Gene Therapy & Molecular Biology Volume 11 Issue B by Niko Boulikas

GENE THERAPY & MOLECULAR BIOLOGY FROM BASIC MECHANISMS TO CLINICAL APPLICATIONS

Volume 11 Number 2 December 2007 Published by Gene Therapy Press

GENE THERAPY & MOLECULAR BIOLOGY Editorial Board Members OPEN ACCESS www.gtmb.org (ISSN: 1529-9120)

!!!!!!!!!!!!!!!!!!!!!!!! Editor

Teni Boulikas Ph. D., CEO Regulon Inc. 715 North Shoreline Blvd. Mountain View, California, 94043 USA Tel: 650-968-1129 Fax: 650-567-9082 E-mail: teni@regulon.org

Teni Boulikas Ph. D., CEO, Regulon AE. Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9853849 Fax: +30-210-9858453 E-mail: teni@regulon.org

!!!!!!!!!!!!!!!!!!!!!!!! Assistant Editor Maria Vougiouka B.Sc., Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9858454 Fax: +30-210-9858453 maria@cancer-therapy.org

Koutoudi Maria MA, Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9858454 Fax: +30-210-9858453 maria.koutoudi@cancer-therapy.org

Ellinas Timi B.Sc., Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9858454 Fax: +30-210-9858453 timi.ellinas@cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!! Associate Editors

Aguilar-Cordova, Estuardo, Ph.D., AdvantaGene, Inc., USA Berezney, Ronald, Ph.D., State University of New York at Buffalo, USA Crooke, Stanley, M.D., Ph.D., ISIS Pharmaceuticals, Inc, USA Crouzet, Joël, Ph.D. Neurotech S.A, France Gronemeyer, Hinrich, Ph.D. I.N.S.E.R.M., IGBMC, France Roberts, Michael, Ph.D., Regulon A.E., Athens Greece Rossi, John, Ph.D., Beckman Research Institute of the City of Hope, USA Shen, James, Ph.D., Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan, Republic of China & University of California at Davis, USA. Webb, David, Ph.D., Celgene Corporation, USA Wolff, Jon, Ph.D., University of Wisconsin, USA

!!!!!!!!!!!!!!!!!!!!!!!! Editorial Board Akporiaye, Emmanuel, Ph.D., Arizona Cancer Center, USA Anson, Donald S., Ph.D., Women's and Children's Hospital, Australia Ariga, Hiroyoshi, Ph.D., Hokkaido University, Japan Baldwin, H. Scott, M.D Vanderbilt University Medical Center, USA Barranger, John, MD, Ph.D., University of Pittsburgh, USA Black, Keith L. M.D., Maxine Dunitz Neurosurgical Institute, Cedars-Sinai Medical Center, USA Blum, Kenneth, Ph.D., Wake Forest University School of Medicine, USA Bode, Jürgen, Gesellschaft für Biotechnologische

Forschung m.b.H., Germany Bohn, Martha C., Ph.D., The Feinberg School of Medicine, Northwestern University, USA Bresnick, Emery, Ph.D., University of Wisconsin Medical School, USA Caiafa, Paola, Ph.D., Università di Roma “La Sapienza”, Italy Chao, Lee, Ph.D., Medical University of South Carolina, USA Cheng, Seng H. Ph.D., Genzyme Corporation, USA Clements, Barklie, Ph.D., University of Glasgow, USA Cole, David J. M.D., Medical University of South Carolina, USA Chishti, Athar H., Ph.D., University of Illinois

College of Medicine, USA Davie, James R, Ph.D., Manitoba Institute of Cell Biology, USA DePamphilis, Melvin L, Ph.D., National Institute of Child Health and Human, National Institutes of Health, USA Donoghue, Daniel J., Ph.D., Center for Molecular Genetics, University of California, San Diego, USA Eckstein, Jens W., Ph.D., Akikoa Pharmaceuticals Inc, USA Fisher, Paul A. Ph.D., State University of New York, USA Galanis, Evanthia, M.D., Mayo Clinic, USA Gardner, Thomas A, M.D., Indiana University Cancer Center, USA Georgiev, Georgii, Ph.D., Russian Academy of Sciences, USA Getzenberg, Robert, Ph.D., Institute Shadyside Medical Center, USA Ghosh, Sankar Ph.D., Yale University School of Medicine, USA Gojobori, Takashi, Ph.D., Center for Information Biology, National Institute of Genetics, Japan Harris David T., Ph.D., Cord Blood Bank, University of Arizona, USA Heldin, Paraskevi Ph.D., Uppsala Universitet, Sweden Hesdorffer, Charles S., M.D., Columbia University, USA Hoekstra, Merl F, Ph.D., Epoch Biosciences, Inc., USA Hung, Mien-Chie, Ph.D., The University of Texas, USA Johnston, Brian, Ph.D., Somagenics, Inc, USA Jolly, Douglas J, Ph.D., Advantagene, Inc.,USA Joshi, Sadhna, Ph.D., D.Sc., University of Toronto Canada Kaltschmidt, Christian, Ph.D., Universität Witten/Herdecke, Germany Kiyama, Ryoiti, Ph.D., National Institute of Bioscience and Human-Technology, Japan Krawetz, Stephen A., Ph.D., Wayne State University School of Medicine, USA Kruse, Carol A., Ph.D., La Jolla Institute for Molecular Medicine, USA Kuo, Tien, Ph.D., The University of Texas M. D. Anderson Cancer USA Kurachi Kotoku, Ph.D., University of Michigan Medical School, USA Kuroki, Masahide, M.D., Ph.D., Fukuoka University School of Medicine, Japan Lai, Mei T. Ph.D., Lilly Research Laboratories USA Latchman, David S., PhD, Dsc, MRCPath University of London, UK Lavin, Martin F, Ph.D., The Queensland Cancer Fund Research Unit, The Queensland Institute of Medical Research, Australia Lebkowski, Jane S., Ph.D., GERON Corporation, USA Li, Jian Jian, Ph.D., City of Hope National Medical Center, USA Li, Liangping Ph.D., Max-Delbrück-Center for Molecular Medicine, Germany

Lu, Yi, Ph.D., University of Tennessee Health Science Center, USA Lundstrom Kenneth, Ph.D. , Bioxtal/Regulon, Inc. Switzerland MacDougald, Ormond A, Ph.D., University of Michigan Medical School, USA Malone, Robert W., M.D., Aeras Global TB Vaccine Foundation, USA Mazarakis, Nicholas D. Ph.D., Imperial College London, UK Mirkin, Sergei, M. Ph.D., University of Illinois at Chicago, USA Moroianu, Junona, Ph.D., Boston College, USA Müller, Rolf, Ph.D., Institut für Molekularbiologie und Tumorforschung, Phillips-Universität Marburg, USA Noteborn, Mathieu, Ph.D., Leiden University, The Netherlands Papamatheakis, Joseph (Sifis), Ph.D., Institute of Molecular Biology and Biotechnology Foundation for Research and Technology Hellas, USA Platsoucas, Chris, D., Ph.D., Temple University School of Medicine, USA Rockson, Stanley G., M.D., Stanford University School of Medicine, USA Poeschla, Eric, M.D., Mayo Clinic, USA Pomerantz, Roger, J., M.D., Tibotec, Inc., USA Raizada, Mohan K., Ph.D., University of Florida, USA Razin, Sergey, Ph.D., Institute of Gene Biology Russian Academy of Sciences, USA Robbins, Paul, D, Ph.D., University of Pittsburgh, USA Rosenblatt, Joseph, D., M.D, University of Miami School of Medicine, USA Rosner, Marsha, R., Ph.D., Ben May Institute for Cancer Research, University of Chicago, USA Royer, Hans-Dieter, M.D., (CAESAR), Germany Rubin, Joseph, M.D., Mayo Medical School Mayo Clinic, USA Saenko Evgueni L., Ph.D., University of Maryland School of Medicine Center for Vascular and Inflammatory Diseases, USA Salmons, Brian, Ph.D., (FSG-Biotechnologie GmbH), Austria Santoro, M. Gabriella, Ph.D., University of Rome Tor Vergata, USA Sharrocks, Andrew, D., Ph.D., University of Manchester, USA Shi, Yang, Ph.D., Harvard Medical School, USA Smythe Roy W., M.D., Texas A&M University Health Sciences Center, USA Srivastava, Arun Ph.D., University of Florida College of Medicine, USA Steiner, Mitchell, M.D., University of Tennessee, USA Tainsky, Michael A., Ph.D., Karmanos Cancer Institute, Wayne State University, USA Sung, Young-Chul, Ph.D., Pohang University of Science & Technology, Korea Taira, Kazunari, Ph.D., The University of Tokyo, Japan

Terzic, Andre, M.D., Ph.D., Mayo Clinic College of Medicine, USA Thierry, Alain, Ph.D., National Cancer Institute, National Institutes of Health, France Trifonov, Edward, N. Ph.D., University of Haifa, Israel Van de Ven, Wim, Ph.D., University of Leuven, Belgium Van Dyke, Michael, W., Ph.D., The University of Texas M. D. Anderson Cancer Center, USA

White, Robert, J., University of Glasgow, UK White-Scharf, Mary, Ph.D., Biotransplant, Inc., USA Wiginton, Dan, A., Ph.D., Children's Hospital Research Foundation, CHRF , USA Yung, Alfred, M.D., University of Texas, USA Zannis-Hadjopoulos, Maria Ph.D., McGill Cancer Centre, Canada Zorbas, Haralabos, Ph.D., BioM AG Team, Germany

!!!!!!!!!!!!!!!!!!!!!!!! Associate Board Members

Aggarwal, Priya, Ph.D., University of Pennsylvania, USA Aoki, Kazunori, M.D., Ph.D., National Cancer Center Research Institute, Japan Cao, Xinmin, Ph.D., Institute of Molecular and Cell Biology, Singapore Falasca, Marco, M.D., University College London, UK Gao, Shou-Jiang, Ph.D., The University of Texas Health Science Center at San Antonio, USA Gibson, Spencer Bruce, Ph.D., University of Manitoba, For submission of manuscripts and inquiries: Editorial Office Teni Boulikas, Ph.D./ Maria Koutoudi MA. Gregoriou Afxentiou 7 Alimos, Athens 17455 innovatory Greece proprietary evolutionary Tel: +30-210-985-8454 Fax: +30-210-985-8453 Email: maria.koutoudi@cancer-therapy.org, teni.boulikas@cancer-therapy.org

USA Gra単a, Xavier, Ph.D., Temple University School of Medicine, USA Gu, Baohua, Ph.D., The Jefferson Center, USA Hiroki, Maruyama, M.D., Ph.D., Niigata University Graduate School of Medical and Dental Sciences, Japan Rigoutsos, Isidore, Ph.D., Thomas J. Watson Research Center, USA

Instructions to authors: Gene Therapy and Molecular Biology (GTMB) FREE ACCESS www.gtmb.org Scope Gene Therapy and Molecular Biology, bridging various fields is one of the most rapid with free access at gtmb.org. The scope of Gene Therapy and Molecular Biology is to promote interaction between researchers in the fields of Gene Therapy and Molecular Biology providing rapid publication of review articles and research papers. Articles (both invited and submitted) review or report novel findings of importance to a general audience in gene therapy, molecular medicine, gene discovery, and molecular biology with emphasis to molecular mechanisms. The journal will accept papers on all aspects of gene therapy, including gene delivery systems, gene therapy of cancer and other diseases (e.g. CFTR, hemophilia, AIDS, restenosis) at the clinical, preclinical or cell culture stage, gene discovery, cancer immunotherapy, DNA vaccines, use of DNA regulatory elements in gene transfer, cell therapy and transplantation, arraying technologies & DNA chips, peptide libraries and drug discovery related to gene therapy, cell targeting, gene targeting, therapy with oligonucleotides (antisense, ribozymes, triplex). The authors are encouraged to elaborate on the molecular mechanisms that govern a gene therapy approach. Gene Therapy and Molecular Biology will also publish articles on, transcription factors, DNA replication, recombination, repair, chromatin, nuclear matrix, DNA regulatory regions, locus control regions, protein phosphorylation, signal transduction, development, and on molecular mechanism of human disease. To make the publication attractive authors are encouraged to include color figures.

Type of articles Both review articles and original research articles will be considered. In addition, short 1-2 page news & views will also be considered for publication. Original research articles should contain a generous introduction in addition to experimental data. The articles contain information important to a general audience as the volume is also addressed to researches outside the field. There is no limit on the length of the articles provided that the subject is interesting to a general audience and covers exhaustively a field. The typical length of each manuscript is a approximately 4-20 printed page including Figures and Tables. This is 12-60 manuscript pages. Charges & Complimentary reprints There are no charges for color figures or page numbers. Corresponding authors receive a hardcopy issue of the volume in which their article is published plus 25 reprints free of charge. In addition, electronic copies of final and formatted drafts are given. Authors also have the full freedom to communicate or utilize their article in professional circumstances. This may be done only with the acknowledgment of the original publication. Sections of the manuscript Each manuscript should have a Title, Authors, Affiliation, Corresponding Author (with Tel, Fax, and E-mail), Summary, key words, running title and Introduction; review articles are subdivided into

headings I, II, III, etc. (starting with I. Introduction) subdivided into A, B, C, and further subdivided using 1, 2, 3, etc. You can further subdivide into 1, 2, 3, etc. Research articles are divided into Summary; I. Introduction; II. Materials and Methods III. Results; IV. Discussion; Acknowledgments; and References. Please include in your text citations the name of authors and year in parenthesis; for three or more authors use: (name of first author et al, with year); for two authors please use both names. Please delete hidden text for references. In the reference list, please, type references with year and Journal in boldface and provide full title of the article such as: Buschle M, Schmidt W, Berger M, Schaffner G, Kurzbauer R, Killisch I, Tiedemann J-K, Trska B, Kirlappos H, Mechtler K, Schilcher F, Gabler C, and Birnstiel ML (1998) Chemically defined, cellfree cancer vaccines: use of tumor antigen-derived peptides or polyepitope proteins for vaccination. Gene Ther Mol Biol 1, 309-321. To avoid delays it is essential to submit an electronic and a hard copy version of your manuscript via e-mail and mail in a floppy, CD-ROM or ZIP, containing the manuscript that will be used to typeset the paper. Please include in the digital media: Tables, if any, (preferably as a Microsoft Word text) and Figure legends. Please use Microsoft Word, font “Times” (Mac users) or “Times New Roman” (PC users) and insert Greek or other characters using the “Insert/Symbol” function in the Microsoft Word rather than simple conversion to font “Symbol”. Please boldface Figure 1, 2, 3 etc. as well as Table 1, 2, etc. throughout the text. Please provide the highest quality of prints of your Figures; whenever possible, please provide in addition an electronic version of your figures. Article contributors are kindly requested to provide a color (or black/white) photo of themselves (preferably 4x5 cm or any size) or a group photo of the authors, as we shall include these in the publication Submission and reviewing Peer reviewing is by members of the Editorial Board and external referees. Please suggest 2-3 reviewers providing their electronic addresses, mailing addresses and telephone/fax numbers. Authors are sent page proofs. Gene Therapy and Molecular Biology is published in on high quality paper, hardbound, and with excellent reproduction of color figures. Reviewing is completed within 5-15 days from receiving the manuscript. Articles accepted without revisions (i.e., review articles) will be published online (www.gtmb.org) in approximately 1 month following submission. Please submit an electronic version of full text and figures preferably in jpeg format. The electronic version of the figures will be used for the rapid reviewing process. High quality prints or photograph of the figures and the original with one copy should be sent via express mail to the Editorial Office. Citation in MedLine Articles accepted for publication by GTMB or Cancer Therapy can be included in MedLine (PubMed) as full articles upon the request of authors provided that the authors have completed their published work under a government grant by NIH (or EU/Japan government grant). If this is you case, please consult the NIH Manuscript Submission System http://www.nihms.nih.gov/.

Editorial Office Teni Boulikas, Ph.D., teni@regulon.org Michael Roberts, Ph.D., michael.roberts@cancer-therapy.org Stella Doukelli, M.D., teni.boulikas@cancer-therapy.org Maria Koutoudi, MA., maria.koutoudi@cancer-therapy.org Maria Vougiouka, B.Sc., maria@cancer-therapy.org Jenny Katsoupi, M.Phil., jenny7@cancer-therapy.org Timi Ellinas, B.Sc., timi.ellinas@cancer-therapy.org, teni.boulikas@regulon.org Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 The free electronic access to articles published in "GTMB" to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in cancer, the anticipated high quality in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board being assembled are prognostic factors of a big success for the newly established journal.

Gene Therapy and Molecular Biology Vol 11, page 103 Gene Ther Mol Biol Vol 11, 103-112, 2007

IAP as a new diagnostic and effective therapeutic target molecule for prostate cancer Review Article

Takeo Nomura*, Fuminori Satoh, Mutsushi Yamasaki, Hiromitsu Mimata Department of Oncological Science (Urology), Oita University Faculty of Medicine, Japan

__________________________________________________________________________________ *Correspondence: Takeo Nomura, Department of Oncological Science (Urology), Oita University Faculty of Medicine, 1-1 Idaigaoka, Hasama-machi, Yufu, Oita 879-5593, Japan; Phone: 81975865893; Fax: 81975865899; e-mail: TAKE@med.oita-u.ac.jp Key words: Prostate cancer, Inhibitor of apoptosis protein Abbreviations: androgen-independent prostate cancer, (AIPC); androgen receptor, (AR); B-cell lymphoma-2, (Bcl-2); Bcell lymphoma-x long, (Bcl-xL); baculoviral IAP repeat, (BIR); caspase activation and recruitment domain, (CARD); cellular IAP, (cIAP); dihydrotestosterone, (DHT); epidermal growth factor, (EGF); human IAP, (hIAP); heat shock protein, (Hsp); high temperature requirement A2, (HtrA2); inhibitor of apoptosis protein, (IAP); immunohistochemistry, (IHC); insulin-like growth factor, (IGF); IGF binding protein, (IGFBP); c-jun N-terminal kinase, (JNK); keratinocyte growth factor, (KGF); mitogen-activated protein kinase, (MAPK); neuronal apoptosis inhibitory protein, (NAIP); nuclear factor kappa B, (NF-!B); phosphatidylinositol 3-kinase, (PI3K); prostate-specific antigen, (PSA); really interesting new gene, (RING); second mitochondrial derived activation of caspase/direct IAP binding protein with low pI, (Smac/DIABLO); sex hormone-binding globulin, (SHBG); small-interesting RNA, (siRNA), TGF !activated kinase, (TAK); transforming growth factor !, (TGF !); tumor necrosis factor, (TNF); TNF receptor-associated factor, (TRAF); TNF-related apoptosis-inducing ligand, (TRAIL); XIAP-associated factor 1, (XAF1); X-chromosome-linked IAP, (XIAP) Received: 30 January 2007; Accepted: 26 February 2007; electronically published: June 2007

Summary Prostate cancer is the second most common cause of cancer-related death among men in the United States. The conversion from androgen-dependent to androgen-independent state constitutes an important event in prostate cancer progression and is the main obstacle to improving the survival and quality of life in patients with advanced prostate cancer. Considerable progress has been made in the understanding of the molecular basis of prostate cancer. Prostate cancer progression and the development of the androgen-independent characteristics have been largely related to genetic abnormalities that not only androgen receptor (AR) but also crucial molecules involved in the regulation of survival or apoptotic pathways. One of these molecules including p53 and the B-cell lymphoma-2 (Bcl-2) family, the antiapoptotic protein, the inhibitor of apoptosis proteins (IAPs) have been associated with the promotion of tumorigenesis and drug sensitivity in prostate cancer due to their overexpression in prostate cancer cells treated with androgen ablation or chemotherapeutic agents. Therefore, IAPs may be of great value in clinical and prognostic markers in patients with prostate cancer and therapies that target IAPs may have the potential to improve outcomes for patients. In this review, we focus on the experimental evidence that associates IAPs expression with prostate carcinogenesis and cancer progression, and summarize the roles of IAPs in chemotherapy to develop a new target for the diagnosis and treatment of prostate cancer.

and mortality rates in the world, however, prostate cancer incidence and mortality in Japan have increased gradually as the country has become Westernized since 1990s (Landis et al, 1998). Since the early 1990s around the time a new screening prostate-specific antigen (PSA) test has been introduced and in widespread use among the world, prostate cancer incidence raised dramatically with a true increase in the number of patients with clinical prostate cancer rather than a simple result of increased detection (Brasso and Iverson, 1999; Hankey et al, 1999). In general, prostate cancer is a relatively slow growing and indolent malignancy with doubling times for local tumors

I. Introduction Prostate cancer is the most frequently diagnosed disease and the second leading cause of cancer-related death in men in the United States (Greenlee et al, 2001). An estimated 240,000 newly diagnosed cases are expected to occur and close to 30,000 patients die from this disease in the United States in 2006. Worldwide, prostate cancer is the fourth most common male cancer with incidence and mortality rates that vary tremendously among countries or ethnic groups. Incidence and mortality rates are higher in Western countries than in Asian countries. Among Asian countries, Japan has the lowest prostate cancer incidence 103

Nomura et al: IAP as a new diagnostic and effective therapeutic target molecule for prostate cancer estimated at 2 to 4 years. Although localized prostate cancer can be controlled successfully with surgery or radiation therapy, 15% of patients relapse after apparently successful treatment, eventually progress and metastasize (Hull et al, 2002). Prostate cancer is characterized by an initial stage during which the tumor growth is dependent on androgen receptor (AR) signaling triggered by dihydrotestosterone (DHT). Therefore, in addition to surgical resection (prostatectomy) and radiation therapy in localized prostate cancer, the main effective treatment for local recurrence after surgery or after radiation therapy or advanced prostate cancer with distant metastasis is androgen deprivation procedures surgically with orchiectomy or medically with estrogens or luteinizing hormone-releasing hormone analogues and by blocking the effects of residual androgen with competitive AR antagonists like flutamide, bicalutamide, and nilutamide. Since 1940s, hormone therapy has been the mainstay of treatment for advanced prostate cancer. The androgen withdrawal could produce a response rate of 70-80% with a median progression-free survival of 12-33 months and a median overall survival of 23-37 months (Hurtado-Coll et al, 2002). Androgen ablation induces rapid and dramatic responses with symptomatic relief by inducing apoptosis, but the effect is usually palliative and temporary. Despite the initial response to anti-androgen therapy, the disease recurs in androgen-independent state that is unresponsive to the existing treatments including additional androgen withdrawal and chemotherapy, as well as a combination of these therapies, within 12-18 months (Petrylak, 1999). The management of androgen-independent prostate cancer (AIPC) by current chemotherapeutic regimens can temporarily eliminate androgen-independent cells by inducing apoptosis, however, these chemotherapeutic agents are generally less effective. Overall median survival from first metastasis is typically 3 years from the time of diagnosis and is 2 years from androgen independence. Thus, AIPC constitutes potentially a serious life threat that accounts for the gross part of prostate cancer mortality. Therefore, to develop rationale alternative therapies and preventive treatments for AIPC, much attention has been directed to understanding the molecular basis for the progression to androgen independence in this process. Although the specific causes of prostate cancer initiation and progression are unknown, it seems valid that both genetics and environment play an important role in the evolution of this disease. Two main potential mechanisms have been identified during the process of the development of AIPC. The first mechanism is hypersensitivity of AR signaling during the development of AIPC. This hypersensitive signaling may be caused by a variety of AR gene mutations (Taplin et al, 1995; Marcelli et al, 2000) or increased AR copy number (Koivisto et al, 1997) that result in a functionally altered expression of the AR. The second mechanism is based on the induction of a positive survival signaling independent of AR signaling pathway that can overcome the apoptosis induced by androgen ablation (Ruiter et al, 1999; Feldman and Feldman, 2001). It has been reported that insufficient apoptosis represents the explanation for the accumulation

of prostate cancer cells (Carson and Ribeiro, 1993; Kerr et al, 1994). That is to say, progression of androgendependent tumor to hormone-refractory disease is related to genetic abnormalities that influence not only the AR but also crucial molecules involved in apoptosis. This aggressive stage of cancer is characterized by the appearance of apoptosis-resistant cells. As previously mentioned, apoptosis is induced in prostate cancer responding to androgen ablation, radiation therapy, and chemotherapy. Molecularly, apoptosis is executed by the activation of caspases, a family of intracellular cysteine proteases that cleave substrates at aspartic acid residues (Cryns and Yuan, 1998; Stennicke and Salvesen, 1998). Unfortunately, cancer fails to respond to treatment in varying degrees. In part, the failure of cell death is caused by failure of the apoptosis and caspase activation pathways. The inhibitor of apoptosis proteins (IAPs) are a family of antiapoptotic mediator that blocks cell death by inhibiting the downstream of the caspase activation pathway (Roy et al, 1997; Deveraux et al, 1999; Deveraux and Reed, 1999; Wright and Duckett, 2005). IAPs have been found to be involved in the molecular biology of a wide range of human cancers since their discovery as direct endogenous caspase inhibitors in baculovirus. It has been reported that there is a positive correlation between IAP expression and tumor progression in prostate cancer (Krajewska et al, 2003; Kishi et al, 2004). IAPs may play an important role in cancer progression, acquisition of androgen independency, and drug-sensitivity in prostate cancer. Understanding the machinery of IAPs function can potentially allow for the development of novel therapeutic strategies targeting caspases and IAPs for prostate cancer. Reviews of the actions of IAPs and their mechanism have already been well published. In this review, we will focus on the experimental evidence of the roles of caspases and their negative regulators, IAPs in prostate cancer, and discuss how this evidence is being translated into the clinical field as the development of new diagnostic and prognostic markers and therapeutic target.

II. Prostate cancer and androgenandrogen receptor (AR) signaling Because prostate cancer develops in aged men with low levels of androgen, a large number of studies have reported whether elevated levels of androgen are associated with an increased risk of prostate cancer. To date, the degree to which androgen or androgen metabolites such as DHT, contribute to risk of prostate cancer remains under discussion. Guess and colleagues reported in 1997 that there is no relationship between testosterone, sex hormone-binding globulin (SHBG), or 5"-reductatse activity and risk of prostate cancer (Guess et al, 1997). In contrast, Gann et al observed increased testosterone levels, low levels of SHBG, and high levels of 5"-reductatse activity as risk factors of prostate cancer (Gann et al, 1996). Although even well-designed clinical studies have presented conflicting views concerning the association of androgen with an increased risk of prostate cancer, it seems valid that prostate cancer initiation and

104

Gene Therapy and Molecular Biology Vol 11, page 105 progression are strongly influenced by androgens in view of prostate cancer regression after surgical or medical castration. Androgen is a necessary growth factor for early-stage prostate cancer cells. The circulating androgen on male is composed of testosterone derived from testis and adrenal glands. Once inside prostate cells, 5"reductatse converts androgen to DHT that is metabolically more active. The action of androgen is mediated by a specific receptor protein, AR, which is located on the human X-chromosome of epithelial and adjacent stromal prostate cells. DHT acts as the main ligand of AR and it is much more active than testosterone, having higher affinity for the AR. The AR, a transcription factor belonging to a classical nuclear receptor superfamily, consists of a ligand-binding domain, an amino terminal activating domain, and DNA-binding domain (Gao et al, 2005). After activation of AR by phosphorylation, this activation promotes nuclear localization and binding of the steroidAR complex to specific DNA target sequences located on androgen response elements of the androgen dependent genes such as PSA, leading to the initiation of transcription (Berger and Watson, 1989). Without AR binding, steroid hormones cannot exert their effects on prostate cancer growth. In addition to androgens, AR also plays a crucial role in several stages of the progression of prostate cancer (Avila et al, 2001; Montgomery et al, 2001). The increased copy number of AR gene contributes to androgenindependent tumor progression (Koivisto et al, 1997). Likewise, mutations in the AR gene are identified in AIPC (Marcelli et al, 2000). These mutations in the AR gene have been found to make the AR responsive to different non-androgenic ligands, and may also contribute to the development of androgen independency. For this reason, urologists experience that AR antagonist, such as bicalutamide and flutamide, works like AR agonist suggesting that AR is stimulated by AR antagonist. Strong evidence supports the relationship between prostate cancer progression and various peptide growth factors such as insulin-like growth factor (IGF), epidermal growth factor (EGF), and keratinocyte growth factor (KGF) (Culig et al, 1994). These growth factors released primarily by stromal cells can activate AR-related transcription on upstream of AR signaling. The cross talk between Her2/neu oncogene and AR signaling also results in the phosphorylation of AR, suggesting a mechanism whereby the pathways triggered by tyrosine kinase receptors could play a role in prostate cancer progression (Craft et al, 1999). In addition, Her2/neu also activates phosphatidylinositol 3-kinase (PI3K)/Akt survival pathway (Lin et al, 2001, Yakes et al, 2002). Although androgen is responsible for proliferative effects on prostate cancer and AR signaling, various complicated cellular regulation mechanisms that affect AR signaling are linked with the development of AIPC.

proliferation of prostate cancer cells comes to a halt and cells fall into apoptotic cell death (Isaacs et al, 1992). The irreversible genomic DNA fragmentation takes place following activation of Ca2+/Mg2+ dependent endonuclease activity in the nucleus of apoptotic cells. However, for reasons that are only partly defined, the apoptotic process induced by androgen ablation fails to eliminate the entire cancer cells, because the threshold of apoptosis progressively drops to a point at which cell proliferation exceeds apoptosis as cancer progresses (Berges et al, 1995). This increase of proliferating cells is caused by the accumulation of androgen-independent cells that eventually relapse and metastasize. As previously mentioned, progression to androgen independence is multifactorial process by which cancer cells acquire the ability to both survive in the absence of androgens and proliferate with the use of androgen non-related stimuli for mitogenesis. In addition to the hypersensitivity of AR, inappropriate activation of AR, and alterations in the regulators of the cell survival pathway, this stage of cancer is also characterized by the emergence of apoptosisresistant cells resulting from various genetic mutations and upregulation of antiapoptotic genes. In general, clusterin, AR, B-cell lymphoma-2 (Bcl-2), B-cell lymphoma-x long (Bcl-xL), heat shock protein 27 (Hsp27), IGF binding protein-2 (IGFBP-2), and IGFBP-5 are upregulated by androgen ablation and remain overexpressed in AIPC (Gleave et al, 2005). We previously reported the overexpression of cellular IAP-1 (cIAP-1) and cIAP-2 in prostate cancer tissue specimens treated with androgen ablation (Mimata et al, 2000), besides, it has been reported that AIPC cell lines PC3 and DU145 cells are highly resistant to drug-induced apoptosis due to the overexpression of cIAP-1, cIAP-2, X-chromosome-linked IAP (XIAP), and neuronal apoptosis inhibitory protein (NAIP) (McEleny et al, 2002). The aspect of AIPC cell biology of these antiapoptotic genes is developing rapidly, and IAPs may prove to be the importance of antiapoptotic action in prostate cancer progression.

IV. IAP: Cell survival gene The IAPs have been identified as one of the most potent inhibitors of endogenous caspases and apoptosis. Unlike Bcl-2 protein, which blocks the mitochondrial pathway of apoptosis, the antiapoptotic function of IAPs is due to its ability to inhibit both intrinsic mitochondriamediated and extrinsic death receptor-mediated pathways by directly binding to and inhibiting both initiator and effector caspases (Deveraux et al, 1997, 1998; Roy et al, 1997; Devi, 2004). To date, at least eight IAP-encoding genes have been recognized and reported in the human genome, including XIAP, human IAP-1 (hIAP-1, cIAP-2), hIAP-2 (cIAP-1), survivin, NAIP, apollon (BRUCE), livin (ML-IAP, KIAP), and IAP-like protein-2 (ILP-2), which are evolutionarily conserved with apparent homologies identified in flies, worms, yeast and several mammalian species including mice, rats, chickens, pigs, and humans (Roy et al, 1997; Deveraux et al, 1998; Tamm et al, 1998; Chen et al, 1999; Kasof and Gomes, 2001; Richter et al, 2001). All the IAPs show varying degrees of antiapoptotic effect, depending on the different mechanisms of action

III. Regulation of apoptosis of prostate cancer cells Even the patients with advanced prostate cancer potentially respond to androgen ablation, and serum PSA levels decrease in almost all patients. After treatment, 105

Nomura et al: IAP as a new diagnostic and effective therapeutic target molecule for prostate cancer for each IAP homology. The IAPs are characterized and grouped together based on the presence of a highly conserved domain of ~70 amino acid motif termed the baculoviral IAP repeat (BIR) domain (Verhagen et al, 2001). In addition to BIR domains, IAPs possess caspase activation and recruitment domain (CARD) and really interesting new gene (RING)-zinc binding domains (Deveraux and Reed, 1999; Yang et al, 2000). IAPs can bind to and potently inhibit activated caspase-3, -7, and -9 through some of BIR domains, suggesting that the majority of IAPs activities are dependent on BIR domains (Deveraux and Reed, 1999). Both hIAP-1 and hIAP-2 inhibit caspase-3, -7, and -9, but they are less potent than XIAP (Zhivotovsky and Orrenius, 2003). A RING domain has ubiquitin protease activity; it can bind to ubiquitinconjugating enzymes that promote autoubiquitination and degradation of IAP-caspase complexes after apoptosis stimulus, suggesting that RING domain-dependent proteasomic caspase degradation may be another mechanism of the IAPsâ&#x20AC;&#x2122; antiapoptotic activity (Yang et al, 2000). The requirement of RING domain for inhibition of apoptotic pathway seems to be dependent on the type of cells. The function of the CARD domain in hIAP-1 and hIAP-2 remains unknown. IAPs can protect cells from various triggers of intrinsic and extrinsic pathways. All the IAPs except NAIP can bind to and inhibit caspase-3 and -7 (Roy et al, 1997; Deveraux et al, 1998). XIAP, hIAP-1, hIAP-2, and survivin were also shown to bind to and inhibit caspase-9, but not caspase-1, -6, -8, or -10 (Roy et al, 1997). Although IAPs cannot bind to or inhibit caspase8, they bind to and inhibit its substrate caspase-3, thus providing protection from death receptor-mediated apoptosis, because both death receptor-mediated and mitochondria-mediated pathways converge finally at the level of activation of caspase-3 (Roy et al, 1997; Deveraux et al, 1998). In contrast, XIAP, hIAP-1, and hIAP-2 bind to directly pro-caspase-9, and prevent its processing and activation induced by cytochrome c released from mitochondria, thus they can prevent the proteolytic processing of pro-caspase-3, -6, and -9 (Deveraux et al, 1998). It has been reported that XIAP mainly binds to active caspase-3, but also partially to the unprocessed procaspase-3 (Deveraux et al, 1997). We transiently cotransfected with XIAP and pro-caspase-3 cDNAs into LNCaP cells, and observed the strong interaction between XIAP and pro-caspase-3 by immunoprecipitation and immunoblot analysis (Nomura et al, 2003). XIAP may block a common downstream by directly inhibiting proand active caspase-9, and by interfering with caspase-3 activity and/or processing of pro-caspase-3. Interestingly, the activity of IAPs are controlled at various levels by the transcriptional factor, nuclear factor kappa B (NF-!B) and mitogen-activated protein kinase (MAPK) signaling pathway. The hIAP-1 and hIAP-2 also bind to tumor necrosis factor receptor-associated factor (TRAF) heterocomplexes through their N-terminal BIR domain, interfering with the upstream activation of caspase-8 (Rothe et al, 1995; Wang et al, 1998). TRAF-1, TRAF-2, XIAP, hIAP-1, and hIAP-2 are identified as gene targets of NF-!B transcription activity (Stehlik et al, 1998; Wang et al, 1998). The activation of NF-!B and the induction of

IAPs are an essential part in the process that protects cells from apoptotic signals caused by tumor necrosis factor-" (TNF- "). In addition, XIAP, NAIP, and ML-IAP bind to transforming growth factor ! (TGF !)-activated kinase (TAK-1) and activate TAK-1/c-Jun N-terminal kinase (JNK) signaling cascade, with resulting inhibition of apoptosis (Sanna et al, 2002). TAK-1 dependent JNK activation also plays an important role in antiapoptotic efficacy of IAPs. In addition to regulation of apoptosis, IAP members such as survivin have been found to be a potent regulator of cell cycle progression and mitosis (Reed and Bischoff, 2000). Survivin was found in cytosolic fraction but it is also associated with chromatin expressed in G2/M phase and downregulated after cell cycle arrest, suggesting that survivin plays a role in monitoring chromosome replication and the inhibition of caspase activity in the nucleus (Ambrosini et al, 1997; Li et al, 1998). The evidence that survivin regulates apoptosis through a cyclin-dependent kinase inhibitor p21WAF1/Cip1 pathway is well documented (Beltrami et al, 2004; Fukuda et al, 2004). Interestingly, it has been also reported that survivin may contribute to tumor angiogenesis via angiopoietin-1 stabilization (Papapetropoulos et al, 2000). Survivin may regulate cell death by not only an antiapoptotic mechanism but also a caspase cascadeindependent mechanism. Taken together, IAPs are classically regarded as caspase inhibitors, but the possibility exist that IAPs have multiple mechanisms of cancer growth and protection from cell death beyond the role as the direct inhibitors of caspases.

V. Endogenous IAP inhibitors Currently, the following three endogenous regulatory proteins are known as blockers of IAPs; second mitochondrial derived activation of caspase/direct IAP binding protein with low pI (Smac/DIABLO), high temperature requirement A (HtrA2/Omi), and XIAPassociated factor 1 (XAF1). Smac/DIABLO and HtrA2/Omi are mitochondrial proteins first identified in Drosophila and subsequently recognized in humans (Srinivasula et al, 2002). Smac/DIABLO is released into the cytosol together with cytochrome c during mitochondrial disruption. Cleaved active form of Smac/DIABLO can inhibit IAPs through binding to some BIR domains of IAPs, resulting in degradation of IAPs protein by ubiquitin/proteasome pathway (Ekert et al, 2001). HtrA2/Omi, which belongs to the shock response serine protease-chaperone HtrA family, is released along with Smac/DIABLO from mitochondria (Gray et al, 2000; Hegde et al, 2002). XAF1 is known as the other endogenous antagonist of XIAP, which has the ability to directly interact with XIAP and exclusively blocks its antiapoptotic activity (Byun et al, 2003). Unlike Smac/DIABLO and HtrA2/Omi, XAF1 is located in the nucleus and affect a redistribution of XIAP from cytosol to the nucleus, resulting in inactivation of XIAP (Liston et al, 2001). Interestingly, XAF1 is mainly expressed in normal tissues but is low or missing in most cancer cells, which implies a tumor-suppressing function in the tumorigenic process. Taken together, these endogenous IAP inhibitors may play an important role as a potent tumor suppressor, 106

Gene Therapy and Molecular Biology Vol 11, page 107 therefore, molecules that mimic the actions of IAPs inhibitors could be therapeutically useful.

hIAP-1, hIAP-2, and XIAP (Tamm et al, 2000), suggesting that these proteins are post-transcriptionally regulated. We previously showed that the expression of cIAP-1 and cIAP-2 was upregulated in patients treated with androgen ablation by IHC, suggesting that the advent of residual cancer cells after androgen ablation was due to the induction of these IAPs (Mimata et al, 2000). Upregulation of IAPs may develop androgen independency. Zhang et al indicated that androgen stimulation with DHT increased survivin expression and antiandrogen therapy with flutamide decreased its expression in LNCaP cells, suggesting that survivin played a potentially important role in androgen sensitivity and resistance to androgen ablation (Zhang et al, 2005). These results, therefore, indicated that prostate cancer cells induce IAPs expression during the progression under an androgen environment. In contrast, another study indicated that IAP expression in LNCaP cells was unaffected by charcoal-stripped medium (McEleny et al, 2002). They also confirmed that androgen-supplemented medium did not influence IAP expression in LNCaP cells (McEleny et al, 2002). These results suggest that IAP expression is unrelated to an androgen environment, then androgen ablation does not affect IAP expression and the acquisition of androgen independence is not due to the expression of IAP in prostate cancer. To show whether upregulation of IAPs expression results in androgen independence or not, the fact that IAPs belong to target genes of AR signaling needs to be explained. Taken together, IAPs, particularly survivin, are thought to be important biomarkers for diagnosis, staging, and prognosis of prostate cancer, and may be useful as therapeutic response inducer for prostate cancer patients, but a relationship between IAP and androgen response remains to be elucidated.

VI. IAP expression in prostate cancer The upregulation of IAPs expression has been considered one of mechanisms for escape from elimination by apoptosis. Therefore, to investigate the IAPs expression in prostate cancer is essential for the development of novel therapeutic strategies targeting IAPs for prostate cancer. Overexpression of IAPs was observed in all the most common cancers by analysis of its transcript and protein. Evidence is accumulating that the levels of IAPs expression are related to progression and poor prognosis, including breast cancer (Tanaka et al, 2000), esophageal cancer (Kato et al, 2001), gastric cancer (Lu et al, 1998), colorectal cancer (Kawasaki et al, 1998), neuroblastma (Adida et al, 1998), non-small cell lung cancer (Monzo et al, 1999), urinary bladder cancer (Swana et al, 1999), epithelial ovarian cancer (Sui et al, 2002), liver cancer (Ito et al, 2000), uterine cancer (Saitoh et al, 1999), skin cancer (Grossman et al, 1999), and leukemia (Nakagawa et al, 2005), etc. These results suggest that IAPs may contribute to tumor progression and that detection of IAPs provides a specific and sensitive diagnostic marker. However, there have been few reports on the expression of IAPs in prostate cancer. Kishi and colleagues reported in 2004 that survivin mRNA expression was positively correlated with the progression (T-stage, lymph node metastasis, vessel invasion, surgical margin, and Gleason score) and aggressiveness (proliferative activity) in prostate cancer tissue specimens obtained from prostatectomy (Kishi et al, 2004). Shariat et al showed that survivin expression was associated with higher Gleason score and positive lymph node metastasis (Shariat et al, 2004). In contrast, Krajewska and colleagues reported in 2003 that expression levels of survivin, hIAP-1, hIAP-2, and XIAP by immunohistochemistry (IHC) on the microarrays elevated in prostate cancer, but the levels of these IAPs expression did not correlate with Gleason score and PSA levels (Krajewska et al, 2003). As previous reports on IAPs expression of many kinds of cancer have described, IAPs expression is thought to be a common event in prostate cancer. The role of IAPs in the development of androgen independency has been controversial. IAPs overexpression in commonly used prostate cancer cell lines, including androgen-dependent LNCaP cells, androgen-independent DU145 and PC3 cells was observed (Tamm et al, 2000; McEleny et al, 2002). McEleny et al confirmed the expression of NAIP, hIAP-1, hIAP-2, XIAP, and survivin in LNCaP, DU145, and PC3 cells at the level of the mRNA and the protein. They also showed an increased expression of hIAP-1, hIAP-2, and XIAP in DU145 and PC3 cells compared with LNCaP cells, and this expression is correlated with resistance to apoptosis (McEleny et al, 2002). Another study identified the expression of hIAP-2 and XIAP in DU145 and PC3 cells, but identified hIAP-1 expression only in DU145 cells, and did not identify the expression of NAIP in these cell lines (Tamm et al, 2000). Interestingly, there are poor relationships between mRNA and protein expression for survivin (McEleny et al, 2002),

VII. Rationale for IAPs as therapeutic targets There appear to be more studies in the recent literature focusing on survivin and XIAP as potential therapeutic targets. The reason for this is that among IAPs, XIAP is the most potent inhibitor of caspases and apoptosis (Roy et al, 1997), and that survivin plays an important role in mitosis and angiogenesis as well as an inhibitor of caspases (Papapetropoulos et al, 2000; Reed and Bischoff, 2000; Adams et al, 2001). In addition, the most important feature of these two molecules is that there are upregulated in various cancers and high levels of survivin and/or XIAP are associated with poor prognosis. The antiapoptotic effects of survivin and XIAP on response to irradiation and chemotherapeutic agents have been extensively documented. Radiation triggers the mitochondria-mediated pathway, resulting in apoptotic cell death in cancer (Zhivotovsky et al, 1999). It is reported that a low dose of "-irradiation in non-small cell lung cancer resulted in upregulation of XIAP, and cancer cells acquired the resistance to "-irradiation (Holcik et al, 2000). Another study showed that an inverse relationship between survivin expression and radiosensitivity in pancreatic cancer (Asanuma et al, 2000). Although radiation therapy is an 107

Nomura et al: IAP as a new diagnostic and effective therapeutic target molecule for prostate cancer effective treatment for localized prostate cancer, the development of radioresistance may occur in some cases with advanced prostate cancer. Since there are no reports on the expression of IAPs in prostate cancer patients after radiation therapy, studies explaining the elusive mechanisms following radiation are expected to constitute a rational approach for molecular targeting treatment. There have been no satisfactory chemotherapeutic strategies for the treatment of both hormone-sensitive and hormone-resistant prostate cancer. Recently, docetaxel (taxotere) or paclitaxel (taxol) based combination chemotherapy demonstrated significant antitumor activity and improvement in overall survival in advanced prostate cancer (Trivedi et al, 2000; Tannock et al, 2004). Although the relationship between IAPs expression and chemosensitivity is still unknown in prostate cancer, several experimental studies showed inhibition of apoptosis by IAPs in response to chemotherapeutic agents in various cancers (Tamm et al, 2000; Li et al, 2001; Nomura et al, 2003, 2004; Chandele et al, 2004). Overexpression of IAPs such as XIAP and survivin confers resistance to chemotherapy and stimuli that trigger the intrinsic and extrinsic pathways of caspase cascade. We previously showed that overexpression of XIAP by stable transfection in LNCaP cells inhibited taxol- and cisplatin-induced apoptosis (Nomura et al, 2003, 2004). Another study reported that XIAP suppressed apoptosis following treatment with some genotoxic agents or after irradiation in myeloid leukemia cells (Datta et al, 2000). In addition to experimental studies, the relationship between increased IAPs expression and chemosensitivity was clinically reported in several cancers (Kato et al, 2001; Schlette et al, 2004). Survivin expression is a useful as a prognostic and therapeutic response indicator for esophageal cancer (Kato et al, 2001) and lymphoma patients (Schlette et al, 2004). These results also suggest that IAPs have the potential as a novel determinant of chemosensitivity and therapeutic target. Cisplatin, a most effective and widely used chemotherapeutic agent, is reported as a negative regulator of XIAP in several cancers including ovarian cancer (Sasaki et al, 2000; Li et al, 2001), oral cancer (Matsumiya et al, 2001), hepatic cancer (Notarbartolo et al, 2005), and glioblastoma (Roa et al, 2003). We reported that cisplatin induced apoptosis by the inhibition of XIAP expression and cisplatin sensitivity was dependent on the levels of XIAP protein expression in LNCaP cells (Nomura et al, 2004). We also reported that cisplatin-resistant LNCaP cells overexpressed hIAP-2, XIAP, and survivin, resulting in cross-resistance to several chemotherapeutic agents (Nomura et al, 2005). The most common reason for acquisition of resistance to a broad range of anticancer agents is expression of energy-dependent transporters that eject anticancer agents from cancer cells, but other mechanisms of resistance including insensitivity to druginduced apoptosis by overexpression of IAPs probably play an important role in acquisition of chemo-resistance. Although the current regimens of chemotherapy for prostate cancer have no satisfactory advantage, therapeutic strategies interfering with XIAP expression by cisplatin

may confer a novel insight to develop a XIAP-targeted therapy.

VIII. Future direction Although the research works have revealed a molecular biology of IAPs, yet it is far from being satisfactory. Currently, two approaches to the management of IAPs activity are being investigated; antisense oligonucleotides and small molecule inhibitors. Antisense oligonucleotides against XIAP and survivin are in clinical phase I trials, but small molecule inhibitors are now under way in the laboratory. The antisense molecule in clinical trial is a mixture of DNA and RNA oligonucleotides. Antisense oligonucletide can inhibit the protein expression by promoting the degradation of mRNA, therefore, this approach is more effective than by directly inhibiting translation from mRNA to protein. It has been reported that downregulation of XIAP expression by XIAP antisense induced apoptosis and enhanced sensitivity to cisplatin and tumor necrosis factor-related apoptosisinducing ligand (TRAIL) in DU145 cells (Amantana et al, 2004). Another study showed that an antisense to cIAP-1 sensitized PC3 cells to Fas antibody and TNF-mediated apoptosis (McEleny et al, 2004). Adenoviral vector of survivin antisense fragment induced apoptosis in DU145 cells and sensitized cancer cells to chemotherapeutic agents docetaxel and etoposide in vitro and in vivo (Hayashi et al, 2005). These results suggest that antisense strategy to downregulate IAPs provides an effective therapeutic approach to hormone refractory prostate cancer. RNA interference (RNAi) refers to a group of related post-transcriptional gene silencing mechanisms whereby double-stranded short antisense RNA posttranscriptionally silences a specific gene. The smallinterfering RNA (siRNA) technique has been broadly used to investigate gene function, gene regulation, and genespecific therapeutics because of its marked efficacy and specificity (Elbashir et al, 2001). Paduano and colleagues reported that silencing of survivin gene by siRNA induced apoptosis and enhanced the sensitivity to the heat shock protein 90 (Hsp90) inhibitor in DU145 cells (Paduano et al, 2006). We confirmed that LNCaP cells transfected with synthetic double-stranded siRNA against XIAP are enhanced to suppress cell growth by inducing apoptosis and sensitized to taxol (unpublished observation). It may be proven that the application of siRNA technique to gene therapy is effective. Several novel approaches to interference of IAP expression have not only the potential for overcoming the antiapoptotic mechanism of IAP in prostate cancer but also an insight into the function of IAP in tumor progression and drug-resistance. However, before using these technologies in human, much work remains to be done to guarantee the specificity and to optimize safe and efficacious delivery system.

IX. Conclusions In this review, we described the molecular mechanisms of androgen independence and discussed the regulators of apoptotic pathway including IAP family 108

Gene Therapy and Molecular Biology Vol 11, page 109 Carson DA, Ribeiro JM (1993) Apoptosis and disease. Lancet 341,1251-1254. Chandele A, Prasad V, Jagtap JC, Shukla R, Shastry PR (2004) Upregulation of survivin in G2/M cells and inhibition of caspase 9 activity enhances resistance in staurosporineinduced apoptosis. Neoplasia 6, 29-40. Chen Z, Naito M, Hori S, Mashima T, Yamori T, Tsuruo T (1999) A human IAP-family gene, apollon, expressed in human brain cancer cells. Biochem Biophys Res Commun 264, 847-854. Craft N, Shostak Y, Carey M, Sawyers CL (1999) A mechanism for hormone-independent prostate cancer through modulation of androgen receptor signaling by the HER-2/neu tyrosine kinase. Nat Med 5, 280-285. Cryns V, Yuan J (1998) Proteases to die for. Genes Dev 12, 1551-1570. Culig Z, Hobisch A, Cronauer MV, Radmayr C, Trapman J, Hittmair A, Bartsch G, Klocker H (1994) Androgen receptor activation in prostatic tumor cell lines by insulin-like growth factor-I, keratinocyte growth factor, and epidermal growth factor. Cancer Res 54, 5474-5478. Datta R, Oki E, Endo K, Biedermann V, Ren J, Kufe D (2000) XIAP regulates DNA damage-induced apoptosis downstream of caspase-9 cleavage. J Biol Chem 275, 31733-31738. Deveraux QL, Reed JC (1999) IAP family proteins--suppressors of apoptosis. Genes Dev 13, 239-252. Deveraux QL, Roy N, Stennicke HR, Van Arsdale T, Zhou Q, Srinivasula SM, Alnemri ES, Salvesen GS, Reed JC (1998) IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases. EMBO J 17, 2215-2223. Deveraux QL, Stennicke HR, Salvesen GS, Reed JC (1999) Endogenous inhibitors of caspases. J Clin Immunol 19, 388398. Deveraux QL, Takahashi R, Salvesen GS, Reed JC (1997) Xlinked IAP is a direct inhibitor of cell-death proteases. Nature 388, 300-304. Devi GR (2004) XIAP as target for therapeutic apoptosis in prostate cancer. Drug News Perspect 17, 127-134. Ekert PG, Silke J, Hawkins CJ, Verhagen AM, Vaux DL (2001) DIABLO promotes apoptosis by removing MIHA/XIAP from processed caspase 9. J Cell Biol 152, 483-490. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-498. Feldman BJ, Feldman D (2001) The development of androgenindependent prostate cancer. Nat Rev Cancer 1, 34-45. Fukuda S, Mantel CR, Pelus LM (2004) Survivin regulates hematopoietic progenitor cell proliferation through p21WAF1/Cip1-dependent and -independent pathways. Blood 103, 120-127. Gann PH, Hennekens CH, Ma J, Longcope C, Stampfer MJ (1996) Prospective study of sex hormone levels and risk of prostate cancer. J Natl Cancer Inst 88, 1118-1126. Gao W, Bohl CE, Dalton JT (2005) Chemistry and structural biology of androgen. Chem Rev 105, 3352-3370. Gleave M, Miyake H, Chi K (2005) Beyond simple castration: targeting the molecular basis of treatment resistance in advanced prostate cancer. Cancer Chemother Pharmacol 56 Suppl 1, 47-57. Gray CW, Ward RV, Karran E, Turconi S, Rowles A, Viglienghi D, Southan C, Barton A, Fantom KG, West A, Savopoulos J, Hassan NJ, Clinkenbeard H, Hanning C, Amegadzie B, Davis JB, Dingwall C, Livi GP, Creasy CL (2000) Characterization of human HtrA2, a novel serine protease involved in the mammalian cellular stress response. Eur J Biochem 267, 5699-5710.

proteins in prostate cancer cells. IAP overexpression occurs commonly in prostate cancer as an early event but it may cause progression and androgen independency. Thus, IAP may play an important role as a new diagnostic and prognostic marker of prostate cancer. Involvement of IAP in prostate cancer resistance to chemotherapeutic agents and other apoptotic maneuver has been investigated by use of IAP gene downregulation technique, supporting to validate IAP as potent therapeutic targets for prostate cancer. Various strategies to downregulate IAP including antisense, small molecules, and siRNA etc in cancer cells are currently under investigation with promising results. IAP family proteins thus may be candidate drug discovery target molecules for restoration of apoptosis sensitivity in prostate cancer. Besides targeting IAP, antagosists of IAPs may be also of great value as novel target genes. Overall, a better molecular knowledge of mechanisms that regulate IAP expression in prostate cancer contribute to developing a promising new approach for the treatment of prostate cancer.

Acknowledgements We thank Ms. N. Hamamatsu, Ms. Y. Ayaki and numerous members of our laboratory for their stimulating comments.

References Adams RR, Carmena M, Earnshaw WC (2001) Chromosomal passengers and the (aurora) ABCs of mitosis. Trends Cell Biol 11, 49-54. Adida C, Berrebi D, Peuchmaur M, Reyes-Mugica M, Altieri DC (1998) Anti-apoptosis gene, survivin, and prognosis of neuroblastoma. Lancet 351, 882-883. Amantana A, London CA, Iversen PL, Devi GR (2004) X-linked inhibitor of apoptosis protein inhibition induces apoptosis and enhances chemotherapy sensitivity in human prostate cancer cells. Mol Cancer Ther 3, 699-707. Ambrosini G, Adida C, Altieri DC (1997) Anovel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med 3, 917-921. Asanuma K, Moriai R, Yajima T, Yagihashi A, Yamada M, Kobayashi D, Watanabe N (2000) Survivin as a radioresistance factor in pancreatic cancer. Jpn J Cancer Res 91, 1204-1209. Avila DM, Zoppi S, McPhaul MJ (2001) The androgen receptor (AR) in syndromes of androgen insensitivity and in prostate cancer. J Steroid Biochem Mol Biol 76, 135-142. Beltrami E, Plescia J, Wilkinson JC, Duckett CS, Altieri DC (2004) Acute ablation of survivin uncovers p53-dependent mitotic checkpoint functions and control of mitochondrial apoptosis. J Biol Chem 279, 2077-2084. Berger FG, Watson G (1989) Androgen-regulated gene expression. Annu Rev Physiol 51, 51-65. Berges RR, Vukanovic J, Epstein JI, CarMichel M, Cisek L, Johnson DE, Veltri RW, Walsh PC, Isaacs JT (1995) Implication of cell kinetic changes during the progression of human prostatic cancer. Clin Cancer Res 1, 473-480. Brasso K, Iverson P (1999) Prostate cancer in Denmark. Incidence, morbidity and mortality. Scand J Urol Nephrol Suppl 203, 29-33. Byun DS, Cho K, Ryu BK, Lee MG, Kang MJ, Kim HR, Chi SG (2003) Hypermethylation of XIAP-associated factor 1, a putative tumor suppressor gene from the 17p13.2 locus, in human gastric adenocarcinomas. Cancer Res 63, 7068-7075.

109

Nomura et al: IAP as a new diagnostic and effective therapeutic target molecule for prostate cancer Greenlee IT, Hill-Harmon MB, Murray T, Thun M (2001) Cancer statistics, 2001. CA Cancer J Clin 51, 15-36. Grossman D, McNiff JM, Li F, Altieri DC (1999) Expression of the apoptosis inhibitor, survivin, in nonmelanoma skin cancer and gene targeting in a keratinocyte cell line. Lab Invest 79, 1121-1126. Guess HA, Friedman GD, Sadler MC, Stanczyk FZ, Vogelman JH, Imperato-McGinley J, Lobo RA, Orentreich N (1997) 5 alpha-reductase activity and prostate cancer: a case-control study using stored sera. Cancer Epidemiol Biomarkers Prev 6, 21-24. Hankey BF, Feuer EJ, Clegg LX, Hayes RB, Legler JM, Prorok PC, Ries LA, Merrill RM,Kaplan RS (1999) Cancer surveillance series: interpreting trends in prostate cancer-part I: Evidence of the effects of screening in recent prostate cancer incidence, mortality, and survival rates. J Natl Cancer Inst 91 1017-1024. Hayashi N, Asano K, Suzuki H, Yamamoto T, Tanigawa N, Egawa S, Manome Y (2005) Adenoviral infection of survivin antisense sensitizes prostate cancer cells to etoposide in vivo. Prostate 65, 10-19. Hegde R, Srinivasula SM, Zhang Z, Wassell R, Mukattash R, Cilenti L, DuBois G, Lazebnik Y, Zervos AS, FernandesAlnemri T, Alnemri ES (2002) Identification of Omi/HtrA2 as a mitochondrial apoptotic serine protease that disrupts inhibitor of apoptosis protein-caspase interaction. J Biol Chem 277, 432-438. Holcik M, Yeh C, Korneluk RG, Chow T (2000) Translational upregulation of X-linked inhibitor of apoptosis (XIAP) increases resistance to radiation induced cell death. Oncogene 19, 4174-4177. Hull GW, Rabbani F, Abbas F, Wheeler TM, Kattan MW, Scardino PT (2002) Cancer control with radical prostatectomy alone in 1,000 consecutive patients. J Urol 167, 528-534. Hurtado-Coll A, Goldenberg SL, Gleave ME, Klotz L (2002) Intermittent androgen suppression in prostate cancer: the Canadian experience. Urology 60, 52-56. Isaacs JT, Lundmo PI, Berges R, Martikainen P, Kyprianou N, English HF (1992) Androgen regulation of programmed death of normal and malignant prostatic cells. J Androl 13, 457-464. Ito T, Shiraki K, Sugimoto K, Yamanaka T, Fujikawa K, Ito M, Takase K, Moriyama M, Kawano H, Hayashida M, Nakano T, Suzuki A (2000) Survivin promotes cell proliferation in human hepatocellular carcinoma. Hepatology 31, 10801085. Kasof GM, Gomes BC (2001) Livin, a novel inhibitor of apoptosis protein family member. J Biol Chem 276, 32383246. Kato J, Kuwabara Y, Mitani M, Shinoda N, Sato A, Toyama T, Mitsui A, Nishiwaki T, Moriyama S, Kudo J, Fujii Y (2001) Expression of survivin in esophageal cancer: correlation with the prognosis and response to chemotherapy. Int J Cancer 95, 92-95. Kawasaki H, Altieri DC, Lu CD, Toyoda M, Tenjo T, Tanigawa N (1998) Inhibition of apoptosis by survivin predicts shorter survival rates in colorectal cancer. Cancer Res 58, 50715074. Kerr JF, Winterford CM, Harmon BV (1994) Apoptosis. Its significance in cancer and cancer therapy. Cancer 73, 20132026. Kishi H, Igawa M, Kikuno N, Yoshino T, Urakami S, Shiina H (2004) Expression of the survivin gene in prostate cancer: correlation with clinicopathological characteristics, proliferative activity and apoptosis. J Urol 171, 1855-1860. Koivisto P, Kononen J, Palmberg C, Tammela T, Hyytinen E, Isola J, Trapman J, Cleutjens K, Noordzij A, Visakorpi T,

Kallioniemi OP (1997) Androgen receptor gene amplification: a possible molecular mechanism for androgen deprivation therapy failure in prostate cancer. Cancer Res 57, 314-319. Krajewska M, Krajewski S, Banares S, Huang X, Turner B, Bubendorf L, Kallioniemi OP, Shabaik A, Vitiello A, Peehl D, Gao GJ, Reed JC (2003) Elevated expression of inhibitor of apoptosis proteins in prostate cancer. Clin Cancer Res 9, 4914-4925. Landis SH, Murray T, Bolden S, Wingo PA (1998) Cancer statistics, 1998. CA Cancer J Clin 48, 6-29. Li F, Ambrosini G, Chu EY, Plescia J, Tognin S, Marchisio PC, Altieri DC (1998) Control of apoptosis and mitotic spindle checkpoint by survivin. Nature 396, 580-584. Li J, Feng Q, Kim JM, Schneiderman D, Liston P, Li M, Vanderhyden B, Faught W, Fung MF, Senterman M, Korneluk RG, Tsang BK (2001) Human ovarian cancer and cisplatin resistance: possible role of inhibitor of apoptosis proteins. Endocrinology 142, 370-380. Lin HK, Yeh S, Kang HY, Chang C (2001) Akt suppresses androgen-induced apoptosis by phosphorylating and inhibiting androgen receptor. Proc Natl Acad Sci USA 98, 7200-7205. Liston P, Fong WG, Kelly NL, Toji S, Miyazaki T, Conte D, Tamai K, Craig CG, McBurney MW, Korneluk RG (2001) Identification of XAF1 as an antagonist of XIAP antiCaspase activity. Nat Cell Biol 3, 128-133. Lu CD, Altieri DC, Tanigawa N (1998) Expression of a novel antiapoptosis gene, survivin, correlated with tumor cell apoptosis and p53 accumulation in gastric carcinomas. Cancer Res 58, 1808-1812. Marcelli M, Ittmann M, Mariani S, Sutherland R, Nigam R, Murthy L, Zhao Y, DiConcini D, Puxeddu E, Esen A, Eastham J, Weigel NL, Lamb DJ (2000) Androgen receptor mutations in prostate cancer. Cancer Res 60, 944-999. Matsumiya T, Imaizumi T, Yoshida H, Kimura H, Satoh K (2001) Cisplatin inhibits the expression of X-chromosomelinked inhibitor of apoptosis protein in an oral carcinoma cell line. Oral Oncol 37, 296-300. McEleny K, Coffey R, Morrissey C, Williamson K, Zangemeister-Wittke U, Fitzpatrick JM, Watson RW (2004) An antisense oligonucleotide to cIAP-1 sensitizes prostate cancer cells to fas and TNFalpha mediated apoptosis. Prostate 59, 419-425. McEleny KR, Watson RW, Coffey RN, O'Neill AJ, Fitzpatrick JM (2002) Inhibitors of apoptosis proteins in prostate cancer cell lines. Prostate 51, 133-140. Mimata H, Satoh F, Hanada T, Kasagi Y, Sakamoto S, Hamada Y, Nomura Y (2000) Expression of the IAP gene family in prostate cancer. Eur Urol 37 Suppl 2: 104. Montgomery JS, Price DK, Figg WD (2001) The androgen receptor gene and its influence on the development and progression of prostate cancer. J Pathol 195, 138-146. Monzo M, Rosell R, Felip E, Astudillo J, Sanchez JJ, Maestre J, Martin C, Font A, Barnadas A, Abad A (1999) A novel antiapoptosis gene: Re-expression of survivin messenger RNA as a prognosis marker in non-small-cell lung cancers. J Clin Oncol 17, 2100-2104. Nakagawa Y, Hasegawa M, Kurata M, Yamamoto K, Abe S, Inoue M, Takemura T, Hirokawa K, Suzuki K, Kitagawa M (2005) Expression of IAP-family proteins in adult acute mixed lineage leukemia (AMLL). Am J Hematol 78, 173180. Nomura T, Mimata H, Takeuchi Y, Yamamoto H, Miyamoto E, Nomura Y (2003) The X-linked inhibitor of apoptosis protein inhibits taxol-induced apoptosis in LNCaP cells. Urol Res 31, 37-44.

110

Gene Therapy and Molecular Biology Vol 11, page 111 Nomura T, Mimata H, Yamasaki M, Nomura Y (2004) Cisplatin inhibits the expression of X-linked inhibitor of apoptosis protein in human LNCaP cells. Urol Oncol 22, 453-460. Nomura T, Yamasaki M, Nomura Y, Mimata H (2005) Expression of the inhibitors of apoptosis proteins in cisplatinresistant prostate cancer cells. Oncol Rep 14, 993-997. Notarbartolo M, Poma P, Perri D, Dusonchet L, Cervello M, D'Alessandro N (2005) Antitumor effects of curcumin, alone or in combination with cisplatin or doxorubicin, on human hepatic cancer cells. Analysis of their possible relationship to changes in NF-kB activation levels and in IAP gene expression. Cancer Lett 224, 53-65. Paduano F, Villa R, Pennati M, Folini M, Binda M, Daidone MG, Zaffaroni N (2006) Silencing of survivin gene by small interfering RNAs produces supra-additive growth suppression in combination with 17-allylamino-17demethoxygeldanamycin in human prostate cancer cells. Mol Cancer Ther 5, 179-186. Papapetropoulos A, Fulton D, Mahboubi K, Kalb RG, O'Connor DS, Li F, Altieri DC, Sessa WC (2000) Angiopoietin-1 inhibits endothelial cell apoptosis via the Akt/survivin pathway. J Biol Chem 275, 9102-9105. Petrylak DP (1999) Chemotherapy for advanced hormone refractory prostate cancer. Urology 54, 30-35. Reed JC, Bischoff JR (2000) BIRinging chromosomes through cell division--and survivin' the experience. Cell 102, 545548. Richter BW, Mir SS, Eiben LJ, Lewis J, Reffey SB, Frattini A, Tian L, Frank S, Youle RJ, Nelson DL, Notarangelo LD, Vezzoni P, Fearnhead HO, Duckett CS (2001) Molecular cloning of ILP-2, a novel member of the inhibitor of apoptosis protein family. Mol Cell Biol 21, 4292-4301. Roa WH, Chen H, Fulton D, Gulavita S, Shaw A, Th'ng J, FarrJones M, Moore R, Petruk K (2003) X-linked inhibitor regulating TRAIL-induced apoptosis in chemoresistant human primary glioblastoma cells. Clin Invest Med 26, 231242. Rothe M, Pan MG, Henzel WJ, Ayres TM, Goeddel DV (1995) The TNFR2-TRAF signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins. Cell 83, 1243-1252. Roy N, Deveraux QL, Takahashi R, Salvesen GS, Reed JC (1997) The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J, 16, 6914-6925. Ruijter E, van de Kaa C, Miller G, Ruiter D, Debruyne F, Schalken J (1999) Molecular genetics and epidemiology of prostate carcinoma. Endocr Rev 20, 22-45. Saitoh Y, Yaginuma Y, Ishikawa M (1999) Analysis of Bcl-2, Bax and survivin genes in uterine cancer. Int J Oncol 15, 137-141. Sanna MG, da Silva Correia J, Ducrey O, Lee J, Nomoto K, Schrantz N, Deveraux QL, Ulevitch RJ (2002) IAP suppression of apoptosis involves distinct mechanisms: the TAK1/JNK1 signaling cascade and caspase inhibition. Mol Cell Biol 22, 1754-1766. Sasaki H, Sheng Y, Kotsuji F, Tsang BK (2000) Downregulation of X-linked inhibitor of apoptosis protein induces apoptosis in chemoresistant human ovarian cancer cells. Cancer Res 60, 5659-5666. Schlette EJ, Medeiros LJ, Goy A, Lai R, Rassidakis GZ (2004) Survivin expression predicts poorer prognosis in anaplastic large-cell lymphoma. J Clin Oncol 22, 1682-1688. Shariat SF, Lotan Y, Saboorian H, Khoddami SM, Roehrborn CG, Slawin KM, Ashfaq R (2004) Survivin expression is associated with features of biologically aggressive prostate carcinoma. Cancer 100, 751-757. Srinivasula SM, Datta P, Kobayashi M, Wu JW, Fujioka M, Hegde R, Zhang Z, Mukattash R, Fernandes-Alnemri T, Shi

Y, Jaynes JB, Alnemri ES (2002) Sickle, a novel Drosophila death gene in the reaper/hid/grim region, encodes an IAPinhibitory protein. Curr Biol 12, 125-130. Stehlik C, de Martin R, Kumabashiri I, Schmid JA, Binder BR, Lipp J (1998) Nuclear factor (NF)-kappaB-regulated Xchromosome-linked iap gene expression protects endothelial cells from tumor necrosis factor alpha-induced apoptosis. J Exp Med 188, 211-216. Stennicke HR, Salvesen GS (1998) Properties of the caspases. Biochim Biophys Acta 1387, 17-31. Sui L, Dong Y, Ohno M, Watanabe Y, Sugimoto K, Tokuda M (2002) Survivin expression and its correlation with cell proliferation and prognosis in epithelial ovarian tumors. Int J Oncol 21, 315-320. Swana HS, Grossman D, Anthony JN, Weiss RM, Altieri DC (1999) Tumor content of the antiapoptosis molecule survivin and recurrence of bladder cancer. N Engl J Med 341, 452453. Tamm I, Kornblau SM, Segall H, Krajewski S, Welsh K, Kitada S, Scudiero DA, Tudor G, Qui YH, Monks A, Andreeff M, Reed JC (2000) Expression and prognostic significance of IAP-family genes in human cancers and myeloid leukemias. Clin Cancer Res 6, 1796-1803. Tamm I, Wang Y, Sausville E, Scudiero DA, Vigna N, Oltersdorf T, Reed JC (1998) IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases, and anticancer drugs. Cancer Res 58, 5315-5320. Tanaka K, Iwamoto S, Gon G, Nohara T, Iwamoto M, Tanigawa N (2000) Expression of survivin and its relationship to loss of apoptosis in breast carcinomas. Clin Cancer Res 6, 127134. Tannock IF, de Wit R, Berry WR, Horti J, Pluzanska A, Chi KN, Oudard S, Theodore C, James ND, Turesson I, Rosenthal MA, Eisenberger MA (2004) Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. N Engl J Med 351, 1502-1512. Taplin ME, Bubley GJ, Shuster TD, Frantz ME, Spooner AE, Ogata GK, Keer HN, Balk S P (1995) Mutation of the androgen-receptor gene in metastatic androgen-independent prostate cancer. N Engl J Med 332, 1393-1398. Trivedi C, Redman B, Flaherty LE, Kucuk O, Du W, Heilbrun LK, Hussain M (2000) Weekly 1-hour infusion of paclitaxel. Clinical feasibility and efficacy in patients with hormonerefractory prostate carcinoma. Cancer 89, 431-436. Verhagen AM, Coulson EJ, Vaux DL (2001) Inhibitor of apoptosis proteins and their relatives: IAPs and other BIRPs. Genome Biol 2, 3009. Wang CY, Mayo MW, Korneluk RG, Goeddel DV, Baldwin AS Jr (1998) NF-kappaB antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation. Science 281, 1680-1683. Wright CW, Duckett CS (2005) Reawakening the cellular death program in neoplasia through the therapeutic blockade of IAP function. J Clin Invest 115, 2673-2678. Yakes FM, Chinratanalab W, Ritter CA, King W, Seelig S, Arteaga CL (2002) Herceptin-induced inhibition of phosphatidylinositol-3 kinase and Akt is required for antibody-mediated effects on p27, cyclin D1, and antitumor action. Cancer Res 62, 4132-4141. Yang Y, Fang S, Jensen JP, Weissman AM, Ashwell JD (2000) Ubiquitin protein ligase activity of IAPs and their degradation in proteasomes in response to apoptotic stimuli. Science 288, 874-877. Zhang M, Latham DE, Delaney MA, Chakravarti A (2005) Survivin mediates resistance to antiandrogen therapy in prostate cancer. Oncogene 24, 2474-2482.

111

Nomura et al: IAP as a new diagnostic and effective therapeutic target molecule for prostate cancer Zhivotovsky B, Joseph B, Orrenius S (1999) Tumor radiosensitivity and apoptosis. Exp Cell Res 248, 10-17. Zhivotovsky B, Orrenius S (2003) Defects in the apoptotic machinery of cancer cells: role in drug resistance. Semi Cancer Biol 13, 125-134.

Takeo Nomura

112

Gene Therapy and Molecular Biology Vol 11, page 103 Gene Ther Mol Biol Vol 11, 103-112, 2007

IAP as a new diagnostic and effective therapeutic target molecule for prostate cancer Review Article

Takeo Nomura*, Fuminori Satoh, Mutsushi Yamasaki, Hiromitsu Mimata Department of Oncological Science (Urology), Oita University Faculty of Medicine, Japan

104

Gene Therapy and Molecular Biology Vol 11, page 107 therefore, molecules that mimic the actions of IAPs inhibitors could be therapeutically useful.

may confer a novel insight to develop a XIAP-targeted therapy.

IX. Conclusions In this review, we described the molecular mechanisms of androgen independence and discussed the regulators of apoptotic pathway including IAP family 108

Acknowledgements We thank Ms. N. Hamamatsu, Ms. Y. Ayaki and numerous members of our laboratory for their stimulating comments.

109

110

111

Takeo Nomura

112

Gene Therapy and Molecular Biology Vol 11, page 113 Gene Ther Mol Biol Vol 11, 113-116, 2007

Gene cloning of P43 surface protein of toxoplasma gondii tachyzoite and bradyzoite (SAG3) Research Article

Bahram Kazemi1,2,*, Leila Maghen3, Mojgan Bandehpour1,4, Saed Shahabi2, Ali Haghighi2 1

Cellular and Molecular Biology Research Center, Shaheed Beheshti Medical University, Tehran I.R. Iran. Parasitology Department- Shaheed Beheshti Medical University, Tehran I.R. Iran. 3 Islamic Azad University of Iran, Science and Research Campus, Tehran I.R. Iran 4 National Research Center for Genetic Engineering and Biotechnology, Tehran I.R. Iran 2

__________________________________________________________________________________ *Correspondence: Bahram Kazemi, Cellular and Molecular Biology Research Center, Shaheed Beheshti Medical University, Tehran I.R. Iran; Telefax: 009821 22428432; Email: bahram14@gmail.com, kazemi@sbmu.ac.ir Key words: Toxoplasma, tachyzoite, bradyzoite, surface antigen, cloning Abbreviations: glycosyl phosphatydyl inositol, (GPI); low melting point, (LMP); P43 surface antigen, (SAG3) Received: 11 September 2006; Revised: 20 September 2006 Accepted: 18 December 2006; electronically published: June 2007

Summary Toxoplasma gondii is an obligate intracellular parasite which its sexual and asexual cycle respectively takes place in the intestinal epithelial of definitive host and tissue of intermediate hosts. Congenital toxoplasmosis is more important when the mother acquired the infection during pregnancy period for the first time. Having a specific antigen is an important element in prevention and detection of parasite. This study has designed and performed in the aim of cloning a specific toxoplasma antigen for further studies. We have amplified gene of P43 of toxoplasma tachyzoite and bradyzoite surface antigen. PCR product was cloned in pGEMEX1 expression vector (named pGEM43) and is ready to make the recombinant protein for using as antigen.

and bradyzoite have covered with antigens which is linked to GPI (glycosyl phosphatydyl inositol) (Nagel and Boothroyd 1989; Tomavo et al, 1989) that are known as SAG (surface antigens) (Boothroyd et al, 1998; Lekutis et al, 2000). Some of these specific molecules are specified stage of parasite life cycle: 30KD (SAG1), 22KDa (SAG2) and 35KDa (SRS3) proteins are only in the surface of tachyzoite and are not in the surface of bradyzoite, meanwhile some other proteins such as 43KD (SAG3) and 23KDa are in the surface of both tachyzoite and bradyzoite (Burg et al, 1988; Prince et al, 1990; Manger et al, 1998; Lekutis et al, 2001). More studies are done about the cloning and expression of genes of toxoplasma surface proteins (Burg et al, 1988; Prince et al, 1990; CesbronDelauw et al, 1994). The toxoplasma P43 have been cloned and sequenced first by Cesbron-Delauw and colleqagues in 1994 and additionaly by Fux and colleqagues in 2003. The aim of this study was cloning the gene of P43 surface antigen (SAG3) of toxoplasma tachyzoite and bradyzoite as a recombinant protein.

I. Introduction Toxoplasma gondii is an obligate intracellular parasite and its life cycle includes definitive and intermediate hosts. The sexual and asexual cycle of parasite respectively takes place in the intestinal epithelial of the cat (as definitive host) and any warm blooded, like mammals and birds (as intermediate hosts) (Frankel et al, 1970). Previous studies have showed that the main human infection can result by ingestion of material contaminated with infected cat feces, from eating raw or partially cooked beef and transplacental transmission from mother to children (Miller et al, 1972). Congenital toxoplasmosis is more important in the pregnant women who acquired the infection for the first one (Guerina 994)). Human infection takes place in two forms: acute infection and chronic infection. After beginning of the infection with initial immune response, tachyzoite (multiply fast) escape to different tissue via blood and lymph, then invert to bradyzoite (multiply slowly) inside tissue cyst (Hutchison 1970). Recently, main attention has been attracting to surface molecules of parasite. The surface of tachyzoite

113

Kazemi et al: Gene cloning of P43 surface protein using dTTP by terminal deoxy nucleotidyl transferase (Gaastra and Klemm, 1984; Eun, 1996) and 3` A tailed PCR product was ligated to it (Gaastra and Hansen, 1984). The ligation reaction was transformed in Ecoli XLI-blue strain competent cells (Hanaham, 1983) and dispensed on LB agar plate containing 50 µg/ml ampicillin. Colonies were screened by X-gal and IPTG and white colonies containing recombinant plasmid were selected (Bothwell et al 1990). Recombinant plasmid was digested by SacI and BamHI and released expected DNA band was recovered by DNA purification kit (Fermentas Cat. No k0513) and subcloned in SacI and BamHI digested pGEMEX 1 expression vector. Reaction was transformed and colonies contained recombinant plasmids were mass cultured on LB medium. Recombinant plasmids were extracted and confirmed by restriction analysis.

II. Materials and Methods A. Parasite Toxoplasma RH strain, kindly provided by Professor Dalimi Tarbiat Modarres University, Tehran, Iran and was maintained by twice-weekly passages of peritoneal fluid into mice. Toxoplasma tachyzoites were isolated from peritoneum puncture of infected mice and were rinsed by PBS buffer many times. Toxoplasma DNA was extracted as previously described (Zia-Ali, 2005).

B. PCR reaction We designed a set of primer for amplification of P43 gene with SacI and BamHI restriction sites at 5` end of forward and reverse primers respectively (Tox43 F 5`GAGCTCATATGCAGCTGT GGCGGC GC–3` and Tox43 R 5`-GGA TCCTTA GGCAGC CACATGCAC–3). PCR reaction contained 0.5 µg DNA, 40 pico mol each of forward and reverse primers, 1.5 mM MgCl2, 0.2 mM dNTPs, 1X PCR buffer, 1.5 unit of Taq DNA polymerase (CinnaGen, Iran) and dH2O up to 50 µL. PCR amplification was carried out with 30 cycles of denaturation at 94 °C for 40 seconds, annealing at 65°C for 60 seconds and extension at 72 °C for 60 seconds. PCR reaction was incubated at 94 °C and 72 °C for 5 min before and after the PCR cycling respectively (Pherson et al 2000).

III. Results Toxoplasma tachyzoites were isolated by peritoneum punction of infected mice and rinsed by PBS buffer. DNA was extracted and PCR reaction was carried out. Figure 1 shows 1158 bp as PCR product of toxoplasma P43 gene. PCR product was ligated in pBluescript via T/A cloning method and recombinant plasmid digested with SacI and BamHI restriction enzyme, Figure 2 shows digested recombinant plasmid. Digestion reaction was electrophoresed on LMP agars gel, released DNA band was purified by DNA purification kit and subcloned in SacI and BamHI digested pGEMEX1 expression vector and named pGEM43. PstI enzyme has a restriction site at position 748 on P43 sequense but pGEMEX1 don't cut by this enzyme. For confirmation of recombinant pGEM43 we digested recombinant plasmid by PstI and lineared plasmid is shown in Figure 3. Gene was sequenced and deposited in GeneBank at accession no. EF445545

C. Electrophoresis PCR product was submitted to electrophoresis using 1% agarose gel and stained by ethidium bromide. The DNA band was visualized under ultraviolet light (UV transilluminator) (Boffey 1984).

D. Gene cloning PCR product was electrophoresed on 1% low melting point (LMP) agarose gel (Gaastra and Jorgensen, 1984) and DNA band was sliced under long wave UV and recovered by DNA purification kit (Fermentas, Cat. No k0513). Recovered DNA was cloned in pBluescript cloning vector via T/A cloning method. Briefly, EcoRV blunt digested pBluescript was 3` tailed

Figure 1. 1% agarose gel electrophoresis. Lane 1: 1158 bp as PCR product of P43. Lane 2: 100 bp DNA ladder marker.

Figure 2. 1% agarose gel electrophoresis. Lane 1: 100 bp DNA ladder marker. Lane 2: Digested recombinant plasmid by SacI and BamHI restriction enzymes.

114

Figure 3. Confirmation of recombinant plasmid. Lane 1: Recombinant plasmid (digested by PstI). Lane 2: No recombinant plasmid (not digested by PstI).

Gene Therapy and Molecular Biology Vol 11, page 115 Dunn D, Wallon M, Peyron F, Petersen E, Peckham C, Gilbert R (1999) Mother-to-child transmission of toxoplasmosis: risk estimates for clinical counselling. Lancet 353, 1829-33. Dzierszinski F, Mortuaire M, Cesbron-Delauw MF, Tomavo S (2000) Targeted disruption of the glycosylphosphatidylinositol-anchored surface antigen SAG3 gene in Toxoplasma gondii decreases host cell adhesion and drastically reduces virulence in mice. Mol Microbiology 37, 574-582. Eun HM (1996) Enzymology primer for Recombinant DNA Technology. Academic Press. Chapter 6 DNA polymerases pp 345-489. Frankel JK, Dubey JP, Miller NL (1970) Toxoplasma gondii in cats: fecal stages identified as coccidian oocyst. Science 167, 893-6. Freeman K, Oakley L, Pollak A, Buffolano W, Petersen E, Semprini AE, Salt A, Gilbert R; European Multicentre Study on Congenital Toxoplasmosis (2005) Association between congenital toxoplasmosis and preterm birth, low birthweight and small for gestational age birth. BJOG 112, 31-7. Fux B, Rodrigues CV, Portela RW, Silva NM, Su C, Sibley D, Vitor RW, Gazzinelli RT (2003) Role of cytokines and major histocompatibility complex restriction in mouse resistance to infection with a natural recombinant strain (type I-III) of Toxoplasma gondii. Infect Immun 71, 6392-401. Gaastra W, Hansen K (1984) Ligation of DNA with T4 DNA ligase. In methods in Molecular Biology vol 2 Nucleic Acids. Edited by John M.Walker; Chapter 32: pp 225-230. Gaastra W, Jorgensen PL (1984) The extraction and isolation of DNA from gels. in methods in Molecular Biology vol 2 Nucleic Acids. Edited by John M.Walker.Chapter 10 pp 6776. Gaastra W, Klemm P (1984) Radiolabeling of DNA with 3` terminal transferase. in methods in Molecular Biology vol 2 Nucleic Acids. Edited by John M.Walker.Chapter 40 pp 269271. Guerina NG (1994) Congenital infection with Toxoplasma gondii. Pediatric Ann 23, 138-142,147-151. Hanaham D (1983) Studies on transformation on E.coli with plasmids. J Mol Biol 98, 503-517. Hutchison WM, Dunachie JF, Siim JC, Work K (1970) Coccidian like nature of Toxoplasma gondii. Br Med J 1, 142-4. Jacque A, Coulon L, NĂ¨ve JD, Daminet V, Haumont M, Garcia L, Bollen A, Jurado M, Biemans R (2001) The surface antigen SAG3 mediates the attachment of Toxoplasma gondii to cell-surface proteoglycans. Mol Biochem Parasitol 116, 35-44. Lekutis C, Ferguson DJP, Boothroyd JC (2000) Identification of developmentally regulated family of gene related to SAG2. Exp Parasitol 96, 89-96. Lekutis C, Ferguson DJP, Grigg ME, Camps M, Boothroyd JC (2001) Surface antigen of Toxoplasma gondii : variation of a theme. Int J Parasitol 31, 1285-92. Manger ID, Hehl AB, Boothroyd JC (1998) The surface of Toxoplasma tachyzoites is dominated by a family of glycosyl phosphatidyl inositol-anchored antigen related to SAG1 dominates the surface of toxoplasma tachyzoites. Infect Immunol 66, 2237-44. Miller NL, Frenkel JK, Dubey JP (1972) Oral infections with Toxoplasma gondii cyst and oocyst in felines, other mammals and in birds. J Parasitol 58, 928-37. Nagel SD, Boothroyd JC (1989) The major surface antigen, P30, of Toxoplasma gondii is anchored by glycolipid. J Biol Chem 264, 5569-74. McPherson MJ, Moller SG (2000) PCR. The Basics from Background to Bench. Bios Scientific publishers. Chapter 2; Undrestanding PCR.,pp: 9-21.

IV. Discussion Toxoplasma gondii is an obligatory intracellular parasite which has complicated life cycle. Sexual and asexual cycle respectively takes place in intestinal epithelial cells of cat and tissues of mammals and birds (Frankel et al, 1970). This parasite almost attacks to all host nucleated cells (Sibley, 1995). Toxoplasma gondii leads to dangerous manifestation in fetus. The most dangerous effect of congenital toxoplasmosis some times is abortion and premature delivery (Dunn, 1999; Freeman, 2005). The congenital infection according to the intensity and variety of the organs contamination has different symptoms. Difference in the intensity of the disease depends on the stage of the pregnancy period which the infection occurs (Zhao 1992; Wallon et al, 2002). This parasite will be detected in human beings by serological tests only, and specific antigen is very essential in diagnosis system. P43 (SAG3) is one member of the redundant system of T. gondii receptors that act as ligands mediating host cell recognition and involved in the parasite attachment to target cells (Jacque 2001, Dzierszinski, 2000). In this study for availability of parasite stage specific antigen, the gene of p43, the tachyzoite and bradyzoite surface antigen was cloned and became ready to make recombinant proteins. It can be used as antigen for detection or prevention of parasite in men.

V. Conclusion In this study, the gene of P43 toxoplasma tachyzoite and bradyzoite surface antigen was cloned in expression vector and confirmed. It can be used for either diagnosis or prevention of parasite in men.

Acknowledgement This study has supported by the Iranian Biotechnology Network and was performed in Cellular and Molecular Biology Research Center of the Shaheed Beheshti Medical University. By this way the authors of this article thanks directors.

References Boffey SA (1984) Agarose gel electrophoresis of DNA. In methods in Molecular Biology vol 2 Nucleic Acids. Edited by John M.Walker; Chapter 32: pp 43-50. Boothroyd JC, Hehl A, Knoll LJ, Manger ID (1998) The surface of Toxoplasma gondii: more and lees. Int J Parasitol 28, 39. Bothwell AL, Yancopulos GD, Alt FW (1990) Methods for cloning and analysis of eukaryotic genes. Jones and Bartlett Publishers; section 10: pp 247-260. Burg JL, Perelman D, Kasper LH, Ware PL, Boothroyd JC (1988) Molecular analysis for gene encoding the major surface antigens of Toxoplasma gondii. J Immunol 141, 3584-91. Cesbron-Delauw MF, Tomavo S, Beauchamps P, Fourmaux MP, Camus D, Capron A, Dubermetz JF (1994) Similarities between the primary structures of two distinct major surface protein of Toxoplasma gondii. J Biol Chem 269, 1621716222.

115

Kazemi et al: Gene cloning of P43 surface protein Prince JB, Auver KL, Huskinson J, Parmely SF, Araujo FG, Remington JS (1990) Cloning, expression and cDNA sequence of surface antigen P22 from Toxoplasma gondii. Mol Biochem Parasitol 43, 97-106. Sibley LD (1995) Invasion of vertebrate cells by Toxoplasma gondii. Trend Cell Biol 5, 129-132. Tomavo S, Schwartz RT, Dubermetz JF (1989) Evidence for glycosyl phosphatidyl inositol anchoring of Toxoplasma gondii major surface antigens. Mol Cell Biol 9, 4576-80.

Wallon M, Gaucherand P, Al Kurdi M, Peyron F (2002) Toxoplasma infections in early pregnancy: consequences and management. J Gynecol Obstet Biol Reprod 31, 478-84. Zhao Z (1992) A prospective study on the relationship between abnormal pregnant outcome and Toxoplasma gondii infection. Zhonghua Liu Xing Bing Xue Za Zhi 13, 154-7. Zia-Ali N, Keshavarz-Valian H, Rezaian M, Khorramizadeh MR, Kazemi B, Fazaeli A, Darde M (2005) Molecular Characterization of Toxoplasma gondii from BirdHosts. Iranian J Publ Health 34, 27-30.

116

Gene Therapy and Molecular Biology Vol 11, page 113 Gene Ther Mol Biol Vol 11, 113-116, 2007

Gene cloning of P43 surface protein of toxoplasma gondii tachyzoite and bradyzoite (SAG3) Research Article

Bahram Kazemi1,2,*, Leila Maghen3, Mojgan Bandehpour1,4, Saed Shahabi2, Ali Haghighi2 1

113

Figure 1. 1% agarose gel electrophoresis. Lane 1: 1158 bp as PCR product of P43. Lane 2: 100 bp DNA ladder marker.

Figure 2. 1% agarose gel electrophoresis. Lane 1: 100 bp DNA ladder marker. Lane 2: Digested recombinant plasmid by SacI and BamHI restriction enzymes.

114

Figure 3. Confirmation of recombinant plasmid. Lane 1: Recombinant plasmid (digested by PstI). Lane 2: No recombinant plasmid (not digested by PstI).

115

116

Gene Therapy and Molecular Biology Vol 11, page 117 Gene Ther Mol Biol Vol 11, 117-132, 2007

Developing and applying a drug delivery model for liposomal and dendritic multifunctional nanoparticles Review Article

Constantinos M. Paleos*, Dimitris Tsiourvas, Zili Sideratou Institute of Physical Chemistry, NCRC â&#x20AC;&#x153;Demokritos, 15310 Aghia Paraskevi, Attiki, Greece

__________________________________________________________________________________ *Correspondence: Constantinos M. Paleos, Institute of Physical Chemistry, NCSR "Demokritos"; 15310 Aghia Paraskevi, Attiki, Greece; Tel.: +30 210 6503666; Fax: +30 210 6529792; e-mail: paleos@chem.demokritos.gr Key words: Drug Delivery Systems, Liposomes, Dendrimers, Hyperbranched Polymers Abbreviations: Adriamycin, (ADR); barbituric acid, (BAR); betamethasone dipropionate, (BD); betamethasone valerate, (BV); cholesterol, (CHOL); diaminobutane poly(propylene imine) dendrimer, (DAB); 5,5-didodecylbarbituric acid, (DBA); 1-(4(dihexadecylcarbamoyl)butyl)guanidinium p-toluenesulfonate, (DBG); di-n-hexadecylphosphate, (DHP); N-[3(dioctadecylamino)propyl] guanidine hydrochloride, (DOPG); doxorubicin, (DXR); dynamic light scattering, (DLS); giant unilamellar vesicles, (GUV); 9-hexadecyladenine, (HA); hyperbranched polyglycerol, (PG); Isothermal Titration Microcalorimetry, (ITC); large unilamellar vesicles, (LUV); monomethyl ether polyethylene glycol, (M-PEG); N-[3-(octadecylamino)propyl] guanidine hydrochloride, (ODPG); octadecylguanidine hydrochloride, (ODG); phosphatidylcholine, (PC); poly(amidoamine) dendrimer, (PAMAM); poly(propylene imine) dendrimers of the fourth generation functionalized with n guanidinium groups, (DAB-Gn); polyethylene glycol, (PEG); tamoxiphen, (TMX); 2,4,6 triaminopyrimidine, (TAP) Received: 8 November 2006; Revised: 8 June 2007 Accepted: 11 June 2007; electronically published: June 2007

Summary This account deals with a strategy for designing multifunctional liposomes and dendritic polymers. Such nanoparticles, although quite different in size and structure, both fulfill properties that drug carriers should exhibit, i.e. specificity or targeting ability, extended time of circulation in biological fluids and ability to be transported through cell membranes. Furthermore, having developed these multifunctional liposomal and dendritic carriers, a drug delivery model is presented that employs instead of cells multilamellar liposomes, which interact with the above mentioned multifunctional carriers. This interaction should primitively mimic the processes which occur in living cells when they interact with loaded or unloaded liposomal and dendritic nanoparticles. Multifunctionality and multivalency coupled with molecular recognition between the interacting pairs render the loaded nanoparticles effective drug delivery vehicles.

phagocytosis and prolong their circulation in biological fluids. The latter property is almost exclusively achieved by coating the surface of the carriers with polyethyleneglycol (PEG) chains applying the well-known strategy of PEGylation (Allen, 1994; Lasic and Needham, 1995; Needham and Kim, 2000; Liu et al, 2000; Gabizon et al, 2003). Another crucial parameter of effective drug delivery systems is their transport through cell membranes, which can be achieved by the introduction of translocating agents on the surface of the nanocarriers. The application of cell penetrating peptides (Prochiantz, 2000; Futaki et al, 2003; Wright et al, 2003; Gorodetsky et al 2004; Futaki, 2005a; Kim, 2006; Maeda and Fujimoto, 2006) and specifically of arginine-rich derivatives which have been extensively studied and found to exhibit enhanced membrane translocation ability, can be

I. Introduction A significant number of bioactive molecules fail to be commercialized as drugs due to lack of tissue specificity, blood solubility, metabolic stability or bioavailability. In order to address these issues effective drug delivery systems, including liposomes and dendritic polymers (comprising of dendrimers and hyperbranched polymers) are being developed. Liposomal and dendritic nanoparticles although quite different in size, structural features and consequently in loading properties, both are susceptible to surface functionalization by analogous strategies. In this manner, nanoparticles sharing common functional groups can be obtained. In fact, liposomes and dendritic polymers have been developed bearing ligands which target to cell receptors or protective groups that prevent their 117

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles employed as the basis for preparing efficient molecular transporting liposomal and dendritic nanoparticles. Hence, by employing oligo- and poly- arginine derivatives the overall molecular transporting process is facilitated; this is attributed to the presence of the guanidinium moiety which interacts with the phosphate and carboxylate groups of the cells surface (VivĂ¨s et al, 1997; Wender et al, 2000; Futaki et al, 2001, 2005b; Kirschberg et al, 2003;). The strategy for the preparation of typical multifunctional liposomes and dendritic polymers is described in this account. These nanoparticles, Figure 1, differing in size and structural features in principle fulfill the above mentioned properties for drug carriers, i.e. specificity or targeting ability, long circulation in biological fluids and transport properties through cell membranes. Furthermore having developed these multifunctional liposomal and dendritic carriers, a drug delivery model is presented employing, instead of cells, multilamellar liposomes. The latter primitively mimic the processes involved in biological cells during their interaction with loaded or unloaded liposomal and dendritic nanoparticles.

functional groups. Recently, a step-wise strategy was adopted for the preparation of multifunctional liposomes as will be briefly discussed below. Complementary liposomes interact mimicking in a way the recognition of cells with liposomes. Molecular engineering of liposomal surfaces, by the introduction of functional groups having the ability to form hydrogen bonds with complementary moieties introduced to other liposomes, leads to the formation of large aggregates when this pair of liposomes is allowed to interact. During this interaction the following processes take place (Cerv and Richardsen, 1999): a. Adhesion during which the liposomes are simply conjoined but retain separate inner compartments and b. Fusion during which the liposomes merge sharing a common inner compartment. In this second process a sequence of events occurs, giving rise to the mixing of the aqueous content of liposomes with or without leakage or rupturing of the fused vesicles. With regard to the mechanism of membrane fusion, two processes have been investigated, i.e. the conventional one involving non-lamellar fusion and that of restructuring and ultimately merging of the membrane on a less ordered basis. It has been supported that both mechanisms are energetically favoured at least for small-scale fusion. However, it has to be noted that small liposomes, i.e. with diameters of about 45nm comprising of less than 10000 molecules, do not have the sufficient number of amphiphiles to form a non-lamellar phase without disintegrating; these liposomes are however known to fuse extensively, apparently through membrane restructuring (Cerv and Richardsen, 1999). Taking into account the above mentioned associative mechanisms, processes such as the exchange of amphiphiles or the effect of liposomal size on the efficiency of interaction should also play an important role in the binding of liposomes. Bearing these considerations in mind and with the understanding that fusion of phospholipids liposomes has been used as a model for simulating biological membrane fusion, the cited examples on liposomal interactions will be discussed.

II. Interaction between complementary liposomes Conventional liposomes have long been employed as drug delivery systems for a diversity of polar and lipophilic bioactive compounds (Gregoriadis, 1995; Barenholz, 2001; Guo and Szoka, 2003). These liposomes, however, are in general unstable in biological media and do not exhibit specificity for certain cell types. These issues were satisfactorily addressed through appropriate functionalization of the liposome surface achieved by a selective choice of the lipids. Specifically, the preparation of these functional liposomes was realized by using the socalled bottom-up strategy in which functional surfactants are used as building blocks for their bilayer formation. The development of multifunctional liposomal nanoparticles should be the ultimate objective for obtaining highly effective drug delivery systems. In fact, in the early stage of these investigations, mono-functional liposomes were prepared which were not bearing all the required

Figure 1. Schematic representation of a multifunctional liposome (left) and dendrimer (right).

118

Gene Therapy and Molecular Biology Vol 11, page 119 As previously mentioned, the functionalization of the external surface of liposomes was achieved through the preparation of mixed liposomes. In this manner, the functional moieties on the external surface, originate from the amphiphilic components, which were incorporated into these liposomes. It is thus possible to monitor the reactivity of liposomes by changing the type and concentration of the incorporated recognizable lipid. In this context, early work (Paleos et al, 1996; MarchiArtzner et al, 1997) triggered the interest in investigating molecular recognition between complementary liposomes. In the following years Lehn et al (Marchi-Artzner et al, 2001) further investigating their previously employed complementary pair, established the supramolecular chemistry of interacting liposomes. This pair of liposomes consisted basically of egg phosphatidylcholine also containing amphiphilic derivatives of barbituric acid (BAR) or triaminopyrimidine (TAP) (Figure 2), each up to 10% molar ratio. The recognition of the complementary moieties was facilitated by the insertion of a suitable spacer in between the recognizable and polar groups. The main conclusions of this study are summarized below: a. Rapid and selective aggregation (in less than 30 s) occurs between the complementary liposomes, followed by lipid exchange (within 30 min after mixing). The lipid exchange, which takes place when the membranes are in contact, results either in fusion or, if fusion does not occur, to a redispersion of the liposomes within 17 hours. b. The aggregation process of the system under investigation can be weakened by decreasing the ionic strength, through the addition of a soluble barbituric competitor or by decreasing the concentration of the recognizable amphiphiles. The effect of ionic strength underlines the basic role of electrostatic interaction in the initial aggregation step. On the other hand, the effect of the recognizable amphiphiles supports the view according to which the recognizable system stabilizes the adhesion state. c. The fusion process was observed by electron microscopy and remained at a low level not resulting in an intermixing of the aqueous pools of the liposomes to a significant degree. It seems that fusion resulted from the collapse of mixed triaminopyridine/barbituric acid liposomes with neighbouring liposomes.

d. The size of the liposomes has a crucial effect on the recognition phenomena. Thus aggregation was not observed when giant liposomes were encountered. The interaction between recognizable groups is not sufficiently strong to establish a stable contact between giant liposomes. A rapid adhesion however occurs between complementary large and giant unilamellar liposomes. Continuing the investigation on the reactivity of complementary liposomes (Sideratou et al, 2000), unilamellar liposomes of about 100 nm diameter were prepared consisting basically of phosphatidylcholine (PC), and cholesterol (CHOL). For accomplishing molecular recognition of these liposomes, one part of them incorporated di-n-hexadecylphosphate (DHP), while the other part 1-(4-(dihexadecylcarbamoyl)butyl)guanidinium p-toluenesulfonate (DBG) as recognizable lipids (Figure 3). Cholesterol was incorporated in the liposomal membrane at various concentrations starting from 10% and up to 50% molar with respect to PC simulating in this way cell membrane composition. The so-prepared complementary liposomes were allowed to interact at ambient temperature. The complementary guanidinium and phosphate groups, located on liposomal surfaces, interact strongly due to electrostatic and hydrogenbonding forces promoting, by their combined action, noncovalent bonding (Onda et al, 1996) between these liposomes (Figure 3). This strong interaction between DHP and DBG lipids allowed experiments to be performed at low molar ratios of these lipids relative to PC (molar ratio PC/DGB and PC/DHP=19:1). Due to molecular recognition of these liposomes, interaction did occur and large aggregates were obtained which were large enough to be observed even by optical microscopy. As concluded from their dimensions, fusion follows initial adhesion leading to large multicompartment aggregates, which in certain cases encapsulate smaller ones. These structures, shown in Figure 4, exhibit a form of compartmentalization, which represents a simplistic analogue of subcellular compartments. The formation of these multicompartment systems was recently presented elsewhere (Paleos and Tsiourvas, 2006) and it is further discussed below.

Figure 2. Chemical structures of amphiphilic derivatives of barbituric acid (BAR) and triaminopyrimidine (TAP).

119

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles

Figure 3. Chemical structures of di-n-hexadecylphosphate (DHP) and 1-(4-(dihexadecylcarbamoyl)butyl) guanidinium ptoluenesulfonate (DBG) and the interaction scheme between the complementary phosphate and guanidinium groups. Figure 4. Multicompartment aggregates obtained following molecular recognition of complementary liposomes incorporating DHP and DBG. The bar in the lower left corner indicates 5!m.

A significant, yet unexpected, outcome of this work (Sideratou et al, 2000) is that the cholesterol incorporated in these liposomes appreciably enhances their molecular recognition effectiveness. The molecular recognition enhancement, which was observed at cholesterol concentrations ranging from 10% to 50% molar with respect to phosphatidylcholine, was attributed to the structural features of lipid-cholesterol bilayers. This finding was explained on the basis of effect of cholesterol on the molecular ordering in the lipid bilayer according to a widely accepted phase diagram (Ipsen et al, 1987; Mouritsen and JĂ¸rgensen, 1992, 1994; Thewalt and Bloom, 1992; Trandum et al, 2000). According to this diagram, within the experimental temperature range in which these experiments were performed and at cholesterol concentrations higher than 25% molar with respect to PC, the liquidâ&#x20AC;&#x201C;ordered phase is formed. The fact that this phase is fluid, from the viewpoint of lateral disorder and diffusion, is significant for the molecular

mobility of the recognizable molecules. On the other hand, since the recognizable lipids are incorporated at a low molar ratio (1:19), their presence does not appreciably perturb the molecular organization of the PC-CHOL bilayer and therefore, the interacting moieties encounter the previously mentioned organized environment allowing their mobility. Apparently, molecular organization combined with fluid lateral mobility of the recognizable lipids in the liquidâ&#x20AC;&#x201C;ordered phase, results in a more enhanced association of the liposomes. The role of encapsulated cholesterol in liposomal membrane, for enhancing liposomal association, as observed by microscopic and light scattering studies, was further established (Sideratou et al, 2000) by isothermal microcalorimetry. The heat released by the interaction of the complementary liposomes was maximum for the system [PC:CHOL:DBG]/[PC:CHOL:DHP] and negligible for all the control experiments. Thus, the binding enthalpy was found to be 1.113 kJ mol-1, when 120

Gene Therapy and Molecular Biology Vol 11, page 121 cholesterol (50%) was present and 0.576 kJ mol-1 in its absence, i.e. in the control experiment. The role of cholesterol in liposomal recognition is also evident from the reaction rates, which were determined by Isothermal Titration Microcalorimetry (ITC) experiments. Assuming single-exponential kinetics, the reaction rates (k) become approximately 4 times faster in the presence of cholesterol. It is therefore evident that cholesterol should be incorporated in liposomes for both stabilizing their membrane and also for enhancing their association ability. Based on the above findings on the role of cholesterol in liposomal membrane an analogous system was prepared (Sideratou et al, 2002a), in which the recognizable amphiphiles 5,5-didodecylbarbituric acid (DBA) and 9-hexadecyladenine (HA) (Figure 5) were incorporated in liposomes based on hydrogenated phosphatidylcholine and cholesterol in a PC:CHOL 2:1 molar ratio. Hydrogen-bonding interactions between these complementary lipid moieties (Figure 5) were relatively weak, and therefore the recognizable lipids were incorporated at a high molar content relative to PC (i.e. Recognizable Lipid:PC 1:4). In this manner, relatively strong binding between the liposomes was obtained and accurate determination of the thermodynamic parameters was achieved. Molecular recognition of liposomes becomes most effective at 1:1 molar ratio of the recognizable molecules. Following mixing of the complementary liposomes multicompartment aggregates were obtained, which have structural analogies to the ones previously observed. These aggregates were apparently obtained following fusion of the initially adhering

liposomes under non-leaking conditions. Investigation of molecular recognition between this pair of liposomes was also investigated by ITC and one-to-one binding between the adenine and barbituric acid moieties in the lipid/water/lipid interface was observed (Sideratou et al, 2002a). The effect of cholesterol on the mechanism of binding between DBA and HA at the lipid-water interface was found to be in concord with a previous study (Sideratou et al, 2000). Thus, in analogy with the previous experiment, the presence of cholesterol rendered the binding process faster, at least at low DBA/HA molar ratios. In recent studies on liposomal interactions (Pantos et al, 2002, 2004) the inhibitory role of the protective polyethylene glycol (PEG) coating on molecular recognition was investigated. In this sense, liposomes consisting of hydrogenated PC and cholesterol were prepared, incorporating recognizable moieties on their surface. One type of liposomes incorporated DHP, whereas their complementary liposomes contained either octadecylguanidine hydrochloride (ODG), or N-[3(octadecylamino)propyl] guanidine hydrochloride (ODPG), or N-[3-(dioctadecylamino)propyl] guanidine hydrochloride (DOPG) (Figure 6). With the application of the two latter guanidinylated lipids, the role of the propylene spacer on the recognition effectiveness of liposomes was evaluated. Due to this spacer, the guanidinium group protrudes from the liposomal interface and therefore its probability of interaction with the complementary phosphate group is enhanced.

Figure 5. Chemical structures of 5,5-didodecylbarbituric acid (DBA) and 9-hexadecyladenine (HA) and the interaction scheme between the complementary barbituric and adenine groups.

121

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles

Figure 6. Chemical structures of octadecylguanidine hydrochloride (ODG), N-[3-(octadecylamino)propyl] guanidine hydrochloride (ODPG) and N-[3-(dioctadecylamino)propyl] guanidine hydrochloride (DOPG).

PEG coating of molecular weight 5000 was introduced to the interface of liposomes through the incorporation of varying amounts of PEGylated cholesterol in the liposomal membrane. This is a convenient method of attaching PEG to the liposomal surface since the end of the polymer chain bearing the cholesterol moiety is effectively anchored inside the liposomal membrane. One of the highlights of this study is that molecular recognition of the complementary liposomes leads to the formation of either large aggregates, which precipitate, or to fused multicompartment aggregates, as measured by dynamic light scattering (DLS) and observed by phase-contrast microscopy (Figure 7). The results obtained by the two methods were in good agreement. The size increase during

the interaction of PC:CHOL:DOPG with PC:CHOL:DHP liposomes in water is shown in Figure 8. Fusion of complementary liposomes takes place under a non-leaking process involving lipid mixing as it was established by calcein entrapment and Resonance Energy Transfer experiments (Pantos et al, 2004). The thermodynamic parameters indicate the processes of aggregation and fusion. The interactions of non-PEGylated liposomes consistently involve exothermic processes of much higher enthalpy compared to the PEGylated counterparts. Thus, for the pairs [PC:CHOL:ODPG]/[PC:CHOL:DHP] and [PC:CHOL:ODG]/[PC:CHOL:DHP], the !" values are –5.7 and –3.0 Kcal/mol respectively, while for the PEGylated liposomes (5% PEG relative to cholesterol) the !" values are –3.8 and –1.1 Kcal/mol respectively. Figure 7. Multicompartment aggregates obtained following molecular recognition of complementary liposomes incorporating DHP and ODPG. The bar in the lower left corner indicates 5!m.

122

Gene Therapy and Molecular Biology Vol 11, page 123

Figure 9. Phase contrast optical microscopy images of liposomal aggregates obtained following the mixing of multilamellar PC:CHOL:DHP liposomes with complementary unilamellar PC:CHOL:ODPG liposomes. The bar in the lower right corner indicates 5 !m.

Figure 8. Particle size distribution of unilamellar PC:CHOL:DOPG liposomes (dotted line) and of the resulting aggregates following their interaction with unilamellar PC:CHOL:DHP liposomes (PEGylated or not) in water. Reproduced from Paleos and Tsiourvas, 2006 with kind permission from Wiley-VCH.

On the basis of the results obtained from liposomeliposome interactions, a model for the interaction of drugloaded liposomes with cells was constructed. This was simulated by the interaction of drug-loaded unilamellar liposomes with multilamellar liposomes in which the latter play the role of cells (Paleos et al, 2001). In these experiments the same lipids, as in previous work (Pantos et al, 2004) were used. The interaction of unilamellar with multilamellar liposomes was investigated by optical microscopy, DLS, #-potential, high-precision differential scanning calorimetry, and ITC experiments (Pantos et al, 2005a). Multicompartment systems were observed by means of optical microscopy as shown in Figure 9, consistent, in size with that determined by DLS experiments, Figure 10. This further supports the hypothesis that molecular recognition induces multicompartment system formation. The aggregates observed are analogous to the ones obtained when unilamellar recognizable liposomes were allowed to interact as previously discussed.

Figure 10. Particle size distribution of PEGylated (upper part) and non-PEGylated (lower part) unilamellar (dotted line) PC:CHOL:ODPG liposomes and of the resulting aggregates (solid line) following interaction with PC:CHOL:DHP multilamellar liposomes (dashed-dotted line) at a 2:1 DHP:ODPG molar ratio. Reproduced from Paleos and Tsiourvas, 2006 with kind permission from Wiley-VCH.

123

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles By a closer examination of multicompartment system formation, as an outcome of molecular recognition between liposomes, the following mechanism may be envisaged: Fusion between liposomes is facilitated by their recognizable functional groups affording liposomes of various sizes (interaction steps A and B in Figure 11), which are in general characterized as large unilamellar vesicles (LUV) and giant unilamellar vesicles (GUV). According to Lehn et al, (Marchi-Artzner et al, 2001) who employed a similar complementary pair of liposomes, adhesion leading to fusion does not take place between giant liposomes, while a selective LUV-GUV adhesion can take place leading to fusion (interaction step C in Figure 11). This last step can rationalize the formation of multicompartment systems, during which large liposomes are recognized, engulfed and internalised by giant liposomes, in a fashion analogous to endocytosis. Aggregates, analogous to the ones presented in this review, were obtained while a mechanism of membrane fusion was proposed elsewhere (Tanaka and Yamazaki, 2004) explaining the incorporation of smaller liposomes into the larger ones. Coming to the issue of simulating the interaction of cells with liposomes loaded with drugs, unilamellar liposomes were loaded either with the hydrophilic drug doxorubicin (DXR) or with the hydrophobic drug tamoxiphen (TMX) (Figure 12) and allowed to interact with multilamellar liposomes (Pantos et al, 2005a). It should be noted that all the experiments were carried out in phosphate buffer saline (PBS) in order to approximate physiological conditions. The interaction of the complementary non-PEGylated unilamellar liposomes loaded with DXR or TMX with multilamellar liposomes, at 1:2 molar ratio with respect to PC, occurred spontaneously. Large aggregate precipitates were obtained as imaged by phase contrast optical microscopy. A few giant fused liposomes were also observed which, in some cases, encapsulated smaller aggregates. When PEGylated unilamellar liposomes were used, precipitation was reduced while the occurrence of fused species was increased.

Figure 11. Schematic diagram of multicompartment aggregates formation steps by the interaction of complementary liposomes. Reproduced from Paleos and Tsiourvas, 2006 with kind permission from Wiley-VCH.

Figure 12. Chemical structure of the drugs doxorubicin, ADR, methotrexate, MTX, betamethasone valerate, BV, and betamethasone dipropionate, BD.

124

Gene Therapy and Molecular Biology Vol 11, page 125 The results of the DXR transport from drug loaded unilamellar liposomes to the ‘empty’ complementary multilamellar liposomes during their interaction are summarized in Table 1. The control experiments demonstrate a rather minor drug transport, not higher than 17%, in the case of simple, PEGylated or non-PEGylated, unilamellar liposomes. In contrast, when PEGylated or non-PEGylated unilamellar liposomes bearing the recognizable ODPG lipid were used, drug transfer increased by a factor of 4 and 4.5 respectively compared to the control experiments, i.e, liposomes without any recognizable moieties on their surface. This was attributed to the formation of aggregates or giant liposomes as a result of molecular recognition between the complementary moieties of the unilamellar and multilamellar liposomes. The observed variation between the PEGylated and non-PEGylated unilamellar liposomes can be attributed to the presence of polymer chains at the external liposomal surface hindering adhesion as also previously established in the case of unilamellar interacting liposomes (Pantos et al, 2002, 2004). Drug transport experiments were also performed with the TMX loaded unilamellar liposomes, demonstrating analogous results as summarized in Table 1. In this case drug transport is even higher, by 85% and 90 %, when PEGylated and non-PEGylated unilamellar liposomes incorporating ODPG were used respectively. In contrast, control experiments clearly show that drug transfer for unilamellar liposomes non-incorporating ODPG is insignificant, i.e. less than 2%. The observed differences in the transport efficacy of TMX and DXR, can be attributed to their different mode of incorporation into the unilamellar liposomes. Specifically, the hydrophilic DXR is encapsulated into the liposomal aqueous core while the hydrophobic TMX is incorporated into the liposomal bilayer. In control experiments DXR transfer is not negligible, in contrast to TMX. This is attributed to its higher water solubility and diffusion through the aqueous phase to the multilamellar liposomes. Nevertheless, during interaction of the complementary liposomes drug transfer of DXR into the multilamellar liposomes is less than that of TMX due to its release and solubilization in the aqueous phase. Conversely since TMX is solubilized in the bilayer, its transport does not involve leakage or diffusion through the aqueous medium, and therefore it is higher than DXR in the case of complementary liposomes and insignificant in the case of non-functionalized ones.

III. Interaction of functional dendritic polymers with complementary liposomes Dendrimers (Bosman et al, 1999; Schlüter and Rabe, 2000; Fréchet and Tomalia, 2001; Newkome et al, 2001; Jiang and Aida, 2005; Tomalia, 2005) are nanoscale, highly branched and monodispersed macromolecules with symmetrical architecture. They consist of a central core, branching units and terminal functional groups. The core and the internal units determine the nanocavity environment and consequently the dendrimer solubilizing or encapsulating properties, whereas, the external groups influence their solubility and chemical behaviour. On the other hand, hyperbranched polymers (Inoue, 2000; Muscat and van Benthem, 2001; Voit, 2003), including the extensively studied hyperbranched polyether polyols or polyglycerols (Sunder et al, 1999a,b, 2000a,b; Haag, 2001; Frey and Haag, 2002; Siegers et al, 2004) are readily prepared but are non-symmetrical, highly branched and polydispersed. Their main structural feature, also common to dendrimers, is the formation of nanocavities able to encapsulate bioactive molecules, among others. In this context, commercially available or custommade dendrimeric or hyperbranched polymers have been functionalized (Vögtle et al, 2000) for their application as effective drug delivery systems (Liu and Fréchet, 1999; Sideratou et al, 2001; Stiriba et al, 2002; Beezer et al, 2003; Kolhe et al, 2003; Ambade et al, 2005; D' Emanuele and Attwood, 2005; Gillies and Fréchet, 2005; Lim and Simanek, 2005; Dhanikula and Hildgen, 2006; Tziveleka et al, 2006; Paleos et al, 2007) or gene vectors (Bielinska et al, 1999; Luo et al, 2002; Ohsaki et al, 2002; Dufès et al, 2005; Lee et al, 2005; Svenson and Tomalia, 2005; Liu and Reineke, 2006; Tziveleka et al, 2007). When more than one type of groups is introduced to the surface of dendritic polymers, these systems are characterized as multifunctional as shown in Figure 1. Each group serves a specific function when these multifunctional dendritic polymers are employed as drug delivery systems. Thus, specificity for certain cell types can be accomplished by attaching targeting ligands to the surface of dendritic polymers, while enhanced solubility, decreased toxicity, biocompatibity, stability and protection from degradation in the biological milieu can be achieved by the functionalization of the end groups of dendritic polymers, e.g. with poly(ethylene glycol) chains (PEG).

Table 1. Drug transport from the unilamellar to the multilamellar liposomes. Reproduced from Pantos et al, 2005a with kind permission from American Chemical Society. Composition of

DXR

!"#

unilamellar liposomes

% transfer

PC-CHOL

17.1±2.9

PC-CHOL-PEG

12.5±3.4

PC-CHOL-ODPG

70.5±3.9

94.9±3.1

PC-CHOL-ODPG-PEG

60.9±2.3

82.5±3.9

125

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles The function of PEG-chains is crucial for modifying the behaviour of drug themselves or their carriers (NopplSimson and Needham, 1996; Ishiwata et al, 1997; Liu et al, 1999, 2000; Veronese, 2001; Roberts et al, 2002; Pantos et al, 2004; Vandermeulen and Klok, 2004; Vonarbourg et al, 2006; Gajbhiye et al, 2007). Targeting ligands attached to the dendritic surface are complementary to cell receptors (Cooper, 1997; Lodish et al, 2000) in order to induce binding of the dendritic carrier to the cell surface and efficient internalisation. This binding is further enhanced by the socalled polyvalent interactions (Mammen et al, 1998; Kitov and Bundle, 2003; Badjic et al, 2005) attributed to the close proximity of the recognizable ligands situated on the limited surface area of the dendritic molecules. Transport through the cell membrane can also be enhanced by the introduction of appropriate moieties to the surface of the dendritic polymers. Moreover, modification of the internal groups of dendrimers affects their solubilizing character, making therefore the encapsulation of a pleiad of drugs possible. In this connection, cationization of dendrimers, and particularly of their external groups, facilitates their application as gene transfer agents (Bielinska et al, 1999; Luo et al, 2002; Ohsaki et al, 2002) through the formation of DNA-Dendritic Polymer complexes. As expected monofunctional dendritic drug carriers cannot compete with their multifunctional counterparts. Thus selected monofunctional dendrimeric polymers such as poly(amidoamine), PAMAM, diaminobutane poly(propylene imine), DAB, or the hyperbranched polyglycerol, PG (Figure 13) have been step-wise multifunctionalized. In order to illustrate dendrimeric encapsulation, a few typical examples are given below: PAMAM functionalized with monomethyl ether poly(ethylene glycol) (M-PEG), having an average molecular weight of 550 or 2000, was employed for encapsulating the anticancer drugs Adriamycin, ADR (Doxorubicin hydrochloride), or Methotrexate, MTX, (Figure 12) (Kojima et al, 2000), while PEGylated DAB dendrimers were used to encapsulate betamethasone valerate (BV) and betamethasone dipropionate (BD) (Figure 12) (Sideratou et al, 2001). It should be noted that BV loading capacity was found to be of the order of 11 wt% in multi-functional dendrimers, i.e. in PEGylated and Guanidinylated derivative (Paleos et al, 2004), which is almost double the loading capacity of the simply PEGylated dendrimer (6 wt%) (Sideratou et al, 2001) and more than 5fold the loading capacity of the parent dendrimeric solution (1.7 wt%). The encapsulation of a diversity of conventional drugs in functional dendritic polymers and the formation of Dendritic-DNA complexes constitute a prospective and very promising new field in drug delivery. The progress in this field has been recently reviewed (Sideratou et al, 2006). In the present review however, the interaction of dendritic polymers with their complementary liposomes is proposed as a drug delivery model mimicking the interaction of functional dendritic polymers with cells. As previously discussed, multilamellar liposomes interacting with multifunctional dendritic polymers were used instead of cells.

Figure 13. Chemical structure of dendritic polymers.

126

Gene Therapy and Molecular Biology Vol 11, page 127 Guanidinylated diaminobutane poly(propylene imine) dendrimers of the fourth and fifth generation acted as a â&#x20AC;&#x153;glueâ&#x20AC;? causing the aggregation of phosphatidylcholine-cholesterol liposomes incorporating dihexadecylphosphate as the recognizable lipid; these aggregates were readily redispersed by the addition of an excess of a phosphate buffer (Sideratou et al, 2002b). These initial results on molecular recognition of DHP bearing liposomes with guanidinylated dendrimers prompted the development of an elaborated multifunctional dendrimer (Paleos et al, 2004) based on a fifth generation DAB (Figure 14). The design of this dendrimeric carrier was intended to simultaneously address issues such as stability in the biological milieu, targeting and transport through cell membranes. For this purpose, in addition to protective poly(ethylene glycol) chains, guanidinium moieties were also introduced to the dendrimer surface, acting both as targeting and transport ligands. In this manner it was possible to achieve, the key features of an efficient drug delivery system: a. Protection of the carrier through coverage of the dendrimeric surface with poly(ethylene glycol) chains, b. Recognition ability towards complementary moieties as surface guanidinium groups secure the facile interaction with acidic receptors, including the biologically significant carboxylate and phosphate groups. The combination of electrostatic forces and hydrogen bonding that occur make this interaction thermodynamically favorable (Hirst et al, 1992), c. Potential of encapsulation of various drugs in the dendrimer nanocavities and subsequent release from them, possibly in a controlled fashion which can be tuned by environmental changes (Sideratou et al, 2001), d. Complexation with DNA for gene therapy applications, e. Capability of polyvalency interactions, associated with enhanced binding, due to the high density of recognizable moieties on the confined surface area of the dendrimer, which can significantly enhance translocation through a bilayer membrane. f. An anticipated decrease in toxicity due to the modification of the toxic amino groups (Malik et al, 2000). In order to investigate the translocation ability of DAB dendrimers across liposomal bilayers, a series of derivatives bearing varying numbers of guanidinium groups on their surfaces were prepared. At low guanidinium/phosphate molar ratios, i.e. when weakly guanidinylated dendrimeric derivatives were employed, the aggregate formation was imaged with AFM microscopy while liposomal fusion occured to a certain extent at high guanidinium/phosphate molar ratios or when highly guanidinylated dendrimeric derivatives were employed (Tsogas et al, 2006). Furthermore, optimal translocation of these dendrimeric derivatives to the liposomal core was shown through fluorescence for low to medium guanidinylation and at low guanidinium/phosphate molar ratios; translocation was further enhanced when the lipid bilayer was in the fluid liquid crystalline phase. In conclusion, an optimum balance is required between the recognition effectiveness as expressed by the number of guanidinium groups interacting with the phosphate groups and the degree of hydrophilicity of the guanidinylated dendrimers for

optimum transport of the latter to the liposomal core (Tsogas et al, 2006). Having discussed the processes involved in the interaction of liposomes with complementary dendrimers their interaction with cells needs to be modelled next. Multilamellar liposomes consisting of PC:CHOL:DHP (19:9.5:1) and dispersed in aqueous or phosphate buffer solutions (Pantos et al, 2005b) were employed to simulate cells interacting with multifunctional dendrimers. Specifically, poly(propylene imine) dendrimers of the fourth generation were functionalized with 6 (DAB-G6) or 12 (DAB-G12) guanidinium groups as targeting ligands, while, the remaining toxic, external primary amino groups of the dendrimers reacted with propylene oxide affording the corresponding hydroxylated derivatives (Figure 15). The fully hydroxylated dendrimer DAB-G0 not containing any guanidinium groups was used as a reference compound. All dendrimers were loaded with corticosteroid drugs, i.e. betamethasone dipropionate and betamethasone valerate in order to evaluate their drug transfer efficiency to liposomes. Microscopy, #-potential, and Dynamic Light Scattering (DLS) revealed liposome-dendrimer molecular recognition leading to the formation of large aggregates at dendrimer/DHP molar ratios higher than 1:30. Calcein liposomal entrapment experiments demonstrate limited leakage (less than 13%) following liposome interaction with modified dendrimers at 1:25 dendrimer/DHP molar ratio. This indicates that liposomal membranes remain almost intact during their molecular recognition with these dendrimers. Isothermal Titration Calorimetry (ITC) indicates that the enthalpy of the interaction is dependent on the number of the guanidinium groups present on the dendrimeric surface. Furthermore, the process is reversible and redispersion of the aggregates occurs by adding a high concentration of phosphate anions.

Figure 14. Reaction scheme for multifunctional dendrimeric derivative.

127

the

synthesis

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles multilamellar liposomes as the ITC and DLS experiments demonstrated. As expected, when the interaction is performed in 10mM phosphate buffer the amount of drug present in the aggregates slightly decreases. This decrease can be explained by the competitive interaction of the phosphate groups in the bulk water phase with the dendrimeric guanidinium groups, leading to less effective adhesion to the multilamellar liposomes. Upon addition of concentrated phosphate buffer followed by the redispersion of the aggregates in the medium and the separation of the no-longer interacting dendrimers, there is still some drug present in the detached multilamellar liposomes. Measurements of BD or BV found in multilamellar liposomes indicate that, in all cases, ca. 50% (Table 2) of the amount of drugs found in the aggregates before redispersion is still present, suggesting that both drugs are incorporated in the liposomal lipid bilayer, since their solubility in water is extremely low. Drug transport is highly enhanced by the use of guanidinylated dendrimers since drug transfer of 40-45% was obtained in the case of DAB-G12 while the corresponding transfer for the non-guanidinylated derivative was merely 12-15%.

IV. Concluding remarks The preparation and physicochemical characterization of multifunctional liposomal and dendritic nanoparticles intended for application as drug delivery systems was presented. The multifunctionality together with the multivalency capability of both categories of nanoparticles gives these systems increased potential as effective drug delivery systems. In view of these features and employing multilamellar liposomes, to simulate cells, it was possible to model the processes occurring during the interaction of liposomal and dendritic nanoparticles with cells. A key feature of this model is molecular recognition of the nanoparticles involved leading to adhesion, which is expected to enhance drug transport.

Figure 15. Multi-functionalization reaction scheme of fourth generation poly(propylene imine) dendrimer.

The interaction between drug-loaded dendrimers and multilamellar liposomes results in drug transport from the dendrimeric derivatives to the ‘void’ multilamellar liposomes as summarized in Table 2. These experiments showed that about 25% of BD or BV was present in the precipitated aggregates when DAB-G0 was used. When the guanidinylated dendrimers DAB-G6 and DAB-G12 were used, the amount of drugs in the precipitate profoundly increases to about 60% and 80%, respectively. These significant differences observed in the transport of drugs between guanidinylated and nonguanidinylated dendrimers can be attributed to the functionalization of the dendrimeric molecules. The presence of guanidinium groups at the external surface of the dendrimers results in effective adhesion to the

Acknowledgements The work was partially supported by Dendrigen SA, Athens, Greece.

Table 2. Drug transfer (%) from dendrimers to multilamellar liposomes in a) aggregates obtained after their interaction in water or in 10 mM phosphate buffer (pH 7.4) and b) multilamellar liposomes obtained following redispersion of the aggregates. Reproduced from Pantos et al, 2005b with kind permission from American Chemical Society.

Drug

Dendrimer DAB-G0 DAB-G6 DAB-G12 DAB-G0 DAB-G6 DAB-G12

Drug transfer (%) in aggregates Phosphate Water Buffer 24.4±2.4 19.8±1.2 62.5±1.9 48.5±1.6 84.5±2.1 68.4±1.5 32.9±2.0 27.1±1.0 59.0±1.5 39.5±2.1 78.1±2.3 57.5±2.0

128

Drug transfer (%) after redispersion Phosphate Water Buffer 15.8±0.9 12.1±1.1 28.1±1.7 24.5±1.3 45.1±1.8 40.0±1.4 15.9±1.2 14.1±0.9 29.0±1.0 26.1±1.5 42.0±1.5 38.2±1.2

Gene Therapy and Molecular Biology Vol 11, page 129 transduction into cells enhanced by haptotactic peptides (Haptides) homologous to fibrinogen C-chain termini. J Controlled Release 95, 477-488. Gregoriadis G (1995) Engineering liposomes for drug delivery: progress and problems. Trends Biotechnol 13, 527-537. Guo X and Szoka FC, Jr (2003) Chemical approaches to triggerable lipid vesicles for drug and gene delivery. Acc Chem Res 36, 335-341. Haag R (2001) Dendrimers and hyperbranched polymers as highloading supports for organic synthesis. Chem Eur J 7, 327335. Hirst SC, Tecilla P, Geib SJ, Fan E and Hamilton AD (1992) Molecular Recognition of Phosphate-esters - A Balance of Hydrogen-bonding and roton-Transfer Interactions. Israel J Chem 32, 105-111. Inoue K (2000) Functional dendrimers, hyperbranched and star polymers. Prog Polym Sci 25, 453-571. Ipsen JH, Karlström G, Mouritsen OG, Wennerström H and Zuckermann MJ (1987) Phase-equilibria in the phosphatidylcholine-cholesterol system. J Biochim Biophys Acta 905, 162-172. Ishiwata H, Sato SB, Vertut-Doi A, Hamashima Y and Miyajima K (1997) Cholesterol derivative of poly(ethylene glycol) inhibits clathrin-independent, but not clathrin-dependent endocytosis. Biochim Biophys Acta 1359, 123-135. Jiang D-L and Aida T (2005) Bioinspired molecular design of functional dendrimers. Prog Polym Sci 30, 403-422. Kim RB (2006) Transporters and Drug Discovery: Why, When, and How. Mol Pharm 3, 26-32. Kirschberg TA, VanDeusen CL, Rothbard JB, Yang M and Wender PA (2003) Arginine-based molecular transporters: The synthesis and chemical evaluation of releasable taxoltransporter conjugates. Org Lett 5, 3459-3462. Kitov PI and Bundle DR (2003) On the nature of the multivalency effect: A thermodynamic model. J Am Chem Soc 125, 16271-16284. Kojima C, Kono K, Maruyama K and Takagishi T (2000) Synthesis of polyamidoamine dendrimers having poly(ethylene glycol) grafts and their ability to encapsulate anticancer drugs. Bioconjugate Chem 11, 910-917. Kolhe P, Misra E, Kannan RM, Kannan S and Lieh-Lai M (2003) Drug complexation, in vitro release and cellular entry of dendrimers and hyperbranched polymers. Int J Pharm 259, 143-160. Lasic DD and Needham D (1995) The ''Stealth'' liposome: A prototypical biomaterial. Chem Rev 95, 2601-2628 and references cited therein. Lee CC, MacKay JA, Fréchet JMJ and Szoka FC (2005) Designing dendrimers for biological applications. Nat Biotechnol 23, 1517-1526. Lim J and Simanek EE (2005) Toward the next-generation drug delivery vehicle: Synthesis of a dendrimer with four orthogonally reactive groups. Mol Pharm 2, 273-277. Liu MJ and Fréchet JMJ (1999) Designing dendrimers for drug delivery. Pharm Sci Technol Today 2, 393-401. Liu MJ, Kono K and Fréchet JMJ (1999) Water-soluble dendrimer-poly(ethylene glycol) starlike conjugates as potential drug carriers. J Polym Sci, Part A: Polym Chem 37, 3492-3503. Liu MJ, Kono K and Fréchet JMJ (2000) Water-soluble dendritic unimolecular micelles: Their potential as drug delivery agents. J Controlled Release 65, 121-131. Liu YM and Reineke TM (2006) Poly(glycoamidoamine)s for gene delivery: Stability of polyplexes and efficacy with cardiomyoblast cells. Bioconjugate Chem 17, 101-108. Lodish H, Berk A, Zipursky SL, Matsudaira P, Baltimore D and Darnell J (2000) Integrating Cells into Tissues, in: Lodish I, Harvey F. (Eds). Molecular Cell Biology. Freeman WH and

References Allen TM (1994) Long-Circulating (Sterically Stabilized) Liposomes For Targeted Drug-Delivery. Trends Pharmacol Sci 15, 215-220. Ambade AV, Savariar EN and Thayumanavan S (2005) Dendrimeric micelles for controlled drug release and targeted delivery. Mol Pharm 2, 264-272. Badjic JD, Nelson A, Cantrill SJ, Turnbull WB and Stoddart JF (2005) Multivalency and cooperativity in supramolecular chemistry. Acc Chem Res 38, 723-732. Barenholz Y (2001) Liposome application: problems and prospects. Curr Opin Colloid Interface Sci 6, 66-77. Beezer AE, King ASH, Martin IK, Mitchel JC, Twyman LJ and Wain CF (2003) Dendrimers as potential drug carriers; encapsulation of acidic hydrophobes within water soluble PAMAM derivatives. Tetrahedron 59, 3873-3880. Bielinska AU, Chen CL, Johnson J and Baker JR, Jr (1999) DNA complexing with polyamidoamine dendrimers: Implications for transfection. Bioconjugate Chem 10, 843-850. Bosman AW, Janssen HM and Meijer EW (1999) About Dendrimers: Structure, Physical Properties, and Applications. Chem Rev 99, 1665-1688. Cevc G and Richardsen H. (1999) Lipid vesicles and membrane fusion. Adv Drug Delivery Rev 38, 207-232. Cooper GM (1997) The Cell Surface, in: The Cell. A Molecular Approach, ASM Press, Washington DC, 477. D' Emanuele A and Attwood D (2005) Dendrimer-drug interactions. Adv Drug Delivery Rev 57, 2147-2162. Dhanikula RS and Hildgen P (2006) Synthesis and Evaluation of Novel Dendrimers with a Hydrophilic Interior as Nanocarriers for Drug Delivery. Bioconjugate Chem 17, 2941. Dufès C, Uchegbu IF and Schätzlein AG (2005) Dendrimers in gene delivery. Adv Drug Delivery Rev 57, 2177-2202. Fréchet JMJ and Tomalia DA (2001) Dendrimers and Other Dendritic Polymers. J. Wiley & Sons, Ltd., Chichester, UK and references cited therein. Frey H and Haag R (2002) Dendritic polyglycerol: a new versatile biocompatible material. Rev Mol Biotechnol 90, 257-267. Futaki S, Suzuki T, Ohashi W, Yagami T, Tanaka S, Ueda K and Sugiura Y (2001) Arginine-rich peptides. An abundant source of membrane-permeable peptides having potential as carriers for intracellular protein delivery. J Biol Chem 276, 5836-5840. Futaki S, Goto S and Sugiura Y (2003) Membrane permeability commonly shared among arginine-rich peptides. J. Molecul. Recognition 16, 260-264. Futaki S (2005a) Membrane-permeable arginine-rich peptides and the translocation mechanisms. Adv Drug Delivery Rev 547-558. Futaki S, Nakase I, Suzuki T, Nameki D, Kodama EI, Matsuoka M and Sugiura Y (2005b) RNase S complex bearing arginine-rich peptide and anti-HIV activity. J Mol Recognit 18, 169-174. Gabizon A, Shmeeda H and Barenholz Y (2003) Pharmacokinetics of pegylated liposomal doxorubicin: review of animal and human studies. Clin Pharmacokinet 42, 419-36. Gajbhiye V, Kumar PV, Tekade RK and Jain NK (2007) Pharmaceutical and biomedical potential of PEGylated dendrimers. Curr. Pharm. Des. 13, 415-429. Gillies ER and Fréchet JMJ (2005) Dendrimers and dendritic polymers in drug delivery. Drug Discovery Today 10, 3543. Gorodetsky R, Levdansky L, Vexler A, Shimeliovich I, Kassis I, Ben-Moshe M, Magdassi S and Marx G (2004) Liposome

129

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles Company, New York, 968. Luo D, Haverstick K, Belcheva N, Han E and Saltzman WM (2002) Poly(ethylene glycol)-conjugated PAMAM dendrimer for biocompatible, high-efficiency DNA delivery. Macromolecules 35, 3456-3462. Maeda T and Fujimoto K (2006) A reduction-triggered delivery by a liposomal carrier possessing membrane-permeable ligands and a detachable coating. Colloid Surf B 49, 15-21. Malik N, Wiwattanapatapee R, Klopsch R, Lorenz K, Frey H, Weener JW, Meijer EW, Paulus W and Duncan R (2000) Dendrimers: Relationship between structure and biocompatibility in vitro, and preliminary studies on the biodistribution of 125I-labelled polyamidoamine dendrimers in vivo. J Controlled Release 65, 133-148. Mammen M, Choi S and Whitesides GM (1998) Polyvalent Interactions in Biological Systems: Implications for Design and Use of Multivalent Ligands and Inhibitors. Angew Chem, Int Ed 37, 2754-2794. Marchi-Artzner V, Jullien L, Gulik-Krzywicki T and Lehn J-M (1997) Molecular recognition induced aggregation and fusion between vesicles containing lipids bearing complementary hydrogen bonding head groups. Chem Commun (Cambridge) 1, 117-118. Marchi-Artzner V, Gulik-Krzywicki T, Guedeau-Boudeville MA, Gosse C, Sanderson JM, Dedieu JC and Lehn JM (2001) Selective adhesion, lipid exchange and membrane-fusion processes between vesicles of various sizes bearing complementary molecular recognition groups. ChemPhysChem 2, 367-376. Mouritsen OG and Jørgensen K (1992) Dynamic lipid-bilayer heterogeneity - a mesoscopic vehicle for membrane-function. BioEssays 14, 129-136. Mouritsen OG and Jørgensen K (1994) Dynamical order and disorder in lipid bilayers. Chem Phys Lipids 73, 3-25. Muscat D and van Benthem RATM (2001) Hyperbranched polyesteramides - New dendritic polymers. Top Curr Chem 212, 41-80. Needham D and Kim DH (2000) PEG-covered lipid surfaces: bilayers and monolayers. Colloids Surf B 18, 183-195. Newkome GR, Moorefield CN and Vögtle F (2001) Dendrimers and Dendrons. Concepts, Syntheses, Perspectives. WileyVCH, Weinheim, Germany, and references cited therein. Noppl-Simson DA and Needham D (1996) Avidin-biotin interactions at vesicle surfaces: Adsorption and binding, cross-bridge formation, and lateral interactions. Biophys J 70, 1391-1401. Ohsaki M, Okuda T, Wada A, Hirayama T, Niidome T and Aoyagi H (2002) In vitro gene transfection using dendritic poly(L-lysine). Bioconjugate Chem 13, 510-517. Onda M, Yoshihara K, Koyano H, Ariga K and Kunitake T (1996) Molecular recognition of nucleotides by the guanidinium unit at the surface of aqueous micelles and bilayers. A comparison of microscopic and macroscopic interfaces. J Am Chem Soc 118, 8524-8530. Paleos CM, Sideratou Z and Tsiourvas D (1996) Mixed vesicles of didodecyldimethylammonium bromide with recognizable moieties at the interface. J Phys Chem 100, 13898-13900. Paleos CM, Sideratou Z and Tsiourvas D (2001) Molecular recognition of complementary liposomes in modeling cellcell recognition. ChemBioChem 2, 305-310. Paleos CM, Tsiourvas D, Sideratou Z and Tziveleka L (2004) Acid- and salt-triggered multifunctional poly(propylene imine) dendrimer as a prospective drug delivery system. Biomacromolecules 5, 524-529. Paleos CM and Tsiourvas D (2006) Interaction between complementary liposomes: a process leading to multicompartment systems formation. J Mol Recognit 19,

60-67. Paleos CM, Tsiourvas D and Sideratou Z (2007) Molecular engineering of dendritic polymers and their application as drug and gene delivery systems. Mol. Pharmaceutics 4, 169-188. Pantos A, Sideratou Z and Paleos CM (2002) Complementary liposomes based on phosphatidylcholine: Interaction effectiveness vs protective coating. J Colloid Interface Sci 253, 435-442. Pantos A, Tsiourvas D, Sideratou Z and Paleos CM (2004) Interactions of complementary PEGylated liposomes and characterization of the resulting aggregates. Langmuir 20, 6165-6172. Pantos A, Tsiourvas D, Paleos CM and Nounesis G (2005a) Enhanced drug transport from unilamellar to multilamellar liposomes induced by molecular recognition of their lipid membranes. Langmuir 21, 6696-6702. Pantos A, Tsiourvas D, Nounesis G and Paleos CM (2005b) Interaction of Functional Dendrimers with Multilamellar Liposomes: Design of a Model System for Studying Drug Delivery. Langmuir 21, 7483-7490. Prochiantz, A. (2000) Messenger proteins: homeoproteins, TAT and others. Curr Opin Cell Biol 12, 400-406. Roberts MJ, Bentley MD and Harris JM (2002) Chemistry for peptide and protein PEGylation. Adv Drug Delivery Rev 54, 459-476. Schlüter AD and Rabe JP (2000) Dendronized Polymers: Synthesis, Characterization, Assembly at Interfaces, and Manipulation. Angew Chem, Int Ed 39, 864-883. Sideratou Z, Tsiourvas D, Paleos CM, Tsortos A and Nounesis G (2000) Molecular recognition of complementary liposomes: The enhancing role of cholesterol. Langmuir 16, 9186-9191. Sideratou Z, Tsiourvas D and Paleos CM (2001) Solubilization and release properties of PEGylated diaminobutane poly(propylene imine) dendrimers. J Colloid Interface Sci 242, 272-276. Sideratou Z, Tsiourvas D, Paleos CM, Tsortos A, Pyrpassopoulos S and Nounesis G (2002a) Interaction of phosphatidyl choline based liposomes functionalized at the interface with adenine and barbituric acid moieties. Langmuir 18, 829-835. Sideratou Z, Foundis J, Tsiourvas D, Nezis IP, Papadimas G and Paleos CM (2002b) A novel dendrimeric "glue" for adhesion of phosphatidyl choline-based liposomes. Langmuir 18, 5036-5039. Sideratou Z, Tziveleka LA, Kontoyianni C, Tsiourvas D and Paleos CM (2006) Design of functional dendritic polymers for application as drug and gene delivery systems. Gene Ther Mol Biol 10, 71-94. Siegers C, Biesalski M and Haag R (2004) Self-assembled monolayers of dendritic polyglycerol derivatives on gold that resist the adsorption of proteins. Chem Eur J 10, 2831-2838. Stiriba S-E, Frey H and Haag R (2002) Dendritic Polymers in Biomedical Applications: From Potential to Clinical Use in Diagnostics and Therapy. Angew Chem, Int Ed 41, 13291334. Sunder A, Krämer M, Hanselmann R, Mühlaupt R and Frey H (1999a) Molecular Nanocapsules Based on Amphiphilic Hyperbranched Polyglycerols. Angew Chem, Int Ed 38, 3552-3555. Sunder A, Quincy M-F, Mülhaupt R and Frey H (1999b) Hyperbranched Polyether Polyols with Liquid Crystalline Properties. Angew Chem, Int Ed 38, 2928-2930. Sunder A, Mülhaupt R and Frey H (2000a) Hyperbranched Polyether-Polyols Based on Polyglycerol: Polarity Desigh by Block Copolymerisation with Propylene Oxide. Macromolecules 33, 309-314. Sunder A, Mülhaupt R, Haag R and Frey H (2000b)

130

Gene Therapy and Molecular Biology Vol 11, page 131 Hyperbranched polyether polyols: A modular approach to complex polymer architectures. Adv Mater 12, 235-239. Svenson S and Tomalia DA (2005) Dendrimers in biomedical applications—reflections on the field. Adv Drug Delivery Rev 57, 2106- 2129. Tanaka T and Yamazaki M (2004) Membrane fusion of giant unilamellar vesicles of neutral phospholipid membranes induced by La3+. Langmuir 20, 5160-5164. Thewalt JL and Bloom M (1992) Phosphatidylcholine cholesterol phase-diagrams. Biophys J 63, 1176-1181. Tomalia DA (2005) The dendritic state. Mater Today 8, 34-36. Trandum C, Westh P, Jørgensen K and Mouritsen OG (2000) A thermodynamic study of the effects of cholesterol on the interaction between liposomes and ethanol. Biophys J 78, 2486-2492. Tsogas I, Tsiourvas D, Nounesis G and Paleos CM (2006) Modelling cell membrane transport: Interaction of guanidylated poly(propylene imine) dendrimers with a liposomal membrane consisting of phosphate based lipids, Accepted. Tziveleka L-A, Kontoyianni C, Sideratou Z, Tsiourvas D and Paleos CM (2006) Novel functional hyperbranched polyether polyols as prospected drug delivery systems. Macromol Biosci 6, 161-169. Tziveleka L-A, Psarra AMG, Tsiourvas D and Paleos CM (2007) Synthesis and characterization of guanidinylated

poly(propylene imine) dendrimers as gene transfection agents. J Controlled Release 117, 137-146. Veronese FM (2001) Peptide and protein PEGylation: a review of problems and solutions. Biomaterials 22, 405-417. Vivès E, Brodin P and Lebleu B (1997) A truncated HIV-1 Tat protein basic domain rapidly translocates through the plasma membrane and accumulates in the cell nucleus. J Biol Chem 272, 16010-16017. Vögtle F, Gestermann S, Hesse R, Schwierz H and Windisch. B (2000) Functional dendrimers. Prog Polym Sci 25, 9871041. Voit BI (2003) Hyperbranched polymers: a chance and a challenge. C R Chim 6, 821-832. Vonarbourg A, Passirani C, Saulnier P, Benoit J-P (2006) Parameters influencing the stealthiness of colloidal drug delivery systems. Biomaterials 27, 4356-4373. Wender PA, Mitchell DJ, Pattabiraman K, Pelkey ET, Steinman L and Rothbard JB (2000) The design, synthesis, and evaluation of molecules that enable or enhance cellular uptake: Peptoid molecular transporters. Proc Natl Acad Sci USA 97, 13003-13008. Wright LR, Rothbard JB and Wender PA (2003) Guanidinium rich peptide transporters and drug delivery. Curr Prot Pept Sci 4, 105-124.

131

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles

132

Gene Therapy and Molecular Biology Vol 11, page 117 Gene Ther Mol Biol Vol 11, 117-132, 2007

Developing and applying a drug delivery model for liposomal and dendritic multifunctional nanoparticles Review Article

Constantinos M. Paleos*, Dimitris Tsiourvas, Zili Sideratou Institute of Physical Chemistry, NCRC â&#x20AC;&#x153;Demokritos, 15310 Aghia Paraskevi, Attiki, Greece

Figure 1. Schematic representation of a multifunctional liposome (left) and dendrimer (right).

118

Figure 2. Chemical structures of amphiphilic derivatives of barbituric acid (BAR) and triaminopyrimidine (TAP).

119

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles

Figure 5. Chemical structures of 5,5-didodecylbarbituric acid (DBA) and 9-hexadecyladenine (HA) and the interaction scheme between the complementary barbituric and adenine groups.

121

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles

Figure 6. Chemical structures of octadecylguanidine hydrochloride (ODG), N-[3-(octadecylamino)propyl] guanidine hydrochloride (ODPG) and N-[3-(dioctadecylamino)propyl] guanidine hydrochloride (DOPG).

122

Gene Therapy and Molecular Biology Vol 11, page 123

123

Figure 12. Chemical structure of the drugs doxorubicin, ADR, methotrexate, MTX, betamethasone valerate, BV, and betamethasone dipropionate, BD.

124

Table 1. Drug transport from the unilamellar to the multilamellar liposomes. Reproduced from Pantos et al, 2005a with kind permission from American Chemical Society. Composition of

DXR

!"#

unilamellar liposomes

% transfer

PC-CHOL

17.1±2.9

PC-CHOL-PEG

12.5±3.4

PC-CHOL-ODPG

70.5±3.9

94.9±3.1

PC-CHOL-ODPG-PEG

60.9±2.3

82.5±3.9

125

Figure 13. Chemical structure of dendritic polymers.

126

Figure 14. Reaction scheme for multifunctional dendrimeric derivative.

127

the

synthesis

Figure 15. Multi-functionalization reaction scheme of fourth generation poly(propylene imine) dendrimer.

Acknowledgements The work was partially supported by Dendrigen SA, Athens, Greece.

Drug

Dendrimer DAB-G0 DAB-G6 DAB-G12 DAB-G0 DAB-G6 DAB-G12

Drug transfer (%) in aggregates Phosphate Water Buffer 24.4±2.4 19.8±1.2 62.5±1.9 48.5±1.6 84.5±2.1 68.4±1.5 32.9±2.0 27.1±1.0 59.0±1.5 39.5±2.1 78.1±2.3 57.5±2.0

128

Drug transfer (%) after redispersion Phosphate Water Buffer 15.8±0.9 12.1±1.1 28.1±1.7 24.5±1.3 45.1±1.8 40.0±1.4 15.9±1.2 14.1±0.9 29.0±1.0 26.1±1.5 42.0±1.5 38.2±1.2

129

130

131

Paleos et al: Drug delivery model for liposomal and dendritic multifunctional nanoparticles

132

Gene Therapy and Molecular Biology Vol 11, page 133 Gene Ther Mol Biol Vol 11, 133-142, 2007

In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells Research Article

M. Waheed Roomi, Vadim Ivanov, Tatiana Kalinovsky, Aleksandra Niedzwiecki*, Matthias Rath Dr. Rath Research Institute, Oncology, 1260 Memorex Drive, Santa Clara, CA 95050

__________________________________________________________________________________ *Correspondence: Aleksandra Niedzwiecki, Dr. Rath Research Institute, Oncology, 1260 Memorex Drive, Santa Clara, CA 95050, USA; Tel: 408-807-5564; Fax: 408-567-5030; E-mail: author@drrath.com Key words: rhabdomyosarcoma, apoptosis, MMPs, Matrigel invasion, nutrients, green tea extract, ascorbic acid, lysine Abbreviations: Matrix metalloproteinases, (MMPs); nitric oxide, (NO); phosphate buffered saline, (PBS); Rhabdomyosarcoma, (RMS) Received: 29 March 2007; Revised: 16 May 2007 Accepted: 22 May 2007; electronically published: June 2007

Summary Rhabdomyosarcoma, the most common pediatric soft tissue sarcoma of mesenchymal origin, has metastasized in ~25% of all patients at time of diagnosis. Though current treatment strategies have achieved some success, they are associated with severe adverse effects. We investigated the effect of a nutrient mixture (NM), which has shown antitumor effects on various cancer cell lines, on rhabdomyosarcoma cell growth, apoptosis, MMP secretion, and invasion. Human rhabdomyosarcoma cells, grown in DME, were treated at near confluence with NM at 0, 10, 50, 100, 500 and 1000 µg/ml in triplicate at each dose. MMP secretion was studied by zymography, viability by MTT assay, cell invasion through Matrigel, and morphology and apoptosis by H&E staining and live green caspase kit. Zymography demonstrated MMP-2 secretion and PMA-induced MMP-9 secretion. NM inhibited the secretion of both MMPs in a dose-dependent fashion, with virtual total inhibition at 500 µg/ml NM. Cell invasion through Matrigel was inhibited at 10, 50, 100 and 500 µg/ml by 75%, 80%, 92% and 100% (p=0.02) respectively. NM was slightly toxic at 1000 µg/ml (20% over control, p=0.016) to rhabdomyosarcoma cells. Cells exposed to NM showed dose-dependent apoptosis with 90% of cells in late apoptosis at 1000 µg/ml. These results suggest that NM has potential in the treatment of rhabdomyosarcoma by inducing cell apoptosis and inhibiting cell invasion and MMP secretion without toxic effects.

in infants (Mandell et al, 1990). Pleomorphic RMS is usually seen in adults and arises in the muscles of the extremities. At diagnosis, roughly 50% of cases consist of patients aged five and younger and 25% of all patients have metastatic disease (Koscielniak et al, 1992). Standard multimodality treatment approaches developed through such trials as the Intergroup Rhabdomyosarcoma Study Group (IRSG) include surgery, radiation therapy, and chemotherapy. The use of neoadjunctive therapy has increased survival in patients with localized disease to 60% five-year survival (Stevens et al, 2005); however, complications resulting from therapy are serious and can be life threatening. Additionally, clinical trials focused on three or five-year event-free survival does not adequately address the needs of pediatric cancer patients. Toxicities and delayed effects of treatment not present during treatment can manifest later as a result of growth and development. Patients with

I. Introduction Rhabdomyosarcoma (RMS), a soft tissue tumor of skeletal muscle origin is the third most common extracranial solid childhood neoplasm with approximately 250 new cases diagnosed each year in the United Sates (Kramer, 1983). While tumors can appear at numerous locations, the primary sites are: the head and neck (35%), the genitourinary tract (22%), and the extremities (18%) (Barr, 1997). There are two main histological types of pediatric RMS: embryonic RMS and alveolar RMS. Embryonal RMS is more prevalent, contributing to roughly 53% of all diagnosed cases; it generally presents in children under fifteen in either the head and neck region or the genitourinary tract (Parham, 2001). Alveolar RMS generally affects the muscles of the extremities or trunk and has been found to be more resistant to treatment and more likely to spread to regional lymph nodes than embryonal RMS and the botryoid variant commonly found 133

Roomi et al: In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells primary tumor sites at the bladder or prostate treated with radiation have been found to be at an increased risk of developing bowel complications, poor bladder function, hemorrhagic cystitis, and sex hormone deficiency (Raney et al, 1993). Ifosfamide (high dose) can lead to renal Fanconiâ&#x20AC;&#x2122;s syndrome with glycosuria, phosphaturia and aminoaciduria (Skinner, 2003). Cyclophosphamide can increase the risk of hepatic dysfunction and lead to early menopause in young women (Sklar, 2005). Anthracyclines cause myocardial cell death and have been implicated in cardiac failure and fatal arrhythmia ten to twenty years after administration (Iarussi et al, 2005). Adriamycin can increase the risk of "late" cardiomyopathy (Lipshultz et al, 1991). Cisplatin is known to cause glomerular and tubular injury (Taguchi et al, 2005). Radiation therapy contributes to tubular damage and hypertension associated with renal artery stenosis (Moulder and Cohen, 2005). Localized radiotherapy is associated with hypoplasia with asymmetry most apparent during pubertal development (Denys et al, 1998). Cranial irradiation affects the hypothalamic-pituitary axis leading to the early onset of puberty and subsequently thwarts ultimate height (Darzy and Shalet, 2005). Children under age five are particularly sensitive to central nervous system irradiation and chemotherapy, which can impair their attention, memory and motor skills, having a profound effect on their educational and occupational success (Monje and Palmer, 2003). The most serious late effect of current treatment is the development of a second malignant neoplasm; childhood cancer survivors have an 8-10% risk within 20 years (Sung et al, 2004) and the risk of developing second malignancies is particularly high among patients who received combined modality therapy (Cohen et al, 2005). Given this data, it is clear that current treatment brings limited benefit to patients, which compels the need for new agents aimed at specific targets involved in metastatic behavior, that are not injurious to the health of the patient. It is now well documented that the family of zincdependent endoproteinases, matrix metalloproteinases (MMPs), facilitate tumor cell invasion and metastasis through: removal of physical barriers to invasion, degradation of extracellular matrix (ECM) macromolecules, and modulation of cell adhesion and activation of ECM components to expose hidden biologic activities. Such has prompted researchers to design therapies that inhibit MMP activity to prevent metastasis. Rath and Pauling proposed that natural inhibitors, such as lysine and ascorbic acid, have the potential to inhibit tumor growth and expansion through the modulation of ECM proteolysis and optimization of connective tissue integrity (Rath and Pauling, 1992). Our previous studies have demonstrated significant antitumoral activity of the nutrient mixture containing lysine, proline, ascorbic acid and green tea extract against a large number of cancer cell lines in vitro (Roomi et al, 2005a,b,c) and in vivo (Roomi et al, 2005d,e,f). In the current study, we investigated the effect of NM on human rhabdomyosarcoma cells by measuring cell proliferation, apoptosis, modulation of MMP-2 and MMP9 secretion, and cancer cell invasive potential.

II. Materials and methods A. Cell Culture Embryonal rhabdomyosarcoma cells (CCL-136RD) obtained from ATCC (American Type Culture Collection, Rockville, MD), were grown in DME media, supplemented with 10% fetal bovine serum, penicillin (100 U/ml) and streptomycin (100 mg/ml) in 24-well tissue culture plates (Costar, Cambridge, MA). Cells were incubated with 1 ml of media at 370 C in a tissue culture incubator equilibrated with 95% air and 5% CO2. At near confluence, the cells were treated with the nutrient mixture, dissolved in media and tested at 0, 10, 50, 100, 500, and 1000 Âľg/ml in triplicate at each dose. Cells were also treated with phorbol 12-myristate 13-acetate (PMA) 200ng/ml to induce MMP-9 secretion. The plates were then returned to the incubator.

B. MTT Assay Cell viability was evaluated by [3-(4,5-dimethylthiazol-2yl) 2,5-diphenyl tetrazolium bromide] (MTT) assay, a colorimetric assay based on the ability of viable cells to reduce a soluble yellow tetrazolium salt MTT to a blue formazan crystal by mitochondrial succinate dehydrogenase activity of viable cells. This test is a good index of mitochondrial activity and thus of cell viability. After 24 h incubation, the cells were washed with phosphate buffered saline (PBS) and 500 !l of MTT (Sigma #M-2128) 0.5 mg/ml in media was added to each well. After MTT addition (0.5mg/ml) the plates were covered and returned to the 370C incubator for 2h, the optimal time for formazan product formation. Following incubation, the supernatant was carefully removed from the wells, the formazan product was dissolved in 1ml DMSO, and absorbance was measured at 570 nm in Bio Spec 1601, Shimadzu spectrometer. The OD570 of the DMSO solution in each well was considered to be proportional to the number of cells. The OD570 of the control (treatment without supplement) was considered 100%.

C. Gelatinase zymography MMP activity in conditioned media was determined by gelatinase zymography. Gelatinase zymography was performed in 10% Novex precast SDS-polyacrylamide gel (Invitrogen Corporation) in the presence of 0.1% gelatin under non-reduced conditions. Culture media (20 !l) mixed with sample buffer was loaded and SDS-PAGE was performed with tris glycine SDS buffer as described by the manufacturer (Novex). Samples were not boiled before electrophoresis. Following electrophoresis the gels were washed twice in 2.5% Triton X-100 for 30 minutes at room temperature to remove SDS. The gels were then incubated at 370 C overnight in substrate buffer containing 50 mM TrisHCl and 10 mM CaCl2 at pH 8.0 and stained with 0.5% Coomassie Blue R250 in 50% methanol and 10% glacial acetic acid for 30 minutes and destained. Protein standards were run concurrently and approximate molecular weights were determined by plotting the relative mobilities of known proteins. Gelatinase zymograms were scanned using CanoScan 9950F Canon scanner at 1200 dpi. The intensity of the bands was evaluated using a pixel-based densitometer program Un-Scan-It, Version 5.1, 32-bit, by Silk Scientific Corporation (Orem, UT, USA), at a resolution of 1 Scanner Unit (1/100 of an inch for an image that was scanned at 100 dpi), and expressed as a percentage of control. The R2 value (0 to 1), which represents how well the line of best fit falls on the dependent data, with R2 = 1.0 being the best possible fit, was determined.

D. Matrigel invasion Invasion studies were conducted using Matrigel (Becton Dickinson) inserts in 24-well plates. Suspended in medium, rhabdomyosarcoma cells were supplemented with nutrients, as specified in the design of the experiment and seeded on the insert

134

Gene Therapy and Molecular Biology Vol 11, page 135 in the well. Thus both the medium on the insert and in the well contained the same supplements. The plates with the inserts were then incubated in a culture incubator equilibrated with 95% air and 5% CO2 for 24 hours. After incubation, the media from the wells were withdrawn. The cells on the upper surface of the inserts were gently scrubbed away with cotton swabs. The cells that had penetrated the Matrigel membrane and migrated onto the lower surface of the Matrigel were stained with Hematoxylin and Eosin and visually counted under the microscope.

slight significant toxicity (20% over control, p=0.016) to RMS cells, as shown in Figure 1.

B. Gelatinase zymography study Zymography demonstrated secretion of MMP-2 by unstimulated cells. Treatment of rhabdomyosarcoma cells with PMA (200 ng/ml) induced MMP-9 activity. NM inhibited secretion of both MMPs in a dose-dependent fashion with virtual total inhibition at 500 µg/ml, as shown in Figures 2A and 2B. Densitometry analysis on relative activity of MMP-2 showed 18% inhibition at 50 µg/ml, 45% at 100 µg/ml and 99% at 500 µg/ml NM, with R2 = 0.8443 (Figure 2C). For MMP-9, relative activity per densitometry revealed 20% inhibition at 50 µg/ml, 46% at 100 µg/ml and 98% at 500 µg/ml NM, with R2 = 0.8875 (Figure 2D).

E. Morphology and apoptosis Morphology of cells cultured for 24h in test concentrations of NM were evaluated by H&E staining and observed and photographed by microscopy. At near confluence, rhabdomyosarcoma cells were challenged with NM dissolved in media at 0, 100, 500, and 1000 µg/ml and incubated for 24 h. The cell culture was washed with PBS and treated with the caspase reagent as specified in the manufacturer’s protocol (Molecular Probes Image-IT™ Live Green Poly Caspases Detection Kit 135104, Invitrogen). The cells were photographed under a fluorescence microscope and counted. Green-colored cells represent viable cells, while yellow orange represents early apoptosis and red late apoptosis.

C. Invasion study NM significantly reduced the invasion of rhabdomyosarcoma cells through Matrigel in a dosedependent fashion, with 75% inhibition at 10 µg/ml, 80% at 50 µg/ml, 92% at 100 µg/ml, and 100% at 500 µg/ml NM (p=0.02), as shown in Figure 3.

F. Composition of NM Stock solution of the nutrient mixture prepared for testing was composed of the following in the ratio indicated: Vitamin C (as ascorbic acid and as Mg, Ca, and palmitate ascorbate) 700 mg; L-lysine 1000 mg; L-proline 750 mg; L-arginine 500 mg; Nacetyl cysteine 200 mg; standardized green tea extract 1000 mg (green tea extract derived from green tea leaves was obtained from US Pharma Lab. The certificate of analysis indicates the following characteristics: total polyphenol 80%, catechins 60%, EGCG 35%, and caffeine 1.0%); selenium 30 !g; copper 2 mg; manganese 1mg.

D. Morphology (H&E staining) and apoptosis (live green caspases detection kit) H&E staining showed no morphological changes at 100 µg/ml NM, but apoptotic cells were evident at 500 and 1000 µg/ml, as shown in Figures 4A-F. The apoptotic cells showed shrinkage with condensed and darkly stained nuclei and strongly acidophilic cytoplasm. Using the live green caspase kit, dose-dependent apoptosis of pediatric rhabdomyosarcoma cells was evident with NM challenge, as shown in Figures 5A-E. Few apoptotic cells were observed in those cells exposed to 100 µg/ml NM; the number of apoptotic cells increased significantly in a dosedependent manner at 250 µg/ml - 1000 µg/ml NM.

G. Statistical analysis The results were expressed as means + SD for the groups. Data was analyzed by independent sample “t” test.

III. Results A. Cell viability study NM demonstrated insignificant effect on RMS cells at 10 µg/ml – 500 µg/ml. At 1000 µg/ml NM showed

Figure 1. Effect of the NM on growth of rhabdomyosarcoma cells: 24h MTT assay. NM demonstrated insignificant effect on RMS cells at 10 µg/ml – 500 µg/ml. At 1000 µg/ml NM showed slight significant toxicity (20% over control, p=0.016) to RMS cells.

135

Roomi et al: In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells

Figure 2. Effect of NM on MMP-2 and MMP-9 secretion by untreated rhabdomyosarcoma cells (A) and by PMA (200 ng/ml)-treated cells (B). Legend 1 – Markers, 2Control, 3-7 NM 10, 50, 100, 500, 1000 µg/ml. Zymography demonstrated secretion of MMP-2 and PMA - induced MMP-9 activity. Densitometry Analysis. Densitometry analysis on relative activity of MMP-2 showed 18% inhibition at 50 µg/ml, 45% at 100 µg/ml and 99% at 500 µg/ml NM, with R 2 = 0.8443 (C). For MMP-9, relative activity per densitometry revealed 20% inhibition at 50 µg/ml, 46% at 100 µg/ml and 98% at 500 µg/ml NM, with R 2 = 0.8875 (D).

Figure 3. Effect of NM on rhabdomyosarcoma Matrigel invasion. NM significantly reduced the invasion of rhabdomyosarcoma cells through Matrigel in a dosedependent fashion, with 75% inhibition at 10 µg/ml, 80% at 50 µg/ml, 92% at 100 µg/ml, and 100% at 500 µg/ml NM (p=0.02).

136

Gene Therapy and Molecular Biology Vol 11, page 137

Figure 4. Effect of NM on rhabdomyosarcoma morphology (H&E staining): A – Control, B – NM 10 µg/ml, C – NM 50 µg/ml, D - 100 µg/ml, E - 500 µg/ml, F – 1000 µg/ml. H&E staining showed no morphological changes at 100 µg/ml NM, but apoptotic cells were evident at 500 and 1000 µg/ml. The apoptotic cells showed shrinkage with condensed and darkly stained nuclei and strongly acidophilic cytoplasm. Typical apoptotic cells indicated with arrows in E and F.

137

Roomi et al: In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells

Figure 5. Effect of NM on rhabdomyosarcoma apoptosis (live green caspase detection kit): A – Control, B – NM 50 µg/ml, C – NM 100 µg/ml, D – NM 250 µg/ml, E – NM 500 µg/ml, 5F – NM 1000 µg/ml. Slight apoptosis of rhabdomyosarcoma cells was observed in cells exposed to 100 µg/ml, moderate at 250 µg/ml and profound at 500 and 1000 µg/ml NM.

Quantitative analysis of live, early and late apoptotic cells is shown in Figure 6. At 100 µg/ml NM, 95% of cells are viable and 5% apoptotic and at 250µg/ml NM 45% of cells are viable, 12% in early apoptosis, and 40% in late apoptosis. RMS cell apoptosis was further increased in

cells exposed to 500 µg/ml NM: 28% viable, 16% early apoptosis, and 60% late apoptosis. Virtually all cells exposed to 1000 µg/ml NM were in late apoptosis: 10% early apoptosis and 90% late apoptosis.

138

Gene Therapy and Molecular Biology Vol 11, page 139

Figure 6. Effect of NM on rhabdomyosarcoma apoptosis (live green caspase detection kit): % of cells in various stages of apoptosis at NM 0, 50, 100, 250, 500, and 1000 µg/ml. At 100 µg/ml NM, 95% of cells are viable and 5% apoptotic and at 250µg/ml NM 46% of cells are viable, 13% in early apoptosis, and 41% in late apoptosis. RMS cell apoptosis was further increased in cells exposed to 500 µg/ml NM: 28% viable, 14% early apoptosis, and 58% late apoptosis. Virtually all cells exposed to 1000 µg/ml NM were in late apoptosis: 10% early apoptosis and 90% late apoptosis.

and optimum structure of collagen fibers. Manganese and copper are also essential cofactors in collagen formation process. Collagen stability can be controlled by lysine (Rath and Pauling, 1992) and also by N-acetyl cysteine through its inhibitory effect on MMP-9 activity (Kawakami et al, 2001) and invasive activities of tumor cells (Morini et al, 1999). Also, selenium has been shown to interfere with MMP expression and tumor invasion (Yoon et al, 2001), as well as migration of endothelial cells through ECM (Morini et al, 1999). Ascorbic acid has been shown to inhibit cell division and growth through production of hydrogen peroxide (Chen et al, 2005). Green tea extract has shown to be a promising agent in controlling angiogenesis, metastasis, and other aspects of cancer progression (Hare, 2001; Landau, 1998; Yang, 1998). Since arginine is a precursor of nitric oxide (NO), any deficiency of arginine can limit the production of NO, which has been shown to predominantly act as an inducer of apoptosis, as in the case of breast cancer cells (Cooke and Dzau, 1997). Based on the evidence available in literature and our own research, we have postulated that metabolic effects of a combination of ascorbic acid, lysine, proline, green tea extract, arginine, N-acetyl cysteine, selenium, copper and manganese would result from their synergy. For example, we found that a combination of ascorbic acid, lysine and proline used with EGCG enhanced the anti-invasive activity of 20 µg/ml EGCG to that of 50 µg/ml (Roomi et al, 2004). Thus by including nutrients like N-acetyl cysteine, arginine, selenium, manganese and copper in addition to ascorbic acid, proline, lysine and EGCG we could obtain significant reduction in cell invasion at a much lower concentration of EGCG. Clearly, while five-year survival has improved with current multimodality pediatric rhabdomyosarcoma treatment, the associated toxicities are significant and can be fatal to the patient in later life. Likewise mutagenic

IV. Discussion The nutrient mixture demonstrated significant inhibition of human rhabdomyosarcoma cell invasive parameters in vitro. Matrigel invasion and MMP-2 and MMP-9 secretion of rhabdomyosarcoma cells decreased in a dose-dependent fashion with complete inhibition of MMP-2 and -9 at 500 µg/ml, and of Matrigel invasion at 500 µg/ml, demonstrating strong antimetastatic potential. In addition NM demonstrated dose-dependent proapoptotic effects on rhabdomyosarcoma cells and profound induction of apoptosis and morphological changes at 500 µg/ml. Matrix metalloproteinases (MMPs) have been implicated in the destruction of the extracellular matrix, neovascularization, tumor spread and metastases, and recent studies have shown overexpression of MMPs is associated with poor prognosis in cancer patients. Due to this, new treatment approaches have targeted universal pathomechanisms involved in cancer progression, such as control of proteolytic activity of the ECM as a potential strategy against cancer progression. A recent study reported that a high level of MMP-2 protein may contribute to the metastatic phenotype of aRMS showing potential for MMP-2 inhibition in the treatment of the aggressive alveolar subtype of rhabdomyosarcoma (Diomedi-Carnassei, 2004). While our study did not examine the effect of the nutrient mixture on inhibition of MMP-2 expression on the aRMS, MMP-2 secretion in the embryonal RMS cells was completely abolished at 500 µg/ml NM. The nutrient mixture was formulated based on targeting different physiological processes involved in cancer progression and metastasis. For example, the ECM integrity is dependent upon adequate collagen formation and its stability. In this aspect, ascorbic acid and the amino acids lysine and proline are necessary for the formation

139

Roomi et al: In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells Mandell L, Ghavimi F, LaQuaglia M, Exelby P (1990) Prognostic significance of regional lymph node involvement in childhood extremity rhabdomyosarcoma. Med Pediatr Oncol 18, 466-71. Monje ML, Palmer T (2003) Radiation injury and neurogenesis. Curr Opin Neurol 16, 129-34. Morini M, Cai T, Aluigi MG, Noonan DM, Masiello L, De For a S, D’Agostini F, Albini A, Fassina G (1999) The role of the thiol N-acetyl cysteine in the prevention of tumor invasion and angiogenesis. Int J Biol Markers 14, 268-271. Moulder JE, Cohen EP (2005) Radiation-induced multi-organ involvement and failure: the contribution of radiation effects on the renal system. BJR Suppl 27, 82-8. Parham DM (2001) Pathologic classification of rhabdomyosarcomas and correlations with molecular studies. Mod Pathol 14, 506-14. Raney B, Heyn R, Hays DM, Tefft M, Newton WA Jr, Wharam M Vassilopoulou-Sellin R, Maurer HM (1993) Sequelae of treatment in 109 patients followed for 5 to 15 years after diagnosis of sarcoma of the bladder and prostate. A report from the Intergroup Rhabdomyosarcoma Study Committee. Cancer 71, 2387-2394. Rath M and Pauling L (1992) Plasmin-induced proteolysis and the role of apoprotein, lysine and synthetic analogs. Orthomolecular Medicine 7, 17-23. Roomi MW Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2004) Synergistic antitumor effect of ascorbic acid, lysine, proline, and epigallocatechin gallate on human fibrosarcoma cells HT-1080. Annals of Cancer Research and Therapy 12, 148-157. Roomi MW, Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2005) Antitumor effect of nutrient synergy on human osteosarcoma cells U-2OS, MNNG-HOS and Ewing's sarcoma SK-ES.1. Oncol Rep 13, 253-7. Roomi MW, Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2005) In vitro and in vivo antitumorigenic activity of a mixture of lysine, proline, ascorbic acid, and green tea extract on human breast cancer lines MDA-MB-231 and MCF-7. Med Oncol 22, 129-38. Roomi MW, Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2005) Antitumor effect of a combination of lysine, proline, arginine, ascorbic acid, and green tea extract on pancreatic cancer cell line MIA PaCa-2. Int J Gastrointest Cancer 35, 97-102. Roomi MW, Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2005) In vivo antitumor effect of ascorbic acid, lysine, proline and green tea extract on human colon cancer cell HCT 116 xenografts in nude mice: evaluation of tumor growth and immunohistochemistry. Oncol Rep 13, 421-5. Roomi MW, Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2005) In vivo antitumor effect of ascorbic acid, lysine, proline and green tea extract on human prostate cancer PC-3 xenografts in nude mice: evaluation of tumor growth and immunohistochemistry. In Vivo 19, 179-83. Roomi MW, Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M (2005) Modulation of N-methyl-N-nitrosourea induced mammary tumors in Sprague–Dawley rats by combination of lysine, proline, arginine, ascorbic acid and green tea extract. Breast Cancer Research 7, R291-R295. Skinner R (2003) Chronic ifosfamide nephrotoxicity in children. Med Pediatr Oncol 41, 190-7. Sklar C (2005) Maintenance of ovarian function and risk of premature menopause related to cancer treatment. J Natl Cancer Inst Monogr 34, 25-7. Stevens MC, Rey A, Bouvet N, Ellershaw C, Flamant F, Habrand JL, Marsden HB, Martelli H, de Toledo JS, Spicer RD, Spooner D, Terrier-Lacombe MJ, van Unnik A, Oberlin O (2005) Treatment of nonmetastatic rhabdomyosarcoma in

risks of radiation therapy and chemotherapy that lead to secondary malignancies necessitate clinical evaluation of novel agents aimed at specific targets involved in metastatic behavior. The nutrient mixture studied induced apoptosis and exerted a strong inhibitory effect on cell invasion and MMP-2 and MMP-9 secretion in human rhabdomyosarcoma cells. These results combined with our previous findings demonstrate significant anticancer potential of the specific nutrients tested, indicating further investigation in vivo.

Acknowledgments The research was funded by Dr. Rath Health Foundation, a non-profit organization.

References Barr FG (1997) Molecular genetics and pathogenesis of rhabdomyosarcoma. J Pediatr Hematol Oncol 19, 483-91. Chen Q, Espey MG, Krishna MC, Mitchell JB, Corpe CP, Buettner GR, Shacter E, Levine M (2005) Pharmacologic ascorbic acid concentrations selectively kill cancer cells: action as a pro-drug to deliver hydrogen peroxide to tissues. Proc Natl Acad Sci U S A 102, 13604-9. Cohen RJ, Curtis RE, Inskip PD, Fraumeni JF Jr (2005) The risk of developing second cancers among survivors of childhood soft tissue sarcoma. Cancer 103, 2391-6. Cooke JP, Dzau VJ (1997) Nitric oxide synthase: Role in the genesis of vascular disease. Annu Rev Med 48, 489-509. Darzy KH, Shalet SM (2005) Hypopituitarism after cranial irradiation. J Endocrinol Invest 28, 78-87. Denys D, Kaste SC, Kun LE, Chadhary MA, Bowman LC, Robbins KT (1998) The effects of radiation on craniofacial skeletal growth: a quantitative study. Int J Pediatr Otorhinolaryngol 45, 7-13. Diomedi-Camassei F, Boldrini R, Rava L, Donfancesco A, Boglino C, Messina E, Dominici C, Callea F (2004) Different pattern of matrix metalloproteinases expression in alveolar versus embryonal rhabdomyosarcoma. J Pediatr Surg 39, 1673-9. Hare Y (2001) Green tea: Health Benefits and Applications, Marcel Dekker, New York, Basel. Iarussi D, Indolfi P, Casale F, Martino V, Di Tullio MT; Calabrò R (2005) Anthracycline-induced cardiotoxicity in children with cancer: strategies for prevention and management. Pediatr Drugs 7, 67-76. Kawakami S, Kageyama Y, Fujii Y, Oshima H (2001) Inhibitory effects of N-acetyl cysteine on invasion and MMP 9 production of T24 human bladder cancer cells. Anticancer Res 21, 213-219. Koscielniak E, Rodary C, Flamant F Carli M, Treuner J, Pinkerton CR, Grotto P (1992) Metastatic rhabdomyosarcoma and histologically similar tumors in childhood: a retrospective European multi-center analysis. Med Pediatr Oncol 20, 209-14. Kramer S, Meadows AT, Jarrett P, Evans AE (1983) Incidence of childhood cancer: experience of a decade in a populationbased registry. J Natl Cancer Inst 70, 49-55. Landau JM, Wang ZY, Yang GY, Ding W, Yang CS (1998) Inhibition of spontaneous formation of lung tumors and rhabdomyosarcomas in A/J mice by black and green tea. Carcinogenesis 19, 501-7. Lipshultz SE, Colan SD, Gelber RD, Perez-Atayde AR, Sallan SE, Sanders SP (1991) Late cardiac effects of doxorubicin therapy for acute lymphoblastic leukemia in childhood. N Engl J Med 324, 80815.

140

Gene Therapy and Molecular Biology Vol 11, page 141 childhood and adolescence: third study of the International Society of Paediatric Oncology--SIOP Malignant Mesenchymal Tumor 89. J Clin Oncol. 23, 2618-28. Sung L, Anderson JR, Donaldson SS, Spunt SL, Crist WM Pappo AS (2004) Soft Tissue Sarcoma Committee of the Children's Oncology Group. Late events occurring five years or more after successful therapy for childhood rhabdomyosarcoma: a report from the Soft Tissue Sarcoma Committee of the Children's Oncology Group. Eur J Cancer 40, 1878-85.

Taguchi T, Nazneen A, Abid MR, Razzaque MS (2005) Cisplatin-associated nephrotoxicity and pathological events. Contrib Nephrol 148, 107-21. Yang CS, Yang GY, Landau JM, Kim S, Liao J (1998) Tea and tea polyphenols inhibit cell hyperproliferation, lung tumorigenesis, and tumor progression. Exp Lung Res 24, 629-39. Yoon SO, Kim MM, Chung AS (2001) Inhibitory effects of selenite on invasion of HT 1080 tumor cells. J Biol Chem 276, 20085-92.

141

Roomi et al: In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells

142

Gene Therapy and Molecular Biology Vol 11, page 133 Gene Ther Mol Biol Vol 11, 133-142, 2007

In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells Research Article

M. Waheed Roomi, Vadim Ivanov, Tatiana Kalinovsky, Aleksandra Niedzwiecki*, Matthias Rath Dr. Rath Research Institute, Oncology, 1260 Memorex Drive, Santa Clara, CA 95050

134

slight significant toxicity (20% over control, p=0.016) to RMS cells, as shown in Figure 1.

G. Statistical analysis The results were expressed as means + SD for the groups. Data was analyzed by independent sample “t” test.

III. Results A. Cell viability study NM demonstrated insignificant effect on RMS cells at 10 µg/ml – 500 µg/ml. At 1000 µg/ml NM showed

135

Roomi et al: In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells

136

Gene Therapy and Molecular Biology Vol 11, page 137

137

Roomi et al: In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells

138

Gene Therapy and Molecular Biology Vol 11, page 139

139

Acknowledgments The research was funded by Dr. Rath Health Foundation, a non-profit organization.

140

141

Roomi et al: In vitro anticarcinogenic effect of a nutrient mixture on human rhabdomyosarcoma cells

142

Gene Therapy and Molecular Biology Vol 11, page 143 Gene Ther Mol Biol Vol 11, 143-150, 2007

Transfection with glutathione-dependent dehydroascorbate reductase genes exerts cytoprotective effects against hydroperoxideinduced cell injury through vitamin C regeneration and oxidative-stress diminishment Research Article

Yasukazu Saitoh1, Yuriko Fukuoka1, Morimitsu Nishikimi2, Nobuhiko Miwa1,* 1

Laboratory of Cell-Death Control BioTechnology, Department of Life Sciences , Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, Shobara, Hiroshima 727-0023, Japan 2 Department of Biochemistry, Wakayama Medical University, Kimiidera, Wakayama 641-8509, Japan.

__________________________________________________________________________________ *Correspondence: Nobuhiko Miwa, Ph.D., Laboratory of Cell-Death Control BioTechnology Department of Life Sciences, Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, Nanatsuka 562, Shobara, Hiroshima 727-0023, Japan. Tel: +81824-74-1754; Fax: +81-824-74-0191; E-mail: miwa-nob@pu-hiroshima.ac.jp Key words: glutathione-dependent dehydroascorbate reductase, dehydroascorbic acid, ascorbic acid, reactive oxygen species, oxidative stress, cell death Abbreviations: 6-carboxy-2', 7'- dichlorodihydrofluorescein diacetate, di (acetoxymethyl ester), (CDCFH-DA); Chinese hamster ovary, (CHO); dehydroascorbic acid, (DehAsc); Dithiothreitol, (DTT); fluorescein isothiocyanate, (FITC); Glutathionee, (GSH); L-ascorbic acid, (Asc); MDA reductase, (MDAR); Monodehydroascorbate, (MDA); tert-butyl hydroperoxide, (t-BuOOH) Received: 7 May 2007; Revised: 25 May 2007 Accepted: 29 May 2007; electronically published: July 2007

Summary To evaluate the potential for utilization of overexpression of glutathione (GSH)-dependent dehydroascorbate (DehAsc) reductase (DHAR) as a tool to alleviate deleterious effects induced by an oxidative stress, the effect of overexpressed DHAR on tert-butylhydroperoxide (t-BuOOH)-induced cell injury was examined using DHAR gene (dhar)-transfected Chinese hamster ovary (CHO) cells. The transfected dhar products-derived DHAR was shown to be expressed all over the cytoplasm rather than in the nucleus, and repressed t-BuOOH-induced cell death, DNA strand cleavages, and intracellular reactive oxygen species (ROS)-generation in cells pretreated with DehAsc plus GSH isopropylester, but not without such pretreatment in contrast to no repression in their vector-transfected counterparts with such pretreatment. Upon the similar pretreatment, the intracellular levels of both ascorbic acid (Asc) and total vitamin C (Asc plus DehAsc) were 1.4- to 1.7-fold higher in dhar-transfected cells than in the vectortransfectants. Thus, our results suggest that overexpressed DHAR exerts cytoprotective effects against hydroperoxide-induced cell injury, and that more abundant intracellular Asc accumulation induced by expression of exogenous dhar may be involved in the mechanism.

regeneration of alpha-tocopheroxyl radicals to alphatocopherol at the membrane interface (Niki, 1991). These antioxidant properties of Asc are based on its univalent or divalent oxidation (Figure 1). The univalent oxidation of Asc produces the short-lived radical to Asc and dehydroascorbic acid (DehAsc). The divalent oxidation of Asc leads to the formation of DehAsc, which readily undergoes irreversible hydrolysis to 2, 3-

I. Introduction L-ascorbic acid (Asc) plays an important role in cellular defense mechanisms against oxidative stress. Asc not only scavenges a variety of aqueous reactive oxygen species (ROS) including superoxide anion radical, singlet oxygen, hydroxyl radical, and water-soluble peroxyl radicals (Halliwell and Gutteridge, 1990), but also takes part in the prevention of lipid peroxidation by reductive

143

Saitoh et al: Repressive effect of DHAR on t-BuOOH-induced cell death novel GSH-dependent dehydroascorbate reductase (DHAR) was purified from rat liver cytosol (Maellaro et al, 1994) and human red cells (Xu et al, 1996). Ishikawa et al. cloned the corresponding gene (dhar) from a rat liver cDNA library and achieved the functional expression of DHAR in Chinese hamster ovary (CHO) cells (Ishikawa et al, 1998). They demonstrated that the DHAR-expressing cells accumulated 1.7-fold more total vitamin C than nontransfected cells. Based on these results, we speculated that overexpressed DHAR can suppress ROS generation and oxidative stress-induced cellular damages by increasing of intracellular Asc. In the present study, we used dhartransfected CHO cells to investigate the repressive effects of DHAR on oxidative stress-induced cellular injuries resulting from the chemical oxidant tert-butyl hydroperoxide (t-BuOOH), an analogue of short-chain lipid hydroperoxide.

ROS, oxidase, peroxidase, Fe3+, Cu2+ etc.

Oxidation

Asc

MDA

MDAR NAD(P) +

NAD(P)H

GSSG

Oxidation

DHAR 2GSH

DehAsc

II. Materials and Methods

2, 3-diketogulonic acid

A. Cell culture Rat liver glutathione-dependent dehydroascorbate reductase gene (dhar) in a pRC/CMV vector-transfected CHO cells (DHAR (+)) and the corresponding nontransfectant (transfected with pRc/CMV only) CHO cells (DHAR (-)) were obtained by electroporation and the subsequent colony selection (Ishikawa et al, 1998). DHAR (+) cells were cultured in Dulbecco's modified Eagle's medium (DMEM, GIBCO BRL, Grand Island, NY, USA) containing 10% heat-inactivated fetal calf serum (FBS, GIBCO BRL), 50 units/mL penicillin, 50 Âľg/mL streptomycin, and 400 Âľg/mL geneticin disulfate (Wako Pure Chemical Industries, Osaka, Japan) at 37 oC in a humidified atmosphere of 95% air and 5% CO 2. DHAR (-) cells were cultured in the same medium without geneticin disulfate.

Figure 1. Metabolism of ascorbic acid in mammalian cells. Ascorbic acid (Asc) is oxidized to monodehydroascorbic acid (MDA) by various types of oxidative stress, such as ROS. MDA is reversibly converted to Asc by MDA reductase (MDAR), localized mainly in the outer mitochondrial membrane, microsomes, and the Golgi apparatus. MDA is further oxidized to dehydroascorbic acid (DehAsc), or, alternatively, nonenzymatically converted to Asc and DehAsc through a disproportionation reaction. DehAsc is easily and irreversibly hydrolyzed to 2, 3-diketogulonic acid unless reduced to Asc by DehAsc reductase (DHAR) using glutathione as the reductant.

B. Evaluation of cell-growth ratio

diketogulonic acid. Although Asc and its oxidized forms are generally unstable in physiological environments, it is known that plants and animals possess an Asc regeneration system. Humans and other primates cannot synthesize Asc due to lack of L-gulono-1, 4-lactone oxidoreductase, which is required for the final step in Asc synthesis. Therefore, for humans and primates who can get Asc only from dietary sources, systems for regeneration of Asc from its oxidized forms would be quite important to protect cells from harmful ROS-induced oxidation. The regeneration system for Asc mainly consists of two pathways associated with MDA or DehAsc reduction. MDA is converted to Asc through spontaneous disproportionation or enzymatic reduction by MDA reductase (MDAR), which is an NAD(P)H-dependent enzyme localized at subcellular membranes of mitochondria (Ito et al, 1981), microsomes, and the Golgi apparatus (Hara and Minakami, 1971; Green and O'Brien, 1973). On the other hand, DehAsc is converted to Asc through nonenzymatic reduction by glutathione (GSH) or diverse enzymes such as with glutaredoxin (Wells et al, 1990; Park and Levine, 1996), protein disulphide disulfide isomerase (Wells et al, 1990), 3!-hydroxysteroid dehydrogenase (Del et al, 1994) and thioredoxin reductase (May et al, 1997). Because of the slowness in the nonenzymatic reducing reaction, much attention has been directed to enzymatic reduction of DehAsc. Recently, a

Cell-growth ratio was assessed based on mitochondrial enzymatic conversion of WST-1 [2-(4-iodophenyl)-3-(4nitrophenyl)-5-(2.4-disulfophenyl)-2H-tetrazolium, sodium salt] (Dojindo, Kumamoto, Japan) to yellowish formazan, which is indicative of the number of viable cells. After t-BuOOH treatment, cells were rinsed with phenol red (PR)-free DMEM and then incubated for 3 hr in PR-free DMEM containing 10% WST-1 at 37 oC. The absorbance at 450 nm was measured with a microplate reader (model 3550, Bio-Rad, Hercules, CA, USA).

C. Immunocytochemical staining of DHAR Cells were grown on poly-L-lysine-coated chamber slides (ASAHI TECHNO GLASS, Chiba, Japan) and washed with phosphate-buffered saline (PBS) and fixed in a freshly prepared solution of 4% paraformaldehyde in PBS for 30 min at room temperature. The cells were permeabilized in PBS containing 0.5% Triton X-100 for 5 min on ice, and then incubated with primary antibody against rat DHAR diluted 1 : 100 in PBS containing 1% bovine serum albumin for 1 hr at 37 oC. The cells were then washed three times with PBS and incubated with a secondary antibody, fluorescein isothiocyanate (FITC)-labeled anti-rabbit IgG, for 30 min at 37 oC. The slides were washed with PBS, mounted with anti-fading solution, and observed with a laser scanning confocal fluorescence microscope MRC-600 (BioRad).

D. TUNEL staining Apoptotic nuclei were detected in situ by the TUNEL (Terminal deoxyribonucleotidyl transferase-mediated dUTP nick

144

Gene Therapy and Molecular Biology Vol 11, page 145 end labeling) assay with an In situ Apoptosis Detection Kit (Takara, Kyoto, Japan). Cells were grown on poly-L-lysinecoated chamber slides (ASAHI TECHNO GLASS). After tBuOOH treatment, cells were washed three times with PBS and fixed in a freshly prepared solution of 4% paraformaldehyde in PBS for 30 min at room temperature. For blocking endogenous peroxide, cells were treated with methanol containing 0.3% hydrogen peroxide for 15 min at room temperature. Then, the cells were permeabilized with permeabilization buffer for 5 min on ice. To label DNA strand cleavage termini, cells were incubated with TUNEL reaction mixture containing TdT and FITC-labeled dUTP in the binding buffer and incubated for 90 min at 37 oC in a humidified atmosphere. Thereafter, the slides were washed three times with PBS and mounted with anti-fading solution. The slides were observed with a laser scanning confocal fluorescence microscope ECLIPSE E600 (Nikon, Tokyo, Japan), and pseudo-color images were produced using AQUACOSMOS software (HAMAMATSU Photonics, Shizuoka, Japan). All of the TUNEL stains were done at the same time and photographed under the same conditions.

III. Results A. Expression and distribution of DHAR in dhar-transfected DHAR (+) cells To confirm the expression of DHAR proteins, we conducted immunocytochemical staining and observed the distribution of DHAR. In DHAR (+) cells, DHAR was abundantly expressed and widely scattered in the cytoplasm, but not present in the nucleus (Figure 2). In contrast, DHAR was scarcely detected in DHAR (-) cells.

B. Preventive effect of DHAR on tBuOOH-induced cell death The effect of DHAR overexpression and administration with DehAsc and/or GSH-iPr on cells exposed to t-BuOOH was examined by the WST-1 assay. DehAsc is transported into cells via glucose transporters (Vera et al, 1993; Welch et al, 1995; Wilson, 2005), and GSH-iPr readily diffuses into cells and is hydrolyzed by intracellular esterases to GSH. The cell-growth ratio of both DHAR (+) and DHAR (-) cells was notably decreased in a dose-dependent manner by treatment with tBuOOH (0, 150, or 200 µM) for 27 hr (Figure 3). Thus, the decrease of cell-growth ratio was not alleviated only by overexpressin of DHAR without supplied enzymatic substrates. And the recovery of cell-growth ratio was not observed by previous administration with either DehAsc or GSH-iPr alone in DHAR (-) cells, either. However, previous administration with DehAsc and GSH-iPr significantly attenuated the decrease of cell-growth ratio in DHAR (+) cells as compared with DHAR (-) cells.

E. Measurement of intracellular ROS Intracellular ROS production was determined based on oxidative conversion of 6-carboxy-2', 7'dichlorodihydrofluorescein diacetate, di (acetoxymethyl ester) (CDCFH-DA) (Molecular Probes, Eugene, OR, USA) to CDCF, which is indicative of the amount of intracellular peroxide production. Cells were rinsed with PR-free DMEM and incubated for 45 min in PR-free DMEM containing 100 µM CDCFH-DA at 37oC. After they were rinsed with PR-free DMEM again, the cells were treated with t-BuOOH. Then, the cells were rinsed three times with PR-free DMEM and the fluorescence intensity was measured with a fluorescence microplate reader (CytoFluor 2350, Millipore, Bedford, MA, USA) with excitation and emission wavelengths of 485 nm and 530 nm, respectively. Finally, the cells were observed with a fluorescence microscope ECLIPSE E600 (Nikon).

F. Determination of intracellular Asc and total Asc Cells were washed with PBS and collected by trypsinization. The cell number was measured using a particle analyzer CDA-500 (Sysmex, Hyogo, Japan). Then, the cells were centrifuged at 500!g for 5 min at 4 oC and resuspended in HPLC mobile phase (99% 0.1 M KH 2PO4-H3PO 4-1% methanol buffer (pH 2.5) containing 50 mg/L octanesulfonic acid and 5 mg/L EDTA-2Na) containing 50 µM dithiothreitol (DTT). The cells were lysed by sonication and the freeze-thaw method, the lysate was centrifuged at 500!g for 5 min at 4 oC and the supernatant was collected. After removal of proteins with an ULTRA FILTER UNIT USY-1 (ADVANTEC, Tokyo, Japan), a 20 µL aliquot was injected on an Eicompak SC-5DS column of 3.0!150 mm (Eicom, Kyoto, Japan) connected to an HPLC pump (Shimazu LC-10AT ; Shimazu; Kyoto, Japan), and developed with a mobile phase at a flow rate of 0.5 mL/min at 25 oC. Asc was detected with an amperometric electrochemical detector (ECD) Eicom ECD-300 (Eicom) operated at 600 mV. For the measurement of total Asc, DTT was added to an aliquot of the same sample for Asc measurement (final 12.5 mM) for reduction of DehAsc to Asc. Standard Asc solutions of 0-500 nM were prepared in the HPLC buffer and freshly diluted just before use.

Figure 2. Immunocytochemical detection of DHAR in dhartransfected (DHAR (+)) or non-transfected (DHAR (-)) Chinese hamster ovary (CHO) cells. Cells were plated at a density of 1.0 x 104 cell/cm2 on a chamber slide. After preincubation for 18-21 hr, the cells were subjected to immunocytochemical staining, and the FITC-derived fluorescence was detected by fluorescence microscopy. The “nucleus”- and “cytoplasm”- photographs were obtained by focusing on the nucleus and cytoplasmic areas, respectively. The scale bar indicates 10 µm.

G. Statistical analysis The unpaired Student’s t-test was used to evaluate the significance of differences between groups, and the criterion of statistical significance was taken as P < 0.05.

145

Saitoh et al: Repressive effect of DHAR on t-BuOOH-induced cell death

Figure 3. Preventive effect of dhar transfection and administration with DehAsc and/or GSH-iPr as DHAR substrates on t4 2 BuOOH-induced cell death. DHAR (+) or DHAR (-) cells were seeded at a density of 1.0 ! 10 cells/cm in 24-well plates, and preincubated for 21 hr. The cells were treated with 100 µM DehAsc and/or 50 µM GSH-iPr for 2 hr, and then treated with various concentrations of t-BuOOH (0, 150, or 200 µM) for 27 hr. Cell-growth ratio was assessed by the WST-1 assay. The bar represents the S.D. of triplicate wells. Significantly different from DHAR (-) cells: *P < 0.05.

Therefore, administration with DehAsc plus GSH-iPr induced a cytoprotective effect against the cytotoxic response to t-BuOOH, and this effect was more notable in DHAR (+) cells than in DHAR (-) cells.

intracellular ROS levels using fluorometry and the fluorescein derivative CDCFH-DA as a redox indicator.

C. Inhibitory effect of administration with DehAsc plus GSH-iPr on t-BuOOHinduced nuclear DNA strand cleavages in DHAR (+) cells The effect of administration with DehAsc plus GSHiPr on t-BuOOH-induced nuclear DNA strand cleavages was investigated by the TUNEL staining assay. Cells that were treated with t-BuOOH showed an intensely red pseudo-color corresponding to brightly fluorescent staining in the nuclei (Figure 4A, center) and an increase in the frequency of DNA cleavages (Figure 4B, center), indicating the incorporation of fluorescein dUTP onto nicked DNA strand terminals. The nuclear DNA strand cleavages were strongly suppressed by administration with DehAsc plus GSH-iPr, but not in their absence (Figure 4A, B). These results suggest that administration with DehAsc plus GSH-iPr exerted protective effects against tBuOOH-induced nuclear DNA strand cleavages in DHAR (+) cells.

Figure 4. Preventive effect of dhar transfection and administration with DehAsc plus GSH-iPr as DHAR substrates on t-BuOOH-induced nuclear DNA strand cleavages in DHAR (+) cells. (A) Cells were seeded as in Figure 2 and preincubated for 21 hr. The cells were treated with 100 µM DehAsc plus 50 µM GSH-iPr for 2 hr before exposure to tBuOOH at 400 µM for 1 hr, the maximum period for DNA cleavages, followed by TUNEL stain and the subsequent fluorography. (B) The histograms represent the fluorescence distribution, which reflects the degree of DNA cleavages and its frequency. The scale bar indicates 15 µm.

D. Preventive effect of DHAR and administration with DehAsc plus GSH-iPr on t-BuOOH-induced intracellular oxidative stress To examine whether DHAR and administration with DehAsc plus GSH-iPr could prevent t-BuOOH-induced intracellular ROS production, we quantified the

146

Gene Therapy and Molecular Biology Vol 11, page 147 After permeation into cells, CDCFH-DA is esterolyzed to CDCFH, being made membrane-impermeable, and oxidized to highly fluorescent CDCF primarily by H2O2, hydroperoxides, and diverse peroxides (Sejda et al, 1984). Treatment with t-BuOOH significantly increased the intracellular ROS levels in both DHAR (+) and DHAR (-) cells (Figure 5(A)). However, previous administration with DehAsc plus GSH-iPr markedly suppressed the increase in intracellular ROS in DHAR (+) cells, but not in DHAR (-) cells. Similar results were also observed using fluorescence microscopy (Figure 5(B)). Previous administration with DehAsc plus GSH-iPr strongly inhibited the irradiance of intracellular fluorescence from the redox indicator CDCFH.

E. Accumulation of intracellular vitamin C in DHAR (+) cells To examine the changes of intracellular total vitamin C (Asc plus DehAsc) and Asc levels after administration with DehAsc plus GSH-iPr, we quantified the intracellular amounts of both total vitamin C and Asc by HPLC and amperometric ECD detection. Intracellular levels of both total vitamin C and Asc increased for 2 hr after administration with DehAsc plus GSH-iPr in either DHAR (+) or DHAR (-) cells (Figures 6(A), (B)). The intracellular amounts of both total vitamin C and Asc in DHAR (+) cells were approximately 1.5- to 1.7-fold higher than those in DHAR (-) cells, respectively. These results suggested that the capacities to accumulate total vitamin C and Asc in DHAR (+) cells were superior to those in DHAR (-) cells.

Figure 5. Preventive effect of dhar-transfection and administration with DehAsc plus GSH-iPr as DHAR substrates on t-BuOOH-induced intracellular reactive oxygen species (ROS) production.(A) Cells were seeded as in Figure 3 and preincubated for 18 hr. The cells were treated with 100 µM DehAsc plus 50 µM GSH-iPr for 2 hr, and then incubated with CDCFH-DA for 45 min. Thereafter, the cells were incubated with or without 150 µM t-BuOOH for 0.5 hr, and intracellular fluorescence was measured with a fluorescence microplate reader (ex: 485 nm; em: 530 nm). The bar represents the S.D. of triplicate wells. Significantly different from 0-µM t-BuOOH group with respective treatment: *P < 0.01; **P < 0.01; N.S.: not significant. (B) Cells were treated in the same manner as in (A). After t-BuOOH exposure, the fluorescence intensity was detected by fluorescence microscopy. The scale bar indicates 15 µm.

Figure 6. Intracellular total vitamin C (Asc + DehAsc) and Asc levels after administration with DehAsc plus GSH-iPr in DHAR (+) and DHAR (-) cells. (A) Cells were seeded at a 4 2 density of 1.0x10 cells/cm on a 60-mm dish and preincubated for 18 hr. Cells were treated with 100 µM DehAsc plus 50 µM GSH-iPr for 0 or 2 hr, and then intracellular total vitamin C and Asc were measured by HPLC and amperometric ECD detection. Error bars are S.D. of 4 dishes. Significantly different from 0 hr: *P < 0.05. (B) Typical chromatograms of no additive (0 hr in DHAR (+) cells), DHAR(-) (2hr in DHAR(-) cells), and DHAR(+) (2hr in DHAR(+) cells) are shown. The first and second peaks at approximately 3 and 15 min are assigned to Asc and DTT, respectively.

147

Saitoh et al: Repressive effect of DHAR on t-BuOOH-induced cell death because overexpressed DHAR was more effective against t-BuOOH-induced cell injury. In summary, our results suggest that overexpressed DHAR exerts cytoprotective effects against hydroperoxide-induced cell injury, and that overexpressed DHAR-induced more abundant intracellular Asc accumulation may contribute its cytoprotective mechanism. Thus, DHAR is suggested to be one of the possible candidates for controlling of oxidative stressinduced cell injury.

IV. Discussion In the present study, we paid attention to DHAR, which enables recycling of Asc by reduction of DehAsc to Asc, and tried to determine the possibility of utilization of overexpressed DHAR as a tool to alleviate deleterious effects induced by an oxidative stress. Our results showed that t-BuOOH-induced cell death was suppressed only by administration with DehAsc plus GSH-iPr in DHAR (+) cells (Figure 3), and not by administration with either DehAsc or GSH-iPr alone. Thus, coexistence of both DehAsc and the GSH derivative is necessary to exert protective effects against oxidative stress in DHAR (+) cells. These results suggest that the cytoprotective effects are due to the reductive reaction by DHAR, which reduces DehAsc to Asc by using GSH as the reductive cofactor. Our results also showed that t-BuOOH-induced DNA strand cleavages, and ROS generation were suppressed by administration with DehAsc plus GSH-iPr in DHAR (+) cells (Figures 4, 5). Because it is known that excessive ROS induces DNA strand cleavages and subsequently cell death (Saitoh et al, 2003; Saitoh and Miwa, 2004), the suppression of ROS generation in DHAR (+) cells seems to be a most critical point for the prevention of cell death. Our results also demonstrated that the intracellular amounts of both Asc and total vitamin C (Asc plus DehAsc) were 1.4- to 1.7-fold higher in DHAR (+) cells than DHAR (-) cells upon administration with DehAsc plus GSH-iPr (Figures 6). It was previously demonstrated that DHAR-transfected CHO cells could accumulate a 1.7fold higher amount of total vitamin C compared with that of nontransfected cells (Ishikawa et al, 1998), but it was not clear about intracellular amounts of Asc. Asc, one of the major intracellular water-soluble antioxidant substances (Halliwell and Gutteridge, 1990), promptly scavenges ROS at an initial stage of ROS generation. Plasma lipoproteins exposed to aqueous peroxy radicals undergo no hydroperoxidation until depletion of endogenous Asc, which is consumed more rapidly and earlier than other plasma ROS-scavengers such as SH groups, alpha-tocopherol, bilirubin and urate, suggesting that Asc efficiently protects biomolecules, including lipids, from oxidative damages (Frei et al, 1984). Moreover, it is also well-known that Asc is transported into cells and accumulated to high concentrations (Washko et al, 1990; Welch et al,! 1995; Saitoh et al, 1997). Therefore, Asc plays an important role for the protection of cellular components from oxidative stress-induced injury, and the enhancement of intracellular amounts of Asc was quite important for cytoprotection against oxidative stress. Since the decrease of cell-growth ratio in DHAR (+) cells was significantly attenuated as compared with that in DHAR (-) cells (Figure 3), we supposed that the enhancement of intracellular Asc accumulation by overexpressed DHAR was correlated with the intracellular antioxidant potential and suppressed the ROS generation, resulting in decreased DNA strand cleavages and cell death. On the other hand, our result implied the presence of endogenous DHAR in CHO cells, because Asc was accumulated also in DHAR (-) cells. However, our data indicated that exogenous DHAR exerts the inherent enzymatic function similar to that of endogeous DHAR,

Acknowledgments The authors thank Dr. Norio Nagao, Mr. Liao Feng and Ms. Kikuko Yoshimitsu for their technical assistance. The present study was supported in part by Grant-in-Aid for Scientific Research, Basis Research (C), 17590064, in 2005-2007 to N.M from the Ministry of Education, Science, Sports and Culture, Japan.

References Del Bello B, Maellaro E, Sugherini L, Santucci A, Comporti M, Casini AF (1994) Purification of NADPH-dependent dehydroascorbate reductase from rat liver and its identification with 3 alpha-hydroxysteroid dehydrogenase. Biochem J. 304(Pt 2), 385-390. Frei B, Stocker R, Ames BN (1988) Antioxidant defenses and lipid peroxidation in human blood plasma. Proc Natl Acad Sci U S A 85, 9748-9752. Green RC, O'Brien PJ (1973) The involvement of semidehydroascorbate reductase in the oxidation of NADH by lipid peroxide in mitochondria and microsomes. Biochim Biophys Acta 293, 334-342. Halliwell B (1990) Gutteridge JM. The antioxidants of human extracellular fluids. Arch Biochem Biophys 280, 1-8. Hara T, Minakami S (1971) On functional role of cytochrome b5. II. NADH-linked ascorbate radical reductase activity in microsomes. J Biochem (Tokyo) 69, 325-330. Ishikawa T, Casini AF, Nishikimi M (1998) Molecular cloning and functional expression of rat liver glutathione-dependent dehydroascorbate reductase. J Biol Chem 273, 2870828712. Ito A, Hayashi S, Yoshida T (1981) Participation of a cytochrome b5-like hemoprotein of outer mitochondrial membrane (OM cytochrome b) in NADHsemidehydroascorbic acid reductase activity of rat liver. Biochem Biophys Res Commun 101, 591-598. Maellaro E, Del Bello B, Sugherini L, Santucci A, Comporti M, Casini AF (1994) Purification and characterization of glutathione-dependent dehydroascorbate reductase from rat liver. Biochem J 301(Pt 2), 471-476. May JM, Mendiratta S, Hill KE, Burk RF (1997) Reduction of dehydroascorbate to ascorbate by the selenoenzyme thioredoxin reductase. J Biol Chem 272, 22607-22610. Niki E (1991) Selected vitamins, minerals and functional consequences of maternal malnutrition. In: World Rev Nutr Diet, Karger, Basel, 1-30. Park JB, Levine M (1996) Purification, cloning and expression of dehydroascorbic acid-reducing activity from human neutrophils: identification as glutaredoxin. Biochem J 315(Pt 3), 931-938. Saitoh Y, Nagao N, O'Uchida R, Yamane T, Kageyama K, Muto N, Miwa N (1997) Moderately controlled transport of ascorbate into aortic endothelial cells against slowdown of the cell cycle, decreasing of the concentration or increasing

148

Gene Therapy and Molecular Biology Vol 11, page 149 of coexistent glucose as compared with dehydroascorbate. Mol Cell Biochem 173, 43-50. Saitoh Y, Ouchida R, Kayasuga A, Miwa N (2003) Antiapoptotic defense of bcl-2 gene against hydroperoxideinduced cytotoxicity together with suppressed lipid peroxidation, enhanced ascorbate uptake, and upregulated Bcl-2 protein. J Cell Biochem 89, 321-334. Saitoh Y and Miwa N (2004) Cytoprotection of vascular endotheliocytes by phosphorylated ascorbate through suppression of oxidative stress that is generated immediately after post-anoxic reoxygenation or with alkylhydroperoxides. J Cell Biochem 93, 653-663. Sejda P, Parce JW, Seeds MS, Bass DA (1984) Flow cytometric quantitation of oxidative produce formation by polymorphonuclear leukocytes during phagocytosis. J Immunol 133, 3303-3307. Vera JC, Rivas CI, Fischbarg J, Golde DW (1993) Mammalian facilitative hexose transporters mediate the transport of dehydroascorbic acid. Nature 364, 79-82.

Washko P, Rotrosen D, Levine M (1990) Ascorbic acid accumulation in plated human neutrophils. FEBS Lett 260, 101-104. Welch RW, Wang Y, Crossman A Jr, Park JB, Kirk KL, Levine M (1995) Accumulation of vitamin C (ascorbate) and its oxidized metabolite dehydroascorbic acid occurs by separate mechanisms. J Biol Chem 270, 12584-12592. Wells WW, Xu DP, Yang YF, Rocque PA (1990) Mammalian thioltransferase (glutaredoxin) and protein disulfide isomerase have dehydroascorbate reductase activity. J Biol Chem 265, 15361-15364. Wilson JX (2005) Regulation of vitamin C transport. Annu Rev Nutr 25, 105-125. Xu DP, Washburn MP, Sun GP, Wells WW (1996) Purification and characterization of a glutathione dependent dehydroascorbate reductase from human erythrocytes. Biochem Biophys Res Commun 221, 117-121.

149

Saitoh et al: Repressive effect of DHAR on t-BuOOH-induced cell death

150

Gene Therapy and Molecular Biology Vol 11, page 143 Gene Ther Mol Biol Vol 11, 143-150, 2007

Yasukazu Saitoh1, Yuriko Fukuoka1, Morimitsu Nishikimi2, Nobuhiko Miwa1,* 1

143

ROS, oxidase, peroxidase, Fe3+, Cu2+ etc.

Oxidation

Asc

MDA

MDAR NAD(P) +

NAD(P)H

GSSG

Oxidation

DHAR 2GSH

DehAsc

II. Materials and Methods

2, 3-diketogulonic acid

B. Evaluation of cell-growth ratio

D. TUNEL staining Apoptotic nuclei were detected in situ by the TUNEL (Terminal deoxyribonucleotidyl transferase-mediated dUTP nick

144

G. Statistical analysis The unpaired Student’s t-test was used to evaluate the significance of differences between groups, and the criterion of statistical significance was taken as P < 0.05.

145

Saitoh et al: Repressive effect of DHAR on t-BuOOH-induced cell death

intracellular ROS levels using fluorometry and the fluorescein derivative CDCFH-DA as a redox indicator.

146

147

148

149

Saitoh et al: Repressive effect of DHAR on t-BuOOH-induced cell death

150

Gene Therapy and Molecular Biology Vol 11, page 151 Gene Ther Mol Biol Vol 11, 151-160, 2007

Adenovirus-mediated Expression of both Antisense Ornithine Decarboxylase (ODC) and Sadenosylmethionine Decarboxylase (AdoMetDC) inhibits human esophageal squamous carcinoma cell growth Research Article

Hui Tian1,*, Xian-Xi Liu2, Bing Zhang2, Qi-Feng Sun1, Dong-Feng Sun1 1 2

Department of Thoracic Surgery, Qi Lu Hospital, Shandong University, Jinan 250012, China Department of Medicine, Medical molecular biology experimental center, Shandong University, Jinan 250012, China

__________________________________________________________________________________ *Correspondence: Hui Tian, Department of Thoracic Surgery, Qi Lu Hospital, Shandong University, Jinan 250012, China; Tel: 860531-82169463; E-mail: tianhuiy@sohu.com Key words: Ornithine decarboxylase, S-adenosylmethionine decarboxylase, Polyamine, Esophageal neoplasms, Eca109 cell line, Gene therapy Abbreviations: bicinchoninic acid (BCA); coxsackie adenovirus receptor (CAR); cyclin-dependent kinases (cdks); cytomegalovirus (CMV); decarboxylated Sadenosylmethionine (dcSAM); Difluoromethylornithine (DFMO); dodecyl sulfate (SDS); Dulbeccoâ&#x20AC;&#x2122;s modified Eagleâ&#x20AC;&#x2122;s medium (DMEM); green fluorescent protein (GFP); high-performance liquid chromatography (HPLC); methylglyoxalbis (guanylhydrazone) (MGBG); monoclonal antibody (mAb); multiplicities of infection (MOIs); ornithine decarboxylase (ODC); reversetranscription polymerase chain reaction (RT-PCR); S-adenosylmethionine decarboxylase (AdoMetDC)

This work was supported by the grants from the national natural science foundation of China (No.30571844) Received: 28 February 2007; Revised: 21 Jun3 2007 Accepted: 2 July 2007; electronically published: July 2007

Summary Polyamine biosynthesis is controlled primarily by ornithine decarboxylase (ODC) and S-adenosylmethionine decarboxylase (AdoMetDC). Antisense ODC and AdoMetDC sequences were cloned into an adenoviral vector (AdODC-AdoMetDCas). To evaluate the effect of recombinant adenovirus Ad-ODC-AdoMetDCas which can simultaneously express both antisense ODC and S-adenosylmethionine decarboxylase (AdoMetDC), the human esophageal squamous carcinoma cell line Eca109, was infected with Ad-ODC-AdoMetDCas as well as with control vector. Viable cell counting, determination of polyamine concentrations, cell cycle analysis, and Matrigel invasion assays were performed in order to assess the properties of tumor growth and invasiveness. Our study demonstrated that adenovirus-mediated ODC and AdoMetDC antisense expression inhibits tumor cell growth through a blockade of the polyamine synthesis pathway. This inhibitory effect cannot be reversed by the administration of putrescine. Tumor cells were arrested at the G1 phase of the cell cycle after gene transfer and had reduced invasiveness. Our study suggests that as a new anticancer reagent, the recombinant adenovirus Ad-ODC-AdoMetDCas holds promising hope for the therapy of esophageal cancers.

growth and differentiation. In mammalian cells, the intracellular polyamine biosynthetic pathway is primarily regulated by the action of two rate-limiting enzymes. Ornithine decarboxylase (ODC) is the first key enzyme required for polyamine synthesis, decarboxylating ornithine to produce putrescine (Tian et al, 2006b). The

I. Introduction Polyamines are naturally occurring aliphatic polycations found in almost all living organisms. Polyamines include spermidine, spermine, and their diamine precursor, putrescine (Tian et al, 2006a). Polyamines have critical physiological functions in cell

151

Tian et al: Adenovirus-mediated Expression of both ODC and AdoMetDC USA) containing 10% fetal bovine serum. All cells were cultured in a 5% CO2 incubator at 37!.The polyamine standards (putrescine, spermidine, and spermine) and densyl chloride for high-performance liquid chromatography (HPLC) were purchased from Sigma (St. Louis, MO, USA). An anti-ODC mouse monoclonal antibody (mAb) and an anti-AdoMetDC mouse polyclonal antibody were prepared in our laboratory. An anti-p21 (sc-6246) mousemAb and an antiactin (sc-1616) goat polyclonal antibody were purchased from Santa Cruz Biotechnology. Matrigel and Transwell plates were obtained from BD Biosciences (Bedford, MA, USA) and Costar (Cambridge, MA, USA), respectively.

second, rate-limiting enzyme is S-adenosylmethionine decarboxylase (AdoMetDC). It generates the aminopropyl donor, decarboxylated Sadenosylmethionine (dcSAM), by decarboxylating adenosylmethionine. DcSAM donates its propylamine moiety for the formation of spermidine and spermine via catalysis by spermidine synthase and spermine synthase, respectively. The association of increased polyamine synthesis with cell proliferation and cancer progression was first reported in the late 1960s. High polyamine levels and elevated polyamine synthesis activity were found in many tumors. Environmental and genetic risk factors for cancer, such as ultraviolet light (Ahmad et al, 2001) and various oncogenes (Holtta et al, 1988; Sistonen et al, 1989; Auvinen et al, 1992), have been reported to induce high ODC activity in normal tissues. Overexpression of ODC or AdoMetDC was also reported to cause malignant transformation of NIH3T3 cells (Auvinen et al, 1992; Paasinen-Sohns et al, 2000). Therefore, inhibition of ODC and/or AdoMetDC activity might induce a depletion of intracellular polyamines, providing an effective anticancer treatment strategy. Previous work has primarily focused on the development of polyamine synthesis inhibitors. Difluoromethylornithine (DFMO) irreversibly inactivates ODC activity and has been used in clinical chemoprevention trials for epithelial cancers, including colon, breast, cutaneous, and prostate malignancies (Meyskens and Gerner, 1999). AdoMetDC inhibitors, such as methylglyoxalbis (guanylhydrazone) (MGBG), have also been shown to inhibit tumor growth (Warrell and Burchenal, 1983). SAM486A is a new AdoMetDC inhibitor that has been shown to possess anti-proliferative activity in both tissue culture cells and preclinical animal studies (Regenass et al, 1994). Esophageal cancer is one of the most lethal cancers known to mainland in China because of the high incidence and high mortality. Metastatic esophageal cancer is essentially resistant to systemic cytotoxic chemotherapy, while external beam and radioisotope radiotherapy offers only symptom palliation. The development of novel therapies, such as gene therapy, is of high priority. In the present study, we constructed a replicationdeficient recombinant adenovirus containing antisense sequences of both ODC and AdoMetDC (AdODCAdoMetDCas) to downregulate their gene expression levels simultaneously. Our data show that downregulation of these two key enzymes by Ad-ODC-AdoMetDCas significantly inhibited esophageal cancer cell growth and tumor invasiveness in vitro. The tumor cells were arrested in the G1 phase of the cell cycle. Polyamine levels were significantly decreased in Ad-ODC-AdoMetDCas-treated cells compared with controls.

B. Construction of Ad-ODC-AdoMetDCas The construction of the adenoviral vector, rAdODC/EX3as, containing antisense ODC sequence with both a cytomegalovirus (CMV) promoter and a green fluorescent protein (GFP) gene, was reported previously (Zhang et al, 2005). To construct an adenoviral vector harboring additional antisense AdoMetDC sequence, a 205-bp cDNA fragment of the 5' end of the AdoMetDC gene was ampli-fied by reverse-transcription polymerase chain reaction (RT-PCR) using specific primers and was subcloned downstream of the ODC gene in the pAd-ODCas vector in the reverse direction. The forward primer was 5'GGTCTAGATTCGCTAGTCTCACGGTGAT3' and the reverse primer was 5'GGCTCGAGTAAGCTTCCTGCTTGTCAGT3'. The sequence of the resulting clone, pAd-ODC-AdoMetDCas, was confirmed by sequencing and was then linearized by digestion with Pme I and transformed into Adeasier-1 cells containing the 33-kb pAdeasy-1 vector to generate recombinant clones as previously described (He et al, 1998). The recombinant adenovirus genome was digested with Pac I and transfected into HEK293 cells with Lipofectamine2000 (Invitrogen USA) for the isolation of recombinant adenovirus.Recombinant viral plaques were identified and amplified by PCR in order to verify ligation success. The recombinant virus particles were purified by CsCl ultracentrifugation (Prevec et al, 1991) and a standard plaque assay was performed to measure the titer of the purified viral stock. The control virus, Ad-GFP, contained no gene insertion in the multiple cloning site.

C. Analysis of gene transduction efficiency in vitro The efficiency of adenovirus-mediated gene transfer was assessed by detection of GFP. Eca109 cells (3x105 cells/well) seeded in 6-well plates were infected with Ad-GFP at different multiplicities of infection (MOIs) of 5, 10, 20, 50 and 100. GFP expression was analyzed at 48 h after the infection using a flow cytometer (Beckman Coulter, Miami, FL, USA).

D. Western blot analysis After the Eca109 cells had been treated with phosphatebuffered saline (PBS), Ad-GFP, Ad-ODCas, and Ad-ODCAdoMetDCas for 72 h, total cell lysates were prepared in extraction buffer containing 50 mM Tris (pH8.0), 1% NP-40, 1 µg/ml aprotinin, 0.1% sodium dodecyl sulfate (SDS), 0.02% sodium azide, 150mM NaCl, and 100 µg/ml phenylmethylsulfonyl fluoride. Sample protein concentrations were quantified using the bicinchoninic acid (BCA) protein assay. After electrophoresis samples were transferred onto nitrocellulose membranes (Millipore, Bedford, MA, USA). After an incubation with appropriate antibodies in PBS containing 5% nonfat dry milk and 0.02% Tween 20, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies, developed using the Western blotting luminol reagent

II. Materials and methods A. Cell culture and reagents Human esophageal cancer Eca109 cell line obtained from the Chinese Academy of Sciences, were maintained in RPMI 1640 medium supplemented with 10% (v/v) heat-inactivated bovine serum, 100 U/ml penicillin and 100 g/ml streptomycin. HEK293 cells (transformed human embryonic kidney cells), also purchased from the Chinese Academy of Sciences, were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen

152

Gene Therapy and Molecular Biology Vol 11, page 153 (Santa Cruz Biotechnology, USA), and exposed to X-ray film (Kodak, Shantou, China).

CAR status in cancer cells is largely unknown, we first evaluated adenoviral gene transfer efficiency in tumor cells using Ad-GFP. Eca109 tumor cells were infected with AdGFP at MOIs of 5, 10, 20, 50 and 100 for 48 h. We demonstrated that 73.6 ± 2.3% of A-549 cells were positive for GFP at an MOI of 50; this MOI was used for further study. To study the inhibitory effects of adenoviral vector-gene transfer on both ODC and Ad-ODCas gene expression, Eca109 cells were infected with Ad-GFP, AdODCas, and Ad-ODC-AdoMetDCas at an MOI of 50 for 72 h. Protein extracted from both adenoviral vector-treated and control conditions were probed with antibodies against ODC and AdoMetDC. Figure 1 shows that Ad-ODCAdoMetDCas induced a greater than 50% reduction of both ODC and AdoMetDC protein in Eca109 cells compared with Ad-GFP-infected or uninfected cells. Similarly, Ad-ODC-AdoMetDCas induced a greater than 50% reduction of both ODC and AdoMetDC protein in Eca109 cells compared with control conditions. Not surprisingly, ODC protein levels dropped more than 50% in Eca109 cells after Ad-ODCas treatment compared with Ad-GFP-infected or uninfected cells. However, there was no appreciable change in AdoMetDC protein levels in AdODCas-treated cells compared with control cells.

E. Measurement of polyamine content Polyamine content was measured as previously described (Aboul-Enein and al-Duraibi, 1998). After an incubation with PBS, Ad-GFP, Ad-ODCas,and Ad-ODC-AdoMetDCas for 3 days, Eca109 cells were harvested by scraping and permeabilized with 5% trichloroacetic acid. The polyamines in the supernatant were separated and quantified on an ionpaired, reversed-phase HPLC system. Protein content was subsequently measured in the precipitate.

F. Measurement of cell growth Viable cell counts were used to evaluate the effects of recombinant adenovirus on cell proliferation. Eca109 cells were plated in 6-well tissue culture plates at a density of 5x104 cells/well. After 24 h, tumor cells were treated with Ad-GFP, Ad-ODCas, and Ad-ODCAdoMetDCas at an MOI of 50 or with PBS as a control. Cells in each treatment group were plated in triplicate and cultured for 6 days. Cells were then treated with trypsin and harvested every 24 h and subsequently stained with 0.4% trypan blue (Gibco, USA) for the identification of dead cells. Viable cells were then counted using a hemocytometer.

G. Cell cycle analysis Eca109 cells were seeded at a density of 3x105 cells/well in 6-well plates and treated with Ad-GFP, Ad-ODCas, or AdODC-AdoMetDCas at an MOI of 50 or treated with PBS as a control. Three days following treatment, cells were harvested as described above, washed once with cold PBS, and fixed with 70% ethanol. Cells were then washed with ice-cold PBS and treated with RNase. DNA was subsequently stained with propidium iodide. Cell cycle phases were analyzed using FACScan (Becton Dickinson).

B. Ad-ODC-AdoMetDCas gene transfer decreases polyamine content in cancer cells After demonstrating that Ad-ODC-AdoMetDCas depressed ODC and AdoMetDC protein expression levels in Eca109 cells, we next evaluated whether the polyamine content could be decreased accordingly by adenoviral gene transfer into these tumor cells. Polyamines in adenovirusinfected or uninfected cancer cells were separated by ionpaired, reversed-phase HPLC. As shown in Table 1, both Ad-ODCas and Ad-ODCAdoMetDCas decreased the polyamine content of Eca109 cells, correlating with the downregulation of polyamine biosynthesis. Table 1 also shows that incubation with Ad-ODCas alone caused a drop in putrescine content in Eca109 cells. Spermidine concentrations decreased, while spermine levels remained low too. In cells treated with Ad-ODC-AdoMetDCas, all three polyamines were reduced to very low levels. After a comparison of Ad-ODC-AdoMetDCas- and Ad-ODCasinfected cells, both spermidine and spermine were significantly reduced (P<0.05).

H. Matrigel invasion assay Eca109 cells were infected with Ad-GFP, Ad-ODCas, or Ad- ODC-AdoMetDCas at an MOI of 50 for 2 days. Invasiveness was measured by counting cells that had traveled through Matrigel-coated Transwell inserts. Transwell inserts (6.5 mm) with a 8.0-µm pore size were coated with 30 µl of Matrigel and dried for 2 h at room temperature. Cells were harvested as described above. A 100-µl cell suspension containing 5x104 cells was added to wells in triplicate. After 24 h of incubation, nonmigrated cells were scraped from the upper side of the membrane with cotton swaps. Cells that passed through the filter into the bottom side of the membrane were fixed and stained with hematoxylin. Five representative fields in each well were quantified to determine the number of invasive cells under a light microscope at 200 x magnification.

C. Ad-ODC-AdoMetDCas inhibits cancer cell proliferation

I. Statistical analysis

After confirming the suppression of ODC and AdoMetDC gene expression and polyamine reduction by adenoviral gene transfer, we then asked whether these inhibitory effects could be translated into inhibition of cell growth. We used viable cell counts to determine rates of tumor cell proliferation. The results in Figure 2 demonstrate significant inhibition of cell proliferation in cancer cell lines treated with either Ad-ODCas or AdODC-AdoMetDCas (P < 0.05) compared with control cells treated with either Ad-GFP or PBS. This inhibition of cell growth was maintained for 7 days (data not shown). Significant differences in the inhibitory effects existed

Data are reported as the mean ± standard deviation (SD).Statistical differences between control and treated cells were evaluated using Student, s t-test. A value of P < 0.05 was considered significant.

III. Results A. Ad-ODC-AdoMetDCas inhibits ODC and AdoMetDC gene expression in cancer cells in vitro Adenovirus infects host cells through the coxsackie and adenovirus receptor (CAR) (Bao et al, 2005). As the

153

Tian et al: Adenovirus-mediated Expression of both ODC and AdoMetDC between Ad-ODCas- and Ad-ODC-AdoMetDCasmediated transduction (P <0.05). When compared with

Ad-ODCas, Ad-ODC-AdoMetDCas was shown to be more effective in inhibiting proliferation of Eca109 cell.

Figure 1. Western blot analysis of ODC and AdoMetDC gene expression in Eca109 cells. Total protein was extracted 3 days after infection with Ad-GFP, Ad-ODCas, or Ad-ODC-AdoMetDCas at an MOI of 50. Each lane was loaded with 50 "g protein and electrotransferred onto a nitocellulose membrane. The blot was probed with either an ODC monoclonal antibody or an AdoMetDC polyclonal antibody.

Table 1. Effects of Ad-ODCas and Ad-ODC-AdoMetDCas on polyamine content (mmol/mg protein) in Eca109 cells. Cells were seeded at a density of 1 # 106 cells/cm2 and infected at an MOI of 50 with Ad-GFP, Ad-ODCas, or Ad-ODCAdoMetDCas. After 3 days of infection, cells were collected and prepared for HPLC analysis. Results are presented as the mean ± SD of three separate experiments. *P < 0.05 vs. Ad-GFP or uninfected cells Cell lines and Treatment Eca109 + Ad-GFP + Ad-ODCas + Ad-ODC-AdoMetDCas

Polyamine pools ( pmol/mg protein) Put Spd Spm 590 1560 1489 525 1463 1672 254* 1189* 1321 76* 632* 337*

Figure 2. Effects of Ad-ODCas and Ad-ODC-AdoMetDCas on proliferation of Eca109 cell. Cells were seeded at 5 # 104 cells/well and allowed to attach for 24 h. Viable cells were counted daily by trypan blue exclusion on days 0–5 after infection with Ad-GFP, AdODCas and Ad-ODC-AdoMetDCas at an MOI of 50 and compared with uninfected cells.

154

Gene Therapy and Molecular Biology Vol 11, page 155 in Ad-ODC-AdoMetDCas treated cells (Figure 4). Our data indicate that Ad-ODCAdoMetDCas treatment arrests tumor cells in G0–G1 phase. This cell cycle arrest correlates with an increased level of p21 expression.

D. Ad-ODC-AdoMetDCas arrests cancer cell cycles in G1 phase After we had established that Ad-ODC-AdoMetDCas inhibited tumor cell proliferation, we further analyzed cell cycle profiles of gene-transferred tumor cells. Eca109 cells were treated with PBS, Ad-GFP, Ad-ODCas, or Ad-ODCAdoMetDCas at an MOI of 50 for 72 h (Figure 3). Cells were then harvested by treatment with trypsin. Propidium iodide staining was used to detect changes in DNA concentrations in different phases of the cell cycle. Results displayed in Table 2 show that Ad-ODC-AdoMetDCas and Ad-ODCas cause more Eca109 cells to arrest compared with controls (P < 0.05). Eca109 cells were arrested in G0-G1 phase (66±3.2% in Ad-ODCAdoMetDCas- and 56±2.3% in Ad-ODCas-treated conditions) compared with 45 ± 2.5% in PBS and 49 ± 3.2% in Ad-GFP- treated conditions. Statistical analysis also revealed a significant difference between Ad-ODCAdoMetDCas-and Ad-ODCas-treated Eca109 cells (P < 0.05) and a greater number of Eca109 cells were arrested by Ad-ODCAdoMetDCas. The cell cycle regulatory protein, p21WAF1/CIP1/SDI1 (p21), is known to regulate the G1-S transition (Kamb, 1995). We further analyzed whether p21 gene expression was altered after adenoviral gene transfer and whether it correlated with cell cycle arrest. Expression of p21 in Eca109 cell was detected by Western blot analysis. After 3 days of incubation, p21 was found increased up to 3-fold

E. Ad-ODC-AdoMetDCas impairs tumor invasiveness in vitro The Matrigel assay is a widely used protocol to evaluate tumor invasiveness in vitro. We therefore performed the Matrigel assay to evaluate whether either Ad-ODCas or Ad-ODC-AdoMetDCas could decrease tumor invasiveness in addition to their anti-proliferative effects reported above. Eca109 cells (5x104 cells per insert) were allowed to invade the Matrigel-coated membrane. The numbers of invading cells were represented as the average of five randomly selected microscopic fields on the underside of the membrane (Figure 5A). As shown in Figure 5B, only 9 ± 3 cells in the Ad-ODCAdoMetDCas condition and 20 ± 5 cells in the Ad-ODCas condition passed through the membrane. In comparison, 51 ± 7 cells in the PBS condition and 48 ± 8 cells in the Ad-GFP condition passed through the filter (P <0.01). In addition, only 30% of Ad-ODC-AdoMetDCasinfected tumor cells successfully passed through the membrane. These results clearly demonstrate that AdODC-AdoMetDCas significantly decreased tumor invasiveness in vitro.

Figure 3. Effects of Ad-ODCas and Ad-ODC-AdoMetDCas on Eca109 cell cycle. Cells were treated with 50 MOI of Ad-GFP, AdODCas, Ad-ODC-AdoMetDCas or PBS (Mock) as a control for 3 days and then collected and dyed by propidium iodide for cell cycle analysis. The data are representative of three separate experiments.

155

Tian et al: Adenovirus-mediated Expression of both ODC and AdoMetDC Table 2. G0 –G1 cell cycle phase distribution of Eca109 cells. Percent of total cells G0-G1 ( X ±S) 45±2.5 49±3.2 * 56±2.3 ! 66±3.2*

Cell lines and treatment Eca109 cell PBS) +Ad-GFP +Ad-ODC/Ex3as +Ad-ODC-AdoMetDCas *

P <0.05, Vs Ad-GFP- and PBS-treated cells.

Figure 4. Western blot analysis of p21 expression levels in Eca109 cell. Total protein was extracted 3 days after infection at an MOI of 50. Each lane was loaded with 80 "g of protein and probed with a p21 monoclonal antibody.

Figure 5. A. Ad-ODC-AdoMetDCas inhibited Eca109 cell invasion. Eca109 cells were treated with recombinant adenovirus at an MOI of 50 for 72 h and then allowed to invade transwell inserts (8-"m pores) coated with Matrigel for 24 h. The cells that invaded through the inserts were stained, counted, and photographed under light microscopy at 200# magnification. B. The numbers of cells that invaded through the Matrigel-coated inserts. The data are presented as the mean ± SD for three separate experiments from each group.

156

Gene Therapy and Molecular Biology Vol 11, page 157 cell types, such as IEC-6, Hep-2, MKN45, and HL-60, in G1 phase (Wallace et al, 2003). Our recent work also demonstrated that treatment of Eca109 cells with AdODCas causes lung cell cycle arrest in G1 phase (Tian et al, 2006a). In agreement with these findings, we demonstrated that both Ad-ODC-AdoMetDCas and AdODCas decreased the rate of DNA synthesis of cancer cells and blocked cell cycle at the G1/S boundary. This result also suggests that synergistic inhibition of ODC and AdoMetDC activities may be more effective in inducing cell cycle arrest and halting cell growth than a single blockade of ODC activity. These data are in agreement with a report that treatment of MALME-3M cells with either the ODC inhibitor, DFMO, or the AdoMetDC inhibitor, MDL-73811, slows cell growth but fails to induce cell cycle arrest, and treatment with a combination of both inhibitors halts cell growth and causes a significant G1 arrest (Kramer et al, 2001). We also assessed the effects of the two antisense constructs in the context of tumor invasiveness. Both AdODCAdoMetDCas and Ad-ODCas reduced the invasiveness of Eca109 cells compared with vector controls. Furthermore, the data also showed that Ad-ODCAdoMetDCas was superior in inhibiting cancer cell invasion compared with Ad-ODCas infection. Overexpression of ODC has been suggested to confer an invasive phenotype on cells. Kubota and colleagues reported in 1997 that overexpression of ODC in mouse 10T1/2 fibroblasts induced not only cell transformation and anchorage-independent growth in soft agar, but also invasiveness through a Matrigel-coated filter. Similar work had been done by this same group (Kubota et al, 1995) that compared the invasiveness of mouse mammary carcinoma FM3A and EXOD cell lines that overexpress ODC and found that EXOD cells showed more than a 5.6fold increase in invasiveness compared with FM3A cells by Matrigel assay. Inhibition of ODC by DFMO reduced invasiveness in breast cancer cells significantly (Manni et al, 2002). Our previous work in which ODC levels were reduced using the adenovirus-delivered antisense ODC found that lower ODC levels also inhibited tumor invasion in lung cancer (Tian et al, 2006a). ODC, however, is not the sole enzyme responsible for olyamine biosynthesis or tumor invasion. AdoMetDC was also proven to strongly correlate with progression of tumor invasiveness. Overexpression of AdoMetDC alone has been reported to be sufficient to transform NIH 3T3 cells and induce highly invasive tumors in nude mice (Manni et al, 1995). High expression levels of AdoMetDC may compensate for and strengthen the activity of ODC through different molecular pathways (Ravanko et al, 2004). Therefore, we simultaneously targeted both these critical enzymes and obtained superior inhibition of cancer invasion. In summary, we provide evidence that polyamine reduction by antisense techniques that targeted ODC and AdoMetDCas suppresses cancer cell growth and invasiveness in vitro. Synergistic inhibition of both ODC and AdoMetDC activities by gene therapy approaches therefore might represent a novel treatment option for esophageal cancer.

IV. Discussion It has been known for many years that normal cell growth is regulated in a cyclical manner by the increase and decrease of cyclins and cyclin-dependent kinases (cdks). Furthermore, there are also changes in polyamine, ODC and AdoMetDC concentrations during the cell cycle. Both ODC and AdoMetDC mRNA levels and polyamine concentration are doubled during the cell cycle. Elevated levels of ODC and AdoMetDC activity were found in various cancers (Cohen, 1998), such as prostate, breast, and colorectal cancer, and are related to cancer recurrence (Pegg and McCann, 1982; Gutman et al, 1995). Our recent work has proven that inhibition of ODC activity by recombinant antisense ODC adenovirus has had antitumor effects on human lung cancer (Tian et al, 2006a,b).This adenovirus, however, did not inhibit AdoMetDC, a critical enzyme that is normally elevated in tumor cells. We speculate that double inhibition of ODC and AdoMetDC might be a more effective way to suppress tumor growth. Our in vitro study demonstrated more robust antitumor effects by dual inhibition of both ODC and AdoMetDC activities compared to inhibition of ODC activity alone. Double inhibition by Ad-ODCAdoMetDCas infection significantly reduced ODC and AdoMetDC protein levels more than 50% Eca109 cells compared to controls. A substantial decrease in ODC and AdoMetDC expression levels also causes a reduction of polyamine biosynthesis. Ad-ODC-AdoMetDCas infection depresses three types of polyamines. In contrast, only putrescine and spermidine were shown to be decreased after Ad-ODCas infection. Ad-ODCas treatment of tumor cells did not elicit a statistical difference in spermine content compared with control treatment. We speculate that the inability of AdODCas to block AdoMetDC activity might be responsible for this observation, consistent with results reported by other researchers who demonstrated that the ODC inhibitor, DFMO, had no effect on spermine levels in tumor cells. Spermine, however, plays an equally important role in carcinogenesis as do the other polyamines. Furthermore, high levels of spermine also contribute to cellular resistance to apoptotic cell death (Hashimoto et al, 1999). The inability of Ad-ODCas to decrease intracellular spermine levels therefore represents an inherent drawback in its potential antitumor effects. P53, also known as tumor protein 53 (TP53), is a transcription factor that regulates the cell cycle and hence functions as a tumor suppressor. It is important in multicellular organisms as it helps to suppress cancer. p53 has been described as "the guardian of the genome", "the guardian angel gene", or the "master watchman", referring to its role in conserving stability by preventing genome mutation. It has also been found to play an important role in sun tanning. The alteration of gene p53 is a key event in esophagus cancer and if there is a relationship between ODC and AdoMetDC on this issue,we will study it in the future. To further understand the underlying mechanism of tumor cell growth inhibition, cell cycle and cellcyclerelated proteins were examined. Previous studies have shown that DFMO arrests a broad spectrum of tumor

157

Tian et al: Adenovirus-mediated Expression of both ODC and AdoMetDC methylglutaryl coenzyme A reductase and isoprenylation inhibitors induce apoptosis of vascular smooth muscle cells in culture. Circ Res 83, 490 –500 Horejsi V, Drbal K, Cebecauer M, Cerny J, Brdicka T, Angelisova P, Stockinger H (1999) GPI-microdomains: a role in signalling via immunoreceptors. Immunol Today 20, 356-361

References Aikawa M, Rabkin E, Okada Y, Voglic SJ, Clinton SK, Brinckerhoff CE, Sukhova GK, Libby P (1998) Lipid lowering by diet reduces matrix metalloproteinase activity and increases collagen content of rabbit atheroma: a potential mechanism of lesion stabilization. Circulation 97, 2433– 2444 Blackford J, Reid HW, Pappin DJ, Bowers FS, Wilkinson JM (1996) A monoclonal antibody, 3/22 to rabbit CD11c which induces homotypic T cell aggregation: evidence that ICAM-1 is a ligand for CD11c/CD18. Eur J Immunol 26, 525-531

Issekutz AC (1998) Adhesion molecules mediating neutrophil migration to arthritis in vivo and across endothelium and connective tissue barriers in vitro. Inflamm Res 47, S123– S132 Kallen J, Welzenbach K, Ramage P, Geyl D, Kriwacki R, Legge G, Cottens S, Weitz-Schmidt G, Hommel U (1999) Structural basis for LFA-1 inhibition upon lovastatin binding to the CD11a I-domain. J Mol Biol 292, 1-9 Katznelson S, Kobashigawa JA (1995) Dual roles of HMG-CoA reductase inhibitors in solid organ transplantation: Lipid lowering and immunosuppression. Kidney Int 48, S112– S115

Carlos TM, Harlan JM (1994) Leukocyte-endothelial adhesion molecules. Blood 84, 2068-2101 Chavakis T, Kanse SM, Yutzy B, Lijnen HR, Preissner KT (1998) Vitronectin concentrates proteolytic activity on the cell surface and extracellular matrix by trapping soluble urokinase receptor-urokinase complexes. Blood 91, 23052312 Chavakis T, May AE, Preissner KT, Kanse SM (1999) Molecular mechanisms of zinc-dependent leukocyte adhesion involving the urokinase receptor and ß2-integrins. Blood 93, 29762983 Chavakis T, Kanse SM, Lupu F, Hammes HP, Muller-Esterl W, Pixley RA, Colman RW, Preissner KT (2000) Different mechanisms define the antiadhesive function of high molecular weight kininogen in integrin- and urokinase receptor-dependent interactions. Blood 96, 514-522 Chavakis T, Kanse SM, Pixley RA, May AE, Isordia-Salas I, Colman RW, Preissner KT (2001) Regulation of leukocyte recruitment by polypeptides derived from high molecular weight kininogen. FASEB J 15 2365-2376 Chavakis T, Hussain M, Kanse SM, Peters G, Bretzel RG, Flock JI, Herrmann M, Preissner KT (2002) Staphylococcus aureus extracellular adherence protein (Eap) serves as antiinflammatory factor by inhibiting the recruitment of host leukocytes. Nature Medicine 8, 687-693 Corsini A, Maggi FM, Catapano AL (1995) Pharmacology of competitive inhibitors of HMG-CoA reductase. Pharmacol Res 31, 9–27

Krauss K, Altevogt P (1999) Integrin leukocyte functionassociated antigen-1-mediated cell binding can be activated by clustering of membrane rafts. J Biol Chem 274, 3692136927 Krueger J, Gottlieb A, Miller B, Dedrick R, Garovoy M, Walicke P (2000) Anti-CD11a treatment for psoriasis concurrently increases circulating T-cells and decreases plaque T-cells, consistent with inhibition of cutaneous T-cell trafficking. J Invest Dermatol 115, 333 Kurzchalia TV, Parton RG (1999) Membrane microdomains and caveolae. Curr Opin Cell Biol 11, 424-431 Kwak BR, Mach F (2001) Statins inhibit leukocyte recruitment. New evidence for their anti-inflammatory properties. Arterioscler Thromb Vasc Biol 21, 1256-1258 Kwak B, Mulhaupt F, Myit S, Mach F (2000) Statins as a newly recognized type of immunomodulator. Nat Med 6, 13991403 Laufs U, La Fata V, Plutzky J, Liao JK (1998) Upregulation of endothelial nitric oxide synthase by HMG CoA reductase inhibitors. Circulation 97, 1129–1135 Laufs U, Liao JK (1998) Post-transcriptional regulation of endothelial nitric oxide synthase mRNA stability by Rho GTPase. J Biol Chem 273, 24266–24271 Laufs U, Marra D, Node K, Liao JK (1999) 3-Hydroxy-3methylglutaryl-CoA reductase inhibitors attenuate vascular smooth muscle proliferation by preventing rho GTPaseinduced down-regulation of p27(Kip1). J Biol Chem 274, 21926 –21931 Liu L, Moesner P, Kovach NL, Bailey R, Hamilton AD, Sebti SM, Harlan JM (1999) Integrin-dependent leukocyte adhesion involves geranylgeranylated protein(s). J Biol Chem 274, 33334–33340 Maron DJ, Fazio S, Linton MF (2000) Current perspectives on statins. Circulation 101, 207–213 Martin X, Da Silva M, Virieux SR, Hadj Aissa A, Buffet R, Tiollier J, Dubernard JM (2000) Protective effect of an antiLFA 1 monoclonal antibody (odulimomab) on renal damage due to ischemia and kidney autotransplantation.Transplant Proc 32, 481 May AE, Kanse SM, Lund LR, Gisler RH, Imhof BA, Preissner KT (1998) Urokinase receptor (CD87) regulates leukocyte recruitment via ß2-integrins in vivo. J Exp Med 188, 10291037

Diomede L, Albani D, Sottocorno M, Polentarutti N, Donati MB, Bianchi M, Fruscella P, Salmona M (2001) The in vivo antiinflammatory effect of statins is mediated by nonsterol mevalonate products. Arterioscler Thromb Vasc Biol 21, 1327–1332 Essig M, Nguyen G, Prie D, Escoubet B, Sraer JD, Friedlander G (1998) 3-Hydroxy-3-methylglutaryl coenzyme A reductase inhibitors increase fibrinolytic activity in rat aortic endothelial cells: role of geranylgeranylation and Rho proteins. Circ Res 83, 683–690 Frenette PS (2001) Locking a leukocyte integrin with statins. N Engl J Med 345, 1419-1421 Gahmberg CG (1997) Leukocyte adhesion: CD11/CD18 integrins and intercellular adhesion molecules. Curr Opin Cell Biol 9, 643-650 Ganne F, Vasse M, Beaudeux JL, Peynet J, Francois A, Mishal Z, Chartier A, Tobelem G, Vannier JP, Soria J, Soria C (2000) Cerivastatin, an inhibitor of HMG-CoA reductase, inhibits urokinase/urokinase-receptor expression and MMP-9 secretion by peripheral blood monocytes-a possible protective mechanism against atherothrombosis. Thromb Haemost 84, 680-688 Guijarro C, Blanco-Colio LM, Ortego M, Alonso C, Ortiz A, Plaza JJ, Diaz C, Hernandez G, Edigo J (1998) 3-Hydroxy-3-

158

Gene Therapy and Molecular Biology Vol 11, page 159 Nakakura EK, Shorthouse RA, Zheng B, McCabe SM, Jardieu PM, Morris RE (1996) Long-term survival of solid organ allografts by brief anti-lymphocyte function-associated antigen-1 monoclonal antibody monotherapy. Transplantation 62, 547–552

normocholesterolemic rabbits. Arterioscler Thromb 13, 571–578 Springer TA (1994) Traffic signals for lymphocyte recirculation and leukocyte emigration: The multistep paradigm. Cell 76, 301-314 Stewart M, Thiel M, Hogg N (1995) Leukocyte integrins. Curr Opin Cell Biol 7, 690-696 Weber C, Erl W, Weber KS, Weber PC (1997) HMG-CoA reductase inhibitors decrease CD11b expression and CD11bdependent adhesion of monocytes to endothelium and reduce increased adhesiveness of monocytes isolated from patients with hypercholesterolemia. J Am Coll Cardiol 30, 1212– 1217 Weber C, Erl W, Weber PC (1995) Lovastatin induces differentiation of Mono Mac 6 cells. Cell Biochem Funct 13, 273-277 Wei Y, Waltz DA, Rao N, Drummond RJ, Rosenberg S, Chapman HA (1994) Identification of the urokinase receptor as an adhesion receptor for vitronectin. J Biol Chem 269, 32380-32388

Ossowski L, Aguirre-Ghiso JA (2000) Urokinase-receptor and integrin partnership: coordination of signaling for cell adhesion, migration and growth. Curr Opin Cell Biol 12, 613-620 Porter JC, Hogg N (1998) Integrins take partners: cross-talk between integrins and other membrane receptors. Trends Cell Biol 8, 390-396 Poston RS, Robbins RC, Chan B, Simms P, Presta L, Jardieu P, Morris RE (2000) Effects of humanized monoclonal antibody to rhesus CD11a in rhesus monkey cardiac allograft recipients. Transplantation 69, 2005–2013 Preissner KT, Kanse SM, May AE(2000) Urokinase receptor: a molecular organizer in cellular communication. Curr Opin Cell Biol 12, 621-628 Romano M, Diomede L, Sironi M, Massimiliano L, Sottocorno M, Polentarutti N, Guglielmotti A, Albani D, Bruno A, Fruscella P, Salmona M, Vecchi A, Pinza M, Mantovani A (2000) Inhibition of monocyte chemotactic protein-1 synthesis by statins. Lab Invest 80, 1095–1100 Simons K, Toomre D (2000) Lipid rafts and signal transduction. Nat Rev Mol Cell Bio 1, 31-39 Sitrin RG, Todd RF, Petty HR, Brock TG, Shollenberger SB, Albrecht E, Gyetko MR (1996) The urokinase receptor (CD87) facilitates CD11b/CD18-mediated adhesion of human monocytes. J Clin Invest 97, 1942-1951

Weitz-Schmidt G, Welzenbach K, Brinkmann V, Kamata T, Kallen J, Bruns C, Cottens S, Takada Y, Hommel U (2001) Statins selectively inhibit leukocyte function antigen-1 by binding to a novel regulatory integrin site. Nat Med 7, 687692 Wojciak-Stothard B, Williams L, Ridley AJ (1999) Monocyte adhesion and spreading on human endothelial cells is dependent on Rho-regulated receptor clustering. J Cell Biol 145, 1293–1307 Woods A, Couchman JR (2000) Integrin modulation by lateral association. J Biol Chem 275, 24233-24236 Yoshida M, Sawada T, Ishii H, Gerszten RE, Rosenzweig A, Gimbrone MA Jr, Yasukochi Y, Numano F (2001) HMGCoA reductase inhibitor modulates monocyte endothelial interaction under physiological flow condition in vitro: involvement of Rho GTPase-dependent mechanism. Arterioscler Thromb Vasc Biol 21, 1165–1171

Smart EJ, Graf GA, McNiven MA, Sessa WC, Engelman JA, Scherer PE, Okamoto T, Lisanti MP (1999) Caveolins, liquid-ordered domains, and signal transduction. Mol Cell Biol 19, 7289-7304 Soma MR, Donetti E, Parolini C, Mazzini G, Ferrari C, Fumagalli R, Paoletti R (1993) HMG CoA reductase inhibitors: in vivo effects on carotid intimal thickening in

159

Tian et al: Adenovirus-mediated Expression of both ODC and AdoMetDC

160

Gene Therapy and Molecular Biology Vol 11, page 151 Gene Ther Mol Biol Vol 11, 151-160, 2007

Hui Tian1,*, Xian-Xi Liu2, Bing Zhang2, Qi-Feng Sun1, Dong-Feng Sun1 1 2

151

152

Gene Therapy and Molecular Biology Vol 11, page 153 (Santa Cruz Biotechnology, USA), and exposed to X-ray film (Kodak, Shantou, China).

C. Ad-ODC-AdoMetDCas inhibits cancer cell proliferation

I. Statistical analysis

153

Tian et al: Adenovirus-mediated Expression of both ODC and AdoMetDC between Ad-ODCas- and Ad-ODC-AdoMetDCasmediated transduction (P <0.05). When compared with

Ad-ODCas, Ad-ODC-AdoMetDCas was shown to be more effective in inhibiting proliferation of Eca109 cell.

Polyamine pools ( pmol/mg protein) Put Spd Spm 590 1560 1489 525 1463 1672 254* 1189* 1321 76* 632* 337*

154

155

Cell lines and treatment Eca109 cell PBS) +Ad-GFP +Ad-ODC/Ex3as +Ad-ODC-AdoMetDCas *

P <0.05, Vs Ad-GFP- and PBS-treated cells.

156

157

158

159

Tian et al: Adenovirus-mediated Expression of both ODC and AdoMetDC

160

Gene Therapy and Molecular Biology Vol 11, page 161 Gene Ther Mol Biol Vol 11, 161-170, 2007

Chromium Picolinate (CrP) a putative anti-obesity nutrient induces changes in body composition as a function of the Taq1 dopamine D2 receptor polymorphisms in a randomized double-blind placebo controlled study Research Article

Thomas JH Chen1, Kenneth Blum2,4,9,11,*, Gilbert Kaats3, Eric R. Braverman4, Arthur Eisenberg5, Mark Sherman5, Katharine Davis5, David E. Comings6, Robert Wood7, Dennis Pullin8, Vanessa Arcuri4, Michael Varshavski4, Julie F. Mengucci9, Seth H. Blum,9 Bernard W. Downs10, Brian Meshkin11, Roger L. Waite12, Lonna Williams11, John Schoolfield13, Thomas J Prihoda14, Lisa White15 1

Chang Jung Christian University, Tainan, Taiwan, Republic of China Department Of Physiology and Pharmacology, Wake Forest University School Of Medicine, Winston Salem, North Carolina, USA 3 Health and Medical research Foundation Of San Antonio, San Antonio, Texas, USA 4 Path Medical Clinic, New York, USA 5 University of North Texas Health Sciences, Forth Worth, Texas, USA 6 Carlsbad Science Foundation, emeritus, City of Hope National Medical Center, Duarte, California, USA 7 University of Texas Health Science Center, San Antonio, Texas, USA 8 Sports Medicine Institute, Baylor College of Medicine, Houston, Texas, USA 9 Synapatmine, Inc., San Antonio, Texas, USA 10 Allied Nutraceutical Research, Lederach, PA, USA 11 Salugen, Inc. San Diego, California, USA 12 GenWellness, Inc. San Diego, California, USA 13 Department of Infomatics, University Of Texas Health Science Center, San Antonio, Texas, USA 14 Department of Pathology, University of Texas Health Science Center, San Antonio, Texas, USA. 15 Department of Molecular Genetics, Baylor College of Medicine, Houston Texas and DNA Services of America, Lafayette, Louisiana, USA 2

__________________________________________________________________________________ *Correspondence: Kenneth Blum, Ph.D. Department Physiology & Pharmacology, Wake Forest University School of Medicine, Medical Center Boulevard, Winston-Salem, North Carolina, 27157-1083, USA; email: drd2gene@aol.com Key words: Chromium Picolinate, genotyping, body-composition, Genotrim®, and dopamine D2 receptor gene Abbreviations: 2’- deoxynucleotide 5’-triphosphates, (dNTPs); body mass index, (BMI); Chromium Picolinate, (CrP); Chromium, (Cr); confidence interval, (CI); D2 receptor, (DRD2); estimated safe and adequate daily dietary intake, (ESADDI); Free Fat Mass, (FFM); Generally Recognized as Safe, (GRAS); high-density lipoprotein, (HDL); lean body mass, (LBM); Leptin OB, (LEPT); obesity, (OB); polymerase chain reaction, (PCR); recommended dietary allowance, (RDA); reference dose, (RfD)

The contents of this publication do not necessarily reflect the views or policies of the respective Universities or research organizations. Kenneth Blum, Ph. D. owns the major stock in Synapatamine and Salugen, Inc. Brian Meshkin is a major stock holder in Salugen, Inc. B. William Downs, is a major stock holder in Allied Nutraceutical Research. Chromium is one of the active ingredients in a patent awarded to Kenneth Blum US patent number 6,132,724, 6,955,873 and other patents pending and a PCT. This paper was presented at the October, 1998 Annual meeting of the American College of Nutrition meeting at Albuquerque, New Mexico as abstract 38.

161

Chen et al: Chromium Picolinate and DRD2 Gene Received: 17 March 2007; Revised: 1 June 2007 Accepted: 26 July 2007; electronically published: August 2007

Summary There is controversy regarding the effects and safety of chromium salts (picolinate and nicotinate) on body composition and weight loss in humans. Thus, we decided to test the hypothesis that typing the obese patients by genotyping the dopamine D2 receptor (DRD2) gene prior to treatment with Chromium Picolinate (CrP) would result in a differential treatment outcome. We genotyped obese subjects for the DRD2 gene utilizing standard PCR techniques. The subjects were assessed for scale weight and for percent body fat using dual energy X-ray absorptiometry (DEXAR). The subjects were divided into matched placebo and CrP groups (400 µg. per day) accordingly. The sample was separated into two independent groups. Those with either an A1/A1 or A1/A2 allele or those with only the A2/A2 allelic pattern. Each of these groups were tested separately for differences between placebo and treatment means for a variety of measures of weight change. The measures of the change in fat weight (p<0.041), change in body weight (p<0.017), the percent change in weight (p<0.044), and the body weight change in kilograms (p<0.012) were all significant for carriers of the DRD2 A2 genotype, whereas no significance was found for any parameter for those subjects possessing a DRD2 A1 allele. These results suggest that the dopaminergic system, specifically the density of the D2 receptors, confers a significant differential therapeutic effect of CrP in terms of weight loss and change in body fat, thereby strengthening the need for DNA testing.

sensitive subgroups that is likely to be without an appreciable risk of deleterious effects over a lifetime (Mertz et al, 1994). The ratio of the RfD to the ESADDI or recommended dietary allowance (RDA) is 350 for Cr ESADDI, compared with less than 2 for zinc RDA, roughly 2 for manganese (ESADDI), and 5-7 for selenium ESADDI (Mertz et al, 1994). Moreover, Anderson (1998) demonstrated a lack of toxicity of Cr chloride (CrCl) and CrP in rats at levels several thousand times the upper limit of the ESADDI for humans (Anderson, 1998). In 1995, there was concern over the demonstration by Stearns and colleagues in 1995 that, at concentrations thousands of times higher than physiological levels, trivalent chromium (CrP and picolinic acid per se) can break chromosomes in cell culture. Others (WHO, 1973; Evans, 1993; Lukaski, 1999) suggest that this finding may not be relevant to nutritional supplementation. In this regard, a prediction that CrP will accumulate in tissues to dangerous levels during long-term supplementation is based on an inappropriate pharmacokinetic model and is at odds with data from long-term rat feeding studies (Anderson, 1979; Evens, 1994). Furthermore, clastgenicity (breakage of chromosomes leads to the production of micronucleus formation of acentric fragments called clastogens) is not equivalent to either mutagenicity or carcinogenicity and studies in animals reveal that any effects observed with regard to clastogenicity of trivalent chromium is only relevant to cell culture studies, not to living animals or humans (Stoecker, 1990; Loveday, 1996; McCarty, 1996). Moreover, the therapeutic–toxic–dose ratio for trivalent chromium is 1:10,000. Thus, clarifying the safety issues concerning Cr+3 in particular the picolinate salt, we believe is quite relevant to the use of this substance as an important dietary supplement, which is utilized on a large scale worldwide to assist in reducing the obesity epidemic (Anderson, 1995). Furthermore, cats tolerate 1000 mg of Cr+3 daily and rodents have no adverse effects with 1000mg of Cr per kg of diet (Lukaski, 1999). It may be

I. Introduction Chromium (Cr) is an essential nutrient involved in the regulation of carbohydrates and lipid metabolism (Anderson, 1998). Normal dietary intake of chromium in humans is often sub-optimal (Anderson, 1998; Diez et al, 2007). In addition to its effects on glucose, insulin, and lipid metabolism, chromium has been reported to increase lean body mass (LBM) and decrease percentage body fat, which may lead to weight loss in humans. The effects of chromium on body composition are controversial but are supported by animal studies, (Page et al, 1993; Lindermann et al, 1995; Kornegay et al, 1997; Min et al, 1997; Mooney et al, 1997; Ward et al, 1997, Fekete et al, 2001) which increase their validity. Negative reports of the effects of CrP on muscle mass and weight loss have also been published in rats (Gonzalez Munoz et al, 2006). Moreover in humans, most recently the effects of CrP on weight loss was not achieved in a recent randomized double-blinded study (Lukaski et al, 2007). A subject’s response to chromium depends on his or her chromium status, the salt of chromium consumed, amount of supplemental chromium, study duration and possibly an individual’s genome. Since we have reported on the involvement of the Taq 1 A1 Dopamine D2 receptor gene polymorphisms and percent body fat (Chen et al, 2007), we decided to test the potential nutrigenetic response of CrP as a function of D2 polymorphisms.

A. Safety issues According to a review by Anderdson in 1998 trivalent Cr found in foods and nutrient supplements, is one of the least toxic nutrients (Mertz et al, 1994). The reference dose (RfD) established by the U.S. Environmental Protection Agency for Cr is 350 times the upper limit of the estimated safe and adequate daily dietary intake (ESADDI) of 200mcg /day (3.85 micro mols.). The RfD is defined as “an estimate (with uncertainly spanning perhaps an order of magnitude) of a daily exposure to the human population, including 162

Gene Therapy and Molecular Biology Vol 11, page 163 noteworthy that hexavalent Cr, according to Lukaski in 1999 is much more toxic than the trivalent form. However, most recently Stallings and colleagues in 2006 in a three-part study examined the effects of several chromium-containing supplements and their components on hatching and eclosion rates and success of development of first generation progeny of adult Drosophila fed food containing these compounds. It further examined the effects of the compounds on longevity of virgin male and female adults. Finally, the chromosomes in the salivary glands of Drosophila late in the third instar larval stage, which were the progeny of Drosophila whose diets were supplemented with nutritional levels of [Cr(pic)(3)], are shown to contain on average over one chromosomal aberration per two identifiable chromosomal arms. No aberrations were observed in chromosomes of progeny of untreated flies. The results suggest that human consumption of the supplement should be a matter of concern and continued investigation to provide insight into the requirements of chromium-containing supplements to give rise to genotoxic effects. There have been both positive and negative cellular findings regarding this potential danger of CRP in humans (Bagchi et al, 2002; Gudi et al, 2005). A review of recent studies on the safety of chromium picolinate was presented by Ronald Slesinski, the president-elect of the regulatory and safety specialty section of the society, at a Centers for Disease Control and Prevention (CDC) conference on metal toxicity and carcinogenesis in 2004: "The safety research overwhelmingly confirms that Chromax chromium picolinate is a safe nutritional supplement," said Dr. Slesinski. "Research studies conducted by the United States Department of Agriculture (USDA), National Toxicology Program (NTP) and at independent testing laboratories, show no evidence of genetic toxicity." As of April 2003, a panel of experts concluded that the weight of the evidence clearly demonstrates the safety of CrP is Generally Recognized as Safe (GRAS) for addition to a number of food categories for human consumption after reviewing the available data. However, other forms of chromium including the polynicotinate form should be considered as an alternative Cr salt (Bagchi et al, 2002).

2000; Luvolsi et al, 2000; Volpe et al, 2001) do not support an effect of Cr on body composition. Other studies (Evans, 1989; Grant et al, 1992; Hasten et al, 1992; Kaats et al, 1992, 1996, 1998; Bulbulian et al, 1996; Bahadori et al, 1997; Crawford et al, 1999) however, do report an effect of Cr on body composition in humans. Additional support is derived from a study by Rubin and colleagues in 1998 showing both acute and chronic resistive exercise increased Cr losses. These data demonstrate that the improvements in body composition due to resistive exercise are associated with increased urinary 53Cr isotope losses that are consistent with increased absorption. It has been suggested that if CrP can lower insulin resistance as reported earlier (Anderson, 1998) it can improve body composition, because insulin resistance or deficiency results in impaired entry of glucose and amino acids into muscle cells, increased catabolism of muscle protein and the potential acceleration of lipid deposition (Evans et al, 1973; Anderson, 1995). In our earlier publication (Kaats et al, 1998), after controlling for differences in caloric intake and expenditure, as compared with the placebo group, subjects in the active treatment group lost significantly more weight (7.79 kg vs. 1.81 kg, respectively) and fat mass (7.71 kg vs. 1.53 kg respectively), and had a greater reduction in percent body fat (6.30% vs. 1.20%, respectively) without any loss of fatfree mass. It was concluded that this study replicated earlier findings (Kaats et al, 1992, 1996) that supplementation with CrP can lead to significant improvements in body composition. Lukaski has argued in 1999 that data from these studies by Kaats and colleagues in 1996, 1998 have the following potential flaws; lack of control of the actual Cr intake and failure to maintain constant energy intake and expenditure. Furthermore, the calculation of fat loss based on a 3500-kcal energy expenditure resulting from physical activity produces dubious results. Thus, according to Lukaski in 1999, our findings (Kaats et al, 1996, 1998) that CrP supplementation promotes fat loss with a preservation of Free Fat Mass (FFM) conflicts with reports of no changes in body composition in adults given CrP supplemented diets and not provided a supplemental exercise program. He further points out that CrP supplementation in conjunction with an exercise-training program also does not facilitate a preferential loss of FFM (Hasten et al, 1992; Trent and Thieding-Cancel, 1995; Lukaski et al, 1996; Hallmark et al, 1996; Grant et al, 1997;Passman et al, 1997). On the other hand, Anderson in 1998 has counterargued and favored the effect of Cr on lean body mass. As stated earlier, there have been at least ten studies of Cr supplementation and resistive exercise. However, the methods used to determine LBM have been questioned, but Anderson suggests in 1998 that this does not negate the actual observed statistical differences between placebo and Cr supplementation. Moreover, three studies (Clancy et al, 1994; Trent and Thieding-Cancel, 1995; Passman et al, 1997), reported no significant increases in LBM from Cr, in subjects performing resistance exercise training. However, changes caused by exercise alone also were not significant. Anderson further points out that it seems

B. Weight related measurements Signs of Cr deficiency in humans consuming parenteral diets that have been documented on numerous occasions by Anderson in 1995, 1998 and Brown and colleagues in 1986, include elevated blood glucose, insulin, cholesterol, and triglycerides and decreased highdensity lipoprotein (HDL) cholesterol (Mertz, 1993). Although numerous reports document the role of Cr in glucose and insulin metabolism (Mertz 1993; Anderson, 1995, 1998b) the role of Cr in the regulation of LBM, percentage body fat, and weight reduction is still highly controversial because a significant number of studies (Clancy et al,1994; Trent and Thieding-Cancel, 1995; Lukaski et al, 1996; Hallmark et al, 1996; Passman et al, 1997; Walker et al, 1998; Campbell et al, 1999; Lukaski, 163

Chen et al: Chromium Picolinate and DRD2 Gene unrealistic to assume that if methods and statistics used do not detect changes caused by resistive exercise in LMB, any changes owing to Cr would be detected. Changes in LBM owing to Cr would certainly be anticipated to be much less than those achieved through strenuous resistive exercise. Moreover, explanation for a number of negative studies could be due to low dosage, small sample size and duration of the study. In a study by Bulbulian and colleagues in 1996, in a study of 20 male and 20 female swimmers who received 400 mcg Cr/day (as CrP), Cr significantly increased LBM, decreased fat mass, and decreased percentage body fat compared with the placebo group. Effects were not significant after 12 weeks but were after 24 weeks. Weight loss is common and relatively easy for many people, but maintaining weight loss is extremely difficult. The failure rate for maintaining weight loss more than 2 years is often greater than 95%. Although there is ample evidence that Cr has an effect on body composition, decreases in body weight from supplemental Cr alone are likely to be small. In studies by Anderson and colleagues (1979,1 998a,b, 1995) during the past 20 years of daily supplementation of 200 mcg CrC and up to 1000 mcg in the form of CrP ranging from 5 weeks to 4 months of supplementation, Andersons’ group have been unable to detect an effect of supplemental Cr on body weight.

alcoholics as a function of dopamine D2 receptor genotype (in 3,329 unscreened controls the A1 allele is present in 29.4% of the general population, whereas the A2 allele is present in 70.6 %) (2003). Other studies involving the D2 receptor gene and drug response includes the work of Nobles’ group showing a differential response of the serotonergic re-uptake inhibitor paroxetine and response of patients with posttraumatic stress disorder .Individuals with the D2 A1 allele were more responsive than those with the D2 A2 allele (Lawford et al ,2003).

E. DRD2 genes and obesity The reinforcing properties of food have also led to an examination of the involvement of DRD2 polymorphisms in obesity. Haplotype 4 (GT) of intron 6 and exon 7 of the DRD2 gene was found to be associated with increasing risk for obesity (Comings et al, 1993). In another study, the DRD2 A1 allele was present in 45.2% of obese subjects (Noble et al, 1994), prevalence similar to that found in alcoholics, nicotine and other drug–dependent subjects. In addition, the A1 allele was significantly associated with carbohydrate craving. Variants of the human obesity (OB) and the DRD2 genes have been examined in relationship to obesity (Comings et al, 1996). Polymorphisms of the Leptin OB gene and the DRD2 A1 allele each associated significantly with obesity. These two polymorphisms together accounted for about 20% of the variance in body mass index (BMI), particularly in younger women. Another study has ascertained the relationship of the DRD2 A1 allele in obese subjects with and without comorbid substance use disorders(Blum et al, 1996c). In obese subjects, the A1 allelic prevalence was significantly higher than controls (P< 10-4). Moreover, the progressive increase in comorbid substance use disorders in these obese subjects was positively related to increased A1 allelic prevalence (P < 10-6). Furthermore, another case control study (Spitz et al, 2000) compared variants of the DRD2 gene in obese (BMI > 30) and non-obese control subjects. The DRD2 A1 allele was significantly higher in obese subjects compared to controls (P = 2 x 10-3) as was the DRD2 B1 allele (P = 3 x 10-3). The risk of obesity associated with the DRD2 A1 genotype was 3.48 compared to 4.55 for the DRD2 B1 genotype. , Moreover, Thomas and colleagues assessed in 2001 Taq1 A DRD2 alleles in 484 obese and 506 non-obese Chinese subjects. Obese subjects, using either BMI or waist–to-hip ratio criteria, had a significantly higher prevalence of the A1 allele (P=0.02) and A1 allelic frequency (P= 0.03) than non-obese subjects. Two studies (Jenkinson et al, 2000; Tataranni et al, 2001) assessed the role of other DRD2 mutations on weight and energy expenditure in Pima Indians. Individuals with a Cys-encoding allele had a higher BMI than those homozygous for the Ser311 –encoding allele (Jenkinson et al, 2000). Further, total energy expenditure and 24-hour resting energy expenditure were lower in homozygotes for the Cys311-encoding allele when compared to heterozygotes and homozygotes for the Ser311-encoding allele (Tataranni et al, 2001). Finally, another study (Rosemond et al, 2001) determined the association of a Nco1 Polymorphism (C-T transition) in

C. Genetic aspects To date there has been no resolution and explanation for the controversial findings related to the effects of Cr salts on body composition and other weight related parameters. However, none of the investigators seriously considered genetic aspects, in spite of the emerging field of nutrigenetics (the biological response to an element is dictated by one’s genotype). The advent of molecular genetic knowledge and techniques, in the past two decades, has revolutionized our understanding of inherited disorders. Although much success has been achieved in localizing genes in Mendelian disorders, great difficulty has been experienced in identifying genes in behavioral disorders (alcoholism, drug dependence, smoking, food and bingeing behavior, etc). In this regard, however, the D2 dopamine receptor gene has been one of the most extensively investigated genes in neuropsychiatric disorders. After the first association of the Taq1 A DRD2 minor (A1) with severe alcoholism in 1990 by Blum and collegaues, a large number of international studies have followed. Variants of the DRD2 gene have also been associated with other addictive disorders including cocaine, nicotine, opioid dependence and obesity. It is hypothesized that the DRD2 gene is a reinforcement or reward gene (Noble, 2003; Blum et al, 1996a,b; Comings et al, 1996; Thanos et al, 2001).

D. DRD2 gene and pharmacogenetics In terms of pharmacogenomic and pharmacogenetic studies involving the D2 receptor gene, Lawford and colleagues showed in 1995 a selective positive effect of bromocriptine, a D2 agonist, in reducing relapse rates in

164

Gene Therapy and Molecular Biology Vol 11, page 165 highly with underwater weighing Nord and Payne, 1995), Deuterium dilution (Jensen et al, 1993), and total potassium (Beshya et al, 1995). The reliability of DEXA makes it possible to monitor the effects of relatively short-term dietary restrictions and exercise on both regional and total body composition. DEXA provides a three-compartment model of body composition: fat, lean tissue mass and bone mineral content. Measurements are made using a constant potential energy source at 78kVp and a K-edge filter (cerium) to achieve a congruent, stable, dual-energy beam with effective energies of 40 to 70 keV. The unit performs a series of transverse scans moving from head to toe at 1-cm intervals; the area being scanned is approximately 60 x 200cm. Data are collected for about 120 pixel elements per transverse, with each pixel approximately 5 x 10 mm. Total body measurements are completed in 10 to 20 minutes with a scan speed of 16 cm/s, or in 20 minutes with a scan speed of 8 cm/s. The rate value (ratio of low – to high – energy attenuation in soft tissue) ranges from 1.2 to 1.4.

exon 6 of the DRD2 gene with hypertension. Subjects with the TT genotype had significantly higher systolic blood pressure than subjects with the CT genotype (P=0.049). Moreover, subjects with TT genotype had significantly higher diastolic blood pressure than either subjects with the CYT or CC genotype (P=0.011). The importance of the latter finding relates to the fact that, there is strong evidence from epidemiological studies of a positive relationship between increased body weight and hypertension (Thomas et al, 2000). In order to resolve the issue of non-responders, we decided to test the hypothesis that typing the obese patients by genotyping the DRD2 gene prior to treatment with CrP would result in a differential treatment outcome. This notion was based on previous research, as discussed above, which in summary, indicated that the DRD2 TaqA1 allele was associated with obesity in general (Comings et al, 1993; Spitzet al, 2000), BMI (Noble et al, 1994), carbohydrate bingeing Comings et al, 1996, co-morbid substance use disorder (Blum et al, 1996c), reduced receptor density (Wang et al, 2001) in very obese people, energy expenditure(Jenkinson, et al, 2000; Tataranni et al, 2001), hypertension (Thomas et al, 2000), and contributed to the overall variance of percent body fat in the present population at a significant rate (Chen et al, 2007). We predicted that carriers of the DRD2 A2 allele, would retain the positive metabolic effects of CrP. In contrast the DRD2 A1, carriers because of a proclivity to increase carbohydrate bingeing, would possibly mask the metabolic effects of CrP on weight loss and change in body fat. To answer these questions, we used DEXA testing to determine body composition and genotyped each subject for polymorphisms of the DRD2 gene and carried out a randomized, double-masked, placebo-controlled study of the effects of CrP on body composition.

C. Procedure Kaats and colleagues have previously published in 1998 the procedure utilized in this study. After completing an initial DEXA test, subjects were provided with a report of their test results and randomly assigned a number from 1 to 130, which corresponded to a bottle containing capsules with 400 microgram of CrP or placebo. None of the investigators, research technicians dispensing the product, or participants, knew which subject number corresponded to the placebo or active product. An independent local pharmacist acted as trustee for the study and randomly assigned subject numbers to bottles that had been prelabeled with either an “X” or “Y” to correspond with either active or placebo. Subjects recorded the total number of steps taken each day in the same daily log used to record their caloric intake, which was subsequently used to adjust the subject’s net change in body fat by using the following formula: 3500 calories = a change of 1 pound of body fat. Subjects checked in at the research center on a weekly basis to obtain a scale weight and to report their weekly physical activity levels, estimated caloric intake and any adverse side effects (none reported). To monitor and adjust for differences in energy expenditure through physical activity throughout their waking hours, all subjects wore a pedometor ( same method as used in previous studies (Kaats et al, 1998b) that reflected the number of steps they took during each day or the step equivalents for activities in which it was impractical to wear the unit. In terms of compliance, each participant was required to provide a $100 deposit by check or credit card, which would not be processed unless the subject failed to complete the last DEXA test and endof-study questionnaire. Participants were advised that return of their deposit was based solely on their completing the last tests no matter how well or poorly they adhered to the research protocol, as long as they reported candidly on how much or how little they complied. On completion of the study and when all data were gathered and entered in the computer system, the trustee opened an envelope supplied by the manufacturer indicating which product was active and subsequently notified the co-senior investigator (GRK). The Department of Computing Resources at the University of Texas Health Sciences Center at San Antonio, Texas, analyzed all information under the supervision of the corresponding author.

II. Research methods and procedures A. Subjects A total of 130 Caucasian subjects were enrolled in the study, 122 (17 men and 105 women; men age, 42.3 years) of which completed the testing (93.8%). Fitness instructors and sales personnel who provided information about the study to potential participants recruited subjects from a variety of fitness and athletic clubs in San Antonio and Houston, Texas. In order to ensure compliance, the fitness instructors were paid to monitor the subjects as they progressed through the study to ensure that the subjects reported their physical activity levels and caloric intake and completed the testing. All subjects were asked to consult with their personal physician before giving written informed consent. All patients signed an approved IRB consent form for both treatment and genotyping by the University of Texas Health Science Center, University Of North Texas, Baylor College of Medicine and the City of Hope National Medical Center and the PATH Medical Foundation.

B. Dual Energy X-Ray absorptiometry A number of studies have shown that DEXA can accurately measure fat and lean content of skeletal mass with a typical precision error for total body bone mineral content <1% (Fredi et al, 1991). DEXA has also been shown to be a precise method for assessing body composition on obese and non-obese subjects (Tataranni et al, 1995; Wang et al, 1995). DEXA correlates

D. Genotyping A total of 130 subjects were genotyped for the dopamine D2 receptor gene. All subjects were genotyped based on a neutral identification number and read without knowledge of the individual being typed.

165

Chen et al: Chromium Picolinate and DRD2 Gene Total genomic DNA was extracted from each coded blood sample, and aliquots were used for polymerase chain reaction (PCR) analysis. The oligonucleotide primers 5’CCGTCGACCCTTCCTGAGTGTCATCA-3’ and 5’ CCGTCGACGGCTGG CCAAGTTGTCTA-3’were used to amplify a 310-base pair(bp) fragment spanning the polymorphic TaqA1site of the DRD2 gene .The D2A1 and D2A2 genotyping was performed by a PCR technique (Blum et al, 1990; Comings et al, 1996). PCR was performed in 30- µL reaction mixtures containing 1.5mM MgCl2, 2mM 2’- deoxynucleotide 5’ – triphosphates (dNTPs). 05 µM primers, 1 µg of template DNA 1.5U of Taq polymerase (Boehringer Mannheim Corp., Indianapolis, IN), and PCR buffer (20 mM Tris-HCL [pH 8.4] and 50mM KCL. After an initial denaturation at 94°C for 4 minutes, the DNA was amplified with 35 cycles of 30 seconds at 94°C, 30 seconds at 58°C, and 30 seconds at 72°C, followed by a final extension step of 5 minutes at 72°C. The PCR product was digested with 5 U of Taq 1 for 22 hours at 65°C for the Taq1A polymorphism. Digestion products were then resolved on a 3% agarose gel (5V/cm) containing 0.65-µg/ml ethidum bromide. There were three DRD2 Taq1A genotypes: 1) the predominant homozygote A2/A2, which exhibits three restriction fragments of 180 and 130 bp; 2) the heterozygote A1/A2, which exhibits three restriction fragments of 310, 180, and 130bp; and, 3) the rare homozygote A1/A1, which produces only the uncleaved 310-bp fragment. We controlled for any false positives by having more than one person extract the genotyping data and the principle investigators (KB and GK) were blinded.

and placebo groups, independent of the DRD2 genotyping, suggesting that the randomization process was successful in providing two equivalent groups of subjects. Figure 1 presents a comparison between group changes that occurred in body composition variables in both active treatment and placebo groups as a function of DRD2 genotyping over the test period. Adjusting for caloric intake and energy expenditure of the data, we then utilized Student’s t test to examine the differences between the four groups. In agreement with our a priori prediction t test analysis revealed that carriers of the DRD2 A2 allele were more responsive to the effects of CrP than were the DRD2 A1 allele carriers. In the DRD2 A2 carriers the measures of the change of fat weight (-0.59 vs. -5.9 p<0.041), change in body weight (-1.5 vs. -8.5 p<0.017), the percent change in weight (0.98 vs. 4.1 p<0.44), and the body weight change in kilograms (-0.7 vs. -3.8 p<0.018) all parameters showing significance. In contrast, in the DRD2 A1 carriers, the change of fat weight (-4.7 vs. -6.7; p = 0.231), change in body weight (-4.7 vs. -5.4; p = 0.7), the percent change in weight (2.8 vs. 2.8 p = 0.97) and the body weight change in kilograms (-2.12 vs. -2.5; p = 0.7) no significance was found in any parameter tested (see Figures 1 and 2). It is noteworthy that a subsequent analysis of these data revealed that among participants receiving CrP, the average amount consumed was 357 µg/d. In terms of distribution of the DRD2 genotypes, we found that carriers of the Taq 1 A1 allele constituted 68% of the 122 subjects tested, whereby the remaining 32% possessed the Taq1 A2 allele. We only found three individuals to carry the homozygous A1/A1 allele. We believe that this high allelic presence of the DRD2 A1 allele is because these individuals tested were obese.

E. Statistical analysis Comparisons were made between body composition variables for the two groups at baseline using a two-tailed student’s t test and between baseline and post test for both groups (n=120) using paired t-test analysis. Finally, comparisons were made between the changes occurring in the two groups without making any adjustments for caloric intake (kilocalorie) or expenditure. All data analysis was conducted at the University of Texas Health Sciences Center’s Department of Computing Resources.

IV. Discussion In general these results confirm and expand our initial studies (Kaats et al, 1992, 1996, 1998a) showing a positive effect of CrP supplementation on body composition. We now find clear differential therapeutic effects for CrP in terms of a number of body composition variables based on genotyping for at least the DRD2 gene. This suggests that the explanation for negative findings with CrP supplementation may be due in part to a gap in information and lack of DNA testing of each patient prior to treatment. For example, as stated above in the past, such explanations discussed the possibility that strenuous

III. Results Of the 130 subjects who were recruited for this study, only 8 failed to complete the final test; 1 subject became pregnant and was asked to withdraw from the study, 3 moved from the area, 1 was ill during the post testing period and 3 was lost to the follow-up. A comparison of the 122 subjects who completed the study with the 8 subjects who did not revealed no significant differences in any of the body composition variables. Baseline characteristics for the 122 subjects who completed the study are provided in Table 1. No statistically significant differences in baseline characteristics were observed between the active treatment

Table 1. Mean (SD) baseline demographic data for 122 subjects randomized to receive ether chromium picolinate (CrP) [n=62} or placebo (n=60).

CrP (400 µg/d)[n=62] Placebo [n=60]

Age (Y) 41.1±10.5 43.5± 7.5

Weight (kg) 85.5 ± 23.0 79.9 ± 20.4

Body-Fat (%) 42.4 ± 8.3 41.8 ±6.7

Reproduced from Kaats et al, 1998a with kind permission from Current Therapeutic Research.

166

Body-Mass Index (kg/m2) 30.2 ±7.1 28.4 ±5.4

Gene Therapy and Molecular Biology Vol 11, page 167

Figure 1. Double-blind comparison of Chromium Picolinate at 400 micrograms per day vs. Placebo on a number of weight and fat measures in subjects with the Dopamine D2 receptor A2/A2 genotype. P values indicate significance in all measures tested.

Figure 2. Double-blind comparison of Chromium Picolinate at 400 micrograms per day vs. Placebo on a number of weight and fat measures in subjects with the Dopamine D2 receptor A1/A1 and A1/A2 genotypes. P values indicate no significance in all measures tested.

physical activity increases urinary chromium loss and therefore the 200 microgram dose is too small an amount to produce positive changes in BMI when following a strenuous exercise program (Anderson, 1998) A more parsimonious explanation could simply be due to DRD2 genotype, at least in part. While obesity is a heterogeneous and prevalent disorder with both genetic and environmental components, the causes of this disease are still unknown. Over the last decade a number of genetic variants have been associated with obesity and related subtypes. Included in the list are CNS regulatory genes such as the Leptin OB (LEPT) and the DRD2 genes (Comings et al, 1996). Additionally other genes have also been associated with obesity (e.g. preenkephalin gene, uncoupling protein, etc). With this in mind, we are proposing that since the dopaminergic pathway is involved in â&#x20AC;&#x153;rewardâ&#x20AC;? behaviors including substance use disorder (alcohol, cocaine, nicotine and food) (Blum et al, 1990, 1996a; Noble, 2003) and since the DRD2 A1 allele is associated with a number of body composition arameters (i.e. BMI, parental history of obesity, carbohydrate bingeing, percent body fat) carriers of the DRD2 A1 allele will be prone to excessive caloric intake. This will in turn significantly impact the positive metabolic effects of CrP, and therefore mask its effect to lower insulin resistance, leading to negative rather than positive changes in body composition as observed in this study for only the DRD2 A2 carriers. In the present study we did find a rather high (68%) A1 allele distribution in the obese subject population, thereby confirming other studies (Noble et al, 1994; Blum et al, 1996a; Comings et al, 1996). In terms of therapeutic benefits, these results take on even greater significance, when one considers data which suggest that certain amino acid precursors or neurotransmitter synthesis promoters alone or in

combination with CrP reduce glucose cravings as well as carbohydrate bingeing episodes (Blum et al, 1990, 1997). Therefore, we propose that future treatment of obesity should consider the importance of combining trivalent chromium salts (picolinate, nicolinate) with amino acid precursors, enkephalinase inhibitors and catecholamine omethy-transferase inhibitors (dl-phenylalanine, 1-tryosine, 1-glutamine, rhodiola rosea etc.) especially in dopamine D2 receptor Taq A1 allele obese subjects. Moreover, we propose that mixed effects now observed with CrP administration in terms of body composition, may be resolved by genotyping the prospective patient prior to administration of a trivalent chromium salt and this may be coupled with electrophysiological markers and anticraving neutraceuticals (Blum et al, 1994; Chen et al, 2004). It is noteworthy that CrP shows promising antidepressant effects in atypical depression (Davidson et al, 2003). Atypical depression (American Psychiatric Association 1994) is a common form of depression (22% of all clinically diagnosed depression), characterized by mood reactivity, increased appetite, weight gain, as well as other features. Its mechanism of action may relate to 5HT2A down regulation, increased insulin sensitivity, or to other effects and other neurotransmitter receptors. While the sample size in the Davidson study in 2003 was small and the effect size was also small (p=0.02), based on our current data, we propose that additional work involving genotyping individuals for both serotonergic and dopaminergic gene polymorphisms linked to CrP response rate may uncover even stronger evidence for certain outcome measures related to the problem of weight gain and mood. To shed some light on this dilemma, a study published in JAMA, by Ali H. Mokdad and colleagues in 2003 from Centers for Disease Control and Prevention,

167

Chen et al: Chromium Picolinate and DRD2 Gene Atlanta, Georgia, using a cross-sectional random -digit telephone survey (Behavioral Risk Factor Surveillance System) of non-institutionalized adults aged 18 years or older, suggest that obesity continues to increase rapidly in the United States. In 2001 the prevalence of obesity (BMI > or =30) was 20.9% vs. 19.8% in 2000, an increase of 5.6%. The prevalence of diabetes increased to 7.9% vs. 7.3% in 2000, an increase of 8.2%. The prevalence of BMI of 40 or higher in 2001 was 2.3%. Overweight and obesity were significantly associated with diabetes, high blood pressure, high cholesterol, asthma, arthritis, and poor health status. Compared with adults with normal weight, adults with a BMI of 40 or higher had an odds ratio (OR) of 7.37 (95% confidence interval [CI], 6.39-8.50) for diagnosed diabetes, 6.38 (95% CI, 5.67-7.17) for high blood pressure, 1.88 (95% CI, 1.67-2.13) for high cholesterol levels, 2.72 (95% CI, 2.38-3.12) for asthma, 4.41 (95% CI, 3.91-4.97) for arthritis, and 4.19 (95% CI, 3.68-4.76) for fair or poor health. Increases in obesity and diabetes among US adults continue in men and women, all ages, all races, all educational levels, and all smoking levels. Obesity is strongly associated with several major health risk factors. Since 1998, approximately one-third of the United States is overweight. It is to be noted, Kaats and colleagues stated in 1998a that the randomization was successful in creating two equivalent groups of subjects. Table 1, reproduced from that earlier study shows how equivalent the groups are with respect to age, weight, body fat, and body mass index. With this mind, any adjustment for differences of groups is not expected to alter results, because the randomization utilized was so successful Finally, because an unusually high number of subjects (93.8%) completed the final testing, requiring research subjects to provide a conditionally refundable deposit to be returned on completion of final testing is a technique worthy of further study.

References Anderson RA (1995) Chromium, glucose tolerance, diabetes, and lipid metabolism. J Adv Med 8, 37-49. Anderson RA (1998a) Effects of chromium on body composition and weight loss. Nutrition Reviews 56, 266-270. Anderson RA (1998b) Recent advances in the clinical and biochemical manifestation of chromium deficiency in human and animal nutrition. J Trace Elem Exp Med 11, 241-250. Anderson, RA (1995) Chromium and parenteral nutrition. Nutrition 11 (suppl 1), 83-86. Anderson, RA, Bryden NA, Polansky NM (1979) Lack of toxicity of chromium chloride and chromium picolinate. J Am Coll Nutr 16, 273-279. Bagchi D, Stohs SJ, Downs BW, Bagchi M, Preuss HG (2002) Cytotoxicity and oxidative mechanisms of different forms of chromium.Toxicology 180, 5-22. Bahadori B, Wallner S, Schneider H, Wascher TC, Toplak H (1997) Effects of chromium yeast and chromium picolinate on body composition of obese, non-diabetic patients during and after a formula diet. Acta Med Austriaca 24, 185-187. Beshya SA, Freemantle C, Thomas E, Johnson DG (1995) Comparison of measurement of body composition by total body potassium, bioimpedance analysis, dual-energy x-ray absorptiometry in hypopituitary adults before and during and after growth hormone treatment. Am J Clin Nutr. 61, 11861194. Blum K, Braverman ER, Wood R, Sheridan PJ (1994) DRD2 A1 Allele and P300 abnormalities in obesity (Abst 146). Am J Med Genet 55. Blum K, Braverman ER, Wood RC, Gill J, Li C, Chen TJH, Taub M, Montgomery AR, Cull JG, Sheridan JP (1996c) Increased prevalence of the Taq 1 A1 allele of the dopamine D2 receptor gene (DRD2) in obesity with comorbid substance use disorder: a preliminary report. Pharmacogenectics 6, 297-305. Blum K, Cull JG, Braverman, ER, Comings DE (1996a) Reward Deficiency Syndrome. American Sci 84, 132-145. Blum K, Cull JG, Chen TJH, Garcia-Swan S, Holder JM, Wood RC, Braverman ER, Bucci LR, Trachtenberg MC. (1997) Clinical evidence for effectiveness of PhenCal! in maintaining weight loss in an open-label, controlled, 2 year study. Curr Ther Res 58, 745-763. Blum K, Noble EP, Sheridan PJ, Montgomery A, Ritchie T, Jagadeeswaran P, Nogami H, Briggs AH, Cahn JB (1990a) Allelic association of human D2 receptor gene in alcoholism. J Am Med Assn 263, 578-580. Blum K, Sheridan PJ, Wood RC, Braverman ER, Chen TJH, Cull JG, Comings DE (1996b) The D2 dopamine receptor gene as a determinant of reward deficiency syndrome. J Royal Soc Med 89, 396-400. Blum K, Trachtenberg MC, Cook DW (1990b) Neuonutrient effects on weight loss in carbohydrate bingers: An open clinical trial. Curr Ther Res 43, 217-233. Brown RO,Forloines-Lynn S, Cross RE, Heizer WD.(1986) Chromium deficiency after long-term parenteral nutrition. Dig Dis Sci 31, 661-664. Bulbulian R, Pringle DD, Liddy MS (1996) Chromium Picolinate supplementation in male and female swimmers. Med Sci Sports Exerc 39, 992-998. Campbell WW, Joseph LJ, Anderson RA, Davey SL, Hinton J, Evans WJ (1999) Effects of resistance training and chromium picolinate on body composition and skeletal muscle in older men. J Appl Physiol 86, 29-39. Chen TJH, Blum K, Kaats G, Braverman ER, Pullin D, Downs BW, Martinez -Pons M, Blum S, Mengucci JF, Bagchi D, Bagchi M, Roarge A, Meshkin B, Arcuri V, Varshavskiy M., Comings DE., White L (2007) Reviewing the role of putative candidate genes in â&#x20AC;&#x153;Neurobesigenicsâ&#x20AC;?, a clinical subtype of

V. Conclusion If these results could be further confirmed and extended by using PET scan to determine the pre and post density of D2 receptors in obese individuals following amino-acid precursor loading techniques and Cr, these future studies may have a powerful impact on the obesity epidemic. Cautiously we encourage additional nutrigenetic studies that will support pre-treatment DNA testing of the DRD2 gene polymorphisms and possibly other genes in obesity and other related RDS behaviors.

Acknowledgements We thank the financial support of Nutrition 2l, Purchase, New York. The research study was conducted at the Health and Medical Research Foundation, San Antonio and the Sports Medicine Institute, Baylor College of Medicine, Houston, Texas. We are also indebted to Salugen Inc, PATH Medical Foundation. We thank Rein Narma, Jim Sowell, and Eduardo Cruz, for their generous financial support. DEC was supported by NIDA grant RO1-DA08417.

168

Gene Therapy and Molecular Biology Vol 11, page 169 Reward Deficiency Syndrome (RDS). Gene Ther Mol Biol 11, 61-74. Chen, TJH, Blum, K, Payte, JT, Schoolfield, J, Hopper, D, Stanford, M, Braverman, ER (2004) Narcotic antagonists in drug dependence: pilot study showing enhancement of compliance with SYN-10, amino-acid and enkephalinase inhibition therapy. Medical Hypotheses 63, 538-548. Clancy SP, Clarkson PM, DeCheke ME, Nosaka K, Freedson PS, Cunningham JJ, Valentine B (1994)Effects of chromium picolinate supplemental on body composition, strength and urinary chromium loss in football players. Int J Sports Nutr 4, 142-53. Comings DE, Flanagan SD, Dietz G, Muhlman D, Knell E, Gysin R (1993) The dopamine D2 receptor (DRD2) as a major gene in obesity and height. Biochem Med Metab Biol 50, 176-185. Comings DE, Gade R, MacMurray JP, Muhlman D, Johnson P, Verde R,, Peters, WR (1996) Genetic variants of the human obesity (OB) gene: association with body mass index in young women, psychiatric symptoms and interaction with the dopamine D2 receptor (DRD2) gene. Molecular Psychiatry 1, 325-335. Comings DE, Wu S, Chiu C, Ring RH, Gade R, Ahn C, MacMurray JP, Dietz G, Muhleman D (1996) Polygenic inhertance of Tourette Syndrome, stuttering, attentiondeficit-hyperactivity, conduct and oppositional defiant disorder. The addictive and substractive effect of the three dopaminergic genes-DRD2, DBH and DAT1. Am J Med Gen (Neuropsychiatric Genetics) 67, 264-288. Crawford V, Scheckenbach R, Preuss HG (1999) Effects of niacin -bound chromium supplementation on body composition in overweight African-American women. Diabetes Obes Metab 1, 331-337. Davidson JRT, Abraham K, Connor KM, McLeod MN (2003) Effectiveness of Chromium in Atypical Depression: A Placebo -Controlled Trial. Biol Psychiatry 53, 261-264. Diaz ML, Watkins BA, Li Y, Anderson RA, Campbell WW (2007) Chromium picolinate and conjugated linoleic acid do not synergistically influence diet- and exercise-induced changes in body composition and health indexes in overweight women. J Nutr Biochem 23, in press. Evans GW (1983) Chromium picolinate is an efficacious and safe supplement. Int J Sport Nutr 3, 117-122. Evans GW (1989) The effect of chromium picolinate on insulin controlled parameters in humans. Int J Biosoc Med Res 11, 163-180. Evans GW, Meyers IK (1994) Life span is increased in rats supplemented with chromium -pyridine 2-carboxylate complex. Adv In Sci Res 1, 19-23. Evans GW, Roginski EE, Merz W (1973) Interaction with the glucose tolerance factor (GTF) with insulin. Biochem Biophys Res Commun 50, 718-722. Fekete S, Szakall I, Kosa E, Andrasofszky E, Fodor K, Hidas A, Tozser J (2001) Alteration of body composition in rats: effect of organic chromium and L-carnitine. Acta Vet Hung 49, 385-398. Fredi KE, DeLuca JP, Marchitelli LJ, Vogel JA (1991) Reliability of body-fat estimations from a four-compartment model by using density, body water and bone mineral measurements. Am J Clin Nutr. 55, 764-770. Gonzalez Munoz MJ, Meseguer I, Martinez Para MC, Aguilar MV, Bernao A (2006) Repercussions of chromium picolinate in the protein metabolism based on the age. Nutr Hosp 21, 709-714. Grant K, Chandler RM, Castle Al, Ivy JL (1997) Chromium and exercise training: effect on obese women. Med Sci Sports Exerc 29, 992-998.

Gudi R, Slesinski RS, Clarke JJ, San RH (2005) Chromium picolinate does not produce chromosome damage in CHO cells. Mutat Res. 587,140-146. Hallmark MA, Reynolds, TH, DeSouza, CA, Dotson CO, Anderson RA, Rogers MA (1996) Effects of chromium supplementation on resistive training on muscle strength and body composition Med Sci Sports Exerc.28, 139-44. Hasten D, Rome EP, Franks BD, Hegsted, M. (1992) Effects of chromium picolinate on beginning weight training students. Int J Sport Nutr, 2, 343-350. Jenkinson CP, Hanson R, Cray K, Wiedrich C, Bogardus C, Baier L (2000) Association of dopamine D2 receptor polymorphisms Ser311Cys and Taq1 with obesity or type 2 diabetes mellitus in Pima Indians. Int J Obes (Lond) 24, 1233-1238. Jensen M, Kanaley J, Roust L, Oâ&#x20AC;&#x2122;Brien PC, Dunn WL, Wahner HW (1993) Assessment of body composition with use of dual-energy x-ray absorptiometry: Evaluation and comparison with other methods. Mayo Clin Proc. 68, 867873. Kaats GR, Blum K, Fisher JA, Adelman JA (1996) Effects of chromium picolinate supplementation of body composition: A randomized, double-masked, placebo-controlled study. Curr Ther Res 57, 747-756. Kaats GR, Blum K, Pullin D, Keith SC, Wood R (1998a) A randomized, double-masked, placebo-controlled study of the effects of chromium picolinate supplementation on body composition: A replication and extension of a previous study. Curr Ther Res 59, 379-388. Kaats GR, Keith SC, Pullin D, Squires WG Jr, Wise JA, Hesslink R Jr, Morin RJ (1998b) Safety and efficacy evaluation of a fitness club weight-loss program. Adv Ther 15, 345-361. Kaats GR, Wise JA, Blum K, Morin RA, Adelman JD, Craig J, Croft HA (1992) The short term therapeutic efficacy of treating obesity with a plan of improved nutrition and moderate caloric restriction. Curr Ther Res. 51, 261-274. Kornegay, ET, Wang Z, Wood CM, Lindemann MD (1997) Supplemental chromium Picolinate influences nitrogen balance, fry matter digestibility, and carcass traits in growing-finishing pigs. J Anim Sci 75, 1319-1323. Lawford BR, Young RM, Rowell J, Qualichefski J, Fletcher BH, Syndulko K, Ritchie T, Noble EP (1995) Bromocriptine in the treatment of alcoholics with the D2 dopamine receptor Al allele. Nature Med 1, 337-341. Lawford BR, Young RMcD, Noble EP, Kann B, Arnold L, Rowell J, Ritchie RT (2003) D2 dopamine receptor gene polymorphism: paroxetine and social functioning in posttraumatic stress disorder. Eur Neuropsychopharmaco l 13, 313-320. Lindermann MD, Wood CM, Harper AF (1995) Dietary chromium picolinate additions improve gain: feed and carcass characteristics in growing -finishing pigs and increase litter size in reproducing sows. J Anim Sci 73, 457465. Loveday KS (1996) Evaluation of chromium picolinate in the rat in vivo chromosomal aberration assay. TSI mason Laboratories, Inc., Worcester, MA. Lukaski HC (2000) Magnesium, zinc, and chromium nutriture and physical activity. Am J Clin Nutr 72 (suppl2), 585S93S. Lukaski HC, Bolonchuk WW, Siders WA, Milne DB. (1996) Chromium supplementation and resistance training: effects on body composition, strength, and trace element status of men. Am J Clin Nutr 63,954-965. Lukaski HC, Siders WA, Penland JG (2007) Chromium picolinate supplementation in women: effects on body weight, composition, and iron status. Nutrition, in press. Lukaski, HC (1999) Chromium as a Supplement. Annu Rev

169

Chen et al: Chromium Picolinate and DRD2 Gene Nutr 19, 279-302. Luvolsi JM, Adams GM, Laguna PL (2000) The effect of chromium picolinate on muscular strength and body composition in women athletes. J Strength Cond Res 15, 161-166. Mazess RB, Barden HS, Bisek JP, Hanson J (1990) Dual-energy absorptionmetry for total body and regional bone-mineral and soft-tissue composition. Am J Clin Nutr. 51, 11061112. McCarty MF (1996) Chromium (III) picolinate. FASEB J 10, 365-367. Mertz W (1993) Chromium in human nutrition: a review. J Nutr 123, 626-633. Mertz W, Abernathy CO, Olin SS (1994) Risk assessment of essential elements. Washington, DC: ILSI Press. Min JK, Kim WY, Chae BJ (1997) Effects of chromium picolinate (CrPic) on growth performance, carcass characteristics, and serum traits in growing-finishing pigs. Asian Aust J Anim Sci 10, 8111 Mokdad AH, Ford ES, Bowman BA, Dietz WH, Vinicor F, Bales VS, Marks JS (2003) Prevalence of obesity, diabetes, and obesity -related health risk factors, 2001. JAMA 289, 76-79. Mooney KW, Cromwell GL (1997) Effects of Cr chloride as potential carcass modifiers in swine. J Anim Sci 75, 26612671. Noble EP, Noble RE, Ritchie T, Grandy DK, Sparkes RS (1994) D2 dopamine receptor gene and obesity. J Eating Disorders 15, 205-217. Noble, EP (2003) D2 Dopamine Receptor Gene in Psychiatric and Neurological Disorders and its phenotypes. Am J Med Gen 116B, 103-125. Nord RH, Payne RK (1995) Dual-energy x-ray absorptiometry vs underwater weighing comparison of strengths and weaknesses. Asia Pacific J Clin Nutr. 4, 173-175. Page TG, Southern LL, Ward, TL, Thompson, DL Jr. (1993) Effects if chromium Picolinate on growth and serum and carcass traits if growing -finishing pigs. J Anim Sc 71, 656662. PassmanWJ, Westerterp-Plantenga MS, Saris WHM (1997) The effectiveness of long-term supplementation of carbohydrate, chromium, fibre, and caffeine on weight maintenance. Int J Obes Rela Metab Disord 21, 1143-1151. Rosemond R, Rankinen T, Chagnon M, PĂŠrusse L, Chagnon YC, Bouchard C, BjĂśrntorp P (2001) Polymorphism in exon 6 of the dopamine D2 receptor gene (DRD2) is associated with elevated blood pressure and personality disorders in men. J Hum Hypertens 15, 553-558. Rubin MA, Miller JP, Ryan AS, Treuth MS, Patterson KY, Pratley RE, Hurley BF, Veillon C, Moser-Veillon PB, Anderson RA (1998) Acute and chronic resistive exercise increase urinary chromium excretion in men as measured with an enriched chromium stable isotope. J Nutr 128, 73-78 Slesinski R (2004) Chromium picolinate cleared of toxic charges. Centers for Disease Control and Prevention (CDC) conference on metal toxicity and carcinogenesis. September 16, Washington, DC. Spitz MR, Duphorne CM, Detry MA, Pillow PC, Amos CI, Lei L, de Andrade M, Gu X, Hong WK, Wu X (2000) Variant

alleles of the D2 dopamine receptor gene and obesity. Nutrition Res 20, 371-380. Stallings DM, Hepburn DD, Hannah M, Vincent JB, O'Donnell J (2006) Nutritional supplement chromium picolinate generates chromosomal aberrations and impedes progeny development in Drosophila melanogaster. Mutat Res 610, 101-113. Stearns DM, Wise JP, Patterno SR, Wetterhahn KE (1995) Chromium picolinate produces chromosome Damage in Chinese hamster ovary cells. FASEB J 9, 1643-1648. Stoecker BJ (1990) Chromium. In: Present Knowledge in Nutrition, Sixth Edition, Brown ML, ed. International Life Sciences Institute, Nutrition Foundation, Washington DC, pp. 287-293. Tataranni PA, Baier L, Jenkinson C, Harper I, Del Parigi A, Bogardus C (2001) Ser311Cys mutation in the human dopamine D2 gene is associated with reduced energy expenditure. Diabetes 50, 901-904. Tataranni PA, Ravussin E (1995) Use of dual-energy x-ray absorptiometry in obese individuals. Am J Clin Nutr. 62, 730-734. Thanos PK, Volkow ND, Freimuth P, Umegaki H, Ikari H, Roth G, Ingram DK, Hitzman R (2001) Overexpression of Dopamine D2 receptors reduces alcohol self -Administration. J Neurochem 78, 1094-1103. Thomas GN, Critchley JAJH, Tomlinson B, Cockram, CS, Chan JCN (2001) Relationships between the Taq1 polymorphism of the dopamine D2 receptor and blood pressure in hyperglycemic and normoglycemic Chinese subjects. Clin Endocrinol 55, 605-611. Thomas GN, Tomlinson B, Critchley AJ (2000) Modulation of blood pressure and obesity with the dopamine D2 receptor gene Taq1 polymorphism. Hypertension 36, 177-182. Trent LK, Thieding-Cancel D (1995) Effects of chromium picolinate on body composition. J Sports Med Phys Fitness 35, 273-280. Volpe SL, Huang HW, Larpadisorn K, Lesser II (2001) Effect of Chromium Supplementation and exercise on Body Composition, Resting Metabolic Rate and selected Biochemical Parameters in Moderately Obese women following an Exercise program. J Am Coll Nutr.20, 293306. Walker LS, Bemben MG, Bemben DA, Knehans AW (1998) Chromium picolinate effects on body composition and muscular performance in wrestlers. Med Sci Sports Exercise 30, 1730-1737. Wang GL, Volkow ND., Logan J, Pappers NR, Wong CT, Zhu W, Netusil N, Fowler JS (2001) Brain dopamine and obesity. Lancet 357, 354-357. Wang ZM, Heschda S, Pierson RN, Heymsfield SB (1995) Systematic organization of body-composition methodology: an overview with emphasis on component-based methods. Am J Clin Nutr. 61, 457-465. Ward TL, Southern LL, Bidner TD (1997) Interactive effects of dietary chromium tripicolinate and crude protein level in growing -finishing pigs provided inadequate and adequate floor space. J Anim Sci 75, 1001-1005. WHO (1973) Tech. Rep. Ser. 532. Geneva: WHO.

170

Gene Therapy and Molecular Biology Vol 11, page 161 Gene Ther Mol Biol Vol 11, 161-170, 2007

161

Chen et al: Chromium Picolinate and DRD2 Gene Received: 17 March 2007; Revised: 1 June 2007 Accepted: 26 July 2007; electronically published: August 2007

164

165

Table 1. Mean (SD) baseline demographic data for 122 subjects randomized to receive ether chromium picolinate (CrP) [n=62} or placebo (n=60).

CrP (400 µg/d)[n=62] Placebo [n=60]

Age (Y) 41.1±10.5 43.5± 7.5

Weight (kg) 85.5 ± 23.0 79.9 ± 20.4

Body-Fat (%) 42.4 ± 8.3 41.8 ±6.7

Reproduced from Kaats et al, 1998a with kind permission from Current Therapeutic Research.

166

Body-Mass Index (kg/m2) 30.2 ±7.1 28.4 ±5.4

Gene Therapy and Molecular Biology Vol 11, page 167

167

168

169

170

Gene Therapy and Molecular Biology Vol 11, page 171 Gene Ther Mol Biol Vol 11, 171-176, 2007

Stringent control of NFATc1 nuclear occupancy is critical for maintaining balanced immune response Research Article

Minggui Pan1,*, Monte M. Winslow2, Joo Seob Keum2, Gerald R. Crabtree3 1 3

Division of Oncology, 2Division of Immunology, Howard Hughes Medical Institute, Department of Developmental Biology and Pathology, Stanford University, Stanford CA 94305-5323, USA

__________________________________________________________________________________ *Correspondence: Minggui Pan, Division of Oncology-Hematology, Kaiser Permanente Medical Center, 710 Lawrence Expressway, Santa Clara, CA 95051, USA; Tel: 408 851 4306; Fax: 408 851 4319; E-mail: Minggui.pan@kp.org Key words: NFATc1; Immune Response; Nuclear Occupancy; Autoimmunity Abbreviations: anti-nuclear antibody, (ANA); nuclear NFATc1 variant, (NFATc1nuc ) Received: 3 June 2007; Revised: 11 July 2007 Accepted: 23 July 2007; electronically published: August 2007

Summary Many immune and inflammatory diseases still lack a clear mechanistic explanation. NFATc transcription factors are involved in immune homeostasis and response. NFATc1 is rapidly imported into the nucleus upon activation of lymphocytes that leads to its stimulation of a battery of cytokines responsible for immune response and is rapidly removed from the nucleus upon termination of the signaling. We have previously established a tetracyclineregulated transgenic mouse model with a subtle increased nuclear NFATc1 expression. The level of nuclear NFATc1 expression was only 1/7th of the total NFATc1 molecules of a wild type T cell. Here we show that this subtle increase of NFATc1 nuclear occupancy caused a severe disease with multi-organ failure characterized with infiltration of immune cells, elevated auto antibodies, leading to early animal death. Suppression of the transgene expression by doxycycline suppressed and reversed the disease. These results indicate that stringent control of NFATc1 nuclear occupancy is critical for maintaining balanced immune response and may have important clinical implications.

biological systems such as cardiac valve morphogenesis, axonal outgrowth in nervous system, in addition to its role in immune system (Crabtree et al, 2002; Graef et al, 2003; Chang et al, 2004). NFATc1 protein contains a number of phosphorylation sites that are normally phosphorylated when it is inactivated and compartmentalized in the cytoplasm (Flanagan et al, 1991; Timmerman et al, 1996; Beals et al, 1997a,b). Activation of T cells leads to its dephosphorylation and rapid shuffling into the nucleus (Flanagan et al, 1991; Timmerman et al, 1996; Beals et al, 1997a,b). NFATc1 has been shown to mediate immune response both in B and T cells (Flanagan et al, 1991; Timmerman et al, 1996; Beals et al, 1997a,b; de Gorter et al, 2007). Activation of lymphocytes causes calcium influx leading to activation of calcineurin, a serine/threonine phosphotase that subsequently dephosphorylates NFATc proteins and leads to their nuclear import (Flanagan et al, 1991; Timmerman et al, 1996; Beals et al, 1997a,b). Activated nuclear NFATc1 protein stimulates production of a battery of cytokines including interleukin-2, interferon, TNF! and many others (Rao et al, 1997). Introduction of calcineurin inhibitors FK506 and

I. Introduction The mechanism of many immune and inflammatory diseases such as lupus, rheumatoid arthritis, polymyalgia rheumatica, multiple sclerosis, fibromyalgia, inflammatory bowel disease and others is still not completely understood (Janeway et al, 2000; Davidson et al, 2001). Steroid traditionally constitutes the mainstay of therapy of these diseases. More recently strategies such as depletion of TNF! and depleting B cells with anti-CD20 antibody have improved the treatment outcome for many diseases (Pisetsky et al, 2000; Kneitz et al, 2002). However, a portion of patients would only respond minimally or would not respond at all (Kneitz et al, 2002; Pisetsky et al, 2000). In addition, durable response often requires continuous therapy (Pisetsky et al, 2000; Kneitz et al, 2002). NFATc proteins are involved in the functional regulation of T and B cells as well as cytokine production (Rao et al, 1997; Ranger et al, 1998; Peng et al, 2001; de Gorter et al, 2007). NFATc1 gene is a widely expressed transcription factor and plays critical roles in many

171

Pan et al: NFATc1 export and immune response cyclosporine A have revolutionized the treatment for patients with organ transplant (Kunz et al, 1993). Blockade of calcineurin activation by cyclosporine A and FK506 inhibits calcineurinâ&#x20AC;&#x2122;s ability to dephosphorylate and activate NFATc proteins, hence causes inhibition of production of many important cytokines (Clipstone et al, 1994; Kiani et al, 2000). We have previously established a tetracyclineregulated transgenic mouse model with expression at subphysiologic level of a nuclear NFATc1 variant (NFATc1nuc) that lacks ability to exit the nucleus (Pan et al, 2007). The level of expression of this nuclear NFATc1 variant was only 1/7th of the total NFATc1 molecules of a wild type T cell yet caused a destabilized positive feedback loop in its own transcription leading to T cell activation independent of CD28 costimuation, partial resistance to cyclosporine A inhibition of T cell proliferation as well as markedly enhanced production of Th1/Th2 cytokines and activation antigens both spontaneously and when activated (Pan et al, 2007). T cell activation of the NFATc1nuc mice were several magnitudes higher than normal T cells in resting state and in activated state and produced increased IgG2!. We have also previously shown using this transgenic mouse model that NFATc1 regulates bone homeostasis (Winslow et al, 2006). In this manuscript, we show that the subtle increase of nuclear NFATc1 occupancy caused a severe mouse phenotype with multi-organ failure involving lungs, liver, kidneys, muscle, joints characterized with dense infiltration of immune cells including lymphocytes, macrophages and granulocytes leading to early animal death. Serum auto antibodies including anti-ANA, antidsDNA, circulating immune complex (CIC) and anti-RNP were elevated and immune complex deposits were detected in the kidneys of the mutant mouse. Treatment of the mutant mouse with doxycycline to suppress the expression of NFATc1nuc prevents the death and reverses the disease (Pan et al, 2007). These results indicate that stringent control of NFATc1 nuclear occupancy is critical for maintaining balanced immune response and may have important clinical implications.

B. Western Blot Cell lysates of lymph nodes, spleen and thymus were prepared, separated on a SDS-polyacrylamide gel, transferred to a nitrocellulose membrane and blotted with anti-HA (16B12, Berkeley antibody company) or anti-actin antibodies (Sigma).

B. Histologic analysis Tissues and organs were fixed for 24 hours with 10% formalin, dehydrated, embedded in wax, sectioned and processed for H + E staining according to standard protocols.

C. Immunofluorescent staining Frozen sections of wild type or mutant kidneys were prepared, blocked with buffer containing BSA, NaCl (200mM) and 0.1%triton, stained with FITC-conjugated goat anti-mouse IgG antibody (PharMingen).

D. Assay of auto antibodies 50ul of serum from wild type or mutant mice was used to assay for auto antibodies using ELISA method according to instructions provided by the manufacturer (Alpha Diagnostic International).

III. Results A. Early death of the NFATc1nuc mice were preventable with suppression of the transgene We have previously established a tetracyclineregulated transgenic mice model NFATc1nuc that expressed a very low sub-physiologic level of NFATc1nuc (1/7 of the total NFATc1 level of wild type T cells) detectable in T cells and was associated with much increased cytokine production and T cell activation that was independent of CD28 costimulation and partially resistant to cyclosporine inhibition (Pan et al, 2007). No abnormality in T cell development was identified in the NFATc1nuc mutant animals (Pan et al, 2007). We have also shown that NFATc1nuc could be detected in osteoblasts and regulates homeostasis of osteoblasts and bone mass formation (Winslow et al, 2006). NFATc1nuc mice were born at normal Mendelian ratios and were normal at birth but later began showing signs of illness that could be recognized as rough fur, retarded weight gain (cachexia), decreased mobility, joint swelling and joint deformation (Figure 1A, right). This gross phenotype appeared coincidence with the expression of NFATc1nuc in the spleen and lymph nodes. As shown in Figure 1B, the expression of NFATc1nuc in the peripheral lymph nodes and spleen was only detected when the mutant mice became apparently ill, while it was detectable in the thymus in latent as well as in late stage (Figure 1A, right) NFATc1nuc mice. Latent stage was defined as the mutant mice appearing normal or mildly ill by gross observation, while late stage was defined as the mutant mice appearing apparently sick by gross observation. The time to onset of the disease varied from a few days after birth to as long as 6 months with male and female mice being equally affected. The early onset (within 6 weeks of age) mutants normally progressed to death within 2 to 3 weeks while late onset mutants progressed more slowly (after 6 weeks). In contrast, no wild type, Tet-O-NFATc1nuc or mice expressing wild type NFATc1 (NFATc1wt/tTA) developed

II. Methods A. Generation of tetracycline-regulated transgemic mouse that contains a constitutively nuclear NFATc1 (NFATc1nuc) and doxycycline treatment of the transgenic mouse This was described previously (Felsher and Bishop 1999; Winslow et al, 2006; Pan et al, 2007). Briefly, NFATc1nuc was made by site-directed mutagenesis and the DNA was inserted inframe into pS vector N-terminally to a HA tag. The construct was digested with Bam HI and Acc 65I and inserted into pUD10-3 downstream of Tet-O promoter. The transgene was digested with Spe1, purified and pro-nucleus injection was performed using B6CBAF1/J (Jackson) mice with standard protocol. Tet-O-C1wt mice were generated in similar method. 83 tTA mice (FVB/N) were previously described (Felsher and Bishop 1999). The treatment of NFATc1nuc mouse with doxycycline was performed by feeding the mouse with drinking water containing doxycycline 200 ug/ml thatâ&#x20AC;&#x2122;s changed once a week.

172

Gene Therapy and Molecular Biology Vol 11, page 173 longer dependent on the expression of NFATc1nuc protein, or the disease had caused multi-organ failure thatâ&#x20AC;&#x2122;s no longer reversible. Treatment of the mutant mice with doxycycline promoted weight gain consistent with their recovery from the disease, indicating that cachexia was associated with the cytokine production (Pan et al, 2007) and the disease (Figure 1E green). The mutant mice not treated with doxycycline continued to show retarded weight gain until death (Figure 1E orange). Histological examination of the doxycycline-treated mutant mice showed normal organs and tissues (Figure 2C and 2F) comparable to the wild type (Figure 2A and 2D). However, three to six months after NFATc1nuc expression is reactivated (by discontinuing doxycycline treatment), these once cured NFATc1nuc mice developed the disease again and died (data not shown).

disease during this time (Figure 1C). By week 5 to 6, approximately half of all the mutant mice have died (Figure 1C). By age six months, ninety five percent of all mutant mice have died of the disease (data not shown). To examine if the expression of NFATc1nuc was responsible for the disease, we treated the mutant mice with docycyline which suppresses the expression of the transgene (Pan et al, 2007). As shown in Figure 1D, when treated with doxycycline during the perinatal or disease latent period, no NFATc1nuc mice developed the illness. However, only 70% of the adult mutant mice that had developed a full-blown onset of the disease during p19-35 had the disease reversed with docycycline suppression of the NFATc1nuc expression, while 30% of these mutant mice still progressed to death. This suggests that 30% of the adult mutant mice had developed a disease thatâ&#x20AC;&#x2122;s no

Figure 1. Early death of the NFATc1nuc mutant mice was preventable with doxycycline treatment. A. Gross appearance of a day 35 wild (left) and mutant mouse (right). B. Expression of NFATc1nuc in periphery of wild type mice, latent, late stage NFATc1nuc mice performed with anti-HA antibody western blot. Tissues, molecular weight and actin control were indicated. The data is representative of three experiments with similar results. C. Survival curves of wild type (black, n=35) and NFATc1 nuc mice (pink, n=66). D. Treatment of mutant mice with doxycycline during perinatal and disease latent period. Time period that doxycycline was treated and survival rate were indicated. Day 0 is designated as the birth date (P0). E5 represents embryonic day 5. n, number of mice treated. Treatment duration and outcome of the treated mice are shown. E. Weight measurement of the mutant mice treated or not treated with doxycycline. NFATc1nuc mice untreated (red, n=10); NFATc1nuc treated with doxycycline (green, n=4); wild type mice (blue, n=12); Doxycycline treatment was started on day 19 and continued for 15 days.

173

Pan et al: NFATc1 export and immune response

Figure 2. H&E examination of organs and tissues of the NFATc1 nuc mice. A. H&E of wt lung. B. H&E of the mutant lung. C. H&E of the lung from the mutant treated with doxycycline. D. H&E of wt liver. E, H&E of the mutant liver. F. H&E of the liver from the mutant treated with doxycycline. G. H&E of the mutant kidney. H. H&E of the mutant muscle. I. H&E of the mutant synovium. Note the dense cellular infiltrates of the mutant organs and tissues. Mice of postnatal age 3-6 weeks were used.

muscle indicating presence of myositis (Figure 2H). In addition, the mutant mice showed redness, swelling and deformation of multiple joints including knees, hips, as well as digital joints and histological examination of the joints found dense cellular infiltration of immune cells present in the synovial space (Figure 2I) and fluid (data not shown) indicating presence of synovitis. This disease of multi-organ damage is clearly responsible for the death of the mutant mice. In addition, expression of NFATc1nuc is responsible for this disease because suppression of its expression prevents and reverses the disease (Figure 2C and 2F; Figure 1D and 1E).

B. Dense immune cell infiltration of multiple organs and tissues in NFATc1nuc mice We examined all organs of the mutant mice compared to the wild type mice and found abnormalities in several organs including skin, bones, lungs, liver, kidneys, muscle, joints and others (Winslow et al, 2006; Pan et al, 2007). We have reported that NFATc1 regulates bone mass previously (Winslow et al, 2006). Histological examination of the mutant mice skin showed non-specific inflammation in the dermis and in the hair follicles consistent with a response to increased cytokine production (data not shown). However, in contrast to the lungs of the wild type mouse (Figure 2A), histological examination of the NFATc1nuc mice with H&E staining revealed dense infiltrates in the lungs with thickening of interstitial spaces and focal destruction of the epithelium (Figure 2B). Compared to the wild type mouse liver (Figure 2D), diffuse as well as focal cellular infiltration surrounding vessels (focal vasculitis) and billiary ducts were consistently demonstrated in the mutant liver coupled with necrosis of the liver tissue (Figure 2E). The liver infiltrate was found by flow cytometry to be a mixture of approximately 50% CD4+ or CD8+ T cells, 30% macrophages (Mac-1 +) and 20% granulocytes (Gr-1 +) (data not shown). We have also analyzed the synovial fluid of the mutant mice and found similar cellular infiltration (data not shown). In the kidneys there was marked hypercellularity and obliteration of the subcapsular space in the glomeruli (Figure 2G). Occasional wire loop formation and hyaline scars or lupus bodies were evident in the mesangium. The mutant mice progressively developed muscle weakness correlated with the presence of severe cellular infiltrates in the

C. Detection of immune deposits in the kidneys and elevated serum auto antibodies in the NFATc1nuc mice To investigate if autoimmune response might be present in the mutant mice, we studied the immune deposits of the kidneys in wild type and the mutant mice as well as serum level of four commonly elevated auto antibodies seen in autoimmune disease. We found that immune deposits could be detected in the mutant glomeruli (Figure 3A, B). This is consistent with the findings with the H&E examination of the kidneys (Figure 2G). We also examined the serum autoantibody titers of the wild and mutant mice. As shown in Figure 3C-F, the serum titers of anti-nuclear antibody, anti-RNP, anti-dsDNA and circulating immune complexes were elevated several folds in the mutant mice compared to the 174

Gene Therapy and Molecular Biology Vol 11, page 175 wild type mice. The higher titer was found in the mutant animals with more severe illness. These results are consistent with our previous finding that IgG2! level was elevated in the serum of the mutant mice (Pan et al, 2007). While in humans these auto antibodies are characteristic of both lupus erythematous and mixed collagen tissue disorder. These increased autoantibody titers in the mutant animals could reflect an autoimmune-like but non-specific inflammatory response, because the mutant mice still died in the absence of T cells when crossed to the TCR! and Rag1-deficient background. The mechanism of the disease is not clear and requires further investigation.

anti-ANA, Anti-dsDNA, anti-RNP and circulating immune complex in the serum (Figure 3C-F). The elevated autoantibody titers could be a result of a nonspecific autoimmune-like inflammatory response of the mutant mice, rather than a classic autoimmune disease, because the mutant mice still died in the absence of T cells when crossed to a TCR- and Rag1- deficient background (Pan et al, 2007). We still do not understand the specific cell type thatâ&#x20AC;&#x2122;s responsible for the disease because no expression of NFATc1nuc has been detectable in cells other than T lymphocytes and osteoblasts (Pan et al, 2007; Winslow et al, 2006). We speculate that NFATc1nuc is expressed in a very subtle level undetectable with our quantitative PCR techniques and this subtle expression well below its physiological level could cause a severe disease characterized with full-blown immune response in multiple organs and tissues. When treated with doxycycline to suppress the expression of NFATc1nuc, the disease could be prevented perinatally or in the latent period. However, only 70% of the adult mutant mice with severe illness were cured with doxycycline (Figure 1C), indicating that at the time of the treatment, these mice might have developed to a disease stage that was no longer dependent on NFATc1nuc gene expression, or the mice had developed end-stage multiorgan failure thatâ&#x20AC;&#x2122;s not clinically reversible.

IV. Discussion We show here that expression of an NFATc1 variant NFATc1nuc in a very small sub-physiologic level in a transgenic mouse model caused a severe disease characterized with multi-organ failure leading to early death of the animals. The skin, lungs, liver and kidneys, as well as muscle and synovium were all involved with a full-blown immune response characterized with dense cellular infiltrates of T lymphocytes, macrophages and granulocytes (Figure 2), coincidence with the expression of the transgene in the peripheral lymphoid organs (Figure 1B). Majority of these mutant mice died within days or weeks after birth with cachexia, muscle weakness, arthritis and with elevation of several auto antibodies including

Figure 3. Immune complex deposit of glomerulus and serum auto antibodies in the mutant mice. A. Anti-mouse IgG Immunofluorescent staining of wild type kidney. B. Anti-mouse IgG Immunofluorescent staining of the mutant kidney. C. Serum titer of anti-nuclear antibody (ANA); D. Anti-RNP autoantibody titers. E. Anti-dsDNA (anti-double-stranded DNA) titers. F, Serum circulating immune complex (CIC) titers. Two wild type controls are shown in gray, NFATc1nuc mice are shown in color. Serum was diluted 1 to 80, 160 and 320. Mice of postnatal age 3-6 weeks were used.

175

Pan et al: NFATc1 export and immune response Crabtree GR, Olson EN (2002) Choreographing the social lives of cells. Cell 108, S67-79. Davidson A, Diamond B (2001) Autoimmune diseases. N Engl J Med 345, 340-350. de Gorter DJ, Johanna CM, Vos S, Pals T and Spaargaren M (2007) The B Cell Antigen Receptor Controls AP-1 and NFAT Activity through Ras-Mediated Activation of Ral. J Immunol 178, 1405-1414. Felsher DW, Bishop JM (1999) Reversible tumorigenesis by Myc in hematopoietic lineages. Mol Cell 4, 199-205. Flanagan W, Corthesy B, Bram RJ, Crabtree GR (1991) Nuclear association of a T-cell transcription factor blocked by FK506 and cyclosporin A. Nature 352, 803-807. Graef IF, Wang F, Charron F, Chen L, Neilson J, TessierLavigne M and Crabtree GR (2003) Neurotrophins and Netrins Require Calcineurin/NFAT Signaling to Stimulate Outgrowth of Embryonic Axons. Cell 113, 657-670. Janeway C, Travers P, Walport M and Capra JD (2000) Immunobiology: the immune system in health and disease. Immunology Today 21, 201-205. Kiani A, Rao A, Aramburu J (2000) Manipulating Immune Responses with Immunosuppressive Agents that Target NFAT. Immunnity 12, 359-372. Kneitz C, Wilhelm M, Tony H (2002) Effective B Cell Depletion with Rituximab in the Treatment of Autoimmune Diseases. Immunobiology 206, 519-527. Kretz-Rommel A, Rubin RL (2000) Disruption of positive selection of thymocytes causes autoimmunity. Nat Med 6, 298-305. Kunz J, Hall MN (1993) Cyclosporin A, FK506 and rapamycin: more than just immunosuppression. Trends Biochem Sci 18, 334-8. Northrop JP, Ho SN, Chen L, Thomas DJ, Timmerman LA, Nolan GP, Admon A, Crabtree GR (1994) NF-AT components define a family of transcription factors targeted by T-cell activation. Nature 369, 497-502. Pan M, Winslow WM, Chen L, Felsher D, Crabtree GR (2007) Enhanced NFATc1 Nuclear Occupancy Causes T Cell Activation Independent of CD28 Costimulation. J. Immunol. 178, 4315-4321. Peng SL, Gerth AJ, Ranger A, Glimcher LH (2001) NFATc1 and NFATc2 together control both T and B Cell activation and differentiation. Immunity 14, 13-20. Pisetsky DS (2000) Tumor Necrosis Factor Blockers in Rheumatoid Arthritis. New Engl J Med 342, 810-811. Ranger AM, Oukka M, Rengarajan J, Glimcher LH (1998) Inhibitory function of two NFAT family members in lymphoid homeostasis and Th2 development. Immunity 9, 627-635. Rao A, Luo C, Hogan PG (1997) Transcription factors of the NFAT family: regulation and function. Ann Rev Immunol 15, 707-747. Shachaf CM, Kopelman AM, Arvanitis C, Karlsson A, Beer S, Mandl S, Bachmann MH, Borowsky AD, Ruebner B, Cardiff RD, Yang Q, Bishop JM, Contag CH, Felsher DW (2004) MYC inactivation uncovers pluripotent differentiation and tumour dormancy in hepatocellular cancer. Nature 431, 1112-1117. Timmerman LA, Clipstone N, Ho SN, Northrop JP, Crabtree GR (1996) Rapid shuttling of NF-AT in discrimination of Ca2+ signals and immunosuppression. Nature 383, 837-840. Winslow MW, Pan M, Starbuck M, Gallo EM, Deng L, Karsentry G, Crabtree GR (2006) Calcineurin/NFAT Signaling in Osteoblasts Regulates Bone Mass. Developmental Cell 10, 771-782.

This is reminiscent of many human immune and inflammatory disorders (Janeway et al, 2000; Davidson et al, 2001). This also appears similar to the transgenic mice model expressing a c-Myc gene that caused T cell lymphoma (Felsher and Bishop 1999). The suppression of c-Myc transgene by doxycycline only reversed a portion of the mice with lymphoma while some continued to progress with lymphoma and died (Felsher and Bishop 1999). Reactivation of the NFATc1nuc expression by discontinuing doxycycline caused disease again after the mutant mice is cured of the disease. This is similar to the c-Myc transgenic mice model of cancer that relapses again from dormancy following the reactivation of the transgene (Felsher and Bishop 1999; Shachav et al, 2004). A subtle increase of nuclear NFATc1 expression caused a full-blown disease with multi-organ failure highlights the critical significance of the stringent control of NFATc1 nuclear occupancy. This is clinically relevant because many autoimmune and inflammatory diseases such as lupus, psoriasis, polymyalgia rheumatica, multiple sclerosis, inflammatory bowel disease as well as fibromyalgia and others still lack a clear mechanistic explanation (Janeway et al, 2000; Davidson et al, 2001). NFATc transcription factors are involved in lymphoid homeostasis and development (Rao et al, 1997; Ranger et al, 1998; Peng et al, 2001; David et al, 2007) and it is possible that a subtle increase of NFATc1 nuclear occupancy might be associated with these diseases. Subtle increase of nuclear NFATc1 destabilizes a positive feedback loop that could easily play a role in human immune and inflammatory diseases. One clinical example is the drug procainamide that induces lupus and disrupts Na+ channel activity leading to secondary changes in intracellular Ca2+level that activates calcineurin and NFATc proteins (Kretz-Rommel and Rubin 2000).

V. Conclusion We have shown that a subtle increase of nuclear NFATc1 expression can cause a severe disease of multiorgan failure with immune response characterized by extensive immune cell infiltration. These results indicate that stringent control of NFATc1 nuclear occupancy is critical for maintaining balanced immune response and may have important clinical implications.

References Beals CR, Sheridan CM, Turck CW, Gardner P, Crabtree GR (1997a) Nuclear export of NF-ATc enhanced by glycogen synthase kinase-3. Science 275, 1930-1933. Beals CR, Clipstone NA, Ho SN, Crabtree GR (1997b) Nuclear localization of NF-ATc by a calcineurin-dependent, cyclosporin-sensitive intramolecular interaction. Genes Dev 11, 824-834 . Chang C, Neilson J, Bayle J, Gestwicki J, Kuo A, Stankunas K, Graef I, Crabtree GR (2004) A Field of MyocardialEndocardial NFAT Signaling Underlies Heart Valve Morphogenesis. Cell 118, 649-663. Clipstone NA, Fiorentino DF and Crabtree GR (1994) Molecular analysis of the interaction of calcineurin with drugimmunophilin complexes J Biol Chem 269, 26431-26437.

176

Gene Therapy and Molecular Biology Vol 11, page 171 Gene Ther Mol Biol Vol 11, 171-176, 2007

Stringent control of NFATc1 nuclear occupancy is critical for maintaining balanced immune response Research Article

Minggui Pan1,*, Monte M. Winslow2, Joo Seob Keum2, Gerald R. Crabtree3 1 3

Division of Oncology, 2Division of Immunology, Howard Hughes Medical Institute, Department of Developmental Biology and Pathology, Stanford University, Stanford CA 94305-5323, USA

171

B. Histologic analysis Tissues and organs were fixed for 24 hours with 10% formalin, dehydrated, embedded in wax, sectioned and processed for H + E staining according to standard protocols.

172

173

Pan et al: NFATc1 export and immune response

175

176

Gene Therapy and Molecular Biology Vol 11, page 177 Gene Ther Mol Biol Vol 11, 177-184, 2007

Assessment of cytogenetic effect of antiblastic therapy by means of micronucleus assay in exfoliated epithelial cells Review Article

Armen K. Nersesyan* Institute of Cancer Research, Medical University of Vienna, Vienna A-1090, Austria

__________________________________________________________________________________ *Correspondence: Armen K. Nersesyan, Institute of Cancer Research, Medical University of Vienna, Vienna A-1090, Austria; Phone: +431 4277 65146; Fax: +431 4277 9651; E-mail: armen.nersesyan@meduniwien.ac.at; armenn@freenet.am Key words: micronucleus assay; exfoliated cells; chemotherapy; radiotherapy Abbreviations: exfoliated epithelial cells, (EEC); micronuclei, (MN) Received: 16 July 2007; Revised: 29 July 2007 Accepted: 3 September 2007; electronically published: September 2007

Summary Literature data concerning possibility to use micronuclei (MN) level in exfoliated epithelial cells of patients under radio- and chemotherapy as a biomarker of cytogenetic effect are presented and discussed. The number of MN in buccal cells of patients under chemotherapy are very few and contradictory. Significant dose-dependent increment of MN in tumor and normal epithelial cells due to radiotherapy of cancer patients was shown by almost all investigators. Evaluation of MN induced by radiotherapy in exfoliated tumor cells can potentially identify radiosensitivity of tumors and the treatment outcome after the first fractions of irradiation. MN assay is almost completely non-invasive and easily done in accessible tumors (oral cavity and uterine cervix).

and occupational pollutants can lead to increased level of MN in epithelial cells. Also some lifestyle habits, such as tobacco smoking, khat, areca nut and betel chewing can be reasons of MN induction in oral mucosal cells. In some diseases, including precancerous ones and cancer, increment of MN was also frequently observed (Nersesian et al, 1996; Majer et al, 2002). The aim of this paper was to evaluate the data concerning MN level in EEC of cancer patients as possible biomarkers of cytogenetic effect of antiblastic chemo- and radiotherapy. In review paper by Majer et al, 2002 three articles were cited concerning radiotherapy of oral cancer (totally 8 subjects, with MN increase in not affected by tumor cells in all cases), treatment of thyroid cancer with 131I (31 subjects, negative result), and one paper concerning cancer chemotherapy (7 subjects, positive results in 5 persons, and correlation with MN numbers in lymphocytes) (Majer et al, 2002). It should be added to the last cited paper (Sarto et al, 1990), that the increment of MN both in EEC and lymphocytes were not observed in two subjects treated only with interferon which is absolutely non-genotoxic. Hence, good agreement (and in one case correlation) was observed between the responsibility of two types of cells

I. Introduction It is well established that radio- and chemotherapy widely used for treatment of cancer patients induce chromosomal aberrations and micronuclei (MN) both in tumor (Widel et al, 1999, 2001; Schlomm et al, 2005, Yin et al, 2005) and normal (healthy) cells (Kutsuki et al, 2005, Lee et al, 2004). Because of technical difficulties (invasive procedure to obtain tumor cells before, during and after treatment) cytogenetic disturbances in organism due to the therapy are mostly studied in lymphocytes (Kopjar et al, 2002, Silva et al, 2002). These cells are the most used targets for biomonitoring of cytogenetic effect of cancer treatment. Of course, it would be of interest to monitor cytogenetic alterations not in surrogate tissue â&#x20AC;&#x201C; lymphocytes, but in the target, tumor cells. It is possible to obtain with minimal invasion and then to study exfoliated epithelial cells (EEC). It is noteworthy that about 90% of all human tumors are derived from this tissue (Cairns 1975a,b). MN assay in EEC is used to study clastogenic/aneugenic effects of agents of various origin (Nersesian et al, 1996; Majer et al, 2002). It has been shown that exposure of persons to many environmental

177

Nersesyan: Assessment of cytogenetic effect of antiblastic therapy (oral mucosa and lymphocytes) to genotoxic action of chemotherapeutic drugs. The papers available via Medline and Scopus were analysed. The most important data concerning MN induction in EEC by radio- and chemotherapy are presented in Tables 1-3 (age and sex of subjects, stain used and the number of cells studied). On the accuracy of scoring and evaluation of number of MN in mucosal cells the most important impact could have only stain used (DNA-specific or no) and the number of studied cells (Casartelli et al, 1997; Nersesyan 2001, 2005).

treatment) and then cells were collected for the investigations. Correlations between MN level induction in somatic epithelial cells and treatment results are unknown because no data were published about the treatment outcome of the patients after chemotherapy. Although contradictory results were published concerning chemotherapy action on MN level in buccal mucosa cells, it is noteworthy that in four studies significantly increased level of MN was observed in buccal cells of nurses handling cytostatic drugs (1.6-2.0fold) (Machado-Santelli et al, 1994; Odio et al, 2004; Cavallo et al, 2005,2007), and in one case 2-fold not significant increase (Burgaz et al, 1999). It is really surprising result because nurses are exposed to antiblastic drugs during preparation of the drug solutions for injections by inhalation and possibly via skin. Of course, the doses of cytostatics received by the nurses are significantly lower than that received by the patients, but all cases the number of MN was increased in nurses unlike the patients. Torres-Bugarin and colelagues mentioned in 2004 that many of patients under chemotherapy had signs of toxicity, and this circumstance could influence on MN induction in EEC. Anyway, this phenomenon warrants further investigations.

II. MN in cells of patients under chemotherapy Only 4 papers were found concerning MN induction in exfoliated epithelial cells due to antiblastic chemotherapy. One was already analysed by Majer et al 2002, others are presented in Table 1. In paper by Nersesyan et al, 1993, 6 males and 4 females with lymphogranulomatosis, 4 males with lung cancer and 7 females with breast cancer were analysed a week after various schedules of antiblastic chemotherapy. Significantly increased number of MN (3.2-fold) was observed. In 21 Mexican patients with various localization of tumor treated with isophosphamide+epirubicin significantly increased number of MN was registered (from 1.2‰ before to 2.6‰ after treatment) (TorresBugarin et al, 2004). In 14 patients (mostly with oral and penis cancer) treated with carboplatin+5-fluorouracil and 6 patients (3 with penis, 1 with prostate, and 2 with oral cancers) treated with cisDDP+5-fluorouracil no such effect was registered. In this paper both primary patients and patients subjected to second and even third courses of chemotherapy were studied. Based on the data presented by the authors, the number of cells with MN only in primary cancer patients treated with three chemotherapeutic schedules were calculated. Totally among them 19 were primary, and MN frequencies were 1.6±0.4‰ before and 2.6±0.7‰ after treatment (p>0.05, Mann Whitney test). In 10 patients treated with carboplatin+5-fluorouracil MN numbers were 0.95±0.12‰ before and 1.35±0.42‰ after treatment, and in 9 patients treated with isophosphamide+epirubicin the frequencies were 2.9±1.0‰ (before) and 4.9±1.6‰ (after treatment) (p>0.05 in both cases, Mann Whitney U-test). In another paper Torres-Burarin and colleagues used in 1998 cells of 10 cancer patients after course of antiblastic chemotherapy as a positive control in their study, but they did not report about the sites of tumors, age and sex of the patients. In this investigation the number of cells with MN was increased significantly 3.3-fold. Hence, two papers (Nersesian et al, 1993; TorresBugarin et al, 1998) reported about significant increment of MN induced by antiblastic chemotherapy and one the same effect only due to one schedule of therapy (TorresBugarin et al, 2004). Two other schedules used for treatment of the patients did not increase the number of MN in buccal cells. But as it was mentioned earlier, there is no possibility to evaluate real increment of MN (if any) because many patients were not primary, i. e. they received polychemotherapy previously (before the last

III. MN in cells of patients under radiotherapy The data concerning the frequencies of MN induced by radiotherapy in healthy (normal) and tumor EEC are presented in Tables 2 and 3, respectively. In Table 2 are presented the most important data of six papers concerning studied cells with no sign of pathology (Cao et al, 2002, Guzman et al, 2003, Mehrotra et al, 2004a, Minicucci et al, 2005, Nersesyan 1994, Vartazaryan 2003), e.g. they were obtained from opposite site of tumors localization, or from the same site, close to the tumor. In other papers the results of studies of tumor cells during and/or after radiotherapy are presented (Table 3) (Bhattathiri et al, 1998a,b; Bindu et al, 2003; Mehrotra et al, 2004b; Rimpu et al, 2005; Singh et al, 2005). Both in normal and tumor cells significant increase of MN was observed due to radiation. It is important that in normal cervical (Vartazaryan 2003) and buccal (Cao et al, 2002; Guzman et al, 2003; Minicucci et al, 2005) cells of patients under radiotherapy, MN level increased linearly until the certain dose (mostly about 25-35 Gy), and then even decreased after additional doses of radiation. In cervix cells the frequency of cells with MN was significantly higher after 35 Gy (8‰) than the level after 70 Gy (7.4‰) (Vartazaryan 2003). In buccal mucosa 8.8‰ cell with MN were observed after the dose of 48 Gy, and only 7.6‰ after 68 Gy (Vartazaryan 2003). This phenomenon was observed also in lymphocytes of head-and-neck and cervix cancer patients during radiotherapy where the frequencies of MN increased during the first half of therapy and declined thereafter, reaching, in some patients, values below the pre-treatment level (Tolbert et al, 1991; Nersesyan 1994; Bhattathiri et al, 1998a,b; Cao et al, 2002; Bindu et al, 2003; Guzman et al, 2003, Mehrotra et al, 2004a,b; Minicucci et al, 2005; Rimpu et al, 2005; Singh et al, 2005). In all mentioned cases no attention was 178

Gene Therapy and Molecular Biology Vol 11, page 179 paid to outcome of therapy. In the study of Vartazaryan in 2003 oral mucosa cells of cervix uterus cancer patients under radiotherapy were studied along with cervix cells (to check possible vulnerability of cells located on long distance from irradiated zone due to circulating reactive oxygen species and/or other genotoxic substances appeared due to irradiation). Unlike cervix cells, even after receiving of high local dose of radiation, no significant increase was observed in oral EEC (Vartazaryan 2003). In seven papers MN levels changes were reported in cervix and oral mucosa tumor cells of cancer patients under radiotherapy (Table 3) (Bhattathiri et al, 1998a,b, Bindu et al, 2003, Mehrotra et al, 2004b, Rimpu et al, 2005, Singh et al, 2005). In some cases MN frequencies in tumor cells were higher than in normal mucosa cells (e.g., 15‰ (Bhattathiri et al, 1998a) and 11‰ (Bhattathiri et al, 1998b) compared with healthy subjects from India – 0.7‰-4.0‰ (Nersesyan, 2006). In all studies linear increase of MN number in cancer cells with dose of radiation was observed (Bhattathiri et al, 1998a,b, Bindu et al, 2003, Mehrotra et al, 2004b, Rimpu et al, 2005, Singh et al, 2005). It is very important that in EEC of oral tumors of patients with good outcome of radiotherapy the number of cells with MN was higher than in resistant to therapy, significant in one case (Bhattathiri et al, 1998b) and not

significant in another (Bhattathiri et al, 1998b). In cervix tumor cells MN have good predictive value after one week of therapy – high number of MN compared to the background level predict good response to radiotherapy (Singh et al, 2005). The same results were obtained by the research group of Widel – but they instead of EEC of tumor investigated tumor cells obtained with biopsy (Widel et al, 1999, 2001). Some groups of investigators studied with MN in EEC also MN, chromosomal aberrations and DNA damage (by means of the comet assay) in lymphocytes (Cao et al, 2002, Guzman et al, 2003, Minicucci et al, 2005). Good correlation was observed with these genotoxicity endpoints, but all of them were more sensitive to radiation than MN assay in EEC. Two-three months after the end of radiotherapy the level of MN in buccal cells, but not in lymphocytes decreased. The number of cells with MN in buccal mucosa was higher than in negative control, but not statistically significant (Minicucci et al, 2005). In the same paper the authors paid attention to the influence of smoking on MN level induced by radiotherapy, and found no effect even in heavy smokers (30 or more cigarettes per day consumers) (Minicucci et al, 2005).

Table 1. Micronuclei frequency in buccal cells of cancer patients under antiblastic chemotherapy. Treatment

Chemotherapy (cancer of various sites, various schedules) Chemotherapy (cancer of various sites, isophosphamide+e pirubicin) Chemotherapy (cancer of various sites, carboplatin+5fluorouracil) Chemotherapy (cancer of various sites, cisDDP+5fluorouracil) Chemotherapy (cancer of various sites, not specified; drugs used – cyclophosphamide, cytosinearabinoside, epirubicin)

Number of subjects, sex, (age) 10m+12f (54) control – the same pts before therapy

Type of cells

13m+8f cancer patients (48.9) control – the same pts before therapy 9m+5f cancer patients (49.7) control – the same pts before therapy 6m cancer patients (61) control – the same pts before therapy 10 (sex not specified)

Buccal

control – the same pts before therapy

Stain (cells studied per subject) Feulgen + fast green (2000)

Remarks

Reference

Effect of exposure: ! x 3.2

Nersesian et al, 1993

0.8 2.6 1.2

Orcein (2000)

Effect of exposure: ! x 2.3

Torres-Bugarin et al, 2004

Buccal

1.3 1.0

Orcein (2000)

Effect of exposure: "

Torres-Bugarin et al, 2004

Buccal

2.7 1.5

Orcein (2000)

Effect of exposure: !

Torres-Bugarin et al, 2004

3.7

Feulgen + fast green (2000)

Effect of exposure: ! x 3.3

Torres-Bugarin et al, 1998

Buccal

Number of cells with MN (‰) 3.2 1.0

1.1

Symbols: ! - significant increase; " - no effect; ! - either increase or decrease, but not significant; pts – patients; f – female, m – male

179

Nersesyan: Assessment of cytogenetic effect of antiblastic therapy

Table 2. Micronuclei frequency in normal (not cancerous) epithelial cells of cancer patients under radiotherapy. Treatment (dose of radiation) Radiotherapy of cervix cancer (50.0 Gy) 1

Radiotherapy of squamos cell carcinoma of oral cavity

Number of subjects, sex, (age) 14f (50) the same pts

Number of cells with MN (‰) 8.0 – (35.0 Gy) 7.4 – (70.0 Gy) 2.9

8m+6f (61)

4.8 (25 Gy) 6.2 (15 Gy)

the same pts

0.9

Radiotherapy of head 25m, 6f (59) and neck cancer 6MeV linear the same pts accelerator (X-ray, equivalent body dose 3.3 Gy)

2.3

Radiotherapy of cancer of cervix uterus1 Radiotherapy of nasopharyngeal cancer (68.0 Gy)

39f (age nor specified) the same pts 9m (36)

0.9

the same pts

2.3

Radiotherapy of squamos cell carcinoma of oral cavity 1

Feulgen + fast green (2000)

Feulgen + fast green (4000 during therapy, 2000 before)

0.8

Feulgen + fast green (2000)

0.6 7.7 – (28 Gy) 8.8 – (48 Gy) 7.6 – (68 Gy)

Acridine orange (1000)

78m, 33f (age nor 4.4 - (24 Gy) specified) 1.8 - (6.0 Gy) the same pts

Stain (cells studied per subject) Feulgen + fast green (2000)

Giemsa (1000)

0.9

Remarks

Reference

Effect of exposure: ! x 2.0 (25 Gy) and ! x 1.8 (50 Gy) [significantly less than in the cells of pts who received 35.0 Gy] Effect of exposure: ! x 5.3 (25 Gy), ! x 6.8 (15 Gy)

Vartazaryan 2003

Effect of exposure: ! x 2.9. No effect of smoking on MN level, although there were 17 heavy smokers (more than 30 cigarettes per day consumers) Effect of exposure: ! x 1.5 Effect of exposure: ! x 3.3 (28 Gy), ! x 3.8 (48 Gy), ! x 3.3 (68 Gy). Positive results were obtained in MN, CAs, and comet assays in lymphocytes with less doses of radiation (410 Gy) Effect of exposure: ! x 2.0 (6 Gy) ! x 4.4 (24 Gy)

Minicucci et al, 2005

Nersesyan 1994

Guzman et al, 2003 Cao et al, 2002

Mehrotra et al, 2004a

– cervix cells were studied, in all other cases buccal cells were studied

! - significant increase; " - no effect; ! - either increase or decrease, but not significant; pts – patients; f – female, m - male

180

Gene Therapy and Molecular Biology Vol 11, page 181 Table 3. Micronuclei frequency in tumor cells of cancer patients under radiotherapy Treatment (dose of radiation) Radiotherapy of squamos cell carcinoma of oral cavity Radiotherapy of squamos cell carcinoma of oral cavity

Radiotherapy of cervix cancer

Radiotherapy of squamos cell carcinoma of oral cavity

Radiotherapy of squamos cell carcinoma of oral cavity Radiotherapy of squamos cell carcinoma of oral cavity Radiotherapy of head and neck cancer (squamos cell carcinoma of oral cavity -6, carcinoma of base of tongue-12 and others) Radiotherapy of epidermoid carcinoma of oral cavity (buccal mucosa - 21, gingival – 8, palate – 3: one site; 12 – more than one site)

Number of subjects, sex, (age) 31(sex and age not specified) the same pts

Number of cells with MN (‰)

49 (sex and age not specified)

25.2 (24 Gy, 21 sensitive to treatment pts) 15.0 (24 Gy, 28 resistant to treatment pts)

the same pts 25f (52)

4.1 42.0

the same pts

15.0

68 (sex not specified) (62)

43 – (7.0 Gy) 55 – (17.5 Gy) 71 – (28 Gy) 78 – (38.5 Gy)

the same pts 78m, 33f

11 6.0 - (24 Gy)

the same pts

1.1

102 m

14.1

the same pts

1.6

27m, 3 f

7.7 (4 Gy) 8.8 (14 Gy) 12.8 (24 Gy)

the same pts

3.5

34m, 10f

27.7 (28 Gy, sensitive) 18.3 7 (28 Gy, resistant)

the same pts

2.0

19.5 (24 Gy)

Stain (cells studied per subject) Giemsa (1000)

Remarks

Reference

Effect of exposure: ! x 7.1

Bhattathiri et al, 1998a

Giemsa (1000)

Effect of exposure: ! in both resistant (x 3.7) and sensitive ( x 6.1) to therapy pts. The number of MN was significantly higher in sensitive to treatment pts Effect of exposure: ! x 2.8. The significant increase of MN in cancer cells after first week could predict for a local better response and survival Effect of exposure: linear, maximally at maximum dose ! x 7.7

Bhattathiri et al, 1998b

Giemsa (1000)

Effect of exposure: ! x 5.4 (24 Gy)

Mehrotra et al, 2004a

Giemsa (1000)

Effect of exposure: ! x 8.8

Mehrotra et al, 2004b

Giemsa (750)

Effect of exposure: Rimpu et al, ! x 3.7 at 24 Gy 2005 Linear increase of the number of MN with the dose

Giemsa (750)

Effect of exposure: Bhattathiri et ! x 13.9 sensitive to al, 1998b therapy tumors, ! x 9.1 resistant Linear increase of the number of MN with the dose. No significant difference between two groups of pts.

2.8

MayGrunwaldGiemsa (1000)

Giemsa (500)

Singh et al, 2005

Bindu et al, 2003

! - significant increase; " - no effect; ! - either increase or decrease, but not significant; pts – patients; f – female, m - male Hence, two papers (Nersesian et al, 1993; TorresBugarin et al, 1998) reported about significant increment of MN induced by antiblastic chemotherapy and 1 the same effect only due to one schedule of therapy. Two

other schedules used for treatment of the patients did not increase the number of MN in buccal cells. But as it was mentioned earlier, there is no possibility to evaluate real increment of MN (if any) because many patients were not 181

Nersesyan: Assessment of cytogenetic effect of antiblastic therapy primary, i. e. they received polychemotherapy previously (before the last treatment) and then cells were collected for the investigations. Correlations between MN level induction in somatic epithelial cells and treatment results are unknown because no data were published about the treatment outcome of the patients after chemotherapy. Although contradictory results were published concerning chemotherapy action on MN level in buccal mucosa cells, it is noteworthy that in four studies significantly increased level of MN was observed in buccal cells of nurses handling cytostatic drugs (1.6-2.0fold) (Machado-Santelli et al, 1994; Odio et al, 2004; Cavallo et al, 2005, 2007), and in one case 2-fold not significant increase (Burgaz et al, 1999). It is really surprising result because nurses are exposed to antiblastic drugs during preparation of the drug solutions for injections by inhalation and possibly via skin. Of course, the doses of cytostatics received by the nurses are significantly lower than that received by the patients, but all cases the number of MN was increased in nurses unlike the patients. Torres-Bugarin and colleagues mentioned in 2004 that many of patients under chemotherapy had signs of toxicity, and this circumstance could influence on MN induction in epithelial cells. Anyway, this phenomenon warrants further investigations.

were studied along with cervix cells (to check possible vulnerability of cells located on long distance from irradiated zone due to circulating reactive oxygen species and/or other genotoxic substances appear due to irradiation). Unlike cervix cells, even after receiving of high local dose of radiation, no significant increase was observed in oral cells (Vartazaryan, 2003). In seven papers MN levels changes were reported in cervix and oral mucosa tumor cells of cancer patients under radiotherapy (Table 3) (Bhattathiri et al, 1998a, b, c; Bindu et al, 2003; Mehrotra et al, 2004a; Rimpu et al, 2005; Singh et al, 2005). In some cases MN frequencies in tumor cells were higher than in normal mucosa cells (e. g., 15‰ (Bhattathiri et al, 1998c) and 11‰ (Bhattathiri et al, 1998a) compared with healthy subjects from India – 0.7‰-4.0‰ (Nersesyan, 2006b)). In all studies linear increase of MN number in cancer cells with dose of radiation was observed (Bhattathiri et al, 1998a, b, c; Bindu et al, 2003; Mehrotra et al, 2004a; Rimpu et al, 2005; Singh et al, 2005). It is very important that in exfoliated oral tumor cells of patients with good outcome of radiotherapy the number of cells with MN was higher than in resistant to therapy, significant in one case (Bhattathiri et al, 1998a) and not significant in another (Bhattathiri et al, 1998b). In cervix tumor cells MN have good predictive value after one week of therapy – high number of MN compared to the background level predict good response to radiotherapy (Singh et al, 2005). The same results were obtained by the research group of Wiedel – but they instead of exfoliated tumor cells investigated tumor cells obtained with biopsy (Widel et al, 1999, 2001). Some groups of investigators studied with MN in exfoliated cells also MN, chromosomal aberrations and DNA damage (by means of the comet assay) in lymphocytes (Cao et al, 2002; Minicucci et al, 2005). Good correlation was observed with these genotoxicity endpoints, but all of them were more sensitive to radiation than MN assay in exfoliated cells. Two-three months after the end of radiotherapy the level of MN in buccal cells, but not in lymphocytes decreased. The number of cells with MN in buccal mucosa was higher than in negative control, but not statistically significant (Minicucci et al, 2005). In the same paper the authors paid attention to the influence of smoking on MN level induced by radiotherapy, and found no effect even in heavy smokers (30 or more cigarettes per day consumers) (Minicucci et al, 2005).

III. MN in cells of patients under radiotherapy The data concerning the frequencies of MN induced by radiotherapy in healthy (normal) and tumor epithelial cells are presented in Tables 2 and 3, respectively. In Table 2 are presented the most important data of six papers concerning studied cells with no sign of pathology (Nersesyan, 1994; Cao et al, 2002; Guzman et al, 2003; Vartazaryan, 2003; Mehrotra et al, 2004b; Minicucci et al, 2005), e. g. they were obtained from opposite site of timors localization, or from the same site, close to the tumor. In other papers the results of studies of tumor cells during and/or after radiotherapy are presented (Table 3) (Bhattathiri et al, 1998a, b, c; Bindu et al, 2003; Mehrotra et al, 2004a; Rimpu et al, 2005; Singh et al, 2005). Both in normal and tumor cells significant increase of MN was observed due to radiation. It is important that in normal cervical (Vartazaryan, 2003) and buccal (Cao et al, 2002; Minicucci et al, 2005) cells of patients under radiotherapy, MN level increased linearly until the certain dose (mostly about 25-35 Gy), and then even decreased after additional doses of radiation. In cervix cells the frequency of cells with MN was significantly higher after 35 Gy (8‰) than the level after 70 Gy (7.4‰) (Vartazaryan, 2003). In buccal mucosa 8.8‰ cell with MN were observed after the dose of 48 Gy, and only 7.6‰ after 68 Gy (Vartazaryan, 2003). This phenomenon was observed also in lymphocytes of head-and-neck and cervix cancer patients during radiotherapy where the frequencies of micronuclei increased during the first half of therapy and declined thereafter, reaching, in some patients, values below the pre-treatment level (Tolbert et al, 1991; Nersesyan, 1994). In all mentioned cases no attention was paid to outcome of therapy. In the study of Vartazaryan in 2003 oral mucosa cells of cervix uterus cancer patients under radiotherapy

IV. Nuclear anomalies in exfoliated cells of subjects exposed to cytostatic drugs and under radiotherapy It is well known that in EEC except the MN also other events called nuclear anomalies (NA) can be registered, e. i. karyorrhexis (nucleus broken to pieces), karyolysis (lysed nucleus which appears as a ghost), binucleated cells (cells with 2 nuclei), pycnosis (very small, shrunken nucleus), budded cells (cells with budded nucleus including so-called “broken egg” phenomenon – a MN attached to main nucleus with the stalk) and

182

Gene Therapy and Molecular Biology Vol 11, page 183 condensed chromatin (Tolbert et al, 1991). Sometimes these NA can be wrongly considered as MN. Although the pioneers of the investigations of NA Tolbert and colleagues proposed in 1991 that some of them, namely binucleates and “broken egg” phenomenon can be connected with genotoxicity, recently two papers were published stating that cells with “broken egg” phenomenon appear not due to genotoxic effect (Nersesyan, 2006a,b). Some investigators proposed that NA are consequences of cytotoxic effects and apoptosis (Cerqueira et al, 2004; Torres-Bugarin et al, 2004; Angelieri et al, 2007). The real meaning of NA is unknown although they should be registered separately from cells with MN because in some cases NA can mimic real MN (Nersesyan et al, 2006a). Only two investigations concerning the effect of chemotherapy on NA in EEC are available. TorresBugarin and colleagues shown in 1998, 2004 that due to only certain schedules of chemotherapy some changes in NA frequencies can be detected. Namely, the number of cells with karyolysis increased significantly in patients treated with cisplatin + fluorouracil, isophosphamid + epirubucin. At the same time, the number of binucleates decreased significantly in buccal cells of patients under chemotherapy. In one study (Odio et al, 2004) was shown that in oral EEC of nurses handling cytostatic drugs the frequencies of all NA were increased compared with nonexposed subjects. Unlike chemotherapy, almost all investigators registered substantial increase of NA frequencies in EEC of cancer patients under radiotherapy. Studying EEC of patients under radiotherapy, Indian investigators proposed some new features of cells, both normal (healthy) and tumor ones, e. g. multinucleated cells (Bindu et al, 2003; Mehrotra et al, 2004b; Rimpu et al, 2005) and cytoplasmic granulation (Bindu et al, 2003; Mehrotra et al, 2004b). Since they did not present the photos of so-called granulation it is not possible to understand what they mean, and is it the same as condensed chromatin. As it was mentioned above, the real meaning of all of these NA is unknown. Recently the group of Indian investigators proposed that binucleates and multinucleation in exfoliated cells could be due to viral infection (Mehrotra et al, 2006). de Almeida and colleagues proposed in 2004 that the cells with ‘broken egg’ phenomenon observed in human liver affected with hepatitis C virus were due to viral infection (de Almeida et al, 2004). Anyway, it is noteworthy that in all cases the number of all nuclear anomalies was increased significantly compared with the levels before the treatment and this increase was linear.

EEC of patients receiving some schedules of chemotherapy could be explained by toxic effect of therapy because in nurses who were exposed to many times less doses of cytostatics the increment of cells with MN was registered. In contrast, all studies showed significant increment of MN and other nuclear anomalies in tumor and normal EEC due to radiotherapy. This increase was dosedependent. It is extremely important that serial cytological assay of MN induction can potentially identify radiosensitivity of tumors and the treatment outcome. The technique to apply MN assay in EEC is almost completely non-invasive and easily done in accessible primary cancers (i.e. oral cavity and uterine cervix). In other sites, fine needle cytology can be applied. It should be mentioned that although MN assay in EEC has many advantages it is less sensitive to register the effects of radiotherapy than conventional chromosomal aberrations and MN assays in lymphocytes and the comet assay in lymphocytes. In conclusion, MN assay in EEC of tumors could be very useful in prognosis of sensitivity of tumors to radiotherapy unlike MN assay in patients treated with cytostatics. Further investigations in this area are certainly warranted to evaluate possibility of the application of this test for prognosis of treatment outcome.

References Angelieri F, de Oliveira GR, Sannomiya EK, Ribeiro DA (2007) DNA damage and cellular death in oral mucosa cells of children who have undergone panoramic dental radiography. Pediatr Radiol 37, 561-565. Bhattathiri NV, Bharathykkutty C, Prathapan R, Chirayathmanjiyil DA, Nair KM (1998b) Prediction of radiosensitivity of oral cancers by serial cytological assay of nuclear changes. Radiother Oncol 49, 61-65. Bhattathiri NV, Bindu L, Remani P, Chandralekha B, Nair KM (1998a) Radiation-induced acute immediate nuclear abnormalities in oral cancer cells: serial cytologic evaluation. Acta Cytol 42, 1084-1090. Bindu L, Balaram P, Mathew A, Remani P, Bhattathiri VN, Nair MK (2003) Radiation-induced changes in oral carcinoma cells - a multiparametric evaluation. Cytopathology 14, 287293. Burgaz S, Karahalil B, Bayrak P, Taskin L, Yavuzaslan F, Bokesoy I, Anzion RB, Bos RP, Platin N (1999) Urinary cyclophosphamide excretion and micronuclei frequencies in peripheral lymphocytes and in exfoliated buccal epithelial cells of nurses handling antineoplastics. Mutat Res 439, 97104. Cairns J (1975a) The cancer problem. Sci Am 233, 64-72. Cairns J (1975b) Mutation selection and the natural history of cancer. Nature 255, 197-200. Cao J, Liu Y, Sun H, Cheng G, Pang X, Zhou Z (2002) Chromosomal aberrations, DNA strand breaks and gene mutations in nasopharyngeal cancer patients undergoing radiation therapy. Mutat Res 504, 85-90. Casartelli G, Monteghirfo S, De Ferrari M, Bonatti S, Scala M, Toma S, Margarino G, Abbondandolo A (1997) Staining of micronuclei in squamous epithelial cells of human oral mucosa. Anal Quant Cytol Histol 19, 475-481. Cavallo D, Ursini CL, Omodeo-Sale E, Iavicoli S (2007) Micronucleus induction and FISH analysis in buccal cells

V. Conclusions In this review an attempt was carried out to analyse all available papers concerning the effect of chemo- and radiotherapy on MN induction in EEC of patients under antiblastic therapy. Based on the small number of papers concerning an effect of cytostatic drugs it is not possible to come to certain conclusions. Absence of changes in MN number in 183

Nersesyan: Assessment of cytogenetic effect of antiblastic therapy and lymphocytes of nurses administering antineoplastic drugs. Mutat Res 628, 11-18. Cavallo D, Ursini CL, Perniconi B, Francesco AD, Giglio M, Rubino FM, Marinaccio A, Iavicoli S (2005) Evaluation of genotoxic effects induced by exposure to antineoplastic drugs in lymphocytes and exfoliated buccal cells of oncology nurses and pharmacy employees. Mutat Res 587, 45-51. Cerqueira EM, Gomes-Filho IS, Trindade S, Lopes MA, Passos JS, Machado-Santelli GM (2004) Genetic damage in exfoliated cells from oral mucosa of individuals exposed to X-rays during panoramic dental radiographies. Mutat Res 562, 111-117. de Almeida TM, Leitao RC, rade JD, Becak W, Carrilho FJ, Sonohara S (2004) Detection of micronuclei formation and nuclear anomalies in regenerative nodules of human cirrhotic livers and relationship to hepatocellular carcinoma. Cancer Genet Cytogenet 150, 16-21. Guzman P, Sotelo-Regil RC, Mohar A, Gonsebatt ME (2003) Positive correlation between the frequency of micronucleated cells and dysplasia in Papanicolaou smears. Environ Mol Mutagen 41, 339-343. Kopjar N, Garaj-Vrhovac V, Milas I (2002) Acute cytogenetic effects of antineoplastic drugs in peripheral blood lymphocytes in cancer patients chromosome aberrations and micronuclei. Tumori 88, 300-312. Kutsuki S, Ihara N, Shigematsu N, Okamoto S, Kubo A (2005) Relation between chromosomal aberrations and radiation dose during the process of TBI). Radiat Med 23, 37-42. Lee R, Yamada S, Yamamoto N, Miyamoto T, Ando K, Durante M, Tsujii H (2004) Chromosomal aberrations in lymphocytes of lung cancer patients treated with carbon ions. J Radiat Res (Tokyo) 45, 195-199. Machado-Santelli GM, Cerqueira EM, Oliveira CT, Pereira CA (1994) Biomonitoring of nurses handling antineoplastic drugs. Mutat Res 322, 203-8. Majer BJ, Laky B, Knasmuller S, Kassie F (2002) Use of the micronucleus assay with exfoliated epithelial cells as a biomarker for monitoring individuals at elevated risk of genetic damage and in chemoprevention trials. Mutat Res 489, 147-72. Mehrotra R, Goel N, Singh M, Kumar D (2004b) Radiationrelated cytological changes in oral malignant cells. Indian J Pathol Microbiol 47, 343-347. Mehrotra R, Gupta A, Singh M, Ibrahim R (2006) Application of cytology and molecular biology in diagnosing premalignant or malignant oral lesions. Mol Cancer 23, 5-11. Mehrotra R, Madhu, Singh M (2004a) Serial scrape smear cytology of radiation response in normal and malignant cells of oral cavity.Indian J Pathol Microbiol 47, 497-502. Minicucci EM, Kowalski LP, Maia MA, Pereira A, Ribeiro LR, de Camargo JL, Salvadori DM (2005) Cytogenetic damage in circulating lymphocytes and buccal mucosa cells of headand-neck cancer patients undergoing radiotherapy. Radiat Res (Tokyo) 46, 135-142. Nersesian AK (1996) The micronucleus test in human exfoliative cells as a method for studying the action of mutagens/carcinogens. Tsitol Genet 30, 91-96. Nersesian AK, Zil'fian VN, Kumkumadzhian VA, Nersesian AK (1993) An analysis of the micronuclei in the oral mucosa of cancer patients for assessing the clastogenic effect of chemical preparations. Tsitol Genet 27, 77 -80. Nersesyan A, Kundi M, Atefie K, Schulte-Hermann R, Knasmuller S (2006) Effect of staining procedures on the results of micronucleus assays with exfoliated oral mucosa cells. Cancer Epidemiol Biomarkers Prev 15, 1835-40.

Nersesyan AK (1994) The study of micronuclei frequency in buccal mucosa cells of oral cancer patients under radiotherapy. In: Proc. of XVI Intern. Cancer Congress, New Delhi, India, R.S.Rao (Ed.), Monduzzi Editore, Bologna, pp. 95-98. Nersesyan AK (2001) Letter to Editor. Carcinogenesis 22, 679. Nersesyan AK (2005) Nuclear buds in exfoliated human cells.Mutat Res 588, 64-68. Nersesyan AK (2005) Strange phenomenon, i.e., an antimutagenic effect of areca nut chewing. Mutat Res 582, 163-4. Nersesyan AK (2006) The nature of "broken egg" events in exfoliated human cells. Acta Cytol 50, 598-589. Odio AD, Duharte AB, Carnesoltas D, Garcia L, Loaces EL, Cabrera LG (2004) Cytogenetis effect of occupational exposure to cytostatics. Rec Med IMSS 42, 487-492. Rimpu K, Arun C, Goyal PK (2005) Karyoanomalic frequency during radiation therapy. J Cancer Res Ther 1, 187-190. Sarto F, Tomanin R, Giacomelli L, Canova A, Raimondi F, Ghiotto C, Fiorentino MV (1990) Evaluation of chromosomal aberrations in lymphocytes and micronuclei in lymphocytes, oral mucosa and hair root cells of patients under antiblastic therapy. Mutat Res 228, 157-169. Schlomm T, Gunawan B, Schulten HJ, Sander B, Thangavelu K, Graf N, Leuschner I, Ringert RH, Fuzesi L (2005) Effects of chemotherapy on the cytogenetic constitution of Wilms' tumor. Clin Cancer Res 11, 4382-4387. Silva LM, Takahashi CS, Carrara HH (2002) Study of chromosome damage in patients with breast cancer treated by two antineoplastic treatments. Teratog Carcinog Mutagen 22, 257-269. Singh S, Datta NR, Krishnani N, Lal P, Kumar S (2005) Radiation therapy induced micronuclei in cervical cancer-does it have a predictive value for local disease control? Gynecol Oncol 97, 764-771. Tolbert PE, Shy CM, Allen JW (1991) Micronuclei and other nuclear anomalies in buccal smears: a field test in snuff users. Am J Epidemiol 134, 840-850. Torres-Bugarin O, De Anda-Casillas A, Ramirez-Munoz MP, Sanchez-Corona J, Cantu JM, Zuniga G (1998) Determination of diesel genotoxicity in firebreathers by micronuclei and nuclear abnormalities in buccal mucosa. Mutat Res 413, 277-281. Torres-Bugarin O, Ventura-Aguilar A, Zamora-Perez A, GomezMeda BC, Ramos-Ibarra ML, Morga-Villela G, GutierrezFranco A, Zuniga-Gonzalez G (2004) Evaluation of cisplatin + 5-FU, carboplatin + 5-FU, ifosfamide + epirubicine regimens using the micronuclei test and nuclear abnormalities in the buccal mucosa. Mutat Res 565, 91-101. Vartazaryan NS (2003) Investigation of cytogenetic disturbances in exfoliated human cells by means of micronucleus assay. PhD thesis. State University, Yerevan, Armenia. Widel M, Jedrus S, Owczarek S, Konopacka M, Lubecka B, Kolosza Z (1999) The increment of micronucleus frequency in cervical carcinoma during irradiation in vivo and its prognostic value for tumour radiocurability. Br J Cancer 80, 1599-1607. Widel M, Kolosza Z, Jedrus S, Lukaszczyk B, RaczekZwierzycka K, Swierniak A (2001) Micronucleus assay in vivo provides significant prognostic information in human cervical carcinoma; the updated analysis. Int J Radiat Biol 77, 631-636. Yin CC, Glassman AB, Lin P, Valbuena JR, Jones D, Luthra R, Medeiros LJ (2005) Morphologic, cytogenetic, molecular abnormalities in therapy-related acute promyelocytic leukaemia. Am J Clin Pathol 123, 840-848.

184

Gene Therapy and Molecular Biology Vol 11, page 177 Gene Ther Mol Biol Vol 11, 177-184, 2007

Assessment of cytogenetic effect of antiblastic therapy by means of micronucleus assay in exfoliated epithelial cells Review Article

Armen K. Nersesyan* Institute of Cancer Research, Medical University of Vienna, Vienna A-1090, Austria

177

Table 1. Micronuclei frequency in buccal cells of cancer patients under antiblastic chemotherapy. Treatment

Number of subjects, sex, (age) 10m+12f (54) control – the same pts before therapy

Type of cells

Buccal

control – the same pts before therapy

Stain (cells studied per subject) Feulgen + fast green (2000)

Remarks

Reference

Effect of exposure: ! x 3.2

Nersesian et al, 1993

0.8 2.6 1.2

Orcein (2000)

Effect of exposure: ! x 2.3

Torres-Bugarin et al, 2004

Buccal

1.3 1.0

Orcein (2000)

Effect of exposure: "

Torres-Bugarin et al, 2004

Buccal

2.7 1.5

Orcein (2000)

Effect of exposure: !

Torres-Bugarin et al, 2004

3.7

Feulgen + fast green (2000)

Effect of exposure: ! x 3.3

Torres-Bugarin et al, 1998

Buccal

Number of cells with MN (‰) 3.2 1.0

1.1

Symbols: ! - significant increase; " - no effect; ! - either increase or decrease, but not significant; pts – patients; f – female, m – male

179

Nersesyan: Assessment of cytogenetic effect of antiblastic therapy

Table 2. Micronuclei frequency in normal (not cancerous) epithelial cells of cancer patients under radiotherapy. Treatment (dose of radiation) Radiotherapy of cervix cancer (50.0 Gy) 1

Radiotherapy of squamos cell carcinoma of oral cavity

Number of subjects, sex, (age) 14f (50) the same pts

Number of cells with MN (‰) 8.0 – (35.0 Gy) 7.4 – (70.0 Gy) 2.9

8m+6f (61)

4.8 (25 Gy) 6.2 (15 Gy)

the same pts

0.9

Radiotherapy of head 25m, 6f (59) and neck cancer 6MeV linear the same pts accelerator (X-ray, equivalent body dose 3.3 Gy)

2.3

Radiotherapy of cancer of cervix uterus1 Radiotherapy of nasopharyngeal cancer (68.0 Gy)

39f (age nor specified) the same pts 9m (36)

0.9

the same pts

2.3

Radiotherapy of squamos cell carcinoma of oral cavity 1

Feulgen + fast green (2000)

Feulgen + fast green (4000 during therapy, 2000 before)

0.8

Feulgen + fast green (2000)

0.6 7.7 – (28 Gy) 8.8 – (48 Gy) 7.6 – (68 Gy)

Acridine orange (1000)

78m, 33f (age nor 4.4 - (24 Gy) specified) 1.8 - (6.0 Gy) the same pts

Stain (cells studied per subject) Feulgen + fast green (2000)

Giemsa (1000)

0.9

Remarks

Reference

Effect of exposure: ! x 2.0 (25 Gy) and ! x 1.8 (50 Gy) [significantly less than in the cells of pts who received 35.0 Gy] Effect of exposure: ! x 5.3 (25 Gy), ! x 6.8 (15 Gy)

Vartazaryan 2003

Minicucci et al, 2005

Nersesyan 1994

Guzman et al, 2003 Cao et al, 2002

Mehrotra et al, 2004a

– cervix cells were studied, in all other cases buccal cells were studied

! - significant increase; " - no effect; ! - either increase or decrease, but not significant; pts – patients; f – female, m - male

180

Radiotherapy of cervix cancer

Radiotherapy of squamos cell carcinoma of oral cavity

Number of subjects, sex, (age) 31(sex and age not specified) the same pts

Number of cells with MN (‰)

49 (sex and age not specified)

25.2 (24 Gy, 21 sensitive to treatment pts) 15.0 (24 Gy, 28 resistant to treatment pts)

the same pts 25f (52)

4.1 42.0

the same pts

15.0

68 (sex not specified) (62)

43 – (7.0 Gy) 55 – (17.5 Gy) 71 – (28 Gy) 78 – (38.5 Gy)

the same pts 78m, 33f

11 6.0 - (24 Gy)

the same pts

1.1

102 m

14.1

the same pts

1.6

27m, 3 f

7.7 (4 Gy) 8.8 (14 Gy) 12.8 (24 Gy)

the same pts

3.5

34m, 10f

27.7 (28 Gy, sensitive) 18.3 7 (28 Gy, resistant)

the same pts

2.0

19.5 (24 Gy)

Stain (cells studied per subject) Giemsa (1000)

Remarks

Reference

Effect of exposure: ! x 7.1

Bhattathiri et al, 1998a

Giemsa (1000)

Bhattathiri et al, 1998b

Giemsa (1000)

Effect of exposure: ! x 5.4 (24 Gy)

Mehrotra et al, 2004a

Giemsa (1000)

Effect of exposure: ! x 8.8

Mehrotra et al, 2004b

Giemsa (750)

Effect of exposure: Rimpu et al, ! x 3.7 at 24 Gy 2005 Linear increase of the number of MN with the dose

Giemsa (750)

2.8

MayGrunwaldGiemsa (1000)

Giemsa (500)

Singh et al, 2005

Bindu et al, 2003

182

184

Gene Therapy and Molecular Biology Vol 11, page 185 Gene Ther Mol Biol Vol 11, 185-202, 2007

Integration of human DNA fragments into the cell genomes of certain tissues from adult mice treated with cytostatic cyclophosphamide in combination with human DNA Research Article

Anastasia S. Likhacheva1, Valeriy P. Nikolin1, Nelly A. Popova1, Tatiana D. Dubatolova1, Dmitriy N. Strunkin2, Vladimir A. Rogachev1, Tamara E. Sebeleva1, Ivan S. Erofeev1, Sergei S. Bogachev1,3,*, Leonid A. Yakubov4, Mikhail A. Shurdov3 1

Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, 10 Lavrentieva ave, Novosibirsk, 630090, Russia; 2 Municipal hospital, Oncology department, Novosibirsk, Russia; 3 LLC Panagen, 29 Choros-Gurkina street, Gorno-Altaisk, 649000, Russia; 4 Panagenic International Inc., 2935 Byberry Road, Hatboro, PA, 19040, USA

__________________________________________________________________________________ *Correspondence: Sergei S. Bogachev, 10 Lavrentieva ave, 630090, Novosibirsk, Russia; Tel: +7-383-333-29-06; Fax: +7-383-333-1278; e-mail: labmolbiol@mail.ru Key words: transgenic mice; human DNA; cyclophosphamide; Alu repeats; blood count (hemogram) Abbreviations: cyclophosphamide (CP); double-stranded break, (DSB); interstrand cross-link, (ICL) Received: 26 May 2007; Revised: 7 August 2007 Accepted: 3 September 2007; electronically published: September 2007

Summary We demonstrate here that, when administered i.p. to adult mice in combination with the cytostatic cyclophosphamide, an inducer of cross-links in the DNA molecule, human exogenous DNA, having reached the nuclear space of liver, thymus, spleen cells, integrates into the mouse genome. The integration of foreign DNA produces change in blood counts and is lethal to the treated mice. It is suggested that the integration mechanism acts through the repair events induced by the formation of covalent interstrand cross-links resulting in double strand breaks during replication fork arrest.

al, 2000; Karle et al, 2001). The arisen ICLs are efficiently repaired in both the prokaryotic and eukaryotic cells. In Escherichia coli, ICL repair is accomplished through excision and recombination pathways (Van Houten et al, 1986; Cheng et al, 1988; Sladek et al, 1989). In yeast cells, a similar mechanism involving excision endonucleases provides repair of ICLs in DNA (Jachymczyk et al, 1981; Magana-Schwencke et al, 1982, Prakash et al, 1993; Friedberg et al, 1995). With respect to mammals, humans too, the DNA machinery whereby such defects in the chromosomes are repaired remains unclear. A complex of excision repair factors has been implicated for the ICL repair mechanism. The factors first identified in xeroderma pigmentosum, XP, a hereditary human disease with a defect in the excision repair mechanism,

I. Introduction Chemical cytostatic agents whose molecules intercalate between stacked base pairs, thereby causing DNA interstrand cross-links (ICLs) between the complementary strands of DNA, are extensively used in anticancer chemotherapeutics. Cyclophosphamide (CP) has gained wide recognition as an anticancer drug. CP is activated in the liver by four hydroxylation reactions accomplished by the catalysts cytochromes. Antitumor effect of CP is believed to be due to its genotoxic DNAalkylating phosphoramide mustard (PM). PM forms adducts with purine bases of the DNA molecule, especially with adjacent guanine residues and gives rise to ICLs in the two DNA strands (Yu et al, 1999; De Silva et

185

Likhacheva et al: Integration of human DNA into the mouse genome include XPA, RPA, TFIIA, XPC, XPG, XPF-ERCC1 (Mu et al, 2000; Park et al, 1995). In vitro experiments have established certain details by which such DNA molecule damage is repaired. The XPG factor makes excisions at the 3’side (Harrington and Lieber, 1994; O’Donovan et al, 1994; Matsunaga et al, 1995) and the XPF-ERRC factor at the 5’side of the experimentally induced lesion (Bessho et al, 1997a). Kinetic experiments with incision formation provided evidence for the occurrence of 3’ prior to 5’ incisions (O’Donovan et al, 1994; Mu et al, 1996; Sijbers et al, 1996). An unwound stretch of the DNA molecule of about 30 bp is required for the two factors to be active (Matsunaga et al, 1996; Evans et al, 1997). It has been demonstrated that the XPF-ERCC1 heterodimer possesses additional 3’-5’ exonuclease activity and, in the presence of replication protein A (RPA), the enzyme can bypass cross-link between the two DNA strands, thus forming a single-stranded DNA with a dinucleotide adduct (Mu et al, 2000). Experimental data have indicated that the XPA component of the excision complex is requisite for DNA opening (Evans et al, 1997). The total incision reaction is dependent on the ATP presence, it proceeds in the presence of the ATP-dependent TFIIH factor with helicase activity (Schaeffer et al, 1993; Hoeijmakers et al, 1996). It has been shown (Bessho et al, 1997b; Caldecott and Jeggo, 1991; Collins, 1993; Pastink and Lohman, 1999; Wang et al, 2001) that the replication fork stoppage in the location of ICL induces DSB initiation and starts the repair processes deleting arisen damage. ICL repair in DNA strands implies at least three independent events entailing (i) an unknown system generating specific DSBs arising during replication in proliferating cells; (ii) an excision enzyme complex; (iii) a DSB repair system. In the case of DSBs induced by ionizing radiation, repair process occurs as nonhomologous joining of broken ends or synthesis depending strand annealing, in contrast, homologous recombination with Holiday structure formation is the major pathway for repair of the DSBs induced by cytostatic drugs (De Silva et al, 2000; Mu et al, 2000; Reardon et al, 1991; Saffran et al, 1994; Lambert et al, 2005; Li et al, 1999). A model for ICL repair in DNA molecule strands has been suggested. According to the model replication is the major inducer of ICL repair (Li et al, 1999; Niedernhofer et al, 2004). Encounter of replication fork with ICLs renders it inactive. This is associated with DSB generation by an unknown mechanism (presumably with the involvement of specific endonuclease Mus81). Excision factors machinery and transit exonuclease activity of XPF-ERCC1-RPA cleave the ICLs and relieve of torsional strain around it. The break and single strand gap with excision enzyme forming initiate homologous recombination whose first step is the formation of the heteroduplex by the activity of XRCC2 and XRCC3 between the lesioned and any other homologous sequence in the nucleus. The recombination process ends up the last step specific cuts made by excision enzymes, complete removal of the adduct, and repair synthesis on new template. The excisions can be possibly made at the time when the replication fork movement is blocked or later, during elimination of the adduct (De Silva et al, 2000).

Multiple DSBs arising in DNA chemically interacting with an alkalyting agent brings the nuclear synthetic process to a halt and impairs the cell cycle. Ultimately, a self-destruction program is turned on, the cell is either subject to apoptosis or to profound genetic changes. It is precisely such DNA damage that makes cancer cells lethal in anticancer therapy with cytotoxic agent. In our previous studies (Yakubov et al, 2002, 2003), we have hypothesized the existence of a natural mechanism that may have an influence on the genetic component of the cells of multicellular organisms, using genomic DNA from biological fluid as an external genomic reference. The mechanism implies that the cell surface DNA binding receptors deliver genomic DNA fragments produced by natural apoptosis from the external environment (blood plasma, intertissue fluid, lymph) into the nucleus, that this turnover is continuous. Within the nuclear space, the internalized DNA fragments may be involved in all repair systems described above where the presence of a damage-free homologous sequence is the necessary condition for the process. From a survey of the literary data and in the light of our concept, it follows that, if the blood bed of an organism exposed to a strong crosslinking mutagen contained DNA fragments with homology to the host genomic sequences, the fragments would be used as substrate for homologous recombination in repair of DNA damage induced by cytostatic agent. With this possibility in mind, a preparation of fragmented human DNA and an alkylating cyclophosphamide (CP) were administered to mice. Molecular genetic analysis of genomic DNA from treated mice revealed human DNA fragments integrated into the host genome.

II. Materials and methods A. DNA sources and probe pre-treatment Human DNA was isolated from placenta of healthy women in childbirth in two maternity wards in Novosibirsk. This material had the required sanitary-regulatory documents for the out-patient clinics for serological confirmation that they were negative for HIV, hepatitis B and C, syphilis. The isolated DNA was certified and PCR diagnosed for the HIV, hepatitis B and C causative agents. Again, the results were negative. Mouse DNA was isolated from liver, spleen, and thymus of CBA mice bred at the animal facility of this Institute. Full-size genomic DNA was disintegrated hydrodynamically using the sonic disintegrator unit UZDN-37 (Russia) down to fragments of 600-6000 bp for further injections to CBA mice (Figure 1).

B. Experimental design for cyclophosphane treatment Cyclophosphane (CP) was injected i.v. to CBA male mice (n=20) at 200 mg/kg body weight. One group (n=10) was administered i.p. 1 mg of human DNA 30 min before CP injection, 0.5 mg portion of DNA was administered 30 min after CP injection, this was followed by administration of the same DNA amounts on days 2 and 3. The controls (n=10) received saline.

186

Gene Therapy and Molecular Biology Vol 11, page 187 hybridization bands cut out from membrane filter) was determined using a 1209 RacBetta counter (Finland).

G. Calculations of the potential number of substitution sites for exogenous extrachromosomal DNA fragments in DNA ICL repair The mouse genome is ~2.5x109 bp = 2.5x106 kb. The human genome is 3.3x109 bp = 3.3x106 kb. The length of Alu-repeat is ~0.3 kb (Jurka, 2004). The number of Alu-repeats in the human genome is ~10% (Bogerd et al, 2006), or 106 copies of 0.3 kb monomer. The length of B1 repeat is ~0.15 kb (Kolchanov et al, 1988). The number of B1 repeats in the mouse genome is ~10%, or ~105 copies of 0.15 kb monomer. Alu elements occur every 3-4 kb. B1 repeats occur every 3 kb. A cross-linking agent at therapeutic doses induces 10002000 DNA ICLs per cell (Palom et al, 2000; Warren et al, 2001; Niedernhofer et al, 2004). Exogenous DNA fragments are 2-30 nucleosome units in size, this makes up ~0.5-6.0 kb (3.0 kb on average). When 1000-2000 !g of DNA, which corresponds to 50100 !g of the preparation per 1 g of body weight, is administered to mice (~20 g), the nuclear extrachromosomal space of the proliferating cells can harbor up to 2% (of the haploid genome) of exogenous DNA fragments (Rogachev et al, 2006). Thus, the nuclear space can contain at the same time of the order of 2000 Alu-monomers in DNA fragments of 3.0 kb on average. CP plus a preparation of fragmented human DNA were administered to mice. In the treated mice, CP through its phosphoramide mustard metabolite forms cross-links in the DNA molecule, concomitantly blocking replication fork. In the arisen recombinogenic situation, with stalled replication fork and activated incision enzyme system, homologous sequence for homologous exchange repair all must be available for repair to be sufficient. We suggested that Alu-monomers of human exogenous DNA by virtue of their high homology to the mouse genome B1 structures, would complete homologous exchange repair at the expense of regions homologous to B1 repeats. An expected consequence would be integration of exogenous foreign DNA into the mouse host genome. B1 repeats are spaced every 3 kb in the genome, the number of cross-links induced in the nucleus being 1000-2000. About 20,000 Alu-monomers distributed among ~3.0 kb fragments are present in the interchromosomal space. This means that the number of sequences potentially capable of substitution exceeds 10-fold that of the available substitution sites. The probability for homologous substitution of B1 repeat by Alu-monomer is calculated as P = [exchange region length – B1 repeat length]/[average period (distance between B1 repeats)]. This yields [3.0 – 0.15]/3.0 = 0.95, i.e. 95%

Figure 1. Electrophoretic characteristics of exogenous therapeutic human placenta DNA administered i.p. to mice. M, molecular weight marker lambda DNA-BssT1I digest.

C. Blood collection for counts in treated mice To prepare smears, blood was withdrawn from the tail vein of each mouse before CP injection, also 4, 7, 10, 14, 17 days after it. The treated and control groups consisted of 10 mice each. Calculations for the leucogram were standard (Menshikov VV, 1987).

D. PCR amplification Thermocycling conditions for amplification of human genome specific fragments were as follows: 94 ºC for 2 min, 1 cycle; (94 ºC for 30 sec, 72 ºC for 1 min), 33 cycles; storage at 4 ºC. The following approach was used to identify the minor fragments of human origin in the treated mice genomes. The minor human templates for the treated mice genomes were first amplified in the presence of a specific primer. Then, the obtained material was amplified in the presence of two specific primers under the indicated thermocyclic conditions in another PCR round. This approach allowed us to detect human DNA fragments in the genomes of treated mice No 1 and No 8. The human genome specific primers used were as follows: Pr.9 CGAGGCGGGAGGATCACTTGAGCCC (25) Pr.10 CGGCTCACTGCAGCCTCGACCTCCC (25) Pr.11 GCGCGCGCCACCACGCCCGGC (21) Amplification was performed using the Tertsik DNAtechnology equipment (Russia).

E. Sequencing PCR fragments

H. Estimation of the number of genomes in treated tissue cells containing X-Alu homologous sequences based on absolute counts of labeled material in dots

PCR fragments were sequenced at the Interinstitute DNA Sequencing Center, Siberian Department of the Russian Academy of Sciences. Big Dye 3.1 (Applied Biosystems, USA) was used to sequence DNA fragments.

DNA from treated and control mice in amounts indicated below was dotted onto Hibond N membrane (Amersham) and hybridized to a "-32P labeled X-Alu DNA fragment. Absolute counts of labeled material in dots (cpm)

F. Southern-blot-dot hybridization Southern-blot-dot hybridization was performed as described by Maniatis et al (1982) at 68ºC under stringent conditions. The membrane was washed with 0.1xSSC containing 0.1% SDS The amount of labeled material (spots and

187

Likhacheva et al: Integration of human DNA into the mouse genome

ng X-Alu SS Nonspecific background CBA Specific background hDNA Mouse No 1 Mouse No 8

0.1 55

0.5 79

1.0 135

250

500

1000

5000

105 not above specific background 42

165

233

291

467

Spleen, ~3x108 nucleus-containing cells. Spleen colony, a derivative of blood stem cell, contains 10x6 cells. Thus, the total cell number is 23.5x108, spleen colonies constitute 0.04% of this number.

To obtain counts for moderate hybridization zones, we chose spots in which the amount of applied DNA did not exceed the resolving capacity of Hibond N membrane. Counts per minute (cpm) were determined in dots of the two treated mice after subtraction of the average specific background, it was at the background level for mouse No 1, some cpms above or equal to the average specific background for mouse No 8. The method was not sensitive enough to accurately define the ratio of the applied DNA quantity to cpms per dot. For this reason and relying on the Southern blotting, we estimated copy number of X-Alu monomers in the genomes of the treated mice. Four X-Alu monomers, one or several copies per haploid genome, were determined for mouse No 8, less than a single copy per haploid genome for mouse No 1. 1. Count for the 0.1 ng X-Alu containing dot is the same as that for the 10 ng human DNA containing a dot. Consequently, the human genome contains ~ 1% of human XAlu fragments. 2. The dot, which contains 5000 ng of DNA from mouse No 8, is virtually not above the specific background level, its count is 50-fold smaller than that for the dot containing 0.1 ng XAlu DNA or 10 ng human DNA, i.e. 0.00004% of the human XAlu fragments are present in the genome of the treated mouse. 3. The human haploid genome contains about 3.3x109 bp DNA, 1% X-Alu about 300 bp long amounts to 105 copies per haploid genome. 4. The mouse genome is of about 2.5x109 bp, a little shorter than the human genome. For simplicity, we consider the genomes of equal lengths in both organisms, if 1% of the haploid genome contained 105copies of X-Alu monomer, it would be present in about 4 copies in the genome of mouse No 8. This means that monomer X-Alu is present in at least 4 (a single or several) copies in the single cell genome. Count is 5-6-fold less for treated mouse No 1 than for mouse No 8, so that copy number is smaller than a single copy per haploid genome. Taking into account the possible clusterisation of X-Alu monomers into a block and the existence of several integration sites, less than 1 cell in the three treated organs of the two mice contains X-Alu monomers. Thus, several kbs of foreign human DNA homologous to Alu-repeats may be present in the host genomes of the treated mice. At the same time X-Alu repeats are limited by the restriction sites BamHI, HindIII or BamHI-HindIII, as follows from the genomic blot analysis. The following parameters must be defined to estimate the possible variants of exogenous DNA integration. The number of cells in organs from which DNA was isolated. Liver, 1.0 mg, 106 cells. Average liver weight is 2 g. Total cell number is 2x109. Thymus, 5-6x107 cells.

III. Results A. Effect of fragmented DNA on recovery of the hemopoietic function by marrow cells in mice. Blood count (hemogram). Treated mouse survival A characteristic response of white blood to CP was severe leucopenia 4 days after treatment. The pattern remained virtually unaltered after combined treatment with CP and fragmented human DNA. The recovery course of leucocytes in the groups treated with CP alone or CP + human DNA was somewhat different 7 days after treatment. Their common feature was prominent leucocytosis with the appearance of juvenile types of the granulocyte series, juvenile and rod neutrophils (the two are united under the rod neutrophil heading in the table). Cells of the granulocyte series became prevalent. By day 7, in the treated group, mature granulocytes appeared and the initial proportions between corpuscular elements in the blood recovered faster than in the control group whose recovery lagged behind up to day 14. Both groups recovered their initial blood counts by day 17. The comparative data for each granulocyte type are given in Tables 1, 2, 3, 4, also in Figure 2. The following observations are of importance. Mice No 5, 7, 9 of the CP + human DNA treated group died on days 6 and 7 (they are highlighted in green in Tables 1-3). The causes of their death are unclear; moreover, their initial blood counts were normal. In mice No 1 and No 8 (highlighted in blue), granulocytes were prevalent, even 14 days after CP injection, while their counts became normal in all the other mice. Mice No 1 and 8 of the treated group showed obvious evidence of disease by day 17. They were sacrificed on day 18, their DNAs was isolated. Another two mice of the treated group (No 2 and 10) died 24 and 45 days after the experiment onset. The remaining three (No 3, 4, 6 of the treated group) were sacrificed on day 56 for isolation and analysis of their DNAs, one of them was ill by that time.

188

Gene Therapy and Molecular Biology Vol 11, page 189 Table 1. Proportions of corpuscular elements in the blood of mice treated with cyclophosphan alone and in combination with human DNA.

Preparation

Corpuscular elements in the blood (%)

Mouse No Rod

CP 1 day before injection

CP + human DNA 1 day before injection

CP day 4

CP + human DNA day 4

CP day 7

CP + human DNA day 7

1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8

Segmented

Eosinophils

Monocytes

Lymphocytes

2.7 5.6 5.6 7.4 5.0 5.0 5.8 2.5 5.4 2.6 0 3 7 2 9 0 2 5 2 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10.2 8.0 9.5 14.6 14.7 17.8 14.6 20.0 14.0 25.0 37.8 29.7 14.0 14.5

47.7 43.0 49.0 34.6 42.4 40.0 31.2 32.0 46.4 51.8 51 55 38 49 57 70 56 40 61 74 2 0 0 3 13 6 0 1 5 2 2 1 3 0 9 0 1 1 7 0 34.6 45.7 35.3 34.4 26.8 34.6 34.4 54.0 51.0 48.0 40.3 39.7 54.0 28.5

3.7 1.3 3.4 5.0 4.8 3.0 1.5 4.3 2.6 0.6 5 3 2 7 5 6 2 2 1 1 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

6.3 10.5 9.0 13.6 11.2 13.0 11.0 14.0 12.4 20.4 6 7 18 7 4 8 10 8 7 13 12 15 13 13 14 8 2 2 9 10 2 4 4 0 0 5 3 1 7 7 48.6 46.7 47.5 43.0 45.2 42.4 47.4 15.0 25.0 5.0 18.0 22.0 26.3 53.2

39.7 19.8 31.6 43.8 36.2 38.8 34.5 29.8 34.6 24.2 38 32 35 35 25 17 30 45 29 46 84 85 87 84 71 83 98 98 86 88 96 95 93 100 91 95 96 97 86 93 5.6 5.0 6.0 7.6 5.5 5.0 3.2 10.0 10.0 22.0 2.5 8.0 3.3 3.7

15.7

48.5

54.2

4.0

15.3

41.0

37.0

6.0

189

Likhacheva et al: Integration of human DNA into the mouse genome

CP day 10

CP + human DNA day 10

CP day 14

CP + human DNA day 14

CP day 17

CP + human DNA day 17

9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10

37.7 13.7 18.3 10.0 16.5 18.0 12.0 9.5 24.0 19.0 20.0 4.0 3.0 17.0 11.5

37.8 53.7 66.7 57.5 56.5 49.0 64.0 66.0 64.0 59.0 52.0 76.5 65.0 59.5 45.0

0 0.3 0.3 0 0 0.5 0.5 1.0 0 0 1.0 0 0 0 0

54.8 24.7 5.7 25.5 0.2 0.2 0.2 17.0 5.5 16.0 14.0 11.0 24.0 14.5 21.5

9.0 9.0 8.7 6.0 6.5 12.5 8.0 5.0 6.5 9.0 7.0 9.0 70 6.5 22.0

5.3

68.0

21.7

6.3

8.0

72.0

6.0

7.5 41 17 14 27.5 21 14 26 13 17 18 1 4 5 11

47.5 20 39 30 31 27 42 38 33 38 26 85 57 49 55

1,0 11 5 8 6 7 9 7 7 6 11 3 8 6 0

17.5 19 28 30 24.5 32 19 12 23 19 19 9 18 31 14

27.5 8 12 18 11 13 16 16 24 20 26 2 15 9 17

8 15 11 15 25 8 24 22 25 12 12 2 3 13 9

42 29 38 43 43 47 37 32 36 30 48 87 52 43 51

7 5 5.5 6 4 7 12 15 8 11 8 0 13 1 7

27 31 33.5 24 17 16 13 15 9 20 15 9 13 27 19

16 20 11 12 10 22 11 16 21 24 17 2 18 17 13

190

Gene Therapy and Molecular Biology Vol 11, page 191 Table 2. Dynamics of the number of rod neutrophils during 17 days after treatment with CP alone or in combination with human DNA Rod (immature) and juvenile neutrophils (%) Preparation

CP + human DNA

Mouse No 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10

1 day before CP injection 2.7 5.6 5.6 7.4 5.0 5.0 5.8 2.5 5.4 2.6 0 3.0 7.0 2.0 9.0 0 2.0 5.0 2.0 6.0

day 4

day 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

day 10

day 14

day 17

10.2 8.0 9.5 14.6 14.7 17.8 14.6 20.0 14.0 25.0 37.8 29.7 14.0 14.5

13.7 18.3 10.0 16.5 18.0 12.0 9.5 24.0 19.0 20.0 4.0 3.0 17.0 11.5

21.0 17.0 14.0 27.5 21.0 14.0 26.0 13.0 17.0 18.0 1.0 4.0 5.0 11.0

15 11 15 25 8 24 22 25 12 12 2 3 13 9

15.7

5.3

6.0

15.3

8.0

37.7

7.5

8.0

Table 3. Dynamics of the number of segmented neutrophils during 17 days after treatment with CP alone or in combination with human DNA Segmented neutrophils (%) Preparation

CP + human DNA

Mouse No 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10

1 day before CP injection 47.7 43.0 49.0 34.6 42.4 40.0 31.2 32.0 46.4 51.8 51.0 55.0 38.0 49.0 57.0 70.0 56.0 40.0 61.0 74.0

day 4

day 7 2 0 0 3 13 6 0 1 5 2 2 1 3 0 9 0 1 1 7 0

191

day 10

day 14

day 17

34.6 45.7 35.3 34.4 26.8 34.6 34.4 54.0 51.0 48.0 40.3 39.7 54.0 28.5

53.7 66.7 57.5 56.5 49.0 64.0 66.0 64.0 59.0 52.0 76.5 65.0 59.5 45.0

20 39 30 31 27 42 38 33 38 26 85 57 49 55

29 38 43 43 47 37 32 36 30 48 87 52 43 51

48.5

68.0

41.0

72.0

37.8

47.5

Likhacheva et al: Integration of human DNA into the mouse genome Table 4. Changes in the number of the corpuscular elements of granulocyte series in the blood after treatment of mice with CP plus human DNA Preparation

CP + human DNA

Days 1 day before CP injection day 4 day 7 day 10 day 14 day 17 1 day before CP injection day 4 day 7 day 10 day 14 day 17

Rod neutrophils, %

Segmented neutrophils, %

Total number of granulocytes, %

47.0

41.8

49.6

0 14.8 14.3 20.8 16.9

3.2 39.9 59.8 32.4 38.3

3.6 59.7 74.5 53.3 55.2

3.6

55.1

62.1

0 23.5 8.1 6.1 6.5

2.4 41.4 61.9 53.0 53.3

2.5 64.9 70.1 60.0 60.6

Figure 2. Graphical representation of the relative proportions and dynamics of groups of corpuscular elements in the blood after injection of cyclophosphan (CP) alone or in combination with human DNA administration. (A) Relative change in the number of segmented neutrophils after treatment with CP alone or with CP plus human DNA. (B) Relative change in the number of rod (immature) neutrophils after CP i.v. injection alone or CP plus human DNA. (!) Relative number of granulocytes after treatment with CP alone or in combination with human DNA, the values are averages for all mice.

A single mouse of the control group died during the observation period. Thus, survival was 20% in the treated group and 80% in the control. The combined effect of human DNA preparation plus cytostatic CP suggested uncoupling of the cause-effect mechanism in the

physiological systems of treated mice. We assumed that the detected impairment was due to drastic changes in the genetic information in the chromosomes of the treated mice brought about by integration of the foreign DNA fragments. 192

Gene Therapy and Molecular Biology Vol 11, page 193 program. Based on the search, we chose those primers that did not form theoretically PCR products with the mouse genomes, yet definitely yielded them with the human genome. It proved that the actual PCR banding pattern did not conform to the one derived from computer analysis. In all the combinations of all the human specific primers, distinct bands were detected in the mouse genome. PCR of DNA from the treated mice using primers for the classical Alu did not allow us to reliably identify human DNA sequence integrated into the mouse genome. There were prominent major bands, the hallmark features of both the control and treated mice (Figure 4A). What if the sequences of the chosen human primers could pair with the homologous regions in the mouse genomes that eluded detection by the applied UCSC In-Silico PCR program? If this were the case, under standard PCR conditions, they would be conferred quantitative competitive advantage relative to the scanty human DNA sequences despite their identity to the primers. To exclude this possibility, PCR amplification was carried out under stringent conditions using a single primer (after having analyzed all the synthesized primers), see Materials and Methods section. We proceeded on the assumption that the primer completely homologous to a particular human sequence would pair with precisely this sequence and would synthesize the PCR product bounded at one end by a

B. Choice of primers for the detection of human DNA fragments integrated into the mouse genome In analysis of human DNA integration into the genome of treated mice, we used a moderately repetitive human Alu-sequence, making up to 10% of the total human DNA. The mouse genome harbors moderate B1 repeats that are highly similar to human Alu, consensus sequences Alu and B1 share about 65% homology. The structure of most human Alu-repeats is dimeric, they are about 290 bp long. In contrast, B1 repeats in the mouse genome are predominantly monomers about 130 bp in length (Kolchanov et al, 1988; Britten et al, 1988). Alignments of Alu-repeat and dimer B1 sequences show that deleted regions or regions without homology occur on the background of high homology. To construct primers specific to Alu-repeat, we chose precisely these regions in such a way that the 3â&#x20AC;&#x2122; end of the primer fell within a region lacking homology in B1 repeat structure. Furthermore, primers (see Materials and Methods section and Figure 3A) were deliberately chosen so that one member of the primer pair fell within one half of Alu, the other within its other half, i.e. PCR using the primers for an individual monomer B1 repeat was made impractical. Analysis of the possible PCR products in the two genomes was performed using the UCSC In-Silico PCR

Figure 3. (A) Alignment of consensusi of human repetitive sequence and mouse B1. (B) A sequence of the X-Alu fragment. Arrows and boldface type highlight the primers used in PCR.

193

Likhacheva et al: Integration of human DNA into the mouse genome

Figure 4. PCR of genomic DNA from treated mice for the presence of human DNA sequences. (A) PCR of genomic DNA in treated mice for the presence of specific DNA fragments with the same mobility as in the PCR products yielded by PCR analysis of the human genome. Left block, electrophoretic separation of the PCR fragments from treated and control mice. Right block, Southern blot hybridization of the same gel to the 32P labeled X-Alu fragment DNA. (B) Rehybridization of positive samples of specific fragments (280 bp for humans and the two mice) further used to determine the nucleotide sequences. Left block, electrophoretic separation of the PCR fragments; right block, Southern hybridization of the same gel to the 32P labeled X-Alu fragment DNA. Numbers on the left to the blocks (280 bp and 310 bp) indicate the fragments that correspond to the two major PCR products detected in the human genome. 1 through 15 are the numbers of the samples. Designations: CBA, host mouse strain; mice No 1 and No 8, treated mice; M, molecular weight markers (100 bp ladder); +hDNA, samples of DNA from mice treated with CP alone; +CP+hDNA, samples of mice treated with CP plus human DNA.

primer specific to human. With this strategy, the PCR material would become enriched in human sequences initially present in very small quantities. During the second PCR amplification round, this time with two primers, competition would not expel the fragments. Analysis of the PCR products allowed us to reliably identify the fragments with the same mobilities as those detected by PCR using the human genome DNA as a template. The specific DNA fragments were revealed in the genome of treated mice No 1 and 8 (Figure 4), their electrophoretic mobility was estimated as about 300 bp (280 bp and 310 bp, respectively). Because we knowingly

chose primers located in Alu-repeat sequence, there was reason for believing that the two major PCR fragments were two variants of the human genome Alu-repeat.

C. Hybridization and nucleotide analysis of PCR product sequences from the treated mouse genome The finding of fragments in the PCR product pattern from treated mice total DNA whose mobilities were the same as that of the major fragments in the PCR product pattern from total human DNA was encouraging. We performed blot hybridization using PCR of the labeled 194

Gene Therapy and Molecular Biology Vol 11, page 195 fragment, a major band in PCR with total human DNA 280 bp in size (Figure 4). Hybridization with the electrophoretically separated PCR products from all the treated mice demonstrated that only two PCR products of 280 bp and 310 bp in samples of genomic DNA from treated mice No 1 and 8 hybridized to a 280 bp fragment obtained in PCR with total human DNA. This was taken to mean that (i) the 280 bp and 310 bp fragments are highly homologous to each other, (ii) the human DNA appeared in the genomes of the two treated mice. Analysis of nucleotide sequence of the fragments yielded by PCR with total human DNA and the two mice (280 bp) established their complete identity (Figure 3). The sequences encompassing a region of about 150 bp almost entirely occupied the same position as a part of the consensus Alu-repeat. This was highly suggestive, either larger fragments might have integrated into the mouse genome or the chosen primers bounded the stretch directly belonging to the Alu-type repeats. The newly described fragments hereafter will be referred to as X-Alu. Screening of the experimentally produced sequences in the available databanks revealed complete homology to a region of human chromosome 16 (AC002400.1) and partial to numerous fragments of the human genome. Southern-blot hybridization of the labeled X-Alu fragment to human and treated mouse DNAs also revealed a large number of homologous fragments in the human genome. This was corroborative evidence for the similarity of the newly identified DNA fragment and the Alu-repeat family.

1) The treated mice indeed contain human DNA fragment(s) homologous to Alu-repeats in their genome. 2) The detected discrete bands evidence that the PCR and subsequent hybridization results are not artifactual. Were the human DNA samples contaminated, the strong hybridization pattern would be smeared like after hybridization to the total human DNA. This is not the case. 3) The number of integrated DNA for the two transgenic mice is different. We cannot explain why transfer onto membrane is nonuniform and focused. One reason is that integrated sequences are not simply present in all the cells, this produces uneven distribution of small DNA amounts throughout the agarose gel band and ultimately biases transfer and focusing. As follows from genome blot analysis, BamHI, HindIII or BamHI-HindIII restrictases set boundaries to X-Alu repeats and they appear as discrete fragments whose numbers are different in the two treated mice. Fragment size is estimated as about 2.2 kb for mouse No 1, mouse No 8 has three strongly hybridizing fragments of about 2.2 kb, 3.1 kb, 4.4 kb, two fragments of about 2.0 and 6.0 kb, respectively (Figure 5A). A series of quantitative dot blot hybridizations were undertaken to estimate the number of integrated DNA and thereby to settle the question whether or not all the cells of the treated mouse organs from which total DNA was isolated harbor the revealed human DNA. It proved that the estimated copy number of the X-Alu probe accounted for 1% of the genomic human DNA (of the order of 105 copies), less than a single copy per haploid genome for mouse No 1, ~4 (a single or a few) copies per haploid genome for mouse No 8 (Figure 5B, also see Materials and Methods section). It may be reasoned that, if monomers integrated as blocks, with several copies in a block and/or integration occurred at several sites of the genome in a cell, less than a single cell of the total cell number would contain integrated human DNA fragments. Molecular analysis of homologous X-Alu fragments cloned from the treated mouse genomes would assure us that we reasoned correctly. It should be noted that additional control experiments with either CP or a preparation of fragmented human DNA demonstrated no abnormalities. All mice survived, there was no experimental evidence for integration of the analyzed X-Alu target (Figure 4A).

D. Comparative Southern-blot analysis and estimation of copy number of the Alufragments in the human and treated mouse genomes It appeared expedient to determine the genomic disposition of the integrated DNA and to see how the two treated mice differed by integrated copy number from each other. Southern-blot hybridization of the treated mouse genomic DNA, the CBA mouse genomic DNA, the human genomic DNA was performed. Each of the DNAs was concomitantly digested with BamHI and HindIII restrictases, the digests were hybridized to a PCR labeled fragment synthesized from the DNA template of the human genome (280 bp). The hybridization pattern is shown in Figure 5A. Its hallmark features are as follows. i) despite the most stringent hybridization conditions chosen, the lane with human DNA shows strong hybridization along its entire length, this indicates that the human genome contains a great number of sequences homologous to the probe. ii) CBA mouse DNA is devoid of homologous sequences that hybridize to the X-Alu probe in the chosen conditions. iii) examination of the hybridization pattern yielded by the treated mouse genomic DNA allowed us to distinguish a set of discrete bands (BamHI, HindIII or BamHI-HindIII) for mouse No 8 and a single band for mouse No 1. The implications for the strong hybridization pattern are as follows.

IV. Discussion A. Integration of foreign DNA into the genome of somatic tissue cells in the adult Based on our earlier observations, we attempted here to obtain assurance that exogenous human DNA integrates into the mouse genome. Our previous work has shown that exogenous DNA affected the development of erythro- and myelopoiesis progenitors, thereby speeding up the recovery of white and red blood cell progenitors following exposure to the cytostatic agent (Yakubov et al, 2003; Nikolin et al, 2006). The important observations were

195

Likhacheva et al: Integration of human DNA into the mouse genome

Figure 5. (A) Southern-blot analysis of genomic DNA from treated mice No 1 and No 8 for the presence of human DNA sequences. M, molecular weight markers (lambda DNA-HindIII digest); 1-4, genomic DNA-BamHI+HindIII digests; m No 1, treated mouse No 1; m No 8, treated mouse No 8; CBA, host mouse strain. Left block, electropheretically separated DNA (lambda DNA-BamHI+HindIII digest). Right block, a genomic blot using the same gel after hybridization to the 32P labeled X-Alu fragment DNA. Arrows in the right block indicate the hybridizing fragments in the treated mouse genomes. (B) Determination of copy number for X-Alu human fragment in the genomes, human, Host CBA and treated mice. Hybridization was performed using 32P labeled X-Alu fragment DNA. The numbers above the blocks indicate DNA spotted onto the membrane. SS, salmon sperm; X-Alu, X-Alu fragment DNA; CBA, host mouse DNA; hDNA, human DNA; Mouse No 1, mouse No 8, treated mouse DNA.

196

Gene Therapy and Molecular Biology Vol 11, page 197 stimulation of the division of the stem blood cells exposed to cyclophosphan, as well as rescue (viability retention) of a considerable proportion of blood stem cells subjected to intense chemotherapy (Yakubov et al, 2003; Nikolin et al, 2006; Patent application No 2006127134, Russia). Based on previous considerations (Yakubov et al, 2002, 2003) and our research results, it has been suggested that, having entered the nuclei of the stem blood cells (and of any proliferating cells), exogenous DNA becomes involved in repair of DNA damage incurred by cytostatic agent. Based on the data on hemopoiesis stimulation under the effect of both allogenic and xenogenic DNAs (Yakubov et al, 2003; Nikolin et al, 2006), we also suggested that the DNA of taxomically close species can be involved in homologous exchange during repair of cytostatic induced DNA damage and, therefore, integrate into the host genome. We assume that, in the recombinogenic situation arising when replication fork is arrested, DSB form at the cross-link site, the excision repair system activated is crucial for the DNA integration (both local on the chromosome and extrachromosomal of allogenic and xenogenic origin). In this situation, the presence of exogenous DNA in somatic cell nuclei in animal tissues during injection of cytostatic agent is a requisite for designing experiments. The major criteria for the events that affected the state of the treated mice was the recovery rate of the hemopoietic function defined by changes in blood counts, their unexpected shift elicited by CP plus exogenous DNA cotreatment, and mouse general status. The pattern of changes in blood counts (Figure 2) supported the experimental results that demonstrated accelerated recovery of inhibited hemopoiesis under the effect of combined therapy with CP and fragmented human DNA preparation in all the treated mice. However, the unusually great increase in granulocyte number persisted in mice No 1 and 8. It is pertinent to note that neutrophilia may be caused by diseases associated with tissue disintegration or immune system stress (Roitberg and Strutynsky, 1999). Surprisingly, mice subjected to combined treatment started to succumb on day 6. The last one died on day 56. Mice phenotypically manifested a different sets of symptoms. It appeared likely that the very dramatic consequences were caused by integration of the foreign DNA into the treated mouse genome. It appeared likely also that the beneficial effect of xenogenous exogenous DNA on the inhibited white blood cell progenitors was not due to homologous substitution of the chromatin regions under the impact of cyclophosphan. In fact, integration of foreign DNA is lethal to the host. Regrettably, post mortem studies were not performed because the dramatic events were unpredictable. Liver, spleen and thymus were excised for extraction of DNA and its subsequent analysis from all the dead mice. The Alu-sequence was chosen to determine whether human DNA integration is possible.

B. Molecular characteristics of integrated sequences homologous to the human Alurepeats In choice of the Alu-repeats for analysis, we reasoned as follows. As known, Alu-elements comprise up to 10% of the haploid genome, this corresponds to about 106 copies of 300 bp Alu monomers. The human Alurepeats are scattered throughout the genome forming clusters, occurring every 3-4 kb on average. The structure of most human Alu-repeats is dimeric. A number of tetrameric sequences and the monomeric repeats in single instances were identified. Structurally similar to Alurepeats were found to be present in the mouse genome. They were called B1 and are almost always monomers (Britten et al, 1988; Kolchanov et al, 1988). The homology degree between the B1 and Alu-repeats is higher, their consensus sequences being up to 65% identical. The percent can be as high as 90% for the real monomers. The mouse B1 repeats are organized similarly to the Alurepeats in the genome. Fragments of exogenous extrachromosomal DNA that represent up to 2% of the haploid genome can accumulate in the nuclear space of the cell (Rogachev et al, 2006), consequently, about 20,000 copies of the Alu monomers can be present in the genomic fragments of about 3 kb on average in the cell nuclei of mice treated with exogenous DNA. The cytostatic agents at doses used in chemotherapy and research induce of the order of 1000-2000 cross-links per nucleus (Palom et al, 2000; Warren et al, 2001). Like Alu, the B1 repeats occur every 3 kb in the mouse genome, it follows from calculation that the probability of a homologous substitution between two similar repeats is over 95% (see Materials and Methods section). This means that a cross-link is present in virtually each cell in the B1 repeat or in its vicinity, that it can induce exchange with an Alu-sequence of extrachromosomal origin. In the case of damage that affects genomic repetitive sequences in the genome, numerous potential homologous regions in its most different parts can be recruited for homologous repair of the damage, if the repair requires homologous exchange. When a DSB caused by a stalled replication fork occurs in a homologous region, variants of repair may be envisioned. One is gene conversion whereby DNA is nonreciprocally transferred from donor to host, with the damaged allele being, as a rule, the host. Another variant is pairing of a single strand followed by synthesis and migration of the strand without an associated crossing over (Langston and Symington, 2004; Leung et al, 1997; Bartsch et al, 2000; Nickoloff, 2002). Provided that the extrachromosomal fragment is long enough and that linear sequences, which flank the damage homologous to the fragment ends, are present in the genome, the fragment can completely repair the damaged locus by double reciprocal exchange through the described mechanism (Hastings et al, 1993; Leung et al, 1997; Li et at al, 2001; Yakubov et al, 2003; Langston and Symington, 2004). The central portion of the sequence, which forms by its end regions two heteroduplexes with the homologous chromosome regions, integrates into the host genome without inducing any changes, by just replacing the 197

Likhacheva et al: Integration of human DNA into the mouse genome chromosome region bounded by two repaired end regions. In DSB homologous repair, the nucleus can contain numerous homologous sequences, for example, repeated genomic, in such a case, vicinity to the homologous exchange site and homology degree are the two important factors that affect the choice of the appropriate homologous segment (Schildkraut et al, 2006). It has been suggested that the large number of Alucontaining fragments in the nuclear space of mouse cells and the high homology between human Alu and mouse B1 repeats would enable them to pair with each other and be involved in homologous pairing. Thymus, liver and spleen from treated mice were used to isolate DNA in the conducted experiments. Analysis of the X-Alu copy number in the two positive mice established that it was less than a single copy for mouse No 1 and about 4 (a single â&#x20AC;&#x201C; a few) copies for mouse No 8 per haploid genome. This meant that only a part (under the assumption that the X-Alu monomers integrated as blocks and/or at a number of genomic sites in the cell for mouse No 8 and without this assumption for mouse No 1) of all the cells of the chosen tissues may contain integrated X-Alu copies. If the cell received several monomer copies, or in the case of X-Alu monomer clusterization, the portion of cells containing foreign sequences integrated into the genome would be still smaller. Analysis of the strong hybridization patterns made apparent the following characteristics of #-Alu containing human DNAs that integrated into the genome. 1) The relation between the estimated number of copies and detected bands, as well as the experimental data on the organization of the Alu and B1 repeats in the genome, evidence that in both mice presumably only a part of cells from which DNA was isolated contain homologous X-Alu sequences. The important finding was the integration of several different X-Alu monomercontaining fragments. 2) It appeared unlikely that exogenous DNA fragments integrated into a unique site in the different cells. Accepting multiple integration, the detection of individual fragments that contained sequences homologous to X-Alu may be explained as follows. Integration occurred at different sites of the genomic regions showing homology to the X-Alu sequence. The integrated fragments were of different lengths, not shorter than about 2 kb. The integrated fragments harbored a single X-Alu repeat or a monomer cluster bounded by BamHI, HindIII or BamHI-HindIII restrictases. Digestion with these restrictases liberated the same monomer or cluster of monomers, regardless of their location and number in the host genome. The fragment was of ~2.2 kb for mouse No 1, fragments were about 2.0, 2.2, 3.1, 4.0, 6.0 kb for mouse No 8. It is inexplicable why only the fragments containing homologous X-Alu sequences integrated into the genomes of treated mice. However, the difference in the number and distribution of the X-Alu repeats among the genomic fragments of the two treated mice evidence for individual specificity in integration in the given experimental conditions.

3) The size of the integrated fragments containing X-Alu cluster was in the 2 â&#x20AC;&#x201C; 6 kb range. This meant that a long homologous region was required for integration in the form of gene conversion or that a mechanism of double reciprocal exchange of paired end regions of the fragment. 4) The rest of the succumbed mice, as well as those of the other experimental series (a single injection of CP and/or human DNA, 30 mice), did not contain integrated X-Alu sequences. However, their death during the long experiment suggested that fragments of exogenous human DNA also integrated into the genomes of these mice whose sequences represented different parts of the human genome that discriminated homologous regions in the genomes of the treated mice. There exists another possibility, integration in several brain marrow stem blood cells whose survived offspring gave rise to individual colonies in spleen. Precisely these colonies consisted of cloned cells into which individual fragments integrated. It was expected that the fragment would integrate at a single site of the genome defined by a parental blood stem cell. Estimates of copy number for XAlu monomers in the genomes of treated mice in the case of their possible clusterization of X-Alu monomers are consistent with our vision of the events. The estimates were not less than a single â&#x20AC;&#x201C; a few copies per haploid genome; cell number in the spleen colony was estimated as 0.04% of the total number of treated cells, with the total number of spleen colonies being up to 40.

C. Events possibly due to exogenous DNA integration into the genome in treatment with CP plus exogenous DNA preparation The question was: How transgenesis might have occurred in the tissue cells of adult mice given the crosslink inducer CP in combination with fragments of exogenous extracellular foreign DNA? Numerous recent studies have shown that the appearance of ICLs in proliferating cells is associated with arrest of the replication fork encountering steric hindrance. This event enhances repair with the result that an extremely recombinogenic structure forms at the cross-link site. The consequences are manifold: DSB formation in the newly synthesized strand in the immediate vicinity to the crosslink site, replication fork arrest, the generation of a single strand region from 70 bp (Mu et al, 2000) to 700 bp (Sinden and Cole, 1978) through the activity of the XRCC1-XPF-RPA complex. The two structures form sequentially at the individual ISL site. There presumably exists a time when they are present together. A number of models for repair of arisen DNA damage have been described, they all incorporate excision exonuclease activity of the XRCC1-XPF-RPA complex followed by homologous recombination (De Silva et al, 2000; Niedernhofer et al, 2004). In the case of generation of such a structure, foreign extrachromosomal DNA has presumably the opportunity for integration into the recombination site by the same mechanism (Kucherlapati et al, 1984) or repair via homologous recombination with the sister chromatid (Niedernhofer et al, 2004). Two DNA damages are obviously required for repair. In the 198

Gene Therapy and Molecular Biology Vol 11, page 199 conceived version of events, any one of the known repair mechanisms of the DNA strand is possibly feasible (Thomas et al, 1986; Van Houten et al, 1986; Hastings et al, 1993; Rouet et al, 1994; Jasin, 1996; Liang et al, 1998; Leung et al, 1997; Bartsch et al, 2000; Li et at al, 2001; Nickoloff, 2002; Yakubov et al, 2003; Langston and Symington, 2004). However, the ultimate necessary condition is repair by homologous exchange between the damaged region and the homologous sequence internalized within the nuclear space. It may be assumed that ICL occurred between two B1 repeats. Our search for homologous sequence for repair of the ICL break induced by the stalled replication fork was successful: the fragment containing Alu-repeat or its clusters within the 2 â&#x20AC;&#x201C; 6 kb fragments seen in the genomic blot paired with its end monomers to the B1 sequences. Further, the intermediate is resolved with integration of the entire fragment into the host genome by the mechanism as previously described (Li et al, 2001). This is the reason why the regions of human DNA integrated into the mouse genome are rather long. Retroposition of integrated into the mouse genome Alu-repeats, which was induced by the genotoxic stressor etoposide, has been observed; by blocking topoisomerase II, etoposide resulted in DSBs and global activation of all repair mechanisms (Hagan et al, 2003). We do not exclude the possible triggering of the retrotransposition mechanism for fragments with the XAlu sequences and the promoter region for RNA polymerase III, moreover that the described transposition phenomenon has been observed for a mouse-human system virtually identical to ours, thereby indicating that there exists an enzymic system in mouse cell capable of transposing human Alu-sequences. However, the fact of cluster retransposition of Alurepeats has not been established as yet, moreover using extrachromosomal fragments as a template. Single copies of the repeats integrate into the target site by the reverse transposition mechanism, involving RNA synthesis, reverse RNA synthesis, transposition of newly synthesized DNA copies to the target site. First, a copy of Alu-element within the host genome is requisite for the process; second, site-specific integration requires specific endonuclease-reverse transcriptase, a DSB-inducing enzyme that directly accomplishes integration and repair of the DNA Alu-copy. To our knowledge, there has been no reference to the presence of this enzyme during events associated with ICL repair in the available literature. Finally, genomic hybridization failed to reveal distinct hybridization band during site-specific Alu retransposition into the nuclear space of the treated mice and also in the case of contamination of the samples with human DNA. This was because the integrated Alu-repeat did not contain sites for the chosen restrictases statically distributed throughout the genome. Hence, a united restriction fragment could not appear in random transposition of different cells into different genomic restriction fragments. In summary, then, we believe that in the current experiments a CP-mediated in vivo transgenic somatic transformation by fragments of exogenous foreign DNA occurred in adult mice.

D. Envisioned therapeutic application of the revealed DNA integration and of its consequences The factual evidence of the integration of exogenous DNA fragments into the eukaryotic genomes in a recombinogenic situation generated by a cytostatic crosslinking anticancer agent is thought-provoking. There appear to be unprecedented opportunities to develop a new approach to treatment of cancer and variety diseases in genetically damaged cells (Patent application No 2006127134, Russia). The repair system of cell promptly becomes active in response to the multiple ICLs induced by anticancer drugs. The choice of the cytostatic is tailored in such way that each cell receives a cytostatic shock (about 2 000 ICLs per cell) deadly to the cancer and other proliferating cells. Cells die presumably because i) they cannot cope to form at the same time sufficient amounts of repair complexes so that a part of the incurred damage remains unheeded, triggering apoptosis; ii) when a homologous chromosome or a sister chromatid serves as substrate for homologous recombination of a homologous chromosome, multiple ICLs pose steric hindrance to simultaneous synapsis of several damaged sites with homologous regions. This is another obstacle to complete repair of all the arisen ICLs with inevitable apoptotic cell death; iii) the last, not the least important, cause of cell death is that the genetic mode of the cell remains the same as before ICL induction, when a homolog or a sister chromatid is used for homologous recombination repair, i.e., if the cytostatic diadduct arose in the region of the gene whose mutation caused cell malignization, repair using endogenous cell substrate would not bring about beneficial genetic change in the mutated gene. If the genome harbored oncomutations, it would continue to do so despite this repair. The only way to get rid of such oncomutations is to kill the cancer cells and, with one stroke, all the other proliferating cells. Cytostatic drugs do this job well. It is suggested that fragments of exogenous allogenic DNA would be involved in repair culmination when all the cross-linked DNA strands are restored. A favorable circumstance is that up to 2% of the haploid genome of extracellular DNA can be present in the nuclear interchromosomal space as fragments of size commensurate with that of DNA fragments resulting from normal apoptosis (Rogachev et al, 2006). The extremely recombinogenic situation engendered by ICL induction and replication fork stalling makes the recombination machineries of the cell highly active. If DNA fragments homologous to the repaired site and serving as substrate for homologous recombination were present at that time in the nucleus, recombination would surely take place, not with the defective endogenous homolog, but with the mutation-free exogenous therapeutic DNA. The newly integrated sequence would become fixed as a result of successive cell divisions, and the oncomutation would be resolved.

199

Likhacheva et al: Integration of human DNA into the mouse genome De Silva IU, McHugh PJ, Clingen PH, Hartley JA (2000) Defining the roles of nucleotide excision repair and recombination in the repair of DNA interstrand cross-links in mammalian cells. Mol Cell Biol 20, 7980-7990. Evans E, Fellows J, Coffer A, Wood RD (1997) Open complex formation around a lesion during nucleotide excision repair provides a structure for cleavage by human XPG protein. EMBO J 16, 625-638. Friedberg EC, Walker GC, Siede W (1995) DNA repair and mutagenesis. Washington, DC: ASM Press. Hagan CR, Sheffield RF, Rudin CM (2003) Human Alu element retrotransposition induced by genotoxic stress. Nat Genet 35, 219-220. Harrington JJ, Lieber MR (1994) Functional domains within FEN-1 and RAD2 define a family of structure-specific endonucleases: implications for nucleotide excision repair. Genes Dev 8, 1344-1355. Hastings PJ, McGill C, Shafer B, Strathern JN (1993) Ends-In vs. ends-out recombination in yeast. Genetics 135, 973-980. Hoeijmakers JH, Egly JM, Vermeulen W (1996) TFIIH: a key component in multiple DNA transactions. Curr Opin Genet Dev 6, 26-33. Jachymczyk WJ, von Borstel RC, Mowat MR, Hastings PJ (1981) Repair of interstrand cross-links in DNA of Saccharomyces cerevisiae requires two systems for DNA repair: the RAD3 system and the RAD51 system. Mol Gen Genet 182, 196-205. Jasin M (1996) Genetic manipulation of genomes with rarecutting endonucleases. Trends Genet 12, 224-228. Jurka J. (2004) Evolutionary impact of human Alu repetitive elements. Curr Opin Genet Dev 14, 603-608. Karle P, Renner M, Salmons B, Gunzburg WH (2001) Necrotic, rather than apoptotic, cell death caused by cytochrome P450activated ifosfamide. Cancer Gene Ther 8, 220-230. Kolchanov NA, Shahmuradov IA, Kapitonov VV, Omelyanchuk LV (1988) Evolutionary aspects of the mammalia Alu repeats. Mol Biol 22, 1335-1344. Kucherlapati RS, Eves EM, Song K-Y, Morse BS, Smithies O (1984) Homologous recombination between plasmids in mammalian cells can be enhanced by treatment of input DNA. Proc Natl Acad Sci USA 81, 3153-3157. Laboratory methods of study in the clinics. Editor Menshikov VV.$ (1987). Lambert S, Watson A, Sheedy DM, Martin B, Carr AM (2005) Gross chromosomal rearrangements and elevated recombination at an inducible site-specific replication fork barrier. Cell 121, 689-702. Langston LD, Symington LS (2004) Gene targeting in yeast is initiated by two independent strand invasions. Proc Natl Acad Sci USA 101, 15392-15397. Leung W, Malkova A, Haber JE (1997) Gene targeting by linear duplex DNA frequently occurs by assimilation of a single strand that is subject to preferential mismatch correction. Proc Natl Acad Sci USA 94, 6851-6856. Li J, Read LR, Baker MD (2001) The mechanism of mammalian gene replacement is consistent with the formation of long regions of heteroduplex DNA associated with two crossingover events. Mol Cell Biol 21, 501-510. Li L, Peterson CA, Lu X, Wei P, Legerski RJ (1999) Interstrand cross-links induce DNA synthesis in damaged and undamaged plasmids in mammalian cell extracts. Mol Cell Biol 19, 5619-5630. Liang F, Han M, Romanienko PJ, Jasin M (1998) Homologydirected repair is a major double-strand break repair pathway in mammalian cells. Proc Natl Acad Sci USA 95, 51725177. Magana-Schwencke N, Henriques JA, Chanet R, Moustacchi E (1982) The fate of 8-methoxypsoralen photoinduced

The artificially created high recombinational activity of the cell is the pivot of the proposed antitumor therapy based on coadministration of exogenous DNA and cytostatic cyclophosphan. Recombination occurs at those sites where ICLs were induced, owing to the chemical nature of the inductors, ICLs can arise at any site of the genome, regardless of its organizational level and conformational DNA-protein association. ICL emergence is a purely static chemical event, so that complete replacement of all the genomic ICLs is dependent only on the number of ICLs induced at oncomutation sites, this number being in turn dependent on the number of oncomutations, chemotherapies, and the patientâ&#x20AC;&#x2122;s luck, whether an ICL will happen to be located in an oncomutation-containing site or not. Exogenous DNA similarly affects healthy cells exposed to a cyclophosphan. In such a case, by involvement in repair in healthy cells, fragments of exogenous therapeutic DNA rescue them from apoptosis, promoting the retention of cell populations in various tissues (blood stem cells, epithelium), facilitating chemotherapy, and allowing to design subsequent cycles of treatment with cytostatic. Thus, we demonstrate a strategy effective at controlling cancer.

Acknowledgements The authors thank Alexandra Kokoza-Bogacheva and Anna Fadeeva for their technical help in preparing the paper and translation. The work was funded by LLC Panagen.

References Bartsch S, Kang LE, Symington LS (2000) RAD51 is required for the repair of plasmid double-strand DNA gaps from either plasmid or chromosomal templates. Mol Cell Biol 20, 1194-1205. Bessho T, Mu D, Sancar A (1997a) Initiation of DNA interstrand cross-link repair in humans: the nucleotide excision repair system makes dual incisions 5' to the cross-linked base and removes a 22- to 28-nucleotide-long damage-free strand. Mol Cell Biol 17,6822-6830. Bessho T, Sancar A, Thompson LH, Thelen MP (1997b) Reconstitution of human excision nuclease with recombinant XPF-ERCC1 complex. J Biol Chem 272, 3833-3837. Bogerd HP, Wiegand HL, Hulme AE, Garcia-Perez JL, O'Shea KS, Moran JV, Cullen BR (2006) Cellular inhibitors of long interspersed element 1 and Alu retrotransposition. Proc Natl Acad Sci USA 103, 8780-8785. Britten RJ, Baron WF, Stout DB, Davidson EH (1988) Sources and evolution of human Alu repeated sequences. Proc Natl Acad Sci USA 85, 4770-4774. Caldecott K, Jeggo P (1991) Cross-sensitivity of gamma-raysensitive hamster mutants to cross-linking agents. Mutat Res 255, 111-121. Cheng S, Van Houten B, Gamper HB, Sancar A, Hearst JE (1988) Use of psoralen-modified oligonucleotides to trap three-stranded RecA-DNA complexes and repair of these cross-linked complexes by ABC excinuclease. J Biol Chem 263, 15110-15117. Collins AR (1993) Mutant rodent cell lines sensitive to ultraviolet light, ionizing radiation and cross-linking agents: a comprehensive survey of genetic and biochemical characteristics. Mutat Res 293, 99-118.

200

Gene Therapy and Molecular Biology Vol 11, page 201 crosslinks in nuclear and mitochondrial yeast DNA: comparison of wild-type and repair-deficient strains. Proc Natl Acad Sci USA 79, 1722-1726. Maniatis T, Fritsch EE, Sambrook J. Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory. (1982) 480 p. Matsunaga T, Mu D, Park CH, Reardon JT, Sancar A (1995) Human DNA repair excision nuclease. Analysis of the roles of the subunits involved in dual incisions by using anti-XPG and anti-ERCC1 antibodies. J Biol Chem 270, 20862-20869. Matsunaga T, Park CH, Bessho T, Mu D, Sancar A (1996) Replication protein A confers structure-specific endonuclease activities to the XPF-ERCC1 and XPG subunits of human DNA repair excision nuclease. J Biol Chem 271, 11047-11050. Mu D, Bessho T, Nechev LV, Chen DJ, Harris TM, Hearst J E, Sancar A (2000) DNA interstrand cross-links induce futile repair synthesis in mammalian cell extracts. Mol Cell Biol 20, 2446-2454. Mu D, Hsu DS, Sancar A (1996) Reaction mechanism of human DNA repair excision nuclease. J Biol Chem 271, 8285-8294. Nickoloff JA (2002) Recombination: mechanisms and roles in tumorigenesis. Encyclopedia of Cancer 2nd ed., 4, 49-59. Elsevier Science, San Diego. Niedernhofer LJ, Odijk H, Budzowska M, van Drunen E, Maas A, Theil AF, de Wit J, Jaspers NG, Beverloo HB, Hoeijmakers JH, Kanaar R (2004) The structure-specific endonuclease Ercc1-Xpf is required to resolve DNA interstrand cross-link-induced double-strand breaks. Mol Cell Biol 24, 5776-5787. Nikolin VP, Popova NA, Sebeleva TE, Strounkin DN, Rogachev VA, Semenov DV, Bogachev SS, Yakubov LA, Shurdov MA (2006) Effect of exogenous DNA injection on leukopoietic repair and antitumor action of cyclophosphamide. Vopr Onkol 52, 336-340. O'Donovan A, Davies AA, Moggs JG, West SC, Wood RD (1994) XPG endonuclease makes the 3' incision in human DNA nucleotide excision repair. Nature 371, 432-435. Palom Y, Kumar GS, Tang LQ, Paz MM, Musser SM, Rockwell S, Tomasz M (2000) Relative toxicities of DNA cross-links and monoadducts: new insights from studies of decarbamoyl mitomycin C and mitomycin C. Chem Res Toxicol 15, 1398-1406. Park CH, Bessho T, Matsunaga T, Sancar A (1995) Purification and characterization of the XPF-ERCC1 complex of human DNA repair excision nuclease. J Biol Chem 270(39), 2265722660. Pastink A, Lohman PH (1999) Repair and consequences of double-strand breaks in DNA. Mutat Res 428, 141-156. Patent application No 2006127134 (Russia). International patent application %&'/RU2007/000007 was submitted. Prakash S, Sung P, Prakash L (1993) DNA repair genes and proteins of Saccharomyces cerevisiae. Annu Rev Genet 27, 33-70. Reardon JT, Spielmann P, Huang JC, Sastry S, Sancar A, Yearts JE (1991) Removal of psoralen monoadducts and crosslinks by human cell free extracts. Nucleic Acids Res 19, 46234629. Rogachev VA, Likhacheva A, Vratskikh O, Mechetina LV, Sebeleva TE, Bogachev SS, Yakubov LA, Shurdov MA (2006) Qualitative and quantitative characteristics of the extracellular DNA delivered to the nucleus of a living cell. Cancer Cell Int 6.

Roitberg GE, Strutynsky AV (1999) Laboratory and instrumental diagnostic of diseases of visceral organs. $.: «Publishing House BINOM». Rouet P, Smih F, Jasin M (1994) Introduction of double-stand breaks into the genome of mouse cells by expression of a rare-cutting endonuclease. Mol Cell Biol 14, 8096-8106. Saffran WA, Greenberg RB, Thaler-Scheer MS, Jones MM (1994) Single strand and double strand DNA damageinduced reciprocal recombination in yeast. Dependence on nucleotide excision repair and RAD1 recombination. Nucleic Acids Res 22, 2823-2829. Schaeffer L, Roy R, Humbert S, Moncollin V, Vermeulen W, Hoeijmakers JH, Chambon P, Egly JM (1993) DNA repair helicase: a component of BTF2 (TFIIH) basic transcription factor. Science 260, 58-63. Schildkraut E, Miller CA, Nickoloff JA (2006) Transcription of a donor enhances its use during double-strand break-induced gene conversion in human cells. Mol Cell Biol 26, 30983105. Sijbers AM, de Laat WL, Ariza RR, Biggerstaff M, Wei YF, Moggs JG, Carter KC, Shell BK, Evans E, de Jong MC, Rademakers S, de Rooij J, Jaspers NG, Hoeijmakers JH, Wood RD (1996) Xeroderma pigmentosum group F caused by a defect in a structure-specific DNA repair endonuclease. Cell 86, 811–822. Sinden RR, Cole RS (1978) Repair of cross-linked DNA and survival of Escherichia coli treated with psoralen and light: effects of mutations influencing genetic recombination and DNA metabolism. J Bacteriol 136, 538-547. Sladek FM, Munn MM, Rupp WD, Howard-Flanders P (1989) In vitro repair of psoralen-DNA cross-links by RecA, UvrABC, the 5'-exonuclease of DNA polymerase I. J Biol Chem 264, 6755-6765. Thomas KR, Folger KR, Capecchi MR (1986) High frequency targeting of genes to specific sites in the mammalian genome. Cell 44, 419-428. Van Houten B, Gamper H, Holbrook SR, Hearts JE, Sancar A (1986) Action mechanism of ABC excision nuclease on a DNA substrate containing a psoralen crosslink at a defined position. Proc Natl Acad Sci USA 83, 8077-8081. Wang X, Peterson CA, Zheng H, Nair RS, Legerski RJ, Li L (2001) Involvement of nucleotide excision repair in a recombination-independent and error-prone pathway of DNA interstrand cross-link repair. Mol Cell Biol 21, 713-720. Warren AJ, Mustra DJ, Hamilton JW (2001) Detection of mitomycin C-DNA adducts in human breast cancer cells grown in culture, as xenografted tumors in nude mice, in biopsies of human breast cancer patient tumors as determined by (32)P-postlabeling. Clin Cancer Res 7, 1033-1042. Yakubov LA, Petrova NA, Popova NA, Nikolin VP, Os'kina IN (2002) The role of extracellular DNA in the stability and variability of cell genomes. Dokl Biochem Biophys 382, 3134. Yakubov LA, Popova NA, Nikolin VP, Semenov DV, Bogachev SS, Os'kina IN (2003) Extracellular genomic DNA protects mice against radiation and chemical mutagens. Genome Biol 5, 3. Yu LJ, Drewes P, Gustafsson K, Brain EG, Hecht JE, Waxman DJ (1999) In vivo modulation of alternative Pathways of P450-catalyzed cyclophosphamide metabolism: impact on pharmacokinetics and antitumor activity. J Pharmacol Exp Ther 288, 928-937.

201

Likhacheva et al: Integration of human DNA into the mouse genome

202

Gene Therapy and Molecular Biology Vol 11, page 185 Gene Ther Mol Biol Vol 11, 185-202, 2007

Integration of human DNA fragments into the cell genomes of certain tissues from adult mice treated with cytostatic cyclophosphamide in combination with human DNA Research Article

185

186

Gene Therapy and Molecular Biology Vol 11, page 187 hybridization bands cut out from membrane filter) was determined using a 1209 RacBetta counter (Finland).

Figure 1. Electrophoretic characteristics of exogenous therapeutic human placenta DNA administered i.p. to mice. M, molecular weight marker lambda DNA-BssT1I digest.

E. Sequencing PCR fragments

H. Estimation of the number of genomes in treated tissue cells containing X-Alu homologous sequences based on absolute counts of labeled material in dots

187

Likhacheva et al: Integration of human DNA into the mouse genome

ng X-Alu SS Nonspecific background CBA Specific background hDNA Mouse No 1 Mouse No 8

0.1 55

0.5 79

1.0 135

250

500

1000

5000

105 not above specific background 42

165

233

291

467

Spleen, ~3x108 nucleus-containing cells. Spleen colony, a derivative of blood stem cell, contains 10x6 cells. Thus, the total cell number is 23.5x108, spleen colonies constitute 0.04% of this number.

188

Gene Therapy and Molecular Biology Vol 11, page 189 Table 1. Proportions of corpuscular elements in the blood of mice treated with cyclophosphan alone and in combination with human DNA.

Preparation

Corpuscular elements in the blood (%)

Mouse No Rod

CP 1 day before injection

CP + human DNA 1 day before injection

CP day 4

CP + human DNA day 4

CP day 7

CP + human DNA day 7

1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8

Segmented

Eosinophils

Monocytes

Lymphocytes

2.7 5.6 5.6 7.4 5.0 5.0 5.8 2.5 5.4 2.6 0 3 7 2 9 0 2 5 2 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10.2 8.0 9.5 14.6 14.7 17.8 14.6 20.0 14.0 25.0 37.8 29.7 14.0 14.5

47.7 43.0 49.0 34.6 42.4 40.0 31.2 32.0 46.4 51.8 51 55 38 49 57 70 56 40 61 74 2 0 0 3 13 6 0 1 5 2 2 1 3 0 9 0 1 1 7 0 34.6 45.7 35.3 34.4 26.8 34.6 34.4 54.0 51.0 48.0 40.3 39.7 54.0 28.5

3.7 1.3 3.4 5.0 4.8 3.0 1.5 4.3 2.6 0.6 5 3 2 7 5 6 2 2 1 1 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

6.3 10.5 9.0 13.6 11.2 13.0 11.0 14.0 12.4 20.4 6 7 18 7 4 8 10 8 7 13 12 15 13 13 14 8 2 2 9 10 2 4 4 0 0 5 3 1 7 7 48.6 46.7 47.5 43.0 45.2 42.4 47.4 15.0 25.0 5.0 18.0 22.0 26.3 53.2

39.7 19.8 31.6 43.8 36.2 38.8 34.5 29.8 34.6 24.2 38 32 35 35 25 17 30 45 29 46 84 85 87 84 71 83 98 98 86 88 96 95 93 100 91 95 96 97 86 93 5.6 5.0 6.0 7.6 5.5 5.0 3.2 10.0 10.0 22.0 2.5 8.0 3.3 3.7

15.7

48.5

54.2

4.0

15.3

41.0

37.0

6.0

189

Likhacheva et al: Integration of human DNA into the mouse genome

CP day 10

CP + human DNA day 10

CP day 14

CP + human DNA day 14

CP day 17

CP + human DNA day 17

9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10

37.7 13.7 18.3 10.0 16.5 18.0 12.0 9.5 24.0 19.0 20.0 4.0 3.0 17.0 11.5

37.8 53.7 66.7 57.5 56.5 49.0 64.0 66.0 64.0 59.0 52.0 76.5 65.0 59.5 45.0

0 0.3 0.3 0 0 0.5 0.5 1.0 0 0 1.0 0 0 0 0

54.8 24.7 5.7 25.5 0.2 0.2 0.2 17.0 5.5 16.0 14.0 11.0 24.0 14.5 21.5

9.0 9.0 8.7 6.0 6.5 12.5 8.0 5.0 6.5 9.0 7.0 9.0 70 6.5 22.0

5.3

68.0

21.7

6.3

8.0

72.0

6.0

7.5 41 17 14 27.5 21 14 26 13 17 18 1 4 5 11

47.5 20 39 30 31 27 42 38 33 38 26 85 57 49 55

1,0 11 5 8 6 7 9 7 7 6 11 3 8 6 0

17.5 19 28 30 24.5 32 19 12 23 19 19 9 18 31 14

27.5 8 12 18 11 13 16 16 24 20 26 2 15 9 17

8 15 11 15 25 8 24 22 25 12 12 2 3 13 9

42 29 38 43 43 47 37 32 36 30 48 87 52 43 51

7 5 5.5 6 4 7 12 15 8 11 8 0 13 1 7

27 31 33.5 24 17 16 13 15 9 20 15 9 13 27 19

16 20 11 12 10 22 11 16 21 24 17 2 18 17 13

190

CP + human DNA

Mouse No 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10

1 day before CP injection 2.7 5.6 5.6 7.4 5.0 5.0 5.8 2.5 5.4 2.6 0 3.0 7.0 2.0 9.0 0 2.0 5.0 2.0 6.0

day 4

day 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

day 10

day 14

day 17

10.2 8.0 9.5 14.6 14.7 17.8 14.6 20.0 14.0 25.0 37.8 29.7 14.0 14.5

13.7 18.3 10.0 16.5 18.0 12.0 9.5 24.0 19.0 20.0 4.0 3.0 17.0 11.5

21.0 17.0 14.0 27.5 21.0 14.0 26.0 13.0 17.0 18.0 1.0 4.0 5.0 11.0

15 11 15 25 8 24 22 25 12 12 2 3 13 9

15.7

5.3

6.0

15.3

8.0

37.7

7.5

8.0

Table 3. Dynamics of the number of segmented neutrophils during 17 days after treatment with CP alone or in combination with human DNA Segmented neutrophils (%) Preparation

CP + human DNA

Mouse No 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10

1 day before CP injection 47.7 43.0 49.0 34.6 42.4 40.0 31.2 32.0 46.4 51.8 51.0 55.0 38.0 49.0 57.0 70.0 56.0 40.0 61.0 74.0

day 4

day 7 2 0 0 3 13 6 0 1 5 2 2 1 3 0 9 0 1 1 7 0

191

day 10

day 14

day 17

34.6 45.7 35.3 34.4 26.8 34.6 34.4 54.0 51.0 48.0 40.3 39.7 54.0 28.5

53.7 66.7 57.5 56.5 49.0 64.0 66.0 64.0 59.0 52.0 76.5 65.0 59.5 45.0

20 39 30 31 27 42 38 33 38 26 85 57 49 55

29 38 43 43 47 37 32 36 30 48 87 52 43 51

48.5

68.0

41.0

72.0

37.8

47.5

CP + human DNA

Days 1 day before CP injection day 4 day 7 day 10 day 14 day 17 1 day before CP injection day 4 day 7 day 10 day 14 day 17

Rod neutrophils, %

Segmented neutrophils, %

Total number of granulocytes, %

47.0

41.8

49.6

0 14.8 14.3 20.8 16.9

3.2 39.9 59.8 32.4 38.3

3.6 59.7 74.5 53.3 55.2

3.6

55.1

62.1

0 23.5 8.1 6.1 6.5

2.4 41.4 61.9 53.0 53.3

2.5 64.9 70.1 60.0 60.6

Figure 3. (A) Alignment of consensusi of human repetitive sequence and mouse B1. (B) A sequence of the X-Alu fragment. Arrows and boldface type highlight the primers used in PCR.

193

Likhacheva et al: Integration of human DNA into the mouse genome

chose primers located in Alu-repeat sequence, there was reason for believing that the two major PCR fragments were two variants of the human genome Alu-repeat.

195

Likhacheva et al: Integration of human DNA into the mouse genome

196

199

Acknowledgements The authors thank Alexandra Kokoza-Bogacheva and Anna Fadeeva for their technical help in preparing the paper and translation. The work was funded by LLC Panagen.

200

201

Likhacheva et al: Integration of human DNA into the mouse genome

202

Gene Therapy and Molecular Biology Vol 11, page 203 Gene Ther Mol Biol Vol 11, 203-218, 2007

Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors Research Article

Abdelnaby Khalyfa1,3,*, Mohamed Buazza3, He Qiang2, Min Xu4, Charles Taylor Marshall1, Fred J. Roisen1, Kathleen M. Klueber1, Nigel GF Cooper1 1

Department of Anatomical Sciences and Neurobiology, Department of Biochemistry and Molecular Biology, 3 Department of Pediatrics, University of Louisville, School of Medicine, Louisville, Kentucky, 4 GE HealthCare, (Microarray Applications Development, Piscataway, NJ) 2

__________________________________________________________________________________ *Correspondence: Abdelnaby Khalyfa, Ph.D., Department of Pediatrics, Kosair Children’s Hospital Research Institute, University of Louisville, School of Medicine, 570 S. Preston St., Room 204, Louisville, KY 40202, USA; Tel: 502-852-7524; Fax: 502-852-2211; Email: a.khalyfa@louisville.edu Key words: Genome microarray, neurosphere forming cells (NSFCs), CodeLink Bioarrays Abbreviations: 4´,6-diamidino-2-phenylindole dihydrochloride, (DAPI); Analysis Of Variance, (ANOVA); bovine serum album, (BSA); central nervous system, (CNS); Database for Annotation, Visualization, and Integrated Discovery, (DAVID); Gene Expression Omnibus, (GEO); Gene Ontology, (GO); human mesenchymal stem cells, (HMSC); nestin-positive neurosphere forming cells, (NSFCs); neural cell adhesion molecule, (NCAM); olfactory neurosensory epithelium, (ONe); Real time-PCR, (RT-PCR); RNA Integrity Number, (RIN); Tris–Buffered Saline, (TBS) Received: 30 May 2007; Revised: 30 July 2007 Accepted: 22 August 2007; electronically published: September 2007

Summary The olfactory neuroepithelium (ONe) is, a specialized tissue that lines a region of the nasal cavity high in the nasal vault, characterized by its life-long regenerative capacity. The purpose of the study was to further characterize and to compare gene expression profiling in neurosphere-forming cells (NSFCs) derived from primary cultures of ONe using a genome-wide array approach. Total RNA was isolated from p14, p78, and p189 in vitro passages and hybridized to the human genome-wide CodeLink Bioarrays. Differentially expressed genes were identified in 9 arrays using statistical filters and bioinformatics analysis. Of 55,775 transcripts, 11,345 (in all passages) were detected and 7,115 were commonly expressed in 9 arrays. From the 7,115 transcripts, 2,690 transcripts were expressed in stem cells. Of these 2,690 transcripts, 1,117 genes containing RefSeq accession numbers were identified and further classified based on their functional similarities using Gene Ontology (GO) tools. The changes in expression levels revealed by microarray experiments were validated using real-time RT-PCR analysis. Biological pathways were constructed to better understand the biological significance of the differentially expressed genes. Each passage of NSFCs was characterized immunocytochemically and compared using antibodies to peripherin, !tubulin III, and nestin. The array results indicate the presence of both neuronal and epithelial phenotypes within the population of NSFCs. The pattern of gene expression of the NSFCs was unique compared to other lines perhaps reflecting species related differences and or adult versus embryonic derived stem cells.

neuroepithelium (ONe), located in the mucosa lining of the nasal cavity is readily accessible (Winstead et al, 2005) and contains a population of progenitors which is responsible for the lifelong regeneration of its neuronal and supporting cells (Calof et al, 1998). Several CNS disorders have been correlated with deficiencies in the olfactory system; therefore ONe provides a potential source of genetic material for analyses of these diseases. Previously, techniques were established

I. Introduction The potential uses of stem cells and their related progenitors are many, including cell transplantation for the repair or replacement of injured or diseased tissues, as well as tools for diagnostic assessment of diseases and pharmacological testing. Progenitor cells are located within many areas of the adult central nervous system (CNS), but their locations require highly invasive surgery for their harvest (Rao, 1999). In contrast, olfactory 203

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors for harvest and culture of ONe which allow the isolation of a mitotically active population of nestin-positive neurosphere forming cells (NSFCs) from tissues obtained postmortem (Roisen et al, 2001) or by endoscopic biopsy of patients undergoing nasal sinus surgery (Winstead et al, 2005). NSFCs appear after 6-8 weeks in vitro and can be maintained as sub-cultures (Calof et al, 1998; Zhang et al, 2004, 2005). Over 70 patient-specific NSFC-lines have been established which can be driven to neuronal or glial lineage restriction (Zhang et al, 2005; Zhang et al, 2004). The NSFCs can be sub-cultured and maintained in vitro indefinitely, thereby providing a prospective source of adult neural progenitors. These cells have been characterized as neural progenitors because they not only contained nestin but were immunologically positive for a variety of neural specific antigens including beta tubulin III, neural cell adhesion molecule (NCAM), and the neural crest marker peripherin (Zhang et al, 2004). Their prospective neural progenitor status makes them potentially important as therapeutic and diagnostic tools for diseases of the nervous system. Previously, we have suggested that the regenerative capacity of ONe could make it a suitable source of cells for replacement transplantation studies for treatment of neurodegenerative diseases and spinal cord injuries (Roisen et al, 2001; Othman et al, 2003; Windstead et al, 2005; Xiao et al, 2005). The structural and functional recovery of a rat spinal cord injury model following engraftment of heterogeneous NSFCs were reported by Xiao and colleagues in 2005, 2007, while Lu and colleagues used in 2002 the source of ensheathing cells for transplantation into the completely transected spinal cord of the adult rat. Marshall and colleagues in 2005 have demonstrated that isolated NSFCs from ONe show no differences in mitotic potential (telomerase activity) and apoptotic activity (ss-DNA levels). The isolated NSFCs were from donors with an age range of 33-96 yrs, from both male and female patients, exhibited a remarkable resiliency across all variables. These studies provide an initial index of the cellular characteristics of the neural progenitors isolated from ONe; the present study applied a gene-based approach to further the formal characterization of this unique progenitor population derived from human olfactory epithelium (Calof et al, 1998; Roisen et al, 2001; Zhang et al, 2004, 2005; Marshall et al, 2005; Xiao et al, 2005). Gene-microarrays provide a relatively recent technological development that can be used for examining multiple transcripts in a single experiment (Belbin et al, 2004). This technology has been used extensively for gene expression profiling (Lockhart et al, 1996; Schena et al, 1995), and gene discovery functions (Schena et al, 1995; Lockhart et al, 1996; Chu et al, 1998; Hughes et al, 2000). Microarrays have already been used to identify differentially expressed genes in neural stem cells and progenitor cells of the rat (Luo et al, 2002) and also in cultured mouse embryonic neural stem cells (Karsten et al, 2003). McCurdy and colleagues explored in 2005 gene expression differences which underlied cell cycle differences in neuropsychiatric disorders. Microarray

analysis of the mouse nasal mucosa has also been described (Getchell et al, 2003). These previous studies were used for comparative purposes. In this study, CodeLink Human Whole Genome Bioarrays (55K) (GE Healthcare, formerly Amersham Biosciences, Piscataway, NJ) were utilized, and each probe consists of 30-mer base pair sequences. The arrays are manufactured using a non-contact spotting method (Ramakrishnan et al, 2002). A prior study has shown that 30-mer probes, as used here, may be more sensitive than 25-mer probes used in some other platforms (Relogio et al, 2002). There are many sources of systematic variation in microarray experiments that can affect the quality of the results. Therefore, normalization is essential for minimizing variations between microarrays (Churchill, 2004; Martinez et al, 2003; Yang et al, 2001). A variety of normalization methods have been proposed (Quackenbush, 2002). Herzel and colleagues suggested in 2001 subtracting the background intensity from the signal intensity, and Chen and colleagues derived in 1997 iterative procedures for estimating normalization constants. The Analysis Of Variance (ANOVA) model has been proposed as a powerful approach for microarray experiments because of the necessity of considering multiple factors and several sources of variation (Churchill, 2004). Yang and colleagues proposed in 2002 the use of permutation-testing and p-value adjustment to address the multiple-testing problem. Dudoit and colleagues developed in 2002 the use of transformed log intensities (MA-plot), the scatter plot of the log ratio versus the average log intensity (MA plot), which is very helpful in terms of identifying spot artifacts and detecting intensity-dependent patterns in the log ratio. In this study, we used within array normalization to compare different samples and to develop methods for the identification of genes that are differentially expressed. Visualization with the aid of MA plots was used to identify spot artifacts, and to detect intensity dependent patterns in the log-ratios. Studies of gene expression patterns in cell cultures, aged by sub-culture in vitro, may contribute towards understanding the mechanism of age-related disease. Previous studies have shown temporal regulation of ONe progenitors over relatively short periods of time in neurogenesis (Getchell et al, 2005; Shetty et al, 2005). Our study presents gene expression profiling of ONe progenitors over a period of passages representing two years time. The NSFCs isolated from ONe provide a unique source of adult human neural progenitors. Our studies indicated that there were no remarkable differences in mitotic activity (proliferation) in populations of NSFCs isolated from donors with an age range of 33-96 yrs between donors of either sex or as a function of time in cultures (Marshall et al, 2005). The goal of this study was further characterize the human adult ONe-derived NSFCs using the recently developed human genome-array (CodeLink Bioarrays). Three different passages (p14, p78, and p189) of a cell line that had been derived from a post-mortem 95 yr old female were used to determine if they would provide identical or variable gene-expression profiles. In this study

204

Gene Therapy and Molecular Biology Vol 11, page 205 we hypothesized that there would be change in the gene expression levels over the period of time for those three cell passages despite that fact that the telomeric activity, apoptotic activity (ss-DNA levels) and some of the apoptotic related genes would remain constant. Our long term goal is to build a gene-array database of human ONe progenitors, which can be used to describe the nature of these expressed genes, which could be very useful to developing different gene therapy approaches.

software and subtracted from all feature intensities before further calculations were performed. Expression values were globally normalized to the median expression value of the entire probes on the array. CodeLink arrays were processed in collaboration with GE Healthcare (Piscataway, NJ). For each probe the local background was comprised of a circular area of pixels surrounding the segmented signal. The mean intensity was taken for each spot and background corrected by subtracting the surrounding median local background intensity. A spot was considered good (G) if the mean of the spot's signal was higher than the mean of corresponding local background plus three standard deviations. The data filtering process was performed on each spot using CodeLink Expression Data Analysis Software v 4.0. Normalization was performed initially on the raw digitized data. The process was adapted from previously published analytical methods (Ramakrishnan et al, 2002) and included subtraction of the local background signal from the raw intensity signal for each spot. The negative control threshold was used to define the lower limits of detection, and the values of threshold cut-off were important for variability determination and data filtration. The resulting value for each spot was then divided by the median signal intensity which is derived from the intensity values for all discovery spots. This ratio value for each gene delivers a measure of gene expression for one gene versus another in any given array.

II. Materials and methods A. Cell culture The initial primary tissue was obtained from an 8 hr postmortem 95 yr old female as previously reported (Zhang et al, 2004), and stored as frozen stock from neurosphere subcultures. The frozen stock (1x106 cells/vial) was thawed rapidly and cultured in flasks (25 cm2, Corning, NY) in medium, consisting of: MEM, 10% FBS and 1% gentamycin (GIBCO, Grand Island, NY) in a humidified atmosphere of 5% CO2, at 37°C. Cells were grown in culture for nearly 200 passages (representing almost 2 yr in culture). Three different passages (p) (p14, p78, and p189) representing young, intermediate, and old passages were used.

B. RNA isolation and labeling Total RNA from cell culture samples was extracted using TRIzol reagent (Life Technologies, Gaithersburg, MD), and RNeasy Mini Kit columns (Qiagen, Valencia, CA) followed by DNase treatment (Ambion, Austin, TX) according to standard protocols (Qiagen, Valencia, CA). The quantity and quality of total RNA were assessed using Agilent 2100 Bioanalyzer, and Agilent’s RNA Integrity Number (RIN) software (Agilent Technologies, Palo Alto, CA). The 28S/18S ratios of the isolated RNA were in the range of 1.8 – 2.0, and the RIN numbers were in the range of 9-10. The total RNA was processed for labeling as described in the CodeLink Expression Bioarray technical manual (GE Healthcare, Piscataway, NJ). Briefly, two µg of total RNA from p14, p78, and p189 samples were used to generate first-strand cDNA using Superscript II reverse transcriptase, and a T7 primer. Subsequently, second-strand cDNA was produced using Eschericia coli DNA polymerase I and RNase H. The resultant double-stranded cDNA was purified on a QIAquick column (Qiagen), and cRNA was generated using T7 RNA polymerase in the presence of biotin-11-UTP (Perkin Elmer, Boston, MA). The cRNA was purified on an RNeasy column (Qiagen), quantified by spectrometry, and ten µg of fragmented cRNA were hybridized overnight at 37°C for 18 hours in 250 µl volume. Cy5-streptavadin (GE Healthcare, Piscataway, NJ) was used for detection of the fluorescence signal. Three Total RNA samples from each passage (p14, p78, p189) were hybridized onto three independent microarray slides.

D. Data and statistical analysis To measure the reproducibility among triplicate technical arrays for each cell passage sample, the ANOVA F-test was applied on the hypothesis of equal mean ‘median-normalized’ intensity. The one-way ANOVA deals with one independent variable (different arrays) and one dependent variable (signal intensities). To further evaluate array reproducibility, scatter plots, box plots, and correlation coefficients were used. Expression values for each gene were obtained based on the average across the triplicate spots from the three independent arrays. Differentially expressed genes among young, intermediate, and old passage were identified using the Student’s t-test to estimate significant differences (p-values cutoff= 0.001). Volcano plots were used to determine highly significant genes based on fold change and p-value. Overall, analyses on the data obtained from these experiments indicated a high reproducibility among technical replicates.

E. Functional classification Our data were compared to human mesenchymal stem cells (HMSC). This HMSC was deposited in Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo) and are accessible through GEO series accession number GSE2776. Gene Ontology (GO) was used to find associations between groups of genes based on the ‘‘cellular component, biological process and molecular function”. GeneSpring, GX 7.3, software (Agilent Technology, Foster City, CA), and Database for Annotation, Visualization, and Integrated Discovery (DAVID) tools, http://david.niaid.nih.gov/david/ were also used for these data analysis.

C. CodeLink array and processing CodeLink Whole Human Genome Bioarray contains 55,775 transcripts utilizing one probe per transcript 30-bp. The oligonucleotide-based microarrays were designed to conserved exons across the target genes and each sequence was carefully screened to ensure high-quality. The array contains about 45,674, (UniGene) as well as 360 positive controls, 384 negative controls, and 100 housekeeping genes. The arrays were scanned at 635 nm with 5 µm resolutions using an Axon GenePix 4000A microarray scanner (Axon Instruments, Union City, CA). The images were analyzed using CodeLink Expression Data Analysis Software v 4.0. Background fluorescence values were automatically calculated by the

F. Real-time PCR Real time-PCR, (RT-PCR) was performed on an ABI 7300 instrument (Applied Biosystems, Foster City, CA) to confirm expression levels of a subset of the common differentially expressed genes. Two micrograms of total RNA were used to generate cDNA templates for RT-PCR. cDNA synthesis was performed using a High-Capacity cDNA Archive kit (Applied Biosystems, Foster City, CA). The first strand cDNA products were further diluted 20- to 50-fold and used as PCR templates.

205

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors The TaqMan® Master Mix Reagent Kit (Applied Biosystems, Foster City, CA) was used to amplify and quantify each transcript of interest in 25 µl reactions. To ensure specific amplification, various negative controls (i.e., water only, reaction without primers, and templates derived without reverse transcriptase) were included in the PCR reaction. The PCR product of selected differentially expressed genes was quantified in real-time, using a dye-labeled fluorogenic reporter oligonucleotide probe. The probe was labeled at its 5´ end with the reporter dye, 6-carboxy-fluoresceine (FAM). All sample reactions were carried out in triplicate samples. The PCR amplification was performed in 96-well plates as follows: the initial step of 2 minutes at 50oC; denaturation at 95oC for 10 min, followed by 40 thermal cycles of denaturation (15 seconds at 95oC) and elongation (1 min at 60oC). The threshold cycle (C T) values were averaged from the values obtained from each reaction, and the gene expressions were normalized to 18S rRNA levels. The C T values were analyzed by ANOVA using Sigma Plot software (Systat Software Inc., San Jose, CA). The fold change was calculated by the 2 -"CT, where -"CT = (C T-old – C Tyoung ). The C T-old means the signal of an individual gene expressed in p78 or p189 passages, while CT-young means the signal of the same gene expressed in p14. The sequences of primers designed were selected to be within the same region of the gene used to develop the microarray sequence probes.

III. Results The CodeLink Human Whole Genome Bioarrays (GE Healthcare, Piscataway, NJ), which represents 55,775 transcripts were used for gene expression profiling of the ONe-derived progenitors. Of these 55,775 transcripts 7,115 were found to be common in all three passages. The cells were grown for varying times in culture and chosen for evaluation based on passage number, p14, p78, and p189 representing the three biological samples. The plating densities were kept constant at all times. The microarrays were hybridized with the biotin-labeled cRNA samples and the hybridization signals were captured and digitized with the aid of a laser scanner (GenePix, Axon Instruments, Union City, CA).

A. Replicates To visualize the reproducibility of the microarray data, several methods were applied. First, a pair-wise comparison was performed using scatter plots of the log10 normalized signal intensities for the p14, p78, and p189 samples (Figure 1). The data showed a representative of scatter plots for replicate 1 vs. replicates 2 for the p14 sample (Figure 1A), the p78 (Figure 1B), and the p189 (Figure 1C). The line at 45 degrees is a straight line denoting a correlation coefficient equal to 1. In these scatter plots, genes with similar expression levels will appear somewhere along the first diagonal (the line y = x) of the coordinate system. A gene that has an expression value that is very different between the two replicates will appear far from the diagonal. Many of the data points were distant from this line. In particular, the data demonstrated increased variability between replicates for the lower end of the spectrum of signal intensities. Thus, those genes with a log10 intensity <0.5 are representing genes with low expression. To better identify spot artifacts and detect intensitydependent patterns, MA plots were used. The MA (M = log intensity ratios, and A = average log intensities) plot has generally been considered a powerful tool for visualizing and quantifying both linear and non-linear differential responses of replicates (Quackenbush, 2002; Yang et al., 2002). If two replicates behave similarly, then the data should appear symmetrically about a horizontal line through zero, and deviations from this horizontal line represent different responses of the two replicates. The M vs. A plot was used in this study to plot the log ratio of the two replicates vs. their average log intensity (Figure 2) for the genes detected in the p14 cells (Figure 2A), p78 cells (Figure 2B), and p189 cells (Figure 2C). Note that for lower average log-intensities, the log ratios were more variable, and this may be expected, and may not necessarily constitute bad replicates.

G. Signal pathway analysis The differentially expressed genes obtained from microarray data and validated by RT-PCR analysis were imported into PathwayStudio software (Ariadne Genomics Inc., Rockville, MD) to identify and classify specific cellular pathways. The PathwayStudio software is a tool for biological pathway analysis based on GO designed to describe key aspects of the molecular function, biological process and cellular component of gene products. The validated differentially expressed genes were used to identify all known relationships between the differentially expressed genes. Only biological pathway networks of differentially expressed genes (RefSeq accession numbers) were modeled onto the software.

H. Immunocytochemistry Cells were plated as previously described (Marshall et al, 2005; Roisen et al, 2001) on 22 mm round glass coverslips in 6well plates (Falcon) for 48 hrs (4 x 104 cells/well). For immunohistochemistry, cultures were incubated with 4´,6diamidino-2-phenylindole dihydrochloride (DAPI) (1:1000, 2 mg/ml, Molecular Probes, Eugene, OR) for 30 min at 37°C for labeling of DNA. The coverslips were rinsed with cytoskeletal buffer (CB: 2-N-morpholino ethane sulfonic acid [MES] 1.95 mg/ml; NaCl, 8.76 mg/ml; 5 mM EGTA; 5 mM MgCl2; glucose 0.9 mg/ml, pH 6.1) twice and fixed in 3% para-formaldehyde in CB for 10 min. Cells were treated with 0.2% Triton X-100 (Sigma) for 10 min and incubated in a blocking solution containing 3% bovine serum album (BSA) in Tris–Buffered Saline (TBS) for 1 hr. Primary antibodies against nestin (monoclonal, Chemicon International, Temecula, CA), peripherin, (polyconal, Chemicon), and !-tubulin III, monoclonal (Sigma, St. Louis, MO), were applied and incubated at 4°C overnight. After washing in TBS three times, cells were incubated for 1 hr at room temperature with the following secondary antibodies: Texas-red-conjugated goat anti-rabbit IgG, Cy2-conjugated goat anti-mouse IgG (all diluted 1:100; Cy2, Jackson Immunology Research Laboratories; Texas-red, Molecular Probes). Omission of primary antibody was used as a control for each experiment. All such controls proved to be negative.

B. Differential expression To identify differentially expressed genes between passages, normalized data were filtered, to remove several categories of data including those with absent signals or low noise ratios, contaminated spots, irregular spots and saturated spots using CodeLink Expression Software.

206

Gene Therapy and Molecular Biology Vol 11, page 207 Analysis of 55,775 transcripts on the array showed that 8,655 (15.6%) transcripts in p14 cells, 8,691 (15.3%) in p78 cells, and 10,562 (18.9%) transcripts in p189 cells were detected. Following data filtration, out of the total 55,775 transcripts, 11,345 transcripts had signal detectable with 7,115 transcripts shown in all arrays. The subsequent analysis was focused on the 7,115 transcripts that were detected in all three samples. For the 7,115 common transcripts, the studentâ&#x20AC;&#x2122;s t-test was used to determine the genes which were differentially expressed between the different cell passages. A p-value of 0.001 (cut-off) was selected to identify differentially expressed genes between p78 and p14 cells, and between p189 and p14 cells. The 7,115 transcripts were evaluated based on the fold changes in expression and p-values, with

the aid of volcano plots. The volcano plot is a scatter plot of the relative expression values against the p-value for each gene. Figure 3 shows the log2 fold-change of 7115 transcripts versus their â&#x20AC;&#x201C;log10 p-values for p78 versus p14 (Figure 3A), and p189 versus p14 (Figure 3B). Spots in the extreme upper left and right corners of the volcano plots show the largest, and statistically most significant, changes in expression. For example, in the p78 versus p14 samples, the log2 at a scale of 1 shows a 2-fold change on the x axis, and â&#x20AC;&#x201C;log10 at scale of 3 on the y axis is equal to a p-value of 0.001. Therefore, based on the fold change and p-value a line can be drawn to identify changes in gene expression values. The same case approach was applied for sample p189 versus sample p14.

Figure 1. Pair-wise comparison for array-to-array comparisons before data filtering. Scatter plots were performed using log median normalized signal intensities. cRNA, were synthesized from olfactory-derived progenitor sub-cultures (p14, p78, and p189). Panel A, is for sample p14, Panel B, is for p78, and, Panel C, is for p189. Increased variability between replicates is evident at lower expression levels. Panel D is a box plot comparing array reproducibility. The log10 of normalized data were plotted against 3 replicate arrays for each of the three samples (p14, p78, and p189). Spot intensity is considered an outlier if it has a value of 1.5 times the inter-quartile range from the top or bottom of the box. The distribution of log normalized signal intensities for all arrays is shown on one plot making for easy comparison.

207

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors

Figure 2. MA plots of normalized filtered signal intensities of the 7,115 transcripts between three passages. The MA plots are related to the scatter plots of the log intensities of the replicates. M represents the log10 ratio of the normalized filtered signal intensities, and A represents the average of the log10 of the normalized signal intensities using p14, p78, and p189 samples. Panel A is a representative of MA plots for technical replicates of the p14 sample, Panel B, shows the MA plot for replicates of the p78 sample, and Panel C, shows the MA plot of replicates of the p189 sample.

C. Characterization expression

global

Figure 3. Volcano plot of normalized filtered 7,115 transcripts. The Volcano plots showed expression differences for the p78 versus p14 (Panel A), and the p189 versus p14 (Panel B) samples, averaged across the technical replicates arrays (x-axis). The gene-specific F-test (y-axis) denoting significance for each gene is represented as an individual spot (â&#x20AC;˘). The Volcano plots allowed the visualization of fold-change and statistically significant p-values at the same time. Thus genes with either a large or small fold change but which have statistical significance can be seen.

molecular function (Figure 4A), biological process (Figure 4B), and cellular components (Figure 4C). The annotated genes were clustered in these categories and were used to determine the biological function of the only genes containing RefSeq accession numbers.

gene

To gain insight into the biological meaning of the common sets (7115 transcript), further data analysis were carried out (data available upon request). Of the 7115 genes, there were 2694 transcripts expressed in stem cells (data available upon request). Of these 2694 transcripts, 1117 genes containing RefSeq accession numbers were identified. Gene Ontology of these 1117 genes was further classified based on their function similarities (Figure 4). Meaningful biological categories were selected from the GO hierarchy by browsing these three categories

D. Database correlation Further data analysis of the common genes detected in all three passages (7115 transcripts) were further analyzed and compared to the GEO (GEO repository, http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gds) to human mesenchymal stem cells (Codelink) database. 208

Gene Therapy and Molecular Biology Vol 11, page 209 About 640 RefSeq genes were highly correlated between our data and to the human mesenchymal stem cells. The following genes were identified in our microarray data and data published by others (Histone deacetylase 9 (NM_014707); microtubule associated serine/threonine kinase 2 (NM_015112); microtubule-associated protein, RP/EB family, member 3 (NM_012326); slit homolog 2 (Drosophila) (NM_004787); transmembrane protein with EGF-like and two follistatin-like domains 2 (NM_016192); ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) (NM_001420); pumilio homolog 1 (Drosophila), (NM_014676); epidermal growth factor (beta-urogastrone) (NM_001963); (9) pumilio homolog 1 (Drosophila) (NM_014676); opioid receptor, mu 1 (NM_000914); bystin-like (NM_004053); LIM domain only 1 (rhombotin 1) (NM_002315); insulinomaassociated 1 (NM_002196); paired box gene 5 (B-cell lineage specific activator) (NM_016734); chloride channel 3 (NM_001829); SH3-domain GRB2-like 1NM_003025); calneuron 1 (NM_031468); and ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) (NM_032281).

E. Validation The changes in expression levels revealed by microarray experiments were validated for a set of selected genes with the aid of QRT-PCR analysis (Table 1). The selected genes were obtained from the common genes to the 3 cell passages and contained genes whose expression values were either up-regulated or down-regulated as determined from the microarrays. The relative expression values obtained from QRT-PCR were normalized to 18S rRNA (control), and the ratio of normalized RT-PCR gene expression values were obtained from intermediate, and old passages compared to the young passage. All negative controls used were reported to be un-amplified, or to have a very weak signal, close to the baseline or background. The microarray and the QRT-PCR results were consistent in terms of gene expression values, although, the fold changes varied between the two techniques. For example, the expression level of aggrecan1 showed the highest fold changes in microarrays (15.83) and QRT-PCR (3.94). The QRT-PCR results show a coefficient of determination (R2 = 0.89) with the microarray expression values.

Figure 4. Gene Ontology for the RefSeq genes within the common transcripts. A Gene Ontology (GO) was attributed to each RefSeq gene (1117) for the three GO ontologies: molecular function (A), biological process (B), and cellular components (C). Annotated genes were then clustered in meaningful biological categories.

F. Biological pathway To better understand the biological significance of the differentially expressed genes obtained by microarray data and validated by RT-PCR technique, these genes were used to build biological pathways utilizing the PathwayStudio software (Figure 5). We found 53 candidate genes associated with the 10 genes (top 5 upregulated highlighted in violet and top 5 down-regulated in blue) identified by microarray analysis using PathwayStudio. The total of 63 genes (red) led to the further identification of seven major cellular processes which included metabolism, proliferation, secretion, motility, assembly, maturation, and differentiation (yellow).

G. Immunocytochemistry To view the cellular characteristics in each passage, cells were immunolabeled for nestin, a neural progenitor intermediate filament, and peripherin, an intermediate filament found in cells derived from the neural crest (Figure 6). The presence of nestin and peripherin was consistent with a progenitor nature. Nestin and peripherin immunolocalization were similar for all passages. In addition, !-tubulin III, a neuron specific tubulin, was used to probe the neuronal lineage of the progenitors in all passages (Figure 6). Positive networks of !-tubulin III were observed within individual cells and their processes

209

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors in all passages. Despite nearly 200 passages, equivalent to nearly 2 years in culture, the NSFCs contained similar morphological and immunocytochemical characteristics.

stem cells. The gene profiling was performed on 3 biological samples representing 3 different passages that were collected over a period of 20 months in vitro. The cells were initially cultured in small flasks and repeatedly purified and followed by an RNA quality check. This process was done to make certain the RNA was of the best possible quality to ensure the best accuracy of the results. Detection of even the smallest amounts of contamination can prevent erroneous results and can avoid wasting money on failed microarray slides. Therefore, due to the high cost of the microarray experiments and limited amount of RNA samples, often time pooling samples might be beneficial especially when using a new platform such as Codelink Bioarrays. From the 55K Code Link gene array, a total of 11,345 transcripts were detected in the 3 biological samples. Of these, 4,230 transcripts were uniquely associated with one or the other of these passages (p14, p78, p189). While the 11,345 transcripts may represent a broad definition of phenotype for these cells, the focus of this initial analysis is the 7,115 transcripts that were found to be common to the 3 biological samples because these were present in all 9 arrays, and the analyses for this common set of genes have greater statistical significance.

IV. Discussion This study is the first genome-wide analysis of geneexpression profiling of human ONe derived NSFCs which serves as an initial index of the cellular characteristics of the neural progenitors isolated from ONe. The present study applied a gene-based microarray approach to further characterize this unique progenitor population derived from human olfactory epithelium (Roisen et al, 2001; Marshall et al, 2005; Xiao et al, 2005; Zhang et al, 2005). The findings from this study are summarized as follows: (1) Genes representing both the neuronal and epithelial phenotypes were identified, (2) no aging or senescent genes were detected in NSFCs in the common datasets, and (3) of the 7,115 transcripts, there were 2,694 transcripts identified to be expressed in stem cells. Of those genes expressed in stem cells there were 1,117 genes containing RefSeq accession numbers. Furthermore, the list of common transcripts and the identified stem cell genes are available upon request. In addition, we compared our data (7115 transcripts) to the available database for neurogenic potential of human mesenchymal

Table 1. Validation of expression changes observed in microarray experiments with Real Time-PCR. The values presented in both microarray and RT-PCR was presented as fold changes between p78 versus p14, and p189 versus p14passages.

210

Gene Therapy and Molecular Biology Vol 11, page 211

Figure 5: Biological pathway for the validated differentially expressed genes obtained by microarray and RT-PCR analyses in passage numbers (p14, p78, and p189). This pathway was constructed by searching for the shortest path to connect the genes of interest by other cell processes with which they interacted though expression or regulation only.

Figure 6. Human Olfactory Epithelial Derived Neurosphere Forming Cells. Cells representing young, p14, (Panel A), intermediate, p78, (Panel B) and old, p189 (Panel C) passages were immunopositive for nestin (an intermediate filament found in neural progenitors, green) and peripherin (a neural crest intermediate filament, red) consistent with their progenitor nature. Similar intracellular fibrillar distribution of nestin and peripherin was observed in all passages. The neuronal lineage restriction of NSFCs was probed using !-tubulin III (nerve specific tubulin, green) and peripherin (red) in the p14 (Panel D), p78 (Panel E) and p189 (Panel F) passages. !-tubulin III positive networks were frequently observed throughout individual cells and their processes in all passages. Nuclear DNA was stained with DAPI (blue) Confocal microscopy.

211

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors One of the biologically significant results from this study is the finding of genes representing both the neuronal and epithelial phenotypes. These were also found within the 7,115 common transcripts. For example, the presence of: neurotrophin receptors, nestin, S100, vimentin, #-internexin, glutamate receptors, dopamine

receptors, olfactory receptors, adenylate cyclase, and calcium/calmodulin-dependent protein kinase II # are all indicators of a neural phenotype. In contrast, the presence of several members of the keratin gene family is indicative of the epithelial heritage of the NSFCs (Table 2). As the

Table 2. List of genes present in the cultured progenitor cells as indicators of neuronal and epithelial cell phenotypes. Number 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34

1 2 3 4 5 6 7 8 9 10 11 12

Neuronal Phenotype neurotrophic tyrosine kinase, receptor, type 1 (NTRK1) receptor tyrosine kinase TrkC (NTRK3) brain-derived neurotrophic factor (BDNF), transcript variant 4 GDNF family receptor # 4 (GFRA4), transcript variant 1 GDNF family receptor # 2 (GFRA2) GDNF family receptor # 3 (GFRA3) nestin (NES) NSE1 (NSE1) S100 calcium binding protein A11 pseudogene (S100A11P vimentin (VIM) internexin neuronal intermediate filament protein, # (INA) glutamate receptor, ionotropic, N-methyl D-aspartate 1, transcript variant NR1-1(GRIN1) glutamate receptor, ionotropic, kainate 5 (GRIK5) glutamate receptor, ionotropic, kainate 2 (GRIK2), transcript variant 1 dopamine receptor D2 (DRD2), transcript variant 1 growth arrest and DNA-damage-inducible, # (GADD45A olfactory receptor, family 1, subfamily D, member 2 (OR1D2) olfactory receptor, family 1, subfamily G, member 1 (OR1G1) olfactory receptor, family 5, subfamily I, member 1 (OR5I1) olfactory receptor, family 10, subfamily H, member 3 (OR10H3) olfactory receptor, family 10, subfamily H, member 2 (OR10H2) olfactory receptor, family 1, subfamily D, member 5 (OR1D5) olfactory receptor, family 7, subfamily C, member 1 (OR7C1) olfactory receptor, family 5, subfamily V, member 1 (OR5V1) olfactory receptor-like (PJCG7) pseudogene clone OR9I1 olfactory receptor gene, partial cds clone OR2Z2 olfactory receptor gene, partial cds adenylate cyclase 2 (brain) (ADCY2) adenylate cyclase activating polypeptide 1 (pituitary) receptor type I (ADCYAP1R1 adenylate cyclase activating polypeptide 1 (pituitary) receptor type I (ADCYAP1R1) calcium/calmodulin-dependent protein kinase (CaM kinase) II $ (CAMK2D), transcript variant 3 calcium/calmodulin-dependent protein kinase (CaM kinase) II % (CAMK2G), transcript variant 4 calcium/calmodulin-dependent protein kinase I (CAMK1) calcium/calmodulin-dependent protein kinase (CaM kinase) II # (CAMK2A), transcript variant 1 Epithelial Phenotype keratin, hair, acidic, 3B (KRTHA3B) keratin, hair, acidic, 6 (KRTHA6) keratin, hair, acidic, 3A (KRTHA3A cytokeratin type II (K6HF high-sulphur keratin keratin 16 (focal non-epidermolytic palmoplantar keratoderma) (KRT16 keratin, hair, acidic, 8 (KRTHA8) cytokeratin 2 (HUMCYT2A) keratin associated protein 9-2 (KRTAP9-2) keratin associated protein 9-3 (KRTAP9-3) keratin 6 irs (KRT6IRS) keratin 5b (K5B)

212

Gene Therapy and Molecular Biology Vol 11, page 213 shown in 2005 that cells from the human olfactory mucosa generate neurospheres that are multipotent in vitro. Ongoing studies are aimed at determining factors that influence ONe lineage-restriction. Further analyses of the genes that are common to the 3 biological samples (p14, p78, and p189) are reported here (Table 3). To explore this issue further a list of genetic markers for senescence was derived from Brandenberger and colleagues in 2004 to identify the presence of such markers in the NSFCs. Fourteen markers were found to be below the threshold of detection: TERF2IP (NM_018975.1); TNKS (NM_003747.1); TERF2 (NM_005652.2); TNKS1BP1 (NM_033396.1); TINF2 (NM_012461.1); TNKS2 (NM_025235.2); TERT (NM_003219.1); HSPA9B (NM_004134.4); SIRT7 (NM_016538.1); SIRT1 (NM_012238.3); SIRT3 (NM_012239.3); SIRT5 (NM_012241.2). Together, these studies support previous reports that have shown a relatively high level of viability and proliferative capacity in ONe cells maintained in subculture (Marshall et al, 2005). These findings also relate to the unique regenerative capacity of the olfactory epithelium.

NSFCs are sub-cultured from primary tissue, they have by definition heterogeneous cellular origin. Future studies will be needed to determine if the neural and epithelial markers occur in a common cell type or in distinct subpopulations. Suslov and colleagues indicated in 2002 that neural stem cells are able to generate clonal structures â&#x20AC;&#x153;neurospheresâ&#x20AC;? which exhibit intra-clonal cell-lineage diversity and that their long-term passage allows the continuous propagation of a potentially heterogeneous population. This possibility is the most likely explanation for the present findings. Although, immunolocalization studies have on rare occasion revealed individual cells with both !-tubulin III networks and keratin positive filaments (data not shown). The NSFCs have been amplified clonally (Othman et al, 2005a) to demonstrate that a heterogeneous population forms within 10 DIV. In addition, as a result of the present studies, the ONe derived progenitors have been shown to generate more than one cellular phenotype, irrespective of passage number (Othman et al, 2005a, b). Progenitors from the olfactory bulb of rats and mice have been shown to generate neurospheres that are clonogenic and multipotent (Lu and Martin, 2003). In addition, Murell and colleagues have

Table 3. Gene annotation of the top 10 most highly expressed genes in the common set for passage numbers p14, p78, and p189.

213

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors Even in culture, the ONe progenitor remains mitotically active and does not exhibit obvious signs of senescence with increased time in vitro. However, accumulation of DNA damage via oxidative stress during ageing has been proposed to be the principal mechanism of adult stem cell exhaustion and altered â&#x20AC;&#x153;normal' gene expression (Nijnik et al, 2007). In another study, it has been reported that senescing human cells and ageing mice accumulate DNA lesions with unrepairable double-strand breaks (Sedelnikova et al 2004). Further studies may be beneficial in determining the correlation of DNA damage due to oxidative stress in geriatric individuals over a long period of passages. To gain further insights into the network of genes of the common transcripts (7115), there were 2694 transcripts that were found to be expressed in stem cells. The complete list for those common transcripts and their annotation such as chromosome location, and area of expression is indicated and are available upon request. To further understand the biological meaning of the genes expressed in stem cells, gene annotation of the 1,117 genes containing RefSeq accession numbers were identified. Those genes were clustered based on gene function similarities, and their known biological pathways. While metadata analysis is beyond the scope of this study, a preliminary comparison shows that the NFSCs are a unique stem/progenitor cell population and share only a few similarities to other stem cell populations. The data are difficult to compare in detail, because the analyses are critically dependent on the algorithms used and the arbitrary criteria used to set parameters such as thresholds, type of platform, and the length, the sensitivity and the specificity of the probes. However, four of the most highly expressed genes in the ONe-derived cells, RPL19 (NM_000981.2), RPL38 (NM_000999.2), RPL37A (NM_000998.2), and actin % 1 (NM_001614.2), were comparable to those reported for mesenchymal derived stem cells (Jeong et al, 2005). In addition, the neuronal progenitor related genes, vim (NM_003380.1), Syn1 (NM_006950.2), and Cst3 (NM_000099.2), found in the ONe-derived cells were also identified in fetal stem cells (Luo et al, 2003). We further compared our data (the common sets) to the GEO (Gene Expression Omnibus (GEO) repository, http://www.ncbi.nih.gov/enterz/query.fcgi?db=gds) to human mesenchymal stem cells, and 939 genes were found in common. A representative of the function of those genes is as follows: Histone deacetylase 9 is playing an important role in transcriptional regulation, cell cycle progression and developmental events. Microtubule associated serine/threonine kinase 2, appears to link the dystrophin/utrophin network with microtubule filaments via the syntrophins. Microtubule-associated protein, RP/EB family, member 3 may be involved in microtubule polymerization, and spindle function by stabilizing microtubules and anchoring them at centrosomes, and play a role in cell migration. Slit homolog 2 (Drosophila) is implicated in spinal cord midline post-crossing axon repulsion, and during neural development involved in axonal navigation at the ventral midline of the neural tube and projection of axons to different regions.

Transmembrane protein with EGF-like and two follistatinlike domains might be a novel survival factor for hippocampal and mesencephalic neurons. ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C), is involved in neuronal differentiation and maintenance. Pumilio homolog 1 (Drosophila), is required to support proliferation and self-renewal of stem cells. Opioid receptor, mu 1, inhibits neurotransmitter release by reducing calcium ion currents and increasing potassium ion conductance. LIM domain only 1 (rhombotin 1) (NM_002315), is involved in gene regulation within neural lineage cells potentially by direct DNA binding or by binding to other transcription factors. Paired box gene 5 (B-cell lineage specific activator), plays an important role in B-cell differentiation as well as neural development and spermatogenesis. Chloride channel 3 (NM_001829), plays an important role in neuronal cell function through regulation of membrane excitability by protein kinase C, and it could help neuronal cells to establish short- term memory. SH3-domain GRB2-like 1 may play a regulatory role in synaptic vesicle recycling. Calneuron 1 plays a role in the physiology of neurons and is potentially important in memory and learning. ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3, may be involved in neuronal differentiation and maintenance. The dynamic profile of gene expression detected in stem cells was used to determine the biological significance based on Gene Ontology. For example in the GO annotation, among the molecular function there were two major categories binding (438 genes), and catalytic activity (274 genes). This binding mainly involves ion channels, GTP or ATP binding, ATP synthesis accounts for the extremely high energy consumption by the nervous system, which is critical to all aspects of neural function. Catalytic activity are mainly DNA repair, transporter activity; DNA damage response, and meiosis which are all very critical in the progenitorâ&#x20AC;&#x2122;s therapeutical role as a repair system for the body replenishing specialized cells. In the biological processes, the two major classes are the physiological process (533) and cellular process (337 genes). Physiological processes mainly function in ATP binding; cell cycle; and protein amino acid phosphorylation; Synthesis of high energy phosphate compounds like ATP play a critical role in neuronal energy because it lies at the center of all energy utilization by neurons. While, the cellular process mainly function in inflammatory response; signal transduction; and intracellular protein transport. These cellular processes are keys to developing future cell therapy and maybe prevent abnormal reactions to the diseased state. In the cellular components, two major classes are identified cell (511 genes), and extracellular (31 genes). Cell components mainly function in cell growth and/or maintenance, cell cycle, and mitosis major extracellular components were identified as actin cytoskeleton, epidermal differentiation, and keratinocyte differentiation. In many cases, single genes were associated with multiple GO identifiers. This reflects the biological reality that a particular protein may function in several processes, may contain domains that carry out diverse molecular functions, and may be active in multiple locations in the

214

Gene Therapy and Molecular Biology Vol 11, page 215 cells. This annotation can provide an overview of the biological process, molecular function, cellular localization and pathway information associated with a particular gene product. Gene markers for both differentiated and undifferentiated cells were identified in the ONe derived progenitors. Markers for undifferentiated cells detected in the NSFCs included galanin (NM_033237), ACVR2B (NM_001106.2), and POU5F1 (NM_002701.1) (Bhattacharya et al, 2004). On the other hand, a known gene marker for early differentiation, LIFR (NM_031048) (Bhattacharya et al, 2004), was detected with elevated expression values with an increasing cell passage number. Stem cells from fetal and adult central nervous system have been isolated and characterized, providing populations for potential replacement therapy for traumatic injury repair and neurodegenerative diseases. The regenerative capacity of the olfactory system has attracted scientific interest because olfactory epithelium (OE) has a unique regenerative capacity and is readily accessible from its location in the nasal cavity, allowing for harvest without lasting damage to the donor. Adult OE contains progenitors responsible for the normal life-long continuous replacement of neurons and supporting cells. Neural stem cells have had therapeutic potential in the treatment of neurodegenerative disease like Parkinsonâ&#x20AC;&#x2122;s disease (Parati et al, 2003). Transplanting olfactory progenitors into the human spinal cord have been reported by Feron et al. (2005) and MacKay-Sim (2004). Also, it has been suggested that olfactory mucosa autografts in human spinal cord injuries is relatively safe and potentially beneficial, but they insist that long term patient monitoring is necessary to rule out any delayed side effects (Lima et al, 2006). We believe our study will potentially help these clinical trials by knowing what genes are present in these progenitor cells. Our results have shown no change in the gene expression of telomerase activity over passages. However, there have been studies using embryonic stem cells showing that there have been changes in chromosome 17q and 12 after several passages (Draper et al, 2004), contrastly there are also studies showing no chromosomal abnormalities over several passages (Buzzard et al, 2004; Rosler et al, 2004; Brimble et al, 2004). In our study, we simply concentrated on changes in expression levels of apoptosis related genes and telomerase activity, karyotypic analysis was not our focus. Future studies need to be performed using comparative genomic hybridization (Inzunza et al, 2004) to determine if there are abnormalities in the chromosomes from passage to passage using ONe progenitors in variable culture conditions. The potential application of these cell lines include transplantation where minimal donor material can be isolated, expanded ex vivo, and lineage restricted to a preferred phenotype prior to/or after re-implantation. Furthermore, these strategies circumvent the ethical issues that arise with embryonic or fetal tissues. On the other hand, understanding the molecular mechanisms of selfrenewal, pluripotency and differentiation of stem cells is a prerequisite not only for overcoming the limitation in

using stem cells as therapeutic tool but also unlocking fundamental mysteries of mammalian development. In summary, the whole human genome array from Codelink (GE) was used to identify the progenitor NSFCs derived from human olfactory epithelium. Over 7,000 genes were found to be common to 3 widely spaced passages. We speculate that the genes that were not commonly expressed in all 3 passages are mostly related to differences in cell cycle which was not controlled in the present study. Future studies should employ synchronized cell populations. There were some changes at the expression level for several genes in the common set with the passage number but the biological significance of these changes remains to be determined. In general, the results concurred with previous characterizations of the NSFCs as being a stable progenitor line with little tendency to change with passage number, with the noted exception that there are several genes that were uniquely expressed in each passage. The results also highlight the fact that the NSFCs express genes associated with more than one cellular phenotype which is not surprising given the tissue source. The potential heterogeneous nature of any progenitor population should be considered in future evaluations. The unique regenerative capacity and relative accessibility of the olfactory neuroepithelial derived progenitors makes them unique candidates for future therapeutic and diagnostic strategies.

Acknowledgments This work was supported in part by NIH: NCRR P20 16481 (NC) and NIH: NIH P20RR015576 (FJR). The authors are grateful to Dr. Rudolph S Parrish, Chair, Department of Bioinformatics and Biostatistics, School of Public Health and Information Sciences, University of Louisville, for reviewing this manuscript. We would like also to thank Zhanfang Guo for technical assistance.

References Belbin TJ, Gaspar J, Haigentz M, Perez-Soler R, Keller SM, Prystowsky MB, Childs G, Socci ND (2004) Indirect measurements of differential gene expression with cDNA microarrays. BioTechn 36, 310-314. Bhattacharya B, Miura T, Brandenberger R, Mejido J, Luo Y, Yang AX, Joshi BH, Ginis I, Thies RS, Amit M, Lyons I, Condie BG, Itskovitz-Eldor J, Rao MS, Puri RK (2004) Gene expression in human embryonic stem cell lines: unique molecular signature. Blood 103, 2956-2964. Brandenberger R, Khrebtukova I, Thies RS, Miura T, Jingli C, Puri R, Vasicek T, Lebkowski J, Rao M (2004) MPSS profiling of human embryonic stem cells. BMC Dev Biol 4, 10. Brimble SN, Zeng X, Weiler DA, Luo Y, Liu Y, Lyons IG, Feed WJ, Robins AJ, Rao MS Schultz TC (2004) Karyotic stability, genotyping, differentiation, feeder-free maintenance, and gene expression sampling in three human embryonic stem cell lines derived prior to August 9, 2001. Stem Cells Dev 13, 585-596. Buzzard JJ, Gough NM, Crook JM, Colman A (2004) Karyotype of human ES cells during extended culture. Nature Biotechnol 22, 381-382. Calof AL, Mumm JS, Rim PC, Shou J (1998) The neuronal stem cell of the olfactory epithelium. J Neurobiol 36, 190-205.

215

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors Chen Y, Dougherty E, Bittner M (1997) Ratio-based decisions and the quantitative analysis of cDNA microarray images. J Biomedi Opti 2, 364-374 Chu S, DeRisi J, Eisen M, Mulholland J, Botstein D, Brown PO, Herskowitz I (1998) The transcriptional program of sporulation in budding yeast. Science 282, 699-705. Churchill GA (2004) Using ANOVA to analyze microarray data. BioTechn 37, 173-175, 177. Draper JS, Smith K, Gokhale P, Moore HD, Maltby E, Johnson J, Meisner L, Zwaka TP, Thompson JA, Andrews, PW (2004) Recurrent gain of chromosomes 17q and 12 in cultured human embryonic stem cells. Nature Biotecnol 22, 53-54. Dudoit S, Yang Y, Callow M, Speed T (2002) Statistical methods for identifying differential expressed genes in replicated cDNA microarray experiments. Stat Sini 12, 111139. Feron F, Perry C, Cochrane J, Licina P, Nowitzke A, Urquhart S, Geraghty T, Mackay-Sim A (2005) Autologous olfactory ensheathing cell transplantation in human spinal cord injury. Brain 128, 2951-2960. Getchell TV, Liu H, Vaishnav RA, Kwong K, Stromberg AJ, Getchell ML (2005) Temporal profiling of gene expression during neurogenesis and remodeling in the olfactory epithelium at short intervals after target ablation. J Neurosci Res 80, 309-329. Getchell TV, Peng X, Stromberg AJ, Chen KC, Paul Green C, Subhedar NK, Shah DS, Mattson MP, Getchell ML (2003) Age-related trends in gene expression in the chemosensorynasal mucosae of senescence-accelerated mice. Age Res Rev 2, 211-243. Herzel H, Beule D, Kielbasa S, Korbel J, Sers C, Malik A, Eickhoff H, Lehrach H, Schuchhardt J (2001) Extracting information from cDNA arrays. Chaos 11, 98-107. Hughes TR, Marton MJ, Jones AR, Roberts CJ, Stoughton R, Armour CD, Bennett HA, Coffey E, Dai H, He YD, Kidd MJ, King AM, Meyer MR, Slade D, Lum PY, Stepaniants SB, Shoemaker DD, Gachotte D, Chakraburtty K, Simon J, Bard M, Friend SH (2000) Functional discovery via a compendium of expression profiles. Cell 102, 109-126. Jeong JA, Hong SH, Gang EJ, Ahn C, Hwang SH, Yang IH, Han H, Kim H (2005) Differential gene expression profiling of human umbilical cord blood-derived mesenchymal stem cells by DNA microarray. Stem cells 23, 584-593. Karsten SL, Kudo LC, Jackson R, Sabatti C, Kornblum HI, Geschwind DH (2003) Global analysis of gene expression in neural progenitors reveals specific cell-cycle, signaling, and metabolic networks. Dev Biol 261, 165-182. Lima C, Pratas-Vital J, Escada P, Hasse-Ferreira A, Capucho C, Peduzzi JD (2006) Olfactory mucosa autografts in human sopinal cord injury: a pilot clinical study. J Spinal Cord Med 29, 191-203. Lockhart DJ, Dong H, Byrne MC, Follettie MT, Gallo MV, Chee MS, Mittmann M, Wang C, Kobayashi M, Horton H, Brown EL (1996) Expression monitoring by hybridization to highdensity oligonucleotide arrays. Nat Biotechnol 14, 16751680. Lu J, Féron F, Mackay-Sim A, Waite PM (2002) Olfactory ensheathing cells promote locomotor recovery after delayed transplantation into transected spinal cord. Brain 125, 14-21 Luo Y, Cai J, Ginis I, Sun Y, Lee S, Yu SX, Hoke A, Rao M (2003) Designing, testing, and validating a focused stem cell microarray for characterization of neural stem cells and progenitor cells. Stem cells 21, 575-587. Luo Y, Cai J, Liu Y, Xue H, Chrest FJ, Wersto RP, Rao M (2002) Microarray analysis of selected genes in neural stem and progenitor cells. J Neurochem 83, 1481-1497.

Mackay-Sim A (2004) Olfactory ensheathing cells and spinal cord repair. Keio J Med 54, 8-14. Marshall CT, Guo Z, Lu C, Klueber KM, Khalyfa A, Cooper NG, Roisen FJ (2005) Human adult olfactory neuroepithelial derived progenitors retain telomerase activity and lack apoptotic activity. Br Res 1045, 45-56. Martinez MJ, Aragon AD, Rodriguez AL, Weber JM, Timlin JA, Sinclair MB, Haaland DM, Werner-Washburne M (2003) Identification and removal of contaminating fluorescence from commercial and in-house printed DNA microarrays. Nucl Acids Res 31, e18. McCurdy RD, Féron F, Perry C, Chant DC, McLean D, Matigian N, Hayward NK, McGrath JJ, Mackay-Sim A (2006) Cell cycle alterations in biopsied olfactory neuroepithelium in schizophrenia and bipolar I disorder using cell culture and gene expression analysis. Schiz Res 82, 163-173. Murrell W, Féron F, Wetzig A, Cameron N, Splatt K, Bellette B, Bianco J, Perry C, Lee G, MacKay-Sim A (2004) Multipotent stem cells from olfactory mucosa. Develop Dyn 233, 496-515. Nijnik A, Woodbine L, Marchetti C, Dawson S, Lambe T, Liu C, Rogrigues NP, Crockford TL, Cabuy E, Vindigni A, Enver T, Bell JI, Slijepcevic P, Goodnow CC, Jeggo PA, Cornall RJ (2007) DNA repair is limiting for haematopoietic stem cells during ageing. Nat 447, 686-691. Othman M, Klueber K, Lu C, Winstead W, Roisen F (2005a) Immunomagnetic separation of adult human olfactory neural progenitors. Biotech Histochem 80, 177-188. Othman M, Lu C, Klueber K, Winstead W, Roisen F (2005b) Clonal analysis of adult human olfactory neurosphere forming cells. Biotech Histochem 80, 189-200. Parati EA, Bez A, Ponti D, Sala S, Pozzi S, Pagano SF (2003) Neural stem cells. Biological features and therapeutic potential in Parkinson’s disease. J Neurosurg Sci 47, 8-17. Quackenbush J (2002) Microarray data normalization and transformation. Nat Genet 32 Suppl, 496-501. Ramakrishnan R, Dorris D, Lublinsky A, Nguyen A, Domanus M, Prokhorova A, Gieser L, Touma E, Lockner R, Tata M, Zhu X, Patterson M, Shippy R, Sendera TJ, Mazumder A (2002) An assessment of Motorola CodeLink microarray performance for gene expression profiling applications. Nucleic Acid Res 30, e30. Rao MS (1999) Multipotent and restricted precursors in the central nervous system. Anatomical Rec 257, 137-148. Relogio A, Schwager C, Richter A, Ansorge W, Valcarcel J (2002) Optimization of oligonucleotide-based DNA microarrays. Nucleic Acids Res 30, e51. Roisen FJ, Klueber KM, Lu CL, Hatcher LM, Dozier A, Shields CB, Maguire S (2001) Adult human olfactory stem cells. Brain Res 890, 11-22. Rosler ES, Fisk GJ, Ares X, Irving J, Miura T, Rao MS, Carpenter MK (2004) Long–term culture of human embryonic stem cells in feeder-free conditions. Dev Dynam 229, 259-274. Schena M, Shalon D, Davis RW, Brown PO (1995) Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270, 467-470. Sedelnikova OA, Horikawa I, Zimonjic DB, Popescu NC, Bonner WM, Barrett JC (2004) Senescing human cells and ageing mice accumulate DNA lesions with unrepairable double-stranded breaks. Nat Cell Biol 6, 168-170. Shetty RS, Bose SC, Nickell MD, McIntyre JC, Hardin DH, Harris AM, McClintock TS (2005) Transcriptional changes during neuronal death and replacement in the olfactory epithelium. Mol Cell Neurosci 30, 90-107. Suslov ON, Kukekov VG, Ignatova TN, Steindler DA (2002) Neural stem cell heterogeneity demonstrated by molecular

216

Gene Therapy and Molecular Biology Vol 11, page 217 phenotyping of clonal neurospheres. Proc Natl Acad Sci U S A 99, 14506-14511. Tsuboi Y, Wszolek ZK, Graff-Radford NR, Cookson N, Dickson DW (2003) Tau pathology in the olfactory bulb correlates with Braak stage, Lewy body pathology and apolipoprotein epsilon4. Neuropathol Appl Neurobiol 29, 503-510. Winstead W, Marshall CT, Lu CL, Klueber KM, Roisen FJ (2005) Endoscopic biopsy of human olfactory epithelium as a source of progenitor cells. Am J Rhinol 19, 83-90. Xiao M, Klueber KM, Lu C, Guo Z, Marshall CT, Wang H, Roisen FJ (2005) Human adult olfactory neural progenitors rescue axotomized rodent rubrospinal neurons and promote functional recovery. Exp Neurol 194, 12-30. Xiao M, Klueber KM, Zhou J, Guo Z, Lu C, Wang H, Roisen FJ (2007) Human adult olfactory neural progenitors promote

axotomized rubrospinal tract axonal reinnervation and locomotor recovery. Neurobiol Dis 26, 363-374. Yang YH, Buckley MJ, Speed TP (2001) Analysis of cDNA microarray images. Brief Bioinform 2, 341-349. Yang YH, Dudoit S, Luu P, Lin DM, Peng V, Ngai J, Speed TP (2002) Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation. Nucleic Acids Res 30, e15. Zhang X, Cai J, Klueber KM, Guo Z, Lu C, Qiu M, Roisen FJ (2005) Induction of oligodendrocytes from adult human olfactory epithelial-derived progenitors by transcription factors. Stem Cells 23, 442-453. Zhang X, Klueber KM, Guo Z, Lu C, Roisen FJ (2004) Adult human olfactory neural progenitors cultured in defined medium. Exp Neuro 186, 112-123.

217

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors

218

Gene Therapy and Molecular Biology Vol 11, page 203 Gene Ther Mol Biol Vol 11, 203-218, 2007

Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors Research Article

Abdelnaby Khalyfa1,3,*, Mohamed Buazza3, He Qiang2, Min Xu4, Charles Taylor Marshall1, Fred J. Roisen1, Kathleen M. Klueber1, Nigel GF Cooper1 1

204

205

206

207

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors

C. Characterization expression

global

gene

209

210

Gene Therapy and Molecular Biology Vol 11, page 211

211

1 2 3 4 5 6 7 8 9 10 11 12

212

Table 3. Gene annotation of the top 10 most highly expressed genes in the common set for passage numbers p14, p78, and p189.

213

214

215

216

217

Khalyfa et al: Gene expression profiling for adult human olfactory neuroepithelial-derived progenitors

218

Gene Therapy and Molecular Biology Vol 11, page 219 Gene Ther Mol Biol Vol 11, 219-228, 2007

Monitoring green fluorescent protein for functional delivery of E. coli cytosine deaminase suicide gene and the effect of curcumin in vitro Research Article

P. Gopinath1, Siddhartha Sankar Ghosh1,2,* 1 2

Department of Biotechnology, Indian Institute of Technology Guwahati, Guwahati 781039, India Centre for Nanotechnology, Indian Institute of Technology Guwahati, Guwahati 781039, India

__________________________________________________________________________________ *Correspondence: Siddhartha Sankar Ghosh, Department of Biotechnology, Indian Institute of Technology Guwahati, Guwahati781039, Assam, India; E-mail: sghosh@iitg.ernet.in Key words: GFP, 5-flurocytosine (5-FC), cytosine deaminase (CD), apoptosis, suicide gene therapy Abbreviations: 5'-bromo-2'-deoxyuridine, (BrdU); Acridine orange, (AO); cytosine deaminase, (CD); Dulbecco's Modified Eagle's medium, (DMEM); ethidium bromide, (EB); ethidium bromide, (EtBr); fetal bovine serum, (FBS); green fluorescence protein, (GFP); Luria-Bertani, (LB); measuring mitochondrial activity, (MTS); phosphate buffer saline, (PBS); positron emission tomography, (PET); single-photon emission computed tomography, (SPECT); uracil phosphoribosyl transferase, (UPRT) Received: 23 July 2007; Revised: 29 August 2007 Accepted: 10 September 2007; electronically published: September 2007

Summary Cytosine deaminase (CD) gene has been quite established as a suicide gene for cancer treatment, which converts nontoxic compound 5-flurocytosine (5-FC) to toxic chemotherapeutic agent 5-flurouracil (5-FU). However, besides choosing delivery system, the lack of suitable noninvasive probes to monitor quantitative gene transfer to the malignant tumor is another major concern that limits widespread application of suicide genes. In order to address this problem, we have constructed a dual expressing recombinant plasmid vector which carries CD and green fluorescent protein (GFP) genes. Herein, the GFP expression was used as a tool for monitoring functional CD gene transfer to investigate the mechanism of cell death by 5-FC/CD system in both cancer and non-cancer cells. The efficacy of CD transgene was enhanced when expressed under human ferritin promoter. Molecular analysis by RTPCR established CD gene expression in the transfected cells, whereas mitochondrial activity (MTS) measurements showed the therapeutic effect of 5-FC/CD. Microscopic experiments, measurement of BrdU labeled DNA fragments release, characteristic laddering of chromosomal DNA and involvement of caspase-3 and Bcl-2 corroborated induction of apoptosis. Apoptosis was further synergized in presence of anticancer agent curcumin. Therefore, this noninvasive fluorescent technique was useful for easy monitoring of plasmid based 5-FC/CD system where a combinatorial effect of curcumin was shown to potentiate the therapeutic efficacy of CD gene.

nonviral plasmid vectors has reduced toxic effect in gene therapy (Ghosh et al, 2000; Kren et al, 2003). Even simple electroporation technique was shown to be quite useful for high transgene expression both in vitro and in vivo (Selby et al, 2000; Heller et al, 2002). However, one of the major limitations of such suicide gene therapy is the difficulty in detecting transgene expression following administration with the delivery system, as most of the therapeutic genes have either no ligands or substrates for functional analysis. One could imagine an ideal detection method would be noninvasive and reproducible to provide detail information of gene expression. Such noninvasive methods would facilitate understanding therapeutic outcomes of the transgene by assessing its magnitude and duration, which

I. Introduction Suicide gene therapy is an alternative approach for cancer treatment, especially when conventional therapy show poor prognosis (Springer et al, 2000). Among many such suicide genes, E. coli cytosine deaminase (CD) is well documented for its strong therapeutic efficacy, where CD enzyme converts prodrug 5-FC to a toxic compound 5FU which kills cells by apoptosis (Kai et al, 1997; Miller et al, 2002). Adenoviral vectors carrying CD alone or in combination to another uracil phosphoribosyl transferase (UPRT) gene have been reported with strong therapeutic potential (Erbs et al, 2000; Liu and Deisseroth, 2006). Furthermore, emergence of new delivery systems with

219

Gopinath and Ghosh: Monitoring GFP for functional delivery and the effect of curcumin in vitro gene, respectively. We have used CD1 (5'CCACCATGGTGTCGAATAACGC3', with NcoI linker) and CD2 (5'CGGCTAGCGCCATTAGCTCCGCTG 3', with NheI linker) primers at the following cycle conditions: denaturation at 94ºC for 30s, annealing at 55ºC for 1min and extension at 72ºC for 1min. The 1.2kb amplified CD gene was cloned into the NcoI and NheI restriction sites of the pVITRO2-GFP/LacZ (InvivoGen) replacing LacZ gene. The CD was placed under human ferritin promoter, and the recombinant pCD-GFP clones were selected in LB hygromycin agar plates. Moreover, the same amplified CD gene was also cloned into the pORF-codA::upp plasmid under elongation factor -1! (EF-1! promoter replacing codA::upp fusion gene. The recombinant pCD clones were selected in LB ampicillin agar plates. Here, we have mentioned only the basic pol II promoter units of the above constructs for our convenience. About 60-70% confluent cells were electroporated with recombinant plasmids (2µg plasmid/ well of 6 well plates) in a BIO-RAD Gene Pulser X cell at the following conditions: a square wave of 25 milliseconds, 140V for BHK-21 cells and an exponential wave of 500 µF, 160V for HT 29 cells.

is an important aspect for vector development. Reporter gene systems have been developed to monitor therapeutic gene transfer noninvasively by imaging modalities, one such example is the optical imaging technique for tracking green fluorescence protein (GFP) (Cao et al, 2007). Luciferase and HSV1-tk gene, single-photon emission computed tomography (SPECT) and positron emission tomography (PET) with high sensitivity and spatial resolution are already reported to be useful in noninvasive molecular imaging (Laxman et al, 2002; Sharma et al, 2005; Sander et al, 2006). Considering the above evidence, we have developed a simple noninvasive fluorescence monitoring system for detecting the functional effect of 5-FC/CD via a plasmid based vector in both cancer (HT 29) and non cancer (BHK 21) cells. We have generated a recombinant plasmid expressing dual transcripts: CD and GFP and used electroporation technique to deliver the plasmid to both the cell types. The GFP fluorescence was monitored microscopically to examine the therapeutic effect of 5FC/CD at varying 5-FC concentrations. Our in vitro study reports on the feasibility of CD suicide gene therapy for cell growth inhibition and induction of apoptosis. Moreover, we used curcumin, which is a known anticancer agent in combination with 5-FC/CD therapy to check whether curcumin has any complimentary additive effect on 5-FC gene therapy, since combination therapy in many cancer treatment is known to be more effective (Kambara et al, 2002; Khor et al, 2006). Our primary observation by tracking GFP fluorescence indicated that curcumin synergized 5-FC/CD mediated apoptosis. The investigations were further supported by microscopic and biochemical assays like, nuclear staining, electron micrographs, cell proliferation, BrdU labeled DNA fragments release and regulation of caspase signals. Therefore, the simple monitoring of GFP fluorescence as a direct signature of combination therapy would be useful tool for cancer therapy where two components maximize the anticancer and anti proliferation activities by synergistic effect.

C. PCR and RT-PCR analysis PCR was performed to amplify 1.2kb CD fragment using CD1 and CD2 with linker primers at the following cycle conditions: denaturation at 94ºC for 30s, annealing at 55ºC for 1min and extension at 72ºC for 1min. Total RNA was extracted with Tri reagent (Sigma, USA), and the RT PCR was performed with the same primers according to the manufacturer’s instructions using Enhanced Avian HS RT-PCR kit (Sigma, USA) in Gene Amp PCR system 9700, Applied Biosystems. The PCR primers and cycle conditions used for the semi-quantitative RT PCR of caspase, "-actin and Bcl-2 genes of HT 29 cells were followed according to the reported work of Pillai and colleagues in 2004.

D. Microscopic measurements

and

spectroscopic

1. Confocal microscopy The cytotoxic activity of 5-FC on transfected cells was determined by observing treated and untreated samples under confocal microscope. We have used AO/EB staining solution in PBS with 100!g/ml of acridine orange and ethidium bromide. Dual staining of nuclei with AO/EB was observed under confocal microscopy (LSM 510 Meta, Carl Zeiss, Germany). Acridine orange (AO) staining showed green fluorescence at 488nm excitation with a band pass filter ranging between 505530nm, where as the ethidium bromide (EtBr) staining showed red fluorescence at 585nm long pass filter. Final images were generated by superimposition of both green and red fluorescence. GFP fluorescence of the transfected cells was also observed at 488nm excitation with the 505-530nm band pass filter.

II. Materials and Methods A. Chemicals, media and cell lines High purity molecular biology grade chemicals, reagents and kits were purchased from Sigma-Aldrich, USA and Roche Applied Science, Germany. The restriction enzymes and PCR reagents were from Bio-line, USA. Cell culture media: Dulbecco's Modified Eagle's medium (DMEM), fetal bovine serum (FBS), penicillin, streptomycin were purchased from Sigma-Aldrich, USA. Bacterial growth media: Luria-Bertani (LB) was purchased from HiMedia, India. HT 29 (human colon adenocarcinoma) and BHK21 (baby hamster kidney) obtained from National Centre for Cell Science, India, were maintained in DMEM medium supplemented with 10% FBS, 50U/mL penicillin and 50mg/mL streptomycin in a humidified atmosphere in 5% CO 2 at 37ºC.

2. Scanning electron microscopy The transfected cells grown in 6 well tissue culture plates were treated with 5-FC for 48h and washed with phosphate buffer saline (PBS). The wells containing cells were cut out from the plate with a heated metal cutter, immediately dried and coated with gold film in the sputter coater. Finally, the cell morphology changes were recorded in LEO 1430VP SEM instrument at a magnification of 7,000 at 20KV.

B. Construction of CD-GFP vector and electroporation

3. Fluorescence spectrophotometry Cells transfected with pCD-GFP plasmid were grown up to 24h, scraped off and resuspended in PBS. The GFP fluorescence was quantified using a fluorescence spectrophotometer (Fluromax 3, Jobin yvon) at 488nm excitation wavelength.

The CD gene was PCR amplified from pORF-codA::upp (InvivoGen) plasmid. The codA and upp stands for bacterial cytosine deaminase gene and uracil phosphoribosyl transferase

220

Gene Therapy and Molecular Biology Vol 11, page 221 confocal microscope in Figure 1d (panel A-E for BHK21 and F-J for HT29 cells) after administration of 0, 5, 10, 20 and 50mM concentrations of 5-FC to the transfected cells. A gradual decrease of fluorescence with more detached and rounded off cells were seen at high 5-FC concentrations because of enhanced cytotoxic effect of 5FC/CD (Ueda et al, 2001). Therefore, GFP fluorescence was a direct probe for functional effect of 5-FC/CD which caused cell death. This effect was further validated with the conventional microscopic and biochemical experiments.

E. Cell proliferation assay CellTiter 96 AQueous One Solution Assay kit (Promega, Madison, WI) was used to monitor cell proliferation by measuring mitochondrial activity (MTS). Transfected cells were seeded in 96-well miroplates at a density of 1x104 cells, and treated with varying concentrations of 5-FC for 96h. Finally, 10 µl of AQueous One solution was directly added to the well and incubated for 2hr and the absorbance was measured at 490 nm in a microplate reader. The absorbance of formazon product formed is directly proportional to the number of living cells in culture. The relative cell viability (%) related to control wells containing cell culture medium without 5-FC was calculated by (A) test/(A) control x 100, where (A)test is the absorbance of the test sample and (A)control is the absorbance of the control untreated sample.

B. Effect of promoter strength on cell viability

F. DNA Laddering

The effect of 5-FC/CD suicide gene therapy leading to BHK 21 (non-cancer) and HT (cancer) cell death was examined. The cell proliferation assay that measures the live mitochondrial activity has been shown in Figure 2a and 2b for BHK 21 and HT 29 cell types, respectively (Bernt et al, 2002). Here, we examined the effect of two different promoters on CD gene expression at varying concentrations of 5-FC for both the cells and obtained a concentration dependent reduction of cell growth in the cell proliferation assay. We found that CD gene showed more significant anti-cell proliferation activity when expressed under human ferritin promoter as compared to the EF-1! promoter. Hence, we considered the pCD-GFP construct, where CD gene was under the control of ferritin promoter for our later experiments. From cell proliferation assay Figure 2c , IC50 (the concentration of 5-FC required to inhibit cell growth by 50% compared to the control) was found to be ~20mM; but we found that 5-FC concentration of 10mM, which is below IC50 value was sufficient to induce cell death, and thus was taken as the working 5-FC concentration for further investigations (Rowley et al, 1996).

The transfected cells were treated with 5-FC for 48h and then lysed with buffer containing 5mM Tris-Cl, pH 8.0, 20mM EDTA, and 0.5% Triton X-100 on ice for 20 min. Chromosomal DNA was isolated by gentle phenol/chloroform/isoamyl alcohol (25:24:1, v/v) extraction and alcohol precipitation. Finally, DNA was resuspended in TE (20mM Tris-Cl, 1mM EDTA pH 8.0) buffer containing RNaseA (100 µg/mL) and incubated at 37 °C for 1 h to remove RNA. The DNA fragments were resolved by 1.2% agarose gel electrophoresis.

G. Cellular DNA fragmentation ELISA We have used cellular DNA fragmentation ELISA kit (Roche Diagnostics GmbH, Germany) to determine release of DNA fragments into cytoplasm due to nucleolytic cleavage of the transfected cells after 5-FC/CD treatment. Cellular DNA was metabolically labeled with 10µM BrdU labeling solution for 12h at 37ºC, electroporated with CD- GFP plasmid, seeded in 96well microplate and further incubated for 24h. After 24h, transfected cells were treated with 5-FC for 72h, lysed and the cytoplasmic extract was assayed for quantitative detection of BrdU labeled fragmented DNA release using antibody ELISA technique as per the manufacturers’ instruction.

H. Statistical analysis Statistical analyses were carried out using student’s ‘t’ test. P-values less than 0.05 were considered significant.

C. Molecular mechanism of cell death with 5-FC/CD The mechanism of cell death by 5-FC/CD was further investigated by microscopic and molecular analysis experiments to correlate the information obtained by tracking GFP fluorescence.

III. Results A. GFP expression for functional CD gene transfer The recombinant plasmid (pCD-GFP) containing dual transcripts of CD and GFP gene was introduced in the BHK 21 (non-cancer) and HT 29 (cancer) cells by electroporation. High level GFP expression was observed at 48h under confocal microscopy for both the cell types (Figure 1a). The GFP expression level was substantiated by measuring fluorescence intensity of the transfected cells using fluorescence spectrophotometer in Figure 1b (Richards et al, 2003). It was observed that fluorescence intensity was almost same at 24 and 48 h post transfection. The CD gene transfer was confirmed by PCR analysis, where a 1.2kb amplicon was obtained for BHK 21 (lane 4) and HT 29 cells (lane 5) in Figure 1c, and the corresponding RT-PCR results on total RNA of the transfected cells (lane 7 and 8 of the Figure 1c) confirmed CD gene expression (Xia et al, 2004). The therapeutic effect of CD gene was tested at different concentrations of 5-FC. Fluorescence expression profile was obtained under

1. Microscopic measurements AO and ethidium bromide (EB) mediated double staining of transfected cell-nuclei upon 5-FC addition showed induction of apoptosis (Ribble et al, 2005). Confocal microscopy images of the dual stained nuclei presented in Figure 3a showed that the live cells nuclei stained green due to AO uptake, whereas progressive nuclear uptake of EB due to cell membrane perforation stained nuclei red. Untreated cells had well organized chromatin structures, whereas the treated cells had fragmented or condensed chromatin. SEM micrographs represented in Figure 3b showed that transfected cells upon 5-FC treatment became rounded off with progressive membrane shrinkage and membrane blebbing that are the characteristics of apoptosis (Cohen et al, 1999).

221

Gopinath and Ghosh: Monitoring GFP for functional delivery and the effect of curcumin in vitro

Figure 1 Green fluorescence protein expression and functional CD gene transfer. a (panel A and B) are the fluorescence images of BHK21 and HT 29 observed under confocal microscope at 48h post transfection. b is the fluorescence intensity measurement of GFP for untransfected control (1) and the transfected cells (2) at 24h. c is the agarose gel picture of PCR and RT PCR analysis of the transfected cells. Cellular DNA and RNA extracted from the transfected cells were subjected to PCR (lane 2- 5) and RT-PCR (lane 6- 8) analysis. Lane 1: l DNA/ EcoR I +Hind III marker; lane 2: 1.2kb PCR amplicon of CD as positive control; lane 3 and 6: untransfected control BHK21 cells; lane 4 and 7: CD transfected BHK21cells; lane 5 and 8: CD transfected HT29 cells. d is the fluorescent images of transfected BHK 21 (A-E) and HT 29 cells (F-J) at varying concentrations (0, 5, 10, 20 and 50mM) of 5-FC.

222

Gene Therapy and Molecular Biology Vol 11, page 223

Figure 2 Effect of 5-FC/CD therapy on cell proliferation. Mitochondrial function was determined by the MTS reduction assay at the end of the 96h. a and b represents BHK 21 and HT 29 cells transfected with pCD-GFP and pCD constructs. The column numbers 1, 2, 3, 4 and 5 are for 0, 5, 10, 20 and 50mM concentrations of 5-FC used. c represents cell viability measurement of both the cells transfected with pCD-GFP and treated with at different 5-FC concentrations (0, 5, 10, 20 and 50mM). The IC50 of 5-FC of both the cell types were calculated.

2. Molecular analysis

the synergy on apoptosis (Pillai et al, 2004). Figure 4a represented the confocal microcopy pictures of GFP of 5FC/CD treated samples in presence and in absence of curcumin treatment. The GFP expression was reduced with more rounded off cells in combination treatment (panel C and F) compared to the untreated samples (panel A and D) and 5-FC/CD treatments (panel B and E) for BHK21 and HT 29 cells, respectively. These fluorescence micrographs indicated synergy on cell death by addition of curcumin.

DNA laddering, the widely regarded biochemical hallmark of late apoptosis was observed by agarose gel electrophoresis (Figure 3c) in treated samples obtained at 48h (Cao et al, 2001). In comparison to untreated control (lane 2 and 4, Figure 3c), the occurrence of DNA ladders in lane 3and 5 of Figure 3c confirmed apoptosis.

D. Synergistic apoptosis with 5-FC/ CD and curcumin treatment Curcumin concentration of 40ÂľM has been chosen which is below IC50 value (data not shown) to evaluate

223

Gopinath and Ghosh: Monitoring GFP for functional delivery and the effect of curcumin in vitro

Figure 3 Induction of apoptosis upon 5-FC/CD treatment. Transfected cells were treated with 10mM 5-FC for 48h. a is the confocal micrographs of AO/EB stained nuclei cells. The representative images for BHK 21 and HT 29 cell are shown in panels (A and B) and (C and D), respectively. The arrows indicated green stained nuclei for early apoptosis (EA) and red stained nuclei for late apoptotic (LA). b represents the scanning electron micrographs to show progressive changes in cell membrane morphology during apoptosis. The panels (A & B) are the representative images of BHK21 and HT29 cells. c is agarose gel picture for DNA laddering. After treatment cellular DNA was extracted and subjected to agarose gel electrophoresis. Lane 1: # DNA/EcoR I+ Hind III marker; lane 2: BHK 21 cells without 5-FC; lane 3: BHK 21 cells with 5-FC; lane 4: HT29 cells without 5-FC; lane 5: HT 29 cells with 5-FC.

Biochemical analysis by using 5'-bromo-2'deoxyuridine (BrdU) labeling cellular DNA fragmentation ELISA was performed to validate the synergistic effect of curcumin on apoptosis (Pan et al, 2001). Quantitative release of BrdU labeled DNA fragments to cytoplasm of the treated cells was shown in Figure 4b. The results of column 2 in Figure 4b for 10mM of 5-FC treatment showed that BrdU labeled DNA fragments increased significantly at 72h in the cytoplasm of the treated cells as compared to the untreated control cells (column 1). The results in column 3 indicated even more pronounced DNA fragments release when treated in combination with curcumin (40ÂľM). This experiment confirmed the release of cleaved genomic DNA to cytoplasm during apoptosis

and also the synergistic apoptosis in combine therapy with curcumin. A semi-quantitative RT PCR detected caspase-3 signal in HT 29 cells after 5-FC/CD treatment and in combine therapy with curcumin (Huang et al, 2002). Amplification of caspase-3 in both untreated and treated samples was shown in Figure 4c, where the !-action was used as an internal control. A slight increase of caspase gene expression was noted for both 5-FC and combine treatment (lane 2 and lane 3) than untreated control in lane 1 in Figure 4c, but the corresponding signals of Bcl-2, an anti-apoptotic regulatory protein was considerably reduced in both treatment Figure 4c, which confirmed the involvement of caspase signaling pathway in apoptosis (Todorova et al, 2004).

224

Gene Therapy and Molecular Biology Vol 11, page 225

Figure 4 Effect of curcumin on 5-FC/CD induced apoptosis and caspase signaling. a is the representative confocal micrographs of the transfected cells in presence of 40µM concentrations of curcumin for 72h. b is the cellular DNA-fragmentation ELISA, where the BrdU labeled cells were transfected with pCD-GFP and treated with 5-FC alone or 5-FC in combination with curcumin (40µM) for 72h. The amount of DNA fragments released from nuclei to cytoplasm due to apoptosis was measured by recording absorbance at 450nm. Column numbers 1, 2, 3, are for the untreated cells; 10mM of 5-FC; 10mM of 5-FC with 40µM of curcumin. c represents the expression of pro-apoptotic caspase and anti-apoptotic Bcl2 gene. Transfected cells were treated with 5-FC alone or in combination with 40µM of curcumin for 12h. Cells were harvested, RNA was isolated and RT PCR was performed for caspase-3, Bcl2 and "- actin genes. The PCR products were analyzed in 1.4% agarose gel. Column numbers: 1, 2, 3 are for untreated control cells; 10mM of 5-FC, and 10mM of 5-FC with 40µM of curcumin treatment.

alternative approach with strong therapeutic efficacies in which an expressed protein in cells changes a nontoxic prodrug to a toxic drug that causes cell death by

IV. Discussions In the search of new therapeutic regimens for cancer, the suicide gene therapy has been recently evolved as an 225

Gopinath and Ghosh: Monitoring GFP for functional delivery and the effect of curcumin in vitro multifunctional damages (Yazawa et al, 2002). This therapy has become very successful for challenging solid and malignant tumors in the context of adenoviral vector, where strong bystander effect to kill neighboring cells has been reported (Kurozumi et al, 2004) However, the application of adenovirus mediated gene therapy is quite limited due to high immunogenicity and toxicity of the virus (Ghosh et al, 2006). So, the plasmid based nonviral vector is an alternative delivery system with reduced toxicity, but the gene transduction efficiency is quite low. This problem could be easily addressed by using electroporation technique that enhances the efficiency of plasmid mediated gene transfer both in vitro and in vivo (Somiari et al, 2000; Goto et al, 2000). But, the main obstacle is being the molecular analysis of transgene expression in cells, which involves destructive and invasive methods for analysis. Therefore, development of noninvasive methods for measuring therapeutic transgene expression has become a challenge, as the clinical application of gene therapy is rapidly expanding (Bell and Taylor-Robinson 2000). The simple approach would be the use of reporter gene systems that can be easily monitored by noninvasive techniques (Vooijs et al, 2002). In our study, we have generated such a recombinant plasmid containing dual transcripts of GFP and CD controlled by two different promoters. The recombinant plasmid was electroporated to both cancer HT 29 and noncancer BHK 21 cells, and the corresponding GFP expression was monitored by confocal microscopy which gave a direct signature of functional CD gene transfer by the same plasmid. The level of GFP expression was used an index of therapeutic potential of 5-FC/CD system. This noninvasive detection method with intrinsic stable property of GFP fluorescence and minimal photobleaching effect is superior to other conventional invasive methods for molecular expression assays. Furthermore, CD gene transfer was quantitated by measuring fluorescence of GFP spectrophotometrically of the transfected cells. We have shown that plasmid based 5-FC/CD system induced cell death via apoptosis in both the cell types. The occurrence of apoptosis due to functional effect of 5FC/CD has been substantiated by the conventional microscopic and biochemical measurements. The experimental results suggested involvement of caspase signaling in apoptosis pathway. Confocal microscopy images of AO/EB dual stained nuclei of treated cells depicted apoptosis at 48h post transfection after 5-FC addition, where AO permeated the cells and made the nuclei appear green, but EB stained nuclei red after membrane perforation due to apoptosis. Fragmented apoptotic nuclei that stained green were found to be progressively stained red with EB during cell membrane perforation. The SEM micrographs showed changes in cell morphology with more floated dead cells and sprouted multiple white buds around the surface of the cells due to membrane blebbing, which is a characteristic feature of apoptosis (Dini 2005). Mitochondrial activity was reduced in concentration dependent treatment of 5-FC on CD transfected cells because of mitochondrial membrane damage. Biochemical changes in treated cells showed

specific cleavage of genomic DNA at inter-nucleosomal linker sites producing unique length DNA fragments. The appearance of 180-200bp oligo-nucleosomal fragments as characteristic laddering pattern in agarose gel electrophoresis confirmed cell death due to apoptosis. The molecular methods have clearly demonstrated apoptotic effect of 5-FC/CD system and confirmed the findings of microscopic experiments. Recently, combinatorial therapy is currently considered as the new regimen of medical science where therapeutic efficacy of any conventional drugs could be enhanced with another agent. The concurrent use of therapeutic agents with different or same mechanisms of action is more effective than each of the monotherapeutic regiment alone due to the multifactorial nature of two compounds. Such as, the known anti-cancer compound curcumin has been reported to potentiate anticancer drug celecoxib and oxiplatin (Howells et al, 2007). More investigations are being progressed for clinical use of such combination therapy in cancer treatments, where the synergistic effects of the two - the traditional drug and curcumin could be considered. It is challenging to develop methods where combination of such agents below their IC50 values could achieve high therapeutic efficacy with low toxic side effects. We examined whether the antiproliferation activity of curcumin could enhance therapeutic efficacy of 5-FC/CD- suicide gene therapy. We measured apoptosis by the release of BrdU- labeled cellular DNA fragments using ELISA, and found apoptosis was synergized in the combined therapy at low concentrations of curcumin. Similar effect was observed when Bcl-2, an anti-apoptotic gene expression was reduced prominently in combination treatment. Such synergistic apoptosis promises the development of new therapeutic regimen of combination therapy for wide range use in cancer treatment. In conclusion, our study demonstrates the ability of GFP to noninvasively estimate the level of functional E.coli CD gene in vitro. The chemotherapeutic effect of 5FC/CD was established in a plasmid based system, and the GFP fluorescence was used to probe the functional detection of CD gene. Moreover, the therapeutic efficacy of the CD gene expression was enhanced in a ferritin promoter construct. Induction profile of apoptosis in transfected cells was dependent on 5-FC concentration. The combination treatment of 5-FC/CD with curcumin where the individual component, either 5-FC or curcumin used at much lower concentration than their IC50 values showed synergistic apoptosis. Thus, the present findings suggest that the noninvasive fluorescent based method can be used as a simple tool to monitor new combinatorial approach which has strong therapeutic potential for cancer treatment.

Acknowledgements The work was supported by the Ministry of Human Resources and Development (MHRD), Council of Scientific and Industrial Research [No.37 (1248)/06/EMRII] Government of India. Assistance from Central instruments facility (CIF) IIT Guwahati, for confocal and SEM analysis is gratefully acknowledged. 226

Gene Therapy and Molecular Biology Vol 11, page 227 AT (2006) Combined inhibitory effects of curcumin and phenethyl isothiocyanate on the growth of human PC-3 prostate xenografts in immunodeficient mice. Cancer Res 66, 613-621.

References Bell JD, Taylor-Robinson SD (2000) Assessing gene expression in vivo: magnetic resonance imaging and spectroscopy. Gene Ther 7, 1259-1264.

Kren BT, Ghosh SS, Linehan CL, Roy Chowdhury N, Hackett PB, Roy Chowdhury J, Steer CJ, (2003) Hepatocyte-targeted delivery of Sleeping Beauty mediates efficient gene transfer in vivo. Gene Ther Mol Bio 7, 229-238.

Bernt KM, Steinwaerder DS, Ni S, Li Z, Roffler SR, Lieber A (2002) Enzyme-activated prodrug therapy enhances tumorspecific replication of adenovirus vectors. Cancer Res 62, 6089-6098. Cao F, Drukker M, Lin S, Sheikh AY, Xie X, Li Z, Connolly AJ, Weissman IL, Wu JC (2007) Molecular imaging of embryonic stem cell misbehavior and suicide gene ablation. Cloning stem cells 9, 107-117.

Kurozumi K, Tamiya T, Ono Y, Otsuka S, Kambara H, Adachi Y, Ichikawa T, Hamada H, Ohmoto T (2004) Apoptosis induction with 5-fluorocytosine /cytosine deaminase gene therapy for human malignant glioma cells mediated by adenovirus. J Neuro-Oncol 66, 117-127.

Cao G, Pei W, Lan J, Stetler RA, Luo Y, Nagayama T, Graham SH, Yin X., Simon RP, Chen J, (2001) Caspase-activated DNase/DNA fragmentation factor 40 mediates apoptotic DNA fragmentation in transient cerebral ischemia and in neuronal cultures. J Neurosci 21, 4678-4690.

Laxman B, Hall DE, Bhojani MS, Hamstra DA, Chenevert TL, Ross BD, Rehemtulla A (2002) Noninvasive real-time imaging of apoptosis. Proc Natl Acad Sci USA 99, 1655116555. Liu Y, Deisseroth A (2006) Oncolytic adenoviral vector carrying the cytosine deaminase gene for melanoma gene therapy. Cancer Gene Ther 13, 845-855.

Cohen E, Ophir I, Shaul YB (1999) Induced differentiation in HT29, a human colon adenocarcinoma cell line. J Cell Sci 112, 2657-2666.

Miller CR, Williams CR, Buchsbaum DJ, Gillespie GY(2002) Intratumoral 5-Fluorouracil produced by cytosine deaminase/5-Fluorocytosine gene therapy is effective for experimental human glioblastomas. Cancer Res 62, 773780.

Dini L, (2005) Apoptosis induction in DU-145 human prostate carcinoma cells. Tissue Cell 37, 379-384. Erbs P, Regulier E, Kintz J, Leroy P, Poitevin Y, Exinger F, Jund R, Mehtali M (2000) In Vivo cancer gene therapy by adenovirus-mediated transfer of a bifunctional yeast cytosine deaminase/uracil phosphoribosyltransferase fusion gene. Cancer Res 60, 3813-3822.

Pan J, Xu G, Yeung SJ (2001) Cytochrome C release is upstream to activation of Caspase-9, Caspase-8, and Caspase-3 in the enhanced apoptosis of anaplastic thyroid cancer cells induced by manumycin and paclitaxel. J Clin Endocr Metab 86, 4731-4740.

Ghosh SS, Gopinath P, Ramesh A (2006) Adenoviral Vectors: A promising tool for gene therapy. Appl Biochem Biotechnol 133, 9-29.

Pillai GR, Srivastava AS, Hassanein TI, Chauhan DP, Carrier E (2004) Induction of apoptosis in human lung cancer cells by curcumin. Cancer Lett 208, 163-170.

Ghosh SS, Takahashi M, Parashar B, Thummala NR, Chowdhury NR, Chowdhury JR (2000) Liver directed gene therapy; promises, problems and prospects at the turn of the century. J Hepatol 32, 238-252.

Ribble D, Goldstein NB, Norris DA, Shellman YG (2005) A simple technique for quantifying apoptosis in 96-well plates. BMC Biotechnol 5.

Goto T, Nishi T, Tamura T, Dev SB, Takeshima H, Kochi M, Yoshizato K, Kuratsu J, Sakata T, Hofmann GA, Ushio Y (2000) Highly efficient electro-gene therapy of solid tumor by using an expression plasmid for the herpes simplex virus thymidine kinase gene. Proc Natl Acad Sci USA 97, 354359.

Richards HA, Halfhill MD, Millwood RJ, Stewart CN (2003) Quantitative GFP fluorescence as an indicator of recombinant protein synthesis in transgenic plants. Plant Cell Rep 22, 117-121. Rowley S, Lindauer M, Gebert JF, Haberkorn U, Oberdorfer F, Moebius U, Herfarth C, Schackert H (1996) Cytosine deaminase gene as a potential tool for the genetic therapy of colorectal cancer. J Surg Oncol 61, 42-48 .

Heller LC, Coppola D (2002) Electrically mediated delivery of vector plasmid DNA elicits an antitumor effect. Gene Ther 9, 1321-1325. Howells LM, Mitra A, Manson MM (2007) Comparison of oxaliplatin- and curcumin-mediated antiproliferative effects in colorectal cell lines. Int J Cancer 121, 2929-2937.

Sander WE, Metzger ME, Morizono K, Bonifacino A, Penzak SR, Xie Y, Chen ISY, Bacon J, Sestrich SG, Szajek LP, Donahue RE (2006) Noninvasive molecular imaging to detect transgene expression of lentiviral vector in nonhuman primates. J Nucl Med 47, 1212-1219.

Huang S, Tang M, Hsu K, Cheng Y, Chou C (2002) Fas and Its Ligand, Caspases, and Bcl-2 expression in gonadotropinreleasing hormone agonist-treated uterine leiomyoma. J Clin Endocr Metab 87,4580-4586.

Selby M, Goldbeck C, Pertile T, Walsh R, Ulmer JB (2000) Enhancement of DNA vaccine potency by electroporation in vivo. J Biotechnol 83, 147-152.

Kai GE, Lingfei XU, Zheng Z, Dehua XU, Sun L, Liu X (1997) Transduction of cytosine deaminase gene makes rat glioma cells highly sensitive to 5-Fluorocytosine. Int J Cancer 71, 675-679.

Sharma V, Prior JL, Belinsky MG, Kruh GD, Worms DP (2005) Characterization of a 67Ga/68Ga radiopharmaceutical for SPECT and PET of MDR1 P-glycoprotein transport activity In Vivo: validation in multidrug-resistant tumors and at the blood-brain barrier. J Nucl Med 46, 354-364.

Kambara H, Tamiya T, Ono Y, Ohtsuka S, Terada K, Adachi Y, Ichikawa T, Hamada H, Ohmoto T (2002) Combined radiation and gene therapy for brain tumors with adenovirusmediated transfer of cytosine deaminase and uracil phosphoribosyltransferase genes. Cancer Gene Ther 9, 840845.

Somiari S, Glasspool-Malone J, Drabick JJ, Gilbert RA, Heller R, Jaroszeski MJ, Malone RW (2000) Theory and in Vivo application of electroporative gene delivery. Mol Ther 2, 178-187.

Khor TO, Keum Y, Lin W, Kim J, Hu R, Shen G, Xu C, Gopalakrishnan A, Reddy B, Zheng X, Conney AH, Kong

Springer CJ, Duvaz IN (2000) Prodrug-activating systems in suicide gene therapy. J Clin Invest 105, 1161-1167.

227

Gopinath and Ghosh: Monitoring GFP for functional delivery and the effect of curcumin in vitro Todorova VK, Harms SA, Kaufmann Y, Luo S, Luo KQ, Babb K, Klimberg VS (2004) Effect of dietary glutamine on tumor glutathione levels and apoptosis-related proteins in DMBAinduced breast cancer of rats. Breast Cancer Res Tr 88, 247-256.

suicide gene therapy for cancer. World J Surg 26, 783-789.

Ueda K, Iwahashi M, Nakamori M, Nakamura M, Matsuura I, Yamaue H, Tanimura H, (2001) Carcinoembryonic antigenspecific suicide gene therapy of cytosine deaminase/5fluorocytosine enhanced by the Cre/loxP system in the orthotopic gastric carcinoma model. Cancer Res 61, 61586162. Vooijs M, Jonkers J, Lyons S, Berns A (2002) Noninvasive imaging of spontaneous retinoblastoma pathway-dependent tumors in mice. Cancer Res 62, 1862-1867. Xia K, Liang D, Tang A, Feng Y, Zhang J, Pan Q, Long Z, Dai H, Cai F, Wu L, Zhao S, Chen Z, Xia J (2004) A novel fusion suicide gene yeast CDglyTK plays a role in radio gene therapy of nasopharyngeal carcinoma. Cancer Gene Ther 11, 790-796.

Siddhartha Sankar Ghosh

Yazawa K, Fisher WE, Brunicardi FC (2002) Current progress in

228