation.

Plasma lipoproteins exposed to aqueous peroxy radicals undergo no hydroperoxidation until depletion of endogenous Asc, which is consumed more rapidly and earlier than other plasma ROS-scavengers such as SH groups, alpha-tocopherol, bilirubin and urate, suggesting that Asc efficiently protects biomolecules, including lipids, from oxidative damages (Frei et al, 1984).

Moreover, it is also well-known that Asc is transported into cells and accumulated to high concentrations (Washko et al, 1990; Welch et al,! 1995; Saitoh et al, 1997).

Therefore, Asc plays an important role for the protection of cellular components from oxidative stress-induced injury, and the enhancement of intracellular amounts of Asc was quite important for cytoprotection against oxidative stress. Since the decrease of cell-growth ratio in DHAR (+) cells was significantly attenuated as compared with that in DHAR (-) cells (Figure 3), we supposed that the enhancement of intracellular Asc accumulation by overexpressed DHAR was correlated with the intracellular antioxidant potential and suppressed the ROS generation, resulting in decreased DNA strand cleavages and cell death. On the other hand, our result implied the presence of endogenous DHAR in CHO cells, because Asc was accumulated also in DHAR (-) cells. However, our data indicated that exogenous DHAR exerts the inherent enzymatic function similar to that of endogeous DHAR,

Acknowledgments The authors thank Dr. Norio Nagao, Mr. Liao Feng and Ms. Kikuko Yoshimitsu for their technical assistance.

The present study was supported in part by Grant-in-Aid for Scientific Research, Basis Research (C), 17590064, in 2005-2007 to N.M from the Ministry of Education, Science, Sports and Culture, Japan.

References Del Bello B, Maellaro E, Sugherini L, Santucci A, Comporti M, Casini AF (1994) Purification of NADPH-dependent dehydroascorbate reductase from rat liver and its identification with 3 alpha-hydroxysteroid dehydrogenase.

Biochem J. 304(Pt 2), 385-390.

Frei B, Stocker R, Ames BN (1988) Antioxidant defenses and lipid peroxidation in human blood plasma. Proc Natl Acad Sci U S A 85, 9748-9752.

Green RC, O'Brien PJ (1973) The involvement of semidehydroascorbate reductase in the oxidation of NADH by lipid peroxide in mitochondria and microsomes. Biochim Biophys Acta 293, 334-342.

Halliwell B (1990) Gutteridge JM. The antioxidants of human extracellular fluids. Arch Biochem Biophys 280, 1-8.

Hara T, Minakami S (1971) On functional role of cytochrome b5.

II. NADH-linked ascorbate radical reductase activity in microsomes. J Biochem (Tokyo) 69, 325-330.

Ishikawa T, Casini AF, Nishikimi M (1998) Molecular cloning and functional expression of rat liver glutathione-dependent dehydroascorbate reductase. J Biol Chem 273, 2870828712.

Ito A, Hayashi S, Yoshida T (1981) Participation of a cytochrome b5-like hemoprotein of outer mitochondrial membrane (OM cytochrome b) in NADHsemidehydroascorbic acid reductase activity of rat liver.

Biochem Biophys Res Commun 101, 591-598.

Maellaro E, Del Bello B, Sugherini L, Santucci A, Comporti M, Casini AF (1994) Purification and characterization of glutathione-dependent dehydroascorbate reductase from rat liver. Biochem J 301(Pt 2), 471-476.

May JM, Mendiratta S, Hill KE, Burk RF (1997) Reduction of dehydroascorbate to ascorbate by the selenoenzyme thioredoxin reductase. J Biol Chem 272, 22607-22610.

Niki E (1991) Selected vitamins, minerals and functional consequences of maternal malnutrition. In: World Rev Nutr Diet, Karger, Basel, 1-30.

Park JB, Levine M (1996) Purification, cloning and expression of dehydroascorbic acid-reducing activity from human neutrophils: identification as glutaredoxin. Biochem J 315(Pt 3), 931-938.

Saitoh Y, Nagao N, O'Uchida R, Yamane T, Kageyama K, Muto N, Miwa N (1997) Moderately controlled transport of ascorbate into aortic endothelial cells against slowdown of the cell cycle, decreasing of the concentration or increasing

148

Gene Therapy and Molecular Biology Vol 11, page 149 of coexistent glucose as compared with dehydroascorbate.

Mol Cell Biochem 173, 43-50.

Saitoh Y, Ouchida R, Kayasuga A, Miwa N (2003) Antiapoptotic defense of bcl-2 gene against hydroperoxideinduced cytotoxicity together with suppressed lipid peroxidation, enhanced ascorbate uptake, and upregulated Bcl-2 protein. J Cell Biochem 89, 321-334.

Saitoh Y and Miwa N (2004) Cytoprotection of vascular endotheliocytes by phosphorylated ascorbate through suppression of oxidative stress that is generated immediately after post-anoxic reoxygenation or with alkylhydroperoxides.

J Cell Biochem 93, 653-663.

Sejda P, Parce JW, Seeds MS, Bass DA (1984) Flow cytometric quantitation of oxidative produce formation by polymorphonuclear leukocytes during phagocytosis. J Immunol 133, 3303-3307.

Vera JC, Rivas CI, Fischbarg J, Golde DW (1993) Mammalian facilitative hexose transporters mediate the transport of dehydroascorbic acid. Nature 364, 79-82.

Washko P, Rotrosen D, Levine M (1990) Ascorbic acid accumulation in plated human neutrophils. FEBS Lett 260, 101-104.

Welch RW, Wang Y, Crossman A Jr, Park JB, Kirk KL, Levine M (1995) Accumulation of vitamin C (ascorbate) and its oxidized metabolite dehydroascorbic acid occurs by separate mechanisms. J Biol Chem 270, 12584-12592.

Wells WW, Xu DP, Yang YF, Rocque PA (1990) Mammalian thioltransferase (glutaredoxin) and protein disulfide isomerase have dehydroascorbate reductase activity. J Biol Chem 265, 15361-15364.

Wilson JX (2005) Regulation of vitamin C transport. Annu Rev Nutr 25, 105-125.

Xu DP, Washburn MP, Sun GP, Wells WW (1996) Purification and characterization of a glutathione dependent dehydroascorbate reductase from human erythrocytes.

Biochem Biophys Res Commun 221, 117-121.

149

Saitoh et al: Repressive effect of DHAR on t-BuOOH-induced cell death

150

Gene Therapy and Molecular Biology Vol 11, page 151 Gene Ther Mol Biol Vol 11, 151-160, 2007

Adenovirus-mediated Expression of both Antisense Ornithine Decarboxylase (ODC) and Sadenosylmethionine Decarboxylase (AdoMetDC) inhibits human esophageal squamous carcinoma cell growth Research Article

Hui Tian1,*, Xian-Xi Liu2, Bing Zhang2, Qi-Feng Sun1, Dong-Feng Sun1 1 2

Department of Thoracic Surgery, Qi Lu Hospital, Shandong University, Jinan 250012, China Department of Medicine, Medical molecular biology experimental center, Shandong University, Jinan 250012, China

__________________________________________________________________________________ *Correspondence: Hui Tian, Department of Thoracic Surgery, Qi Lu Hospital, Shandong University, Jinan 250012, China; Tel: 860531-82169463; E-mail: tianhuiy@sohu.com Key words: Ornithine decarboxylase, S-adenosylmethionine decarboxylase, Polyamine, Esophageal neoplasms, Eca109 cell line, Gene therapy Abbreviations: bicinchoninic acid (BCA); coxsackie adenovirus receptor (CAR); cyclin-dependent kinases (cdks); cytomegalovirus (CMV); decarboxylated Sadenosylmethionine (dcSAM); Difluoromethylornithine (DFMO); dodecyl sulfate (SDS); Dulbeccoâ&#x20AC;&#x2122;s modified Eagleâ&#x20AC;&#x2122;s medium (DMEM); green fluorescent protein (GFP); high-performance liquid chromatography (HPLC); methylglyoxalbis (guanylhydrazone) (MGBG); monoclonal antibody (mAb); multiplicities of infection (MOIs); ornithine decarboxylase (ODC); reversetranscription polymerase chain reaction (RT-PCR); S-adenosylmethionine decarboxylase (AdoMetDC)

This work was supported by the grants from the national natural science foundation of China (No.30571844) Received: 28 February 2007; Revised: 21 Jun3 2007 Accepted: 2 July 2007; electronically published: July 2007

Summary Polyamine biosynthesis is controlled primarily by ornithine decarboxylase (ODC) and S-adenosylmethionine decarboxylase (AdoMetDC). Antisense ODC and AdoMetDC sequences were cloned into an adenoviral vector (AdODC-AdoMetDCas). To evaluate the effect of recombinant adenovirus Ad-ODC-AdoMetDCas which can simultaneously express both antisense ODC and S-adenosylmethionine decarboxylase (AdoMetDC), the human esophageal squamous carcinoma cell line Eca109, was infected with Ad-ODC-AdoMetDCas as well as with control vector. Viable cell counting, determination of polyamine concentrations, cell cycle analysis, and Matrigel invasion assays were performed in order to assess the properties of tumor growth and invasiveness. Our study demonstrated that adenovirus-mediated ODC and AdoMetDC antisense expression inhibits tumor cell growth through a blockade of the polyamine synthesis pathway. This inhibitory effect cannot be reversed by the administration of putrescine.

Tumor cells were arrested at the G1 phase of the cell cycle after gene transfer and had reduced invasiveness. Our study suggests that as a new anticancer reagent, the recombinant adenovirus Ad-ODC-AdoMetDCas holds promising hope for the therapy of esophageal cancers.

growth and differentiation. In mammalian cells, the intracellular polyamine biosynthetic pathway is primarily regulated by the action of two rate-limiting enzymes.

Ornithine decarboxylase (ODC) is the first key enzyme required for polyamine synthesis, decarboxylating ornithine to produce putrescine (Tian et al, 2006b). The

I. Introduction Polyamines are naturally occurring aliphatic polycations found in almost all living organisms.

Polyamines include spermidine, spermine, and their diamine precursor, putrescine (Tian et al, 2006a).

Polyamines have critical physiological functions in cell

151

Tian et al: Adenovirus-mediated Expression of both ODC and AdoMetDC USA) containing 10% fetal bovine serum. All cells were cultured in a 5% CO2 incubator at 37!.The polyamine standards (putrescine, spermidine, and spermine) and densyl chloride for high-performance liquid chromatography (HPLC) were purchased from Sigma (St. Louis, MO, USA). An anti-ODC mouse monoclonal antibody (mAb) and an anti-AdoMetDC mouse polyclonal antibody were prepared in our laboratory. An anti-p21 (sc-6246) mousemAb and an antiactin (sc-1616) goat polyclonal antibody were purchased from Santa Cruz Biotechnology. Matrigel and Transwell plates were obtained from BD Biosciences (Bedford, MA, USA) and Costar (Cambridge, MA, USA), respectively.

second, rate-limiting enzyme is S-adenosylmethionine decarboxylase (AdoMetDC). It generates the aminopropyl donor, decarboxylated Sadenosylmethionine (dcSAM), by decarboxylating adenosylmethionine. DcSAM donates its propylamine moiety for the formation of spermidine and spermine via catalysis by spermidine synthase and spermine synthase, respectively.

The association of increased polyamine synthesis with cell proliferation and cancer progression was first reported in the late 1960s. High polyamine levels and elevated polyamine synthesis activity were found in many tumors. Environmental and genetic risk factors for cancer, such as ultraviolet light (Ahmad et al, 2001) and various oncogenes (Holtta et al, 1988; Sistonen et al, 1989; Auvinen et al, 1992), have been reported to induce high ODC activity in normal tissues. Overexpression of ODC or AdoMetDC was also reported to cause malignant transformation of NIH3T3 cells (Auvinen et al, 1992; Paasinen-Sohns et al, 2000). Therefore, inhibition of ODC and/or AdoMetDC activity might induce a depletion of intracellular polyamines, providing an effective anticancer treatment strategy. Previous work has primarily focused on the development of polyamine synthesis inhibitors.

Difluoromethylornithine (DFMO) irreversibly inactivates ODC activity and has been used in clinical chemoprevention trials for epithelial cancers, including colon, breast, cutaneous, and prostate malignancies (Meyskens and Gerner, 1999). AdoMetDC inhibitors, such as methylglyoxalbis (guanylhydrazone) (MGBG), have also been shown to inhibit tumor growth (Warrell and Burchenal, 1983). SAM486A is a new AdoMetDC inhibitor that has been shown to possess anti-proliferative activity in both tissue culture cells and preclinical animal studies (Regenass et al, 1994).

Esophageal cancer is one of the most lethal cancers known to mainland in China because of the high incidence and high mortality. Metastatic esophageal cancer is essentially resistant to systemic cytotoxic chemotherapy, while external beam and radioisotope radiotherapy offers only symptom palliation. The development of novel therapies, such as gene therapy, is of high priority.

In the present study, we constructed a replicationdeficient recombinant adenovirus containing antisense sequences of both ODC and AdoMetDC (AdODCAdoMetDCas) to downregulate their gene expression levels simultaneously. Our data show that downregulation of these two key enzymes by Ad-ODC-AdoMetDCas significantly inhibited esophageal cancer cell growth and tumor invasiveness in vitro. The tumor cells were arrested in the G1 phase of the cell cycle. Polyamine levels were significantly decreased in Ad-ODC-AdoMetDCas-treated cells compared with controls.

B. Construction of Ad-ODC-AdoMetDCas The construction of the adenoviral vector, rAdODC/EX3as, containing antisense ODC sequence with both a cytomegalovirus (CMV) promoter and a green fluorescent protein (GFP) gene, was reported previously (Zhang et al, 2005).

To construct an adenoviral vector harboring additional antisense AdoMetDC sequence, a 205-bp cDNA fragment of the 5' end of the AdoMetDC gene was ampli-fied by reverse-transcription polymerase chain reaction (RT-PCR) using specific primers and was subcloned downstream of the ODC gene in the pAd-ODCas vector in the reverse direction. The forward primer was 5'GGTCTAGATTCGCTAGTCTCACGGTGAT3' and the reverse primer was 5'GGCTCGAGTAAGCTTCCTGCTTGTCAGT3'. The sequence of the resulting clone, pAd-ODC-AdoMetDCas, was confirmed by sequencing and was then linearized by digestion with Pme I and transformed into Adeasier-1 cells containing the 33-kb pAdeasy-1 vector to generate recombinant clones as previously described (He et al, 1998). The recombinant adenovirus genome was digested with Pac I and transfected into HEK293 cells with Lipofectamine2000 (Invitrogen USA) for the isolation of recombinant adenovirus.Recombinant viral plaques were identified and amplified by PCR in order to verify ligation success. The recombinant virus particles were purified by CsCl ultracentrifugation (Prevec et al, 1991) and a standard plaque assay was performed to measure the titer of the purified viral stock. The control virus, Ad-GFP, contained no gene insertion in the multiple cloning site.

C. Analysis of gene transduction efficiency in vitro The efficiency of adenovirus-mediated gene transfer was assessed by detection of GFP. Eca109 cells (3x105 cells/well) seeded in 6-well plates were infected with Ad-GFP at different multiplicities of infection (MOIs) of 5, 10, 20, 50 and 100. GFP expression was analyzed at 48 h after the infection using a flow cytometer (Beckman Coulter, Miami, FL, USA).

D. Western blot analysis After the Eca109 cells had been treated with phosphatebuffered saline (PBS), Ad-GFP, Ad-ODCas, and Ad-ODCAdoMetDCas for 72 h, total cell lysates were prepared in extraction buffer containing 50 mM Tris (pH8.0), 1% NP-40, 1 µg/ml aprotinin, 0.1% sodium dodecyl sulfate (SDS), 0.02% sodium azide, 150mM NaCl, and 100 µg/ml phenylmethylsulfonyl fluoride. Sample protein concentrations were quantified using the bicinchoninic acid (BCA) protein assay. After electrophoresis samples were transferred onto nitrocellulose membranes (Millipore, Bedford, MA, USA). After an incubation with appropriate antibodies in PBS containing 5% nonfat dry milk and 0.02% Tween 20, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies, developed using the Western blotting luminol reagent

II. Materials and methods A. Cell culture and reagents Human esophageal cancer Eca109 cell line obtained from the Chinese Academy of Sciences, were maintained in RPMI 1640 medium supplemented with 10% (v/v) heat-inactivated bovine serum, 100 U/ml penicillin and 100 g/ml streptomycin.

HEK293 cells (transformed human embryonic kidney cells), also purchased from the Chinese Academy of Sciences, were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen

152

Gene Therapy and Molecular Biology Vol 11, page 153 (Santa Cruz Biotechnology, USA), and exposed to X-ray film (Kodak, Shantou, China).

CAR status in cancer cells is largely unknown, we first evaluated adenoviral gene transfer efficiency in tumor cells using Ad-GFP. Eca109 tumor cells were infected with AdGFP at MOIs of 5, 10, 20, 50 and 100 for 48 h.

We demonstrated that 73.6 ± 2.3% of A-549 cells were positive for GFP at an MOI of 50; this MOI was used for further study. To study the inhibitory effects of adenoviral vector-gene transfer on both ODC and Ad-ODCas gene expression, Eca109 cells were infected with Ad-GFP, AdODCas, and Ad-ODC-AdoMetDCas at an MOI of 50 for 72 h. Protein extracted from both adenoviral vector-treated and control conditions were probed with antibodies against ODC and AdoMetDC. Figure 1 shows that Ad-ODCAdoMetDCas induced a greater than 50% reduction of both ODC and AdoMetDC protein in Eca109 cells compared with Ad-GFP-infected or uninfected cells.

Similarly, Ad-ODC-AdoMetDCas induced a greater than 50% reduction of both ODC and AdoMetDC protein in Eca109 cells compared with control conditions. Not surprisingly, ODC protein levels dropped more than 50% in Eca109 cells after Ad-ODCas treatment compared with Ad-GFP-infected or uninfected cells. However, there was no appreciable change in AdoMetDC protein levels in AdODCas-treated cells compared with control cells.

E. Measurement of polyamine content Polyamine content was measured as previously described (Aboul-Enein and al-Duraibi, 1998). After an incubation with PBS, Ad-GFP, Ad-ODCas,and Ad-ODC-AdoMetDCas for 3 days, Eca109 cells were harvested by scraping and permeabilized with 5% trichloroacetic acid. The polyamines in the supernatant were separated and quantified on an ionpaired, reversed-phase HPLC system. Protein content was subsequently measured in the precipitate.

F. Measurement of cell growth Viable cell counts were used to evaluate the effects of recombinant adenovirus on cell proliferation. Eca109 cells were plated in 6-well tissue culture plates at a density of 5x104 cells/well. After 24 h, tumor cells were treated with Ad-GFP, Ad-ODCas, and Ad-ODCAdoMetDCas at an MOI of 50 or with PBS as a control. Cells in each treatment group were plated in triplicate and cultured for 6 days. Cells were then treated with trypsin and harvested every 24 h and subsequently stained with 0.4% trypan blue (Gibco, USA) for the identification of dead cells. Viable cells were then counted using a hemocytometer.

G. Cell cycle analysis Eca109 cells were seeded at a density of 3x105 cells/well in 6-well plates and treated with Ad-GFP, Ad-ODCas, or AdODC-AdoMetDCas at an MOI of 50 or treated with PBS as a control. Three days following treatment, cells were harvested as described above, washed once with cold PBS, and fixed with 70% ethanol. Cells were then washed with ice-cold PBS and treated with RNase. DNA was subsequently stained with propidium iodide. Cell cycle phases were analyzed using FACScan (Becton Dickinson).

B. Ad-ODC-AdoMetDCas gene transfer decreases polyamine content in cancer cells After demonstrating that Ad-ODC-AdoMetDCas depressed ODC and AdoMetDC protein expression levels in Eca109 cells, we next evaluated whether the polyamine content could be decreased accordingly by adenoviral gene transfer into these tumor cells. Polyamines in adenovirusinfected or uninfected cancer cells were separated by ionpaired, reversed-phase HPLC. As shown in Table 1, both Ad-ODCas and Ad-ODCAdoMetDCas decreased the polyamine content of Eca109 cells, correlating with the downregulation of polyamine biosynthesis. Table 1 also shows that incubation with Ad-ODCas alone caused a drop in putrescine content in Eca109 cells. Spermidine concentrations decreased, while spermine levels remained low too. In cells treated with Ad-ODC-AdoMetDCas, all three polyamines were reduced to very low levels. After a comparison of Ad-ODC-AdoMetDCas- and Ad-ODCasinfected cells, both spermidine and spermine were significantly reduced (P<0.05).

H. Matrigel invasion assay Eca109 cells were infected with Ad-GFP, Ad-ODCas, or Ad- ODC-AdoMetDCas at an MOI of 50 for 2 days.

Invasiveness was measured by counting cells that had traveled through Matrigel-coated Transwell inserts. Transwell inserts (6.5 mm) with a 8.0-µm pore size were coated with 30 µl of Matrigel and dried for 2 h at room temperature. Cells were harvested as described above. A 100-µl cell suspension containing 5x104 cells was added to wells in triplicate. After 24 h of incubation, nonmigrated cells were scraped from the upper side of the membrane with cotton swaps. Cells that passed through the filter into the bottom side of the membrane were fixed and stained with hematoxylin. Five representative fields in each well were quantified to determine the number of invasive cells under a light microscope at 200 x magnification.

C. Ad-ODC-AdoMetDCas inhibits cancer cell proliferation

I. Statistical analysis

After confirming the suppression of ODC and AdoMetDC gene expression and polyamine reduction by adenoviral gene transfer, we then asked whether these inhibitory effects could be translated into inhibition of cell growth. We used viable cell counts to determine rates of tumor cell proliferation. The results in Figure 2 demonstrate significant inhibition of cell proliferation in cancer cell lines treated with either Ad-ODCas or AdODC-AdoMetDCas (P < 0.05) compared with control cells treated with either Ad-GFP or PBS. This inhibition of cell growth was maintained for 7 days (data not shown).

Significant differences in the inhibitory effects existed

Data are reported as the mean ± standard deviation (SD).Statistical differences between control and treated cells were evaluated using Student, s t-test. A value of P < 0.05 was considered significant.

III. Results A. Ad-ODC-AdoMetDCas inhibits ODC and AdoMetDC gene expression in cancer cells in vitro Adenovirus infects host cells through the coxsackie and adenovirus receptor (CAR) (Bao et al, 2005). As the

153

Tian et al: Adenovirus-mediated Expression of both ODC and AdoMetDC between Ad-ODCas- and Ad-ODC-AdoMetDCasmediated transduction (P <0.05). When compared with

Ad-ODCas, Ad-ODC-AdoMetDCas was shown to be more effective in inhibiting proliferation of Eca109 cell.

Figure 1. Western blot analysis of ODC and AdoMetDC gene expression in Eca109 cells. Total protein was extracted 3 days after infection with Ad-GFP, Ad-ODCas, or Ad-ODC-AdoMetDCas at an MOI of 50. Each lane was loaded with 50 "g protein and electrotransferred onto a nitocellulose membrane. The blot was probed with either an ODC monoclonal antibody or an AdoMetDC polyclonal antibody.

Table 1. Effects of Ad-ODCas and Ad-ODC-AdoMetDCas on polyamine content (mmol/mg protein) in Eca109 cells.

Cells were seeded at a density of 1 # 106 cells/cm2 and infected at an MOI of 50 with Ad-GFP, Ad-ODCas, or Ad-ODCAdoMetDCas. After 3 days of infection, cells were collected and prepared for HPLC analysis. Results are presented as the mean ± SD of three separate experiments. *P < 0.05 vs. Ad-GFP or uninfected cells Cell lines and Treatment Eca109 + Ad-GFP + Ad-ODCas + Ad-ODC-AdoMetDCas

Polyamine pools ( pmol/mg protein) Put Spd Spm 590 1560 1489 525 1463 1672 254* 1189* 1321 76* 632* 337*

Figure 2. Effects of Ad-ODCas and Ad-ODC-AdoMetDCas on proliferation of Eca109 cell. Cells were seeded at 5 # 104 cells/well and allowed to attach for 24 h. Viable cells were counted daily by trypan blue exclusion on days 0–5 after infection with Ad-GFP, AdODCas and Ad-ODC-AdoMetDCas at an MOI of 50 and compared with uninfected cells.

154

Gene Therapy and Molecular Biology Vol 11, page 155 in Ad-ODC-AdoMetDCas treated cells (Figure 4). Our data indicate that Ad-ODCAdoMetDCas treatment arrests tumor cells in G0–G1 phase. This cell cycle arrest correlates with an increased level of p21 expression.

D. Ad-ODC-AdoMetDCas arrests cancer cell cycles in G1 phase After we had established that Ad-ODC-AdoMetDCas inhibited tumor cell proliferation, we further analyzed cell cycle profiles of gene-transferred tumor cells. Eca109 cells were treated with PBS, Ad-GFP, Ad-ODCas, or Ad-ODCAdoMetDCas at an MOI of 50 for 72 h (Figure 3). Cells were then harvested by treatment with trypsin. Propidium iodide staining was used to detect changes in DNA concentrations in different phases of the cell cycle. Results displayed in Table 2 show that Ad-ODC-AdoMetDCas and Ad-ODCas cause more Eca109 cells to arrest compared with controls (P < 0.05). Eca109 cells were arrested in G0-G1 phase (66±3.2% in Ad-ODCAdoMetDCas- and 56±2.3% in Ad-ODCas-treated conditions) compared with 45 ± 2.5% in PBS and 49 ± 3.2% in Ad-GFP- treated conditions. Statistical analysis also revealed a significant difference between Ad-ODCAdoMetDCas-and Ad-ODCas-treated Eca109 cells (P < 0.05) and a greater number of Eca109 cells were arrested

by Ad-ODCAdoMetDCas. The cell cycle regulatory protein, p21WAF1/CIP1/SDI1 (p21), is known to regulate the G1-S transition (Kamb, 1995). We further analyzed whether p21 gene expression was altered after adenoviral gene transfer and whether it correlated with cell cycle arrest. Expression of p21 in Eca109 cell was detected by Western blot analysis. After 3 days of incubation, p21 was found increased up to 3-fold

E. Ad-ODC-AdoMetDCas impairs tumor invasiveness in vitro The Matrigel assay is a widely used protocol to evaluate tumor invasiveness in vitro. We therefore performed the Matrigel assay to evaluate whether either Ad-ODCas or Ad-ODC-AdoMetDCas could decrease tumor invasiveness in addition to their anti-proliferative effects reported above. Eca109 cells (5x104 cells per insert) were allowed to invade the Matrigel-coated membrane. The numbers of invading cells were represented as the average of five randomly selected microscopic fields on the underside of the membrane (Figure 5A). As shown in Figure 5B, only 9 ± 3 cells in the Ad-ODCAdoMetDCas condition and 20 ± 5 cells in the Ad-ODCas condition passed through the membrane. In comparison, 51 ± 7 cells in the PBS condition and 48 ± 8 cells in the Ad-GFP condition passed through the filter (P <0.01). In addition, only 30% of Ad-ODC-AdoMetDCasinfected tumor cells successfully passed through the membrane. These results clearly demonstrate that AdODC-AdoMetDCas significantly decreased tumor invasiveness in vitro.

Figure 3. Effects of Ad-ODCas and Ad-ODC-AdoMetDCas on Eca109 cell cycle. Cells were treated with 50 MOI of Ad-GFP, AdODCas, Ad-ODC-AdoMetDCas or PBS (Mock) as a control for 3 days and then collected and dyed by propidium iodide for cell cycle analysis. The data are representative of three separate experiments.

155

Tian et al: Adenovirus-mediated Expression of both ODC and AdoMetDC Table 2. G0 –G1 cell cycle phase distribution of Eca109 cells.

Percent of total cells G0-G1 ( X ±S) 45±2.5 49±3.2 * 56±2.3 !

66±3.2*

Cell lines and treatment Eca109 cell PBS) +Ad-GFP +Ad-ODC/Ex3as +Ad-ODC-AdoMetDCas *

P <0.05, Vs Ad-GFP- and PBS-treated cells.

Figure 4. Western blot analysis of p21 expression levels in Eca109 cell. Total protein was extracted 3 days after infection at an MOI of 50. Each lane was loaded with 80 "g of protein and probed with a p21 monoclonal antibody.

Figure 5. A. Ad-ODC-AdoMetDCas inhibited Eca109 cell invasion.

Eca109 cells were treated with recombinant adenovirus at an MOI of 50 for 72 h and then allowed to invade transwell inserts (8-"m pores) coated with Matrigel for 24 h. The cells that invaded through the inserts were stained, counted, and photographed under light microscopy at 200# magnification.

B. The numbers of cells that invaded through the Matrigel-coated inserts.

The data are presented as the mean ± SD for three separate experiments from each group.

156

Gene Therapy and Molecular Biology Vol 11, page 157 cell types, such as IEC-6, Hep-2, MKN45, and HL-60, in G1 phase (Wallace et al, 2003). Our recent work also demonstrated that treatment of Eca109 cells with AdODCas causes lung cell cycle arrest in G1 phase (Tian et al, 2006a). In agreement with these findings, we demonstrated that both Ad-ODC-AdoMetDCas and AdODCas decreased the rate of DNA synthesis of cancer cells and blocked cell cycle at the G1/S boundary. This result also suggests that synergistic inhibition of ODC and AdoMetDC activities may be more effective in inducing cell cycle arrest and halting cell growth than a single blockade of ODC activity. These data are in agreement with a report that treatment of MALME-3M cells with either the ODC inhibitor, DFMO, or the AdoMetDC inhibitor, MDL-73811, slows cell growth but fails to induce cell cycle arrest, and treatment with a combination of both inhibitors halts cell growth and causes a significant G1 arrest (Kramer et al, 2001).

We also assessed the effects of the two antisense constructs in the context of tumor invasiveness. Both AdODCAdoMetDCas and Ad-ODCas reduced the invasiveness of Eca109 cells compared with vector controls. Furthermore, the data also showed that Ad-ODCAdoMetDCas was superior in inhibiting cancer cell invasion compared with Ad-ODCas infection.

Overexpression of ODC has been suggested to confer an invasive phenotype on cells. Kubota and colleagues reported in 1997 that overexpression of ODC in mouse 10T1/2 fibroblasts induced not only cell transformation and anchorage-independent growth in soft agar, but also invasiveness through a Matrigel-coated filter. Similar work had been done by this same group (Kubota et al, 1995) that compared the invasiveness of mouse mammary carcinoma FM3A and EXOD cell lines that overexpress ODC and found that EXOD cells showed more than a 5.6fold increase in invasiveness compared with FM3A cells

by Matrigel assay. Inhibition of ODC by DFMO reduced invasiveness in breast cancer cells significantly (Manni et al, 2002). Our previous work in which ODC levels were reduced using the adenovirus-delivered antisense ODC found that lower ODC levels also inhibited tumor invasion in lung cancer (Tian et al, 2006a). ODC, however, is not the sole enzyme responsible for olyamine biosynthesis or tumor invasion. AdoMetDC was also proven to strongly correlate with progression of tumor invasiveness.

Overexpression of AdoMetDC alone has been reported to be sufficient to transform NIH 3T3 cells and induce highly invasive tumors in nude mice (Manni et al, 1995). High expression levels of AdoMetDC may compensate for and strengthen the activity of ODC through different molecular pathways (Ravanko et al, 2004). Therefore, we simultaneously targeted both these critical enzymes and obtained superior inhibition of cancer invasion.

In summary, we provide evidence that polyamine reduction by antisense techniques that targeted ODC and AdoMetDCas suppresses cancer cell growth and invasiveness in vitro. Synergistic inhibition of both ODC and AdoMetDC activities by gene therapy approaches therefore might represent a novel treatment option for esophageal cancer.

IV. Discussion It has been known for many years that normal cell growth is regulated in a cyclical manner by the increase and decrease of cyclins and cyclin-dependent kinases (cdks). Furthermore, there are also changes in polyamine, ODC and AdoMetDC concentrations during the cell cycle.

Both ODC and AdoMetDC mRNA levels and polyamine concentration are doubled during the cell cycle. Elevated levels of ODC and AdoMetDC activity were found in various cancers (Cohen, 1998), such as prostate, breast, and colorectal cancer, and are related to cancer recurrence (Pegg and McCann, 1982; Gutman et al, 1995). Our recent work has proven that inhibition of ODC activity by recombinant antisense ODC adenovirus has had antitumor effects on human lung cancer (Tian et al, 2006a,b).This adenovirus, however, did not inhibit AdoMetDC, a critical enzyme that is normally elevated in tumor cells. We speculate that double inhibition of ODC and AdoMetDC might be a more effective way to suppress tumor growth.

Our in vitro study demonstrated more robust antitumor effects by dual inhibition of both ODC and AdoMetDC activities compared to inhibition of ODC activity alone.

Double inhibition by Ad-ODCAdoMetDCas infection significantly reduced ODC and AdoMetDC protein levels more than 50% Eca109 cells compared to controls. A substantial decrease in ODC and AdoMetDC expression levels also causes a reduction of polyamine biosynthesis.

Ad-ODC-AdoMetDCas infection depresses three types of polyamines. In contrast, only putrescine and spermidine were shown to be decreased after Ad-ODCas infection.

Ad-ODCas treatment of tumor cells did not elicit a statistical difference in spermine content compared with control treatment. We speculate that the inability of AdODCas to block AdoMetDC activity might be responsible for this observation, consistent with results reported by other researchers who demonstrated that the ODC inhibitor, DFMO, had no effect on spermine levels in tumor cells. Spermine, however, plays an equally important role in carcinogenesis as do the other polyamines. Furthermore, high levels of spermine also contribute to cellular resistance to apoptotic cell death (Hashimoto et al, 1999). The inability of Ad-ODCas to decrease intracellular spermine levels therefore represents an inherent drawback in its potential antitumor effects.

P53, also known as tumor protein 53 (TP53), is a transcription factor that regulates the cell cycle and hence functions as a tumor suppressor. It is important in multicellular organisms as it helps to suppress cancer. p53 has been described as "the guardian of the genome", "the guardian angel gene", or the "master watchman", referring to its role in conserving stability by preventing genome mutation. It has also been found to play an important role in sun tanning. The alteration of gene p53 is a key event in esophagus cancer and if there is a relationship between ODC and AdoMetDC on this issue,we will study it in the future.

To further understand the underlying mechanism of tumor cell growth inhibition, cell cycle and cellcyclerelated proteins were examined. Previous studies have shown that DFMO arrests a broad spectrum of tumor

157

Tian et al: Adenovirus-mediated Expression of both ODC and AdoMetDC methylglutaryl coenzyme A reductase and isoprenylation inhibitors induce apoptosis of vascular smooth muscle cells in culture. Circ Res 83, 490 –500 Horejsi V, Drbal K, Cebecauer M, Cerny J, Brdicka T, Angelisova P, Stockinger H (1999) GPI-microdomains: a role in signalling via immunoreceptors. Immunol Today 20, 356-361

References Aikawa M, Rabkin E, Okada Y, Voglic SJ, Clinton SK, Brinckerhoff CE, Sukhova GK, Libby P (1998) Lipid lowering by diet reduces matrix metalloproteinase activity and increases collagen content of rabbit atheroma: a potential mechanism of lesion stabilization. Circulation 97, 2433– 2444 Blackford J, Reid HW, Pappin DJ, Bowers FS, Wilkinson JM (1996) A monoclonal antibody, 3/22 to rabbit CD11c which induces homotypic T cell aggregation: evidence that ICAM-1 is a ligand for CD11c/CD18. Eur J Immunol 26, 525-531

Issekutz AC (1998) Adhesion molecules mediating neutrophil migration to arthritis in vivo and across endothelium and connective tissue barriers in vitro. Inflamm Res 47, S123– S132 Kallen J, Welzenbach K, Ramage P, Geyl D, Kriwacki R, Legge G, Cottens S, Weitz-Schmidt G, Hommel U (1999) Structural basis for LFA-1 inhibition upon lovastatin binding to the CD11a I-domain. J Mol Biol 292, 1-9 Katznelson S, Kobashigawa JA (1995) Dual roles of HMG-CoA reductase inhibitors in solid organ transplantation: Lipid lowering and immunosuppression. Kidney Int 48, S112– S115

Carlos TM, Harlan JM (1994) Leukocyte-endothelial adhesion molecules. Blood 84, 2068-2101 Chavakis T, Kanse SM, Yutzy B, Lijnen HR, Preissner KT (1998) Vitronectin concentrates proteolytic activity on the cell surface and extracellular matrix by trapping soluble urokinase receptor-urokinase complexes. Blood 91, 23052312 Chavakis T, May AE, Preissner KT, Kanse SM (1999) Molecular mechanisms of zinc-dependent leukocyte adhesion involving the urokinase receptor and ß2-integrins. Blood 93, 29762983 Chavakis T, Kanse SM, Lupu F, Hammes HP, Muller-Esterl W, Pixley RA, Colman RW, Preissner KT (2000) Different mechanisms define the antiadhesive function of high molecular weight kininogen in integrin- and urokinase receptor-dependent interactions. Blood 96, 514-522 Chavakis T, Kanse SM, Pixley RA, May AE, Isordia-Salas I, Colman RW, Preissner KT (2001) Regulation of leukocyte recruitment by polypeptides derived from high molecular weight kininogen. FASEB J 15 2365-2376 Chavakis T, Hussain M, Kanse SM, Peters G, Bretzel RG, Flock JI, Herrmann M, Preissner KT (2002) Staphylococcus aureus extracellular adherence protein (Eap) serves as antiinflammatory factor by inhibiting the recruitment of host leukocytes. Nature Medicine 8, 687-693 Corsini A, Maggi FM, Catapano AL (1995) Pharmacology of competitive inhibitors of HMG-CoA reductase. Pharmacol Res 31, 9–27

Krauss K, Altevogt P (1999) Integrin leukocyte functionassociated antigen-1-mediated cell binding can be activated by clustering of membrane rafts. J Biol Chem 274, 3692136927 Krueger J, Gottlieb A, Miller B, Dedrick R, Garovoy M, Walicke P (2000) Anti-CD11a treatment for psoriasis concurrently increases circulating T-cells and decreases plaque T-cells, consistent with inhibition of cutaneous T-cell trafficking. J Invest Dermatol 115, 333 Kurzchalia TV, Parton RG (1999) Membrane microdomains and caveolae. Curr Opin Cell Biol 11, 424-431 Kwak BR, Mach F (2001) Statins inhibit leukocyte recruitment.

New evidence for their anti-inflammatory properties.

Arterioscler Thromb Vasc Biol 21, 1256-1258 Kwak B, Mulhaupt F, Myit S, Mach F (2000) Statins as a newly recognized type of immunomodulator. Nat Med 6, 13991403 Laufs U, La Fata V, Plutzky J, Liao JK (1998) Upregulation of endothelial nitric oxide synthase by HMG CoA reductase inhibitors. Circulation 97, 1129–1135 Laufs U, Liao JK (1998) Post-transcriptional regulation of endothelial nitric oxide synthase mRNA stability by Rho GTPase. J Biol Chem 273, 24266–24271 Laufs U, Marra D, Node K, Liao JK (1999) 3-Hydroxy-3methylglutaryl-CoA reductase inhibitors attenuate vascular smooth muscle proliferation by preventing rho GTPaseinduced down-regulation of p27(Kip1). J Biol Chem 274, 21926 –21931 Liu L, Moesner P, Kovach NL, Bailey R, Hamilton AD, Sebti SM, Harlan JM (1999) Integrin-dependent leukocyte adhesion involves geranylgeranylated protein(s). J Biol Chem 274, 33334–33340 Maron DJ, Fazio S, Linton MF (2000) Current perspectives on statins. Circulation 101, 207–213 Martin X, Da Silva M, Virieux SR, Hadj Aissa A, Buffet R, Tiollier J, Dubernard JM (2000) Protective effect of an antiLFA 1 monoclonal antibody (odulimomab) on renal damage due to ischemia and kidney autotransplantation.Transplant Proc 32, 481 May AE, Kanse SM, Lund LR, Gisler RH, Imhof BA, Preissner KT (1998) Urokinase receptor (CD87) regulates leukocyte recruitment via ß2-integrins in vivo. J Exp Med 188, 10291037

Diomede L, Albani D, Sottocorno M, Polentarutti N, Donati MB, Bianchi M, Fruscella P, Salmona M (2001) The in vivo antiinflammatory effect of statins is mediated by nonsterol mevalonate products. Arterioscler Thromb Vasc Biol 21, 1327–1332 Essig M, Nguyen G, Prie D, Escoubet B, Sraer JD, Friedlander G (1998) 3-Hydroxy-3-methylglutaryl coenzyme A reductase inhibitors increase fibrinolytic activity in rat aortic endothelial cells: role of geranylgeranylation and Rho proteins. Circ Res 83, 683–690 Frenette PS (2001) Locking a leukocyte integrin with statins. N Engl J Med 345, 1419-1421 Gahmberg CG (1997) Leukocyte adhesion: CD11/CD18 integrins and intercellular adhesion molecules. Curr Opin Cell Biol 9, 643-650 Ganne F, Vasse M, Beaudeux JL, Peynet J, Francois A, Mishal Z, Chartier A, Tobelem G, Vannier JP, Soria J, Soria C (2000) Cerivastatin, an inhibitor of HMG-CoA reductase, inhibits urokinase/urokinase-receptor expression and MMP-9 secretion by peripheral blood monocytes-a possible protective mechanism against atherothrombosis. Thromb Haemost 84, 680-688 Guijarro C, Blanco-Colio LM, Ortego M, Alonso C, Ortiz A, Plaza JJ, Diaz C, Hernandez G, Edigo J (1998) 3-Hydroxy-3-

158

Gene Therapy and Molecular Biology Vol 11, page 159 Nakakura EK, Shorthouse RA, Zheng B, McCabe SM, Jardieu PM, Morris RE (1996) Long-term survival of solid organ allografts by brief anti-lymphocyte function-associated antigen-1 monoclonal antibody monotherapy.

Transplantation 62, 547–552

normocholesterolemic rabbits. Arterioscler Thromb 13, 571–578 Springer TA (1994) Traffic signals for lymphocyte recirculation and leukocyte emigration: The multistep paradigm. Cell 76, 301-314 Stewart M, Thiel M, Hogg N (1995) Leukocyte integrins. Curr Opin Cell Biol 7, 690-696 Weber C, Erl W, Weber KS, Weber PC (1997) HMG-CoA reductase inhibitors decrease CD11b expression and CD11bdependent adhesion of monocytes to endothelium and reduce increased adhesiveness of monocytes isolated from patients with hypercholesterolemia. J Am Coll Cardiol 30, 1212– 1217 Weber C, Erl W, Weber PC (1995) Lovastatin induces differentiation of Mono Mac 6 cells. Cell Biochem Funct 13, 273-277 Wei Y, Waltz DA, Rao N, Drummond RJ, Rosenberg S, Chapman HA (1994) Identification of the urokinase receptor as an adhesion receptor for vitronectin. J Biol Chem 269, 32380-32388

Ossowski L, Aguirre-Ghiso JA (2000) Urokinase-receptor and integrin partnership: coordination of signaling for cell adhesion, migration and growth. Curr Opin Cell Biol 12, 613-620 Porter JC, Hogg N (1998) Integrins take partners: cross-talk between integrins and other membrane receptors. Trends Cell Biol 8, 390-396 Poston RS, Robbins RC, Chan B, Simms P, Presta L, Jardieu P, Morris RE (2000) Effects of humanized monoclonal antibody to rhesus CD11a in rhesus monkey cardiac allograft recipients. Transplantation 69, 2005–2013 Preissner KT, Kanse SM, May AE(2000) Urokinase receptor: a molecular organizer in cellular communication. Curr Opin Cell Biol 12, 621-628 Romano M, Diomede L, Sironi M, Massimiliano L, Sottocorno M, Polentarutti N, Guglielmotti A, Albani D, Bruno A, Fruscella P, Salmona M, Vecchi A, Pinza M, Mantovani A (2000) Inhibition of monocyte chemotactic protein-1 synthesis by statins. Lab Invest 80, 1095–1100 Simons K, Toomre D (2000) Lipid rafts and signal transduction.

Nat Rev Mol Cell Bio 1, 31-39 Sitrin RG, Todd RF, Petty HR, Brock TG, Shollenberger SB, Albrecht E, Gyetko MR (1996) The urokinase receptor (CD87) facilitates CD11b/CD18-mediated adhesion of human monocytes. J Clin Invest 97, 1942-1951

Weitz-Schmidt G, Welzenbach K, Brinkmann V, Kamata T, Kallen J, Bruns C, Cottens S, Takada Y, Hommel U (2001) Statins selectively inhibit leukocyte function antigen-1 by binding to a novel regulatory integrin site. Nat Med 7, 687692 Wojciak-Stothard B, Williams L, Ridley AJ (1999) Monocyte adhesion and spreading on human endothelial cells is dependent on Rho-regulated receptor clustering. J Cell Biol 145, 1293–1307 Woods A, Couchman JR (2000) Integrin modulation by lateral association. J Biol Chem 275, 24233-24236 Yoshida M, Sawada T, Ishii H, Gerszten RE, Rosenzweig A, Gimbrone MA Jr, Yasukochi Y, Numano F (2001) HMGCoA reductase inhibitor modulates monocyte endothelial interaction under physiological flow condition in vitro: involvement of Rho GTPase-dependent mechanism.

Arterioscler Thromb Vasc Biol 21, 1165–1171

Smart EJ, Graf GA, McNiven MA, Sessa WC, Engelman JA, Scherer PE, Okamoto T, Lisanti MP (1999) Caveolins, liquid-ordered domains, and signal transduction. Mol Cell Biol 19, 7289-7304 Soma MR, Donetti E, Parolini C, Mazzini G, Ferrari C, Fumagalli R, Paoletti R (1993) HMG CoA reductase inhibitors: in vivo effects on carotid intimal thickening in

159

Tian et al: Adenovirus-mediated Expression of both ODC and AdoMetDC

160

Gene Therapy and Molecular Biology Vol 11, page 161 Gene Ther Mol Biol Vol 11, 161-170, 2007

Chromium Picolinate (CrP) a putative anti-obesity nutrient induces changes in body composition as a function of the Taq1 dopamine D2 receptor polymorphisms in a randomized double-blind placebo controlled study Research Article

Thomas JH Chen1, Kenneth Blum2,4,9,11,*, Gilbert Kaats3, Eric R. Braverman4, Arthur Eisenberg5, Mark Sherman5, Katharine Davis5, David E. Comings6, Robert Wood7, Dennis Pullin8, Vanessa Arcuri4, Michael Varshavski4, Julie F. Mengucci9, Seth H. Blum,9 Bernard W. Downs10, Brian Meshkin11, Roger L. Waite12, Lonna Williams11, John Schoolfield13, Thomas J Prihoda14, Lisa White15 1

Chang Jung Christian University, Tainan, Taiwan, Republic of China Department Of Physiology and Pharmacology, Wake Forest University School Of Medicine, Winston Salem, North Carolina, USA 3 Health and Medical research Foundation Of San Antonio, San Antonio, Texas, USA 4 Path Medical Clinic, New York, USA 5 University of North Texas Health Sciences, Forth Worth, Texas, USA 6 Carlsbad Science Foundation, emeritus, City of Hope National Medical Center, Duarte, California, USA 7 University of Texas Health Science Center, San Antonio, Texas, USA 8 Sports Medicine Institute, Baylor College of Medicine, Houston, Texas, USA 9 Synapatmine, Inc., San Antonio, Texas, USA 10 Allied Nutraceutical Research, Lederach, PA, USA 11 Salugen, Inc. San Diego, California, USA 12 GenWellness, Inc. San Diego, California, USA 13 Department of Infomatics, University Of Texas Health Science Center, San Antonio, Texas, USA 14 Department of Pathology, University of Texas Health Science Center, San Antonio, Texas, USA. 15 Department of Molecular Genetics, Baylor College of Medicine, Houston Texas and DNA Services of America, Lafayette, Louisiana, USA 2

__________________________________________________________________________________ *Correspondence: Kenneth Blum, Ph.D. Department Physiology & Pharmacology, Wake Forest University School of Medicine, Medical Center Boulevard, Winston-Salem, North Carolina, 27157-1083, USA; email: drd2gene@aol.com Key words: Chromium Picolinate, genotyping, body-composition, Genotrim®, and dopamine D2 receptor gene Abbreviations: 2’- deoxynucleotide 5’-triphosphates, (dNTPs); body mass index, (BMI); Chromium Picolinate, (CrP); Chromium, (Cr); confidence interval, (CI); D2 receptor, (DRD2); estimated safe and adequate daily dietary intake, (ESADDI); Free Fat Mass, (FFM); Generally Recognized as Safe, (GRAS); high-density lipoprotein, (HDL); lean body mass, (LBM); Leptin OB, (LEPT); obesity, (OB); polymerase chain reaction, (PCR); recommended dietary allowance, (RDA); reference dose, (RfD)

The contents of this publication do not necessarily reflect the views or policies of the respective Universities or research organizations. Kenneth Blum, Ph. D. owns the major stock in Synapatamine and Salugen, Inc. Brian Meshkin is a major stock holder in Salugen, Inc. B. William Downs, is a major stock holder in Allied Nutraceutical Research. Chromium is one of the active ingredients in a patent awarded to Kenneth Blum US patent number 6,132,724, 6,955,873 and other patents pending and a PCT. This paper was presented at the October, 1998 Annual meeting of the American College of Nutrition meeting at Albuquerque, New Mexico as abstract 38.

161

Chen et al: Chromium Picolinate and DRD2 Gene Received: 17 March 2007; Revised: 1 June 2007 Accepted: 26 July 2007; electronically published: August 2007

Summary There is controversy regarding the effects and safety of chromium salts (picolinate and nicotinate) on body composition and weight loss in humans. Thus, we decided to test the hypothesis that typing the obese patients by genotyping the dopamine D2 receptor (DRD2) gene prior to treatment with Chromium Picolinate (CrP) would result in a differential treatment outcome. We genotyped obese subjects for the DRD2 gene utilizing standard PCR techniques. The subjects were assessed for scale weight and for percent body fat using dual energy X-ray absorptiometry (DEXAR). The subjects were divided into matched placebo and CrP groups (400 µg. per day) accordingly. The sample was separated into two independent groups. Those with either an A1/A1 or A1/A2 allele or those with only the A2/A2 allelic pattern. Each of these groups were tested separately for differences between placebo and treatment means for a variety of measures of weight change. The measures of the change in fat weight (p<0.041), change in body weight (p<0.017), the percent change in weight (p<0.044), and the body weight change in kilograms (p<0.012) were all significant for carriers of the DRD2 A2 genotype, whereas no significance was found for any parameter for those subjects possessing a DRD2 A1 allele. These results suggest that the dopaminergic system, specifically the density of the D2 receptors, confers a significant differential therapeutic effect of CrP in terms of weight loss and change in body fat, thereby strengthening the need for DNA testing.

sensitive subgroups that is likely to be without an appreciable risk of deleterious effects over a lifetime (Mertz et al, 1994). The ratio of the RfD to the ESADDI or recommended dietary allowance (RDA) is 350 for Cr ESADDI, compared with less than 2 for zinc RDA, roughly 2 for manganese (ESADDI), and 5-7 for selenium ESADDI (Mertz et al, 1994). Moreover, Anderson (1998) demonstrated a lack of toxicity of Cr chloride (CrCl) and CrP in rats at levels several thousand times the upper limit of the ESADDI for humans (Anderson, 1998). In 1995, there was concern over the demonstration by Stearns and colleagues in 1995 that, at concentrations thousands of times higher than physiological levels, trivalent chromium (CrP and picolinic acid per se) can break chromosomes in cell culture. Others (WHO, 1973; Evans, 1993; Lukaski, 1999) suggest that this finding may not be relevant to nutritional supplementation. In this regard, a prediction that CrP will accumulate in tissues to dangerous levels during long-term supplementation is based on an inappropriate pharmacokinetic model and is at odds with data from long-term rat feeding studies (Anderson, 1979; Evens, 1994). Furthermore, clastgenicity (breakage of chromosomes leads to the production of micronucleus formation of acentric fragments called clastogens) is not equivalent to either mutagenicity or carcinogenicity and studies in animals reveal that any effects observed with regard to clastogenicity of trivalent chromium is only relevant to cell culture studies, not to living animals or humans (Stoecker, 1990; Loveday, 1996; McCarty, 1996).

Moreover, the therapeutic–toxic–dose ratio for trivalent chromium is 1:10,000. Thus, clarifying the safety issues concerning Cr+3 in particular the picolinate salt, we believe is quite relevant to the use of this substance as an important dietary supplement, which is utilized on a large scale worldwide to assist in reducing the obesity epidemic (Anderson, 1995). Furthermore, cats tolerate 1000 mg of Cr+3 daily and rodents have no adverse effects with 1000mg of Cr per kg of diet (Lukaski, 1999). It may be

I. Introduction Chromium (Cr) is an essential nutrient involved in the regulation of carbohydrates and lipid metabolism (Anderson, 1998). Normal dietary intake of chromium in humans is often sub-optimal (Anderson, 1998; Diez et al, 2007). In addition to its effects on glucose, insulin, and lipid metabolism, chromium has been reported to increase lean body mass (LBM) and decrease percentage body fat, which may lead to weight loss in humans. The effects of chromium on body composition are controversial but are supported by animal studies, (Page et al, 1993; Lindermann et al, 1995; Kornegay et al, 1997; Min et al, 1997; Mooney et al, 1997; Ward et al, 1997, Fekete et al, 2001) which increase their validity. Negative reports of the effects of CrP on muscle mass and weight loss have also been published in rats (Gonzalez Munoz et al, 2006).

Moreover in humans, most recently the effects of CrP on weight loss was not achieved in a recent randomized double-blinded study (Lukaski et al, 2007). A subject’s response to chromium depends on his or her chromium status, the salt of chromium consumed, amount of supplemental chromium, study duration and possibly an individual’s genome. Since we have reported on the involvement of the Taq 1 A1 Dopamine D2 receptor gene polymorphisms and percent body fat (Chen et al, 2007), we decided to test the potential nutrigenetic response of CrP as a function of D2 polymorphisms.

A. Safety issues According to a review by Anderdson in 1998 trivalent Cr found in foods and nutrient supplements, is one of the least toxic nutrients (Mertz et al, 1994). The reference dose (RfD) established by the U.S. Environmental Protection Agency for Cr is 350 times the upper limit of the estimated safe and adequate daily dietary intake (ESADDI) of 200mcg /day (3.85 micro mols.). The RfD is defined as “an estimate (with uncertainly spanning perhaps an order of magnitude) of a daily exposure to the human population, including 162

Gene Therapy and Molecular Biology Vol 11, page 163 noteworthy that hexavalent Cr, according to Lukaski in 1999 is much more toxic than the trivalent form.

However, most recently Stallings and colleagues in 2006 in a three-part study examined the effects of several chromium-containing supplements and their components on hatching and eclosion rates and success of development of first generation progeny of adult Drosophila fed food containing these compounds. It further examined the effects of the compounds on longevity of virgin male and female adults. Finally, the chromosomes in the salivary glands of Drosophila late in the third instar larval stage, which were the progeny of Drosophila whose diets were supplemented with nutritional levels of [Cr(pic)(3)], are shown to contain on average over one chromosomal aberration per two identifiable chromosomal arms. No aberrations were observed in chromosomes of progeny of untreated flies. The results suggest that human consumption of the supplement should be a matter of concern and continued investigation to provide insight into the requirements of chromium-containing supplements to give rise to genotoxic effects. There have been both positive and negative cellular findings regarding this potential danger of CRP in humans (Bagchi et al, 2002; Gudi et al, 2005).

A review of recent studies on the safety of chromium picolinate was presented by Ronald Slesinski, the president-elect of the regulatory and safety specialty section of the society, at a Centers for Disease Control and Prevention (CDC) conference on metal toxicity and carcinogenesis in 2004: "The safety research overwhelmingly confirms that Chromax chromium picolinate is a safe nutritional supplement," said Dr. Slesinski. "Research studies conducted by the United States Department of Agriculture (USDA), National Toxicology Program (NTP) and at independent testing laboratories, show no evidence of genetic toxicity."

As of April 2003, a panel of experts concluded that the weight of the evidence clearly demonstrates the safety of CrP is Generally Recognized as Safe (GRAS) for addition to a number of food categories for human consumption after reviewing the available data. However, other forms of chromium including the polynicotinate form should be considered as an alternative Cr salt (Bagchi et al, 2002).

2000; Luvolsi et al, 2000; Volpe et al, 2001) do not support an effect of Cr on body composition. Other studies (Evans, 1989; Grant et al, 1992; Hasten et al, 1992; Kaats et al, 1992, 1996, 1998; Bulbulian et al, 1996; Bahadori et al, 1997; Crawford et al, 1999) however, do report an effect of Cr on body composition in humans. Additional support is derived from a study by Rubin and colleagues in 1998 showing both acute and chronic resistive exercise increased Cr losses. These data demonstrate that the improvements in body composition due to resistive exercise are associated with increased urinary 53Cr isotope losses that are consistent with increased absorption.

It has been suggested that if CrP can lower insulin resistance as reported earlier (Anderson, 1998) it can improve body composition, because insulin resistance or deficiency results in impaired entry of glucose and amino acids into muscle cells, increased catabolism of muscle protein and the potential acceleration of lipid deposition (Evans et al, 1973; Anderson, 1995). In our earlier publication (Kaats et al, 1998), after controlling for differences in caloric intake and expenditure, as compared with the placebo group, subjects in the active treatment group lost significantly more weight (7.79 kg vs. 1.81 kg, respectively) and fat mass (7.71 kg vs. 1.53 kg respectively), and had a greater reduction in percent body fat (6.30% vs. 1.20%, respectively) without any loss of fatfree mass. It was concluded that this study replicated earlier findings (Kaats et al, 1992, 1996) that supplementation with CrP can lead to significant improvements in body composition.

Lukaski has argued in 1999 that data from these studies by Kaats and colleagues in 1996, 1998 have the following potential flaws; lack of control of the actual Cr intake and failure to maintain constant energy intake and expenditure. Furthermore, the calculation of fat loss based on a 3500-kcal energy expenditure resulting from physical activity produces dubious results. Thus, according to Lukaski in 1999, our findings (Kaats et al, 1996, 1998) that CrP supplementation promotes fat loss with a preservation of Free Fat Mass (FFM) conflicts with reports of no changes in body composition in adults given CrP supplemented diets and not provided a supplemental exercise program. He further points out that CrP supplementation in conjunction with an exercise-training program also does not facilitate a preferential loss of FFM (Hasten et al, 1992; Trent and Thieding-Cancel, 1995; Lukaski et al, 1996; Hallmark et al, 1996; Grant et al, 1997;Passman et al, 1997).

On the other hand, Anderson in 1998 has counterargued and favored the effect of Cr on lean body mass. As stated earlier, there have been at least ten studies of Cr supplementation and resistive exercise. However, the methods used to determine LBM have been questioned, but Anderson suggests in 1998 that this does not negate the actual observed statistical differences between placebo and Cr supplementation. Moreover, three studies (Clancy et al, 1994; Trent and Thieding-Cancel, 1995; Passman et al, 1997), reported no significant increases in LBM from Cr, in subjects performing resistance exercise training.

However, changes caused by exercise alone also were not significant. Anderson further points out that it seems

B. Weight related measurements Signs of Cr deficiency in humans consuming parenteral diets that have been documented on numerous occasions by Anderson in 1995, 1998 and Brown and colleagues in 1986, include elevated blood glucose, insulin, cholesterol, and triglycerides and decreased highdensity lipoprotein (HDL) cholesterol (Mertz, 1993).

Although numerous reports document the role of Cr in glucose and insulin metabolism (Mertz 1993; Anderson, 1995, 1998b) the role of Cr in the regulation of LBM, percentage body fat, and weight reduction is still highly controversial because a significant number of studies (Clancy et al,1994; Trent and Thieding-Cancel, 1995; Lukaski et al, 1996; Hallmark et al, 1996; Passman et al, 1997; Walker et al, 1998; Campbell et al, 1999; Lukaski, 163

Chen et al: Chromium Picolinate and DRD2 Gene unrealistic to assume that if methods and statistics used do not detect changes caused by resistive exercise in LMB, any changes owing to Cr would be detected. Changes in LBM owing to Cr would certainly be anticipated to be much less than those achieved through strenuous resistive exercise. Moreover, explanation for a number of negative studies could be due to low dosage, small sample size and duration of the study. In a study by Bulbulian and colleagues in 1996, in a study of 20 male and 20 female swimmers who received 400 mcg Cr/day (as CrP), Cr significantly increased LBM, decreased fat mass, and decreased percentage body fat compared with the placebo group. Effects were not significant after 12 weeks but were after 24 weeks.

Weight loss is common and relatively easy for many people, but maintaining weight loss is extremely difficult.

The failure rate for maintaining weight loss more than 2 years is often greater than 95%. Although there is ample evidence that Cr has an effect on body composition, decreases in body weight from supplemental Cr alone are likely to be small. In studies by Anderson and colleagues (1979,1 998a,b, 1995) during the past 20 years of daily supplementation of 200 mcg CrC and up to 1000 mcg in the form of CrP ranging from 5 weeks to 4 months of supplementation, Andersons’ group have been unable to detect an effect of supplemental Cr on body weight.

alcoholics as a function of dopamine D2 receptor genotype (in 3,329 unscreened controls the A1 allele is present in 29.4% of the general population, whereas the A2 allele is present in 70.6 %) (2003). Other studies involving the D2 receptor gene and drug response includes the work of Nobles’ group showing a differential response of the serotonergic re-uptake inhibitor paroxetine and response of patients with posttraumatic stress disorder .Individuals with the D2 A1 allele were more responsive than those with the D2 A2 allele (Lawford et al ,2003).

E. DRD2 genes and obesity The reinforcing properties of food have also led to an examination of the involvement of DRD2 polymorphisms in obesity. Haplotype 4 (GT) of intron 6 and exon 7 of the DRD2 gene was found to be associated with increasing risk for obesity (Comings et al, 1993). In another study, the DRD2 A1 allele was present in 45.2% of obese subjects (Noble et al, 1994), prevalence similar to that found in alcoholics, nicotine and other drug–dependent subjects. In addition, the A1 allele was significantly associated with carbohydrate craving. Variants of the human obesity (OB) and the DRD2 genes have been examined in relationship to obesity (Comings et al, 1996).

Polymorphisms of the Leptin OB gene and the DRD2 A1 allele each associated significantly with obesity. These two polymorphisms together accounted for about 20% of the variance in body mass index (BMI), particularly in younger women. Another study has ascertained the relationship of the DRD2 A1 allele in obese subjects with and without comorbid substance use disorders(Blum et al, 1996c). In obese subjects, the A1 allelic prevalence was significantly higher than controls (P< 10-4). Moreover, the progressive increase in comorbid substance use disorders in these obese subjects was positively related to increased A1 allelic prevalence (P < 10-6). Furthermore, another case control study (Spitz et al, 2000) compared variants of the DRD2 gene in obese (BMI > 30) and non-obese control subjects. The DRD2 A1 allele was significantly higher in obese subjects compared to controls (P = 2 x 10-3) as was the DRD2 B1 allele (P = 3 x 10-3). The risk of obesity associated with the DRD2 A1 genotype was 3.48 compared to 4.55 for the DRD2 B1 genotype. , Moreover, Thomas and colleagues assessed in 2001 Taq1 A DRD2 alleles in 484 obese and 506 non-obese Chinese subjects.

Obese subjects, using either BMI or waist–to-hip ratio criteria, had a significantly higher prevalence of the A1 allele (P=0.02) and A1 allelic frequency (P= 0.03) than non-obese subjects.

Two studies (Jenkinson et al, 2000; Tataranni et al, 2001) assessed the role of other DRD2 mutations on weight and energy expenditure in Pima Indians.

Individuals with a Cys-encoding allele had a higher BMI than those homozygous for the Ser311 –encoding allele (Jenkinson et al, 2000). Further, total energy expenditure and 24-hour resting energy expenditure were lower in homozygotes for the Cys311-encoding allele when compared to heterozygotes and homozygotes for the Ser311-encoding allele (Tataranni et al, 2001). Finally, another study (Rosemond et al, 2001) determined the association of a Nco1 Polymorphism (C-T transition) in

C. Genetic aspects To date there has been no resolution and explanation for the controversial findings related to the effects of Cr salts on body composition and other weight related parameters. However, none of the investigators seriously considered genetic aspects, in spite of the emerging field of nutrigenetics (the biological response to an element is dictated by one’s genotype).

The advent of molecular genetic knowledge and techniques, in the past two decades, has revolutionized our understanding of inherited disorders. Although much success has been achieved in localizing genes in Mendelian disorders, great difficulty has been experienced in identifying genes in behavioral disorders (alcoholism, drug dependence, smoking, food and bingeing behavior, etc). In this regard, however, the D2 dopamine receptor gene has been one of the most extensively investigated genes in neuropsychiatric disorders. After the first association of the Taq1 A DRD2 minor (A1) with severe alcoholism in 1990 by Blum and collegaues, a large number of international studies have followed. Variants of the DRD2 gene have also been associated with other addictive disorders including cocaine, nicotine, opioid dependence and obesity. It is hypothesized that the DRD2 gene is a reinforcement or reward gene (Noble, 2003; Blum et al, 1996a,b; Comings et al, 1996; Thanos et al, 2001).

D. DRD2 gene and pharmacogenetics In terms of pharmacogenomic and pharmacogenetic studies involving the D2 receptor gene, Lawford and colleagues showed in 1995 a selective positive effect of bromocriptine, a D2 agonist, in reducing relapse rates in

164

Gene Therapy and Molecular Biology Vol 11, page 165 highly with underwater weighing Nord and Payne, 1995), Deuterium dilution (Jensen et al, 1993), and total potassium (Beshya et al, 1995). The reliability of DEXA makes it possible to monitor the effects of relatively short-term dietary restrictions and exercise on both regional and total body composition.

DEXA provides a three-compartment model of body composition: fat, lean tissue mass and bone mineral content.

Measurements are made using a constant potential energy source at 78kVp and a K-edge filter (cerium) to achieve a congruent, stable, dual-energy beam with effective energies of 40 to 70 keV. The unit performs a series of transverse scans moving from head to toe at 1-cm intervals; the area being scanned is approximately 60 x 200cm. Data are collected for about 120 pixel elements per transverse, with each pixel approximately 5 x 10 mm. Total body measurements are completed in 10 to 20 minutes with a scan speed of 16 cm/s, or in 20 minutes with a scan speed of 8 cm/s.

The rate value (ratio of low – to high – energy attenuation in soft tissue) ranges from 1.2 to 1.4.

exon 6 of the DRD2 gene with hypertension. Subjects with the TT genotype had significantly higher systolic blood pressure than subjects with the CT genotype (P=0.049).

Moreover, subjects with TT genotype had significantly higher diastolic blood pressure than either subjects with the CYT or CC genotype (P=0.011). The importance of the latter finding relates to the fact that, there is strong evidence from epidemiological studies of a positive relationship between increased body weight and hypertension (Thomas et al, 2000).

In order to resolve the issue of non-responders, we decided to test the hypothesis that typing the obese patients by genotyping the DRD2 gene prior to treatment with CrP would result in a differential treatment outcome.

This notion was based on previous research, as discussed above, which in summary, indicated that the DRD2 TaqA1 allele was associated with obesity in general (Comings et al, 1993; Spitzet al, 2000), BMI (Noble et al, 1994), carbohydrate bingeing Comings et al, 1996, co-morbid substance use disorder (Blum et al, 1996c), reduced receptor density (Wang et al, 2001) in very obese people, energy expenditure(Jenkinson, et al, 2000; Tataranni et al, 2001), hypertension (Thomas et al, 2000), and contributed to the overall variance of percent body fat in the present population at a significant rate (Chen et al, 2007). We predicted that carriers of the DRD2 A2 allele, would retain the positive metabolic effects of CrP. In contrast the DRD2 A1, carriers because of a proclivity to increase carbohydrate bingeing, would possibly mask the metabolic effects of CrP on weight loss and change in body fat.

To answer these questions, we used DEXA testing to determine body composition and genotyped each subject for polymorphisms of the DRD2 gene and carried out a randomized, double-masked, placebo-controlled study of the effects of CrP on body composition.

C. Procedure Kaats and colleagues have previously published in 1998 the procedure utilized in this study. After completing an initial DEXA test, subjects were provided with a report of their test results and randomly assigned a number from 1 to 130, which corresponded to a bottle containing capsules with 400 microgram of CrP or placebo. None of the investigators, research technicians dispensing the product, or participants, knew which subject number corresponded to the placebo or active product. An independent local pharmacist acted as trustee for the study and randomly assigned subject numbers to bottles that had been prelabeled with either an “X” or “Y” to correspond with either active or placebo.

Subjects recorded the total number of steps taken each day in the same daily log used to record their caloric intake, which was subsequently used to adjust the subject’s net change in body fat by using the following formula: 3500 calories = a change of 1 pound of body fat. Subjects checked in at the research center on a weekly basis to obtain a scale weight and to report their weekly physical activity levels, estimated caloric intake and any adverse side effects (none reported).

To monitor and adjust for differences in energy expenditure through physical activity throughout their waking hours, all subjects wore a pedometor ( same method as used in previous studies (Kaats et al, 1998b) that reflected the number of steps they took during each day or the step equivalents for activities in which it was impractical to wear the unit. In terms of compliance, each participant was required to provide a $100 deposit by check or credit card, which would not be processed unless the subject failed to complete the last DEXA test and endof-study questionnaire. Participants were advised that return of their deposit was based solely on their completing the last tests no matter how well or poorly they adhered to the research protocol, as long as they reported candidly on how much or how little they complied.

On completion of the study and when all data were gathered and entered in the computer system, the trustee opened an envelope supplied by the manufacturer indicating which product was active and subsequently notified the co-senior investigator (GRK). The Department of Computing Resources at the University of Texas Health Sciences Center at San Antonio, Texas, analyzed all information under the supervision of the corresponding author.

II. Research methods and procedures A. Subjects A total of 130 Caucasian subjects were enrolled in the study, 122 (17 men and 105 women; men age, 42.3 years) of which completed the testing (93.8%). Fitness instructors and sales personnel who provided information about the study to potential participants recruited subjects from a variety of fitness and athletic clubs in San Antonio and Houston, Texas. In order to ensure compliance, the fitness instructors were paid to monitor the subjects as they progressed through the study to ensure that the subjects reported their physical activity levels and caloric intake and completed the testing. All subjects were asked to consult with their personal physician before giving written informed consent. All patients signed an approved IRB consent form for both treatment and genotyping by the University of Texas Health Science Center, University Of North Texas, Baylor College of Medicine and the City of Hope National Medical Center and the PATH Medical Foundation.

B. Dual Energy X-Ray absorptiometry A number of studies have shown that DEXA can accurately measure fat and lean content of skeletal mass with a typical precision error for total body bone mineral content <1% (Fredi et al, 1991).

DEXA has also been shown to be a precise method for assessing body composition on obese and non-obese subjects (Tataranni et al, 1995; Wang et al, 1995). DEXA correlates

D. Genotyping A total of 130 subjects were genotyped for the dopamine D2 receptor gene. All subjects were genotyped based on a neutral identification number and read without knowledge of the individual being typed.

165

Chen et al: Chromium Picolinate and DRD2 Gene Total genomic DNA was extracted from each coded blood sample, and aliquots were used for polymerase chain reaction (PCR) analysis. The oligo- nucleotide primers 5’CCGTCGACCCTTCCTGAGTGTCATCA-3’ and 5’ CCGTCGACGGCTGG CCAAGTTGTCTA-3’were used to amplify a 310-base pair(bp) fragment spanning the polymorphic TaqA1site of the DRD2 gene .The D2A1 and D2A2 genotyping was performed by a PCR technique (Blum et al, 1990; Comings et al, 1996). PCR was performed in 30- µL reaction mixtures containing 1.5mM MgCl2, 2mM 2’- deoxynucleotide 5’ – triphosphates (dNTPs). 05 µM primers, 1 µg of template DNA 1.5U of Taq polymerase (Boehringer Mannheim Corp., Indianapolis, IN), and PCR buffer (20 mM Tris-HCL [pH 8.4] and 50mM KCL. After an initial denaturation at 94°C for 4 minutes, the DNA was amplified with 35 cycles of 30 seconds at 94°C, 30 seconds at 58°C, and 30 seconds at 72°C, followed by a final extension step of 5 minutes at 72°C. The PCR product was digested with 5 U of Taq 1 for 22 hours at 65°C for the Taq1A polymorphism. Digestion products were then resolved on a 3% agarose gel (5V/cm) containing 0.65-µg/ml ethidum bromide.

There were three DRD2 Taq1A genotypes: 1) the predominant homozygote A2/A2, which exhibits three restriction fragments of 180 and 130 bp; 2) the heterozygote A1/A2, which exhibits three restriction fragments of 310, 180, and 130bp; and, 3) the rare homozygote A1/A1, which produces only the uncleaved 310-bp fragment.

We controlled for any false positives by having more than one person extract the genotyping data and the principle investigators (KB and GK) were blinded.

and placebo groups, independent of the DRD2 genotyping, suggesting that the randomization process was successful in providing two equivalent groups of subjects.

Figure 1 presents a comparison between group changes that occurred in body composition variables in both active treatment and placebo groups as a function of DRD2 genotyping over the test period. Adjusting for caloric intake and energy expenditure of the data, we then utilized Student’s t test to examine the differences between the four groups. In agreement with our a priori prediction t test analysis revealed that carriers of the DRD2 A2 allele were more responsive to the effects of CrP than were the DRD2 A1 allele carriers. In the DRD2 A2 carriers the measures of the change of fat weight (-0.59 vs. -5.9 p<0.041), change in body weight (-1.5 vs. -8.5 p<0.017), the percent change in weight (0.98 vs. 4.1 p<0.44), and the body weight change in kilograms (-0.7 vs. -3.8 p<0.018) all parameters showing significance. In contrast, in the DRD2 A1 carriers, the change of fat weight (-4.7 vs. -6.7; p = 0.231), change in body weight (-4.7 vs. -5.4; p = 0.7), the percent change in weight (2.8 vs. 2.8 p = 0.97) and the body weight change in kilograms (-2.12 vs. -2.5; p = 0.7) no significance was found in any parameter tested (see Figures 1 and 2). It is noteworthy that a subsequent analysis of these data revealed that among participants receiving CrP, the average amount consumed was 357 µg/d.

In terms of distribution of the DRD2 genotypes, we found that carriers of the Taq 1 A1 allele constituted 68% of the 122 subjects tested, whereby the remaining 32% possessed the Taq1 A2 allele. We only found three individuals to carry the homozygous A1/A1 allele. We believe that this high allelic presence of the DRD2 A1 allele is because these individuals tested were obese.

E. Statistical analysis Comparisons were made between body composition variables for the two groups at baseline using a two-tailed student’s t test and between baseline and post test for both groups (n=120) using paired t-test analysis. Finally, comparisons were made between the changes occurring in the two groups without making any adjustments for caloric intake (kilocalorie) or expenditure. All data analysis was conducted at the University of Texas Health Sciences Center’s Department of Computing Resources.

IV. Discussion In general these results confirm and expand our initial studies (Kaats et al, 1992, 1996, 1998a) showing a positive effect of CrP supplementation on body composition. We now find clear differential therapeutic effects for CrP in terms of a number of body composition variables based on genotyping for at least the DRD2 gene.

This suggests that the explanation for negative findings with CrP supplementation may be due in part to a gap in information and lack of DNA testing of each patient prior to treatment. For example, as stated above in the past, such explanations discussed the possibility that strenuous

III. Results Of the 130 subjects who were recruited for this study, only 8 failed to complete the final test; 1 subject became pregnant and was asked to withdraw from the study, 3 moved from the area, 1 was ill during the post testing period and 3 was lost to the follow-up. A comparison of the 122 subjects who completed the study with the 8 subjects who did not revealed no significant differences in any of the body composition variables. Baseline characteristics for the 122 subjects who completed the study are provided in Table 1.

No statistically significant differences in baseline characteristics were observed between the active treatment

Table 1. Mean (SD) baseline demographic data for 122 subjects randomized to receive ether chromium picolinate (CrP) [n=62} or placebo (n=60).

CrP (400 µg/d)[n=62] Placebo [n=60]

Age (Y) 41.1±10.5 43.5± 7.5

Weight (kg) 85.5 ± 23.0 79.9 ± 20.4

Body-Fat (%) 42.4 ± 8.3 41.8 ±6.7

Reproduced from Kaats et al, 1998a with kind permission from Current Therapeutic Research.

166

Body-Mass Index (kg/m2) 30.2 ±7.1 28.4 ±5.4

Gene Therapy and Molecular Biology Vol 11, page 167

Figure 1. Double-blind comparison of Chromium Picolinate at 400 micrograms per day vs. Placebo on a number of weight and fat measures in subjects with the Dopamine D2 receptor A2/A2 genotype. P values indicate significance in all measures tested.

Figure 2. Double-blind comparison of Chromium Picolinate at 400 micrograms per day vs. Placebo on a number of weight and fat measures in subjects with the Dopamine D2 receptor A1/A1 and A1/A2 genotypes. P values indicate no significance in all measures tested.

physical activity increases urinary chromium loss and therefore the 200 microgram dose is too small an amount to produce positive changes in BMI when following a strenuous exercise program (Anderson, 1998) A more parsimonious explanation could simply be due to DRD2 genotype, at least in part.

While obesity is a heterogeneous and prevalent disorder with both genetic and environmental components, the causes of this disease are still unknown. Over the last decade a number of genetic variants have been associated with obesity and related subtypes. Included in the list are CNS regulatory genes such as the Leptin OB (LEPT) and the DRD2 genes (Comings et al, 1996). Additionally other genes have also been associated with obesity (e.g. preenkephalin gene, uncoupling protein, etc). With this in mind, we are proposing that since the dopaminergic pathway is involved in â&#x20AC;&#x153;rewardâ&#x20AC;? behaviors including substance use disorder (alcohol, cocaine, nicotine and food) (Blum et al, 1990, 1996a; Noble, 2003) and since the DRD2 A1 allele is associated with a number of body composition arameters (i.e. BMI, parental history of obesity, carbohydrate bingeing, percent body fat) carriers of the DRD2 A1 allele will be prone to excessive caloric intake. This will in turn significantly impact the positive metabolic effects of CrP, and therefore mask its effect to lower insulin resistance, leading to negative rather than positive changes in body composition as observed in this study for only the DRD2 A2 carriers. In the present study we did find a rather high (68%) A1 allele distribution in the obese subject population, thereby confirming other studies (Noble et al, 1994; Blum et al, 1996a; Comings et al, 1996).

In terms of therapeutic benefits, these results take on even greater significance, when one considers data which suggest that certain amino acid precursors or neurotransmitter synthesis promoters alone or in

combination with CrP reduce glucose cravings as well as carbohydrate bingeing episodes (Blum et al, 1990, 1997).

Therefore, we propose that future treatment of obesity should consider the importance of combining trivalent chromium salts (picolinate, nicolinate) with amino acid precursors, enkephalinase inhibitors and catecholamine omethy-transferase inhibitors (dl-phenylalanine, 1-tryosine, 1-glutamine, rhodiola rosea etc.) especially in dopamine D2 receptor Taq A1 allele obese subjects. Moreover, we propose that mixed effects now observed with CrP administration in terms of body composition, may be resolved by genotyping the prospective patient prior to administration of a trivalent chromium salt and this may be coupled with electrophysiological markers and anticraving neutraceuticals (Blum et al, 1994; Chen et al, 2004).

It is noteworthy that CrP shows promising antidepressant effects in atypical depression (Davidson et al, 2003). Atypical depression (American Psychiatric Association 1994) is a common form of depression (22% of all clinically diagnosed depression), characterized by mood reactivity, increased appetite, weight gain, as well as other features. Its mechanism of action may relate to 5HT2A down regulation, increased insulin sensitivity, or to other effects and other neurotransmitter receptors. While the sample size in the Davidson study in 2003 was small and the effect size was also small (p=0.02), based on our current data, we propose that additional work involving genotyping individuals for both serotonergic and dopaminergic gene polymorphisms linked to CrP response rate may uncover even stronger evidence for certain outcome measures related to the problem of weight gain and mood.

To shed some light on this dilemma, a study published in JAMA, by Ali H. Mokdad and colleagues in 2003 from Centers for Disease Control and Prevention,

167

Chen et al: Chromium Picolinate and DRD2 Gene Atlanta, Georgia, using a cross-sectional random -digit telephone survey (Behavioral Risk Factor Surveillance System) of non-institutionalized adults aged 18 years or older, suggest that obesity continues to increase rapidly in the United States. In 2001 the prevalence of obesity (BMI > or =30) was 20.9% vs. 19.8% in 2000, an increase of 5.6%. The prevalence of diabetes increased to 7.9% vs.

7.3% in 2000, an increase of 8.2%. The prevalence of BMI of 40 or higher in 2001 was 2.3%. Overweight and obesity were significantly associated with diabetes, high blood pressure, high cholesterol, asthma, arthritis, and poor health status. Compared with adults with normal weight, adults with a BMI of 40 or higher had an odds ratio (OR) of 7.37 (95% confidence interval [CI], 6.39-8.50) for diagnosed diabetes, 6.38 (95% CI, 5.67-7.17) for high blood pressure, 1.88 (95% CI, 1.67-2.13) for high cholesterol levels, 2.72 (95% CI, 2.38-3.12) for asthma, 4.41 (95% CI, 3.91-4.97) for arthritis, and 4.19 (95% CI, 3.68-4.76) for fair or poor health. Increases in obesity and diabetes among US adults continue in men and women, all ages, all races, all educational levels, and all smoking levels. Obesity is strongly associated with several major health risk factors. Since 1998, approximately one-third of the United States is overweight.

It is to be noted, Kaats and colleagues stated in 1998a that the randomization was successful in creating two equivalent groups of subjects. Table 1, reproduced from that earlier study shows how equivalent the groups are with respect to age, weight, body fat, and body mass index. With this mind, any adjustment for differences of groups is not expected to alter results, because the randomization utilized was so successful Finally, because an unusually high number of subjects (93.8%) completed the final testing, requiring research subjects to provide a conditionally refundable deposit to be returned on completion of final testing is a technique worthy of further study.

References Anderson RA (1995) Chromium, glucose tolerance, diabetes, and lipid metabolism. J Adv Med 8, 37-49.

Anderson RA (1998a) Effects of chromium on body composition and weight loss. Nutrition Reviews 56, 266-270.

Anderson RA (1998b) Recent advances in the clinical and biochemical manifestation of chromium deficiency in human and animal nutrition. J Trace Elem Exp Med 11, 241-250.

Anderson, RA (1995) Chromium and parenteral nutrition.

Nutrition 11 (suppl 1), 83-86.

Anderson, RA, Bryden NA, Polansky NM (1979) Lack of toxicity of chromium chloride and chromium picolinate. J Am Coll Nutr 16, 273-279.

Bagchi D, Stohs SJ, Downs BW, Bagchi M, Preuss HG (2002) Cytotoxicity and oxidative mechanisms of different forms of chromium.Toxicology 180, 5-22.

Bahadori B, Wallner S, Schneider H, Wascher TC, Toplak H (1997) Effects of chromium yeast and chromium picolinate on body composition of obese, non-diabetic patients during and after a formula diet. Acta Med Austriaca 24, 185-187.

Beshya SA, Freemantle C, Thomas E, Johnson DG (1995) Comparison of measurement of body composition by total body potassium, bioimpedance analysis, dual-energy x-ray absorptiometry in hypopituitary adults before and during and after growth hormone treatment. Am J Clin Nutr. 61, 11861194.

Blum K, Braverman ER, Wood R, Sheridan PJ (1994) DRD2 A1 Allele and P300 abnormalities in obesity (Abst 146). Am J Med Genet 55.

Blum K, Braverman ER, Wood RC, Gill J, Li C, Chen TJH, Taub M, Montgomery AR, Cull JG, Sheridan JP (1996c) Increased prevalence of the Taq 1 A1 allele of the dopamine D2 receptor gene (DRD2) in obesity with comorbid substance use disorder: a preliminary report.

Pharmacogenectics 6, 297-305.

Blum K, Cull JG, Braverman, ER, Comings DE (1996a) Reward Deficiency Syndrome. American Sci 84, 132-145.

Blum K, Cull JG, Chen TJH, Garcia-Swan S, Holder JM, Wood RC, Braverman ER, Bucci LR, Trachtenberg MC. (1997) Clinical evidence for effectiveness of PhenCal! in maintaining weight loss in an open-label, controlled, 2 year study. Curr Ther Res 58, 745-763.

Blum K, Noble EP, Sheridan PJ, Montgomery A, Ritchie T, Jagadeeswaran P, Nogami H, Briggs AH, Cahn JB (1990a) Allelic association of human D2 receptor gene in alcoholism.

J Am Med Assn 263, 578-580.

Blum K, Sheridan PJ, Wood RC, Braverman ER, Chen TJH, Cull JG, Comings DE (1996b) The D2 dopamine receptor gene as a determinant of reward deficiency syndrome. J Royal Soc Med 89, 396-400.

Blum K, Trachtenberg MC, Cook DW (1990b) Neuonutrient effects on weight loss in carbohydrate bingers: An open clinical trial. Curr Ther Res 43, 217-233.

Brown RO,Forloines-Lynn S, Cross RE, Heizer WD.(1986) Chromium deficiency after long-term parenteral nutrition.

Dig Dis Sci 31, 661-664.

Bulbulian R, Pringle DD, Liddy MS (1996) Chromium Picolinate supplementation in male and female swimmers. Med Sci Sports Exerc 39, 992-998.

Campbell WW, Joseph LJ, Anderson RA, Davey SL, Hinton J, Evans WJ (1999) Effects of resistance training and chromium picolinate on body composition and skeletal muscle in older men. J Appl Physiol 86, 29-39.

Chen TJH, Blum K, Kaats G, Braverman ER, Pullin D, Downs BW, Martinez -Pons M, Blum S, Mengucci JF, Bagchi D, Bagchi M, Roarge A, Meshkin B, Arcuri V, Varshavskiy M., Comings DE., White L (2007) Reviewing the role of putative candidate genes in â&#x20AC;&#x153;Neurobesigenicsâ&#x20AC;?, a clinical subtype of

V. Conclusion If these results could be further confirmed and extended by using PET scan to determine the pre and post density of D2 receptors in obese individuals following amino-acid precursor loading techniques and Cr, these future studies may have a powerful impact on the obesity epidemic. Cautiously we encourage additional nutrigenetic studies that will support pre-treatment DNA testing of the DRD2 gene polymorphisms and possibly other genes in obesity and other related RDS behaviors.

Acknowledgements We thank the financial support of Nutrition 2l, Purchase, New York. The research study was conducted at the Health and Medical Research Foundation, San Antonio and the Sports Medicine Institute, Baylor College of Medicine, Houston, Texas. We are also indebted to Salugen Inc, PATH Medical Foundation. We thank Rein Narma, Jim Sowell, and Eduardo Cruz, for their generous financial support. DEC was supported by NIDA grant RO1-DA08417.

168

Gene Therapy and Molecular Biology Vol 11, page 169 Reward Deficiency Syndrome (RDS). Gene Ther Mol Biol 11, 61-74.

Chen, TJH, Blum, K, Payte, JT, Schoolfield, J, Hopper, D, Stanford, M, Braverman, ER (2004) Narcotic antagonists in drug dependence: pilot study showing enhancement of compliance with SYN-10, amino-acid and enkephalinase inhibition therapy. Medical Hypotheses 63, 538-548.

Clancy SP, Clarkson PM, DeCheke ME, Nosaka K, Freedson PS, Cunningham JJ, Valentine B (1994)Effects of chromium picolinate supplemental on body composition, strength and urinary chromium loss in football players. Int J Sports Nutr 4, 142-53.

Comings DE, Flanagan SD, Dietz G, Muhlman D, Knell E, Gysin R (1993) The dopamine D2 receptor (DRD2) as a major gene in obesity and height. Biochem Med Metab Biol 50, 176-185.

Comings DE, Gade R, MacMurray JP, Muhlman D, Johnson P, Verde R,, Peters, WR (1996) Genetic variants of the human obesity (OB) gene: association with body mass index in young women, psychiatric symptoms and interaction with the dopamine D2 receptor (DRD2) gene. Molecular Psychiatry 1, 325-335.

Comings DE, Wu S, Chiu C, Ring RH, Gade R, Ahn C, MacMurray JP, Dietz G, Muhleman D (1996) Polygenic inhertance of Tourette Syndrome, stuttering, attentiondeficit-hyperactivity, conduct and oppositional defiant disorder. The addictive and substractive effect of the three dopaminergic genes-DRD2, DBH and DAT1. Am J Med Gen (Neuropsychiatric Genetics) 67, 264-288.

Crawford V, Scheckenbach R, Preuss HG (1999) Effects of niacin -bound chromium supplementation on body composition in overweight African-American women.

Diabetes Obes Metab 1, 331-337.

Davidson JRT, Abraham K, Connor KM, McLeod MN (2003) Effectiveness of Chromium in Atypical Depression: A Placebo -Controlled Trial. Biol Psychiatry 53, 261-264.

Diaz ML, Watkins BA, Li Y, Anderson RA, Campbell WW (2007) Chromium picolinate and conjugated linoleic acid do not synergistically influence diet- and exercise-induced changes in body composition and health indexes in overweight women. J Nutr Biochem 23, in press.

Evans GW (1983) Chromium picolinate is an efficacious and safe supplement. Int J Sport Nutr 3, 117-122.

Evans GW (1989) The effect of chromium picolinate on insulin controlled parameters in humans. Int J Biosoc Med Res 11, 163-180.

Evans GW, Meyers IK (1994) Life span is increased in rats supplemented with chromium -pyridine 2-carboxylate complex. Adv In Sci Res 1, 19-23.

Evans GW, Roginski EE, Merz W (1973) Interaction with the glucose tolerance factor (GTF) with insulin. Biochem Biophys Res Commun 50, 718-722.

Fekete S, Szakall I, Kosa E, Andrasofszky E, Fodor K, Hidas A, Tozser J (2001) Alteration of body composition in rats: effect of organic chromium and L-carnitine. Acta Vet Hung 49, 385-398.

Fredi KE, DeLuca JP, Marchitelli LJ, Vogel JA (1991) Reliability of body-fat estimations from a four-compartment model by using density, body water and bone mineral measurements. Am J Clin Nutr. 55, 764-770.

Gonzalez Munoz MJ, Meseguer I, Martinez Para MC, Aguilar MV, Bernao A (2006) Repercussions of chromium picolinate in the protein metabolism based on the age. Nutr Hosp 21, 709-714.

Grant K, Chandler RM, Castle Al, Ivy JL (1997) Chromium and exercise training: effect on obese women. Med Sci Sports Exerc 29, 992-998.

Gudi R, Slesinski RS, Clarke JJ, San RH (2005) Chromium picolinate does not produce chromosome damage in CHO cells. Mutat Res. 587,140-146.

Hallmark MA, Reynolds, TH, DeSouza, CA, Dotson CO, Anderson RA, Rogers MA (1996) Effects of chromium supplementation on resistive training on muscle strength and body composition Med Sci Sports Exerc.28, 139-44.

Hasten D, Rome EP, Franks BD, Hegsted, M. (1992) Effects of chromium picolinate on beginning weight training students.

Int J Sport Nutr, 2, 343-350.

Jenkinson CP, Hanson R, Cray K, Wiedrich C, Bogardus C, Baier L (2000) Association of dopamine D2 receptor polymorphisms Ser311Cys and Taq1 with obesity or type 2 diabetes mellitus in Pima Indians. Int J Obes (Lond) 24, 1233-1238.

Jensen M, Kanaley J, Roust L, Oâ&#x20AC;&#x2122;Brien PC, Dunn WL, Wahner HW (1993) Assessment of body composition with use of dual-energy x-ray absorptiometry: Evaluation and comparison with other methods. Mayo Clin Proc. 68, 867873.

Kaats GR, Blum K, Fisher JA, Adelman JA (1996) Effects of chromium picolinate supplementation of body composition: A randomized, double-masked, placebo-controlled study.

Curr Ther Res 57, 747-756.

Kaats GR, Blum K, Pullin D, Keith SC, Wood R (1998a) A randomized, double-masked, placebo-controlled study of the effects of chromium picolinate supplementation on body composition: A replication and extension of a previous study.

Curr Ther Res 59, 379-388.

Kaats GR, Keith SC, Pullin D, Squires WG Jr, Wise JA, Hesslink R Jr, Morin RJ (1998b) Safety and efficacy evaluation of a fitness club weight-loss program. Adv Ther 15, 345-361.

Kaats GR, Wise JA, Blum K, Morin RA, Adelman JD, Craig J, Croft HA (1992) The short term therapeutic efficacy of treating obesity with a plan of improved nutrition and moderate caloric restriction. Curr Ther Res. 51, 261-274.

Kornegay, ET, Wang Z, Wood CM, Lindemann MD (1997) Supplemental chromium Picolinate influences nitrogen balance, fry matter digestibility, and carcass traits in growing-finishing pigs. J Anim Sci 75, 1319-1323.

Lawford BR, Young RM, Rowell J, Qualichefski J, Fletcher BH, Syndulko K, Ritchie T, Noble EP (1995) Bromocriptine in the treatment of alcoholics with the D2 dopamine receptor Al allele. Nature Med 1, 337-341.

Lawford BR, Young RMcD, Noble EP, Kann B, Arnold L, Rowell J, Ritchie RT (2003) D2 dopamine receptor gene polymorphism: paroxetine and social functioning in posttraumatic stress disorder. Eur Neuropsychopharmaco l 13, 313-320.

Lindermann MD, Wood CM, Harper AF (1995) Dietary chromium picolinate additions improve gain: feed and carcass characteristics in growing -finishing pigs and increase litter size in reproducing sows. J Anim Sci 73, 457465.

Loveday KS (1996) Evaluation of chromium picolinate in the rat in vivo chromosomal aberration assay. TSI mason Laboratories, Inc., Worcester, MA. Lukaski HC (2000) Magnesium, zinc, and chromium nutriture and physical activity. Am J Clin Nutr 72 (suppl2), 585S93S. Lukaski HC, Bolonchuk WW, Siders WA, Milne DB. (1996) Chromium supplementation and resistance training: effects on body composition, strength, and trace element status of men. Am J Clin Nutr 63,954-965.

Lukaski HC, Siders WA, Penland JG (2007) Chromium picolinate supplementation in women: effects on body weight, composition, and iron status. Nutrition, in press.

Lukaski, HC (1999) Chromium as a Supplement. Annu Rev

169

Chen et al: Chromium Picolinate and DRD2 Gene Nutr 19, 279-302.

Luvolsi JM, Adams GM, Laguna PL (2000) The effect of chromium picolinate on muscular strength and body composition in women athletes. J Strength Cond Res 15, 161-166.

Mazess RB, Barden HS, Bisek JP, Hanson J (1990) Dual-energy absorptionmetry for total body and regional bone-mineral and soft-tissue composition. Am J Clin Nutr. 51, 11061112.

McCarty MF (1996) Chromium (III) picolinate. FASEB J 10, 365-367.

Mertz W (1993) Chromium in human nutrition: a review. J Nutr 123, 626-633.

Mertz W, Abernathy CO, Olin SS (1994) Risk assessment of essential elements. Washington, DC: ILSI Press.

Min JK, Kim WY, Chae BJ (1997) Effects of chromium picolinate (CrPic) on growth performance, carcass characteristics, and serum traits in growing-finishing pigs.

Asian Aust J Anim Sci 10, 8111 Mokdad AH, Ford ES, Bowman BA, Dietz WH, Vinicor F, Bales VS, Marks JS (2003) Prevalence of obesity, diabetes, and obesity -related health risk factors, 2001. JAMA 289, 76-79.

Mooney KW, Cromwell GL (1997) Effects of Cr chloride as potential carcass modifiers in swine. J Anim Sci 75, 26612671.

Noble EP, Noble RE, Ritchie T, Grandy DK, Sparkes RS (1994) D2 dopamine receptor gene and obesity. J Eating Disorders 15, 205-217.

Noble, EP (2003) D2 Dopamine Receptor Gene in Psychiatric and Neurological Disorders and its phenotypes. Am J Med Gen 116B, 103-125.

Nord RH, Payne RK (1995) Dual-energy x-ray absorptiometry vs underwater weighing comparison of strengths and weaknesses. Asia Pacific J Clin Nutr. 4, 173-175.

Page TG, Southern LL, Ward, TL, Thompson, DL Jr. (1993) Effects if chromium Picolinate on growth and serum and carcass traits if growing -finishing pigs. J Anim Sc 71, 656662.

PassmanWJ, Westerterp-Plantenga MS, Saris WHM (1997) The effectiveness of long-term supplementation of carbohydrate, chromium, fibre, and caffeine on weight maintenance. Int J Obes Rela Metab Disord 21, 1143-1151.

Rosemond R, Rankinen T, Chagnon M, PĂŠrusse L, Chagnon YC, Bouchard C, BjĂśrntorp P (2001) Polymorphism in exon 6 of the dopamine D2 receptor gene (DRD2) is associated with elevated blood pressure and personality disorders in men. J Hum Hypertens 15, 553-558.

Rubin MA, Miller JP, Ryan AS, Treuth MS, Patterson KY, Pratley RE, Hurley BF, Veillon C, Moser-Veillon PB, Anderson RA (1998) Acute and chronic resistive exercise increase urinary chromium excretion in men as measured with an enriched chromium stable isotope. J Nutr 128, 73-78 Slesinski R (2004) Chromium picolinate cleared of toxic charges.

Centers for Disease Control and Prevention (CDC) conference on metal toxicity and carcinogenesis. September 16, Washington, DC. Spitz MR, Duphorne CM, Detry MA, Pillow PC, Amos CI, Lei L, de Andrade M, Gu X, Hong WK, Wu X (2000) Variant

alleles of the D2 dopamine receptor gene and obesity.

Nutrition Res 20, 371-380.

Stallings DM, Hepburn DD, Hannah M, Vincent JB, O'Donnell J (2006) Nutritional supplement chromium picolinate generates chromosomal aberrations and impedes progeny development in Drosophila melanogaster. Mutat Res 610, 101-113.

Stearns DM, Wise JP, Patterno SR, Wetterhahn KE (1995) Chromium picolinate produces chromosome Damage in Chinese hamster ovary cells. FASEB J 9, 1643-1648.

Stoecker BJ (1990) Chromium. In: Present Knowledge in Nutrition, Sixth Edition, Brown ML, ed. International Life Sciences Institute, Nutrition Foundation, Washington DC, pp. 287-293.

Tataranni PA, Baier L, Jenkinson C, Harper I, Del Parigi A, Bogardus C (2001) Ser311Cys mutation in the human dopamine D2 gene is associated with reduced energy expenditure. Diabetes 50, 901-904.

Tataranni PA, Ravussin E (1995) Use of dual-energy x-ray absorptiometry in obese individuals. Am J Clin Nutr. 62, 730-734.

Thanos PK, Volkow ND, Freimuth P, Umegaki H, Ikari H, Roth G, Ingram DK, Hitzman R (2001) Overexpression of Dopamine D2 receptors reduces alcohol self -Administration.

J Neurochem 78, 1094-1103.

Thomas GN, Critchley JAJH, Tomlinson B, Cockram, CS, Chan JCN (2001) Relationships between the Taq1 polymorphism of the dopamine D2 receptor and blood pressure in hyperglycemic and normoglycemic Chinese subjects. Clin Endocrinol 55, 605-611.

Thomas GN, Tomlinson B, Critchley AJ (2000) Modulation of blood pressure and obesity with the dopamine D2 receptor gene Taq1 polymorphism. Hypertension 36, 177-182.

Trent LK, Thieding-Cancel D (1995) Effects of chromium picolinate on body composition. J Sports Med Phys Fitness 35, 273-280.

Volpe SL, Huang HW, Larpadisorn K, Lesser II (2001) Effect of Chromium Supplementation and exercise on Body Composition, Resting Metabolic Rate and selected Biochemical Parameters in Moderately Obese women following an Exercise program. J Am Coll Nutr.20, 293306.

Walker LS, Bemben MG, Bemben DA, Knehans AW (1998) Chromium picolinate effects on body composition and muscular performance in wrestlers. Med Sci Sports Exercise 30, 1730-1737.

Wang GL, Volkow ND., Logan J, Pappers NR, Wong CT, Zhu W, Netusil N, Fowler JS (2001) Brain dopamine and obesity.

Lancet 357, 354-357.

Wang ZM, Heschda S, Pierson RN, Heymsfield SB (1995) Systematic organization of body-composition methodology: an overview with emphasis on component-based methods.

Am J Clin Nutr. 61, 457-465.

Ward TL, Southern LL, Bidner TD (1997) Interactive effects of dietary chromium tripicolinate and crude protein level in growing -finishing pigs provided inadequate and adequate floor space. J Anim Sci 75, 1001-1005.

WHO (1973) Tech. Rep. Ser. 532. Geneva: WHO.

170

Gene Therapy and Molecular Biology Vol 11, page 171 Gene Ther Mol Biol Vol 11, 171-176, 2007

Stringent control of NFATc1 nuclear occupancy is critical for maintaining balanced immune response Research Article

Minggui Pan1,*, Monte M. Winslow2, Joo Seob Keum2, Gerald R. Crabtree3 1 3

Division of Oncology, 2Division of Immunology, Howard Hughes Medical Institute, Department of Developmental Biology and Pathology, Stanford University, Stanford CA 94305-5323, USA

__________________________________________________________________________________ *Correspondence: Minggui Pan, Division of Oncology-Hematology, Kaiser Permanente Medical Center, 710 Lawrence Expressway, Santa Clara, CA 95051, USA; Tel: 408 851 4306; Fax: 408 851 4319; E-mail: Minggui.pan@kp.org Key words: NFATc1; Immune Response; Nuclear Occupancy; Autoimmunity Abbreviations: anti-nuclear antibody, (ANA); nuclear NFATc1 variant, (NFATc1nuc ) Received: 3 June 2007; Revised: 11 July 2007 Accepted: 23 July 2007; electronically published: August 2007

Summary Many immune and inflammatory diseases still lack a clear mechanistic explanation. NFATc transcription factors are involved in immune homeostasis and response. NFATc1 is rapidly imported into the nucleus upon activation of lymphocytes that leads to its stimulation of a battery of cytokines responsible for immune response and is rapidly removed from the nucleus upon termination of the signaling. We have previously established a tetracyclineregulated transgenic mouse model with a subtle increased nuclear NFATc1 expression. The level of nuclear NFATc1 expression was only 1/7th of the total NFATc1 molecules of a wild type T cell. Here we show that this subtle increase of NFATc1 nuclear occupancy caused a severe disease with multi-organ failure characterized with infiltration of immune cells, elevated auto antibodies, leading to early animal death. Suppression of the transgene expression by doxycycline suppressed and reversed the disease. These results indicate that stringent control of NFATc1 nuclear occupancy is critical for maintaining balanced immune response and may have important clinical implications.

biological systems such as cardiac valve morphogenesis, axonal outgrowth in nervous system, in addition to its role in immune system (Crabtree et al, 2002; Graef et al, 2003; Chang et al, 2004). NFATc1 protein contains a number of phosphorylation sites that are normally phosphorylated when it is inactivated and compartmentalized in the cytoplasm (Flanagan et al, 1991; Timmerman et al, 1996; Beals et al, 1997a,b). Activation of T cells leads to its dephosphorylation and rapid shuffling into the nucleus (Flanagan et al, 1991; Timmerman et al, 1996; Beals et al, 1997a,b). NFATc1 has been shown to mediate immune response both in B and T cells (Flanagan et al, 1991; Timmerman et al, 1996; Beals et al, 1997a,b; de Gorter et al, 2007). Activation of lymphocytes causes calcium influx leading to activation of calcineurin, a serine/threonine phosphotase that subsequently dephosphorylates NFATc proteins and leads to their nuclear import (Flanagan et al, 1991; Timmerman et al, 1996; Beals et al, 1997a,b).

Activated nuclear NFATc1 protein stimulates production of a battery of cytokines including interleukin-2, interferon, TNF! and many others (Rao et al, 1997).

Introduction of calcineurin inhibitors FK506 and

I. Introduction The mechanism of many immune and inflammatory diseases such as lupus, rheumatoid arthritis, polymyalgia rheumatica, multiple sclerosis, fibromyalgia, inflammatory bowel disease and others is still not completely understood (Janeway et al, 2000; Davidson et al, 2001). Steroid traditionally constitutes the mainstay of therapy of these diseases. More recently strategies such as depletion of TNF! and depleting B cells with anti-CD20 antibody have improved the treatment outcome for many diseases (Pisetsky et al, 2000; Kneitz et al, 2002). However, a portion of patients would only respond minimally or would not respond at all (Kneitz et al, 2002; Pisetsky et al, 2000). In addition, durable response often requires continuous therapy (Pisetsky et al, 2000; Kneitz et al, 2002).

NFATc proteins are involved in the functional regulation of T and B cells as well as cytokine production (Rao et al, 1997; Ranger et al, 1998; Peng et al, 2001; de Gorter et al, 2007). NFATc1 gene is a widely expressed transcription factor and plays critical roles in many

171

Pan et al: NFATc1 export and immune response cyclosporine A have revolutionized the treatment for patients with organ transplant (Kunz et al, 1993).

Blockade of calcineurin activation by cyclosporine A and FK506 inhibits calcineurinâ&#x20AC;&#x2122;s ability to dephosphorylate and activate NFATc proteins, hence causes inhibition of production of many important cytokines (Clipstone et al, 1994; Kiani et al, 2000).

We have previously established a tetracyclineregulated transgenic mouse model with expression at subphysiologic level of a nuclear NFATc1 variant (NFATc1nuc) that lacks ability to exit the nucleus (Pan et al, 2007). The level of expression of this nuclear NFATc1 variant was only 1/7th of the total NFATc1 molecules of a wild type T cell yet caused a destabilized positive feedback loop in its own transcription leading to T cell activation independent of CD28 costimuation, partial resistance to cyclosporine A inhibition of T cell proliferation as well as markedly enhanced production of Th1/Th2 cytokines and activation antigens both spontaneously and when activated (Pan et al, 2007). T cell activation of the NFATc1nuc mice were several magnitudes higher than normal T cells in resting state and in activated state and produced increased IgG2!. We have also previously shown using this transgenic mouse model that NFATc1 regulates bone homeostasis (Winslow et al, 2006).

In this manuscript, we show that the subtle increase of nuclear NFATc1 occupancy caused a severe mouse phenotype with multi-organ failure involving lungs, liver, kidneys, muscle, joints characterized with dense infiltration of immune cells including lymphocytes, macrophages and granulocytes leading to early animal death. Serum auto antibodies including anti-ANA, antidsDNA, circulating immune complex (CIC) and anti-RNP were elevated and immune complex deposits were detected in the kidneys of the mutant mouse. Treatment of the mutant mouse with doxycycline to suppress the expression of NFATc1nuc prevents the death and reverses the disease (Pan et al, 2007). These results indicate that stringent control of NFATc1 nuclear occupancy is critical for maintaining balanced immune response and may have important clinical implications.

B. Western Blot Cell lysates of lymph nodes, spleen and thymus were prepared, separated on a SDS-polyacrylamide gel, transferred to a nitrocellulose membrane and blotted with anti-HA (16B12, Berkeley antibody company) or anti-actin antibodies (Sigma).

B. Histologic analysis Tissues and organs were fixed for 24 hours with 10% formalin, dehydrated, embedded in wax, sectioned and processed for H + E staining according to standard protocols.

C. Immunofluorescent staining Frozen sections of wild type or mutant kidneys were prepared, blocked with buffer containing BSA, NaCl (200mM) and 0.1%triton, stained with FITC-conjugated goat anti-mouse IgG antibody (PharMingen).

D. Assay of auto antibodies 50ul of serum from wild type or mutant mice was used to assay for auto antibodies using ELISA method according to instructions provided by the manufacturer (Alpha Diagnostic International).

III. Results A. Early death of the NFATc1nuc mice were preventable with suppression of the transgene We have previously established a tetracyclineregulated transgenic mice model NFATc1nuc that expressed a very low sub-physiologic level of NFATc1nuc (1/7 of the total NFATc1 level of wild type T cells) detectable in T cells and was associated with much increased cytokine production and T cell activation that was independent of CD28 costimulation and partially resistant to cyclosporine inhibition (Pan et al, 2007). No abnormality in T cell development was identified in the NFATc1nuc mutant animals (Pan et al, 2007). We have also shown that NFATc1nuc could be detected in osteoblasts and regulates homeostasis of osteoblasts and bone mass formation (Winslow et al, 2006). NFATc1nuc mice were born at normal Mendelian ratios and were normal at birth but later began showing signs of illness that could be recognized as rough fur, retarded weight gain (cachexia), decreased mobility, joint swelling and joint deformation (Figure 1A, right). This gross phenotype appeared coincidence with the expression of NFATc1nuc in the spleen and lymph nodes. As shown in Figure 1B, the expression of NFATc1nuc in the peripheral lymph nodes and spleen was only detected when the mutant mice became apparently ill, while it was detectable in the thymus in latent as well as in late stage (Figure 1A, right) NFATc1nuc mice. Latent stage was defined as the mutant mice appearing normal or mildly ill by gross observation, while late stage was defined as the mutant mice appearing apparently sick by gross observation. The time to onset of the disease varied from a few days after birth to as long as 6 months with male and female mice being equally affected. The early onset (within 6 weeks of age) mutants normally progressed to death within 2 to 3 weeks while late onset mutants progressed more slowly (after 6 weeks). In contrast, no wild type, Tet-O-NFATc1nuc or mice expressing wild type NFATc1 (NFATc1wt/tTA) developed

II. Methods A. Generation of tetracycline-regulated transgemic mouse that contains a constitutively nuclear NFATc1 (NFATc1nuc) and doxycycline treatment of the transgenic mouse This was described previously (Felsher and Bishop 1999; Winslow et al, 2006; Pan et al, 2007). Briefly, NFATc1nuc was made by site-directed mutagenesis and the DNA was inserted inframe into pS vector N-terminally to a HA tag. The construct was digested with Bam HI and Acc 65I and inserted into pUD10-3 downstream of Tet-O promoter. The transgene was digested with Spe1, purified and pro-nucleus injection was performed using B6CBAF1/J (Jackson) mice with standard protocol. Tet-O-C1wt mice were generated in similar method. 83 tTA mice (FVB/N) were previously described (Felsher and Bishop 1999). The treatment of NFATc1nuc mouse with doxycycline was performed by feeding the mouse with drinking water containing doxycycline 200 ug/ml thatâ&#x20AC;&#x2122;s changed once a week.

172

Gene Therapy and Molecular Biology Vol 11, page 173 longer dependent on the expression of NFATc1nuc protein, or the disease had caused multi-organ failure thatâ&#x20AC;&#x2122;s no longer reversible. Treatment of the mutant mice with doxycycline promoted weight gain consistent with their recovery from the disease, indicating that cachexia was associated with the cytokine production (Pan et al, 2007) and the disease (Figure 1E green). The mutant mice not treated with doxycycline continued to show retarded weight gain until death (Figure 1E orange). Histological examination of the doxycycline-treated mutant mice showed normal organs and tissues (Figure 2C and 2F) comparable to the wild type (Figure 2A and 2D).

However, three to six months after NFATc1nuc expression is reactivated (by discontinuing doxycycline treatment), these once cured NFATc1nuc mice developed the disease again and died (data not shown).

disease during this time (Figure 1C). By week 5 to 6, approximately half of all the mutant mice have died (Figure 1C). By age six months, ninety five percent of all mutant mice have died of the disease (data not shown).

To examine if the expression of NFATc1nuc was responsible for the disease, we treated the mutant mice with docycyline which suppresses the expression of the transgene (Pan et al, 2007). As shown in Figure 1D, when treated with doxycycline during the perinatal or disease latent period, no NFATc1nuc mice developed the illness.

However, only 70% of the adult mutant mice that had developed a full-blown onset of the disease during p19-35 had the disease reversed with docycycline suppression of the NFATc1nuc expression, while 30% of these mutant mice still progressed to death. This suggests that 30% of the adult mutant mice had developed a disease thatâ&#x20AC;&#x2122;s no

Figure 1. Early death of the NFATc1nuc mutant mice was preventable with doxycycline treatment. A. Gross appearance of a day 35 wild (left) and mutant mouse (right). B. Expression of NFATc1nuc in periphery of wild type mice, latent, late stage NFATc1nuc mice performed with anti-HA antibody western blot. Tissues, molecular weight and actin control were indicated. The data is representative of three experiments with similar results. C. Survival curves of wild type (black, n=35) and NFATc1 nuc mice (pink, n=66). D. Treatment of mutant mice with doxycycline during perinatal and disease latent period. Time period that doxycycline was treated and survival rate were indicated. Day 0 is designated as the birth date (P0). E5 represents embryonic day 5. n, number of mice treated. Treatment duration and outcome of the treated mice are shown. E. Weight measurement of the mutant mice treated or not treated with doxycycline.

NFATc1nuc mice untreated (red, n=10); NFATc1nuc treated with doxycycline (green, n=4); wild type mice (blue, n=12); Doxycycline treatment was started on day 19 and continued for 15 days.

173

Pan et al: NFATc1 export and immune response

Figure 2. H&E examination of organs and tissues of the NFATc1 nuc mice. A. H&E of wt lung. B. H&E of the mutant lung. C. H&E of the lung from the mutant treated with doxycycline. D. H&E of wt liver. E, H&E of the mutant liver. F. H&E of the liver from the mutant treated with doxycycline. G. H&E of the mutant kidney. H. H&E of the mutant muscle. I. H&E of the mutant synovium. Note the dense cellular infiltrates of the mutant organs and tissues. Mice of postnatal age 3-6 weeks were used.

muscle indicating presence of myositis (Figure 2H). In addition, the mutant mice showed redness, swelling and deformation of multiple joints including knees, hips, as well as digital joints and histological examination of the joints found dense cellular infiltration of immune cells present in the synovial space (Figure 2I) and fluid (data not shown) indicating presence of synovitis.

This disease of multi-organ damage is clearly responsible for the death of the mutant mice. In addition, expression of NFATc1nuc is responsible for this disease because suppression of its expression prevents and reverses the disease (Figure 2C and 2F; Figure 1D and 1E).

B. Dense immune cell infiltration of multiple organs and tissues in NFATc1nuc mice We examined all organs of the mutant mice compared to the wild type mice and found abnormalities in several organs including skin, bones, lungs, liver, kidneys, muscle, joints and others (Winslow et al, 2006; Pan et al, 2007). We have reported that NFATc1 regulates bone mass previously (Winslow et al, 2006). Histological examination of the mutant mice skin showed non-specific inflammation in the dermis and in the hair follicles consistent with a response to increased cytokine production (data not shown). However, in contrast to the lungs of the wild type mouse (Figure 2A), histological examination of the NFATc1nuc mice with H&E staining revealed dense infiltrates in the lungs with thickening of interstitial spaces and focal destruction of the epithelium (Figure 2B). Compared to the wild type mouse liver (Figure 2D), diffuse as well as focal cellular infiltration surrounding vessels (focal vasculitis) and billiary ducts were consistently demonstrated in the mutant liver coupled with necrosis of the liver tissue (Figure 2E). The liver infiltrate was found by flow cytometry to be a mixture of approximately 50% CD4+ or CD8+ T cells, 30% macrophages (Mac-1 +) and 20% granulocytes (Gr-1 +) (data not shown). We have also analyzed the synovial fluid of the mutant mice and found similar cellular infiltration (data not shown). In the kidneys there was marked hypercellularity and obliteration of the subcapsular space in the glomeruli (Figure 2G). Occasional wire loop formation and hyaline scars or lupus bodies were evident in the mesangium.

The mutant mice progressively developed muscle weakness correlated with the presence of severe cellular infiltrates in the

C. Detection of immune deposits in the kidneys and elevated serum auto antibodies in the NFATc1nuc mice To investigate if autoimmune response might be present in the mutant mice, we studied the immune deposits of the kidneys in wild type and the mutant mice as well as serum level of four commonly elevated auto antibodies seen in autoimmune disease. We found that immune deposits could be detected in the mutant glomeruli (Figure 3A, B). This is consistent with the findings with the H&E examination of the kidneys (Figure 2G). We also examined the serum autoantibody titers of the wild and mutant mice. As shown in Figure 3C-F, the serum titers of anti-nuclear antibody, anti-RNP, anti-dsDNA and circulating immune complexes were elevated several folds in the mutant mice compared to the 174

Gene Therapy and Molecular Biology Vol 11, page 175 wild type mice. The higher titer was found in the mutant animals with more severe illness. These results are consistent with our previous finding that IgG2! level was elevated in the serum of the mutant mice (Pan et al, 2007).

While in humans these auto antibodies are characteristic of both lupus erythematous and mixed collagen tissue disorder. These increased autoantibody titers in the mutant animals could reflect an autoimmune-like but non-specific inflammatory response, because the mutant mice still died in the absence of T cells when crossed to the TCR! and Rag1-deficient background. The mechanism of the disease is not clear and requires further investigation.

anti-ANA, Anti-dsDNA, anti-RNP and circulating immune complex in the serum (Figure 3C-F). The elevated autoantibody titers could be a result of a nonspecific autoimmune-like inflammatory response of the mutant mice, rather than a classic autoimmune disease, because the mutant mice still died in the absence of T cells when crossed to a TCR- and Rag1- deficient background (Pan et al, 2007). We still do not understand the specific cell type thatâ&#x20AC;&#x2122;s responsible for the disease because no expression of NFATc1nuc has been detectable in cells other than T lymphocytes and osteoblasts (Pan et al, 2007; Winslow et al, 2006). We speculate that NFATc1nuc is expressed in a very subtle level undetectable with our quantitative PCR techniques and this subtle expression well below its physiological level could cause a severe disease characterized with full-blown immune response in multiple organs and tissues.

When treated with doxycycline to suppress the expression of NFATc1nuc, the disease could be prevented perinatally or in the latent period. However, only 70% of the adult mutant mice with severe illness were cured with doxycycline (Figure 1C), indicating that at the time of the treatment, these mice might have developed to a disease stage that was no longer dependent on NFATc1nuc gene expression, or the mice had developed end-stage multiorgan failure thatâ&#x20AC;&#x2122;s not clinically reversible.

IV. Discussion We show here that expression of an NFATc1 variant NFATc1nuc in a very small sub-physiologic level in a transgenic mouse model caused a severe disease characterized with multi-organ failure leading to early death of the animals. The skin, lungs, liver and kidneys, as well as muscle and synovium were all involved with a full-blown immune response characterized with dense cellular infiltrates of T lymphocytes, macrophages and granulocytes (Figure 2), coincidence with the expression of the transgene in the peripheral lymphoid organs (Figure 1B). Majority of these mutant mice died within days or weeks after birth with cachexia, muscle weakness, arthritis and with elevation of several auto antibodies including

Figure 3. Immune complex deposit of glomerulus and serum auto antibodies in the mutant mice. A. Anti-mouse IgG Immunofluorescent staining of wild type kidney. B. Anti-mouse IgG Immunofluorescent staining of the mutant kidney. C. Serum titer of anti-nuclear antibody (ANA); D. Anti-RNP autoantibody titers. E. Anti-dsDNA (anti-double-stranded DNA) titers. F, Serum circulating immune complex (CIC) titers. Two wild type controls are shown in gray, NFATc1nuc mice are shown in color. Serum was diluted 1 to 80, 160 and 320. Mice of postnatal age 3-6 weeks were used.

175

Pan et al: NFATc1 export and immune response Crabtree GR, Olson EN (2002) Choreographing the social lives of cells. Cell 108, S67-79.

Davidson A, Diamond B (2001) Autoimmune diseases. N Engl J Med 345, 340-350. de Gorter DJ, Johanna CM, Vos S, Pals T and Spaargaren M (2007) The B Cell Antigen Receptor Controls AP-1 and NFAT Activity through Ras-Mediated Activation of Ral. J Immunol 178, 1405-1414.

Felsher DW, Bishop JM (1999) Reversible tumorigenesis by Myc in hematopoietic lineages. Mol Cell 4, 199-205.

Flanagan W, Corthesy B, Bram RJ, Crabtree GR (1991) Nuclear association of a T-cell transcription factor blocked by FK506 and cyclosporin A. Nature 352, 803-807.

Graef IF, Wang F, Charron F, Chen L, Neilson J, TessierLavigne M and Crabtree GR (2003) Neurotrophins and Netrins Require Calcineurin/NFAT Signaling to Stimulate Outgrowth of Embryonic Axons. Cell 113, 657-670.

Janeway C, Travers P, Walport M and Capra JD (2000) Immunobiology: the immune system in health and disease.

Immunology Today 21, 201-205.

Kiani A, Rao A, Aramburu J (2000) Manipulating Immune Responses with Immunosuppressive Agents that Target NFAT. Immunnity 12, 359-372.

Kneitz C, Wilhelm M, Tony H (2002) Effective B Cell Depletion with Rituximab in the Treatment of Autoimmune Diseases.

Immunobiology 206, 519-527.

Kretz-Rommel A, Rubin RL (2000) Disruption of positive selection of thymocytes causes autoimmunity. Nat Med 6, 298-305.

Kunz J, Hall MN (1993) Cyclosporin A, FK506 and rapamycin: more than just immunosuppression. Trends Biochem Sci 18, 334-8.

Northrop JP, Ho SN, Chen L, Thomas DJ, Timmerman LA, Nolan GP, Admon A, Crabtree GR (1994) NF-AT components define a family of transcription factors targeted

by T-cell activation. Nature 369, 497-502.

Pan M, Winslow WM, Chen L, Felsher D, Crabtree GR (2007) Enhanced NFATc1 Nuclear Occupancy Causes T Cell Activation Independent of CD28 Costimulation. J. Immunol. 178, 4315-4321.

Peng SL, Gerth AJ, Ranger A, Glimcher LH (2001) NFATc1 and NFATc2 together control both T and B Cell activation and differentiation. Immunity 14, 13-20.

Pisetsky DS (2000) Tumor Necrosis Factor Blockers in Rheumatoid Arthritis. New Engl J Med 342, 810-811.

Ranger AM, Oukka M, Rengarajan J, Glimcher LH (1998) Inhibitory function of two NFAT family members in lymphoid homeostasis and Th2 development. Immunity 9, 627-635.

Rao A, Luo C, Hogan PG (1997) Transcription factors of the NFAT family: regulation and function. Ann Rev Immunol 15, 707-747.

Shachaf CM, Kopelman AM, Arvanitis C, Karlsson A, Beer S, Mandl S, Bachmann MH, Borowsky AD, Ruebner B, Cardiff RD, Yang Q, Bishop JM, Contag CH, Felsher DW (2004) MYC inactivation uncovers pluripotent differentiation and tumour dormancy in hepatocellular cancer. Nature 431, 1112-1117.

Timmerman LA, Clipstone N, Ho SN, Northrop JP, Crabtree GR (1996) Rapid shuttling of NF-AT in discrimination of Ca2+ signals and immunosuppression. Nature 383, 837-840.

Winslow MW, Pan M, Starbuck M, Gallo EM, Deng L, Karsentry G, Crabtree GR (2006) Calcineurin/NFAT Signaling in Osteoblasts Regulates Bone Mass.

Developmental Cell 10, 771-782.

This is reminiscent of many human immune and inflammatory disorders (Janeway et al, 2000; Davidson et al, 2001). This also appears similar to the transgenic mice model expressing a c-Myc gene that caused T cell lymphoma (Felsher and Bishop 1999). The suppression of c-Myc transgene by doxycycline only reversed a portion of the mice with lymphoma while some continued to progress with lymphoma and died (Felsher and Bishop 1999). Reactivation of the NFATc1nuc expression by discontinuing doxycycline caused disease again after the mutant mice is cured of the disease. This is similar to the c-Myc transgenic mice model of cancer that relapses again from dormancy following the reactivation of the transgene (Felsher and Bishop 1999; Shachav et al, 2004).

A subtle increase of nuclear NFATc1 expression caused a full-blown disease with multi-organ failure highlights the critical significance of the stringent control of NFATc1 nuclear occupancy. This is clinically relevant because many autoimmune and inflammatory diseases such as lupus, psoriasis, polymyalgia rheumatica, multiple sclerosis, inflammatory bowel disease as well as fibromyalgia and others still lack a clear mechanistic explanation (Janeway et al, 2000; Davidson et al, 2001).

NFATc transcription factors are involved in lymphoid homeostasis and development (Rao et al, 1997; Ranger et al, 1998; Peng et al, 2001; David et al, 2007) and it is possible that a subtle increase of NFATc1 nuclear occupancy might be associated with these diseases. Subtle increase of nuclear NFATc1 destabilizes a positive feedback loop that could easily play a role in human immune and inflammatory diseases. One clinical example is the drug procainamide that induces lupus and disrupts Na+ channel activity leading to secondary changes in intracellular Ca2+level that activates calcineurin and NFATc proteins (Kretz-Rommel and Rubin 2000).

V. Conclusion We have shown that a subtle increase of nuclear NFATc1 expression can cause a severe disease of multiorgan failure with immune response characterized by extensive immune cell infiltration. These results indicate that stringent control of NFATc1 nuclear occupancy is critical for maintaining balanced immune response and may have important clinical implications.

References Beals CR, Sheridan CM, Turck CW, Gardner P, Crabtree GR (1997a) Nuclear export of NF-ATc enhanced by glycogen synthase kinase-3. Science 275, 1930-1933.

Beals CR, Clipstone NA, Ho SN, Crabtree GR (1997b) Nuclear localization of NF-ATc by a calcineurin-dependent, cyclosporin-sensitive intramolecular interaction. Genes Dev 11, 824-834 .

Chang C, Neilson J, Bayle J, Gestwicki J, Kuo A, Stankunas K, Graef I, Crabtree GR (2004) A Field of MyocardialEndocardial NFAT Signaling Underlies Heart Valve Morphogenesis. Cell 118, 649-663.

Clipstone NA, Fiorentino DF and Crabtree GR (1994) Molecular analysis of the interaction of calcineurin with drugimmunophilin complexes J Biol Chem 269, 26431-26437.

176

Gene Therapy and Molecular Biology Vol 11, page 177 Gene Ther Mol Biol Vol 11, 177-184, 2007

Assessment of cytogenetic effect of antiblastic therapy by means of micronucleus assay in exfoliated epithelial cells Review Article

Armen K. Nersesyan* Institute of Cancer Research, Medical University of Vienna, Vienna A-1090, Austria

__________________________________________________________________________________ *Correspondence: Armen K. Nersesyan, Institute of Cancer Research, Medical University of Vienna, Vienna A-1090, Austria; Phone: +431 4277 65146; Fax: +431 4277 9651; E-mail: armen.nersesyan@meduniwien.ac.at; armenn@freenet.am Key words: micronucleus assay; exfoliated cells; chemotherapy; radiotherapy Abbreviations: exfoliated epithelial cells, (EEC); micronuclei, (MN) Received: 16 July 2007; Revised: 29 July 2007 Accepted: 3 September 2007; electronically published: September 2007

Summary Literature data concerning possibility to use micronuclei (MN) level in exfoliated epithelial cells of patients under radio- and chemotherapy as a biomarker of cytogenetic effect are presented and discussed. The number of MN in buccal cells of patients under chemotherapy are very few and contradictory. Significant dose-dependent increment of MN in tumor and normal epithelial cells due to radiotherapy of cancer patients was shown by almost all investigators. Evaluation of MN induced by radiotherapy in exfoliated tumor cells can potentially identify radiosensitivity of tumors and the treatment outcome after the first fractions of irradiation. MN assay is almost completely non-invasive and easily done in accessible tumors (oral cavity and uterine cervix).

and occupational pollutants can lead to increased level of MN in epithelial cells. Also some lifestyle habits, such as tobacco smoking, khat, areca nut and betel chewing can be reasons of MN induction in oral mucosal cells. In some diseases, including precancerous ones and cancer, increment of MN was also frequently observed (Nersesian et al, 1996; Majer et al, 2002).

The aim of this paper was to evaluate the data concerning MN level in EEC of cancer patients as possible biomarkers of cytogenetic effect of antiblastic chemo- and radiotherapy.

In review paper by Majer et al, 2002 three articles were cited concerning radiotherapy of oral cancer (totally 8 subjects, with MN increase in not affected by tumor cells in all cases), treatment of thyroid cancer with 131I (31 subjects, negative result), and one paper concerning cancer chemotherapy (7 subjects, positive results in 5 persons, and correlation with MN numbers in lymphocytes) (Majer et al, 2002). It should be added to the last cited paper (Sarto et al, 1990), that the increment of MN both in EEC and lymphocytes were not observed in two subjects treated only with interferon which is absolutely non-genotoxic.

Hence, good agreement (and in one case correlation) was observed between the responsibility of two types of cells

I. Introduction It is well established that radio- and chemotherapy widely used for treatment of cancer patients induce chromosomal aberrations and micronuclei (MN) both in tumor (Widel et al, 1999, 2001; Schlomm et al, 2005, Yin et al, 2005) and normal (healthy) cells (Kutsuki et al, 2005, Lee et al, 2004). Because of technical difficulties (invasive procedure to obtain tumor cells before, during and after treatment) cytogenetic disturbances in organism due to the therapy are mostly studied in lymphocytes (Kopjar et al, 2002, Silva et al, 2002). These cells are the most used targets for biomonitoring of cytogenetic effect of cancer treatment.

Of course, it would be of interest to monitor cytogenetic alterations not in surrogate tissue â&#x20AC;&#x201C; lymphocytes, but in the target, tumor cells. It is possible to obtain with minimal invasion and then to study exfoliated epithelial cells (EEC). It is noteworthy that about 90% of all human tumors are derived from this tissue (Cairns 1975a,b).

MN assay in EEC is used to study clastogenic/aneugenic effects of agents of various origin (Nersesian et al, 1996; Majer et al, 2002). It has been shown that exposure of persons to many environmental

177

Nersesyan: Assessment of cytogenetic effect of antiblastic therapy (oral mucosa and lymphocytes) to genotoxic action of chemotherapeutic drugs.

The papers available via Medline and Scopus were analysed. The most important data concerning MN induction in EEC by radio- and chemotherapy are presented in Tables 1-3 (age and sex of subjects, stain used and the number of cells studied). On the accuracy of scoring and evaluation of number of MN in mucosal cells the most important impact could have only stain used (DNA-specific or no) and the number of studied cells (Casartelli et al, 1997; Nersesyan 2001, 2005).

treatment) and then cells were collected for the investigations. Correlations between MN level induction in somatic epithelial cells and treatment results are unknown because no data were published about the treatment outcome of the patients after chemotherapy.

Although contradictory results were published concerning chemotherapy action on MN level in buccal mucosa cells, it is noteworthy that in four studies significantly increased level of MN was observed in buccal cells of nurses handling cytostatic drugs (1.6-2.0fold) (Machado-Santelli et al, 1994; Odio et al, 2004; Cavallo et al, 2005,2007), and in one case 2-fold not significant increase (Burgaz et al, 1999). It is really surprising result because nurses are exposed to antiblastic drugs during preparation of the drug solutions for injections by inhalation and possibly via skin. Of course, the doses of cytostatics received by the nurses are significantly lower than that received by the patients, but all cases the number of MN was increased in nurses unlike the patients. Torres-Bugarin and colelagues mentioned in 2004 that many of patients under chemotherapy had signs of toxicity, and this circumstance could influence on MN induction in EEC. Anyway, this phenomenon warrants further investigations.

II. MN in cells of patients under chemotherapy Only 4 papers were found concerning MN induction in exfoliated epithelial cells due to antiblastic chemotherapy. One was already analysed by Majer et al 2002, others are presented in Table 1. In paper by Nersesyan et al, 1993, 6 males and 4 females with lymphogranulomatosis, 4 males with lung cancer and 7 females with breast cancer were analysed a week after various schedules of antiblastic chemotherapy.

Significantly increased number of MN (3.2-fold) was observed. In 21 Mexican patients with various localization of tumor treated with isophosphamide+epirubicin significantly increased number of MN was registered (from 1.2‰ before to 2.6‰ after treatment) (TorresBugarin et al, 2004). In 14 patients (mostly with oral and penis cancer) treated with carboplatin+5-fluorouracil and 6 patients (3 with penis, 1 with prostate, and 2 with oral cancers) treated with cisDDP+5-fluorouracil no such effect was registered. In this paper both primary patients and patients subjected to second and even third courses of chemotherapy were studied. Based on the data presented by the authors, the number of cells with MN only in primary cancer patients treated with three chemotherapeutic schedules were calculated. Totally among them 19 were primary, and MN frequencies were 1.6±0.4‰ before and 2.6±0.7‰ after treatment (p>0.05, Mann Whitney test). In 10 patients treated with carboplatin+5-fluorouracil MN numbers were 0.95±0.12‰ before and 1.35±0.42‰ after treatment, and in 9 patients treated with isophosphamide+epirubicin the frequencies were 2.9±1.0‰ (before) and 4.9±1.6‰ (after treatment) (p>0.05 in both cases, Mann Whitney U-test).

In another paper Torres-Burarin and colleagues used in 1998 cells of 10 cancer patients after course of antiblastic chemotherapy as a positive control in their study, but they did not report about the sites of tumors, age and sex of the patients. In this investigation the number of cells with MN was increased significantly 3.3-fold.

Hence, two papers (Nersesian et al, 1993; TorresBugarin et al, 1998) reported about significant increment of MN induced by antiblastic chemotherapy and one the same effect only due to one schedule of therapy (TorresBugarin et al, 2004). Two other schedules used for treatment of the patients did not increase the number of MN in buccal cells. But as it was mentioned earlier, there is no possibility to evaluate real increment of MN (if any) because many patients were not primary, i. e. they received polychemotherapy previously (before the last

III. MN in cells of patients under radiotherapy The data concerning the frequencies of MN induced by radiotherapy in healthy (normal) and tumor EEC are presented in Tables 2 and 3, respectively. In Table 2 are presented the most important data of six papers concerning studied cells with no sign of pathology (Cao et al, 2002, Guzman et al, 2003, Mehrotra et al, 2004a, Minicucci et al, 2005, Nersesyan 1994, Vartazaryan 2003), e.g. they were obtained from opposite site of tumors localization, or from the same site, close to the tumor. In other papers the results of studies of tumor cells during and/or after radiotherapy are presented (Table 3) (Bhattathiri et al, 1998a,b; Bindu et al, 2003; Mehrotra et al, 2004b; Rimpu et al, 2005; Singh et al, 2005). Both in normal and tumor cells significant increase of MN was observed due to radiation. It is important that in normal cervical (Vartazaryan 2003) and buccal (Cao et al, 2002; Guzman et al, 2003; Minicucci et al, 2005) cells of patients under radiotherapy, MN level increased linearly until the certain dose (mostly about 25-35 Gy), and then even decreased after additional doses of radiation. In cervix cells the frequency of cells with MN was significantly higher after 35 Gy (8‰) than the level after 70 Gy (7.4‰) (Vartazaryan 2003). In buccal mucosa 8.8‰ cell with MN were observed after the dose of 48 Gy, and only 7.6‰ after 68 Gy (Vartazaryan 2003). This phenomenon was observed also in lymphocytes of head-and-neck and cervix cancer patients during radiotherapy where the frequencies of MN increased during the first half of therapy and declined thereafter, reaching, in some patients, values below the pre-treatment level (Tolbert et al, 1991; Nersesyan 1994; Bhattathiri et al, 1998a,b; Cao et al, 2002; Bindu et al, 2003; Guzman et al, 2003, Mehrotra et al, 2004a,b; Minicucci et al, 2005; Rimpu et al, 2005; Singh et al, 2005). In all mentioned cases no attention was 178

Gene Therapy and Molecular Biology Vol 11, page 179 paid to outcome of therapy. In the study of Vartazaryan in 2003 oral mucosa cells of cervix uterus cancer patients under radiotherapy were studied along with cervix cells (to check possible vulnerability of cells located on long distance from irradiated zone due to circulating reactive oxygen species and/or other genotoxic substances appeared due to irradiation). Unlike cervix cells, even after receiving of high local dose of radiation, no significant increase was observed in oral EEC (Vartazaryan 2003).

In seven papers MN levels changes were reported in cervix and oral mucosa tumor cells of cancer patients under radiotherapy (Table 3) (Bhattathiri et al, 1998a,b, Bindu et al, 2003, Mehrotra et al, 2004b, Rimpu et al, 2005, Singh et al, 2005). In some cases MN frequencies in tumor cells were higher than in normal mucosa cells (e.g., 15‰ (Bhattathiri et al, 1998a) and 11‰ (Bhattathiri et al, 1998b) compared with healthy subjects from India – 0.7‰-4.0‰ (Nersesyan, 2006). In all studies linear increase of MN number in cancer cells with dose of radiation was observed (Bhattathiri et al, 1998a,b, Bindu et al, 2003, Mehrotra et al, 2004b, Rimpu et al, 2005, Singh et al, 2005). It is very important that in EEC of oral tumors of patients with good outcome of radiotherapy the number of cells with MN was higher than in resistant to therapy, significant in one case (Bhattathiri et al, 1998b) and not

significant in another (Bhattathiri et al, 1998b). In cervix tumor cells MN have good predictive value after one week of therapy – high number of MN compared to the background level predict good response to radiotherapy (Singh et al, 2005). The same results were obtained by the research group of Widel – but they instead of EEC of tumor investigated tumor cells obtained with biopsy (Widel et al, 1999, 2001).

Some groups of investigators studied with MN in EEC also MN, chromosomal aberrations and DNA damage (by means of the comet assay) in lymphocytes (Cao et al, 2002, Guzman et al, 2003, Minicucci et al, 2005). Good correlation was observed with these genotoxicity endpoints, but all of them were more sensitive to radiation than MN assay in EEC. Two-three months after the end of radiotherapy the level of MN in buccal cells, but not in lymphocytes decreased. The number of cells with MN in buccal mucosa was higher than in negative control, but not statistically significant (Minicucci et al, 2005). In the same paper the authors paid attention to the influence of smoking on MN level induced by radiotherapy, and found no effect even in heavy smokers (30 or more cigarettes per day consumers) (Minicucci et al, 2005).

Table 1. Micronuclei frequency in buccal cells of cancer patients under antiblastic chemotherapy.

Treatment

Chemotherapy (cancer of various sites, various schedules) Chemotherapy (cancer of various sites, isophosphamide+e pirubicin) Chemotherapy (cancer of various sites, carboplatin+5fluorouracil) Chemotherapy (cancer of various sites, cisDDP+5fluorouracil) Chemotherapy (cancer of various sites, not specified; drugs used – cyclophosphamide, cytosinearabinoside, epirubicin)

Number of subjects, sex, (age) 10m+12f (54) control – the same pts before therapy

Type of cells

13m+8f cancer patients (48.9) control – the same pts before therapy 9m+5f cancer patients (49.7) control – the same pts before therapy 6m cancer patients (61) control – the same pts before therapy 10 (sex not specified)

Buccal

control – the same pts before therapy

Stain (cells studied per subject) Feulgen + fast green (2000)

Remarks

Reference

Effect of exposure: ! x 3.2

Nersesian et al, 1993

0.8 2.6 1.2

Orcein (2000)

Effect of exposure: ! x 2.3

Torres-Bugarin et al, 2004

Buccal

1.3 1.0

Orcein (2000)

Effect of exposure: "

Torres-Bugarin et al, 2004

Buccal

2.7 1.5

Orcein (2000)

Effect of exposure: !

Torres-Bugarin et al, 2004

3.7

Feulgen + fast green (2000)

Effect of exposure: ! x 3.3

Torres-Bugarin et al, 1998

Buccal

Number of cells with MN (‰) 3.2 1.0

1.1

Symbols: ! - significant increase; " - no effect; ! - either increase or decrease, but not significant; pts – patients; f – female, m – male

179

Nersesyan: Assessment of cytogenetic effect of antiblastic therapy

Table 2. Micronuclei frequency in normal (not cancerous) epithelial cells of cancer patients under radiotherapy.

Treatment (dose of radiation) Radiotherapy of cervix cancer (50.0 Gy) 1

Radiotherapy of squamos cell carcinoma of oral cavity

Number of subjects, sex, (age) 14f (50) the same pts

Number of cells with MN (‰) 8.0 – (35.0 Gy) 7.4 – (70.0 Gy) 2.9

8m+6f (61)

4.8 (25 Gy) 6.2 (15 Gy)

the same pts

0.9

Radiotherapy of head 25m, 6f (59) and neck cancer 6MeV linear the same pts accelerator (X-ray, equivalent body dose 3.3 Gy)

2.3

Radiotherapy of cancer of cervix uterus1 Radiotherapy of nasopharyngeal cancer (68.0 Gy)

39f (age nor specified) the same pts 9m (36)

0.9

the same pts

2.3

Radiotherapy of squamos cell carcinoma of oral cavity 1

Feulgen + fast green (2000)

Feulgen + fast green (4000 during therapy, 2000 before)

0.8

Feulgen + fast green (2000)

0.6 7.7 – (28 Gy) 8.8 – (48 Gy) 7.6 – (68 Gy)

Acridine orange (1000)

78m, 33f (age nor 4.4 - (24 Gy) specified) 1.8 - (6.0 Gy) the same pts

Stain (cells studied per subject) Feulgen + fast green (2000)

Giemsa (1000)

0.9

Remarks

Reference

Effect of exposure: ! x 2.0 (25 Gy) and ! x 1.8 (50 Gy) [significantly less than in the cells of pts who received 35.0 Gy] Effect of exposure: ! x 5.3 (25 Gy), ! x 6.8 (15 Gy)

Vartazaryan 2003

Effect of exposure: ! x 2.9. No effect of smoking on MN level, although there were 17 heavy smokers (more than 30 cigarettes per day consumers) Effect of exposure: ! x 1.5 Effect of exposure: ! x 3.3 (28 Gy), ! x 3.8 (48 Gy), ! x 3.3 (68 Gy).

Positive results were obtained in MN, CAs, and comet assays in lymphocytes with less doses of radiation (410 Gy) Effect of exposure: ! x 2.0 (6 Gy) ! x 4.4 (24 Gy)

Minicucci et al, 2005

Nersesyan 1994

Guzman et al, 2003 Cao et al, 2002

Mehrotra et al, 2004a

– cervix cells were studied, in all other cases buccal cells were studied

! - significant increase; " - no effect; ! - either increase or decrease, but not significant; pts – patients; f – female, m - male

180

Gene Therapy and Molecular Biology Vol 11, page 181 Table 3. Micronuclei frequency in tumor cells of cancer patients under radiotherapy Treatment (dose of radiation) Radiotherapy of squamos cell carcinoma of oral cavity Radiotherapy of squamos cell carcinoma of oral cavity

Radiotherapy of cervix cancer

Radiotherapy of squamos cell carcinoma of oral cavity

Radiotherapy of squamos cell carcinoma of oral cavity Radiotherapy of squamos cell carcinoma of oral cavity Radiotherapy of head and neck cancer (squamos cell carcinoma of oral cavity -6, carcinoma of base of tongue-12 and others) Radiotherapy of epidermoid carcinoma of oral cavity (buccal mucosa - 21, gingival – 8, palate – 3: one site; 12 – more than one site)

Number of subjects, sex, (age) 31(sex and age not specified) the same pts

Number of cells with MN (‰)

49 (sex and age not specified)

25.2 (24 Gy, 21 sensitive to treatment pts) 15.0 (24 Gy, 28 resistant to treatment pts)

the same pts 25f (52)

4.1 42.0

the same pts

15.0

68 (sex not specified) (62)

43 – (7.0 Gy) 55 – (17.5 Gy) 71 – (28 Gy) 78 – (38.5 Gy)

the same pts 78m, 33f

11 6.0 - (24 Gy)

the same pts

1.1

102 m

14.1

the same pts

1.6

27m, 3 f

7.7 (4 Gy) 8.8 (14 Gy) 12.8 (24 Gy)

the same pts

3.5

34m, 10f

27.7 (28 Gy, sensitive) 18.3 7 (28 Gy, resistant)

the same pts

2.0

19.5 (24 Gy)

Stain (cells studied per subject) Giemsa (1000)

Remarks

Reference

Effect of exposure: ! x 7.1

Bhattathiri et al, 1998a

Giemsa (1000)

Effect of exposure: ! in both resistant (x 3.7) and sensitive ( x 6.1) to therapy pts.

The number of MN was significantly higher in sensitive to treatment pts Effect of exposure: ! x 2.8. The significant increase of MN in cancer cells after first week could predict for a local better response and survival Effect of exposure: linear, maximally at maximum dose ! x 7.7

Bhattathiri et al, 1998b

Giemsa (1000)

Effect of exposure: ! x 5.4 (24 Gy)

Mehrotra et al, 2004a

Giemsa (1000)

Effect of exposure: ! x 8.8

Mehrotra et al, 2004b

Giemsa (750)

Effect of exposure: Rimpu et al, ! x 3.7 at 24 Gy 2005 Linear increase of the number of MN with the dose

Giemsa (750)

Effect of exposure: Bhattathiri et ! x 13.9 sensitive to al, 1998b therapy tumors, ! x 9.1 resistant Linear increase of the number of MN with the dose. No significant difference between two groups of pts.

2.8

MayGrunwaldGiemsa (1000)

Giemsa (500)

Singh et al, 2005

Bindu et al, 2003

! - significant increase; " - no effect; ! - either increase or decrease, but not significant; pts – patients; f – female, m - male Hence, two papers (Nersesian et al, 1993; TorresBugarin et al, 1998) reported about significant increment of MN induced by antiblastic chemotherapy and 1 the same effect only due to one schedule of therapy. Two

other schedules used for treatment of the patients did not increase the number of MN in buccal cells. But as it was mentioned earlier, there is no possibility to evaluate real increment of MN (if any) because many patients were not 181

Nersesyan: Assessment of cytogenetic effect of antiblastic therapy primary, i. e. they received polychemotherapy previously (before the last treatment) and then cells were collected for the investigations. Correlations between MN level induction in somatic epithelial cells and treatment results are unknown because no data were published about the treatment outcome of the patients after chemotherapy.

Although contradictory results were published concerning chemotherapy action on MN level in buccal mucosa cells, it is noteworthy that in four studies significantly increased level of MN was observed in buccal cells of nurses handling cytostatic drugs (1.6-2.0fold) (Machado-Santelli et al, 1994; Odio et al, 2004; Cavallo et al, 2005, 2007), and in one case 2-fold not significant increase (Burgaz et al, 1999). It is really surprising result because nurses are exposed to antiblastic drugs during preparation of the drug solutions for injections by inhalation and possibly via skin. Of course, the doses of cytostatics received by the nurses are significantly lower than that received by the patients, but all cases the number of MN was increased in nurses unlike the patients. Torres-Bugarin and colleagues mentioned in 2004 that many of patients under chemotherapy had signs of toxicity, and this circumstance could influence on MN induction in epithelial cells. Anyway, this phenomenon warrants further investigations.

were studied along with cervix cells (to check possible vulnerability of cells located on long distance from irradiated zone due to circulating reactive oxygen species and/or other genotoxic substances appear due to irradiation). Unlike cervix cells, even after receiving of high local dose of radiation, no significant increase was observed in oral cells (Vartazaryan, 2003).

In seven papers MN levels changes were reported in cervix and oral mucosa tumor cells of cancer patients under radiotherapy (Table 3) (Bhattathiri et al, 1998a, b, c; Bindu et al, 2003; Mehrotra et al, 2004a; Rimpu et al, 2005; Singh et al, 2005). In some cases MN frequencies in tumor cells were higher than in normal mucosa cells (e. g., 15‰ (Bhattathiri et al, 1998c) and 11‰ (Bhattathiri et al, 1998a) compared with healthy subjects from India – 0.7‰-4.0‰ (Nersesyan, 2006b)). In all studies linear increase of MN number in cancer cells with dose of radiation was observed (Bhattathiri et al, 1998a, b, c; Bindu et al, 2003; Mehrotra et al, 2004a; Rimpu et al, 2005; Singh et al, 2005). It is very important that in exfoliated oral tumor cells of patients with good outcome of radiotherapy the number of cells with MN was higher than in resistant to therapy, significant in one case (Bhattathiri et al, 1998a) and not significant in another (Bhattathiri et al, 1998b). In cervix tumor cells MN have good predictive value after one week of therapy – high number of MN compared to the background level predict good response to radiotherapy (Singh et al, 2005). The same results were obtained by the research group of Wiedel – but they instead of exfoliated tumor cells investigated tumor cells obtained with biopsy (Widel et al, 1999, 2001).

Some groups of investigators studied with MN in exfoliated cells also MN, chromosomal aberrations and DNA damage (by means of the comet assay) in lymphocytes (Cao et al, 2002; Minicucci et al, 2005).

Good correlation was observed with these genotoxicity endpoints, but all of them were more sensitive to radiation than MN assay in exfoliated cells. Two-three months after the end of radiotherapy the level of MN in buccal cells, but not in lymphocytes decreased. The number of cells with MN in buccal mucosa was higher than in negative control, but not statistically significant (Minicucci et al, 2005). In the same paper the authors paid attention to the influence of smoking on MN level induced by radiotherapy, and found no effect even in heavy smokers (30 or more cigarettes per day consumers) (Minicucci et al, 2005).

III. MN in cells of patients under radiotherapy The data concerning the frequencies of MN induced by radiotherapy in healthy (normal) and tumor epithelial cells are presented in Tables 2 and 3, respectively. In Table 2 are presented the most important data of six papers concerning studied cells with no sign of pathology (Nersesyan, 1994; Cao et al, 2002; Guzman et al, 2003; Vartazaryan, 2003; Mehrotra et al, 2004b; Minicucci et al, 2005), e. g. they were obtained from opposite site of timors localization, or from the same site, close to the tumor. In other papers the results of studies of tumor cells during and/or after radiotherapy are presented (Table 3) (Bhattathiri et al, 1998a, b, c; Bindu et al, 2003; Mehrotra et al, 2004a; Rimpu et al, 2005; Singh et al, 2005). Both in normal and tumor cells significant increase of MN was observed due to radiation. It is important that in normal cervical (Vartazaryan, 2003) and buccal (Cao et al, 2002; Minicucci et al, 2005) cells of patients under radiotherapy, MN level increased linearly until the certain dose (mostly about 25-35 Gy), and then even decreased after additional doses of radiation. In cervix cells the frequency of cells with MN was significantly higher after 35 Gy (8‰) than the level after 70 Gy (7.4‰) (Vartazaryan, 2003). In buccal mucosa 8.8‰ cell with MN were observed after the dose of 48 Gy, and only 7.6‰ after 68 Gy (Vartazaryan, 2003). This phenomenon was observed also in lymphocytes of head-and-neck and cervix cancer patients during radiotherapy where the frequencies of micronuclei increased during the first half of therapy and declined thereafter, reaching, in some patients, values below the pre-treatment level (Tolbert et al, 1991; Nersesyan, 1994).

In all mentioned cases no attention was paid to outcome of therapy. In the study of Vartazaryan in 2003 oral mucosa cells of cervix uterus cancer patients under radiotherapy

IV. Nuclear anomalies in exfoliated cells of subjects exposed to cytostatic drugs and under radiotherapy It is well known that in EEC except the MN also other events called nuclear anomalies (NA) can be registered, e. i. karyorrhexis (nucleus broken to pieces), karyolysis (lysed nucleus which appears as a ghost), binucleated cells (cells with 2 nuclei), pycnosis (very small, shrunken nucleus), budded cells (cells with budded nucleus including so-called “broken egg” phenomenon – a MN attached to main nucleus with the stalk) and

182

Gene Therapy and Molecular Biology Vol 11, page 183 condensed chromatin (Tolbert et al, 1991). Sometimes these NA can be wrongly considered as MN. Although the pioneers of the investigations of NA Tolbert and colleagues proposed in 1991 that some of them, namely binucleates and “broken egg” phenomenon can be connected with genotoxicity, recently two papers were published stating that cells with “broken egg” phenomenon appear not due to genotoxic effect (Nersesyan, 2006a,b). Some investigators proposed that NA are consequences of cytotoxic effects and apoptosis (Cerqueira et al, 2004; Torres-Bugarin et al, 2004; Angelieri et al, 2007). The real meaning of NA is unknown although they should be registered separately from cells with MN because in some cases NA can mimic real MN (Nersesyan et al, 2006a).

Only two investigations concerning the effect of chemotherapy on NA in EEC are available. TorresBugarin and colleagues shown in 1998, 2004 that due to only certain schedules of chemotherapy some changes in NA frequencies can be detected. Namely, the number of cells with karyolysis increased significantly in patients treated with cisplatin + fluorouracil, isophosphamid + epirubucin. At the same time, the number of binucleates decreased significantly in buccal cells of patients under chemotherapy. In one study (Odio et al, 2004) was shown that in oral EEC of nurses handling cytostatic drugs the frequencies of all NA were increased compared with nonexposed subjects.

Unlike chemotherapy, almost all investigators registered substantial increase of NA frequencies in EEC of cancer patients under radiotherapy. Studying EEC of patients under radiotherapy, Indian investigators proposed some new features of cells, both normal (healthy) and tumor ones, e. g. multinucleated cells (Bindu et al, 2003; Mehrotra et al, 2004b; Rimpu et al, 2005) and cytoplasmic granulation (Bindu et al, 2003; Mehrotra et al, 2004b).

Since they did not present the photos of so-called granulation it is not possible to understand what they mean, and is it the same as condensed chromatin.

As it was mentioned above, the real meaning of all of these NA is unknown. Recently the group of Indian investigators proposed that binucleates and multinucleation in exfoliated cells could be due to viral infection (Mehrotra et al, 2006). de Almeida and colleagues proposed in 2004 that the cells with ‘broken egg’ phenomenon observed in human liver affected with hepatitis C virus were due to viral infection (de Almeida et al, 2004).

Anyway, it is noteworthy that in all cases the number of all nuclear anomalies was increased significantly compared with the levels before the treatment and this increase was linear.

EEC of patients receiving some schedules of chemotherapy could be explained by toxic effect of therapy because in nurses who were exposed to many times less doses of cytostatics the increment of cells with MN was registered.

In contrast, all studies showed significant increment of MN and other nuclear anomalies in tumor and normal EEC due to radiotherapy. This increase was dosedependent. It is extremely important that serial cytological assay of MN induction can potentially identify radiosensitivity of tumors and the treatment outcome.

The technique to apply MN assay in EEC is almost completely non-invasive and easily done in accessible primary cancers (i.e. oral cavity and uterine cervix). In other sites, fine needle cytology can be applied.

It should be mentioned that although MN assay in EEC has many advantages it is less sensitive to register the effects of radiotherapy than conventional chromosomal aberrations and MN assays in lymphocytes and the comet assay in lymphocytes.

In conclusion, MN assay in EEC of tumors could be very useful in prognosis of sensitivity of tumors to radiotherapy unlike MN assay in patients treated with cytostatics. Further investigations in this area are certainly warranted to evaluate possibility of the application of this test for prognosis of treatment outcome.

References Angelieri F, de Oliveira GR, Sannomiya EK, Ribeiro DA (2007) DNA damage and cellular death in oral mucosa cells of children who have undergone panoramic dental radiography.

Pediatr Radiol 37, 561-565.

Bhattathiri NV, Bharathykkutty C, Prathapan R, Chirayathmanjiyil DA, Nair KM (1998b) Prediction of radiosensitivity of oral cancers by serial cytological assay of nuclear changes. Radiother Oncol 49, 61-65.

Bhattathiri NV, Bindu L, Remani P, Chandralekha B, Nair KM (1998a) Radiation-induced acute immediate nuclear abnormalities in oral cancer cells: serial cytologic evaluation.

Acta Cytol 42, 1084-1090.

Bindu L, Balaram P, Mathew A, Remani P, Bhattathiri VN, Nair MK (2003) Radiation-induced changes in oral carcinoma cells - a multiparametric evaluation. Cytopathology 14, 287293.

Burgaz S, Karahalil B, Bayrak P, Taskin L, Yavuzaslan F, Bokesoy I, Anzion RB, Bos RP, Platin N (1999) Urinary cyclophosphamide excretion and micronuclei frequencies in peripheral lymphocytes and in exfoliated buccal epithelial cells of nurses handling antineoplastics. Mutat Res 439, 97104.

Cairns J (1975a) The cancer problem. Sci Am 233, 64-72.

Cairns J (1975b) Mutation selection and the natural history of cancer. Nature 255, 197-200.

Cao J, Liu Y, Sun H, Cheng G, Pang X, Zhou Z (2002) Chromosomal aberrations, DNA strand breaks and gene mutations in nasopharyngeal cancer patients undergoing radiation therapy. Mutat Res 504, 85-90.

Casartelli G, Monteghirfo S, De Ferrari M, Bonatti S, Scala M, Toma S, Margarino G, Abbondandolo A (1997) Staining of micronuclei in squamous epithelial cells of human oral mucosa. Anal Quant Cytol Histol 19, 475-481.

Cavallo D, Ursini CL, Omodeo-Sale E, Iavicoli S (2007) Micronucleus induction and FISH analysis in buccal cells

V. Conclusions In this review an attempt was carried out to analyse all available papers concerning the effect of chemo- and radiotherapy on MN induction in EEC of patients under antiblastic therapy.

Based on the small number of papers concerning an effect of cytostatic drugs it is not possible to come to certain conclusions. Absence of changes in MN number in 183

Nersesyan: Assessment of cytogenetic effect of antiblastic therapy and lymphocytes of nurses administering antineoplastic drugs. Mutat Res 628, 11-18.

Cavallo D, Ursini CL, Perniconi B, Francesco AD, Giglio M, Rubino FM, Marinaccio A, Iavicoli S (2005) Evaluation of genotoxic effects induced by exposure to antineoplastic drugs in lymphocytes and exfoliated buccal cells of oncology nurses and pharmacy employees. Mutat Res 587, 45-51.

Cerqueira EM, Gomes-Filho IS, Trindade S, Lopes MA, Passos JS, Machado-Santelli GM (2004) Genetic damage in exfoliated cells from oral mucosa of individuals exposed to X-rays during panoramic dental radiographies. Mutat Res 562, 111-117. de Almeida TM, Leitao RC, rade JD, Becak W, Carrilho FJ, Sonohara S (2004) Detection of micronuclei formation and nuclear anomalies in regenerative nodules of human cirrhotic livers and relationship to hepatocellular carcinoma. Cancer Genet Cytogenet 150, 16-21.

Guzman P, Sotelo-Regil RC, Mohar A, Gonsebatt ME (2003) Positive correlation between the frequency of micronucleated cells and dysplasia in Papanicolaou smears. Environ Mol Mutagen 41, 339-343.

Kopjar N, Garaj-Vrhovac V, Milas I (2002) Acute cytogenetic effects of antineoplastic drugs in peripheral blood lymphocytes in cancer patients chromosome aberrations and micronuclei. Tumori 88, 300-312.

Kutsuki S, Ihara N, Shigematsu N, Okamoto S, Kubo A (2005) Relation between chromosomal aberrations and radiation dose during the process of TBI). Radiat Med 23, 37-42.

Lee R, Yamada S, Yamamoto N, Miyamoto T, Ando K, Durante M, Tsujii H (2004) Chromosomal aberrations in lymphocytes of lung cancer patients treated with carbon ions. J Radiat Res (Tokyo) 45, 195-199.

Machado-Santelli GM, Cerqueira EM, Oliveira CT, Pereira CA (1994) Biomonitoring of nurses handling antineoplastic drugs. Mutat Res 322, 203-8.

Majer BJ, Laky B, Knasmuller S, Kassie F (2002) Use of the micronucleus assay with exfoliated epithelial cells as a biomarker for monitoring individuals at elevated risk of genetic damage and in chemoprevention trials. Mutat Res 489, 147-72.

Mehrotra R, Goel N, Singh M, Kumar D (2004b) Radiationrelated cytological changes in oral malignant cells. Indian J Pathol Microbiol 47, 343-347.

Mehrotra R, Gupta A, Singh M, Ibrahim R (2006) Application of cytology and molecular biology in diagnosing premalignant or malignant oral lesions. Mol Cancer 23, 5-11.

Mehrotra R, Madhu, Singh M (2004a) Serial scrape smear cytology of radiation response in normal and malignant cells of oral cavity.Indian J Pathol Microbiol 47, 497-502.

Minicucci EM, Kowalski LP, Maia MA, Pereira A, Ribeiro LR, de Camargo JL, Salvadori DM (2005) Cytogenetic damage in circulating lymphocytes and buccal mucosa cells of headand-neck cancer patients undergoing radiotherapy. Radiat Res (Tokyo) 46, 135-142.

Nersesian AK (1996) The micronucleus test in human exfoliative cells as a method for studying the action of mutagens/carcinogens. Tsitol Genet 30, 91-96.

Nersesian AK, Zil'fian VN, Kumkumadzhian VA, Nersesian AK (1993) An analysis of the micronuclei in the oral mucosa of cancer patients for assessing the clastogenic effect of chemical preparations. Tsitol Genet 27, 77 -80.

Nersesyan A, Kundi M, Atefie K, Schulte-Hermann R, Knasmuller S (2006) Effect of staining procedures on the results of micronucleus assays with exfoliated oral mucosa cells. Cancer Epidemiol Biomarkers Prev 15, 1835-40.

Nersesyan AK (1994) The study of micronuclei frequency in buccal mucosa cells of oral cancer patients under radiotherapy. In: Proc. of XVI Intern. Cancer Congress, New Delhi, India, R.S.Rao (Ed.), Monduzzi Editore, Bologna, pp.

95-98.

Nersesyan AK (2001) Letter to Editor. Carcinogenesis 22, 679.

Nersesyan AK (2005) Nuclear buds in exfoliated human cells.Mutat Res 588, 64-68.

Nersesyan AK (2005) Strange phenomenon, i.e., an antimutagenic effect of areca nut chewing. Mutat Res 582, 163-4.

Nersesyan AK (2006) The nature of "broken egg" events in exfoliated human cells. Acta Cytol 50, 598-589.

Odio AD, Duharte AB, Carnesoltas D, Garcia L, Loaces EL, Cabrera LG (2004) Cytogenetis effect of occupational exposure to cytostatics. Rec Med IMSS 42, 487-492.

Rimpu K, Arun C, Goyal PK (2005) Karyoanomalic frequency during radiation therapy. J Cancer Res Ther 1, 187-190.

Sarto F, Tomanin R, Giacomelli L, Canova A, Raimondi F, Ghiotto C, Fiorentino MV (1990) Evaluation of chromosomal aberrations in lymphocytes and micronuclei in lymphocytes, oral mucosa and hair root cells of patients under antiblastic therapy. Mutat Res 228, 157-169.

Schlomm T, Gunawan B, Schulten HJ, Sander B, Thangavelu K, Graf N, Leuschner I, Ringert RH, Fuzesi L (2005) Effects of chemotherapy on the cytogenetic constitution of Wilms' tumor. Clin Cancer Res 11, 4382-4387.

Silva LM, Takahashi CS, Carrara HH (2002) Study of chromosome damage in patients with breast cancer treated by two antineoplastic treatments. Teratog Carcinog Mutagen 22, 257-269.

Singh S, Datta NR, Krishnani N, Lal P, Kumar S (2005) Radiation therapy induced micronuclei in cervical cancer-does it have a predictive value for local disease control?

Gynecol Oncol 97, 764-771.

Tolbert PE, Shy CM, Allen JW (1991) Micronuclei and other nuclear anomalies in buccal smears: a field test in snuff users. Am J Epidemiol 134, 840-850.

Torres-Bugarin O, De Anda-Casillas A, Ramirez-Munoz MP, Sanchez-Corona J, Cantu JM, Zuniga G (1998) Determination of diesel genotoxicity in firebreathers by micronuclei and nuclear abnormalities in buccal mucosa.

Mutat Res 413, 277-281.

Torres-Bugarin O, Ventura-Aguilar A, Zamora-Perez A, GomezMeda BC, Ramos-Ibarra ML, Morga-Villela G, GutierrezFranco A, Zuniga-Gonzalez G (2004) Evaluation of cisplatin + 5-FU, carboplatin + 5-FU, ifosfamide + epirubicine regimens using the micronuclei test and nuclear abnormalities in the buccal mucosa. Mutat Res 565, 91-101.

Vartazaryan NS (2003) Investigation of cytogenetic disturbances in exfoliated human cells by means of micronucleus assay.

PhD thesis. State University, Yerevan, Armenia.

Widel M, Jedrus S, Owczarek S, Konopacka M, Lubecka B, Kolosza Z (1999) The increment of micronucleus frequency in cervical carcinoma during irradiation in vivo and its prognostic value for tumour radiocurability. Br J Cancer 80, 1599-1607.

Widel M, Kolosza Z, Jedrus S, Lukaszczyk B, RaczekZwierzycka K, Swierniak A (2001) Micronucleus assay in vivo provides significant prognostic information in human cervical carcinoma; the updated analysis. Int J Radiat Biol 77, 631-636.

Yin CC, Glassman AB, Lin P, Valbuena JR, Jones D, Luthra R, Medeiros LJ (2005) Morphologic, cytogenetic, molecular abnormalities in therapy-related acute promyelocytic leukaemia. Am J Clin Pathol 123, 840-848.

184

Gene Therapy and Molecular Biology Vol 11, page 185 Gene Ther Mol Biol Vol 11, 185-202, 2007

Integration of human DNA fragments into the cell genomes of certain tissues from adult mice treated with cytostatic cyclophosphamide in combination with human DNA Research Article

Anastasia S. Likhacheva1, Valeriy P. Nikolin1, Nelly A. Popova1, Tatiana D. Dubatolova1, Dmitriy N. Strunkin2, Vladimir A. Rogachev1, Tamara E. Sebeleva1, Ivan S. Erofeev1, Sergei S. Bogachev1,3,*, Leonid A. Yakubov4, Mikhail A. Shurdov3 1

Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, 10 Lavrentieva ave, Novosibirsk, 630090, Russia; 2 Municipal hospital, Oncology department, Novosibirsk, Russia; 3 LLC Panagen, 29 Choros-Gurkina street, Gorno-Altaisk, 649000, Russia; 4 Panagenic International Inc., 2935 Byberry Road, Hatboro, PA, 19040, USA

__________________________________________________________________________________ *Correspondence: Sergei S. Bogachev, 10 Lavrentieva ave, 630090, Novosibirsk, Russia; Tel: +7-383-333-29-06; Fax: +7-383-333-1278; e-mail: labmolbiol@mail.ru Key words: transgenic mice; human DNA; cyclophosphamide; Alu repeats; blood count (hemogram) Abbreviations: cyclophosphamide (CP); double-stranded break, (DSB); interstrand cross-link, (ICL) Received: 26 May 2007; Revised: 7 August 2007 Accepted: 3 September 2007; electronically published: September 2007

Summary We demonstrate here that, when administered i.p. to adult mice in combination with the cytostatic cyclophosphamide, an inducer of cross-links in the DNA molecule, human exogenous DNA, having reached the nuclear space of liver, thymus, spleen cells, integrates into the mouse genome. The integration of foreign DNA produces change in blood counts and is lethal to the treated mice. It is suggested that the integration mechanism acts through the repair events induced by the formation of covalent interstrand cross-links resulting in double strand breaks during replication fork arrest.

al, 2000; Karle et al, 2001). The arisen ICLs are efficiently repaired in both the prokaryotic and eukaryotic cells.

In Escherichia coli, ICL repair is accomplished through excision and recombination pathways (Van Houten et al, 1986; Cheng et al, 1988; Sladek et al, 1989).

In yeast cells, a similar mechanism involving excision endonucleases provides repair of ICLs in DNA (Jachymczyk et al, 1981; Magana-Schwencke et al, 1982, Prakash et al, 1993; Friedberg et al, 1995). With respect to mammals, humans too, the DNA machinery whereby such defects in the chromosomes are repaired remains unclear.

A complex of excision repair factors has been implicated for the ICL repair mechanism. The factors first identified in xeroderma pigmentosum, XP, a hereditary human disease with a defect in the excision repair mechanism,

I. Introduction Chemical cytostatic agents whose molecules intercalate between stacked base pairs, thereby causing DNA interstrand cross-links (ICLs) between the complementary strands of DNA, are extensively used in anticancer chemotherapeutics. Cyclophosphamide (CP) has gained wide recognition as an anticancer drug. CP is activated in the liver by four hydroxylation reactions accomplished by the catalysts cytochromes. Antitumor effect of CP is believed to be due to its genotoxic DNAalkylating phosphoramide mustard (PM). PM forms adducts with purine bases of the DNA molecule, especially with adjacent guanine residues and gives rise to ICLs in the two DNA strands (Yu et al, 1999; De Silva et

185

Likhacheva et al: Integration of human DNA into the mouse genome include XPA, RPA, TFIIA, XPC, XPG, XPF-ERCC1 (Mu et al, 2000; Park et al, 1995). In vitro experiments have established certain details by which such DNA molecule damage is repaired. The XPG factor makes excisions at the 3’side (Harrington and Lieber, 1994; O’Donovan et al, 1994; Matsunaga et al, 1995) and the XPF-ERRC factor at the 5’side of the experimentally induced lesion (Bessho et al, 1997a). Kinetic experiments with incision formation provided evidence for the occurrence of 3’ prior to 5’ incisions (O’Donovan et al, 1994; Mu et al, 1996; Sijbers et al, 1996). An unwound stretch of the DNA molecule of about 30 bp is required for the two factors to be active (Matsunaga et al, 1996; Evans et al, 1997). It has been demonstrated that the XPF-ERCC1 heterodimer possesses additional 3’-5’ exonuclease activity and, in the presence of replication protein A (RPA), the enzyme can bypass cross-link between the two DNA strands, thus forming a single-stranded DNA with a dinucleotide adduct (Mu et al, 2000). Experimental data have indicated that the XPA component of the excision complex is requisite for DNA opening (Evans et al, 1997). The total incision reaction is dependent on the ATP presence, it proceeds in the presence of the ATP-dependent TFIIH factor with helicase activity (Schaeffer et al, 1993; Hoeijmakers et al, 1996).

It has been shown (Bessho et al, 1997b; Caldecott and Jeggo, 1991; Collins, 1993; Pastink and Lohman, 1999; Wang et al, 2001) that the replication fork stoppage in the location of ICL induces DSB initiation and starts the repair processes deleting arisen damage. ICL repair in DNA strands implies at least three independent events entailing (i) an unknown system generating specific DSBs arising during replication in proliferating cells; (ii) an excision enzyme complex; (iii) a DSB repair system. In the case of DSBs induced by ionizing radiation, repair process occurs as nonhomologous joining of broken ends or synthesis depending strand annealing, in contrast, homologous recombination with Holiday structure formation is the major pathway for repair of the DSBs induced by cytostatic drugs (De Silva et al, 2000; Mu et al, 2000; Reardon et al, 1991; Saffran et al, 1994; Lambert et al, 2005; Li et al, 1999).

A model for ICL repair in DNA molecule strands has been suggested. According to the model replication is the major inducer of ICL repair (Li et al, 1999; Niedernhofer et al, 2004). Encounter of replication fork with ICLs renders it inactive. This is associated with DSB generation by an unknown mechanism (presumably with the involvement of specific endonuclease Mus81).

Excision factors machinery and transit exonuclease activity of XPF-ERCC1-RPA cleave the ICLs and relieve of torsional strain around it. The break and single strand gap with excision enzyme forming initiate homologous recombination whose first step is the formation of the heteroduplex by the activity of XRCC2 and XRCC3 between the lesioned and any other homologous sequence in the nucleus. The recombination process ends up the last step specific cuts made by excision enzymes, complete removal of the adduct, and repair synthesis on new template. The excisions can be possibly made at the time when the replication fork movement is blocked or later, during elimination of the adduct (De Silva et al, 2000).

Multiple DSBs arising in DNA chemically interacting with an alkalyting agent brings the nuclear synthetic process to a halt and impairs the cell cycle.

Ultimately, a self-destruction program is turned on, the cell is either subject to apoptosis or to profound genetic changes. It is precisely such DNA damage that makes cancer cells lethal in anticancer therapy with cytotoxic agent.

In our previous studies (Yakubov et al, 2002, 2003), we have hypothesized the existence of a natural mechanism that may have an influence on the genetic component of the cells of multicellular organisms, using genomic DNA from biological fluid as an external genomic reference. The mechanism implies that the cell surface DNA binding receptors deliver genomic DNA fragments produced by natural apoptosis from the external environment (blood plasma, intertissue fluid, lymph) into the nucleus, that this turnover is continuous. Within the nuclear space, the internalized DNA fragments may be involved in all repair systems described above where the presence of a damage-free homologous sequence is the necessary condition for the process. From a survey of the literary data and in the light of our concept, it follows that, if the blood bed of an organism exposed to a strong crosslinking mutagen contained DNA fragments with homology to the host genomic sequences, the fragments would be used as substrate for homologous recombination in repair of DNA damage induced by cytostatic agent.

With this possibility in mind, a preparation of fragmented human DNA and an alkylating cyclophosphamide (CP) were administered to mice.

Molecular genetic analysis of genomic DNA from treated mice revealed human DNA fragments integrated into the host genome.

II. Materials and methods A. DNA sources and probe pre-treatment Human DNA was isolated from placenta of healthy women in childbirth in two maternity wards in Novosibirsk. This material had the required sanitary-regulatory documents for the out-patient clinics for serological confirmation that they were negative for HIV, hepatitis B and C, syphilis. The isolated DNA was certified and PCR diagnosed for the HIV, hepatitis B and C causative agents. Again, the results were negative.

Mouse DNA was isolated from liver, spleen, and thymus of CBA mice bred at the animal facility of this Institute.

Full-size genomic DNA was disintegrated hydrodynamically using the sonic disintegrator unit UZDN-37 (Russia) down to fragments of 600-6000 bp for further injections to CBA mice (Figure 1).

B. Experimental design for cyclophosphane treatment Cyclophosphane (CP) was injected i.v. to CBA male mice (n=20) at 200 mg/kg body weight. One group (n=10) was administered i.p. 1 mg of human DNA 30 min before CP injection, 0.5 mg portion of DNA was administered 30 min after CP injection, this was followed by administration of the same DNA amounts on days 2 and 3. The controls (n=10) received saline.

186

Gene Therapy and Molecular Biology Vol 11, page 187 hybridization bands cut out from membrane filter) was determined using a 1209 RacBetta counter (Finland).

G. Calculations of the potential number of substitution sites for exogenous extrachromosomal DNA fragments in DNA ICL repair The mouse genome is ~2.5x109 bp = 2.5x106 kb.

The human genome is 3.3x109 bp = 3.3x106 kb.

The length of Alu-repeat is ~0.3 kb (Jurka, 2004).

The number of Alu-repeats in the human genome is ~10% (Bogerd et al, 2006), or 106 copies of 0.3 kb monomer.

The length of B1 repeat is ~0.15 kb (Kolchanov et al, 1988).

The number of B1 repeats in the mouse genome is ~10%, or ~105 copies of 0.15 kb monomer.

Alu elements occur every 3-4 kb.

B1 repeats occur every 3 kb.

A cross-linking agent at therapeutic doses induces 10002000 DNA ICLs per cell (Palom et al, 2000; Warren et al, 2001; Niedernhofer et al, 2004).

Exogenous DNA fragments are 2-30 nucleosome units in size, this makes up ~0.5-6.0 kb (3.0 kb on average).

When 1000-2000 !g of DNA, which corresponds to 50100 !g of the preparation per 1 g of body weight, is administered to mice (~20 g), the nuclear extrachromosomal space of the proliferating cells can harbor up to 2% (of the haploid genome) of exogenous DNA fragments (Rogachev et al, 2006). Thus, the nuclear space can contain at the same time of the order of 2000 Alu-monomers in DNA fragments of 3.0 kb on average. CP plus a preparation of fragmented human DNA were administered to mice. In the treated mice, CP through its phosphoramide mustard metabolite forms cross-links in the DNA molecule, concomitantly blocking replication fork. In the arisen recombinogenic situation, with stalled replication fork and activated incision enzyme system, homologous sequence for homologous exchange repair all must be available for repair to be sufficient. We suggested that Alu-monomers of human exogenous DNA by virtue of their high homology to the mouse genome B1 structures, would complete homologous exchange repair at the expense of regions homologous to B1 repeats. An expected consequence would be integration of exogenous foreign DNA into the mouse host genome.

B1 repeats are spaced every 3 kb in the genome, the number of cross-links induced in the nucleus being 1000-2000.

About 20,000 Alu-monomers distributed among ~3.0 kb fragments are present in the interchromosomal space. This means that the number of sequences potentially capable of substitution exceeds 10-fold that of the available substitution sites.

The probability for homologous substitution of B1 repeat

by Alu-monomer is calculated as P = [exchange region length – B1 repeat length]/[average period (distance between B1 repeats)]. This yields [3.0 – 0.15]/3.0 = 0.95, i.e. 95%

Figure 1. Electrophoretic characteristics of exogenous therapeutic human placenta DNA administered i.p. to mice. M, molecular weight marker lambda DNA-BssT1I digest.

C. Blood collection for counts in treated mice To prepare smears, blood was withdrawn from the tail vein of each mouse before CP injection, also 4, 7, 10, 14, 17 days after it. The treated and control groups consisted of 10 mice each.

Calculations for the leucogram were standard (Menshikov VV, 1987).

D. PCR amplification Thermocycling conditions for amplification of human genome specific fragments were as follows: 94 ºC for 2 min, 1 cycle; (94 ºC for 30 sec, 72 ºC for 1 min), 33 cycles; storage at 4 ºC. The following approach was used to identify the minor fragments of human origin in the treated mice genomes. The minor human templates for the treated mice genomes were first amplified in the presence of a specific primer. Then, the obtained material was amplified in the presence of two specific primers under the indicated thermocyclic conditions in another PCR round. This approach allowed us to detect human DNA fragments in the genomes of treated mice No 1 and No 8. The human genome specific primers used were as follows: Pr.9 CGAGGCGGGAGGATCACTTGAGCCC (25) Pr.10 CGGCTCACTGCAGCCTCGACCTCCC (25) Pr.11 GCGCGCGCCACCACGCCCGGC (21) Amplification was performed using the Tertsik DNAtechnology equipment (Russia).

E. Sequencing PCR fragments

H. Estimation of the number of genomes in treated tissue cells containing X-Alu homologous sequences based on absolute counts of labeled material in dots

PCR fragments were sequenced at the Interinstitute DNA Sequencing Center, Siberian Department of the Russian Academy of Sciences. Big Dye 3.1 (Applied Biosystems, USA) was used to sequence DNA fragments.

DNA from treated and control mice in amounts indicated below was dotted onto Hibond N membrane (Amersham) and hybridized to a "-32P labeled X-Alu DNA fragment.

Absolute counts of labeled material in dots (cpm)

F. Southern-blot-dot hybridization Southern-blot-dot hybridization was performed as described by Maniatis et al (1982) at 68ºC under stringent conditions. The membrane was washed with 0.1xSSC containing 0.1% SDS The amount of labeled material (spots and

187

Likhacheva et al: Integration of human DNA into the mouse genome

ng X-Alu SS Nonspecific background CBA Specific background hDNA Mouse No 1 Mouse No 8

0.1 55

0.5 79

1.0 135

10

50

250

500

1000

5000

0

0

0

0

24

26

34

23

30

31

58

105 not above specific background 42

165

233

291

467

14

23

47

28

Spleen, ~3x108 nucleus-containing cells.

Spleen colony, a derivative of blood stem cell, contains 10x6 cells.

Thus, the total cell number is 23.5x108, spleen colonies constitute 0.04% of this number.

To obtain counts for moderate hybridization zones, we chose spots in which the amount of applied DNA did not exceed the resolving capacity of Hibond N membrane. Counts per minute (cpm) were determined in dots of the two treated mice after subtraction of the average specific background, it was at the background level for mouse No 1, some cpms above or equal to the average specific background for mouse No 8. The method was not sensitive enough to accurately define the ratio of the applied DNA quantity to cpms per dot. For this reason and relying on the Southern blotting, we estimated copy number of X-Alu monomers in the genomes of the treated mice. Four X-Alu monomers, one or several copies per haploid genome, were determined for mouse No 8, less than a single copy per haploid genome for mouse No 1.

1. Count for the 0.1 ng X-Alu containing dot is the same as that for the 10 ng human DNA containing a dot.

Consequently, the human genome contains ~ 1% of human XAlu fragments.

2. The dot, which contains 5000 ng of DNA from mouse No 8, is virtually not above the specific background level, its count is 50-fold smaller than that for the dot containing 0.1 ng XAlu DNA or 10 ng human DNA, i.e. 0.00004% of the human XAlu fragments are present in the genome of the treated mouse.

3. The human haploid genome contains about 3.3x109 bp DNA, 1% X-Alu about 300 bp long amounts to 105 copies per haploid genome.

4. The mouse genome is of about 2.5x109 bp, a little shorter than the human genome. For simplicity, we consider the genomes of equal lengths in both organisms, if 1% of the haploid genome contained 105copies of X-Alu monomer, it would be present in about 4 copies in the genome of mouse No 8. This means that monomer X-Alu is present in at least 4 (a single or several) copies in the single cell genome. Count is 5-6-fold less for treated mouse No 1 than for mouse No 8, so that copy number is smaller than a single copy per haploid genome. Taking into account the possible clusterisation of X-Alu monomers into a block and the existence of several integration sites, less than 1 cell in the three treated organs of the two mice contains X-Alu monomers.

Thus, several kbs of foreign human DNA homologous to Alu-repeats may be present in the host genomes of the treated mice. At the same time X-Alu repeats are limited by the restriction sites BamHI, HindIII or BamHI-HindIII, as follows from the genomic blot analysis.

The following parameters must be defined to estimate the possible variants of exogenous DNA integration.

The number of cells in organs from which DNA was isolated.

Liver, 1.0 mg, 106 cells. Average liver weight is 2 g. Total cell number is 2x109.

Thymus, 5-6x107 cells.

III. Results A. Effect of fragmented DNA on recovery of the hemopoietic function by marrow cells in mice. Blood count (hemogram). Treated mouse survival A characteristic response of white blood to CP was severe leucopenia 4 days after treatment. The pattern remained virtually unaltered after combined treatment with CP and fragmented human DNA. The recovery course of leucocytes in the groups treated with CP alone or CP + human DNA was somewhat different 7 days after treatment. Their common feature was prominent leucocytosis with the appearance of juvenile types of the granulocyte series, juvenile and rod neutrophils (the two are united under the rod neutrophil heading in the table).

Cells of the granulocyte series became prevalent. By day 7, in the treated group, mature granulocytes appeared and the initial proportions between corpuscular elements in the blood recovered faster than in the control group whose recovery lagged behind up to day 14. Both groups recovered their initial blood counts by day 17. The comparative data for each granulocyte type are given in Tables 1, 2, 3, 4, also in Figure 2.

The following observations are of importance. Mice No 5, 7, 9 of the CP + human DNA treated group died on days 6 and 7 (they are highlighted in green in Tables 1-3).

The causes of their death are unclear; moreover, their initial blood counts were normal. In mice No 1 and No 8 (highlighted in blue), granulocytes were prevalent, even 14 days after CP injection, while their counts became normal in all the other mice. Mice No 1 and 8 of the treated group showed obvious evidence of disease by day 17. They were sacrificed on day 18, their DNAs was isolated. Another two mice of the treated group (No 2 and 10) died 24 and 45 days after the experiment onset. The remaining three (No 3, 4, 6 of the treated group) were sacrificed on day 56 for isolation and analysis of their DNAs, one of them was ill by that time.

188

Gene Therapy and Molecular Biology Vol 11, page 189 Table 1. Proportions of corpuscular elements in the blood of mice treated with cyclophosphan alone and in combination with human DNA.

Preparation

Corpuscular elements in the blood (%)

Mouse No Rod

CP 1 day before injection

CP + human DNA 1 day before injection

CP day 4

CP + human DNA day 4

CP day 7

CP + human DNA day 7

1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8

Segmented

Eosinophils

Monocytes

Lymphocytes

2.7 5.6 5.6 7.4 5.0 5.0 5.8 2.5 5.4 2.6 0 3 7 2 9 0 2 5 2 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10.2 8.0 9.5 14.6 14.7 17.8 14.6 20.0 14.0 25.0 37.8 29.7 14.0 14.5

47.7 43.0 49.0 34.6 42.4 40.0 31.2 32.0 46.4 51.8 51 55 38 49 57 70 56 40 61 74 2 0 0 3 13 6 0 1 5 2 2 1 3 0 9 0 1 1 7 0 34.6 45.7 35.3 34.4 26.8 34.6 34.4 54.0 51.0 48.0 40.3 39.7 54.0 28.5

3.7 1.3 3.4 5.0 4.8 3.0 1.5 4.3 2.6 0.6 5 3 2 7 5 6 2 2 1 1 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

6.3 10.5 9.0 13.6 11.2 13.0 11.0 14.0 12.4 20.4 6 7 18 7 4 8 10 8 7 13 12 15 13 13 14 8 2 2 9 10 2 4 4 0 0 5 3 1 7 7 48.6 46.7 47.5 43.0 45.2 42.4 47.4 15.0 25.0 5.0 18.0 22.0 26.3 53.2

39.7 19.8 31.6 43.8 36.2 38.8 34.5 29.8 34.6 24.2 38 32 35 35 25 17 30 45 29 46 84 85 87 84 71 83 98 98 86 88 96 95 93 100 91 95 96 97 86 93 5.6 5.0 6.0 7.6 5.5 5.0 3.2 10.0 10.0 22.0 2.5 8.0 3.3 3.7

15.7

48.5

0

54.2

4.0

15.3

41.0

0

37.0

6.0

189

Likhacheva et al: Integration of human DNA into the mouse genome

CP day 10

CP + human DNA day 10

CP day 14

CP + human DNA day 14

CP day 17

CP + human DNA day 17

9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10

37.7 13.7 18.3 10.0 16.5 18.0 12.0 9.5 24.0 19.0 20.0 4.0 3.0 17.0 11.5

37.8 53.7 66.7 57.5 56.5 49.0 64.0 66.0 64.0 59.0 52.0 76.5 65.0 59.5 45.0

0 0.3 0.3 0 0 0.5 0.5 1.0 0 0 1.0 0 0 0 0

54.8 24.7 5.7 25.5 0.2 0.2 0.2 17.0 5.5 16.0 14.0 11.0 24.0 14.5 21.5

9.0 9.0 8.7 6.0 6.5 12.5 8.0 5.0 6.5 9.0 7.0 9.0 70 6.5 22.0

5.3

68.0

0

21.7

6.3

8.0

72.0

0

6.0

6.0

7.5 41 17 14 27.5 21 14 26 13 17 18 1 4 5 11

47.5 20 39 30 31 27 42 38 33 38 26 85 57 49 55

1,0 11 5 8 6 7 9 7 7 6 11 3 8 6 0

17.5 19 28 30 24.5 32 19 12 23 19 19 9 18 31 14

27.5 8 12 18 11 13 16 16 24 20 26 2 15 9 17

6

52

5

21

16

8

63

5

5

18

8 15 11 15 25 8 24 22 25 12 12 2 3 13 9

42 29 38 43 43 47 37 32 36 30 48 87 52 43 51

7 5 5.5 6 4 7 12 15 8 11 8 0 13 1 7

27 31 33.5 24 17 16 13 15 9 20 15 9 13 27 19

16 20 11 12 10 22 11 16 21 24 17 2 18 17 13

5

59

8

6

23

5

71

11

5

7

9

44

1

11

32

190

Gene Therapy and Molecular Biology Vol 11, page 191 Table 2. Dynamics of the number of rod neutrophils during 17 days after treatment with CP alone or in combination with human DNA Rod (immature) and juvenile neutrophils (%) Preparation

CP

CP + human DNA

Mouse No 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10

1 day before CP injection 2.7 5.6 5.6 7.4 5.0 5.0 5.8 2.5 5.4 2.6 0 3.0 7.0 2.0 9.0 0 2.0 5.0 2.0 6.0

day 4

day 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

day 10

day 14

day 17

10.2 8.0 9.5 14.6 14.7 17.8 14.6 20.0 14.0 25.0 37.8 29.7 14.0 14.5

13.7 18.3 10.0 16.5 18.0 12.0 9.5 24.0 19.0 20.0 4.0 3.0 17.0 11.5

21.0 17.0 14.0 27.5 21.0 14.0 26.0 13.0 17.0 18.0 1.0 4.0 5.0 11.0

15 11 15 25 8 24 22 25 12 12 2 3 13 9

15.7

5.3

6.0

5

15.3

8.0

8.0

5

37.7

7.5

8.0

9

Table 3. Dynamics of the number of segmented neutrophils during 17 days after treatment with CP alone or in combination with human DNA Segmented neutrophils (%) Preparation

CP

CP + human DNA

Mouse No 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10

1 day before CP injection 47.7 43.0 49.0 34.6 42.4 40.0 31.2 32.0 46.4 51.8 51.0 55.0 38.0 49.0 57.0 70.0 56.0 40.0 61.0 74.0

day 4

day 7 2 0 0 3 13 6 0 1 5 2 2 1 3 0 9 0 1 1 7 0

191

day 10

day 14

day 17

34.6 45.7 35.3 34.4 26.8 34.6 34.4 54.0 51.0 48.0 40.3 39.7 54.0 28.5

53.7 66.7 57.5 56.5 49.0 64.0 66.0 64.0 59.0 52.0 76.5 65.0 59.5 45.0

20 39 30 31 27 42 38 33 38 26 85 57 49 55

29 38 43 43 47 37 32 36 30 48 87 52 43 51

48.5

68.0

52

59

41.0

72.0

63

71

37.8

47.5

42

44

Likhacheva et al: Integration of human DNA into the mouse genome Table 4. Changes in the number of the corpuscular elements of granulocyte series in the blood after treatment of mice with CP plus human DNA Preparation

CP

CP + human DNA

Days 1 day before CP injection day 4 day 7 day 10 day 14 day 17 1 day before CP injection day 4 day 7 day 10 day 14 day 17

Rod neutrophils, %

Segmented neutrophils, %

Total number of granulocytes, %

47.0

41.8

49.6

0 14.8 14.3 20.8 16.9

3.2 39.9 59.8 32.4 38.3

3.6 59.7 74.5 53.3 55.2

3.6

55.1

62.1

0 23.5 8.1 6.1 6.5

2.4 41.4 61.9 53.0 53.3

2.5 64.9 70.1 60.0 60.6

Figure 2. Graphical representation of the relative proportions and dynamics of groups of corpuscular elements in the blood after injection of cyclophosphan (CP) alone or in combination with human DNA administration. (A) Relative change in the number of segmented neutrophils after treatment with CP alone or with CP plus human DNA. (B) Relative change in the number of rod (immature) neutrophils after CP i.v. injection alone or CP plus human DNA. (!) Relative number of granulocytes after treatment with CP alone or in combination with human DNA, the values are averages for all mice.

A single mouse of the control group died during the observation period. Thus, survival was 20% in the treated group and 80% in the control. The combined effect of human DNA preparation plus cytostatic CP suggested uncoupling of the cause-effect mechanism in the

physiological systems of treated mice. We assumed that the detected impairment was due to drastic changes in the genetic information in the chromosomes of the treated mice brought about by integration of the foreign DNA fragments.

192

Gene Therapy and Molecular Biology Vol 11, page 193 program. Based on the search, we chose those primers that did not form theoretically PCR products with the mouse genomes, yet definitely yielded them with the human genome. It proved that the actual PCR banding pattern did not conform to the one derived from computer analysis. In all the combinations of all the human specific primers, distinct bands were detected in the mouse genome. PCR of DNA from the treated mice using primers for the classical Alu did not allow us to reliably identify human DNA sequence integrated into the mouse genome. There were prominent major bands, the hallmark features of both the control and treated mice (Figure 4A). What if the sequences of the chosen human primers could pair with the homologous regions in the mouse genomes that eluded detection by the applied UCSC In-Silico PCR program? If this were the case, under standard PCR conditions, they would be conferred quantitative competitive advantage relative to the scanty human DNA sequences despite their identity to the primers. To exclude this possibility, PCR amplification was carried out under stringent conditions using a single primer (after having analyzed all the synthesized primers), see Materials and Methods section.

We proceeded on the assumption that the primer completely homologous to a particular human sequence would pair with precisely this sequence and would synthesize the PCR product bounded at one end by a

B. Choice of primers for the detection of human DNA fragments integrated into the mouse genome In analysis of human DNA integration into the genome of treated mice, we used a moderately repetitive human Alu-sequence, making up to 10% of the total human DNA. The mouse genome harbors moderate B1 repeats that are highly similar to human Alu, consensus sequences Alu and B1 share about 65% homology. The structure of most human Alu-repeats is dimeric, they are about 290 bp long. In contrast, B1 repeats in the mouse genome are predominantly monomers about 130 bp in length (Kolchanov et al, 1988; Britten et al, 1988).

Alignments of Alu-repeat and dimer B1 sequences show that deleted regions or regions without homology occur on the background of high homology. To construct primers specific to Alu-repeat, we chose precisely these regions in such a way that the 3â&#x20AC;&#x2122; end of the primer fell within a region lacking homology in B1 repeat structure.

Furthermore, primers (see Materials and Methods section and Figure 3A) were deliberately chosen so that one member of the primer pair fell within one half of Alu, the other within its other half, i.e. PCR using the primers for an individual monomer B1 repeat was made impractical.

Analysis of the possible PCR products in the two genomes was performed using the UCSC In-Silico PCR

Figure 3. (A) Alignment of consensusi of human repetitive sequence and mouse B1. (B) A sequence of the X-Alu fragment. Arrows and boldface type highlight the primers used in PCR.

193

Likhacheva et al: Integration of human DNA into the mouse genome

Figure 4. PCR of genomic DNA from treated mice for the presence of human DNA sequences. (A) PCR of genomic DNA in treated mice for the presence of specific DNA fragments with the same mobility as in the PCR products yielded by PCR analysis of the human genome. Left block, electrophoretic separation of the PCR fragments from treated and control mice. Right block, Southern blot hybridization of the same gel to the 32P labeled X-Alu fragment DNA. (B) Rehybridization of positive samples of specific fragments (280 bp for humans and the two mice) further used to determine the nucleotide sequences. Left block, electrophoretic separation of the PCR fragments; right block, Southern hybridization of the same gel to the 32P labeled X-Alu fragment DNA. Numbers on the left to the blocks (280 bp and 310 bp) indicate the fragments that correspond to the two major PCR products detected in the human genome. 1 through 15 are the numbers of the samples. Designations: CBA, host mouse strain; mice No 1 and No 8, treated mice; M, molecular weight markers (100 bp ladder); +hDNA, samples of DNA from mice treated with CP alone; +CP+hDNA, samples of mice treated with CP plus human DNA.

primer specific to human. With this strategy, the PCR material would become enriched in human sequences initially present in very small quantities. During the second PCR amplification round, this time with two primers, competition would not expel the fragments.

Analysis of the PCR products allowed us to reliably identify the fragments with the same mobilities as those detected by PCR using the human genome DNA as a template. The specific DNA fragments were revealed in the genome of treated mice No 1 and 8 (Figure 4), their electrophoretic mobility was estimated as about 300 bp (280 bp and 310 bp, respectively). Because we knowingly

chose primers located in Alu-repeat sequence, there was reason for believing that the two major PCR fragments were two variants of the human genome Alu-repeat.

C. Hybridization and nucleotide analysis of PCR product sequences from the treated mouse genome The finding of fragments in the PCR product pattern from treated mice total DNA whose mobilities were the same as that of the major fragments in the PCR product pattern from total human DNA was encouraging. We performed blot hybridization using PCR of the labeled 194

Gene Therapy and Molecular Biology Vol 11, page 195 fragment, a major band in PCR with total human DNA 280 bp in size (Figure 4). Hybridization with the electrophoretically separated PCR products from all the treated mice demonstrated that only two PCR products of 280 bp and 310 bp in samples of genomic DNA from treated mice No 1 and 8 hybridized to a 280 bp fragment obtained in PCR with total human DNA. This was taken to mean that (i) the 280 bp and 310 bp fragments are highly homologous to each other, (ii) the human DNA appeared in the genomes of the two treated mice.

Analysis of nucleotide sequence of the fragments yielded by PCR with total human DNA and the two mice (280 bp) established their complete identity (Figure 3).

The sequences encompassing a region of about 150 bp almost entirely occupied the same position as a part of the consensus Alu-repeat. This was highly suggestive, either larger fragments might have integrated into the mouse genome or the chosen primers bounded the stretch directly belonging to the Alu-type repeats. The newly described fragments hereafter will be referred to as X-Alu. Screening of the experimentally produced sequences in the available databanks revealed complete homology to a region of human chromosome 16 (AC002400.1) and partial to numerous fragments of the human genome. Southern-blot hybridization of the labeled X-Alu fragment to human and treated mouse DNAs also revealed a large number of homologous fragments in the human genome. This was corroborative evidence for the similarity of the newly identified DNA fragment and the Alu-repeat family.

1) The treated mice indeed contain human DNA fragment(s) homologous to Alu-repeats in their genome.

2) The detected discrete bands evidence that the PCR and subsequent hybridization results are not artifactual. Were the human DNA samples contaminated, the strong hybridization pattern would be smeared like after hybridization to the total human DNA. This is not the case.

3) The number of integrated DNA for the two transgenic mice is different.

We cannot explain why transfer onto membrane is nonuniform and focused. One reason is that integrated sequences are not simply present in all the cells, this produces uneven distribution of small DNA amounts throughout the agarose gel band and ultimately biases transfer and focusing. As follows from genome blot analysis, BamHI, HindIII or BamHI-HindIII restrictases set boundaries to X-Alu repeats and they appear as discrete fragments whose numbers are different in the two treated mice. Fragment size is estimated as about 2.2 kb for mouse No 1, mouse No 8 has three strongly hybridizing fragments of about 2.2 kb, 3.1 kb, 4.4 kb, two fragments of about 2.0 and 6.0 kb, respectively (Figure 5A).

A series of quantitative dot blot hybridizations were undertaken to estimate the number of integrated DNA and thereby to settle the question whether or not all the cells of the treated mouse organs from which total DNA was isolated harbor the revealed human DNA. It proved that the estimated copy number of the X-Alu probe accounted for 1% of the genomic human DNA (of the order of 105 copies), less than a single copy per haploid genome for mouse No 1, ~4 (a single or a few) copies per haploid genome for mouse No 8 (Figure 5B, also see Materials and Methods section). It may be reasoned that, if monomers integrated as blocks, with several copies in a block and/or integration occurred at several sites of the genome in a cell, less than a single cell of the total cell number would contain integrated human DNA fragments.

Molecular analysis of homologous X-Alu fragments cloned from the treated mouse genomes would assure us that we reasoned correctly.

It should be noted that additional control experiments with either CP or a preparation of fragmented human DNA demonstrated no abnormalities. All mice survived, there was no experimental evidence for integration of the analyzed X-Alu target (Figure 4A).

D. Comparative Southern-blot analysis and estimation of copy number of the Alufragments in the human and treated mouse genomes It appeared expedient to determine the genomic disposition of the integrated DNA and to see how the two treated mice differed by integrated copy number from each other. Southern-blot hybridization of the treated mouse genomic DNA, the CBA mouse genomic DNA, the human genomic DNA was performed. Each of the DNAs was concomitantly digested with BamHI and HindIII restrictases, the digests were hybridized to a PCR labeled fragment synthesized from the DNA template of the human genome (280 bp). The hybridization pattern is shown in Figure 5A. Its hallmark features are as follows. i) despite the most stringent hybridization conditions chosen, the lane with human DNA shows strong hybridization along its entire length, this indicates that the human genome contains a great number of sequences homologous to the probe. ii) CBA mouse DNA is devoid of homologous sequences that hybridize to the X-Alu probe in the chosen conditions. iii) examination of the hybridization pattern yielded by the treated mouse genomic DNA allowed us to distinguish a set of discrete bands (BamHI, HindIII or BamHI-HindIII) for mouse No 8 and a single band for mouse No 1. The implications for the strong hybridization pattern are as follows.

IV. Discussion A. Integration of foreign DNA into the genome of somatic tissue cells in the adult Based on our earlier observations, we attempted here to obtain assurance that exogenous human DNA integrates into the mouse genome. Our previous work has shown that exogenous DNA affected the development of erythro- and myelopoiesis progenitors, thereby speeding up the recovery of white and red blood cell progenitors following exposure to the cytostatic agent (Yakubov et al, 2003; Nikolin et al, 2006). The important observations were

195

Likhacheva et al: Integration of human DNA into the mouse genome

Figure 5. (A) Southern-blot analysis of genomic DNA from treated mice No 1 and No 8 for the presence of human DNA sequences. M, molecular weight markers (lambda DNA-HindIII digest); 1-4, genomic DNA-BamHI+HindIII digests; m No 1, treated mouse No 1; m No 8, treated mouse No 8; CBA, host mouse strain. Left block, electropheretically separated DNA (lambda DNA-BamHI+HindIII digest). Right block, a genomic blot using the same gel after hybridization to the 32P labeled X-Alu fragment DNA. Arrows in the right block indicate the hybridizing fragments in the treated mouse genomes. (B) Determination of copy number for X-Alu human fragment in the genomes, human, Host CBA and treated mice. Hybridization was performed using 32P labeled X-Alu fragment DNA. The numbers above the blocks indicate DNA spotted onto the membrane. SS, salmon sperm; X-Alu, X-Alu fragment DNA; CBA, host mouse DNA; hDNA, human DNA; Mouse No 1, mouse No 8, treated mouse DNA.

196

Gene Therapy and Molecular Biology Vol 11, page 197 stimulation of the division of the stem blood cells exposed to cyclophosphan, as well as rescue (viability retention) of a considerable proportion of blood stem cells subjected to intense chemotherapy (Yakubov et al, 2003; Nikolin et al, 2006; Patent application No 2006127134, Russia). Based on previous considerations (Yakubov et al, 2002, 2003) and our research results, it has been suggested that, having entered the nuclei of the stem blood cells (and of any proliferating cells), exogenous DNA becomes involved in repair of DNA damage incurred by cytostatic agent. Based on the data on hemopoiesis stimulation under the effect of both allogenic and xenogenic DNAs (Yakubov et al, 2003; Nikolin et al, 2006), we also suggested that the DNA of taxomically close species can be involved in homologous exchange during repair of cytostatic induced DNA damage and, therefore, integrate into the host genome.

We assume that, in the recombinogenic situation arising when replication fork is arrested, DSB form at the cross-link site, the excision repair system activated is crucial for the DNA integration (both local on the chromosome and extrachromosomal of allogenic and xenogenic origin). In this situation, the presence of exogenous DNA in somatic cell nuclei in animal tissues during injection of cytostatic agent is a requisite for designing experiments.

The major criteria for the events that affected the state of the treated mice was the recovery rate of the hemopoietic function defined by changes in blood counts, their unexpected shift elicited by CP plus exogenous DNA cotreatment, and mouse general status.

The pattern of changes in blood counts (Figure 2) supported the experimental results that demonstrated accelerated recovery of inhibited hemopoiesis under the effect of combined therapy with CP and fragmented human DNA preparation in all the treated mice. However, the unusually great increase in granulocyte number persisted in mice No 1 and 8. It is pertinent to note that neutrophilia may be caused by diseases associated with tissue disintegration or immune system stress (Roitberg and Strutynsky, 1999).

Surprisingly, mice subjected to combined treatment started to succumb on day 6. The last one died on day 56.

Mice phenotypically manifested a different sets of symptoms. It appeared likely that the very dramatic consequences were caused by integration of the foreign DNA into the treated mouse genome. It appeared likely also that the beneficial effect of xenogenous exogenous DNA on the inhibited white blood cell progenitors was not due to homologous substitution of the chromatin regions under the impact of cyclophosphan. In fact, integration of foreign DNA is lethal to the host. Regrettably, post mortem studies were not performed because the dramatic events were unpredictable. Liver, spleen and thymus were excised for extraction of DNA and its subsequent analysis from all the dead mice.

The Alu-sequence was chosen to determine whether human DNA integration is possible.

B. Molecular characteristics of integrated sequences homologous to the human Alurepeats In choice of the Alu-repeats for analysis, we reasoned as follows. As known, Alu-elements comprise up to 10% of the haploid genome, this corresponds to about 106 copies of 300 bp Alu monomers. The human Alurepeats are scattered throughout the genome forming clusters, occurring every 3-4 kb on average. The structure of most human Alu-repeats is dimeric. A number of tetrameric sequences and the monomeric repeats in single instances were identified. Structurally similar to Alurepeats were found to be present in the mouse genome.

They were called B1 and are almost always monomers (Britten et al, 1988; Kolchanov et al, 1988). The homology degree between the B1 and Alu-repeats is higher, their consensus sequences being up to 65% identical. The percent can be as high as 90% for the real monomers. The mouse B1 repeats are organized similarly to the Alurepeats in the genome.

Fragments of exogenous extrachromosomal DNA that represent up to 2% of the haploid genome can accumulate in the nuclear space of the cell (Rogachev et al, 2006), consequently, about 20,000 copies of the Alu monomers can be present in the genomic fragments of about 3 kb on average in the cell nuclei of mice treated with exogenous DNA. The cytostatic agents at doses used in chemotherapy and research induce of the order of 1000-2000 cross-links per nucleus (Palom et al, 2000; Warren et al, 2001). Like Alu, the B1 repeats occur every 3 kb in the mouse genome, it follows from calculation that the probability of a homologous substitution between two similar repeats is over 95% (see Materials and Methods section). This means that a cross-link is present in virtually each cell in the B1 repeat or in its vicinity, that it can induce exchange with an Alu-sequence of extrachromosomal origin.

In the case of damage that affects genomic repetitive sequences in the genome, numerous potential homologous regions in its most different parts can be recruited for homologous repair of the damage, if the repair requires homologous exchange. When a DSB caused by a stalled replication fork occurs in a homologous region, variants of repair may be envisioned. One is gene conversion whereby DNA is nonreciprocally transferred from donor to host, with the damaged allele being, as a rule, the host. Another variant is pairing of a single strand followed by synthesis and migration of the strand without an associated crossing over (Langston and Symington, 2004; Leung et al, 1997; Bartsch et al, 2000; Nickoloff, 2002). Provided that the extrachromosomal fragment is long enough and that linear sequences, which flank the damage homologous to the fragment ends, are present in the genome, the fragment can completely repair the damaged locus by double reciprocal exchange through the described mechanism (Hastings et al, 1993; Leung et al, 1997; Li et at al, 2001; Yakubov et al, 2003; Langston and Symington, 2004). The central portion of the sequence, which forms by its end regions two heteroduplexes with the homologous chromosome regions, integrates into the host genome without inducing any changes, by just replacing the 197

Likhacheva et al: Integration of human DNA into the mouse genome chromosome region bounded by two repaired end regions.

In DSB homologous repair, the nucleus can contain numerous homologous sequences, for example, repeated genomic, in such a case, vicinity to the homologous exchange site and homology degree are the two important factors that affect the choice of the appropriate homologous segment (Schildkraut et al, 2006).

It has been suggested that the large number of Alucontaining fragments in the nuclear space of mouse cells and the high homology between human Alu and mouse B1 repeats would enable them to pair with each other and be involved in homologous pairing.

Thymus, liver and spleen from treated mice were used to isolate DNA in the conducted experiments.

Analysis of the X-Alu copy number in the two positive mice established that it was less than a single copy for mouse No 1 and about 4 (a single â&#x20AC;&#x201C; a few) copies for mouse No 8 per haploid genome. This meant that only a part (under the assumption that the X-Alu monomers integrated as blocks and/or at a number of genomic sites in the cell for mouse No 8 and without this assumption for mouse No 1) of all the cells of the chosen tissues may contain integrated X-Alu copies. If the cell received several monomer copies, or in the case of X-Alu monomer clusterization, the portion of cells containing foreign sequences integrated into the genome would be still smaller.

Analysis of the strong hybridization patterns made apparent the following characteristics of #-Alu containing human DNAs that integrated into the genome.

1) The relation between the estimated number of copies and detected bands, as well as the experimental data on the organization of the Alu and B1 repeats in the genome, evidence that in both mice presumably only a part of cells from which DNA was isolated contain homologous X-Alu sequences. The important finding was the integration of several different X-Alu monomercontaining fragments.

2) It appeared unlikely that exogenous DNA fragments integrated into a unique site in the different cells. Accepting multiple integration, the detection of individual fragments that contained sequences homologous to X-Alu may be explained as follows.

Integration occurred at different sites of the genomic regions showing homology to the X-Alu sequence. The integrated fragments were of different lengths, not shorter than about 2 kb. The integrated fragments harbored a single X-Alu repeat or a monomer cluster bounded by BamHI, HindIII or BamHI-HindIII restrictases. Digestion with these restrictases liberated the same monomer or cluster of monomers, regardless of their location and number in the host genome. The fragment was of ~2.2 kb for mouse No 1, fragments were about 2.0, 2.2, 3.1, 4.0, 6.0 kb for mouse No 8. It is inexplicable why only the fragments containing homologous X-Alu sequences integrated into the genomes of treated mice. However, the difference in the number and distribution of the X-Alu repeats among the genomic fragments of the two treated mice evidence for individual specificity in integration in the given experimental conditions.

3) The size of the integrated fragments containing X-Alu cluster was in the 2 â&#x20AC;&#x201C; 6 kb range. This meant that a long homologous region was required for integration in the form of gene conversion or that a mechanism of double reciprocal exchange of paired end regions of the fragment.

4) The rest of the succumbed mice, as well as those of the other experimental series (a single injection of CP and/or human DNA, 30 mice), did not contain integrated X-Alu sequences. However, their death during the long experiment suggested that fragments of exogenous human DNA also integrated into the genomes of these mice whose sequences represented different parts of the human genome that discriminated homologous regions in the genomes of the treated mice.

There exists another possibility, integration in several brain marrow stem blood cells whose survived offspring gave rise to individual colonies in spleen. Precisely these colonies consisted of cloned cells into which individual fragments integrated. It was expected that the fragment would integrate at a single site of the genome defined by a parental blood stem cell. Estimates of copy number for XAlu monomers in the genomes of treated mice in the case of their possible clusterization of X-Alu monomers are consistent with our vision of the events. The estimates were not less than a single â&#x20AC;&#x201C; a few copies per haploid genome; cell number in the spleen colony was estimated as 0.04% of the total number of treated cells, with the total number of spleen colonies being up to 40.

C. Events possibly due to exogenous DNA integration into the genome in treatment with CP plus exogenous DNA preparation The question was: How transgenesis might have occurred in the tissue cells of adult mice given the crosslink inducer CP in combination with fragments of exogenous extracellular foreign DNA? Numerous recent studies have shown that the appearance of ICLs in proliferating cells is associated with arrest of the replication fork encountering steric hindrance. This event enhances repair with the result that an extremely recombinogenic structure forms at the cross-link site. The consequences are manifold: DSB formation in the newly synthesized strand in the immediate vicinity to the crosslink site, replication fork arrest, the generation of a single strand region from 70 bp (Mu et al, 2000) to 700 bp (Sinden and Cole, 1978) through the activity of the XRCC1-XPF-RPA complex. The two structures form sequentially at the individual ISL site. There presumably exists a time when they are present together. A number of models for repair of arisen DNA damage have been described, they all incorporate excision exonuclease activity of the XRCC1-XPF-RPA complex followed by homologous recombination (De Silva et al, 2000; Niedernhofer et al, 2004). In the case of generation of such a structure, foreign extrachromosomal DNA has presumably the opportunity for integration into the recombination site by the same mechanism (Kucherlapati et al, 1984) or repair via homologous recombination with the sister chromatid (Niedernhofer et al, 2004). Two DNA damages are obviously required for repair. In the 198

Gene Therapy and Molecular Biology Vol 11, page 199 conceived version of events, any one of the known repair mechanisms of the DNA strand is possibly feasible (Thomas et al, 1986; Van Houten et al, 1986; Hastings et al, 1993; Rouet et al, 1994; Jasin, 1996; Liang et al, 1998; Leung et al, 1997; Bartsch et al, 2000; Li et at al, 2001; Nickoloff, 2002; Yakubov et al, 2003; Langston and Symington, 2004). However, the ultimate necessary condition is repair by homologous exchange between the damaged region and the homologous sequence internalized within the nuclear space.

It may be assumed that ICL occurred between two B1 repeats. Our search for homologous sequence for repair of the ICL break induced by the stalled replication fork was successful: the fragment containing Alu-repeat or its clusters within the 2 â&#x20AC;&#x201C; 6 kb fragments seen in the genomic blot paired with its end monomers to the B1 sequences.

Further, the intermediate is resolved with integration of the entire fragment into the host genome by the mechanism as previously described (Li et al, 2001). This is the reason why the regions of human DNA integrated into the mouse genome are rather long.

Retroposition of integrated into the mouse genome Alu-repeats, which was induced by the genotoxic stressor etoposide, has been observed; by blocking topoisomerase II, etoposide resulted in DSBs and global activation of all repair mechanisms (Hagan et al, 2003).

We do not exclude the possible triggering of the retrotransposition mechanism for fragments with the XAlu sequences and the promoter region for RNA polymerase III, moreover that the described transposition phenomenon has been observed for a mouse-human system virtually identical to ours, thereby indicating that there exists an enzymic system in mouse cell capable of transposing human Alu-sequences.

However, the fact of cluster retransposition of Alurepeats has not been established as yet, moreover using extrachromosomal fragments as a template. Single copies of the repeats integrate into the target site by the reverse transposition mechanism, involving RNA synthesis, reverse RNA synthesis, transposition of newly synthesized DNA copies to the target site. First, a copy of Alu-element within the host genome is requisite for the process; second, site-specific integration requires specific endonuclease-reverse transcriptase, a DSB-inducing enzyme that directly accomplishes integration and repair of the DNA Alu-copy. To our knowledge, there has been no reference to the presence of this enzyme during events associated with ICL repair in the available literature.

Finally, genomic hybridization failed to reveal distinct hybridization band during site-specific Alu retransposition into the nuclear space of the treated mice and also in the case of contamination of the samples with human DNA. This was because the integrated Alu-repeat did not contain sites for the chosen restrictases statically distributed throughout the genome. Hence, a united restriction fragment could not appear in random transposition of different cells into different genomic restriction fragments.

In summary, then, we believe that in the current experiments a CP-mediated in vivo transgenic somatic transformation by fragments of exogenous foreign DNA occurred in adult mice.

D. Envisioned therapeutic application of the revealed DNA integration and of its consequences The factual evidence of the integration of exogenous DNA fragments into the eukaryotic genomes in a recombinogenic situation generated by a cytostatic crosslinking anticancer agent is thought-provoking. There appear to be unprecedented opportunities to develop a new approach to treatment of cancer and variety diseases in genetically damaged cells (Patent application No 2006127134, Russia).

The repair system of cell promptly becomes active in response to the multiple ICLs induced by anticancer drugs.

The choice of the cytostatic is tailored in such way that each cell receives a cytostatic shock (about 2 000 ICLs per cell) deadly to the cancer and other proliferating cells.

Cells die presumably because i) they cannot cope to form at the same time sufficient amounts of repair complexes so that a part of the incurred damage remains unheeded, triggering apoptosis; ii) when a homologous chromosome or a sister chromatid serves as substrate for homologous recombination of a homologous chromosome, multiple ICLs pose steric hindrance to simultaneous synapsis of several damaged sites with homologous regions. This is another obstacle to complete repair of all the arisen ICLs with inevitable apoptotic cell death; iii) the last, not the least important, cause of cell death is that the genetic mode of the cell remains the same as before ICL induction, when a homolog or a sister chromatid is used for homologous recombination repair, i.e., if the cytostatic diadduct arose in the region of the gene whose mutation caused cell malignization, repair using endogenous cell substrate would not bring about beneficial genetic change in the mutated gene. If the genome harbored oncomutations, it would continue to do so despite this repair.

The only way to get rid of such oncomutations is to kill the cancer cells and, with one stroke, all the other proliferating cells. Cytostatic drugs do this job well.

It is suggested that fragments of exogenous allogenic DNA would be involved in repair culmination when all the cross-linked DNA strands are restored. A favorable circumstance is that up to 2% of the haploid genome of extracellular DNA can be present in the nuclear interchromosomal space as fragments of size commensurate with that of DNA fragments resulting from normal apoptosis (Rogachev et al, 2006). The extremely recombinogenic situation engendered by ICL induction and replication fork stalling makes the recombination machineries of the cell highly active. If DNA fragments homologous to the repaired site and serving as substrate for homologous recombination were present at that time in the nucleus, recombination would surely take place, not with the defective endogenous homolog, but with the mutation-free exogenous therapeutic DNA. The newly integrated sequence would become fixed as a result of successive cell divisions, and the oncomutation would be resolved.

199

Likhacheva et al: Integration of human DNA into the mouse genome De Silva IU, McHugh PJ, Clingen PH, Hartley JA (2000) Defining the roles of nucleotide excision repair and recombination in the repair of DNA interstrand cross-links in mammalian cells. Mol Cell Biol 20, 7980-7990.

Evans E, Fellows J, Coffer A, Wood RD (1997) Open complex formation around a lesion during nucleotide excision repair provides a structure for cleavage by human XPG protein.

EMBO J 16, 625-638.

Friedberg EC, Walker GC, Siede W (1995) DNA repair and mutagenesis. Washington, DC: ASM Press.

Hagan CR, Sheffield RF, Rudin CM (2003) Human Alu element retrotransposition induced by genotoxic stress. Nat Genet 35, 219-220.

Harrington JJ, Lieber MR (1994) Functional domains within FEN-1 and RAD2 define a family of structure-specific endonucleases: implications for nucleotide excision repair.

Genes Dev 8, 1344-1355.

Hastings PJ, McGill C, Shafer B, Strathern JN (1993) Ends-In vs. ends-out recombination in yeast. Genetics 135, 973-980.

Hoeijmakers JH, Egly JM, Vermeulen W (1996) TFIIH: a key component in multiple DNA transactions. Curr Opin Genet Dev 6, 26-33.

Jachymczyk WJ, von Borstel RC, Mowat MR, Hastings PJ (1981) Repair of interstrand cross-links in DNA of Saccharomyces cerevisiae requires two systems for DNA repair: the RAD3 system and the RAD51 system. Mol Gen Genet 182, 196-205.

Jasin M (1996) Genetic manipulation of genomes with rarecutting endonucleases. Trends Genet 12, 224-228.

Jurka J. (2004) Evolutionary impact of human Alu repetitive elements. Curr Opin Genet Dev 14, 603-608.

Karle P, Renner M, Salmons B, Gunzburg WH (2001) Necrotic, rather than apoptotic, cell death caused by cytochrome P450activated ifosfamide. Cancer Gene Ther 8, 220-230.

Kolchanov NA, Shahmuradov IA, Kapitonov VV, Omelyanchuk LV (1988) Evolutionary aspects of the mammalia Alu repeats. Mol Biol 22, 1335-1344.

Kucherlapati RS, Eves EM, Song K-Y, Morse BS, Smithies O (1984) Homologous recombination between plasmids in mammalian cells can be enhanced by treatment of input DNA. Proc Natl Acad Sci USA 81, 3153-3157.

Laboratory methods of study in the clinics. Editor Menshikov VV.$ (1987).

Lambert S, Watson A, Sheedy DM, Martin B, Carr AM (2005) Gross chromosomal rearrangements and elevated recombination at an inducible site-specific replication fork barrier. Cell 121, 689-702.

Langston LD, Symington LS (2004) Gene targeting in yeast is initiated by two independent strand invasions. Proc Natl Acad Sci USA 101, 15392-15397.

Leung W, Malkova A, Haber JE (1997) Gene targeting by linear duplex DNA frequently occurs by assimilation of a single strand that is subject to preferential mismatch correction.

Proc Natl Acad Sci USA 94, 6851-6856.

Li J, Read LR, Baker MD (2001) The mechanism of mammalian gene replacement is consistent with the formation of long regions of heteroduplex DNA associated with two crossingover events. Mol Cell Biol 21, 501-510.

Li L, Peterson CA, Lu X, Wei P, Legerski RJ (1999) Interstrand cross-links induce DNA synthesis in damaged and undamaged plasmids in mammalian cell extracts. Mol Cell Biol 19, 5619-5630.

Liang F, Han M, Romanienko PJ, Jasin M (1998) Homologydirected repair is a major double-strand break repair pathway in mammalian cells. Proc Natl Acad Sci USA 95, 51725177.

Magana-Schwencke N, Henriques JA, Chanet R, Moustacchi E (1982) The fate of 8-methoxypsoralen photoinduced

The artificially created high recombinational activity of the cell is the pivot of the proposed antitumor therapy based on coadministration of exogenous DNA and cytostatic cyclophosphan. Recombination occurs at those sites where ICLs were induced, owing to the chemical nature of the inductors, ICLs can arise at any site of the genome, regardless of its organizational level and conformational DNA-protein association. ICL emergence is a purely static chemical event, so that complete replacement of all the genomic ICLs is dependent only on the number of ICLs induced at oncomutation sites, this number being in turn dependent on the number of oncomutations, chemotherapies, and the patientâ&#x20AC;&#x2122;s luck, whether an ICL will happen to be located in an oncomutation-containing site or not.

Exogenous DNA similarly affects healthy cells exposed to a cyclophosphan. In such a case, by involvement in repair in healthy cells, fragments of exogenous therapeutic DNA rescue them from apoptosis, promoting the retention of cell populations in various tissues (blood stem cells, epithelium), facilitating chemotherapy, and allowing to design subsequent cycles of treatment with cytostatic. Thus, we demonstrate a strategy effective at controlling cancer.

Acknowledgements The authors thank Alexandra Kokoza-Bogacheva and Anna Fadeeva for their technical help in preparing the paper and translation.

The work was funded by LLC Panagen.

References Bartsch S, Kang LE, Symington LS (2000) RAD51 is required for the repair of plasmid double-strand DNA gaps from either plasmid or chromosomal templates. Mol Cell Biol 20, 1194-1205.

Bessho T, Mu D, Sancar A (1997a) Initiation of DNA interstrand cross-link repair in humans: the nucleotide excision repair system makes dual incisions 5' to the cross-linked base and removes a 22- to 28-nucleotide-long damage-free strand.

Mol Cell Biol 17,6822-6830.

Bessho T, Sancar A, Thompson LH, Thelen MP (1997b) Reconstitution of human excision nuclease with recombinant XPF-ERCC1 complex. J Biol Chem 272, 3833-3837.

Bogerd HP, Wiegand HL, Hulme AE, Garcia-Perez JL, O'Shea KS, Moran JV, Cullen BR (2006) Cellular inhibitors of long interspersed element 1 and Alu retrotransposition. Proc Natl Acad Sci USA 103, 8780-8785.

Britten RJ, Baron WF, Stout DB, Davidson EH (1988) Sources and evolution of human Alu repeated sequences. Proc Natl Acad Sci USA 85, 4770-4774.

Caldecott K, Jeggo P (1991) Cross-sensitivity of gamma-raysensitive hamster mutants to cross-linking agents. Mutat Res 255, 111-121.

Cheng S, Van Houten B, Gamper HB, Sancar A, Hearst JE (1988) Use of psoralen-modified oligonucleotides to trap three-stranded RecA-DNA complexes and repair of these cross-linked complexes by ABC excinuclease. J Biol Chem 263, 15110-15117.

Collins AR (1993) Mutant rodent cell lines sensitive to ultraviolet light, ionizing radiation and cross-linking agents: a comprehensive survey of genetic and biochemical characteristics. Mutat Res 293, 99-118.

200

Gene Therapy and Molecular Biology Vol 11, page 201 crosslinks in nuclear and mitochondrial yeast DNA: comparison of wild-type and repair-deficient strains. Proc Natl Acad Sci USA 79, 1722-1726.

Maniatis T, Fritsch EE, Sambrook J. Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory. (1982) 480 p.

Matsunaga T, Mu D, Park CH, Reardon JT, Sancar A (1995) Human DNA repair excision nuclease. Analysis of the roles of the subunits involved in dual incisions by using anti-XPG and anti-ERCC1 antibodies. J Biol Chem 270, 20862-20869.

Matsunaga T, Park CH, Bessho T, Mu D, Sancar A (1996) Replication protein A confers structure-specific endonuclease activities to the XPF-ERCC1 and XPG subunits of human DNA repair excision nuclease. J Biol Chem 271, 11047-11050.

Mu D, Bessho T, Nechev LV, Chen DJ, Harris TM, Hearst J E, Sancar A (2000) DNA interstrand cross-links induce futile repair synthesis in mammalian cell extracts. Mol Cell Biol 20, 2446-2454.

Mu D, Hsu DS, Sancar A (1996) Reaction mechanism of human DNA repair excision nuclease. J Biol Chem 271, 8285-8294.

Nickoloff JA (2002) Recombination: mechanisms and roles in tumorigenesis. Encyclopedia of Cancer 2nd ed., 4, 49-59.

Elsevier Science, San Diego.

Niedernhofer LJ, Odijk H, Budzowska M, van Drunen E, Maas A, Theil AF, de Wit J, Jaspers NG, Beverloo HB, Hoeijmakers JH, Kanaar R (2004) The structure-specific endonuclease Ercc1-Xpf is required to resolve DNA interstrand cross-link-induced double-strand breaks. Mol Cell Biol 24, 5776-5787.

Nikolin VP, Popova NA, Sebeleva TE, Strounkin DN, Rogachev VA, Semenov DV, Bogachev SS, Yakubov LA, Shurdov MA (2006) Effect of exogenous DNA injection on leukopoietic repair and antitumor action of cyclophosphamide. Vopr Onkol 52, 336-340.

O'Donovan A, Davies AA, Moggs JG, West SC, Wood RD (1994) XPG endonuclease makes the 3' incision in human DNA nucleotide excision repair. Nature 371, 432-435.

Palom Y, Kumar GS, Tang LQ, Paz MM, Musser SM, Rockwell S, Tomasz M (2000) Relative toxicities of DNA cross-links and monoadducts: new insights from studies of decarbamoyl mitomycin C and mitomycin C. Chem Res Toxicol 15, 1398-1406.

Park CH, Bessho T, Matsunaga T, Sancar A (1995) Purification and characterization of the XPF-ERCC1 complex of human DNA repair excision nuclease. J Biol Chem 270(39), 2265722660.

Pastink A, Lohman PH (1999) Repair and consequences of double-strand breaks in DNA. Mutat Res 428, 141-156.

Patent application No 2006127134 (Russia). International patent application %&'/RU2007/000007 was submitted.

Prakash S, Sung P, Prakash L (1993) DNA repair genes and proteins of Saccharomyces cerevisiae. Annu Rev Genet 27, 33-70.

Reardon JT, Spielmann P, Huang JC, Sastry S, Sancar A, Yearts JE (1991) Removal of psoralen monoadducts and crosslinks by human cell free extracts. Nucleic Acids Res 19, 46234629.

Rogachev VA, Likhacheva A, Vratskikh O, Mechetina LV, Sebeleva TE, Bogachev SS, Yakubov LA, Shurdov MA (2006) Qualitative and quantitative characteristics of the extracellular DNA delivered to the nucleus of a living cell.

Cancer Cell Int 6.

Roitberg GE, Strutynsky AV (1999) Laboratory and instrumental diagnostic of diseases of visceral organs. $.: «Publishing House BINOM».

Rouet P, Smih F, Jasin M (1994) Introduction of double-stand breaks into the genome of mouse cells by expression of a rare-cutting endonuclease. Mol Cell Biol 14, 8096-8106.

Saffran WA, Greenberg RB, Thaler-Scheer MS, Jones MM (1994) Single strand and double strand DNA damageinduced reciprocal recombination in yeast. Dependence on nucleotide excision repair and RAD1 recombination. Nucleic Acids Res 22, 2823-2829.

Schaeffer L, Roy R, Humbert S, Moncollin V, Vermeulen W, Hoeijmakers JH, Chambon P, Egly JM (1993) DNA repair helicase: a component of BTF2 (TFIIH) basic transcription factor. Science 260, 58-63.

Schildkraut E, Miller CA, Nickoloff JA (2006) Transcription of a donor enhances its use during double-strand break-induced gene conversion in human cells. Mol Cell Biol 26, 30983105.

Sijbers AM, de Laat WL, Ariza RR, Biggerstaff M, Wei YF, Moggs JG, Carter KC, Shell BK, Evans E, de Jong MC, Rademakers S, de Rooij J, Jaspers NG, Hoeijmakers JH, Wood RD (1996) Xeroderma pigmentosum group F caused by a defect in a structure-specific DNA repair endonuclease.

Cell 86, 811–822.

Sinden RR, Cole RS (1978) Repair of cross-linked DNA and survival of Escherichia coli treated with psoralen and light: effects of mutations influencing genetic recombination and DNA metabolism. J Bacteriol 136, 538-547.

Sladek FM, Munn MM, Rupp WD, Howard-Flanders P (1989) In vitro repair of psoralen-DNA cross-links by RecA, UvrABC, the 5'-exonuclease of DNA polymerase I. J Biol Chem 264, 6755-6765.

Thomas KR, Folger KR, Capecchi MR (1986) High frequency targeting of genes to specific sites in the mammalian genome. Cell 44, 419-428.

Van Houten B, Gamper H, Holbrook SR, Hearts JE, Sancar A (1986) Action mechanism of ABC excision nuclease on a DNA substrate containing a psoralen crosslink at a defined position. Proc Natl Acad Sci USA 83, 8077-8081.

Wang X, Peterson CA, Zheng H, Nair RS, Legerski RJ, Li L (2001) Involvement of nucleotide excision repair in a recombination-independent and error-prone pathway of DNA interstrand cross-link repair. Mol Cell Biol 21, 713-720.

Warren AJ, Mustra DJ, Hamilton JW (2001) Detection of mitomycin C-DNA adducts in human breast cancer cells grown in culture, as xenografted tumors in nude mice, in biopsies of human breast cancer patient tumors as determined by (32)P-postlabeling. Clin Cancer Res 7, 1033-1042.

Yakubov LA, Petrova NA, Popova NA, Nikolin VP, Os'kina IN (2002) The role of extracellular DNA in the stability and variability of cell genomes. Dokl Biochem Biophys 382, 3134.

Yakubov LA, Popova NA, Nikolin VP, Semenov DV, Bogachev SS, Os'kina IN (2003) Extracellular genomic DNA protects mice against radiation and chemical mutagens. Genome Biol 5, 3.

Yu LJ, Drewes P, Gustafsson K, Brain EG, Hecht JE, Waxman DJ (1999) In vivo modulation of alternative Pathways of P450-catalyzed cyclophosphamide metabolism: impact on pharmacokinetics and antitumor activity. J Pharmacol Exp Ther 288, 928-937.

201

Likhacheva et al: Integration of human DNA into the mouse genome

202

Gene Therapy and Molecular Biology Vol 11, page 203 Gene Ther Mol Biol Vol 11, 203-218, 2007

Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors Research Article

Abdelnaby Khalyfa1,3,*, Mohamed Buazza3, He Qiang2, Min Xu4, Charles Taylor Marshall1, Fred J. Roisen1, Kathleen M. Klueber1, Nigel GF Cooper1 1

Department of Anatomical Sciences and Neurobiology, Department of Biochemistry and Molecular Biology, 3 Department of Pediatrics, University of Louisville, School of Medicine, Louisville, Kentucky, 4 GE HealthCare, (Microarray Applications Development, Piscataway, NJ) 2

__________________________________________________________________________________ *Correspondence: Abdelnaby Khalyfa, Ph.D., Department of Pediatrics, Kosair Children’s Hospital Research Institute, University of Louisville, School of Medicine, 570 S. Preston St., Room 204, Louisville, KY 40202, USA; Tel: 502-852-7524; Fax: 502-852-2211; Email: a.khalyfa@louisville.edu Key words: Genome microarray, neurosphere forming cells (NSFCs), CodeLink Bioarrays Abbreviations: 4´,6-diamidino-2-phenylindole dihydrochloride, (DAPI); Analysis Of Variance, (ANOVA); bovine serum album, (BSA); central nervous system, (CNS); Database for Annotation, Visualization, and Integrated Discovery, (DAVID); Gene Expression Omnibus, (GEO); Gene Ontology, (GO); human mesenchymal stem cells, (HMSC); nestin-positive neurosphere forming cells, (NSFCs); neural cell adhesion molecule, (NCAM); olfactory neurosensory epithelium, (ONe); Real time-PCR, (RT-PCR); RNA Integrity Number, (RIN); Tris–Buffered Saline, (TBS) Received: 30 May 2007; Revised: 30 July 2007 Accepted: 22 August 2007; electronically published: September 2007

Summary The olfactory neuroepithelium (ONe) is, a specialized tissue that lines a region of the nasal cavity high in the nasal vault, characterized by its life-long regenerative capacity. The purpose of the study was to further characterize and to compare gene expression profiling in neurosphere-forming cells (NSFCs) derived from primary cultures of ONe using a genome-wide array approach. Total RNA was isolated from p14, p78, and p189 in vitro passages and hybridized to the human genome-wide CodeLink Bioarrays. Differentially expressed genes were identified in 9 arrays using statistical filters and bioinformatics analysis. Of 55,775 transcripts, 11,345 (in all passages) were detected and 7,115 were commonly expressed in 9 arrays. From the 7,115 transcripts, 2,690 transcripts were expressed in stem cells. Of these 2,690 transcripts, 1,117 genes containing RefSeq accession numbers were identified and further classified based on their functional similarities using Gene Ontology (GO) tools. The changes in expression levels revealed by microarray experiments were validated using real-time RT-PCR analysis. Biological pathways were constructed to better understand the biological significance of the differentially expressed genes.

Each passage of NSFCs was characterized immunocytochemically and compared using antibodies to peripherin, !tubulin III, and nestin. The array results indicate the presence of both neuronal and epithelial phenotypes within the population of NSFCs. The pattern of gene expression of the NSFCs was unique compared to other lines perhaps reflecting species related differences and or adult versus embryonic derived stem cells.

neuroepithelium (ONe), located in the mucosa lining of the nasal cavity is readily accessible (Winstead et al, 2005) and contains a population of progenitors which is responsible for the lifelong regeneration of its neuronal and supporting cells (Calof et al, 1998).

Several CNS disorders have been correlated with deficiencies in the olfactory system; therefore ONe provides a potential source of genetic material for analyses of these diseases. Previously, techniques were established

I. Introduction The potential uses of stem cells and their related progenitors are many, including cell transplantation for the repair or replacement of injured or diseased tissues, as well as tools for diagnostic assessment of diseases and pharmacological testing. Progenitor cells are located within many areas of the adult central nervous system (CNS), but their locations require highly invasive surgery for their harvest (Rao, 1999). In contrast, olfactory 203

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors for harvest and culture of ONe which allow the isolation of a mitotically active population of nestin-positive neurosphere forming cells (NSFCs) from tissues obtained postmortem (Roisen et al, 2001) or by endoscopic biopsy of patients undergoing nasal sinus surgery (Winstead et al, 2005). NSFCs appear after 6-8 weeks in vitro and can be maintained as sub-cultures (Calof et al, 1998; Zhang et al, 2004, 2005). Over 70 patient-specific NSFC-lines have been established which can be driven to neuronal or glial lineage restriction (Zhang et al, 2005; Zhang et al, 2004).

The NSFCs can be sub-cultured and maintained in vitro indefinitely, thereby providing a prospective source of adult neural progenitors. These cells have been characterized as neural progenitors because they not only contained nestin but were immunologically positive for a variety of neural specific antigens including beta tubulin III, neural cell adhesion molecule (NCAM), and the neural crest marker peripherin (Zhang et al, 2004). Their prospective neural progenitor status makes them potentially important as therapeutic and diagnostic tools for diseases of the nervous system.

Previously, we have suggested that the regenerative capacity of ONe could make it a suitable source of cells for replacement transplantation studies for treatment of neurodegenerative diseases and spinal cord injuries (Roisen et al, 2001; Othman et al, 2003; Windstead et al, 2005; Xiao et al, 2005). The structural and functional recovery of a rat spinal cord injury model following engraftment of heterogeneous NSFCs were reported by Xiao and colleagues in 2005, 2007, while Lu and colleagues used in 2002 the source of ensheathing cells for transplantation into the completely transected spinal cord of the adult rat.

Marshall and colleagues in 2005 have demonstrated that isolated NSFCs from ONe show no differences in mitotic potential (telomerase activity) and apoptotic activity (ss-DNA levels). The isolated NSFCs were from donors with an age range of 33-96 yrs, from both male and female patients, exhibited a remarkable resiliency across all variables. These studies provide an initial index of the cellular characteristics of the neural progenitors isolated from ONe; the present study applied a gene-based approach to further the formal characterization of this unique progenitor population derived from human olfactory epithelium (Calof et al, 1998; Roisen et al, 2001; Zhang et al, 2004, 2005; Marshall et al, 2005; Xiao et al, 2005).

Gene-microarrays provide a relatively recent technological development that can be used for examining multiple transcripts in a single experiment (Belbin et al, 2004). This technology has been used extensively for gene expression profiling (Lockhart et al, 1996; Schena et al, 1995), and gene discovery functions (Schena et al, 1995; Lockhart et al, 1996; Chu et al, 1998; Hughes et al, 2000).

Microarrays have already been used to identify differentially expressed genes in neural stem cells and progenitor cells of the rat (Luo et al, 2002) and also in cultured mouse embryonic neural stem cells (Karsten et al, 2003). McCurdy and colleagues explored in 2005 gene expression differences which underlied cell cycle differences in neuropsychiatric disorders. Microarray

analysis of the mouse nasal mucosa has also been described (Getchell et al, 2003). These previous studies were used for comparative purposes.

In this study, CodeLink Human Whole Genome Bioarrays (55K) (GE Healthcare, formerly Amersham Biosciences, Piscataway, NJ) were utilized, and each probe consists of 30-mer base pair sequences. The arrays are manufactured using a non-contact spotting method (Ramakrishnan et al, 2002). A prior study has shown that 30-mer probes, as used here, may be more sensitive than 25-mer probes used in some other platforms (Relogio et al, 2002).

There are many sources of systematic variation in microarray experiments that can affect the quality of the results. Therefore, normalization is essential for minimizing variations between microarrays (Churchill, 2004; Martinez et al, 2003; Yang et al, 2001). A variety of normalization methods have been proposed (Quackenbush, 2002). Herzel and colleagues suggested in 2001 subtracting the background intensity from the signal intensity, and Chen and colleagues derived in 1997 iterative procedures for estimating normalization constants. The Analysis Of Variance (ANOVA) model has been proposed as a powerful approach for microarray experiments because of the necessity of considering multiple factors and several sources of variation (Churchill, 2004). Yang and colleagues proposed in 2002 the use of permutation-testing and p-value adjustment to address the multiple-testing problem. Dudoit and colleagues developed in 2002 the use of transformed log intensities (MA-plot), the scatter plot of the log ratio versus the average log intensity (MA plot), which is very helpful in terms of identifying spot artifacts and detecting intensity-dependent patterns in the log ratio. In this study, we used within array normalization to compare different samples and to develop methods for the identification of genes that are differentially expressed. Visualization with the aid of MA plots was used to identify spot artifacts, and to detect intensity dependent patterns in the log-ratios.

Studies of gene expression patterns in cell cultures, aged by sub-culture in vitro, may contribute towards understanding the mechanism of age-related disease.

Previous studies have shown temporal regulation of ONe progenitors over relatively short periods of time in neurogenesis (Getchell et al, 2005; Shetty et al, 2005). Our study presents gene expression profiling of ONe progenitors over a period of passages representing two years time. The NSFCs isolated from ONe provide a unique source of adult human neural progenitors. Our studies indicated that there were no remarkable differences in mitotic activity (proliferation) in populations of NSFCs isolated from donors with an age range of 33-96 yrs between donors of either sex or as a function of time in cultures (Marshall et al, 2005).

The goal of this study was further characterize the human adult ONe-derived NSFCs using the recently developed human genome-array (CodeLink Bioarrays).

Three different passages (p14, p78, and p189) of a cell line that had been derived from a post-mortem 95 yr old female were used to determine if they would provide identical or variable gene-expression profiles. In this study

204

Gene Therapy and Molecular Biology Vol 11, page 205 we hypothesized that there would be change in the gene expression levels over the period of time for those three cell passages despite that fact that the telomeric activity, apoptotic activity (ss-DNA levels) and some of the apoptotic related genes would remain constant. Our long term goal is to build a gene-array database of human ONe progenitors, which can be used to describe the nature of these expressed genes, which could be very useful to developing different gene therapy approaches.

software and subtracted from all feature intensities before further calculations were performed. Expression values were globally normalized to the median expression value of the entire probes on the array. CodeLink arrays were processed in collaboration with GE Healthcare (Piscataway, NJ).

For each probe the local background was comprised of a circular area of pixels surrounding the segmented signal. The mean intensity was taken for each spot and background corrected by subtracting the surrounding median local background intensity. A spot was considered good (G) if the mean of the spot's signal was higher than the mean of corresponding local background plus three standard deviations. The data filtering process was performed on each spot using CodeLink Expression Data Analysis Software v 4.0.

Normalization was performed initially on the raw digitized data. The process was adapted from previously published analytical methods (Ramakrishnan et al, 2002) and included subtraction of the local background signal from the raw intensity signal for each spot. The negative control threshold was used to define the lower limits of detection, and the values of threshold cut-off were important for variability determination and data filtration. The resulting value for each spot was then divided by the median signal intensity which is derived from the intensity values for all discovery spots. This ratio value for each gene delivers a measure of gene expression for one gene versus another in any given array.

II. Materials and methods A. Cell culture The initial primary tissue was obtained from an 8 hr postmortem 95 yr old female as previously reported (Zhang et al, 2004), and stored as frozen stock from neurosphere subcultures. The frozen stock (1x106 cells/vial) was thawed rapidly and cultured in flasks (25 cm2, Corning, NY) in medium, consisting of: MEM, 10% FBS and 1% gentamycin (GIBCO, Grand Island, NY) in a humidified atmosphere of 5% CO2, at 37°C. Cells were grown in culture for nearly 200 passages (representing almost 2 yr in culture). Three different passages (p) (p14, p78, and p189) representing young, intermediate, and old passages were used.

B. RNA isolation and labeling Total RNA from cell culture samples was extracted using TRIzol reagent (Life Technologies, Gaithersburg, MD), and RNeasy Mini Kit columns (Qiagen, Valencia, CA) followed by DNase treatment (Ambion, Austin, TX) according to standard protocols (Qiagen, Valencia, CA). The quantity and quality of total RNA were assessed using Agilent 2100 Bioanalyzer, and Agilent’s RNA Integrity Number (RIN) software (Agilent Technologies, Palo Alto, CA). The 28S/18S ratios of the isolated RNA were in the range of 1.8 – 2.0, and the RIN numbers were in the range of 9-10.

The total RNA was processed for labeling as described in the CodeLink Expression Bioarray technical manual (GE Healthcare, Piscataway, NJ). Briefly, two µg of total RNA from p14, p78, and p189 samples were used to generate first-strand cDNA using Superscript II reverse transcriptase, and a T7 primer. Subsequently, second-strand cDNA was produced using Eschericia coli DNA polymerase I and RNase H. The resultant double-stranded cDNA was purified on a QIAquick column (Qiagen), and cRNA was generated using T7 RNA polymerase in the presence of biotin-11-UTP (Perkin Elmer, Boston, MA). The cRNA was purified on an RNeasy column (Qiagen), quantified by spectrometry, and ten µg of fragmented cRNA were hybridized overnight at 37°C for 18 hours in 250 µl volume.

Cy5-streptavadin (GE Healthcare, Piscataway, NJ) was used for detection of the fluorescence signal. Three Total RNA samples from each passage (p14, p78, p189) were hybridized onto three independent microarray slides.

D. Data and statistical analysis To measure the reproducibility among triplicate technical arrays for each cell passage sample, the ANOVA F-test was applied on the hypothesis of equal mean ‘median-normalized’ intensity. The one-way ANOVA deals with one independent variable (different arrays) and one dependent variable (signal intensities). To further evaluate array reproducibility, scatter plots, box plots, and correlation coefficients were used.

Expression values for each gene were obtained based on the average across the triplicate spots from the three independent arrays. Differentially expressed genes among young, intermediate, and old passage were identified using the Student’s t-test to estimate significant differences (p-values cutoff= 0.001).

Volcano plots were used to determine highly significant genes based on fold change and p-value. Overall, analyses on the data obtained from these experiments indicated a high reproducibility among technical replicates.

E. Functional classification Our data were compared to human mesenchymal stem cells (HMSC). This HMSC was deposited in Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo) and are accessible through GEO series accession number GSE2776.

Gene Ontology (GO) was used to find associations between groups of genes based on the ‘‘cellular component, biological process and molecular function”. GeneSpring, GX 7.3, software (Agilent Technology, Foster City, CA), and Database for Annotation, Visualization, and Integrated Discovery (DAVID) tools, http://david.niaid.nih.gov/david/ were also used for these data analysis.

C. CodeLink array and processing CodeLink Whole Human Genome Bioarray contains 55,775 transcripts utilizing one probe per transcript 30-bp. The oligonucleotide-based microarrays were designed to conserved exons across the target genes and each sequence was carefully screened to ensure high-quality. The array contains about 45,674, (UniGene) as well as 360 positive controls, 384 negative controls, and 100 housekeeping genes.

The arrays were scanned at 635 nm with 5 µm resolutions using an Axon GenePix 4000A microarray scanner (Axon Instruments, Union City, CA). The images were analyzed using CodeLink Expression Data Analysis Software v 4.0. Background fluorescence values were automatically calculated by the

F. Real-time PCR Real time-PCR, (RT-PCR) was performed on an ABI 7300 instrument (Applied Biosystems, Foster City, CA) to confirm expression levels of a subset of the common differentially expressed genes. Two micrograms of total RNA were used to generate cDNA templates for RT-PCR. cDNA synthesis was performed using a High-Capacity cDNA Archive kit (Applied Biosystems, Foster City, CA). The first strand cDNA products were further diluted 20- to 50-fold and used as PCR templates.

205

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors The TaqMan® Master Mix Reagent Kit (Applied Biosystems, Foster City, CA) was used to amplify and quantify each transcript of interest in 25 µl reactions. To ensure specific amplification, various negative controls (i.e., water only, reaction without primers, and templates derived without reverse transcriptase) were included in the PCR reaction. The PCR product of selected differentially expressed genes was quantified in real-time, using a dye-labeled fluorogenic reporter oligonucleotide probe. The probe was labeled at its 5´ end with the reporter dye, 6-carboxy-fluoresceine (FAM). All sample reactions were carried out in triplicate samples. The PCR amplification was performed in 96-well plates as follows: the initial step of 2 minutes at 50oC; denaturation at 95oC for 10 min, followed by 40 thermal cycles of denaturation (15 seconds at 95oC) and elongation (1 min at 60oC). The threshold cycle (C T) values were averaged from the values obtained from each reaction, and the gene expressions were normalized to 18S rRNA levels. The C T values were analyzed by ANOVA using Sigma Plot software (Systat Software Inc., San Jose, CA). The fold change was calculated by the 2 -"CT, where -"CT = (C T-old – C Tyoung ). The C T-old means the signal of an individual gene expressed in p78 or p189 passages, while CT-young means the signal of the same gene expressed in p14. The sequences of primers designed were selected to be within the same region of the gene used to develop the microarray sequence probes.

III. Results The CodeLink Human Whole Genome Bioarrays (GE Healthcare, Piscataway, NJ), which represents 55,775 transcripts were used for gene expression profiling of the ONe-derived progenitors. Of these 55,775 transcripts 7,115 were found to be common in all three passages. The cells were grown for varying times in culture and chosen for evaluation based on passage number, p14, p78, and p189 representing the three biological samples. The plating densities were kept constant at all times. The microarrays were hybridized with the biotin-labeled cRNA samples and the hybridization signals were captured and digitized with the aid of a laser scanner (GenePix, Axon Instruments, Union City, CA).

A. Replicates To visualize the reproducibility of the microarray data, several methods were applied. First, a pair-wise comparison was performed using scatter plots of the log10 normalized signal intensities for the p14, p78, and p189 samples (Figure 1). The data showed a representative of scatter plots for replicate 1 vs. replicates 2 for the p14 sample (Figure 1A), the p78 (Figure 1B), and the p189 (Figure 1C). The line at 45 degrees is a straight line denoting a correlation coefficient equal to 1. In these scatter plots, genes with similar expression levels will appear somewhere along the first diagonal (the line y = x) of the coordinate system. A gene that has an expression value that is very different between the two replicates will appear far from the diagonal. Many of the data points were distant from this line. In particular, the data demonstrated increased variability between replicates for the lower end of the spectrum of signal intensities. Thus, those genes with a log10 intensity <0.5 are representing genes with low expression.

To better identify spot artifacts and detect intensitydependent patterns, MA plots were used. The MA (M = log intensity ratios, and A = average log intensities) plot has generally been considered a powerful tool for visualizing and quantifying both linear and non-linear differential responses of replicates (Quackenbush, 2002; Yang et al., 2002). If two replicates behave similarly, then the data should appear symmetrically about a horizontal line through zero, and deviations from this horizontal line represent different responses of the two replicates. The M vs. A plot was used in this study to plot the log ratio of the two replicates vs. their average log intensity (Figure 2) for the genes detected in the p14 cells (Figure 2A), p78 cells (Figure 2B), and p189 cells (Figure 2C). Note that for lower average log-intensities, the log ratios were more variable, and this may be expected, and may not necessarily constitute bad replicates.

G. Signal pathway analysis The differentially expressed genes obtained from microarray data and validated by RT-PCR analysis were imported into PathwayStudio software (Ariadne Genomics Inc., Rockville, MD) to identify and classify specific cellular pathways. The PathwayStudio software is a tool for biological pathway analysis based on GO designed to describe key aspects of the molecular function, biological process and cellular component of gene products. The validated differentially expressed genes were used to identify all known relationships between the differentially expressed genes. Only biological pathway networks of differentially expressed genes (RefSeq accession numbers) were modeled onto the software.

H. Immunocytochemistry Cells were plated as previously described (Marshall et al, 2005; Roisen et al, 2001) on 22 mm round glass coverslips in 6well plates (Falcon) for 48 hrs (4 x 104 cells/well). For immunohistochemistry, cultures were incubated with 4´,6diamidino-2-phenylindole dihydrochloride (DAPI) (1:1000, 2 mg/ml, Molecular Probes, Eugene, OR) for 30 min at 37°C for labeling of DNA. The coverslips were rinsed with cytoskeletal buffer (CB: 2-N-morpholino ethane sulfonic acid [MES] 1.95 mg/ml; NaCl, 8.76 mg/ml; 5 mM EGTA; 5 mM MgCl2; glucose 0.9 mg/ml, pH 6.1) twice and fixed in 3% para-formaldehyde in CB for 10 min. Cells were treated with 0.2% Triton X-100 (Sigma) for 10 min and incubated in a blocking solution containing 3% bovine serum album (BSA) in Tris–Buffered Saline (TBS) for 1 hr. Primary antibodies against nestin (monoclonal, Chemicon International, Temecula, CA), peripherin, (polyconal, Chemicon), and !-tubulin III, monoclonal (Sigma, St. Louis, MO), were applied and incubated at 4°C overnight. After washing in TBS three times, cells were incubated for 1 hr at room temperature with the following secondary antibodies: Texas-red-conjugated goat anti-rabbit IgG, Cy2-conjugated goat anti-mouse IgG (all diluted 1:100; Cy2, Jackson Immunology Research Laboratories; Texas-red, Molecular Probes). Omission of primary antibody was used as a control for each experiment. All such controls proved to be negative.

B. Differential expression To identify differentially expressed genes between passages, normalized data were filtered, to remove several categories of data including those with absent signals or low noise ratios, contaminated spots, irregular spots and saturated spots using CodeLink Expression Software.

206

Gene Therapy and Molecular Biology Vol 11, page 207 Analysis of 55,775 transcripts on the array showed that 8,655 (15.6%) transcripts in p14 cells, 8,691 (15.3%) in p78 cells, and 10,562 (18.9%) transcripts in p189 cells were detected. Following data filtration, out of the total 55,775 transcripts, 11,345 transcripts had signal detectable with 7,115 transcripts shown in all arrays. The subsequent analysis was focused on the 7,115 transcripts that were detected in all three samples.

For the 7,115 common transcripts, the studentâ&#x20AC;&#x2122;s t-test was used to determine the genes which were differentially expressed between the different cell passages. A p-value of 0.001 (cut-off) was selected to identify differentially expressed genes between p78 and p14 cells, and between p189 and p14 cells. The 7,115 transcripts were evaluated based on the fold changes in expression and p-values, with

the aid of volcano plots. The volcano plot is a scatter plot of the relative expression values against the p-value for each gene. Figure 3 shows the log2 fold-change of 7115 transcripts versus their â&#x20AC;&#x201C;log10 p-values for p78 versus p14 (Figure 3A), and p189 versus p14 (Figure 3B). Spots in the extreme upper left and right corners of the volcano plots show the largest, and statistically most significant, changes in expression. For example, in the p78 versus p14 samples, the log2 at a scale of 1 shows a 2-fold change on the x axis, and â&#x20AC;&#x201C;log10 at scale of 3 on the y axis is equal to a p-value of 0.001. Therefore, based on the fold change and p-value a line can be drawn to identify changes in gene expression values. The same case approach was applied for sample p189 versus sample p14.

Figure 1. Pair-wise comparison for array-to-array comparisons before data filtering. Scatter plots were performed using log median normalized signal intensities. cRNA, were synthesized from olfactory-derived progenitor sub-cultures (p14, p78, and p189). Panel A, is for sample p14, Panel B, is for p78, and, Panel C, is for p189. Increased variability between replicates is evident at lower expression levels. Panel D is a box plot comparing array reproducibility. The log10 of normalized data were plotted against 3 replicate arrays for each of the three samples (p14, p78, and p189). Spot intensity is considered an outlier if it has a value of 1.5 times the inter-quartile range from the top or bottom of the box. The distribution of log normalized signal intensities for all arrays is shown on one plot making for easy comparison.

207

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors

Figure 2. MA plots of normalized filtered signal intensities of the 7,115 transcripts between three passages. The MA plots are related to the scatter plots of the log intensities of the replicates.

M represents the log10 ratio of the normalized filtered signal intensities, and A represents the average of the log10 of the normalized signal intensities using p14, p78, and p189 samples.

Panel A is a representative of MA plots for technical replicates of the p14 sample, Panel B, shows the MA plot for replicates of the p78 sample, and Panel C, shows the MA plot of replicates of the p189 sample.

C. Characterization expression

of

global

Figure 3. Volcano plot of normalized filtered 7,115 transcripts.

The Volcano plots showed expression differences for the p78 versus p14 (Panel A), and the p189 versus p14 (Panel B) samples, averaged across the technical replicates arrays (x-axis).

The gene-specific F-test (y-axis) denoting significance for each gene is represented as an individual spot (â&#x20AC;˘). The Volcano plots allowed the visualization of fold-change and statistically significant p-values at the same time. Thus genes with either a large or small fold change but which have statistical significance can be seen.

molecular function (Figure 4A), biological process (Figure 4B), and cellular components (Figure 4C). The annotated genes were clustered in these categories and were used to determine the biological function of the only genes containing RefSeq accession numbers.

gene

To gain insight into the biological meaning of the common sets (7115 transcript), further data analysis were carried out (data available upon request). Of the 7115 genes, there were 2694 transcripts expressed in stem cells (data available upon request). Of these 2694 transcripts, 1117 genes containing RefSeq accession numbers were identified. Gene Ontology of these 1117 genes was further classified based on their function similarities (Figure 4).

Meaningful biological categories were selected from the GO hierarchy by browsing these three categories

D. Database correlation Further data analysis of the common genes detected in all three passages (7115 transcripts) were further analyzed and compared to the GEO (GEO repository, http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gds) to human mesenchymal stem cells (Codelink) database.

208

Gene Therapy and Molecular Biology Vol 11, page 209 About 640 RefSeq genes were highly correlated between our data and to the human mesenchymal stem cells. The following genes were identified in our microarray data and data published by others (Histone deacetylase 9 (NM_014707); microtubule associated serine/threonine kinase 2 (NM_015112); microtubule-associated protein, RP/EB family, member 3 (NM_012326); slit homolog 2 (Drosophila) (NM_004787); transmembrane protein with EGF-like and two follistatin-like domains 2 (NM_016192); ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) (NM_001420); pumilio homolog 1 (Drosophila), (NM_014676); epidermal growth factor (beta-urogastrone) (NM_001963); (9) pumilio homolog 1 (Drosophila) (NM_014676); opioid receptor, mu 1 (NM_000914); bystin-like (NM_004053); LIM domain only 1 (rhombotin 1) (NM_002315); insulinomaassociated 1 (NM_002196); paired box gene 5 (B-cell lineage specific activator) (NM_016734); chloride channel 3 (NM_001829); SH3-domain GRB2-like 1NM_003025); calneuron 1 (NM_031468); and ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) (NM_032281).

E. Validation The changes in expression levels revealed by microarray experiments were validated for a set of selected genes with the aid of QRT-PCR analysis (Table 1). The selected genes were obtained from the common genes to the 3 cell passages and contained genes whose expression values were either up-regulated or down-regulated as determined from the microarrays. The relative expression values obtained from QRT-PCR were normalized to 18S rRNA (control), and the ratio of normalized RT-PCR gene expression values were obtained from intermediate, and old passages compared to the young passage. All negative controls used were reported to be un-amplified, or to have a very weak signal, close to the baseline or background.

The microarray and the QRT-PCR results were consistent in terms of gene expression values, although, the fold changes varied between the two techniques. For example, the expression level of aggrecan1 showed the highest fold changes in microarrays (15.83) and QRT-PCR (3.94). The QRT-PCR results show a coefficient of determination (R2 = 0.89) with the microarray expression values.

Figure 4. Gene Ontology for the RefSeq genes within the common transcripts. A Gene Ontology (GO) was attributed to each RefSeq gene (1117) for the three GO ontologies: molecular function (A), biological process (B), and cellular components (C). Annotated genes were then clustered in meaningful biological categories.

F. Biological pathway To better understand the biological significance of the differentially expressed genes obtained by microarray data and validated by RT-PCR technique, these genes were used to build biological pathways utilizing the PathwayStudio software (Figure 5). We found 53 candidate genes associated with the 10 genes (top 5 upregulated highlighted in violet and top 5 down-regulated in blue) identified by microarray analysis using PathwayStudio. The total of 63 genes (red) led to the further identification of seven major cellular processes which included metabolism, proliferation, secretion, motility, assembly, maturation, and differentiation (yellow).

G. Immunocytochemistry To view the cellular characteristics in each passage, cells were immunolabeled for nestin, a neural progenitor intermediate filament, and peripherin, an intermediate filament found in cells derived from the neural crest (Figure 6). The presence of nestin and peripherin was consistent with a progenitor nature. Nestin and peripherin immunolocalization were similar for all passages. In addition, !-tubulin III, a neuron specific tubulin, was used to probe the neuronal lineage of the progenitors in all passages (Figure 6). Positive networks of !-tubulin III were observed within individual cells and their processes

209

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors in all passages. Despite nearly 200 passages, equivalent to nearly 2 years in culture, the NSFCs contained similar morphological and immunocytochemical characteristics.

stem cells. The gene profiling was performed on 3 biological samples representing 3 different passages that were collected over a period of 20 months in vitro. The cells were initially cultured in small flasks and repeatedly purified and followed by an RNA quality check. This process was done to make certain the RNA was of the best possible quality to ensure the best accuracy of the results.

Detection of even the smallest amounts of contamination can prevent erroneous results and can avoid wasting money on failed microarray slides. Therefore, due to the high cost of the microarray experiments and limited amount of RNA samples, often time pooling samples might be beneficial especially when using a new platform such as Codelink Bioarrays. From the 55K Code Link gene array, a total of 11,345 transcripts were detected in the 3 biological samples. Of these, 4,230 transcripts were uniquely associated with one or the other of these passages (p14, p78, p189). While the 11,345 transcripts may represent a broad definition of phenotype for these cells, the focus of this initial analysis is the 7,115 transcripts that were found to be common to the 3 biological samples because these were present in all 9 arrays, and the analyses for this common set of genes have greater statistical significance.

IV. Discussion This study is the first genome-wide analysis of geneexpression profiling of human ONe derived NSFCs which serves as an initial index of the cellular characteristics of the neural progenitors isolated from ONe. The present study applied a gene-based microarray approach to further characterize this unique progenitor population derived from human olfactory epithelium (Roisen et al, 2001; Marshall et al, 2005; Xiao et al, 2005; Zhang et al, 2005).

The findings from this study are summarized as follows: (1) Genes representing both the neuronal and epithelial phenotypes were identified, (2) no aging or senescent genes were detected in NSFCs in the common datasets, and (3) of the 7,115 transcripts, there were 2,694 transcripts identified to be expressed in stem cells. Of those genes expressed in stem cells there were 1,117 genes containing RefSeq accession numbers. Furthermore, the list of common transcripts and the identified stem cell genes are available upon request. In addition, we compared our data (7115 transcripts) to the available database for neurogenic potential of human mesenchymal

Table 1. Validation of expression changes observed in microarray experiments with Real Time-PCR. The values presented in both microarray and RT-PCR was presented as fold changes between p78 versus p14, and p189 versus p14passages.

210

Gene Therapy and Molecular Biology Vol 11, page 211

Figure 5: Biological pathway for the validated differentially expressed genes obtained by microarray and RT-PCR analyses in passage numbers (p14, p78, and p189). This pathway was constructed by searching for the shortest path to connect the genes of interest by other cell processes with which they interacted though expression or regulation only.

Figure 6. Human Olfactory Epithelial Derived Neurosphere Forming Cells. Cells representing young, p14, (Panel A), intermediate, p78, (Panel B) and old, p189 (Panel C) passages were immunopositive for nestin (an intermediate filament found in neural progenitors, green) and peripherin (a neural crest intermediate filament, red) consistent with their progenitor nature. Similar intracellular fibrillar distribution of nestin and peripherin was observed in all passages. The neuronal lineage restriction of NSFCs was probed using !-tubulin III (nerve specific tubulin, green) and peripherin (red) in the p14 (Panel D), p78 (Panel E) and p189 (Panel F) passages. !-tubulin III positive networks were frequently observed throughout individual cells and their processes in all passages. Nuclear DNA was stained with DAPI (blue) Confocal microscopy.

211

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors One of the biologically significant results from this study is the finding of genes representing both the neuronal and epithelial phenotypes. These were also found within the 7,115 common transcripts. For example, the presence of: neurotrophin receptors, nestin, S100, vimentin, #-internexin, glutamate receptors, dopamine

receptors, olfactory receptors, adenylate cyclase, and calcium/calmodulin-dependent protein kinase II # are all indicators of a neural phenotype. In contrast, the presence of several members of the keratin gene family is indicative of the epithelial heritage of the NSFCs (Table 2). As the

Table 2. List of genes present in the cultured progenitor cells as indicators of neuronal and epithelial cell phenotypes.

Number 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34

1 2 3 4 5 6 7 8 9 10 11 12

Neuronal Phenotype neurotrophic tyrosine kinase, receptor, type 1 (NTRK1) receptor tyrosine kinase TrkC (NTRK3) brain-derived neurotrophic factor (BDNF), transcript variant 4 GDNF family receptor # 4 (GFRA4), transcript variant 1 GDNF family receptor # 2 (GFRA2) GDNF family receptor # 3 (GFRA3) nestin (NES) NSE1 (NSE1) S100 calcium binding protein A11 pseudogene (S100A11P vimentin (VIM) internexin neuronal intermediate filament protein, # (INA) glutamate receptor, ionotropic, N-methyl D-aspartate 1, transcript variant NR1-1(GRIN1) glutamate receptor, ionotropic, kainate 5 (GRIK5) glutamate receptor, ionotropic, kainate 2 (GRIK2), transcript variant 1 dopamine receptor D2 (DRD2), transcript variant 1 growth arrest and DNA-damage-inducible, # (GADD45A olfactory receptor, family 1, subfamily D, member 2 (OR1D2) olfactory receptor, family 1, subfamily G, member 1 (OR1G1) olfactory receptor, family 5, subfamily I, member 1 (OR5I1) olfactory receptor, family 10, subfamily H, member 3 (OR10H3) olfactory receptor, family 10, subfamily H, member 2 (OR10H2) olfactory receptor, family 1, subfamily D, member 5 (OR1D5) olfactory receptor, family 7, subfamily C, member 1 (OR7C1) olfactory receptor, family 5, subfamily V, member 1 (OR5V1) olfactory receptor-like (PJCG7) pseudogene clone OR9I1 olfactory receptor gene, partial cds clone OR2Z2 olfactory receptor gene, partial cds adenylate cyclase 2 (brain) (ADCY2) adenylate cyclase activating polypeptide 1 (pituitary) receptor type I (ADCYAP1R1 adenylate cyclase activating polypeptide 1 (pituitary) receptor type I (ADCYAP1R1) calcium/calmodulin-dependent protein kinase (CaM kinase) II $ (CAMK2D), transcript variant 3 calcium/calmodulin-dependent protein kinase (CaM kinase) II % (CAMK2G), transcript variant 4 calcium/calmodulin-dependent protein kinase I (CAMK1) calcium/calmodulin-dependent protein kinase (CaM kinase) II # (CAMK2A), transcript variant 1 Epithelial Phenotype keratin, hair, acidic, 3B (KRTHA3B) keratin, hair, acidic, 6 (KRTHA6) keratin, hair, acidic, 3A (KRTHA3A cytokeratin type II (K6HF high-sulphur keratin keratin 16 (focal non-epidermolytic palmoplantar keratoderma) (KRT16 keratin, hair, acidic, 8 (KRTHA8) cytokeratin 2 (HUMCYT2A) keratin associated protein 9-2 (KRTAP9-2) keratin associated protein 9-3 (KRTAP9-3) keratin 6 irs (KRT6IRS) keratin 5b (K5B)

212

Gene Therapy and Molecular Biology Vol 11, page 213 shown in 2005 that cells from the human olfactory mucosa generate neurospheres that are multipotent in vitro.

Ongoing studies are aimed at determining factors that influence ONe lineage-restriction.

Further analyses of the genes that are common to the 3 biological samples (p14, p78, and p189) are reported here (Table 3). To explore this issue further a list of genetic markers for senescence was derived from Brandenberger and colleagues in 2004 to identify the presence of such markers in the NSFCs. Fourteen markers were found to be below the threshold of detection: TERF2IP (NM_018975.1); TNKS (NM_003747.1); TERF2 (NM_005652.2); TNKS1BP1 (NM_033396.1); TINF2 (NM_012461.1); TNKS2 (NM_025235.2); TERT (NM_003219.1); HSPA9B (NM_004134.4); SIRT7 (NM_016538.1); SIRT1 (NM_012238.3); SIRT3 (NM_012239.3); SIRT5 (NM_012241.2). Together, these studies support previous reports that have shown a relatively high level of viability and proliferative capacity in ONe cells maintained in subculture (Marshall et al, 2005). These findings also relate to the unique regenerative capacity of the olfactory epithelium.

NSFCs are sub-cultured from primary tissue, they have by definition heterogeneous cellular origin. Future studies will be needed to determine if the neural and epithelial markers occur in a common cell type or in distinct subpopulations. Suslov and colleagues indicated in 2002 that neural stem cells are able to generate clonal structures â&#x20AC;&#x153;neurospheresâ&#x20AC;? which exhibit intra-clonal cell-lineage diversity and that their long-term passage allows the continuous propagation of a potentially heterogeneous population. This possibility is the most likely explanation for the present findings. Although, immunolocalization studies have on rare occasion revealed individual cells with both !-tubulin III networks and keratin positive filaments (data not shown). The NSFCs have been amplified clonally (Othman et al, 2005a) to demonstrate that a heterogeneous population forms within 10 DIV. In addition, as a result of the present studies, the ONe derived progenitors have been shown to generate more than one cellular phenotype, irrespective of passage number (Othman et al, 2005a, b). Progenitors from the olfactory bulb of rats and mice have been shown to generate neurospheres that are clonogenic and multipotent (Lu and Martin, 2003). In addition, Murell and colleagues have

Table 3. Gene annotation of the top 10 most highly expressed genes in the common set for passage numbers p14, p78, and p189.

213

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors Even in culture, the ONe progenitor remains mitotically active and does not exhibit obvious signs of senescence with increased time in vitro. However, accumulation of DNA damage via oxidative stress during ageing has been proposed to be the principal mechanism of adult stem cell exhaustion and altered â&#x20AC;&#x153;normal' gene expression (Nijnik et al, 2007). In another study, it has been reported that senescing human cells and ageing mice accumulate DNA lesions with unrepairable double-strand breaks (Sedelnikova et al 2004). Further studies may be beneficial in determining the correlation of DNA damage due to oxidative stress in geriatric individuals over a long period of passages.

To gain further insights into the network of genes of the common transcripts (7115), there were 2694 transcripts that were found to be expressed in stem cells.

The complete list for those common transcripts and their annotation such as chromosome location, and area of expression is indicated and are available upon request. To further understand the biological meaning of the genes expressed in stem cells, gene annotation of the 1,117 genes containing RefSeq accession numbers were identified.

Those genes were clustered based on gene function similarities, and their known biological pathways.

While metadata analysis is beyond the scope of this study, a preliminary comparison shows that the NFSCs are a unique stem/progenitor cell population and share only a few similarities to other stem cell populations. The data are difficult to compare in detail, because the analyses are critically dependent on the algorithms used and the arbitrary criteria used to set parameters such as thresholds, type of platform, and the length, the sensitivity and the specificity of the probes. However, four of the most highly expressed genes in the ONe-derived cells, RPL19 (NM_000981.2), RPL38 (NM_000999.2), RPL37A (NM_000998.2), and actin % 1 (NM_001614.2), were comparable to those reported for mesenchymal derived stem cells (Jeong et al, 2005). In addition, the neuronal progenitor related genes, vim (NM_003380.1), Syn1 (NM_006950.2), and Cst3 (NM_000099.2), found in the ONe-derived cells were also identified in fetal stem cells (Luo et al, 2003). We further compared our data (the common sets) to the GEO (Gene Expression Omnibus (GEO) repository, http://www.ncbi.nih.gov/enterz/query.fcgi?db=gds) to human mesenchymal stem cells, and 939 genes were found in common. A representative of the function of those genes is as follows: Histone deacetylase 9 is playing an important role in transcriptional regulation, cell cycle progression and developmental events. Microtubule associated serine/threonine kinase 2, appears to link the dystrophin/utrophin network with microtubule filaments via the syntrophins. Microtubule-associated protein, RP/EB family, member 3 may be involved in microtubule polymerization, and spindle function by stabilizing microtubules and anchoring them at centrosomes, and play a role in cell migration. Slit homolog 2 (Drosophila) is implicated in spinal cord midline post-crossing axon repulsion, and during neural development involved in axonal navigation at the ventral midline of the neural tube and projection of axons to different regions.

Transmembrane protein with EGF-like and two follistatinlike domains might be a novel survival factor for hippocampal and mesencephalic neurons. ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C), is involved in neuronal differentiation and maintenance. Pumilio homolog 1 (Drosophila), is required to support proliferation and self-renewal of stem cells.

Opioid receptor, mu 1, inhibits neurotransmitter release by reducing calcium ion currents and increasing potassium ion conductance. LIM domain only 1 (rhombotin 1) (NM_002315), is involved in gene regulation within neural lineage cells potentially by direct DNA binding or by binding to other transcription factors. Paired box gene 5 (B-cell lineage specific activator), plays an important role in B-cell differentiation as well as neural development and spermatogenesis. Chloride channel 3 (NM_001829), plays an important role in neuronal cell function through regulation of membrane excitability by protein kinase C, and it could help neuronal cells to establish short- term memory. SH3-domain GRB2-like 1 may play a regulatory role in synaptic vesicle recycling. Calneuron 1 plays a role in the physiology of neurons and is potentially important in memory and learning. ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3, may be involved in neuronal differentiation and maintenance.

The dynamic profile of gene expression detected in stem cells was used to determine the biological significance based on Gene Ontology. For example in the GO annotation, among the molecular function there were two major categories binding (438 genes), and catalytic activity (274 genes). This binding mainly involves ion channels, GTP or ATP binding, ATP synthesis accounts for the extremely high energy consumption by the nervous system, which is critical to all aspects of neural function.

Catalytic activity are mainly DNA repair, transporter activity; DNA damage response, and meiosis which are all very critical in the progenitorâ&#x20AC;&#x2122;s therapeutical role as a repair system for the body replenishing specialized cells.

In the biological processes, the two major classes are the physiological process (533) and cellular process (337 genes). Physiological processes mainly function in ATP binding; cell cycle; and protein amino acid phosphorylation; Synthesis of high energy phosphate compounds like ATP play a critical role in neuronal energy because it lies at the center of all energy utilization by neurons. While, the cellular process mainly function in inflammatory response; signal transduction; and intracellular protein transport. These cellular processes are keys to developing future cell therapy and maybe prevent abnormal reactions to the diseased state.

In the cellular components, two major classes are identified cell (511 genes), and extracellular (31 genes).

Cell components mainly function in cell growth and/or maintenance, cell cycle, and mitosis major extracellular components were identified as actin cytoskeleton, epidermal differentiation, and keratinocyte differentiation.

In many cases, single genes were associated with multiple GO identifiers. This reflects the biological reality that a particular protein may function in several processes, may contain domains that carry out diverse molecular functions, and may be active in multiple locations in the

214

Gene Therapy and Molecular Biology Vol 11, page 215 cells. This annotation can provide an overview of the biological process, molecular function, cellular localization and pathway information associated with a particular gene product.

Gene markers for both differentiated and undifferentiated cells were identified in the ONe derived progenitors. Markers for undifferentiated cells detected in the NSFCs included galanin (NM_033237), ACVR2B (NM_001106.2), and POU5F1 (NM_002701.1) (Bhattacharya et al, 2004). On the other hand, a known gene marker for early differentiation, LIFR (NM_031048) (Bhattacharya et al, 2004), was detected with elevated expression values with an increasing cell passage number.

Stem cells from fetal and adult central nervous system have been isolated and characterized, providing populations for potential replacement therapy for traumatic injury repair and neurodegenerative diseases.

The regenerative capacity of the olfactory system has attracted scientific interest because olfactory epithelium (OE) has a unique regenerative capacity and is readily accessible from its location in the nasal cavity, allowing for harvest without lasting damage to the donor. Adult OE contains progenitors responsible for the normal life-long continuous replacement of neurons and supporting cells.

Neural stem cells have had therapeutic potential in the treatment of neurodegenerative disease like Parkinsonâ&#x20AC;&#x2122;s disease (Parati et al, 2003). Transplanting olfactory progenitors into the human spinal cord have been reported

by Feron et al. (2005) and MacKay-Sim (2004). Also, it has been suggested that olfactory mucosa autografts in human spinal cord injuries is relatively safe and potentially beneficial, but they insist that long term patient monitoring is necessary to rule out any delayed side effects (Lima et al, 2006). We believe our study will potentially help these clinical trials by knowing what genes are present in these progenitor cells.

Our results have shown no change in the gene expression of telomerase activity over passages. However, there have been studies using embryonic stem cells showing that there have been changes in chromosome 17q and 12 after several passages (Draper et al, 2004), contrastly there are also studies showing no chromosomal abnormalities over several passages (Buzzard et al, 2004; Rosler et al, 2004; Brimble et al, 2004). In our study, we simply concentrated on changes in expression levels of apoptosis related genes and telomerase activity, karyotypic analysis was not our focus. Future studies need to be performed using comparative genomic hybridization (Inzunza et al, 2004) to determine if there are abnormalities in the chromosomes from passage to passage using ONe progenitors in variable culture conditions.

The potential application of these cell lines include transplantation where minimal donor material can be isolated, expanded ex vivo, and lineage restricted to a preferred phenotype prior to/or after re-implantation.

Furthermore, these strategies circumvent the ethical issues that arise with embryonic or fetal tissues. On the other hand, understanding the molecular mechanisms of selfrenewal, pluripotency and differentiation of stem cells is a prerequisite not only for overcoming the limitation in

using stem cells as therapeutic tool but also unlocking fundamental mysteries of mammalian development.

In summary, the whole human genome array from Codelink (GE) was used to identify the progenitor NSFCs derived from human olfactory epithelium. Over 7,000 genes were found to be common to 3 widely spaced passages. We speculate that the genes that were not commonly expressed in all 3 passages are mostly related to differences in cell cycle which was not controlled in the present study. Future studies should employ synchronized cell populations. There were some changes at the expression level for several genes in the common set with the passage number but the biological significance of these changes remains to be determined. In general, the results concurred with previous characterizations of the NSFCs as being a stable progenitor line with little tendency to change with passage number, with the noted exception that there are several genes that were uniquely expressed in each passage. The results also highlight the fact that the NSFCs express genes associated with more than one cellular phenotype which is not surprising given the tissue source. The potential heterogeneous nature of any progenitor population should be considered in future evaluations. The unique regenerative capacity and relative accessibility of the olfactory neuroepithelial derived progenitors makes them unique candidates for future therapeutic and diagnostic strategies.

Acknowledgments This work was supported in part by NIH: NCRR P20 16481 (NC) and NIH: NIH P20RR015576 (FJR). The authors are grateful to Dr. Rudolph S Parrish, Chair, Department of Bioinformatics and Biostatistics, School of Public Health and Information Sciences, University of Louisville, for reviewing this manuscript. We would like also to thank Zhanfang Guo for technical assistance.

References Belbin TJ, Gaspar J, Haigentz M, Perez-Soler R, Keller SM, Prystowsky MB, Childs G, Socci ND (2004) Indirect measurements of differential gene expression with cDNA microarrays. BioTechn 36, 310-314.

Bhattacharya B, Miura T, Brandenberger R, Mejido J, Luo Y, Yang AX, Joshi BH, Ginis I, Thies RS, Amit M, Lyons I, Condie BG, Itskovitz-Eldor J, Rao MS, Puri RK (2004) Gene expression in human embryonic stem cell lines: unique molecular signature. Blood 103, 2956-2964.

Brandenberger R, Khrebtukova I, Thies RS, Miura T, Jingli C, Puri R, Vasicek T, Lebkowski J, Rao M (2004) MPSS profiling of human embryonic stem cells. BMC Dev Biol 4, 10.

Brimble SN, Zeng X, Weiler DA, Luo Y, Liu Y, Lyons IG, Feed WJ, Robins AJ, Rao MS Schultz TC (2004) Karyotic stability, genotyping, differentiation, feeder-free maintenance, and gene expression sampling in three human embryonic stem cell lines derived prior to August 9, 2001.

Stem Cells Dev 13, 585-596.

Buzzard JJ, Gough NM, Crook JM, Colman A (2004) Karyotype of human ES cells during extended culture. Nature Biotechnol 22, 381-382.

Calof AL, Mumm JS, Rim PC, Shou J (1998) The neuronal stem cell of the olfactory epithelium. J Neurobiol 36, 190-205.

215

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors Chen Y, Dougherty E, Bittner M (1997) Ratio-based decisions and the quantitative analysis of cDNA microarray images. J Biomedi Opti 2, 364-374 Chu S, DeRisi J, Eisen M, Mulholland J, Botstein D, Brown PO, Herskowitz I (1998) The transcriptional program of sporulation in budding yeast. Science 282, 699-705.

Churchill GA (2004) Using ANOVA to analyze microarray data.

BioTechn 37, 173-175, 177.

Draper JS, Smith K, Gokhale P, Moore HD, Maltby E, Johnson J, Meisner L, Zwaka TP, Thompson JA, Andrews, PW (2004) Recurrent gain of chromosomes 17q and 12 in cultured human embryonic stem cells. Nature Biotecnol 22, 53-54.

Dudoit S, Yang Y, Callow M, Speed T (2002) Statistical methods for identifying differential expressed genes in replicated cDNA microarray experiments. Stat Sini 12, 111139.

Feron F, Perry C, Cochrane J, Licina P, Nowitzke A, Urquhart S, Geraghty T, Mackay-Sim A (2005) Autologous olfactory ensheathing cell transplantation in human spinal cord injury.

Brain 128, 2951-2960.

Getchell TV, Liu H, Vaishnav RA, Kwong K, Stromberg AJ, Getchell ML (2005) Temporal profiling of gene expression during neurogenesis and remodeling in the olfactory epithelium at short intervals after target ablation. J Neurosci Res 80, 309-329.

Getchell TV, Peng X, Stromberg AJ, Chen KC, Paul Green C, Subhedar NK, Shah DS, Mattson MP, Getchell ML (2003) Age-related trends in gene expression in the chemosensorynasal mucosae of senescence-accelerated mice. Age Res Rev 2, 211-243.

Herzel H, Beule D, Kielbasa S, Korbel J, Sers C, Malik A, Eickhoff H, Lehrach H, Schuchhardt J (2001) Extracting information from cDNA arrays. Chaos 11, 98-107.

Hughes TR, Marton MJ, Jones AR, Roberts CJ, Stoughton R, Armour CD, Bennett HA, Coffey E, Dai H, He YD, Kidd MJ, King AM, Meyer MR, Slade D, Lum PY, Stepaniants SB, Shoemaker DD, Gachotte D, Chakraburtty K, Simon J, Bard M, Friend SH (2000) Functional discovery via a compendium of expression profiles. Cell 102, 109-126.

Jeong JA, Hong SH, Gang EJ, Ahn C, Hwang SH, Yang IH, Han H, Kim H (2005) Differential gene expression profiling of human umbilical cord blood-derived mesenchymal stem cells

by DNA microarray. Stem cells 23, 584-593.

Karsten SL, Kudo LC, Jackson R, Sabatti C, Kornblum HI, Geschwind DH (2003) Global analysis of gene expression in neural progenitors reveals specific cell-cycle, signaling, and metabolic networks. Dev Biol 261, 165-182.

Lima C, Pratas-Vital J, Escada P, Hasse-Ferreira A, Capucho C, Peduzzi JD (2006) Olfactory mucosa autografts in human sopinal cord injury: a pilot clinical study. J Spinal Cord Med 29, 191-203.

Lockhart DJ, Dong H, Byrne MC, Follettie MT, Gallo MV, Chee MS, Mittmann M, Wang C, Kobayashi M, Horton H, Brown EL (1996) Expression monitoring by hybridization to highdensity oligonucleotide arrays. Nat Biotechnol 14, 16751680.

Lu J, Féron F, Mackay-Sim A, Waite PM (2002) Olfactory ensheathing cells promote locomotor recovery after delayed transplantation into transected spinal cord. Brain 125, 14-21 Luo Y, Cai J, Ginis I, Sun Y, Lee S, Yu SX, Hoke A, Rao M (2003) Designing, testing, and validating a focused stem cell microarray for characterization of neural stem cells and progenitor cells. Stem cells 21, 575-587.

Luo Y, Cai J, Liu Y, Xue H, Chrest FJ, Wersto RP, Rao M (2002) Microarray analysis of selected genes in neural stem and progenitor cells. J Neurochem 83, 1481-1497.

Mackay-Sim A (2004) Olfactory ensheathing cells and spinal cord repair. Keio J Med 54, 8-14.

Marshall CT, Guo Z, Lu C, Klueber KM, Khalyfa A, Cooper NG, Roisen FJ (2005) Human adult olfactory neuroepithelial derived progenitors retain telomerase activity and lack apoptotic activity. Br Res 1045, 45-56.

Martinez MJ, Aragon AD, Rodriguez AL, Weber JM, Timlin JA, Sinclair MB, Haaland DM, Werner-Washburne M (2003) Identification and removal of contaminating fluorescence from commercial and in-house printed DNA microarrays.

Nucl Acids Res 31, e18.

McCurdy RD, Féron F, Perry C, Chant DC, McLean D, Matigian N, Hayward NK, McGrath JJ, Mackay-Sim A (2006) Cell cycle alterations in biopsied olfactory neuroepithelium in schizophrenia and bipolar I disorder using cell culture and gene expression analysis. Schiz Res 82, 163-173.

Murrell W, Féron F, Wetzig A, Cameron N, Splatt K, Bellette B, Bianco J, Perry C, Lee G, MacKay-Sim A (2004) Multipotent stem cells from olfactory mucosa. Develop Dyn 233, 496-515.

Nijnik A, Woodbine L, Marchetti C, Dawson S, Lambe T, Liu C, Rogrigues NP, Crockford TL, Cabuy E, Vindigni A, Enver T, Bell JI, Slijepcevic P, Goodnow CC, Jeggo PA, Cornall RJ (2007) DNA repair is limiting for haematopoietic stem cells during ageing. Nat 447, 686-691.

Othman M, Klueber K, Lu C, Winstead W, Roisen F (2005a) Immunomagnetic separation of adult human olfactory neural progenitors. Biotech Histochem 80, 177-188.

Othman M, Lu C, Klueber K, Winstead W, Roisen F (2005b) Clonal analysis of adult human olfactory neurosphere forming cells. Biotech Histochem 80, 189-200.

Parati EA, Bez A, Ponti D, Sala S, Pozzi S, Pagano SF (2003) Neural stem cells. Biological features and therapeutic potential in Parkinson’s disease. J Neurosurg Sci 47, 8-17.

Quackenbush J (2002) Microarray data normalization and transformation. Nat Genet 32 Suppl, 496-501.

Ramakrishnan R, Dorris D, Lublinsky A, Nguyen A, Domanus M, Prokhorova A, Gieser L, Touma E, Lockner R, Tata M, Zhu X, Patterson M, Shippy R, Sendera TJ, Mazumder A (2002) An assessment of Motorola CodeLink microarray performance for gene expression profiling applications.

Nucleic Acid Res 30, e30.

Rao MS (1999) Multipotent and restricted precursors in the central nervous system. Anatomical Rec 257, 137-148.

Relogio A, Schwager C, Richter A, Ansorge W, Valcarcel J (2002) Optimization of oligonucleotide-based DNA microarrays. Nucleic Acids Res 30, e51.

Roisen FJ, Klueber KM, Lu CL, Hatcher LM, Dozier A, Shields CB, Maguire S (2001) Adult human olfactory stem cells.

Brain Res 890, 11-22.

Rosler ES, Fisk GJ, Ares X, Irving J, Miura T, Rao MS, Carpenter MK (2004) Long–term culture of human embryonic stem cells in feeder-free conditions. Dev Dynam 229, 259-274.

Schena M, Shalon D, Davis RW, Brown PO (1995) Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270, 467-470.

Sedelnikova OA, Horikawa I, Zimonjic DB, Popescu NC, Bonner WM, Barrett JC (2004) Senescing human cells and ageing mice accumulate DNA lesions with unrepairable double-stranded breaks. Nat Cell Biol 6, 168-170.

Shetty RS, Bose SC, Nickell MD, McIntyre JC, Hardin DH, Harris AM, McClintock TS (2005) Transcriptional changes during neuronal death and replacement in the olfactory epithelium. Mol Cell Neurosci 30, 90-107.

Suslov ON, Kukekov VG, Ignatova TN, Steindler DA (2002) Neural stem cell heterogeneity demonstrated by molecular

216

Gene Therapy and Molecular Biology Vol 11, page 217 phenotyping of clonal neurospheres. Proc Natl Acad Sci U S A 99, 14506-14511.

Tsuboi Y, Wszolek ZK, Graff-Radford NR, Cookson N, Dickson DW (2003) Tau pathology in the olfactory bulb correlates with Braak stage, Lewy body pathology and apolipoprotein epsilon4. Neuropathol Appl Neurobiol 29, 503-510.

Winstead W, Marshall CT, Lu CL, Klueber KM, Roisen FJ (2005) Endoscopic biopsy of human olfactory epithelium as a source of progenitor cells. Am J Rhinol 19, 83-90.

Xiao M, Klueber KM, Lu C, Guo Z, Marshall CT, Wang H, Roisen FJ (2005) Human adult olfactory neural progenitors rescue axotomized rodent rubrospinal neurons and promote functional recovery. Exp Neurol 194, 12-30.

Xiao M, Klueber KM, Zhou J, Guo Z, Lu C, Wang H, Roisen FJ (2007) Human adult olfactory neural progenitors promote

axotomized rubrospinal tract axonal reinnervation and locomotor recovery. Neurobiol Dis 26, 363-374.

Yang YH, Buckley MJ, Speed TP (2001) Analysis of cDNA microarray images. Brief Bioinform 2, 341-349.

Yang YH, Dudoit S, Luu P, Lin DM, Peng V, Ngai J, Speed TP (2002) Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation. Nucleic Acids Res 30, e15.

Zhang X, Cai J, Klueber KM, Guo Z, Lu C, Qiu M, Roisen FJ (2005) Induction of oligodendrocytes from adult human olfactory epithelial-derived progenitors by transcription factors. Stem Cells 23, 442-453.

Zhang X, Klueber KM, Guo Z, Lu C, Roisen FJ (2004) Adult human olfactory neural progenitors cultured in defined medium. Exp Neuro 186, 112-123.

217

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors

218

Gene Therapy and Molecular Biology Vol 11, page 219 Gene Ther Mol Biol Vol 11, 219-228, 2007

Monitoring green fluorescent protein for functional delivery of E. coli cytosine deaminase suicide gene and the effect of curcumin in vitro Research Article

P. Gopinath1, Siddhartha Sankar Ghosh1,2,* 1 2

Department of Biotechnology, Indian Institute of Technology Guwahati, Guwahati 781039, India Centre for Nanotechnology, Indian Institute of Technology Guwahati, Guwahati 781039, India

__________________________________________________________________________________ *Correspondence: Siddhartha Sankar Ghosh, Department of Biotechnology, Indian Institute of Technology Guwahati, Guwahati781039, Assam, India; E-mail: sghosh@iitg.ernet.in Key words: GFP, 5-flurocytosine (5-FC), cytosine deaminase (CD), apoptosis, suicide gene therapy Abbreviations: 5'-bromo-2'-deoxyuridine, (BrdU); Acridine orange, (AO); cytosine deaminase, (CD); Dulbecco's Modified Eagle's medium, (DMEM); ethidium bromide, (EB); ethidium bromide, (EtBr); fetal bovine serum, (FBS); green fluorescence protein, (GFP); Luria-Bertani, (LB); measuring mitochondrial activity, (MTS); phosphate buffer saline, (PBS); positron emission tomography, (PET); single-photon emission computed tomography, (SPECT); uracil phosphoribosyl transferase, (UPRT) Received: 23 July 2007; Revised: 29 August 2007 Accepted: 10 September 2007; electronically published: September 2007

Summary Cytosine deaminase (CD) gene has been quite established as a suicide gene for cancer treatment, which converts nontoxic compound 5-flurocytosine (5-FC) to toxic chemotherapeutic agent 5-flurouracil (5-FU). However, besides choosing delivery system, the lack of suitable noninvasive probes to monitor quantitative gene transfer to the malignant tumor is another major concern that limits widespread application of suicide genes. In order to address this problem, we have constructed a dual expressing recombinant plasmid vector which carries CD and green fluorescent protein (GFP) genes. Herein, the GFP expression was used as a tool for monitoring functional CD gene transfer to investigate the mechanism of cell death by 5-FC/CD system in both cancer and non-cancer cells. The efficacy of CD transgene was enhanced when expressed under human ferritin promoter. Molecular analysis by RTPCR established CD gene expression in the transfected cells, whereas mitochondrial activity (MTS) measurements showed the therapeutic effect of 5-FC/CD. Microscopic experiments, measurement of BrdU labeled DNA fragments release, characteristic laddering of chromosomal DNA and involvement of caspase-3 and Bcl-2 corroborated induction of apoptosis. Apoptosis was further synergized in presence of anticancer agent curcumin. Therefore, this noninvasive fluorescent technique was useful for easy monitoring of plasmid based 5-FC/CD system where a combinatorial effect of curcumin was shown to potentiate the therapeutic efficacy of CD gene.

nonviral plasmid vectors has reduced toxic effect in gene therapy (Ghosh et al, 2000; Kren et al, 2003). Even simple electroporation technique was shown to be quite useful for high transgene expression both in vitro and in vivo (Selby et al, 2000; Heller et al, 2002). However, one of the major limitations of such suicide gene therapy is the difficulty in detecting transgene expression following administration with the delivery system, as most of the therapeutic genes have either no ligands or substrates for functional analysis.

One could imagine an ideal detection method would be noninvasive and reproducible to provide detail information of gene expression. Such noninvasive methods would facilitate understanding therapeutic outcomes of the transgene by assessing its magnitude and duration, which

I. Introduction Suicide gene therapy is an alternative approach for cancer treatment, especially when conventional therapy show poor prognosis (Springer et al, 2000). Among many such suicide genes, E. coli cytosine deaminase (CD) is well documented for its strong therapeutic efficacy, where CD enzyme converts prodrug 5-FC to a toxic compound 5FU which kills cells by apoptosis (Kai et al, 1997; Miller et al, 2002). Adenoviral vectors carrying CD alone or in combination to another uracil phosphoribosyl transferase (UPRT) gene have been reported with strong therapeutic potential (Erbs et al, 2000; Liu and Deisseroth, 2006).

Furthermore, emergence of new delivery systems with

219

Gopinath and Ghosh: Monitoring GFP for functional delivery and the effect of curcumin in vitro gene, respectively.

We have used CD1 (5'CCACCATGGTGTCGAATAACGC3', with NcoI linker) and CD2 (5'CGGCTAGCGCCATTAGCTCCGCTG 3', with NheI linker) primers at the following cycle conditions: denaturation at 94ºC for 30s, annealing at 55ºC for 1min and extension at 72ºC for 1min. The 1.2kb amplified CD gene was cloned into the NcoI and NheI restriction sites of the pVITRO2-GFP/LacZ (InvivoGen) replacing LacZ gene. The CD was placed under human ferritin promoter, and the recombinant pCD-GFP clones were selected in LB hygromycin agar plates. Moreover, the same amplified CD gene was also cloned into the pORF-codA::upp plasmid under elongation factor -1! (EF-1! promoter replacing codA::upp fusion gene. The recombinant pCD clones were selected in LB ampicillin agar plates. Here, we have mentioned only the basic pol II promoter units of the above constructs for our convenience.

About 60-70% confluent cells were electroporated with recombinant plasmids (2µg plasmid/ well of 6 well plates) in a BIO-RAD Gene Pulser X cell at the following conditions: a square wave of 25 milliseconds, 140V for BHK-21 cells and an exponential wave of 500 µF, 160V for HT 29 cells.

is an important aspect for vector development. Reporter gene systems have been developed to monitor therapeutic gene transfer noninvasively by imaging modalities, one such example is the optical imaging technique for tracking green fluorescence protein (GFP) (Cao et al, 2007).

Luciferase and HSV1-tk gene, single-photon emission computed tomography (SPECT) and positron emission tomography (PET) with high sensitivity and spatial resolution are already reported to be useful in noninvasive molecular imaging (Laxman et al, 2002; Sharma et al, 2005; Sander et al, 2006).

Considering the above evidence, we have developed a simple noninvasive fluorescence monitoring system for detecting the functional effect of 5-FC/CD via a plasmid based vector in both cancer (HT 29) and non cancer (BHK 21) cells. We have generated a recombinant plasmid expressing dual transcripts: CD and GFP and used electroporation technique to deliver the plasmid to both the cell types. The GFP fluorescence was monitored microscopically to examine the therapeutic effect of 5FC/CD at varying 5-FC concentrations. Our in vitro study reports on the feasibility of CD suicide gene therapy for cell growth inhibition and induction of apoptosis.

Moreover, we used curcumin, which is a known anticancer agent in combination with 5-FC/CD therapy to check whether curcumin has any complimentary additive effect on 5-FC gene therapy, since combination therapy in many cancer treatment is known to be more effective (Kambara et al, 2002; Khor et al, 2006). Our primary observation by tracking GFP fluorescence indicated that curcumin synergized 5-FC/CD mediated apoptosis.

The investigations were further supported by microscopic and biochemical assays like, nuclear staining, electron micrographs, cell proliferation, BrdU labeled DNA fragments release and regulation of caspase signals.

Therefore, the simple monitoring of GFP fluorescence as a direct signature of combination therapy would be useful tool for cancer therapy where two components maximize the anticancer and anti proliferation activities by synergistic effect.

C. PCR and RT-PCR analysis PCR was performed to amplify 1.2kb CD fragment using CD1 and CD2 with linker primers at the following cycle conditions: denaturation at 94ºC for 30s, annealing at 55ºC for 1min and extension at 72ºC for 1min. Total RNA was extracted with Tri reagent (Sigma, USA), and the RT PCR was performed with the same primers according to the manufacturer’s instructions using Enhanced Avian HS RT-PCR kit (Sigma, USA) in Gene Amp PCR system 9700, Applied Biosystems. The PCR primers and cycle conditions used for the semi-quantitative RT PCR of caspase, "-actin and Bcl-2 genes of HT 29 cells were followed according to the reported work of Pillai and colleagues in 2004.

D. Microscopic measurements

and

spectroscopic

1. Confocal microscopy The cytotoxic activity of 5-FC on transfected cells was determined by observing treated and untreated samples under confocal microscope. We have used AO/EB staining solution in PBS with 100!g/ml of acridine orange and ethidium bromide.

Dual staining of nuclei with AO/EB was observed under confocal microscopy (LSM 510 Meta, Carl Zeiss, Germany).

Acridine orange (AO) staining showed green fluorescence at 488nm excitation with a band pass filter ranging between 505530nm, where as the ethidium bromide (EtBr) staining showed red fluorescence at 585nm long pass filter. Final images were generated by superimposition of both green and red fluorescence.

GFP fluorescence of the transfected cells was also observed at 488nm excitation with the 505-530nm band pass filter.

II. Materials and Methods A. Chemicals, media and cell lines High purity molecular biology grade chemicals, reagents and kits were purchased from Sigma-Aldrich, USA and Roche Applied Science, Germany. The restriction enzymes and PCR reagents were from Bio-line, USA. Cell culture media: Dulbecco's Modified Eagle's medium (DMEM), fetal bovine serum (FBS), penicillin, streptomycin were purchased from Sigma-Aldrich, USA. Bacterial growth media: Luria-Bertani (LB) was purchased from HiMedia, India.

HT 29 (human colon adenocarcinoma) and BHK21 (baby hamster kidney) obtained from National Centre for Cell Science, India, were maintained in DMEM medium supplemented with 10% FBS, 50U/mL penicillin and 50mg/mL streptomycin in a humidified atmosphere in 5% CO 2 at 37ºC.

2. Scanning electron microscopy The transfected cells grown in 6 well tissue culture plates were treated with 5-FC for 48h and washed with phosphate buffer saline (PBS). The wells containing cells were cut out from the plate with a heated metal cutter, immediately dried and coated with gold film in the sputter coater. Finally, the cell morphology changes were recorded in LEO 1430VP SEM instrument at a magnification of 7,000 at 20KV.

B. Construction of CD-GFP vector and electroporation

3. Fluorescence spectrophotometry Cells transfected with pCD-GFP plasmid were grown up to 24h, scraped off and resuspended in PBS. The GFP fluorescence was quantified using a fluorescence spectrophotometer (Fluromax 3, Jobin yvon) at 488nm excitation wavelength.

The CD gene was PCR amplified from pORF-codA::upp (InvivoGen) plasmid. The codA and upp stands for bacterial cytosine deaminase gene and uracil phosphoribosyl transferase

220

Gene Therapy and Molecular Biology Vol 11, page 221 confocal microscope in Figure 1d (panel A-E for BHK21 and F-J for HT29 cells) after administration of 0, 5, 10, 20 and 50mM concentrations of 5-FC to the transfected cells.

A gradual decrease of fluorescence with more detached and rounded off cells were seen at high 5-FC concentrations because of enhanced cytotoxic effect of 5FC/CD (Ueda et al, 2001). Therefore, GFP fluorescence was a direct probe for functional effect of 5-FC/CD which caused cell death. This effect was further validated with the conventional microscopic and biochemical experiments.

E. Cell proliferation assay CellTiter 96 AQueous One Solution Assay kit (Promega, Madison, WI) was used to monitor cell proliferation by measuring mitochondrial activity (MTS). Transfected cells were seeded in 96-well miroplates at a density of 1x104 cells, and treated with varying concentrations of 5-FC for 96h. Finally, 10 µl of AQueous One solution was directly added to the well and incubated for 2hr and the absorbance was measured at 490 nm in a microplate reader. The absorbance of formazon product formed is directly proportional to the number of living cells in culture.

The relative cell viability (%) related to control wells containing cell culture medium without 5-FC was calculated by (A) test/(A) control x 100, where (A)test is the absorbance of the test sample and (A)control is the absorbance of the control untreated sample.

B. Effect of promoter strength on cell viability

F. DNA Laddering

The effect of 5-FC/CD suicide gene therapy leading to BHK 21 (non-cancer) and HT (cancer) cell death was examined. The cell proliferation assay that measures the live mitochondrial activity has been shown in Figure 2a and 2b for BHK 21 and HT 29 cell types, respectively (Bernt et al, 2002). Here, we examined the effect of two different promoters on CD gene expression at varying concentrations of 5-FC for both the cells and obtained a concentration dependent reduction of cell growth in the cell proliferation assay. We found that CD gene showed more significant anti-cell proliferation activity when expressed under human ferritin promoter as compared to the EF-1! promoter. Hence, we considered the pCD-GFP construct, where CD gene was under the control of ferritin promoter for our later experiments. From cell proliferation assay Figure 2c , IC50 (the concentration of 5-FC required to inhibit cell growth by 50% compared to the control) was found to be ~20mM; but we found that 5-FC concentration of 10mM, which is below IC50 value was sufficient to induce cell death, and thus was taken as the working 5-FC concentration for further investigations (Rowley et al, 1996).

The transfected cells were treated with 5-FC for 48h and then lysed with buffer containing 5mM Tris-Cl, pH 8.0, 20mM EDTA, and 0.5% Triton X-100 on ice for 20 min. Chromosomal DNA was isolated by gentle phenol/chloroform/isoamyl alcohol (25:24:1, v/v) extraction and alcohol precipitation. Finally, DNA was resuspended in TE (20mM Tris-Cl, 1mM EDTA pH 8.0) buffer containing RNaseA (100 µg/mL) and incubated at 37 °C for 1 h to remove RNA. The DNA fragments were resolved by 1.2% agarose gel electrophoresis.

G. Cellular DNA fragmentation ELISA We have used cellular DNA fragmentation ELISA kit (Roche Diagnostics GmbH, Germany) to determine release of DNA fragments into cytoplasm due to nucleolytic cleavage of the transfected cells after 5-FC/CD treatment. Cellular DNA was metabolically labeled with 10µM BrdU labeling solution for 12h at 37ºC, electroporated with CD- GFP plasmid, seeded in 96well microplate and further incubated for 24h. After 24h, transfected cells were treated with 5-FC for 72h, lysed and the cytoplasmic extract was assayed for quantitative detection of BrdU labeled fragmented DNA release using antibody ELISA technique as per the manufacturers’ instruction.

H. Statistical analysis Statistical analyses were carried out using student’s ‘t’ test.

P-values less than 0.05 were considered significant.

C. Molecular mechanism of cell death with 5-FC/CD The mechanism of cell death by 5-FC/CD was further investigated by microscopic and molecular analysis experiments to correlate the information obtained by tracking GFP fluorescence.

III. Results A. GFP expression for functional CD gene transfer The recombinant plasmid (pCD-GFP) containing dual transcripts of CD and GFP gene was introduced in the BHK 21 (non-cancer) and HT 29 (cancer) cells by electroporation. High level GFP expression was observed at 48h under confocal microscopy for both the cell types (Figure 1a). The GFP expression level was substantiated by measuring fluorescence intensity of the transfected cells using fluorescence spectrophotometer in Figure 1b (Richards et al, 2003). It was observed that fluorescence intensity was almost same at 24 and 48 h post transfection.

The CD gene transfer was confirmed by PCR analysis, where a 1.2kb amplicon was obtained for BHK 21 (lane 4) and HT 29 cells (lane 5) in Figure 1c, and the corresponding RT-PCR results on total RNA of the transfected cells (lane 7 and 8 of the Figure 1c) confirmed CD gene expression (Xia et al, 2004). The therapeutic effect of CD gene was tested at different concentrations of 5-FC. Fluorescence expression profile was obtained under

1. Microscopic measurements AO and ethidium bromide (EB) mediated double staining of transfected cell-nuclei upon 5-FC addition showed induction of apoptosis (Ribble et al, 2005).

Confocal microscopy images of the dual stained nuclei presented in Figure 3a showed that the live cells nuclei stained green due to AO uptake, whereas progressive nuclear uptake of EB due to cell membrane perforation stained nuclei red. Untreated cells had well organized chromatin structures, whereas the treated cells had fragmented or condensed chromatin.

SEM micrographs represented in Figure 3b showed that transfected cells upon 5-FC treatment became rounded off with progressive membrane shrinkage and membrane blebbing that are the characteristics of apoptosis (Cohen et al, 1999).

221

Gopinath and Ghosh: Monitoring GFP for functional delivery and the effect of curcumin in vitro

Figure 1 Green fluorescence protein expression and functional CD gene transfer. a (panel A and B) are the fluorescence images of BHK21 and HT 29 observed under confocal microscope at 48h post transfection. b is the fluorescence intensity measurement of GFP for untransfected control (1) and the transfected cells (2) at 24h. c is the agarose gel picture of PCR and RT PCR analysis of the transfected cells. Cellular DNA and RNA extracted from the transfected cells were subjected to PCR (lane 2- 5) and RT-PCR (lane 6- 8) analysis.

Lane 1: l DNA/ EcoR I +Hind III marker; lane 2: 1.2kb PCR amplicon of CD as positive control; lane 3 and 6: untransfected control BHK21 cells; lane 4 and 7: CD transfected BHK21cells; lane 5 and 8: CD transfected HT29 cells. d is the fluorescent images of transfected BHK 21 (A-E) and HT 29 cells (F-J) at varying concentrations (0, 5, 10, 20 and 50mM) of 5-FC.

222

Gene Therapy and Molecular Biology Vol 11, page 223

Figure 2 Effect of 5-FC/CD therapy on cell proliferation. Mitochondrial function was determined by the MTS reduction assay at the end of the 96h. a and b represents BHK 21 and HT 29 cells transfected with pCD-GFP and pCD constructs. The column numbers 1, 2, 3, 4 and 5 are for 0, 5, 10, 20 and 50mM concentrations of 5-FC used. c represents cell viability measurement of both the cells transfected with pCD-GFP and treated with at different 5-FC concentrations (0, 5, 10, 20 and 50mM). The IC50 of 5-FC of both the cell types were calculated.

2. Molecular analysis

the synergy on apoptosis (Pillai et al, 2004). Figure 4a represented the confocal microcopy pictures of GFP of 5FC/CD treated samples in presence and in absence of curcumin treatment. The GFP expression was reduced with more rounded off cells in combination treatment (panel C and F) compared to the untreated samples (panel A and D) and 5-FC/CD treatments (panel B and E) for BHK21 and HT 29 cells, respectively. These fluorescence micrographs indicated synergy on cell death by addition of curcumin.

DNA laddering, the widely regarded biochemical hallmark of late apoptosis was observed by agarose gel electrophoresis (Figure 3c) in treated samples obtained at 48h (Cao et al, 2001). In comparison to untreated control (lane 2 and 4, Figure 3c), the occurrence of DNA ladders in lane 3and 5 of Figure 3c confirmed apoptosis.

D. Synergistic apoptosis with 5-FC/ CD and curcumin treatment Curcumin concentration of 40ÂľM has been chosen which is below IC50 value (data not shown) to evaluate

223

Gopinath and Ghosh: Monitoring GFP for functional delivery and the effect of curcumin in vitro

Figure 3 Induction of apoptosis upon 5-FC/CD treatment. Transfected cells were treated with 10mM 5-FC for 48h. a is the confocal micrographs of AO/EB stained nuclei cells. The representative images for BHK 21 and HT 29 cell are shown in panels (A and B) and (C and D), respectively. The arrows indicated green stained nuclei for early apoptosis (EA) and red stained nuclei for late apoptotic (LA). b represents the scanning electron micrographs to show progressive changes in cell membrane morphology during apoptosis. The panels (A & B) are the representative images of BHK21 and HT29 cells. c is agarose gel picture for DNA laddering. After treatment cellular DNA was extracted and subjected to agarose gel electrophoresis. Lane 1: # DNA/EcoR I+ Hind III marker; lane 2: BHK 21 cells without 5-FC; lane 3: BHK 21 cells with 5-FC; lane 4: HT29 cells without 5-FC; lane 5: HT 29 cells with 5-FC.

Biochemical analysis by using 5'-bromo-2'deoxyuridine (BrdU) labeling cellular DNA fragmentation ELISA was performed to validate the synergistic effect of curcumin on apoptosis (Pan et al, 2001). Quantitative release of BrdU labeled DNA fragments to cytoplasm of the treated cells was shown in Figure 4b. The results of column 2 in Figure 4b for 10mM of 5-FC treatment showed that BrdU labeled DNA fragments increased significantly at 72h in the cytoplasm of the treated cells as compared to the untreated control cells (column 1). The results in column 3 indicated even more pronounced DNA fragments release when treated in combination with curcumin (40ÂľM). This experiment confirmed the release of cleaved genomic DNA to cytoplasm during apoptosis

and also the synergistic apoptosis in combine therapy with curcumin.

A semi-quantitative RT PCR detected caspase-3 signal in HT 29 cells after 5-FC/CD treatment and in combine therapy with curcumin (Huang et al, 2002).

Amplification of caspase-3 in both untreated and treated samples was shown in Figure 4c, where the !-action was used as an internal control. A slight increase of caspase gene expression was noted for both 5-FC and combine treatment (lane 2 and lane 3) than untreated control in lane 1 in Figure 4c, but the corresponding signals of Bcl-2, an anti-apoptotic regulatory protein was considerably reduced in both treatment Figure 4c, which confirmed the involvement of caspase signaling pathway in apoptosis (Todorova et al, 2004).

224

Gene Therapy and Molecular Biology Vol 11, page 225

Figure 4 Effect of curcumin on 5-FC/CD induced apoptosis and caspase signaling. a is the representative confocal micrographs of the transfected cells in presence of 40µM concentrations of curcumin for 72h. b is the cellular DNA-fragmentation ELISA, where the BrdU labeled cells were transfected with pCD-GFP and treated with 5-FC alone or 5-FC in combination with curcumin (40µM) for 72h.

The amount of DNA fragments released from nuclei to cytoplasm due to apoptosis was measured by recording absorbance at 450nm.

Column numbers 1, 2, 3, are for the untreated cells; 10mM of 5-FC; 10mM of 5-FC with 40µM of curcumin. c represents the expression of pro-apoptotic caspase and anti-apoptotic Bcl2 gene. Transfected cells were treated with 5-FC alone or in combination with 40µM of curcumin for 12h. Cells were harvested, RNA was isolated and RT PCR was performed for caspase-3, Bcl2 and "- actin genes. The PCR products were analyzed in 1.4% agarose gel. Column numbers: 1, 2, 3 are for untreated control cells; 10mM of 5-FC, and 10mM of 5-FC with 40µM of curcumin treatment.

alternative approach with strong therapeutic efficacies in which an expressed protein in cells changes a nontoxic prodrug to a toxic drug that causes cell death by

IV. Discussions In the search of new therapeutic regimens for cancer, the suicide gene therapy has been recently evolved as an 225

Gopinath and Ghosh: Monitoring GFP for functional delivery and the effect of curcumin in vitro multifunctional damages (Yazawa et al, 2002). This therapy has become very successful for challenging solid and malignant tumors in the context of adenoviral vector, where strong bystander effect to kill neighboring cells has been reported (Kurozumi et al, 2004) However, the application of adenovirus mediated gene therapy is quite limited due to high immunogenicity and toxicity of the virus (Ghosh et al, 2006). So, the plasmid based nonviral vector is an alternative delivery system with reduced toxicity, but the gene transduction efficiency is quite low. This problem could be easily addressed by using electroporation technique that enhances the efficiency of plasmid mediated gene transfer both in vitro and in vivo (Somiari et al, 2000; Goto et al, 2000). But, the main obstacle is being the molecular analysis of transgene expression in cells, which involves destructive and invasive methods for analysis. Therefore, development of noninvasive methods for measuring therapeutic transgene expression has become a challenge, as the clinical application of gene therapy is rapidly expanding (Bell and Taylor-Robinson 2000). The simple approach would be the use of reporter gene systems that can be easily monitored by noninvasive techniques (Vooijs et al, 2002).

In our study, we have generated such a recombinant plasmid containing dual transcripts of GFP and CD controlled by two different promoters. The recombinant plasmid was electroporated to both cancer HT 29 and noncancer BHK 21 cells, and the corresponding GFP expression was monitored by confocal microscopy which gave a direct signature of functional CD gene transfer by the same plasmid. The level of GFP expression was used an index of therapeutic potential of 5-FC/CD system. This noninvasive detection method with intrinsic stable property of GFP fluorescence and minimal photobleaching effect is superior to other conventional invasive methods for molecular expression assays. Furthermore, CD gene transfer was quantitated by measuring fluorescence of GFP spectrophotometrically of the transfected cells. We have shown that plasmid based 5-FC/CD system induced cell death via apoptosis in both the cell types. The occurrence of apoptosis due to functional effect of 5FC/CD has been substantiated by the conventional microscopic and biochemical measurements. The experimental results suggested involvement of caspase signaling in apoptosis pathway. Confocal microscopy images of AO/EB dual stained nuclei of treated cells depicted apoptosis at 48h post transfection after 5-FC addition, where AO permeated the cells and made the nuclei appear green, but EB stained nuclei red after membrane perforation due to apoptosis. Fragmented apoptotic nuclei that stained green were found to be progressively stained red with EB during cell membrane perforation. The SEM micrographs showed changes in cell morphology with more floated dead cells and sprouted multiple white buds around the surface of the cells due to membrane blebbing, which is a characteristic feature of apoptosis (Dini 2005). Mitochondrial activity was reduced in concentration dependent treatment of 5-FC on CD transfected cells because of mitochondrial membrane damage. Biochemical changes in treated cells showed

specific cleavage of genomic DNA at inter-nucleosomal linker sites producing unique length DNA fragments. The appearance of 180-200bp oligo-nucleosomal fragments as characteristic laddering pattern in agarose gel electrophoresis confirmed cell death due to apoptosis. The molecular methods have clearly demonstrated apoptotic effect of 5-FC/CD system and confirmed the findings of microscopic experiments.

Recently, combinatorial therapy is currently considered as the new regimen of medical science where therapeutic efficacy of any conventional drugs could be enhanced with another agent. The concurrent use of therapeutic agents with different or same mechanisms of action is more effective than each of the monotherapeutic regiment alone due to the multifactorial nature of two compounds. Such as, the known anti-cancer compound curcumin has been reported to potentiate anticancer drug celecoxib and oxiplatin (Howells et al, 2007). More investigations are being progressed for clinical use of such combination therapy in cancer treatments, where the synergistic effects of the two - the traditional drug and curcumin could be considered. It is challenging to develop methods where combination of such agents below their IC50 values could achieve high therapeutic efficacy with low toxic side effects. We examined whether the antiproliferation activity of curcumin could enhance therapeutic efficacy of 5-FC/CD- suicide gene therapy.

We measured apoptosis by the release of BrdU- labeled cellular DNA fragments using ELISA, and found apoptosis was synergized in the combined therapy at low concentrations of curcumin. Similar effect was observed when Bcl-2, an anti-apoptotic gene expression was reduced prominently in combination treatment. Such synergistic apoptosis promises the development of new therapeutic regimen of combination therapy for wide range use in cancer treatment.

In conclusion, our study demonstrates the ability of GFP to noninvasively estimate the level of functional E.coli CD gene in vitro. The chemotherapeutic effect of 5FC/CD was established in a plasmid based system, and the GFP fluorescence was used to probe the functional detection of CD gene. Moreover, the therapeutic efficacy of the CD gene expression was enhanced in a ferritin promoter construct. Induction profile of apoptosis in transfected cells was dependent on 5-FC concentration.

The combination treatment of 5-FC/CD with curcumin where the individual component, either 5-FC or curcumin used at much lower concentration than their IC50 values showed synergistic apoptosis. Thus, the present findings suggest that the noninvasive fluorescent based method can be used as a simple tool to monitor new combinatorial approach which has strong therapeutic potential for cancer treatment.

Acknowledgements The work was supported by the Ministry of Human Resources and Development (MHRD), Council of Scientific and Industrial Research [No.37 (1248)/06/EMRII] Government of India. Assistance from Central instruments facility (CIF) IIT Guwahati, for confocal and SEM analysis is gratefully acknowledged.

226

Gene Therapy and Molecular Biology Vol 11, page 227 AT (2006) Combined inhibitory effects of curcumin and phenethyl isothiocyanate on the growth of human PC-3 prostate xenografts in immunodeficient mice. Cancer Res 66, 613-621.

References Bell JD, Taylor-Robinson SD (2000) Assessing gene expression in vivo: magnetic resonance imaging and spectroscopy. Gene Ther 7, 1259-1264.

Kren BT, Ghosh SS, Linehan CL, Roy Chowdhury N, Hackett PB, Roy Chowdhury J, Steer CJ, (2003) Hepatocyte-targeted delivery of Sleeping Beauty mediates efficient gene transfer in vivo. Gene Ther Mol Bio 7, 229-238.

Bernt KM, Steinwaerder DS, Ni S, Li Z, Roffler SR, Lieber A (2002) Enzyme-activated prodrug therapy enhances tumorspecific replication of adenovirus vectors. Cancer Res 62, 6089-6098.

Cao F, Drukker M, Lin S, Sheikh AY, Xie X, Li Z, Connolly AJ, Weissman IL, Wu JC (2007) Molecular imaging of embryonic stem cell misbehavior and suicide gene ablation.

Cloning stem cells 9, 107-117.

Kurozumi K, Tamiya T, Ono Y, Otsuka S, Kambara H, Adachi Y, Ichikawa T, Hamada H, Ohmoto T (2004) Apoptosis induction with 5-fluorocytosine /cytosine deaminase gene therapy for human malignant glioma cells mediated by adenovirus. J Neuro-Oncol 66, 117-127.

Cao G, Pei W, Lan J, Stetler RA, Luo Y, Nagayama T, Graham SH, Yin X., Simon RP, Chen J, (2001) Caspase-activated DNase/DNA fragmentation factor 40 mediates apoptotic DNA fragmentation in transient cerebral ischemia and in neuronal cultures. J Neurosci 21, 4678-4690.

Laxman B, Hall DE, Bhojani MS, Hamstra DA, Chenevert TL, Ross BD, Rehemtulla A (2002) Noninvasive real-time imaging of apoptosis. Proc Natl Acad Sci USA 99, 1655116555.

Liu Y, Deisseroth A (2006) Oncolytic adenoviral vector carrying the cytosine deaminase gene for melanoma gene therapy.

Cancer Gene Ther 13, 845-855.

Cohen E, Ophir I, Shaul YB (1999) Induced differentiation in HT29, a human colon adenocarcinoma cell line. J Cell Sci 112, 2657-2666.

Miller CR, Williams CR, Buchsbaum DJ, Gillespie GY(2002) Intratumoral 5-Fluorouracil produced by cytosine deaminase/5-Fluorocytosine gene therapy is effective for experimental human glioblastomas. Cancer Res 62, 773780.

Dini L, (2005) Apoptosis induction in DU-145 human prostate carcinoma cells. Tissue Cell 37, 379-384.

Erbs P, Regulier E, Kintz J, Leroy P, Poitevin Y, Exinger F, Jund R, Mehtali M (2000) In Vivo cancer gene therapy by adenovirus-mediated transfer of a bifunctional yeast cytosine deaminase/uracil phosphoribosyltransferase fusion gene.

Cancer Res 60, 3813-3822.

Pan J, Xu G, Yeung SJ (2001) Cytochrome C release is upstream to activation of Caspase-9, Caspase-8, and Caspase-3 in the enhanced apoptosis of anaplastic thyroid cancer cells induced by manumycin and paclitaxel. J Clin Endocr Metab 86, 4731-4740.

Ghosh SS, Gopinath P, Ramesh A (2006) Adenoviral Vectors: A promising tool for gene therapy. Appl Biochem Biotechnol 133, 9-29.

Pillai GR, Srivastava AS, Hassanein TI, Chauhan DP, Carrier E (2004) Induction of apoptosis in human lung cancer cells by curcumin. Cancer Lett 208, 163-170.

Ghosh SS, Takahashi M, Parashar B, Thummala NR, Chowdhury NR, Chowdhury JR (2000) Liver directed gene therapy; promises, problems and prospects at the turn of the century. J Hepatol 32, 238-252.

Ribble D, Goldstein NB, Norris DA, Shellman YG (2005) A simple technique for quantifying apoptosis in 96-well plates.

BMC Biotechnol 5.

Goto T, Nishi T, Tamura T, Dev SB, Takeshima H, Kochi M, Yoshizato K, Kuratsu J, Sakata T, Hofmann GA, Ushio Y (2000) Highly efficient electro-gene therapy of solid tumor by using an expression plasmid for the herpes simplex virus thymidine kinase gene. Proc Natl Acad Sci USA 97, 354359.

Richards HA, Halfhill MD, Millwood RJ, Stewart CN (2003) Quantitative GFP fluorescence as an indicator of recombinant protein synthesis in transgenic plants. Plant Cell Rep 22, 117-121.

Rowley S, Lindauer M, Gebert JF, Haberkorn U, Oberdorfer F, Moebius U, Herfarth C, Schackert H (1996) Cytosine deaminase gene as a potential tool for the genetic therapy of colorectal cancer. J Surg Oncol 61, 42-48 .

Heller LC, Coppola D (2002) Electrically mediated delivery of vector plasmid DNA elicits an antitumor effect. Gene Ther 9, 1321-1325.

Howells LM, Mitra A, Manson MM (2007) Comparison of oxaliplatin- and curcumin-mediated antiproliferative effects in colorectal cell lines. Int J Cancer 121, 2929-2937.

Sander WE, Metzger ME, Morizono K, Bonifacino A, Penzak SR, Xie Y, Chen ISY, Bacon J, Sestrich SG, Szajek LP, Donahue RE (2006) Noninvasive molecular imaging to detect transgene expression of lentiviral vector in nonhuman primates. J Nucl Med 47, 1212-1219.

Huang S, Tang M, Hsu K, Cheng Y, Chou C (2002) Fas and Its Ligand, Caspases, and Bcl-2 expression in gonadotropinreleasing hormone agonist-treated uterine leiomyoma. J Clin Endocr Metab 87,4580-4586.

Selby M, Goldbeck C, Pertile T, Walsh R, Ulmer JB (2000) Enhancement of DNA vaccine potency by electroporation in vivo. J Biotechnol 83, 147-152.

Kai GE, Lingfei XU, Zheng Z, Dehua XU, Sun L, Liu X (1997) Transduction of cytosine deaminase gene makes rat glioma cells highly sensitive to 5-Fluorocytosine. Int J Cancer 71, 675-679.

Sharma V, Prior JL, Belinsky MG, Kruh GD, Worms DP (2005) Characterization of a 67Ga/68Ga radiopharmaceutical for SPECT and PET of MDR1 P-glycoprotein transport activity In Vivo: validation in multidrug-resistant tumors and at the blood-brain barrier. J Nucl Med 46, 354-364.

Kambara H, Tamiya T, Ono Y, Ohtsuka S, Terada K, Adachi Y, Ichikawa T, Hamada H, Ohmoto T (2002) Combined radiation and gene therapy for brain tumors with adenovirusmediated transfer of cytosine deaminase and uracil phosphoribosyltransferase genes. Cancer Gene Ther 9, 840845.

Somiari S, Glasspool-Malone J, Drabick JJ, Gilbert RA, Heller R, Jaroszeski MJ, Malone RW (2000) Theory and in Vivo application of electroporative gene delivery. Mol Ther 2, 178-187.

Khor TO, Keum Y, Lin W, Kim J, Hu R, Shen G, Xu C, Gopalakrishnan A, Reddy B, Zheng X, Conney AH, Kong

Springer CJ, Duvaz IN (2000) Prodrug-activating systems in suicide gene therapy. J Clin Invest 105, 1161-1167.

227

Gopinath and Ghosh: Monitoring GFP for functional delivery and the effect of curcumin in vitro Todorova VK, Harms SA, Kaufmann Y, Luo S, Luo KQ, Babb K, Klimberg VS (2004) Effect of dietary glutamine on tumor glutathione levels and apoptosis-related proteins in DMBAinduced breast cancer of rats. Breast Cancer Res Tr 88, 247-256.

suicide gene therapy for cancer. World J Surg 26, 783-789.

Ueda K, Iwahashi M, Nakamori M, Nakamura M, Matsuura I, Yamaue H, Tanimura H, (2001) Carcinoembryonic antigenspecific suicide gene therapy of cytosine deaminase/5fluorocytosine enhanced by the Cre/loxP system in the orthotopic gastric carcinoma model. Cancer Res 61, 61586162.

Vooijs M, Jonkers J, Lyons S, Berns A (2002) Noninvasive imaging of spontaneous retinoblastoma pathway-dependent tumors in mice. Cancer Res 62, 1862-1867.

Xia K, Liang D, Tang A, Feng Y, Zhang J, Pan Q, Long Z, Dai H, Cai F, Wu L, Zhao S, Chen Z, Xia J (2004) A novel fusion suicide gene yeast CDglyTK plays a role in radio gene therapy of nasopharyngeal carcinoma. Cancer Gene Ther 11, 790-796.

Siddhartha Sankar Ghosh

Yazawa K, Fisher WE, Brunicardi FC (2002) Current progress in

228

Gene Therapy and Molecular Biology Vol 11, page 229 Gene Ther Mol Biol Vol 11, 229-262, 2007

Genetic models of retinal degeneration and targets for gene therapy Review Article

Brian J. Song, Stephen H. Tsang*, Chyuan-Sheng Lin The Bernard and Shirlee Brown Glaucoma Laboratory, Departments of Ophthalmology and Pathology, Columbia University College of Physicians and Surgeons, 160 Fort Washington Avenue, New York, NY, 10032, USA

__________________________________________________________________________________ *Correspondence: Stephen H. Tsang, M.D., Ph.D., Columbia College of Physicians & Surgeons, Harkness Eye Institute Research Annex 513, 160 Fort Washington Avenue, New York, NY 10032. Tel: (212)-342-1189, Fax: (212)-305-4987, Email: sht2@columbia.edu Key words: Animal models, congenital stationary night blindness, Models of Bardet-Biedl syndrome, Models of Best disease, Models of Norrie disease, Models of SFD, Models of Stargardt disease, Models of Stargardt-like macular dystrophy, Models of Usher syndrome, achromatopsia, Rodent models, age-related macular degeneration, autosomal-dominant retinitis pigmentosa, autosomal-recessive retinitis pigmentosa, Leber congenital amaurosis, X-linked retinitis pigmentosa, Nonrodent models Abbreviations: adeno-associated virus, (AAV); age-related macular degeneration, (AMD); Ames waltzer, (av); amyloid beta, (A!); aryl-hydrocarbon interacting protein-like 1, (AIPL1); Bardet-Biedl syndrome, (BBS); Caribbean Primate Research Center, (CPRC); cathepsin D, (CatD); C-C chemokine receptor-2, (Ccr2); centrosomal protein 290, (CEP290); ceruloplasmin, (Cp); choroidal neovascularization, (CNV); complement factor H, (CFH); cone degeneration, (cd); cone photoreceptor function loss, (cpfl); cone-rod dystrophy, (cord1); cone-rod homeobox, (CRX); Congenital stationary night blindness, (CSNB); crumbâ&#x20AC;&#x2122;s homolog 1, (CRB1); cyclic guanosine monophosphate phosphodiesterase, (cGMP PDE); cyclic nucleotide gated channel !3, (CNGA3); cyclic nucleotide gated channel "3, (CNGB3); cyclic nucleotide-gated, (CNG); doublecortin, (DCX); electroretinograms, (ERG); guanine nucleotide binding protein, (GNAT2); guanylate cyclase, (GC); guanylate cyclase-activating proteins, (GCAPs); hephaestin, (Heph); hypoxia inducible factor-1!, (HIF-1!); interphotoreceptor retinoid binding-protein (IRBP); Leber Congenital Amaurosis, (LCA); low density lipoprotein, (LDL); luteinizing hormone beta subunit (LHbeta); McKusick-Kaufman syndrome, (MKS); monogenic audiogenic seizure-susceptible gene, (MASS1); Myosin VIIa, (MYO7A); neprilysin, (NEP); N-retinylidine-phosphatidylethanolamine, (N-RPE); photoreceptor-specific guanylate cyclase, (GUCY2D); pigment epithelium-derived growth factor, (PEDF); prokineticin 1, (hPK1); proline at position 27, (P27L); retinal degeneration 3, (rd3); retinal degeneration 5, (rd5); retinal degeneration slow, (rds); retinal degeneration, (rd); retinal dystrophy, (rdy); retinal pigment epithelium, (RPE); retinitis pigmentosa GTPase regulator, (RPGR); Retinitis pigmentosa, (RP); rhodopsin, (Rho); rod-cone dysplasia 3, (rcd3); rod-cone dysplasia, (rcd1); Royal College of Surgeons, (RCS); Sorsby fundus dystrophy, (SFD); superoxide dismutase, (SOD1); simian virus 40 T antigen (SV40 Tag); tissue inhibitor of metalloproteinases-3, (Timp3); tubby, (tub); tubby-like protein 1, (TULP1); Usher syndrome, (USH); valine at position 20, (V20G); vascular endothelial growth factor, (VEGF); very large G-protein couple receptor family, (VLGR1);very low density lipoprotein, (VLDL); waltzer, (v)

No author has a proprietary interest in the development or marketing of any of the products or devices mentioned in the study.

Received: 1 June 2007; Revised: 13 August 2007 Accepted: 3 September 2007; electronically published: September 2007

Summary Studies utilizing animal models in combination with progress in the field of molecular genetics have improved our understanding of pathways leading to retinal degenerations. As a result, it has become clear that genes are involved in many processes that are responsible for the symptomatology seen in these conditions. However, it is still a mystery how certain genetic defects can cause a myriad of retinal degenerations while others defects, often in the same genes, lead to much more benign conditions such as stationary night blindness. As future research uncovers new details about specific genetic defects and the discovery of more accurate animal models, we can hopefully develop gene therapeutic strategies that will one day prevent, treat, and even cure these blinding and debilitating diseases.

intervention, are limited. While many retinal degenerations are believed to have a multifactorial etiology, we now know that there is a genetic component that is at least partially responsible for the clinical manifestations seen in many of these diseases, such as

I. Introduction Retinal degenerative diseases are the leading cause of irreversible blindness in western countries today. In contrast, our knowledge of the underlying pathophysiology and hence, targets for therapeutic 229

Song et al: Genetic models of retinal degeneration and targets for gene therapy retinitis pigmentosa and age-related macular degeneration (AMD). As a result, the development of accurate and reproducible disease models is critical for identifying the genes and underlying mechanisms by which retinal diseases occur. Most current models of retinal degenerative disease are the result of naturally occurring mutations in humans or animals, particularly rodents.

However, technological advances have led to significant developments in genetic engineering, which have allowed researchers to manipulate the expression of genes involved in both retinal disease and normal retinal function (Tsang et al, 1996, 1998, 2007). In this review, we will summarize the most significant inherited retinal diseases and the available animal models currently used to study them.

epithelial cells located between the RPE of the fovea and Bruch’s membrane. These findings are also accompanied by the loss of foveal photoreceptors (O'Gorman et al, 1988). Best Disease is diagnosed by a reduced Arden ratio on the electrooculogram. It is now known that a mutation in the VMD2 gene on chromosome 11q13 is responsible for Best Disease (Petrukhin et al, 1998). VMD2 encodes a protein called bestrophin, which acts as a chloride channel in the basolateral membrane of the RPE (Sun et al, 2002).

Currently, VMD2 is not thought to be a major contributer in the etiology of AMD (Allikmets et al, 1999; Kramer et al, 2000; Lotery et al, 2000b).

1. Models of Best disease Recently, Marmorstein and colleagues reported a rat model of Best Disease using adenovirus gene transfer in wildtype animals to cause overexpression of bestrophin and two bestrophin mutants - bestrophin W93C and bestrophin R218C (Marmorstein et al, 2004). Their study showed that the reduced light peak amplitude that is characteristic of Best Disease is seen to varying degrees in mutants expressing bestrophin W93C and R218C. Though all animals exhibited similar waveforms of the major ERG components (a- and b-wave), diminished amplitudes were seen when compared to controls.

II. Degenerations of the macula Macular degeneration is a heterogeneous group of diseases that mainly affect the macular region of the retina. As a result, the primary clinical finding is a defect in central vision. In contrast to global retinal diseases and cone-predominant degenerations, normal full-field electroretinograms (ERG) and peripheral visual fields are seen in macular dystrophies. Pathologically, they are characterized by atrophy and degeneration of the retinal pigment epithelium (RPE) and photoreceptors. As a group, macular degenerations are the leading cause of irreversible blindness in the general population, particularly among the elderly and in the western world.

B. Stargardt disease Unlike the other common macular dystrophies (most of which have a dominant inheritance pattern), Stargardt Disease has an autosomal recessive mode of inheritance.

Abnormally high accumulations of lipofuscin in the RPE of patients with Stargardt Disease leads to atrophy and the formation of a “bull’s eye”-like lesion on the fundus (Figure 1). Yellowish “fishtail” flecks are also seen at the level of the RPE (Figure 2) – a phenomenon known as fundus flavimaculatus (Klaver et al, 2003).

A. Best disease Best Disease is a congenital disease of autosomal dominant inheritance that affects the central retina. Also known as vitelliform macular dystrophy, its name is derived from the appearance of the classic vitelliform, or “egg yolk” lesion seen in the macula. This characteristic finding is the result of excess lipofuscin in the RPE cells across the fundus as well as degenerating pigment

Figure 1. Autofluorescent imaging shows RPE atrophy (hypofluorescent) centrally and A2E related flecks (hyperfluorescent) in an individual with compound heterozygous mutation in the ABCA4 gene.

Figure 2. Corresponding fundus photo of Figure 1. Notice the presence of the yellowish “fishtail-like flecks” prominent in macular region to the right of the optic nerve.

230

Gene Therapy and Molecular Biology Vol 11, page 231 Due to the work of Allikmets and colleagues, it is now known that ABCA4, also known as ABCR, is the gene that is responsible for Stargardt disease (Allikmets et al, 1997).

ABCA4 encodes a protein called rim, which is a transmembrane protein involved in the transport of vitamin A intermediates, specifically N-retinylidinephosphatidylethanolamine (N-RPE), to the RPE. As its name suggests, the rim protein is expressed in the rims of photoreceptor disc membranes. Alterations in the normal function of ABCA4 lead to N-RPE accumulation in the outer segments of the photoreceptor discs, which leads to the formation of the lipofuscin component, N-retinylideneN-retinylethanolamine (A2E). As a result, high levels of lipofuscin accumulate in the RPE, causing the subsequent photoreceptor degeneration seen in Stargardt Disease.

D. Stargardt-like macular dystrophy An autosomal dominant variant of Stargardt disease is known as Stargardt-like macular dystrophy. Much like classic Stargardt disease, electrophysiologic findings can vary but tend to be fairly normal in this condition. In contrast, the appearance of a “dark choroid” that is commonly seen on fluorescein angiography in recessive Stargardt disease patients is absent in Stargardt-like macular dystrophy (Klaver et al, 2003). Stargardt-like macular dystrophy is much less common than recessive Stargardt disease, and it was not until 2001 that ELOVL4 was identified as the responsible gene (Zhang et al, 2001b). It is thought that ELOVL4 encodes an enzyme that is highly expressed in photoreceptor cells and is involved in the elongation of very long chain fatty acids, hence its name (Mandal et al, 2004; Zhang et al, 2003b). It has been hypothesized that the ELOVL4 protein contributes to proper photoreceptor function and membrane composition because of its role in the synthesis of polyunsaturated fatty acids of the outer segment (Klaver et al, 2003). Genetic analyses of Stargardt-like macular dystrophy pedigrees have demonstrated that a 5 base-pair (bp) deletion or two 1 bp deletions result in the formation of a truncated ELOVL4 protein that causes macular disease (Bernstein et al, 2001; Zhang et al, 2001b).

1. Models of Stargardt disease An Abca4 knockout mouse was developed which has expanded our knowledge of this disease and has identified possible targets for therapeutic intervention (Weng et al, 1999). Mice lacking rim protein develop delayed dark adaptation and increased all-trans-retinaldehyde following light exposure. In addition, there is increased accumulation of both lipofuscin and A2E, the toxic lipofuscin fluorophore, within the RPE cells (Mata et al, 2000; Weng et al, 1999). A2E accumulation eventually causes secondary degeneration of photoreceptors. To date, the Abca4-/- mouse is the only genetic model of recessively inherited Stargardt Disease.

1. Models dystrophy

of

Stargardt-like

macular

The identification of ELOVL4 as the responsible gene for Stargardt-like macular dystrophy eventually led to the development of a transgenic mouse model for studying the disease (Karan et al, 2005). The Elovl4 transgenic mouse expresses a mutant form of human ELOVL4 resulting from a 5 bp deletion that produces an accumulation of phagosomes and lipofuscin in the RPE, much like the Abca4 knockout mouse. Photoreceptor degeneration develops and abnormal ERG changes are seen subsequently. As a result, this mouse model exhibits some features of both Stargardt-like macular dystrophy as well as rod-cone dystrophy.

C. Sorsby fundus dystrophy Sorsby fundus dystrophy (SFD) is an autosomal dominant condition that causes visual loss in affected individuals at approximately 40 years of age. It has been linked to a mutation in the tissue inhibitor of metalloproteinases-3 (TIMP3) gene, which encodes a TIMP3 protein that inhibits the action of matrix metalloproteinases (Weber et al, 1994). Starting around the fourth decade of life, affected patients present with problems transitioning between light and dark followed by central vision abnormalities and late loss of peripheral vision (Sorsby et al, 1949). Clinically, the formation of drusen is accompanied by choroidal neovascularization that grows into the subretinal space through a thickened Bruch’s membrane (Polkinghorne et al, 1989). As a result, SFD has garnered much interest because of its clinical similarities to AMD.

E. Age-related macular degeneration AMD is the leading cause of visual impairment among the elderly in the United States and other developed countries. As its name suggests, it is relatively localized to the macula, and the prevalence increases with age. The end result is ultimately the progressive deterioration of (fine) central vision. AMD is clinically divided into two types: atrophic (also known as dry or nonexudative) and exudative (wet). Atrophic AMD, which accounts for the vast majority of all cases, is characterized by deposits called “drusen” between the RPE and Bruch’s membrane (Figure 3). The accumulation of A2E and its isomers along with subsequent RPE death leads to secondary degeneration of photoreceptors (Kim et al, 2004). Eventually, the retina thins and visual impairment occurs. In contrast, exudative AMD is characterized by choroidal neovascularization (CNV). Rapid visual impairment occurs when newly formed vessels leak into the subretinal space and damage the retina. Though only about 10% of patients develop exudative AMD, it

1. Models of Sorsby fundus dystrophy To date, only one model of SFD has been developed.

Weber and colleagues developed a knock-in mouse carrying the Ser156Cys mutation in the Timp3 gene using site-directed mutagenesis and homologous recombination in embryonic stem cells (Weber et al, 2002). After eight months, abnormal morphology was seen in both Bruch’s membrane and the RPE. Scotopic and photopic ERGs were normal during the lifespan of affected Timp3S156C/S156C mice. Neovascularization was not seen in these mice.

231

Song et al: Genetic models of retinal degeneration and targets for gene therapy accounts for the vast majority of cases of severe visual loss. While there is some debate as to whether both forms are related or represent separate disease processes, polymorphisms in complement factor H (CFH) have been linked to both types suggesting an association between the two forms (Chen et al, 2006; Fuse et al, 2006).

AMD is thought to have a multifactorial etiology in which both genetic and environmental risk factors (e.g. smoking and diet) contribute to the development of disease. One of the main hurdles in studying AMD has been the lack of precise animal models to study the disease and to elucidate the genetic components involved. While association studies have clearly implicated the role of genetics in the development of AMD, elucidation of a clear-cut causal gene(s) has been difficult (Klaver et al, 1998; Hammond et al, 2002). Fundus photos comparing a patient with exudative AMD with a normal fundus are shown in Figure 4A and B.

1. Rodent models of age-related macular degeneration Rodents, specifically mice, are currently the primary species used to study AMD. Though rodents lack a macula, they offer several advantages for studying retinal disease in spite of this deficit. They are cheap and easy to handle. As a result, they can be studied in high numbers, while their relatively short lifespan allows for timely and efficient study of diseases of the elderly, such as AMD. Perhaps even more significant is the fact that rod-cone photoreceptor interactions with the retinal pigment epithelium are conserved between humans and mice. In addition, a wide variety of hereditary retinal degenerations occur in mice, and genetic manipulation is fairly simple, reproducible, and well-established in the medical literature. More importantly, many of the disease genes in mice possess a corresponding human equivalent.

Figure 3. Fundus photo of a patient with atrophic macular degeneration. Drusen can be seen in the area of the macula.

Figure 4. Fundus photos comparing a patient with exudative AMD (A) with that of a normal patient (B).

232

Gene Therapy and Molecular Biology Vol 11, page 233 The Abca4-/- and the Elovl4 transgenic mice described earlier are useful models of Stargardt Disease and Stargardt-like macular dystrophy respectively.

However, the pathologic findings in these mice as well as the association of these genes to AMD make them useful for the investigation of AMD, particularly nonexudative AMD. Because partial loss of Abca4 in knockout mice causes A2E accumulation similar to Stargardt disease and AMD, it has been suggested that the Stargardt disease carrier state may be a predisposing factor to the development of AMD (Mata et al, 2001). The aforementioned Timp3 transgenic mouse used for SFD is also considered as a model for AMD by some due to the overlap of clinical features between SFD and AMD (Rakoczy et al, 2006).

Hypercholesterolemia and diet are two risk factors that have been implicated in the pathogenesis of AMD (van Leeuwen et al, 2003). Consequently, several models of AMD have been developed which involve impaired cholesterol and/or lipid metabolism. One such model that utilized the concept of impaired lipoprotein metabolism was a very low density lipoprotein (VLDL) receptor gene knockout mouse (Heckenlively et al, 2003). A homozygous mutation in the VLDL receptor gene (Vldlrtm1Her) causes retinal angiomatous proliferation, a form of occult CNV. Later, Rudolf and colleagues developed a similar model that utilized a knockout of the low density lipoprotein (LDL) receptor (Rudolf et al, 2005). An accumulation of lipid particles is seen in Bruch’s membrane which tends to increase with fat intake.

In addition, histology showed vascular endothelial growth factor (VEGF) expression in the outer retinal layers of affected mice and was directly correlated with the amount of lipid particle deposition in Bruch’s membrane. No evidence of neovascularization was seen in these mice.

The APOE gene, which encodes apolipoprotein E, has been identified as a risk factor for AMD (Baird et al, 2004). Transgenic mice expressing the APO*E3-Leiden gene (which produces a dysfunctional form of APO-E3) were found to have basal laminar deposits that tended to be more severe in mice consuming a diet high in fat and cholesterol (Kliffen et al, 2000). Dithmar and colleagues were the first to examine the ultrastructural changes in an ApoE (-) model in mice (Dithmar et al, 2000). ApoE deficient mice developed electron-lucent deposits in Bruch’s membrane, similar to the basal laminar deposits seen in humans with AMD. A later study by Malek et al combined the risk factors of advanced age and a high fat, cholesterol-rich diet in mice with an ApoE genotype (Malek et al, 2005). Of the different apoE subtypes examined in this study, those deficient in apoE4 were most severely affected and developed many of the pathologic characteristics of AMD. These changes include thickening of Bruch’s membrane, atrophy of and pigmentary changes in the RPE, drusenoid deposits, and CNV in some cases.

The transgenic C57BL/6 mouse is another combined model that develops hyperlipidemia from the overexpression of human Apo B100 using an Apo B100 gene promoter (Espinosa-Heidmann et al, 2004).

Transgenic mice that were treated with blue-green light or were given a high fat diet acquired basal laminar deposits,

while transgenic mice that were fed normal diets had no deposits or abnormal morphology. Thus, most models that utilize the impairment of cholesterol or lipid metabolism result in the formation of basal laminar deposits or drusen.

Based on the finding that AMD patients tend to have elevated iron levels in the retina, Hahn et al developed a mouse that was deficient in both ceruloplasmin (Cp) and hephaestin (Heph) (Hahn et al, 2003, 2004). They found that mice that are Cp-/-Heph-/Y had increased retinal iron levels. Soon thereafter, affected mice developed RPE death, photoreceptor degeneration, and subretinal neovascularization. As a result, Cp and Heph deficiency leads to increases in ferritin, retinal iron accumulation, and retinal degenerative changes similar to many of the features of AMD. However, the lack of clinically observable drusen is one shortcoming of this model.

Though an increase in amyloid " (A") is typically associated with neurodegenerative diseases, such as Alzheimer’s disease, Yoshida and colleagues examined the role of A" in the pathogenesis of AMD by disrupting the neprilysin (Mme or Nep) gene in a mouse model (Yoshida et al, 2005). Increased A" led to decreased pigment epithelium-derived growth factor (PEDF), RPE degeneration, and basal laminar deposits. Though VEGF was upregulated, there was no observable CNV. Another genetic modification that has been used to create models of AMD is the impairment of macrophage mobilization. Ambati et al reported the ocular findings in knockout mice that were deficient in monocyte chemoattractant protein-1 (Ccl2) as well as another line of mice deficient in C-C chemokine receptor-2 (Ccr2) (Ambati et al, 2003). Both strains of mice showed similar phenotypic features including thickening of Bruch’s membrane, subretinal deposits, drusen, and lipofuscin accumulation. Immune complexes accumulated in the retinas of affected mice, much like humans with AMD, and it was hypothesized that abnormalities in macrophage trafficking contributed to drusen formation. Ccl2-/- and Ccr2 -/- mice also exhibited photoreceptor atrophy, outer nuclear layer cell loss, and increased amounts of A2E. Another mouse model developed by Rakoczy and colleagues is a transgenic heterozygous mouse (mcd/mcd) that expresses an inactive mutant cathepsin D (CatD). It is believed that CatD is involved in photoreceptor outer segment digestion, which is thought to be impaired in patients with AMD (Rakoczy et al, 1999, 2002; Zimmerman et al, 1983). As a result, mcd/mcd mice showed age-related RPE proliferation and atrophy, photoreceptor degeneration, shortened outer segments, lipofuscin, and basal laminar deposits. ERG a- and b-wave amplitudes were also significantly reduced compared to wildtype mice. This model provides supportive evidence that AMD is largely due to the accumulation of abnormal photoreceptor breakdown products in RPE cells.

Certain models of AMD primarily involve the development of choroidal neovascularization for the study of wet AMD. One such model is a transgenic mouse that expresses murine VEGF cDNA coupled to an Rpe65 promoter (Schwesinger et al, 2001). Choroidal neovascularization and blood vessel leakage occurs as a result of increased VEGF expression in this model.

233

Song et al: Genetic models of retinal degeneration and targets for gene therapy However, choroidal vessels did not penetrate Bruch’s membrane into the subretinal space. The most recent model of CNV is a transgenic mouse that expresses prokineticin 1 (hPK1) in the retina using a rhodopsin promoter (Tanaka et al, 2005). Since hPK1 is a mitogen of fenestrated endothelium, it causes enlargement of the fenestrated choroidal vascular bed without affecting the nonfenestrated retinal vasculature. Despite the absence of morphologic changes, histologic analysis showed accumulation of the lipofuscin fluorophore, A2E, in affected mice.

The latest model of AMD reported in the literature involves the impairment of free radical dismutation through a knockout of Cu, Zn-superoxide dismutase (SOD1) in mice (Imamura et al, 2006). Homozygous mice for a deficiency in SOD1 develop thickening of Bruch’s membrane, drusen, and CNV, all of which worsen over time. Oxidative damage and degeneration of the RPE was seen on histology, while photoreceptor cell loss occurred in a subset of affected mice. One unique advantage of this model is that the pathologic features seen in these animals tend to be progressive with age, much like AMD in human patients. Our laboratory has also developed a new mouse model of AMD using an RPE65 promoter to overexpress a hypoxia inducible factor-1! (HIF-1!) transgene, which led to the development of drusen-like deposits in the subretinal space (Lin et al, 2006). Autofluorescence images of these animals compared to age-matched controls are shown in Figure 5A and B. To date, only one model of AMD has been reported in the rat. Wang and colleagues developed a potential model of exudative AMD by injecting an adeno-associated virus (AAV) encoding human VEGF into the subretinal space of rats (Wang et al, 2003). These rats subsequently developed extensive subretinal neovascularization, photoreceptor degeneration, and blood vessel leakage on fluorescein angiography. ERG amplitudes were also significantly decreased in AAV-VEGF injected eyes.

human eyes and animals. Specifically, the absence of a macula in non-primate species makes them less than ideal for studying a relatively geographically-specific disease process like AMD. However, the difficulty in handling non-human primates as well as their higher cost are some of the major disadvantages that prevent many investigators from using primates as AMD models.

The only evidence of a truly naturally-occurring nonrodent model of AMD was reported in a seminatural colony of aged adult rhesus monkeys at the Caribbean Primate Research Center (CPRC) that were found to have abnormalities consistent with human aging and AMD (Ulshafer et al, 1987). Drusen-like deposits were seen in the inner and outer collagenous zones of Bruch’s membrane, and dense bodies were found in both Bruch’s membrane and the RPE cytoplasm. A follow-up study in the same colony showed that none of the animals in this sample showed signs of exudative (wet) AMD or disciform scarring, making these animals suitable only for the study of dry AMD (Engel et al, 1988). Since AMD is not a disease of simple Mendelian genetics, no gene was identified in either study that could account for this phenotype. It should be noted that the relatively long lifespan of monkeys requires that they be tracked over a lengthy period of time before they develop signs of macular disease. While this monkey colony presents a unique opportunity to study AMD in a naturally occurring disease model, the drawbacks of using primates for research, as mentioned above, limit the practicality of their use for these purposes. Table 1 summarizes the characteristics of each model of AMD and the above mentioned macular dystrophies.

III. Retinitis pigmentosa Retinitis pigmentosa (RP) is a name given to a broad group of inherited diseases that are characterized by progressive rod-cone photoreceptor degeneration, mainly in the peripheral retina, and often result in legal blindness (Figure 6). RP affects 1 in 3000 people, which makes it the most common cause of inherited blindness worldwide (Humphries et al, 1992; McKusick, 1998). RP exhibits

2. Non-rodent models of age-related macular degeneration One of the primary challenges of studying macular diseases is the anatomic variation that exists between

Figure 5. High power autofluorescence image of a HIF1-! transgenic mouse (A) with an age-matched control mouse (B). Subretinal, drusen-like deposits are clearly seen in the HIF1-! mouse.

234

Gene Therapy and Molecular Biology Vol 11, page 235

Table 1. Genetic models for macular diseases.

Name

Gene

Protein

Modification

Species

Metabolic proteins APO B100 APO B100

APO B100

Transgenic

Mouse

ApoE-/-

ApoE

ApoE

Knockout

Mouse

APO*E3Leiden

APO*E3Leiden

Apo-E3

Transgenic

Mouse

LDL-r-/-

LDL-r

LDL receptor

Knockout

Mouse

Vldlrtm1Her

Vldlr

VLDL receptor

Knockout

Mouse

Degradation proteins NEP-/NEP

Neprilysin

Knockout

Mouse

mcd / mcd

CatDM1

Cathepsin D

Transgenic

Mouse

SOD1-/-

SOD1

Cu, Znsuperoxide dismutase

Knockout

Mouse

Monocyte chemoattractant protein-1

Knockout

Mouse

Immune function Ccl2-/Ccl2

235

Findings

Disease Equivalent

Basal laminar deposits (only when combined with high fat diet or bluegreen light exposure) Basal laminar deposits; BM thickening, CNV, drusen, and RPE atrophy also seen when combined with old age and high fat/cholesterol diet Basal laminar deposits that increase with fat and cholesterol intake Lipid deposition in BM and VEGF expression in outer retina that increase with fat intake Retinal and subretinal neovascularization

AMD

Basal laminar deposits, RPE degeneration, increased VEGF PR degeneration, RPE atrophy and proliferation, lipfuscin, basal laminar deposits, decreased ERG aand b-waves Thick BM, CNV, drusen, RPE degeneration, PR atrophy

AMD

Thick BM, drusen, lipofuscin, A2E, PR atrophy, subretinal deposits

AMD

AMD

AMD

AMD

AMD

AMD

AMD

Song et al: Genetic models of retinal degeneration and targets for gene therapy

Ccr2-/-

C-C chemokine receptor-2

Knockout

Mouse

Same as Ccl2-/-

AMD

Structural proteins Timp3S156C/S156C Timp3

Timp3

Knock-in

Mouse

Shortened RPE processes, abnormal PR morphology, thin ONL, thick BM

Sorsby fundus dystrophy, AMD

Transcription factors AAV-VEGF None

VEGF

Transgenic

Rat

CNV, blood vessel leakage, PR degeneration, decreased ERG amplitudes Hard and soft drusen, irregular choroidal vasculature A2E, enlargement of choroidal vessels CNV, blood vessel leakage

Wet AMD

Ccr2

HIF1-!

RPE65 promoter

HIF1-!

Transgenic

Mouse

hPK1

RHO promoter RPE65 promoter

hPK1

Transgenic

Mouse

VEGF

Transgenic

Mouse

Ceruloplasmin, Hephaestin

Transgenic

Mouse

RPE death, PR degeneration, subretinal neovascularization

AMD

Visual cascade ABCR -/ABCR

Rim

Knockout

Mouse

Stargardt disease, AMD

ELOVL4

ELOVL4

ELOVL4

Transgenic

Mouse

Wt-bestrophin

VMD2

Bestrophin

Transgenic

Rat

Lipofuscin and A2E accumulation, PR degeneration, delayed dark adaptation Lipofuscin and phagosome accumulation in RPE, localized PR degeneration, decreased ERG bwave ERG changes

Unknown

None

Primate

Drusen, BM abnormalities

Dry AMD

VEGF/RPE65

Transport proteins Cp-/- Heph-/Y Cp, Heph

Others CPRC Monkey Unknown

Dry AMD

Wet AMD Wet AMD

Stargardtlike macular dystrophy, AMD

Best Disease

Abbreviations: A2E, N-retinylidene-N_retinylethanolamine; AMD, age-related macular degeneration; BM, Bruchâ&#x20AC;&#x2122;s membrane; CNV, choroidal neovascularization; ERG, electroretinogram; ONL, outer nuclear layer; PR, photoreceptor; RPE, retinal pigment epithelium

236

Gene Therapy and Molecular Biology Vol 11, page 237

Figure 6. Fundus photo taken from a patient with retinitis pigmentosa. The appearance of intra-retinal pigmentation is most prominent in the mid-periphery early in the course of the disease. RPE migration and retinal atrophy is illustrated.

multiple patterns of inheritance, including autosomal dominant, autosomal recessive, sex-linked, and mitochondrial inheritance patterns (Dryja and Berson, 1995). A study conducted in Maine showed the frequency of these inheritance patterns as follows: 19% dominant, 19% recessive, 8% X-linked, 46% isolates and 8% undetermined (Dryja and Li, 1995). The majority of the isolated cases of RP probably involve recessive inheritance. Initially, RP presents with night blindness due to the progressive loss of rod photoreceptor cells.

Subsequently, affected individuals develop tunnel vision and eventually, complete loss of sight as the cones also degenerate. ERGs tend to be abnormal in affected individuals before the onset of symptoms (Berson et al, 1969; Humphries et al, 1992).

Despite the high prevalence of RP among inherited photoreceptor degenerative diseases, it was not until the past decade (1990) that it was discovered that mutations in the rhodopsin gene could cause autosomal dominant RP (Dryja et al, 1990; Pacione et al, 2003). It is now known that photoreceptor specific gene defects account for many forms of RP (Dryja and Berson, 1995; Humphries et al, 1992; Lindsay et al, 1992; Rosenfeld and Dryja, 1995).

Some involve alterations in rhodopsin, while some cause changes in structural proteins such as peripherin/RDS or ROM-1 (Humphries et al, 1992; Rosenfeld and Dryja, 1995). Others involve defects in the signal transduction mechanism, such as the ! and ! subunits of cyclic guanosine monophosphate phosphodiesterase (cGMP PDE) (Huang et al, 1995; McLaughlin et al, 1995). Why such gene defects cause rods to degenerate is unknown.

The problem is intriguing, because some rhodopsin and PDE gene defects eliminate rod function but do not lead to any further degeneration, resulting in stationary night blindness (Dryja et al, 1990; Gal et al, 1994). More often, however, rod specific gene defects cause a degeneration of rods first, and then a degeneration of cones later.

A. Autosomal-dominant pigmentosa

dominant form of RP (Dejneka et al, 2003). Mutations involved in dominant disease tend to cause a mutant protein with an unwanted gain of function. It is estimated that roughly 15-35% of all cases of RP are due to autosomal-dominant inheritance (Ayuso et al, 1995; Bunker et al, 1984; Novak-Laus et al, 2002).

1. Rodent models of autosomal-dominant retinitis pigmentosa In 1975, the Wag/Rij rat was reported as a new spontaneously occurring model of an early onset retinal degeneration similar to RP (Lai et al, 1975). This model was initially thought to be valuable, because it displayed the slowest progression of photoreceptor cell death compared to other models (Lai et al, 1975; Lai and Jonas, 1977). About a decade later, subsequent studies failed to reproduce the findings reported originally by Lai and colleagues (LaVail et al, 1987). As a result, the Wag/Rij rat has proven to be suitable as a model of epilepsy but is not currently considered useful in the study of RP (Aker et al, 2006; Citraro et al, 2006).

The retinal degeneration slow (rds) mouse has a loss of function mutation in the gene Prph2 that encodes a photoreceptor-specific membrane glycoprotein called peripherin (Dalke and Graw, 2005; Dejneka et al, 2003; Van Nie et al, 1978). The rds mouse is also known as rd2 (retinal degeneration 2) or Prph2Rd2, the name of the affected gene. Some of the most striking phenotypic features in homozygous rds mice are the absence of photoreceptor outer segments and a receptor layer that consists only of inner segments (Sanyal and Jansen, 1981).

Compared to the retinal degeneration (rd) mouse discussed below, the rds mouse undergoes slow and specific photoreceptor death leading to thinning of the outer nuclear layer (Sanyal, 1987).

A mutation in the gene RP1 (retinitis pigmentosa 1) has been associated with autosomal dominant RP in several linkage studies (Blanton et al, 1991; Berson et al, 2001; Bowne et al, 1999; Guillonneau et al, 1999; Jacobson et al, 2000; Pierce et al, 1999; Sullivan et al, 1999). RP1 encodes a protein of unknown function whose N-terminus resembles human doublecortin (DCX), which interacts with microtubules (des Portes et al, 1998;

retinitis

A number of photoreceptor-specific gene defects have been implicated in the etiology of the autosomal

237

Song et al: Genetic models of retinal degeneration and targets for gene therapy 1997). Homozygous mice (Rho-/-) do not elaborate rod outer segments and undergo uniform loss of photoreceptors that is complete by 3 months. In addition, the rod ERG is extinguished. Heterozygous mice show some structural disorganization of the inner and outer segments but retain the majority of their photoreceptors (Calvert et al, 1999; Humphries et al, 1997).

The mutation Q344ter causes the absence of the last 5 amino acids in the C terminus of Rho and has been linked to functional abnormalities in autosomal dominant RP (Jacobson et al, 1994; Sung et al, 1994; Vaughan et al, 2003). Mice that express this transgene exhibit impaired Rho transport to the rod outer segment (Sung et al, 1994).

Q344ter mice undergo progressive photoreceptor degeneration and thinning of the outer nuclear layer. In addition, transgenic rods displayed a later implicit time on ERGs. A similar transgenic model in rats that involves abnormalities in Rho is the S334ter mutation. In these animals, a termination codon at residue 334 leads to the production of a truncated opsin protein (Steinberg et al, 1996). Unlike Q344ter, the S334ter mutation is only a feature of animal models and is not seen in human autosomal dominant RP. Affected rats undergo rapid retinal degeneration, losing over half of their photoreceptors by postnatal day 2 (Liu et al, 1999). It has been proposed that caspase-3 activation may play a part in the rapid rate of photoreceptor death seen in these rats. In addition, rats with the S334ter mutation undergo thinning of the outer nuclear layer and diminished ERGs relative to wildtype rats (Martin et al, 2004)

Gleeson et al, 1999; Horesh et al, 1999). Therefore, Gao et al developed a model of progressive photoreceptor degeneration using targeted disruption of Rp1h (formerly known as Rp1) in mice (Gao et al, 2002). Mice with a homozygous knockout of Rp1h experience progressive rod-cone degeneration over a period of one year due to mislocalization of rhodopsin. The number of cone photoreceptors did not change until about 10 months of age. Morphologically, both rods and cones were found to be abnormal in structure and became progressively shorter over time. ERG amplitudes were also significantly decreased when compared to heterozygous mice or mice without the Rp1h mutation.

Rod photoreceptor cells use a photoreactive pigment called rhodopsin (Rho), and genetic linkage has been clearly established between RP and abnormalities in the RHO gene (McWilliam et al, 1989). Consequently, most genetic models of RP involve some sort of mutation in the gene for Rho. In 1992, Olsson et al developed a transgenic mouse model of autosomal dominant RP with a substitution of histidine for proline (P23H) at codon 23 of the rhodopsin gene (Olsson et al, 1992). This substitution in the rhodopsin gene is found in approximately 12% of patients with autosomal dominant RP. This mutation leads to overexpression of rod opsin, which leads to a retinal degeneration that is similar to that seen in human RP. Rho accumulates in the outer nuclear layer of the retina, suggesting that mutant Rho may utilize a different intracellular pathway than that used by normal rhodopsin (Roof et al, 1994).

Later, Lewin and colleagues rescued the P23H mutation in a transgenic rat using AAV vectors to develop a model with a phenotype similar to humans with RP (Lewin et al, 1998). This substitution causes a mutation in opsin transgene expression beginning on postnatal day 5.

Abnormalities become apparent beginning on day 15, with an increase in pyknotic photoreceptor nuclei in the outer nuclear layer of the retina. Affected rats undergo slow rod degeneration with normal cone function initially (Machida et al, 2000). Over time, rod outer segments shorten and outer nuclear layer cells are lost. A-wave amplitudes are also significantly smaller compared to controls on scotopic ERGs. The VPP mouse is a variant of the P23H mouse that involves three mutations (Goto et al, 1995; Naash et al, 1993). In addition to P23H, the VPP mouse also carries the following mutations near the N-terminus of opsin (a rhodopsin apoprotein): glycine for valine at position 20 (V20G) and leucine for proline at position 27 (P27L). It should be noted that V20G and P27L, which improved antibody epitope recognition, are not associated with human RP. Affected mice undergo shortening of rod outer segments and loss of photoreceptor nuclei (Naash et al, 1993). In addition, there is a decrease in photoreceptor Rho content (Goto et al, 1995; Naash et al, 1993, 1996).

Rod-mediated ERGs in VPP mice show decreased amplitudes at 1 month that continue to decline over time (Goto et al, 1995). Cone-mediated ERGs remain intact until 5 months of age, at which time a progressive decline is also seen. A model utilizing a complete knockout of the Rho gene was later reported in 1997 (Humphries et al,

2. Nonrodent models of autosomal-dominant retinitis pigmentosa Hereditary rod-cone degeneration was first noted in the Abyssinian cat in 1985 (Narfstrom et al, 1985). Further studies to characterize the retinal degeneration in these animals showed that a slowly progressive, generalized retinal atrophy occurs at approximately 2 years of age with photoreceptor degeneration of rods first, and then both rods and cones later (Narfstrom and Nilsson, 1987). Since then, this strain of cats has been referred to as the retinal dystrophy (rdy) cat and has garnered interest as a legitimate model of autosomal dominant retinitis pigmentosa (Gould and Sargan, 2002). A study to identify the gene responsible for the rdy phenotype excluded PDE6G (PDE-6-#) and ROM1 (retinal outer membrane 1) as candidate genes, and genetic sequencing of RHO showed that rhodopsin was unlikely to be a candidate gene as well (Gould and Sargan, 2002).

Another model of autosomal-dominant RP that has the distinct advantage of having many anatomical similarities to the human retina is the Pro347Leu (P347L) rhodopsin transgenic pig (Petters et al, 1997). Compared to rodents, pigs have a much more human-like globe size and cone:rod ratio in the retina. However, the drawbacks of using such a model include the high cost of these animals as well as the difficulty in handling them. The rhodopsin P347L transgenic pig develops severe, early rod degeneration with complete rod death by 20 months (Li et al, 1998). Progressive degeneration of cones is also seen,

238

Gene Therapy and Molecular Biology Vol 11, page 239 but at a much slower rate than rods. Histology shows that these pigs display short outer segments and stacks of Rhopositive membranes in the inner segments. Misrouting of mutant Rho appears to contribute to early rod cell death.

A point mutation (Thr4Arg) in the RHO gene has been shown to be responsible for a naturally occurring model of autosomal dominant RP in the English Mastiff dog (Kijas et al, 2002). As a result, this is the only mammal with a naturally occurring mutation in the RHO gene causing visual impairment. There is topographic variation of photoreceptor degeneration in the early stages, with the most severe disease in the area of the optic nerve head. While rods degenerate before cones, end stage atrophy results in progressive loss of all photoreceptors and the RPE. Like humans with RP, RHO mutant dogs displayed abnormal photoreceptor adaptation on ERG.

B. Autosomal-recessive pigmentosa

could rescue the retinal degeneration seen in homozygous Pdegtm1/Pdegtm1 mice (Tsang et al, 1997). Using ERGs and histology, it was shown that mice carrying the Bcl2 transgene experienced partial and temporal delay of the photoreceptor degeneration typically found in mutant mice.

Mutations in the tubby gene family are also a known cause of retinal degeneration (Hagstrom et al, 1999). The gene, tubby-like protein 1 (TULP1), is a member of the tubby family that has been linked to autosomal recessive RP in several linkage studies (Banerjee et al, 1999; Gu et al, 1999; Hagstrom et al, 1998). TULP1 encodes a photoreceptor protein of unknown function that is necessary for rod and cone viability (Hagstrom et al, 1999). In mammals, genetic mutations of tubby or TULP is associated with three distinct disease phenotypes: obesity, retinal degeneration, and hearing loss (Boggon et al, 1999). As a result, a homozygous knockout of Tulp1 (Tulp1-/-) causes early onset, progressive retinal degeneration affecting both rods and cones. Scotopic and photopic ERGs in homozygous mice are diminished, and massive vesicle accumulation is seen in the interphotoreceptor matrix. Shortened, disorganized outer and inner segments are seen on microscopy.

One of the most commonly used spontaneous rodent models of autosomal recessive RP is the Royal College of Surgeons (RCS) rat (LaVail, 2001; Strauss et al, 1998).

Retinal degeneration in this model is due to a mutation in the MERTK gene, which encodes a receptor tyrosine kinase (MER protein) that is responsible for proper phagocytosis of shed rod outer segments by the RPE (Dâ&#x20AC;&#x2122;Cruz et al, 2000). Photoreceptors degenerate slowly in the RCS rat until complete loss occurs at approximately 6 months of age (Dowling and Sidman, 1962; LaVail and Battelle, 1975). Despite photoreceptor degeneration, morphologic studies show that the inner retinal architecture remains fairly normal (Ball et al, 2003a). In 2003, retinal degeneration in the Mertk knockout mouse, which was originally developed by Camenisch and colleagues, was reported (Camenisch et al, 1999; Duncan et al, 2003). Similar to the RCS rat, the Mertk knockout mouse exhibited progressive photoreceptor degeneration, absence of phagosomes in the RPE at the peak of outer segment disc shedding, accumulation of debris in the outer segment-RPE interface, and slow removal of pyknotic photoreceptor nuclei (Duncan et al, 2003). Their study showed that ablation of MER function resulted in decreased scotopic ERG readings and a similar retinal phenotype as the RCS rat on histology.

Mutations in the ABCA4 gene for Stargardt disease have also been linked to some cases of cone-rod dystrophies as well (Cremers et al, 1998). However, the clinical features seen in Abca4 knockout mice more closely mimic human Stargardt maculopathy, and as a result, this mouse is not commonly used as a model for the biochemical features of RP.

retinitis

RP most commonly occurs in an autosomal recessive fashion (Hartong et al, 2006). This form of RP tends to occur as a result of lack-of-function mutations in genes that are involved in the visual transduction cascade as well as photoreceptor outer segment maintenance (Dejneka et al, 2003). Numerous genes have been identified in the etiology of RP. For example, the RPE based gene, MERTK (MER tyrosine kinase), is involved in the RPE phagocytic pathway, and loss of function in this gene can cause retinal degeneration as a result (Dâ&#x20AC;&#x2122;Cruz et al, 2000). The investigation of recessive RP has a distinct advantage in that there are several useful animal models that develop spontaneous retinal degeneration. These include both rodents as well as higher species, including dogs and cats.

1. Rodent models of autosomal-recessive retinitis pigmentosa One of the most commonly used mouse models of retinal pathology is called the retinal degeneration (rd1) mouse, whose abnormality has been localized to chromosome 5 (Sidman and Green, 1965). Also known as rd1 and Pde6brd1, retinal degeneration in this model is inherited as an autosomal recessive trait. The rd1 mouse carries a null mutation in the Pde6! gene, which encodes the " subunit of PDE in rod photoreceptors (Lolley, 1994).

As a result, affected mice undergo early, progressive degeneration of the outer retina and complete loss of rod photoreceptors by day 36 (Carter-Dawson et al, 1978).

Cones degenerate at a much slower rate in comparison, while other retinal cells remain fairly intact (CarterDawson et al, 1978).

A more recent model utilizing a defect in retinal cGMP PDE was developed by Tsang and colleagues (Tsang et al, 1996). A homozygous mutant allele in the gamma subunit of PDE causes a rapid and severe retinal degeneration that resembles autosomal recessive RP in humans. ERGs of homozygous mutants show severely diminished a- and b-wave amplitudes as well as a delayed b-wave implicit time. Outer segments become shortened and disorganized, and by 8 weeks of age, the photoreceptor layer is completely lost. A later study by the same group examined whether the antiapoptotic Bcl2 gene

2. Nonrodent models of autosomal-recessive retinitis pigmentosa Much has been learned about recessive RP from the use of companion animals as disease models. One of the

239

Song et al: Genetic models of retinal degeneration and targets for gene therapy most well-established disease models is the rod-cone dysplasia (rcd1) seen in Irish setter dogs (Aguirre et al, 1978; Aguirre et al, 1982; Liu et al, 1979; Suber et al, 1993). The rcd1 phenotype is caused by a nonsense mutation that produces a nonfunctional rod cGMP PDE " subunit (Suber et al, 1993). Histologic examination shows that affected animals have a fragmented outer segment, diminutive inner segments, and progressive photoreceptor and outer nuclear layer degeneration (Pearce-Kelling et al, 2001). Both rod and cone b-waves are either absent or decreased on ERG when compared to control animals.

Around the same time that the rcd1 setter dog was first discovered, a recessively inherited retinopathy was reported in the collie dog (Wolf et al, 1978). The rod-cone dysplasia seen in the collie is now known as rcd2 (SantosAnderson et al, 1980; Woodford et al, 1982; Wolf et al, 1978). Rod and cone outer segments fail to develop normally and undergo subsequent degeneration. Cones degenerate slower than rods, and histologic changes are similar to those seen in the rcd1 Irish setter dog. Affected collie dogs have more severe changes electrophysiologically and ophthalmoscopically at an earlier age than the Irish setter (Santos-Anderson et al, 1980). However, the gene responsible for the phenotype of the rcd2 collie has not been identified.

In addition, an extended pedigree of Cardigan Welsh corgi dogs has been studied as a potential model of autosomal recessive RP (Petersen-Jones et al, 1999). A single base deletion in the Pde6A gene, which encodes the ! subunit of cGMP PDE, was found to be responsible for retinopathy in affected dogs. Degenerative changes can be seen on ophthalmoscopy at 6-16 weeks of age, but progressive retinal atrophy occurs slowly over time, with some animals retaining limited central vision for up to 3-4 years (Keep, 1972). As a result, this line of dogs is categorized as rod-cone dysplasia 3 (rcd3) (Petersen-Jones et al, 1999).

An early onset, autosomal recessive, progressive retinal dystrophy in a colony of Persian cats was reported recently by Rah and colleagues (Rah et al, 2005). Clinical and histologic evidence from their study shows that retinal degeneration occurs early in life (approximately 3 weeks of age) and progresses rapidly until there is complete loss of photoreceptor cells by 17 weeks. Scotopic and photopic ERGs were nonrecordable in affected animals, suggesting that both rods and cones undergo degeneration. Although the causal gene was not identified in the study, the authors point out that many of the histologic features of these Persian cats mimic those seen in other models of rod-cone degeneration, such as the rcd2 collie (Santos-Anderson et al, 1980; Rah et al, 2005).

patchy distribution of rod degeneration that is consistent with X chromosome inactivation (Zeiss et al, 2000). The retinitis pigmentosa GTPase regulator (RPGR) gene has been implicated as a major cause of X-linked RP (Meindl et al, 1996). The exact function of the RPGR protein remains unclear, however. It has been proposed that RPGR is involved in the maintenance of outer segment specific proteins, which makes it essential for photoreceptor viability (Hong et al, 2000).

1. Rodent models of pigmentosa

X-linked retinitis

After the identification of RPGR as a causal gene in X-linked RP, a Rpgr knockout mouse model was subsequently developed (Hong et al, 2000). Histologic analysis showed that mutant mice exhibited ectopic localization of cone opsins in the cell body and synapses, while decreased levels of rhodopsin were seen in rod photoreceptors (Hong et al, 2000). Eventually, both cones and rods degenerate. In their study, RPGR was localized to the connecting cilia of rod and cone photoreceptors (Hong et al, 2000). As a result, they hypothesize that RPGR is involved in maintaining the polarized protein distribution across the connecting cilium by facilitating directional transport or restricting redistribution.

2. Nonrodent models of X-linked retinitis pigmentosa To date, the Siberian husky dog is the only known naturally occurring model of X-linked RP in a companion animal (Acland et al, 1994). Electron microscopy of the XLPRA (X-linked progressive retinal atrophy) dog shows vesiculation of rod discs and disruption of outer segments.

Eventually, there is a loss of cones and progressive atrophy of the inner retinal layers as well (Zeiss et al, 1999). The most significant lesions are seen in the peripheral retina with advancement to the area of the optic nerve (Zeiss et al, 1999). ERGs of affected male dogs and homozygous females showed decreased b-wave amplitudes consistent with these histopathologic abnormalities. The canine XLPRA phenotype has been linked to the gene RPGR, and homology of canine XLPRA and human RP3, an X-linked form of RP, has been established (Zeiss et al, 2000; Zhang et al, 2001a).

In addition to companion animals, a blind mutation known as retinal dysplasia and degeneration (rdd) has been reported in chickens since 1980 (Kondoh et al, 1980; Randall et al, 1983; Wilson et al, 1982). Affected animals have a significant reduction in photoreceptors and progressive retinal thinning secondary to cell loss in the photoreceptor and inner nuclear layers (Burt et al, 2003).

While it is still unclear which gene(s) is responsible for the clinical phenotype in the rdd chicken, a linkage study by Burt and colleagues have proposed that PDE6A, which encodes the ! subunit of cGMP PDE, is a possible candidate (Burt et al, 2003). It is still yet to be determined whether the rdd chicken is a direct human equivalent of RP or whether it represents a different disease process.

Table 2 summarizes the features of genetic RP models by functional class of the affected gene.

C. X-linked retinitis pigmentosa In contrast to other forms of RP, X-linked RP, also known as RP3, has an early age of onset as well as early involvement of both rods and cones (Bauer et al, 1998; Berson et al, 1980; Buraczynska et al, 1997; Fishman et al, 1998; Jacobson et al, 1997; Weleber et al, 1997). Affected teenage males experience severe degeneration of rods followed closely by degeneration of cones and retinal atrophy (Zeiss et al, 2000). Female carriers undergo a

240

Gene Therapy and Molecular Biology Vol 11, page 241 Table 2. Genetic models of retinitis pigmentosa Name

Gene

Protein

Modification

Species

Degradation proteins merkd MER

MER protein

Knockout

Mouse

RCS

MER protein

Naturallyoccurring

Rat

Unknown

Naturallyoccurring

Collie dog

rcd2

MERTK Structural proteins Unknown

rds (rd2, Prph2)

Prph2

Peripherin

Naturallyoccurring

Mouse

RP1-/-

RP1

RP1 protein

Knockout

Mouse

RPGR-/-

RPGR

RPGR protein

Knockout

Mouse

Visual cascade RHO

RHO

Transgenic

Mouse, rat

P347L

RHO

RHO

Transgenic

Pig

Q344ter

RHO

RHO

Transgenic

Mouse

RHO-/-

RHO

RHO

Knockout

Mouse

S344ter

RHO

RHO

Transgenic

Rat

Thr4Arg

RHO

RHO

Naturallyoccurring

English Mastiff dog

VPP (V20G, P23H, P27L)

RHO

RHO

Transgenic

Mouse

P23H

241

Findings

Disease Equivalent

Rapid, progressive PR degeneration, debris in RPEouter segment interface, decreased scotopic ERG Slow, progressive PR degeneration

ARRP

Rod-cone degeneration, decreased ERGs Absent PR outer segments, PR degeneration, ONL thinning Progressive rodcone degeneration, decreased ERGs PR degeneration, decreased RHO, decreased ERG

ARRP

Progressive rodcone degeneration, PR death, ONL cell loss, decreased scotopic ERGs Progressive rodcone degeneration, shortened outer segments Progressive PR degeneration, ONL thinning, increased ERG implicit time PR degeneration, absent rod ERG Rapid PR degeneration, ONL thinning, decreased ERG Progressive rodcone degeneration, RPE loss, abnormal ERG PR degeneration, decreased RHO, progressively

ADRP

ARRP

ADRP

ADRP XLRP

ADRP

ADRP

ADRP ADRP

ADRP

ADRP

Song et al: Genetic models of retinal degeneration and targets for gene therapy

Pdegtm1/Pdegtm1

Pde6g

Gamma subunit of cGMP-PDE

Knockout

Mouse

rcd1

Pde6b

Beta subunit of cGMP-PDE

Naturallyoccurring

Irish Setter dog

rcd3

Pde6a

Alpha subunit of cGMP-PDE

Naturallyoccurring

rd (rd1)

Pde6b

Beta subunit of cGMP-PDE

Naturallyoccurring

Cardigan Welsh corgi dog Mouse

tulp1-/-

TULP1

TULP1 protein

Knockout

Mouse

Unknown

Naturallyoccurring

Persian cat

Naturallyoccurring Naturallyoccurring

Chicken

Naturallyoccurring

Siberian husky dog

Others Early onset Unknown PRA Persian cat rdd

Unknown

Unknown

rdy

Unknown

Unknown

XLPRA Siberian husky dog

Unknown

Unknown

Abyssinian cat

PR loss, outer segment shortening and disorganization, decreased ERG aand b-wave Progressive PR and ONL degeneration, decreased ERG bwave Slowly progressive retinal atrophy

ARRP

Progressive rodcone and outer retinal degeneration Early onset progressive rodcone degeneration, extracellular vesicles, diminished ERG

ARRP

Early, rapidly progressive PR degeneration, absent ERG PR death, retinal thinning Progressive rodcone degeneration, retinal atrophy Progressive rodcone degeneration, inner retinal atrophy, decreased ERG b-wave

ARRP

ARRP

ARRP

ARRP

XLRP ADRP XLRP

Abbreviations: ADRP, autosomal dominant retinitis pigmentosa; ARRP, autosomal recessive retinitis pigmentosa; ERG, electroretinogram; ONL, outer nuclear layer; PR, photoreceptor; RPE, retinal pigment epithelium; XLRP, X-linked recessive retinitis pigmentosa

differs. Defects in cilial cells are seen in USH1, while abnormalities of basement membranes are the cause of USH2. In contrast, USH3 is thought to be caused by synaptic differences (Koenig, 2003).

D. Usher syndrome RP can also be seen as part of a syndrome characterized by systemic signs and symptoms in addition to the progressive visual impairment typically associated with the disease (Hartong et al, 2006). Two of the most well-documented syndromes involving RP are Usher syndrome (USH) and Bardet-Biedl syndrome (BBS). USH is the most common RP syndrome (Boughman et al, 1983; Heckenlively et al, 1988). Affected patients suffer earlyonset hearing loss in combination with RP and areflexia in an autosomal recessive pattern of inheritance. USH is divided into three subtypes, USH1 â&#x20AC;&#x201C; USH3, based on the severity of the clinical symptoms and the genes involved (Koenig, 2003). As a result, the pathogenesis of each type

1. Models of Usher syndrome The tubby (tub) mouse, also known as the retinal degeneration 5 (rd5) mouse, has a homozygous (rd5/rd5) defect in the tub gene, which leads to retinal degeneration and neurosensory hearing loss in combination with obesity (Noben-Trauth et al, 1996). Affected mice exhibit reduced ERG amplitudes which are extinguished by 6 months of age (Heckenlively et al, 1995). There is focal and diffuse loss of the RPE, with patches of pigment deposits on

242

Gene Therapy and Molecular Biology Vol 11, page 243 indirect ophthalmoscopy. Photoreceptors and the outer nuclear layer undergo progressive degeneration, and by 8 months of age, no photoreceptors are present. Inner ear histology also shows loss of both inner and outer ear hair cells in the organ of Corti by 6 months. While the molecular genetics of the rd5 mouse are not completely understood, it is thought that the tub mutation is not associated with a primary axonemal defect (Ohlemiller, 1998). However, it is clear that mutations in the tub gene family (e.g. tubby-like proteins) are involved in retinal degeneration (Ikeda et al, 2000).

The inbred mouse strain RBF/DnJ was the first proposed model for type IIA USH in 1997 (Pieke-Dahl et al, 1997). Retinal degeneration in this mouse is caused by a defect in retinal degeneration 3 (rd3), which is a recessive gene that has been localized to mouse chromosome 1 (Chang et al, 1993). This is orthologous to the location of the USH2A gene in humans (DeBry and Seldin, 1996). Retinal degeneration due to rd3 is characteristic of a progressive rod-cone dystrophy beginning at about 2 weeks of age (Chang et al, 1993).

Unlike the rd or rds mouse, initial photoreceptor development until that time is thought to be normal. There are no reports of hearing or vestibular abnormalities in mice that are homozygous only for rd3. However, PiekeDahl and colleagues found that RBF/DnJ mice develop progressive high frequency hearing loss, which may be independent of the rd3 gene (Pieke-Dahl et al, 1997).

Several mouse models of USH in the literature develop hearing loss but fail to demonstrate the progressive retinal degeneration that is characteristic of this disease. The Ames waltzer (av) mouse is one such animal model of USH1F, due mainly to the severe vestibular and auditory impairment seen in affected animals (Raphael et al, 2001). Hearing loss in affected mice is due to a recessive mutation in the Pcdh15 gene, which encodes a protein called protocadherin (Ahmed et al, 2001; Alagramam et al, 2001). Ahmed and colleagues showed that PCDH15 is expressed in the retina and may contribute to both RP and hearing loss in affected USH1F patients (Ahmed et al, 2001). However, a study of ERG and histology in av mice did not find any retinal abnormalities due to mutations in Pcdh15 (Ball et al, 2003b). A more recent study confirmed the lack of histologic changes on retinal sections, but did find attenuated scotopic ERG amplitudes in affected mice (Haywood-Watson et al, 2006). As a result, mutations in Pcdh15 do not accurately mimic the RP seen in human USH1F. The waltzer (v) mouse has also been proposed as an animal model of USH1D because of the development of hearing loss secondary to a defect in the Cdh23 gene (Di Palma et al, 2001). Specifically, Cdh23 encodes a type of cadherin that is expressed in the sensory hair cells of the cochlea (Di Palma et al, 2001; Wilson et al, 2001). A later study of the relationship between retinal function and Cdh23 found that mutations in this gene do in fact cause retinal dysfunction, but not retinal degeneration (Libby et al, 2003). Retinal histology shows no signs of photoreceptor degeneration or anatomic abnormalities,

although some changes were noted in ERGs of mutant mice.

Myosin VIIa (MYO7A) is a gene that has been linked to USH1B (Weil et al, 1997). It is involved in deafness at the mouse equivalent Myo7a locus and has been proposed as a model of USH1B (Gibson et al, 1995). Previously, this model was called the shaker1 (sh1) mouse. Though myosin VIIa is present in the RPE and photoreceptors, mutations in MYO7A have not been shown to cause retinal degeneration in affected mice with hearing loss (elAmraoui et al, 1996; Hasson et al, 1995; Liu et al, 1997, 1999). Like the waltzer mouse however, Libby and Steel showed that the sh1 mouse has decreased ERG amplitudes in spite of normal retinal structure (Libby and Steel, 2001).

Hearing impairment has also led to the use of a strain of BUB/BnJ (Mass1frings) mouse as a model of USH IIC (Johnson et al, 2005; Klein et al, 2005). The responsible defect is a nonsense mutation found in the monogenic audiogenic seizure-susceptible gene (MASS1) (Skradski et al, 2001). It is thought that MASS1 is involved in the transcription of a very large G-protein couple receptor family (VLGR1) whose function is unknown (McMillian et al, 2002). However, visual defects have not been reported in this model. As a result, it appears that the Mass1frings mouse, like the av, v, and Myo7a mice, is a good model for the hearing loss seen in USH but is challenging for studying the retinal degeneration associated with the human disease.

Recently, a knock-in mouse containing the Ush1c216A mutation was developed to mimic USH1C (Lentz et al, 2006). The introduction of the 216G!A splice site mutation, found in some patients with USH1C, caused circling and head tossing behavior that are characteristic in deaf mice. However, it is not known whether these mice develop progressive retinal degeneration as well.

E. Bardet-Biedl syndrome BBS is a genetic disorder in which retinopathy is seen as part of a constellation of systemic symptoms including obesity, polydactyly, mental retardation, hypogenitalism, and renal abnormalities of varying severity. In addition, cardiac anomalies, ataxia, poor coordination, and hearing loss have also been reported. To date, twelve BBS loci, named BBS1 â&#x20AC;&#x201C; BBS12, have been uncovered (Koenig, 2003; Stoetzel et al, 2007). Of these, BBS1 is the most common, accounting for almost half of all cases of BBS (Mykytyn et al, 2002). However, it is still unclear what the exact function of the BBS proteins are.

1. Models of Bardet-Biedl syndrome Thus far, animal models of BBS have only been found in rodents. Mice that possess a null mutation in the BBS genes have displayed a phenotype mimicking the multiorgan involvement seen in human BBS. There are currently three knockout mouse models of BBS which involve a lack of expression of one of the BBS proteins Bbs2-/-, Bbs4-/-, and Bbs6-/- (also known as MKKS). The first model to be reported was the Bbs4-null mouse, which possesses many of the features seen in human BBS, including obesity and retinal degeneration (Mykytyn et al, 243

Song et al: Genetic models of retinal degeneration and targets for gene therapy 2004). Lack of proper Bbs4 expression results in failure of flagella synthesis during spermatogenesis. However, ciliogenesis remains intact. While the loss of Bbs4 does not appear to affect the initial formation of photoreceptor outer segments, it has been proposed that intracellular transport required for maintenance of the outer segments is somehow compromised leading to retinal degeneration. In contrast, the Bbs2 knockout mouse has renal cysts and defects in olfaction in addition to retinopathy, obesity, and impaired spermatogenesis (Nishimura et al, 2004). In Bbs2-/- retinopathy, the initial development of the retina is normal, but this is soon followed by apoptotic photoreceptor death secondary to mislocalization of rhodopsin. Both the Bbs4 and Bbs2 knockout mice show deficits in social interaction as well.

BBS6 is a gene that is also known as MKKS, because of its relationship to an autosomal recessive disorder called McKusick-Kaufman syndrome (MKS), which has many clinical features that overlap with BBS. A small percentage of BBS cases are due to a defect in MKKS. As a result, Fath and colleagues developed a knockout mouse of the Mkks gene which resulted in another animal model with a phenotype resembling BBS (Fath et al, 2005). Like the Bbs2 and Bbs4 knockout mice, these animals developed retinopathy, impaired spermatozoa flagella formation, and obesity. In addition, there was elevated blood pressure and deficits in olfaction and social dominance. Retinas appeared normal early in life, but by 8 months, the outer nuclear layer was completely degenerated and the presence of inner and outer segments was not detectable.

One mouse model that does not involve the impairment of BBS gene expression is the tubby mouse described above. Since BBS can be characterized partially as a human obesity syndrome, the phenotypic similarity of this model combined with the presence of retinopathy makes the tubby mouse an adequate model for BBS as well as USH (Noben-Trauth et al, 1996; Ohlemiller et al, 1995). Key features of the genetic models of RP-related syndromes are listed in Table 3.

A. Achromatopsia Achromatopsia is a rare, recessive disease in which affected individuals present during infancy with nonprogressive cone dysfunction and total color blindness.

As a result, patients with achromatopsia experience poor visual acuity, photophobia, and nystagmus despite a normal fundoscopic exam in most instances (Simunovic and Moore, 1998). ERGs in these patients typically show absent cone responses and preserved rod responses (Andreasson and Tornqvist, 1991).

Two types of achromatopsia are recognized: complete (typical) and incomplete (atypical).

Phenotypically, the two types are similar with the only difference being that incomplete achromatopsia patients tend to retain some residual color vision and have slightly better visual acuity. To date, three genes have been linked to achromatopsia: cyclic nucleotide gated channel !3 (CNGA3), cyclic nucleotide gated channel !3 (CNGB3), and guanine nucleotide binding protein (GNAT2) (Eksandh et al, 2002; Kohl et al, 1998, 2000; Michaelides et al, 2003b; Sundin et al, 2000; Wissinger et al, 2001). Of these, only CNGA3 is associated with both types of achromatopsia (Wissinger et al, 2001).

1. Rodent models of achromatopsia Currently, there are two mouse models of achromatopsia.

The first was generated by a homozygous knockout of the ! subunit of the cyclic nucleotide-gated (CNG) cation channel gene (Biel et al, 1999). Mice that are deficient in CNG3, one of the two types of CNG ! subunits, exhibit progressive cone degeneration with normal rod function and structure. Photopic ERGs and oscillatory potentials in homozygous knockouts show no perceivable cone response, while rod responses were no different from wildtype mice (Lei et al, 2006). Immunohistochemistry showed that CNG3 was absent in the retina of mutant mice, and electron microscopy revealed disorganized cone outer segments.

There are two mice that exhibit cone photoreceptor function loss (cpfl) that have been proposed as models of achromatopsia. The cpfl1 mouse is caused by an autosomal recessive mutation on mouse chromosome 19 that is thought to be one of the first naturally occurring mice with cone dysfunction (Chang et al, 2002). Mice with a homozygous mutation in cpfl1 display a normal fundus and overall retinal structure with a decreased number of cones. Though ERG rod responses are normal, conemediated photoresponses are absent. Recently, Chang and colleagues reported a cpfl3 mouse model which is due to a mutation in the GNAT2 gene (Chang et al, 2006b). As a result, this mutation has also been called GNAT2cpfl3.

Homozygous cpfl3 mice exhibit shortening of outer segments and vacuolization over time as well as signs of early retinal degeneration (retinal vein dilation and arteriole constriction) at 8 months. ERGs show decreased photopic responses that progressively decrease with age and scotopic responses that are near normal at 9 months.

IV. Cone disorders In contrast to RP and other rod-cone dystrophies, cone disorders are a heterogenous group of diseases that are characterized by deficiencies in color vision, loss of day vision, central scotoma, photophobia, and nystagmus (Michaelides et al, 2003a). They are not as prevalent as rod-cone dystrophies, and they may have either a stationary or progressive course. Stationary cone diseases tend to be congenital and affected patients retain normal rod function. Progressive cone dystrophies (and also conerod dystrophies), on the other hand, usually present during childhood or early adolescence with eventual deterioration of rod function as well. While several cone diseases have been identified exhibiting variable modes of inheritance, achromatopsia is the only one with available genetic models for investigation and will be the focus of this discussion.

244

Gene Therapy and Molecular Biology Vol 11, page 245 Table 3. Genetic models of retinitis pigmentosa syndromes.

Name Gene Intracellular transport Bbs2-/BBS2

BBS2 protein

Knockout

Mouse

Bbs4-/-

BBS4

BBS4 protein

Knockout

Mouse

MKKS-/- (BBS6/)

MKKS

BB6 protein

Knockout

Mouse

Protocadherin

Naturallyoccurring

Mouse

rd3 (USH2A)

USH2A protein

Naturallyoccurring

Mouse

Myo7A

Myosin VIIA

Naturallyoccurring

Mouse

tubby (rd5)

Tub

Tub protein

Naturallyoccurring

Mouse

Waltzer (v)

Cdh23

Cadherin

Mouse

Ush1c216A

USH1C

Harmonin

Naturallyoccurring Knock-in

Naturallyoccurrring

Mouse

Structural proteins Ames Waltzer PCDH15 (av)

rd3/rd3

shaker1 (sh1, myo7A)

Transport proteins Frings Mass1

Protein

Mass1 protein

Modification

Species

Mouse

Findings

Disease

Obesity, mislocalized RHO, apoptotic PR death, ONL thinning, infertility, renal cysts Obesity, infertility, apoptotic PR degeneration, thin ONL Obesity, hypertension, increased leptin, reduced ONL, PR degeneration, abnormal social interaction, olfactory dysfunction

BBS

Vestibular and auditory impairment, attenuated scotopic ERG amplitude, normal retinal architecture Progressive rodcone degeneration with normal PR development until 2 weeks, high frequency hearing loss Decreased ERG, abnormal hair cell development, hearing loss PR and ONL degeneration, reduced ERG, inner and outer ear hair cell loss ERG abnormalities, hearing loss Hyperactivity, loss of Preyer reflex, circling, headtossing

USH Type IF

Hearing impairment, audiogenic seizures, ear hair cell degeneration

USH Type IIC

BBS

BBS

USH Type IIA

USH IB

BBS, USH

USH Type ID USH Type IC

Abbreviations: BBS, Bardet-Biedl Syndrome; ERG, electroretinogram; ONL, outer nuclear layer; PR, photoreceptor; RHO, Rhodopsin; USH, Usher Syndrome

2. Nonrodent models of achromatopsia

canines exhibit day-blindness and the absence of retinal cone function as tested on ERG. Linkage mapping of the canine cone degeneration (cd) disease locus identified the canine homologue of the CNGB3 gene as the positional candidate for this spontaneous retinal degeneration. A later

Cone degeneration has also been reported as a naturally occurring autosomal recessive disease in certain Alaskan malamutes and German shorthaired pointer dogs (Sidjanin et al, 2002). Like human achromatopsia, affected

245

Song et al: Genetic models of retinal degeneration and targets for gene therapy report by Hurn et al identified day-blindness in three other breeds of dogs: Rhodesian ridgeback cross, Chihuahua, and the Australian cattle dog (Hurn et al, 2003). Under dim light, these dogs negotiated obstacle courses successfully but became blind during daylight conditions.

ERGs confirmed cone dysfunction in all three animals despite a normal ophthalmic examination. Genetic studies of the three dogs in this report have not been performed.

Table 4 summarizes the features of achromatopsia models along with the progressive cone dystrophy models (discussed below).

Knockout of GC1 in mice is accomplished by targeting the Gucy2e gene (Yang et al, 1999). Though cones are initially present at birth in affected mice, their numbers diminish fairly rapidly over time. By 5 weeks of age, cone cell bodies are unidentifiable on histology and photopic ERG measurements are barely detectable. While rods appear morphologically normal, they exhibit a paradoxical behavior in their response to light. A more recent study showed that the rate of cone cell degeneration occurred more gradually than in the initial report by Yang and colleagues (Coleman et al, 2004). In this report, cone cell loss was most severe in the inferior retina, while 40-70% of cone cells remained in the superior region after 6 months. Both GCAP1 and GCAP2 were downregulated in knockout mice, and immunostaining showed the absence of GCAP1 in the photoreceptor outer segments. Because of the link between GC1 and human Leber Congenital Amaurosis (LCA) as well as the progressive cone dystrophy seen in these animals, the GC1 knockout mouse may be a potential model of LCA (Lotery et al, 2000a; Perrault et al, 1996). The GC1 deficient chicken, also called the rd chicken, is an accepted model of LCA and is discussed below.

B. Models of progressive cone-dominant dystrophies The phototransduction cascade is tightly regulated by proteins such as cGMP-PDE, guanylate cyclase (GC), and guanylate cyclase-activating proteins (GCAPs) (Gorcyzca et al, 1994; Haeseleer et al, 1999; Palczewski et al, 1994; Ridge et al, 2003). Specifically, GCAP is a photoreceptorspecific member of a family of Ca2+-binding proteins that regulate GC activation. It is known that the mammalian retina contains two types of GC (GC1 and GC2) and two forms of GCAPs (GCAP1 and GCAP2). Recent studies have shown that GC1 and GCAP1 are essential for normal cone function and survival (Coleman et al, 2004). As a result, animal models of cone dystrophies have been developed based on these findings.

Due to the genetic proximity of GCAP1 and GCAP2, Mendez and colleagues introduced a double knockout model in which both GCAP proteins were not expressed (Mendez et al, 2001). The Guca1a-/- mouse (previously called GCAP-/-) exhibits decreased flash sensitivity in darkness and delayed recovery of light responses in cones (Mendez et al, 2001; Pennesi et al, 2003). However, introduction of GCAP1 in these mice can restore the rod light response, even in the absence of GCAP2 (Howes et al, 2002).

The absence of GC1 (also known as GCE) abolishes cone cell function in mouse and chicken models as well as reducing the ERG rod response in the GC1 knockout mouse (Semple-Rowland et al, 1998; Yang et al, 1999).

V. Early onset rod-cone dystrophies A. Congenital stationary night blindness Congenital stationary night blindness (CSNB) is the name given to a family of inherited, nonprogressive (stationary) retinal dystrophies in which affected patients experience a loss of rod-mediated (night) vision from birth but never develop the pigmentary and vascular changes associated with RP. Individuals with CSNB show signs of rod dysfunction, but rarely exhibit photoreceptor cell death. As a result, various ERG changes are seen, depending on the type and severity of CSNB. Clinically, these patients experience impaired night vision, decreased visual acuity, myopia, nystagmus, and strabismus (Tsang et al, 2007). CSNB can have an autosomal dominant, autosomal recessive, or X-linked pattern of inheritance.

Table 4. Genetic models of achromatopsia Name

Gene

Protein

Modification

Cd

CNGB3

CNG"3 subunit

Naturally-occurring

CNG3-/-

CNG3

CNG !subunit

Knockout

Alaskan malamute dog, German shorthaired pointer dog Mouse

cpfl3/cpfl3 (GNAT2cpfl3)

GNAT2

Cone transducin G t2!

Naturally-occurring

Mouse

cpfl1

Unknown

Unknown

Naturally-occurring

Mouse

Abbreviations: CNG, cyclic nucleotide gated channel; ERG, electroretinogram

246

Species

Findings Absent ERG cone function, day-blindness

Impaired cone function on ERG, progressive cone degeneration Early signs of retinal degeneration, decreased photopic ERG, progressive outer segment vacuolization Progressive cone degeneration, absent ERG cone photoresponse

Gene Therapy and Molecular Biology Vol 11, page 247 Oguchiâ&#x20AC;&#x2122;s disease is the name given to a non-progressive autosomal recessive variant of CSNB that is the result of defects in rhodopsin kinase and arrestin. X-linked CSNB accounts for the majority of cases in males.

CSNB can be broadly divided into two categories based on severity: complete CSNB (CSNB1) and incomplete CSNB (CSNB2). It is hypothesized that CSNB1 is caused by mutations in the NYX gene, while mutations in CACNA1F are responsible for CSNB2 (BechHansen et al, 1998; Bech-Hansen et al, 2000; Pusch et al, 2000; Strom et al, 1998; Zhang et al, 2003a). Therefore, it is believed that a number of genetic mutations can cause CSNB. Some of these include genetic abnormalities in PDE6B, rod opsin, and rhodopsin kinase (Dryja et al, 1993; Gal et al, 1994; Yamamoto et al, 1997). Particularly in the case of PDE6B, it is still a mystery why abnormalities in this rod-specific protein causes nonprogressive CSNB in some cases and progressive rodcone degeneration in others (Danciger et al, 1995; McLaughlin et al, 1993, 1995).

scotopic conditions using ERG, suggesting decreased rod function. However, cone function appeared to remain intact. Compared to rodents, which are largely nocturnal animals and have few cones in the retina, guinea pigs tend to be more diurnal (like humans). While it appears that this pedigree of animals may be a useful model for studying CSNB, no gene has been identified.

B. Leber congenital amaurosis As its name implies, LCA is a heterogeneous autosomal recessive form of retinal degeneration that occurs in early childhood. Of all the inherited childhood retinal degenerative diseases, LCA is the earliest and the most severe (Perrault et al, 1999). Clinically, many features are seen in LCA including an extinguished ERG, pigmentary retinopathy, photophobia, central (fine) vision deterioration, fundus atrophy, and eye poking. Eventually, children with LCA develop blindness, although the majority of afflicted infants are already blind at birth. In addition, other systemic symptoms, such as cataract and keratoconus are commonly seen in these patients.

Though LCA was first described by Leber in 1869, it was not until 1995 that the first disease-causing gene, LCA1, was identified (Perrault et al, 1999). Since then, research has uncovered several genes that can cause LCA (Dejneka et al, 2003). One of the most significant genes involved in the development of LCA is RPE65 (Gu et al, 1997). It is now known that RPE65 encodes a microsomal protein in the RPE which plays a role in the metabolism of vitamin A, a precursor of rhodopsin. As a result, mutations in RPE65 lead to decreased rhodopsin production and subsequent visual impairment. Other genes implicated in LCA include (but are not limited to) photoreceptorspecific guanylate cyclase (GUCY2D), cone-rod homeobox (CRX), crumbâ&#x20AC;&#x2122;s homolog 1 (CRB1), and the aryl-hydrocarbon interacting protein-like 1 (AIPL1) gene (Lotery et al, 2001; Perrault et al, 1996; Sohocki et al, 2000; Swaroop et al, 1999). To date, the most common single genetic cause of LCA is centrosomal protein 290 (CEP290), which accounts for approximately 21% of all cases (den Hollander et al, 2006).

1. Animal models of congenital stationary night blindness The first reported animal model of CSNB was published in 1978 by Witzel and colleagues who described ERG abnormalities in nyctalopic Appaloosa horses that were similar to those seen in humans with CSNB (Witzel et al, 1978). However, no gene was ever identified, and this animal has had limited utility in studying CSNB due to the impracticalities of housing and handling such a large animal. Until recently, animals with mutations in Rpe65, such as the Swedish Briard dog, were thought to be useful models for CSNB (Aguirre et al, 1998). However, it was later found that these animals had progressive eye disease, which made them unsuitable for the study of stationary night blindness.

Currently, there are two primary mouse models used to study CSNB: the nob (no b-wave) mouse and a transgenic mouse carrying the H258N mutation in the gene encoding Pde6B (Pardue et al, 1998; Tsang et al, 2007).

The nob mouse is a spontaneous, X-linked recessive mouse mutant that was first reported as a model of CSNB in 1998 (Pardue et al, 1998). Its name is derived from the absence of a b-wave on the ERG and decreased light sensitivity, despite normal retinal morphology on light microscopy (Pardue et al, 1998). The nob phenotype is thought to be caused by an 85-bp deletion in the mouse nyx gene, which encodes a protein of unknown function called nyctalopin (Gregg et al, 2003). Since then, a potential rat model of X-linked CSNB has been reported that has similar ERG findings to the nob mouse (Zhang et al, 2003a). However, no gene was identified. Tsang and colleagues recently developed a transgenic mouse model based on the finding that the H258N missense mutation in Pde6B was related to CSNB in a study of a Danish pedigree (Gal et al, 1994; Tsang et al, 2007). ERGs in the H258N mouse show selective loss of the b-wave with relatively normal a-waves (Tsang et al, 2007).

In 2003, Racine et al reported a potential model for CSNB in guinea pigs as a result of consanguineous mating (Racine et al, 2003). Abnormalities were seen during

1. Rodent amaurosis

models

of

Leber

congenital

As is the case with the majority of the inherited retinal degenerations, the most common animal models have been developed in mice. Soon after the discovery of the role of RPE65 in the pathogenesis of LCA, a Rpe65 knockout mouse was developed (Redmond et al, 1998).

Compared to wildtype and heterozygous mice that had normal retinal morphology and ERGs, the knockout mice displayed decreased a-, b-, and c-waves on scotopic ERGs. However, photopic ERGs were preserved in all (wildtype, heterozygous, and knockout) mice, suggesting that a knockout of Rpe65 affects mostly rod function. In addition, affected mice lacked rhodopsin and 11-cisretinal, with an over-accumulation of all-trans-retinyl esters in the RPE, which suggest that there is a block in the RPE visual cycle causing slow retinal degeneration. Light and electron microscopy show that Rpe65-/- mice have

247

Song et al: Genetic models of retinal degeneration and targets for gene therapy shortened and disorganized outer segments with loss of photoreceptor nuclei over time.

Similar to the Rpe65 knockout mouse, the retinal degeneration 12 (rd12) mouse was recently reported as a new, spontaneously occurring mouse model of LCA that is the result of a nonsense mutation in the Rpe65 gene (Pang et al, 2005). Clinically, small, evenly spaced, white dots are seen throughout the retina, which increase with age.

Rod ERGs are diminished in affected animals. Histologic abnormalities are not apparent until 6 weeks of age when disorganization of the outer segment of photoreceptor cells occurs. Eventually, lipid-like droplets accumulate in the RPE cells and the outer segment degenerates. Like the Rpe65 knockout mouse, no rhodopsin or 11-cis-retinal could be detected in the retinas of rd12/rd12 mice.

There are two mouse models of LCA that do not involve abnormalities in RPE65. The first is a homozygous knockout of Crx (Pignatelli et al, 2004).

Mice that are deficient in Crx display abnormal photoreceptor development which leads eventually to a degenerative retinal morphology that is indistinguishable from the rd mouse. Specifically, outer segment morphogenesis is blocked at the elongation stage, causing failure of the phototransduction apparatus and abnormal photoreceptor synaptic endings in the outer plexiform layer (Morrow et al, 2005). Another recently developed model of LCA is the Aipl1 deficient mouse (Dyer et al, 2004; Ramamurthy et al, 2004). AIPL1 is a protein that is expressed only in the pineal gland and the retina, specifically the photoreceptors (Sohocki et al, 2000). It is now known to be chaperone involved in PDE folding (Akey et al, 2002; Pittler et al, 1995; Qin and Baehr, 1994). Mice that are deficient in Aipl1 experience normal development of the outer nuclear layer and photoreceptors, but the photoreceptors undergo rapid degeneration soon thereafter (Ramamurthy et al, 2004). Photoreceptor outer segments are shortened and disorganized, and there is loss of both rod and cone ERGs. Biochemically, it is thought that destabilization of cGMP PDE is the cause of the retinal degeneration seen in these animals.

Mutations in RPGR-interacting protein (RPGRIP) have also been linked to LCA (Gerber et al, 2001). The RPGRIP gene, also known as RPGRIP1, is expressed in photoreceptor cilia, and as its name suggests, the protein encoded by this gene interacts with RPGR to anchor it to connecting photoreceptor cilia (Hong et al, 2001). While the function of the RPGRIP protein is not completely understood, it is thought to be involved in outer segment disk morphogenesis by regulating actin (Zhao et al, 2003).

In addition, RPGRIP tethers RPGR and allows it to regulate proper protein trafficking across connecting cilia.

Rpgrip1-/- mice undergo early and rapidly progressive photoreceptor degeneration, which is clinically similar to LCA patients who experience progressive visual loss that is nearly complete by early adolescence (Pawlyk et al, 2005; Zhao et al, 2003). Photoreceptor abnormalities are seen as early as postnatal day 15, and most photoreceptors are lost by 3 months of age (Zhao et al, 2003). A recent study examining gene replacement therapy in the RPGRIP/mouse demonstrated significant morphologic and partial

functional rescue of the retinal phenotype (Pawlyk et al, 2005).

The rd16 mouse has recently been implicated as a model for LCA due to its progressive and early-onset photoreceptor degeneration and ERG changes (Chang et al, 2006a). The phenotypic abnormalities in this model are due to a truncated CEP290 protein, which leads to impairment of several microtubule-based transport proteins including RPGR. As a result, affected mice develop progressive retinal thinning and decreased scotopic and photopic ERG a- and b-waves which become flat by 4 weeks of age.

2. Non-rodent models of Leber congenital amaurosis In comparison to many other retinal degenerative diseases however, the study of LCA has an advantage in the sense that there are several higher species that can be utilized as disease models. The earliest and one of the most well-known examples is the Swedish Briard dog (Narfstrom et al, 1989; Nilsson et al, 1992; Veske et al, 1999; Wrigstad et al, 1994). These dogs have a homozygrous 4-bp deletion in Rpe65 (Veske et al, 1999).

This defect is thought to cause a nonfunctional mutant protein. As a result, affected animals undergo an early onset, autosomal recessive progressive retinal dystrophy.

Scotopic ERGs are either nonrecordable or of significantly decreased amplitude, while photopic ERGs are relatively preserved (Narfstrom et al, 1989; Redmond et al, 1998).

Rod outer segments showed signs of early degenerative change with continued deterioration over time. Though cones were better preserved, outer segments were shortened in older animals. A lesser known canine model of LCA exists in the miniature dachshund (Curtis and Barnett, 1993; Mellersh et al, 2006). In this case, a mutation in Rpgrip1 causes a recessive cone-rod dystrophy (cord1) in affected animals (Mellersh et al, 2006). ERGs in affected animals are fairly normal early in life but become severely diminished by 9 months of age (Curtis and Barnett, 1993). At 2-3 months, there is thinning of the outer nuclear layer and degenerative changes in the rod outer segments are seen. In addition, the cone-rod dystrophy seen in this model makes it an authentic and accurate model for human LCA (Mellersh et al, 2006).

First reported in 1980, the retinal degeneration (rd) chicken is a model of autosomal recessive blindness at hatch (Cheng et al, 1980). Despite the absence of pathologic changes in the retina at the time of hatch, affected chickens fail to illicit measurable scotopic or photopic ERGs (Ulshafer et al, 1984). Beginning about 1 week after hatch, the first visible changes of degeneration are seen in the photoreceptors, first in the central retina then advancing to the peripheral retina over time. After the photoreceptors begin to degenerate, the RPE and inner retina begin to show signs of pathology. By 8 months of age, there is almost complete degeneration of the photoreceptor cell layer (Ulshafer et al, 1984; Ulshafer and Allen, 1985). Eventually, Semple-Rowland and associates were able to identify a null mutation in the chicken Gc1 gene as being responsible for the decreased levels of cGMP in the rd chicken causing retinal degeneration 248

Gene Therapy and Molecular Biology Vol 11, page 249 (Semple-Rowland et al, 1998). As a result, the rd chicken is considered a spontaneously occurring animal model of LCA. In the case of LCA, gene transfer therapy trials are currently ongoing and have shown great promise in reversing or at least partially ameliorating the visual defects associated with this disease. Initial results in the RPE65 null mutation dog showed improvement of functional vision after subretinal injection of a recombinant adeno-associated virus construct (rAAV.RPE65) (Acland et al, 2001; Ford et al, 2003).

Gene transfer studies have also been successful in restoring visual function in the rd chicken, Gc1 knockout mouse, and the Rpe65 knockout mouse models of LCA as well (Bemelmans et al, 2006; Haire et al, 2006; Williams et al, 2006). A recently published safety study conducted in normal cynomolgus monkeys showed that treatment with rAAV.RPE65 warrants consideration for future human trials (Jacobson et al, 2006).

inner retina is compromised (Ruether et al, 1997). In terms of non-ocular findings, inner ear pathology and hearing loss have been reported in mutant mice as well (Chen et al, 1998). Models of Norrie disease in other species have not yet been reported. Table 5 summarizes the available models of early onset rod-cone dystrophies.

VI. Retinal tumors In recent years, there have been numerous advancements in both the diagnosis and treatment of ocular neoplasms. Of those that occur in the posterior segment of the eye and involve the retina, retinoblastoma is the most well-documented with regard to genetic research and clinical management. Interest in this rare malignant tumor stems from that fact that retinoblastoma is the most common primary cancer of the eye in children, and it has also used as a prototypical model for inherited cancer (Gallie and Phillips, 1984).

Retinoblastoma appears as either a spontaneous, unilateral form or a hereditary, bilateral form (Zhang et al, 2004). According to Knudsonâ&#x20AC;&#x2122;s â&#x20AC;&#x153;two-hitâ&#x20AC;? hypothesis of heritable disease, a mutation in both alleles of the RB1 gene leads to the manifestation of disease (Knudson, 1971). The RB1 gene, located on the long arm of chromosome 13, was the first tumor suppressor gene identified in humans (Friend et al, 1986; Lee et al, 1987) and was subsequently the first tumor suppressor gene knocked out in mice in an attempt to develop an animal model of malignancy (Clarke et al, 1992; Jacks et al, 1992; Lee et al, 1992).

Leukocoria (loss of the red reflex on fundoscopic examination) is the most common presenting sign of retinoblastoma in patients (Figure 7). However, it is also a late sign that is associated with poor globe salvage (Balmer et al, 2006). Strabismus is a less common sign that is typically seen earlier in the course of the disease.

Though treatment in the early stages of the disease is associated with good outcomes, the prognosis for visual function and survival can be poor in the later stages.

C. Norrie disease Norrie disease is a congenital, X-linked recessive neurological syndrome that is characterized by bilateral, congenital blindness (Warburg, 1961, 1966). In addition, leukocoria, retinal detachment, and partial avascularity of the retina may also be seen. In later stages, the eye progressively shrinks and atrophies. A significant number of patients also suffer from hearing loss. Mental retardation and psychotic features develop in up to twothirds of all patients (Gorlin et al, 1995). Multiple studies have identified and confirmed that a variety of mutations in the Norrie disease (NDP) gene can lead to the clinical features seen in Norrie disease (de la Chapelle et al, 1985; Donnai et al, 1988; Gal et al, 1986; Zhu et al, 1989).

1. Models of Norrie disease Only one genetic model of Norrie disease has been reported in the literature to date. The Norrie disease mouse was created by knocking out the Ndph gene (equivalent to NDP in humans), using homologous recombination in embryonic stem cells (Berger et al, 1996). This gene encodes a protein called norrin in the cysteine knot growth factor family and is expressed in the brain and inner retina (Lenzner et al, 2002). Structurally, this protein resembles transforming growth factor-! (TGF!), so it is thought to be involved in developmental and differentiation processes although the precise function is unknown (Meitinger et al, 1993). Hemizygous knockout of the Ndph in mice causes disorganization of the retinal ganglion cell layer and the appearance of fibrous masses within the vitreous body (Berger et al, 1996). The inner nuclear and photoreceptor cell layers exhibit regional disorganization, although it is to a lesser degree than the ganglion cell layer. Rods and cones are affected relatively late in this mouse model, but suggest nonetheless that the Ndph gene product is required for long-term photoreceptor cell survival (Lenzner et al, 2002). Malformation of the retinal vasculature occurs with persistence of hyaloid vessels in the vitreous (Richter et al, 1998). ERGs show a negative b-wave, suggesting that the

Figure 7. Photo taken from a child with leukocoria caused by retinoblastoma.

249

Song et al: Genetic models of retinal degeneration and targets for gene therapy

Table 5. Genetic models of early-onset retinal dystrophies Name Gene Transcription factors crx -/CRX

ND

NDP

Transport proteins AIPL1-/AIPL1

Protein

Modification

Species

Knockout

Mouse

Abnormal PR development, PR dendrite retraction

LCA

Knockout

Mouse

Disorganized RGC layer, late PR degeneration, fibrous masses in vitreous, retinal vessel malformation, negative ERG bwave, hearing loss

ND

AIPL1 protein

Knockout

Mouse

Rapid PR degeneration, abnormal rod and cone ERG, M端ller cell gliosis Progressively decreased ERG, ONL thinning, PR degeneration Early and rapid PR degeneration, oversized outer segment discs

LCA

Early-onset PR degeneration, absent scotopic ERG Absent scotopic and photopic ERG, progressive PR degeneration Absent ERG bwave with normal a-wave Decreased rod ERG, lipid accumulation in RPE cells, PR outer segment disorganization, white dots on retina, absent RHO and 11-cis-retinal Decreased scotopic ERG, slow PR degeneration, absent RHO and 11-cis-retinal, alltrans-retinyl ester accumulation

LCA

Abnormal ERG

CSNB

RPGRIP

RPGR interacting protein

Naturallyoccurring

Miniature dachshund

RPGRIP-/-

RPGRIP

RPGR interacting protein

Knockout

Mouse

Retinal pigment epithelium specific 65 kD protein Photoreceptor guanylate cyclase

Naturallyoccurring

Swedish Briard dog

Naturallyoccurring

Chicken

rd

GC1

Nob

NYX

Nyctalopin

Naturallyoccurring

Mouse

rd12

RPE65

Retinal pigment epithelium specific 65 kD protein

Naturallyoccurring

Mouse

RPE65-/-

RPE65

Retinal pigment epithelium specific 65 kD protein

Knockout

Mouse

Unknown

Naturallyoccurring

Appaloosa horse

Others Nyctalopic Unknown horse

Disease

Cone-rod otx-like homeobox transcription factor Norrin

cord1

Visual cascade Briard dog RPE65

Findings

LCA

LCA

LCA

CSNB

LCA

LCA

Abbreviations: CSNB, Congenital stationary night blindness; ERG, electroretinogram; RGC, retinal ganglion cell; LCA, Leber congenital amaurosis; ND, Norrie disease; ONL, outer nuclear layer; PDE, phosphodiesterase; PR, photoreceptor; RHO, rhodpsin; RPE, retinal pigment epithelium

250

Gene Therapy and Molecular Biology Vol 11, page 251 The first nonchimeric knockout mouse model of retinoblastoma was created in 2004 by introducing six different alleles into a single mouse strain (Zhang et al, 2004). Named after the institution where this model was developed, it has been named the St. Jude retinoblastoma mouse. Their study showed that inactivation of Rb1 and Rbl1 (also known as p107) leads to deregulated proliferation of retinal progenitor cells. Cells deficient in Rb1 and Rbl1 appear to form retinoblastoma in some animals, but these lesions may be more similar to an early stage of retinoblastoma known as “retinoma.” In contrast, mice lacking Rb1, Trp53, and Rbl1 in their retinal progenitor cells developed aggressive, invasive retinoblastoma that even involved the anterior chamber.

B. Models of retinoblastoma Though hereditary retinoblastoma does not occur in nonhuman species, several rodent models of retinoblastoma have been developed by transgenic methods since the discovery of RB1 (Mills et al, 1999).

The first studies targeting the Rb1 gene for the purpose of developing a murine model of retinoblastoma had surprising results. Mice with a homozygous knockout of Rb1 died on day 14 or 15 of gestation. On the other hand, heterozygous Rb1 mice developed pituitary adenomas and medullary thyroid carcinomas but not ocular tumors.

The first true transgenic model of retinoblastoma was ironically the result of work targeted at developing a model of pituitary adenoma. In 1990, Windle et al reported the results of expressing a genetic construct consisting of a viral oncogene, simian virus 40 T antigen (SV40 Tag), with the promoter for the beta subunit of human luteinizing (LHbeta) hormone in mice (Windle et al, 1990). While those mice expressing high levels of LHbeta Tag in the pituitary did develop pituitary adenomas, mice that expressed LHbeta Tag in the retina developed heritable ocular tumors with histologic features similar to human retinoblastoma. Ultrastructurally, tumors in affected mice show small, hyperchromatic cells with large nuclei arranged in a rosette pattern, a finding also known as Flexner-Wintersteiner rosettes (O’Brien et al, 1989; Windle et al, 1990). Homer-Wright rosettes, consisting of a single-layered row of tumor cells surrounding a central lumen of neurofibrils, are also seen. However, it should be noted that rosette formation are nonspecific and can be found in other disruptive conditions of the retina (Johnson et al, 2007). Necrosis and local invasion of the choroid, vitreous, and optic nerve also occurs (O’Brien et al, 1990).

SV40 Tag expression can also be targeted at a specific population of intraocular cells to create tumor models using promoters for other genes besides LHbeta.

One such example is interphotoreceptor retinoid bindingprotein (IRBP), which is a protein that is expressed in both rod and cone photoreceptors during early retinal development (Liou et al, 1994). A transgene construct with an IRBP promotor can be used to direct Tag expression in mice causing the formation of outer retinal tumors (Al-Ubaidi et al, 1992; Howes et al, 1994; Marcus et al, 1996). Retinal tumors in these mice occur earlier than in LHbeta Tag mice and tend to be nonfocal, arising from the entire photoreceptor layer. Homer-Wright rosettes are seen in affected mice, but FlexnerWintersteiner rosettes are not.

The role of viral oncogenes in the development of malignancy has been well-established, particularly in regard to cervical cancer. Two viral oncogenes associated with human papilloma virus-induced malignant transformation are E6 and E7 (Mills et al, 1999).

Transgenic mice that express E6 and E7 in the retina under the control of an alpha-crystallin promotor are prone to develop retinoblastoma tumors that originate in the bipolar layer of the retina (Albert et al, 1994). However, the onset and prevalence of retinal tumors are highly dependent on the genetic background of these E6/E7 transgenic mice (Griep et al, 1998). As crystallin is specific to the lens of the eye, these mice also develop cataracts and lens tumors.

VII. Conclusion The identification of genetic abnormalities using animal models of retinal disease presents a unique opportunity to develop therapeutic modalities for both inherited and acquired retinal degenerative diseases that cannot otherwise be treated. Not only do models of retinal degeneration provide valuable insight into the pathogenesis of these blinding diseases, but they also serve as preclinical models for testing gene-based therapies. In addition, advances in intraocular gene transfer offer potentially new and attractive methods of retinal transgene expression that are less dependent on large scale production of high viral titers. Due to the data from such animal models, the progression from bench to bedside is already in progress. Proposals for clinical trials in earlyonset retinal degeneration patients with defective RPE65 expression have already been approved (Bainbridge et al, 2006). As the medical community awaits these results and continues its efforts to identify new targets for gene transfer therapy, there is now hope that we may be able to provide effective interventions for the millions of people suffering from these most common degenerative diseases of the central nervous system in the near future.

Acknowledgements The Bernard and Shirlee Brown Glaucoma Laboratory is supported by Burroughs-Wellcome Program in Biomedical Sciences, the Bernard Becker-Association of University Professors in Ophthalmology-Research to Prevent Blindness Award, Foundation Fighting Blindness.

Columbia Retinal Phenomics Program is supported by Dennis W. Jahnigen Award of the American Geriatrics Society, Joel Hoffman Fund, Gale and Richard Siegel Stem Cell Fund, Charles Culpeper Scholarship, Schneeweiss Stem Cell Fund, Irma T. Hirschl Charitable Trust, Barbara & Donald Jonas Family Fund, Eye Surgery Fund, and Bernard and Anne Spitzer Stem Cell Fund. CSL is supported by the Homer McK. Rees scholarship. We are especially grateful to Takayuki Nagasaki and members of the Division of Medical Imaging at Edward S. Harkness Eye Institute, Columbia University for their support.

251

Song et al: Genetic models of retinal degeneration and targets for gene therapy Bainbridge JW, Tan MH, Ali RR (2006) Gene therapy progress and prospects: the eye. Gene Ther 13, 1191-1197.

Baird PN, Guida E, Chu DT, Vu HT, Guymer RH (2004) The epsilon2 and epsilon4 alleles of the apolipoprotein gene are associated with age-related macular degeneration. Invest Ophthalmol Vis Sci 45, 1311-1315.

Ball S, Hanzlicek B, Blum M, Pardue M (2003a) Evaluation of inner retinal structure in the age RCS rat. Adv Exp Med Biol 533, 181-188.

Ball SL, Bardenstein D, Alagramam KN (2003b) Assessment of retinal structure and function in Ames waltzer mice. Invest Ophthalmol Vis Sci 44, 3986-3992.

Balmer A, Zografos L, Munier F (2006) Diagnosis and current management of retinoblastoma. Oncogene 25, 5341-5349.

Banerjee P, Kleyn PW, Knowles JA, Lewis CA, Ross BM, Parano E, Kovats SG, Lee JJ, Penchaszadeh GK, Jacobson SG, Gilliam TC (1998) TULP1 mutation in two extended Dominican kindreds with autosomal recessive retinitis pigmentosa. Nat Genet 18, 177-179.

Bauer S, Fujita R, Buraczynska M, Abrahamson M, Ehinger B, Wu W, Falls TJ, Andreasson S, Swaroop A (1998) Phenotype of an X-linked retinitis pigmentosa family with a novel splice defect in the RPGR gene. Invest Ophthalmol Vis Sci 39, 2470-2474.

Bech-Hansen NT, Naylor MJ, Maybaum TA, Pearce WG, Koop B, Fishman GA, Mets M, Musarella MA, Boycott KM (1998) Loss-of-function mutations in a calcium channel !1subunit gene in Xp11.23 cause incomplete X-linked congenital stationary night blindness. Nat Genet 19, 264267.

Bech-Hansen NT, Naylor MJ, Maybaum TA, Sparkes RL, Koop B, Birch DG, Bergen AA, Prinsen CF, Polomeno RC, Gal A, Drack AV, Musarella MA, Jacobson SG, Young RS, Weleber RG (2000) Mutations in NYX, encoding the leucine-rich proteoglycan nyctalopin, cause X-linked complete congenital stationary night blindness. Nat Genet 26, 319-323.

Bemelmans AP, Kostic C, Crippa SV, Hauswirth WW, Lem J, Munier FL, Seeliger MW, Wenzel A, Arsenijevic Y (2006) Lentiviral gene transfer of RPE65 rescues survival and function of cones in a mouse model of Leber congenital amaurosis. PLoS Med 3, e347.

Berger W, van de Pol D, Bachner D, Oerlemans F, Winkens H, Hameister H, Wieringa B, Hendriks W, Ropers HH (1996) An animal model for Norrie disease (ND): gene targeting of the mouse ND gene. Hum Mol Genet 5, 51-59.

Bernstein PS, Tammur J, Singh N, Hutchinson A, Dixon M, Pappas CM, Zabriskie NA, Zhang K, Petrukhin K, Leppert M, Allikmets R (2001) Diverse macular dystrophy phenotype caused by a novel complex mutation in the ELOVL4 gene.

Invest Ophthalmol Vis Sci 42, 3331–3336.

Berson EL, Gouras P, Gunkel RD (1968) Rod responses in retinitis pigmentosa, dominantly inherited.

Arch Ophthalmol 80, 58-67.

Berson EL, Grimsby JL, Adams SM, McGee TL, Sweklo E, Pierce EA, Sandberg MA, Dryja TP (2001) Clinical features and mutations in patients with dominant retinitis pigmentosa1 (RP1). Invest Ophthalmol Vis Sci 42, 2217-2224.

Berson EL, Rosner B, Simonoff E (1980) Risk factors for genetic typing and detection in retinitis pigmentosa. Am J Ophthalmol 89, 763-775.

Biel M, Seeliger M, Pfeifer A, Kohler K, Gerstner A, Ludwig A, Jaissle G, Fauser S, Zrenner E, Hofmann F (1999) Selective loss of cone function in mice lacking the cyclic nucleotidegated channel CNG3. Proc Natl Acad Sci USA 96, 7553– 7557.

Blanton SH, Heckenlively JR, Cottingham AW, Friedman J, Saddler L, Wagner M, Friedman LH, Daiger SP (1991)

References Acland GM, Aguirre GD, Ray J, Zhang Q, Aleman TS, Cideciyan AV, Pearce-Kelling SE, Anand V, Zeng Y, Maguire AM, Jacobson SG, Hauswirth WW, Bennett J (2001) Gene therapy restores vision in a canine model of childhood blindness. Nat Genet 28, 92-95.

Acland GM, Blanton S, Heshfield B, Aguirre GD (1994) XLPRA: a canine retinal degeneration inherited as an Xlinked trait. Am J Med Genet 52, 27-33.

Aguirre GD, Baldwin V, Pearce-Kelling S, Narfstrom K, Ray K, Acland GM (1998) Congenital stationary night blindness in the dog: common mutation in the RPE65 gene indicates founder effect. Mol Vis 4, 23.

Aguirre GD, Farber D, Lolley R, Fletcher RT, Chader GJ (1978) Rod-cone dysplasia in Irish setters: a defect in cyclic GMP metabolism in visual cells. Science 201, 1133-1134.

Aguirre GD, Farber D, Lolley R, O’Brien P, Alligood J, Fletcher RT, Chader G (1982) Retinal degeneration in the dog. III. Abnormal cyclic nucleotide metabolism in rod-cone dysplasia. Exp Eye Res 35, 625-642.

Aker RG, Yananli HR, Gurbanova AA, Ozkaynakci AE, Ates N, van Luigtelaar G, Onat FY (2006) Amygdala kindling in the WAG/Rij rat model of absence epilepsy. Epilepsia 47, 3340.

Akey DT, Zhu X, Dyer M, Li A, Sorensen A, Blackshaw S, Fukuda-Kamitani T, Daiger SP, Craft CM, Kamitani T, Sohocki MM (2002) The inherited blindness associated protein AIPL1 interacts with the cell cycle regulator protein NUB1. Hum Mol Genet 11, 2723–2733.

Al-Ubaidi MR, Font RL, Quiambao AB, Keener MJ, Liou GI, Overbeek PA, Baehr W (1992) Bilateral retina and brain tumors in transgenic mice expressing simian virus 40 large T antigen under control of the human interphotoreceptor retinoid-binding protein promoter. J Cell Biol 119, 16811687.

Alagramam KN, Murcia CL, Kwon HY, Pawlowski KS, Wright CG, Woychik RP (2001) The mouse Ames waltzer hearingloss mutant is caused by mutation of Pcdh15, a novel protocadherin gene. Nat Genet 27, 99-102.

Albert DM, Griep AE, Lambert PF, Howes KA, Windle JJ, Lasudry JG (1994) Transgenic models of retinoblastoma: what they tell us about its cause and treatment. Trans Am Ophthalmol Soc 92, 385-400.

Allikmets R, Seddon JM, Bernstein PS, Hutchinson A, Atkinson A, Sharma S, Gerrard B, Li W, Metzker ML, Wadelius C, Caskey CT, Dean M, Petrukhin K (1999) Evaluation of the best disease gene in patients with age-related macular degeneration and other maculopathies. Hum Genet 104, 449-453.

Allikmets R, Singh N, Sun H, Shroyer NF, Hutchinson A, Chidambaram A, Gerrard B, Baird L, Stauffer D, Peiffer A, Rattner A, Smallwood P, Li Y, Anderson KL, Lewis RA, Nathans J, Leppert M, Dean M, Lupski JR (1997) A photoreceptor cell-specific ATP-binding transporter gene (ABCR) is mutated in recessive Stargardt macular dystrophy.

Nat Genet 15, 236-246.

Ambati J, Anand A, Fernandez S, Sakurai E, Lynn BC, Kuziel WA, Rollins BJ, Ambati BK (2003) An animal model of agerelated macular degeneration in senescent Ccl-2- or Ccr-2deficient mice. Nat Med 9, 1390-1397.

Andreasson S, Tornqvist K (1991) Electroretinograms in patients with achromatopsia. Acta Ophthalmol (Copenh) 69, 711– 716.

Ayuso C, Garcia-Sandoval B, Najera C, Valverde D, Carballo M, Antinolo G (1995) Retinitis pigmentosa in Spain. The Spanish Multicentric and Multidisciplinary Group for Research into Retinitis Pigmentosa. Clin Genet 48, 120–122.

252

Gene Therapy and Molecular Biology Vol 11, page 253 Linkage mapping of autosomal dominant retinitis pigmentosa (RP1) to the pericentric region of human chromosome 8.

Genomics 11, 857-869.

Boggon TJ, Shan WS, Santagata S, Myers SC, Shapiro L (1999) Implication of tubby proteins as transcription factors by structure-based functional analysis. Science 286, 2119-2125.

Boughman JA, Vernon M, Shaver KA (1983) Usher syndrome: definition and estimate of prevalence from two high-risk populations. J Chronic Dis 36, 595-603.

Bowne SJ, Daiger SP, Hims MM, Sohocki MM, Malone KA, McKie AB, Heckenlively JR, Birch DG, Inglehearn CF, Bhattacharya SS, Bird A, Sullivan LS (1999) Mutations in the RP1 gene causing autosomal dominant retinitis pigmentosa. Hum Mol Genet 8, 2121-2128 Bunker CH, Berson EL, Bromley WC, Hayes RP, Roderick TH (1984) Prevalence of retinitis pigmentosa in Maine. Am J Ophthalmol 97, 357-365.

Buraczynska M, Wu W, Fujita R, Buraczynska K, Phelps E, Andreasson S, Bennet J, Birch DG, Fishman GA, Hoffman DR, Inana G, Jacobson SG, Musarella MA, Sieving PA, Swaroop A (1997) Spectrum of mutations in the RPGR gene that are identified in 20% of families with X-linked retinitis pigmentosa. Am J Hum Genet 61, 1287-1292.

Burt DW, Morrice DR, Lester DH, Robertson GW, Mohamed AD, Simmons I, Downey LM, Thuang C, Bridges LR, Patron IR, Gentle M, Smith J, Hocking PM, Inglehearn CF (2003) Analysis of the rdd locus in chicken: a model for human retinitis pigmentosa. Mol Vis 9, 164-170.

Calvert PD, Govardovskii VI, Krasnoperova N, Anderson RE, Lem J, Makino CL (2001) Membrane protein diffusion sets the speed of rod phototransduction. Nature 411, 90-94.

Camenisch TD, BH Koller, Earp HS, Matsushima GK (1999) A novel receptor tyrosine kinase, Mer, inhibits TNF-! production and lipopolysaccharide-induced endotoxic shock.

J Immunol 162, 3498–3503.

Carter-Dawson LD, LaVail MM, Sidman RL (1978) Differential effect of the rd mutation on rods and cones in the mouse retina. Invest Ophthalmol Vis Sci 17, 489-498.

Chang B, Dacey MS, Hawes NL, Hitchcock PF, Milam AH, Atmaca-Sonmez P, Nusinowitz S, Heckenlively JR (2006b) Cone photoreceptor function loss-3, a novel mouse model of achromatopsia due to a mutation in Gnat2. Invest Ophthalmol Vis Sci 47, 5017-5021.

Chang B, Hawes NL, Hurd RE, Davisson MT, Nusinowitz S, Heckenlively JR (2002) Retinal degeneration mutants in the mouse. Vision Res 42, 517-525.

Chang B, Heckenlively JR, Hawes NL, Roderick TH (1993) New mouse primary retinal degeneration (rd-3). Genomics 16, 4549.

Chang B, Khanna H, Hawes N, Jimeno D, He S, Lillo C, Parapuram SK, Cheng H, Scott A, Hurd RE, Sayer JA, Otto EA, Attanasio M, O’Toole JF, Jin G, Shou C, Hildebrandt F, Williams DS, Heckenlively JR, Swaroop A (2006a) In-frame deletion in a novel centrosomal/ciliary protein CEP290/NPHP6 perturbs its interaction with RPGR and results in early-onset retinal degeneration in the rd16 mouse.

Hum Mol Genet 15,1847-1857.

Chen LJ, Liu DT, Tam PO, Chan WM, Liu K, Chong KK, Lam DS, Pang CP (2006) Association of complement factor H polymorphisms with exudative age-related macular degeneration. Mol Vis 12:1536-1542.

Chen Z-Y, Adams JC, Ropers H-H, Brown MC, Berger W, Corey DC (1998) Inner ear pathology in the Norrie knockout mouse supports the role of norrin as a growth factor required for survival and maintenance of cells. Am J Hum Genet 63(suppl), 2057.

Cheng KM, Shoffner RN, Gelatt KN, Gum GG, Otis JS, Bitgood JJ (1980) An autosomal recessive blind mutant in the chicken. Poultry Sci 59, 2179-2182.

Citraro R, Russo E, Gratteri S, Di Paola ED, Ibbadu GF, Curinga C, Gitto R, Chimirri A, Donato G, De Sarro G (2006) Effects of some neurosteroids injected into some brain areas of WAG/Rij rats, an animal model of generalized absence epilepsy. Neuropharmacology 50, 1059-1071.

Clarke AR, Mandaag ER, van Roon M, van der Lugt NM, van der Valk M, Hooper ML, Berns A, te Riele H (1992) Requirement for a functional Rb-1 gene in murine development. Nature 359, 328-330.

Coleman JE, Zhang Y, Brown GAJ, Semple-Rowland SL (2004) Cone cell survival and downregulation of GCAP1 protein in the retinas of GC1 knockout mice. Invest Ophthalmol Vis Sci 45, 3397-3403.

Cremers FP, van de Pol DJ, van Driel M, den Hollander AI, van Haren FJ, Knoers NV, Tijimes N, Bergen AA, Rohrschneider K, Blackenagel A, Pinckers AJ, Deutman AF, Hoyng CB (1998) Autosomal recessive retinitis pigmentosa and conerod dystrophy caused by splice site mutations in the Stargardt disease gene ABCR. Hum Mol Genet 7, 355-362.

Curtis R, Barnett KC (1993) Progressive retinal atrophy in miniature longhaired dachshund dogs. Br Vet J 149, 71–85.

D’Cruz PM, Yasumura D, Weir J, Matthes MT, Abderrahim H, LaVail MM, Vollrath D (2000) Mutation of the receptor tyrosine kinase gene mertk in the retinal dystrophic RCS rat.

Hum Mol Genet 9, 645-651.

Dalke C, Graw J (2005) Mouse mutants as models for congenital retinal disorders. Exp Eye Res 81, 503-512.

Danciger M, Blaney J, Gao Y, Zhao DY, Heckenlively JR, Jacobson SG, Farber DB (1995) Mutations in the PDE6B gene in autosomal recessive retinitis pigmentosa. Genomics 30, 1-7. de la Chapelle A, Sankila E-M, Lindlöf M, Aula P, Norio R (1985) Norrie disease caused by a gene deletion allowing carrier detection and prenatal diagnosis. Clin Genet 28, 317320.

DeBry RW, Seldin MF (1996) Human/mouse orthology.

Genomics 33, 337-351.

Dejneka NS, Rex TS, Bennet J (2003) Gene therapy and animal models for retinal disease. Dev Ophthalmol 37, 188-198. den Hollander AI, Koenekoop RK, Yzer S, Lopez I, Voesenek KE, Zonneveld MN, Strom TM, Meitinger T, Brunner HG, Hoyng CB, van den Born LI, Rohrschneider K, Cremers FP (2006) Mutations in the CEP290 (NPHP6) gene are a frequent cause of Leber congenital amaurosis. Am J Hum Genet 79, 556-561 des Portes V, Pinard JM, Billuart P, Vinet MC, Koulakoff A, Carrie A, Gelot A, Dupuis E, Motte J, Berwald-Netter Y, Catala M, Kahn A, Beldjord C, Chelly J (1998) A novel CNS gene required for neuronal migration and involved in Xlinked subcortical laminar heterotopia and lissencephaly syndrome. Cell 92, 51-61.

Di Palma F, Holme RH, Bryda EC, Belyantseva IA, Pellegrino R, Kachar B, Steel KP, Noben-Trauth K (2001) Mutations in Cdh23, encoding a new type of cadherin cause stereocilia disorganization in waltzer, the mouse model for Usher syndrome type 1D. Nat Genet 27, 103-107.

Dithmar S, Curcio CA, Le NA, Brown S, Grossniklaus HE (2000) Ultrastructural changes in Bruch’s membrane of apolipoprotein E-deficient mice. Invest Ophthalmol Vis Sci 41, 2035-2042.

Donnai D, Mountford RC, Read AP (1988) Norrie disease resulting from a gene deletion: clinical features and DNA studies. J Med Genet 25, 73-78.

Dowling JE, Sidman RL (1962) Inherited retinal dystrophy in the rat. J Cell Biol 14, 73-109.

253

Song et al: Genetic models of retinal degeneration and targets for gene therapy Dryja TP, Berson EL, Rao VR, Oprian DD (1993) Heterozygous missense mutation in the rhodopsin gene as a cause of congenital stationary night blindness. Nat Genet 4, 280-283.

Dryja TP, Berson EL (1995) Retinitis pigmentosa and allied diseases: Implications of genetic heterogeneity. Invest Ophthalmol Vis Sci 36, 1197-1200.

Dryja TP, McGee TL, Reichel E, Hahn LB, Cowley GS, Yandell DW, Sandberg MA, Berson EL (1990) A point mutation of the rhodopsin gene in one form of retinitis pigmentosa.

Nature 343, 364-366.

Duncan JL, LaVail MM, Yasumura D, Matthes MT, Yang H, Trautmann N, Chappelow AV, Feng W, Earp HS, Matsushima GK, Vollrath D (2003) An RCS-like retinal dystrophy phenotype in Mer knockout mice. Invest Ophthalmol Vis Sci 44, 826-838.

Dyer MA, Donovan SL, Zhang J, Gray J, Ortiz A, Tenney R, Kong J, Allikmets R, Sohocki MM (2004) Retinal degeneration in Aipl1-deficient mice: a new genetic model of Leber congenital amaurosis. Brain Res Mol Brain Res 132, 208-220.

Eksandh L, Kohl S, Wissinger B (2002) Clinical features of achromatopsia in Swedish patients with defined genotypes.

Ophthalmic Genet 23, 109–120. el-Amraoui A, Sahly I, Picaud S, Sahel J, Abitbol M, Petit C (1996) Human Usher 1B/mouse shaker-1: the retinal phenotype discrepancy explained by the presence/absence of myosin VIIA in the photoreceptor cells. Hum Mol Genet 5, 1171-1178.

Engel HM, Dawson WW, Ulshafer RJ, Hines MW, Kessler MJ (1988) Degenerative changes in maculas of rhesus monkeys.

Ophthalmologica 196, 143-150.

Espinosa-Heidmann DG, Sall J, Hernandez EP, Cousins SW (2004) Basal laminar deposit formation in APO B100 transgenic mice: complex interactions between dietary fat, blue light, and vitamin E. Invest Ophthalmol Vis Sci 45, 260-266.

Fath MA, Mullins RF, Searby C, Nishimura DY, Wei J, Rahmouni K, Davis RE, Tayeh MK, Andrews M, Yang B, Sigmund CD, Stone EM, Sheffield VC (2005) Mkks-null mice have a phenotype resembling Bardet-Biedl syndrome.

Hum Mol Genet 14, 1109-1118.

Fishman GA, Grover S, Jacobson SG, Alexander KR, Derlacki DJ, Wu W, Buraczynska M, Swaroop A (1998) X-linked retinitis pigmentosa in two families with a missense mutation in the RPGR gene and putative change of glycine to valine at codon 60. Ophthalmology 105, 2286-2296.

Friend SH, Bernards R, Rogelj S, Weinberg RA, Rapaport JM, Albert DM, Dryja TP (1986) A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature 323, 643-646.

Fuse N, Miyazawa A, Mengkegale M, Yoshida M, Wakusawa R, Abe T, Tamai M (2006) Polymorphisms in Complement Factor H and Hemicentin-1 genes in a Japanese population with dry-type age-related macular degeneration. Am J Ophthalmol 142, 1074-1076.

Gal A, Orth U, Baehr W, Schwinger E, Rosenberg T (1994) Heterozygous missense mutation in the rod cGMP phosphodiesterase !-subunit in autosomal dominant stationary night blindness. Nat Genet 7, 64-68.

Gal A, Wieringa B, Smeets DF, Bleeker-Wagemakers L, Ropers HH (1986) Submicroscopic interstitial deletion of the X chromosome explains a complex genetic syndrome dominated by Norrie disease. Cytogenet Cell Genet 42, 219224.

Gallie BL, Phillips RA. (1984) Retinoblastoma: a model of oncogenesis. Ophthalmology 91, 666–672.

Gao J, Cheon K, Nusinowitz S, Liu Q, Bei D, Atkins K, Azimi A, Daiger SP, Farber DB, Heckelively JR, Pierce EA,

Sullivan LS, Zuo J (2002) Progressive photoreceptor degeneration, outer segment dysplasia, and rhodopsin mislocalization in mice with targeted disruption of the retinitis pigmentosa-1 (Rp1) gene. Proc Natl Acad Sci USA 99, 5698-5703.

Gerber S, Perrault I, Hanein S, Barbet F, Ducroq D, Ghazi I, Martin-Coignard D, Leowski C, Homfray T, Dufier JL, Munnich A, Kaplan J, Rozet JM (2001) Complete exonintron structure of the RPGR-interacting protein (RPGRIP1) gene allows the identification of mutations underlying Leber congenital amaurosis. Eur J Hum Genet 9, 561-571.

Gibson F, Walsh J, Mburu P, Varela A, Brown KA, Antonio M, Beisel KW, Steel KP, Brown SD (1995) A type VII myosin encoded by the mouse deafness gene shaker-1. Nature 374, 62-64.

Gleeson JG, Lin PT, Flanagan LA, Walsh CA (1999) Doublecortin is a microtubule-associated protein and is expressed widely by migrating neurons. Neuron 23, 257271.

Gorczyca W, Gray-Keller M, Detwiler P, Palczewski K (1994) Purification and physiological evaluation of a guanylate cyclase activating protein from retinal rods. Proc Natl Acad Sci USA 91, 4014–4018.

Gorlin RJ, Toriello HV, Cohen MM (1995) Hereditary hearing loss and its syndromes. New York: Oxford University Press.

Goto Y, Peachey NS, Ripps H, Naash MI (1995) Functional abnormalities in transgenic mice expressing a mutant rhodopsin gene. Invest Ophthalmol Vis Sci 36, 62-71.

Gould DJ, Sargan DR (2002) Autosomal dominant retinal dystrophy (rdy) in Abyssinian cats: exclusion of PDE6G and ROM1 and likely exclusion of rhodopsin as candidate genes.

Anim Genet 33, 436-440.

Gregg RG, Mukhopadhyay S, Candille SI, Ball SL, Pardue MT, McCall MA, Peachey NS (2003) Identification of the gene and mutation responsible for the mouse nob phenotype.

Invest Ophthalmol Vis Sci 44, 378-384.

Griep AE, Krawcek J, Lee D, Liem A, Albert DM, Carabeo R, Drinkwater N, McCall M, Sattler C, Lasudry JGH, Lambert PF (1998) Multiple genetic loci modify risk for retinoblastoma in transgenic mice. Invest Ophthalmol Vis Sci 39, 2723-2732.

Grondahl J (1987) Estimation of prognosis and prevalence of retinitis pigmentosa and Usher syndrome in Norway. Clin Genet 31, 255-264.

Gu S, Lennon A, Li Y, Lorenz B, Fossarello M, North M, Gal A, Wright A (1998) Tubby-like protein-1 mutations in autosomal recessive retinitis pigmentosa. Lancet 351, 11031104.

Gu SM, Thompson DA, Srikumari CR, Lorenz B, Finckh U, Niccoleti A, Murthy KR, Rathmann M, Kumaramanickavel G, Denton MJ, Gal A (1997) Mutations in RPE65 cause autosomal recessive childhood-onset severe retinal dystrophy. Nat Genet 17, 194-197.

Guillonneau X, Piriev NI, Danciger M, Kozak CA, Cideciyan AV, Jacobson SG, Farber DB (1999) A nonsense mutation in a novel gene is associated with retinitis pigmentosa in a family linked to the RP1 locus. Hum Mol Genet 8, 15411546.

Haeseleer F, Sokal I, Li N, Pettenati M, Rao N, Bronson D, Wechter R, Baehr W, Palczewski K (1999) Molecular characterization of a third member of the guanylyl cyclaseactivating protein subfamily. J Biol Chem 274, 6526–6535.

Hagstrom SA, Duyao M, North MA, Li T (1999) Retinal degeneration in tulp1-/- mice: vesicular accumulation in the interphotoreceptor matrix. Invest Ophthalmol Vis Sci 40, 2795-2802.

254

Gene Therapy and Molecular Biology Vol 11, page 255 Hagstrom SA, North MA, Nishina PM, Berson EL, Dryja TP (1998) Recessive mutations in the gene encoding the tubbylike protein TULP1 in patients with retinitis pigmentosa. Nat Genet 18, 174-176.

Hahn P, Milam AH, Dunaief JL (2003) Maculas affected by agerelated macular degeneration contain increased chelatable iron in the retinal pigment epithelium and Bruch's membrane.

Arch Ophthalmol 121, 1099–1105.

Hahn P, Qian Y, Dentchev T, Chen L, Beard J, Harris ZL, Dunaief JL (2004) Disruption of ceruloplasmin and hephaestin in mice causes retinal iron overload and retinal degeneration with features of age-related macular degeneration. Proc Natl Acad Sci USA 101, 13850–13855.

Haire SE, Pang J, Boye SL, Sokal I, Craft CM, Palczewski K, Hauswirth WW, Semple-Rowland SL (2006) Light-driven cone arrestin translocation in cones of postnatal guanylate cyclase-1 knockout mouse retina treated with AAV-GC1.

Invest Ophthalmol Vis Sci 47, 3745-3753.

Hammond CJ, Webster AR, Snieder H, Bird AC, Gilbert CE, Spector TD (2002) Genetic influence on early age-related maculopathy: a twin study. Ophthalmology 109, 730-736.

Hartong DT, Berson EL, Dryja TP (2006) Retinitis pigmentosa.

Lancet 368, 1795-1809.

Hasson T, Heintzelman MB, Santos–Sacchi J, Corey DP, Mooseker MS (1995) Expression in cochlea and retina of myosin VIIa, the gene product defective in Usher syndrome type 1B. Proc Natl Acad Sci USA 92, 9815-9819.

Haywood-Watson RJ 2nd, Ahmed ZM, Kjellstrom S, Bush RA, Takada Y, Hampton LL, Battey JF, Sieving PA, Friedman TB (2006) Ames Waltzer deaf mice have reduced electroretinogram amplitudes and complex alternative splicing of Pcdh15 transcripts. Invest Ophthalmol Vis Sci 47, 3074-3084.

Heckenlively JR, Chang B, Erway LC, Peng C, Hawes NL, Hageman GS, Roderick TH (1995) Mouse model for Usher syndrome: linkage mapping suggests homology to Usher type I reported at human chromosome 11p15. Proc Natl Acad Sci USA 92, 11100-11104.

Heckenlively JR, Hawes NL, Friedlander M, Nusinowitz S, Hurd R, Davisson M, Chang B (2003) Mouse model of subretinal neovascularization with choroidal anastomosis. Retina 23, 518-522.

Heckenlively JR, Yoser SL, Friedman LH, Oversier JJ (1988) Clinical findings and common symptoms in retinitis pigmentosa. Am J Ophthalmol 105, 504-511.

Hong DH, Pawlyk BS, Shang J, Sandberg MA, Berson EL, Li T (2000) A retinitis pigmentosa GTPase regulator (RPGR) – deficient mouse model for X-linked retinitis pigmentosa (RP3). Proc Natl Acad Sci USA 97, 3649-3654.

Hong DH, Yue G, Adamian M, Li T (2001) Retinitis pigmentosa GTPase regulator (RPGRr)-interacting protein is stably associated with the photoreceptor ciliary axoneme and anchors RPGR to the connecting cilium. J Biol Chem 276, 12091-12099.

Horesh D, Sapir T, Francis F, Wolf SG, Caspi C, Elbaum M, Chelly J, Reiner O (1999) Doublecortin, a stabilizer of microtubules. Hum Mol Genet 8, 1599-1610.

Howes KA, Lasudry JG, Albert DM, Windle JJ (1994) Photoreceptor cell tumors in transgenic mice. Invest Ophthalmol Vis Sci 35, 342-351.

Howes KA, Pennesi ME, Sokal I, Church-Kopish J, Schmidt B, Margolis D, Frederick JM, Rieke F, Palczewski K, Wu SM, Detwiler PB, Baehr W (2002) GCAP1 rescues rod photoreceptor response in GCAP1/GCAP2 knockout mice.

EMBO J 21, 1545-1554.

Huang SH, Huang X, Pittler SJ, Oliveira L, Berson EL, Dryja TP (1995) A mutation in the gene encoding the a-subunit of rod

cGMP phosphodiesterase (PDEA) in retinitis pigmentosa.

Invest Ophthalmol Vis Sci 36, S825.

Humphries MM, Rancourt D, Farrar GJ, Kenna P, Hazel M, Bush RA, Sieving PA, Sheils DM, McNally N, Creighton P, Erven A, Boros A, Gulya K, Capecchi MR, Humphries P (1997) Retinopathy induced in mice by targeted disruption of the rhodopsin gene. Nat Genet 15, 216-219.

Humphries P, Kenna P, Farrar J (1992) On the molecular genetics of retinitis pigmentosa. Science 256, 804-808.

Hurn SD, Hardman C, Stanley RG (2003) Day-blindness in three dogs: clinical and electroretinographic findings. Vet Ophthalmol 6, 127-30.

Ikeda S, Shiva N, Ikeda A, Smith RS, Nusinowitz S, Yan G, Lin TR, Chu S, Heckenlively JR, North MA, Naggert JK, Nishina PM, Duyao MP (2000) Retinal degeneration but not obesity is observed in null mutants of the tubby-like protein 1 gene. Hum Mol Genet 9, 155-163.

Imamura Y, Noda S, Hasizume K, Shinoda K, Yamaguchi M, Uchiyama S, Shimizu T, Mizushima Y, Shirasawa T, Tsubota K (2006) Drusen, choroidal neovascularization, and retinal pigment epithelium dysfunction in SOD1-deficient mice: a model of age-related macular degeneration. Proc Natl Acad Sci USA 103, 11282-11287.

Jacks T, Fazeli A, Schmitt EM, Bronson RT, Goodell MA, Weinberg RA (1992) Effects of an Rb mutation in the mouse. Nature 359, 295-300.

Jacobson SG, Boye SL, Aleman TS, Conlon TJ, Zeiss CJ, Roman AJ, Cideciyan AV, Schwartz SB, Komaromy AM, Doobrajh M, Cheung AY, Sumaroka A, Pearce-Kelling SE, Aguirre GD, Kaushal S, Maguire AM, Flotte TR, Hauswirth WW (2006) Safety in nonhuman primates of ocular AAV2RPE65, a candidate treatment in Leber congenital amaurosis.

Hum Gene Ther 12, 845-858.

Jacobson SG, Buraczynska M, Milam AH, Chen C, Jarvalainen M, Fujita R, Wu W, Huang Y, Cideciyan AV, Swaroop A (1997) Disease expression in X-linked retinitis pigmentosa caused by a putative null mutation in the RPGR gene. Invest Ophthalmol Vis Sci 38, 1983-1997.

Jacobson SG, Cideciyan AV, Iannaccone A, Weleber RG, Fishman GA, Maguire AM, Affatigato LM, Bennett J, Pierce EA, Danciger M, Farber DB, Stone EM (2000) Disease expression of RP1 mutations causing autosomal dominant retinitis pigmentosa. Invest Ophthalmol Vis Sci 41, 18981908.

Jacobson SG, Kemp CM, Cideciyan AV, Macke JP, Sung CH, Nathans J (1994) Phenotypes of stop codon and splice site rhodopsin mutations causing retinitis pigmentosa. Invest Ophthalmol Vis Sci 35, 2521-2534.

Johnson DA, Zhang J, Frase S, Wilson M, Rodriguez-Galindo C, Dyer MA (2007) Neuronal differentiation and synaptogenesis in retinoblastoma. Cancer Res 67, 27012711.

Johnson KR, Zheng QY, Weston MD, Ptacek LJ, Noben-Trauth K (2005) The Mass1frings mutation underlies early onset hearing impairment in BUB/BnJ mice, a model for the auditory pathology of Usher syndrome IIC. Genomics 85, 582-90.

Karan G, Lillo C, Yang Z, Cameron DJ, Locke KG, Zhao Y, Thirumalaichary S, Li C, Birch DG, Vollmer-Snarr HR, Williams DS, Zhang K (2005) Lipofuscin accumulation, abnormal electrophysiology, and photoreceptor degeneration in mutant ELOVL4 transgenic mice: a model for macular degeneration. Proc Natl Acad Sci USA 102, 4164-4169.

Keep JM (1972) Clinical aspects of progressive retinal atrophy in the Cardigan Welsh corgi. Aus Vet J 48, 197-199.

Kijas JW, Cideciyan AV, Aleman TS, Pianta MJ, Pearce-Kelling SE, Miller BJ, Jacobson SG, Aguirre GD, Acland GM (2002) Naturally occurring rhodopsin mutation in the dog causes

255

Song et al: Genetic models of retinal degeneration and targets for gene therapy retinal dysfunction and degeneration mimicking human dominant retinitis pigmentosa. Proc Natl Acad Sci USA 99, 6328–6333 Kim SR, Fishkin N, Kong J, Nakanishi K, Allikmets R, Sparrow JR (2004) Rpe65 Leu450Met variant is associated with reduced levels of the retinal pigment epithelium lipofuscin fluorophores A2E and iso-A2E. Proc Natl Acad Sci USA 101, 11668-11672.

Klaver CC, Allikmets R (2003) Genetics of macular dystrophies and implications for age-related macular degeneration. Dev Ophthalmol 37, 155-169.

Klaver CCW, Wolfs RCW, Assink JJM, van Duijin CM, Hofman A, de Jong PT (1998) Genetic risk of age-related maculopathy. Population-based familial aggregation study.

Arch Ophthalmol 116, 1646-1651.

Klein BD, Fu YH, Ptacek LJ, White HS (2005) Auditory deficits associated with the Frings (Mass1) mutation in mice. Dev Neurosci 27, 321-332.

Kliffen M, Lutgens E, Daemen MJ, de Muinck ED, Mooy CM, de Jong PT (2000) The APO(*)E3-Leiden mouse as an animal model for basal laminar deposit. Br J Ophthalmol 84, 1415-1419.

Knudson AG (1971) Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci USA 68, 820-823.

Koenig R (2003) Bardet-biedl syndrome and usher syndrome.

Dev Ophthalmol 37, 126-140.

Kohl S, Baumann B, Broghammer M, Jagle H, Sieving P, Kellner U, Spegal R, Anastasi M, Zrenner E, Sharpe LT, Wissinger B (2000) Mutations in the CNGB3 gene encoding the !-subunit of the cone photoreceptor cGMP-gated channel are responsible for achromatopsia (ACHM3) linked to chromosome 8q21. Hum Mol Genet 9, 2107–2116.

Kohl S, Marx T, Giddings I, Jagle H, Jacobson SG, ApfelstedtSylla E, Zrenner E, Sharpe LT, Wissinger B (1998) Total colour-blindness is caused by mutations in the gene encoding the !-subunit of the cone photoreceptor cGMP-gated cation channel. Nat Genet 19, 257–259.

Kondoh H, Okada TS, Randall CJ, Brody J, Zahir A, Clayton R (1980) Intrinsic programming of neural retina degeneration in a mutant chick. Dev Growth Differ 22, 724.

Kramer F, White K, Pauleikhoff D, Gehrig A, Passmore L, Rivera A, Rudolph G, Kellner U, Andrassi M, Lorenz B, Rohrschneider K, Blankenagel A, Jurklies B, Schilling H, Schutt F, Holz FG, Weber BH (2000) Mutations in the VMD2 gene are associated with juvenile-onset vitelliform macular dystrophy (best disease) and adult vitelliform macular dystrophy but not age-related macular degeneration.

Eur J Hum Genet 8, 286-292.

Lai YL, Jacoby RO, Jones AM, Papermaster DS (1975) A new form of hereditary retinal degeneration in Wag/Rij rats.

Invest Ophthalmol 14, 62-67.

Lai YL, Jonas AM (1977) Rat model for hereditary retinal degeneration. Adv Exp Med Biol 77, 115-136.

LaVail MM, Battelle BA (1975) Influence of eye pigmentation and light deprivation on inherited retinal dystrophy in the rat.

Exp Eye Res 21, 167-192.

LaVail MM (2001) Legacy of the RCS rat: impact of a seminal study on retinal cell biology and retinal degenerative diseases. Prog Brain Res 131, 617-627.

Lee EY, Chang CY, Hu N, Wang YC, Lai CC, Herrup K, Lee WH, Bradley A (1992) Mice deficient for Rb are nonviable and show defects in neurogenesis and haematopoiesis.

Nature 359, 288-294.

Lee WH, Bookstein R, Hong F, Young LJ, Shew JY, Lee EY. (1987) Human retinoblastoma susceptibility gene: cloning, identification, and sequence. Science 235, 1394–1399.

Lei B, Yao G, Zhang K, Hofeldt KJ, Chang B (2006) Study of rod- and cone-driven oscillatory potentials in mice. Invest Ophthalmol Vis Sci 47, 2732-2738.

Lentz J, Pan F, Ng SS, Deininger P, Keats B (2007) Ush1c216A knock-in mouse survives Katrina. Mutat Res 616, 139-144.

Lenzner S, Prietz S, Feil S, Nuber UA, Ropers HH, Berger W (2002) Global gene expression analysis in a mouse model for Norrie disease: late involvement of photoreceptor cells.

Invest Ophthalmol Vis Sci 43, 2825-2833.

Lewin AS, Drenser KA, Hauswirth WW, Nishikawa S, Yasumura D, Flannery JG, LaVail MM (1998) Ribozyme rescue of photoreceptor cells in a transgenic rat model of autosomal dominant retinitis pigmentosa. Nat Med 4, 967971.

Li ZY, Wong F, Chang JH, Possin DE, Hao Y, Petters RM, Milam AH (1998) Rhodopsin transgenic pigs as a model for human retinitis pigmentosa. Invest Ophthalmol Vis Sci 39, 808-819.

Libby RT, Kitamoto J, Holme RH, Williams DS, Steel KP (2003) Cdh23 mutations in the mouse are associated with retinal dysfunction but not retinal degeneration. Exp Eye Res 77, 731-739.

Libby RT, Steel KP (2001) Electroretinographic anomalies in mice with mutations in Myo7a , the gene involved in human Usher syndrome type IB. Invest Ophthalmol Vis Sci 42, 770-778.

Lin J, Nagasaki T, Mahajan V, Yamashita CK, Ngan SH, Farber DB, Lin CS, Tsang SH (2006) Live Autofluorescence Imaging in a New Mouse Model for Age–Related Macular Degeneration (AMD). Invest Ophthalmol Vis Sci 47: ARVO E-Abstract 4149.

Lindsay S, Inglehearn CF, Curtis A, Bhattacharya S (1992) Molecular Genetics of Inherited Retinal Degenerations. Curr Opin Genet Dev 2, 459-466.

Liou GI, Wang M, Matragoon S (1994) Timing of interphotoreceptor retinoid binding protein (IRBP) gene expression and hypomethylation in developing mouse retina.

Dev Biol 161, 345-356.

Liu C, Li Y, Peng M, Laties AM, Wen R (1999) Activation of caspase-3 in the retina of transgenic rats with the rhodopsin mutation s334ter during photoreceptor degeneration. J Neurosci 19, 4778-85.

Liu X, Udovichenko IP, Brown SD, Steel KP, Williams DS (1999) Myosin VIIa participates in opsin transport through the photoreceptor cilium. J Neurosci 19, 6267-6274.

Liu X, Vansant G, Udovichenko IP, Wolfrum U, Williams DS (1997) Myosin VIIa, the product of the Usher 1B syndrome gene, is concentrated in the connecting cilia of photoreceptor cells. Cell Motil Cytoskeleton 37, 240-252.

Liu YP, Krishna G, Aguirre G, Chader GJ (1979) Involvement of cyclic GMP phosphodiesterase activator in a hereditary retinal degeneration. Nature 280, 62-64.

Lolley RN (1994) The rd gene defect triggers programmed rod cell death. The Proctor Lecture. Invest Ophthalmol Vis Sci 35, 4182-4191.

Lotery A, Namperumalsamy P, Jacobson S, Weleber RG, Fishman GA, Musarella MA, Hoyt CS, Heon E, Levin A, Jan J, Lam B, Carr RE, Franklin A, Radha S, Andorf JL, Sheffield VC, Stone EM (2000a) Mutation analysis of 3 genes in patients with Leber congenital amaurosis. Arch Ophthalmol 118, 538–543.

Lotery AJ, Jacobson SG, Fishman GA, Weleber RG, Fulton AB, Namperumalsamy P, Heon E, Levin AV, Grover S, Rosenow JR, Kopp KK, Sheffield VC, Stone EM (2001) Mutations in the CRB1 gene cause Leber congenital amaurosis. Arch Ophthalmol 119, 415-420.

Lotery AJ, Munier FL, Fishman GA, Weleber RG, Jacobson SG, Affatigato LM, Nichols BE, Schorderet DF, Sheffield VC,

256

Gene Therapy and Molecular Biology Vol 11, page 257 Stone EM (2000b) Allelic variation in the VMD2 gene in best disease and age-related macular degeneration. Invest Ophthalmol Vis Sci 41, 1291-1296.

Machida S, Kondo M, Jamison JA, Khan NW, Kononen LT, Sugawara T, Bush RA, Sieving PA (2000) P23h rhodopsin transgenic rat: correlation of retinal function with histology.

Invest Ophthalmol Vis Sci 41, 3200-3209.

Malek G, Johnson LV, Mace BE, Saloupis P, Schemchel DE, Rickman DW, Toth CA, Sullivan PM, Bowes Rickman C (2005) Apolipoprotein E allele-dependent pathogenesis: a model for age-related retinal degeneration. Proc Natl Acad Sci USA 102, 11900–11905.

Mandal MN, Ambasudhan R, Wong PW, Gage PJ, Sieving PA, Ayyagari R (2004) Characterization of mouse orthologue of ELOVL4: genomic organization and spatial and temporal expression. Genomics 83, 615-625.

Marcus DM, Lasudry JG, Carpenter JL, Windle J, Howes KA, Al-Ubaidi MR, Baehr W, Overbeek PA, Font RL, Albert DM (1996) Trilateral tumors in four different lines of transgenic mice expressing SV40 T-antigen. Invest Ophthalmol Vis Sci 37, 392-396.

Marmorstein AD, Stanton JB, Yocom J, Bakall B, Schiavone MT, Wadelius C, Marmorstein LY, Peachey NS (2004) A model of best vitelliform macular dystrophy in rats. Invest Ophthalmol Vis Sci 45, 3733-3739.

Martin RE, Ranchon-Cole I, Brush RS, Williamson CR, Hopkins SA, Li F, Anderson RE (2004) P23H and S344ter opsin mutations: increasing photoreceptor outer segment n-3 fatty acid content does not affect the course of retinal degeneration. Mol Vis 26, 199-207.

Mata NL, Weng J, Travis GH (2000) Biosynthesis of a major lipofuscin fluorophore in mice and humans with ABCRmediated retinal and macular degeneration. Proc Natl Acad Sci USA 97, 7154-7159.

McKusick VA (1998) Mendelian inheritance in man: A catalog of human genes and genetic disorders. 12th ed. Baltimore: The Johns Hopkins University Press.

McLaughlin ME, Ehrhart TL, Berson EL, Dryja, TP (1995) Mutation spectrum of the gene encoding the ! subunit of rod phosphodiesterase among patients with autosomal recessive retinitis pigmentosa. Proc Natl Acad Sci USA 92, 32493253.

McLaughlin ME, Sandberg MA, Berson El, Dryja TP (1993) Recessive mutations in the gene encoding the !-subunit of rod phosphodiesterase in patients with retinitis pigmentosa.

Nat Genet 4, 130-134.

McMillan DR, Kayes-Wandover KM, Richardson JA, White PC (2002) Very large G-protein couple receptor-1, the largest known cell surface protein, is highly expressed in the developing central nervous system. J Biol Chem 277, 785792.

McWilliam P, Farrar GJ, Kenna P, Bradley DG, Humphries MM, Sharp EM, McConnell DJ, Lawler M, Sheils D, Ryan C, Stevens K, Daiger SP, Humphries P (1989) Autosomal dominant retinitis pigmentosa: localization of an adRP gene to the long arm of chromosome 3. Genomics 5, 619-622.

Meitinger T, Meindl A, Bork P, Rost B, Sander C, Haasemann M, Murken J (1993) Molecular modeling of the Norrie disease protein predicts a cystine knot growth factor tertiary structure. Nat Genet 5, 376-380.

Mellersh CS, Boursnell ME, Pettitt L, Ryder EJ, Holmes NG, Grafham D, Forman OP, Sampson J, Barnett KC, Blanton S, Binns MM, Vaudin M (2006) Canine RPGRIP1 mutation establishes cone-rod dystrophy in miniature longhaired dachshunds as a homologue of human Leber congenital amaurosis. Genomics 88, 293-301.

Mendez A, Burns ME, Sokal I, Dizhoor AM, Baehr W, Palczeski K, Baylor DA, Chen J (2001) Role of guanylate cyclase-

activating proteins (GCAPs) in setting the flash sensitivity of rod photoreceptors. Proc Natl Acad Sci USA 98, 9948-9953.

Michaelides M, Aligianis IA, Holder GE, Simunovic M, Mollon JD, Maher ER, Hunt DM, Moore AT (2003b) Cone dystrophy phenotype associated with a frameshift mutation (M280fsX291) in the !-subunit of cone specific transducin (GNAT2). Br J Ophthalmol 87, 1317–1320.

Michaelides M, Hunt DM, Moore AT (2003a) The cone dysfunction syndromes. Br J Ophthalmol 88, 291-297.

Mills MD, Windle JJ, Albert DM (1999) Models of hereditary retinoblastoma. Surv Ophthalmol 43, 508-518.

Morrow EM, Furukawa T, Raviola E, Cepko CL (2005) Synaptogenesis and outer segment formation are perturbed in the neural retina of crx mutant mice. BMC Neurosci 6, 5.

Mykytyn K, Mullins RF, Andrews M, Chiang AP, Swiderski RE, Yang B, Braun T, Casavant T, Stone EM, Sheffield VC (2004) Bardet-Biedl syndrome type 4 (BBS4)-null mice implicate Bbs4 in flagella formation but not global cilia assembly. Proc Natl Acad Sci USA 101, 8664-8669.

Mykytyn K, Nishimura DY, Searby CC, Shastri M, Yen HJ, Beck JS, Braun T, Streb LM, Cornier AS, Cox GF, Fulton AB, Carmi R, Luleci G, Chandrasekharappa SC, Collins FS, Jacobson SG, Heckenlively JR, Weleber RG, Stone EM, Sheffield VC (2002) Identification of the gene (BBS1) most commonly involved in Bardet-Biedl syndrome, a complex human obesity syndrome. Nat Genet 31, 435-438.

Naash MI, Hollyfield JG, Al-Ubaidi MR, Baehr W (1993) Stimulation of human autosomal dominant retinitis pigmentosa in transgenic mice expressing a mutated murine opsin gene. Proc Natl Acad Sci USA 90, 5499-5503.

Naash MI, Peachey NS, Li Z-Y, Gryczan CC, Goto Y, Blanks J, Milam AH, Ripps H (1996) Light-induced acceleration of photoreceptor degeneration in transgenic mice expressing mutant rhodopsin. Invest Ophthalmol Vis Sci 37, 775-782.

Narfstrom K, Nilsson SE (1987) Hereditary rod-cone degeneration in a strain of Abyssinian cats. Prog Clin Biol Res 247, 349-368.

Narfstrom K, Wrigstad A, Nilsson SEG (1989) The briard dog: a new animal model of congenital stationary night blindness.

Br J Ophthalmol 73, 750-756.

Narfstrom KL, Nilsson SE, Andersson BE (1985) Progressive retinal atrophy in the Abyssinian cat: studies of the DCrecorded electroretinogram and the standing potential of the eye. Br J Ophthalmol 69, 618-623.

Nilsson SEG, Wrigstad A., Narfstrom K (1992) Changes in the DC electroretinogram in briard dogs with hereditary congenital night blindness and partial day blindness. Exp Eye Res 54, 291-296.

Nishimura DY, Fath M, Mullins RF, Searby C, Andrews M, Davis R, Andorf JL, Mykytyn K, Swiderski RE, Yang B, Carmi R, Stone EM, Sheffield VC (2004) Bbs2-null mice have neurosensory deficits, a defect in social dominance, and retinopathy associated with mislocalization of rhodopsin.

Proc Natl Acad Sci USA 101, 16588-16593.

Noben-Trauth K, Naggert JK, North MA, Nishina PM (1996) A candidate gene for the mouse mutation tubby. Nature 380, 534-538.

Novak-Laus K, Suzana Kukulj S, Zoric-Geber M, Bastaic O (2002) Primary tapetoretinal dystrophies as the cause of blindness and impaired vision in the republic of Croatia.

Acta Clin Croat 41, 23-27.

O’Brien JM, Marcus DM, Niffenegger AS, Bernards R, Carpeneter JL, Windle JJ, Melon P, Albert DM (1989) Trilateral retinoblastoma in transgenic mice. Trans Am Ophthalmol Soc 87, 301-322.

O’Brien JM, Marcus DM, Bernards R, Carpenter JL, Windle JJ, Mellon P, Albert DM (1990) A transgenic mouse model for trilateral retinoblastoma. Arch Ophthalmol 108, 1145-1151.

257

Song et al: Genetic models of retinal degeneration and targets for gene therapy O’Gorman S, Flaherty WA, Fishman GA, Berson EL (1988) Histopathologic findings in best’s vitelliform macular dystrophy. Arch Ophthalmol 106, 1261-1268.

Ohlemiller KK, Hughes RM, Mosinger-Ogilvie J, Speck JD, Grosof DH, Silverman MS (1995) Cochlear and retinal degeneration in the tubby mouse. Neuroreport 6, 845-849.

Ohlemiller KK, Mosinger Ogilvie J, Lett JM, Hughes RM, LaRegina MC, Olson LM (1998) The murine tub (rd5) mutation is not associated with a primary axonemal defect.

Cell Tissue Res 291, 489-495.

Olsson JE, Gordon JW, Pawlyk BS, Roof D, Hayes A, Molday RS, Mukai S, Cowley GS, Berson EL, Dryja TP (1992) Transgenic mice with a rhodopsin mutation (Pro23His): a mouse model of autosomal dominant retinitis pigmentosa.

Neuron 9, 815-830.

Pacione LR, Szego MJ, Ikeda S, Nishina PM, McInnes RR (2003) Progress toward understanding the genetic and biochemical mechanisms of inherited photoreceptor degenerations. Annu Rev Neurosci 26, 657-700.

Palczewski K, Subbaraya I, Gorczyca W, Helekar BS, Ruiz CC, Ohguro H, Huang J, Zhao X, Crabb JW, Johnson RS, Walsh KA, Gray-Keller MP, Detwiler PB, Baehr W (1994) Molecular cloning and characterization of retinal photoreceptor guanylyl cyclase-activating protein. Neuron 13, 395–404.

Pang JJ, Chang B, Hawes NL, Hurd RE, Davisson MT, Li J, Noorwez SM, Malhotra R, McDowell JH, Kaushal S, Hauswirth WW, Nusinowitz S, Thompson DA, Heckenlively JR (2005) Retinal degeneration 12 (rd12): a new, spontaneously arising mouse model for human Leber congenital amaurosis (LCA). Mol Vis 28, 152-162.

Pardue MT, McCall MA, LaVail MM, Gregg RG, Peachey NS (1998) A naturally occurring mouse model of x-linked congenital stationary night blindness. Invest Ophthalmol Vis Sci 39, 2443-2449.

Pawlyk BS, Smith AJ, Buch PK, Adamian M, Hong DH, Sandberg MA, Ali RR, Li T (2005) Gene replacement therapy rescues photoreceptor degeneration in a murine model of Leber congenital amaurosis lacking RPGRIP. Invest Ophthalmol Vis Sci 46, 3039-45.

Pearce-Kelling SE, Aleman TS, Nickle A, Laties AM, Aguirre GD, Jacobson SG, Acland GM (2001) Calcium channel blocker D-cis-diltiazem does not slow retinal degeneration in the PDE6B mutant rcd1 canine model of retinitis pigmentosa. Mol Vis 25, 42-47.

Pennesi ME, Howes KA, Baehr W, Wu SM (2003) Guanylate cyclase-activating protein (GCAP) 1 rescues cone recovery kinetics in GCAP1/GCAP2 knockout mice. Proc Natl Acad Sci USA 100, 6783–6788.

Perrault I, Rozet JM, Calvas P, Gerber S, Camuzat A, Dollfus H, Chatelin S, Souied E, Ghazi I, Leowski C, Bonnemaison M, Le Paslier D, Frezal J, Dufier JL, Pittler S, Munnich A, Kaplan J (1996) Retinal-specific guanylate cyclase gene mutations in Leber congenital amaurosis. Nat Genet 14, 461-464.

Perrault I, Rozet JM, Gerber S, Ghazi I, Leowski C, Ducroq D, Souied D, Dufier JL, Munnich A, Kaplan J (1999) Leber congenital amaurosis. Mol Genet Metab 68, 200-208.

Peterson-Jones SM, Entz DD, Sargan DR (1999) cGMP phosphodiesterase mutation causes progressive retinal atrophy in the cardigan welsh corgi dog. Invest Ophthalmol Vis Sci 40, 1637-1644.

Petrukhin K, Koisti MJ, Bakall B, Li W, Xie G, Marknell T, Sandgren O, Forsman K, Holmgren G, Andreasson S, Vujic M, Bergen AA, McGarty-Dugan V, Figueroa D, Austin CP, Metzker ML, Caskey CT, Wadelius C (1998) Identification of the gene responsible for Best macular dystrophy. Nat Genet 19, 241-247.

Petters RM, Alexander CA, Wells KD, Collins EB, Sommer JR, Blanton MR, Rojas G, Hao Y, Flowers WL, Banin E, Cideciyan AV, Jacobson SG, Wong F (1997) Genetically engineered large animal model for studying cone photoreceptor survival and degeneration in retinitis pigmentosa. Nature Biotechnol 15, 965-970.

Pieke-Dahl S, Ohlemiller KK, McGee J, Walsh EJ, Kimberling WJ (1997) Hearing loss in the RBF/DnJ mouse, a proposed animal model of Usher syndrome type IIa. Hear Res 112, 112.

Pierce, EA, Quinn T, Meehan T, McGee TL, Berson EL, Dryja TP (1999) Mutations in a gene encoding a new oxygenregulated photoreceptor protein cause dominant retinitis pigmentosa. Nat Genet 22, 248-254 Pignatelli V, Cepko CL, Strettoi E (2004) Inner retinal abnormalities in a mouse model of Leber's congenital amaurosis. J Comp Neurol 469, 351-359.

Pittler SJ, Fliesler SJ, Fisher PL, Keller PK, Rapp LM (1995) In vivo requirement of protein prenylation for maintenance of retinal cytoarchitecture and photoreceptor structure. J Cell Biol 130, 431–439 Polkinghorne PJ, Capon MR, Berninger T, Lyness AL, Sehmi K, Bird AC (1989) Sorsby’s fundus dystrophy. A clinical study.

Ophthalmology 96, 1763-1768.

Pusch CM, Zeitz C, Brandau O, Pesch K, Achatz H, Feil S, Scharfe C, Maurer J, Jacobi FK, Pinckers A, Andreasson S, Hardcastle A, Wissinger B, Berger W, Meindl A (2000) The complete form of X-linked congenital stationary night blindness is caused by mutations in a gene encoding a leucine-rich repeat protein. Nat Genet 26, 324-327.

Qin N, Baehr W (1994) Expression and mutagenesis of mouse rod photoreceptor cGMP phosphodiesterase. J Biol Chem 269, 3265–3271.

Racine J, Behn D, Simard E, Lachapelle P (2003) Spontaneous occurrence of a potentially night blinding disorder in guinea pigs. Doc Ophthalmol 107, 59-69.

Rah H, Maggs DJ, Blankenship TN, Narfstrom K, Lyons LA (2005) Early-onset, autosomal recessive, progressive retinal atrophy in Persian cats. Invest Ophthalmol Vis Sci 46, 1742-1747.

Rakoczy PE, Sarks SH, Daw N, Constable IJ (1999) Distribution of cathepsin D in human eyes with or without age-related maculopathy. Exp Eye Res 69, 367-374.

Rakoczy PE, Yu MJ, Nusinowitz S, Chang B, Heckenlively JR (2006) Mouse models of age-related macular degeneration.

Exp Eye Res 82, 741-752.

Rakoczy PE, Zhang D, Robertson T, Barnett NL, Papadimitriou J, Constable IJ, Lai CM (2002) Progressive age-related changes similar to age-related macular degeneration in a transgenic mouse model. Am J Pathol 161, 1515-1524.

Ramamurthy V, Niemi GA, Reh TA, Hurley JB (2004) Leber congenital amaurosis linked to AIPL1: a mouse model reveals destabilization of cGMP phosphodiesterase.

Proc Natl Acad Sci USA 101, 13897-13902.

Randall CJ, Wilson MA, Pollock BJ, Clayton RM, Ross AS, Bard JB, McLachlin I (1983) Partial retinal dysplasia and subsequent degeneration in a mutant strain of domestic fowl (rdd). Exp Eye Res 37, 337-347.

Raphael Y, Kobayashi KN, Dootz GA, Beyer LA, Dolan DF, Burmeister M (2001) Severe vestibular and auditory impairment in three alleles of Ames waltzer (av) mice. Hear Res 151, 237-249.

Redmond TM, Yu S, Lee E, Bok D, Hamasaki D, Chen N, Goletz P, Ma JX, Crouch RK, Pfeifer K (1998) Rpe65 is necessary for production of 11-cis-vitamin A in the retinal visual cycle. Nat Genet 20, 344-351.

Richter M, Gottanka J, May CA, Welge-Lussen U, Berger W, Lutjen-Drecoll E (1998) Retinal vasculature changes in

258

Gene Therapy and Molecular Biology Vol 11, page 259 Norrie disease mice. Invest Ophthalmol Vis Sci 39, 24502457.

Ridge K, Abdulaev N, Sousa M, Palczewski K (2003) Phototransduction: crystal clear. Trends Biochem Sci 28, 479–487.

Roof DJ, Adamian M, Hayes A (1994) Rhodopsin accumulation at abnormal sites in retinas of mice with a human P23H rhodopsin transgene. Invest Ophthalmol Vis Sci 35, 40494062.

Rosenfeld PJ, Dryja TP (1995) Molecular Genetics of Retinitis Pigmentosa and Related Retinal Degenerations. In: Wiggs J, ed. Molecular Genetics of Ocular Diseases. New York: Wiley-Liss 99-126.

Rudolf M, Winkler B, Aherrahou Z, Doehring LC, Kaczmarek P, Schmidt-Erfurth U (2005) Increased expression of vascular endothelial growth factor associated with accumulation of lipids in Bruch's membrane of LDL receptor knockout mice.

Br J Ophthalmol 89, 1627-1630.

Ruether K, van de Pol D, Jaissle G, Berger W, Tornow RP, Zrenner E (1997) Retinoschisis-like alterations in the mouse eye due to gene targeting of the Norrie disease (ND) gene.

Invest Ophthalmol Vis Sci 38, 710-718.

Santos-Anderson RM, Tso MO, Wolf ED (1980) An inherited retinopathy in collies: a light and electron microscopic study.

Invest Ophthalmol Vis Sci 19, 1281–1294.

Sanyal S, Jansen HG (1981) Absence of receptor outer segments in the retina of rds mutant mice. Neurosci Lett 21:23-26.

Sanyal S (1987) Cellular site of expression and genetic interaction of the rd and the rds loci in the retina of the mouse. Prog Clin Biol Res 247, 175-194.

Schwesinger C, Yee C, Rohan RM, Joussen AM, Fernandez A, Meyer TN, Poulaki V, Ma JJ, Redmond TM, Liu S, Adamis AP, D’Amato RJ (2001) Intrachoroidal neovascularization in transgenic mice overexpressing vascular endothelial growth factor in the retinal pigment epithelium. Am J Pathol 158, 1161-1172.

Semple-Rowland SL, Lee NR, Van Hooser JP, Palczewski K, Baehr W (1998) A null mutation in the photoreceptor guanylate cyclase gene causes the retinal degeneration chicken phenotype. Proc Natl Acad Sci USA 95, 1271-1276.

Sidjanin DJ, Lowe JK, McElwee JL, Milne BS, Phippen TM, Sargan DR, Aguirre GD, Acland GM, Ostrander EA (2002) Canine CNGB3 mutations establish cone degeneration as orthologous to the human achromatopsia locus ACHM3.

Hum Mol Genet 11, 1823-1833.

Sidman RL, Green MC (1965) Retinal degeneration in the mouse; location of the rd locus in linkage group XVII. J Hered 56, 23-29.

Simunovic MP, Moore AT (1998) The cone dystrophies. Eye 12, 553–565.

Skradski SL, Clark AM, Jiang H, White HS, Fu YH, Ptacek LJ (2001) A novel gene causing a mendelian audiogenic mouse epilepsy. Neuron 31, 537-544.

Sohocki MM, Bowne SJ, Sullivan LS, Blackshaw S, Cepko CL, Payne AM, Bhattacharya SS, Khaliq S, Qasim Mehdi S, Birch DG, Harrison WR, Elder FF, Heckenlively JR, Daiger SP (2000) Mutations in a new photoreceptor-pineal gene on 17p cause Leber congenital amaurosis. Nat Genet 24, 79-83.

Sorsby A, Mason MEJ, Gardner N (1949) A fundus dystrophy with unusual features. Br J Ophthalmol 33, 67-97.

Steinberg RH, Flannery JG, Naash M, Oh P, Matthes MT, Yasumura D, Lau-Villacorta C, Chen J, LaVail MM (1996) Transgenic rat models of inherited retinal degeneration caused by mutant opsin genes. Invest Ophthalmol Vis Sci 37, S698.

Stoetzel C, Muller J, Laurier V, Davis EE, Zaghloul NA, Vicaire S, Jacquelin C, Plewniak F, Leitch CC, Sarda P, Hamel C, de Ravel TJ, Lewis RA, Friederich E, Thibault C, Danse JM,

Verloes A, Bonneau D, Katsanis N, Poch O, Mandel JL, Dollfus H (2007) Identification of a novel BBS gene (BBS12) highlights the major role of a vertebrate-specific branch of chaperonin-related proteins in Bardet-Biedl syndrome. Am J Hum Genet 80, 1-11.

Strauss O, Stumpff F, Mergler S, Wienrich M, Wiederholt M (1998) The Royal College of Surgeons rat: an animal model for inherited retinal degeneration with a still unknown genetic defect. Acta Anat 162101-162111.

Strom TM, Nyakatura G, Apfelstedt-Sylla E, Hellebrand H, Lorenz B, Weber BH, Wutz K, Gutwillinger N, Ruther K, Drescher B, Sauer C, Zrenner E, Meitinger T, Rosenthal A, Meindl A (1998) An L-type calcium-channel gene mutated in incomplete X-linked congenital stationary night blindness.

Nat Genet 19, 260-263.

Suber ML, Pittler SJ, Qin N, Wright GC, Holcombe V, Lee RH, Craft CM, Lolley RN, Baehr W, Hurwitz RL (1993) Irish setter dogs affected with rod/cone dysplasia contain a nonsense mutation in the rod cGMP phosphodiesterase !subunit gene. Proc Natl Acad Sci USA 90, 3968-3972.

Sullivan LS, Heckenlively JR, Bowne SJ, Zuo J, Hide WA, Gal A, Denton M, Inglehearn CF, Blanton SH, Daiger SP (1999) Mutations in a novel retina-specific gene cause autosomal dominant retinitis pigmentosa. Nat Genet 22, 255-259.

Sun H, Tsunenari T, Yau KW, Nathans J (2002) The vitelliform macular dystrophy protein defines a new family of chloride channels. Proc Natl Acad Sci USA 99, 4008-4013.

Sundin OH, Yang J-M, Li Y, Zhu D, Hurd JN, Mitchell TN, Silva ED, Maumenee IH (2000) Genetic basis of total colourblindness among the Pingelapese islanders. Nat Genet 25, 289–93.

Sung CH, Makino C, Baylor D, Nathans J (1994) A rhodopsin gene mutation responsible for autosomal dominant retinitis pigmentosa results in a protein that is defective in localization to the photoreceptor outer segment. J Neurosci 14, 5818-5833.

Swaroop A, Wang QL, Wu W, Cook J, Coats C, Xu S, Chen S, Zack DJ, Sieving PA (1999) Leber congenital amaurosis caused by a homozygous mutation (R90W) in the homeodomain of the retinal transcription factor CRX: direct evidence for the involvement of CRX in the development of photoreceptor function. Hum Mol Genet 8, 299-305.

Tanaka N, Ikawa M, Mata NL, Verma IM (2005) Choroidal neovascularization in transgenic mice expressing prokineticin 1: an animal model for age-related macular degeneration. Mol Ther 13, 609-616.

Tsang SH, Burns ME, Calvert PD, Gouras P, Baylor DA, Goff SP, Arshavsky VY (1998) Role for the target enzyme in deactivation of photoreceptor G protein in vivo. Science 282, 117-121.

Tsang SH, Chen J, Kjeldbye H, Li WS, Simon MI, Gouras P, Goff SP (1997) Retarding photoreceptor degeneration in Pdegtm1/Pdegtml mice by an apoptosis suppressor gene.

Invest Ophthalmol Vis Sci 38, 943-950.

Tsang SH, Gouras P, Yamashita CK, Kjeldbye H, Fisher J, Farber DB, Goff SP (1996) Retinal degeneration in mice lacking the gamma subunit of rod cGMP phosphodiesterase.

Science 272, 1026-1029.

Tsang SH, Woodruff ML, Lin J, Mahajan V, Yamashita CK, Pederson R, Lin CS, Goff SP, Rosenberg T, Larsen M, Farber DB, Nusinowitz S (2007) Transgenic mice carrying the H258N mutation in the gene encoding the !-subunit of phosphodiesterase-6 (PDE6B) provide a model for human congenital stationary night blindness. Hum Mutat 28, 243254.

Ulshafer RJ, Allen C, Dawson WW, Wolf ED (1984) Hereditary retinal degeneration in the Rhode Island Red chicken. I. Histology and ERG. Exp Eye Res 39, 125-135.

259

Song et al: Genetic models of retinal degeneration and targets for gene therapy Ulshafer RJ, Allen CB (1985) Hereditary retinal degeneration in the Rhode Island Red chicken: ultrastructural analysis. Exp Eye Res 40, 865-877.

Ulshafer RJ, Engel HM, Dawson WW, Allen CB, Kessler MJ (1987) Macular degeneration in a community of rhesus monkeys. Ultrastructural observations. Retina 7, 198-203. van Leeuwen R, Klaver CC, Vingerling JR, Hofman A, de Jong PT (2003) Epidemiology of age-related maculopathy : a review. Eur J Epidemiol 18, 845-854.

Van Nie R, Ivanyi D, Demant P (1978) A new H-2 linked mutation, rds causing retinal degeneration in the mouse.

Tissue Antigens 12, 106-108.

Vaughan DK, Coulibaly SF, Darrow RM, Organisciak DT (2003) A morphometric study of light-induced damage in transgenic rat models of retinitis pigmentosa. Invest Ophthalmol Vis Sci 44, 848-855.

Veske A, Nilsson SEG, Narfstrom K, Gal A (1999) Retinal dystrophy of swedish briard/briad-beagle dogs is due to a 4bp deletion in RPE65. Genomics 57, 57-61.

Wang F, Rendahl KG, Manning WC, Quiroz D, Coyne M, Miller SS (2003) AAV-mediated expression of vascular endothelial growth factor induces choroidal neovascularization in rat.

Invest Ophthalmol Vis Sci 44, 781-790.

Warburg, M (1961) Norrie’s disease: a new hereditary bilateral pseudotumour of the retina. Acta Ophthalmol 39, 757-772.

Warburg, M (1966) Norrie’s disease: a congenital progressive oculo-acoustico-cerebral degeneration. Acta Ophthalmol 89(suppl), 1-147.

Weber BH, Lin B, White K, Kohler K, Soboleva G, Herterich S, Seeliger MW, Jaissle GB, Grimm C, Reme C, Wenzel A, Asan E, Schrewe H (2002) A mouse model for Sorsby fundus dystrophy. Invest Ophthalmol Vis Sci 43, 27322740.

Weber BHF, Vogt G, Pruett RC, Stohr H, Felbor U (1994) Mutations in the tissue inhibitor of metalloproteinases-3 (Timp3) in patients with Sorsby’s fundus dystrophy. Nat Genet 8, 352-356.

Weil D, Blanchard S, Kaplan J, Guilford P, Gibson F, Walsh J, Mburu P, Varela A, Levilliers J, Weston MD, Kelley PM, Kimberling WJ, Wagenaar M, Levi-Acobas F, Larget-Piet D, Munnich A, Steel KP, Brown SDM, Petit C (1995) Defective myosin VIIA gene responsible for Usher syndrome type 1B. Nature 374, 60-61.

Weleber RG, Butler NS, Murphey WH, Sheffield VC, Stone EM (1997) X-linked retinitis pigmentosa associated with a 2 base-pair insertion in codon 99 of the RP3 gene RPGR. Arch Ophthalmol 115, 1429-1435.

Weng J, Mata NL, Azarian SM, Tzekov RT, Birch DG, Travis GH (1999) Insights into the function of Rim protein in photoreceptors and etiology of Stargardt’s disease from the phenotype in ABCR knockout mice. Cell 98, 13-23.

Williams ML, Coleman JE, Haire SE, Aleman TS, Cideciyan AV, Sokal I, Palczewski K, Jacobson SG, Semple-Rowland SL (2006) Lentiviral expression of retinal guanylate cyclase1 (RetGC1) restores vision in an avian model of childhood blindness. PLoS Med 3, e201.

Wilson MA, Pollock BJ, Clayton RM, Randall CJ (1982) Early development of a new RP-like mutant in the chick. In: Clayton RM, Reading HW, Haywood J, Wright A, eds.

Problems of normal and genetically abnormal retinas.

London: Academic Press 233-239.

Wilson SM, Householder DB, Coppola V, Tessarollo L, Fritzsch B, Lee EC, Goss D, Carlson GA, Copeland NG, Jenkins NA (2001) Mutations in Cdh23 cause nonsyndromic hearing loss in waltzer mice. Genomics 74, 228-33.

Windle JJ, Albert DM, O’Brien JM, Marcus DM, Disteche CM, Bernards R, Mellon PL (1990) Retinoblastoma in transgenic mice. Nature 343, 665-669.

Wissinger B, Gamer D, Jägle H, Giorda R, Marx T, Mayer S, Tippmann S, Broghammer M, Jurklies B, Rosenberg T, Jacobson SG, Sener EC, Tatlipinar S, Hoyng CB, Castellan C, Bitoun P, Andreasson S, Rudolph G, Kellner U, Lorenz B, Wolff G, Verellen-Dumoulin C, Schwartz M, Cremers FP, Apfelstedt-Sylla E, Zrenner E, Salati R, Sharpe LT, Kohl S (2001) CNGA3 mutations in hereditary cone photoreceptor disorders. Am J Hum Genet 69, 722–737.

Witzel DA, Smith EL, Wilson RD, Aguirre GD (1978) Congenital stationary night blindness: an animal model.

Invest Ophthalmol Vis Sci 17, 788-795.

Wolf ED, Vainisi SJ, Santos–Anderson RM (1978) Rod cone dysplasia in the collie. J Am Vet Med Assoc 173, 13311333.

Woodford BJ, Liu Y, Fletcher RT, Chader GJ, Farber DB, Santos-Anderson R, Tso MO (1982) Cyclic nucleotide metabolism in inherited retinopathy in collies: a biochemical and histochemical study. Exp Eye Res 34, 703-714.

Wrigstad A, Narfstrom K, Nilsson SEG (1994) Slowly progressive changes of the retina and retinal pigment epithelium in briard dogs with hereditary retinal dystrophy.

Doc Ophthalmol 87, 337-354.

Yamamoto S, Sippel C, Berson EL, Dryja TP (1997) Defects in the rhodopsin kinase gene in the Oguchi form of stationary night blindness. Nat Genet 15, 175-178.

Yang R, Robinson S, Xiong W, Yau KW, Birch DG, Garbers DL (1999) Disruption of a retinal guanylyl cyclase gene leads to cone-specific dystrophy and paradoxical rod behavior. J Neurosci 19, 5889–5897.

Yoshida T, Ohno-Matsui K, Ichinose S, Sato T, Iwata N, Saido TC, Hisatomi T, Mochizuki M, Morita I (2005) The potential role of amyloid ! in the pathogenesis of age-related macular degeneration. J Clin Invest 115, 2793–2800.

Zeiss CJ, Acland GM, Aguirre GD (1999) Retinal pathology of canine X-linked progressive retinal atrophy, the locus homologue of RP3. Invest Ophthalmol Vis Sci 40, 32923304.

Zeiss CJ, Ray K, Acland GM, Aguirre GD (2000) Mapping of Xlinked progressive retinal atrophy (XLPRA), the canine homolog of retinitis pigmentosa 3 (RP3). Hum Mol Genet 9, 531-537.

Zhang J, Schweers B, Dyer MA (2004) The first knockout mouse model of retinoblastoma. Cell Cycle 3, 952-959.

Zhang K, Kniazeva M, Han M, Li W, Yu Z, Yang Z, Li Y, Metzker ML, Allikmets R, Zack DJ, Kakuk LE, Lagali PS, Wong PW, MacDonald IM, Sieving PA, Figueroa DJ, Austin CP, Gould RJ, Ayyagari R, Petrukhin K (2001b) A 5-bp deletion in ELOVL4 is associated with two related forms of autosomal dominant macular dystrophy. Nat Genet 27, 8993.

Zhang Q, Acland GM, Zangerl B, Johnson JL, Mao Z, Zeiss CJ, Ostrander EA, Aguirre GD (2001a) Fine mapping of canine XLPRA establishes homology of the human and canine RP3 intervals. Invest Ophthalmol Vis Sci 42, 2466-2471.

Zhang XM, Yang Z, Karan G, Hashimoto T, Baehr W, Yang XJ, Zhang K (2003b) ELOVL4 mRNA distribution in the developing mouse retina and phylogenetic conservation of ELOVL4 genes. Mol Vis 9, 301-307.

Zhang Z, Gu Y, Li L, Long T, Guo Q, Shi L (2003a) A potential spontaneous rat model of X-linked congenital stationary night blindness. Doc Ophthalmol 107, 53-57.

Zhao Y, Hong DH, Pawlyk B, Yue G, Adamian M, Grynberg M, Godzik A, Li T (2003) The retinitis pigmentosa GTPase regulator (RPGR)-interacting protein: subserving RPGR function and participating in disk morphogenesis. Proc Natl Acad Sci USA 100, 3965-3970.

Zhu D, Antonarakis SE, Schmeckpeper BJ, Diergaarde PJ, Greb AE, Maumenee IH (1989) Microdeletion in the X-

260

Gene Therapy and Molecular Biology Vol 11, page 261 chromosome and prenatal diagnosis in a family with Norrie disease. Am J Med Genet 33, 485-488.

Zimmerman WF, Godchaux W, III, Belkin M (1983) The relative proportions of lysosomal enzyme activities in bovine retinal pigment epithelium. Exp Eye Res 36, 151-158.

261

Song et al: Genetic models of retinal degeneration and targets for gene therapy

262

Gene Therapy and Molecular Biology Vol 11, page 263 Gene Ther Mol Biol Vol 11, 263-268, 2007

Evaluation of cross immune response in DNA based vaccinated mice against HSV-1 and HSV-2 Research Article

Mohammad Jazayeri, Hoorieh Soleimanjahi*, Fatemeh Fotouhi, Taravat Bamdad, Abbas Jamali Department of Virology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran

__________________________________________________________________________________ *Correspondence: Hoorieh Soleimanjahi, Ph. D., Department of Virology, Faculty of Medical Sciences, Tarbiat Modares University, P.O. BOX:14110-111, Tehran, Iran; Tel: +98-21-88011001 ext 3561; Fax: +98-21-88013030; e-mail: soleim_h@modares.ac.ir Key words: HSV-1, HSV-2, Glycoprotein D, DNA immunization, Cross immune response Abbreviations: Dulbeccoâ&#x20AC;&#x2122;s modified eagle medium, (DMEM); fetal calf serum, (FCS); glycoprotein D, (gD); Herpes simplex virus, (HSV); lactate dehydrogenase, (LDH); Cytotoxic T Lymphocyte, (CTL) Received: 1 Jun 2003; Revised: 11 September 2007 Accepted: 12 September 2007; electronically published: September 2007

Summary Herpes simplex viruses are the most widespread human viral infections which are major targets of vaccine development. An effective vaccine for HSV must be stimulating both arms of immune system. DNA immunization with HSV-gD gene has been shown to induce both humoral and cellular immune responses against HSV infections.

In the present study the cross immune responses of HSV-gD1 (gD1) or HSV-gD2 (gD2) against two HSV strains were evaluated. Mice were immunized with DNA vaccine containing gD1 or gD2 gene showed considerable responses against HSV-1 and HSV-2 respectively. While gD1 immunized mice showed significant cellular and humoral cross immune responses against HSV-2 strain but, gD2 did not. Due to important role of cellular immune responses against HSV infection, it can be concluded that vaccination with gD1 is more effective compared to gD2 when used as candidate vaccine against HSV infection.

protective immunity in animal models. DNA-based immunization elicits a significant cellular immune response and cytotoxic T lymphocytes (CTLs) as well as humoral immunity to the expressed antigens (Manickan et al, 1995; Tengvall et al, 2005; Soleimanjahi et al, 2006).

It has been shown that immunization with gD recombinant protein induces significant protection against clinically apparent genital herpes in women who were seronegative for both HSV-1 and HSV-2 (BenMohamed et al, 2003). Immunization of animals with purified gD1 or gD2 proteins stimulates the production of neutralizing antibodies and a cross-protective immune response to lethal virus challenge. It is, therefore, a logical target for construction of recombinant vaccines against HSV infections (Heber-Katz and Dietzschold 1986). At the amino acid level, gD1 is 85% identical to gD2. They are similar in antigenic structure and thermal stability but vary in secondary structure which is measurably different (Nicola et al, 1996).

In the present study, the cross immune responses were evaluated in DNA vaccinated BALB/c mice that

I. Introduction Herpes simplex virus (HSV) with two closely related serotypes, HSV-1 and HSV-2, is one of the most common infectious agents in human. They cause orolabelial or sexually transmitted genital and lifelong latent infections (Roizman and Knipe 2001). The incidence of herpes infections continues to increase in populations, and new strains of HSV viruses become resistant to chemotherapy (Bernstein and Stanberry 1999). Thus, prevention and control of HSV infection on a global basis is needed.

HSV glycoproteins are the major targets of vaccination studies as they are highly immunogenic and able to induce humoral and cellular responces .The glycoprotein D (gD) of HSV is a major envelope protein which also expresses in the membrane of infected cells. It plays an important role in the initial stages of viral infection and induces high titers of virus neutralizing antibodies (Fuller and Lee 1992). This glycoprotein is highly conserved and antigenically cross-reactive in HSV1 and HSV-2. Several reports have described the use of plasmid DNAs encoding HSV proteins to evoke a 263

Jazayeri et al:Cross immune response in HSV-gD vaccinated mice immunized with gD1 or gD2 using Cytokine and CTL assay as well as antibody titration.

F. Cytokine assays Three weeks after the last immunization, spleens of individual mice were removed aseptically and homogenized in RPMI 1640 (Gibco-BRL) supplemented with 10% FCS and antibiotics. Erythrocyte-depleted spleen cell suspensions were prepared by treatment with potassium carbonate-buffered NH4Cl solution and plated at a concentration of 2!106 viable cells/ well in 24 well plates. The cells were stimulated with HSV-1 or HSV2 and incubated in a humidified 5% CO2 atmosphere. After 48 h later, supernatants were removed and kept at "80 º C for evaluation of secreted IL-2 level.

The concentration of IL-2 in the supernatants was estimated using ELISA kit (Bender Medsystems), according to the manufacturer’s instructions by comparing the optical densities of the unknowns to those of the standards and presented as mean concentration (#g/ml) ± standard error.

II. Materials and Methods A. Mice Six to eight week old inbred female BALB/c mice were obtained from Pasture Institute of Iran (Karaj, IRI). Given free access to food and water, mice were housed for one week before experiments, and maintained in a good standard condition. All experiments were done according to Animal Care and Use Protocol of Tarbiat Modares University.

B. Cell lines and viruses African green monkey kidney (Vero) cells were grown in Dulbecco’s modified eagle medium (DMEM) supplemented with 5% fetal calf serum (FCS) at 37°C, and used for preparation of virus stocks. WEHI 164 and spleen cells were grown in RPMI1640, supplemented with 10% FCS. The KOS strain of HSV-1 and Iranian isolate of HSV-2 were propagated and subjected to titer determination on Vero cells.

G. CTL assay Three weeks after the last immunization, spleenocyte single cell suspensions were prepared without in vitro stimulation. The WEHI 164 target cells were infected with 5 MOI HSV-1(KOS) or HSV-2 for 4 h and washed three times with assay medium. The CTL activity was measured by the lactate dehydrogenase (LDH) release assay in 96-well roundbottom plates. Target cells (2 ! 104 cells/well) in a 100-µl volume were incubated with 100 µl of effector cells at various effector/ target ratios for 4 h in phenol red-free RPMI 1640 containing 3% FCS. After centrifugation, the supernatants (50 µl/well) were transferred to the 96-well flat-bottom plates, and lyses of target cells was determined by measuring LDH release using the LDH assay kit (Takara Company ) according to the manufacture’s instruction. Blank PBS buffer and a 0.1% Triton X100 solution in PBS buffer were used as controls. The LDHmediated conversion of the tetrazolium salt into red formazan product measured at 490 nm after incubation at room temperature for 30 min. The percentage of specific cytolysis was determined by the following formula: the specific cytolysis (%) = (optical density [OD] of experimental LDH release- OD of spontaneous LDH release of effector cells- OD of spontaneous LDH release from target cells)/(maximum LDH release of target cells- OD of spontaneous LDH release of target cells)!100%. All determinations were performed in triplicate.

C. Preparation of Recombinant plasmid DNA fragments containing gD1 or gD2 genes were subcloned into pcDNA3 under the control of the CMV immediate early promoter. Preparation of competent cells, transformation of bacteria, DNA preparation, and electrophoresis in agarose gels were performed according to the standard protocols (Sambrook and Russell 2001). Maxipreparation of the interest clones were done using endotoxin free plasmid isolation kit (Macherey-Nagel) and transfected into COS-7 using Lipofectamine (Invitrogen) according to the manufacturer’s instructions.The recombinant proteins expression in mammalian cells were examined by indirect Immuno Fluorescence Test (Fotouhi et al, 2005; Soleimanjahi et al, 2006)

D. Study design The mice were put in eight groups (10 mice per group).

The first and second groups of BALB/c mice were immunized three times intramuscularly with 100 µg of pcDNA3 gD1 per mouse into the left and right quadriceps muscles on days 0, 14, and 21. The other two groups of mice were immunized with 100 µg of pcDNA3 gD2 per mouse in the same manner. The fifth and the sixth groups of mice received 100 µg of the pcDNA3 per mouse as null vector. Finally the two last control groups of mice were inoculated intraperitoneally three times with 100 µl of inoculums containing 105 pfu of HSV-1 or 104 pfu of HSV-2 (sub lethal doses). The serum samples were obtained before and 21 days after the last inoculation and subjected to viral neutralization test against HSV-1 and HSV-2 separately. The splenocytes from these subjects were stimulated in vitro with HSV-1 or HSV-2 and subjected to evaluation of CTL responses.

H. Statistical analysis The SPSS version 13 was used for statistical analysis.

Antibody titer, CTL responses (LDH assay) and IL-2 production were analyzed by one-way analysis of variance (ANOVA).

Results were considered to be statistically significant when the P value was less than 0.05.

III. Results A. Induction of HSV antibody in immunized mice

E. Viral neutralizing test The mice were bled by retro-orbital puncture 21 days after the final vaccination. The sera were separated, heat inactivated at 56° C for 30 min and stored individually for serological analyses.

Serial twofold dilutions of serum samples were prepared in duplicate in DMEM containing 5% FCS and then mixed with 100 TCID50 of HSV viruses separately and incubated for 1 hour at 37º C. One hundred microliter of the incubated mixture were added on monolayer Vero cells and then incubated at 37º C for 3 days. The presence of replicating virus in cells was scored by cytopathic assays. The neutralizing titre was defined as the reciprocal of the highest serum dilution at which no viral plaque was detected. In assay complete cytopathic effect was seen in virus control wells.

neutralizing

Three weeks after the last immunization, sera were collected from immunized mice, and the neutralizing titers were determined using Virus Neutralization Test (VNT) as shown in Table 1. The result showed both gD1 and gD2 based DNA vaccine induce significant level of antibody in comparison with pcDNA3 vector groups. Furthermore the results showed that both gD1 and gD2 could induce high level of cross antibody against HSV-2 or HSV-1 respectively, but the differences are not statistically significant.

264

Gene Therapy and Molecular Biology Vol 11, page 265 immunized groups (p< 0.0001). Furthermore gD1 showed suitable levels of IL-2 production, but no significant differences were shown between restimulation by HSV-1 or HSV-2.

In contrast, supernatants from gD2 group which is restimulated by HSV-1 could not produced significant amount of IL-2 in comparison with restimulation by HSV2. The lymphocytes from pcDNA3 mock- immunized mice secreted only very small amounts of IL-2.

B. Cytokine assay Three weeks after the last immunization, cellular immunity was evaluated by measuring IL-2 levels as an indicator of Th1 cell responses. Following in vitro restimulation of splenocytes, a predominant IL-2 secretion was found in vitro. As shown in Figure 1, KOS or HSV-2 immunized mice showed large amounts of IL-2 secretion.

Immunized mice with gD1 and gD2 vaccines showed significant level of IL-2 induction, compared to the mockTable 1. Neutralizing antibody titers in immunized mice Groups

Against

Neutralizing antibody titer

gD1

HSV-1

64 ± 11.6

gD1

HSV-2

33.6 ± 5.5

gD2

HSV-1

22.4 ± 2.6

gD2

HSV-2

35.2 ± 5.2

HSV-2

HSV-2

268.8 ± 44.5

KOS

HSV-1

288 ± 53.3

pcDNA3

HSV-1

8 ± 1.46

pcDNA3

HSV-2

6.8 ± 1.2

Mice were immunized three times with 100 µg of the DNA containing gD-1/gD2(i.m) or HSV-1/ HSV-2 (i.p) as described in Material and Methods. Ten mice per group were bled 3 weeks after the third immunization and the neutralizing antibody titer was evaluated (ANOVA test). The indicated results represent the average of the titers from 10 serum samples ± standard error.

Figure 1. IL-2 production by immunized mice splenocytes. BALB/c mice were immunized three times as described in Materials and Methods. Three weeks after the final immunization, mice were euthanized; spleens from three mice per group were harvested. The single-cell suspensions were prepared and stimulated in vitro for 48 h with heat - inactivated HSV-1 strain KOS or HSV-2.The concentrations of IL-2 in the supernatants were measured by mouse IL-2 ELISA Kit. Each bar represents the mean of the titers from three experiments ± standard error (error bar). Mice immunized with gD1 showed suitable levels of IL-2 production but no significant differences were shown between restimulation by HSV-1 or HSV-2. In contrast, supernatants from gD2 group which is restimulated by HSV-1 failed to produce as high amount of IL-2 in comparison with restimulation by HSV-2 (*P = 0.012).

265

Jazayeri et al:Cross immune response in HSV-gD vaccinated mice

conserved glycoproteins which have high structural and functional homology (Watson et al, 1982). Several study point to gD being a major target of HSV immune clearance due to its highly conserve and antigenically cross-reactive between HSV-1 and HSV-2 (Nesburn et al, 2005).They would engender cross - protective immune responses that would afford protection against HSV-1 and HSV-2 (Grammer et al, 1990; BenMohamed et al, 2003).

Glycoprotein D has emerged as an excellent candidate antigen for inducing a protective immunity in animal models against ocular and genital infections with both types of HSV-1 and HSV-2 (Bourne et al, 2003). DNA vaccine expressing HSV gD is inducer of both humoral and cell mediated immune responses and can provide highly protective responses against disease following virus challenge (Nass et al, 2001). It was shown that antibody may help to prevent the initial infection but is usually insufficient to control and resolve HSV infection and disease. Significant benefit in blocking of HSV infection was achieved when pooled human HSV immunoglobulins was used (Keadle et al, 1997; Dalai et al, 2002). An effective vaccine against HSV should be able to generate a Th1-type T cell response for limiting the progression of disease. A Th1 type of response is important and sufficient to control the progression of infection. Studies by HeberKatz et al have shown that the T cells which respond to HSV-1 gD1-23 do not cross reactive with HSV-2 gD1-23 due to the amino acid differences at positions 7 and 21 (HeberKatz et al, 1985). Ben Mohamed and colleagues showed in 2003 that the epitopes between amino acid 332-358 including V epitope, which induced strong Th1 cytokine, had an important role in secretion of IL-2 and IFN-!, as

C. CTL assay The CTL response in immunized mice was examined in this study by the lactate dehydrogenase (LDH) release assay in 96 well plates. The mice were immunized three times, and the CTL activity was measured as described in Materials and Methods. In contrast to gD1, gD2 immunized mice showed significant difference CTL activity when exposed to HSV-1 or HSV-2 infected target cells. The pcDNA3 mock-immunized mice did not exhibit any detectable CTL response (Figure 2). Based on the results, the cross CTL activities were much stronger in gD1 immunized mice as compared with those in gD2 once.

IV. Discussion Herpes simplex virus infections are major public health problems worldwide with significant morbidity in genital herpes simplex virus type 1 and 2 (Bettahi et al, 2006). The prevalence of HSV infections has increased in the past two decades in developing countries. The magnitude of the public health problem posed by HSV-2 infection in immunocompromised individuals and failure of antiviral drugs to prevent drug resistant HSV spread, points to a clear need for a safe and effective therapeutic vaccine to elicit virus specific cellular immune responses (Hosken 2005).

During the last decade, numerous vaccines that provide protection against HSV infection have been developed. They have primarily focused on various forms of recombinantly expressed glycoproteins (Nicola et al, 1996). Among the 11 known HSV glycoproteins, HSV glycoproteins D (gD1 and gD2) are the most highly

Figure 2. CTL activity in immunized mice. Splenocytes from immunized and mock-immunized mice were prepared as described in Materials and Methods. LDH release assays were performed in triplicate with splenocytes as effector cells and HSV-1(KOS strain) and HSV-2 infected WEHI 164 cells as target cells. Each point represents mean Âą standard error of three experiments. The mice immunized with gD1 and then exposed to HSV-1 or HSV-2 infected target cells not showed significant difference, in comparison with gD2 groups (*P = 0.028 compared with the gD2/HSV-2).

E: T ratio, effector-to-target cell ratio.

266

Gene Therapy and Molecular Biology Vol 11, page 267 indicators of cellular immunity and in restricting HSV replication (Ben Mohamed et al 2003; Goel et al, 2003; Ghaemi et al, 2007).

The published data showed that gD2 vaccines provided cross-protection against disease resulting from genital HSV-1 challenge, and also gD2 has a immunomodulatory effect on HSV-1 infected mice (Bourne et al, 2003). The present study showed that, vaccination with vector containing gD1 significantly induced cellular immune response versus gD2 in challenge experiments using both HSV-1 and HSV-2(P<0.05). Although DNA vaccine containing gD1 or gD2 could induce humoral and cellular immunity against HSV-1 and HSV-2 respectively, but gD1 based vaccine was able to induce stronger cellular response compared to gD2 against both types of herpes simplex viruses. These results support the idea that the gD1 structure may constitute ability for eliciting a cellular immune response to both HSV-1 and HSV-2 when used as DNA vaccine.

In conclusion, the induction of optimal humoral and CMI responses against HSV infection is a critical determinant in the development of an efficient vaccine.

Based on the data obtained in the current study gD1 DNA vaccine can use as a preferred target antigen in HSV vaccine development. It seems that the more effectiveness of gD1 in this study may be due to the existence of its specific epitopes on gD1. Since modulation of T helper subsets as effecter cell populations is responsible for protective immunity, therefore, directing immune responses is needed for considerable protection. In this study we considered cross immune responses between gD DNA vaccines and the cross protection of serum from KOS infected mice as a live vaccine against HSV-2 and vice versa should be performed to compared their efficacy to gD DNA vaccine in future. By focusing specifically on high induction of cell-mediated immunity, specific HSVgD1 based epitopes vaccines could have possible clinical applications against HSV-1 and HSV-2 in the future.

References BenMohamed L, Bertrand G, McNamara C, Gras-Masse H, Hammer J, Wechsler SL, Nesburn AB (2003) Identification of Novel Immunodominant CD4+ Th1-Type T-Cell Peptide Epitopes from Herpes Simplex Virus Glycoprotein D That Confer Protective Immunity. J Virol 77, 9463-9473.

Bernstein DI, Stanberry LR (1999) Herpes simplex virus vaccines. Vaccine 17, 1681-1689.

Bettahi I, Zhang X, Afifi R, Benmohamed L (2006) Protective Immunity to Genital Herpes Simplex Virus Type 1 and Type 2 Provided by Self-Adjuvanting Lipopeptides That Drive Dendritic Cell Maturation and Elicit a Polarized Th1 Immune Response. Viral Immunology 2, 220 -236.

Bourne N, Bravo FJ, Francotte M, Bernstein DI, Myers MG, Slaoui M, Stanberry LR (2003) Herpes Simplex Virus Type 2 Glycoprotein D Subunit Vaccines and Protection against Genital HSV-1 and HSV-2 Disease in Guinea Pigs. J Infect Dis 187,542-549.

Dalai SK, Pesnicak L, Miller GF, Straus SE (2002) Prophylactic and therapeutic effects of human immunoglobulin on the pathobiology of HSV-1 infection, latency, reactivation. J Neurovirol 8, 35-44.

267

Fotouhi F, Roustaee MH, Soleimanjah H, Haqshenas R, (2005) Construction of an eukaryotic expression vector encoding Herpes Simplex Virus Type 2 glycoprotein D (gD2) and in vitro expression of the desired protein. Arch razi 59, 1-11.

Fuller AO, Lee WC (1992) Herpes simplex virus type 1 entry through a cascade of virus-cell interactions requires different roles of gD and gH in penetration. J Virol 66, 5002-5012.

Ghaemi A, Soleimanjahi H, Bamdad T, Soudi S, Arefeian E, Ebtekar M (2007) Induction of humoral and cellular immunity against latent HSV-1 infections by DNA immunization in BALB/c mice (in press). Comp Immunol Microbiol Infect Dis 30, 197-210.

Goel N, Rong Q, Zimmerman D, Rosenthal KS (2003) AL.E.A.P.S. Heteroconjugate vaccine containing a T cell epitope from HSV-1 glycoprotein D elicits Th1 responses and protection. Vaccine 21, 4410-4420.

Grammer SF, Sette A, Colon S, Walker L, Chesnut R (1990) Identification of an HSV-1/HSV-2 cross-reactive T cell determinant. J Immunol 145, 2249-2253.

Heber-Katz E, Hollosi M, Dietzschold B, Hudecz F, Fasman GD (1985) The T cell response to the glycoprotein D of the herpes simplex virus: the significance of antigen conformation. J Immunol 135, 1385-90.

Heber-Katz E, Dietzschold B (1986) Immune response to synthetic herpes simplex virus peptides: the feasibility of a synthetic vaccine. Curr Top Microbiol Immunol 130, 5164.

Hosken AN (2005) Development of a therapeutic vaccine for HSV-2. Vaccine 23, 2395-98.

Keadle TL, Laycock KA, Miller JK, Hook KK, Fenoglio ED, Francotte M, Slaoui M, Stuart PM, Pepose JS (1997) Efficacy of a recombinant glycoprotein D subunit vaccine on the development of primary and recurrent ocular infection with herpes simplex virus type 1 in mice. J Infect Dis 176, 331-338.

Manickan E, Rouse RJ, Yu Z, Wire WS, Rouse BT (1995) Genetic immunization against herpes simplex virus.

Protection is mediated by CD4+ T lymphocytes. J Immunol 155, 259-265.

Nass PH, Elkins KL, Weir JP (2001) Protective immunity against herpes simplex virus generated by DNA vaccination compared to natural infection. Vaccine 19, 1538-1546.

Nesburn AB, Ramos TV, Zhu X, Asgarzadeh H, Nguyen V, BenMohamed L (2005) Local and systemic B cell and Th1 responses induced following ocular mucosal delivery of multiple epitopes of herpes simplex virus type 1 glycoprotein D together with cytosine-phosphate-guanine adjuvant.

Vaccine 23, 873-83.

Nicola A, Willis S, Naidoo N, Eisenberg R, Cohen G (1996) Structure function analysis of soluble forms of herpes simplex virus glycoprotein D. J Virol 70, 3815-3822.

Roizman B, Knipe DM (2001) Herpes simplex viruses and their replication. In: Knipe DM, Howley PM (Eds.), Fields Virology, 4th ed. Lippincott, Williams & Wilkins, Philadelphia, pp. 2399- 2459.

Sambrook J, Russell DW (2001) Molecular Cloning: A Laboratory Manual. (3rd ed). Cold Spring Harbor, N.Y. Soleimanjahi H, RoostaeeMH, Rassaee MJ, Mahboodi F, Kazemnejad A, Bamdad T (2006) The effect of DNA priming-protein boosting on enhancing humoral immunity and protecting mice against lethal HSV infections. FEMS Immunol Med Microbi 46, 100-106.

Tengvall S, Josefsson A, Holmgren J, Harandi AM (2005) CpG oligodeoxynucleotide augments HSV-2 glycoprotein D DNA

Jazayeri et al:Cross immune response in HSV-gD vaccinated mice vaccine efficacy to generate T helper 1 response and subsequent protection against primary genital herpes infection in mice. J Reprod Immunol 68, 53-69.

Watson RJ, Weis JH, Salstrom JS, Enquist LW (1982) Herpes simplex virus type-1 glycoprotein D gene: nucleotide sequence and expression in Escherichia coli. Science 218, 381-384.

268

Gene Therapy and Molecular Biology Vol 11, page 269 Gene Ther Mol Biol Vol 11, 269-274, 2007

Improving probiotic function using a pathobiotechnology approach Review Article

Roy D. Sleator*, Colin Hill Alimentary Pharmabiotic Centre, University College Cork, Ireland

__________________________________________________________________________________ *Correspondence: Roy Sleator, Alimentary Pharmabiotic Centre, University College Cork, Ireland; Phone: 00 353 21 490 1366; Fax: 00 353 21 490 3101; email: r.sleator@ucc.ie Key words: Patho-biotechnology, probiotics, betaine, BetL, Listeria monocytogenes, Bifidobacterium, Lactobacillus Abbreviations: cholera toxin, (Ctx); lipopolysaccharide, (LPS); shiga toxin, (Stx) Received: 28 June 2007; Revised: 29 August 2007 Accepted: 12 September 2007; electronically published: October 2007

Summary Although described for over a century, scientists and clinicians alike are only now beginning to realise the significant medical applications of probiotic cultures. Given the increasing commercial and clinical relevance of probiotics, improving their stress tolerance profile and ability to overcome the physiochemical defences of the host is an important biological goal. Patho-biotechnology describes the application of pathogen derived (ex vivo and in vivo) stress survival strategies for the design of more technologically robust and effective probiotic cultures with improved biotechnological and clinical applications as well as the development of novel vaccine and drug delivery platforms.

effect (Sleator and Hill, 2007a). Herein, we review the most recent advances in this aspect of the pathobiotechnology concept.

This strategy can be further divided into three distinct approaches (Figure 1). The first tackles the issue of probiotic storage and delivery by cloning and expression of pathogen specific stress survival mechanisms (facilitating improved survival at extremes of temperature and water availability), thus countering reductions in probiotic numbers which can occur during manufacture and storage of delivery matrices (such as foods and tablet formulations). The second approach aims to improve host colonisation by expression of host specific survival strategies (or virulence associated factors) thereby positively affecting the therapeutic efficacy of the probiotic. The final approach involves the development of so called â&#x20AC;&#x2DC;designer probioticsâ&#x20AC;&#x2122;; strains which specifically target invading pathogens by blocking crucial ligandreceptor interactions between the pathogen and host cell (Paton et al, 2006).

I. Introduction In 2006 we introduced the term patho-biotechnology to describe the exploitation of pathogenic bacteria, and in particular pathogen stress survival strategies, for beneficial applications in food and biomedicine (Sleator and Hill, 2006). The patho-biotechnology concept encompasses three specific approaches; firstly, the use of attenuated bacterial pathogens as vaccine and/or drug delivery platforms (Roland et al, 2005). The second approach involves the isolation and purification of pathogen-specific immunogenic proteins for direct application (Dietrich et al, 2003), while the third focuses on equipping nonpathogenic or probiotic bacteria with the genetic elements necessary to overcome stresses encountered outside the host (eg spray and freeze drying; experienced during product formulation (Shahidi and Han, 1993; Maa and Prestrelski, 2000) as well as the antimicrobial defences faced during host transit and/or colonisation (eg gastric acidity, bile, low iron and elevated osmolarity) and in some cases to specifically antagonise invading pathogens (Figure 1).

While much information is available concerning the first two approaches (ie the exploitation of attenuated pathogens and their associated virulence factors), considerably less information is available concerning the third approach; so called bio-engineering of nonpathogenic or probiotic strains for improved therapeutic

II. Improving tolerance

probiotic

stress

A. ex vivo Perhaps the most important stresses encountered during food production and/or tablet formulation (the most

269

Sleator and Hill: Improving probiotic function using a patho-biotechnology approach common probiotic delivery matrices) are temperature (both low and high) and water availability (aw) (Hill et al, 2002). The ability to overcome such stresses is thus a particularly desirable trait in the selection of commercially important probiotic strains. A common strategy employed by both prokaryotes and eukaryotes to overcome low aw and temperature stress involves the accumulation of protective compounds, termed compatible solutes (examples of which include betaine and trehalose), which stabilise protein structure and function at low temperatures and prevent water loss from the cell and plasmolysis under low aw conditions (Sleator and Hill, 2002).

Improving a strainâ&#x20AC;&#x2122;s ability to accumulate compatible solutes is thus an obvious step in the development of more robust probiotic strains. Bacteria (as well as higher organisms) have evolved several sophisticated mechanisms for compatible solute accumulation. Indeed, the foodborne pathogen Listeria monocytogenes (probably the best studied pathogen in terms of compatible solute accumulation) possesses three distinct uptake systems (BetL, Gbu and OpuC), the simplest of which (in genetic terms, since it is encoded by a single gene) is the secondary betaine transporter BetL (Sleator et al, 1999, 2000, 2003a,b). By cloning the betL gene under the transcriptional control of the nisin inducible promoter PnisA we were able to assess the ability of BetL, and thus betaine accumulation, to contribute to probiotic survival under a variety of stresses likely encountered during food and/or tablet manufacture (Sheehan et al, 2006). Our probiotic of choice, Lactobacillus salivarius UCC118, while already in possession of an endogenous betaine uptake system (Claesson et al, 2006), exhibits significantly lower accumulation levels than L. monocytogenes and is correspondingly less physiologically robust than the pathogen. Thus, we proposed that expressing betL in L. salivarius might increase betaine accumulation, thereby improving the strains stress tolerance profile. As expected, following nisin induction, the betL complemented L. salivarius strain showed a significant increase in betaine accumulation compared to the wild type (Figure 2a).

Indeed, sufficient BetL was produced to confer increased salt tolerance, with growth of the transformed construct at

significantly higher salt concentrations (7% NaCl) than the parent strain (Figure 2b), or indeed any other lactobacilli.

In addition to increased osmotolerance the BetL+ strain showed significantly improved resistance to both chill and cryotolerance (2 logs greater survival than the control at 20ÂşC and 0.5 logs greater at -70ÂşC) as well as freezedrying (36% survival as compared to 18% for the control strain) and spray-drying (1.4% compared to 0.3%); common stresses encountered during food and/or tablet formulation. Furthermore, the presence of BetL resulted in a significant improvement in barotolerance (Figure 2c).

This is particularly significant given that high pressure processing is gaining increasing popularity as a novel nonthermal mechanism of food processing and preservation (Smiddy et al, 2004, 2005).

As well as compatible solute uptake systems, recent studies have shown that heterologously expressed compatible solute syntheses systems may also offer similar protective effects. For example Termont et al, (2006) recently demonstrated that Lactococcus lactis expressing the trehalose synthesizing genes (ostAB) from Escherichia coli (under the transcriptional control of PnisA) retained almost 100% viability after freeze-drying, together with a markedly prolonged shelf life.

Thus, improving the stress tolerance profile of probiotic cultures significantly improves tolerance to processing stress and prolongs survival during subsequent storage. This in turn contributes to a significantly larger proportion of the administered probiotic reaching the desired location (eg the gastrointestinal tract) in a bioactive form.

B. In vivo In addition to the ex vivo stresses encountered during food/tablet manufacture and storage, probiotic bacteria must also overcome the physiological defences of the host in order to survive within the gastrointestinal tract in sufficient numbers to exert a therapeutic effect. Recently we demonstrated that cloning betL into Bifidobacterium breve UCC2003, significantly improved the tolerance of the probiotic to gastric juice (Sheehan et al, 2007).

Figure 1. Graphic overview of the patho-biotechnology concept.

270

Gene Therapy and Molecular Biology Vol 11, page 271

Figure 2. (A) [14C]glycine betaine uptake in the Lactobacillus salivarius wild type (yellow bar) and the BetL complemented strain UCC118-BetL + (red bar). (B) Growth of L. salivarius wild type (yellow circles) and UCC118-BetL + (red circles) in MRS broth with 7% added NaCl. (C) High-pressure-induced inactivation of L. salivarius wild type (yellow bars) and UCC118-BetL + (red bars). Reproduced from Sheehan et al, 2006 with kind permission from Appl Environ Microbiol.

Interestingly, in support of this observation Termont and colleagues also reported in 2006 improved tolerance to gastric juice in a L. lactis strain expressing the E. coli trehalose synthesis genes, thus suggesting a novel protective role for compatible solutes in the gastric environment.

Once free of the stomach bacteria enter the upper small intestine where they are exposed to low aw conditions (equivalent to 0.3 M NaCl). Consistent with our previous observations with L. salivarius UCC118 (Sheehan et al, 2006), a significant osmoprotective effect was observed following the introduction of betL into B. breve, facilitating growth of the probiotic in conditions similar to those encountered in vivo (1.5% NaCl and 6% sucrose, both of which approximate the osmolarity of the gut). Furthermore, whilst stable colonisation of the murine intestine was achieved by oral administration of B. breve UCC2003, strains harbouring BetL were recovered at significantly higher levels in the faeces, intestines and caecum of inoculated animals. Finally, in addition to improved gastric transit and intestinal persistence, the addition of BetL improved the clinical efficacy of the probiotic culture; mice fed B. breve UCC2003 (BetL+) exhibited significantly lower levels of systemic infection compared to the control strain following oral inoculation with L. monocytogenes (Figure 3). This is, to the best of our knowledge, the first clear evidence of an enhanced therapeutic effect following precise bio-engineering of a probiotic strain.

infections by blocking crucial ligand-receptor interactions between the pathogen and host cell (Paton et al, 2006).

Many of the pathogens responsible for the major enteric infections exploit oligosaccharides displayed on the surface of host cells as receptors for toxins and/or adhesins, enabling colonization of the mucosa and entry of the pathogen or secreted toxins into the host cell. Blocking this adherence prevents infection, while toxin neutralization ameliorates symptoms until the pathogen is eventually overcome by the immune system. ‘Designer probiotics’ have been engineered to express receptormimic structures on their surface (Paton et al, 2000).

When administered orally these probiotics bind to and neutralize toxins in the gut lumen and interfere with pathogen adherence to the intestinal epithelium (Figure 4). One such construct consists of an E. coli strain expressing a chimeric lipopolysaccharide (LPS) terminating in a shiga toxin (Stx) receptor. 1 mg dry weight of this recombinant strain has been shown to neutralize >100 !g of Stx1 and Stx2 (Paton et al, 2000).

Paton and colleagues (2001, 2005) have also constructed probiotics with receptor blocking potential against Enterotoxigenic E. coli (ETEC) toxin LT and cholera toxin (Ctx).

As well as treating enteric infections, ‘designer probiotics’ have also been recruited to combat HIV. In 2005 Rao and colleagues described the construction of a probiotic strain of E. coli, engineered to secrete HIVgp41-haemolysin A hybrid peptides, which block HIV fusion and entry into target cells. When administered orally or as a rectal suppository, this ‘live microbicide’ colonizes the gut mucosa and secretes the peptide in situ, thereby providing protection in advance of HIV exposure

III. ‘Designer Probiotics’ In addition to improving their physiological stress tolerance, recent studies have lead to the development of ‘designer probiotics’ which specifically target enteric 271

Sleator and Hill: Improving probiotic function using a patho-biotechnology approach

Figure 3. (A) Recovery of Bifidobacterium breve UCC2003-BetL + (green circles) and UCC2003 wild type (blue circles) from female BALB/c mice over 32 days of analysis. Faeces for bacteriological analysis were obtained from five mice in each treatment group and viable counts of B. breve UCC2003 derivatives were determined. (B) Listerial infection in the spleens of BALB/c mice. Animals were fed ~109 CFU ml-1 of either UCC2003-BetL + or UCC2003 wild type for three consecutive days. On the fourth day, all animals were infected with ~1011 CFU ml-1 Listeria monocytogenes EGD-e. Three days post infection the animals were sacrificed and the numbers of Listeria were determined. Reproduced from Sheehan et al, 2007 with kind permission from Microbiol.

Figure 4. Receptor mimic strategy employed by â&#x20AC;&#x2DC;designer probioticsâ&#x20AC;&#x2122;. Probiotic bacteria (in blue) engineered to express surface hostreceptor mimics that can bind to and neutralise toxins (red stars) in the gut lumen or interfere with the adherence of pathogens (in red)/antigens (green circles) to the intestinal epithelium.

for up to a month (Laurel and Berger, 2005). Other antiHIV probiotics currently in development include a genetically engineered Streptococcus gordonii which produces cyanovirin-N, a potent HIV-inactivating protein originally isolated from cyanobacterium, and a natural human vaginal isolate of Lactobacillus jensenii modified to secrete two-domain CD4 which inhibits HIV entry into target cells (Chang et al, 2003).

In addition to in infection control probiotics (and other non-pathogenic bacteria) are also being engineered to function as novel vaccine delivery vehicles which can stimulate both innate and acquired immunity but lack the possibility of reversion to virulence which exists with more conventional pathogenic platforms. In 2005 GuimarĂŁes and colleagues described the construction of a

L. lactis strain expressing inlA, encoding internalin A, a surface protein related to invasion in L. monocytogenes. In this instance the otherwise non-invasive L. lactis strain is now capable of invading the small intestine and delivering molecules (DNA or protein) into mammalian epithelial cells, making it a safer and more attractive alternative to attenuated L. monocytogenes as an antigen delivery vehicle. Furthermore, the authors suggest that the addition of hlyA (encoding listeriolysin) to L. lactis inlA+ may promote phagosomal escape within the macrophage and induction of an immune response comparable to that of the intracellular pathogen.

Probiotic vaccine carriers administered by the mucosal route mimic the immune response elicited by natural infection and can lead to long lasting protective

272

Gene Therapy and Molecular Biology Vol 11, page 273 mucosal and systemic responses (Holmgren and Czerkinsky, 2005). Mucosal vaccine delivery (those administered orally, anally or by nasal spray) also offers significant technological and commercial advantages over traditional formulations including: reduced pain and the possibility of cross contamination associated with intramuscular injection as well as the lack of a requirement for medically trained personnel to administer the vaccine.

probiotics thus provide an effective means of circumventing the short half-life and fragility of conventional therapeutics, providing a cost effective alternative which will ultimately contribute to health and social gain particularly in developing countries (Sleator and Hill, 2007b). However while consumer acceptance of genetically engineered ‘designer probiotics’ still remains a significant challenge this obstacle should eventually be overcome by the application of rigorous scientific controls, such as adequate biological containment, and proper risk-benefit analysis of the potential advantages of such a strategy.

IV. Biological containment The use of genetically modified organisms in medicine raises legitimate concerns about their survival and propagation in the environment and the host and about the dissemination of antibiotic markers or other genetic modifications to other microorganisms. At least some of these concerns might be allayed by the implementation of stringent bio-containment measures.

Biological containment systems can be subdivided into active and passive forms. Active containment provides control through the conditional production of a compound which is toxic to the cells. Examples of this type of control include the phage T7 lysozome and colicin E3 in E. coli (Torres et al, 2003). Passive containment on the other hand is dependent on complementation of an auxotrophy by supplementation with either an intact gene or the essential metabolite.

Perhaps the most elegant biological containment strategy devised to date targets the essential thymidylate synthase (thyA) gene, replacing it with a transgene (encoding the desired stress survival trait) (Steidler et al, 2003). Since the thyA gene is essential for growth; mutant strains only grow in the presence of added thymidine or thymine. Thymine auxotrophy involves activation of the SOS repair system and DNA fragmentation, thereby constituting an indigenous suicide system. Thymine and thymidine growth dependence differs from most other auxotrophies in that absence of the essential component is bactericidal in the former and bacteriostatic in the latter.

The choice of thyA as a target gene thus combines the advantages of passive and active containment systems, with the end result being that thyA-deficient bacteria cannot accumulate in the environment.

This approach addresses biosafety concerns on several levels. Firstly, no resistance marker is required to guarantee stable inheritance of the transgene, thus overcoming any potential problems associated with dissemination of antibiotic resistance to the commensal populations or opportunistic pathogens. Second, accumulation of the genetically modified organism in the environment is highly unlikely given that rapid death occurs upon thymidine starvation. Finally should an intact thyA be acquired from closely related bacteria by means of homologous recombination - the transgene would be lost as a result of the double cross over.

Acknowledgements Dr Roy Sleator is a Health Research Board Principal Investigator. The authors also wish to acknowledge the continued financial assistance of the Alimentary Pharmabiotic Centre, funded by Science Foundation Ireland under the Centres for Science, Engineering and Technology Research Programme.

References Chang TL-Y, Chang CH, Simpson DA, Xu Q, Martin PK, Lagenaur LA, Schoolnik GK Ho DD, Hillier SL, Holodniy M, Lewicki JA, LeE PP (2003) Inhibition of HIV infectivity by a natural human isolate of Lactobacillus jensenii engineered to express functional two-domain CD4. Proc Natl Acad Sci USA 100, 11672-7.

Claesson MJ , Li Y, Leahy S, Canchaya C, van Pijkeren JP, Cerdeño-Tárraga AM, Parkhill J Flynn S, O’Sullivan GC, Collins JK, Higgins D, Shanahan F, Fitzgerald GF, van Sinderen D and O’Toole PW (2006) Multireplicon genome architecture of Lactobacillus salivarius. Proc Natl Acad Sci USA 103, 6718-6723.

Dietrich G, Viret JF and Gentschev I (2003) Haemolysin A and listeriolysin - two vaccine delivery tools for the induction of cell-mediated immunity. Int J Parasitol 33, 495-505.

Guimarães VD, Gabriel JE, Lefèvre F, Cabanes D, Gruss A, Cossart P, Azevedo V, Langella P (2005) Internalinexpressing Lactococcus lactis is able to invade small intestine of guinea pigs and deliver DNA into mammalian epithelial cells. Microbes Infect 7, 836-844.

Hill C, Cotter P, Sleator RD, Gahan CGM (2002) Bacterial stress response in Listeria monocytogenes: jumping the hurdles imposed by minimal processing. Int Dairy J 12, 273-283.

Holmgren J, Czerkinsky C (2005) Mucosal immunity and vaccines. Nat Med 11, S45-53.

Laurel AL, Berger EA (2005) An anti-HIV microbicide comes alive Proc Natl Acad Sci USA 102, 12294-12295.

Maa YF and Prestrelski SJ (2000) Biopharmaceutical powders: particle formation and formulation considerations. Curr Pharm Biotechnol 1, 283-302.

Paton AW, Morona R, Paton JC (2000) A new biological agent for treatment of Shiga toxigenic Escherichia coli infections and dysentery in humans. Nat Med 6, 265-270.

Paton AW, Morona R, Paton JC (2001) Neutralization of shiga toxins Stx1, Stx2c and Stx2e by recombinant bacteria expressing mimics of globotriose and globotetraose. Infect Immun 69, 1967-1970.

Paton AW, Jennings MP, Morona R, Wang H, Focareta A, Roddam LF, Paton JC (2005) Recombinant probiotics for treatment and prevention of enterotoxigenic Escherichia coli diarrhea. Gastroenterology 128, 1219-28.

V. Conclusions Although conventional molecular medical research continues to provide effective therapeutic and prophylactic compounds, their application is often complicated by in vivo sensitivity and rising production costs. Engineered 273

Sleator and Hill: Improving probiotic function using a patho-biotechnology approach Paton AW, Morona R, Paton JC (2006) Designer probiotics for prevention of enteric infections. Nat Rev Microbiol 4, 193200.

Rao S, Hu S, McHugh L, Lueders K, Henry K, Zhao Q, Fekete RA, Kar S, Adhya S, Hamer DH (2005) Toward a live microbial microbicide for HIV: commensal bacteria secreting an HIV fusion inhibitor peptide. Proc Natl Acad Sci USA 102, 11993-11998.

Roland KL, Tinge SA, Killeen KP and Kochi SK (2005) Recent advances in the development of live, attenuated bacterial vectors. Curr Opin Mol Ther 7, 62-72.

Shahidi F and Han XQ (1993) Encapsulation of food ingredients.

Crit Rev Food Sci Nutr 33, 501-547.

Sheehan VM, Sleator RD, Fitzgerald GF and Hill C (2006) Heterologous expression of BetL, a betaine uptake system, enhances the stress tolerance of Lactobacillus salivarius UCC118. Appl Environ Microbiol 72, 2170-2177.

Sheehan V, Sleator RD, Fitzgerald G and Hill C (2007) Improving gastric transit, gastrointestinal persistence and therapeutic efficacy of the probiotic strain Bifidobacterium breve UCC2003. Microbiol 153, 3563-3571.

Sleator RD, Gahan CGM, Abee T and Hill C (1999) Identification and disruption of BetL, a secondary glycine betaine transport system linked to the salt tolerance of Listeria monocytogenes LO28. Appl Environl Microbiol 65, 2078-2083.

Sleator RD, Gahan CGM, O’Driscoll B and Hill C (2000) Analysis of the role of betL in contributing to the growth and survival of Listeria monocytogenes LO28. Int J Food Microbiol 60, 261-268.

Sleator RD, Gahan CGM, Abee T, Wouters JA and Hill C. (2001). Analysis of the role of OpuC, an osmolyte transport system, in salt tolerance and virulence potential of Listeria monocytogenes. Appl. Environ. Microbiol 67, 2692-2698.

Sleator RD and Hill C (2002) Bacterial osmoadaptation: the role of osmolytes in bacterial stress and virulence. FEMS Microbiol Rev 26, 49-71.

Sleator RD, Gahan CGM and Hill C (2003a) A post-genomic appraisal of osmotolerance in Listeria monocytogenes. Appl Environl Microbiol 69, 1-9.

Sleator RD, Wood JM and Hill C (2003b) Transcriptional regulation and post-translational activity of the betaine transporter BetL in Listeria monocytogenes is controlled by environmental salinity. J Bacteriol 185, 7140-7144.

Sleator RD, and Hill C (2006) Patho-biotechnology; using bad bugs to do good things. Curr Opin Biotech 17, 211-216.

Sleator RD and Hill C (2007a) ‘Bioengineered bugs’ – A pathobiotechnology approach to probiotic research and applications.

Med Hypotheses doi:10.1016/j.mehy.2007.03.008.

Sleator RD and Hill C (2007b) Probiotics as therapeutics for the developing world. J Infect Develop Countries 1, 7-12.

Smiddy M, Sleator RD, Patterson MF, C Hill and AL Kelly (2004) Role for compatible solutes glycine betaine and Lcarnitine in listerial barotolerance. Appl Environ Microbiol 70, 7555-7557.

Smiddy M, O’Gorman L, Sleator RD, Hill C and Kelly A (2005) Greater high-pressure resistance of bacteria in oysters than in broth. Inn Food Sci Emerg Tech 6, 83-90.

Steidler L, Neirynck S, Huyghebaert N, Snoeck V, Vermeire A, Goddeeris B, Cox E, Remon JP, Remaut E (2003) Biological containment of genetically modified Lactococcus lactis for intestinal delivery of human interleukin 10. Nat Biotechnol 21, 785-9.

Termont S, Vandenbroucke K, Iserentant D, Neirynck S, Steidler L, Remaut E and Rottiers P (2006) Intracellular accumulation of trehalose protects Lactococcus lactis from freeze-drying damage and bile toxicity and increases gastric acid resistance. Appl Environ Microbiol 72, 7694-7700.

Torres B, Jaenecke S, Timmis KN, Garcia JL, Diaz E (2003) A dual lethal system to enhance containment of recombinant micro-organisms. Microbiol 149, 3595-3601.

Roy D. Sleator

274

Gene Therapy and Molecular Biology Vol 11, page 275 Gene Ther Mol Biol Vol 11, 275-288, 2007

Apoptosis prevention in neuronally differentiated PC12 cells, by bcl-2 gene transfection in the nonproliferative and differentiated state, with retention of neuron-specific proteins and blockage of mitocondrion-relayed apoptotic pathway Research Article

Yasukazu Saitoh, Shoji Masumoto, Shinobu Yanada, Nobuhiko Miwa* Laboratory of Cell-Death Control BioTechnology, Department of Life Sciences, Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, Shobara, Hiroshima 727-0023, Japan

__________________________________________________________________________________ *Correspondence: Nobuhiko Miwa, Ph.D., Laboratory of Cell-Death Control BioTechnology Department of Life Sciences, Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, Nanatsuka 562, Shobara, Hiroshima 727-0023, Japan. Tel: +81824-74-1754; Fax: +81-824-74-1754; E-mail: miwa-nob@pu-hiroshima.ac.jp Key words: bcl-2, NGF, PC12 cells, reactive oxygen species, apoptosis Abbreviations: 6-carboxy-2', 7'- dichlorodihydrofluorescein diacetate, (CDCFH-DA); aminomethylcoumarin, (AMC); artifical viral envelope, (AVE); hemagglutinating virus of Japan, (HVJ); high mobility group protein, (HMG); human bcl-2, (hbcl-2); nerve growth factor, (NGF); neuron-specific enolase, (NSE); rat pheochromocytoma cell line 12, (PC12); reactive oxygen species, (ROS); Rhodamine 123, (R123); terminal deoxyribonucleotidyl transferase-mediated dUTP nick end labeling, (TUNEL) Received: 23 August 2007; Revised: 7 October 2007 Accepted: 10 October 2007; electronically published: October 2007

Summary Transfected bcl-2 genes are known to inhibit apoptosis in proliferative or stable transfectants, but have been scarcely scrutinized in neuronally differentiated cells that are transiently transfected in the non-proliferative and differentiated state. In the present study, NGF-differentiated PC12 cells were transiently transfected with cDNA encoding human bcl-2 wrapped by HVJ virus-based liposomes. The resultant >50-fold Bcl-2 overexpression prevented NGF-removal-induced cell death, as shown by repression of either the diminished mitocondrial tetrazolium-reducing function or the augmented DNA-3â&#x20AC;&#x2122;-OH cleavage terminals, through blockages of apoptosisassociated events such as lowered mitochodrial membrane potentials, release of cytochrome c and activation of caspase-3, together with transiently repressed intracellular ROS. Overexpressed Bcl-2 could also inhibit NGF removal-induced neurite-retraction, and the decreased levels of neurofilaments and neuron-specific enolase.

can prevent or delay apoptosis induced by a variety of physiologic or pathologic insults and environmental stimuli in numerous types of cells (Tsujimoto et al, 1986; Vaux et al, 1988; Allsopp et al, 1993; Mah et al, 1993; Zhong et al, 1993; Reed, 1994; Caleo et al, 2002; Cao et al, 2002; Staecker et al, 2007). Furthermore, Bcl-2 is seems to be one of the important molecules in nerve growth factor (NGF) deprivation-induced apoptosis in sympathetic neurons because the mRNA levels of the Bcl2 family members decrease after NGF deprivation and during apoptosis (Greenlund et al, 1995a), but sufficient data have not been accumulated for repressive effects of bcl-2 transfection on neuronal apoptosis.

I. Introduction Neuronal apoptosis is closely correlated with not only normal nervous system development (Oppenheim, 1991), but also with the disastrous consequences of a number of neurodegenerative disorders (Appel, 1981) and various nervous system injuries (Olney et al, 1989; Choi et al, 1990). Neuronal apoptosis is known to be regulated partly by neurotrophic factors (Ellis et al, 1991). For example, removal of neurotrophic factors modifies signaling pathways in ways that eventually lead to apoptosis (Raff et al, 1993; Pettmann et al, 1998).

A number of proteins are important in the apoptotic process. Among them, the proto-oncogene bcl-2 is known to be a key regulator of apoptosis. Overexpression of bcl-2 275

Saitoh et al: Repressive effect of bcl-2 on NGF deprivation-induced cell death cDNA (1.0 kbp) into the EcoRI site of the SV40 early promoter in pC!j-SV-2.

The rat pheochromocytoma cell line PC12, which is a widely used model to examine the molecular and cellular mechanism of neuronal apoptosis induced by loss of trophic supports, can be differentiated into cells that resemble sympathetic neurons in the presence of NGF. Subsequent withdrawal of serum and NGF induces apoptosis in neuronally differentiated PC12 cells. The serum- and NGF-deprivation-induced apoptosis is known to be inhibited in differentiated PC 12 cells which have been stably transfected with bcl-2 gene in the undifferentiated state, as the previous manipulation prior to the apoptosis experiments, and then undergo the differentiation (Batistatou et al, 1993; Mah et al, 1993; Zhong et al, 1993), but remains to be demonstrated for repression by bcl-2 gene transfer after differentiation of PC12 cells.

Several hypotheses have been proposed to explain the antiapoptotic function of Bcl-2. For instance, Bcl-2 has been shown to block the collapse of the mitochondrial transmembrane potential (!") and the release of cytochrome c and other apoptogenic proteins, possibly by preventing Bax/Bak oligomerization and consequent pore formation (Hockenbery et al, 1990; Kluck et al, 1997; Yang et al, 1997; Mikhailov et al, 2001). In addition, it has also been proposed that Bcl-2 acts as an apparent antioxidant (Hockenbery et al, 1993; Kane et al, 1993), which seems to be important because there are growing evidences that reactive oxygen species (ROS) play a key role in the regulation of apoptosis (Buttke et al, 1994; Bonfoco et al, 1995; Salgo et al, 1995; Lin et al, 1997). In fact, it is also known that ROS play a critical role in neurotrophic factors deprivation-induced apoptosis (Greenlund et al, 1995b; Schulz et al, 1997). However, this proposed mechanism was questioned in other reports, because Bcl-2 expression blocked apoptosis under anaerobic conditions, in which ROS are not generated (Jacobson et al, 1995; Shimizu et al, 1995). Thus, the mechanism underlying the regulation of apoptosis by Bcl2 is not fully understood.

In the present study, we have explored the mechanisms by which Bcl-2 suppresses trophic factordeprived cell death using bcl-2 gene-transfected PC12 cells after differentiation. We found here that Bcl-2 inhibited trophic factor deprivation-induced apoptosis and maintained neuronal functions through the promotion of intracellular ROS scavenging and through prevention of the collapse of the mitochondrial transmembrane potential (!"), release of cytochrome c, and activation of caspase3.

B. Cell culture Rat pheochromocytoma cell line 12 (PC12) cells were obtained from the Riken Cell Bank (Tsukuba, Japan). Cells were maintained in Dulbecco’s modified Eagle’s medium:Nutrient mixture F-12 (DMEM/F-12) supplemented with 5% heatinactivated horse serum (MITSUBISHI CHEMIICAL, Tokyo, Japan), 5% fetal calf serum (GIBCO BRL, Grand Island, NY, USA), 30 nM Na2SeO3, 50 U/mL penicillin, and 50 µg/mL streptomycin at 37 oC in a humidified atmosphere of 95% air and 5% CO2. To induce neuronal differentiation, the cells were plated on collagen type I-coated culture plates (Becton Dickinson, Franklin Lakes, NJ, USA) for 24 h and then cultured in serumfree DMEM/F-12 medium with 100 ng/mL 2.5 S-NGF (Wako Pure Chemical Industries, Osaka, Japan) for 12-14 days.

Neuronal cell differentiation was confirmed under a phasecontrast microscope. To conduct NGF deprivation, neuronally differentiated PC12 cells, which had been cultured for 12 days with NGF treatment, were washed twice with NGF-free medium and then incubated with 10 µg/mL anti-mouse 2.5-S-NGF rabbit IgG (Wako Pure Chemical Industries).

C. Transfection of hbcl-2 into PC12 cells Transfection of hbcl-2 into PC12 cells was conducted by using HVJ-liposomes. HVJ-liposomes were prepared as described previously (Saeki et al, 1997; Yanada et al. 2005).

Briefly, 200 µg of plasmid DNA, 65 µg of high mobility group protein (HMG)-1, 2 mixture (Wako) or balanced salt solution (140 mM NaCl, 5.4 mM KCl, 10 mM Tris-HCl, pH 7.5), and a dried lipid mixture (phosphatidylcholine, phosphatidylserine, and cholesterol) were mixed and shaken vigorously, and then sonicated to produce unilamellar liposomes. Then the liposomes were conjugated with HVJ, which had been inactivated by ultraviolet irradiation. For gene transfection, the prepared HVJliposomes were added to the neuronally differentiated PC12 cells, and the cells were incubated for 2 days. The expression of hBcl-2 protein was verified by Western blot analysis.

D. Immunocytochemical neurofilaments

staining

of

Cells grown on coverslips were washed with phosphatebuffered saline (PBS) and fixed in paraformaldehyde solution (3.7% in PBS) for 15 min at room temperature. Then the cells were permeabilized in a solution containing 0.5% Triton X-100 for 5 min on ice, and treated with anti-rat neurofilament mouse monoclonal antibody Neurofilament 200 (SIGMA, St. Louis, MO, USA) in PBS containing 3% bovine serum albumin (BSA) for 30 min at 37 oC. After they were washed three times with PBS containing 3% BSA, the cells were incubated with FITCconjugated anti-mouse IgG antibody (Santa Cruz Biotechnology Inc.) for 30 min at 37 oC. The coverslips were washed with PBS and mounted on slides with anti-fading solution.

Immunocytochemical staining was analyzed with a laser scanning confocal microscope MRC-600 (Bio-Rad).

II. Materials and Methods A. Plasmid DNA Plasmids pC!j-SV-2 (12.5 kbp) and pC!j-bcl-2 (13.5 kbp) (Tsujimoto, 1989) were kindly provided by Dr. Shoji Yamaoka (Tokyo Medical Dental University, Tokyo, Japan) and Dr. Yoshihide Tsujimoto (Osaka University School of Medicine, Osaka, Japan), respectively. The pC!j-SV-2, which is a mammalian expression vector, contains the simian virus 40 (SV40) early promoter, Epstein-Barr virus oriP, SV40 enhancer, a poly (A) signal, and neomycin and ampicillin resistance genes.

The pC!j-bcl-2 was constructed by insertion of human bcl-2

E. Western blot analysis Cells were washed twice with PBS and lysed with an ice-cold lysis buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 4 mM EDTA, 1 mM DTT, 1 mM PMSF, 1% IGEPALCA-630, 1% SDS, 1 µM leupeptin and 1 µM pepstatin A). After being freezethawed three times, the lysate was centrifuged at 20,000!g for 5 min at 4 oC and the supernatant was collected. The amount of protein was measured using a DC Protein Assay kit (Bio-Rad).

276

Gene Therapy and Molecular Biology Vol 11, page 277 centrifugation at 16,000g for 20 min at 4 oC and the supernatant was collected, and the amount of protein was measured using a DC Protein Assay kit (Bio-Rad). The lysates were mixed with ICE-Like Assay Buffer containing 312.5 mM HEPES (pH 7.5), 31.25% sucrose, 0.3125% CHAPS, 2% DMSO, 10 mM DTT and 50 µM inhibitors of caspase-1 and caspase-3, respectively. After a 30-min incubation at 30 oC, 50 µM tetrapeptide substrate (acetyl-tyrosyl-valyl-alanyl-aspartic acid 7-amino-4-methyl coumarin (Ac-YVAD-AMC) for caspase-1, or acetyl-aspartylglutamyl-valyl-aspartic acid 7-amino-4-methyl coumarin (AcDEVD-AMC) for caspase-3) was added to the lysates and incubated for 60 min at 30 oC. The fluorescence which was derived from free aminomethylcoumarin (AMC) released by substrate cleavage was measured with a fluorescence plate reader CytoFluor 2350 (Millipore) with excitation and emission wavelengths of 360 nm and 460 nm, respectively. Fluorescent units were converted to picomoles of AMC using a standard calibration curve generated with free AMC per microgram protein.

The cell lysates were resuspended in buffer containing 62.5 mM Tris-HCl (pH 6.8), 15% glycerol, 10% "-mercaptoethanol, 0.005% bromophenol blue and 4% SDS. Then the cell lysates were boiled for 3 min and electrophoresed through 12% SDSpolyacrylamide gel, and the separated proteins were blotted onto 0.45-µm polyvinylidene difluoride (PVDF) membranes (ATTO, Tokyo, Japan). Nonspecific binding was blocked by incubating the membranes for 2 hr at room temperature in a blocking buffer containing 50 mM Tris-HCl (pH 7.5), 3% BSA, and 150 mM NaCl. The membranes were then treated with anti-rat neuron specific enolase rabbit polyclonal antibody (CosmoBio Co., LTD., Tokyo, Japan) or anti-human Bcl-2 mouse monoclonal antibody (sc-509; Santa Cruz Biotechnology Inc., CA, USA) in blocking buffer overnight at 4 oC with agitation. After they were washed three times with washing buffer containing 50 mM Tris (pH 7.9), 100 mM NaCl, and 0.05% Tween-20, the membranes were incubated with the horseradish peroxidase-conjugated antirabbit or anti-mouse IgG (Santa Cruz Biotechnology Inc.) in a blocking buffer for 30 min at room temperature. After they were washed twice with the washing buffer for 20 min, the membranes were washed with the blocking buffer for 20 min. The specific bands were detected using an enhanced chemiluminescence (ECL) detection system (Amersham-Pharmacia Biotech, England, UK), and blots were exposed to Hyperfilm MP (Kodak,Tokyo, Japan) for 0.5 to 2 min. Laser scanning densitometry was conducted for semiquantitative analysis of the data.

I. Determination of mitochondrial membrane potential (!")

Mitochondrial membrane potential (!") was determined by the uptake of rhodamine 123 (R123) (Wako). Cells were incubated with 10 µM R123 for 30 min at 37 oC. After washing with PBS, cells were treated with PBS containing 2% paraformaldehyde and 2.5% glutaraldehyde. Then the !" was observed with a laser scanning confocal microscope. Alterations of !" were assessed by fluorescence microscopy with digital image analysis.

F. Determination of cell viability Cell viability was quantified by measuring mitochondrial dehydrogenase activity retained in the cultured cells by a photometric assay using the formazan-forming dye WST-1 [2-(4iodophenyl)-3-(4-nitrophenyl)-5-(2.4-disulfophenyl)-2Htetrazolium, sodium salt; Wako, Osaka, Japan]. Briefly, cells were cultured in 6 well plates with phenol red-free medium. At selected times, 30 µL of solution containing 5 mM WST-1 and 200 µM 1-methoxy PMS was added to a well of the microplate, and the cells were incubated for 2 hr at 37oC. Then, absorbance at 450 nm was measured with a Bio-Rad microplate absorbance reader model 3550 (Bio-Rad, Hercules, CA, USA). The cell viability is expressed as a percentage of that of control cells (100 x A450, treated / A450, control).

J. Determination of cytoplasmic mitochondrial cytochrome c content

and

Cytochrome c was determined after subcellular fractionation by the Western blot analysis. Cells were harvested by trypsinization and centrifuged at 800g for 5 min at 4°C. After homogenization with a Dounce-type glass homogenizer (60 strokes) in homogenization buffer (20 mM HEPES-NaOH [pH 7.5], 250 mM sucrose), the lysate was centrifuged at 700g for 5 min at 4°C to remove unbroken cells, large plasma membrane pieces, and nuclei. The supernatant was centrifuged at 7,000g for 10 min at 4°C. The resulting supernatant was centrifuged at 105,000g for 100 min at 4°C to obtain the supernatant, which we designated the cytoplasmic fraction. The pellet was resuspended in homogenization buffer, and centrifuged at 24,000g for 10 min at 4°C. This operation was repeated twice, and the resulting pellet was subjected to centrifugation at 56,000g for 100 min at 4°C on a sucrose gradient (0.8-1.2 M) to obtain the lower layer, which we designated the mitochondrial fraction. The obtained mitochondrial fraction was dissolved in the lysis buffer described in the above Western blot analysis section. The amount of protein was measured using a DC Protein Assay kit (Bio-Rad).

The cytochrome c content was analyzed by SDS-PAGE and Western blotting by using rat cytochrome c mouse monoclonal antibody (H-104; Santa Cruz Biotechnology Inc.) and horseradish peroxidase-conjugated anti-mouse IgG (Santa Cruz Biotechnology Inc.).

G. TUNEL assay DNA fragmentation of individual cells was detected in situ

by TUNEL (terminal deoxyribonucleotidyl transferase-mediated dUTP nick end labeling) with an In situ Apoptosis Detection Kit (Takara, Kyoto, Japan). Cells grown on coverslips were washed with PBS and fixed in paraformaldehyde solution (3.7% in PBS) for 15 min at room temperature. Then the cells were permeabilized in a solution containing 0.1% Triton X-100 for 5 min on ice, followed by incubation in freshly prepared TUNEL reaction mixture for 90 min at 37oC in the dark. The coverslips were washed with PBS and mounted on slides with anti-fading solution. TUNEL staining was analyzed with a laser scanning confocal microscope.

H. Assay of caspase-1 and caspase-3 activities Caspase-1 and caspase-3 activities were assessed by a fluorometric assay quantifying the extent of cleavage of a fluorometric peptide substrate using a CaspACE TM Assay System kit (Promega, Madison, WI, USA). Cells were collected by trypsinization and suspended in an ice-cold buffer containing 10 mM Tris-HCl (pH 7.5), 2 mM MgCl2, 5 mM EDTA, 2 mM DTT, 2 mM PMSF, 4 µM leupeptin and 3 µM pepstatin A. After three rounds of freeze-thawing, the lysates were obtained by

K. Measurement of ROS production The ROS production was assessed using the fluorescent probe 6-carboxy-2', 7'- dichlorodihydrofluorescein diacetate (CDCFH-DA) (Molecular Probes, Eugene, OR, USA). This dye is a stable compound that readily diffuses into cells and is hydrolyzed by intracellular esterase to yield CDCFH, which is trapped within cells. Hydrogen peroxide or low-molecularweight peroxides produced by cells oxidize CDCFH to the highly

277

Saitoh et al: Repressive effect of bcl-2 on NGF deprivation-induced cell death fluorescent compound 6-carboxy-2’,7’-dichlorofluorescin (CDCF). Thus, the fluorescence intensity is proportional to the amount of intracellular peroxide produced by the cells. Cells were treated with 50 µM CDCFH-DA for 30 min, and the media were replaced by phenol red-free DMEM. Then, the fluorescence intensity was measured with a fluorescence microplate reader CytoFluor 2350 (Millipore, Bedford, MA, USA) with excitation and emission wavelengths of 510 nm and 534 nm, respectively.

PC12 cells, we observed the cellular morphology and the expression of neurofilaments and neuron specific enolase (NSE). As for the cellular morphology, neurite outgrowth was appreciably observed at 12 days after NGF treatment (Figure 1 A). In addition, the expressions of neurofilaments and NSE were increased in a timedependent manner, and their expressions were stabilized later than 12 days after NGF treatment (Figure 1 B, C).

These results suggested that the neuronal differentiation could be induced by NGF treatment for 12 days in PC12 cells. Therefore, we induced neuronal differentiation in PC12 cells by incubation with NGF for 12 days in all of our experiments.

L. Statistical analysis Data were presented as mean ± SD, and statistical comparisons were performed using an unpaired Student’s t-test or Dunnet’s multiple comparison test (StatView IV; Abacus Concepts, CA, USA). Differences with P < 0.05 were considered to be statistically significant.

B. Expression of proteins in PC12 cells

III. Results

transfected

Bcl-2

To confirm the expression level of Bcl-2 proteins after transfection in neuronally differentiated PC12 cells, we analyzed Bcl-2 expression by western blot analysis and densitometry (Figure 2). The expression level of Bcl-2

A. NGF-induced neuronal differentiation in PC12 cells To determine the time of treatment with NGF which is necessary for the induction of neuronal differentiation in

Figure 1. NGF-induced neuronal differentiation in PC12 cells. A. Morphological changes after NGF treatment: PC12 cells were seeded on collagen type I-coated culture plates. After preincubation for 24 hr, cells were cultured in normal medium (left) or serum-free medium with 100 ng/mL NGF (right) for 14 days. These media were exchanged every 3 days. After 14 days, cells were observed under a phase-contrast microscope. The scale bar indicates 50 #m. B. Immunocytochemical detection of neurofilaments: Cells were plated on collagen type I-coated coverslips. After preincubation for 24 hr, the cells were cultured in serum-free medium with 100 ng/mL NGF for 0, 9, 12, and 14 days. Then, cells were subjected to immunocytochemical staining, and the FITC-derived fluorescence was detected by fluorescence microscopy. Fluorescence intensity was expressed in pseudo-colors (rainbow color bar; H: high, L: low). The scale bar indicates 200 #m. C. Expression of NSE after NGF treatment: PC12 cells were seeded on collagen type I-coated culture plates. After preincubation for 24 hr, cells were cultured in serum-free medium with 100 ng/mL NGF for 0, 3, 6, 9, 12, and 14 days. Then, the cellular proteins were extracted and subjected to the western blot analysis.

278

Gene Therapy and Molecular Biology Vol 11, page 279

Figure 2. Expression level of transfected hBcl-2 protein in PC12 cells. Transfection of bcl-2 into neuronally differentiated PC12 cells, which had been cultured for 12 days with NGF treatment, was conducted using HVJ-liposomes.

After transfection, the cellular proteins were extracted at the indicated times and subjected to western blot analysis, followed by densitometry for each band in the electrophorograms.

proteins was increased from 48 hr, and the level reached a maximum at 72 hr after transfection, and was decreased afterwards. Thus, the expression of Bcl-2 proteins was transiently induced. In contrast, the expression in nontransfectants was too low to be detected.

strand cleavages (Figure 4). The DNA-3â&#x20AC;&#x2122;OH-cleaved terminals that are typically observed upon apoptosis were detected, and the fluorescence intensity for TUNEL staining and expressed as diverse pseudo-colors. NGF deprivation induced an intense green fluorescent staining in the nuclei, indicating the incorporation of fluorescein dUTP into nicked DNA strand ends at 21 hr after NGF deprivation in hbcl-2 (-) cells. In contrast, most hbcl-2 (+) cells were shown to be negative for TUNEL staining, as indicated by yellowish pseudo-color. Thus, transfection with the bcl-2 gene inhibited NGF deprivation-induced apoptosis.

C. Protective effects of Bcl-2 on NGF deprivation-induced cell death We examined whether NGF deprivation could induce cell death, and whether bcl-2 gene transfection could suppress NGF deprivation-induced cell death. We therefore assessed the time-dependent changes of the cell viability after NGF deprivation by the WST-1 assay.

Neuronally differentiated PC12 cells, which were transfected with pC$j-SV-2 (hbcl-2 (-)) or pC$j-bcl-2 (hbcl-2 (+)), and incubated for 2 days, were subjected to NGF deprivation. In hbcl-2 (-) cells, the cell viability was decreased in a time-dependent manner after NGF deprivation. Especially, the cell viability was markedly decreased at 48 and 72 hr after NGF deprivation. Thus, NGF deprivation is a potent inducer of cell death. On the other hand, the cell viability of hbcl-2 (+) cells was significantly maintained as compared to that of hbcl-2 (-) cells (Figure 3). These results show that transfection with the bcl-2 gene exerts a cytoprotective effect against NGF deprivation-induced cell death.

E. Bcl-2 suppresses NGF deprivationinduced cellular degeneration and dysfunction To examine whether the surviving cells, which had been protected against NGF-induced cell death by bcl-2 transfection, maintained the neural morphology and functions, we observed aspects of cellular morphology, the levels of neurofilaments, and NSE (Figure 5 A-C). NGF deprivation induced neurite retraction, cell degeneration and the lowering of the levels of neurofilament and NSE in hbcl-2 (-) cells. On the other hand, these aspects of cellular morphology were not changed in hbcl-2 (+) cells.

Furthermore, the levels of neurofilaments and NSE were notably elevated as compared with those before NGF deprivation. These results suggest that transfection with the bcl-2 gene exerts a protective effect against NGF deprivation-induced morphological changes and dysfunction.

D. Repressive effects of Bcl-2 against NGF deprivation-induced DNA strand cleavages It is well-known that neuronally differentiated PC12 cells undergo apoptosis as a result of NGF deprivation.

We investigated by TUNEL assay whether Bcl-2 exerted a protective effect against NGF deprivation-induced DNA

279

Saitoh et al: Repressive effect of bcl-2 on NGF deprivation-induced cell death was transiently and significantly increased by more than 2fold at 2 hr after NGF deprivation as compared to before NGF withdrawal. The activation of caspase-1 may be involved in the mechanism of the NGF deprivationinduced cell death, but was not prevented by bcl-2 gene transfection. Thus, the cytoprotective effect of transfection with the bcl-2 gene is not mediated through its effect on caspase-1 activation. In contrast, caspase-3 activity in both types of cells was also transiently increased after NGF deprivation, but was significantly suppressed in hbcl-2 (+) cells when compared to hbcl-2 (-) cells at 8 hr. These results indicate that the activation and repression of caspase-3 may be involved in the mechanisms whereby cell death was induced by NGF deprivation and prevented by bcl-2 gene transfection.

F. Suppressive effect of Bcl-2 on NGF deprivation-induced activation of caspase-3, but not caspase-1 Caspase-1 and caspase-3, members of the cysteinylaspartate-specific protease family, play key roles in inflammation and apoptosis in mammalian cells (Thornberry et al, 1992; Nicholson et al, 1995; Tewari et al, 1995; Fernandes-Alnemri et al, 1996). To investigate the role of the bcl-2 gene in NGF deprivation-induced cell death in hbcl-2 (+) cells, the activation of caspase-1 and caspase-3 was monitored as hallmarks of apoptosis (Figure 6).

The activation was measured spectrofluorometrically by assaying the hydrolysis of fluorophore-conjugated tetrapeptide substrates that can be selectively cleaved only by caspase-1 or caspase-3.

Caspase-1 activity in both hbcl-2 (-) and hbcl-2 (+) cells

Figure 3. Protective effects of Bcl-2 on NGF deprivationinduced cell death. Transfection was conducted using HVJliposomes into neuronally differentiated PC12 cells, which were cultured for 12 days after NGF treatment. After incubation for 2 days, cells were subjected to NGF deprivation. Cell viability was assessed by WST-1 assay at 0, 24, 48, and 72 hr after NGF deprivation. Vector-transfectants are represented by â&#x20AC;&#x153;hbcl-2(-)â&#x20AC;?, whereas non-transfectants means the parent cells without vectortransfection. Significantly different from non-transfectants: *P < 0.05; **P < 0.01.

Figure 4. Preventive effects of Bcl-2 on NGF deprivationinduced nuclear DNA strand cleavages in non-transfected hbcl-2 (-) cells and bcl-2 transfected hbcl-2 (+). After NGF deprivation, cells were fixed and stained for DNA cleavage terminals by the fluorescent dyebased TUNEL method. The fluorescence intensity corresponding to the extent of DNA cleavages was measured by laser scanning confocal microscopy. The fluorographs shown are typical of three independent experiments and were selected as representative fields out of 8 microscopic fields per well.

The scale bar indicates 200 #m.

The rainbow-colored bar shows the graded degrees of TUNEL fluorescence intensities.

280

Gene Therapy and Molecular Biology Vol 11, page 281

Figure 5. Protective effects of Bcl-2 on NGF deprivationinduced cellular modifications.

A. NGF deprivation-induced morphological changes in nontransfected hbcl-2 (-) cells and the corresponding bcl-2 transfected hbcl-2 (+) cells. Cells were observed under a phase-contrast microscope at 18, 21, and 24 hr after NGF deprivation. The scale bar indicates 50 #m.

B. Immunocytochemical detection of neurofilaments in non-transfectants hbcl-2 (-) and bcl-2 transfectants hbcl-2 (+). Cells were subjected to immunocytochemical staining at 24 and 48 hr after NGF deprivation, and the FITC-derived fluorescence was detected by fluorescence microscopy. The scale bar indicates 200 #m. C. Expression of NSE after NGF deprivation in nontransfectants hbcl-2 (-) and bcl-2 transfectants hbcl-2 (+). The cellular proteins were extracted at 24 and 48 hr after NGF deprivation, and subjected to the western blot analysis, followed by densitometry for each band in the electrophorograms.

281

Saitoh et al: Repressive effect of bcl-2 on NGF deprivation-induced cell death

Figure 6. Repressive effects of Bcl-2 on NGF deprivation-induced activation of caspase-1 and caspase-3. Cytosolic proteins were extracted from cells at the indicated times after NGF deprivation, and assayed for caspase-1 and caspase-3 activities.

cytochrome c in the mitochondria and a marked increase in cytochrome c in the cytosol at 12 hr after NGF deprivation. On the other hand, cytochrome c release from the mitochondria into the cytosol was strongly inhibited in hbcl-2 (+) cells. These results suggest that transfection with the bcl-2 gene exerts a protective effect against NGF deprivation-induced cytochrome c release.

G. Preventive effects of Bcl-2 on NGF deprivation-induced collapse of mitochondrial membrane potential (!")

A number of studies have demonstrated that the mitochondria play a central role in apoptosis, and revealed that opening of membrane permeability transition (MPT) pores, which is associated with collapse of the mitochondrial membrane potential (!"), is a determinative event leading to apoptosis (Green et al, 1998; Kroemer et al, 2000). To examine whether NGF deprivation can induce the collapse of !" and whether bcl-2 transfection can prevent the !" collapse, we assessed !" in NGF-deprived cells using Rhodamine 123 (R123). R123 is a lipophilic, cationic fluorescent dye that is accumulated within the mitochondria according to !".

Alterations of !" were assessed by fluorescence microscopy with digital image analysis (Figure 7 A, B).

The !" value was transiently reduced at 4-5 hr after NGF deprivation in hbcl-2 (-) cells. On the other hand, the !" value in hbcl-2 (+) cells was maintained better than that in hbcl-2 (-) cells. Thus transfection with the bcl-2 gene exerted an inhibitory effect against NGF deprivationinduced loss of !".

I. Generation of intracellular reactive oxygen species (ROS) after NGF deprivation It has been reported that a transient increase of ROS occurs prior to cell death induced by NGF deprivation in neuronally differentiated PC12 cells (Schulz et al, 1997).

This suggests that ROS generation is closely concerned with NGF-deprivation-induced cell death. Therefore, we attempted to examine whether NGF deprivation could cause the generation of intracellular ROS, and whether bcl-2 gene transfection could influence the ROS level. The intracellular ROS level was quantified by fluorometry using the fluorescein derivative CDCFH-DA as a redox indicator which primarily detects H2O2, hydroxyl radicals, and diverse peroxides (Sejda et al, 1984). Temporal analysis showed that intracellular ROS levels hardly showed a change when NGF was not removed from the medium (Figure 9). On the other hand, NGF deprivation induced a transient accumulation of intracellular ROS in both hbcl-2 (-) and hbcl-2 (+) cells. The ROS levels in both cells gradually increased, and reached the maximum level (approximately 2.5-fold increases) 3 hr after NGF deprivation. However, the lowering of the ROS level in hbcl-2 (+) cells occurred faster than that in hbcl-2 (-) cells, with a clear difference observed at 4 hr after NGF deprivation. The transient ROS generation was reversed to the control level after 5 hr of NGF deprivation. Thus, the transfection with the bcl-2 gene did not suppress NGF deprivation-induced ROS production, but it might have enhanced the intracellular antioxidative potential.

H. Protective effects of Bcl-2 against NGF deprivation-induced cytochrome c release Many studies have indicated that apoptosis is associated with the release of cytochrome c and potentially other apoptotic factors (Reed, 1997) from the intermembrane space of the mitochondria and with their subsequent release into the cytosol. Cytochrome c binds to apoptosis-activating factor 1 to form a complex with and activate caspase-9 (Li et al, 1997). Caspase-9 triggers a subsequent proteolytic cascade, activating caspase-3 and resulting in cell death. Cytochrome c release from the mitochondria into the cytosol was examined by western blot analysis and densitometry (Figure 8). In hbcl-2 (-) cells, there was a notable decrease in amounts of

282

Gene Therapy and Molecular Biology Vol 11, page 283

Figure 7. Preventive effects of Bcl-2 against NGF deprivation-induced collapse of mitochondrial membrane potential (! "). A. Cells were treated with rhodamine 123 (R123) for 30 min, and then fixed at the indicated times after NGF deprivation. The mitochondrial membrane potential was estimated with a laser scanning confocal microscope. The scale bar indicates 50 #m. The rainbow-colored bar shows the graded degrees of !"-derived fluorescence intensities. B. The histograms represent the fluorescence distribution, which reflects the degree of !". Arrows indicate the collapse of mitochondrial membrane potential (!").

Figure 8. Repressive effects of Bcl-2 on NGF deprivation-induced cytochrome c release into cytoplasm from mitochondria.

Cytoplasmic and mitochondrial proteins were extracted at 0 and 12 hr after NGF deprivation, and subjected to the western blot analysis and densitometic quantification.

283

Saitoh et al: Repressive effect of bcl-2 on NGF deprivation-induced cell death

Figure 9. NGF deprivation-induced intracellular reactive oxygen species (ROS) production in non-transfectants and bcl-2 transfectants hbcl-2 (+). Cells were treated with CDCFH-DA, and the fluorescence intensity was measured with a fluorescence microplate reader (ex: 485 nm; em: 530 nm) at the indicated times after NGF deprivation. Significantly different from wNGF (-): *P < 0.05.

process (Martins et al, 1997; Yuan et al, 1997; Thornberry et al, 1998). Especially, caspase-3, once activated, is responsible for many of the downstream events associated with apoptosis. The activation of caspase-3 was significantly prevented in hbcl-2 (+) cells after 8 hr of NGF deprivation, whereas the activation of caspase-1 could not be prevented (Figure 6). Because the activation of caspase-1 is followed by the activation of caspase-3, caspase-1 may be one of upstream regulators for caspase-3 activation, as previously indicated (Enari et al, 1996; Cohen, 1997). Taken together, our results suggest that Bcl-2 participates in the control of NGF deprivation-induced cell death via mediating interactions between caspase-1 and caspase-3. Loss of !" and release of cytochrome c have been defined as reflecting an early stage of apoptosis (Green et al, 1998; Kroemer et al, 2000). Our results, in which the loss of !" and release of cytochrome c were detected after NGF deprivation (Figure 7), suggest that NGF deprivation led to the induction of apoptosis at least partially via the mitochondrion-relayed pathway. Additionally, the suppression of the NGF-deprivation-induced !" loss and release of cytochrome c by overexpressed Bcl-2 (Figure 8) suggests that the suppression of mitochondrial modulation played an important role in the cytoprotective effects of Bcl-2. It is a well-known fact that caspase-3 is located at a downstream point of the mitochondrial pathway in apoptosis signal transduction. Thus, the overexpressed Bcl-2-induced suppression of mitochondrial dysfunction reflected by the loss of !" and release of

IV. Discussion In the present study, we investigated the preventive effect of Bcl-2 and its mechanisms on NGF deprivation-induced apoptosis. We determined that overexpression of Bcl-2 could markedly suppress the NGF deprivation-induced decrease of cell viability and apoptosis in neuronally differentiated PC12 cells as transient transfectants (Figures 2 and 3), in contrast to a considerable number of conventional studies on cytoprotection by stable transfectants that were obtained by bcl-2 gene transfer into proliferative and undifferentiated cell lines. Furthermore, our results also indicated that Bcl-2 could suppress morphologically the NGF deprivation-induced neurite retraction and biochemically decreases of the levels of neurofilaments and NSE. These results suggest that overexpression of Bcl-2 could enable PC12 cells in the neuronally differentiated state to maintain the neuronal differentiation after NGF deprivation. Thus, our results suggest that transfection with bcl-2 genes exerts a protective effect against not only NGF deprivationinduced apoptosis, but also NGF deprivation-induced morphological changes and dysfunction in PC12 cells.

A number of processes are important in the apoptotic process. Among them, Bcl-2 has been shown to block the collapse of the mitochondrial transmembrane potential (!") and the release of cytochrome c (which activates cytosolic caspases) (Hockenbery et al, 1990; Burlacu, 2003). Extensive investigations have revealed that the activation of two cysteine proteases, caspase-1 and caspase-3, participates in the execution of the cell death

284

Gene Therapy and Molecular Biology Vol 11, page 285 cytochrome c caused the inhibition of caspase-3 activation. These results are consistent with previous reports demonstrating that Bcl-2 functions upstream of caspase-3 and prevents apoptosis induced by a variety of physiologic or pathologic insults and environmental stimuli in numerous types of cells (Stefanis et al, 1996; Schulz et al, 1997; Saitoh et al, 2003a, b).

Several mechanisms have been proposed to explain the ability of Bcl-2 to suppress apoptosis (Oltvai et al, 1993; Kluck et al, 1997; Yang et al, 1997; Shimizu et al, 1998; Roberts et al, 2000). One of the proposed mechanisms is controversially considered to be based on the function of Bcl-2 as an apparent antioxidant (Hockenbery et al, 1993; Kane et al, 1993). The generation of ROS may be a sequential and essential event in NGF withdrawal-induced apoptosis of neuroanlly differentiated PC12 cells as previously indicated (Schulz et al, 1997).

Our results also indicated that the generation of ROS was induced after NGF deprivation, and the generated intracellular ROS was more quickly decreased in hbcl-2 (+) cells than in hbcl-2 (-) cells (Figure 9). These results suggest that the cytoprotection by Bcl-2 against NGF deprivation may be due at least in part to the function of Bcl-2 as an antioxidant effecter. Recently, it was suggested that Bcl-2 overexpression allows cells to adapt to ROS overproduction (Esposti et al, 1999; Saitoh et al, 2003a, b), and Bcl-2-expressing cells elevate their intracellular redox potential through accumulating high concentrations of GSH and NAD(P)H and a high level of fatty acid binding protein (FABP), which might act as a molecular scavenger through binding the cytotoxic oxidized forms of fatty acids that are generated by oxidative stress at early stages of apoptosis (Mei et al, 1997; Voehringer et al, 2000); Bcl-2-expressing cells promote the intracellular uptake and accumulation of exogenously added ascorbic acid and its accumulation (Saitoh et al, 2003a, Yanada et al, 2004 ). Thus, it may be reasonably thought that Bcl-2 protein may control the intracellular ROS levels indirectly by acting to maintain the intracellular redox potential rather than by directly scavenging ROS. From these observations, we think that the enhancement of antioxidative potential accompanying the overexpression of Bcl-2 also played an important role in the protection against NGF-deprivation-induced apoptosis. Our results showed that Bcl-2 did not inhibit the generation of intracellular ROS in the rising phase, but the ROS was appreciably decreased in hbcl-2 (+) cells in the declining phase (Figure 9). Based on the hypothesis that the antioxidative potential is enhanced over the inherent non-transfected level in hbcl-2 (+) cells, it is naturally guessed that the decrease of once generated ROS is due to an extra part of antioxidative ability exogenously or transfectionally bestowed to cells. In addition, our results suggested that ROS is one of upstream mediators that may acceleratively execute NGF deprivation-induced cell death, because the increase of ROS production occurred prior to the loss of !", release of cytochrome c, activation of caspase-3 and cell death. The mitochondrial membrane potential in hbcl-2 (-) cells was transiently diminished in at early timepoints after NGF deprivation, but immediately restored, in contrast to the continuous retention in hbcl-2

(+) cells (Figure 7). This early and transient event may ensue from the partial disruption and subsequent repair of the membrane-potential-maintenance machinery including the mitochondrial proton pump, which can be regarded as an immediate occurrence after NGF deprivation, and followed by release of cytochrome c inside the mitochondria into the cytoplasmic space (Figure 8) together with caspase-3 activation (Figure 6) in hbcl-2 (-) cells, in contrast to the prevention in hbcl-2 (+) cells.

On the other hand, other mechanisms have been reported about antiapoptotic functions of Bcl-2. Roberts et al. reported that the transfected hBcl-2 prevents NGFdeprivation-induced apoptosis in sympathetic neurons by promoting the degradation of BAD proteins (Roberts et al, 2000). In addition, Bcl-2 can inhibit the activation of proapoptotic family members such as Bax and Bak through formation of heterodimers, both of which were known as mediators that are operated by multiple apoptotic stimuli such as the mitochondrial disfunction and the endoplasmic reticulum stress (Wei et al, 2003).

Since apoptosis is regulated by the balance of the action of pro- and anti-apoptotic Bcl-2 proteins (Oltvai et al, 1993), the overexpression of Bcl-2 might maintain or compensate the balance and lead cells to survival against NGFdeprivation-induced apoptosis. These mechanisms may also be related to the NGF-deprivation-induced apoptosis.

In conclusion, our results demonstrated that the forced expression of Bcl-2 prevents NGF deprivation-induced apoptosis through inhibition of cell death-associated events such as loss of !", release of cytochrome c and activation of caspase-3, and suggested that the promotion of intracellular ROS elimination in hbcl-2 (+) cells was closely concerned with the neuroprotective effect of Bcl-2.

Moreover, our results also demonstrated that Bcl-2 could inhibit NGF deprivation-induced neurite retraction and the decrease of the levels of neurofilaments and NSE. The present study raises the possibility of an antioxidant action of Bcl-2 for utilization as gene therapy in the future towards diverse NGF-lacking neurodegenarative diseases.

Acknowledgement The authors thank Dr. Norio Nagao for his technical advice and encouragement.

References Allsopp TE, Wyatt S, Paterson HF and Davies AM (1993) The proto-oncogene bcl-2 can selectively rescue neurotrophic factor-dependent neurons from apoptosis. Cell 73, 295-307.

Appel SH (1981) A unifying hypothesis for the cause of amyotrophic lateral sclerosis, parkinsonism, and Alzheimer disease. Ann Neurol 10, 499-505.

Batistatou A, Merry DE, Korsmeyer SJ and Greene LA (1993) Bcl-2 affects survival but not neuronal differentiation of PC12 cells. J Neurosci 13, 4422-4428.

Bonfoco E, Krainc D, Ankarcrona M, Nicotera P and Lipton SA (1995) Apoptosis and necrosis: two distinct events induced, respectively, by mild and intense insults with N-methyl-Daspartate or nitric oxide/superoxide in cortical cell cultures.

Proc Natl Acad Sci U S A 92, 7162-7166.

Burlacu A (2003) Regulation of apoptosis by Bcl-2 family proteins. J Cell Mol Med 7, 249-257.

285

Saitoh et al: Repressive effect of bcl-2 on NGF deprivation-induced cell death Buttke TM, Sandstrom PA, Buttke TM and Sandstrom PA (1994) Oxidative stress as a mediator of apoptosis. Immunol Today 15, 7-10.

Caleo M, Cenni MC, Costa M, Menna E, Zentilin L, Giadrossi S, Giacca M, Maffei L (2002) Expression of BCL-2 via adenoassociated virus vectors rescues thalamic neurons after visual cortex lesion in the adult rat. Eur J Neurosci 15, 1271-1277.

Cao YJ, Shibata T, Rainov NG (2002) Liposome-mediated transfer of the bcl-2 gene results in neuroprotection after in vivo transient focal cerebral ischemia in an animal model.

Gene Ther 9, 415-419.

Choi DW and Rothman SM (1990) The role of glutamate neurotoxicity in hypoxic-ischemic neuronal death. Annu Rev Neurosci 13, 171-182.

Cohen GM (1997) Caspases: the executioners of apoptosis.

Biochem J 326, 1-16.

Ellis RE, Yuan J and Horvitz HR (1991) Mechanisms and functions of cell death. Annu Rev Cell Biol 7, 663-698.

Enari M, Talanian RV, Wong WW, and Nagata S (1996) Sequential activation of ICE-like and CPP32-like proteases during Fas-mediated apoptosis. Nature 380, 723 -726.

Esposti MD, Hatzinisiriou I, McLennan H and Ralph S (1999) Bcl-2 and mitochondrial oxygen radicals. New approaches with reactive oxygen species-sensitive probes. J Biol Chem 274, 29831-29837.

Fernandes-Alnemri T, Armstrong RC, Krebs J, Srinivasula SM, Wang L, Bullrich F, Fritz LC, Trapani JA, Tomaselli KJ, Litwack G and Alnemri ES (1996) In vitro activation of CPP32 and Mch3 by Mch4, a novel human apoptotic cysteine protease containing two FADD-like domains. Proc Natl Acad Sci U S A 93, 7464-7469.

Green DR, Reed JC (1998) Mitochondria and apoptosis. Science 281, 1309-1312.

Greenlund LJ, Deckwerth TL and Johnson EM (1995b) Superoxide dismutase delays neuronal apoptosis: A role for reactive oxygen species in programmed neuronal death.

Neuron 14, 303-315.

Greenlund LJ, Korsmeyer SJ and Johnson EM (1995a) Role of BCL-2 in the survival and function of developing and mature sympathetic neurons. Neuron 15, 649-661.

Hockenbery DM, Nunez G, Milliman CL, Schreiber RD and Korsmeyer SJ (1990) Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death.

Nature 348, 334-336.

Hockenbery DM, Oltvai ZN, Yin XM, Milliman CL and Korsmeyer SJ (1993) Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell 75, 241-251.

Jacobson MD and Raff MC (1995) Programmed cell death and Bcl-2 protection in very low oxygen. Nature 374, 814-816.

Kane DJ, Sarafian TA, Anton R, Hahn H, Gralla EB, Valentine JS, Ord T and Bredesen DE (1993) Bcl-2 inhibition of neural death: decreased generation of reactive oxygen species.

Science 262, 1274-1277.

Kluck RM, Bossy-Wetzel E, Green DR and Newmeyer DD (1997) The release of cytochrome c from mitochondria: a primary site for Bcl-2 regulation of apoptosis. Science 275, 1132–1136.

Kroemer G, Reed JC (2000) Mitochondrial control of cell death.

Nat Med 6, 513-519.

Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES and Wang X (1997) Cytochrome c and dATPdependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91. 479–489.

Lin KT, Xue JY, Sun FF and Wong PY (1997) Reactive oxygen species participate in peroxynitrite-induced apoptosis in HL60 cells. Biochem Biophys Res Commun 230, 115-119.

Mah SP, Zhong LT, Liu Y, Roghani A, Edwards RH and Bredesen DE (1993) The protooncogene bcl-2 inhibits apoptosis in PC12 cells. J Neurochem 60, 1183-1186.

Mei B, Kennedy MW, Beauchamp J, Komuniecki PR and Komuniecki R (1997) Secretion of a novel, developmentally regulated fatty acid-binding protein into the perivitelline fluid of the parasitic nematode, Ascaris suum. J Biol Chem 272, 9933-9941.

Mikhailov V, Mikhailova M, Pulkrabek DJ, Dong Z, Venkatachalam MA and Saikumar P (2001) Bcl-2 prevents bax oligomerization in the mitochondrial outer membrane. J Biol Chem 276, 18361–18374.

Nicholson DW, Ali A, Thornberry NA, Vaillancourt JP, Ding CK, Gallant M, Gareau Y, Griffin PR, Labelle M, Lazebnik YA, Munday NA, Raju SM, Smulson ME, Yamin T, Yu VL and Miller DK (1995) Identification and inhibition of the ICE/CED-3 protease necessary for mammalian apoptosis.

Nature 376, 37-43.

Olney JW, Labruyere J and Price MT (1989) Pathological changes induced in cerebrocortical neurons by phencyclidine and related drugs. Science 244, 1360-1362.

Oltvai ZN, Milliman CL and Korsmeyer SJ (1993) Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74, 609-619.

Oppenheim RW (1991) Cell death during development of the nervous system. Annu Rev Neurosci 14, 453-501.

Pettmann B. and Henderson CE (1998) Neuronal cell death.

Neuron 20. 633–647.

Raff MC, Barres BA, Burne JF, Coles HS, Ishizaki Y and Jacobson MD (1993) Programmed cell death and the control of cell survival: lessons from the nervous system. Science 262, 695–700.

Reed JC (1994) Bcl-2 and the regulation of programmed cell death. J Cell Biol 124, 1-6.

Reed JC (1997) Cytochrome c: can’t live with it, can’t live without it. Cell 91, 559–562.

Roberts ML, Virdee K, Sampson CP, Gordon I, Parone P, Tolkovsky AM. (2000) The combination of bcl-2 expression and NGF-deprivation facilitates the selective destruction of BAD protein in living sympathetic neurons. Mol Cell Neurosci 16, 97-110.

Saeki Y, Matsumoto N, Nakano Y, Mori M, Awai K and Kaneda Y (1997) Development and characterization of cationic liposomes conjugated with HVJ (Sendai virus): reciprocal effect of cationic lipid for in vitro and in vivo gene transfer.

Hum Gene Ther 8, 2133-2141.

Saitoh Y, Ouchida R and Miwa N (2003b) Bcl-2 prevents hypoxia/reoxygenation-induced cell death through suppressed generation of reactive oxygen species and upregulation of Bcl-2 proteins. J Cell Biochem 90, 914-924.

Saitoh Y, Ouchida R, Kayasuga A and Miwa N (2003a) Antiapoptotic defense of bcl-2 gene against hydroperoxideinduced cytotoxicity together with suppressed lipid peroxidation, enhanced ascorbate uptake, and upregulated Bcl-2 protein. J Cell Biochem 89, 321-334.

Salgo MG, Squadrito GL and Pryor WA (1995) Peroxynitrite causes apoptosis in rat thymocytes. Biochem Biophys Res Commun 215, 1111-1118.

Schulz JB, Bremen D, Reed JC, Lommatzsch J, Takayama S, Wullner U, Loschmann PA, Klockgether T and Weller M (1997) Cooperative interception of neuronal apoptosis by BCL-2 and BAG-1 expression: prevention of caspase activation and reduced production of reactive oxygen species. J Neurochem 69, 2075-2086.

Sejda P, Parce JW, Seeds MS and Bass DA (1984) Flow cytometric quantitation of oxidative produce formation by polymorphonuclear leukocytes during phagocytosis. J Immunol 133, 3303-3307.

286

Gene Therapy and Molecular Biology Vol 11, page 287 Shimizu S, Eguchi Y, Kamiike W, Funahashi Y, Mignon A, Lacronique V, Matsuda H and Tsujimoto Y (1998) Bcl-2 prevents apoptotic mitochondrial dysfunction by regulating proton flux. Proc Natl Acad Sci U S A 95, 1455-1459.

Shimizu S, Eguchi Y, Kosaka H, Kamiike W, Matsuda H and Tsujimoto Y (1995) Prevention of hypoxia-induced cell death by Bcl-2 and Bcl-xL. Nature 374, 811-813.

Staecker H, Liu W, Malgrange B, Lefebvre PP, Van De Water TR (2007) Vector-mediated delivery of bcl-2 prevents degeneration of auditory hair cells and neurons after injury.

ORL J Otorhinolaryngol Relat Spec 69, 43-50.

Stefanis L, Park DS, Yan CYI, Farinelli SE, Troy CM, Shelanski ML and Greene LA (1996) Induction of CPP32-like activity in PC12 cells by withdrawal of trophic supportâ&#x20AC;&#x201D;dissociation from apoptosis. J Biol Chem 271, 30663â&#x20AC;&#x201C;30671.

Tewari M, Quan LT, O'Rourke K, Desnoyers S, Zeng Z, Beidler DR, Poirier GG, Salvesen GS and Dixit VM (1995) Yama/CPP32 beta, a mammalian homolog of CED-3, is a CrmA-inhibitable protease that cleaves the death substrate poly(ADP-ribose) polymerase. Cell 81, 801-809.

Thornberry NA, Bull HG, Calaycay JR, Chapman KT, Howard AD, Kostura MJ, Miller DK, Molineaux SM, Weidner JR, Aunins J, Elliston KO, Ayala JM, Casano FJ, Chin J, Ding GJ-F, Egger LA, Gaffney EP, Limjuco G, Palyha OC, Raji SM, Rolando AM, Salley JP, Yamin TT, Lee TD, Shively JE, MacCross M, Mumford RA, Schmidt JA and Tocci MJ (1992) A novel heterodimeric cysteine protease is required for interleukin-1 beta processing in monocytes. Nature 356, 768-774.

Tsujimoto Y and Croce CM (1986) Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma. Proc Natl Acad Sci U S A 83, 5214-5218.

Vaux DL, Cory S and Adams JM (1988) Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature 335, 440-442.

Voehringer DW, Hirschberg DL, Xiao J, Lu Q, Roederer M, Lock CB, Herzenberg LA, Steinman L and Herzenberg LA (2000) Gene microarray identification of redox and mitochondrial elements that control resistance or sensitivity to apoptosis. Proc Natl Acad Sci U S A 97, 2680-2685.

Wei MC, Zong WX, Cheng EH, Lindsten T, Panoutsakopoulou V, Ross AJ, Roth KA, MacGregor GR, Thompson CB, Korsmeyer SJ (2001) Proapoptotic BAX and BAK: a requisite gateway to mitochondrial dysfunction and death.

Science 292, 727-730.

Yanada S, Saitoh Y, Kaneda Y and Miwa N (2004) Cytoprotection by bcl-2 Gene Transfer against Ischemic Liver Injuries Together with Repressed Lipid Peroxidation and Increased Ascorbic Acid in Livers and Serum. J Cell.

Biochem 93, 857-870.

Yanada S, Sasaki M, Takayama S, Kaneda Y, Miwa N (2005) Hemagglutinating virus of Japan-artificial viral envelope liposome-mediated cotransfer of bag-1 and bcl-2 genes protects hepatic cells against ischemic injury through BAG1-assisted preferential enhancement of bcl-2 protein expression. Hum Gene Ther 16, 627-633.

Yang J, Liu X, Bhalla K, Kim CN, Ibrado AM, Cai J, Peng TI, Jones DP and Wang X (1997) Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked.

Science 275, 1129-1132.

Zhong LT, Sarafian T, Kane DJ, Charles AC, Mah SP, Edwards RH and Bredesen DE (1993) bcl-2 inhibits death of central neural cells induced by multiple agents. Proc Natl Acad Sci U S A 90, 4533-4537.

287

Saitoh et al: Repressive effect of bcl-2 on NGF deprivation-induced cell death

288

Gene Therapy and Molecular Biology Vol 11, page 289 Gene Ther Mol Biol Vol 11, 289-298, 2007

Role of homologous recombination repair and nonhomologous end joining in therapeutic resistance of BCR/ABL-expressing leukemia cells Research Article

Dariusz Pytel1, Pawel Rusin1, Agnieszka Sliwinska2, Alina Morawiec-Bajda3, Jozef Drzewoski2, Ireneusz Majsterek1,* 1

Department of Molecular Genetics, University of Lodz, Lodz, Poland Department of Internal Medicine, Diabetology and Clinical Pharmacology, Medical University of Lodz, Lodz, Poland 3 Department of Head and Neck Cancer, Medical University of Lodz, Lodz, Poland 2

__________________________________________________________________________________ *Correspondence: Ireneusz Majsterek, Ph.D., Department of Molecular Genetics University of Lodz, Banacha 12/16 street, 90-237 Lodz, Poland; Tel: +48+42 6354486; Fax: +48+42 6354484; e-mail: imajst@biol.uni.lodz.pl Key words: BCR/ABL; Leukemia; Drug resistance; DNA repair; STI571 Abbreviations: Chronic myeloid leukemia, (CML); double strand breaks, (DSBs); homologous recombination repair, (HRR); nonhomologous end joining repair, (NHEJ); phosphate buffered saline, (PBS) Received: 15 May 2007; Revised: 31 May 2007 Accepted: 4 June 2007; electronically published: December 2007

Summary The BCR/ABL oncogene resulting from chromosome translocation t(9;22) is the pathogenic principle of human chronic myelogenous leukemia. BCR/ABL-expressing cells may display drug and radiation resistance due to accelerated DNA repair stimulated by BCR/ABL. The aim of this study was determination of a role of homologous recombination (HRR) and non-homologous end joining repair (NHEJ) of double strand breaks (DSBs) in drug and radiation resistance of human BCR/ABL-expressing leukemic cells. K562 BCR/ABL-positive and CCRF-CEM BCR/ABL-negative human leukemia cells were used to examine the contribution of DSBs repair in their resistance to !-radiation and idarubicin. Long-term viability and clonogenic test of the cell proliferation ability was used to estimate resistance against the DNA-damaging agents. The activity of BCR/ABL was inhibited by STI571 (Gleevec, Imatinib mesylate) as assayed by Western blotting. The kinetics of DNA repair after cell treatment with idarubicin at 0.5 and 1 !M or !-radiation at 15 Gy and 25 Gy with or without STI571 pre-treatment were examined by the alkaline comet assay. It was found that DNA repair was more effective in K562 than in CCRF-CEM cells that correlated with drug and radiation resistance. The decrease of HRR pathway was 3.2-fold greater than NHEJ in K562 cells after STI571 treatment. Moreover, the induction of DSBs caused a 2.6-fold higher activation of HRR in K562 than in CCRF-CEM cells. We did not find significant changes in the activity of NHEJ pathway between both cell lines. Our results suggest that DSBs recovery by HRR-dependent pathway is critical for drug and radiation resistance of BCR/ABL-positive human leukemia cells.

The induction of G2/M cell cycle delays, the elevation of the anti-apoptotic Bcl-xL protein and the activation of DNA repair are suggested to be involved in the BCR/ABL cellular pathway (Lugo et al, 1990; Druker et al, 1996; Sattler and Salgia, 1998; Grumbach et al, 2001; Nagar et al, 2002, 2003). In addition our findings indicate that the repair of drug-induced DNA lesions might be essential for drug resistance of BCR/ABL-positive cells (Slupianek et al, 2001, 2002; Majsterek et al, 2002, 2003, 2004; Hoser et al, 2003). Previously, we reported that BCR/ABL stimulated homologous recombination repair (HRR) in

I. Introduction Chronic myeloid leukemia (CML) is characterized by a reciprocal chromosomal translocation between chromosomes 9 and 22 (t(9;22)(q34;q11)) resulting in BCR/ABL fusion tyrosine kinase. The constitutively activated BCR/ABL plays a critical role in the pathogenesis of CML, likely via phosphorylation of multiple downstream protein-targets, resulting in the activation of mitogenic cellular pathways (Daley and Van Etten, 1990; Lugo et al, 1990; Sattler and Salgia, 1998).

289

Pytel et al: Role of HRR and NHJE resistance of BCR/ABL-expressing leukemia cells (Vilnius, Lithuania), 40% acrylamide/bis solution, precision plus protein standards All Blue (10-250 kDa) and hyperbound-ECL nitrocellulose were obtained from Bio-Rad Laboratories, Inc. (Hercules, CA, USA). Crk-L antibody (C20) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). "-actin Loading Control mouse 1:5000 was purchased from Apcam plc.

(Cambridge, UK). ECL Western Blotting Analysis System was obtained from Amersham Biosciences (Little Chalfont, K).

murine pro-B lymphoid BaF3 cells, but our latest data suggest that multiple pathways of DNA repair may be stimulated by BCR/ABL kinase (Slupianek et al, 2002; Majsterek et al, 2004).

The introduction of STI571 in the treatment of CML has been a major medical advance for the management of this disease. STI571 selectively inhibits the kinase activity of the BCR/ABL fusion protein and suppresses the growth of leukemic progenitors (Druker at al. 1996; Buchdunger et al, 1996). Extensive clinical studies have established high efficacy of this agent in the treatment of CML patients, including those in the chronic phase, as well as patients in the accelerated or blast phase (Druker et al, 2001a,b, 2003; Mauro at al. 2002; Deininger and Druker, 2003; Kurzrock et al, 2003; O'Brien et al, 2003). Since it is known that BCR/ABL promotes drug resistance, it has been a great importance to define whether STI571 might abrogate this effect by blocking its oncogenic pathways.

Recently it was reported that STI571 could be successfully used in combined therapy of patients with CML when conventional chemotherapy is inefficient (Nishii et al, 1996; Tipping and Melo, 2003; Zhang et al, 2003; Yin et al, 2004).

In order to elucidate the mechanism of leukemia resistance, we used BCR/ABL-positive K562 human chronic myelogenus leukemia cells and BCR/ABLnegative CCRF-CEM cells, derived from human lymphoblastic leukemia treated with idarubicin and !radiation. Idarubicin is a member of the anthracycline antibiotics group, which reveals antiproliferation properties and is used in leukemia treatment. Its pharmalogical activity originates from the ability to diffuse across the cell membrane and intercalate between DNA base pairs and/or target DNA topoisomerase II, leading to DNA single (SSBs) and double strand breaks (DBSs). It may also induce free radicals (ROS) (Borchmann et al, 1997; Siu et al, 1999; Laroche-Clary et al, 2000; Blasiak et al, 2002). Since idarubicin is considered to introduce replication-associated DSBs we used !-irradiation that causes direct breaks and ROS induced DNA lesions. In our experiments, the MMT viability assay and the cells proliferation ability test were performed to estimate cells sensitivity to DNA-damaging agents with or without STI571 pre-treatment. The contribution of two main pathways involved in DSBs reapir: the HRR and non-homologous end-joining (NHEJ) were investigated by an extrachromosomal assay to estimate their contribution to drug and radiation resistance of K562 and CCRF-CEM human leukemia cells.

B. Cells K562 human chronic myeloid leukemia cells expressing BCR/ABL were obtained from dr. Malgorzata Czyz (Medical University of Lodz, Lodz, Poland) and CCRF-CEM human acute lymphoblastic leukemia cells not-expressing BCR/ABL were obtained from dr. Blazej Rychlik (University of Lodz, Lodz, Poland). K562 and CCRF-CEM cells were maintained in RPMI 1640 medium supplemented with 10% FBS and antibiotic mixture (the growth medium) at a final concentration of 1-3 x 105 cells/ml. The incubation of cells in culture with STI571 at 1 "M was performed in 37°C in the atmosphere of 5% CO 2 for 24 hours. K562 and CCRF-CEM cells for the positive control were treated with 10 "M hydrogen peroxide in the growth medium for 10 min at 4°C with or without STI571 pre-incubation. Cells were treated with idarubicin at the concentration ranging from 0.01 "M to 100 "M in the growth medium at 37oC for 1 hour with or without STI571 pre-incubation. !-irradiation at a dose rate 0.0266 Gy/s was carried out using a 60Co source (Technical University of Lodz, Lodz, Poland). The cells were kept at room temperature during irradiation with 5-30 Gy with or without STI571 pre-incubation. The initial viability of cells in each experiment was about 90%, as measured by the trypan blue exclusion method.

1. MTT assay for drug and radiation resistance After irradiation or incubation with idarubicin with and without STI571 pre-incubation at 1 µM the resistance of cells was evaluated by the MTT assay (Siu et al, 1999). Idarubicin at a final concentration 0 - 2.5 "M was added to the cells or cells were irradiated with dose 0-30 Gy at density 1.5 x 106 ml-1 in the growth medium and plated onto 96 well plates in 200 "l growth medium. Then, 20 "l aliquot of 10 mg/ml MTT reagent was added to each well four days later. After incubation at 37°C for 4 h, the supernatant was removed and 200 "l of a aliquot solution containing 10% SDS and 0.04 M HCl was added to dissolve the water-insoluble formazan salt. One hour later, the difference OD650 nm-OD 570 nm was measured with an ELISA microplate reader (Bio-Rad, Hercules, CA, USA). Drug resistance and radiation was expressed as a percentage of viable cells in suspension culture exposed to idarubicin or !-radiation in comparison to the untreated control cells.

C. Clonogenic assay for proliferation ability Idarubicin at 1 µM was added to cells growing in a semisolid medium (1 x 103/ml) MethoCult H4230 (StemCell Technologies Inc., Vancouver, Canada) with or without preincubation with STI571 at 1 µM. Colonies were scored after 7 days. Results are represented as the percentage of colony forming cells after idarubicin and radiation treatment in comparison to the untreated control group. Viable cells were detected by trypan blue dye exclusion after 48 h of incubation with the drug. Results represent the percentage of drug-treated cells excluding trypan blue in comparison to the untreated cells.

II. Materials and Methods A. Drugs and chemicals Idarubicin was obtained from Pharmacia & Upjohn (Milan, Italy). Tris, RPMI 1640 medium, agarose, low melting point agarose, phosphate buffered saline (PBS), DAPI (4’, 6diamidino-2-phenylindole), fetal bovine serum (FBS), MTT (3(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide), DTT (dithiothreitol), Bradford reagent, pCGJ and pBR322 vectors, DH5! competent cells, and the secondary rabbit peroxidase conjugate antibody were obtained from Sigma Chemicals (St. Louis, MO, USA). Endonucleases EcoRV, NheI, NruI, XmaIII and SspI were purchased from Fermantas UAB

D. Comet assay for DNA repair To examine DNA repair, K562 and CCRF-CEM cells (1.5 x 106 ml-1) were treated with idarubicin at 0.5 "M or 1 µM for 1 hour at 37°C with or without pre-incubation with STI571,

290

Gene Therapy and Molecular Biology Vol 11, page 291 washed and re-suspended in a fresh, drug-free growth medium.

K562 and CCRF-CEM control cells were treated with 10 "M hydrogen peroxide for 10 min at 4°C. Aliquots of cell suspensions were harvested immediately (time 0) and 30, 60 and 120 min thereafter, and placed on ice to stop the repair reaction.

Cells exposed to 10 "M hydrogen peroxide for 10 min at 4°C served as a positive control. The comet assay was performed under alkaline conditions essentially according to the procedure of Singh and colleagues in 1988 with some modifications (Klaude et al, 1996). A freshly prepared cell suspension in 0.75% low melting point agarose dissolved in PBS was placed onto microscope slides pre-coated with 0.5% normal melting agarose.

The cells were then lysed for 1 h at 4°C in a buffer consisting of 2.5 M NaCl, 100 mM EDTA, 1% Triton X-100, 10 mM Tris, pH 10. After the lysis, the slides were placed in an electrophoresis unit, DNA was allowed to unwind for 40 min in an electrophoretic solution containing 300 mM NaOH, 1 mM EDTA, pH >13. Electrophoresis was conducted at 4°C (the temperature of the running buffer not exceeding 12°C) for 30 min at electric field strength 0.73 V/cm (30 mA). The slides were then neutralized with 0.4 M Tris, pH 7.5, stained with 2 "g/ml DAPI and covered with cover slips. To prevent additional DNA damage all steps were conducted under a dimmed light or in the dark.

repeated in triplicate. The comet tail moment is positively correlated with the level of DNA breakage in a cell (Ashby et al, 1995). A mean value of tail moment in particular sample was taken as an indicator of DNA damage in this sample.

F. Extrachromosomal double strand break repair TAK assay To delineate the nature of the double strand repair mechanism, a three-plasmids TAK (Tetracycline, Ampicillin, Kanamycin) assay based on bacterial transformation was utilized (Liang and Jasin, 1996). The scheme of TAK assay with repair substrates and HRR or NHEJ repair products is shown in Figure 1. Plasmid pCGJKm with kanamycin resistance (KmR) gene was introduced uncleaved into mammalian cells to serve as a transfection control. Two plasmids pBR322Amp and pBR322Tet were used to measure homologous recombination repair and DNA non-homologous end joining. Plasmid pBR322Amp was cleaved with EcoRV and NheI, and plasmid pBR322Tet with NruI and XmaIII, then both linear forms were recovered from agarose gel after electrophoresis using a Millipore elution kit (Millipore QIAquick Gel Extraction Kit, QIAGEN Valencia, CA, USA).

The plasmid backbones of pBR322Amp and pBR322Tet are each capable of being recircularized in mammalian cells to measure DNA end joining. When recovered from mammalian cells and reintroduced into bacteria, the recircularized plasmids confer ampicillin resistance (AmpR ), which serves as the measure of DNA end joining.

In a separate experiment the pBR322Tet and pBR322Amp plasmids are also used to measure double strand break-promoted homologous recombination in mammalian cells. Plasmid pBR322Tet contains the 5’ end, and pBR322Amp contains the 3’ end of the tetracycline resistance (TetR ) gene with tet fragment (552 bp) of homology between them in the middle of the gene.

The plasmid backbones are also homologous. When the two plasmids recombine within the tet homology region, TetR gene is recovered, and the recombined plasmid confers tetracycline resistance (TetR). Homologous recombination between two

E. Comet analysis The slides were examined at 200x magnification in an Eclipse fluorescence microscope (Nikon, Tokyo, Japan) attached to a COHU 4910 video camera (Cohu, Inc., San Diego, CA, USA) equipped with a UV filter block containing an excitation filter (359 nm) and barrier filter (461 nm) connected to a personal computer-based image analysis system, Lucia-Comet v.

4.51 (Laboratory Imaging, Prague, Czech Republic). One hundred images were randomly selected from each sample and the comet tail moment (a product of fraction of DNA in tail and tail length) was measured. Two parallel tests with aliquots of the same sample were performed for a total of 200 cells and the mean comet tail moment was calculated. Each experiment was

Figure 1. The TAK (Tetracycline, Ampicillin, Kanamycin) assay for extrachromosomal DSBs repair analysis. Plasmid substrates are transfected into mammalian cells, recovered after 4 h, and then transformed into bacteria. Plasmids confer resistance to tetracycline (TetR), ampicillin (AmpR), kanamycin (KanR ) were used as markers of homologous recombination, DNA end-joining and transfection efficiency or DNA stability, respectively. Plasmids of pBR322 are introduced after cleavage with EcoRV + NheI (1) and SspI + XmaIII + NruI (2), as indicated. pCGJ plasmid which confers KanR , is introduced uncleaved and serves as transfection control (3). Rejoining of plasmid ends confers AmpR to bacteria. Recombination within the Tet gene of plasmid (1) and the homologous fragment from plasmid (2) confers TetR to bacteria.

291

Pytel et al: Role of HRR and NHJE resistance of BCR/ABL-expressing leukemia cells circular plasmids is inefficient in mammalian cells but is greatly stimulated when a double strand break is introduced next to the homology region (Liang and Jasin, 1996). Thus, pBR322Tet linearized with NruI and XmaIII was then cleaved with SspI to release the homologous tet fragment. The two linear plasmids and the small fragment of tet gene were all gel-purified to detect HRR recombination repair.

All the plasmid substrates were electrotransfected into K562 and CCRF-CEM cells using Electrotransfomation Module Gene Pulser Xcell (Bio-Rad, Hercules, CA, USA) at 1000 "F/155 V at 0.2 cm cuvette (Bio-Rad, Hercules, CA, USA). Then DNA from transfected cells was recovered after 4 hours of repair incubation by phenol/chloroform extraction and transformed into bacteria E. coli DH5! strain. Colonies growing with selective antibiotics were scoring and plates were washed with 2 ml PBS in order to analyze DNA repair products. In this procedure, TAK assay allowed to estimate DSBs repair, since number of KmR colonies measure transfection efficiency, AmpR indicate DNA end joining, and TetR indicate homologous recombination. A control experiment to verify if HR occurs indeed in the mammalian cells and not in E. coli was made using separate incubation of the linear substrates in mammalian cells and combining the all DNA isolates just before bacteria transformation. No-colonies resistant to tetracycline were observed (data not shown).

G. Western blot analysis K562 cells were lysed in a buffer (10 mM HEPES pH 7.5, 150 mM NaCl, 1% NP-40, 10% glycerol, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 50 mM NaF, 1 mM Na3VO 4, and 10 "g each of aprotinin and leupeptin/ml). Proteins were quantified using the Bradford assay and equal amounts of cell lysates were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 12% acrylamide). All blue prestained protein standards (10–250 kDa) were used for band identification. Proteins in gel were transferred to HyperboundECL nitrocellulose and Western analysis was performed with the Crk-L antibody or "-actin antibody and the secondary rabbit peroxidase conjugate antibody. Proteins were visualized with ECL reagents and analyzed by Gel Documentation and Analysis System (InGenius Syngen Bio Imaging, Cambridge, UK).

H. Statistical analysis The data of MTT assay were expressed as mean from three experiments ± SD and the values from comet assay in this study were expressed as mean ± SEM from three separate experiments.

If no significant differences between variations were found, as assessed by Snedecor-Fisher test, the differences between means were evaluated by applying Student’s t-test. Otherwise, the Cochran-Cox test was used. The data were analyzed using STATISTICA (StatSoft, Tulsa, OK) statistical package. 100 cells were scored to estimate proliferation ability of the cell lines. The data of TAK assay was presented as a two independent experiments.

Figure 2. Drug resistance of K562 and CCRF-CEM cells measured by MTT assay. The upper panel shows the survival of K562 cells (!) with BCR/ABL expression and CCRF-CEM cells (") without BCR/ABL expression by the MTT assay in the presence of increasing concentration of STI571 (0–10 "M). The survival of K562 cells in the presence of increasing concentrations of idarubicin (0-2.5 "M) on middle panel and on the lower panel the survival of K562 cells exposed to increased dose of !-radiation (0-30 Gy) was showed: K562 cells (!) exposed to !-radiation or idarubicin and K562 cells (") exposed to !-radiation or idarubicin and STI571 at 1 "M. Results represent mean of three independent experiments; error bars denote SD.

III. Results A. Drug and radiation resistance Figure 2 displays results of MTT assay. The upper panel shows survival of K562 cells and CCRF-CEM cells under increasing concentration of STI571 in the range 0.12.5 "M. The results show that STI571 had no effect on CCRF-CEM cells; there were not statistical changes in the cells viability up to 5 "M of STI571 (P < 0.05). Only the highest concentration 10 "M of STI571 caused slight decrease of cells viability (79%, P < 0.05). STI571 preincubation of K562 cells caused their viability decrease to 292

Gene Therapy and Molecular Biology Vol 11, page 293 down and cells were able to recovered 120 min thereafter (lower panel; P > 0.05).

59% at 0.5 "M (P < 0.05) and 55% at the 10 "M (P < 0.001). The results of MTT assay measuring survival of the K562 after idarubicin treatment show that STI571 at 1 "M caused statistical changes in viability of cells treated with idarubicin form the concentration range of 0.01-1 ÂľM (Figure 2; middle panel). The lower panel of Figure 2 shows K562 cells survival under increasing dose of !radiation from 0 to 30 Gy. STI571 significantly decreased survival of K562 cells above 5 Gy (P < 0.5).

D. Inhibition of BCR/ABL activity BCR/ABL tyrosine kinase activity was determined by the assessment of tyrosine phosphorylation of CRKL adaptor protein by Western Blot analysis with CRKL antibody (Figure 7). CRKL phosphorylated by the BCR/ABL kinase migrates slower than its nonphosphorylated form in SDS-PAGE. The variable bands are visible on gel when BCR/ABL is active resulting from the level of CRKL protein phosphorylation (Senechal et al, 1998). Figure 4 shows effect of STI571 on the BCR/ABL activity in K562 cells depending on its concentration. In our experiment the relative portion of phosphorylated CRKL reflecting BCR/ABL kinase activity was 63-70%

B. Proliferation ability The analysis of the proliferation ability of K562 cells and CCRM-CEM cells after idarubicin and !-radiation treatment is shown on Figure 3. BCR/ABL-positive cells formed more colonies at the drug free medium than cells without BCR/ABL. In this experiment almost all of the K562 cells formed colonies but colonies of CCRF-CEM arose from only about 50% of the cells cultured in the same experimental conditions (Figure 3, upper panel 98% vs. 50%; lower panel 96% vs. 64%). The higher clonogenic ability of K562 cells depended on BCR/ABL kinase activity because cells incubation with STI571 decreased number of colonies for K562 but not for CCRFCEM cells (Figure 3, upper panel 21% vs. 52%; lower panel 23% vs. 68%). BCR/ABL-positive cells arose even at the idarubicin concentration as high as 1 ÂľM that eliminated most colonies from CCRF-CEM cells (Fig. 3 upper panel; 63 % vs. 15 %; P < 0.001); pre-incubation with STI571 decreased their proliferation ability to 7%. It was also estimated that K562 cells irradiated with 25 Gy formed more colonies than CCRF-CEM cells (38% vs.

9%; P < 0.001), however treatment with STI571 reduced number of K562 colonies to 8.6%.

C. DNA repair Figure 4 shows effect of STI571 at 1 "M on the kinetics of DNA repair after hydrogen peroxide treatment of K562 and CCRF-CEM cells. The results show that STI571 had no effect on the kinetic of DNA repair in CCRF-CEM cells not-expressing BCR/ABL. After hydrogen peroxide treatment only K562 cells responded to STI571 and the inhibition of DNA repair was observed.

The kinetics of DNA repair after K562 cells exposure to idarubicin at 0.5 and 1 "M with or without preincubation with STI571 is displayed in Figure 5. The cells of the control group (no idarubicin) had small comet tail moment even after STI571 pre-incubation indicating that the procedure does not introduce any significant damage to their DNA. K562 cells were able to complete recovery after 60 min of repair incubation (upper panel). The kinetics of DNA repair in the presence of STI571 was slowed down and cells were able to recover 120 min thereafter (lower panel; P > 0.05).

The kinetics of DNA repair after K562 cells exposure to !-irradiation at 15 and 25 Gy with (lower panel) or without (upper panel) pre-incubation with STI571 is displayed in Figure 6. Within the first 60 min of incubation repair, K562 cells were able to recover completely (upper panel; P > 0.05). The kinetics of DNA repair in the presence of STI571 was dramatically slowed

Figure 3. Proliferation ability of K562 (gray bars) and CCRFCEM (black bars) cells. Cells were plated in methylcellulose after incubation with idarubicin at 1 "M for 24 h (upper panel) or after irradiation with 25 Gy (lower panel) or with or without preincubation with STI571. The figures display untreated cells (control), cells incubated for 48 h with STI571 at 1 "M (STI571), cells irradiated with 25 Gy (!) or incubated with idarubicin at 1 "M (Ida), cells after 24 h pre-incubation with STI571 at 1 "M and irradiated with 25 Gy (STI571/Gamma) or treated with idarubicin at 1 "M (STI571/Ida). Colonies were scored after 7 days.

293

Pytel et al: Role of HRR and NHJE resistance of BCR/ABL-expressing leukemia cells

Figure 4. Time course of DNA repair in K562 and CCRF-CEM cells measured by alkaline comet assay. The upper panel represents K562 cells treated with hydrogen peroxide at 10 "M with STI571 pre-incubation at 1 "M (!); K562 cells treated with hydrogen peroxide at 10 "M without STI571 pre-incubation ("); compared with untreated K562 control cells (!). The lower panel represents untreated CCRF-CEM cells (!); CCRF-CEM cells treated with hydrogen peroxide at 10 "M with STI571 preincubation at 1 "M (!) and CCRF-CEM cells treated with hydrogen peroxide at 10 "M without STI571 pre-incubation (").

Two hundred cells were analyzed per each point. Results represent the mean of tail moment (a product of fraction of DNA in tail and tail length) of three independent experiments; error bars denote SEM.

Figure 5. Time course of DNA repair in K562 cells exposed to idarubicin with or without pre-incubation with STI571. The upper panel presents untreated K562 cells (!) compared with K562 cells treated with idarubicin at 0.25 "M (") and K562 cells treated with idarubicin at 1 "M (!). The lower panel shows K562 cells treated with idarubicin at 0.25 "M after pre-treatment with STI571 at 1 "M (") and K562 cells treated with idarubicin at 1 "M after pre-treatment with STI571 at 1 "M (!) compared with K562 cells treated with STI571 at 1 "M alone. (!). Two hundred cells were analyzed per each point. Results represent the mean of tail moment (a product of fraction of DNA in tail and tail length) of three independent experiments; error bars denote SEM.

before (control) and 15-18% after K562 cells incubation with STI571 at 1 "M; the increase of the STI571 concentration above this dose had no effect on BCR/ACL activity. At the lower panel the level of "-actin used as a protein loading control is displayed.

products. The analysis of DNA recovered from AmpRcolonies revealed the presence of different size products (Figure 9) resulting from DNA-ends processing of the linear substrates (Figure 1) by NHEJ (Slupianek et al, 2005). As seen in the electrophoresis analysis, the transfection control pCGJKm is taken up by the cells and was used to calculate repair efficiency. The end joining products represented roughly 44.5% of the transfected DNA, whereas the recombination product was about 7.4% for K562 cells in comparison to 39.8% for end joining and 2% for the recombination repair for CCRF-CEM. The ratio of NHEJ/HRR repair effectiveness was similar to those obtained previously by Liang and Jasin in 1996.

Homologous recombination products were underrepresented relative to end joining products in both the TAK assay, since only one repair event is needed to rejoin the plasmid backbones to confer AmpR, whereas

E. DSBs repair The results obtained with the extrachromosomal plasmids indicate that after entering cells, transfected DNA begins to be repaired in both cell lines. Figure 8 displays number of colonies calculated per "g of DNA transformed to bacterial cells. A clear signal for both end joining and homologous recombination is obtained, as evidenced by the recovery of AmpR and TetR colonies at the 4-h time point. The restriction analysis of DNA recovered from TetR colonies confirmed that full size fragment of tetracycline gene is present in HRR repair

294

Gene Therapy and Molecular Biology Vol 11, page 295 glycoproteins transporters (MDR1), elevated level of Bcl2 family of antiapoptotic proteins, cell cycle arrest and modulation of DNA repair (Bedi et al, 1995; AmaranteMendes et al, 1998a,b). Our previous studies revealed the stimulation of DNA double strands breaks repair in mouse murine BaF3 cells transformed with BCR/ABL (Slupianek et al, 2002). This process was dependent on the BCR/ABL-mediated overexpresion of RAD51 protein, the key factor in HRR pathway. Recently, Slupianek at al, 2006 suggested that BCR/ABL might also alter fidelity of DSBs repair. It is believed that HRR is precise, however there are homology-dependent repair pathways such as break-induced replication and single strand annealing repair of DSBs that cause loss of heterozygosity and intrachromosomal deletions. In the same work authors reported that the percentage of !-H2AX co-localization with RAD51 was higher in the BCR/ABL-expressing cells, but parental and BCR/ABL cells displayed similar kinetics of !-H2AX co-localizing with Ku70, thus suggesting HRR rather than NHEJ contribution to genomic instability in BCR/ABL-positive leukemias. n the present study we examined DSBs repair in two human leukemia cell lines, K562 BCR/ABL-expressing cells and BCR/ABL-negative CCRF-CEM cells. The analysis of the efficacy of DSBs repair by two repair pathways, HRR and NHEJ in K562 and CCRF-CEM cell lines with/or without STI571 pre-incubation was performed using an extrachromosomal repair substrates.

Our research revealed that in K562 BCR/ABL-positive cells, STI571 caused 3.2 fold stronger inhibition of HRR than NHEJ pathway. We found changes neither in HRR nor NHEJ pathway in CCRF-CEM cells after STI571 treatment. Moreover we observed 2.6 fold higher activity of HRR in K562 cells than in CCRF-CEM cells. While no differences in NHEJ pathway between these cell lines were found, we suggested that BCR/ABL was responsible for enhancing the activity of DSBs repair in HRRdependent manner.

Figure 6. Time course of DNA repair in K562 cells exposed to !radiation with or without pre-incubation with STI571. The upper panel presents untreated K562 cells (!) compared with K562 cells exposed to !-radiation at 15 Gy (") and K562 cells exposed to !-radiation at 25 Gy (!). The lower panel shows K562 cells exposed to !-radiation at 15 Gy after pre-treatment with STI571 at 1 "M ("); K562 cells exposed to !-radiation at 25 Gy after pre-treatment with STI571 at 1 "M (!) compared with K562 cells treated with STI571 at 1 "M alone (!). Two hundred cells were analyzed per each point. Results represent the mean of tail moment (a product of fraction of DNA in tail and tail length) of three independent experiments; error bars denote SEM.

two repair events are required to reclose the plasmid to confer TetR. In addition to recombination within the tetracyline gene, either a second recombination event or end joining must occur within the downstream plasmid sequences. It was also found that, incubation with STI571 slowed down repair efficiency of DSBs in K562 cells.

After cells treatment with STI571 the end joining products represented roughly 39% of the transfected DNA and the recombination products was about 2.3% for K562 cells.

We did not observe any influence of STI571 on repair efficiency in CCRF-CEM. Figure 7. Western blot analysis of CRKL adaptor protein phosphorylation by the BCR/ABL kinase. The K562 cells were treated with an increasing concentration of STI571 inhibitor for 24 h. Cell lysates were separated on 12% SDS-PAGE. The Western analysis were performed with the Crk-L antibody and visualized with ECL reagents. Bands represent: untreated cells (control) with an active form of BCR/ABL and cells after incubation in the presence of STI571 at 0.5 "M, 1 "M and 2 "M. The CRKL adaptor protein and its CRKL-P phosphorylated form is shown. Molecular mass is expressed in kilodaltons (kDa). At

IV. Discussion Drug and radiation resistance of leukemia cells is main obstacle of an effective anticancer therapy. Usually, it is not consequence of tumor transformation, but arises as a result of a clone selection able to survive anti-cancer treatment (Goldie 1994; Harrison 1995; Hochhaus et al, 2002). Several mechanisms of resistance are considered for human leukemia cells including overexpression of

295

Pytel et al: Role of HRR and NHJE resistance of BCR/ABL-expressing leukemia cells the lower panel the level of "-actin used as a protein loading

control is presented.

Figure 8. Double strand break repair of extrachromosomal substrates. Linear plasmids pBR322Ap (NHEJ substrate), pBR322Tet (HRR substrate) and pCGJKm were electroporated into K562 and CCRF-CEM cells. After 4-h repair incubation with (black bars) or without pre-incubation (gray bars) with STI571 at 1 "M for 24 h in host cells, plasmid were isolated and transformed to bacterial DH5! competent cells. Number of colonies resistant to Tet indicates HRR repair efficiency (upper panel) and colonies resistant to Ap demonstrate mechanism of NHEJ (lower panel). Results represent number of colonies per "g of DNA transformed to DH5! cells in two independent experiments.

Figure 9. Agarose gel electophoresis analysis of repaired substrates isolated from colonies which grew in medium with selective antibiotics: kanamycin (Km), ampicillin (Ap), tetracycline (Tet). Colonies washed with 2 ml PBS from the dish with Ap indicate NHEJ and from the dish with Tet indicate HRR mechanism. Substrates were separated on a 1% agarose gel after restriction enzymes digestion: 1. DNA ladder 1 kbp-10 kbp; 2. pCGJ plasmids isolated from Km resistant colonies digested with EcoRI; 3. pBR322 control plasmids digested with EcoRI enzyme; 4. plasmids isolated from Ap resistant colonies digested with EcoRI; 5. plasmids isolated from Ap resistant colonies and pre-treated with STI571 at 1 "M digested with EcoRI; 6. plasmids isolated from Tet resistant colonies digested with EcoRI; 7. plasmids isolated from Tet resistant colonies pre-treated with STI571 at 1 "M and digested with EcoRI; 8. plasmids isolated from Tet resistant colonies digested with XmaIII and EcoRV; 9. plasmids isolated from Tet resistant colonies pre-treated with STI571 at 1 "M and digested XmaIII and EcoRV.

296

Gene Therapy and Molecular Biology Vol 11, page 297

Ashby JA, Tinwell H, Lefevre PA, Browne MA (1995) The single cell gel electrophoresis assay for induced DNA damage (comet assay): Measurement of tail length and moment. Mutagenesis 10, 85-90.

Bedi A, Barber JP, Bedi GC, El-Deiry WS, Sidransky D, Vala MS, Akhtar AJ, Hilton J, Jones RJ (1995) BCR-ABLmediated inhibition of apoptosis with delay of G2/M transition after DNA damage: a mechanism of resistance to multiple anticancer agents. Blood, 86, 1148-1158.

Blasiak J, Gloc E, Wozniak K, Mlynarski W, Stolarska M, Skorski T, Majsterek I (2002) Genotoxicity of idarubicin and its modulation by vitamins C and E and amifostine. Chem Biol Interact 149, 1-18.

Borchmann P, Hubel K, Schnell R, Engert A (1997) Idarubicin: a brief overview on pharmacology and clinical use. Int J Clin Pharmacol 35, 80-83.

Buchdunger E, Zimmermann J, Mett H, Meyer T, Muller M, Druker BJ, Lydon HB (1996) Inhibition of the Abl proteintyrosine kinase in vitro and in vivo by a 2phenylaminopyrimidine derivative. Cancer Res 56, 100-104.

Chan TA, Hwang PM, Hermeking H, Kinzler KW, Vogelstein B (2000) Cooperative effects of genes controlling the G(2)/M checkpoint. Genes Dev 14, 1584-1588.

Corradini F, Cesi V, Bartella V, Pani E, Bussolari R, Candini O, Calabretta B (2005) Enhanced proliferative potential of hematopoietic cells expressing degradation-resistant c-Myb mutants. J Biol Chem 280, 30254-30262.

Daley GQ, Van Etten RA, Baltimore D (1990) Transformation of an interleukin 3-dependent hematopoietic cell line by the chronic myelogenous leukemia-specific P210 bcr/abl protein.

Science 247, 824-830.

De Angeli C, Gandini D, Cuneo A, Moretti S, Bigoni R, Roberti MG, Bardi A, Castoldi GL, del Senno L (2000) BCL-1 rearrangements and p53 mutations in atypical chronic lymphocytic leukemia with t(11;14)(q13;q32).

Haematologica 85, 913-921.

Deininger MW, Druker BJ (2003) Specific targeted therapy of chronic myelogenous leukemia with imatinib. Pharmacol Rev 55, 401-423.

Druker BJ, Sawyers CL, Kantarjian H, Resta DJ, Reese SF, Ford JM, Capdeville R, Talpaz M (2001b) Activity of a specific inhibitor of the BCR/ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia and acute lymphoblastic leukemia with the Philadelphia chromosome. N Engl J Med 344, 1038-1042.

Druker BJ, Talpaz M, Resta DJ, Peng B, Buchdunger E, Ford JM, Lydon NB, Kantarjian H, Capdeville R, Ohno-Jones S, Sawyers CL (2001a) Efficacy and safety of a specific inhibitor of the BCR/ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med 344, 1031-1037.

Druker BJ, Tamura S, Buchdunger E, Ohno S, Segal GM, Fanning S, Zimmermann J, Lydon NB (1996) Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of BCR/ABL positive cells. Nat Med 2, 561-566.

Druker BJ (2003) Chronic myeloid leukemia in the imatinib era.

Semin Hematol 40, 50-58.

Goldie JH (1994) Modelling the process of drug resistance. Lung Cancer 10, 91-96.

Gruber FX, Lamark T, Anonli TA, Sovershaev MA, Olsen M, Gedde-Dahl T, Hjort-Hansen H, Skogen B (2005) Selecting and deselecting imatinib-resistant clones: observations made by longitudinal, quantitative monitoring of mutated BCRABL. Leukemia 19, 2159-2165.

Grumbach IM, Mayer IA, Uddin S, Lekmine F, Majchrzak B, Yamauchi H, Fujita S, Druker B, Fish EN, Platanias LC (2001) Engagement of the CrkL adaptor in interferon alpha

IA significant part of our work was the determination of STI571 effectiveness in cells with BCR/ABL expression. It was reported that cells could acquire resistance to STI571, which is the consequence of BCR/ABL gene duplication or mutations in a kinase catalytic domain (Gruber et al, 2005). We demonstrated that STI571 could effectively inhibit BCR/ABL tyrosine kinase activity in K562 cells, STI571 treatment at 1 "M decreased relative portion of phosphorylated CRKL protein reflecting BCR/ABL inactivation. The level of "actin was evaluated to control protein production and cell viability under STI571 condition. Cell survival and proliferation ability analysis showed that STI571 did not affect CCRF-CEM cells, while it was observed for K562 cells. Moreover, using both MTT and proliferation ability test we showed that K562 cells were resistant to idarubicin and radiation treatment but STI571 could increase cells sensitivity. The results of the proliferation test confirmed that BCR/ABL had also ability to stimulate proliferation, which is due to growth factor independent proliferation reported previously (Corradini et al, 2005). An analysis of cells treated with hydrogen peroxide revealed that STI571 selectively slowed down kinetic of DNA repair for K562 cells. Finally, we found that STI571 elevated K562 cells sensitivity to idarubicin and !-radiation, which was correlated with the inhibition of DNA repair processes.

The literature data showed that cells with an expression of oncogenic tyrosine kinases such as BCR/ABL, v-SRC and HER2/neu revealed early drug resistance (Pietras et al, 1994; Nishii et al, 1996; Masumoto et al, 1999; De Angeli et al, 2000). BCR/BL was found to affect Bcl-xL that prevented apoptosis and caused temporary G2/M cell cycle arrest, which seems to be essential for resistance (Bedi et al, 1995; AmaranteMendes et al, 1998a). HRR was reported to predominate in late S and G2 phase while NHEJ was characteristic mostly for G1 (Tsuzuki et al, 1996). In connection with latest results (Slupianek et al, 2006), these findings suggest that BCR/ABL may promote DSBs processing by HRR pathway what confirm discovery coming from our work.

Therefore, we conclude that BCR/ABL-dependent HRR pathway might serve for an effective DSBs recovery and is critical for drug and radiation resistance of leukemia cells.

Acknowledgements This work was supported by grant 505/363 from the University of Lodz in Poland and grant of Polish Ministry of Science and Higher Education N301099 32/3581.

References Amarante-Mendes GP, McGahon AJ, Nishioka WK, Afar DE, Witte ON, Green DR (1998a) Bcl-2-independent Bcr-Ablmediated resistance to apoptosis: protection is correlated with up regulation of Bcl-xL. Oncogene 16, 1383-1390.

Amarante-Mendes GP, Naekyung Kim C, Liu L, Huang Y, Perkins CL, Green DR, Bhalla K (1998b) Bcr-Abl exerts its antiapoptotic effect against diverse apoptotic stimuli through blockage of mitochondrial release of cytochrome C and activation of caspase-3. Blood 91, 1700-1705.

297

Pytel et al: Role of HRR and NHJE resistance of BCR/ABL-expressing leukemia cells signalling in BCR/ABL-expressing cells. Br J Haematol 112, 327-336.

Harrison DJ (1995) Molecular mechanisms of drug resistance in tumours. J Pathol, 175, 7-12.

Hochhaus A, Kreil S, Corbin AS, La Rosee P, Muller MC, Lahaye T, Hanfstein B, Schoch C, Cross NC, Berger U, Gschaidmeier H, Druker BJ, Hehlmann R (2002) Molecular and chromosomal mechanisms of resistance to imatinib (STI571) therapy. Leukemia 16, 2190-2106.

Hoser G, Majsterek I, Romana DL, Slupianek A, Blasiak J, Skorski T (2003) Fusion oncogenic tyrosine kinases alter DNA damage and repair after genotoxic treatment: role in drug resistance? Leukemia Res 27, 267-273.

Klaude M, Eriksson S, Nygren J, Ahnstrom G (1996) The comet assay: mechanisms and technical considerations. Mutat Res 12, 89-96.

Kurzrock R, Kantarjian HM, Druker BJ, Talpaz M (2003) Philadelphia chromosome-positive leukemias: from basic mechanisms to molecular therapeutics. Ann Int Med 138, 819-830.

Laroche-Clary A, Larrue A, Robert J (2000) Down-regulation of BCR/ABL and bcl-xl expression in a leukemia cell line and its doxorubicine-resistant variant by topoisomerase II inhibitors. Biochemical Pharmacology 60, 1832-1828.

Liang F, Jasin M (1996) Ku80-deficient cells exhibit excess degradation of Extrachromosomal DNA. J Biol Chem 271, 14405â&#x20AC;&#x201C;14411.

Lugo TG, Pendergast AM, Muller AJ, Witte ON (1990) Tyrosine kinse activity and transformation potency of BCR/ABL oncogene products. Science 247, 1079-1082.

Majsterek I, Blasiak J, Mlynarski W, Hoser G, Skorski T (2002) Does the bcr/abl-mediated increase in the efficacy of DNA repair play a role in the drug resistance of cancer cells? Cell Biol Int 26, 363-370.

Majsterek I, Slupianek A, Blasiak J (2003) TEL-fusion oncogenic tyrosine kinases determine leukemic cells response to idarubicin. Anti-Cancer Drugs 14, 625â&#x20AC;&#x201C;631.

Majsterek I, Slupianek A, Hoser G, Skorski T, Blasiak J (2004) ABL-fusion oncoproteins activate multi-pathway of DNA repair: role in drug resistance? Biochemie 86, 53-65.

Masumoto N, Nakano S, Fujishima H, Kohno K, Niho Y (1999) v-src induces cisplatin resistance by increasing the repair of cisplatin-DNA interstrand cross-links in human gallbladder adenocarcinoma cells Int J Cancer 80, 731-737.

Mauro MJ, O'Dwyer M, Heinrich MC, Druker BJ (2002) STI571: a paradigm of new agents for cancer therapeutics.

Clin Oncol 20, 325-334.

Nagar B, Bornmann WG, Pellicena P, Schindler T, Veach DR, Miller WT, Clarkson B, Kuriyan J (2002) Crystal structures of the kinase domain of c-Abl in complex with the small molecule inhibitors PD173955 and imatinib (STI-571).

Cancer Res 62, 4236-4243.

Nagar B, Hantschel O, Young MA, Scheffzek K, Veach D, Bornmann W,Clarkson B, Superti-Furga G, Kuriyan J (2003) Structural basis for the autoinhibition of c-Abl tyrosine kinase. Cell 112, 859-871.

Nishii K, Kabarowski JH, Gibbons DL, Griffiths SD, Titley I, Wiedemann LM, Greaves MF (1996) BCR-ABL kinase

activation confers increased resistance to genotoxic damage via cell cycle block. Oncogene 13, 2225-2234.

O'Brien SG, Guilhot F, Larson RA, Gathmann I, Baccarani M, Cervantes F, Cornelissen JJ, Fischer T, Hochhaus A, Hughes T, Lechner K, Nielsen JL,Rousselot P, Reiffers J, Saglio G, Shepherd J, Simonsson B, Gratwohl A, Goldman JM, Kantarjian H, Taylor K, Verhoef G, Bolton AE, Capdeville R,Druker BJ (2003) Imatinib compared with interferon and low-dose cytarabine for newly diagnosed chronic-phase chronic myeloid leukemia. N Engl J Med 348, 994-1004.

Pietras RJ, Fendly BM, Chazin VR, Pegram MD, Howell SB, Slamon DJ (1994) Antibody to HER-2/neu receptor blocks DNA repair after cisplatin in human breast and ovarian cancer cells, Oncogene 9, 1829-1838.

Sattler M, Salgia R (1998) Activation of hematopoietic growth factor signal transduction pathways by the human oncogene BCR/ABL. Leukemia 12, 637-644.

Senechal K, Heaney C, Druker B, Sawyers CL (1998) Structural Requirements for Function of the Crkl Adapter Protein in Fibroblasts and Hematopoietic Cells. Mol Cell Biol 18, 5082-5090.

Singh NP, McCoy T, Tice RR, Schneider EL (1988) A simple technique for quantitation of low levels of DNA damage in individual cells. Exp Cell Res 175, 184-192.

Siu WY, Arooz T, Poon RYC (1999) Differential responses of proliferating versus quiescent cells to adriamycin. Exp Cell Res 250, 131-141.

Slupianek A, Gurdek E, Koptyra M, Nowicki MO, Siddiqui KM, Groden J, Skorski T (2005) BLM helicase is activated in BCR/ABL leukemia cells to modulate responses to cisplatin.

Oncogene 24, 3914-3922.

Slupianek A, Hoser G, Majsterek I, Bronisz A, Malecki M, Blasiak J, Fishel R, Skorski T (2002) Fusion tyrosine kinases induce therapeutic drug resistance by stimulation of homology-dependent recombination repair, prolongation of G2/M phase and protection from apoptosis. Mol Cell Biol 22, 4189-4201.

Slupianek A, Nowicki MO, Koptyra M, Skorski T (2006) BCR/ABL modifies the kinetics and fidelity of DNA double-strand break repair in hematopoetic cells. DNA Repair 5, 243-250.

Slupianek A, Schmutte C, Tombline G, Nieborowska-Skorska M, Hoser G, Nowicki MO, Pierce AJ, Fishel R, Skorski T (2001) BCR/ABL regulates mammalian RecA homologs resulting in drug resistance. Mol Cell 8, 795-806.

Tipping AJ, Melo JV (2003) Imatinib mesylate in combination with other chemotherapeutic drugs: in vitro studies. Semin.

Hematol 40, 83-91.

Tsuzuki T, Fujii Y, Sakumi K, Tominaga Y, Nakao K, Sekiguchi M, Matsushiro A, Yoshimura Y, Morita T (1996) Targeted disruption of the Rad51 gene leads to lethality in embryonic mice. Proc Natl Acad Sci USA 93, 6236-6240.

Yin T, Wu YL, Sun HP, Sun GL, Du YZ, Wang KK, Zhang J, Chen GQ, Chen SJ, Chen Z (2004) Combined effects of As4S4 and imatinib on chronic myeloid leukemia cells and BCR-ABL oncoprotein. Blood 104, 4219-4225.

Zhang P, Gao WY, Turner S, Ducatman BS (2003) Gleevec (STI-571) inhibits lung cancer cell growth (A549) and potentiates the cisplatin effect in vitro. Mol Cancer 2, 1.

298

Gene Therapy and Molecular Biology Vol 11, page 299 Gene Ther Mol Biol Vol 11, 299-304, 2007

Vitamin D receptor gene polymorphisms in patients with thyroid cancer Research Article

Vahid Haghpanah1, Seyed H. Ghaffari2, Parisa Rahimpour2, Avisa Abbasi2 , Marjan Saeedi1, Hale Pak1, Foroogh Alborzi1, Shaghayegh Barzegar1, Ramin Heshmat1, Kamran Alimoghadam2, Peiman Shoushtarizadeh1, Seyed Mohammad Tavangar3, Ardeshir Ghavamzadeh2, Bagher Larijani1 1

Endocrinology and Metabolism Research Center, Medical Sciences/University of Tehran, Tehran 14114, Iran Hematology, Oncology and BMT Research Center, Medical Sciences/University of Tehran, Tehran 14114, Iran 3 Department of Pathology, School of Medicine, Medical Sciences/University of Tehran, Tehran 14114, Iran 2

__________________________________________________________________________________ *Correspondence: Seyed H. Ghaffari, Hematology, Oncology and BMT Research Center, Shariati Hospital, North Kargar Ave, Tehran 14114, Iran; Tel. +98 21 88026902-3; Fax +98 21 88029399; e-mail: emrc@tums.ac.ir Key words: vitamin D receptor; gene polymorphism; thyroid cancer Abbreviations: cyclic adenosine mono phosphate, (cAMP); Endocrinology and Metabolism Research Center, (EMRC); Hematology, Oncology and BMT Research Center, (HOCR-BMT); Tehran University of Medical Sciences, (TUMS); thyroid cancer, (TC); vitamin D receptor, (VDR) Received: 10 August 2007; Revised: 29 October 2007 Accepted: 28 November 2007; electronically published: December 2007

Summary The association between vitamin D receptor (VDR) gene polymorphisms and some diseases such as colorectal cancer, breast cancer, osteoporosis and psoriasis has been extensively investigated during the past few years. This research was performed not only because of the role of vitamin D as an anticancer agent, but also because of the suppressing action of vitamin D on TSH, the major regulator of thyroid cell growth. In this case-control study, comprising 71 thyroid cancer patients and 82 healthy population controls, we investigated the association between altered thyroid cancer risk with four polymorphisms located at the 3' end of the VDR gene detectable by ApaI, TaqI, Tru9 and BsmI restriction enzymes and with a start codon polymorphism located at the 5' end characterized by restriction enzyme FokI. The individual genetic pattern for VDR was evaluated by DNA extraction followed by PCR amplification of the VDR gene and the digestion with the restriction enzymes. For the effect of existence of the mentioned polymorphisms and thyroid cancer the odds ratio and 95% CI were calculated. All the odds ratios were within their CI, representing no relationship between these polymorphisms and risk of thyroid cancer. These observations suggest that VDR gene polymorphisms may not commonly contribute to the risk of thyroid cancer.

genomic and non-genomic mechanisms. The TSH stimulates production of the intracellular signaling molecule 3', 5'-cyclic adenosine mono phosphate (cAMP), iodine uptake and cell growth (Berg et al, 1994; Rajendra et al, 2002). In addition, VDR is induced by P53, which is a known tumor suppressor gene in thyroid cancer (Maruyama et al, 2006).

1, 25-(OH) 2-vitamin D3 is known to have potent anti-proliferative effects in many cancer cell types, including breast and prostate cancers (Furuya et al, 1999; Watanabe et al, 1999; Habuchi et al, 2000; BerthertonWatt et al, 2001; Cui et al, 2001; Guy et al, 2004).The anticancer properties of 1, 25-(OH) 2-vitamin D3 include

I. Introduction Thyroid cancer (TC) is the most common endocrine malignancy and accounts for 1-2% of all cancers.

Epidemiological studies have reported a progressive increase in the overall incidence over the past 20 years (Larijani et al, 2004). Thyroid growth is regulated by several factors, among them thyroid stimulating hormone (TSH) is a major regulator of thyroid cell growth and differentiation (Jameson and Weetman, 2005). There are some suppressor factors which attenuate the effect of TSH on thyroid cells. One of these factors is active metabolite of vitamin D (1, 25-(OH) 2-vitamin D3), which binds to vitamin D receptor (VDR), through a complex network of 299

Haghpanah et al: Vitamin D receptor gene polymorphisms in patients with thyroid cancer divided into 280 and 210 bp by ApaI digestion or into 290 and 200 bp by TaqI digestion. The 265 bp fragment containing FokI site was divided into 196 and 69 by FokI digestion; and 331 bp fragment containing Tru9 was divided into 153 and 178 bp by Tru9 digestion.

The PCR products were digested overnight with BsmI (65 C), ApaI (37 C), TaqI (65 C), FokI (55 C) and Tru9 (72 C), and were electrophoresed on 2% agarose gel. The genotypes were designated as B, A, T, F, and R when the BsmI, ApaI, TaqI, FokI and Tru9 restriction sites were present respectively. All genotyping assays were performed by individuals who were unaware of the clinical status of the subjects.

induction of differentiation and apoptosis in addition to the inhibition of cancer cell growth (Osborne et al, 2002; Rajendra et al, 2002).

1,25 (OH)2 D3 exerts its growth-regulatory effect through binding to the vitamin D receptor (VDR), a member of the steroid/thyroid-retinoic acid receptor family which functions as a ligand-dependent nuclear transcription factor. To date, only one VDR gene has been identified, giving rise to one main functional VDR in different tissues. Biological and immunocytochemical studies have shown that VDR is widely distributed in normal human tissues including intestine, kidney, bone, parathyroid, thyroid, skin, adrenal, breast and prostate (Malloy and Feldman ,1999). Several polymorphisms have been identified in various introns and exons of VDR gene such as ApaI, BsmI, FokI, TaqI and Tru9 (Hutchinson et al, 2000; Ye WZ et al, 2000; Ntais et al, 2003). Recent molecular and epidemiological studies have shown that these polymorphisms may be linked with many cancer risks and/or with its aggressive phenotype such as colorectal cancer (Peters et al, 2001, Wong et al, 2003), breast cancer (Curran et al, 1999; Bertherton-Watt et al, 2001; Cui et al, 2001; Guy et al, 2004) and prostate cancer(Watanabe et al, 1999; Furuya et al, 1999; Habuchi et al, 2000; Xu Y et al, 2003).

This study was conducted to investigate the association of ApaI, BsmI, FokI, TaqI and Tru9 polymorphisms of the VDR gene with thyroid cancer risk.

C. Statistical analysis The association between disease and genotypes were assessed by chi square and Fisher's exact tests using SPSS (version 11.5) software. The P<0.05 was considered significant.

The odds ratios and their 95% confidence intervals were calculated.

The study was conducted according to the principles of the Declaration of Helsinki and was approved by the medical ethics review board of the Endocrinology and Metabolism Research Center (EMRC) of Tehran University of Medical Sciences (TUMS). A written informed consent was obtained from all patients and volunteers.

III. Results A total of 71 patients with thyroid cancer, including 58 papillary (mean age 43.73 ± 12.81) and 13 follicular (mean age 49.69 ± 10.76) and 82 controls (mean age 43.93 ± 13.30) were included in this study. The distribution in two main histological types with respect to sex was as follows: 47 (41.2%) of papillary and 12 (10.5%) of follicular in females: 11(28.2%) of papillary and 1 (2.6%) of follicular in males.

The frequencies of ApaI, BsmI, TaqI, Tru9 and FokI genotypes, P-value and Odds ratio in cases and controls are shown in Table 2. The determination of all mentioned genotypes in patients with thyroid cancer and in the control population displayed similar frequencies and revealed no association between these polymorphisms and risk of thyroid cancer (Table 2). But about FokI polymorphism, considering FF genotype as reference group (wild type), a decreasing pattern in Odds ratio from FF to ff was seen (1.00, 0.87 and 0.37 for FF, Ff and ff respectively) (Calculated odds ratios are not shown in the Table 2). The polymorphism distribution in the present population was in Hardy-Weinberg equilibrium (P>0.05).

We also examined the allelic frequencies mentioned in polymorphisms in the patients with thyroid cancer.

Except for Tru9, there were no significant differences in allelic prevalence among the cases and the controls (Table 3).

The association of VDR with thyroid cancer was analyzed with respect to sex. The distribution of genotype frequencies did not differ significantly between females with thyroid cancer and females in the control group (Pvalue: FokI: 0.203, BsmI: 0.536, ApaI: 0.329, TaqI: 0.804 and Tru9: 0.207). The same results were obtained for the men (P-value: FokI: 0.760, BsmI: 0.612, ApaI: 0.989, TaqI: 0.665 and Tru9: 0.179).

Because a series of these polymorphisms had been shown to be in strong linkage disequilibrium (LD) with

II. Materials and methods A. Samples preparation Seventy-one thyroid cancer patients were studied in a referral center for endocrine disorders. In this study, only patients with follicular and papillary thyroid cancer were included. The diagnoses were confirmed by the pathology examination from thyroid tissue samples; 58/71 patients were diagnosed as papillary type and 13/71 patients as follicular type. A total of 82 healthy volunteers, selected from the minor trauma ward with a negative history of malignancies, chemotherapy and radiotherapy were also included in this study. Cases and controls were matched according to age and sex. About 5 ml peripheral blood samples were collected from each patient. High molecular weight DNA was extracted from whole blood nuclear cells by a standard salting out procedure. (Miller et al, 1988) The concentration of DNA sample was evaluated by a UV spectrophotometer.

B. Restriction fragment length polymorphism (RFLP) The PCR assay was performed in a final volume of 30 !l containing 50-100 ng DNA, 100 pmol of each amplification primers, 1 U Taq polymerase, and 3 !l 10X PCR buffer comprising 500 mM KCl, 0.1 M Tris HCl (pH 8.8), 25 mM MgCl2 and 2 mM of each dNTP. PCR was carried out for 35 cycles (each cycle consisted of 30' seconds at 94°C, 30' seconds at 50-60°C (depending on the different primer sets), and 30' seconds at 72°C), with an initial denaturation at 95°C for 5 minutes.

The 825 bp fragment encompassing the BsmI polymorphic site in intron 8 was amplified using the specific primers (Table 1). When the BsmI site was present, the PCR fragment was divided into 650 and 175 bp by BsmI endonuclease digestion.

The 490 bp fragment encompassing ApaI and TaqI sites was

300

Gene Therapy and Molecular Biology Vol 11, page 301 one another in many populations, we analyzed the presence of the LD between the BsmI, ApaI, TaqI and Tru9 polymorphisms which are located at the 3' end of VDR gene and also with FokI at the 5' end in the control group. LD was statistically significant between BsmI, ApaI and TaqI polymorphisms (P<0.05) (Table 4).

However, LD between Tru9 and TaqI or Tru9 and ApaI polymorphisms were not significant (P=0.201). A marginal significant of LD between Tru9 and BsmI was observed (0.039). No LD was found between Fok I at the 5' end and those polymorphisms located at the 3' end.

through binding to it's receptor may act as an anticancer agent.

In our study, we see no evidence for associations between genotype defined by polymorphisms of the VDR gene and thyroid cancer susceptibility. Although, 1,25(OH)2D3 attenuated the stimulatory effects of cAMP on proliferation and iodine uptake in rat thyroid FRTL-5 cells (Berg et al, 1994), this result deserves a more comprehensive research on human thyroid cells. It is also known that mutations of the tumor suppressor, P53, appear to play an important role in the development of anaplastic thyroid cancer (Jameson and Weetman, 2005). Because we did not find enough anaplastic thyroid cancer patients, the rare variant, this type of cancer was excluded from our study.

The 3' end polymorphisms of the VDR gene do not alter the amino acid sequence (Guy et al, 2004, Taverna et al, 2005). However, It has been reported that the polymorphisms in the 3' UTR-region (BsmI, Taq I, Tru 9,Apa I and Poly-A) might alter transcriptional activity and mRNA degradation(You-Ling et al, 2005). No relationship between VDR polymorphisms located in the 3' end and the risk of thyroid cancer was found in this study. The lack of a relationship of the BsmI, TaqI and ApaI polymorphisms of VDR gene with the risk of thyroid cancer was probably due to the strong LD among these polymorphisms as observed in our study which is also reported in previous researches in different population (Morrison et al, 1992, 1994; Habuchi et al, 2000).

IV. Discussion In the present study, we assessed for the first time, five VDR polymorphisms FokI, ApaI, TaqI, BsmI and Tru9 as risk factors for thyroid cancer. This became a plausible hypothesis in the light of three findings.

First: Recent studies describe the molecular basis of the anticancer activity of 1, 25 (OH) 2D3 which induces cell differentiation and inhibit proliferation, invasiveness, angiogenesis and metastatic potential (Dusso et al, 1998; Nagpal et al, 2001; Carlberg 2003; Ordonez-Moran et al, 2005). Second: 1, 25-(OH) 2-vitamin D3 at physiological concentrations inhibits both basal and TSH stimulated cAMP production in rat thyroid cells. This indicates that calcitriol may modulate the effect of TSH on thyroid function and growth (Berg et al, 1994). Third: VDR is induced by P53, which is a known tumor suppressor gene in thyroid cancer (Maruyama et al, 2006). All these findings may suggest that 1, 25-(OH) 2-vitamin D3 Table1. The primers used in VDR gene PCR Primer BsmI ApaI TaqI FokI Tru9

Ref

F:5'-ACC TGG CCA TTG TCT CTC AC-3 R: 5-CTA ACC AGC GGA AGA GGT CA-3 F: 5'-AGC AGA GCA GAG TTC CAA GC-3' R: 5'-GTG AGG AGG GCT GCT GAG TA-3' F: 5'-AGC AGA GCA GAG TTC CAA GC-3' R: 5'-GTG AGG AGG GCT GCT GAG TA-3' F: 5'-CCC TGG CAC TGA CTC TGG CTC-3' R: 5'-AAA CAC CTT GCT TCT TCT CC-3â&#x20AC;&#x2122; F:5'-AAT ACT CAG GCT CTG CTC TT-3' R:5'-CAT CTC CAT TCC TTG AGC CT-3'

29 14 14 18,14 27,15

Table 2. Frequencies, P-value and Odds ratio of VDR polymorphism in patients with thyroid cancer and controls

carcinoma control P-value Odds ratio * CI 95%**

BsmI BB Bb 23 20 20 26 0.81 1.41 0.61-2.46

bb 28 33

ApaI AA Aa 29 27 25 38 0.39 1.57 0.80-3.06

aa 15 19

TaqI TT Tt 31 28 38 32 0.83 0.87 0.46-1.6

tt 12 11

Tru9 RR Rr 45 22 52 28 0.57 0.99 0.49-2.03

rr 4 2

*The all Odds ratio for both capital vs capital, small and small, small were calculated (e.g. [BB vs Bb, bb]) **CI: Confidence Interval

301

FokI FF Ff 49 18 50 21 0.29 0.70 0.34-1.45

ff 4 11

Haghpanah et al: Vitamin D receptor gene polymorphisms in patients with thyroid cancer Table 3. Allele frequency of FokI, BsmI, TaqI, Tru9 and ApaI alleles between genotypes in cases and controls

Case % Control % P-value*

FokI F 116 81.7 121 73.8 0.099

f 26 18.3 43 26.2

BsmI B 54 45.76 72 43.90 0.661

TaqI T 90 63.4 108 65.8 0.498

b 62 52.54 92 56.09

t 52 36.6 56 34.2

Tru9 R 112 78.8 132 68.04 0.028

r 30 21.2 62 31.96

ApaI A 85 59.8 88 53.6 0.275

a 57 40.2 76 46.3

Table 4. Linkage disequilibrium between VDR gene polymorphism in control group*

Fok I Apa I Bsm I Taq I

Tru 9 0.900 0.201 0.039 0.201

Taq I 0.629 0.000 0.000

Bsm I 0.868 0.000

Apa I 0.724

*All values are P-value for LD between polymorphism. FokI located at the 5' end and BsmI, ApaI, TaqI and Tru9 polymorphisms are located at the 3' end of the VDR gene. LD were significant between BsmI and Tru9, ApaI, TaqI and also between ApaI and TaqI polymorphisms.

The FokI VDR polymorphism, located in 5' end, is a T to C substitution in the first codon, abolishing the first translation initiation sites and results in a peptide lacking three amino acids, which increase the transcriptional activity of VDR. The resulting difference in VDR length by three amino acids may affect the function of the protein. However, we did not see any evidence for association between FokI polymorphism and the risk of thyroid cancer susceptibility. But a decreasing pattern in Odds ratio from FF to ff was seen (1.00, 0.87 and 0.37 for FF, Ff and ff respectively).This indicates a possible protective effect for ff genotype resulting from altered protein function.

The difference of allelic frequency of Tru9 between cases and controls (p=0.028) and lack of LD between Tru9 and other polymorphisms at the 3' end, suggests a possible association between this polymorphism and thyroid cancer risk.

This study seems to be one of the earliest in its kind.

While no association between VDR polymorphisms and thyroid cancer was detected, the small sample size and subsequent low power of statistical tests have limited value of results.

We can not exclude the possibility that different polymorphisms in the VDR gene are associated with thyroid cancer. However it seems likely that other genomic and nongenomic factors will be more important in determining common thyroid cancer risk, a further larger study is needed to verify the present data.

Research Center (EMRC) and Hematology, Oncology and BMT Research Center (HOCR-BMT), Tehran University of Medical Sciences.

References Berg JP, Liane KM, Bjorhovde SB, Bijoro T, Torjesen PA, Haug E (1994) Vitamin D receptor binding and biological effects of cholecalciferol analogues in rat thyroid cells. J Steroid Biochem Mol Biol 50, 145-150.

Bertherton-Watt D, Given-Wilson R, Mansi JL, Thomas V, Cater N, Colston KW (2001) Vitamin D receptor gene polymorphisms are associated with breast cancer risk in a UK Caucasian population. Br J Cancer 85, 171-175.

Carlberg C (2003) Current understanding of the function of the nuclear vitamin D receptor in response to its natural and synthetic ligands. Recent Results Cancer Res 164, 29-42.

Cui J, Shen K, Shen Z, Jiang F, Shen F (2001) Relationship of vitamin D receptor polymorphism with breast cancer.

Zhonghua Yi Xue Chuan Xue Za Zhi 18, 286-288 Curran JE, Vaughan T, Lea RA, Weinstein SR, Morrison NA, Griffiths LR (1999) Association of vitamin D receptor polymorphism with sporadic beast cancer development. Int J Cancer 83, 723-726.

Dusso AS, Brown AJ (1998) Mechanism of vitamin D action and its regulation. Am J Kidney Dis 32, 13-24.

Furuya Y, Akakura K, Masai M, Ito H (1999) Vitamin D receptor gene polymorphism in Japanese patients with prostate cancer. Endocr Jour 46, 467-470.

Guy M, Lowe LC, Bretheron-Watt D, Mansi JL, Peckitt C, Bliss, Wilson RG, Thomas V, Colston KW (2004) Vitamin D Receptor Gene Polymorphism and Breast Cancer Risk. Clin Cancer Res 10, 5472-5481.

Habuchi T, Suzuki T, Sasaki R, Wang L, Sato K, Satoh S, Akao T, Tsuchiya N, Shimoda N, Wada Y, Koizumi A, Chihara J, Ogawa O, Kato T (2000) Association of vitamin D receptor gene polymorphism with prostate cancer and benign prostatic hyperplasia in a Japanese population. Cancer Res 60, 305308.

Hutchinson PE, Osborne JE, Lear JT, Smith AG, Bowers PW, Morris PN, Jones PW, York C, Strange RC, Fryer AA (2000)

Acknowledgments We would like to express our gratitude to the people who helped us in the completion of this project: SM Hejazi, N Khaleghian as well as the staff of Tehran Cancer Institute and Nuclear Medicine Research Center, Shariati Hospital; Tehran University of Medical Sciences. This study was supported by Endocrinology and Metabolism

302

Gene Therapy and Molecular Biology Vol 11, page 303 Vitamin D receptor polymorphisms are associated with altered prognosis in patients with malignant melanoma. Clin Cancer Res 6, 498-504.

Jameson LJ, Weetman AP (2005) Disorders of the thyroid gland.

In :Kasper D.L, Fausi A.S, Longo D.L, Braunwald E, Hauser S.L, Jamson L.J. Harrison's principle of internal medicine.16th ed. New York McGraw-Hill: 2104-2106.

Jameson LJ, Weetman AP (2005) Disorders of the thyroid gland.

In :Kasper D.L, Fausi A.S, Longo D.L, Braunwald E, Hauser S.L, Jamson L.J. Harrison's principle of internal medicine.16th ed. New York McGraw-Hill: 2124.

Larijani B, Shirzad M, Mohagheghi MA, Haghpanah V, MosaviJarrahi AR, Tavangar SM, Vassigh AR, Hossein-Nezhad A, Bandarian F, Bardar-Jalili R (2004) Epidemiologic analysis of the Tehran Cancer Institute Data System Registry (TCIDSR).Asian Pac J Cancer Prev 5, 36-39.

Malloy PJ, Feldman D (1999) vitamin D resistance. Am J Med 106, 355-370.

Maruyama R, Aoki F, Toyota M, Sasaki H, Mita H, Suzuki H, Akino K, Ohe-toyota M, Maruyama Y, Tatsumi H, Imai K, Shinomura Y, Tokino T (2006) Comparative genome analysis identifies the vitamin D receptor as a direct target of p53-mediated transcriptional activation .Cancer Res 66, 4574-83.

Miller SA, Dykes DD, Polesky HF (1988) A simple salting out procedure for extracting DNA from human nucleated cells.

Nucleic Acids Res 16, 12-15.

Morrison N. A, Qi JC, Tokita A, Kelly PJ, crofts L, Nguyen T. V, Sambrook PN, Eisman JA (1994) Prediction of bone density from vitamin D receptor alleles. Nature 367, 284287.

Morrison N.A, Yeoman R, Kelly PJ, Eisman JA (1992) Contribution of trans-acting factor alleles to normal physiological variability: vitamin D receptor gene polymorphism and circulating osteocalcin. Proc Natl Acad Sci USA 89, 6665-6669.

Nagpal S, Lu J, Boehm MF (2001) Vitamin D analogs: mechanism of action and therapeutic applications. Curr Med Chem 8, 1661-1679.

Ntais C, Polycarpou A, Ioannidis JP (2003) Vitamin D Receptor gene polymorphisms and risk of prostate cancer: a Meta analysis. Cancer Epidemiol Biomarkers Prev 12, 1395-

1402.

Ordonez-Moran P, Larriba MJ, Pendas-France N, Aguilera O, Gonzalez-Sancho JM, Munoz A (2005) Vitamin D and cancer: an update in vivo and in vitro data. Front Biosci 10, 2723-2749.

Osborne JE, Hutchinson PE (2002) Vitamin D and systemic cancer: is this relevant to malignant melanoma? Br J Dermatol 147, 197-213.

Peters U, McGlynn KA, Chatterjee N, Gunter E, Garcia-Closas M, Rothman N, Sinha R (2001) Vitamin D, calcium and vitamin D receptor polymorphism in colorectal adenomas.

Cancer Epidemiol Biomarkers Prev 10, 1267-1274.

Rajendra G.Mehta, Rajeshwari R. Mehta (2002) Vitamin D and cancer. J Nutr Biochem 13, 252-264.

Taverna MJ, Selam JL, Slama G (2005) Association between a protein polymorphism in the start codon of the vitamin D receptor gene and severe diabetic retinopathy in C-peptidenegative type 1 diabetes. J Clin Endocrinol Metab 90, 4803-4808.

Watanabe M, Fukutome K, Muata M, Uemura H, Kubota Y, Kawamura J, Yatani R. (1999) Significance of vitamin D receptor gene polymorphism for prostate cancer risk in Japanese. Anticancer Res 19, 4511-4514.

Wong HL, Seow A, Arakawa K, Lee HP, Yu MC, Ingles SA (2003) Vitamin D receptor start codon polymorphism and colorectal cancer risk: effect modification by dietary calcium and fat in Singapore Chinese. Carcinogenesis 24, 10911095.

Xu Y, Shibata A, McNeal JE, Stamey TA, Feldman D, Peehl DM (2003) Vitamin D receptor start codon polymorphism (FokI) and prostate cancer progression. Cancer epidemiol Biomarkers Prev 12, 23-27.

Ye WZ, Reis AF, Velho G (2000) Identification of the novel Tru9 I polymorphism in the human vitamin D receptor gene.

J Hum Genet 45, 56-57.

You-Ling Gong, Da-Wen Xie, Zong-Lin Deng, Roberd M Bostick, Xi-jiang Miao, Jil-Hui Zhang, Zhi-Hong Gong (2005) Vitamin D receptor gene Tru9 polymorphism and risk for incidental sporadic colorectal adenomas. World J Gastroenterol 11, 4794-4799.

303

Haghpanah et al: Vitamin D receptor gene polymorphisms in patients with thyroid cancer

304

Gene Therapy and Molecular Biology Vol 11, page 305 Gene Ther Mol Biol Vol 11, 305-314, 2007

Exogenous DNA can be captured by stem cells and be involved in their rescue from death after lethaldose !-radiation Research Article

Anastasia S. Likhacheva1, Valeriy P. Nikolin1, Nelly A. Popova1, Vladimir A. Rogachev1, Maria A. Prokhorovich1, Tamara E. Sebeleva1, Sergei S. Bogachev1,2,*, Mikhail A. Shurdov2 1

Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, 10 Lavrentieva ave, Novosibirsk, 630090, Russia; 2 LLC Panagen, 29 Choros-Gurkina street, Gorno-Altaisk, 649000, Russia

__________________________________________________________________________________ *Correspondence: Sergei S. Bogachev, 10 Lavrentieva ave, 630090, Novosibirsk, Russia; Tel: +7-383-330-45-65; Fax: +7-383-333-1278; e-mail: gorbi@bionet.nsc.ru Key words: gene therapy, radioprotection, stem cells, exogenous DNA, DNA uptake Abbreviations: double-strand break, (DSB); blood stem cell, (BSC); stem cell, (SC); embryonic stem cell, (ESC) Received: 22 August 2007; Revised: 22 November 2007 Accepted: 4 December 2007; electronically published: December 2007

Summary Here we demonstrate that stem cells capture exogenous DNA internalized into the nuclear space. Injection of fragmented exogenous DNA to lethally radiated mice affords a very strong radioprotective effect: up to 90% of treated mice survived long after exposure to !-rays. We also demonstrate that the high survival of mice after lethaldose radiation is due to blood stem cell rescue whose offspring give rise to spleen colonies participating in recovery of the damaged immune system. It is suggested that the DNA radioprotective effect may result from involvement of exogenous DNA as substrate in homologous recombination during repair of double-strand break sites induced by high-dose radiation.

consequences, such as neoplastic transformation and cancer development.

Control mechanisms deal with the DSBs arisen in the mammalian cells. Their triggering causes assembly and activation of repair-recombination complexes whose major function is posttranscriptional histone modification (Peterson and Cote, 2004). Autocatalytic phosphorylation of the entire pool of ATM/ATR kinases leads to prompt phosphorylation of histone H2AX in a stretch covering megabases at either side of a DSB that may quite reasonably be the event highlighting the DSB emergence (Rogakou et al, 1999; Stiff et al, 2004).

There are two different, cell cycle dependent pathways for repair of DSBs arisen in human and mammalian cells (Takata et al, 2000, 2001; Rodrigue et al, 2006). In cells damaged in the G1 phase of the cell cycle, joining of the processed ends of the damaged DNA molecule is the major pathway for DSB repair.

Heterodimer Ku70/Ku80, DNA-PK, a number of accessory factors that process the ends to be ligated, and DNA ligase IV are all involved in this repair pathway

I. Introduction Collisions of ionizing particles with living tissue generate a cascade of extremely reactive free radicals that spontaneously react with any nearby molecule, including DNA. The broad spectrum of damage incurred to DNA molecule includes the appearance of thymidin dimers, disruption of sugar and phosphate bonds, base integrity loss. DNA double-strand breaks (DSBs) giving rise to two open broken DNA ends entail the most dramatic consequences (Bonner, 2003). Some DNA fragments between close DSBs can be lost during attempts to repair such damage. In their natural strive to recover chromosomal integrity, the eukaryotic cells join the broken DNA ends. This repair can be error-prone in situations where DNA strands lying in close vicinity, yet belonging to distinct chromosomes or chromosome regions, are joined. This faulty repair stops synthetic cellular processes and the cells then undergo apoptosis, or mutation fixed chromosomal aberrations can arise. The aberrations can increase the risk of pathological

305

Likhacheva et al: Exogenous DNA and its radioprotective action (Scott and Pandita, 2006). As to cells lesioned in the S or G2 phase, homologous recombination serves as the major pathway for repair of DSBs. Factors responsible for homologous recombination in the cell were detected at the repair site. These included the RAD 51 paralogs and accessory proteins – specific nucleases and helicase, which remove secondary structure from the single-strand tail formed by specific exonuclease (Symington, 2005; Rodrigue et al, 2006). Repair with the involvement of the molecular machinery for homologous recombination can occur with homologous region exchange or without crossing over. Whatever the case, a sister chromatid or a homologous chromosome is used as substrate for homologous pairing of the filament formed by RAD 51 and its paralogs (Symington, 2005).

We have previously hypothesized the existence of a natural mechanism that may affect the genetic constituent of multicellular organisms by taking advantage of genomic DNA from biological fluid as external genomic standard (Yakubov et al, 2002, 2003). We have proposed that the cellular surface receptors that bind DNA deliver the genomic DNA fragments resulting from natural apoptosis from the external environment (blood plasma, intertissue fluid, lymph) into the nucleus and that the turnover is continuous. Once internalized within the nuclear space, the DNA fragments may participate in all the repair processes for whose enfoldment the presence of undamaged homologous sequence appears to be imperative (Rogachev et al, 2006).

Our subsequent study has demonstrated that integration of heterologous DNA into the adult mouse genome was feasible by using exogenous DNA as substrate for homologous recombination in interstrand cross-link repair and by correct timing of exogenous DNA injection (Likhacheva et al, 2007). Delivery of exogenous fragments into the cell during excision repair when a DSB and a single-strand region arose in the close proximity to the cross-link site was crucial.

Immunodetection of the foci formed by the modified !-H2AX histones and recombination factors provided evidence indicating that the time DSBs appeared after radiation and chemotherapy was incomparable. Foci promptly appeared in response to high-dose radiation. Foci were undetectable 6 hrs after treatment with a cytostatic (mytomycin C, for example) and their peak was at 12 hrs after it (Rogakou et al, 1999; Niedernhofer et al, 2004).

The above concept and literary data are consistent with our idea. If the blood bed of totally radiated subjects contained DNA fragments, these fragments would be used as substrate in homologous recombination for repair of radiation-induced damage. Exogenous DNA fragments must be delivered at the same time as the foci of phosphorylated histones, the markers of arisen DSBs, appear.

The classical experiments with injection of a suspension of bone red marrow cells or a blood stem cell (BSC) enriched fraction to lethally radiated mice have demonstrated that colonies, each of which was offspring of a single BSCs delivered by injection, appeared in their spleens (Afanasiev et al, 2004). We proceeded on the following assumption. If BSCs were capable of capturing

exogenous DNA, their injection to radiated mice followed by its use as substrate for homologous recombination in BSCs with incurred multiple DSBs would rescue a part of BSCs from programmed cell death, and they would form spleen colonies to give rise to differentiated offspring, and the restored immune system would beneficially affect the viability of the treated mice.

Here, we demonstrate that internalization of exogenous DNA in stem cell (SC) nuclei is feasible, providing the human embryonic SC as an example. We also demonstrate the radioprotective effect of exogenous DNA. Survival of lethally radiated mice that had received therapeutic DNA fragments from different sources reached 70-90% (after 30 days) in some of the replicates, and numerous colonies formed in their spleens. Both observations evidence that BSCs are rescued in amounts sufficient for recovery of the immune system of the treated mice.

II. Materials and methods A. Cell culture Colonies of a human embryonic stem cell (ESC) strain hSSMO1r were cultivated on gelatin covered 35 mm Petri dishes (Costar) in KODMEM medium (Invitrogen) containing 20% of serum substitute (Invitrogen), 0.1mM "-methapoethanol (Sigma), 1mM glutamine (Hyclone), 1# mixture of essential amino acids (Gibco), 4 ng/ml bFGF (Chemicon), and antibiotics under 6.5% $%2 using a feeder of mitotically inactivated mouse embryonic fibroblasts.

B. Preparation of DNA and precursor Twenty mkg of human placental DNA fragmented to 2002000 bp were labeled by nick translation in the presence of Klenow fragment, 3 unlabeled and 1 P32-labeled dNTPs. To remove the unlabeled precursor DNA was isopropanol precipitated two times according to Glover’s procedure (1985).

The yield of labeled DNA after purification was 15-18 mkg.

DNA was diluted in an appropriate volume of distilled water and added to each 35 mm Petri dish in a volume not greater than 20 µl. Each Petri dish contained 1-3 ml of medium. An aliquot of labeled probe (1 µl) was taken for radioactivity counts.

An &dNTP* aliquot was diluted in appropriate ' 2% volume; 1 µl of diluted triphosphate was taken for determination of radioactivity. About the same amount of & related to DNA with respect to cpm and volume was added at each experimental point.

Estimates for DNA (mkg, (pm) and &dNTP* (cpm) are given in Table 1.

Restriction DNA fragments of Carnegie 20-)1.4(*8) plasmid DNA (Baricheva et al, 1996) were labeled in the presence of Klenow fragment, 3 unlabeled dNTPs and P32labeled d+TP at the cohesive end resulting from SalGI digestion.

After filling of the cohesive ends with unlabeled d+TP and formation of the blunt ends, DNA was freed from the unlabeled precursors by double precipitation from 0.3 , NaAc with a 0.6 volume of isopropanol.

C. Treatment of fragmented DNA cells, preparation of cell extracts, analysis of cell compartment DNA Labeled DNA treated as described above was added to culture medium in Petri dishes. Cell number per Petri dish was about 5x105 on average. Cells were incubated with human DNA under 6.5% $%2 for the required time at 37°$. The chosen

306

Gene Therapy and Molecular Biology Vol 11, page 307 incubation time was 0 (P 32-labeled DNA added to medium kept on ice in Petri dish, medium promptly removed, Triton --100 added); 1 h; 2 h; 3 h; 6 h; 12 h with variations from one experiment to another. Incubation time was 12 h for &d+TP*.

The DNA amounts in incubation medium per point are given in Table 1.

Petri dishes were placed on ice after incubation completion, medium was removed, Triton --100 in buffer A was promptly added (buffer + containing 2 mM CaCl2, 0.5% Triton --100); 1 ml of lysis buffer was added to each Petri dish (Roberts, 1986). Cells were kept in lysis buffer on ice for 10 min.

Lysed cells were resuspended several times and fractionated by 10% sucrose gradient centrifugation in buffer A. Cells were centrifuged 20 min at 600 g (2000 rpm) in 25 ml conical tubes using centrifuge .23 (bucket-rotor R-15). Supernatant, a cytoplasmic fraction, was transferred to a separate tube and isopropanol precipitated. Nuclear residue was washed two times in 250 ml of lysis buffer (buffer + containing 0.5% Triton -100). After each washing, cell preparation was centrifuged 10 min at 600 g (2000 rpm) in a bucket-rotor.

In experiments with total fragmented human DNA as substrate nuclear fraction was separated to chromatin and interchromosomal fraction. Nuclei were resuspended in 500 µl of buffer +, examined cytologically, and transferred to tubes. Up to 2 , of NaCl and 1% SDS were added to nuclear suspension.

Nuclear lysate was incubated for 30 min without shaking at 65°$ until reaction mixture clarified, then it was centrifuged at 52,000 g (21,000 rpm) in Beckman J2-21 centrifuge (rotor JA-21) for 30 min at 30°$. Supernatant (interchromosomal material), was pipetted off and transferred to another tube; a 1:10 NaAc volume was added to supernatant, and it was precipitated with a 0.6 volume of isopropanol. 100 µl of water was added to transparent lentil-shaped residue, a chromosomal fraction; the mixture was left to swell for 60 min and immediately subjected to electrophoresis. All the procedures were performed at 0°$. After treatment, all samples were immediately isopropanol precipitated from 0.3 , NaAc into 25 ml conical tubes and centrifuged at 4000g (4 500 rpm) using centrifuge .23 (bucket-rotor R-15) for 20 min. Precipitate was dissolved in 100 µl of water. Amounts of labeled material were determined by the standard method using a 1209 RacBetta counter (Finland). Samples were separated on 0.7% agarose gels. Chromosomal fraction DNA was not dissolved to completion; to minimize DNA degradation, it was left to swell for 60 min. The jellyfish-like undissolved, yet swollen, chromatin residue was immersed into the agarose block.

Chromosomal DNA was fixed at the start during DNA electrophoresis.

In case of SalG1 digested Carnegie 20-)1.4(*8) DNA hybrid plasmid we have used the following procedure. Nuclear samples embedded in blocks of low-melting agarose, 80 µl in volume, were kept in an excessive amount of 20 mM EDTA for several days and the entire exogenous DNA, if retained in a sample as contaminant, inevitably diffused into storage buffer.

There were about 2.5x105 nuclei per agarose block. Before electrophoresis, agarose-fixed nuclei were treated with 1% SDS,

20 mM EDTA, and 200 mkg/ml ProtK for 2 h at 37°$ and washed three times, 10 min each, in /0 buffer. Then DNA was fractionated in 1.0% agarose gel.

After electrophoresis, agarose block was dried under a stream of hot air. Gels were exposed to X-ray Kodak films overnight or for a time dependent on the amounts of labeled material.

D. Quantitation of experimental results was based on the following values Cell number in human ESC culture at each experimental point, 5#105 DNA content per cell, 6 pg.

Total DNA content in cells at each experimental point, 3 mkg.

Amount of labeled DNA added at experimental point indicated in Table 1. Radioactivity counts at a point for added DNA expressed as cpm in Table 1.

Radioactivity counts at a point for &dNTP* expressed as cpm in Table 1.

Human cell haploid genome, 3.3#109 bp Size of the labeled genomic DNA fragments added to medium initially was 200-2000 bp.

We analyzed the qualitative and quantitative parameters for the behavior of extracellular DNA during its cell entry.

E. Radioprotection experiments Three-months old CBA/Lac females maintained and bred at the animal facility of this Institute were used in the experiments; 9-10 mice were kept in separate plastic cages.

Water and food were freely available. Their chow was standard granulated PK120-1 (Laboratorsnab, Moscow). They were radiated with a !-radiation unit IGUR-1, Russia (Cs137). Four experiments were performed.

In the first three experiments, different doses of nucleic acids and DNA of different origin were tested. DNA from CBA organs or human placenta DNA was administered i.p. to mice before / after radiation according to the schemes shown in Table 2. Radiation dose was lethal.

In experiment 4, the effect of human placenta DNA on RBSCs was examined in mice exposed to a sub-lethal dose radiation. These received i.p. human placenta DNA before radiation (Table 2). Mice were sacrificed on day 10, and the number of spleen homopoietic colonies was determined. Bone marrow is a radiosensitive tissue and, consequently, !-ray exposed BSCs died. It was assumed that, by having gained access to the cells and becoming involved in repair, exogenous DNA allowed BSCs to survive. The rescued BSCs migrated to colonize lymphoid organs, such as lymph nodes, spleen, thymus, among others. This promoted further hemopoiesis recovery and mouse survival. It was also assumed that high homology between the mouse and human genomes would make feasible homologous recombination repair for healing of DSBs induced by ionizing radiation.

Table 1. Amounts of DNA* and &dATP* used in experiments.

Amount per experimental point (added to medium) DNA* "dATP*

307

mkg

cpm

2.7

4.53#106 1.05#107

Likhacheva et al: Exogenous DNA and its radioprotective action Table 2. Time before / after radiation and amount of DNA administered to CBA mice.

natural cellular mechanism, internalized exogenous DNA fragments into intracellular space. The compartments we analyzed were cytoplasm, interchromosomal fraction, and chromatin. Human ESCs efficiently captured exogenous DNA of different origin delivered to nuclear space (Figures 1, 2). Once within the nucleus, exogenous DNA became degraded at 0 point. Nevertheless, using the digested plasmid as substrate, we detected labeled fragments of size commensurate with that of substrate initial fragments in the interchromosomal space. Delivered DNA fragments were stored in the nucleus and not digested by nucleases.

The procedure for isolation of fragmented human DNA fraction internalized into nuclear compartment was essentially the same as previously described (Rogachev et al, 2006). Nuclei were lysed in suspension and promptly fractionated into chromatin and interchromosomal fraction. Exogenous fragments were internalized slower than in the case of MCF-7 cells. The DNA fragments delivered to the interchromosomal space are end joined, forming concatomers (Figure 1B, right block, interchromosomal fraction, 2, 6, 12). The time that joined DNA fragments were internalized into the nuclear space and of that of concatomersâ&#x20AC;&#x2122; formation differed greatly from the reported for MCF-7 mammary adenocarcinoma cells (Rogachev et al, 2006). As follows from the results, after 1 h exposure of cells with substrate, the DNA fragments within the nucleus retained their native mobility with no concatomeric joining. From 2 up to 12 h, a part of the fragments were joined, forming a fragment longer than 10 kb. Some of the fragments were in the migration zone of 200-300 kb, a possible evidence of continuous inflow of exogenous labeled material from culture medium to nuclear space (Figure 1B, right block, interchromosomal fraction, 0, 1). Labeled material was consistently found in the chromatin fraction (Figure 1B, right block, chromatin, 1, 2, 6, 12). In the cytoplasmic fraction, cell samples exposed to labeled substrate for different times showed no visible changes in amounts or in size of DNA. In another experiment we used Carnegie 20-)1.4(*8) clone plasmid DNA as substrate. Its SalG1 digestion liberated fragments of 1.4 and 10.8 kb. Copy number for 1.4 kb fragment was 8 monomers per plasmid. After incubation of ESCs with plasmid DNA cell nuclei were purified by gradient centrifugation, thoroughly washed,

III. Results A. Capture of exogenous DNA by SCs and their internalization in nuclear space We analyzed the ability of SCs to capture exogenous DNA of different origin. For this purpose, we chose hSSMO1r human ESCs. To detect DNA internalization into intracellular space, fragmented human DNA was used. The fragments were as long as DNA apoptotic fragments present in blood plasma and multiples of DNA length forming a nucleosome (Figure 1, right blocks, 74*) and the SalG1 digested Carnegie 20-)1.4(*8) DNA hybrid plasmid (Figure 2, right blocks, Carnegie 20)1.4(*8)SalG1) (Baricheva et al, 1996; Rogachev et al, 2006) with 1.4 kb and 10.8 kb marker fragments. Both substrates were labeled with P32.

In the past decade, it has been established that there are several ways for DNA penetration into the intracellular space. One is by capture of DNA-containing apoptotic bodies. This is actually either the task of professional phagocytes or simply of tissue cells in the immediate vicinity to the apoptotic bodies (Lawen, 2003; Savill et al, 1993). The other way is receptor-mediated, and it provides penetration of extracellular DNA material into the intracellular compartments of the eukaryotic cell. Two major types of receptors on the cytoplasmic membrane provide this way of entry. Their molecular mass is 33 (30) and 79 (80) kDa (Benett et al, 1985; Loke et al, 1989; Zamecnik et al, 1994). Once bound to the receptor, the ligand becomes internalized within the acidic cellular compartment via pinocytosis and is delivered to the nucleus (Shestova et al, 1999; Lin et al, 1985). A variety of other proteins differing by molecular mass are involved in binding and uptake of nucleic acids by the cell (for reference, see Chelobanov et al, 2006). These are mainly different membranes proteins, also nuclear proteins and blood plasma proteins. Relevant findings were membrane channels formed by transmembrane proteins through which nucleic acids are directly transported. It is noteworthy that DNA has access to the cell in a short time (just a few sec or min) (for references, see Shestova et al, 1999; Ledoux, 1965). There is ample evidence indicating that the process is unrelated to the degradation of DNA and its subsequent resynthesis in the cell.

As reported for MCF-7 mammary adenocarcinoma cell culture (Rogachev et al, 2006), human ESCs captured exogenous DNA from the culture medium and, using the 308

Gene Therapy and Molecular Biology Vol 11, page 309

Figure 1. Analysis of the distribution among cellular compartments of hSSMO1r embryonic stem cell culture labeled fragmented human DNA, depending on the time of its presence in culture medium. A) cytoplasmic fraction; B) interchromosomal fraction and chromatin.

Left, ethidium bromide stained blocks of agarose. Right, X-ray pattern of these blocks after drying. Numbers above blocks indicate incubation time (hrs) of cell culture with &-132 labeled human extracellular DNA and &d+TP* (12&). 7-4*, fragmented human DNA used for incubation with cell culture; &*, initial precursor &d+TP*. Arrows indicate fragments of initial and processed DNA in interchromosomal space.

Figure 2. Analysis of the distribution among cellular compartments of hSSMO1r embryonic stem cell culture of two labeled individual plasmid DNA fragments (Carnegie 20-)1.4(*8)SalGI) of 10.8 kb and 1.4 kb, depending on the time of its presence in culture medium.

A) cytoplasmic fraction; B) nuclear fraction. Nuclei were fixed in low-melting agarose blocks and treated with PrK in lysis buffer. Freed nuclear material was separated in 1.0% agarose. Left, ethidium bromide stained agarose blocks. Right, X-ray pattern of these blocks after drying. Numbers above blocks indicate incubation time (min) of cell culture with &-132 labeled fragments. Electrophoregram shows that heterologous plasmid and Drosophila DNA penetrates into the internal nuclear compartments, as observed for allogenic human DNA.

309

Likhacheva et al: Exogenous DNA and its radioprotective action and embedded into agarose blocks. The embedded nuclei were lysed, PrK digested, and DNA was fractionated in 1.0% agarose gel. It was suggested that the whole cellular chromatin was intact, and it would not migrate in gels because of linear size; exogenous DNA fraction internalized into the nuclear space would migrate in gel according to molecular weight. As the results showed, plasmid DNA was already seen unaltered at the 0 experimental point in the nuclear space, 1.4 and 10.8 kb fragments being both present. Labeled material seen in the cytoplasmic fraction was a presumably degraded DNA fragments added to culture medium. Fragments of 1.4 and 10.8 kb and multimeric copies of concatomerized 1.4 kb fragment were also seen at time points 60, 120, and 180 min in the nuclear fraction (Figure 2). Once again, the results provided that the ESCs, like MCF-7 cancer cells, can capture exogenous DNA in culture medium and internalize the fragments into intracellular space. The following observations are noteworthy. In the case of MCF-7 cells, 1.4 and 10.8 kb fragments were seen intact in the intracellular space in the presence of salmon sperm competitor DNA only, which presumably blocked nuclease effect in culture medium, and at the point 0 only.

In the case of hSSMO1r ESCs, undegraded DNA fragments were detected in the nuclear fraction at all the 0, 60, 120, and 180 min points; this can be explained by the very low nuclease concentration in medium or by the fact that the initial undegraded DNA fragments first delivered to nuclear space filled up interchromosomal volume and the other DNA molecules simply could not enter nucleus until those already there were all utilized.

We estimated the amounts of labeled material delivered to cellular compartments using genomic DNA fragmented to 200-2000 bp as substrate (Table 3).

Exogenous DNA can reside as fragments making up 0.05% of the cell genome, or ~ 1700 kb, in the interchromosomal space of hSSMO1r cells. Taking into account the 200-2000 bp size of exogenous DNA fragments, about 8000-800 fragments were consistently present in the interchromosomal space of this cell type.

This amount of internalized DNA was of 1.5 orders of magnitude less than for MCF-7 human adenocarcinoma cells, the difference may be ascribed to the biological features of these cells.

In control samples, we analyzed the ability of mitotically inactivated mouse embryonic fibroblasts (MEF) to deliver exogenous DNA to intracellular space. It was found (data not shown) that the analyzed compartments contained no labeled material, and this was evidence that MEF had no adequate system for DNA delivery to these cells.

It follows that ESCs can capture exogenous DNA and internalize it into nuclear space. This suggested that internalized DNA fragment could be used, in certain conditions, by the cell repair system as substrate for homologous recombination in repair of induced DSBs. We have reported that human DNA indeed integrated into the adult mouse genome, when treated with the cross-linking cytostatic cyclophosphan in combination with fragmented human DNA (Likhacheva et al, 2007). In the current study, the inducer of DSBs was high-dose radiation.

B. Radioprotective action of fragmented exogenous DNA Death of BSCs that leads to irrecoverable leukoerythropenia and ultimately death is the most serious consequence of ionizing radiation. In the current experiments, lethally radiated mice received injections of exogenous DNA (Figure 3). Of the 7 performed experiments, 4 proved to be successful. The correct timing of exogenous DNA administration for radioprotection was at first unknown. This might have been why some of the replicates failed. A more powerful unit allowed us to choose the lethal-dose within 5-10 min and injection of DNA preparations within 30 min after radiation provided a stable radioprotective effect. This was taken to mean that cell utilized during repair the delivered substrate of fragmented DNA. Doses of nucleic acids and DNA of different origin (isolated from mouse organs, human placenta) were tested in 3 experiments. In addition, fragmented DNA was administered either before or after radiation (Table 2). Mouse longevity was registered in each group. Survival of mice injected with exogenous DNA reached 70-90% (after 30 days), varying depending on the human or mouse origin of DNA substrate. Figure 4 presents data on the effect of mouse and human DNAs on the survival of mice exposed to lethal-dose radiation. The grey-haired survivors lived to the end of the observation period, 1.5-2 years (Figure 4D).

Table 3. Quantitative characterization of labeled material in cell compartments depending on incubation time of cells with labeled substrate.

Incubation time, h Cytoplasmic fraction (absolute count, cpm) % of amount added to medium Amount in mkg calculated from % Interchromosomal fraction (absolute count, cpm) % of amount added to medium Amount in mkg calculated from % % of the genome Chromatin (absolute count, cpm) % of amount added to medium

310

0 7176 0.16% 0.004 429 0.009% 0.0002 0.007% 217 0.005%

1 6724 0.15% 0.004 2318 0.05% 0.0013 0.04% 928 0.02%

3 13344 0.29% 0.008 3029 0.06% 0.0016 0.05% 2064 0.06%

6 15987 0.35% 0.0094 2812 0.06% 0.0016 0.05% 5463 0.12%

12 19431 0.43% 0.012 1777 0.039% 0.001 0.03% 6308 0.14%

Gene Therapy and Molecular Biology Vol 11, page 311 presence would be the hallmark features of BSC rescue from apoptotic death induced by high-dose radiation.

Consequently, the radioprotective effect of exogenous DNA was due to rescue of BSCs whose offspring gave rise to individual colonies in spleens of radiated mice (Figure 5, Table 4). The average number of spleen colonies increased by 18 times after i.p. DNA administration as compared with the control. The effect of administered DNA was specific in that it either occurred or not in a particular individual. It is encouraging that 50% of the treated mice responded favorably to treatment.

Despite small sample size and the wide variability in spleen colony number in the treated group, the differences between the samples were significant at p > 0.95.

IV. Conclusions SCs can capture exogenous extracellular DNA from the cell environment. The amount of exogenous DNA fragments internalized into the intracellular space was 0.05% of the eukaryotic cell genome, i.e. 1700 kb, or ~ 800-8000 fragments of 2.0-0.2 kb. When administered to lethally !-radiated mice, exogenous intracellular DNA afforded a very strong radioprotective action. These radiated mice were rescued by BSCs whose survival was due to the beneficial effect of DNA preparation that gave rise to SC colony formation in spleen. Variations in individual sensitivity in the mouse experiments depended on availability of therapeutic DNA to BSCs at the time DSBs were induced. DNAs of different origin exerted a radioprotective action. This was presumably because repair was of the gene conversion type whereby a Holliday junction formed with crossover or without formation of the junction; in the latter case, repair synthesis on homologous substrate caused an elongation of the RAD 51 filament of the 3â&#x20AC;&#x2122;-processed double-strand end following by joining of the homologous region at the other end of DSB (synthesis-dependent strand annealing) (Bartsch et al, 2000; Symington, 2005; for reference see also Abaji et al, 2005); homologous repair of this type does not require extensive homology between the processed end of the DSB site and molecule substrate. In the current experiments, numerous homologous regions in the mouse and human genomes allowed the SC repair machinery to utilize human DNA substrate for repair of radiation induced DSBs. SC capacity to capture exogenous DNA and to deliver it to the nuclear space implies the involvement of exogenous DNA fragments as substrate for homologous recombination repair of DSBs in progenitor cells induced by high-dose !-radiation exposure.

Figure 3. Electrophoretic characterization of exogenous therapeutic placental human DNA used for injection into treated mice. M, "DNA BssT1I digest molecular weight marker.

C. Formation of spleen colonies in lethally radiated mice under the effect of exogenous DNA Here, we consider the radioprotective effect of exogenous DNA on BSCs in mice exposed to radiation at sub-lethal doses. Because bone marrow is a radiosensitive organ, !-rays are deadly for BSCs. On our assumption, by gaining access to the cells and becoming involved in repair process, exogenous DNA gives BSCs chances to survive.

The survived BSCs would migrate and colonize lymphoid organs such as lymph nodes, spleen, and thymus. This would further promote hematopoiesis and increase longevity. It was expected that differentiated BSC offspring that survived treatment with exogenous DNA would form spleen colonies distinctly seen and whose

311

Likhacheva et al: Exogenous DNA and its radioprotective action

Figure 4. Effect of mouse and human DNA i.p. administered to mice before and after lethal-dose radiation on mouse survival.

Experiments: A) 2 1 (Yakubov et al, 2003), B) 2 2, C) 2 3; D) mice grown grey after exposure to lethal-dose radiation and treatment with allogenic DNA (compared with coat color of untreated CBA mice).

Table 4. Number of spleen colonies formed in mice under the effect of exposure to sub-lethal dose radiation combined with exogenous DNA therapy as compared with the untreated controls.

Control mice Treated mice

0 0

0 0

0 1

0 3

0 4

1 5

1 9

1 24

1 30

2 33

0,6Âą0,22 10,9Âą4,09

Figure 5. Spleens from mice exposed to sub-lethal dose radiation treated with exogenous DNA (A) and untreated (B). Arrows indicate spleen colonies appearing after treatment of radiated mice with extracellular DNA from human placenta.

312

Gene Therapy and Molecular Biology Vol 11, page 313 Peterson CL, Cote J (2004) Cellular machineries for chromosomal DNA repair. Genes Dev 18, 602-616.

Rodrigue A, Lafrance M, Gauthier MC, McDonald D, Hendzel M, West SC, Jasin M, and Masson JY (2006) Interplay between human DNA repair proteins at a unique doublestrand break in vivo. EMBO J 25, 222-231.

Rogachev VA, Likhacheva A, Vratskikh O, Mechetina LV, Sebeleva TE, Bogachev SS, Yakubov LA, and Shurdov MA (2006) Qualitative and quantitative characteristics of the extracellular DNA delivered to the nucleus of a living cell.

Cancer Cell Int 6.

Rogakou EP, Boon C, Redon C, and Bonner WM (1999) Megabase chromatin domains involved in DNA doublestrand breaks in vivo. J Cell Biol 146, 905-916.

Savill J, Fadok V, Henson P, and Haslett C (1993) Phagocyte recognition of cells undergoing apoptosis. Immunol Today 14, 131.

Scott SP, Pandita TK (2006) The cellular control of DNA double-strand breaks. J Cell Biochem 99, 1463-1475.

Shestova OE, Andreeva AY, Vlasov VV, and Yakubov LA (1999) Transport of complexes of oligonucleotides with cell-surface proteins to the cell nucleus. Dokl Akad Nauk 368, 264-267. In Russian.

Stiff T, O'Driscoll M, Rief N, Iwabuchi K, Lobrich M, and Jeggo PA (2004) ATM and DNA-PK function redundantly to phosphorylate H2AX after exposure to ionizing radiation.

Cancer Res 64, 2390-2396.

Symington LS (2005) Focus on recombinational DNA repair.

EMBO Rep 6, 512-517.

Takata M, Sasaki MS, Sonoda E, Fukushima T, Morrison C, Albala JS, Swagemakers SM, Kanaar R, Thompson LH, and Takeda S (2000) The RAD 51 paralog RAD 51B promotes homologous recombinational repair. Mol Cell Biol 20, 6476-6482.

Takata M, Sasaki MS, Tachiiri S, Fukushima T, Sonoda E, Schild D, Thompson LH, and Takeda S (2001) Chromosome instability and defective recombinational repair in knockout mutants of the five RAD 51 paralogs.

Mol Cell Biol 21, 2858-2866.

Yakubov LA, Petrova NA, Popova NA, Nikolin VP, and Os'kina IN (2002) The role of extracellular DNA in the stability and variability of cell genomes. Dokl Biochem Biophys 382, 31-34.

Yakubov LA, Popova NA, Nikolin VP, Semenov DV, Bogachev SS, and Os'kina IN (2003) Extracellular genomic DNA protects mice against radiation and chemical mutagens.

Genome Biol 5, 3.

Zamecnik P, Aghajanian J, Zamecnik M, Goodchild J, and Witman G (1994) Electron micrographic studies of transport of oligodeoxynucleotides across eukaryotic membranes.

Proc Natl Acad Sci USA 91, 3156-3160.

Acknowledgements The authors are grateful to Maria Lagarkova for providing them with cell culture hSSMO1r. They are also grateful to Anna Fadeeva for translating the manuscript from Russian to English.

References Abaji C, Cousineau I, and Belmaaza A (2005) BRCA2 regulates homologous recombination in response to DNA damage: implications for genome stability and carcinogenesis.

Cancer Res 65, 4117-4125.

Baricheva EA, Berrios M, Bogachev SS, Borisevich IV, Lapik ER, Sharakhov IV, Stuurman N, and Fisher PA (1996) DNA from Drosophila melanogaster beta-heterochromatin binds specifically to nuclear lamins in vitro and the nuclear envelope in situ. Gene 171, 171-176.

Bartsch S, Kang LE, and Symington LS (2000) RAD 51 is required for the repair of plasmid double-stranded DNA gaps from either plasmid or chromosomal templates. Mol Cell Biol 20, 1194-1205.

Benett R, Garbor GT, and Merritt MM (1985) DNA binding to human leukocytes. J Clin Invest 76, 2182-2190.

Bonner WM (2003) Low-dose radiation: thresholds, bystander effects, and adaptive responses. Proc Natl Acad Sci USA 100, 4973-4975.

Chelobanov BP, Lactionov PP, and Vlasov VV (2006) Proteins involved in binding and uptake of nucleic acids by the cell.

Biochemistry 71, 725-741. In Russian.

DNA cloning: a practical approach. Volume I, II. (1985) Edited

by Glover DM. Oxford-Washington, DC: IRL Press.

Drosophila: a practical approach. (1986) Edited by Roberts DB. Oxford-Washington, DC: IRL Press. 295 pp.

Histology, cytology and embryology. (2004) Edited by Afanasiev YI, Kuznetsov SL, Yurina NA. M: Medicine. 768 pp.

Lawen A (2003) Apoptosis - an introduction. Bioessays 25, 888896.

Ledoux L (1965) Uptake of DNA by living cells. Prog Nucleic Acid Res Mol Biol 4, 231-267.

Likhacheva AS, Nikolin VP, Popova NA, Dubatolova TD, Strunkin DN, Rogachev VA, Sebeleva TE, Erofeev IS, Bogachev SS, Yakubov LA, and Shurdov MA (2007) Integration of human DNA fragments into the cell genomes of certain tissues from adult mice treated with cytostatic cyclophosphamide in combination with human DNA. Gene Ther Mol Biol 11, 185-202.

Lin J, Krishnaraj ., and Kemp RG (1985) Exogenous ATP enhances calcium influx in intact thymocytes. J Immunol 135, 3403-3410.

Loke SL, Stein CA, Zhang XH, Moir K, Nakanishi M, Subasinghe C, Cohen JS, and Neckers LM (1989) Characterization of oligonucleotide transport in to living cells. Proc Natl Acad Sci USA 86, 3474-3478.

Niedernhofer LJ, Odijk H, Budzowska M, van Drunen E, Maas A, Theil AF, de Wit J, Jaspers NG, Beverloo HB, Hoeijmakers JH, and Kanaar R (2004) The structurespecific endonuclease Ercc1-Xpf is required to resolve DNA interstrand cross-link-induced double-strand breaks.

Mol Cell Biol 24, 5776-5787.

313

Likhacheva et al: Exogenous DNA and its radioprotective action

314

Gene Therapy and Molecular Biology Vol 11, page 315 Gene Ther Mol Biol Vol 11, 315-320, 2007

Bioterrorism: warfare of the 21st century Review Article

Edit Nadasi1,*, Timea Varjas1, Ida Prantner1, Viktoria Virag2, Istvan Ember1 1

University of Pécs, Faculty of Medicine, Department of Public Health and Preventive Medicine, Szigeti u 12, H-7624 Pécs, Hungary 2 Lilly Hungary Ltd, Madach I u 13-14, H-1075 Budapest, Hungary

__________________________________________________________________________________ *Correspondence: Edit Nadasi MD, PhD, Quintiles Hungary Ltd, Budafoki u 91-93, H-1176 Budapest, Hungary Tel: 36/1/457-2413, Presently working at Quintiles Hungary Ltd, Budafoki u 91-93, H-1176 Budapest, Hungary; Fax: 36/1/225-2339; Email: edit.nadasi@aok.pte.hu Key words: bio weapon, defence, prevention Received: 1 July 2007; Revised: 3 December 2007 Accepted: 4 December 2007; electronically published: December 2007

Summary The terrorist attacks on and after September 11, 2001 have drawn attention to the fact that besides the traditional warfare, microorganism-based weapons are playing greater and greater role in military activities, especially in terror attacks. The ongoing war activities worldwide and the continuing international conflicts suggest that despite the international treaties, sooner or later germ warfare must be considered. The relatively easy preparation, storage and application of biologic weapons, despite the strictly regulated access, hold out major advantages when compared to traditional warfare, especially for terrorist activities. Germ warfare, divided into three different categories by the Center for Disease Control and Prevention USA, are based on use of bacteria, toxins and viruses.

Besides the causative agents of the traditionally fearful contagious diseases (plague, smallpox, anthrax) other biologic agents (toxin of C. botulinum, hemorrhagic fever viruses) also play an important role in biologic warfare.

Cognition of biologic weapons is very important because the infections originate from causative agents existing in the natural environment, but are generated artificially. These infections, whether air or food born, may generate numerous infections. Since the initial clinical features are usually not characteristic for the disease, it is crucial to be aware of the circumstances and clinical symptoms indicating biologic attack when produced en masse. When bio attack is recognized in time, suitable countermeasures may effectively reduce the severeness and expansion of the resulting infection.

development of biologic warfare until the restriction signed by President Nixon in 1969 and the United Nations treaty signed in 1970 have banned the biological weapon research. Though the treaty has been signed by 140 countries, 17 of them are still possessing biological weapons. Events of the past few years have drawn attention to the fact that bioterrorism is a living threat for all countries, thus we have to be prepared and acceptable countermeasures have to be authorized.

I. Introduction Though only the events on and after 11 September 2001 have drawn the public’s attention to the dangers of terrorism and bioterrorism, the use of biologic warfare originates from the ancient times. Even in the Native American wars in 1754-1767 blankets contaminated with smallpox were used in order to infect the Native Americans (Henderson et al, 2002). Widespread research of the production of biological warfare was initiated in the 1930s and during the World War II. “Product development” was based on the traditionally fearful infections (plague, smallpox, anthrax), but other infective agents were also considered (botulinum toxin, tularaemia, hemorrhagic fevers). Moreover, agents not considered very dangerous have also been taken into account (Salmonella, vermin) as biological weapons (Phills et al, 1972; Torok et al, 1977). During the cold war, both the East and the West had been intensively working on the

II. General features of biological weapons Microorganisms suitable for developing biological weapons possess several advantageous features when compared to traditional missiles. Since these microorganisms can be found in nature (in several cases also in laboratories) and are ready-to-use, no money, time

315

Nadasi et al: Bioterrorism: warfare of the 21st century and energy are needed for development. Their easiness of being processed in great quantity, low need for storage space, and delayed effect assuring escape for the assassins make them the first choice for terrorist attack. The high number of induced infections generates fear and panic among the public which facilitates further diffusion of the disease (Hughes, 1999).

Naturally, not all microorganisms are suitable for biological warfare development. According to the classification of the Center for Disease Control and Prevention, USA (CDC), three groups (CDC, 2000) of infective agents can be created based on the virulence, mortality and panic-inducing ability (Table 1). In general, the „best” biological weapons are easy-to-access, easy-toproduce, and easy-to-spread; generate widespread infection and serious disease. These requirements are completely fulfilled by the causative agents of plague, smallpox, anthrax, tularaemia, and by the toxin of Clostridium botulinum.

There are several ways to artificially induce and diffuse infections. Early experiments have mainly focused on injecting infectious agents into recipients or on the use of vectors (flies, mosquitoes), but these methods assure only restricted facilitation of spreading infections.

Moreover, since vectors can not be completely controlled, diffusion of the disease could not be accurately predicted.

Later experiments were conducted on generating diseases by infected food and water, but the strict public health restrictions, highly effective filtering of drinking water and heat treatments of food prevent most of the infections. In the past two decades, place have been given to diffusing infections by air (aerosol) and (in case of anthrax) by mail.

Since the infective agents cause no change in the colour or smell of air and due to their small size (<5 micrometers) their sedimentation is very slow, they are able to cover great distances without being detected and are able to venenate a great number of people. Diffusion by mail takes advantage of the unusual way of spreading infection and lack of control, and assures the infection of the previously selected persons (Detels et al, 2002).

III. Potential biological weapons A. Anthrax The disease caused by the B. anthracis is already mentioned in the Bible, and has been denominated the “black disaster” during the great epidemics in the Middle Ages. Due to the great discoveries in the 19th century, the disease has become rare and only sporadic cases can be found in most countries of Europe.

As biological warfare, B anthracis was used first by the German army during World War I when they infected the livestock marked out for the Allies. After the military occupation of Manchuria by Japan in 1932, prisoners of war were used as experimental subjects for anthrax (Harris, 1994). The British army spread anthrax infection as part of an experiment on the uninhabited island of Gruinard at the Scottish shores in 1942, but due to the dominant direction of wind, the microorganisms reached the Scottish mainland causing numerous infections among cats and sheep. Spores of the bacterium originating from this experiment can be found on the Gruinard island even nowadays.

During the cold war, both the Soviet Union and the USA produced great quantities of missiles filled with B. anthracis, until the production has been banned by the United Nation treaty signed in 1970 and the stocks have been annihilated. According to a simulation conducted by the WHO in the same year, 50 kilograms of B. anthracis spread over a city with 5 million inhabitants would cause 250,000 cases of infection and 100,000 cases of death (Detels et al, 2002).

In the 1990s, an extremist terrorist group attacked the subway system of Tokyo, Japan, but fortunately, no clinical cases resulted from the assault. Analysts think it possible that the bacteria the terrorists had obtained stemmed from an avirulent stock; thus, the attack has been “unsuccessful”. After 11 September 2007, five anthrax cases have been proven to be caused by inhalation of the infectious agent among mail service employees with two cases resulting in death. These employees have been infected by anthrax bacteria wrapped in envelopes (Henderson et al, 2002).

Table 1. Classification of potential biological weapons according to the Center for Disease Control and Prevention, USA. Category A

Category B

Category C

Variola virus Bacillus anthracis Francisella tularensis Yersinia pestis Ebola virus Marburg virus Lassa virus Junin (and related) viruses Clostridium botulinum toxin Coxiella burnetti Brucella species Burkholderia mallei Salmonella species Shigella dysenteriae Escherichia coli 0157:H7 Vibrio cholerae Cryptosporidium parvum Eastern encephalitis virus Western encephalitis virus Venezuelai encephalitis virus Staphylococcus enterotoxin Epsylon enterotoxin (Clostridim perfringens) Ricinus Nipah virus Hantaviruses Yellow fever Hemorrhagic fever viruses spread by tick bite Tick encephalitis viruses Mycobacterium tuberculosis (multiresistent)

316

Gene Therapy and Molecular Biology Vol 11, page 317 suspicion when the infection is geographically well localised with very similar symptoms but no common food or other source of infection can be identified (Henderson et al, 2002).

Despite of its hazards, botulinum toxin may also be used for curing different symptoms. It is already applied for the treatment of torticollis, blepharospam and strabismus and in cosmetology in anti-aging creams.

B. Smallpox As already mentioned before, smallpox as biological weapon has been used for the first time in the North American Indian wars between 1754 and 1767. Blankets of patients died of smallpox were given as presents to the Native Americans resulting in the decrease of the native population by fifty percents. Thanks to the discovery of Edward Jenner, with continuous vaccination, smallpox has been eradicated from Earth by 1977; therefore, smallpox vaccination is not compulsory since 1980. All laboratory stocks of smallpox should have been destructed by 1999, but because of sake of research, annulment has been postponed. Smallpox, as biological weapon was mostly developed in the former Soviet Union and they have managed to produce the virus in great quantity (several tons/year). According to certain sources, research is still conducted in Russia in order to generate more virulent and recombinant stocks (Henderson et al, 2002).

E. Tularaemia Though being less known than the previously discussed infections, F. tularensis is the most virulent pathogenic bacterium; inhalation of only 10 bacteria already results in a clinically manifest infection. The microorganism is prevalent in Eurasia and North America.

The disease was nominated “plague of rodents” in 1911, because mostly these animals fall victim to the infection.

Humans may be infected by insect bite, infected animal tissues, food, water, soil, inhalation of infected aerosol.

Mostly hunters, butchers, agricultural and laboratory employees are affected. No spread from human to human is known yet.

As a biological weapon, tularaemia has been used for the first time during World War II (Harris, 1994).

According to the simulation conducted in 1970, 50 kilograms of F. tularensis spread over a city with 5 million inhabitants, 250,000 clinical cases and 19,000 deaths should be considered. It is worth to compare these numbers to the ones mentioned in connection with the plague WHO simulation (Henderson et al, 2002).

C. Plague Plague was one of the contagious diseases feared the most. Historical descriptions exist already from 541 BC when a pandemic originated from Egypt and spread all over the then-known world. The “black death” in 1346 destructed about one-third of the European population and resulted in significant religious, cultural and political changes.

Plague was used as biological weapon for the first time in World War II by the Japanese military. Flies infected with plague were spread over the highly populated parts of China, causing a severe plague epidemic (Harris, 1994). In the years of the cold war, both world-powers succeeded in spreading plague in aerosol, independently from the precarious vectors. According to the simulation conducted by the WHO in 1970, 50 kilograms of Y. pestis spread over a city of 5 million inhabitants would cause 150,000 clinical cases and 36,000 deaths. From the point of origin, the infection would diffuse in a 10-km-diameter circle, and the panic generated in the population would further exacerbate the situation. It is also worth to mention that lethality of plague caused by inhalation is 4 times of the lethality of the classical clinical case (57% versus 14%); thus, the already dangerous infection would become even more hazardous when caused by inhalation of the infective agent (Henderson et al, 2002).

F. Haemorrhagic fevers Haemorrhagic fevers are infectious diseases characterized by fever and severe bleeding, spread by insect bites, infected aerosol, contact with infected animal cadavers.

Human-to-human spread (except in bunyaviruses and flaviviruses) was detected by direct contact, infected blood and air born. Ebola virus, Marburg virus and Lassa virus particles were detected by molecular biologic methods (PCR) in the seminal fluid of patients 82, 83 and 90 days after recovery respectively.

Furthermore, sexual transmission to the partners of these patients was also detected. Virus of the Argentinean hemorrhagic fever is able to infect sexual partners of recovered patients 7-22 days after disappearance of symptoms (Henderson et al, 2002).

Use of hemorrhagic fever viruses as biological weapons was studied both in the Soviet Union and in the USA. Non-primate monkeys were successfully infected with virus-containing aerosol and inhalation of only several virions is able to generate clinical symptoms of the disease. Since these viruses belong to the category A biological weapons, handling of a possible epidemic would require special countermeasures and would have serious public health impact (Henderson et al, 2002).

D. Botulinum toxin Toxin of C. botulinum was used as biological weapon for the first time in 1932 in Manchuria by the Japanese army (Harris, 1994) and was later, during World War II, under development in the USA. The development program was stopped by the United Nation treaty signed in 1970. During the Gulf War in 1991, 19,000 litres of concentrated botulinum toxin were found, mostly readyto-use, built in missiles.

The toxin can be spread in aerosol as well as with infected food. In case of a food born epidemic, possibility of biological attack should be considered if the toxin type is unusual (C, D, E, F, G), but in case of toxin type E only if the infected food is not seafood. Further enhances

G. Other infective agents Besides the contagious diseases traditionally considered very dangerous, other, relatively harmless microorganisms can also used as biological weapons.

317

Nadasi et al: Bioterrorism: warfare of the 21st century In 1991, four college students were deliberately infected in Toronto, Canada with eggs of Ascaris suum that normally cause vermin infection of pigs. After having been treated at the intensive care unit, all four students were discharged completely recovered from the local hospital (Phills et al, 1972).

Members of the Rajneeshee religious group infected the salads served at the election buffets with Salmonella typhimurium in the USA (Wasco County, Oregon) in 1984 in order to influence the outcome of the elections. The attack resulted in the infection of 751 persons (Torok et al, 1977).

In their confessions to the Commission of People’s Rights, members of the apartheid groups admitted that among other means, biological weapons were used as well against the anti-apartheid forces in South Africa (Detels et al, 2002).

DNA shuffling is one of the most powerful methods for unnatural selection of microorganisms. Multiple copies of a given gene are first shattered into fragments, then reassembled using a variation of polymerase chain reaction. This procedure creates a range of “daughter” genes with the fragments linked together in subtly different ways. The enzymes used in the procedure are prone to errors themselves, which introduce point mutations and thus further increase the genetic diversity.

These “daughter” genes can then be reintroduced to bacteria which are selected to identify those with the desired traits (Dennis, 2001). The refined version of the technique reassembles fragments taken from families of related genes from different bacteria.

Other approaches that might be used to develop a bioweapon include the deliberate hybridization of related virus strains. Though most crosses of viruses are less potent that the parent strains, sometimes virulence increases – some virulent strains of flue arise as the naturally occurring recombinants of different influenza viruses.

One disturbing possibility is that knowledge of pathogen genomics could be combined with insights to human genetics to target particular ethnic groups.

IV. Genetic engineering in bioweapon development The ever-developing possibilities of creating genetically modified microorganisms increases the probability of new strains being used as bioweapons – strains which may use virulence factors other than those targeted in traditional vaccines (Ales and Katial, 2004).

However, the idea of developing biologic warfare by genetic engineering is not completely new. Cold-era scientists in the former Soviet Union developed a form of plague resistant to 16 different antibiotics (Niiler, 2002), as well as a more virulent strain of smallpox (Henderson et al, 2002) and a C botulinum strain expressing recombinant toxin (Henderson et al, 2002). Other sources hinted that Russia is in possession of a modified Ebola virus weapon (Niiler, 2002). According to Greenfield and Bronze, all possible bioweapon agents share the potential of naturally occurring or genetically engineered resistance to the currently available antimicrobial therapies (Greenfield and Bronze, 2003).

Recently, synthetic biologists are increasingly able to alter large parts of genomes at once and assemble new ones from scratch (Kaplan and Magnus, 2003; Service, 2006). The technique, called directed molecular evolution, has been developed by companies such as Maxygen in Redwood City, CA (Dennis, 2001; Niiler, 2002).

Theoretically, it might be possible to build novel microorganisms from a set of different component parts, though most experts don’t think it as a realistic scenario yet (Dennis, 2001). But making subtle genetic alterations to existing pathogens to increase their virulence or durability in the environment, or to make them harder to detect or to treat with drugs is well within the limits of today’s technology (Dennis, 2001).

Plasmids carrying antibiotic resistance can be moved between bacteria and genes carried on plasmids can be incorporated into the genome, thus creating resistant strains. For example, anthrax, which is usually treated with penicillin, can be made resistant to treatment by introducing a gene coding the enzyme beta-lactamase. The gene coding the botulinum toxin could be introduced into ubiquitous bacteria such as Escheria coli.

V. Countermeasures A. Criminal law and public health: a new working relationship Events of 2001 have made it clear that in case of a bioterrorist attack countermeasures can not be restricted to public health measures. Follow-up of the clinical cases and collection of evidence consider criminal law employees as well. Public health experts are normally not qualified to handle infectious samples as evidence of law.

Furthermore, at least in theory, it is possible that the experts themselves may contaminate the samples collected for analysis. Therefore, the real challenge is to identify the point where public health investigation is transformed into criminal investigation. Criminal investigation against persons performing bioterrorist attack must include public health experts, since investigations consider biological samples and infectious diseases. Besides, countermeasures have to be initiated at local level, by the public health authorities (Detels et al, 2002). Hence, relationship between public health and criminal law should be strengthened.

B. Improvement of public health control and of the infrastructure of public health laboratories Identification of bioterrorist attack as early as possible is a crucial point in performing the suitable countermeasures and in decrease of the number of casualties. Basis of this identification could be created by the enlargement of online databases and their being opened to the public, by educating the public health experts and by the thorough and continuous control of events bearing the risk of being attacked by biological weapons (e.g. political events, Olympics).

318

Gene Therapy and Molecular Biology Vol 11, page 319 Acquisition of the suitable laboratory equipments and reagents, besides the set-up of a central laboratory may ensure the early diagnosis and identification of the infection and thus the decrease of the number of cases by applying early adequate therapy and prevention.

The first agency of the WHO educating experts for identifying and handling bioterrorist attacks has been set up in Lyon, France in 2001 (Detels et al, 2002). As a consequence, the quality level of the public health laboratories should be improved and in case of a biological attack these laboratories should be able to identify the infective source and the population at risk within a limited time. Among others, countermeasures may contain isolation, set-up of a quarantine, disinfection and decontamination.

VI. Prevention In prevention of infections resulting from biological attack, defence of water supply, food, air and mail service employees is crucial.

Water supply networks are usually safe against bioterrorist attack. Built-in filtering, cleaning and controlling systems against naturally generated infections are also effective against biological attacks. Due to the high dilution effect in the water networks of huge towns, toxins are very unlikely to generate infection, even if injected in a great quantity. Bacteria are another question, since they are able to multiply even in the cleaned water; therefore, continuous monitoring of the water supply networks is a must (Detels et al, 2002).

Food may be contaminated with microorganisms at several steps during the processing. Plants and animals serving as source of nutrition must be protected by the responsible government all the time. During food processing, the producer is obliged to ensure the purity of the product.

In the industrial societies, widespread distribution of ready-cooked, canned food and ingredients creates possibility for infection and/or contamination even after processing. Fortunately, since the most virulent infective agents are sensitive to heat, and most of the possibly contaminable food is treated with heat prior to consuming, infections deliberately generated by infected food are rare.

However, in case of a food born biological attack, strict cooperation of the local, regional and public health authorities, as well as increased efficacy and frequency of food control is needed for the identification of source (Detels et al, 2002).

It is proven that to spread infection deliberately is easiest by contaminating air. On the other hand, infective agents may enter buildings by some other means as well, therefore, prior to re-constructing air circulating and conditioning systems, risk of the building and the persons usually abiding in it should be considered versus the benefit of the re-construction. As a temporary solution, effective air filtering system combined with frequent air sampling and analysis may be installed. In case such a system detects an infective agent, it would automatically shut the air circulation down, and thus would decrease the speed of disseminating infection (Detels et al, 2002).

Mail is not considered the most probable way of using biological weapons, but infections generated by bacteria posted in envelopes have drawn the attention to the necessity of defending mail service employees against such events. Prevention basically means the use of gloves, face masks and respirators in the short term, and neutralisation of the infective agents by irradiating the mail in the long term (Detels et al, 2002).

Such as in any other case of infection, diseases generated by biological attack could be prevented the simplest, most effective and cheapest way by using primary prevention. According to Horton, terrorism is the consequence of widespread changes in politics and social status, most frequently in countries that fail functioning as an independent state (Horton 2001). Moreover, terrorist attacks may also be induced by national politics, religious and/or political persuasions and inequalities considered

C. Medical arrangements The most important action is to think of the possibility of biological attack during certain circumstances. To provide the population with effective defence, medical students should already be familiarised with the infective agents that may potentially be used as biological weapon and with the means of their identification. Adequate infrastructure should be built in order to treat and isolate the infected persons, and to set quarantine up. Stocks of antibiotics and vaccines against the possible infections must be accumulated. Pre-exposure vaccination of the na誰ve population and post-exposure vaccination of the already exposed population may play a crucial role in the prevention of a widespread epidemic (Detels et al, 2002).

D. Mass media Panic generated by a bioterrorist attack may multiply the number of induced cases and may prohibit the early installation of the effective countermeasures. To avoid panic, to quickly provide the public with accurate information is crucial.

Events of September, 2001 in the USA have drawn attention to the fact that keeping certain pieces of information from the public opens wide area for guessing, exaggerating and hysteria generated by the inappropriate information. In case the government is not willing to share all information with the public (e.g. to facilitate criminal investigation later), then appropriate quantity of data should be provided for the media, and pieces of information must not be controversial. Keeping information secret and leaking them later may shock the trust of the public and may generate further panic.

Information that may be disclosed should be recorded and provided for the responsible authorities beforehand, thus coverage given at the time of attack will be unambiguous and trustworthy. The local public health authorities should continuously be kept updated including the treatment and prevention of the diseases generated by the biological attack, thus the public can later be provided with this information without further delay.

319

Nadasi et al: Bioterrorism: warfare of the 21st century Harris SH (1994) Factories of death: Japanese biological warfare, 1932-1944, and the american cover-up. Routledge, New York.

Henderson DA, Inglesby TV, O’Toole T (2002) Bioterrorism.

Guidelines for Medical and Public Health Management.

AMA Press, USA. Horton R (2001) Public health: a neglected counterterrorist measure. Lancet 358, 1112-1113.

Hughes J (1999) The emerging threat of bioterrorism. Emerg Infect Dis 5, 494-495.

Niiler E (2002) Bioterrorism–biotechnology to the rescue?

Nature Biotechnol 20, 21-25 Phills JA, Harrold AJ, Whiteman GV, Perelmutter L (1972) Pulmorary infiltrates, asthma and eosinophilia due to Ascaris suum infestation in man. N Engl J Med 286, 965-670.

Service R (2006) Biosecurity: synthetic biologists debate policing themselves. Science 312, 1116 Torok TJ, Tauxe RV, Wise RP, Livengood JR, Sokolow R, Mauvais S, Birkness KA, Skeels MR, Horan JM, Foster LR (1997) A large community outbreak of salmonellosis caused by intentional contamination of restaurant salad bars. JAMA 278, 389-395.

unchangeable. Terrorists feel being victimized and are convinced that the only option they have is executing aggressive attacks. Victims’ first reaction to terrorist attacks, whether individuals, groups or nations, is to take vengeance. However, this can not be the solution. In order to abolish bioterrorism, its triggering causes should be first ceased. Therefore, even during a terrorist attack, it is important to analyze and understand the national, local and individual difficulties lying in the background. The necessary measures would most probably be unpopular, but the national leaders and the international committees are responsible for identifying and executing the adequate actions (Detels et al, 2002).

Though temper has been evened after 11 September 2001 and no other biological attack of such a great dimension has been committed, the possibility of bioterrorism should always be considered and necessary countermeasures should immediately be taken when the suspicion of such action rises.

References Ales NC, Katial RK (2004) Vaccines against biologic agents: uses and developments. Respire care Clin N Am 10, 123146.

Caplan AL, Magnus D (2003) New life forms: new threats, new possibilities. Hastings Center Report 33, 7.

CDC (2000) Biological and chemical terrorism: strategic plan for preparedness and response. Morb Mortal 49, RR-4.

Dennis C (2001) The bugs of war. Nature 411, 232-235.

Detels R, McEwen J, Beaglehole R, Tamaka H (2002) Oxford Textbook of Public Health, Oxford University Press, Oxford, UK. Greenfield RA, Bronze MS (2003) Prevention and treatment of bacterial diseases caused by bacterial bioterrorism threat agents. Drug Discov Today 8, 881-888.

Dr. Edit Nadasi

320

Gene Therapy and Molecular Biology Vol 11, page 321 Gene Ther Mol Biol Vol 11, 321-328, 2007

Genotypic determination of Hepatitis C virus in Tehran using PCR-RFLP analysis Research Article

Bahram Kazemi1,2,*, Shaily Varasteh- Moradi3, Mojgan Bandehpour1, Negar Seyed1, Parviz Pakzad4, Farzaneh Tafvizi5 1

Cellular and Molecular Biology Research Center. Shahid Beheshti University, M.C., Tehran, I.R.Iran.

Parasitology Department, Shahid Beheshti University ,M.C., Tehran, I.R. Iran.

3 Islamic Azad University of Iran- Tehran North Branch, Tehran, I.R. Iran.

4 Immunology Department - Shahid Beheshti University, M.C., Tehran, I.R. Iran.

5 Islamic Azad University of Iran, Science and Research Campus. Tehran, I.R. Iran.

2

__________________________________________________________________________________ *Correspondence: Bahram Kazemi Ph.D., Cellular and Molecular Biology Research Center, Shahid Beheshti University, M.C., Tehran, I.R. Iran. PO BOX: 19395- 4719; Tele/fax: 009821 22428432; Email: kazemi@sbmu.ac.ir, bahram_14@yahoo.com Key words: Hepatitis C virus; RFLP; Genotyping; Tehran Abbreviations: 5`untranslated region, (5`UTR); Reverse transcription, (RT); Hepatitis C virus, (HCV); ribonucleic acid, (RNA) Received: 2 May 2007; Revised: 14 July 2007 Accepted: 3 December 2007; electronically published: December 2007

Summary Hepatitis C virus (HCV) is the etiologic agent of most parentally transmitted hepatitis viruses and is responsible for more than 60% of chronic hepatitis cases that lead to liver transplantation. Based on its genetic variability, HCV is classified into at least six genotypes and a series of subtypes. HCV genotyping is important in order to select appropriate therapy. The aim of this study was to determine which HCV virus genotypes are most prevalent in Tehran. Serum HCV RNA was extracted by RNXplus buffer. RT-PCR and nested PCR were used on the 5â&#x20AC;&#x2122; untranslated region and a 250 bp fragment was amplified. 80 HCV positive sera samples were selectively chosen from 250 patients who were referred to the laboratory by their physicians. HCV genotypes were determined using restriction fragment length polymorphism (RFLP). The patients were grouped as follows: 32 cases (40%) had type 1a, 15 cases (18.75%) had type 3a, 7 cases (8.75%) had type 1b, 5 cases (6.25%) had type 3b, 3 cases (3.75%) had type 4, and 18 cases (22.5%) could not be typed because their sequences differed from any that were previously reported. Our results showed that types 1a and 3a were the most prevalent HCV genotypes in our Tehran samples, while types 2a, 2b, 5, and 6 were not observed.

Ramia and Eid-Fares, 2005). Other genotypes, including 5 and 6, have an even more distinct distribution. For example, genotype 6 is specifically prevalent in Hong Kong (Zhou et al, 2006). HCV genotypes may have different clinical implications (Alavian et al, 2005). While not thoroughly understood, viremia and the severity and progression of liver disease may be type dependent. There is also some indication that the efficacy and duration of interferon treatment may also depend on viral genotype (Hadziyannis et al, 2004).

HCV is a small enveloped human flavivirus with a positive strand ribonucleic acid (RNA) genome of approximately 9400 bases in length. The genome organization of several prototype isolates has already been determined (Robertson et al, 1998). A comparison of these isolates has shown considerable variability in the envelope

I. Introduction Hepatitis C virus (HCV) was first identified by Choo and colleagues in 1998. The virus is an important human pathogen that causes acute and chronic hepatitis, liver cirrhosis, and hepatocellualar carcinoma (Zein, 2000).

Approximately 180 million people worldwide are infected with hepatitis C virus (Schiff 2007), but the prevalence and incidence of HCV genotypes in specific geographic areas is not well established (Wasley and Alter, 2000). For example, in Europe, North America, and South America, HCV genotypes 1a and 1b are shown to be the most prevalent (Alter et al, 1999; Harris et al, 1999). In Japan, subtype 1b is responsible for most cases of HCV infection (Takeshita et al, 2006), while in the Middle East and central Africa subtype 4 is predominant (Attia, 1998;

321

Kazemi et al: Tehran hepatitis C virus genotypes and nonstructural regions (Hijikata et al, 1991), while the 5`untranslated region (5`UTR) and core regions are more conserved (Hijikata et al, 1991). HCV isolates have four levels of genetic variation: types, subtypes, isolates, and quasispecies (Ruiz-Jarabo et al, 2000). To date, 6 genotypes, including more than 90 subtypes have been identified (Bukh et al, 1993). Subtypes can be classified into several major types that show sequence similarities ranging from 65% to 75% of the total genome (Davidson et al, 1995). Different regions of the HCV genome show varying degrees of diversity, but the 5’ noncoding region has the highest degree of conservation and is thus most commonly used for polymerase chain reaction (Halfon et al, 2001). There are, however, some differences in the nucleotide sequences of the 5’ noncoding region between HCV strains and these specific nucleotide substitutions can be useful for genotyping (Halfon et al, 2001). Several methods have been developed to determine the genotypes of HCV isolates. The aim of this study was to determine which HCV genotypes are most common in Tehran, the capital of Iran, using restriction fragment length polymorphism within the virus 5`UTR.

E. Detection of the PCR product The PCR product was electrophoresed on 2% agarose and stained using ethidium bromide. The DNA band was observed by UV light with an UVTransilluminator.

F. HCV genotyping The PCR product was used for HCV virus genotyping by RFLP as previously described (Pohjanpelto et al, 1996; Park et al, 1998). In brief, 1 µg DNA was used for digestion with the RsaI, SmaI, HaeIII, and NcoI restriction enzymes and incubated for 60 min at 37oC. Digested reactions were electrophoresed on a 15% acryl amide gel, stained with ethidium bromide, and visualized using a UV Transilluminator. Results were obtained

by RFLP.

G. Sequencing PCR products were purified by DNA purification kit (Fermentas Cat. No. k0513) and were subjected to sequencing by dideoxy chain termination method (Maxam and Gilbert 1992).

III. Results A. RNA extraction and PCR We selectively chose 80 HCV positive infected sera from 250 patients who were referred to our laboratory by their physician. Total RNA was extracted from eighty serum samples, and RT and PCR reactions were performed and used for HCV genotyping. Figure 1 shows the 250 bp PCR product from the virus 5`UTR.

II. Materials and methods A. Sampling This research was designed as descriptive study. HCV viral RNA was positive for 80 infected sera from 250 patients in Tehran who had been referred to the Cellular and Molecular Biology Research Center of Shaheed Beheshti University of Medical Sciences by their physician. All drug users and haemodialysis patients were excluded from this study. Sera were aliquoted and stored at -20°C prior to genotyping.

B. Genotyping PCR reaction was done and PCR products submitted for RFLP. Results are as follows: 3 cases (3.75%) were identified as type 4 (Figure 2), 32 cases (40%) as type 1a (Figures 3 and 4), 7 cases (8.75%) as type 1b, 15 cases (18.75%) as type 3a (Figure 5), 5 cases (6.25%) as type 3b (Figure 6), and 18 cases (22.5%) could not be typed.

B. Viral RNA extraction Viral RNA extraction was conducted using RNXplus buffer, as described by the manufacturer (CinnaGen, Iran). In brief, 50 µl of serum were mixed with 200 µl RNXplus buffer, and incubated for 5 min at room temperature. 50 µl of chloroform was added and centrifuged at 12000 rpm for 15 min at 4OC. Total serum RNA (including the viral RNA) was ethanol precipitated, and dissolved in 10 µl diethyl pyrocarbonate treated water.

C. cDNA synthesis Reverse transcription (RT) was performed as previously described (Pfeffer 1998). In brief, template RNA (equivalent to 50 µl of serum) was incubated in a 20 µl reaction mixture containing 40 pmol specific antisense external primer (HCV1R1 5`-GGT GCA CGG TCT ACG AGA CCT C-3`), 100 units AMV revers transcriptase enzyme (Fermentas, Lithuania), 20 units RNasine (Fermentas, Lithuania), 1x RT buffer, and 0.2 mM dNTP, for 1 h at 42 °C.

D. PCR reactions Nested-PCR for the virus 5` UTR was used to amplify a 250 nucleotide fragment. The Nest I primers were HCV1F1 5`CTG TGA GGA ACTA CTG TCT T -3` and HCV1R1 5` - GGT GCA CGG TCT ACG AGA CCT C - 3`. The first PCR reaction was carried out using 30 cycles of denaturation at 94 °C for 30 sec, annealing at 55 °C for 60 sec, and extension at 72 °C for 40 sec. A second PCR reaction was conducted similarly, with the only difference being an annealing temperature of 58 °C. The Nest II primers were HCV2F2 5`- TTC ACG CAG AAA GCG TCT AG -3` and HCV2R2 5` - GGG CAC TCG CAA GCA CCC TAT C-3` (Pherson and Moller 2000).

Lane 1: 100 bp DNA ladder marker Lane 2: PCR product of HCV 5! UTR as 250 bp Figure 1. 2% agarose gel electrophoresis.

322

Gene Therapy and Molecular Biology Vol 11, page 323

Lane 1: PCR product digested with RsaI Lane 2: PCR product digested with NcoI Lane 3: 100 bp DNA ladder marker Lane 4: Undigested PCR product Lane 5: PCR product digested with SmaI Lane 6: PCR product digested with NcoI Figure 2. RFLP pattern of HCV type 4.

Lane 1: PCR product digested with SmaI Lane 2: 100 bp DNA ladder marker Lane 3: Undigested PCR product Lane 4: PCR product digested with NcoI Lane 5: PCR product digested with RsaI Lane 6: PCR product digested with Hae III Figure 3. RFLP pattern of HCV type 1a.

323

Kazemi et al: Tehran hepatitis C virus genotypes

Lane 1: 100 bp DNA ladder marker Lane 2: Undigested PCR product Lane 3: PCR product digested with NcoI

Lane 1: 100 bp DNA ladder marker Lane 2: Undigested PCR product Lane 3: PCR product digested with NcoI

Figure 4. RFLP pattern of HCV type 1b.

Figure 6. RFLP pattern of HCV type 3b.

Lane 1: PCR product digested with SmaI Lane 2: PCR product digested with RsaI Lane 3: PCR product digested with NcoI Lane 4: 100 bp DNA ladder marker Lane 5: Undigested PCR product Lane 6: PCR product digested with Hae III Figure 5. RFLP pattern of HCV type 3a.

Table 1 shows the frequency and percentage of HCV genotypes in Tehran. HCV types 2a, 2b, 5 and 6 could not be identified in any of the Tehran samples. 18 cases (22.5%) had one of two new sequences that had not been previously reported and this is the first report on these genotypes.

C. Nucleotide numbers

sequence

accession

The sequences obtained from the non type able samples were deposited into GeneBank under the accession numbers DQ835670 and DQ835671.

324

Gene Therapy and Molecular Biology Vol 11, page 325 Table 1. Frequency and Percent of HCV genotypes in Tehran Virus type Type 1a Type 3a Type 1b Type 3b Type 4 Non typeable Total

Frequency 32 15 7 5 3 18 80

al, 2006). It was expected that the distribution of HCV genotypes would be particularly distinct in Iran, which serves as a bridge between the Indian subcontinent, the Arab peninsula, middle Asia, and Europe, and has a number of immigrants from Afghanistan and Iraq, as well as regular travelers from Pakistan and Afghanistan (Alavian et al, 2005). In Pakistan, the most common isolate is genotype 3 (Shah et al, 1997), while in the Turkish population, genotype 1a is the most common isolate, and HCV genotypes 1, 2, 3, and 4 are also prevalent (Turhan et al, 2005). In the western province of Saudi Arabia, the most predominant genotypes are 4 and to a lesser extent, subtype 1b (Osoba et al, 2000). Based on the pattern of genotype distribution in this geographical setting, we expected that the distribution in Iran would be similar. Our results showed that the types of HCV found in Iran were similar to surrounding countries, but had a different prevalence. The predominant types in patients in this study were types 1a, 3a, and 1b respectively. Type 4 was also observed, but at a lower prevalence. These results differ from other studies published in Iran (Zali et al, 2000; Samimi-Rad et al, 2004; Hosseini-Moghaddam et al, 2006; Kabir et al, 2006; Keyvani et al, 2007; Smimi-Rad and Shahbaz 2007), Estonia (Zusinaite et al, 2000), Uzbekistan (Kurbanov et al, 2003), and England (Harris et al, 1999). Zali and colleagues in 2000), Keyvani and colleagues in 2007 and Kabir and colleagues in 2006 performed HCV genotyping in Iranian patients using typespecific primers. Samimi-Rad and colleagues used the NS5B or 5'-UTR/core regions (Samimi-Rad et al, 2004), Hosseini-Moghaddam and colleagues used PCR-RFLP in heamodialysis patients (Hosseini-Moghaddam et al, 2006) and Samimi-Rad and Shahbaz were genotyped HCV in patients with thalassemia and inherited bleeding disorders using reverse hybridization by type-specific probes (Samimi-Rad and Shahbaz, 2007). In this study, we used the RFLP method for genotyping, and 80 cases were grouped as follows: 32 cases (40%) were observed as type 1a, 15 cases (18.75%) as type 3a, 7 cases (8.75%) as type 1b, 5 cases (6.25%) as type 3b, 3 cases (3.75%) as type 4, and 18 cases (22.5%) were non type able. We compared our results with of other studies performed in Iran and are shown in Table 2. Non type able cases formed two

Percent 40 18.75 8.75 6.25 3.75 22.5 100

IV. Discussion The gold question is which of the HCV genotypes are prevalent in Tehran? Sequence analysis of the entire HCV genome has revealed four levels of heterogeneity, types, subtypes, isolates, and quasispecies (Ruiz-Jarabo et al, 2000). HCV genotyping has been particularly important for studying the relationship between type/subtype and clinical status, pathogenesis, and disease outcome. This is useful for vaccine research and development (Lechmann and Liang, 2000), specifically because different genotypes often respond differently to antiviral treatment (Attia, 1998; Zein, 2000). At present, three rapid genotyping methods are used: 1) type specific PCR amplification using various sets of genotype-primers, 2) PCR amplification using conserved primers, followed by restriction fragment length polymorphism analysis of PCR products with restriction enzymes, and 3) PCR amplification using conserved primers, followed by reverse hybridization to genotype-specific oligonucleotide probes coated on microtiter plates or nitrocellulose membrane strips (Davidson et al, 1995; Forns et al, 1996; Furione et al, 1999). The diversity of HCV genotypes and the presence of multiple subtypes suggest that HCV has remained endemic within the same regions of the world (Forns et al, 1996). Genotypes are also distributed differently within each geographic region (Wasley and Alter, 2000). Genotypes 1, 2, and 3 have a worldwide distribution, while genotype 4 is primarily found in the Middle East and Africa but at a lower prevalence (Attia, 1998; Ramia and Eid- Fares 2005). Genotypes 5 and 6 appear confined in South Africa and Hong Kong (Zhou et

Table 2. Comparison of HCV genotypes determined in Iran based on author and year.

Author Virus type 1 1a 3a 1b 3b 2 4 Mixed genotypes Non type able Determined new sequences

Kazemi 2007 --40 18.75 8.75 6.25 --3.75 --22.5 2

Keyvani 2007 --39.7 27.5 12.1 ------1.6 18 ---

Samimi-Rad 2007 27.3 13.6 18.2 9.1 --4.54 --27.26 -----

325

Hosseni-Moghaddam 2006 --28.8 30.3 18.2 3 --16.7 3 -----

Kabir 2006 --37.8 28.9 16.7 ----1.2 0.6 13.4 ---

Samimi-Rad 2004 --47 36 8 ----7 -------

Zali 2000 --46 26.6 20 ----6.6 -------

Kazemi et al: Tehran hepatitis C virus genotypes Jimenez De, Anta MT, Rodes J (1996) Comparative study of three methods for genotyping hepatitis C virus strains in samples from Spanish patients. J Clin Microbiol. 34, 25162521.

Furione M, Simoncini L, Gatti M, Baldanti F (1999) HCV genotyping by three methods: analysis of discordant results based on sequencing. J Clin Viral 13, 121-130.

Hadziyannis SJ, Sette JH, Morgan TR (2004) Peginterferonalpha2a and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose. Ann Intern Med 140, 346-355.

Halfon P, Trimoulet P, Bourliere M, Khiri H, de Ledinghen V, Couzigou P, Feryn JM, Alcaraz P, Renou C, Fleury HJ, Ouzan D (2001) Hepatitis C virus genotyping based on 5' noncoding sequence analysis (Trugene). J Clin Microbiol 39, 1771-1773.

Harris KA, Gilham C, Mortime, PP, Teo CG (1999) The most prevalent hepatitis C virus genotypes in England and Wales are 3a and 1a. J Med Virol 58, 127-131.

Hijikata M, Kato N, Ootsuyama Y, Nakagawa M, Shimitohno K (1991) Gene mapping of the putative structural region of the hepatitis C virus genome by in vitro processing analysis.

Proc Natl Acad Sci USA 88, 5547-5551.

Hofmann WP, Polta A, Herrmann E, Mihn U, Kronenberger B, Sonntag T, Lohmann V, Schonberger B, Zeuzem S, Sarrazin C (2007) Mutagenic effect of ribavirin on hepatitis C nonstructural 5B quasispecies in vitro and during antiviral therapy. Gastroenterology 132, 921-30 Hosseini - Moghaddam SM, Keyvani H, Kasiri H, Kazemeyni SM, Basiri A, Aghel N, Alavian SM (2006) Distribution of hepatitis C virus genotypes among hemodialysis patients in Tehran--a multicenter study. J Med Virol 78, 569-573.

Kabir A, Alavian SM, Keyvani H (2006) Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters, a preliminary study. Comp Hepatol 2, 5-4.

Keyvani H, Alizadeh AH, Alavian SM, Ranjbar M, Hatami S (2007) Distribution frequency of hepatitis C virus genotypes in 2231 patients in Iran. Hepatol Res 37, 101-3.

Kurbanov F, Tanaka Y, Sugauchi F, Kato H, Rozibakiev M, Zalyalieva M, Yunusova Z, Mizokami M (2003) Hepatitis C virus molecular epidemiology in Uzbekistan. J Med Virol 69, 367-375.

Lutchman G, Danehower S, Song BC, Liang TJ, Hoofnagle JH, Thomson M, Ghany MG (2007) Mutation rate of the hepatitis C virus NS5B in patients undergoing treatment with ribavirin monotherapy. Gastroenterology 132, 1757-66.

Lechmann M, Liang TJ (2000) Vaccine development for hepatitis C, national institute of health, Maryland. Semin Liver Dis 20, 211-26.

Maxam AM, Gilbert W (1992) A new method for sequencing DNA. 1977. Biotechnology 24, 99-103.

Osoba AO, Ibrahim M, Abdelaal MA, Al-Mowallad A, Shareef AB, Al Haj Hussein B (2000) Hepatitis C virus genotyping by polymerase chain reaction and DNA enzyme immunoassay among Saudi patients in western province ,Saudi Arabia. Ann Saudi Med 20, 394-397.

Park YS, Lee KO, Oh MJ, Chai YG (1998) Distributions of genotypes in the 5` untranslated region of hepatitis C virus in Korea. J Med Microbiology 47, 643-647.

Pohjanpelto P, Lappalainen M, Widell A, Asikainen K and Paunio M (1996) Hepatitis C genotypes in Finland determined by RFLP. Clin Diagn Virol 7, 7-16 Pfeffer U (1998) One-Tube RT-PCR with sequence - Specific Primers. In RNA isolation and characterization protocols.

Edited by Ralph rapley and David L. manning. Published by Humana Press Chapter 22, pp 143-151.

groups, those infected with more than one virus genotype (mixed) or those infected by a virus with a different sequence while, Keyvani and colleagues found in 2007 a 18% undetermined genotype and 1.6% mixed genotypes and Kabir and colleagues found in 2006 a 13.4% (21 of 156) impossible genotyping. The non type able samples (in our study) were sequenced and two different sequences were determined that shared 93% identity and were different from sequences reported previously. This difference probably arose from the immigration of viruses into Iran from Iraq, Afghanistan, or other countries, because Tehran is Capital city and some refuges from Iraq and Afghanistan are seeking for job, or from mutations in the virus sequence; which some scientists hypothesis that ribavirin, a common antiviral drug, by its mutagenic action drives virus into an error catastrophe of replication (Chevaliez et al, 2007; Hofmann et al, 2007; Lutchman et al, 2007; Sallie, 2007). There is no information about HCV genotypes in Afghanistan but HCV genotypes in Iraq is as follow, 1a (27.1%), 1b (22.9%), type 4 (35.4%) and Mixed genotype (14.6%) (Al-Kubaisy et al, 2006a,b).

However more work is required to confirm this prediction.

Acknowledgment This study was supported by Vice Chancellor for Research of Shahid Beheshti University, M.C. (Grant No. 2234) and was done in Cellular and Molecular Biology Research Canter. Here with, authors of research appreciating relevant responsible men.

References Alavian M, Adibi P, Zali MR (2005) Hepatitis C virus in Iran: epidemiology of an emerging infection. Arch Iranian Med 8, 84-90.

Al-Kubaisy WA, Al-Naib KT, Habib M (2006a). Seroprevalence of hepatitis C virus specific antibodies among Iraqi children with thalassaemia. East Mediterr Health J 12, 204-210.

Al-Kubaisy WA, Al-Naib KT, Habib M (2006b). Prevalence of HCV/HIV co-infection among haemophilia patients in Baghdad. East Mediterr Health J 12, 264-269.

Alter MJ, Kruszon-Moran D, Nainan OV, McQuillan GM, Gao F, Moyer LaA, Kaslow RA, Marglis HS (1999) Prevalence of hepatitis C virus infection in the United States. Engl J Med 341, 556-558.

Attia MA (1998) Prevalence of hepatitis B and C in Egypt and Africa. Antivir Ther 3, 1-9.

Bukh J, Purcell RH, Miller RH (1993) At least 12 genotypes of hepatitis C virus predicted by sequence analysis of the putative E1 gene of isolates collected worldwide. Proc Natl Acad Sci USA 90, 8234-8238.

Chevaliez S, Brillet R, Lazaro F, Hezode C, Pawlotskv JM (2007) Analysis of ribavirin mutagenicity in human hepatitis C virus infection. J Virol 81, 7732-41.

Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M (1998) Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science 244, 359-362.

Davidson F, Simmonds P, Ferguson JC, Jarvis LM, Dow BC, Follett EA, Seed CR, Krusinus T, Lin C, Medgyesi GA (1995) Survay of major genotypes and subtypes of hepatitis C virus using RFLP of sequences amplified from the 5' noncoding region. J Gen Virol 76,1197-1204.

Forns X, Maluenda MD, Lopez-Labrador FX, Ampurdanes S, Olmedo E, Costa J, Simmonds P, Sanchez-Tapias JM,

326

Gene Therapy and Molecular Biology Vol 11, page 327 Pherson Mc, Moller MJ (2000) PCR. The Basics from Background to Bench. Bios Scientific publishers. Chapter 2 Undrestanding PCR.,pp, 9-21.

Ramia S, Eid- Fares J (2005) Distribution of hepatitis C virus genotypes in the Middle East. Int J Infect Dis 10, 272-277.

Robertson B, Myers G, Howard C, Brettin T, Bukh J, Gaschen B, Gojobori T, Maertens G, Mizokami M, Nainan O, Netesoy S, Nishioka K, Shin IT, Simmonds P, Smith D, Stuwer L, Weiner A (1998) Classification, nomenclature, and database development for hepatitis C virus (HCV) and related viruses, proposals for standardization. International Committee on Virus Taxonomy. Arch Virol 143, 2493-2503.

Ruiz-Jarabo CM, Arias A, Baranowski E, EscarmĂ­s C, Domingo E (2000) Memory in Viral Quasispecies. J Virol 74, 35433547.

Sallie R (2007) Replicative homeostasis III, implications for antiviral therapy and mechanisms of response and nonresponse. Virol J 4, 29.

Samimi-Rad K, Nategh R, Malekzadeh R, Norder H, Magnius L (2004) .Molecular epidemiology of hepatitis C virus in Iran as reflected by phylogenetic analysis of the NS5B region. J Med Virol 74, 246-52.

Samimi-Rad K, Shahbaz B (2007) Hepatitis C virus genotypes among patients with thalassemia and inherited bleeding disorders in Markazi province, Iran. Haemophilia 13, 15663.

Schiff ER (2007) Introduction, advances in antiviral therapy for chronic hepatitis C infection-the influence of genotype and HIV co-infection Nat Clin Pract Gastroenterol Hepatol 4, S1-S2.

Shah HA, Jafri W, Malik I, Prscott L, Simmonds P (1997) Hepatitis C virus (HCV) genotypes and chronic liver disease In Pakistan. J Gastroenterol Hepatol 12, 758-761.

Takeshita M, Sakai H, Okamura K, Higaki K, Oshiro Y, Uike N, Yamamoto I, Shimamatsu K, Muranaka T (2006) Prevalence of hepatitis C virus infection in cases of B-cell lymphoma in Japan. Histopathlogy 48, 189-98.

Turhan V, Ardic N, Eyigun CP, Avci IY, Sengul A, Pahsa A (2005) Investigation of the genotype distribution of hepatitis C virus among Turkish population in Turkey and various European countries. Chin Med Journal 118, 1392-1394.

Wasley A, Alter MJ (2000) Epidemiology of hepatitis C, geographic differences and temporal trend. Semin Liver Dis 20, 1-16.

Zali MR, Mayumi M, Raufi M, Nowroozi, A (2000) Hepatitis C virus genotypes in the Islamic Republic of Iran. Eastern Health J 6, 372-377.

Zein NZ (2000) Clinical significance of hepatitis C virus genotypes. Clin Microbial Rev 13, 223-35.

Zhou DX, Tang JW, Chu IM, Cheung JL, Tang NL, Tam JS, Chan PK (2006) Hepatitis C virus genotype distribution among intravenous drug user and the general population in Hong Kong. J Med Virol 78, 574-581.

Zusinaite E, Krispin T, Raukas E, Kiiver K, Salupere R, Ott K, Ustina V, Zilmer K, Schmidt J, Sizemski L, Jaago K, Luman M, Ilmoja M, Prukk T, Uatav M (2000) Hepatitis C virus genotypes in Estonia. APMIS 108, 739-746.

327

Kazemi et al: Tehran hepatitis C virus genotypes

328