Gene Therapy & Molecular Biology Volume 6 Issue A by Niko Boulikas

GENE THERAPY & MOLECULAR BIOLOGY FROM BASIC MECHANISMS TO CLINICAL APPLICATIONS

Volume 6 2003 Published by Gene Therapy Press

GENE THERAPY & MOLECULAR BIOLOGY FREE ACCESS www.gtmb.org

!!!!!!!!!!!!!!!!!!!!!!!! ! Editor

Teni Boulikas Ph. D., CEO Regulon Inc. 715 North Shoreline Blvd. Mountain View, California, 94043 USA Tel: 650-968-1129 Fax: 650-567-9082 E-mail: teni@regulon.org

Teni Boulikas Ph. D., CEO, Regulon AE. Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9853849 Fax: +30-210-9858453 E-mail: teni@regulon.org

!!!!!!!!!!!!!!!!!!!!!!!! ! Assistant to the Editor Maria Vougiouka B.Sc., Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9858454 Fax: +30-210-9858453 E-mail: maria@cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!! ! Associate Editors

Aguilar-Cordova, Estuardo, Ph.D., AdvantaGene, Inc., USA Berezney, Ronald, Ph.D., State University of New York at Buffalo, USA Crooke, Stanley, M.D., Ph.D., ISIS Pharmaceuticals, Inc, USA Crouzet, Joël, Ph.D. Neurotech S.A, France Gronemeyer, Hinrich, Ph.D. I.N.S.E.R.M., IGBMC, France Rossi, John, Ph.D., Beckman Research Institute of the City of Hope, USA Shen, James, Ph.D., Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan, Republic of China & University of California at Davis, USA. Webb, David, Ph.D., Celgene Corporation, USA Wolff, Jon, Ph.D., University of Wisconsin, USA

!!!!!!!!!!!!!!!!!!!!!!!! ! Editorial Board Akporiaye, Emmanuel, Ph.D., Arizona Cancer Center, USA Anson, Donald S., Ph.D., Women's and Children's Hospital, Australia Ariga, Hiroyoshi, Ph.D., Hokkaido University, Japan Baldwin, H. Scott, M.D Vanderbilt University Medical Center, USA Barranger, John, MD, Ph.D., University of Pittsburgh, USA Black, Keith L. M.D., Maxine Dunitz Neurosurgical

Institute, Cedars-Sinai Medical Center, USA Bode, Jürgen, Gesellschaft für Biotechnologische Forschung m.b.H., Germany Bohn, Martha C., Ph.D., The Feinberg School of Medicine, Northwestern University, USA Bresnick, Emery, Ph.D., University of Wisconsin Medical School, USA Caiafa, Paola, Ph.D., Università di Roma “La Sapienza”, Italy Chao, Lee, Ph.D., Medical University of South Carolina, USA

Cheng, Seng H. Ph.D., Genzyme Corporation, USA Clements, Barklie, Ph.D., University of Glasgow, USA Cole, David J. M.D., Medical University of South Carolina, USA Chishti, Athar H., Ph.D., University of Illinois College of Medicine, USA Davie, James R, Ph.D., Manitoba Institute of Cell Biology;USA DePamphilis, Melvin L, Ph.D., National Institute of Child Health and Human, National Institutes of Health, USA Donoghue, Daniel J., Ph.D., Center for Molecular Genetics, University of California, San Diego, USA Eckstein, Jens W., Ph.D., Akikoa Pharmaceuticals Inc, USA Fisher, Paul A. Ph.D., State University of New York, USA Galanis, Evanthia, M.D., Mayo Clinic, USA Gardner, Thomas A, M.D., Indiana University Cancer Center, USA Georgiev, Georgii, Ph.D., Russian Academy of Sciences, USA Getzenberg, Robert, Ph.D., Institute Shadyside Medical Center, USA Ghosh, Sankar Ph.D., Yale University School of Medicine, USA Gojobori, Takashi, Ph.D., Center for Information Biology, National Institute of Genetics, Japan Harris David T., Ph.D., Cord Blood Bank, University of Arizona, USA Heldin, Paraskevi Ph.D., Uppsala Universitet, Sweden Hesdorffer, Charles S., M.D., Columbia University, USA Hoekstra, Merl F, Ph.D., Epoch Biosciences, Inc., USA Hung, Mien-Chie, Ph.D., The University of Texas, USA Johnston, Brian, Ph.D., Somagenics, Inc, USA Jolly, Douglas J, Ph.D., Advantagene, Inc.,USA Joshi, Sadhna, Ph.D., D.Sc., University of Toronto Canada Kaltschmidt, Christian, Ph.D., Universität Witten/Herdecke, Germany Kiyama, Ryoiti, Ph.D., National Institute of Bioscience and Human-Technology, Japan Krawetz, Stephen A., Ph.D., Wayne State University School of Medicine, USA Kruse, Carol A., Ph.D., La Jolla Institute for Molecular Medicine, USA Kuo, Tien, Ph.D., The University of Texas M. D. Anderson Cancer USA Kurachi Kotoku, Ph.D., University of Michigan Medical School, USA Kuroki, Masahide, M.D., Ph.D., Fukuoka University School of Medicine, Japan Lai, Mei T. Ph.D., Lilly Research Laboratories USA

Latchman, David S., PhD, Dsc, MRCPath University of London, UK Lavin, Martin F, Ph.D., The Queensland Cancer Fund Research Unit, The Queensland Institute of Medical Research, Australia Lebkowski, Jane S., Ph.D., GERON Corporation, USA Li, Jian Jian, Ph.D., City of Hope National Medical Center, USA Li, Liangping Ph.D., Max-Delbrück-Center for Molecular Medicine, Germany Lu, Yi, Ph.D., University of Tennessee Health Science Center, USA Lundstrom Kenneth, Ph.D. , Bioxtal/Regulon, Inc. Switzerland Malone, Robert W., M.D., Aeras Global TB Vaccine Foundation, USA Mazarakis, Nicholas D. Ph.D., Oxford BioMedica, UK Mirkin, Sergei, M. Ph.D., University of Illinois at Chicago, USA Moroianu, Junona, Ph.D., Boston College, USA Müller, Rolf, Ph.D., Institut für Molekularbiologie und Tumorforschung, Phillips-Universität Marburg, USA Noteborn, Mathieu, Ph.D., Leiden University, The Netherlands Papamatheakis, Joseph (Sifis), Ph.D., Institute of Molecular Biology and Biotechnology Foundation for Research and Technology Hellas, USA Platsoucas, Chris, D., Ph.D., Temple University School of Medicine, USA Rockson, Stanley G., M.D., Stanford University School of Medicine, USA Poeschla, Eric, M.D., Mayo Clinic, USA Pomerantz, Roger, J., M.D., Tibotec, Inc., USA Raizada, Mohan K., Ph.D., University of Florida, USA Razin, Sergey, Ph.D., Institute of Gene Biology Russian Academy of Sciences, USA Robbins, Paul, D, Ph.D., University of Pittsburgh, USA Rosenblatt, Joseph, D., M.D, University of Miami School of Medicine, USA Rosner, Marsha, R., Ph.D., Ben May Institute for Cancer Research, University of Chicago, USA Royer, Hans-Dieter, M.D., (CAESAR), Germany Rubin, Joseph, M.D., Mayo Medical School Mayo Clinic, USA Saenko Evgueni L., Ph.D., University of Maryland School of Medicine Center for Vascular and Inflammatory Diseases, USA Salmons, Brian, Ph.D., (FSG-Biotechnologie GmbH), Austria Santoro, M. Gabriella, Ph.D., University of Rome Tor Vergata, USA Sharrocks, Andrew, D., Ph.D., University of Manchester, USA

Shi, Yang, Ph.D., Harvard Medical School, USA Smythe Roy W., M.D., Texas A&M University Health Sciences Center, USA Srivastava, Arun Ph.D., University of Florida College of Medicine, USA Steiner, Mitchell, M.D., University of Tennessee, USA Tainsky, Michael A., Ph.D., Karmanos Cancer Institute, Wayne State University, USA Sung, Young-Chul, Ph.D., Pohang University of Science & Technology, Korea Taira, Kazunari, Ph.D., The University of Tokyo, Japan Terzic, Andre, M.D., Ph.D., Mayo Clinic College of Medicine, USA Thierry, Alain, Ph.D., National Cancer Institute, National Institutes of Health, France

Trifonov, Edward, N. Ph.D., University of Haifa, Israel Van de Ven, Wim, Ph.D., University of Leuven, Belgium Van Dyke, Michael, W., Ph.D., The University of Texas M. D. Anderson Cancer Center, USA White, Robert, J., University of Glasgow, UK White-Scharf, Mary, Ph.D., Biotransplant, Inc., USA Wiginton, Dan, A., Ph.D., Children's Hospital Research Foundation, CHRF , USA Yung, Alfred, M.D., University of Texas, USA Zannis-Hadjopoulos, Maria Ph.D., McGill Cancer Centre, Canada Zorbas, Haralabos, Ph.D., BioM AG Team, Germany

!!!!!!!!!!!!!!!!!!!!!!!! ! Associate Board Members

Aoki, Kazunori, M.D., Ph.D., National Cancer Center Research Institute, Japan Cao, Xinmin, Ph.D., Institute of Molecular and Cell Biology, Singapore Falasca, Marco, M.D., University College London, UK Gao, Shou-Jiang, Ph.D., The University of Texas Health Science Center at San Antonio, USA Gibson, Spencer Bruce, Ph.D., University of Manitoba, USA Graâ&#x20AC;˘a, Xavier, Ph.D., Temple University School of Medicine, USA

For submission of manuscripts and inquiries: Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org

Gu, Baohua, Ph.D., The Jefferson Center, USA Hiroki, Maruyama, M.D., Ph.D., Niigata University Graduate School of Medical and Dental Sciences, Japan MacDougald, Ormond A, Ph.D., University of Michigan Medical School, USA Rigoutsos, Isidore, Ph.D., Thomas J. Watson Research Center, USA

Instructions to authors: Gene Therapy and Molecular Biology (GTMB) FREE ACCESS www.gtmb.org Scope Gene Therapy and Molecular Biology, bridging various fields is one of the most rapid with free access at gtmb.org. The scope of Gene Therapy and Molecular Biology is to promote interaction between researchers in the fields of Gene Therapy and Molecular Biology providing rapid publication of review articles and research papers. Articles (both invited and submitted) review or report novel findings of importance to a general audience in gene therapy, molecular medicine, gene discovery, and molecular biology with emphasis to molecular mechanisms. The journal will accept papers on all aspects of gene therapy, including gene delivery systems, gene therapy of cancer and other diseases (e.g. CFTR, hemophilia, AIDS, restenosis) at the clinical, preclinical or cell culture stage, gene discovery, cancer immunotherapy, DNA vaccines, use of DNA regulatory elements in gene transfer, cell therapy and transplantation, arraying technologies & DNA chips, peptide libraries and drug discovery related to gene therapy, cell targeting, gene targeting, therapy with oligonucleotides (antisense, ribozymes, triplex). The authors are encouraged to elaborate on the molecular mechanisms that govern a gene therapy approach. Gene Therapy and Molecular Biology will also publish articles on, transcription factors, DNA replication, recombination, repair, chromatin, nuclear matrix, DNA regulatory regions, locus control regions, protein phosphorylation, signal transduction, development, and on molecular mechanism of human disease. To make the publication attractive authors are encouraged to include color figures.

Type of articles Both review articles and original research articles will be considered. In addition, short 1-2 page news & views will also be considered for publication. Original research articles should contain a generous introduction in addition to experimental data. The articles contain information important to a general audience as the volume is also addressed to researches outside the field. There is no limit on the length of the articles provided that the subject is interesting to a general audience and covers exhaustively a field. The typical length of each manuscript is a approximately 4-20 printed page including Figures and Tables. This is 12-60 manuscript pages. Charges, Complimentary reprints & Subscriptions There are no charges for color figures or page numbers. Corresponding authors get a one-year free subscription (hard copy) plus 25 reprints free of charge. The free subscription can be renewed for additional years by having one paper per year accepted for publication. The free electronic access to articles published in " Gene Therapy and Molecular Biology " to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in gene therapy (from molecular mechanisms to clinical trials), the high quality

in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board being assembled are prognostic factors of a big success for GTMB.

Sections of the manuscript Each manuscript should have a Title, Authors, Affiliation, Corresponding Author (with Tel, Fax, and Email), Summary, key words , running title and Introduction; review articles are subdivided into headings I, II, III, etc. (starting with I. Introduction) subdivided into A, B, C, and further subdivided using 1, 2, 3, etc. You can further subdivide into 1, 2, 3, etc. Research articles are divided into Summary; I. Introduction; II. Materials and Methods III. Results; IV. Discussion; Acknowledgments; and References. Please include in your text citations the name of authors and year in parenthesis; for three or more authors use: (name of first author et al, with year); for two authors please use both names. Please delete hidden text for references. In the reference list, please, type references with year and Journal in boldface and provide full title of the article such as: Buschle M, Schmidt W, Berger M, Schaffner G, Kurzbauer R, Killisch I, Tiedemann J-K, Trska B, Kirlappos H, Mechtler K, Schilcher F, Gabler C, and Birnstiel ML (1998) Chemically defined, cell-free cancer vaccines: use of tumor antigen-derived peptides or polyepitope proteins for vaccination. Gene Ther Mol Biol 1, 309-321. To avoid delays it is essential to submit an electronic and a hard copy version of your manuscript via email and mail in a floppy, CD-ROM or ZIP, containing the manuscript that will be used to typeset the paper. Please include in the digital media: Tables, if any, (preferably as a Microsoft Word text) and Figure legends. Please use Microsoft Word, font “Times” (Mac users) or “Times New Roman” (PC users) and insert Greek or other characters using the “Insert/Symbol” function in the Microsoft Word rather than simple conversion to font “Symbol”. Please boldface Figure 1, 2, 3 etc. as well as Table 1, 2, etc. throughout the text. Please provide the highest quality of prints of your Figures; whenever possible, please provide in addition an electronic version of your figures. Article contributors are kindly requested to provide a color (or black/white) photo of themselves (preferably 4x5 cm or any size) or a group photo of the authors, as we shall include these in the publication Submission and reviewing Peer reviewing is by members of the Editorial Board and external referees. Please suggest 2-3 reviewers providing their electronic addresses, mailing addresses and telephone/fax numbers. Authors are sent page proofs. Gene Therapy and Molecular Biology is published in on high quality paper, hardbound, and with excellent reproduction of color figures. Reviewing is completed within 5-15 days from receiving the manuscript. Articles accepted without revisions (i.e., review articles) will be published online (www.gtmb.org) in approximately 1 month following submission.

Please submit an electronic version of full text and figures preferably in jpeg format. The electronic version of the figures will be used for the rapid reviewing process. High quality prints or photograph of the figures and the original with one copy should be sent via express mail to the Editorial Office. Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org The free electronic access to articles published in "GTMB" to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in cancer, the anticipated high quality in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board being assembled are prognostic factors of a big success for the newly established journal.

Table of contents

Gene Therapy and Molecular Biology Vol 6, December 2003

Pages

Type of Article

Article title

Authors (corresponding author is in boldface)

1-24

Review Article

Mammalian genome organization and its implications for the development of gene therapy vectors

Daniele Zink, Andreas Bolzer, Christoph Mayr, Wolfgang Hofmann, Nicolas Sadoni, and Klaus Ă&#x153;berla

25-31

Review Article

Novel developments for applications of Kenneth Lundstrom alphavirus vectors in gene therapy

33-46

Review Article

The Hitchhiking principle: Optimizing JĂźrgen Bode, Christian P. Fetzer, Kristina Nehlsen, Monica Scinteie, Bokepisomal vectors for the use in gene Hee Hinrichsen, Armin Baiker, therapy and biotechnology

Christoph Piechazcek, Craig Benham,and Hans J. Lipps

47-55

Review Article

Mammalian genome organization and its implications for the development of gene therapy vectors

Merav Cohen, Katherine L. Wilson, and Yosef Gruenbaum

57-67

Research Article

Design and construction of oncoretroviral vectors expressing a packageable ribonuclease for use in HIV gene therapy

Alka Arora, Reza Nazari, Betty Lamothe, Sanjeev Singwi and Sadhna Joshi

69-77

Research Article

Tat-RNase H and its use in HIV gene therapy

Yuri Melekhovets, Ali Ramezani, Lianna Kyriakopoulou and Sadhna Joshi

79-89

Research Article

DNA Vaccination for the induction of immune responses against HIV-1 , subtype C envelope gene in mice

Alka Arora, John L. Fahey, and Pradeep Seth

91-99

Research Article

James A. Grunkemeyer, Clague P. Hodgson, and Dominic Cosgrove

101-119

Research Article

Sustained tissue -specific transgene expression from a vl30 retrotransposon-derived vector in vivo Cytokine gene transduced T cells in the treatment of allergic encephalomyelitis and airway hypersensitivity

121-131

Review Article

LZ Chen, Rosemarie DeKruyff, Dale Umetsu, J-W Oh, Jeanette Thorbecke and Gerald Hochwald

The adenine nucleotide translocator as Anne-Sophie Belzacq, Helena L.A. Vieira, Marjorie Perrimon, Florence a potential therapeutic target

Verrier, Isabel Cohen, Guido Kroemer, and Catherine Brenner

133-142

Review Article

Reticuloendotheliosis virus-derived vectors for human gene therapy

Ralph Dornburg

143-148

Review Article

Design of methacrylate-based polyplexes for tumor targeting

Gert Storm, Enrico Mastrobattista, Ferry J. Verbaan, Daan J.A. Crommelin and Wim E. Hennink

149-157

Research Article

Regulation of globin genes expression: New findings made with the chicken domain of alpha globin genes

Elena S. Ioudinkova, Olga V. Iarovaia, Klaus Scherrer, and Sergey V. Razin,

159-167

Review Article

Surface-shielded polycation-based systems targeting reporter and therapeutic genes to distant tumors

Ralf Kircheis, Lionel Wightman, Malgorzata Kursa, Birgit Smrekar, Elinborg Ostermann, and Ernst Wagner

169-181

Research Article

A retroviral model for tissue-specific transcription: lessons for gene therapy

Quan Zhu and Jaquelin P. Dudley

183-194

Review Article

Integrating vector and stem cell-based strategies for gene therapy of Duchenne muscular dystrophy

Michael L. Roberts, Steve Patterson, and George Dickson

195-200

Reserach Article

Bifidobacterium longum as a gene delivery system for cancer gene therapy

Minoru Fujimori, Toshiyuki Nakamura, Takayuki Sasaki, Kazuyuki Yazawa, Jun Amano, Yasunobu Kano, Shunâ&#x20AC;&#x2122;ichiro Taniguchi

Gene Therapy and Molecular Biology Vol 6, page 1

Gene Ther Mol Biol Vol 6, 1-24, 2001

Mammalian genome organization and its implications for the development of gene therapy vectors Review Article

Daniele Zink1*, Andreas Bolzer1, Christoph Mayr1, Wolfgang Hofmann3, Nicolas Sadoni1, and Klaus Überla4 1

LMU München, Institut für Anthropologie und Humangenetik, Goethestr. 31, 80336 München, Germany Novartis International AG, Lichtstr. 35, WSJ 200.192, 4002 Basel, Switzerland 4 Universität Leipzig, Institut für Virologie, Johannisalle 30, 04103 Leipzig 3

_________________________________________________________________________________________________ *Correspondence: Daniele Zink Phone: +49 (0) 89/5996-617, Fax: +49 (0) 89/5996-618, e-mail: Dani.Zink@lrz.uni-muenchen.de Key words: Nuclear architecture, genome architecture, chromosome structure, interphase chromosome territory, nuclear positioning, nuclear localization, chromatin structure, genome dynamics, integration site, integrating gene therapy vector Abbreviations: adeno-associated virus, (AAV); Emery-Dreifuss muscular dystrophy, (EDMD); human immunodeficiency virus type 1, (HIV-1); inner nuclear membrane, (INM); inter-chromosomal domain compartment (ICD); lamin B receptor, (LBR); lamina-associated polypeptide-1, (LAP 1); locus control region, (LCR); Rous Sarcoma Virus, (RSV); scaffold- or matrix-attached regions, (S/MARs); simian immunodeficiency virus, (SIV) Received: 11 January 2001; accepted: 24 January 2001; electronically published: February 2004

Summary The transcription of mammalian genes and transgenes integrated into mammalian genomes is regulated at three different levels: the molecular level (comprising the interaction of transcription factors with specific DNA elements), the level of chromatin structure, and the level of nuclear architecture. Transcriptional regulation of integrating gene therapy vectors is only well investigated at the molecular level, few data exist regarding the involvement of chromatin structure, and virtually nothing is known about the involvement of nuclear chromosomeand genome architecture. Therefore, it is not surprising that the expressional behavior of gene therapy vectors after integration is often unpredictable and difficult to improve. This review will outline, after giving an overview of recent results and concepts concerning mammalian genome architecture, how this level of organization might be involved in the transcriptional regulation of integrating vectors. First results will be presented and the implications for future vector development will be discussed. in chromatin packaging, ranging from nucleosome-DNA interactions and histone modifications to only rarely understood forms of higher-order packaging of chromatin. Although gene regulation at this level is less well understood, many details, in particular regarding nucleosome-DNA interactions and their dynamic regulation as well as the influences of histone modifications and specific forms of higher-order packaging on gene regulation, were intensively studied and are in the focus of research activities (Henikoff, 1990; Imhof and Wolffe, 1998; Varga-Weisz and Becker, 1998; Strahl and Allis, 2000).

I. Introduction The transcription of mammalian genes is regulated at three different levels: the molecular level, the level of chromatin structure, and the level of nuclear architecture. The first level, comprising the interaction of positive and negative regulatory transcription factors with specific DNA elements flanking a gene, has been investigated for many years now and multiple regulatory processes are understood in detail. During the nineties research concentrated also on the second level of gene regulation, i.e. chromatin structure. Gene regulation at this level concerns a plenitude of structures and processes involved

Zink et al: Mammalian genome organization and gene therapy vectors

In contrast, not very much is known about the question how mammalian nuclear architecture and in particular nuclear chromosome- and genome architecture is involved in transcriptional regulation. Detailed knowledge is still missing. Nevertheless, recent studies gave for the first time clear evidence for a specific mammalian chromosome- and genome architecture and its involvement in functional processes like replication or transcription. In the following paragraphs we will describe the present state of knowledge. The review will concentrate on results obtained with mammalian cells. (Although this review focuses on mammalian nuclear architecture and a comparison between different eukaryotic taxa would go far beyond the necessary limitations of this review it should be noted that important concepts regarding functional nuclear architecture have been developed in model organisms like yeast and Drosophila (Cockell and Gasser, 1999) and citations therein). As until recently no clear evidence existed for a specific functional genome architecture in mammals, it was also difficult to investigate its involvement in gene regulation. There is not only a remarkable lack of knowledge in this regard concerning the regulation of endogenous genes. It is even less understood how integrated exogenous sequences, as proviruses or retroviral gene therapy vectors are regulated in the context of functional genome architecture. As transcriptional regulation of gene therapy vectors is only well investigated at the molecular level, few data exist regarding involvement of chromatin structure, and nothing is known about the involvement of nuclear chromosomeand genome architecture it is not surprising that the expressional behavior of gene therapy vectors after integration is often unpredictable and difficult to improve. In the following paragraphs we will outline, after giving an overview about the recent results concerning mammalian genome architecture, how this level of organization might be involved in the transcriptional regulation of integrating vectors. First results will be presented and the implications for future vector development will be discussed.

rich Alu-repeats are predominantly integrated into the GCrich R-bands (Korenberg and Rykowski, 1988; Dunham, 1999; Hattori et al, 2000). More important concerning functional chromosomeand genome architecture is the finding that the bulk of genes localizes to R-bands (Craig and Bickmore, 1993; Hattori et al, 2000). Only about 20% of all human genes are found within G-bands. Strikingly, housekeeping genes are found almost exclusively within R-bands. Correspondingly, R-bands are rich in CpG islands (Craig and Bickmore, 1994). Therefore, one would expect transcriptional activity mainly confined to R-band chromatin during interphase. This is consistent with the estimation that about 97% of the mostly cell type specific G-band genes are inactive in a given cell type (Goldman et al, 1984). It was also well documented that chromosomal banding patterns are related to another interphase function, namely the process of replication. While R-bands harbor early replicating chromatin, G- and C-bands replicate late during S-phase (Dutrillaux et al, 1976; Camargo and Cervenka, 1982). Although these findings indicated that the organization of mitotic chromosomes into alternating distinct bands might be closely related to functional chromosome and genome architecture during interphase, clarification of this point was a major problem. Favored models, like the random-walk/giant-loop model, did not predict that interphase chromosome organization is related to the structure of mitotic chromosomes (Sachs et al, 1995; Yokota et al, 1995). Other favored models like the interchromosomal domain compartment (ICD)-model (Cremer et al, 1993, 1995) also did not make clear suggestions regarding this relationship. Thus, for more than ten years after the discovery that during interphase chromosomes occupy individual territories (Schardin et al, 1985; Lichter et al, 1988), the relationship between the organization of mitotic and interphase chromosomes remained unclear as well as the internal structure of interphase chromosomes and their contribution to a presumable higher-order genome architecture within cell nuclei. Interestingly, the major impulse that led to recent advances in understanding nuclear genome architecture came from replication labeling studies. Nakayasu and Berezney, (1989) for the first time that DNA synthesized at specific temporal stages during S-phase localizes to specific nuclear sub-regions. Therefore, pulse labeling with nucleotide analogs at specific S-phase stages results in typical nuclear patterns. During early S-phase, hundreds of small so-called replication foci occupy the nuclear interior. At later stages of S-phase the replication activity within the nuclear interior ceases and replication foci concentrate at the nuclear and nucleolar peripheries. During late S-phase, replication activity is only found within a few large foci, which locate at the nuclear periphery as well as within the nuclear interior. It was mainly believed that these patterns reflect a specific Sphase arrangement of replication proteins and DNA and

II. Mammalian chromosome- and genome Since the end of the eighties it became more and more clear that the banding patterns of mammalian mitotic chromosomes are closely related to mammalian genome organization (Bickmore and Sumner, 1989; Craig and Bickmore, 1993). For example, DNA sequence composition differs between the so-called R- and G- or Cbands. While R-bands are GC-rich, G- and C-bands (the latter contain heterochromatic repeats while G- and Rbands belong to the euchromatin) are AT-rich. Interestingly, the about 105 copies of AT-rich LINEelements within the human genome are mainly found in the AT-rich G-bands, while the about 106 copies of GC-

Gene Therapy and Molecular Biology Vol 6, page 3

therefore patterns of pulse-labeled DNA were predominantly investigated during S-phase from the extensive literature on S-phase replication patterns (Manders et al, 1992; OÂ´Keefe et al, 1992; Aten et al, 1992, 1993; Berezney et al, 1995). However, eight years after the first description of these patterns it was published in 1997 that the typical patterns of DNA pulse-labeled at specific S-phase stages are maintained at other cell cycle stages (Ferreira et al, 1997). This finding indicated that DNA with a specific replication timing occupies specific nuclear positions not only during S-phase. The results further indicated that DNA with a defined replication timing locates to its typical nuclear positions already at telophase/early G1. Therefore, the data implied that a defined higher-order architecture of chromatin with a specific replication timing exists within mammalian cell nuclei independent of the replication process. Furthermore, it was shown that this higher-order organization is related to the banding patterns of mitotic chromosomes. It was concluded that chromosomes re-arrange their banding patterns at interphase into clusters of early- or later replicating chromatin and that alignment of these interphase chromosomes with a particular sub-structure gives rise to the observed higher-order nuclear architecture of chromatin. However, a direct prove for a particular substructure of interphase chromosomes was missing as well as its involvement in other nuclear functions like, for example, transcription. Double-pulse labeling experiments directly demonstrated for chromosomes 13 and 15 that R- and G/C-bands are maintained during interphase as distinct domains but are rearranged in cycling cells in a way that R-bands cluster in one part of the interphase chromosome while G-/C-bands cluster in another part, thereby giving rise to a polar sub-structure of the chromosome territory (Zink et al, 1999) (Figure 1). Additional double-pulse labeling experiments demonstrated that a polar substructure is generally adopted by interphase chromosomes and that the alignment of the polar chromosomes generates the higher-order nuclear arrangement of chromatin into specific compartments that can be distinguished by their replication timing (Sadoni et al, 1999) (Figure 2). Furthermore, it was shown that this specific higher-order compartmentalization organizes chromatin not only with regard to the process of replication but also with regard to the process of transcription. Transcriptional activity is confined to the nuclear interior (interior compartment), which is occupied by early replicating R-band chromatin (Sadoni et al, 1999)(Figure 3). In contrast, no obvious transcriptional activity is found at the nuclear and nucleolar peripheries (peripheral compartments) and minor internal compartments (late replicating compartments) which are occupied by later replicating G-/C-band chromatin. The relationships between mitotic chromosome structure, polar interphase chromosome structure, and the typical nuclear

Figure 1. Three-dimensional structure of chromosome 15 territories. Early replicating R-band DNA (red) and late replicating G-/C-band DNA (green) of chromosome 15 territories was labeled by double-pulse replication labeling several cell cycles before fixation (for exact procedures see (Zink et al, 1999)). After immunodetection, chromosome territories were scanned by confocal microscopy, segmented and threedimensionally reconstructed. The squares from which the reconstructed territories are build correspond to the voxels of the original image stacks. The axes correspond to those of the confocal microscope and the ticks denote distances of 1 Âľm. The figure shows pseudo three-dimensional visualizations of two chromosome 15 territories from quiescent cells (a, b) and two chromosome 15 territories from cycling G1 cells (e, f). The overlap between red R-band domains and green G-/C-band domains is shown in yellow and exclusively (c,d,g,h) below each corresponding panel. Note that R- and G-/C-band chromatin occupies exclusive domains in G0 as well as in G1 chromosome territories. R- and G-/C-band domains display a polar organization (clustering within different parts of the territory) only in G1 chromosome territories (e, f). The figure was reproduced with permission from (Zink et al, 1999).

Zink et al: Mammalian genome organization and gene therapy vectors

higher-order genome compartments established by the alignment of polar interphase chromosomes are summarized in Figure 4. The figure also outlines the functional characteristics of the distinct nuclear higherorder compartments regarding the processes of replication and transcription and the distribution of highly acetylated isoforms of histone H4. It was shown that this specific

functional higher-order genome architecture, which seems to be highly conserved in mammals, is present during all interphase stages (Sadoni et al, 1999). An elegant study by Dimitrova and Gilbert, (1999) recently demonstrated that higher-order compartments are established in early G1 in parallel with the determination of the replication timing of comprised chromatin.

Figure 2. Establishment of higher-order compartments after cell division and contribution of single chromosome territories to higher-order genome organization. Synchronized HeLa cells were double-pulse labeled with two different thymidine analogs (Iododesoxy-uridine, IdU, red and Chlorodesoxy-uridine, CldU, green) according to the labeling scheme shown at the top. This doublepulse labeling scheme results in simultaneous labeling of the interior compartment containing early replicating R-band chromatin (IdU, red) and the peripheral compartments containing later replicating G-/C-band chromatin (CldU, green). After 14h the labeled cells went through mitosis and panels a, b, c show three different nuclear planes of two early G1 daughter cells. These early G1 cells already established the higher-order genome organization typical for cycling cells. IdU labeled early replicating chromatin fills the nuclear interior while CldU labeled late replicating chromatin occupies the nuclear peripheries (exclusively visible in the peripheral nuclear planes, a) as well as the nucleolar peripheries (e.g. arrowhead in c). 69h after double-pulse labeling the labeled cells went through at least two cell divisions. Therefore, the nuclei contain a mixture of labeled and unlabeled (not visible) chromosomes (Zink et al, 1998, 1999). Panel (d) shows a mid-nuclear plane of one cell nucleus with a few labeled chromosome territories (double-labeled “patches”). The polar structure of the single chromosomes is visible and the parts of the territories occupied by CldU-labeld chromatin are oriented towards the nuclear or nucleolar (arrowheads) peripheries while those parts occupied by IdU labeled chromatin localize to the nuclear interior between these peripheries (IdU and CldU label is exclusively shown in e and f). The alignment of these polar chromosome territories with a defined nuclear orientation leads to the higher-order chromatin organization as shown in panels a, b and c. This figure was reproduced from “The Journal of Cell Biology”, Sadoni et al, 1999, Vol. 146(6), pp. 1211-1226, by copyright permission of “The Rockefeller University Press”.

Gene Therapy and Molecular Biology Vol 6, page 5

Figure 3. RNA synthesis is confined to the early replicating interior compartment. Higher-order genome compartments of HeLa cells (a,b,c) and CHO cells (d,e,f) were marked by replicational pulse labeling (green). A so-called type I pattern (b) highlights the interior compartment containing the early replicating R-bands while a so-called type III pattern (e) labels the peripheral compartments containing the later replicating G- and C-bands (for the distinct labeling patterns and their relationship to chromosomal bands see (Sadoni et al, 1999)). Nascent RNA was labeled with short pulses of BrUTP (red, c,f). The merge of replication labeling patterns and BrUTP labeling patterns shows that nascent RNA synthesis is confined to the interior nuclear compartment (a) and exclusded from the peripheral compartments (d). Arrows in f show that sites occupied by the replication label are indeed devoid of BrUTP label. The nascent RNA label in the left upper corner in a and c stems from an adjacent nucleus which displays no replication label. This figure was reproduced from “The Journal of Cell Biology”, Sadoni et al, 1999, Vol. 146(6), pp. 1211-1226, by copyright permission of “The Rockefeller University Press”.

In addition, it was shown that higher-order chromatin architecture is clonally inherited (Sadoni et al, 1999). In agreement with these data it was demonstrated for different human cell types that the gene-poor (high proportion of G-bands) chromosome 18 occupies more peripheral positions in cell nuclei while the gene-rich (high proportion of R-bands) chromosome 19 occupies more central positions (Croft et al, 1999). Although it was hypothesized that at least in Drosophila heterochromatic sequences play an important role in nuclear chromatin architecture (Csink and Henikoff, 1996), data obtained with translocations between chromosomes 18 and 19 indicated that the centromeric heterochromatin does not play an outstanding role in chromosome positioning. Rather, sub-regions of the euchromatic chromosome arms seem to localize to corresponding nuclear sub-regions independent from the rest of the chromosome (Croft et al, 1999).

III. How is nuclear architecture integrated with the other levels of gene regulation? The results described so far raise the question what mediates the nuclear positioning of chromosomes and chromosomal sub-regions. The establishment of the typical mammalian genome compartments (occupying specific nuclear positions) shortly after mitosis in early G1, the clonal inheritance of this form of genome compartmentalizaton as well as the results obtained with translocation chromosomes (see above) imply that chromosomal sub-regions must contain positional information that mediates their correct nuclear localization. The close relationship between chromosome banding patterns during mitosis, interphase chromosome organization, and nuclear higher-order genome architecture suggests that positional information might be specific for chromosome bands or sub-bands. Regarding the nature of the positional information it lies unlikely in the DNA sequence as the active and

Zink et al: Mammalian genome organization and gene therapy vectors

inactive X chromosomes of female mammals adopt nuclear positions corresponding to their functional states (Belmont et al, 1986) although their DNA sequences are similar. This implies that an answer to the question about the positional information might lie in the functional regulation. Indeed, it has been demonstrated that replication timing, transcriptional regulation, corresponding changes of chromatin structure, and nuclear localization are closely related to each other. This applies to the functionally distinct X chromosomes of female mammals, to chromosomal bands and sub-bands in the size range of mega-basepairs (see above) as well as to single gene loci (Hatton et al, 1988; Dhar et al, 1989; Forrester et al, 1990; Imhof and Wolffe, 1998; Dimitrova and Gilbert, 1999). Although the findings show that the different levels of gene regulation are closely linked to each other, the question remains how they are integrated and which is the cause and the consequence of what. Regarding the question, how gene regulation at the molecular level, chromatin structure and nuclear positioning are linked to each other, one possibility might be provided by regulatory proteins like Ikaros. This protein is a transcription factor in activated lymphocytes and binds to specific regulatory DNA sequences (Lo et al, 1991). Target sequences have been described within many lymphoid-associated genes (Hambor et al, 1993; Molnar and Georgopoulos, 1994). Strikingly, Ikaros localizes to clusters of centromeric satellite DNA (included into the silenced, late replicating compartments described above) in activated or cycling mouse lymphocytes (Brown et al, 1997, 1999). Inactive gene loci associate with these clusters and it was suggested that Ikaros is involved in recruiting genes upon inactivation to these clusters (Brown et al, 1997, 1999). Thus, Ikaros might be involved in both, regulation at the molecular level and nuclear positioning and therefore provides a link between these two levels of gene regulation. Another way of integrating information between the different levels of gene regulation might be provided by modifications of the chromatin structure. Specific modifications of chromatin structure are closely linked to the molecular level of gene regulation and it is, for example, well established that transcription factors target enzymes to specific gene loci that alter the histoneacetylation status (Grant et al, 1998; Imhof and Wolffe, 1998; Utley et al, 1998). The once established histoneacetylation status is maintained during mitosis and it has been suggested that the histone-acetylation status serves as a cellular “memory” in order to transmit information concerning the activity of gene loci from one interphase into the next (Jeppesen, 1996). Strikingly, histone acetylation patterns also follow the chromosomal banding patterns during mitosis (Jeppesen and Turner, 1993) and are specific for the corresponding higher-order genome compartments during interphase (Sadoni et al, 1999) (Figure 4). It is tempting to speculate that, as the positional information carried through mitosis is likely not

transferred via the DNA sequence, it is provided by chromosme band and gene locus specific chromatin modifications like histone acetylation patterns. Thus, histone-acetylation patterns and other chromatin modifications might play a multiple role in i) creating specialized structures at the chromatin level suitable for transcription or silencing, ii) conveying cellular memory regarding gene activity and iii) serve as a “tag” for specific nuclear positions. Regarding the latter point, this would imply that the connection between gene regulation at the molecular level and higher-order nuclear architecture is mediated via the chromatin structure. A close link between chromatin structure and nuclear positioning has been demonstrated with regard to the human !-globin locus (Schübeler et al, 2000). Here, general histone H3/H4 acetylation correlates with a general nuclease sensitivity of the !-globin locus, which is typical for the “open state” of active genes. As studies with mutated loci did show, these changes of chromatin structure (histone H3/H4 acetylation, nuclease sensitivity) occur independent from a functional locus control region (LCR) and correlate with a re-localization of the locus away from the centromeric heterochromatin (included into the inactive, late replicating compartments described above). As in the absence of a functional LCR the !globin locus is transcriptionally inactive these data show that transcriptional activity is not a prerequisite for relocalization of the locus in a specific nuclear compartment. However, in this case it is not clear whether localization into a specific nuclear compartment is a prerequisite for propagation of an open or closed chromatin structure and histone acetylation or a consequence thereof. Concerning the relationship between the three levels of gene regulation, they might not reflect a strict hierarchy. As suggested by Schübeler et al, (2000) the different levels might interact in a multi-step process. According to this model, specific cis-acting elements in the !-globin locus other than the LCR are responsible for establishing an open/acetylated chromatin configuration in conjunction with the specific nuclear localization. This LCR independent pre-activation step would be followed by a LCR dependent local change in chromatin structure and gene activation. In addition, it is tempting to speculate whether gene regulation at the molecular level, chromatin structure and nuclear architecture are not only required at specific points of an integrative multi-step process but also play specific roles in the establishment and maintenance of defined functional states. In this sense, chromatin structure and nuclear positioning might rather play a role in “freezing” and maintaining established states, while transcription factors might impose flexibility on the system if necessary. In this regard it is interesting to note that nuclear re-positioning of silenced genes in murine lymphocytes occurs only if silencing becomes heritable (Brown et al, 1999). Also an intriguing study by

Gene Therapy and Molecular Biology Vol 6, page 7

Francastel et al, (1999) supports this view. Here, the authors integrated a reporter construct under the control ofthe 5’HS2 enhancer into different sites. of the genome of K 562 erythroleukemia cells. They found in accordance with earlier studies that an intact enhancer counteracts position dependent silencing. In accordance with the studies described above (Brown et al, 1997, 1999; Schübeler et al, 2000) active constructs localize away from centromeric heterochromatin. Mutational analysis demonstrated that the same enhancer motifs were required for both suppression of transgene silencing and localization of the transgene away from centromeric heterochromatin. In addition, binding of transcription

factors to core enhancer sequences increased the stability of an active chromatin structure as assessed by DNase I and methylation analysis. Interestingly, this study revealed that transcriptional activity per se does not influence the localization of the transgenes but that the nuclear position corresponds to the stability of the expressional status. These data support the notion that nuclear positioning might be involved in “freezing” an established state while the interaction of transcription factors with corresponding DNA elements can serve to establish specific functional states and to switch them (high levels of expression at normally repressive loci).

Figure 4. The scheme depicts the higher-order organization of mammalian genomes during mitosis and interphase. The well characterized bands of mitotic chromosomes give rise to distinct higher-order functional compartments within the cell nucleus. Distinct bands of mitotic chromosomes differ in a variety of features as isochore composition and corresponding DNA sequence composition (Bickmore and Sumner, 1989; Craig and Bickmore, 1993; Bernardi, 1995), gene content (Bickmore and Sumner, 1989; Craig and Bickmore, 1993; Bernardi, 1995; Cross et al, 1997), acetylation levels of histone H4 (Jeppesen and Turner, 1993), transcriptional activity of genes (Craig and Bickmore, 1993; Craig and Bickmore, 1994) and replication timing during interphase (Camargo and Cervenka, 1982; Dutrillaux et al, 1976). Differences in DNA sequence composition ((Sadoni et al, 1999) (Rae and Franke, 1972; Manuelidis and Borden, 1988; O´Keefe et al, 1992)), acetylation levels of histone H4 (Sadoni et al, 1999), transcriptional activity (see Figure 3) and replication timing (Ferreira et al, 1997; Sadoni et al, 1999) of chromatin targeted to distinct nuclear compartments demonstrate the functional features of these compartments and their relation to genome organization revealed by banding patterns of mitotic chromosomes. R-band sequences (symbolized by red dots) localize to the interior compartment while G- and C-band sequences localize to the peripheral and late replicating compartments (symbolized by green and grey dots). Higher order nuclear compartments are build up by chromosome territories displaying a polar distribution of R-band DNA and G-/C-band DNA (see Figures. 1 and 2). Speckles occupy chromatin-depleted regions within the interior compartment (see (Sadoni et al, in press) and Figure 6). This figure was reproduced with minor changes from “The Journal of Cell Biology”, Sadoni et al, 1999, Vol. 146(6), pp. 1211-1226, by copyright permission of “The Rockefeller University Press”.

Zink et al: Mammalian genome organization and gene therapy vectors

In addition, the study by Francastel et al, (1999) revealed that the chromosomal integration sites possess nuclear addresses that are related to their ability to suppress transcriptional activity. For example, an integration site where the transgene was also stably active in the absence of a functional enhancer was always at a position distant from centromeric DNA, suggesting that this was its “default address”. In contrast, more repressive loci moved closer to the centromeric DNA in the absence of a functional enhancer. In the light of these results it is obvious that a promising strategy for obtaining transcriptionally active transgenes is to integrate them into chromosomal sites that possess a “default address” for the active nuclear compartment (see chapter IX). From the previous chapter it is clear that these are the chromosomal R-bands.

-bands do not show a polar organization within chromosome territories (Zink et al, 1999) (Figure 1), the nuclear positions of chromosome territories 18 and 19 become similar and chromosome 18 is located at more central positions (Bridger et al, 2000), accordingly, late replicating chromatin occupies also central nuclear positions (Figure 5) and silenced genes do no longer contact clusters of centromeric DNA (Brown et al, 1999). These differences to cycling cells suggest that higherorder genome architecture plays a prominent role in functions specifically associated with the cell cycle. Remarkably, although overall nuclear higher-order architecture is relaxed in non-cycling cells, the distinct band domains of chromosomes are maintained (Figure 1) (Zink et al, 1999). This result demonstrates that expressed and silenced gene loci, which cluster in the distinct chromosomal bands do not intermingle in quiescent cells but are still organized into distinct higher-order domains. As from the genome-associated functions mentioned above only transcription is maintained in non-cycling cells, chromosomal band domains might play a role in creating suitable environments for transcription or silencing. It should be kept in mind that chromosomal bands are in the size range of mega-basepairs and that the nuclear domains created by these bands display diameters in the size range of several hundred nanometers and are well resolvable by light microscopy. Therefore, as these domains are already of considerable size, it might only for transcriptional regulation not be necessary to build up from these domains the huge higher-order compartments typical for cycling cells (Figure 4). As stated above, this even higher level of genome organization might become important if the number and complexity of associated processes increases.

IV. Involvement of nuclear organization in functions specific for cycling cells Providing broader chromosomal regions where genes with similar states of activity cluster (as for example the R-bands where the constitutively active housekeeping genes cluster) with a default “address” for the suitable nuclear compartment might help to efficiently organize the genome after mitosis. It should be considered that in the case that each single gene locus must be sorted out individually after mitosis the cell nucleus would have the difficult task to sort about hundred-thousand loci (diploid nucleus) in a short time period (after the highly energy consuming process of mitosis during which a cell cannot exert its functional duties a cell should be ready for function again as soon as possible). Individual sorting of each locus would also be sterically difficult and might lead to an entangling of DNA fibers that would be challenging to handle during the next mitosis. Therefore, providing broader chromosomal regions harboring many genes with a “default address” and thereby facilitating genome dynamics associated with cell division might be one reason why chromosomal bands evolved. Indeed, so far no good explanation exists for the fact that on mammalian chromosomes specific genes (and other specific sequences) cluster within chromosomal bands. A default sorting mechanism for the bulk of genes does not exclude, of course, that under special conditions single gene loci within a band might switch their “address” by mechanisms discussed above. Indeed, it should be considered that gene expression is only one of the manifold genome-associated functions and that higher-order architecture might also play an important role in other processes. The results described above demonstrated that higher-order genome architecture is closely linked to the process of replication and chromosome organization during mitosis. Replication and mitosis do not occur in quiescent and senescent cells. Strikingly, higher-order genome architecture seems to be “relaxed” in quiescent and/or senescent cells: R- and G-/C

V. How dynamic is the architecture of mammalian genomes? Regarding cycling cells, the finding that the nuclear higher-order architecture established in early G1 is maintained during all stages of interphase (Sadoni et al, 1999) implies that mammalian genomes are not very dynamically organized. The most dynamic process associated with mammalian genomes is mitosis. Nevertheless, recent data obtained with live cell microscopy suggest that dramatic rearrangements of chromosomal domains do not occur during mitotic prophase (Manders et al, 1999). This is in accordance with the finding that R- and G- or C-bands, that alternate on mitotic chromosomes, display a polar organization during interphase. As G- and C-bands are already attached to the nuclear lamina during interphase, R-bands only have to be retracted into interstitial positions in order to create a mitotic chromosome, which indeed seems to be the case (Zink, unpublished observations). These findings also support the idea that the maintenance of band domains and their polar organization in cycling cells facilitates mitosis (see above). Accordingly, also no complicated

Gene Therapy and Molecular Biology Vol 6, page 9

rearrangements seem to take place after mitosis. Timelapse series of centromeric domains show that they are redistributed at telophase/G1 transition by uniform isometric expansion with little evidence for directed motion of individual centromeres (Sullivan and Shelby, 1999). Another process, which was expected to be associated with considerable chromatin dynamics is the

process of replication. However, also the process of replication does not involve large-scale movements of chromatin. Chromatin occupies already shortly after mitosis those nuclear compartments where it will replicate during S-phase (Ferreira et al, 1997; Dimitrova and Gilbert, 1999; Sadoni et al, 1999). In these compartments the replication factories appear at the appropriate time

Figure 5. Nuclear genome organization is â&#x20AC;&#x153;relaxedâ&#x20AC;? in quiescent cells. Early R-band and later replicating G-/C-band DNA of human diploid fibroblasts was labeled with two 30 min pulses of IdU (red, first pulse) and CldU (green, second pulse) with a chase period of 6h between the two pulses. The cells were examined after one mitosis in G1 (a,b) or G0 (c,d). Note that the later replicating chromatin (b,d) is no more confined to the peripheral compartments in quiescent cells but is distributed throughout the nuclear volume (d). This is in accordance with the fact that chromosome territories loose their polar structure in G0 (compare Figure 1). Nevertheless, although the huge higher-order compartments are disorganized in quiescent cells, the chromatin is still confined to distinct band domains (compare Figure 1).

Zink et al: Mammalian genome organization and gene therapy vectors

points of S-phase, locally replicate the chromatin without performing large-scale movements and leave the newly synthesized chromatin in these compartments after performing their task (Leonhardt et al, 2000). Remarkably, the replication factories also do not perform large-scale movements in order to â&#x20AC;&#x153;visitâ&#x20AC;? the distinct genome compartments during S-phase progression. The changes in higher-order nuclear patterns of replication factories during S-phase are due to an asynchronous and constant process of assembly and reassembly of these factories (Leonhardt et al, 2000). Also time-lapse microscopy of single interphase chromosomes or pericentromeric domains in live cells revealed that large-scale movements are exceptional (Shelby et al, 1996; Zink et al, 1998; Sullivan and Shelby, 1999). Nevertheless, some large-scale movements have been observed and are also suggested by fixed cell studies (the latter are reviewed in (De Boni, 1994)). However, this does not contradict the finding that the overall higherorder nuclear architecture is maintained. If chromosome domains move within a particular compartment or between functionally equivalent compartments (e.g. if a pericentromeric C-band domain moves from the nuclear to the nucleolar periphery) the overall higher-order nuclear architecture would be maintained. Together the data obtained with cycling cells suggest that large-scale movements of chromosomes or chromosomal sub-domains in cells, which do not change their functional state are rare and slow (Zink and Cremer, 1998). The kinetics of the movements observed are compatible with the idea that diffusion is the driving force (Zink and Cremer, 1998; Bornfleth et al, 1999) and so far (except for the phenomenon of nuclear rotation in neuronal cells) no chromatin dynamics have been described that could only be explained by the involvement of motor proteins. So far, no comprehensive data exist regarding the extent of re-arrangements taking place if a cell switches its functional state. Re-localization of single activated and silenced genes is linked to B-cell differentiation (Brown et al, 1997). Whether this occurs during interphase or in association with mitosis has to be determined. At least for quiescent lymphocytes it was shown that the repositioning of gene loci in response to stimulation occurs before cell division (Brown et al, 1999). The kinetics of these movements are not known but these movements seem to take place during a time period of several hours and therefore might also be slow. In contrast, re-positioning of chromosome 18 to the nuclear periphery after stimulation of quiescent cells does not take place before the first mitosis. As re-positioning occurs during G1 after the first mitosis nuclear movements of the chromosome seem to be involved (Bridger et al, 2000). Regarding the extent of re-arrangements it should be kept in mind that no gross differences could be detected in the interphase higher-order genome architecture of different cell types (Ferreira et al, 1997; Sadoni et al,

1999). A relatively constant genome architecture in functionally different cells is also indicated by the fact that replication patterns are highly conserved (from the extensive literature on S-phase replication patterns see e.g. (Nakayasu and Berezney, 1989; Aten et al, 1992, 1993; Manders et al, 1992; O"Keefe et al, 1992; Berezney et al, 1995)). Therefore, at least with regard to cycling cells that switch their functional state one would expect that this does not lead to gross alterations in overall nuclear genome architecture but that re-positioning rather affects single gene loci with altered functional states.

VI. Anchoring domains

chromosome

The finding that chromosomal domains are predominantly stably positioned raises the question whether there are specific interactions between defined chromosomal domains and other nuclear components that anchor chromosomal domains at specific nuclear regions. This seems to be the case with regard to the nuclear lamina. In mammalian cells the nuclear lamina consists of A- and B-type lamins (lamin C belongs to the A-type lamins) that form a meshwork underlying the inner nuclear membrane (INM) (Stuurman et al, 1998). While B-type lamins are found in all nucleated somatic cells, the expression of A-type lamins is developmentally regulated. In addition to the lamins, a variety of lamin-binding proteins are associated with the inner nuclear membrane (Gerace and Foisner, 1994; Gant and Wilson, 1997). These include the lamin B receptor (LBR) and different isoforms of the lamina-associated polypeptide-1 (LAP 1) and LAP 2. Two proteins related to LAP 2, named emerin and MAN, also reside at the INM. Loss of emerin causes Emery-Dreifuss muscular dystrophy (EDMD) (Bione et al, 1994). The INM proteins seem to interact with DNA and chromatin in multiple ways: for example, biochemical studies suggest that the tail domains of lamins bind to DNA and core histones (Burke, 1990; Glass et al, 1993; Taniura et al, 1995). LBR and LAP2 both bind to chromatin in vitro. Particularly interesting is the chromatin-binding partner of LBR, which are the mammalian HP1-type proteins (Ye and Worman, 1996; Ye et al, 1997). These proteins are associated with repressed chromatin and the LBR seems to play a role in targeting membranes to repressed G- and C-band chromatin (Pyrpasopoulou et al, 1996). Therefore, the LBR might be involved in establishing the silenced compartment at the nuclear periphery after mitosis. This might be an alternative mechanism of chromatin positioning in addition to the mechanisms discussed above. In addition to the LBR, A-type lamins seem to play a role in anchoring the silenced chromatin at the nuclear periphery. Obvious discontinuities in this chromatin layer are present in cells derived from A-type lamin knockout mice (Sullivan et al, 1999). However, it is not clear

Gene Therapy and Molecular Biology Vol 6, page 11

whether this is due to a direct interaction of peripheral chromatin with A-type lamins or due to the interaction of the peripheral chromatin with other factors, which are mislocalized in A-type lamin mutants. The latter possibility is supported by the following findings: emerin is mislocalized in A-type lamin mutants and an EDMD-like phenotype occurs in mice after ablation of A-type lamin expression (Sullivan et al, 1999). Interestingly, human EDMD in most cases maps to the emerin locus on the Xchromosome (Bione et al, 1994). However, a human autosomal dominant variant of EDMD maps to the lamin A/C gene (Bonne et al, 1999). How defects at the nuclear lamina can cause the EDMD phenotype is still unclear. Another principle for anchoring chromatin domains within the cell nucleus might be the interaction of socalled scaffold- or matrix-attached regions (S/MARs) with a skeleton of protein cross-ties called nuclear matrix (interphase) or nuclear scaffold (metaphase). It is now generally accepted that the DNA within a mammalian nucleus can be organized into about 60 000 chromatin loops, each representing an independent regulatory unit. The domain organization is brought about by the anchorage of the loop bases to the nuclear matrix via S/MARs. As the properties of S/MARs and the nuclear matrix are extensively reviewed elsewhere (Berezney et al, 1995; Bode et al, 1995; Boulikas, 1995; van Driel et al, 1995; Pederson, 2000) and as this review focuses on genome architecture above the level of chromatin loops these topics will not be further discussed here.

is in agreement with the finding that transcriptionally active gene loci are in intimate contact with speckles (Xing et al, 1995). Also, the mainly positionally stable speckles can move to sites where transcriptional activity is induced (Misteli et al, 1997). However, it has also been shown that there is a fraction of active gene loci, which is not in contact with speckles (see (Xing et al, 1995) and citations therein). Furthermore, splicing factors only concentrate into speckles and there is a substantial fraction of these factors, which is more uniformly distributed within the nucleus (see e.g. (Misteli et al, 1997)). The diffusely distributed factors might be sufficient to provide at least a part of the active loci with splicing factors and a closer contact to speckles with a higher concentration of these factors might only be necessary in cases of high transcriptional activity. Recent studies indicated that the splicing factor ASF/SF2 fused to GFP that is also concentrated in speckles moves through the nucleus with high mobility (Kruhlak et al, 2000; Phair and Misteli, 2000). Regarding the diffusion coefficient of 0.24 µm2s-1 there seems to be no difference between ASF-GFP molecules enriched in speckles and those more diffusely distributed. Although the rate of diffusion is about hundred times slower than expected there seems to be a rapid movement of the proteins through the nucleus that should allow them to reach every gene locus within a short time period (with the given diffusion coefficient it would take about one minute to move half-way across the nucleus). A prominent model of nuclear architecture, the socalled ICD-model proposed that proteins and other nuclear components do not move freely through the nucleus but are confined to a network of channels between chromatin domains (the so-called ICD-space) (Cremer et al, 1993, 1995; Zirbel et al, 1993). As proteins and enzyme complexes would be confined to the ICD-space a consequence would be that DNA sequences determined to interact with these proteins (e.g. transcription factors, splicing factors, replication factors) have to be exposed at the surfaces of chromatin domains. Therefore, surface exposure of DNA-sequences would play a fundamental role in their regulation. In contrast to the predictions of this model the recent investigations concerning the diffusional motion of proteins did not reveal that the motion of even large protein complexes (about 500 nm in diameter) is hindered by chromatin domains (Kruhlak et al, 2000). Also, studies investigating a general surface exposure of transcriptionally active sequences lead to conflicting results (Abranches et al, 1998; Verschure et al, 1999). As described above, transcriptionally competent or active sequences are organized into specific sub-chromosomal regions but show within these regions no specific exposure to any known surfaces (Sadoni et al, 1999; Zink et al, 1999). The same is true for the organization of DNA sequences with a defined replication timing (Sadoni et al, 1999; Zink et al, 1999). Therefore, the functionally

VII. Interactions between the genome and compartments involved in genomeassociated functions Given the findings that mammalian genomes are not very dynamically organized and that nuclear proteins or macromolecular complexes in many cases localize to confined nuclear compartments (van Driel et al, 1995; de Jong et al, 1996)) the question arises how DNA sequences and other nuclear factors come together in order to interact with each other. One example is already discussed above. In case of replication the replication factors move to the stably localized DNA sequences. However, not the whole factories move but rather their single components assemble into the large complexes called factories at those places where they are needed (Leonhardt et al, 2000). An unresolved question is still how the single proteins “know” where to assemble when. Regarding splicing factors it is known that they concentrate within the so-called speckles. Although the function of speckles is not clear a favored hypothesis is that they supply sites of active transcription with splicing factors (Pombo et al, 1994; Huang and Spector, 1996; Misteli et al, 1997). Interesting in this regard is the finding that speckles are embedded into the transcriptionally active chromatin within the interior compartment (Sadoni et al, in press). Therefore, transcriptionally active chromatin and speckles are already in close contact. This

Zink et al: Mammalian genome organization and gene therapy vectors

significant predictions of the ICD-model that the interaction between proteins and DNA sequences is facilitated and regulated by channeled diffusion of the former and specific surface exposure of the latter so far have not been confirmed. Rather, the experimental results argue against this scenario. Also, in living cells no chromatin-free channel system can be observed (data from fixed and/or stained cells should be carefully interpreted as various standard procedures easily can induce or suggest an artificial â&#x20AC;&#x153;spaceâ&#x20AC;? between chromatin domains (Sadoni et al, in press)). Some chromatin-depleted regions can be observed, which are occupied by nucleoli, speckles or nuclear bodies ((Sadoni et al, in press), (Figure 6 and Tables 1 and 2 ). Although these regions were regarded as the equivalents of the ICD-space (Cremer et al, in press) the findings might be due to the simple fact that DNA is not a component of all nuclear structures. When using the term ICD-space one should keep in mind that the ICDspace according to its definition is not simply a chromatindepleted region but that the ICD-space should be involved in specific functional and architectural characteristics of the cell nucleus as predicted by the ICD-model. As described above, recent experimental results suggest that the nucleus might not be organized as predicted by the ICD-model. In summary, recent data suggest that proteins that are involved in the formation of structures like speckles or replication factories diffuse rapidly and not hindered by chromatin domains through the whole nucleus. Therefore, the relatively static arrangement of DNA sequences should not be a problem for dynamic interactions. The enrichment of specific proteins in defined compartments might facilitate and coordinate the interaction of proteins and the assembly of larger complexes, as well as the temporal control of processes like replication.

Apart from classical enhancer elements, regulatory elements like LCRs or S/MARs came recently into the focus of interest. LCRs mediate at ectopic sites expression levels independent of the integration locus (Grosveld et al, 1987; Talbot et al, 1989). This makes them of course particularly attractive for gene therapy approaches although the function of the most intensively studied LCR from the !-globin locus is of integration was GC-rich and contained an open reading frame expressed at low levels in some tissues (Kotin et al, 1992). The nuclear localization of the integration site did not seem to be important, since transferring the target-site to an extrachromosomally-replicating vector also allowed sitespecific integration (Giraud and Berns, 1994). However, it remains unclear, whether site-specific integration indeed provides any selective advantage for the virus over other integration sites. For retroviruses including the lentiviruses, a large number of different integration sites have been observed (Pryciak and Varmus, 1992; Withers-Ward et al, 1994; Stevens and Griffith, 1996; Carteau et al, 1998), leading to the popular notion that retroviruses integrate randomly into the genome of the host cell. In vitro studies revealed preferential integration at specific positions of nucleosomes (Brown, 1997). In intact cells, frequent integration of murine leukemia virus in the vicinity of DNase-hypersensitive sites (Rohdewohld et al, 1987; Vijaya and Robinson, 1986), CpG islands (Scherdin and Breindl, 1990) or transcribed regions (Mooslehner and Harbers, 1990) suggested preferential integration into the transcriptionally active regions of the genome. Although an initial study provided evidence for highly preferred regions of integration for Rous Sarcoma Virus (RSV) (Shih et al, 1988), a second study concluded that integration of RSV into all genomic regions tested occurred with a frequency close to that expected for random integration (Withers-Ward et al, 1994). In agreement with the in vitro data, the frequency of integration site usage varied considerably within the regions (Withers-Ward et al, 1994). To determine the effect of transcriptional activity on integration site usage, a transcription factor activating a target gene was expressed. In the 1.3 kb target DNA analysed, the integration frequency seemed to be reduced rather than enhanced by expression of the transcription factor (Weidhaas et al, 2000). For human immunodeficiency virus type 1 (HIV-1), sequence analysis of a number of integration sites suggested preferential integration in the vicinity of topoisomerase cleavage sites (Howard, 1993), LINE elements (Stevens SW, 1994) or Alu islands (Stevens and Griffith, 1996). A second study revealed that centromeric alphoid repeats were disfavored target sites, but could not confirm preferential integration close to LINE or Alu repetitive elements (Carteau et al, 1998). Most of these studies only analysed the sites of integration within approximately 1000 bp. With the exception of one study (Weidhaas et al, 2000) the transcriptional activity of the

VIII. The nuclear localization of integrated viral genomes and gene therapy vectors Given the findings described above, it is expected that the genomic and nuclear positions of proviruses influence their transcriptional regulation. Therefore, it might be possible that viruses have evolved mechanisms to either preferentially integrate at advantageous genomic and nuclear positions or to modulate the nuclear organization. Evidence for the former was observed for adeno-associated virus (AAV), which preferentially integrates at a position on the q-arm of chromosome 19 (Kotin et al, 1990, 1991; Samulski et al, 1991). Chromosome 19 is a very gene rich chromosome with a high proportion of R-bands. In accordance, the site A corresponding screening approach for suitable regulatory elements (using, for example, experimental procedures as those outlined in Figures 7-11) will be much cheaper and faster then the approaches used so far to identify suitable regulatory elements.

Gene Therapy and Molecular Biology Vol 6, page 13

Figure 6. Speckles and nuclear bodies occupy chromatin-depleted areas. Speckles (A), coiled bodies (B, E, F) and PML bodies (C) were immunostained (formaldehyde fixation, all immunostained structures are shown in red) in HeLa cell nuclei with histone H2B-GFP labeled chromatin (green). Panels A, B and C show mid-nuclear planes of three different nuclei. The corresponding light optical sections displaying the immunostained speckles or nuclear bodies (red) or the H2B-GFP fluorescence (green) were merged (overlapping red and green appears yellow). The large chromatin depleted regions correspond to nucleoli. Panels D-F show light optical sections from an identical mid-nuclear plane displaying the histone H2B-GFP fluorescence (D) and the immunostained coiled bodies (E). The merge of D and E is shown in F. Panels G-I show binary images corresponding to the images shown in D-F that were used to determine the degree of overlap for the quantitative evaluation presented in tables 1 and 2. Both coiled bodies detected here were localized in chromatindepleted regions (arrows in D and G) and displayed peripheral overlap with chromatin (yellow rim around the red coiled bodies in I).

Zink et al: Mammalian genome organization and gene therapy vectors

Table 1. A) The table shows the numbers of coiled bodies counted in 12 nuclei (115 in total) that show complete overlap, peripheral overlap or no overlap with chromatin. Coiled bodies were classified according to their sizes: one group contained only coiled bodies with diameters in the x, y plane above 500nm while a second group contained only coiled bodies with diameters in the x, y plane between 400nm and 500nm. B) Graphical representation of the data shown in A). The numbers of coiled bodies that show complete overlap (light grey bars), peripheral overlap (dark grey bars) or no overlap (black bars) with chromatin are shown. The higher degree of overlap observed in the group of coiled bodies with diameters between 400nm-500nm as well as the frequently observed peripheral overlap is likely due to the limited resolution of light microscopy.

sites of integration at the time of integration could not be assessed. In addition, little is known about the association of integration sites with the functional compartments of the nucleus. Some hints on the association of proviruses with functional compartments could be obtained from studies reporting that proviruses of different mammalian species reside predominantly at genomic sites where the ATcontent of the host DNA sequence corresponds to their own sequence composition (Kettmann et al, 1979; Salinas et al, 1987; Rynditch et al, 1991; Zoubak et al, 1992, 1994; Glukhova et al, 1999). Furthermore, expression of proviral sequences seems to be dependent on the ATcontent of host DNA sequences at the integration site. Again, a comparable AT-content of the host and the proviral sequence favors expression (Zoubak et al, 1992; Zoubak et al, 1994; Bernardi, 1995). However, since stable cell lines were used in these studies, the preferential location of proviruses at genomic sites with an AT-content similar to the provirus could also be due to selective processes after integration rather than during integration. Therefore, it is still unclear whether retroviruses preferentially integrate into defined functional compartments of the nucleus or not. Whereas the knowledge about nuclear positions of wild-type proviruses is at the moment not a problem that might have a direct impact on therapeutic applications, the situation is different with regard to corresponding retroviral, lentiviral, and other integrating vectors. One of the most serious drawbacks in the use of integrating vectors in gene therapy is the problem that an efficient and

stable long-term expression is difficult to achieve. This seems to be a particular problem, if undifferentiated cells such as bone marrow stem cells are first infected with a retroviral vector and then undergo differentiation. Methylation-dependent mechanisms seemed to be involved in silencing of integrated retroviruses during differentiation (Jaenisch et al, 1985; Laker et al, 1998). Since inhibition of methylation only rescued a fraction of silenced cells, methylation independent mechanisms were postulated (Cherry et al, 2000). It was frequently suggested that silencing of retroviral vectors might be at least partially due to changes in chromatin structure (Naldini et al, 1996)). However, as discussed above, chromatin structure and nuclear localization seem to be intimately linked with each other and both seem to be involved in the stable maintenance of an active or silenced state. As in particular the maintenance of an active state is a major problem it would be advisable to investigate the nuclear localization of integrating vectors and to optimize them for localization into the active genome compartment. So far, it was difficult to investigate the localization of gene-therapy vectors with regard to the distinct genome compartments. On the one hand, there was a lack of knowledge regarding nuclear genome architecture and, one the other hand, tools to visualize integrated vectors within distinct genome compartments were not developed. This situation has changed. Distinct genome compartments can be easily visualized now with a variety of methods, for example, replication labeling or immunostaining with antibodies against specific histone isoforms (Sadoni et al, 1999). In addition, the in situ

Gene Therapy and Molecular Biology Vol 6, page 15

hybridization techniques are now sensitive enough to detect reliably DNA sequences of only a few kb in length (typical length of vectors used), also in combination with the detection of genome compartments. To demonstrate the reliability of the techniques available we show in Figures 7-10 the methods applied to the endogenous Masp 2 gene we used as a control. This housekeeping-gene has been mapped to the chromosomal region 1p36 at the distal tip of the short arm of chromosome 1 (Figure 7) (Stover et al, 1999). This is a very gene-rich region mostly occupied by R-bands. Accordingly, the gene localizes to the active nuclear compartment as shown in Figure 8 (active compartment detected by replication labeling) and Figure 10 (active compartment detected by immunostaining against highly acetylated isoforms of histone H4). Clearly, the gene loci are excluded from the silenced peripheral and late replicating compartments as shown in Figure 9. (Although this is generally believed, it should be noted that in humans loci close to the telomere do not predominantly localize to the nuclear periphery as in yeast or Drosophila. This is in accordance with the fact that terminal chromosome bands in humans are in most cases very gene-rich R-bands). The Masp 2 gene was detected in the experiments outlined in Figures 7-10 with a DNA probe of only 2.5 kb in length and the detection procedure (which was compatible with both, replication labeling and immunostaining) involved amplification of the signal with biotinyl-tyramide (commercially available kit, (Kappelsberger, 1999)). How this technique can be used to investigate the nuclear localization of vectors in relation to their transcriptional behavior is shown in Figure 11. Here, a simian immunodeficiency virus derived vector (Schnell et al, 2000) was detected within the active nuclear compartment. Accordingly, the GFP reporter gene of the vector was expressed. These results demonstrate that the tools are at hand now to investigate the transcriptional behavior of gene therapy vectors in relation to their nuclear localization.

developed. However, until now this requires the transfer of the rep-gene, which might be not feasible in a clinical setting. An interesting naturally occurring example for targeted integration comes from Ty3 retrotransposons. By interaction of the Ty3 integration machinery with basal transcription factors the retrotransposon is believed to be targeted close to the start sites of RNA polymerase III transcription units (Chalker and Sandmeyer, 1990; Chalker, 1992, 1993; Kirchner, 1995). By fusion of the integrase of HIV-1 to a DNA-binding protein the integration could be targeted at least in vitro to the respective binding site (Bushman, 1994). Another possible route for targeting integration to favourable genomic regions might be the direct integration into Rband sequences by homologous recombination. Recent results indicated that integration of transgene containing vectors via homologous recombination seems to be a frequent event in mammalian cells (McCreath et al, 2000). The frequency should increase if the regions of homology are present in multiple copies in the genome. Therefore, the R-band specific Alu-repeat family with about 106 copies per genome might be an ideal target for this approach. Another route might involve the use of specific regulatory elements. Although mechanisms like methylation of viral sequences seem to play a role in silencing (Jaenisch et al, 1985; Laker et al, 1998), silencing of constructs lacking any viral sequences has also been observed. Therefore, it is yet unclear if these epigenetic inactivation events are triggered by particular sequences or if certain enhancer-promoter combinations have different abilities to overcome the negative effects of an integration site and its corresponding nuclear compartment. The latter possibility is supported by the results discussed above, which demonstrated that regulatory elements as enhancer elements are able to switch the chromatin structure as well as the nuclear “address” of transgenes (Francastel et al, 1999). Strikingly, the nuclear localization of transgenes does not seem to be correlated with their actual transcriptional status but is rather correlated with the ability to stably maintain a given level of expression (Francastel et al, 1999). Therefore, by investigating how regulatory elements influence the nuclear localization of integrated vectors one might not only be able to improve the levels of expression. In addition, to screen regulatory elements for their ability to mediate localization into the actively transcribed compartment likely provides information about their ability to sustain efficient long-term expression (as the nuclear localization correlates with the stable maintenance of given expression levels) mainly restricted to erythroid cells. Although it is still an open question how LCRs work experimental data involving an enhancer element derived from the !-globin LCR strongly suggest that at least at ectopic sites this LCR or its sub-regions act also on the level of nuclear positioning (Francastel et al, 1999).

IX. Strategies for targeting vectors to specific genome compartments Integration of a vector into a chromosomal locus permissive for high expression levels is advantageous to obtain a stable and efficient long-term expression. The data discussed above suggest that these loci are predominantly those, which posses a “default address” for the active nuclear genome compartment. These are the chromosomal R-bands. As stable localization of an integrating vector into the active genome compartment consisting of R-band sequences might be crucial to obtain a stable and efficient long-term expression the question arises how this might be achieved. If the preferred integration site of AAV localizes to the R-band sequences, AAV based vectors that maintain the site-specific integration property of the parental virus could be

Zink et al: Mammalian genome organization and gene therapy vectors

Therefore, LCRs or LCR sub-regions might be useful elements for localizing gene therapy vectors into the transcriptionally active nuclear compartments. S/MARs are thought to act on the level of chromatin structure (Zhao et al, 1993) and/or by targeting transgenes to the nuclear matrix (Boulikas, 1995). In addition, they might function as domain borders shielding chromatin domains from the influences of neighboring regulatory elements (Bode et al, 1995). Whatever their mode of action is, they have been shown to improve expression from retroviral vectors (Sch端beler et al, 1996; Agarwal et al, 1998). Strikingly, they mediate mitotic stability of episomal vectors and this function correlates with targeting these vectors to the nuclear matrix (Piechaczek et al, 1999; Baiker et al, 2000). Whether S/MARs in addition might be useful for localizing a transgene into specific higher-order nuclear compartments remains to be shown. In summary, the data imply that position effects, which often lead to problems in transgene expression are not only due to the local chromatin environment which might be permissive or repressive for transcription. In addition, specific chromosomal sites are targeted to defined nuclear higher-order compartments, which are transcriptionally active or silenced. The targeting to nuclear higher-order compartments correlates with the

stability of expression levels. A variety of possible routes to prevent sequestration of a transgene into a silenced

Figure 7. The Masp2 gene localizes to 1p36 at the tip of the short arm of chromosome 1. The Masp2 gene was mapped on human mitotic chromosomes (blue) with a 2.5 kb probe. Also with this short probe clear signals (red, arrowheads) could be obtained.

Figure 8. The Masp2 gene localizes to the interior early-replicating compartment. The nucleus of a human neuroblastoma cell was labeled with Cy3-dUTP (green) in order to detect the early replicating interior R-band compartment (type I replication pattern). After replication labeling, the Masp2 gene was detected by in situ hybridization with a 2.5 kb DNA probe (red, arrows). The upper and the lower rows of images represent two different nuclear planes. Only in the plane shown in the upper row both signals are present. Only the replication label is shown in the right panels while the panels in the middle of each row show only the in situ hybridization. The merges of both are shown on the left panels.

Gene Therapy and Molecular Biology Vol 6, page 17

Figure 9. The Masp2 gene is excluded from the silenced peripheral and late replicating compartments. Nuclei of human neuroblastoma cells were labeled with Cy3-dUTP (green) in order to detect the silenced peripheral (a, type III replication pattern) and late replicating (b, type V replication pattern) compartments. After replication labeling, the Masp2 gene was detected by in situ hybridization with a 2.5 kb DNA probe (red, arrowheads).

Zink et al: Mammalian genome organization and gene therapy vectors

Figure 10. An alternative way of detecting the Masp2 gene within the transcriptionally active interior compartment. The interior compartment was labeled with an antibody against highly acetylated isoforms of histone H4 (green, left) (Sadoni et al, 1999). The Masp2 gene was detected by in situ hybridization with a 2.5 kb DNA probe (red, middle, arrow). The overlay (right) of the immunostaining and the in situ hybridization shows the localization of the gene to the active, interior compartment. In the nuclear plane shown only one of the two copies of the gene is present.

Figure 11. The localization of a simian immunodeficiency virus (SIV) derived vector to the active nuclear compartment and its transcriptional activity. Human lung epithelial cells were infected with a SIV-derived vector, which was detected by in situ hybridization (red, arrowheads). The active genome compartment was stained with an antibody against highly acetylated isoforms of histone H4 (H4 Ac) (dark blue, â&#x20AC;&#x153;holesâ&#x20AC;? in the nuclear interior result from the exclusion of nucleoli and transcriptionally inactive chromatin). Clearly, the integrated vector localizes to the active nuclear compartment. The small panels on the left show from top to bottom the DAPI counterstain, the GFP-fluorescence (shows that the GFP reporter gene of the vector is expressed), only the anti H4Ac staining and only the in situ hybridization signals.

Gene Therapy and Molecular Biology Vol 6, page 19

cytology, Vol. 162A. Jeon KW and Berezney R (eds.). Academic Press, Orlando. pp. 389-453 Bonne G, Di Barletta MR, Varnous S, Becane HM, Hammouda EH, Merlini L, Muntoni F, Greenberg CR, Gary F, Urtizberea JA and et al (1999) Mutations in the gene encoding lamin A/C cause autosomal dominant EmeryDreyfuss muscular dystrophy. Nat. Genet. 21, 285-288. Bornfleth H, Edelmann P, Zink D, Cremer T and Cremer C (1999) Quantitative motion analysis of subchromosomal foci in living cells using four-dimensional microscopy. Biophysical Journal 77, 2871-2886. Boulikas T (1995) Chromatin domains and prediction of MAR sequences. In: Structural and functional organization of the nuclear matrix - Internal review of cytology. Eds.: Jeon KW and Berezney R. Academic Press, Orlando. pp. 279-388. Bridger JM, Boyle S, Kill IR and Bickmore WA (2000) Remodelling of nuclear architecture in quiescent and senescent human fibroblasts. Curr. Biol. 10, 149-152. Brown KE, Baxter J, Graf D, Merkenschlager M and Fisher AG (1999) Dynamic repositioning of genes in the nucleus of lymphocytes preparing for cell division. Mol. Cell 3, 207217. Brown KE, Guest SS, Smale ST, Hahm K, Merkenschlager M and Fisher AG (1997) Association of transcriptionally silent genes with Ikaros complexes at centromeric heterochromatin. Cell 91, 845-854. Brown PO (1997) Retroviruses. Integration. J. M. Coffin, Hughes, S.H, Varmus, H.E. Cold Spring Harbor Laboratory Press), Burke B (1990) On the cell-free association of lamins A and C with metaphase chromosomes. Exp. Cell Res. 186, 169-176. Bushman F (1994) Tethering human immunodeficiency virus 1 integrase to a DNA site directs integration to nearby sequences. Proc Natl Acad Sci USA 91, 9233-7. Camargo M and Cervenka J (1982) Patterns of DNA Replication of HUman Chromosomes. II. Replication Map and Replication Model. Am. J. Hum. Genet. 34, 757-780. Carteau S, Hoffmann C and Bushman F (1998) Chromosome Structure and Human Immunodeficiency Virus Type 1 cDNA Integration: Centromeric Alphoid Repeats Are a Disfavored Target. J. Virol. 72, 4005-4014. Chalker D and Sandmeyer S (1990) Transfer RNA genes are genomic targets for de Novo transposition of the yeast retrotransposon Ty3. Genetics 126, 837-850. Chalker DL and Sandmeyer S (1992) Ty3 integrates within the region of RNA polymerase III transcription initiation. Genes Dev 6, 117-28. Chalker DL and Sandmeyer S (1993) Sites of RNA polymerase III transcription initiation and Ty3 integration at the U6 gene are positioned by the TATA box. Proc Natl Acad Sci USA 90, 4927-31. Cherry SR, Biniszkiewicz D, van Parijs L, Baltimore D and Jaenisch R (2000) Retroviral Expression in Embryonic Stem Cells and Hematopoietic Stem Cells. Mol. Cell. Biol. 20, 7419-7426. Cockell M and Gasser SM (1999) Nuclear compartments and gene regulation. Curr Opin Genet Dev 9, 199-205. Craig JM and Bickmore WA (1993) Chromosome BandsFlavours to Savour. Bioessays 15, 349-354.

higher-order compartment and to localize it into an actively transcribed compartment can be tested now experimentally. This might not only lead to new strategies to improve expression from gene therapy vectors but might also help to develop fast and efficient screening methods for suitable vector constructs.

Acknowledgements We thank Dr. Michael Speicher (LMU Munich) for kindly providing DNA probes for in situ hybridization. We are grateful to Prof. Angus Lamond (University of Dundee) and Prof. Bryan Turner (University of Birmingham) for providing antibodies. We thank Prof. Peter Becker (LMU Munich) for helpful comments and Andi Barnea (LMU Munich) for help with the arrangement of images. This work was supported by a grant from the Wilhelm-Sander Stiftung Nr. 1999.131.1 to D.Z. and K.Ă&#x153;.

References Abranches R, Beven AF, Aragon-Alcaide L and Shaw PJ (1998) Transcription sites are not correlated with chromosome territories in wheat nuclei. J. Cell Biol. 143, 5-12. Agarwal M, Austin TW, Morel F, Chen J, Bohnlein E and Plavec I (1998) Scaffold Attachment Region-Mediated Enhancement of Retroviral Vector Expression in Primary T Cells. J. Virol. 72, 3720-3728. Aten JA, Bakker PJM, Stap J, Boschmann GA and Veenhof CHN (1992) DNA double labelling with IdUrd and CldUrd for spatial and temporal analysis of cell proliferation and DNA replication. Histochemical J. 24, 251-259. Aten JA, Stap J, Manders EMM and Bakker PJM (1993) Progression of DNA-replication in cell nuclei and changes in cell proliferation investigated by DNA double-labelling with IdUrd and CldUrd. Eur. J. Histochem. 37, 65-71. Baiker A, Maercker C, Piechaczek C, Schmidt SBA, Bode J, Benham C and Lipps HJ (2000) Mitotic stability of an episomal vector containing a human scaffold/matrix-attached region is provided by association with nuclear matrix. Nature Cell Biology 2, 182-184. Belmont AS, Bignone F and TsĂ˛ POP (1986) The relative intranuclear positions of Barr bodies in XXX nontransformed human fibroblasts. Exp. Cell Res. 165, 165-179. Berezney R, Mortillaro MJ, Ma H, Wei X and Samarabandu J (1995) The Nuclear Matrix: A Structural Milieu for Genomic Function. Int. Rev. Cytol. 162A, 1-65. Bernardi G (1995) The human genome: organization and evolutionary history. Annu. Rev. Genetics 29, 445-476. Bickmore WA and Sumner AT (1989) Mammalian chromosome banding-an expression of genome organization. TIG 5, 144148. Bione S, Maestrini E, Rivella S, Mancini M, Regis S, Romeo G and Toniolo D (1994) Identification of a novel X-linked gene responsible for Emery-Dreyfuss muscular Dystrophy. Nature Genet. 8, 323-327. Bode J, Schlake T, Rios-Ramirez M, Mielke C, Stengert M, Kay V and Klehr-Wirth, D (1995) In: Structural and functional organization of the nuclear matrix - Internal review of

Zink et al: Mammalian genome organization and gene therapy vectors

Craig JM and Bickmore WA (1994) The distribution of CpG islands in mammalian chromosomes. Nat. Genet. 7, 376382. Cremer T, Dietzel S, Eils R, Lichter P and Cremer C (1995) Chromosome territories, nuclear matrix filaments and interchromatin channels: a topological view on nuclear architecture and function. In: P.E. Brandham and M.D. Bennett (editors). Kew Chromosome Conference IV, Royal Botanic Gardens, Kew 63-81. Cremer T, Kreth G, Koester H, Fink RHA, Heintzmann R, Cremer M, Solovei I, Zink D and Cremer C (in press) Chromosome territories, interchromatin domain compartment and nuclear matrix: an integrated view of the functional nuclear architecture. Critical Reviews in Eukaryotic Gene Expression Cremer T, Kurz A, Zirbel R, Dietzel S, Rinke B, Schroeck E, Speicher MR, Mathieu U, Jauch A, Emmerich P, Scherthan H, Ried T, Cremer C and Lichter P (1993) The role of chromosome territories in the functional compartmentalization of the cell nucleus. Cold Spring Harb. Symp. Quant. Biol. 58, 777-792. Croft JA, Bridger JM, Boyle S, Perry P, Teague P and Bickmore WA (1999) Differences in the localization and morphology of chromosomes in the human nucleus. J. Cell Biol. 145, 1119-1131. Cross SH, Lee M, Clark VH, Craig JM, Bird AP and Bickmore WA (1997) The chromosomal distribution of CpG islands in the mouse: evidence for genome scrambling in the rodent lineage. Genomics 40, 454-461. Csink A and Henikoff S (1996) Genetic modification of heterochromatic association and nuclear organization in Drosophila. Nature 381, 529-531. De Boni U (1994) The Interphase Nucleus as a Dynamic Structure. Int. Rev. Cytol. 150, 149-171. de Jong L, Grande MA, Mattern KA, Schul W and van Driel R (1996) Nuclear domains involved in RNA synthesis, RNA processing , and replication. Crit. Rev. Eukar. Gene Exp. 6, 215-246. Dhar V, Skoultchi AI and Schildkraut CL (1989) Activation and repression of a b-globin gene in cell hybrids is accompanied by a shift in its temporal regulation. Mol. Cell Biol. 9, 35243532. Dimitrova DS and Gilbert DM (1999) The spatial position and replication timing of chromosomal domains are both established in early G1 phase. Molecular Cell 4, 983-993. Dunham et al (The chromosome 22 sequencing and mapping consortium) (1999) The DNA sequence of human chromosome 22. Nature 402, 489-495. Dutrillaux B, Couturier J, Richer C-L and Viegas-Peguinot E (1976) Sequence of DNA replication in 277 R- and Q-bands of human chromosomes using a BrdU treatment. Chromosoma 58, 51-61. Ferreira J, Paolella G, Ramos C and Lamond AI (1997) Spatial organization of large-scale chromatin domains in the nucleus: a magnified view of single chromosome territories. J Cell Biol 139, 1597-1610. Forrester WC, Epner E, Driscoll MC, Enver T, Brice M, Papayannopoulou T and Groudine M (1990) A deletion of the human beta-globin locus activation region causes a major alteration in chromatin structure and replication across the entire beta-globin locus. Genes Dev. 4, 1637-1649.

Francastel C, Walters MC, Groudine M and Martin DIK (1999) A functional enhancer suppresses silencing of a transgene and prevents its localization close to centromeric heterochromatin. Cell 99, 259-269. Gant TM and Wilson KL (1997) Nuclear assembly. Ann. Rev. Cell Dev. Biol. 13, 669-695. Gerace L and Foisner R (1994) Integral membrane proteins and dynamic organization of the nuclear envelope. Trends Cell Biol. 4, 127-131. Giraud C WE, Berns KI (1994) Site-specific integration by adeno-associated virus is directed by a cellular DNA sequence. Proc Natl Acad Sci USA 91, 10039-43. Glass CA, Glass JR, Taniura H, Hasel KW, Blevitt JM and Gerace L (1993) The alpha-helical rod domain of human lamins A and C contains a chromatin binding site. EMBO J 12, 4413-4424. Glukhova LA, Zoubek SV, Rynditch AV, Miller GG, Titova IV, Vorobyeva N, Lazurkevitch ZV, Graphodatskii AS, Kushch AA, Bernardi G (1999) Localization of HTLV-1 and HIV-1 proviral sequences in chromosomes of persistently infected cells. Chromosome Res 7, 177-83. Goldman MA, Holmquist GP, Gray MC, Caston LA and Nag A (1984) Replication timing of genes and middle repetitive sequences. Science 224, 686-692. Grant PA, Sterner DE, Duggan LJ, Workman JL and Berger SL (1998) The SAGA unfolds: convergence of transcription regulators in chromatin-modifying complexes. Trends Cell Biol. 8, 193-197. Grosveld F, van Assendelft GB, Greaves DR and Kollias G (1987) Position-independent, high-level expression of the human beta-globin gene in transgenic mice. Cell 51, 975. Hambor JE, Mennone J, Coon ME, Hanke JH and Kavathas P (1993) Identification and characterization of an Alucontaining, T cell-specific enhancer located in the last intron of the human CD8 alpha gene. Mol. Cell Biol. 13, 70567070. Hatton KS, Dhar V, Brown EH, Iqbal MA, Stuart S, Didamo VT and Schildkraut CL (1988) Replication program of active and inactive multigene families in mammalian cells. Mol. Cell Biol. 8, 2149-2158. Hattori et al (The chromosome 21 sequencing and mapping consortium) (2000) The DNA sequence of human chromosome 21. Nature 405, 311-319. Henikoff S (1990) Position-effect variegation after 60 years. Trends. Genet. 6, 422-426. Howard MT and Griffith JD (1993) A cluster of strong topoisomerase II cleavage sites is located near an integrated human immunodeficiency virus. J Mol Biol 232, 1060-8. Huang S and Spector DL (1996) Intron-dependent recruitment of pre-mRNA splicing factors to sites of transcription. J Cell Biol 131, 719-732. Imhof A and Wolffe AP (1998) Transcription: Gene control by targeted histone acetylation. Curr. Biol. 8, R422-R424. Jaenisch R, Schnieke A, Harbers K (1985) Treatment of mice with 5-azacytidine efficiently activates silent retroviral genomes in different tissues. Proc Natl Acad Sci USA 82, 1451-5. Jeppesen P (1996) Histone acetylation: a possible mechanism for the inheritance of cell memory at mitosis. BioEssays 19, 6774.

Gene Therapy and Molecular Biology Vol 6, page 21

Jeppesen P and Turner BM (1993) The inactive X chromosome in female mammals is distinguished by a lack of histone H4 acetylation, a cytogenetic marker for gene expression. Cell 74, 281-289. Kappelsberger C (2000) Etablierung hochsensitiver Methoden der in situ Hybridisierung fuer die Untersuchung der dreidimensionalen Genomarchitektur im Zellkern. Diploma Thesis. Institut fuer Anthropologie und Humangenetik, LMU Muenchen. pp 1-143 Kettmann R, Meunier-Rotival M, Cortadas J, Cuny G, Ghysdael J, Mammerickx M, Burny A and Bernardi G (1979) Integration of bovine leukemia virus DNA in the bovine genome. Proc. Natl. Acad. Sci. USA 76, 4822-4826. Kirchner J, Connolly CM, Sandmeyer SB (1995) Requirement of RNA polymerase III transcription factors for in vitro position-specific integration of a retroviruslike element. Science 267, 1488-91. Korenberg JR and Rykowski MC (1988) Human genome organization: Alu, Lines, and the molecular structure of metaphase chromosome bands. Cell 53, 391-400. Kotin R, Linden R and Berns K (1992) Characterization of a preferred site on human chromosome 19q for integration of adeno-associated virus DNA by non-homologous recombination. EMBO J. 11, 5071-5078. Kotin RM MJ, Ward DC, Berns KI (1991) Mapping and direct visualization of a region-specific viral DNA integration site on chromosome 19q13-qter. Genomics 10, 831-4. Kotin RM SM, Samulski RJ, Zhu XD, Hunter L, Laughlin CA, McLaughlin S, Muzyczka N, Rocchi M, Berns KI (1990) Site-Specific Integration by Adeno-Associated Virus. Proc Natl Acad Sci USA 87, 2211-2215. Kruhlak MJ, Lever MA, Fischle W, Verdin E, Bazett-Jones DP and Hendzel MJ (2000) Reduced Mobility of the alternate splicing factor (ASF) through the nucleoplasm and steady state speckle compartments. J Cell Biol 150, 41-51. Laker C, Meyer J, Schopen A, Friel J, Heberlein C, Ostertag W, Stocking C (1998) Host cis-mediated extinction of a retrovirus permissive for expression in embryonal stem cells during differentiation. J Virol 72, 339-48. Leonhardt H, Rahn H-P, Weinzierl P, Sporbert A, Cremer T, Zink D and Cardoso MC (2000) Dynamics of DNA replication factories in living cells. J Cell Biol 149, 271-279. Lichter P, Cremer T, Borden J, Manuelidis L and Ward DC (1988) Delineation of individual human chromosomes in metaphase and interphase cells by in situ suppression hybridization using recombinant DNA libraries. Hum. Genet. 80, 224-234. Lo K, Landau NR and Smale ST (1991) LyF-1, a transcriptional regulator that interacts with a novel class of promoters for lymphocyte-specific genes. Mol. Cell Biol. 11, 5229-5243. Manders EMM, Kimura H and Cook PR (1999) Direct imaging of DNA in living cells reveals the dynamics of chromosome formation. J. Cell Biol. 144, 813-821. Manders EMM, Stap J, Brakenhoff GJ, van Driel R and Aten JA (1992) Dynamics of three-dimensional replication patterns during S-phase, analysed by double labelling of DNA and confocal microscopy. J. Cell Science 103, 857-862. Manuelidis L and Borden J (1988) Reproducible compartmentalization of individual chromosome domains in human CNS cells revealed by in situ hybridization and threedimensional reconstruction. Chromosoma 96, 397-410.

McCreath KJ, Howcroft J, Campbell KHS, Colman A, Schnieke AE and Kind AJ (2000) Production of gene-targeted sheep by nuclear transfer from cultured somatic cells. Nature 405, 1066-1069. Misteli T, Caceres JF and Spector DL (1997) The dynamics of a pre-mRNA splicing factor in living cells. Nature 387, 523527. Molnar A and Georgopoulos K (1994) The Ikaros gene encodes a family of functionally diverse zinc finger DNA-binding proteins. Mol. Cell Biol. 14, 8292-8303. Mooslehner K, Karls U, Harbers K (1990) Retroviral integration sites in transgenic Mov mice frequently map in the vicinity of transcribed DNA regions. J Virol 64, 3056-8. Nakayasu H and Berezney R (1989) Mapping Replicational Sites in the Eucaryotic Cell Nucleus. J. Cell Biol. 108, 1-11. Naldini L, Blรถmer U, Gage FH, Trono D and Verma IM (1996) Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc. Natl. Acad. Sci. USA 93, 1138211388. O"Keefe RT, Henderson SC and Spector DL (1992) Dynamic Organization of DNA Replication in Mammalian Cell Nuclei: Spatially and Temporally Defined Replication of Chromosome-specific a-Satellite DNA Sequences. J. Cell Biol. 116, 1095-1110. Pederson T (2000) Half a century of "the nuclear matrix". Mol. Biol. Celll 11, 799-805. Phair RD and Misteli T (2000) High mobility proteins in the cell nucleus. Nature 404, 604-609. Piechaczek C, Fetzer C, Baiker A, Bode J and Lipps HJ (1999) A vector based on the SV40 origin of replication and chromosomal S/MARs replicates episomally in CHO cells. Nucleic Acids Res 27, 426-428. Pombo A, Ferreira J, Bridge E and Carmo-Fonseca M (1994) Adenovirus replication and transcription sites are spatially separated in the nucleus of infected cells. EMBO J 13, 50755085. Pryciak PM MH, Varmus HE (1992) Simian virus 40 minichromosomes as targets for retroviral integration in vivo. Proc Natl Acad Sci USA 89, 9237-41. Pyrpasopoulou A, Meier J, Maison C, Simons G and Georgatos SG (1996) The lamin B receptor (LBR) provides essential chromatin docking sites at the nuclear envelope. EMBO J. 15, 7108-7119. Rae PMM and Franke WW (1972) The interphase distribution of satellite DNA-containing heterochromatin in mouse nuclei. Chromosoma 39, 443-456. Rohdewohld H, Weiher H, Reik W, Jaenisch R, Breindl M (1987) Retrovirus integration and chromatin structure: Moloney murine leukemia proviral integration sites map near DNaseI-hypersensitive sites. J Virol 61, 336-43. Rynditch A, Kadi F, Geryk J, Zoubak S, Svoboda J and Bernardi G (1991) The isopycnic, compartmentalized integration of Rous sarcoma virus sequences. Gene 106, 165-172. Sachs RK, van den Engh G, Trask B, Yokota H and Hearst JE (1995) A random-walk/giant-loop model for interphase chromosomes. Proc. Natl. Acad. Sci. USA 92, 2710-2714. Sadoni N, Langer S, Fauth C, Bernardi G, Cremer T, Turner BM and Zink D (1999) Nuclear organization of mammalian genomes: polar chromosome territories built up functionally

Zink et al: Mammalian genome organization and gene therapy vectors

distinct higher order compartments. J. Cell Biol. 146, 12111226. Sadoni N, Sullivan KF, Weinzierl P, Stelzer E and Zink D (in press) Large-scale chromatin fibers of living cells display a discontinous functional organization. Chromosoma Salinas J, Zerial M, Filipski J, Crepin M and Bernardi G (1987) Non-random distribution of MMTV proviral sequences in the mouse genome. Nucleic Acids Res. 15, 3009-3022. Samulski RJ, Zhu X, Xiao X, Brook JD, Housman DE, Epstein N, Hunter LA (1991) Targeted integration of adenoassociated virus (AAV) into human chromosome 19. EMBO J 10, 3941-50. Schardin M, Cremer T, Hager HD and Lang M (1985) Specific staining of human chromosome position in chinese hamster x man hybrid cell lines demonstrates interphase chromosome territories. Hum. Genet. 71, 281-287. Scherdin U, Rhodes K, Breindl M (1990) Transcriptionally active genome regions are preferred targets for retrovirus integration. J Virol 64, 907-12. Schnell T, Foley P, Wirth M, Munch J and Überla K (2000) Development of a self-inactivating, minimal lentivirus vector based on simian immunodeficiency virus. Hum Gene Ther. 11, 439-447. Schübeler D, Francastel C, Cimbora DM, Reik A, Martin DIK and Groudine M (2000) Nuclear localization and histone acetylation: a pathway for chromatin opening and transcriptional activation of the human b-globin locus. Genes and Dev. 14, 940-950. Schübeler D, Mielke C, Maass K and Bode J (1996) Scaffold/Matrix-Attached Regions Act upon Transcription in a Context-Dependent Manner. Biochemistry 35, 1116011169. Shelby RD, Hahn KM and Sullivan KF (1996) Dynamic Elastic Behaviour of a-Satellite DNA Domains Visualized In Situ in Living Human Cells. J. Cell Biol. 135, 545-557. Shih CC, Stoye, J. P, Coffin, J. M. (1988) Highly Preferred Targets For Retrovirus Integration. Cell 53, 531-537. Stevens S and Griffith J (1996) Sequence analysis of the human DNA flanking sites of human immunodeficiency virus type 1 integration. J. Virol. 70, 6459-6462. Stevens SW and Griffith J (1994) Human immunodeficiency virus type 1 may preferentially integrate into chromatin occupied by L1Hs repetitive elements. Proc Natl Acad Sci USA 91, 5557-61. Stover CM, Schwaeble CJ, Lynch NJ, Thiel S and Speicher MR (1999) Assignment of the gene encoding mannan-binding lectin-associated serine protease 2 (Masp2) to human chromosome 1.36.3-p36.2 by in situ hybridization and somatic cell hybrid analysis. Cytogenet Cell Genet. 84, 148149. Strahl BD and Allis CD (2000) The language of covalent histone modifications. Nature 403, 41-45. Stuurman N, Heins S and Aebi U (1998) Nuclear lamins: their structure, assembly, and interactions. J. Struct. Biol. 122, 42-66. Sullivan KF and Shelby RD (1999) Using time-lapse confocal microscopy for analysis of centromere dynamics in human cells. Methods in Cell Biol. 58, 183-202. Sullivan T, Escalante-Alcalde D, Bhatt H, Anver M, Bhat N, Nagashima K, Stewart CL and Burke B (1999) Loss of Atype lamin expression compromises nuclear envelope

integrity leading to muscular dystrophy. J Cell Biol 147, 913-915. Talbot D, Collis P, Antoniou M, Vidal M, Grosveld F and Greaves DR (1989) A dominant control region from the human beta-globin locus conferring integration siteindependent gene expression. Nature 338, 352. Taniura H, Glass C and Gerace L (1995) A chromatin binding site in the tail domain of nuclear lamins that interacts with core histones. J Cell Biol 131, 33-44. Utley RT, Ikeda K, Grant PA, Cote J, Steger DJ, Eberharter A, John S and Workman JL (1998) Transcriptional activators direct histone acetyltransferase complexes to nucleosomes. Nature 394, 498-502. van Driel R, Wansink DG, van Steensel B, Grande MA, Schul W and de Jong L (1995) Nuclear Domains and the Nuclear Matrix. Int. Rev. Cytol. 162A, 151-189. Varga-Weisz PD and Becker PB (1998) Chromatin-remodeling factors: machines that regulate. Current Opinion in Cell Biology 10, 346-353. Verschure PJ, van der Kraan I, Manders EMM and van Driel R (1999) Spatial relationship between transcription sites and chromosome territories. J. Cell Biol. 147, 13-24. Vijaya S SD, Robinson HL (1986) Acceptor sites for retroviral integrations map near DNase I-hypersensitive sites in chromatin. J Virol 60, 683-92. Weidhaas JB, Angelichio EL, Fenner S and Coffin JM (2000) Relationship between Retroviral DNA Integration and Gene Expression. J. Virol. 74, 8382-8389. Withers-Ward ES, Kitamura Y, Barnes JP, Coffin JM (1994) Distribution of targets for avian retrovirus DNA integration in vivo. Genes Dev 8, 1473-87. Xing Y, Johnson CV, Moen PTJ, McNeil JA and Lawrence J (1995) Nonrandom gene organization: structural arrangements of specific pre-mRNA transcription and splicing with SC-35 domains. J. Cell Biol. 131, 1635-1647. Ye Q and Worman HJ (1996) Interaction between an integral protein of the nuclear envelope inner membrane and human chromodomain proteins homologous to Drosophila HP1. J. Biol. Chem. 269, 11306-11311. Ye Q, Callebaut I, Pezhman A, Courvalin JC and Worman HJ (1997) Domain-specific interactions of human HP1-type chromodomain proteins and inner nuclear membrane protein LBR. J. Biol. Chem. 271, 14983-14989. Yokota H, van den Engh G, Hearst JE, Sachs RK and Trask B (1995) Evidence for the organization of chromatin in megabase pair-sized loops arranged along a random walk path in the human G0/G1 interphase nucleus. J. Cell Biol. 130, 1239-1249. Zhao K, Kaes E, Gonzalez E and Laemmli UK (1993) SARdependent mobilization of histone H1 by HMG-I/Y in vitro: HMG-I/Y is enriched in H1-depleted chromatin. EMBO J 12, 3237-3247. Zink D and Cremer T (1998) Chromosome dynamics in nuclei of living cells. Curr. Biol. 8, R321-R324. Zink D, Bornfleth H, Visser A, Cremer C and Cremer T (1999) Organization of early and late replicating DNA in human chromosome territories. Exp. Cell Res. 247, 176-188. Zink D, Cremer T, Saffrich R, Fischer R, Trendelenburg MF, Ansorge W and Stelzer EHK (1998) Structure and dynamics of human interphase chromosome territories in vivo. Hum. Genet. 102, 241-251.

Gene Therapy and Molecular Biology Vol 6, page 23

Zirbel RM, Mathieu UR, Kurz A, Cremer T and Lichter P (1993) Evidence for a nuclear compartment of transcription and splicing located at chromosome domain boundaries. Chromosome Res. 1, 93-106. Zoubak S, Richardson JH, Rynditch A, Hรถllsberg P, Hafler DA, Boeri E, Lever AML and Bernardi G (1994) Regional

specificity of HTLV-I proviral integration in the human genome. Gene 143, 155-163. Zoubak S, Rynditch A and Bernardi G (1992) Compositional bimodality and evolution of retroviral genomes. Gene 119, 207-213.

Zink et al: Mammalian genome organization and gene therapy vectors

Gene Therapy and Molecular Biology Vol 6, page 25

Gene Ther Mol Biol Vol 6, 25-31, 2001

Novel developments for applications of alphavirus vectors in gene therapy Review Article

Kenneth Lundstrom F. Hoffmann-La Roche, Research Laboratories, CH-4070 Basel, Switzerland _________________________________________________________________________________________________ Correspondence: Kenneth Lundstrom, Ph.D. Tel: 41-61-687 8653, Fax: 41-61-688 4575, E-mail: Kenneth.Lundstrom@Roche.com Key words: Semliki Forest virus, gene therapy, vaccine, LacZ, cell targeting, gene expression Abbreviations: adeno-associated virus, (AAV); cytotoxic T cell, (CTL); G protein-coupled receptors, (GPCRs); Moloney murine leukemia virus, (MMLV); multiplicity of infection, (MOI); murine leukemia virus, (MuLV); Semliki Forest virus, (SFV); Sindbis virus, (SIN); Venezuelan Equine Encephalitis virus, (VEE) Received: 19 January 2001; accepted: 23 January 2001; electronically published: February 2004

Summary As a prerequisite for gene therapy applications, alphavirus-mediated delivery of reporter genes to different brain regions in rodents has resulted in local, high-level expression of a transient nature. Infection of human prostate tumor cell lines with recombinant Semliki Forest virus (SFV)-LacZ particles demonstrated a strong induction of apoptosis that led to premature cell death. Injection of self-replicative SFV-LacZ RNA showed in prophylactic and therapeutic effects in animals. Furthermore, injection of SFV vectors expressing interleukin-12 resulted in tumor regression in a mouse B16 melanoma tumor model. Similarly, injection of SFV vectors expressing GFP, !galactosidase or even empty SFV vectors led to p53-independent induction of apoptosis in nude mice with implanted human lung carcinomas. Repeated injections showed improved anti-tumor responses without any visible immune reaction against injected SFV particles. The envelope structure of alphaviruses has been modified to allow cell/tissue specific targeting. Moreover, SFV vectors have been used for the production of retrovirus-like particles. Extensive development on alphavirus vectors has resulted in novel non-cytopathogenic and replication-persistent forms. Overall, alphavirus vectors can be considered highly attractive for future gene therapy applications. Replication-deficient vectors, where a helper vector is required for the expression of the viral structural proteins. III. Layered DNA vectors, where an RNA polymerase II expression cassette drives the transcription of a selfreplicative RNA vector (replicon) (Berglund et al, 1996, Dubensky et al, 1996). All three vector systems have their special features and their advantages as well as their disadvantages for different applications. The replicationcompetent vectors have the greatest potential of infecting a large population of cells in a tissue/organism due to their capability to produce progeny virus. However, these generated particles can pose a safety risk when used in vivo if efficient cell/tissue-specific targeting is not developed. The replication-deficient vectors represent a higher safety level because no further virus production occurs from them. However, the gene delivery efficiency is impaired especially in larger tissue sections. On the

I. Introduction Viral vectors have proven to be powerful for efficient gene delivery both in vitro and in vivo. At present there are many efficient viral vector systems described including retroviruses, adenoviruses, AAV (adeno-associated virus), herpes simplex virus and lentivirus. One group of viruses that recently has received increased attention is alphaviruses. The three most common alphaviruses, of which expression vectors have been developed are Semliki Forest virus (SFV) (Liljestrรถm and Garoff, 1991), Sindbis virus (Xiong et al, 1989) and Venezuelan Equine Encephalitis virus (VEE) (Davis et al, 1989). The expression vector systems are generally based on three modifications of the alphavirus genome (Figure 1). I. Replication-competent vectors, where in addition to the full-length genome a second subgenomic promoter is engineered to express the foreign gene of interest. II.

Lundstrom: Semliki Forest virus vectors in gene therapy

other hand, the expression levels obtained are extremely high, which can contribute to better by-stander effects seen in neighboring non-infected cells. Finally, the layered DNA vectors are the safest gene delivery vehicles since no viral particles are present at any stage. Obviously, their main disadvantage is the poor gene delivery efficiency common to all plasmid vectors. In this review are highlighted the use of alphavirus vectors for expression of recombinant proteins as well as in vivo expression studies in rodents. The efficiency of gene delivery to tumor cells and the efficacy of intratumoral injections into animals with implanted tumors are described. Furthermore, alphavirus vectors can be employed for the production of retrovirus-like particles in a simple and efficient way. Alphavirus particles, selfreplicating RNA molecules as well as layered DNA vectors have been used for vaccine approaches that can be applied to both prophylactic and therapeutic cancer gene therapy. Emphasis is also put on the development of novel alphavirus vectors for cell/tissue-specific targeting, for lower toxic effects on host cells and prolonged expression time.

cell lines and primary cell cultures (Lundstrom, 1999). Particularly G protein-coupled receptors (GPCRs) and ligand-gated ion channels have been expressed at high densities in mammalian host cells. Saturation binding studies indicated that more than 100 pmol receptor per mg protein and receptor densities of more than 6 million receptors per cell were achieved. Functional coupling of GPCRs to G-proteins could be demonstrated by measuring intracellular Ca2+-release, inositol phosphate accumulation, cAMP stimulation and GTP"S binding. However, there are some potential disadvantages of using SFV vectors for functional studies. SFV infection inhibits the host cell protein synthesis, which will deprive the cells from endogenous G-proteins and therefore result in less efficient coupling. The other issue is the extreme receptor levels obtained, which in itself will lead to an inappropriate receptor / G-protein ratio for detection of strong functional responses. To overcome these problems, multiple infections with SFV vectors expressing both GPCRs (#1b-adrenergic receptor) and G-proteins (G#q, G !2 and G"2) were carried out in the same cells resulting in substantially increased functional responses in COS7 cells (Scheer et al, 1999). Establishment of large-scale SFV technology in suspension cultures of mammalian cells led to the production of high receptor yields (1-5 mg/l), which has allowed efficient receptor purification for structural studies (Hovius et al, 1998)

II. Gene expression in vitro Topologically different proteins (nuclear, cytoplasmic, membrane and secreted proteins) have been expressed at high levels from SFV vectors in a variety of

Figure 1. Schematic presentation of alphavirus expression systems., mammalian host cell; , alphavirus particle; , recombinant protein

, 26S subgenomic promoter;

, CMV promoter;

Gene Therapy and Molecular Biology Vol 6, page 27

This efficient gene expression and the possibility of simultaneous expression of several proteins in the same host cell should be a good basis for using alphavirus vectors for in vivo applications.

expression. The SFV-mediated transgene expression in vivo was remarkably neuron-specific. Similar observations were obtained from primary rat hippocampal neurons cultured on a feeder layer of astrocytes, where SFVmediated GFP expression was mainly detected in neurons (> 90%) and in very few glial cells (< 5%) (Figure 2). Likewise, injection of SFV-GFP vectors into organotypic hippocampal slices demonstrated that more than 90% of the GFP-positive cells were of neuronal origin (Ehrengruber et al, 1999).

III. Gene expression in vivo Both Sindbis and SFV vectors have been used for efficient gene delivery to rodent brain in vivo. Stereotactic injections of replication-deficient Sindbis virus carrying the LacZ gene into mouse nucleus caudatus/putamen and nucleus accumbens septi resulted in high transient !galactosidase expression (Altman-Hamandzic et al, 1997). Similar observations were made after injection of SFVLacZ particles into the striatum and amygdala of male Wistar rats (Lundstrom et al, 1999a). The injected animals were monitored for general health (food intake, body weight, body temperature), sensorimotor function, muscle strength and exploratory behavior and compared to control animals injected with cell culture medium. No significant differences were found between the two groups. High, local expression of !-galactosidase was observed at 1-2 days post-injection. The transient nature of expression from replication-deficient SFV vectors became evident from time-course studies that showed a decrease in !galactosidase levels at 4 days post-injection. Some staining was still detectable at 28 days post-injection, most likely due to the high stability of !-galactosidase. In situ hybridization data also confirmed the transient nature of

IV. Alphavirus vectors in tumor cells and animal models It is well documented that SFV vectors causes a strong induction of apoptosis after infection (Lundstrom et al, 1997). This feature could therefore make SFV vectors attractive for cancer gene therapy applications. It has been shown that SFV vectors can efficiently infect human prostate tumor cell lines and prostate duct epithelial cells ex vivo (Hardy et al, 2000). Furthermore, strong apoptosis was detected in cells infected with SFV-LacZ virus and led to premature cell death. To achieve even stronger responses in tumor cells, cytokine genes have been introduced into the SFV vector. Intratumoral injections of SFV-IL12 virus particles, expressing the p40 and p35 subunits of IL-12 from the same SFV vector, showed significant tumor regression and inhibition of tumor blood

Figure 2. Expression of GFP in primary rat hippocampal neurons. Primary hippocampal neurons were infected with SFV-GFP at a multiplicity of infection (MOI) of 10 and visualized by fluorescence microscopy at 2 days post-infection.

Lundstrom: Semliki Forest virus vectors in gene therapy

vessel formation in a mouse B16 melanoma model when monitored by Doppler ultrasonography (Asselin-Paturel et al, 1999). Moreover, multiple injections resulted in increased anti-tumor response, but interestingly no antiviral immune reaction could be detected. In another study, nude mice with implanted human lung carcinomas were injected with various SFV vectors (Murphy et al, 2000). It could be concluded that intratumoral injections with SFV-LacZ, SFV-GFP or even empty SFV particles (containing only the SFV replicase genes) resulted in induction of p53-independent apoptosis and in significant tumor shrinkage. Again, repeated injections according to a scheme of 3 injections on consecutive days followed by another series of 3 injections one week later turned out to be beneficial. Most encouragingly, these repeated injections resulted in no antiviral responses in the treated animals.

VI. Production particles

retrovirus-like

The efficient recombinant protein expression from alphavirus vectors has encouraged to produce retroviruslike particles by co-transfection of SFV vectors carrying the gag-pol, env and LTR-$+-neo-LTR constructs from Moloney murine leukemia virus (MMLV) into BHK cells (Li and Garoff, 1996). The advantage of this approach is that helper-free high-titer retrovirus-like particles possessing reverse-transcriptase activity could be rapidly produced, even when constructs contain intron sequences (Li and Garoff, 1998). In another approach, retrovirus virion RNA was cloned into the SFV expression vector. Introduction of in vitro transcribed full-length chimeric SFV-retrovirus RNA into retrovirus packaging cell lines by electroporation or SFV infection resulted in retroviruslike particles that were capable of transducing target cells, showed reverse transcriptase activity and could integrate into the host cell genome (Wahlfors et al, 1997). Finally, in a hybrid application of virus targeting and retrovirus production, the SFV envelope protein genes were replaced by the env gene from murine leukemia virus (MuLV), which resulted in packaging of minimal virus particles with strong affinity to host cells carrying MuLV receptors (Lebedeva et al, 1997).

V. Cell/tissue-specific targeting To further increase the safety of using alphavirus vectors for gene therapy applications it would be of great advantage to be able to specifically target virus infections to specific cells / tissue. Sindbis virus (SIN) vectors with 105-fold reduction in infection rates of normal host cells were obtained by introduction of IgG-binding domains of protein A into the E2 membrane protein (Ohno et al, 1997). Protein A-mediated infection occurred through specific monoclonal antibodies reacting with cell surface proteins. In another approach #- and !-hCG gene sequences were introduced into the Sindbis envelope, which led to no infection of BHK cells nor human cancer cells lacking LH/CG receptors (Sawai and Meruelo, 1998). In contrast, choriocarcinoma cells showed high infection rates. Targeting of SFV vectors has also been initiated by the generation of chimeric SFV paticles wit protein A domains in various regions of SFV E1 and E2 membrane proteins. Most of these chimeric SFV vectors were not capable of producing virus progeny due to incorrect folding of envelope structures (Lundstrom, unpublished results). However, EM studies confirmed that vectors with inserts close to the N-terminus of the E2 protein generated viable SFV particles. The infection rate of BHK cell was dramatically reduced and studies on infection through the protein A domains are now in progress. The advantage of using SFV compared to SIN vectors is the possibility to generate conditionally infectious particles with the second-generation pSFVHelper2 vector (Berglund et al, 1993). These SFV particles are almost non-infectious (1 particle out of 105 are infectious) without #-chymotrypsin treatment, which means that chimeric SFV particles will have a further 105fold down-regulation of infectivity.

VII. Vaccine strategies Traditionally application of vaccine strategies has been to use alphavirus particles, self-replicative naked RNA or layered DNA vectors for immunization of animals to obtain cytotoxic T cell (CTL) responses and protection against lethal challenges with virus (Lundstrom, 2001). In this sense, VEE has turned out to be a particularly efficient vector. Immunization with VEE particles expressing influenza HA resulted in complete protection against intranasal challenge with influenza virus in BALB/c mice (Caley et al, 1997). Likewise, macaques vaccinated with VEE vectors expressing the GP and NP structural proteins of Marburg virus remained aviremic and were completely protected from the disease (Hevey et al, 1998). The use of naked RNA or layered DNA vectors for vaccination has become attractive because of the simple and safe administration. The self-replicative alphavirus vectors have gained much popularity mainly because antigenspecific immune responses could be obtained at concentrations 1,000-fold lower than those for conventional plasmids (Berglund et al, 1998; Hariharan et al, 1998). More closely related to gene therapy applications, vaccine strategies have also been initiated to induce tumor immunity. Expression of the P1A gene from recombinant SFV vectors resulted in induction of P185 tumor immunity (Colmenero et al, 1999). Injection of self-replicating SFVLacZ RNA intramuscularly protected mice from tumor challenge and prolonged the survival time of mice with established tumors (Ying et al, 1999). Furthermore,

Gene Therapy and Molecular Biology Vol 6, page 29

immunization of mice with 5 x 106 SFV particles expressing the human papillomavirus early genes E6 and E7 protected 40% of the animals from cervical cancer challenge (Daemen et al, 2000).

host cells tested (BHK, CHO, HEK293, HeLa cells) including primary neurons in culture. Moreover, the recombinant protein expression from the mutant SFV vector was increased by 5- to 10-fold. Another drawback with applying alphavirus vectors has been their transient nature of gene expression. This has been partly due to the high cytotoxicity subjected to the host cells, but also the novel non-cytopathogenic alphavirus vectors clearly show only short-term expression mainly due to RNA degradation and termination of RNA replication. Recently, it was demonstrated that some point mutations or deletions in the nsP2 gene of both Sindbis and SFV generated vectors with persistent RNA replication that allowed a substantially prolonged transgene expression in host cell lines (Perri et al, 2000). Development of these novel vectors for long-term gene therapy applications could be very attractive.

VIII. Vector development Although the alphavirus vectors are rather efficient in relation to gene delivery and transgene expression efficiency, there are some disadvantages that need to be addressed. The vectors are highly toxic to the host cells and typically induce apoptosis. Additionally, shortly after alphavirus infection there is generally a dramatic shut down of endogenous gene expression, which will certainly contribute to the premature cell death. In the case of cancer gene therapy, this is necessarily not a negative feature, but for other applications it might be favorable to have a prolonged survival of the host cells. For this reason, novel non-cytopathogenic vectors have been developed for both Sindbis (Agapov et al, 1998) and SFV (Lundstrom et al, 1999b). In both cases it turned out that point mutations in the nonstructural gene nsP2 resulted in the noncytopathogenic phenotype. The non-cytopathogenic Sindbis vector showed change in phenotype only in a limited number of host cells (BHK and Vero cells) and a significantly reduced RNA replication, whereas the SFV vector showed a substantially reduced cytotoxicity in all

IX. Conclusions and future prospects As described in this review alphavirus vectors can be used as versatile tools for in vitro and in vivo gene expression studies (Figure 3). The rapid high-titer virus production, broad host range, cytoplasmic RNA replication and extreme overexpression of recombinant proteins are features that have made alphaviruses

Figure 3. Overview of alphavirus vector applications. , replication-deficient alphavirus particle; , chimeric alphavirus particle; , lethal virus or tumor challenge; , retrovirus-like particle; , mammalian host cell; , tumor cell; , recombinant protein.

Lundstrom: Semliki Forest virus vectors in gene therapy

Dubensky TW Jr, Driver DA, Polo JM, Belli BA, Latham EM, Ibanez CE, Chada S, Brumm D, Banks TA, Mento SJ, Jolly DJ, Chang SM (1996) Sindbis virus DNA-based expression vectors, Utility for in vitro and in vivo gene transfer. J Virol 70, 508-519. Ehrengruber MU, Lundstrom K, Schweitzer C, Heuss C, Schlesinger S, Gahwiler BH (1999) Recombinant Semliki Forest virus and Sindbis virus efficiently infect neurons in hippocampal slice cultures. Proc Natl Acad Sci USA 96, 7041-7046. Hardy PA, Mazzini MJ, Schweitzer C, Lundstrom K, Glode LM (2000) Recombinant Semliki Forest virus infects and kills human prostate cancer cell lines and prostatic duct epithelial cells ex vivo. Int J Mol Med 5, 241-245. Hariharan MJ, Driver DA, Townsend K, Brumm D, Polo JM, Belli BA, Catton DJ, Hsu D, Mittelstaedt D, McCormack JE, Karavodin L, Dubensky TW Jr, Chang SM, Banks TA (1998) DNA immunization against herpes simplex virus, enhanced efficacy using Sindbis virus-based vector. J Virol 72, 950-958. Hevey M, Negley D, Pushko P, Smith J, Schmaljohn A (1998) Marburg virus vaccines based upon alphavirus replicons protect guinea pigs and nonhuman primates. Virology 251, 28-37. Hovius R, Tairi AP, Blasey H, Bernard A, Lundstrom K, Vogel H (1998) Characterization of a mouse 5-HT3 receptor purified from mammalian cells. J Neurochem 70, 824-834. Lebedeva I, Fujita K, Nihrane A, Silver J (1997) Infectious particles derived from Semliki Forest virus vectors encoding murine leukemia virus envelope. J Virol 71, 7061-7067. Li KJ and Garoff H (1996) Production of infectious recombinant Moloney murine leukemia virus particles in BHK cells using Semliki Forest virus-derived RNA expression vectors. Proc Natl Acad Sci USA 93, 11658-11663. Li KJ and Garoff H (1998) Packaging of intron-containing genes into retrovirus vectors by alphavirus vectors. Proc Natl Acad Sci USA 95, 3650-3654. Liljeström P and Garoff H (1991) A new generation of animal cell expression vectors based on the Semliki Forest virus replicon. Bio/Technology 9, 1356-1360. Lundstrom K (1999) Alphaviruses as tools in neurobiology and gene therapy. J Receptor & Signal Transd Res 19, 673686. Lundstrom K (2001) Alphavirus vectors, applications for DNA vaccine production and gene expression. Intervirology, in press. Lundstrom K, Pralong W, Martinou JC (1997) Anti-apoptotic effect of Bcl-2 overexpression in RIN cells infected with Semliki Forest virus. Apoptosis 2, 189-191. Lundstrom K, Richards JG, Pink JR and Jenck F (1999a) Efficient in vivo expression of a reporter gene in rat brain after injection of recombinant replication deficient Semliki Forest virus. Gene Ther Mol Biol 3, 15-23. Lundstrom K, Schweitzer C, Richards JG, Ehrengruber MU, Jenck F and Mülhardt C (1999b) Semliki Forest virus vectors for in vitro and in vivo applications. Gene Ther Mol Biol 4, 23-31. Murphy AM, Morris-Downes MM, Sheahan BJ, Atkins GJ (2000) Inhibition of human lung carcinoma cell growth by apoptosis induction using Semliki Forest virus recombinant particles. Gene Ther 7, 1477-1482. Ohno K, Sawai K, Iijima Y, Levin B, Meruelo D (1997) Cellspecific targeting of Sindbis virus vectors displaying IgGbinding domains of protein A. Nat Biotechnol 15, 763-767.

attractive. Today, a multitude of recombinant proteins have been successfully expressed from SFV vectors, not the least the highly important family of GPCRs. Moreover, techniques for in vivo gene delivery are well established. Preliminary studies on tumor models in animal have resulted in promising regression in tumor size and the absence of immune responses against the virus after repeated injections have been most encouraging. The vaccine approach for cancer therapy with both therapeutic and prophylactic efficacy obtained is also very exciting. The proof of principle demonstrated for cell/tissue specific targeting, should also encourage further development. Novel non-cytopathogenic and replication persistent vectors will certainly increase the application possibilities of alphavirus vectors and should allow the use of antisense, ribozyme and RNA interference technologies as modes of cancer gene therapy. In general, it can be concluded that the wide range of applications of alphavirus vectors today should with further development make them highly attractive for clinical trials and gene therapy applications in the future.

References Agapov EV, Frolov I, Lindenbach BD, Pragai BM, Schlesinger S, Rice CM (1998) Noncytopathogenic Sindbis RNA vectors for heterologous gene expression. Proc Natl Acad Sci USA 95, 12989-12994. Altman-Hamamdzic S, Groseclose C, Ma JX, Hamamdzic D, Vrindavanam NS, Middaugh LD, Parratto NP, Sallee FR (1997) Expression of !-galactosidase in mouse brain, Utilization of a nonreplicative Sindbis virus vector as a neuronal gene delivery system. Gene Ther 4, 815-822. Asselin-Paturel C, Lassau N, Guinebretiere JM, Zhang J, Gay F, Bex F, Hallez S, Leclere J, Peronneau P, Mami-Chouaib F, Chouaib S (1999) Transfer of the murine interleukin-12 gene in vivo by Semliki Forest virus vector induces B16 tumor regression through inhibition of tumor blood vessel formation monitored by Doppler ultrasonography. Gene Ther 6, 606-615. Berglund P, Sjoberg M, Garoff H, Atkins GJ, Sheahan BJ, Liljestrom P (1993) Semliki Forest virus expression system, production of conditionally infectious recombinant particles. Biotechnology 11, 916-920. Berglund P, Smerdou C, Fleeton MN, Tubulekas I, Liljestrom P (1998) Enhancing immune response using suicidal vaccines. Nat Biotechnol 16, 562-565. Berglund P, Tubulekas I and Liljeström P (1996) Alphaviruses as vectors for gene delivery. Trends Biotechnol 14, 130-134. Caley IJ, Betts MR, Irlbeck DM, Davis NL, Swanstrom R, Frelinger JA, Johnston RE (1997) Humoral, mucosal, and cellular immunity in response to a human immunodeficiency virus type 1 immunogen expressed by a Venezuelan equine encepahlitis virus vaccine vector. J Virol 71, 3031-3038. Colmenero P, Liljeström P and Jondal M (1999) Induction of P185 tumor immunity by recombinant Semliki Forest virus expressing the P1A gene. Gene Ther 6, 1728-1733. Daemen T, Pries F, Bungener L, Kraak M, Regts J, Wilschut J (2000) Genetic immunization against cervical carcinoma, induction of cytotoxic T lymphocyte activity with a recombinant alphavirus vector expressing human papillomavirus type 16 E6 and E7. Gene Ther 7, 1859-1866.

Gene Therapy and Molecular Biology Vol 6, page 31

Perri S, Driver DA, Gardner JP, Sherrill S, Belli BA, Dubensky TW Jr, Polo JM (2000) Replicon vectors derived from Sindbis virus and Semliki Forest virus that established persistent replication in host cells. J Virol 74, 9802-9807. Sawai K and Meruelo D (1998) Cells-specific transfection of choriocarcinoma cells by using Sindbis virus hCG expressing chimeric vector. Biochem Biophys Res Comm 248, 315323. Scheer A, Bjรถrklรถf K, Cotecchia S, Lundstrom K (1999) Expression of the #1b-adrenergic receptor and G protein subunits in mammalian cell lines using the Semliki Forest virus expression system. J Receptor & Signal Transd Res 19, 369-378. Wahlfors JJ, Xanthopoulos KG, Morgan RA (1997) Semliki Forest virus-mediated production of retroviral vector RNA in retroviral packaging cells. Hum Gene Ther 8, 2031-2041. Ying H, Zaks TZ, Wang RF, Irvine KR, Kammula US, Marincola FM, Leitner WW, Restifo NP (1999) Cancer therapy using self-replicating RNA vaccine. Nat Medic 5, 823-827.

Kenneth Lundstrom Tel: 41-61-687 8653, Fax: 41-61-688 4575, E-mail: Kenneth.Lundstrom@Roche.com

Lundstrom: Semliki Forest virus vectors in gene therapy

Gene Therapy and Molecular Biology Vol 6, page 33

Gene Ther Mol Biol Vol 6, 33-46, 2001

The Hitchhiking principle: Optimizing episomal vectors for the use in gene therapy and biotechnology Review Article

Jürgen Bode 1*, Christian P. Fetzer2, Kristina Nehlsen1, Monica Scinteie2, Bok-Hee Hinrichsen2, Armin Baiker2#, Christoph Piechazcek2¨, Craig Benham3 and Hans J. Lipps2 1

German Reasearch Institute for Biotechnology, Braunschweig, Germany Institute of Cell Biology, University Witten/Herdecke, Witten 3 Department of Biomathematical Sciences Mount Sinai School of Medicince New York, NY 2

_________________________________________________________________________________________________ *Correspondence: Jürgen Bode, Ph.D., German Reasearch Institute for Biotechnology, D- 38124 Braunschweig, FRG, Mascheroder Weg 1; Tel./Fax: +49 531 6181 251/262; email: jbo@gbf.de #present address: Stanford University Department of Pediatrics, 300 Pasteur Drive,Grant Bldg. Room S 356, Stanford, CA 94305-5208. ¨

present address: AmCell D-51429 Bergisch Gladbach, Technologiepark H 13 Key words: Hitchhiking principle, gene therapy, biotechnology, replication origins, mammalian viruses, Maintenance elements, Replication–transcription coupling, nonviral episomes Abbreviations: auxiliary elements, (Aux); base-unpaired region, (BUR); cyclin-dependent class, (CDKs); DNA unwinding element, (DUE); duplex destabilization, (SIDD); dyad symmetry, (DS); Epstein-Barr viral nuclear antigen 1, (EBNA-1); Epstein-Barr virus, (EBV); family of repeats, (FR); inverted repeats, (IRs); lyric origins, (ori Lyt); minichromosome maintenance proteins, (Mcms); origin recognition complex, (ORC); origin recognition element, (ORE); origins, (ORIs); papilloma virus, (BPV); parent vector, (pC1); polyoma virus, (PyV); Proliferating-cell nuclear antigen, (PCNA); replication fork barrier, (RFB); replication protein A, (RPA); scaffold/matrix attached region, (S/MAR) Received: 24 January 2001; accepted: 29 January 2001; electronically published: February 2004

Summary We have recently introduced an episomally replicating vector the function of which depends on the combination of SV40 origin of replication with a human scaffold/matrix attached region (S/MAR). The episomal status of this vector is maintained in several cell lines for an extended period of time in the absence of a virally encoded protein and in the absence of selection conditions. In this article we start to identify the elements required for recruiting this type of episome to the endogenous cellular replication machinery and we discuss aspects of replication-transcription coupling. We try to establish a catalogue of parameters which should be considered for the design of functional episomes.

1993, Boulikas, 1996; Kelly and Brown, 2000). Understanding the control of replication is relevant both for the purpose of academic and applied research. Failure in the control of replication may result in cell death and is one of the primary reasons leading to cellular transformation and uncontrolled growth. From a practical point of view episomal replicating vectors provide several advantages over the classical systems (Calos 1996).

I. Introduction Considerable efforts have been undertaken in the past years to construct vectors which replicate episomally in higher eukaryotic cells. While in bacteria and yeast the structure and regulation of replication origins (ORIs) is rather well understood and origin functions can clearly be assigned to certain sequence elements this is not true for chromosomal origins of mammalian cells (De Pamphilis

Bode et al: Episomal vectors in gene therapy

With the present technology targeted integration is still no routine (Bode et al, 2000b) and the conventional alternative, random integration, may lead to insertional mutagenesis with unpredictable consequences. For the same reasons expression of the transgene can not be controlled since it is dependent on the chromatin context of the integration site (Baer et al, 2000). High level expression can only be achieved at favorable genomic loci but the danger exists that integration into highly expressed sites interferes with vital cellular functions. In addition, there is increasing evidence for the existence of cellular defense mechanisms against foreign DNA which operate by down-regulating transgenes in a process that is accompanied by DNA methylation (Bingham 1997; Garrick et al, 1998). As discussed below, episomal vectors are intrinsically free from all these disadvantages. A number of DNA viruses, such as SV40, BPV or EBV replicate episomally in mammalian cells. These processes depend both on viral trans-acting factors and on accessory activities recruited from the host cell replication machinery. For their segregation DNA viruses apply a “hitchhiking principle” (Calos, 1998), i.e. they acquire centromere functions by associating with host chromosomes. Since the replication origins of these viruses are well characterized, they represent convenient tools for the study of the associated elements and the relation between ongoing transcription and replication. Still, vectors derived from these minimal systems require at least one viral protein, the large T-antigen in case of SV40, E1/E2 for BPV or EBNA-1 for EBV which usually restrict their replication to a narrow host range. Since transformation of recipient cells is an inevitable consequence of these factors the development of a new vector generation is desirable in which their function is replaced by components of the endogenous cellular replication machinery. Such a vector, pEPI-1, which is based on the SV40 origin of replication but is independent on the virally encoded large T-antigen for replication has recently been introduced (Piechaczek et al, 1999, Baiker et al, 2000). pEPI-1 contains a well characterized S/MAR from the human interferon-! gene (Element I in Mielke et al, 1990), it replicates episomally in a variety of mammalian cell types and is stably maintained and segregated over several hundred generations even in the absence of selection. Further facets of potential relevance are the two transcription units present on this construct ( Figure 3). All these factors may contribute to the properties of this vector but the exact functions and interactions of the participating elements still have to be determined.. In this review we will describe the role of modules in minimal eukaryotic origins of replication (ORIs) as well as possible interrelations between transcription and replication. We will discuss how we can take advantage of this knowledge to design novel non-viral episomal vector systems of wide applicability.

II. Common structural features of replication origins It seems that among all terrestrial life forms the activation of replication origins shares some common fundamental characteristics. First, an initiator protein, such as dnaA in E. coli, T antigen in SV40 or polyoma, and EBNA1 in Epstein-Barr virus, directs the formation of a large complex containing several initiator protein molecules. As a prerequisite, most ORI sequences possess AT-rich stretches, so called base-unpairing regions (BURs), which undergo strand separation under superhelical tension (see chapter IIB below). Most ORIs also harbor a significant number of nearby tri, tetra and higher nucleotide repeats which can recruit the energy stored in a BUR in order to induce a defined secondary structure (hairpin, stem-loop) which in turn is the recognition feature for the initiator protein complex. Frequently, these repeats are parts of an element which has been termed a “DUE“ (DNA unwinding element) and which can be characterized by its localized reactivity towards single strand specific agents. While the function of a base unpairing region may certainly overlap that of a DUE, this is not necessarily the case (Figure 1): in the context of the present article, a BUR is a box that is composed of multiple destabilized sites and which is hence defined by its duplex destabilization (SIDD) parameters as introduced in Benham et al, (1997) (Figure 4). In contrast, a DUE depends on repetitive sequence features. Once formed, ssDNA binding proteins have to interact with the induced secondary structures before the DNA polymerase/primase complex is able to initiate DNA replication. In this view a continuously reciprocating transition may exist between extended single strands and DNA forms which invest the energy stored in BURs in the formation of alternative structures. For eukaryotes, competence to initiate DNA replication in G1 depends on the ordered assembly of multiprotein complexes at the ORI. Once assembled, the competent complexes initiate DNA synthesis, triggered by protein kinases of the cyclin-dependent class (CDKs) and the Cdc 7 family. In addition to initiating replication, CDKs have a role in preventing re-initiation within a given cell cycle. Competence is restored by the elimination of CDK activity during metaphase (review: Kelly and Brown, 2000). This CDK-driven switch explains why the default state of an eukaryotic cell is the one in which DNA is replicated once and only once per cell cycle (Figure 2).

A. Yeast: ARS A glimpse of the complexity of eukaryotic origins arises from studies on ARS activation in the budding yeast Saccharomyces cerevisiae. This unicellular lower eukaryote does not have to cope with the complexity of multicellular organisms that need to develop a specific program of silencing sets of ORIs during embryogenesis. Nevertheless, its ORIs appear to be differentially activated

Gene Therapy and Molecular Biology Vol 6, page 35

Figure 1. Anatomy of an eukaryotic minimal origin of replication, exemplified by SV40. Replication initiation is usually supported by an easily melting DNA tract, the so-called base-unpairing region (BUR; cf. Figure 4). The energy absorbed by base-unpairing can be delivered to a DNA unwinding element (DUE) and used to establish secondary structures such as a hairpins or a stem-loop (cf. Figure 2). These are the prerequisites for the origin recognition complex (ORC) to associate with the origin recognition element (ORE) and to initiate replication. The process gains additional support from transcription factors which may associate with auxiliary elements (Aux). The polyoma (PyV) and papilloma virus (BPV) origins conform to the same general design whereas related features are found in case of Epstein-Barr virus (EBV, Figure 2, top) and the yeast autonomously replicating sequences (ARSs, Figure 2, bottom).

during S-phase intervals (Ferguson et al, 1991). Yeast ORIs could be cloned using an in vivo selection system based on autonomous replication. The responsible sequences were called autonomously replicating sequences or ARS elements as they permit replication of the selected gene as an extra-chromosomal plasmid. The properties of ARS-containing plasmids were consistent with the function of genomic ORIs, in that their replication occurs in the nucleus, only once during the S-phase, and in that it requires the same genes as does chromosomal replication. ARS elements contain a 15-35 bp binding site for origin recognition proteins, the ORE (origin recognition element) which comprises a conserved 11 bp AT-rich tract (ARS consensus sequence, ACS, T/ATTTAT/CA/GTTTT/A). This tract represents the binding site for ACS binding proteins (parts of the origin recognition complex, ORC), which are constituents of the nuclear matrix from which they can be recovered by extraction. The ACS forms the core of a larger functional sequence called element “A“. In addition to A, a region called “B“, located downstream of the T-rich strand of the ACS, is also required for ARS function. In several or all ARSs, domain B is easily unwound. A functional role for a BUR/DUE system localized within domain B is supported by mutations which reduce the ease of unwinding and thereby replication activity. It is also suggested by the substitution of domain B-sequences with dissimilar sequences that are easily unwound (Huang and Kowalski 1996). While the A element plays the major role in specifying a sequence as a replication origin, the B region elements serve to enhance the efficiency of origin utilization (Figures 1, 2).

Usually, the B-region can be further subdivided into 2 or 3 essential subregions which may overlap in function: while single mutations in any subregion reduce replication activity, replication is still observed as long as a a single B-element is left. In contrast to the A element, the Bregion is not conserved among different ARSs. In case of ARS1, element B3 contains a characterized binding site for the ABF1 transcriptional regulatory protein. While binding of ABF1 to several ARS elements stimulates initiation of replication, the factor also contributes to either repression or activation of transcription, (Diffley and Stillman, 1988, 1990). Its function can be substituted by other transcriptional regulators such as RAP1 or GAL4 if they are provided with both, DNA binding and activation domains to stimulate DNA synthesis, and if their recognition sites are adapted to region B sequences. The protein complex specifically recognizing the ARS core region was originally identified by DNA footprinting. This complete “origin recognition complex” (ORC), consists of 6 polypeptides which protect the ACS throughout the cell cycle. During Gl, the protection over the ACS extends to adjacent nucleotides, a result suggesting that either the ORC undergoes significant conformation alteration prior to S phase, or - more plausibly - that additional proteins become associated with it. Most likely, these alterations are an imprint by Cdc6 and the Mcm (minichromosome maintenance) proteins which 'reset' chromatin for another round of DNA replication early in the cell cycle. Mcm2-7 family members are highly conserved in the eukaryotic kingdom. They are nuclear proteins which form several types of oligomeric complexes some of which have ATPase and

Bode et al: Episomal vectors in gene therapy

weak helicase activity. Chromatin, thus 'licensed' for replication, is guided into the S phase by the activation of cell cycle-regulated protein kinases. Upon entry into S phase, the pre-replication complex is partially dissolved, first by the dissociation of Cdc6 and then by a gradual release of Mcm proteins. This process appears to be accompanied by a recruitment of chain elongation factors and the establishment of replication forks (Kelly and Brown, 2000). While ARS plasmids replicate efficiently, some authors state that they still lack the sequences needed for proper and efficient segregation into daughter cells during mitosis (dePamphilis, 1993). A more or less random segregation of the replicated plasmid at division is thought to produce cells with multiple copies and some with none. Since cells with multiple copies have a selective advantage they would accumulate with time. On the other hand,

S/MAR-characteristic of yeast ARSs have been noted which could well serve a maintenance function (Amati and Gasser, 1990). Metazoan ORIs may in fact differ from those of yeast because their nuclei become disassembled during mitosis whereas they remain largely intact in fungi. This puts emphasis on nuclear retention activities which are strictly needed to establish and maintain extrachromosomal DNA in higher eukaryotes.

B. Minimal ORIs in mammalian viruses Activation of yeast ARS sequences seems to be more complicated than structural distortions that are caused by a simple complex formed by a unique protein such as the large T antigen in SV40, or the E1/E2 complex in Bovine papilloma. It is now believed that an eukaryotic cell can

Figure 2: Some particular features of the Epstein Barr virus-oriP (top) and of yeast ARSs (bottom) For EBV a dyad symmetry element (DS) serves the function of a DUE and (sometimes) ORE. Only in case of artificial BPV-ori constructs EBNA-1 has a function at the DUE which otherwise seems to attract ORCs from the host cell (Norio et al, 2000). On the other hand, there is a massive association of EBNA-1 with the family of repeats (FR) segment which, in its presence, serves the function of a maintenance element. Unwinding potential is probably provided by the surrounding S/MAR sequences (Jankelevich et al, 1992) which can serve as highly efficient BURs (Benham et al, 1997). All ARS elements are characterized by an element “A“ harboring the 11 bp AT rich ARS consensus sequence (ACS). ACS is the principal binding site of the ORC. ORC is followed by Cdc6 (a protein necessary for origin firing (Cocker et al, 1996) and the minichromosome maintenance proteins (Mcms) which together form the initiation complex (review: Kelly and Brown, 2000). Element “A“ is supported by one or more B-elements of various composition which mark segments with DNA unwinding potential (Huang and Kowalski, 1996). Whether or not replication in yeast requires maintenance functions has remained a controversial matter.

Gene Therapy and Molecular Biology Vol 6, page 37

replicate any sequence which contains the appropriate signals for initiation in a once per cell cycle manner. Therefore, an unexpected complication arose from the observation that some DNA viruses seem to have developed strategies to overcome this stringent copy number regulation. An notable exception is the latent Epstein-Barr virus.

(iii) Local DNA unwinding or distortion: transcription factors stabilize weak interactions with replication proteins by causing limited unwinding or altering local structure of the DNA to favor replication protein-DNA interactions.

2. BPV Papillomaviruses are members of the small DNA tumor virus family. Their mode of replication is closely coupled to the differentiation status of the infected epithelium. In the basal and parabasal cells, the virus is maintained as a low copy number extra-chromosomal episome and undergoes regulated DNA replication modulated by both viral and host proteins. As cells undergo progressive differentiation, vegetative viral replication is triggered, "late" viral genes are expressed, and progeny virions are produced in a fraction of the terminally differentiated cells in papillomas. The latent stage of papillomaviral replication provides an ideal system for the study of regulated eukaryotic DNA replication. The BPV ORI appears similar in organization to that of SV40, with a 12 bp ATrich sequence at one end and a palindrome at the other that constitutes the primary binding site for the BPV E1 protein. E1 is a functional homolog of SV40 large T antigen, with origin binding potential as well as ATPase and helicase activity. E1associates as a trimer or a hexamer on its cognate E1-binding site in the viral origin with relatively low initial affinity and sequence specificity. In the replication competent form of BPV, E1 forms a dihexameric complex which may be stabilized by the Hsp40 chaperone, mirroring the structure of SV40 T antigen on the SV40 ORI. In addition to its role in initiation, HPV-11 E1 is also required during elongation in vitro, suggesting that its helicase activity may be critical at the replicating forks. E2 is a viral transcriptional transactivator that is also essential for viral DNA replication in vivo. It binds as a dimer with high affinity to its conserved binding sites in the viral genome, including several sites in the viral origin of replication. One of the critical functions of E2 in replication is to interact with and recruit E1 to the viral ORI by virtue of its stronger DNA binding affinity and specificity for E1. Based on these data the following model of E2/E1 interaction during initiation of bovine papillomaviral DNA replication has been proposed: once the first molecule of E1 is loaded onto the origin by E2, E2 is released from the origin, allowing E1 to multimerize into a replication-competent form. The role of E2 may extend beyond the recruitment of E1 as it was found to contribute to the formation of the entire pre-initiation complex, but it is dispensable during elongation.

1. SV40 As any origin of replication, the SV40 ORI consists of multiple modules (Figure 1). Although flanking regulatory sequences of the early promoter facilitate replication, a 64 bp core is sufficient for initiation. A 20 bp motif, 5"TGCATAAATAAAAAAAATTA-3", forms one T-antigen binding site. Its continuos tract of 8 adenines is highly conserved also among polyoma viruses as it is the prerequisite for DNA bending. Bending has been shown to facilitate strand separation of the AT tract and it is thought that DNA supercoiling and the 27 bp Tantigen binding palindrome cooperate with the A-tract to destabilize the origin. SV40 large T antigen (T-Ag) is the only viral protein required for replication. The host provides all other replication proteins, among these the ssDNA binding protein (SSB), DNA polymerase-primase complex, topoisomerases I and II, RNAseH, a 5"-> 3"exonuclease, Proliferating-cell nuclear antigen (PCNA) and PCNA-dependent DNA polymerase. An initial event in the replication pathway is ATPdependent binding of T-Ag molecules to four GAGGC repeats which are part of a palindrome within the ORE (Fig. 1). In the presence of ATP, 12 molecules of large T become assembled as two hexamers on the SV40 core ORI (Valle et al, 2000). These hexamers melt the early and untwist the late half of the core ORI. These process releases T-Ag from the pentanucleotides and permits its action as a helicase at the flanking AT tract. The SV40 ORI region overlaps promoter regions for the SV40 early genes and mutational studies demonstrated that transcription factor binding greatly enhances the efficiency of replication. While the SV40 replicon may be unusual in that it is a highly compact genetic element it has been observed that this and other ORIs are in close proximity to transcription factor binding sites. The stimulation of replication afforded by these auxiliary elements is generally ascribed to several contributing factors: (i) An altered chromatin structure: Factor NF1 binds adjacent to the SV40 origin and prevents nucleosome formation in the ori region thereby allowing more efficient binding of T-Ag and replication proteins. This contribution stimulates replication at least 20-fold. (ii) Direct protein-protein contact: transcription factors are thought to interact with essential replication proteins and to enhance their activity. Both DNA binding and acidic activation domains are required for these stimulatory effects.

3. EBV Within latently infected human B-lymphocytes the circular 165 kb chromosome of Epstein-Barr virus (EBV) is maintained as a large episome. Synthesis and

Bode et al: Episomal vectors in gene therapy

maintenance of this episome is mediated by a viral cisacting sequence, oriP, and a single viral protein, the Epstein-Barr viral nuclear antigen 1 (EBNA-1). On latent EBV chromosomes replication initiates at multiple sites including a 1.8-kb region called oriP, which is sufficient for both replication and stabilization of recombinant plasmids in the presence of EBNA- 1. In such a minimal system replication depends on multiple EBNA-1 binding sites and it is initiated at or near the dyad symmetry component which contains two 46 bp protected regions each encompassing two paired core binding sites. Altogether, there are 24 binding sites for EBNA-1 within ORIP. These sites are organized into two clusters, 1000 bp apart, referred to as the dyad symmetry element (DS) and the family of repeats (FR-element). The relative orientation of DS and FR can be altered without affecting oriP function which is also barely affected by yet another locus, BamHI-Q, with two additional low-affinity EBNA1 bindings sites (Rawlins et al, 1985) FR consists of 20 copies of a 30 bp repeat unit each of which represents a high affinity site for EBNA-1. This interaction is able to prevent plasmids from being lost from mitotically active cells, it serves as replication enhancer and also as a potent EBNA1-dependent transcriptional enhancer. In addition to sequence-specific DNA binding, EBNA-1 molecules interact efficiently with each other by a DNA looping mechanism (Laine and Frappier, 1995), by which they link the various binding sites. These interactions lend EBNA-1 properties which are otherwise typical of nuclear matrix proteins such as SAF-A and RAP-1 and, as a consequence, it might stabilize binding of EBNA-1 to the DS element or it might attract the cellular replication machinery (Frappier and O'Donnell, 199l). Named for the dyad symmetry it contains, the DS element, has four overlapping, palindromic binding sites of intermediate affinity for EBNA-1. In vivo footprinting studies have proven that EBNA1 is the only protein interacting with these sites. Considering the dimeric nature of EBNA-1, and the importance of the precise spacing between the palindromic halves, it is likely that the dimer is the associating species. EBNA-1 is closely associated with cellular chromatin as it is uniformly distributed over all chromosomes in metaphase spreads (Reedman and Klein, 1973). By itself, it does not appear to melt origin DNA but it induces localized changes, visible as sensitivity to permanganate oxidation, at two of the four DS sites, which may be the prerequisite for origin DNA melting. The core of the EBNA-1 DNA binding region is virtually identical in structure and positioning on DNA with the DNA-binding domain of BPV-E2 protein. A distinguishing feature is an N-terminal extension which mediates several sequence-specific DNA contacts along the minor groove. While this extended chain is not immediately required for DNA binding, it is responsible for permanganate sensitivity: this structure appears to

produce DNA overwinding in two ratchet-like events enforcing a distorted B-helix that is bent around the protein core. EBNA-1 appears to lack the enzymatic activities that are present in ORI-binding proteins of other mammalian viruses and it does not seem to interact with human cellular proteins that provide the equivalent functions. It has even been demonstrated that it is dispensable for the synthesis of oriP plasmids. However, in its absence, newly synthesized oriP plasmids are lost rapidly from proliferating cells indicating the existence of elements that permit retention of replicated DNA in daughter cells. Although the precise role of EBNA-1 in this process has remained elusive, it is now agreed that its main function occurs post-synthetically to ensure plasmid maintenance and segregation in dividing cells. Unlike plasmids of other viruses but akin to human chromosomes, ORIP plasmids are synthesized once per cell cycle and are partitioned faithfully to daughter chromosomes during mitosis. Aiyar et al, (1998) have found that oriP is recognized directly by the human DNA synthesizing machinery, indicating why, unlike most other viral origins, oriP is replicated once per cell cycle and in synchrony with cellular chromosomes. By all these criteria, replication of the oriP replicon differs substantially from the replication of other viral replicons and it has therefore been used as a paradigm for the function of chromosomal ORIs. Its action is clearly different from large the T-Ag of SV40 and the E1 of BPV described above which possess an ATP-hydrolysisdependent DNA helicase activity and which interact directly with cellular proteins involved in initiation of DNA synthesis to recruit them to the viral origin. These observations suggest a mechanism by which the SV40 and BPV but not EBV replicons bypass the cellular mechanisms that restrict chromosomal and ORIP DNA synthesis to a single round per cell cycle. As with initiation zones on human chromosomes, in EBV initiation occurs more often at some regions than at others. A major zone exists adjacent to the terminal repeats resembling the zones at chromosomal mammalian loci. Initiation within the zone is likely to be determined by interactions with cellular proteins. It is not known what determines extended initiation zones but this property is certainly contributed by the host cell rather than the viral protein. Therefore, a functional redundancy of sites with the potential to serve origin functions is a common feature of genomic DNA replication in the mammalian nucleus.

III. Conserved properties in higher origins A. AT-Rich stretches in ORIs AT-rich regions of varying size are omnipresent components of origins of replication. They may flank the core ORI, as, for example, in EBV where the core is defined as the short sequence where the initiator protein causes local distortion in the double helix to initiate DNA

Gene Therapy and Molecular Biology Vol 6, page 39

unwinding. More often the AT-rich tract is situated between two binding sites of the initiator protein. Five different functions have been assigned to ATrich stretches (Boulikas, 1996). The most conspicuous role is their property to facilitate DNA unwinding catalyzed by helicases. A DNA unwinding element is already present in the origin of E. coli in form of a GATCTnTTnTTTT tract which is thermodynamically unstable, as evidenced by its sensitivity to the single-strand-specific mung bean nuclease (Kowalski and Eddy, 1989). Therefore, AT tracts become unwound caused by the binding of the initiator proteins to the flanking region(s). ssDNA-binding proteins then interact with the melted portion and attract the DNA polymerase-primase complex. Second, AT tracts are typical constituents of S/MARs which in higher eukaryotes guide the ORI to the replication factories which are organized by the nuclear matrix. A DNA unwinding potential has been ascribed to rather short ATrich motifs, for instance the AATATATTT tract which is present within the S/MARs of both IgH gene and interferon-# genes where it becomes the nucleation site for DNA base unpairing under torsional strain (Bode et al, 1992). Third, AT-rich stretches in ORIs might interact with HMG 1 and 2 as in the 50 bp AT-rich stretches of the amplification origins located within the nontranscribed spacer of the murine rDNA (Wegner et al, 1990). Fourth, AT-rich stretches represent the binding sites of a special class of regulatory proteins; for example, yeast ARS elements include the mentioned T/ATTTAT/CA/GTTTT/A sequence which here and in ORIs of other species forms the binding site of the ORC protein complex (Diffley and Cocker, 1992). Fifth, if not the actual binding sites of the initiator protein, AT tracts may be the principal place of local distortion of the double helix caused by the binding of the initiator protein to the immediate flanks.

at the core origin. The role of a special class of inverted repeat-binding proteins and their function in stabilizing DNA in its cruciform structure has been anticipated by Pearson et al, (1994). Several lines of evidence suggest cruciform formation at the time of activation of an origin of replication (Boulikas, 1996), monoclonal antibodies, directed against cruciforms occurring in ors sequences supposed to represent monkey origins of replication from unknown genes were shown to enhance DNA replication in permeabilized monkey cells. Using monoclonal antibodies directed against cruciform and quantitative fluorescence flow cytometry, 3-5E5 cruciforms/nucleus were estimated for monkey CV-1 and human colon adenocarcinoma SW48 cells throughout S phase while no cruciform-like structures could be detected during G0, G2M or in metaphase chromosomes. Sl nuclease sensitive sites appear as rodent cells move through Gl phase (Collins et al, l982). A number of studies on ORIs in viral and in higher genomes support the idea that either the origin possesses intrinsically curved DNA or that a severe bent is produced at the origin fragment as a result of its interaction with replication initiator proteins. The fact that origins of replication coincide or colocalize with S/MARs and that S/MARs have been proven to possess intrinsically curved DNA from the retardation in mobility on agarose gels is one additional argument in favor of curved DNA occurring in ORIs (Boulikas and Kong, 1993; Boulikas, 1996). The EBV-origin does not appear to be an exception to this rule. Based on the known functions of oriP, this region was likely to be situated within or adjacent to a S/MAR which has been verified in an elegant study by Jankelevich et al, (1992). More recently, Mattia et al, (1999) have demonstrated that both the latent (oriP) and one of the lyric origins (ori Lyt) become attached to the nuclear matrix, oriP during the latent cycle of infection and ori Lyt after induction of the lytic cycle.

B. BURs, DUEs and IRs In general, origins of replication require a DNA unwinding element. Adenovirus is only an apparent exception since replication begins at the end of the linear genome where unwinding requires less energy. We have shown above that a DUE is determined by base-stacking interactions rather than AT content. Frequently, DUEs comprise inverted repeats (IRs) which have found their perfection in viral ORIs. They easily convert into cruciform structures when DNA is torsionally strained due to the action of a tracking protein for instance during transcription (RNA polymerase) or replication (DNA polymerase). This process can be supported by retrieving the energy stored in a nearby AT rich base-unpaired region (BUR). Inverted repeats are of two kinds. They can be quite short (5-20 bp), usually representing the binding sites of initiator proteins. Long IRs are exemplified by a 144 bp perfect inverted repeat in HSV-1 oriL which is believed to convert into cruciform structures and to act like sinks of torsional strain, to facilitate unwinding of the double helix

C. Maintenance elements The role of nuclear retention functions for the authentic segregation of episomes has been emphasized above for EBV-based plasmids. In that example, retention is supported to a significant extent by the EBNA-protein which binds to its cognate sequences in the FR region. In other examples a strategically positioned S/MAR may mediate at least some of the required interactions. In case of BPV the E1/E2 proteins are believed to be the main contributors to chromosome attachment and episome maintenance (Calos, 1998). Although the participation of a S/MAR has not directly been demonstrated in this case, such a role has become evident during the construction of artificial episomes: the potential of BPV-derived vectors was increased dramatically when a hybrid plasmid (BPVBV1) was constructed which could be shuttled between E. coli and mouse cells (Di Maio et al, 1981). For this

Bode et al: Episomal vectors in gene therapy

function it had to contain a 69% subfragment of BPV and a minimum of 2.7 kb eukaryotic “stabilizing sequence” which had been found by trial and error in the large ßglobin intron. Later on we have demonstrated that this sequence coincides with a S/MAR (Klehr and Bode, 1988). In mammalian cells, ORIs colocalize with S/MARs and become DNAse I hypersensitive during their activation. ORIs are in close proximity to even within the nuclear matrix attachment sites of chromatin loops and a number of studies has conclusively demonstrated that initiation of DNA replication takes place on the nuclear matrix (review: Boulikas, 1996). In addition, elongation of new DNA proceeds by reeling of the old strands through the matrix where the replication forks are anchored.

been reasoned that the high number of initiation sites in embryos may reflect a relative transcriptional quiescence of embryonic cells. At a lower level of complexity, replication in yeast is enhanced by the transcription factor Abf1p (ARS binding factor 1) which associates with a region 3" to the T-rich strand (B-domain). In the tandemly organized rDNA repeats mentioned above, the RNA Pol I enhancer also contains a weak binding site for Abf1. While binding of Abf1 is inhibited at the nucleosome-packed enhancers 3" from inactive gene copies, enhancers downstream from active genes are always organized in a nucleosome free structure that is accessible to transcription factors. In this situation Abf1 could attract replication protein A (RPA) which would assist the unwinding process thereby mediating activation of a nearby A domain.

IV. Replication–transcription coupling

B. Role of transcription direction In bacteria the majority of strong promoters on the chromosome are oriented such that transcription complexes move away from oriC (Brewer 1988) which is plausible in the framework of the twin- domain model (Wu et al, 1988) which postulates that a tracking protein like RNA polymerase leaves behind underwound DNA in its wake (which may be stabilized by negative supercoiling) and causes overwinding in front of it (which may revert to B-type DNA by positive superhelicity). Therefore, an initiation site would become single stranded more easily if transcription would move away from it. For eukaryotes, the scenario is clearly more complicated, possibly because of the rules according to which nucleosomes associate with superhelical DNA. Since DNA is wrapped in a left-handed sense around a nucleosome, this packaging represents a repository of underwound DNA which is released once the proteinDNA interaction is weakened, for instance by nucleosome hyperacetylation (Norton et al, 1989, 1990). As a consequence, nucleosomes will tend to associate with the negative superhelical part of the twin-domain (Wang et al, 1993) while they will be driven off by the approach of a tracking protein (Studitsky et al, 1994). It has been proposed that transcription through a yeast ARS element affects ARS function in a negative sense (Kipling and Kearsey, 1989). A common model to demonstrate this property is the yeast rDNA locus which consists of a tandem array of 9.1 kb units that are repeated 100-200 times. Although each rARS constitutes a potential ORI, less then one third of rARSs are actually used in a given S-phase (Muller et al, 2000). Recently, replication initiation has been demonstrated exclusively for those rARSs placed immediately downstream of actually transcribed genes. Once an rARS has fired, replication proceeds bidirectionally. The leftward moving fork is stopped at the replication fork barrier (RFB) at the 3´ end of transcriptionally active genes whereas the rightwardmoving fork proceeds through about 5 repeats. In contrast

There is evidence that transcription and replication may be antagonistic: transcription appears to prevent replication from initiating within transcribed regions (Haase et al, 1994). We will show below that such a generalization cannot be true and under which conditions transcription and replication may affect each other either in a positive or a negative sense.

A. Contribution of transcription factors Exemplified by SV40, a single protein may simultaneously regulate two entirely different processes: transcription and replication. Spl stimulates SV40 DNA replication (Guo and DePamphilis, 1992) as does NF-I (also called CTF, or C/EBP). The CCAAT element recognized by NF-I is an important promoter element for a significant number of eukaryotic genes. NF-I as Oct-1 which is involved in the regulation of the histone H2B and immunoglobulin genes can also stimulate initiation of adenovirus DNA replication in vitro. In addition, proteins implicated in the control of DNA replication may include p53, a sequence-specific DNA-binding factor with a GCrich sequence preference that might interact with the Spl site of SV40 ORI (Boulikas, 1994). The tight coupling between replication and transcription might simply arise from the fact that most replication factors interacting with the core ORI are actually at the same time transcription factors. Along the same lines, transcriptional enhancers effective in replication may exert this effect by stabilizing replication initiation complexes at the origin core, even in the cases where they are found at a large distance. This is particularly pronounced for the ORIs in multicellular organisms which comprise binding sites for a high number of transcription factors in addition to the binding sites for the replication-specific initiator protein. This level of complexity directs their programming during embryogenesis and their differential replication during S phase which is tightly coupled to gene expression sometimes in a negative sense (see below). It has also

Gene Therapy and Molecular Biology Vol 6, page 41

Figure 3. Verification and disproval of the episomal status. Upper row: The S/MAR-ORISV40 plasmid pEPI-1 and its derivatives; Bottom row: A S/MAR-ORIP plasmid. A - PCR tests using primers neo-up and neo-fwd; lane 1: pEPI-1 plasmid; lane 2 control CHO cells; lanes 3, 4 pEPI-1 transfected CHO cells after extended culture. B - Southern blots; lanes 1, 2, pEPI1 restricted by EcoRI plus Bgl II or EcoRI, resp.; lanes 3,4 same for pEPI-1-transfected CHO cells after extended culture. C - lane 1, Southern blot for pEPI-1 restricted by EcoRI plus NheI; lanes 2, 3 same for two independent pEPI-1-transfected HaCat clones. D - lanes 1,2 Southern blots for two clones transfected by pEPI1 GFP. 6.0 kb mark shows localization of the signal expected for episomal status (after linearization by EcoRI). E lanes 1,2 Southern blots for two clones transfected by pEPI1 S/MAR. 4.7 kb mark shows localization of the signal expected for episomal status (after linearization by EcoRI). F - lanes 1,2 Southern blots for two pOriP-transfected CHO clones. 5.0 and 4.5 kb marks show localization of the signals expected for episomal status (after restriction with BamHI/Bgl II). G - same for HaCat cells.

to the upstream gene, the transcriptional activity of the downstream gene does not influence ARS activation. Unlike yeast, genomic DNA replication in metazoa and particularly in mammalians does not initiate at fixed ORI sequences. In some cases, active genes appear to possess an actively used ORI in their 5´ flanking region, whereas inactive genes are replicated from an origin in their 3´ flanking region (Boulikas, 1996). Thus, replication of the transcriptionally active c-myc and histone H5 genes occurs from origins in the 5´ flanking region, whereas in cell types where these genes are in a transcriptionally inactive conformation, these genes are replicated from a 3´ flanking ORI. However, replication of the active DHFR locus in CHO cells which occurs from a position in the 3´

flank underlines that we may still have to deal with isolated observations rather than with a firm rule.

C. Importance of terminators We have shown above, that replication is tuned by transcription in a rather unpredictable fashion which in several examples is correlated with the direction of RNA polymerase movement. In case of plasmids a more general statement seems to hold that replication is only possible as long as transcription is restricted to small regions and sufficient non-transcribed regions are available for replication initiation (Haase et al 1994). Possibly, transcription through extended regions of a small circular entity affects supercoiling in a rather global fashion which

Bode et al: Episomal vectors in gene therapy

might interfere with binding of the DNA polymerase complex . While it appears conceivable that inhibition of plasmid replication is a result of interference with replication fork progression by opposing transcription complexes, other examples seem to indicate that replication inhibition can also be the consequence of an interference with replication initiation functions rather than fork progression. These properties may depend on the nature of the participating transcription factors and on their precise constellation . In the quoted work (Haase et al, 1994) the authors have described the antagonistic effects of transcription and replication for a 24 kb episome in short-term culture. Here, unspecified origin functions were contributed by a 17 kb piece of human DNA whereas the nuclear retention functions were provided by the FR (family of repeats) from EBV (cf. Figure 2). The plasmid contained a complete active transcription unit composed of the Hyg gene which was driven by a HSV-tk promoter and flanked downstream by a tk transcriptional terminator. In addition, it contained a CMV promoter/enhancer the orientation of which could be changed to transcribe either a short pBR322 sequence in the (-) direction or some of the human insert in the (+)-direction. A severe inhibition of replication activity was monitored only for the (+)-case and it was reasoned that the precise termination of the (-) transcript might have prevented such an interference. This assumption was verified by adding the UMS element, a known terminator sequence, directly downstream of the promoter in the (+) construct which raised its replication activity sevenfold. For yeast and for many eukaryotic viruses transcription units are arranged such that RNA polymerase proceeds in the same direction as the replication fork whereby it is restricted from moving through an ORI. These paradigms, however cannot necessarily be extended to the present system in which replication does not start a fixed position but rather at any of several sites throughout an initiation zone. Since there is no single region required for replication initiation, it is unlikely that transcription through a specific site will interfere with replication. It is therefore conceivable that plasmids of this type replicate as long as active transcription is confined to small regions leaving sufficient non-transcribed sequences for replication initiation. Interestingly, such a situation can be enforced by the appropriate positioning of termination sequences.

polyadenylation site. In addition, it harbors a reporter, i.e. a GFP gene cassette consisting of the CMV promoter, the S/MAR and an SV40 polyadenylation sequence which again shields the ORI from being approached by RNA polymerase. This vector replicates as an episome in the absence of a viral protein (T-Ag) and it is maintained for several hundred generations at a copy number around 10. Although the design of this vector has considered several of the above mentioned criteria, it is felt that its performance is not a trivial consequence of appropriately inserting transcription units, terminators and a potential nuclear retention signal in form of a S/MAR. We are in the process of unraveling the relative role these factors play for the function of the episome, its retention and the regulation of its replication, during the cell cycle. To this end we apply the entire scope of strategies offered by sitespecific recombinase, to excise elements, flip their orientation or supplement them by inserting accessory elements (Bode et al 2000). Experiments so far have shown that any major alteration of this constellation is detrimental in the sense that it leads to integration (Figure 3). Figure 3 (top row) show some criteria that have been used for establishing the episomal status of pEPI 1 before this property could unambiguously be demonstrated by FISH analysis (Baiker et al, 2000). As an initial test, part A shows PCR signals that are generated by closely apposed primers which have been positioned in the Kan/Neo termination region. The 6.7 kb signal shows that no random opening of pEPI 1 has occurred which would inevitably have led to its integration. Although this signal has been derived from a Hirt extract which is commonly used to enrich for episomal (non-integrated) DNA, this does not strictly exclude the presence of a precise tandem head-to-tail integration event consisting of two or more copies. Although such an integration mode is a common consequence of the classical Ca-phosphate mediated transfection of transgenes it is very unlikely if electroporation is used as in the present case (Baer et al, 2000). A more stringent criterion are Southern blots which demonstrate the presence of the restriction fragments expected for a circular vector. This analysis is valid if presence of any additional signal can be excluded which would indicate a “bordering fragment” as a consequence of an integration event. Such a “bordering fragment“ would comprise parts of the vector and a stretch of host cell DNA terminating at the respective restriction site. Panels D and E demonstrate that no major alterations are tolerated by the system. Unexpectedly, excision of the GFP coding region causes integration which indicates an intricate interplay of transcription and replication which will have to be unraveled. Other modifications that have been performed are exemplified by Figure 1E which demonstrates the consequence of deleting the S/MAR. It is noted that this deletion causes integration which suggests that the S/MAR

V. Lessons for the design of nonviral episomes We have recently demonstrated that a prototype scaffold/matrix attachment element (S/MAR) is capable of recruiting the cellular replication machinery to an SV40 origin of replication which is flanked by two transcription units (Figure 3). This vector contains an Kan/Neo transcription gene which is transcribed in the direction of fork progression and terminated by a HSV-tk

Gene Therapy and Molecular Biology Vol 6, page 43

not only serves a retention function but also is the element enabling the formation a functional replication initiation complex. It could be argued that it is the S/MAR which contains an endogenous human origin of replication since a cohabitation of ORIs and S/MARs has frequently been documented. This is most likely not the case however, as the complementary experiment (deletion of the SV40-ORI but maintenance of the S/MAR) leads to the same outcome: integration (Baiker et al, 2000). Besides SV40 we have also studied the function of alternative minimal viral origins of replication. Integration of a construct pORIP into the genome of either CHO or HaCat cells is demonstrated in panels F and G. We have not looked into the molecular reasons of this results which may be manifold: there is only a single (appropriately terminated) transcription unit and the S/MAR lies in the underwound part of the twin-domain (which would reinforce its strand-separation properties). Whether the underwound and overwound parts of the plasmid can compensate out each other is hard to decide due to the interposition of the matrix attachment region. The function of the S/MAR in pEPI-1 is probably not a trivial one which could be provided by any AT rich sequence. The AT rich NTS-1 and NTS-2 sequences are associated with an endogenous origin of replication in mice (Wegner et al, 1990). When these sequences were cloned in place of the S/MAR, they did not mediate episomal replication nor did they prevent the construct_s integration. We have recently performed biomathematical analyses on multiple S/MAR elements and have demonstrated that S/MAR activities can be derived from stress-induced duplex destabilization (SIDD-) profiles in which the double strand stability of each nucleotide in the context of a given sequence is plotted (Benham et al, 1997 and in preparation). S/MARs are characterized by a regular distribution of unwinding elements which can be visualized as destabilized regions in the SIDD diagram. If these minima reach a certain level, if a certain spacing requirement is fulfilled between them and if the baseunpairing region (BUR) as a whole exceeds a threshold extension, these parameters indicate matrix attachment potential. This type of analyses is exemplified in Figure. 4 for pEPI-1 (Piechaczek et al, 1999), the S/MAR-free parent vector (pC1) and its NTS-1 and -2 derivatives. For pC1 the AT rich element is clearly seen as a base unpairing element. If AT sequences are cloned next to the ORI, unwinding at this site is efficiently competed for and this is most pronounced for the particular constellation which is present in the S/MAR construct pEPI-1. This finding can be interpreted as follows: the S/MAR is a major sink for superhelical strain and will be singlestranded in the absence of dsDNA binding proteins. Once the replication initiation complex has formed over the ORE, the energy stored in this sink can be retrieved by the DUE and later on by the ORE which will use it for the formation of secondary structures as a prelude to helicase action and replication initiation. Since the process is

independent of viral proteins, it is possible though unproven that such a vector becomes subject to the “once per cell cycle” replication control that is typical for endogenous replication initiation zones and for EBV.

VI. Outlook and perspective By now, it has become obvious that viruses depend on host cell functions for coming alive. Cellular functions that require a structural organization are used by the virus for transcription and replication. Replication of the small DNA tumor virus SV40 is an excellent example, because in addition to virion proteins, it encodes only a few regulatory proteins. Deppert and Schirmbeck, (1995) have summarized the evidence that all major viral processes during the life cycle from viral DNA replication to virion formation occur within the structural systems of the nucleus, in particular the chromatin and the nuclear matrix. Large T antigen itself becomes a member of the nuclear matrix where it binds to the ORI and starts the assembly of an initiation complex in concert with cellular factors. It might also mediate the known matrix association of SV40 minichromosomes which grants their replication and maintenance as episomes. Interestingly, the SV40 genome contains a S/MAR which is part of the large T coding region (Pommier et al, 1990). DNA viruses from several families start their transcription and replication adjacent to a specific nuclear compartment which has been termed ND10, PML body or POD. Association of SV40 with ND10 appears to be a prerequisite for replication (Tang et al, 2000) where also SV40 transcription is noted. Apparently, transcription would also occur at other nuclear locations but might be concentrated at ND10 as a consequence of replication. A possible role of a S/MAR in mediating these contacts remains to be documented. Besides their established function in replication and in the establishment of a transcriptionally active methylation-free DNA status in the genome (Dang et al, 2000) there is at least one convincing demonstration that S/MARs maintain central activities also in replicating episomes: to define the elements of the Ig- gene involved in deregulation of the c-myc gene after translocation, Hörtnagel et al (1995) have assembled different parts of the Ig-locus in an EBV-derived episomal vector. These experiments clearly showed that the S/MAR is required for the maximum c-myc activation observed in Burkitt lymphoma cells. In order to differentiate between S/MAR and enhancer functions, both elements were also tested in transient transfection experiments where the enhancers provided a 30 fold activation while in the presence of the S/MAR transcription was reduced to the background level. This work suggests that episomally replicating constructs allow to study the role of S/MARs in transcription and these systems should therefore be useful for their detailed analysis. From a practical viewpoint it is hoped that a systematic exploitation of the “hitchhiking” strategy

Bode et al: Episomal vectors in gene therapy

Figure 4. Stress-induced duplex destabilization (SIDD) profiles for the episome, pEPI-1, the non-episomal basic construct pC1 and its derivatives pNTS1 and pNTS2. Insert: Anatomy of a BUR. High resolution analysis for the boxed part in the C1-SIDD profile demonstrates that the A8-tract forms the BUR (see also Fig. 1). The destabilization of this BUR (marked by the dashed line labelled â&#x20AC;&#x153;SV40 oriâ&#x20AC;? is seen to be strongly modulated by the nature of elements which are present on the left of map position 1.8 (NTS2, NTS1 and S/MAR). Thereby it can be used as a gauge for estimating the relative base-unpairing potential of the surroundings which may be one parameter responsible for ORI support Amati B and Gasser SM (1990) Drosophila scaffold-attached regions bind nuclear scaffolds and can function as ARS elements in both budding and fission yeasts. Mol Cell Biol 10, 5442- 5454. Baer A, Schubeler D, Bode J (2000) Transcriptional properties of genomic transgenes integration sites marked by electroporation or retroviral infection. Biochemistry 39, 7041-7049. Baiker A, Maercker C, Piechaczek C, Schmidt SB, Bode J, Benham C, Lipps HJ (2000) Mitotic stability of an episomal vector containing a human scaffold/matrix-attached region is provided by association with nuclear matrix. Nat Cell Biol 2, 182-184. Benham C, Kohwi-Shigematsu T, Bode J (1997) Stress- induced duplex DNA destabilization in scaffold/matrix attachment regions. J Mol Biol 274, 181-196. Bingham PM (1997) Cosuppression comes to the animals. Cell 90, 385-387. Bode J, Benham C, Knopp A and Mielke C (2000a) Transcriptional Augmentation, Modulation of Gene Expression by Scaffold/Matrix Attached Regions (S/MAR Elements) Crit. Rev. Eukaryot. Gene Expr 10, 73-90. Bode J, Kohwi Y, Dickinson L, Joh T, Klehr D, Mielke C, Kohwi-Shigematsu T (1992) Biological significance of

invented by viruses and the positive effects of a S/MAR on both replication and transcription activities will lead to a new generation of vectors with wide applications in gene therapy and biotechnology.

Acknowledgements We want to thank all colleagues who contributed concepts, references and outlines for the Figures. The help of Angela Knopp (GBF) in this respect is particularly acknowledged. Special thanks are due to Teni Boulikas for his encouragement and for setting the path in this evolving field. Work in the authors laboratories was supported by grants from Deutsche Forschungsgemeinschaft (Bo 419/10-1/-2 and Li 231/18-1/-2).

References Aiyar A, Tyree C, Sugden B (1998) The plasmid replicon of EBV consists of multiple cis-acting elements that facilitate DNA synthesis by the cell and a viral maintenance element. EMBO J 21, 6394-6403.

Gene Therapy and Molecular Biology Vol 6, page 45

unwinding capability of nuclear matrix-associating DNAs. Science 255, 195-197. Bode J, Schlake T, Iber M, Schubeler D, Seibler J, Snezhkov E, Nikolaev L (2000b) The transgeneticist s toolbox: Novel methods for the targeted modification of eukaryotic genomes. Biol. Chem. 381, 801-813. Boulikas T (1994) A compilation and classification of DNA binding sites for protein transcriptionfactors from vertebrates. Crit. Rev. Eukaryot. Gene Expression 4, 117321. Boulikas T (1996) Common structural features of replication origins in all life forms. J Cell Biochem 60, 297-316. Boulikas T. and Kong CF (1993) A novel class of matrix attached regions (MARs) identified by random cloning and their implications in differentiation and carcinogenesis. Int. J. Oncology 2, 325-330. Brewer BJ (1988) When polymerases collide , Replication and the transcriptional organization of the E. coli chromosome. Cell 53, 679-686. Calos MP (1996) The potential of extrachromosomal replicating vectors for gene therapy. Trends Genet 12, 463-466. Calos MP (1998) Stability without a centromere. Proc. Natl. Acad. Sci. USA 95, 4084-4085. Cocker JH, Piatti S, Santocanale C, Nasmyth K, Diffley JF (1996) An essential role for the Cdc6 protein in forming the pre-replicative complexes of budding yeast. Nature (London) 379, 180-182. Collins JM, Glock MS, Chu AK (1982) Nuclease S1 sensitive sites in parental deoxyribonucleic acid of cold- and temperature-sensitive mammalian cells. Biochemistry 21, 3414- 3419. Dang Q, Auten J, Plavec I (2000) Human beta interferon scaffold attachment region inhibits de novo methylation and confers long-term, copy number- dependent expression to a retroviral vector. J Virol 74, 2671-2678. DePamphilis ML (1993) Eukaryotic DNA replication: Anatomy of an origin. Ann Rev Biochem 62, 29-63. Deppert W and Schirmbeck R (1995) The nuclear matrix and virus function. Int Rev Cytol 162A, 485-537. Diffley JF and Cocker JH (1992) Protein-DNA interactions at a yeast replication origin. Nature (London) 357, 169-172. Diffley JF and Stillman B (1988) Protein-DNA interactions at a yeast origin. Nature (London) 357, 169-172. Diffley JF and Stillman B (1990) The initiation of chromosomal DNA replication in eukaryotes. Trends Genet. 6, 427- 432. DiMaio D, Treisman R and Maniatis T (1982) Bovine papilloma vector that propagates as a plasmid in both mouse and bacterial cells. Proc Natl Acad Sci USA 79, 4030-4034. Ferguson BM, Brewer BJ, Reynolds AE, Fangman WL (1991) A yeast origin of replication is activated late in S phase. Cell 65, 507-515. Frappier L and Donnell MO (1991) Overproduction, purifuication, and characterization of EBNA-1, the origin binding protein of Epstein-Barr virus. J Biol Chem 266, 7819- 7826. Garrick D, Fiering S, Martin DI, Whitelaw E (1998) Repeatinduced gene silencing in mammals. Nature Genetics 18, 56- 59. Guo ZS and DePamphilis ML (1992) Specific transcription factors stimulate simian virus 40 and polyomavirus origins of DNA replication. Mol Cell Biol 12, 2514-2524. Haase SB, Heinzel SS, Calos MP (1994) Transcription Inhibits the Replication of Autonomously Replicating Plasmids in Human Cells. Mol Cell Biol 14, 2516- 2524.

Hรถrtnagel K, Mautner J, Strobl LJ, Wolf DA, Christoph B, Geltinger C, Polack A (1995) The role of immunoglobulin kappa elements in c-myc activation. Oncogene 10, 13931401. Huang RY and Kowalski D (1996) Multiple DNA elements in ARS305 determine replication origin activity in a yeast chromosome. Nucleic Acids Res. 24 ,816-823. Jankelevich S, Kolman JL, Bodnar JW, Miller G (1992) A nuclear matrix attachment region organizes the Epstein- Barr viral plasmid in Raji cells into a single DNA domain. EMBO J 11, 1165-1176. Kelly TJ and Brown GW (2000) Regulation of chromosome replication. Annu Rev Biochem 69, 829-880. Kipling D and Kearsey SE (1989) Analysis of expression of hybrid yeast genes containing ARS elements. Mol. Gen. Genet. 218, 531-535. Klehr D and Bode J (1988) Comparative evaluation of bovine papilloma virus (BPV) vectors for the study of gene expression in mammalian cells. Mol Gen (Life Sci Adv) 7, 47-52. Kowalski D and Eddy MJ (1989) The DNA unwinding element, A novel, cis-acting component that facilitates opening of the E. coli replication origin. EMBO J 8, 4335-4344. Laine A and Frappier L (1995) Identification of Epstein-Barr virus nuclear antigen 1 protein domains that direct interactions at a distance between DNA-bound proteins. J Biol Chem 270, 30914-30918. Mattia E, Ceridono M, Chichiarelli S, D'Erme M (1999) Interactions of Epstein-Barr virus origins of replication with nuclear matrix in the latent and in the lytic phases of viral infection. Virology 262, 9-17. Mielke, C Kohwi, Y Kohwi-Shigematsu, T. and Bode, J (1990) Hierarchical binding of DNA fragments derived from scaffold-attached regions: Correlations of properties in vitro and function in vivo. Biochemistry 29, 7475-7485. Muller M, Lucchini R, Sogo JM (2000) Replication of yeast rDNA initiates downstream of transcriptionally active genes. Mol Cell 5, 767-777. Norio P, Schildkraut CL, Yates JL (2000) Initiation of DNA replication within oriP is dispensable for stable replication of the latent Epstein-Barr virus chromosome after infection of established cell lines. J Virol 74, 8563-8574. Norton VG, Imai BS, Yau P, Bradbury EM (1989) Histone acetylation reduces nucleosome core particle linking number change. Cell 57, 449-457. Norton VG, Marvin KW, Yau P, Bradbury EM (1990) Nucleosome linking number change controlled by acetylation of histones H3 and H4. J Biol Chem 265, 1984819852. Pearson CE, Ruiz MT, Price GB, Zannis-Hadjopoulos M (1994) Cruciform DNA- binding protein in HeLa vcell extracts. Biochemistry 33, 14185-14196. Piechaczek C, Fetzer C, Baiker A, Bode J, Lipps HJ (1999) A vector based on the SV40 origin of replication and chromosomal S/MARs replicates episomally in CHO cells. Nucl Acid Res 27, 426-428. Pommier Y, Cockerill PN, Kohn KW, Garrard WT (1990) Identification within the simian virus 40 genome of a chromosomal loop attachment site that contains topoisomerase II cleavage sites. J Virol 64, 419-423. Rawlins DR, Milman G, Hayward SD, Hayward GS (1985) Sequence-specific DNA binding of the Epstein-Barr virus nuclear antigen (EBNA-1) to clustered sites in the plasmid maintenance region. Cell 42, 859-868.

Bode et al: Episomal vectors in gene therapy

Reedman BM. and Klein G (1973) Cellular localization of an Epstein-Barr virus (EBV-) associated complement-fixing antigen in producer and non-producer lymphoblastoid cell lines. Int. J. Cancer 11, 499-520. Studitsky VM, Clark DJ, Felsenfeld G (1994) A histone octamer can step around a transcribing polymerase without leaving the template. Cell 76, 371-382. Tang Q, Bell P, Tegtmeyer P, Maul GG (2000) Replication but not transcription of simian virus 40 DNA is dependent on nuclear domain 10. J Virol 74, 9694-9700. Valle M, Gruss C, Halmer L, Carazo JM, Donate LE (2000) Large T-antigen double hexamers imaged at the simian virus 40 origin of replication. Mol Cell Biol 20, 34-41.

Wang JC and Lynch AS (1993) Transcription and DNA supercoiling. Curr Opin Genet Dev 3, 764-768. Wegner M, Schwender S, Dinkl E, Grummt F (1990) Interaction of a protein with a palindromic sequence from murine rDNA increases the occurence of amplification-dependent transformation in mouse cells. J Biol Chem 265, 1392513932. Wu HY, Shyy SH, Wang JC, Liu LF (1988) Transcription generates positively and negatively supercoiled domains in the template. Cell 53, 433-440.

Gene Therapy and Molecular Biology Vol 6, page 47

Gene Ther Mol Biol Vol 6, 47-55, 2001

Mammalian genome organization and its implications for the development of gene therapy vectors Review Article

Merav Cohen1, Katherine L. Wilson2 and Yosef Gruenbaum1* 1

Department of Genetics, The Institute of Life Sciences, The Hebrew University of Jerusalem, Jerusalem 91904 Israel Dept. Cell Biology and Anatomy, The Johns Hopkins University School of Medicine, 725 N. Wolfe Street, Baltimore MD 21205 USA 2.

_________________________________________________________________________________________________ *Correspondence: Yosef Gruenbaum, Ph.D.; Telephone: 972-2-6585995; Fax: 972-2-5637848 or 972-2-6586975; E-mail: gru@vms.huji.ac.il Key words: Nucleocytoplasmic trafficking, nucleoporins, gene therapy vectors, Abbreviations: A. thaliana, (At); C. elegans, (Cel); D. melanogaster, (Dm); endoplasmic reticulum, (ER); hemagglutinin, (HA); inner membranes, (IM); nuclear envelope, (NE); nuclear pore complex, (NPC); outer membranes, (OM); phenylalanine-glycine, (FG); pore membrane proteins, (POMs); wheat germ agglutinin, (WGA) Received: 9 June 2001; Accepted: 17 July 2001; electronically published: February 2004

Summary The nuclear pore complex (NPC) is the site for macromolecular traffic between the nucleus and cytoplasm. NPCs are composed of 30-40 distinct proteins (termed nucleoporins) in yeast, and an estimated 50 distinct nucleoporins in vertebrates. Most nucleoporins are soluble proteins. In contrast, the number of integral membrane nucleoporins is small and includes only four proteins in yeast (Pom152, Ndc1, Snl1 and Pom34), and two proteins in metazoans (gp210 and Pom121). We discuss the known membrane nucleoporins, and present for the first time the sequences of putative gp210 orthologs from Drosophila, C. elegans and Arabidopsis. Our results suggest that Gp210 is conserved among all multicellular eukaryotes, including plants, consistent with a fundamental role in NPC structure or biogenesis.

nucleus and cytoplasm. The NPC is anchored to the pore membrane via interactions with integral pore membrane proteins, which are known as pore membrane proteins (POMs) in yeast (Pante and Aebi, 1996). In yeast, the NPC has an estimated mass of 50 MDa and consists of multiple copies of about 30 distinct proteins (Rout et al, 2000). The vertebrate NPC is larger (estimated mass, 120 MDa) and is thought to contain at least fifty different proteins (Bagley et al, 2000; Miller and Forbes, 2000). Nucleoporins can be divided into two groups: soluble proteins and integral membrane proteins. The vast majority of nucleoporins is soluble and disperses into the cytoplasm during mitosis. In multicellular eukaryotes many soluble nucleoporins contain phenylalanine-glycine (FG) repeats which are important

I. Nuclear pore complexes (NPCs) mediate nucleo-cytoplasmic traffic In all eukaryotic cells the nuclear envelope (NE) separates the nucleoplasm from the cytoplasm. The NE is composed of outer and inner membranes (OM and IM, respectively), a nuclear lamina and nuclear pore complexes (NPCs) (Figure 1). The OM is continuous with the rough endoplasmic reticulum (ER) (Gant and Wilson, 1997). At the end of mitosis, the two nuclear membranes fuse to form a channels or pores as a prerequisite for NPC assembly. This process forms a third domain, termed the pore membrane domain At the pore membrane there is ordered recruitment of nuclear pore complex proteins, known as nucleoporins, to form a mature NPC that mediates the selective transport of molecules between the

Cohen et al: Membrane proteins of the nuclear pore complex

Figure 1. A model of vertebrate NPC structure (adapted from Pante and Aebi, 1996). The orientation of POM121 and Gp210 proteins is shown.

Figure 2. Motifs and domains found in Pore Membrane (POM) proteins from yeast and vertebrates. TM, transmembrane domain.

central roles in pore formation and NPC assembly (Greber et al, 1990; Soderqvist and Hallberg, 1994).

for transport through the NPC (Talcott and Moore, 1999). In contrast, very few membrane nucleoporins have been identified. Because NPCs assemble at pore membrane domains, membrane nucleoporins are proposed to play

Gene Therapy and Molecular Biology Vol 6, page 49

Ndc1 localizes to the membrane domains of both NPCs and SPBs (Chial et al, 1998). In Ndc1-null cells, SPBs are not inserted into the nuclear envelope, but there is no detectable phenotype related to NPC structure or distribution. The lack of an NPC phenotype in cells that lack either Ndc1 or Pom152 suggests a redundancy among NPC components. The Ndc1 localization results further suggest a common assembly mechanism for NPCs and SPBs in yeast. Interestingly, the SPB phenotype of ndc1-1 mutant cells is suppressed by deletion of Pom152. It was proposed that the loss of Pom152 releases ‘defective’ Ndc1 from NPCs, allowing all copies of ‘defective’ Ndc1 to function at the SPB (Chial et al, 1998). It is not known if Pom152 is also present in SPBs. The S. pombe Ndc1 homologue, cut11+, encodes a protein with seven predicted membrane spanning regions. Cut11+ is also localized to both SPBs and NPCs and affects SPB function, consistent with being a functional homologue of Ndc1p (West et al, 1998).

II. Yeast POMs We will first discuss the four POM proteins identified in the yeast Saccharomyces cerevisiae (Figure 2), namely Pom152 (Wozniak et al, 1994), Ndc1 (Chial et al, 1998), Snl1 (Ho et al, 1998) and Pom34 (Rout et al, 2000). The yeast genome has been completely sequenced and no other candidate POMs have been identified. Thus, these four proteins might represent the full set of yeast membrane nucleoporins. Interestingly, another nucleoporin named nup53, which lacks a transmembrane domain, interacts with the nuclear inner membrane via an amphipathic !-helix (Marelli et al, 2001).

III. POM 152 Pom152 is posttranslationally modified by OGlcNAc, and was isolated biochemically because it binds to a lectin, concanavalin A (conA; Wozniak et al, 1994). Pom152 was subsequently localized to the NPC (Yang et al, 1998). Pom152 is a type II integral membrane protein with a relatively short N-terminal head (175 residues) that faces the NPC and a long C-terminal domain (1141 residues) that resides in NE lumen. Sequence analysis predicted that Pom152 had two closely-spaced putative transmembrane domains. Nevertheless, Pom152 spans the pore membrane only once (Tcheperegine et al, 1999). In this regard, Pom152 is similar to gp210, a membrane nucleoporin in multicellular eukaryotes that is proposed to mediate membrane fusion (discussed below). Deletion mutants of POM152 are viable alone, but lethal in combination with mutations in either Nup188 or Nup170 (Aichison et al, 1995), both of which are proposed to help establish the functional diameter of the NPC central channel (Shulga et al, 2000). Over-expression of Pom152 reduces the growth rate of cells for reasons that are not understood (Wozniak et al, 1994). When expressed in mammalian cells, Pom152 localizes correctly to the pore membrane domain, suggesting that the microenvironment of the pore membrane domain is functionally conserved between yeast and mammals (Wozniak et al, 1994). We found a putative ortholog for Pom152 in S. pombe (GenBank accession number AL034463.2). Because S. pombe is evolutionarily distant from S. cerevisiae, the function of Pom152 appears to be highly conserved among single-cell eukaryotes.

V. Snl1 Snl1 was isolated in a baroque genetic screen for high-copy suppressors of the lethal over-expression of the carboxy-terminal 200 amino acids of the nucleoporin Nup116p (Nup116-C) in a nup116 null background (Ho et al, 1998). Nup116 localizes to the cytoplasmic face of the NPC (Ho et al, 2000) and is a docking site for nuclear import and export factors (Iovine et al, 1995, 1997). Snl1, when expressed at high copy, suppressed temperature sensitive mutations in two genes: gle2, which is essential for NPC assembly (Murphy et al, 1996) and nic96, which is involved in the transport of polyadenylated RNA and perhaps also protein transport (Gomez-Ospina et al, 2000). Snl1 has a predicted mass of 18.3 kDa, a putative transmembrane domain, and limited sequence homology to Pom152p. The C-terminal region of Snl1 faces the NPC. Results from both fluorescence localization and biochemical fractionation confirm that Snl1 is an integral pore membrane protein, but unexpectedly show that it is also present in the ER. Cells that lack both snl1 and Pom152 show no obvious growth defects and are viable, suggesting that both proteins are non-essential, and may be functionally redundant with at least one other pore membrane protein (Ho et al, 1998).

IV. Ndc1

VI. POM34

Ndc1 is an unusual nucleoporin first characterized due to its function at a late stage of spindle pole body (SPB; microtubule organizing center) duplication. In contrast to mammalian centrosomes, the S. cerevisiae SPB is embedded in the nuclear envelope, like pore complexes. NDC1 is an essential gene that encodes a 74 kDa protein with six or seven putative transmembrane domains (Winey et al, 1993). By indirect immunofluorescence analysis,

POM34 was identified by mass spectrometry as a component of biochemically-purified yeast NPCs, and localizes to the pore membrane (Rout et al, 2000). Biochemical extraction experiments revealed that Pom34 is an integral membrane protein. By hydropathy analysis, Pom34 is predicted to have two putative transmembrane domains (Rout et al, 2000).

Cohen et al: Membrane proteins of the nuclear pore complex

However, the topology of POM34 has not been determined.

NPC, suggesting that gp210 is linked structurally to the NPC (Greber and Gerace, 1992). For reasons that are not yet understood, patients with biliary cirrhosis and other hepatic auto-immune diseases produce autoimmune antibodies against lumenal epitopes of gp210 (Nickowitz and Worman, 1993; Nickowitz et al, 1994). Gp210 is conserved in metazoans and plants. A proposed gp210 ortholog in Xenopus migrates in SDS gels as a 200-215 kDa conA-binding protein, and was localized to the NPC by fluorescence (Gajewski et al, 1996). A short cDNA sequence corresponding to Xe-gp210 is now available in the GenBank (GenBank accession number: AW642061), and has been shown to encode a bona fide nucleoporin (Drummond and Wilson, manuscript in preparation). The first putative homolog of gp210 in invertebrates was described in Drosophila and localized to the NPC (Berrios et al, 1995), but was not cloned. A blast search in the Berkeley D. melanogaster Genome Project (http://www.fruitfly.org/) revealed an EST clone similar to rat gp210. We sequenced this EST clone (Dm-Gp210, GenBank accession number AF322889) and found that it encodes the complete Dm-Gp210. Drosophila gp210 is a protein of 1870 residue s and calculated mass of 209 kDa. We showed that Dm-gp210 is a unique gene that maps to the 41F11 band of the right arm of chromosome 2 by in situ hybridization to polytene chromosomes (Figure 3).

VII. Vertebrate POMs Only two integral pore membrane proteins have been identified in vertebrates; Pom121 and gp210, which are shown schematically in Figure 2.

VIII. Pom121 Pom121 was isolated from rat liver nuclei as a wheat germ agglutinin (WGA) binding glycoprotein, and subsequently localized to the NPC (Hallberg et al, 1993). Pom121 contains six XFXFG repeats, which are common to nucleoporins that are posttranslationally modified by Olinked N-GlcNAc. Antibody accessibility experiments showed that Pom121 spans the pore membrane only once; its short N-terminal head is in the lumen and its C-terminal domain, comprising 90% of its mass, is exposed to the NPC (Soderqvist and Hallberg, 1994). The signal that targets Pom121 to pores is found in a region of 310 residues near its transmembrane domain, on the cytosolic side, suggesting that Pom121 is localized by interacting with soluble nucleoporins (Soderqvist et al, 1997).

IX. Gp210 Gp210, the other membrane nucleoporin in vertebrates, was isolated almost twenty years ago from rat liver nuclei and identified as an integral glycoprotein associated with the NPC (Gerace et al, 1982). The cDNA sequences of gp210 have been determined for rat (Wozniak et al, 1989) and mouse (Olsson et al, 1999). We have now identified proposed orthologs for gp210 in C. elegans, D. melanogaster, and the plant A. thaliana, and compare these proteins below. Rat gp210 has a predicted mass of 210 kDa but migrates with an apparent mass of ~185 kDa on SDS gels. Topological analysis showed that gp210 has a small cytoplasmic tail, one membrane spanning region and a long N-terminal domain, comprising 95% of its mass, positioned within the nuclear envelope lumen (Greber et al, 1990). Gp210 is localized by two independent sorting signals; the transmembrane domain, which is sufficient for localization at the pore membrane domain, and the carboxy-terminal tail, which encodes a weaker sorting signal (Wozniak and Blobel, 1992). Similar to yeast Pom152, the lumenal domain of gp210 is core glycosylated by N-linked high mannose oligosaccharides and therefore binds to con A (Wozniak and Blobel, 1992). Rat gp210 is phosphorylated at Ser1880 during mitosis, by cyclin B-p34cdc2 or a related kinase (Favreau et al, 1996). When expressed in rat cells, antibodies that recognize the lumenal tail of gp210 decreased both active and passive transport through the

Figure 3. Dm-gp210 maps to the 41F11 band (marked by an arrow) on the right arm of D. melanogaster chromosome 2. Mapping was carried out by in situ hybridization on D. melanogaster polytene chromosomes, using full length Drosophila Gp210 cDNA as a probe.

Gene Therapy and Molecular Biology Vol 6, page 51

Figure 4. Dot matrix plot comparing the amino acid sequence of D. melanogaster (Dm) Gp210 to Gp210 in rat, mouse, C. elegans (Cel) and A. thaliana (At). Matrix was made with a window of 23 residues, using DNA Strider 1.3. The percent similarity and identity for Gp210 from each species relative to Drosophila Gp210 are, indicated below each plot.

probably not mediated by the gp210 second hydrophobic domain, since the hydropathy plots shown in Figure 5 did not reveal significant evolutionarily conservation of this putative second hydrophobic domain between species.

A search in the C. elegans genome database (http://www.sanger.ac.uk/Projects/C_elegans/blast_server. shtml) revealed a worm gp210 homologue (Ce-Gp210, GenBank accession number: U80033.1), which encodes a predicted 1847 residue protein with a calculated mass of ~200 kDa. Antibodies raised against Ce-Gp210 peptides produce a punctate staining pattern at the nuclear envelope rim in C. elegans embryos (our unpublished observation), which is characteristic of NPC staining. We also identified a gp210 homolog in Arabidopsis thaliana (GenBank accession number: AB017062). At-gp210 encodes a 1962 residue protein with a calculated mass of 215 kDa. We compared the amino acid sequences of the predicted gp210 proteins from rat, Drosophila, C. elegans and Arabidopsis using the UWGCG and BOXSHADE programs (http://www.ch.embnet.org/software /BOX_form.html). This analysis showed that Dm-Gp210 is 25%, 21% and 19% identical and 44%, 40% and 37% similar to the rat, nematode, and plant gp210 proteins, respectively (Figure 4). Hydrophobicity plots of these four proteins all predict a conserved transmembrane domain at the C-terminus (Figure 5). Rat gp210 was originally predicted to have two membrane-spanning hydrophobic domains (Wozniak et al, 1989). However, topological and biochemical analyses showed definitively that only one of these domains actually crosses the pore membrane, while the other remains in the lumen. Based on this topology, Wozniak and Gerace, (1992) hypothesized that the rat gp210 may promote membrane fusion between the IM and OM to generate pores, through mechanisms analogous to the influenza hemagglutinin protein (Skehel, and Wiley, 2000). Gp210 is present in16-24 copies per NPC (Gerace et al, 1982), which theoretically allows it to assemble in a similar way to the trimers of HA, which co-operate to mediate fusion (Danieli et al, 1996). This assembly is

X. Cell cycle dynamics of NPCs Single-cell organisms such as yeast undergo a â&#x20AC;&#x2DC;closedâ&#x20AC;&#x2122; mitosis, in which the NE and NPCs do not break down. In contrast, higher eukaryotes exhibit an open mitosis in which the nuclear lamina and NPCs disassemble and nuclear membranes merge into the ER (Ellenberg et al, 1997). Vertebrate and Drosophila NPCs start to disassemble at prophase (Georgatos et al, 1997; Harel et al, 1989), whereas C. elegans NPCs begin to disassemble later, after prometaphase (Lee et al, 2000). NE reassembly occurs during late anaphase/telophase. The assembly of NPCs does not require de-novo protein synthesis, suggesting that NPC components are recycled (Maul, 1977). NPC breakdown and reassembly are regulated by cell cycle-dependant phosphorylation of several nucleoporins including gp210, Nup153, Nup214 and Nup358 (Macaulay et al, 1995; Favreau et al, 1996). In vitro, NPC assembly is initiated as soon as membranes bind to chromatin and form flattened membrane patches (Lohka and Masui, 1984; Macaulay and Forbes, 1996; Wiese et al, 1997). A pathway for NPC assembly has been proposed based on the discovery of structures termed dimples, holes and star-rings on nuclei assembling in Xenopus cell-free extracts (Goldberg et al, 1997). NPCs can assemble prior to the full enclosure of chromatin within the NE; assembly is rapid (6-7 minutes in Xenopus extracts) and asynchronous (Wiese et al, 1997). The recruitment of nucleoporins into assembling nuclei has been studied in a number of experimental systems, although many questions remain as to the order

Cohen et al: Membrane proteins of the nuclear pore complex

of nucleoporin recruitment during NPC assembly. NPC assembly begins at late anaphase, possibly with early recruitment of Nup153 (a constituent of the nuclear basket; Pante et al, 2000). Assembly continues throughout telophase, with sequential accumulation of Pom121, p62 (a constituent of the central channel; Davis and Blobel, 1986), CAN/Nup214 (Fornerod et al, 1997), and finally Gp210 and Tpr (which forms fibers extending the nucleus, Cordes et al, 1997). Haraguchi et al, (2000) studied the

components (RanBP2, Nup153, p62), but not Tpr, reconstitute around chromosomes very early in telophase prior to the recovery of nuclear import activity. However in Xenopus extracts, NUP153 is recruited very late in the assembly process and binds to lamins, which mostly also assemble late (Smythe et al, 2000).

XI. Membrane formation

fusion

and

NPC

Membranes do not tend to fuse spontaneously due to strong electrostatic repulsion between phospholipid head groups in an aqueous environment is high. To fuse, membranes must first circumvent this repulsion. The stalk hypothesis of membrane fusion (Siegel, 1993, 1999), predicts several stages in fusion, beginning with the formation of a â&#x20AC;&#x153;stalkâ&#x20AC;? between facing phospholipid monolayers. The stalk then forms a dimple. Further pulling produces a hemifusion diaphragm followed by an opening of a fusion pore by the opening of a fusion pore by an unknown mechanism (Jahn and Sudhof, 1999). Membrane fusions are key events in the secretory pathway, synaptic release, endocytosis, ER dynamics and certain viral infections, The formation of the nuclear pore is mediated within the lumen of the NE, and is therefore likely to resemble viral fusion rather than cytosolmediated events observed throughout the secretory pathway. Viral fusion proteins are glycoproteins, with a single membrane spanning region, and a relatively large tail, exposed on surface of the virus (Jahn and Sudhof, 1999). Viral fusogenic proteins differ in sequence between viruses, but all have a similar key feature; a short helical amphiphilic domain with alternating hydrophobic and charged amino acid residues. In the case of hemagglutinin (HA), fusion is triggered by the low pH (pH 5-6) within endosomes, from whence the virus fuses to enter the cytoplasm. Low pH induces a conformational change in HA exposing the N-terminal fusion peptide. The fusion peptide is then inserted into the target membrane (Li et al, 1993; Durrer et al, 1995) and possibly also into the viral membrane (Weber et al, 1994). This insertion is thought to produce a stalk structure, which connects the two membranes. At this stage of fusion, the stalk structure expands in such a way that the inner leaflets form a hemifusion diaphragm, where a fusion pore is opened. The expansion of the fusion pore completes the fusion event (Gaudin, 2000). The fusion mechanism that produces nuclear pores is an open question. However, Gp210 remains an excellent candidate for the fusogen as originally proposed by Wozniak and Blobel, (1992). Our work suggests that Gp210 is conserved in all multicellular eukaryotes including plants, as expected for a protein with a fundamental function. We anticipate that the identification of gp210 homologs from insects, worms and plants, here reported for the first time, will contribute to a better

. Figure 5: Hydropathy plots for Gp210 from A. thaliana (At), D. melanogaster (Dm), C. elegans (Cel) and rat, were made over a window of 7 amino acids using DNA Strider 1.3. Hydrophobicity was calculated according to Kyte and Doolittle (Kyte and Doolittle, 1982). An arrow indicates the transmembrane domain.

timing of NPC assembly by immunofluorescence staining of human cells fixed at precise times after the onset of anaphase. Their results showed that several NPC

Gene Therapy and Molecular Biology Vol 6, page 53

Gajewski A, Lourim D, Krohne G (1996) An antibody against a glycosylated integral membrane protein of the Xenopus laevis nuclear pore complex: a tool for the study of pore complex membranes. Eur. J. Cell Biol. 71, 14-21. Gant TM and Wilson KL (1997) Nuclear assembly. Annu. Rev. Cell Dev. Biol 13, 669-695.

understanding of gp210 function and nuclear pore formation.

Acknowledgements We thank Ueli Aebi for providing Figure 1 and Sheona Drummond for critical reading of the manuscript. This work was supported by grants from the National Institutes of Health (GM48646, to K.L.W.), and the USAIsrael Binational Science Foundation (BSF), the Israel Science Foundation (ISF) and the German-Israel Foundation (GIF #1-573-036.13) (to Y.G.).

Gaudin Y (2000) Rabies virus-induced membrane fusion pathway. J. Cell Biol. 150, 601-612. Georgatos SD, Pyrpasopoulou A, Theodoropoulos PA (1997) Nuclear envelope breakdown in mammalian cells involves stepwise lamina disassembly and microtubule-drive deformation of the nuclear membrane. J. Cell Sci. 110, 2129-2140. Gerace L, Ottaviano Y, Kondor-Koch C (1982) Identification of a major polypeptide of the nuclear pore complex. J. Cell Biol. 95, 826-837. Goldberg MW, Wiese C, Allen TD, Wilson KL (1997) Dimples, pores, star-rings, and thin rings on growing nuclear envelopes: evidence for structural intermediates in nuclear pore complex assembly. J. Cell Sci 110, 409-420.

References Aitchison JD, Rout MP, Marelli M, Blobel G, Wozniak RW (1995) Two novel related yeast nucleoporins Nup170p and Nup157p: complementation with the vertebrate homologue Nup155p and functional interactions with the yeast nuclear pore-membrane protein Pom152p. J. Cell Biol. 131, 11331148.

Gomez-Ospina N, Morgan G, Giddings TH Jr, Kosova B, Hurt E, Winey M (2000) Yeast nuclear pore complex assembly defects determined by nuclear envelope reconstruction. J. Struc. Biol. 132, 1-5.

Bagley S, Goldberg MW, Cronshaw JM, Rutherford S, Allen TD (2000) The nuclear pore complex. J. Cell Sci. 113, 38853886. Berrios M, Meller VH, McConnell M, Fisher PA (1995) Drosophila gp210, an invertebrate nuclear pore complex glycoprotein. Eur. J. Cell Biol 67, 1-7. Chial HJ, Rout MP, Giddings TH, Winey M (1998) Saccharomyces cerevisiae Ndc1p is a shared component of nuclear pore complexes and spindle pole bodies. J. Cell Biol. 143, 1789-1800. Cordes VC, Rackwitz HR, Reidenbach S (1997) Mediators of nuclear protein import target karyophilic proteins to pore complexes of cytoplasmic annulate lamellae. Exp. Cell Res. 237, 419-433.

Greber U and Gerace L (1992) Nuclear protein import is inhibited by an antibody to a lumenal epitope of a nuclear pore complex glycoprotein. J. Cell Biol. 116, 15-30. Greber UF, Senior A, Gerace L (1990) A major glycoprotein of the nuclear pore complex is a membrane-spanning polypeptide with a large lumenal domain and a small cytoplasmic tail. EMBO J. 9, 1495-1502. Hallberg E, Wozniak RW, Blobel G (1993) An integral membrane protein of the pore membrane domain of the nuclear envelope contains a nucleoporin-like region. J, Cell Biol, 122, 513-521. Haraguchi T, Koujin T, Hayakawa T, Kaneda T, Tsutsumi C, Imamoto N, Akazawa C, Sukegawa J, Yoneda Y, Hiraoka Y (2000) Live fluorescence imaging reveals early recruitment of emerin, LBR, RanBP2, and Nup153 to reforming functional nuclear envelopes. J. Cell Sci 113, 779-794.

Danieli T, Pelletier SL, Henis YI, White JM (1996) Membrane fusion mediated by the influenza virus hemagglutinin requires the concerted action of at least three hemagglutinin trimers. J. Cell Biol. 133, 559-569. Davis LI and Blobel G (1986) Identification and characterization of a nuclear pore complex protein. Cell 45, 699-709. Durrer P, Gaudin Y, Ruigrok RW, Graf R, Brunner J (1995) Photolabeling identifies a putative fusion domain in the envelope glycoprotein of rabies and vesicular stomatitis viruses. J. Biol. Chem. 270, 17575-17581. Ellenberg J, Siggia ED, Moreira JE, Smith CL, Presley JF, Worman HJ, Lippincott-Schwartz J (1997) Nuclear membrane dynamics and reassembly in living cells: targeting of an inner nuclear membrane protein in interphase and mitosis. J. Cell Biol. 138, 1193-1206. Favreau C, Worman HJ, Wozniak RW, Frappier T, Courvalin JC (1996) Cell cycle-dependent phosphorylation of nucleoporins and nuclear pore membrane protein Gp210. Biochemistry 35, 8035-8044.

Harel A, Zlotkin E, Nainudel-Epszteyn S, Feinstein N, Fisher PA, Gruenbaum Y (1989) Persistence of major nuclear envelope antigens in an envelope-like structure during mitosis in Drosophila melanogaster embryos. J. Cell Sci. 94, 463-470. Ho AK, Raczniak GA, Ives EB, Wente SR (1998) The integral membrane protein snl1p is genetically linked to yeast nuclear pore complex function. Mol. Biol. Cell, 9, 355-373. Ho AK, Shen TX, Ryan KJ, Kiseleva E, Levy MA, Allen TD, Wente SR (2000) Assembly and preferential localization of Nup116p on the cytoplasmic face of the nuclear pore complex by interaction with Nup82p. Mol. Cell Biol. 20, 5736-5748. Iovine MK, Watkins JL, Wente SR (1995) The GLFG repetitive region of the nucleoporin Nup116p interacts with Kap95p, an essential yeast nuclear import factor. J Cell Biol , 131, 16991713.

Fornerod M, van Deursen J, van Baal S, Reynolds A, Davis D, Murti KG, Fransen J, Grosveld G (1997) The human homologue of yeast CRM1 is in a dynamic subcomplex with CAN/Nup214 and a novel nuclear pore component Nup88. EMBO J, 16, 807-816.

Iovine MK, Wente SR (1997) Nuclear export signal in kap95p is required for both recycling the import factor and interaction

Cohen et al: Membrane proteins of the nuclear pore complex

with the nucleoporin glfg repeat regions of nup116p and nup100p. J. Cell Biol. 137, 797-811. Jahn R and Sudhof TC (1999) Membrane fusion and exocytosis. Annu. Rev. Biochem. 68, 863-911. Kyte J and Doolittle RF (1982) A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157, 105-132. Lee KK, Gruenbaum Y, Spann P, Liu J, Wilson KL (2000) C. elegans nuclear envelope proteins emerin, MAN1, lamin, and nucleoporins reveal unique timing of nuclear envelope breakdown during mitosis. Mol. Biol. Cell, 11, 3089-3099. Li Y, Drone C, Sat E, Ghosh HP (1993) Mutational analysis of the vesicular stomatitis virus glycoprotein G for membrane fusion domains. J. Virol. 67, 4070-4077. Lohka MJ and Masui Y (1984) Roles of cytosol and cytoplasmic particles in nuclear envelope assembly and sperm pronuclear formation in cell-free preparations from amphibian eggs. J. Cell Biol. 98, 1222-1230. Macaulay C, Forbes DJ (1996) Assembly of the nuclear pore: biochemically distinct steps revealed with NEM, GTP gamma S, and BAPTA. J Cell Bio 132, 5-20. Macaulay C, Meier E, Forbes DJ (1995) Differential mitotic phosphorylation of proteins of the nuclear pore complex. J. Biol. Chem. 270, 254-262.

architecture, and transport mechanism. J. Cell Biol. 148, 635-651. Shulga N, Mosammaparast N, Wozniak R, Goldfarb DS (2000) Yeast nucleoporins involved in passive nuclear envelope permeability. J. Cell Biol. 149, 1027-1038. Siegel DP (1993) Energetics of intermediates in membrane fusion: comparison of stalk and inverted micellar intermediate mechanisms. Biophys J. 65, 124-140. Siegel DP (1999) The modified stalk mechanism of lamellar/inverted phase transitions and its implications for membrane fusion. Biophys. J. 76, 291-313. Skehel JJ and Wiley DC (2000) Receptor binding and membrane fusion in virus entry: the influenza hemagglutinin. Annu. Rev. Biochem 69, 531-569. Smythe C, Jenkins HE, Hutchison CJ (2000) Incorporation of the nuclear pore basket protein Nup153 into nuclear pore structures is dependent upon lamina assembly: evidence from cell-free extracts of Xenopus eggs. EMBO J. 19, 3918-3931. Soderqvist H and Hallberg E (1994) The large C-terminal region of the integral pore membrane protein, POM121, is facing the nuclear pore complex. Eur. J. Cell Biol. 64, 186-191. Soderqvist H, Imreh G, Kihlmark M, Linnman C, Ringertz N, Hallberg E (1997) Intracellular distribution of an integral nuclear pore membrane protein fused to green fluorescent protein--localization of a targeting domain. Eur. J. Biochem 250, 808-813.

Marelli M, Lusk CP, Chan H, Aitchison JD, Wozniak RW (2001) A link between the synthesis of nucleoporins and the biogenesis of the nuclear envelope. J. Cell Biol. 153, 709724. Maul GG (1977) The nuclear and the cytoplasmic pore complex: structure, dynamics, distribution, and evolution. Int. Rev. Cytol. Suppl. 6, 75-186.

Talcott B and Moore MS (1999) Getting across the nuclear pore complex. Trends Cell. Biol. 9, 312-318. Tcheperegine SE, Marelli M, Wozniak RW (1999) Topology and functional domains of the yeast pore membrane protein Pom152p. J Biol Chem 274, 5252-5258.

Miller BR and Forbes DJ (2000) Purification of the vertebrate nuclear pore complex by biochemical criteria. Traffic 1, 941-951.

Weber T, Paesold G, Galli C, Mischler R, Semenza G, Brunner J (1994) Evidence for H(+)-induced insertion of influenza hemagglutinin HA2 N-terminal segment into viral membrane. J. Biol. Chem. 269, 18353-18258. West RR, Vaisberg EV, Ding R, Nurse P, McIntosh JR (1998) cut11(+): A gene required for cell cycle-dependent spindle pole body anchoring in the nuclear envelope and bipolar spindle formation in Schizosaccharomyces pombe. Mol. Cell. Biol. 9, 2839-2855.

Murphy R, Watkins JL, Wente SR (1996) GLE2, a Saccharomyces cerevisiae homologue of the Schizosaccharomyces pombe export factor RAE1, is required for nuclear pore complex structure and function. Mol. Biol. Cell, 7, 1921-1937. Nickowitz RE and Worman HJ (1993) Autoantibodies from patients with primary biliary cirrhosis recognize a restricted region within the cytoplasmic tail of nuclear pore membrane glycoprotein Gp210. J. Exp. Med. 178, 2237-2242.

Wiese C, Goldberg MW, Allen TD, Wilson KL (1997) Nuclear envelope assembly in Xenopus extracts visualized by scanning em reveals a transport dependent envelope smoothing event. J. Cell Sci. 13, 1489-1502. Winey M, Hoyt MA, Chan C, Goetsch L, Botstein D, Byers B (1993) NDC1: a nuclear periphery component required for yeast spindle pole body duplication. J. Cell Biol. 122, 743751.

Nickowitz RE, Wozniak RW, Schaffner F, Worman HJ (1994) Autoantibodies against integral membrane proteins of the nuclear envelope in patients with primary biliary cirrhosis. Gastroenterology 106, 193-199. Olsson M, Ekblom M, Fecker L, Kurkinen M, Ekblom P (1999) cDNA cloning and embryonic expression of mouse nuclear pore membrane glycoprotein 210 mRNA. Kidney Int. 56, 827-838. Pante N and Aebi U (1996) Molecular dissection of the nuclear pore complex. Crit. Rev. Biochem. Mol. Biol. 31, 153-199.

Wozniak RW and Blobel G (1992) The single transmembrane segment of gp210 is sufficient for sorting to the pore membrane domain of the nuclear envelope. J. Cell Biol. 119, 1441-1449. Wozniak RW, Bartnik E, Blobel G (1989) Primary structure analysis of an integral membrane glycoprotein of the nuclear pore. J. Cell Biol. 108, 2083-2092.

Pante N, Thomas F, Aebi U, Burke B, Bastos R (2000) Recombinant Nup153 incorporates in vivo into Xenopus oocyte nuclear pore complexes. J Struct. Biol 129, 306-312. Rout MP, Aitchison JD, Suprapto A, Hjertaas K, Zhao Y, Chait BT (2000) The yeast nuclear pore complex: composition,

Wozniak RW, Blobel G, Rout MP (1994) POM152 is an integral protein of the pore membrane domain of the yeast nuclear envelope. J Cell Biol. 125, 31-42.

Gene Therapy and Molecular Biology Vol 6, page 55

Yang Q, Rout MP, Akey CW (1998) Three-dimensional architecture of the isolated yeast nuclear pore complex:

Functional and evolutionary implications. Mol. Cell, 1, 223234.

Cohen et al: Membrane proteins of the nuclear pore complex

Gene Therapy and Molecular Biology Vol 6, page 57

Gene Ther Mol Biol Vol 6, 57-67, 2001

Design and construction of oncoretroviral vectors expressing a packageable ribonuclease for use in HIV gene therapy Research Article

Alka Arora, Reza Nazari, Betty Lamothe, Sanjeev Singwi and Sadhna Joshi* Department of Medical Genetics and Microbiology, Faculty of Medicine, University of Toronto, Toronto, Ontario M5S 3E2, Canada _________________________________________________________________________________________________ *Correspondence: Sadhna Joshi, Ph.D., Department of Medical Genetics and Microbiology, Faculty of Medicine, University of Toronto, 150 College St. # 212, Toronto, Ontario M5S 3E2, Canada. Tel: (416)-978-2499; Fax: (416)-978-4468; E-mail: sadhna.joshi.sukhwal@utoronto.ca Key words: HIV-1 Gag, Packageable nuclease, RNase T1, Moloney murine leukemia virus-based vector, murine stem cell virus-based vector. Abbreviations: Acquired immunodeficiency syndrome, (AIDS); capsid, (CA); constitutive transport element, (CTE); cytomegalovirus, (CMV); enhanced green fluorescence protein, (egfp); enzyme linked immunosorbent assay, (ELISA); human immunodeficiency virus type-1, (HIV-1); internal ribosome entry site, (IRES); isopropylthio-!-D-galactoside, (IPTG); long terminal repeat, (LTR); LuriaBertani, (LB); mason-pfizer monkey virus, (MPMV); matrix, (MA); Moloney murine leukemia virus, (MoMuLV); murine stem cell virus, (MSCV); mutant, (mt); neomycin phosphotransferase, (neo); nucleocapsid, (NC); polyacrylamide gel electro-phoresis, (PAGE); regulator of expression of virion proteins, (Rev); Rev responsive element, (RRE); ribonucleases, (RNases); RNase T1, (rt1); sodium dodecyl sulphate, (SDS); staphylococcal nuclease, (SN); thymidine kinase, (tk); trans-activation response element, (TAR); Vesicular stomatitis virus-G, (VSV-G) Received: 21 June 2001; accepted: 10 August 2001; published electronically: February 2004

Summary A number of different strategies are being developed for inhibition of human immunodeficiency virus type-1 (HIV1) replication via gene therapy. In this study, a packageable ribonuclease, Gag-RNase T1, was constructed. The Gag domain from HIV-1 should allow copackaging into HIV-1 virions and the RNase T1 domain from Aspergillus oryzae should allow cleavage of HIV-1 virion RNA. In order to have regulator of expression of virion proteins (Rev)dependent and Rev-independent production of Gag-RNase T1, the HIV-1 Rev responsive element (RRE) and the mason-pfizer monkey virus (MPMV) constitutive transport element (CTE) were cloned downstream to the gagt1 gene. Expression and enzymatic activity of the Gag-RNase T1 fusion protein was compared using the Moloney murine leukemia virus (MoMuLV)-based vector, MoTiN, and murine stem cell virus (MSCV)-based vector, MGIN. Very little amount of Gag-RNase T1 was present in the cell lysate and in the culture supernatant of cells cotransfected with the MoTiN-based vector. In contrast, the amount of Gag-RNase T1 present in the cell lysate and in the culture supernatant of cells co-transfected with the MGIN-based vector was ~20 fold better. HIV-based lentiviral vector particles produced from cells expressing Gag-RNase T1 or mutant Gag-RNase T1 were also analyzed. Gag-RNase T1 present in these samples was shown to be full-length (56 kDa) and was enzymatically active in vitro. However, the titer of these vector particles was not decreased. These results suggest that Gag-RNase T1 is only capable of homochimeric assembly and is excluded from vector particles containing the HIV-1 Gag and Gag-Pol proteins. (HIV-1), which infects CD4+ T lymphoid and myeloid cells, and causes a slow and progressive destruction of the immune system. Despite advances in the understanding of

I. Introduction Acquired immunodeficiency syndrome (AIDS) is caused by the human immunodeficiency virus type-1

Arora et al: Oncoretroviral vectors for HIV gene therapy

the biology of HIV-1, there is still no cure for this disease. Currently available antiretroviral drugs seem to slow down HIV-1 replication in infected persons, but are partially successful because of side effects associated with prolonged use and the development of viral resistance to these drugs (Max et al, 2000; Servais et al, 2001). AntiHIV gene therapy offers an alternative treatment and is currently being developed. Many gene therapy strategies are being developed to inhibit HIV replication. These include the use of RNA decoys, antisense RNAs, ribozymes, trans-dominant negative mutants of viral proteins, and ribonucleases (RNases) (Lamothe and Joshi, 2000). RNases are proteins that cleave RNA molecules in a catalytic manner, resulting in a permanent loss of RNA function (Sorrentino and Libonati, 1997). Three types of anti-HIV RNases may be developed: targeted RNases (Melekhovets and Joshi, 1996; Singwi et al, 1999; Singwi and Joshi, 2000) to specifically recognize and cleave HIV1 RNAs, co-localized RNases to be co-localized with and cleave HIV-1 RNAs, and cytotoxic RNases (Singwi and Joshi, 2000) to specifically kill HIV-infected cells. Co-localized RNases may be designed to be packaged within the virions. It is expected that the virion genomic RNA and the co-packaged cellular tRNA3lys that serves as a primer during reverse transcription will both be cleaved. This can be achieved by fusing a viral structural protein to a ribonucleolytic domain. Vpr and Vpx proteins have been used to package staphylococcal nuclease (SN) into HIV particles (Wu et al, 1995). Vpr-SN and Vpx-SN fusion proteins were shown to be incorporated into viruslike particles via association with HIV-1 and HIV-2 Gag, respectively, and to possess nuclease activity in vitro (Wu et al, 1995). However, in experiments where HIV protease was also present, the SN moiety was shown to be inactivated (Wu et al, 1995). The efficacy of a packageable nuclease based on Gag has been demonstrated using the Moloney murine leukemia virus

(MoMuLV) Gag-SN and Gag-E. coli RNase H fusion proteins (Schumann et al, 1996; VanBrocklin et al, 1997; VanBrocklin and Federspiel, 2000). The Gag-SN and Gag-RNase H fusion proteins were shown to be incorporated into MoMuLV virions and to reduce their infectivity by degrading virion RNA. In this paper, we have used HIV-1 Gag to develop a packageable RNase. We fused the HIV-1 gag gene to the RNase T1 (rt1) gene from Aspergillus oryzae. RNase T1 (104 amino acids) is an endoribonuclease that cleaves single stranded RNA 3' to the G residues (Takahashi, 1971). The HIV-1 Gag precursor polyprotein, Pr55Gag, is cleaved by viral protease into MA (matrix), CA (capsid), p1, NC (nucleocapsid), and the C-terminal product p6 (Gottlinger et al, 1989). The NC protein is the major protein component of the virion nucleocapsid where it coats the RNA genome (Lapadt-Tapolski et al, 1995; Poon et al, 1998). It is required for viral genomic RNA dimerization, encapsidation, and initiation of reverse transcription (Lapadt-Tapolsky et al, 1993). The 51 amino acid-long p6 region, downstream of the NC domain in the wild type HIV-1 Gag precursor, was not included as this region is believed to bind to the envelope within the virion and is not necessary for packaging HIV-1 Gag into virus particles (Royer et al, 1991; Hockley et al, 1994). Also, no proteolytic cleavage site was inserted between the NC domain and the RNase T1 domain (Figure 1a). Thus, upon maturation in virus particles, the GagRNase T1 fusion protein should give rise to MA, CA, and NC-RNase T1. NC-RNase T1 is expected to degrade HIV RNA as well as the cellular tRNA3lys that is packaged within the virions. Since the gag coding region contains several cis-acting repressive sequences (Fukumori et al, 1999; Brighty and Rosenberg, 1994), the HIV-1 regulator of expression of virion proteins (Rev) response element (RRE) was included downstream of the gagt1 gene to allow Rev-dependent production of Gag-RNase T1. To

Figure 1a. Schematic diagram of the Gag-RNase T1 fusion protein and of its processing products. The Gag-RNase T1 fusion protein contains two domains Gag and RNase T1. The Gag domain contains MA, CA, p1, and NC regions of HIV-1 Gag protein; p2 and p6 domains of HIV-1 Gag were not included as they are not required for virion assembly. The RNase T1 domain consists of the entire 104 amino acids of RNase T1 from A. oryzae. The HIV-1 protease cleavage site at the NC-RNase T1 junction was deleted.

Gene Therapy and Molecular Biology Vol 6, page 59

Figure 1b. Schematic diagram of MoTiN- and MGIN-derived oncoretroviral vectors. The MoMuLV-based MoTiN vector expresses the neo gene under control of the HSV tk-HIV-1 TAR fusion promoter. MoTiN-GTRC and MoTiN-mtGTRC vectors allow gagt1 and mt gagt1 gene expression under the control of the CMV promoter in an HIV-1 Rev-dependent and Rev-independent fashion. MSCV-based MGIN vector contains the egfp gene, an IRES, and the neo gene. MGI-GTRC and MGI-mtGTRC vectors allow gagt1 and mt gagt1 gene expression under the control of 5â&#x20AC;&#x2122; LTR promoter in an HIV-1 Rev-dependent and Rev-independent manner. Transcripts produced from the 5â&#x20AC;&#x2122; LTR and internal promoters are also shown.

Figure 1c. Schematic diagram showing various steps involved in the construction of the MoTiN-GTRC vector. Firstly, the cmv-gagt1 insert was constructed using a three-step overlap PCR strategy. The cmv-gagt1 insert was digested with Bgl II and Csp 451 and ligated with the Cla I to BamH I fragment of MoTiN to generate the MoTiN-GT vector. A tetrapartite ligation strategy was used to construct the MoTiN-GTRC retroviral vector. The rt1-rre and rre-cte fragments were derived by overlap PCRs and double digested with Xho I/Hind III and Hind III/Csp451, respectively. These fragments were ligated to the EcoR I to Xho I fragment of the MoTiN-GT vector and the Cla I to EcoR I fragment of the MoTiN vector. The resulting vector, MoTiN-GTRC, contained the gagt1 gene flanked by Not I sites, the rre element flanked by Sfi I sites, the cte element flanked by Bcl I sites, and both the rre and the cte elements flanked by Stu I sites.

Arora et al: Oncoretroviral vectors for HIV gene therapy

allow Rev-independent production of Gag-RNase T1, the constitutive transport element (CTE) from the masonpfizer monkey virus (MPMV) was inserted 3’ to the RRE. CTE has been shown to promote nuclear export of incompletely spliced HIV RNAs in a Rev-independent manner (Bray et al, 1994); RRE and CTE together were shown to allow even higher levels of expression. A mutant (mt) Gag-RNase T1 fusion protein with an inactive RNase T1 domain served as a control. We demonstrate here that Gag-RNase T1 expression is better from the murine stem cell virus (MSCV)-based MGIN vector than from the MoMuLV-based MoTiN vector. The fusion protein formed vector particles. HIVbased vector particles produced from cells expressing Gag-RNase T1 were also analyzed. Gag-RNase T1 present in these samples was full-length and displayed RNase activity in vitro. However, the titer of the HIV-based vector particles produced from cells expressing GagRNase T1 was not decreased compared to the controls.

the HIV-1 RRE (Brighty and Rosenberg, 1994) and Revindependent production was achieved by including the MPMV CTE (Bray et al, 1994) within the mRNA encoding Gag-RNase T1 or mt Gag-RNase T1. Inclusion of both RRE and CTE within the 3’ untranslated region has been shown to produce high levels of HIV-1 Gag (Bray et al, 1994). The CTE element was cloned near the polyadenylation signal, as it functions in a positiondependent manner (Rizvi et al, 1997). In order to demonstrate that the gagt1 open reading frame is intact and that the fusion protein is functionally active, the pET-GTRC vector was constructed to express gagt1 gene under the control of T7 lac promoter in the bacterial system. The MoTiN-GTRC vector was constructed to express the gagt1 gene in mammalian cells (Figure 1c). This vector was designed to allow gagt1 gene expression under control of the cytomegalovirus (CMV) promoter in an HIV-1 Rev-dependent and Rev-independent manner (Figure 1c). The MoTiN-mtGTRC vector was constructed to allow expression of the mt gagt1 gene encoding a mtGag-RNase T1 fusion protein with an inactive RNase T1 domain (Figure 1b). MGI-GTRC and MGI-mtGTRC vectors were constructed to express gagt1 and mt gagt1 genes in mammalian cells. Both of these vectors were designed to allow gagt1 and mt gagt1 gene expression under the control of LTR promoter in an HIV-1 Revdependent and -independent manner (Figure 1b).

II. Results A. Design and construction of vectors expressing Gag-RNase T1 and mt Gag-RNase T1 Oncoretroviral vectors MoTiN (Joshi et al, 1993) and MGIN (Cheng et al, 1997) were used in this study. MoTiN expresses the neomycin phosphotransferase (neo) gene under control of the herpes simplex virus thymidine kinase (tk)-HIV-1 trans-activation response element (TAR) fusion promoter (Figure 1b). MGIN contains the enhanced green fluorescence protein (egfp) gene, an internal ribosome entry site (IRES), and the neo gene (Figure 1b). The inclusion of IRES allows translation of the two proteins from the 5’ long terminal repeat (LTR) directed RNA. To construct the gagt1 gene, the rt1 gene encoding RNase T1 was cloned in frame immediately downstream of sequences coding for the NC domain within the HIV-1 gag gene (Figure 1a). The p6 domain located downstream of the NC domain was not included in Gag-RNase T1 fusion protein. The gagt1 gene was also designed to exclude the HIV-1 protease cleavage site between the NC and the RNase T1 domains. A mt gagt1 gene (as a control) was similarly designed to produce Gag-RNase T1 with an inactive RNase T1 domain. Glu58 and His40 are essential for RNase T1 activity (Heinemann and Saenger, 1982; Steyaert et al, 1990). Therefore, these amino acids were substituted by Ala in the mt gagt1 gene. The HIV-1 gagcoding region within the gagt1 and mt gagt1 genes contains cis-acting repressive sequences. Therefore, expression of these genes in mammalian cells is Revdependent and requires inclusion of HIV-1 RRE. Alternatively, MPMV CTE (Bray et al, 1994) can be used to allow Rev-independent gene expression. Therefore, Rev-dependent production was accomplished by including

B. Inducible expression and analysis of Gag-RNase T1 produced in BL21 (DE3)pLysS and BL21 RIL Codon Plus strains of E. coli The pET-GTRC vector was transformed into the BL21 (DE3)pLysS strain for isopropylthio-!-Dgalactoside (IPTG)-inducible expression of Gag-RNase T1. The pET15b vector was used as a control. However, upon IPTG-induction, no Gag-RNase T1 could be detected by sodium dodecyl sulphate (SDS)-polyacrylamide gel electro-phoresis (PAGE) (results not shown). Expression of !-galactosidase, which served as an induction control, could be detected in the induced samples, indicating that the induction conditions were appropriate. Poor translation of Gag-RNase T1 in E. coli could be due to the fact that codon usage and the respective tRNA pools are different in bacterial and mammalian cells. Analysis of the gagt1 open reading frame revealed a high occurrence of certain codons, which are rarely found in highly expressed bacterial genes. High level expression (upon IPTGinduction) of Gag-RNase T1 containing these rare codons could have resulted in the depletion of the corresponding tRNA pools, which in turn, could have slowed down or aborted translation (Kane, 1995; Kleiber-Janke and Becker, 2000). BL21-Codon Plus-RIL E.coli cells contain a ColE1compatible plasmid with extra copies of the rare argU,

Gene Therapy and Molecular Biology Vol 6, page 61

ileY, and leuW tRNA genes. These tRNAs recognize Arg (AGA/AGG), Ile (AUA), and Leu (CUA) codons. Therefore, pET15b and pET-GTRC vectors were transformed into BL21 RIL Codon Plus E. coli strain. Bacterial cell lysates were analyzed 2, 4, 6, and 19 hours post-IPTG induction by SDS-PAGE, followed by Coomassie blue staining. The induced sample obtained from BL21 RIL Codon Plus E. coli transformed with pETGTRC revealed an intense dark band corresponding to Gag-RNase T1. Expression was maximal at 19 hours postinduction. This band was absent in the samples obtained from uninduced E. coli transformed with pET-GTRC and in the uninduced and induced E. coli transformed with pET15b (results not shown). As expected, the !galactosidase was detectable in the induced induction control sample but not in the corresponding uninduced sample. These results were further supported by Western blot analysis of the induced pET15b and pET-GTRC samples. Gag-RNase T1 could be detected after immunostaining with HIV-1 positive human polyclonal serum in the induced pET-GTRC sample; no such reactivity was observed with the induced pET15b sample (results not shown). Immunostaining with anti-RNase T1 antibodies demonstrated a 56-kDa band corresponding to Gag-RNase T1 (Figure 2). This band was only detected in the induced pET-GTRC sample. The induced pET15b sample did not show any reactivity with anti-RNase T1 antibodies. To determine if the Gag-RNase T1 produced in E.coli was enzymatically active, induced pET15b and pET-GTRC samples from transformed BL21 RIL Codon Plus E. coli were analyzed on a Zymogram. Following electrophoresis and protein renaturation, the RNase T1 activity was detected by incubating the gel in the presence of ethidium bromide. A zone of clearance, indicating localized enzymatic digestion of the RNA, became visible in the lane containing the induced pET-GTRC sample; no such activity was observed in induced pET15b sample (result not shown). These results demonstrate that the gagt1 open reading frame is intact, and that the Gag-RNase T1 produced in BL21 RIL codon plus strain can cleave RNA in vitro.

(modified by replacing the lacZ gene with the egfp gene in pHRâ&#x20AC;&#x2122;CMVlacZ) was used to express HIV-based vector RNA. And, pCMV"8.2 (Naldini et al, 1996a) was used to express HIV-1 Gag, Gag-Pol, Tat, and Rev proteins. Transfections were performed both in the presence and absence of pCMV"8.2. In the absence of pCMV"8.2, VSV-G envelope-pseudotyped vector particles should be produced that contain Gag-RNase T1 (or mt Gag-RNase T1) and the HRG vector RNA. In the presence of pCMV"8.2, VSV-G envelope pseudotyped HIV-based vector particles should be produced that contain either Gag-RNase T1 (or mt Gag-RNase T1) and HIV-1 Gag/Gag-Pol proteins and the HRG vector RNA. Heterochimeric assembly should result in maturation of both HIV-1 Gag/Gag-Pol and Gag-RNase T1 proteins. Processing of Gag-RNase T1 by HIV-1 protease is expected to give rise to MA, CA, and NC-RNase T1 products. Gag-RNase T1 and NC-RNase T1 are both expected to contain the RNase T1 activity. To determine whether gagt1 and mt gagt1 are expressed, cell lysates and cell culture supernatants from co-transfection experiments performed in the absence of pCMV"8.2 were analyzed by enzyme linked immunosorbent assay (ELISA) using p24 antibodies (Table 1). The p24 ELISA results from cell lysates and culture supernatants indicate that Gag-RNase T1 and mt Gag-RNase T1 are produced from both MoTiN- and MGIN-based vectors. However, Gag-RNase T1/mt GagRNase T1 expression is ~20 fold better from the MGINbased vectors than from the MoTiN-based vectors. The p24 antigen detection from the cells transduced with the parental retroviral vectors MoTiN and MGIN is negligible,

C. Characterization of Gag-RNase T1 and mt Gag-RNase T1 produced in mammalian cells The retroviral vectors MoTiN-GTRC, MoTiNmtGTRC, MGI-GTRC, and MGI-mtGTRC were transiently transfected into 293T cells to determine GagRNase T1 and mt Gag-RNase T1 production level, assembly and release into vector particles. The parent retroviral vectors, MoTiN and MGIN, were used as negative controls. Cells were co-transfected with pMD.G and pHRG, and with pCMV"8.2 where indicated. pMD.G (Ory et al, 1996) was used to express the Vesicular stomatitis virus-G (VSV-G) envelope protein. pHRG

Figure 2. Western blot analysis of Gag-RNase T1 produced in E. coli BL21 RIL codon plus strain. Western Blot analysis was performed using anti-RNase T1 antibodies. Cell lysate from E.coli transformed with pET15b (lane 1) or pET-GTRC (lane 2) was analyzed 19 hours post-induction with 1 mM IPTG. Molecular weight markers are in kDa.

Arora et al: Oncoretroviral vectors for HIV gene therapy

as expected. These results show that the gagt1 and mt gagt1 genes are better expressed from the MGIN-based vectors than from the MoTiN-based vectors, and GagRNase T1 and mt Gag-RNase T1 are also capable of homochimeric assembly resulting in the production of vector particles. Co-transfection with the pCMV"8.2 plasmid resulted in high levels of Gag and Gag-Pol production (result not shown). Expression of fusion protein by MGI-GTRC and MGI-mtGTRC vectors was further confirmed by Western blot analysis using anti-RNase T1 antibodies. Concentrated vector particles from cells co-transfected

with pMD.G, pHRG, pCMV"8.2, and either MGIN, MGIGTRC or MGI-mtGTRC were analyzed for this purpose. The 56 kDa full-length Gag-RNase T1 and mt Gag-RNase T1 fusion proteins were detected in the concentrated samples from cells co-transfected with MGI-GTRC or MGI-mtGTRC vectors (Figure 3). No such protein was detected in samples analyzed from cells co-transfected with pMD.G, pCMV"8.2, and MGIN. This result indicates that Gag-RNase T1 and mt Gag-RNase T1 are not processed by the viral protease, suggesting homochimeric assembly.

Table 1. Amount of Gag-RNase T1/mt Gag-RNase T1 present within the cell lysate and cell culture supernatant of 293-T cells cotransfected with pMD.G, pHRG, and MoTiN- or MGIN-based vectors. Gag RNase T1/

MoTiN

MoTiNGTRC

MoTiN-mt GTRC

MGIN

MGIGTRC

MGImtGTRC

6.2x10-4 pmoles

16.6x10-4 pmoles

14.5x10-4 pmoles

6.2x10-4 pmoles

312x10-4 pmoles

126x10-4 pmoles

5.8x10-4 pmoles

46.6x10-4 pmoles

5.8x10-4 pmoles

163x10-4 pmoles

122x10-4 pmoles

mt Gag RNase T1 (pmoles)* Cell lysate

Cell supernatant

culture

*The amount of p24 antigen (in pg/ml) as determined by ELISA was converted to pmoles/ml. Each pmole of p24 antigen corresponds to one pmole of Gag-RNase T1/mt Gag-RNase T1. Total amount of Gag-RNase T1/mt Gag-RNase T1 produced from MoTiN- or MGINbased vectors in cell lysates or cell culture supernatants was calculated by multiplying the pmoles/ml values with the total volume of cell lysates and cell culture supernatants.

Figure 3. Western blot analysis of Gag-RNase T1 present within the vector particles produced from mammalian cells. Concentrated vector particles were analyzed from 293-T cells cotransfected with MGIN (lane 1), MGI-mtGTRC (lane 2), or MGI-GTRC (lane 3). These cells were also co-transfected with pMD.G, pHRG, and pCMV"8.2. Purified RNase T1 was analyzed as a positive control (lane 4). Analysis was performed using RNase T1 antibodies. Molecular weight markers are in kDa.

Figure 4. Zymogram displaying RNase activity of Gag-RNase T1 or mt Gag-RNase T1 present within the vector particles produced from mammalian cells. Concentrated vector particles released from 293-Tcells co-transfected with MGIN (lane1), MGI-mtGTRC (lane2), or MGI-GTRC (lane 3), along with pMD.G, pHRG, and pCMV"8.2, were analyzed on a 15% SDSPAGE containing RNA. Purified RNase T1 served as a positive control (lane 4).

Gene Therapy and Molecular Biology Vol 6, page 63

Concentrated vector particles from cells cotransfected in a serum-free medium with pMD.G, pHRG and pCMV"8.2 along with MGIN, MGI-GTRC or MGImtGTRC, were analyzed by a Zymogram. To preserve enzymatic activity, loading samples were prepared in the absence of !-mercaptoethanol and were not boiled although this resulted in smearing. A diffused zone of clearance, indicating localized enzymatic digestion of the RNA, became visible in the lane containing the concentrated vector particles from MGI-GTRC cotransfected cells (Figure 4). No RNase activity was observed in lanes containing concentrated vector particles from cells co-transfected with MGIN or MGI-mtGTRC. Pure RNase T1 showed specific zone of clearance, as expected. This result indicates that the RNase T1 domain of the Gag-RNase T1 fusion protein is enzymatically active. However, since heterochimeric assembly could not be demonstrated, we cannot conclude that the RNase T1 domain of Gag-RNase T1 is not inactivated by the HIV-1 protease. Vector particles from cells co-transfected with pMD.G, pHRG, pCMV"8.2 and either MGIN, MGIGTRC or MGI-mtGTRC were also analyzed for their titer. Heterochimeric assembly of Gag-RNase T1 within the lentiviral vector particles followed by HRG vector RNA cleavage should decrease the vector titer. However, vector titer was not decreased (results not shown). This result is consistent with a homochimeric assembly model for GagRNase T1.

antibodies (Figure 2). Gag-RNase T1 produced in E. coli was also shown to be active in vitro (results not shown). For expression in mammalian cells and for testing the homo-/heterochimeric assembly and RNase activity of the fusion protein, a MoMuLV-based MoTiN vector (Joshi et al, 1993) was designed to express the gtrc cassette containing the gagt1 gene, rre and cte elements under control of the CMV promoter. Very little Gag-RNase T1 was detected in cell lysates and in the cell culture supernatants from the 293T cells co-transfected with the MoTiN-GTRC or MoTiN-mtGTRC vectors (Table 1). Poor expression could be due to promoter interference as the 5’ LTR promoter has been shown to exert a negative effect on other promoters directly downstream of it (Emerman and Temin, 1984). Next, the gtrc and mt gtrc expression cassettes were cloned in the MSCV-based MGIN vector (Cheng et al, 1997), which lacks an internal promoter. The second open reading frame in this vector is translated by internal initiation at the IRES element. Gag-RNase T1 and mt Gag-RNase T1 was detected in both cell lysates and culture supernatants (by ELISA using p24 antibodies; (Table 1). HIV-based vector particles from cells cotransfected with MGIN, MGI-GTRC or MGIN-mtGTRC vectors were also analyzed. Western blot analysis using RNase T1 antibodies (Figure 3) revealed that Gag-RNase T1 present in these samples is 56 kDa in size. Zymogram for the RNase activity revealed that Gag-RNase T1 present in this sample is active (Figure 4). No such activity was observed in the samples obtained from the MGI-mtGTRC or MGIN vector co-transfected cells, suggesting that the cleavage activity in the samples analyzed from the MGIGTRC co-transfected cells is due to Gag-RNase T1. The titer of HIV-based vector particles produced from cells cotransfected with pMD.G, pHRG and pCMV"8.2, along with MGIN, MGI-GTRC or MGI-mtGTRC, was also determined. Similar titers were obtained from all three samples. Thus, HIV-1 Gag-RNase T1 fusion protein can be expressed in mammalian cells, can form vector particles, is not processed/inactivated by HIV-1 protease, and is enzymatically active in vitro. Also the titer of HIVbased vector particles produced from cells co-transfected with MGI-GTRC is not decreased. Taken together, these results suggest that Gag-RNase T1 is capable of homochimeric, but not heterochimeric, assembly. This study also demonstrated that MGIN vector with IRES elements allows higher level of expression of Gag-RNase T1 fusion protein than the MoTiN vector which contains an internal promoter.

III. Discussion In this study, we investigated the use of HIV-1 Gag to incorporate an RNase into HIV-1 virions. We designed the fusion protein Gag-RNase T1 which contains the HIV1 Gag domain and the A. oryzae RNase T1 domain. We expressed the gagt1 gene from a bacterial expression vector pET15b to confirm that the fusion protein can be expressed and is enzymatically active. Initial transformation of BL-21 (DE3) pLysS with pETGTRC did not show Gag-RNase T1 production upon IPTG induction. This low/undetectable level of the fusion protein could have been due to rare codon usage. A subset of codons, mainly Arg codons AGA and AGG are the least used codons in E. coli, and Ile AUA, Leu CUA, and Pro CCC codons are also known to affect the amount and quality of heterologous proteins produced in E. coli. These codons are decoded by rare tRNAs. An excess usage of any of these codons in a gene expressed in a bacterial system is known to result in very little/absence of fulllength protein (Kane, 1995; Klaber-Janke and Beckor, 2000). Therefore we used BL21 RIL Codon Plus cells to allow Gag-RNase T1 expression from the pET-GTRC vector. The highest amount of recombinant protein was produced at 19 hours post-IPTG-induction. Western blot analysis resulted in specific reactivity of the induced pETGTRC sample with HIV-1 positive human polyclonal serum (results not shown) and with anti-RNase T1

IV. Materials and Methods A. Vectors and oligonucleotides The nucleotide sequence of various oligonucleotides used in this study was as follows. CMV-5’: 5’GGGCGCGGAGATCT-CGGGCCAGATATACGCGTTGAC3’; CMV-3’: 5’-TCTCTCTCCTGCGGCCGCGGGTCTCCCTATAGTGAGTCGTAT-3’; CMVGag-5’: 5’TCACTATAGGGAGACCC-GCGGCCGCAGGAGAGAGAT-

Arora et al: Oncoretroviral vectors for HIV gene therapy

GGGTGC-3’; Gag-3’: 5’-AGCCTGTCTCTCAGTA-CAA-3’; GagT1-5’: 5’GATTGTACTGAGAGACAGGCTGCTTGCGACTACACTTGC-3’; T1-3’: 5’ATATATATTTCGAATCGATTACTATGTACATTCAACGAA GT-3’; T1-3’NotI: 5’GAGGCCATTTTGGCCAGGCCTGCGGCCGCAATTACTATG TACA-TTCAACGA-3’; CTE-5’: 5’AGGCCAAAATGGCCTGATCACCCTCCCCTGTGAGCTAGACT-3’; CTE-3’: 5’ATATATATTTCGAAAGGCCTTGATCACGACATCATCC-3’; RRE-5’: 5’TTGCGGCCGGCCTGGCCAAAATGGCCTCGGAGTAGCACC CAC-CAGG-3’; RRE-3’: 5’GTGATCAGGCCATTTTGGCCTAAGGAGTGTATTAAGCTTGT-3’; mtT1-5’: 5’-A-AACTGTTGGATCCAATTCTTACCCAGCCAAATACAACA-ACTACGAAGGTTTTGATTTCTG3’; mtT1-3’: 5’-CATCACCGCTCGAGAGGATAGGCCACGCGTAGTAGGGAGAGCTCACAGAGAAATCAA AACCTT-3’; GTRC-5’: 5’-ATATATCCATGGCTGCGAGAGCGTCAGTATTAA-3’; and GTRC-3’: 5’-GCGCGCAGATCTGAATTCAGGCCTTGATCACCA-3’. The restriction sites are shown in Italics. The beginning or end of an open reading frame is underlined. And, mutations resulting in an amino acid change are double underlined.

bp) was amplified using the pSgprm (pSV-gag-pol-rre-mpmv) vector (Bray et al, 1994) and the RRE-5’/RRE-3’ primer pair. The PCR amplified rt1 gene and rre sequence were combined to produce the 869 bp rt1-rre insert via an overlap PCR using the GagT1-5’/RRE-3’ primer pair. To produce the rre-cte insert, the MPMV cte element (283 bp) was PCR amplified using the pSgprm vector and the CTE-5’/CTE-3’ primer pair. PCR amplified rre and cte were combined in an overlap PCR to generate a 787 bp rre-cte insert using the RRE-5’/CTE-3’ primer pair. The Xho I and Hind III digested rt1-rre product and the Hind III and Csp 451 digested rre-cte product were then ligated with the EcoR I to Xho I fragment of MoTiN-GT and the Cla I to Eco RI fragment of MoTiN (Figure 1c). MoTiN-GTRC clones were identified by extensive restriction enzyme and PCR analyses. In order to produce the MoTiN-mtGTRC vector, His40 and Glu58 within the rt1-coding region were mutated to Ala40 and Ala58 via PCR followed by cloning. Nucleotide changes leading to amino acid substitutions were introduced within the synthetic primers. The mtT1-5’ primer contained point mutations within the His40 codon, and the mtT1-3’ primer contained point mutations within the Glu58 codon. The BamH I and Xho I site were inserted in mtT1-5’ and mtT1-3’ primers, respectively. These primers were used to amplify the mt t1 gene using MoTiNGTRC. The resulting PCR product was digested with BamH I and Xho I and was cloned at the same sites within MoTiN-GTRC to construct MoTiN-mtGTRC. A Mlu I restriction site was introduced into the mtT13’ primer while maintaining the amino acid composition. Mlu I digestion was therefore performed for screening the MoTiN-mtGTRC clone. In order to construct the pET-GTRC, the gtrc cassette was amplified from the MoTiN-GTRC vector (using GTRC5’/GTRC-3’ primer pair). The amplified product was digested with Nco I and Bgl II and cloned at the Nco I and BamH I sites within the E. coli expression vector, pET15b. A similar strategy was used to generate MGI-GTRC and MGI-mtGTRC vectors. Essentially, the gtrc and mt gtrc cassettes were PCR amplified from MoTiN-GTRC and MoTiN-mtGTRC vectors using the GTRC-5’/GTRC-3’ primer pair. The PCR products containing gtrc and mt gtrc sequences were digested with Nco I and Bgl II and cloned at the Nco I and BamH I sites within the MGIN vector (Cheng et al, 1997). As a result, the neo gene within the MGIN vector was deleted. Ampicillin resistant, kanamycin sensitive colonies containing the MGI-GTRC and MGI-mtGTRC clones were selected. Correct clones were further characterized by extensive restriction enzyme and PCR analyses.

B. Vector constructions The MoMuLV-based MoTiN vector (Joshi et al, 1993), MSCV-based MGIN vector (Cheng et al, 1997), and a bacterial expression vector pET15b (Novagen, Madison, WI, USA) were used in this study. First, an expression cassette containing the CMV immediate early promoter and the gagt1 gene was constructed and cloned into the MoTiN vector, downstream of the neo gene (Figure 1c). All polymerase chain reactions (PCRs) were performed as described earlier (Medina and Joshi, 1999), except that Vent DNA polymerase (New England Biolabs, Beverly, MA, USA) was used for all PCRs and overlap PCRs performed for cloning. These products were gel purified using the Gene Clean kit before restriction enzyme digestion and subsequent use in cloning. Taq DNA polymerase was used for PCRs performed for characterization of clones. The cmv-gagt1 expression cassette was constructed using an overlap PCR strategy where the 365 bp rt1 gene was amplified from the pA2T1 (Quaas et al, 1988) plasmid using the GagT1-5’/T1-3’ primer pair. The 1341 bp gag gene was amplified from pNL4-3 (Adachi et al, 1986) using the CMVGag5’/Gag-3’ primer pair. The CMV-5’/CMV-3’ primer pair was used for the amplification of a 703 bp region containing the CMV immediate early promoter and enhancer elements using the pCDM8 plasmid (Invitrogen, Faraday Ave, CA, USA). The Gag and rt1 PCR products were combined in an overlap PCR using the CMVGag5’/T1-3’ primer pair to construct the gagt1 gene. The PCR amplified cmv promoter and gagt1 gene were combined in an overlap PCR using the CMV-5’/T1-3’ primer pair. The PCR amplified cmv-gagt1 gene was digested with Bgl II and Csp 451 and was ligated with the Cla I to BamH I fragment of MoTiN to generate the MoTiN-GT vector (Figure 1c). Next, the MoTiN-GTRC vector was constructed (Figure 1c). In order to produce the rt1-rre PCR product, the 365 bp rt1 gene was amplified from the MoTiN-GT plasmid using the GagT1-5’/T1-3’NotI primer pair which also created a Not I restriction site 3’ to the rt1 gene. The HIV-1 rre sequence (504

C. Inducible expression and analysis of GagRNase T1 produced in E. coli BL21 (DE3)pLysS and BL21 RIL Codon Plus strains The bacterial expression vectors, pET15b and pET-GTRC, were used to transform competent E. coli strains BL21 (DE3)pLysS (Novagen) and BL21 RIL Codon Plus (Stratagene, La Jolla, CA, USA) Transformed E. coli cells were grown in 10 ml of Luria-Bertani (LB) broth containing 50 µg/ml of ampicillin, 20 µg/ml chloramphenicol, and 1% glucose at 37°C overnight. 500 µl of the overnight culture was used to inoculate two separate flasks (for each plasmid) containing 100 ml of the same media (one of the two flasks was used as an uninduced control), and incubation continued at 37°C. To test the induction conditions for fusion protein expression, the diluted overnight cultures were grown for 3-4 hours at 37°C until mid-log phase (OD600 = 0.6). IPTG was then added at a final concentration of 1

Gene Therapy and Molecular Biology Vol 6, page 65

mM, and incubation was continued at 37°C for 2, 4, 6, and 19 hours. No IPTG was added to the uninduced cells, which were cultured in a similar manner. Following IPTG induction, the cells were pelleted by centrifugation. A positive induction control strain provided by Novagen matching in promoter, selectable marker, and other vector elements was also included in the induction experiments. This strain contains a pET15b plasmid with an insert encoding 116kDa !-galactosidase. SDS-PAGE and Western blot analysis: Cell pellets obtained from 100 µl of the pET15b and pET-GTRC transformed cell cultures (19 hours post-induction) were resuspended in SDS-PAGE gel loading buffer (Sambrook et al, 1989) containing !-mercaptoethanol. Samples were boiled for 3 minutes and loaded on a denatured SDS-15% polyacrylamide gel. For immuno-blotting, proteins were transferred following electrophoresis, from polyacrylamide gels to Biotrans Nylon membrane (ICN, Irvine, CA) and prewetted in Tris/glycine electroblotting buffer (20% methanol) for 15 min. Trans-Blot semi dry electrophoretic transfer cell (Bio-Rad Laboratories, Mississauga, ON, CA) was used for 25 min at 22 volts to allow complete protein transfer. Anti-RNase T1 antibodies raised in rabbits were used (1:200 dilution) as the source of primary antibodies. The blot was then incubated with alkaline phosphatase-conjugated goat anti-rabbit IgG (1:2500 dilution; Sigma Chemical Co., St Louis, MO, USA). Finally, the blot was placed with the substrate BCIP (5-bromo-4-chloro-3-indolyl phosphate), which generates an alcohol insoluble dark blue/purple stain, and NBT (nitro blue tetrazolium) which enhances the product colour. Purified RNase T1 (Sigma) was used as a positive control. Zymogram: The Zymogram was performed as described earlier (Singwi et al, 1999). Briefly, 100 µg/ml E. coli RNA was included in the 15% resolving gel. The protein samples to be loaded on this gel were prepared in the same manner as for SDSPAGE, except that no !-mercaptoethanol was added in the loading buffer and the samples were not boiled. Following electrophoresis, the gel was washed 3 times with distilled water while allowing gentle shaking and was then immersed in Zymogram buffer (Tris-Cl, pH 7.4 50 mM; EDTA, 2 mM; ethidium bromide, 2.5 µg/ml) and incubated overnight at 37oC. The gel was then placed under ultraviolet light to detect the zone of clearance due to RNase activity.

while shaking the medium. Cells were incubated at 37°C overnight. The next day, medium was replaced with 7 ml of fresh medium. Transfections were also performed using a serum-free medium (Gibco BRL, Burlington, ON, CA).

1. ELISA using p24 antibodies The presence of Gag-RNase T1 or mt Gag-RNase T1 in cell lysates and in the vector particles released in the cell culture supernatants was determined by ELISA using HIV-1 p24 antibodies (Abbott, Chicago, IL, USA). Cell lysates were prepared by lysing cells on day 3 post-transfection. Cell pellets were resuspended in 250 µl lysis buffer (50 mM Tris-Cl pH 8.0, 150 mM NaCl, 0.02% NaN3, and 100 µg/ml phenylmethylsulfonyl fluoride, 1% NP-40), kept at 4°C for 20 min, and then centrifuged at 10,000 x g for 2 min to remove cell debris. The supernatant was diluted 10 fold in the culture media and used for p24 antigen determination using instructions provided by the supplier. p24 antigen levels were also determined in the cell culture supernatants.

2. Western blot and Zymogram analyses Vector particles present in the supernatant of the cotransfected cells were first concentrated as follows. Samples were centrifuged at 1500 rpm for 5 minutes to remove the cell debris and then ultracentrifuged through a 20 % sucrose (prepared in phosphate buffer saline) cushion for 2 hours at 35,000 rpm, 4oC (Schumann et al, 1997). The pellet was resuspended in a buffer containing 50 mM Tris-Cl, pH 6.8, 100 mM NaCl. Concentrated vector particles from cells co-transfected with MGIN-based vectors, pMD.G, pCMV"8.2, and pHRG were analyzed by Western blot analysis using anti-RNase T1 antibodies. Assuming that the amount of Gag-RNase T1 or mt Gag-RNase T1 present in these vector particles is the same as when the particles are produced in the absence of pCMV"8.2, concentrated vector particles containing ~50-100 pg equivalent of Gag-RNase T1 (or mutant Gag-RNase T1) were loaded in each well. Purified RNase T1 (0.4 µg) was used as positive control. In order to determine RNase activity of the fusion protein, vector particles were obtained as described above from cells cotransfected with MGIN-based vectors, pMD.G, pCMV"8.2, and pHRG and cultured in the serum-free medium. Concentrated vector particles containing ~50-100 pg equivalent of Gag-RNase T1 (or mt Gag-RNase T1) were analyzed by the Zymogram assay. Purified RNase T1 (0.4 µg) was analyzed in parallel to serve as a positive control

D. Transient expression and analysis of GagRNase T1 and mt Gag-RNase T1 produced in 293T cells VSV-G pseudotyped vector particles were generated by co-transfection of plasmid DNAs into 293 T cells as described previously (Joshi et al, 1990). Briefly, transfections were done in 10 cm cell culture dishes using 30 µg of each retroviral vector construct, 5 µg of the env expression vector pMD.G (Ory et al, 1996), 10 µg of the gag/gag-pol, tat, and rev expressing vector pCMV"8.2 (Naldini et al, 1996a), and 15 µg of the transfer vector pHRG. pHRG was constructed by replacing the lacZ gene with egfp gene in the pHR'CMVlacZ vector (Naldini et al, 1996b). 293 T cells (4#106) were plated for 8 hours at 37°C. Plasmid DNAs were mixed together in a 450 µl volume. 50 µl of 2.5 M CaCl2 was added to the DNA mix. 500 µl of hepes buffered saline solution (pH 7.05) was then added drop-wise, while bubbling with a plastic pipette. The tube was left at room temperature for 20 min and DNA was added gently over the cells

3. HIV-based vector titer Vector particles released from the 293-T cells cotransfected with MGIN-based vectors, pMD.G, pHRG, and pCMV"8.2 were analyzed for their titer. Equal amount of vector particles was used to transduce 293-T cells as described previously (Joshi et al, 1990). The number of EGFP+ and EGFP cells was then determined on day 5 post-transduction and used to calculate vector titer.

Acknowledgements This work was supported by a grant from the Canadian Institutes of Health Research. We thank Dr. XZ Ma for pHRG vector construction and CH Wang for serum-free vector particle production. 293T cell line,

Arora et al: Oncoretroviral vectors for HIV gene therapy

Lapadat-Tapolsky M, De Rocquigny H, Van Gent D, Roques B, Plasterk R, and Darlix JL (1993) Interactions between HIV-1 NC protein and viral DNA may have important functions in the viral life cycle. Nucl Acids Res 21, 831-839. Lapadat-Tapolsky M, Pernelle C, Borie C, and Darlix JL (1995) Analysis of the nucleic acid annealing activities of nucleocapsid protein from HIV-1. Nucl Acids Res 23, 24342441. Max B, and Sherer R (2000) Management of the adverse effects of antiretroviral therapy and medication adherence. Clin Infect Dis Suppl 2, S96-S116. Medina MF, Joshi S (1999) Design, characterization and testing of tRNA 3Lys-based hammerhead ribozymes. Nucl Acids Res 27,1698-1708. Melekhovets YF, and Joshi S (1996) Fusion with an RNA binding domain to confer target RNA specificity to an RNase: design and engineering of Tat-RNase H that specifically recognizes and cleaves HIV-1 RNA in vitro. Nucl Acids Res 24, 1908-1912. Naldini L, Blomer U, Gage FH, Trono D, and Verma IM (1996a) Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc Natl Acad Sci USA 93, 11382-11388. Naldini L, Blomer U, Gallay P, Ory D, Mulligan R, Gage FH, Verma IM, and Trono D (1996b) In vivo gene delivery and stable transduction of non-dividing cells by a lentiviral vector. Science 272, 263-267. Ory DS, Neugeboren BA and Mulligan, RC (1996) A stable human-derived packaging cell line for production of high titer retrovirus/VSV-G pseudotypes. Proc Natl Acad Sci USA 93, 11400-11406. Poon DT, Li G, and Aldovini A (1998) NC and MA protein contributions to selective HIV-1 genomic RNA packaging. J Virol 72, 1983-1993. Quaas R, McKeown Y, Stanssens P, Frank R, Blocker H, and Hahn U (1988) Expression of the chemically synthesized RNase T1 in E. coli using a secretion cloning vector. Eur J Biochem 173, 617-622. Rizvi TA, Schmidt RD, and Lew KA, (1997) MPMV CTE functions in a position-dependent manner. Virology 236, 118-129. Royer M, Cerutti M, Gay B, Hong SS, Devauchelle G, and Boulanger P (1991) Functional domains of HIV-1 Gagpolyprotein expressed in baculovirus infected cells. Virology 184, 417â&#x20AC;&#x201C;422. Sambrook J, Fritsch EF, and Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York). Schumann G, Cannon K, Ma WP, Crouch RJ, and Boeke JD (1997) Antiretroviral effect of a Gag-RNase HI fusion gene. Gene Ther 4, 593-599. Schumann G, Qin L, Rein A, Natsoulis G, and Boeke JD (1996) Therapeutic effect of Gag-nuclease fusion protein on retrovirus-infected cell cultures. J Virol 70, 4329-4337. Servais J, Lambert C, Fontaine E, Plesseria JM, Robert I, Arendt V, Staub T, Schneider F, Hemmer R, Burtonboy G, and Schmit JC (2001) Comparison of DNA sequencing and a Line probe assay for detection of HIV-1 drug resistance mutations in patients failing Highly Active Antiretroviral Therapy. J Clin Microbiol 39, 454-459. Singwi S, and Joshi S (2000) Potential nuclease-based strategies for HIV gene therapy. Front Biosci 1,556- 579.

pMD.G, pCMV"8.2, and pHR'CMVlacZ were obtained from Dr. D Trono, pA2T1 was obtained from Dr. U Hahn, and pSV-gag-pol-rre-mpmv was obtained from Dr. M. Hammarskjold. pNL4-3 was obtained from Dr. A Adachi through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH.

References Adachi A, Gendelman HE, Koenig S, Folks T, Willey R, Rabson A, and Martin MA (1986) Production of AIDS-associated retrovirus in human and non-human cells transfected with an infectious molecular clone. J Virol 59, 284-291. Aldovini A, and Young RA (1990) Mutations of RNA and protein sequences involved in HIV-1 packaging result in production of noninfectious virus. J Virol 64, 1920-1926. Bray M, Prasad S, Dubay JW, Hunter E, Jeang K, Rekosh D and Hammarskjold M (1994) A small element from the MPMV genome makes HIV-1 expression and replication Revindependent. Proc Natl Acad Sci USA 91, 1256-1260. Brighty DW, and Rosenberg M (1994) A cis-acting repressive sequence that overlaps the RRE of HIV-1 regulates nuclear retention of env mRNAs independently of known splice signals. Proc Natl Acad Sci USA 91, 8314-8318. Cheng L, Du C, Murray D, Tong X, Zhang YA, Chen BP, and Hawley RG (1997) A GFP reporter system to assess gene transfer and expression in human hematopoietic progenitor cells. Gene Ther 4, 1013-1022. Emerman M, and Temin HM (1984) Genes with promoters in retrovirus vectors can be independently suppressed by an epigenetic mechanism. Cell 39, 449-467. Fukumori T, Kagawa S, Iida S, Oshima Y, Akari H, Koyama AH, and Adachi A (1999) Rev-dependent expression of three species of HIV-1 mRNAs. Int J Mol Med 3, 297-302. Gottlinger HG, Sodroski JG, and Haseltine WA (1989) Role of capsid precursor processing and myristoylation in morphogenesis and infectivity of HIV-1. Proc Natl Acad Sci USA 86, 5781-5785. Heinemann U, and Saenger W (1982) Specific protein-nucleic acid recognition in RNase T1-2'-guanylic acid complex: an X-ray study. Nature 299, 27-31. Hockley DJ, Nermut MV, Grief C, Jowett JBM, and Jones IM (1994) Comparative morphology of Gag protein structures produced by mutants of the gag gene of HIV-1. J Gen Virol 75, 2985â&#x20AC;&#x201C;2997. Joshi S, Davison L, Van Brunschot A, and Van der Elst, I (1993) A retroviral vector to allow constitutive and Tat-inducible gene expression for anti-HIV-1 gene therapy. Mol Biol Life Sci Adv 12, 135-189. Joshi S, Van Brunschot A, Robson I, and Bernstein A (1990) Efficient replication, integration, and packaging of retroviral vectors with modified LTRs containing the packaging signal. Nucl Acids Res 18, 4223-4226. Kane JF (1995) Effects of rare codon clusters on high-level expression of heterologous proteins in E. coli. Curr Opin Biotechnol 6, 494-500. Kleber-Janke T, and Becker WM (2000) Use of modified BL21(DE3) E. coli cells for high-level expression of recombinant peanut allergens affected by poor codon usage. Protein Expression and Purification 19, 419-424. Lamothe B, and Joshi S (2000) Current developments and future prospects for HIV gene therapy using interfering RNA-based strategies Front Biosci 5, 527-555.

Gene Therapy and Molecular Biology Vol 6, page 67

Singwi S, Ramezani A, Ding SF, and Joshi S (1999) Targeted RNases: a feasibility study for use in HIV gene therapy. Gene Ther 6, 913-921. Sorrentino S, and Libonati M (1997) Structure-function relationships in human ribonucleases: main distinctive features of the major RNase types. FEBS Lett 404, 1-5. Steyaert J, Hallenga K, Wyns L, and Stanssens P (1990) Histidine-40 of RNase T1 acts as base catalyst when the true catalytic base, glutamic acid-58, is replaced by alanine. Biochemistry 29, 9064-9072. Takahashi K (1971) The structure and function of RNase T1. J Biochem 70, 945â&#x20AC;&#x201C;960.

VanBrocklin M, and Federspiel MJ (2000) Capsid targeted viral inactivation can eliminate the production of infectious MoMuLV in vitro. J Virol 267, 111-123. VanBrocklin M, Ferris AL, Hughes SH, and Federspiel MJ (1997) Expression of a MoMuLV Gag-E. coli RNase HI fusion poly protein significantly inhibits virus spread. J Virol 71, 3312-3318. Wu X, Liu H, Xiao H, Kim J, Seshaiah P, Natsoulis G, Boeke JD, Hahn BH, and Kappes JC (1995) Targeting foreign proteins to human immunodeficiency virus particles via fusion with Vpr and Vpx J Virol 69, 3389-3398.

Arora et al: Oncoretroviral vectors for HIV gene therapy

Gene Therapy and Molecular Biology Vol 6, page 69

Gene Ther Mol Biol Vol 6, 69-77, 2001

Tat-RNase H and its use in HIV gene therapy Research Article

Yuri Melekhovets, Ali Ramezani, Lianna Kyriakopoulou and Sadhna Joshi* Department of Medical Genetics and Microbiology, Faculty of Medicine, University of Toronto, 150 College Street, # 212, Toronto, Ontario M5S 3E2, Canada _________________________________________________________________________________________________ *Correspondence: Sadhna Joshi, Department of Medical Genetics and Microbiology, Faculty of Medicine, University of Toronto, 150 College St. # 212, Toronto, Ontario M5S 3E2, Canada. Tel: (416)-978-2499; Fax: (416)-978-4468; E-mail: sadhna.joshi.sukhwal@utoronto.ca Key words: Gene therapy, HIV-1, retroviral vector, targeted RNase. Abbreviations: blood T-lymphocytes, (PBLs); CD4+ T-lymphoid, (MT4); HIV-1 virion protein R, (Vpr); HIV-2 virion protein X, (Vpx); human immunodeficiency virus type-1, (HIV-1); Moloney murine leukemia virus, (MoMuLV); neomycin phosphotransferase, (neo); phosphate buffered saline, (PBS); reverse transcriptase, (RT) Received: 22 June 2001; accepted: 10 August 2001; electronically published; February 2004

Summary A targeted RNase, Tat-RNase H, was designed and tested for its activity in vitro and inhibition of HIV-1 replication in vivo. The Tat-RNase H protein consists of the TAR (trans-activation response) element-binding domain of the HIV-1 Tat (trans-activator of transcription) and the RNase H domain of the HIV-1 reverse transcriptase (RT) (Melekhovets and Joshi, 1996). The Tat protein binds specifically to the TAR element present in all HIV-1 RNA molecules, whereas HIV-1 RNase H specifically degrades RNA within RNA/DNA hybrid in vivo (Skalka and Goff, 1993; Telesnitsky and Goff, 1997) and to a lesser degree within RNA/RNA hybrid in vitro (Ben-Artzi et al, 1992; Gotte et al, 1995). Thus, there are two anticipated modes of action of the Tat-RNase H protein. It could cleave HIV1 TAR RNA in RNA/RNA hybrid or in RNA/DNA hybrid. RNA cleavage in RNA/RNA hybrid was previously shown to be specific and to depend on interaction between the Tat domain of Tat-RNase H and the TAR element of HIV-1 RNA (Melekhovets and Joshi, 1996). We demonstrate here that the Tat-RNase H mediated cleavage of RNA in RNA/DNA hybrid is non-specific as both TAR and mutant TAR RNA/DNA hybrids could be efficiently cleaved. A retroviral vector expressing Tat-RNase H was then constructed to assess whether Tat-RNase H can inhibit HIV-1 replication. However, the Tat-RNase H protein failed to inhibit HIV-1 replication in transduced MT4 cells and in peripheral blood T lymphocytes (PBLs). The possible reasons why Tat-RNase H might have failed to inhibit HIV-1 replication in MT4 cells and PBLs are discussed. the progeny virus and cleave the virion RNA (Singwi and Joshi, 2000). This would inactivate the progeny virus by cleaving the virion RNA. The Staphylococcal nuclease (SN) fused with the HIV-1 virion protein R (Vpr) or HIV2 virion protein X (Vpx) has been shown to allow its packaging within the HIV virion (Wu et al, 1995); however, this nuclease was inactivated by the HIV protease. In a third strategy, others and we have developed targeted RNases that can cleave specific RNA sequences (Melekhovets and Joshi, 1996; Singwi et al, 1999). The probability of escape mutants interfering with the function of targeted RNases is significantly lower since it would require mutations in both the viral protein from which the binding moiety of the RNase is derived and the RNA sequence it binds to.

I. Introduction AIDS is caused by the human immunodeficiency virus type-1, HIV-1, the genome of which consists of two “+” strand RNAs. Destruction of HIV RNA molecules within the cell or within virion could prove to be a successful strategy in inhibiting HIV replication. The therapeutic potential of a number of strategies based on the ability of ribozymes and ribonucleases to cleave RNA/DNA molecules is currently being investigated. Three RNase-based strategies may be used to inactivate HIV RNA (Singwi and Joshi, 2000). In the first strategy, “cytotoxic” RNases may be employed to specifically destroy cells that become infected by HIV (Singwi and Joshi, 2000). In the second strategy, “colocalized” RNases may be designed to be packaged within

Melekhovets et al: Tat-RNase H and its use in HIV gene therapy

Two targeted RNases were designed and constructed in our laboratory by fusing an RNase molecule with HIV RNA binding proteins, a Tat-RNase H (Melekhovets and Joshi, 1996) and a Tev-RNase T1 (Singwi et al, 1999). The Tat-RNase H protein consists of the TAR (transactivation response) element-binding domain of the HIV-1 Tat and the RNase H domain of the HIV-1 reverse transcriptase (RT) (Melekhovets and Joshi, 1996). The Tat portion of the fusion protein spans the first 72 amino acids of the Tat protein and it is essential and sufficient for the transport of the protein to the nucleus and specific binding to the TAR element present in all HIV-1 RNA molecules (Hoffmann et al, 1997). The RNase portion of the HIV-1 RT specifically degrades the RNA moiety within RNA/DNA hybrid in vivo (Skalka and Goff, 1993; Telesnitsky and Goff, 1997) and to a lesser degree within RNA/RNA hybrid in vitro (Ben-Artzi et al, 1992; Gotte et al, 1995). Although the two domains (i.e., the TAR binding domain of the Tat protein and the RNase H domain of HIV-1 RT) when not fused, were shown to be inactive, the chimeric Tat-RNase H protein was demonstrated to specifically recognize and cleave TAR RNA in vitro (Melekhovets and Joshi, 1996). The TevRNase T1 protein consists of the RNA binding domain of HIV-1 Tev protein and the RNase domain of the Aspergillus oryzae RNase T1 protein. In vitro, the TevRNase T1 protein was shown to exhibit poor specificity, however, when expressed in a CD4 + human T lymphoid (MT4) cell line or human peripheral blood T-lymphocytes (PBLs) no cytotoxicity was observed (Singwi et al, 1999). In addition, HIV-1 replication was inhibited both in transduced MT4 cells and PBLs (Singwi et al, 1999). The Tat-RNase H was previously shown to specifically recognize and cleave HIV-1 TAR RNA in vitro in RNA/RNA hybrid (Melekhovets and Joshi, 1996). In this paper, we demonstrate that Tat-RNase H-mediated cleavage of TAR RNA in vitro in RNA/DNA hybrid occurs much more efficiently. However, this activity was shown to be non-specific as both TAR RNA and mutant TAR RNA/DNA hybrids were efficiently cleaved. A retroviral vector was then engineered for the delivery and expression of tat-RNase H gene in the human CD4+ T lymphoid cells. However, Tat-RNase H failed to inhibit HIV-1 replication in transduced MT4 cells and PBLs. The possible explanations for the inability of the Tat-RNase H to cleave HIV-RNA in vivo are discussed.

RNA in RNA/RNA or RNA/DNA hybrid. The RNA cleaving activity of Tat-RNase H in RNA/RNA hybrid had been previously demonstrated (Melekhovets and Joshi, 1996). The RNA cleaving activity of Tat-RNase H in RNA/DNA hybrid was studied as follows. A 75 nt-long TAR/mutant TAR RNA was transcribed and 5’ endlabeled in vitro. This RNA contained the 59 nt-long stem loop structure forming the TAR/mutant TAR element at its 5’ end and a 16 nt-long single stranded RNA at its 3’ end. This 75 nt-long TAR/mutant TAR RNA and a 18 nt-long oligodeoxynucleotide complementary to the single stranded RNA were used to provide Tat-RNase H with a substrate containing TAR/mutant TAR element at the 5’ end and RNA/DNA hybrid at the 3’ end (Figure 1A). As the oligodeoxynucleotide is not designed to hybridize to the nucleotides forming the TAR element, the TAR stemloop structure will form. Thus, while testing RNA cleavage in RNA/DNA hybrid, the TAR stem loop structure at the 5’ end would allow Tat-RNase H/TAR element interaction as well as cleavage in an RNA/RNA hybrid. Cleavage in RNA/RNA hybrid was previously shown to yield 37, 46-49, 56-58 nt-long fragments (Melekhovets and Joshi, 1996). RNA cleavage in RNA/DNA hybrid should yield 57-75 nt-long fragments. If the cleavage was complete, only the shortest 57 nt-long fragment would be detected (Figure 1A); alternatively, as the two nucleotides at the 3’ end of the oligodeoxynucleotide are complementary to the nts 58 and 59 forming the TAR stem structure, a 59 nt-long fragment may be detected if the formation of the TAR structure was to prevent these two nucleotides from hybridizing to the oligodeoxynucleotides. Cleavage products were analyzed on a 12-15% polyacrylamide gel. As shown in Figure 1B, no TAR RNA (lane 1) or TAR RNA/DNA (lane 2) cleavage was observed in control samples that were incubated in the absence of Tat-RNase H. Tat-RNase H-mediated cleavage of TAR RNA is shown in lane 3. The expected 37, 46-49 and 46-48 nt-long cleavage products were observed. TatRNase H-mediated cleavage of TAR RNA/DNA hybrid is shown in lane 4. Almost 99% of the TAR RNA is cleaved in RNA/DNA hybrid; both 57 and 59 nt-long products were observed. Bands corresponding to RNA cleavage in the RNA/RNA hybrid are also observed (lane 4); however, the intensity of these bands is very week compared to those obtained from cleavage in RNA/DNA hybrid. Thus, the efficiency of Tat-RNase H-mediated cleavage of TAR RNA in RNA/DNA hybrid is much higher than in RNA/RNA hybrid. To determine cleavage specificity of Tat-RNase H in cleaving TAR RNA in RNA/DNA hybrid, TAR-RNase H was used to cleave both TAR and mutant TAR RNA/DNA hybrids (Figure 1C). Cleavage was performed for 5, 10 and 15 min. RNA was effectively cleaved within both TAR RNA/DNA (lanes 1-3) and mutant TAR RNA/DNA (lanes 4-6) hybrids. Mutant TAR RNA/DNA hybrid cleavage by Tat-RNase H indicates that Tat-RNase H can

II. Results A. Tat-RNase H-mediated cleavage in vitro of TAR RNA and mutant TAR RNA in RNA/RNA or RNA/DNA hybrid We have previously designed and expressed a fusion Tat-RNase H protein (Melekhovets and Joshi, 1996). TatRNase H produced in E. coli was shown to specifically recognize and cleave RNAs containing the HIV-1 TAR element. Tat-RNase H could potentially cleave HIV-1

Gene Therapy and Molecular Biology Vol 6, page 71

Figure 1A. Structure of TAR/mutant TAR RNA in RNA/RNA (left) and RNA/DNA (right) hybrids. Nucleotides mutated within the mutant TAR RNA are shown with an arrow and are circled. Oligodeoxynucleotide is shown in Grey. RNA cleavage sites and the size of the resulting cleavage products from cleavage within the RNA/RNA (black arrows) and RNA/DNA (Grey arrows) hybrids are shown. B. TAR RNA cleavage in a RNA/RNA or RNA/DNA hybrid. 5â&#x20AC;&#x2122;-End-labeled TAR RNA cleavage in RNA/RNA (lanes 1 and 3) or RNA/DNA (lanes 2 and 4) hybrid in the absence (lanes 1 and 2) or presence of Tat-RNase H (lanes 3 and 4). Results are shown after 1hour incubation at 37oC. C. TAR and mutant TAR RNA cleavage in a RNA/DNA hybrid. 5â&#x20AC;&#x2122;-End-labeled TAR (lanes 1-3) and mutant TAR (lanes 4-6) RNA cleavage in RNA/DNA hybrid following 5 (lanes 1 and 4), 10 (lanes 2 and 5) and 15 (lanes 3 and 6) min incubation with Tat-RNase H.

cleave RNA in RNA/DNA hybrid in the absence of Tat/TAR interaction and thus demonstrates the nonspecificity of this reaction. Cleavage in RNA/RNA hybrid requires Tat-RNase H/TAR element interaction (Melekhovets and Joshi, 1996); as expected, this cleavage was only observed when the TAR RNA/DNA was used (lanes 1-3) and not when the mutant TAR RNA/DNA was used (lanes 4-6).

B. Construction of a retroviral vector expressing tat-RNase H gene In order to test whether Tat-RNase H can inhibit HIV replication, the tat-RNase H gene was cloned in a Moloney murine leukemia virus (MoMuLV) based retroviral vector MoTN (Magli et al, 1987). This vector contains the MoMuLV 5' LTR promoter driving vector expression and the HSV tk promoter driving the expression of the neomycin phosphotransferase (neo) gene. Using a two step PCR procedure, a 1-kb cassette

Melekhovets et al: Tat-RNase H and its use in HIV gene therapy

Figure 2. Schematic representation of MoTN and MoTN-TH vectors. Only those sequences that are part of the retroviral vector DNA are shown. The neo gene is expressed under control of the HSV tk promoter and the tat-RNase H gene is expressed under control of the SV40 promoter.

containing the SV40 promoter that allows the tat-RNase H gene expression was generated. The restriction enzyme sites BamH I and Cla I were used to clone the cassette at the BamH I and Cla I sites of the MoTN vector. The resulting vector was referred to as MoTN-TH (Figure 2).

when the RNA was analyzed by PCR without reverse transcription (lane 2), confirming the lack of DNA contamination in the RNA samples. Expression of the tatRNase gene was also detected in PBLs transduced with the MoTN-TH vector but not with the MoTN (control) vector (data not shown).

C. Transduction of human CD4+ Tlymphoid (MT4) cells and PBLs with MoTN and MoTN-TH retroviral vectors

D. Susceptibility of MoTN and MoTNTH-transduced MT4 cells and PBLs to HIV-1 infection

Amphotropic MoTN and MoTN-TH vector particles, generated from the PA317 packaging cell line, were used to transduce the human CD4 + T-lymphoid (MT4) cells and PBLs. Resistance to the G418 antibiotic conferred by the neo gene was used to select for transduced MT4 cells and PBLs. To confirm the presence of the MoTN and MoTNTH vector DNA in the MT4 transductants and PBLs, PCR analysis was carried out using the Tat-RNase H-5' and 3' primers. Shown in Figure 3A are the results obtained from the PCR analysis of genomic DNA extracted from MT4 transductants. PCR analysis of genomic DNA from MoTN vector-transduced MT4 cells served as a negative control (Figure 3A, lane 1) and of MoTN-TH plasmid served as a positive control (Figure 3A, lane 3). A 0.6-kb PCR product is observed when DNA from MoTN-TH transduced MT4 cells (Figure 3A, lane 2) or when MoTNTH vector DNA only were used. Similar results (data not shown) were obtained from PBLs transduced with the MoTN or MoTN-TH vectors. To establish the expression of the tat-RNase H gene, RT-PCR analyses were performed. No RT-PCR products were observed when total RNA from MT4 cells transduced with the MoTN vector was analyzed (Figure 3B, lane 1). A 0.6-kb RT-PCR product was observed in RNA from MT4 cells transduced with the MoTN-TH vector (Figure 3B, lane 3). This product was not detected

After initial testing for the presence of tat-RNase-H gene and its expression, pools of MT4 and PBL transductants were tested for their susceptibility to HIV-1 infection. Stable MT4 transductants were challenged with the HIV-1 strain NL4-3 and transduced PBLs were challenged with a clinical isolate of HIV-1. HIV-1 production was monitored by assaying for the presence of HIV-1 p24 antigen in culture supernatants at various time points. Similar results were obtained from both MoTN or MoTNTH vector transduced cells. Shown in Figure 4 are the results obtained from MT4 and PBL transductants infected with the HIV-1. Following an initial lag period of three days, an increase in the virus production, as reflected by the p24 antigen values, was observed in MT4 cells that had been transduced with the MoTN-TH vector. The increase of the viral production from MoTN-TH vectortransduced MT4 cells paralleled the viral increase observed from MT4 cells transduced with the MoTN vector. Similar results were observed with PBLs transduced with the MoTN-TH vector. The values obtained from PBLs transduced with the MoTN-TH vector were similar, although not identical, to the p24 antigen values obtained from PBLs that had been transduced with the MoTN vector. These results indicate that expression of

Gene Therapy and Molecular Biology Vol 6, page 73

Figure 3A. PCR analysis of the genomic DNA from MT4 transductants. PCR amplification using the Tat-RNase H-5' and 3' primers (described in Materials and Methods) of total DNA isolated from MT4 cells transduced with MoTN vector (lane 1), total DNA isolated from MT4 cells transduced with the MoTN-TH vector (lane 2), or MoTN plasmid DNA (lane 3). B. RT-PCR analysis of total RNA from MT4 transductants. RT-PCR amplification using the above primers and total RNA isolated from MT4 cells transduced with the MoTN vector (lane 1), PCR amplification of total RNA isolated from MT4 cells transduced with the MoTN-TH vector (lane 2), or RTPCR amplification of total RNA isolated from MT4 cells transduced with the MoTN-TH vector (lane 3).

Figure 4A. HIV-1 challenge of MT4 transductants. The amount of HIV-1 p24 antigen present in the infected cell culture supernatants at various time intervals. Challenge of MT4 transductants expressing MoTN or MoTN-TH, with the laboratory HIV-1 strain NL4-3. B. HIV-1 challenge of transduced PBLs. The amount of HIV-1 p24 antigen present in the infected cell culture supernatants at various time intervals. Challenge of transduced PBLs with a clinical isolate of HIV-1. Results are expressed as pg/ml of the HIV-1 core antigen p24 at days post-infection.

Melekhovets et al: Tat-RNase H and its use in HIV gene therapy

Tat-RNase H-mediated cleavage of HIV RNAs, which all contain the TAR element at their 5â&#x20AC;&#x2122; end, should result in inhibition of HIV-1 replication. Thus, a retroviral vector MoTN-TH was designed to allow constitutive expression of tat-RNase H gene under the control of the SV 40 promoter. Note that constitutive expression is the only effective way to express Tat-RNase H. Tat-inducible expression would require Tat-RNase H mRNA to contain the TAR element and therefore would be suicidal for TatRNase Hâ&#x20AC;&#x2122;s own production. Rev-inducible expression would make it too late for Tat-RNase-H to inhibit virus replication. Tat-RNase H mediated inhibition of HIV-1 replication was tested in both transduced human CD4+ Tlymphoid cell line (MT4) and in PBLs. Amphotropic MoTN and MoTN-TH vector particles were used to transduce MT4 cells and PBLs. PCR and RT-PCR analyses confirmed the presence and expression of MoTN and MoTN-TH vectors. Also the viability of MoTN or MoTN-TH transduced packaging cell lines, MT4 cells and PBLs was similar, suggesting lack of cytotoxicity. This result indicates that the RNA/DNA cleaving activity of Tat-RNase H is not predominant in vivo. As this activity is not dependent on Tat-RNase H/TAR element interaction, if present it was expected to cause cytotoxicity. However, Tat-RNase H failed to inhibit HIV-1 replication in both MT4 transductants challenged with a laboratory strain of HIV-1 and PBL transductants challenged with a clinical isolate of HIV-1. As virus production in MoTN-TH transduced cells was not delayed as compared to cells transduced with the MoTN vector, it seems unlikely, that the lack of inhibition of HIV-1 replication by the Tat-RNase H protein would be due to escape virus production. These results indicate that, the Tat-RNase H fusion protein cannot cleave HIV-1 RNA in MT4 cells or PBLs. There are three stages in the virus life cycle that could be affected by the Tat-RNase H activity: during reverse transcription in the cytoplasm, during transcription in the nucleus, or post-transcription in the nucleus or in the cytoplasm. However, in order for the Tat-RNase H to cleave HIV-1 RNA in RNA/RNA or RNA/DNA hybrid during reverse transcription, it would have to enter the partially uncoated virion which is rather unlikely. Next, Tat-RNase H could cleave RNA in RNA/RNA or RNA/DNA hybrid during transcription in the nucleus. Note that Tat-RNase H contains the nuclear localization signal of Tat and therefore it should have been localized in the nucleus (Endo et al, 1989; Hoffmann et al, 1997). Lastly, HIV RNA in RNA/RNA hybrid could have been cleaved post-transcription in the nucleus or in the cytoplasm. However, as Tat is predominantly localized in the nucleus, chances of Tat-RNase H localization and cleaving HIV RNA in the nucleus are much greater than in the cytoplasm. Failure of the Tat-RNase H to inhibit HIV1 replication, by virtue of destroying HIV-1 RNA, could be attributed to a number of reasons discussed below.

the Tat-RNase H fusion protein does not inhibit HIV-1 replication in transduced MT4 cells and PBLs.

III. Discussion A number of functions have been attributed to the RNase H domain of the HIV-1 RT (Hostomsky et al, 1992, 1994). RNase H activity is required for strand transfer and strand displacement both of which are essential functions for the viral replication (Pop, 1996; Gabbara et al, 1999). RNase H shows a strong affinity for RNA/DNA hybrids in vivo (Skalka and Goff, 1993; Telesnitsky and Goff, 1997) and to a lesser degree for RNA/RNA hybrids in vitro (Ben-Artzi et al, 1992; Gotte et al, 1995). The HIV-1 RNase H has been shown to exhibit both endonuclease and exonuclease activities. The exonucleolytic activity on RNA/DNA complex is also referred to as "directional processing" (Zhan et al, 1994). It has been proposed that the dual function of RNase H might be the result of two distinct conformations (Zhan et al, 1994; Cirino et al, 1995). The two conformations are regulated by the presence and relative amounts of divalent ions (Davis et al, 1991; Cirino et al, 1995). HIV-1 RNase H binds two divalent ions, namely Mn2+ or Mg2+. The presence of Mn2+ has been implicated in the exonucleolytic activity of the enzyme in RNA/DNA and RNA/RNA hybrids, while Mg2+ is required for both the exonucleolytic and endonucleotic activities (Ben-Artzi et al, 1993). The intimate association of the RNase H function with viral replication and its ability to recognize and cleave both RNA/RNA and RNA/DNA hybrids, renders it an attractive candidate for anti-HIV-1 gene therapy. We have previously reported the design and expression of the fusion gene tat-RNase H, composed of the sequence encoding a portion of the Tat protein of HIV1 and of the sequence encoding the RNase H domain of the HIV-1 RT (Melekhovets and Joshi, 1996). In vitro studies using Tat-RNase H fusion protein expressed in E. coli and an HIV-1 TAR RNA had previously shown that the fusion protein specifically recognizes the TAR element and cleaves RNA in RNA/RNA hybrid (Melekhovets and Joshi, 1996). Tat-RNase H could cleave RNA in RNA/RNA and also in RNA/DNA hybrid (Ben-Artzi et al, 1992; Skalka and Goff, 1993; Gotte et al, 1995; Telesnitsky and Goff, 1997). The RNA cleaving activity of Tat-RNase H in RNA/DNA hybrid was therefore studied. The efficiency of Tat-RNase H-mediated cleavage of TAR RNA in RNA/DNA hybrid was found to be much higher than in RNA/RNA hybrid. However, the RNA cleaving activity of Tat-RNase H in RNA/DNA hybrid was non-specific and did not require Tat-RNase H/TAR element interaction as both TAR and mutant TAR RNAs were efficiently cleaved in RNA/DNA hybrid. How the mutant TAR RNA/DNA hybrid is recognized by TatRNase H was not investigated.

Gene Therapy and Molecular Biology Vol 6, page 75

RNA (75 nt-long) were transcribed in vitro and 5’ end-labeled as described previously (Melekhovets and Joshi, 1996). These RNAs (30,000 cpm) were then subjected to Tat-RNase H cleavage in the presence of 10 mM Mn2+ as described previously (Melekhovets and Joshi, 1996). Control samples lacked TatRNase H. In order to study the RNA/DNA cleaving activity of Tat-RNase H, an oligodeoxynucleotide (5’-TTG-AGG-CTTAAG-CAG-TGG-3’) complementary to the last 18 nucleotides of the TAR/mutant TAR RNA was added. All cleavage reactions were performed for 1 hour at 37oC, unless specified otherwise. The cleaved and uncleaved RNA was then ethanol precipitated and analyzed by electrophoresis on a 12-15% polyacrylamide gel.

As Tat-RNase H-mediated cleavage of RNA in RNA/DNA hybrid is non-specific in vitro and does not require Tat/TAR interaction, this activity could not have resulted in specific inhibition of HIV replication. If present, this activity would have caused cytotoxicity, which was not observed. The RNA cleaving activity of Tat-RNase H in RNA/RNA hybrid observed in vitro (Melekhovets and Joshi, 1996) is the one that was expected to specifically inhibit virus replication. Thus, it seems that this activity was poorly exhibited in vivo. Tat-RNase H was designed to contain the nuclear localization signal of Tat for transport of the fusion protein to the nucleus to be localized in the nucleus. This should have enabled the Tat-RNase H to recognize and cleave nascent HIV-1 transcripts. However, the last few amino acids present in the C-terminus of the Tat protein have not been included in the Tat-RNase H protein. Although the significance of this sequence is not clear, some evidence exists to implicate it in the nuclear localization of the protein (Hoffmann et al, 1997). Therefore, it is possible that inadequate localization of the Tat-RNase H protein in the nucleus might have resulted in poor inhibition of HIV1 replication. Alternatively, it is also possible that TatRNase H does enter the nucleus but that TAR RNA recognition and/or cleavage by the fusion protein is inhibited in vivo. This could be due to steric interference caused by other TAR RNA binding proteins, or those typically interacting with the Tat protein (Kato et al, 1992; Kaczmarski and Khan, 1993). High levels of viral Tat protein could also out-compete the Tat-RNase H protein for TAR RNA binding, rendering the HIV-1 RNA inaccessible to the Tat-RNase H activity. A poor Tat-RNase H-mediated cleavage of TAR RNA in RNA/RNA hybrid in vivo is consistent with the fact that RNase H activity of RT/RNase H during viral reverse transcription only shows RNase activity within RNA/DNA hybrids and not within RNA/RNA hybrids. Our in vitro studies have shown that the Tat-RNase H protein can cleave TAR RNA in an RNA/RNA or RNA/DNA hybrid in the presence of Mn2+ but not in the presence of Mg2+. It is possible that the physiological concentrations of Mn2+ in MT4 cells or PBLs are suboptimal for RNA cleaving activity of Tat-RNase H. As this activity (RNA cleavage in RNA/RNA hybrid) would have been detrimental for virus evolution, it seems that the reason why this targeted RNase failed to inhibit HIV-1 replication is because of the choice of the RNase used. Indeed, Tev-RNase T1 was shown to inhibit HIV-1 replication in both MT4 cells and PBLs (Singwi et al, 1999).

B. MoTN-TH vector construction The tat-RNase H gene was constructed as described previously (Melekhovets and Joshi, 1996). The SV 40 promoter and the tat-RNase H gene were then subcloned in a retroviral vector using a two step PCR strategy. In the first PCR, the TatRNase H-5’ primer (5’-CGG-AAG-ATC-TAA-TAC-GAC-TCACTA-T-3’) and Tat-RNase H-3’ primer (5’-GCG-CAT-CGATCT-ATA-GTA-CTT-TCC-TGA-TTC-C-3’) were used to amplify the tat-RNase H gene from the pET-TH plasmid. This PCR product and the SV-5’ primer (5’-CGG-AAG-ATC-TAATAC-GAC-TCA-CTA-T-3’) were then used in a second PCR reaction with the pB1-SVR6842 plasmid DNA, to amplify the SV40 promoter and the tat-RNase H gene. The resulting PCR product contained a Bgl II restriction site, the SV40 promoter, the tat-RNase H gene and a Cla I restriction site. This cassette was digested with Bgl II and Cla I and cloned at the BamH I and Cla I sites of the MoTN vector. Clones containing the SV40 promoter and the tat-RNase H gene in the correct orientation were confirmed using restriction enzyme and PCR analyses.

C. Transduction of MT4 cells and PBLs with MoTN and MoTN-TH Amphotropic MoTN and MoTN-TH vector particles were produced as described previously (Joshi et al, 1990). Either MoTN or MoTN-TH vector particles were used to transduce the human CD4 + T lymphoid (MT4) cell line (Pauwels et al, 1987; Larder et al, 1989) as described previously (Liem et al, 1993). Stable MT4 transductants containing either the MoTN or MoTNTH vector were selected for resistance to the antibiotic G418 over a period of three weeks. Human peripheral blood mononuclear cells were isolated using Ficoll-Hypaque gradient centrifugation. Following a phosphate buffered saline (PBS) wash, 1 x 106 cells/ml were cultured for a day at 37oC in RPMI 1640 medium that contained 10% fetal bovine serum, 20 units/ml recombinant human interleukin (IL)-2 (Boehringer Mannheim) and 5 µg/ml phytohemagglutinin (Sigma). Cells in suspension were collected and cultured for two more days. T cell-specific monoclonal antibodies were used to determine T lymphocytes by flow cytometry. Approximately 1 x 106 PBLs were transduced with MoTN or MoTN-TH vector particles as described previously (Singwi et al, 1999) in the presence of 16 µg/ml polybrene and 20 units/ml IL-2. The cells were then collected by centrifugation at 200 x g for 1 hour at 32oC and cultured for 16 hours at 32oC. Prior to transduction, the cells were incubated at 37 oC for 6 hours in medium containing IL-2. Three rounds of transduction were carried out. Following the final round, transduced cells were selected for four days in medium containing G418 (500 µg/ml).

IV. Materials and Methods A. In vitro cleavage of TAR RNA and mutant TAR RNA in RNA/RNA and RNA/DNA hybrids by Tat-RNase H Tat-RNase H was produced and purified from E. coli (Melekhovets and Joshi, 1996). TAR RNA and mutant TAR

Melekhovets et al: Tat-RNase H and its use in HIV gene therapy

Gabbara S, Davis WR, Hupe L, Hupe D and Peliska JA (1999) Inhibitors of DNA strand transfer reactions catalyzed by HIV-1 reverse transcriptase. Biochemistry 38, 13070-13076. Gotte M, Fackler S, Hermann T, Perola E, Cellai L, Gross HJ, Le Grice SF and Heumann H (1995) HIV-1 reverse transcriptase-associated RNase H cleaves RNA/RNA in arrested complexes: implications for the mechanism by which RNase H discriminates between RNA/RNA and RNA/DNA. EMBO J 14, 833-841. Hoffmann S and Willbold D (1997) A selection system to study protein-RNA interactions: functional display of HIV-1 Tat protein on filamentous bacteriophage M13. Biochem Biophys Res Commun 235, 806-811. Hostomsky Z, Hudson GO, Rahmati S and Hostomska Z (1992) RNase D, a reported new activity associated with HIV-1 reverse transcriptase, displays the same cleavage specificity as E. coli RNase III. Nucleic Acids Res 21, 5819-5824. Hostomsky Z, Hughes SH, Goff SP and Le Grice SF (1994) Redesignation of the RNase D activity associated with retroviral reverse transcriptase as RNase H. J Virol 3, 19701971. Joshi S, Van Brunschot A, Robson I and Bernstein A (1990) Efficient replication, integration and packaging of retroviral vectors with modified long terminal repeats containing the packaging signal. Nucl Acids Res 18, 4223-4226. Kaczmarski W and Khan SA (1993) Lupus autoantigen Ku protein binds HIV-1 TAR RNA in vitro. Biochem Biophys Res Commun 196, 935-942. Kato H, Sumimoto H, Pognonec P, Chen CH, Rosen CA and Roeder RG (1992) HIV-1 Tat acts as a processivity factor in vitro in conjunction with cellular elongation factors. Gene Dev 6, 655-666. Larder BA, Darby G and Richman DD (1989) HIV with reduced sensitivity to zidovudine (AZT) isolated during prolonged therapy. Science 243, 1731-1734. Liem SE, Ramezani A, Li X and Joshi S (1993) The development and testing of retroviral vectors expressing trans-dominant mutants of HIV-1 proteins to confer antiHIV-1 resistance. Hum Gene Ther 4, 625-634. Magli MC, Dick JE, Huszar D, Bernstein A and Phillips RA (1987) Modulation of gene expression in multiple hematopoietic cell lineages following retroviral vector gene transfer. Proc Natl Acad Sci USA 84, 789-793. Melekhovets YF and Joshi S (1996) Fusion with an RNA binding domain to confer target RNA specificity to an RNase: design and engineering of Tat-RNase H that specifically recognizes and cleaves HIV-1 RNA in vitro. Nucl Acids Res 24, 1908-1912. Pauwels R, DeClerq E, Desmyter J, Balzarini J, Goubau P, Herdewijn P, Banderhaeghe H and Van de Putte M (1987) Sensitive and rapid assay on MT-4 cells for detection of antiviral compounds against the AIDS virus. J Virol Methods 16, 171-185. Pop MP (1996) In vitro analysis of the HIV-1 second strandtransfer reaction. Biochim Biophys Acta 1307, 193-204. Ramezani A and Joshi S (1996) Comparative analysis of five highly conserved target sites within the HIV-1 RNA for their susceptibility to hammerhead ribozyme-mediated cleavage in vitro and in vivo Antisense Nucleic Acid Drug Dev 6, 229235. Rosen C (1992) HIV Regulatory Proteins: Potential Targets For Therapeutic Interventions. AIDS Res Hum Retroviruses 8, 175-181.

D. Detection of tat-RNase H DNA and RNA in transduced cells Genomic DNA isolation from cells transduced with MoTN and MoTN-TH vector was carried out as described earlier (Sambrook et al, 1989). PCR analysis was performed as described earlier (Ramezani and Joshi, 1996) using the TatRNase H-5' and 3' primers. Total cellular RNA was extracted from MoTN and MoTN-TH vector transduced cells as described elsewhere (Chomezynski and Sacchi, 1987). Reverse transcription was performed using the Tat-RNase H-3’ primer followed by PCR using the Tat-RNase H-5’ and 3’ primers as described previously (Ramezani and Joshi, 1996). PCR and RTPCR products were analyzed by electrophoresis on a 1.5% agarose gel.

E. HIV-1 susceptibility of MT4 and PBL transductants expressing Tat-RNase H The pools of actively dividing stable MT4 transductants lacking or expressing Tat-RNase H (2 x 106 cells) were each infected with the HIV-1 strain NL4-3 (500 ng p24 equivalent) for 6 hours at 37oC as described previously (Ramezani and Joshi, 1996). Transduced PBLs (5 x 106 cells) were infected with 1.5 ng (p24 equivalent) of a clinical isolate of HIV-1 for 16 hours at 37oC as described previously (Singwi et al, 1999). Half of the culture supernatants was collected every third day and replaced with fresh medium. The amount of HIV-1 p24 antigen released in the cell culture supernatant was measured by enzyme linked immunosorbent assay (ELISA, Abbott) as described by the manufacturer.

Acknowledgements This work was supported by a grant from the Canadian Institutes of Health Research. The following reagents were obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 strain NL4-3 from Dr. R.C. Gallo, pNL4-3 from Dr. A. Adachi; MT4 cell line from Dr. D. Richman.

References Ben-Artzi H, Zeelon E, Le Grice SFJ, Gorecki M and Panet A (1992) Characterization of the double stranded RNA dependent RNase activity associated with recombinant retroviruses. Nucleic Acids Res 20, 5115–5118. Ben-Artzi H, Zeelon E, Amit B, Wortzel A, Gorecki M and Panet A (1993) RNase H activity of reverse transcriptases on substrates derived from the 5' end of retroviral genome. J Biol Chem 268, 16465-16471. Chomezynski P and Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction. Anal Biochem 162, 156-159. Cirino NM, Cameron CE, Smith JS, Rausch JW, Roth MJ, Benkovic SJ and Le Grice SF (1995) Divalent cation modulation of the ribonuclease functions of HIV reverse transcriptase. Biochemistry 34, 9936-9943. Davis JF, Hostomska Z, Hostomsky Z, Jordan SR and Matthews DA (1991) Crystal structure of the ribonuclease H domain of HIV-1 reverse transcriptase. Science 252, 88-95. Endo S, Kubota S, Siomi H, Adachi A, Oroszlan S, Maki M and Hatanaka M (1989) A region of basic amino-acid cluster in HIV-1 Tat protein is essential for trans-acting activity and nucleolar localization. Virus Genes 3, 99-110.

Gene Therapy and Molecular Biology Vol 6, page 77

Sambrook J, Fritsch EF and Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Singwi S, Ding SG, Ramezani A and Joshi S (1999) Targeted RNases: a feasibility study for use in HIV gene therapy. Gene Therapy 6, 913-921. Singwi S and Joshi S (2000) Potential nuclease-based strategies for HIV gene therapy. Front Biosci 5, 556-579. Skalka AM and Goff SP (eds) (1993) Reverse Transcriptase, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Telesnitsky A and Goff SP (1997) Reverse transcriptase and the generation of retroviral DNA. In Coffin JM, Hughes SH and

Varmus HE (eds), Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Wu X, Liu H, Xiao H, Kim J, Seshaiah P, Natsoulis G, Boeke JD, Hahn BH and Kappes JC (1995) Targeting foreign proteins to HIV particles via fusion with Vpr and Vpx. J Virol 69, 3389-3398. Zhan X, Tan CK, Scott WA, Mian AM, Dowrey KM and So AG (1994) Catalytically distinct conformations of the ribonuclease H of HIV-1 reverse transcriptase by substrate cleavage patterns and inhibition by azidothymidylate and Nethylmaleimide. Biochemistry 33, 1366-1372.

Melekhovets et al: Tat-RNase H and its use in HIV gene therapy

Gene Therapy and Molecular Biology Vol 6, page 79

Gene Ther Mol Biol Vol 6, 79-89, 2001

DNA Vaccination for the induction of immune responses against HIV-1 subtype C envelope gene in mice Research Article

Alka Arora 1, John L. Fahey2 and Pradeep Seth1 1

Department of Microbiology, All India Institute of Medical Sciences, Ansari Nagar, New Delhi, India -110029. Department of Microbiology and Immunology, UCLA School of Medicine, Center for Health Sciences, 10833 Le Conte Avenue, Los Angeles, California-90095-1747. 2

_________________________________________________________________________________________________ *Correspodence: Dr. Pradeep Seth, Professor and Head, Department of Microbiology, All India Institute of Medical Sciences, Ansari Nagar, New Delhi, India -110029.Tel: 91-11-652 6814; Fax: 91-11-686 2663; E mail: pseth@aiims.aiims.ac.in Key words: HIV-1, subtype C, DNA vaccine, cross reactivity, cell mediated immunity, HIV vaccine Abbreviations: bovine growth hormone, (BGH); cytomegalovirus, (CMV); cytotoxic T lymphocyte, (CTL); envelope, (env); human immunodeficiency virus, (HIV); Joint United Nations Program on HIV/AIDS, (UNAIDS); lactate dehydrogenase, (LDH); National Centre for Cell Science, (NCCS); peripheral blood mononuclear cells, (PBMCs); stimulation index, (SI); tetramethylbenzidine dihydrochloride,, (TMB); tissue plasminogen activator, (tPA); World Health Organization, (WHO) Received: 26 June 2001; accepted: 9 July 2001; electroniacally published: February 2004

Summary Most human immunodeficiency virus (HIV) DNA vaccines currently being developed are based on clade B strains of HIV-1, which are found predominantly in North America and Europe. Since in India, subtype C is the predominant strain of HIV-1, it is imperative that a vaccine based on the local circulating subtype should be designed. Two DNA constructs encoding HIV-1 envelope glycoprotein (gp120) obtained from HIV-1 subtype C primary isolates were used for immunising mice. Mice immunised intramuscularly with these constructs produced low levels of antibodies against Gp120. However, these animals showed MHC class I restricted cytotoxic T lymphocyte (CTL) activity against homologous (subtype C) as well as heterologous (subtype B) peptide pulsed target cells thus demonstrating cross clade reactivity. In addition, in vitro lymphocyte proliferation and Th1 cytokine response to HIV antigen stimulus was seen with high levels of IFN-! and IL-2 but undetectable IL-4 and IL-5 production. These findings indicate that these constructs have possible value as potent vaccines. Their further characterization in nonhuman primate models is warranted. most of the world (Berger, 1996; Hogg et al, 1998). In addition, these drugs are partially successful because of side effects associated with prolonged use and the development of viral resistance to these drugs (Max et al, 2000; Servais et al, 2001). Therefore, a safe and effective HIV preventive vaccine is urgently needed to bring the HIV/AIDS epidemic under control. Historically, live-attenuated vaccines have been able to elicit a complete and long-lasting immunity (Melnick et al, 1994), but an attenuated HIV that is still able to replicate raises obvious safety concerns (Baba et al, 1995, 1999; Desrosiers, 1998; Johnson, 1999). DNA vaccines serve as an alternative to the live attenuated virus. DNA vaccines have been effective in generating immune

I. Introduction The need for an effective vaccine against human immunodeficiency virus type 1 (HIV-1) has never been greater. It has been estimated by the Joint United Nations Program on HIV/AIDS (UNAIDS) and World Health Organization (WHO), that more than 36 million people are currently infected with HIV worldwide. Although the epidemic was initially recognized in industrialized countries, it is spreading most rapidly in the developing world with more than 95% of new infections occurring in these countries. Although new antiretroviral drugs have been able to prolong life of HIV infected individuals (Moreno et al, 2000), the high cost of such therapy puts it beyond reach for

Arora et al: DNA Vaccination against HIV-1 subtype C envelope gene

response and protection in a wide variety of preclinical models of viral, bacterial and parasitic infections, and cancer (Hoffman et al, 1997; Inchauspe et al, 1997; Lozes et al, 1997). Intramuscular vaccination with plasmids expressing HIV-1 genes have been shown to generate specific CTL and helper T cells and antibodies in mice and nonhuman primates (Wang et al, 1993, Otten et al, 2000; Cherpelis et al, 2001). A therapeutic phase 1 trial on humans with such constructs induced a good safety profile and also demonstrated an immunologic potentiation (Ugen et al, 1998, Boyer et al, 2000; Mac Gregor et al, 2000). Virtually all the HIV DNA vaccines being developed are based on clade B strains of HIV (which are found predominantly in North America and Europe). The envelope (env) gene of HIV-1 encodes for a precursor glycoprotein 160 (Gp160) which is cloven by a cellular protease to surface glycoprotein Gp120 and a transmembrane glycoprotein Gp41. Gp120 and Gp41, are assembled into a trimeric complex that mediates virus entry into target cells (Weiss et al, 1990; Poumbourios et al, 1995). Earlier we have demonstrated that HIV-1 (subtype B) gp160, tat, rev based DNA constructs resulted in induction of cell mediated immune response but antibody response was low and transient in mice (Arora and Seth, submitted). HIV-1 env glycoprotein has been shown to contain some immunomodulatory sequences in gp41, which are known to downregulate antibody responses (Haynes et al, 1993). Also it is known that replacing the signal sequence of HIV-1 env gene with signal sequence from human tissue plasminogen activator protein (tPA), yields better expression of env gene (Golden et al, 1998). In addition, signal sequence of HIV-1 envelope glycoprotein inhibits the folding of HIV-1 Env protein (Li et al, 2000) which may result in poor antibody response. Therefore, we cloned HIV-1 gp120 gene from two Indian isolates of HIV1 into mammalian expression vector in frame with tPA signal sequence and studied its expression in vitro in HeLa cells. Mice were intramuscularly immunized with these constructs. DNA immunization resulted in induction of low antibody response thus indicating that replacing leader sequence of HIV-1 env with that of tPA leader sequence and removal of gp41 did not result in increased antibody response. However, we observed specific and crossreactive CTL and helper T lymphocyte responses. CTL response is known to play a major role in controlling primary viremia (Koup et al, 1994), and also long term non-progressors have been shown to have strong CTL response (Harrer et al, 1996). The findings indicate that these constructs have possible value as potent vaccines. Their further characterization in non-human primate models is warranted.

II. Results A. Construction of vectors expressing HIV-1 Gp120 HIV-1 gp120 was PCR amplified using a nested PCR approach. DNA isolated from peripheral blood mononuclear cells (PBMCs) of two HIV-1 infected individuals (referred to as Ch18 and SK3, respectively) were used as template DNA. Several studies have demonstrated that the HIV-1 gp120 gene with its natural signal sequence expressed in any prokaryotic or eukaryotic expression systems showed extremely low levels of synthesis and secretion (Murphy et al, 1993; Li et al, 1994; Golden et al, 1998). Therefore, a sense primer was designed internal to the signal sequence of HIV-1 env gene and Nhe I restriction site was introduced in the primer so that gp120 gene could be cloned in frame with human tissue plasminogen activator (tPA) signal sequence in pJW4304 mammalian expression vector. The gp120 from two isolates was cloned into pJW4304 mammalian expression vector in frame with tPA leader sequence to generate plasmids pJWCh18 and pJWSK3.

B. Subtyping of HIV-1 strains The subtypes of the infecting viruses were characterized by sequencing of the C2-V3-C3 region and also by heteroduplex mobility assay (HMA). Sequencing revealed that both the patients (Ch18 and SK3) were infected with HIV-1 subtype C (Table 1). Heteroduplex mobility assay showed that the HIV-1 gp120 insert in clone Table 1. Sequence of V3 region of gp120 gene of Ch18 and SK3 isolates. Ch 18 (Sequence map points : 795-1182) 5'-AGATCTGAAAATCTGACAAACAATGTCAAAACAATA ATAGTGCACCTTAATGAATCTGTAGAAATTGTGTGTAC AAGACCCAACAATAATACAAGAAGAAGTATAAGAATA GGACCAGGACAAGTATTCTATGCAAATAATGACATAA TAGGAGACATAAGACAAGCACATTGCAACATTAGTAA GGATGTCTGGAACAGTACTTTACAAAAGGTAGGTAAAA AATTAAAAGAACACTTCCCTAATAAAACAATAACATTT GAACCACACTCAGGAGGAGATCTAGAAATTACAACAC ATAGTTTTAATTGTAGAGGAGAATTTTTCTATTGCAATA CATCAGGGCTGTTTAAAAGTAACTTTAATGATACAGAA GGTAATTCAACTT-3'

SK 3 (sequence map points : 794-1183) 5'-TTAGATCTGAAAATCTGACAAACAATGTCAAAACAA TAATAGTGCACCTTAATGAATCTGTAGAAATTGTGTGT ACAAGACCCAACAATAATACAAGAAGAAGTATAAGAA TAGGACCAGGACTAGTTTTCTATGCAAATAATGACATA ATAGGAGACATAAGACAAGCACATTGCAACATTAGTA AGGATGTCTGGAACAGTACTTTACAAAAGGTAGGTAAA AAATTAAAAGAACACTTCCCTAAAAAAACAATAACATT TGAACCACACTCAGGGGGAGATCTAGAAATTACAACA CATAGTTTTAATTGTAGAGGAGAATTTTTCTATTGCAAT ACATCGGGGCTGTTTAAAAGTAACTTTAATGAAACAGA AGGTAATTCAACTT- 3

Gene Therapy and Molecular Biology Vol 6, page 81

pJWCh18 was most closely related to subtype C3 and that in clone pJWSK3 was most closely related to subtype C2 (Figures 1a &b).

cell culture supernatant obtained from cells transfected with pJW4304 did not react with HIV-1 positive human polyclonal serum (Figure 2).

D. Animal immunisation

C. In vitro expression

Balb/c mice injected with pJW4304, pJWCh18 and pJWSK3 DNA constructs thrice at 4-week intervals were used to study both humoral and cell mediated immune response generated as a result of DNA immunisations.

HeLa cells were transiently transfected with pJW4304, pJWCh18 or pJWSK3. A time course experiment was performed and cells culture supernatant and cell lysate of transiently transfected HeLa cells were analyzed for expression of HIV-1 gp120 by pJWCh18 and pJWSK3 vectors. Western blot analysis using HIV-1 positive human polyclonal serum demonstrated that HIV-1 Gp120 was present in cell lysate at 48-60 hrs post transfection. Gp120 was also secreted into the culture supernatant derived from pJWCh18 and pJWSK3 transfected cells (results shown for 72-hrs post transfection). Cell lysate and

E. Lymphocyte proliferation response Splenocytes from mice immunised with three doses of pJWCh18 showed stimulation index (SI) of 11.4 and 6.12 on stimulation with homologous peptide, pep10 and heterologous peptide pep09 respectively. Similarly, SI of 8.3 and 6.2 was observed when splenocytes from mice immunised with 3 doses of pJWSK3 were stimulated with pep10 and pep09 respectively. SI of 7.6 and 7.1 was observed on in vitro stimulation with recombinant Gp120 of splenocytes from mice immunized with pJWCh18 and pJWSK3, respectively. Splenocytes from pJW4304 (vector without the insert) immunised mice showed S.I. of <2 on stimulation with either peptide or recombinant Gp120 (Figure 3).

Figure 2. (a) Western Blot analysis of HeLa cell lysates transfected with pJWCh18 (lane 1); pJWSK3 (lane 2) and pJW4304 (lane 3) 60 hrs post transfection. (b) Western Blot analysis of cell culture supernatant from HeLa cells transfected with pJWCh18 (lane 1); pJWSK3 (lane 2) and pJW4304 (lane 3) 72 hrs post transfection. Western Blot analysis was performed using HIV-1 positive human polyclonal serum Figure 1. Heteroduplex mobility analysis of HIV-1 gp120 genes cloned in a) pJWCh18 and b) pJWSK3.

Arora et al: DNA Vaccination against HIV-1 subtype C envelope gene

without the insert) immunised mice showed S.I. of <2 on stimulation with either peptide or recombinant Gp120 (Figure 3).

F. Cytokine production by splenocytes Splenocytes from mice immunised with 3 doses of either pJWCh18 or pJWSK3 constructs, on stimulation with homologous (pep10) or heterologous (pep09) peptide or recombinant Gp120, produced significantly high levels of IFN-! and IL -2 in culture supernatants (Figure 4).

Figure 3. In vitro T Cell proliferative responses to homologous and heterologous peptides (pep09 and pep10) and recombinant gp120 from HIV-1 gp120 DNA immunised mice. Mice were immunized 3 times with 100µg of either of the constructs pJWCh18 (Gp I) or pJWSK3 (Gp II) at 4 week intervals, while control mice (N) were injected with the vector pJW4304 alone (without the insert). Splenocyte cultures were incubated with 20µg/ml of the stimulating peptides and 1µg/ml of recombinant gp120 and harvested 72 hrs later.

Figure 4. In vitro cytokine secretions from splenocyte culture from mice immunised intramuscularly with three doses of 100µg of pJWCh18 (Gp I), pJWSK3 (Gp II) and vector alone, pJW4304 (N). Supernatants were tested for cytokines (IL-2, IFN-!, IL-4 and IL-5) on the third day of culture with homologous (pep10), heterologous (pep09) peptides, or recombinant gp120. IL-4 and IL-5 levels were undetectable (data not shown).

Gene Therapy and Molecular Biology Vol 6, page 83

compared to heterologous peptide (pep09) pulsed target cells. Unstimulated target cells (N) were taken as control targets and effector cells from mice immunized with either pJWCh18 or pJWSK3 showed negligible CTL activity against unstimulated target cells (Figure 5). Effector cells from control animals (immunised with the vector DNA alone) demonstrated negligible CTL activity against either pep09 or pep10 pulsed target cells (data not shown).

However, IL-4 and IL-5 levels were undetectable in these stimulated cultures (data not shown). Cultures of splenocytes from mice immunised with the vector alone (without insert) showed undetectable to low levels of all the cytokines.

G. Cytotoxic responses

lymphocyte

(CTL)

H. Humoral immune response

Cytotoxic-T cell activity was measured in splenocytes harvested from the immunised mice 4 weeks after the third dose. Effector cells from pJWCh18 immunised mice demonstrated comparable CTL activity against homologous (pep10) or heterologous (pep09) peptide pulsed P815 target cells. The lysis remained within a range of 33%-48% at various graded effector to target ratios. Whereas, effector cells from pJWSK3 immunised mice demonstrated an increase in CTL activity (12.7%-51%) with corresponding increase in effector to target ratio. The lysis was greater for homologous peptide (pep10) pulsed target cells as

Low levels of HIV-1 specific antibody response was detected in mice immunised with three doses of either pJWCh18 or pJWSK3 against recombinant Gp120 protein coated plates in ELISA and not against peptide pep10 (data shown for pJWCh18 only). Sera obtained from animals immunised with three doses of recombinant vaccinia virus expressing gp120 gene of HIV-1 subtype B (vPE8) reacted strongly with recombinant Gp120 as well as pep10 and served as a positive control (Figure 6).

Figure 5. Induction of cytotoxic T lymphocytes in mice immunised with pJWCh18 (panel a) and pJWSK3 (panel b) plasmid DNA. Female Balb/c mice (H-2d) (4-6 weeks old) were injected intramuscularly three times at four-week interval with 100Âľg of either construct. Spleen cells were used as effector cells against mouse mastocytoma cells, P815, as target cells that were stimulated with 20Âľg/ml of either pep10 (homologous peptide) or pep09 (heterologous peptide). Unstimulated target cells (N) were taken as control targets.

Arora et al: DNA Vaccination against HIV-1 subtype C envelope gene

Gp120 specific MHC class I restricted CTL activities utilizing V3 peptide-sensitized P815 cells as targets. Several groups have independently reported successful results generating HIV-1 specific antibody and CTL responses in mice and non-human primates (Fuller et al, 1994; Lu et al, 1995; Shiver et al, 1995). Increasing evidence indicate a protective role for cytotoxic T lymphocytes in the host defence against HIV infection. Much of the evidence for the role of HIV specific CTLs in controlling HIV infection has come from the observation of CTL activity in HIV infected people at different stages of the disease. An HIV-1 specific CTL response has been detected at the time of primary infection and is maintained vigorously in long-term non progressors (Harrer et al, 1996). The initial viremia is controlled by CTL response as it is found that the appearance of the latter occurs just as the viremia falls, although antibodies with the capacity to neutralise the virus are rarely detected at this stage (Koup et al, 1994). A decline of antiviral CTL is usually coincident with disease progression (Klein et al, 1995). This loss of CTL activity is secondary to the loss of CD4+ T cell numbers (Pantaleo et al, 1995; Fauci et al, 1996). CTL reactivity against HIV antigens has been detected in seronegative persons who had been exposed to the virus. These include a small number of commercial sex workers in Africa, sexual partners of infected persons, children born to infected mothers and health care workers exposed to infectious body fluids (Clerici et al, 1993, 1994; Fowke et al, 1996).

III. Discussion Present study demonstrated Gp120 specific CTL responses against both subtype C (pep10) and subtype B (pep09) stimulated target cells, using effector cells from mice immunised with pJWCh18 and pJWSK3 showing that CTLs are capable of crossreacting with non-C clade target cells. Effector cells from either pJWCh18 or pJWSK3 immunised mice showed comparable CTL activity against both homologous peptide, pep10 and heterologous peptide, pep09 pulsed target cells (Figure 5). Effector cells from mice immunised with pJWSK3 also demonstrated CTL activity against homologous peptide, pep10 and heterologous peptide, pep09 pulsed target cells. However, percent specific lysis was greater for homologous peptide pulsed target cells as compared to heterologous peptide pulsed target cells (Figure 5). Broadly reactive cross clade CTL activity is highly desirable as the extent of HIV-1 sequence diversity affects the efficacy of an HIV vaccine. Cross-clade HIV-1 specific cytotoxic T lymphocyte responses have been demonstrated in HIV-1 infected individuals. Betts et al, (1997) demonstrated that CTLs from HIV-1 C clade infected individuals kill autologous targets expressing HIV-1 clade B derived Gag, Pol or Env. The induction of CTLs in Balb/c mice after immunization with envelope DNA constructs has been reported earlier (Wang et al, 1995; Kim et al, 1997). Shiver et al, (1995) showed that mice immunized with gp120 DNA exhibited

Figure 6. Antibody response to HIV-1 recombinant gp120 in the serum samples (1:10 serum dilution) collected 2 and 4 weeks after the second and third dose respectively in pJWCh18 immunised mice. Pos = positive, Neg= negative.

Gene Therapy and Molecular Biology Vol 6, page 85

IV. Materials and Methods

Memory T cell responses, as manifested by proliferation of antigen specific T cells and secretion of cytokines during in vitro culture of splenocytes have been shown by intramuscular immunisations with DNA plasmids encoding a variety of antigens such as influenza HA and NP, HIV Env, and Rev (Shiver et al, 1997). The present study demonstrated that the splenocytes from pJWCh18 and pJWSK3 immunised mice showed antigen specific proliferation in response to stimulation with peptide from homologous strain, (pep10) and to a lesser extent with a peptide from a heterologous strain (pep09). Thus indicating that helper T cell crossreactive lymphoproliferative immune responses were induced. The profile of cytokine secretion in response to antigen restimulation of spleen cells from immunised mice was indicative of a Th1 like helper T cell response i.e. high IL-2 and IFN-! levels and negligible level of IL-4 and IL-5 levels. Similarly, Shiver et al, (1997) demonstrated in vitro proliferation and Th1 like cytokine secretion from various lymphoid sites from gp120 (subtype B) DNA-immunised mice. Th1 cells are crucial to the containment of HIV. A steady shift from Th1 to Th2 has been reported in HIV infected individuals with disease progression (Clerici and Shearer, 1993). Th1 pattern has also been observed in response to a panel of HIV envelope peptides in a group of seronegative individuals who remain uninfected despite repeated exposures to HIV (Clerici et al, 1994). In the present study direct inoculation with DNA construct (pJWCh18 or pJWSK3) encoding HIV-1 gp120 gene induced low antibody response in mice as demonstrated by ELISA on sera obtained 2 - 4 weeks following primary and the booster doses. Similarly, low levels of ELISA antibodies have been detected in mice immunised with plasmids expressing Gp120 from BaL and JR-FL, which are prototypic monocyte/macrophage tropic virus strains of subtype B as compared to the antibody levels obtained on immunisation with DNA constructs expressing Gp120 from a T-cell line adapted virus (Richmond et al 1997). In the present study also primary isolates were used as the source of gp120 gene for the preparation of DNA constructs. The present study shows that DNA vaccines not only are potentially effective in generating Th1 response and CTL response but that these responses are also crossreactive. Therefore, it is reasonable to design a vaccine capable of inducing cellular immune responses. Nonetheless, the studies in mouse model on potential HIV-1 vaccine strategies are limited to demonstrating immunogenicity only. Since these animals are neither susceptible to infection with HIV-1 nor the subsequent immunodeficiency, studies of Indian HIV-1 subtype C DNA vaccine preparations in non-human primate models should be pursued.

A. Cells and reagents HeLa and P815 (mouse mastocytoma cells) cell lines were purchased from National Centre for Cell Science (NCCS) Pune, India. P815 cells were maintained in DMEM and HeLa cells in MEM, supplemented with 10% fetal calf serum (FCS), antibiotics and glutamine. Murine IFN-!, IL-2, IL-4 and IL-5 ELISA kits were purchased from Endogen Inc.Woburn, MA. HIV-1 gp120 V3 loop peptides, Pep 09 (RGPGRAFVTI-OH, aa313-322) corresponding to HIV-1 subtype B and Pep 10 (RIGPGQTFYATG-OH, aa 313-324) corresponding to HIV-1 subtype C were commercially synthesised for us by Commonwealth Biotechnologies Inc., Richmond, VA. Recombinant gp120 was provided by the NIH AIDS Research and Reference Reagent Program, Bethesda, MD). Plasmid vector pJW4304 was a kind gift from Dr. J.I. Mullins (University of Washington, Seattle, WA) and pCR-Script SK (+) cloning vector was purchased from Stratagene, LaJolla, CA. Plasmids were grown in DH5" strains of Escherichia coli (Life Technologies, Gaithesburg, MD), and purified using Wizard miniprep columns (Promega Corp, Madison, WI).

B. Animals 2-4 weeks old inbred female BALB/c mice, were purchased from National Central Laboratory Animal Sciences (NCLAS), Hyderabad, India.

C. DNA construction PBMCs were separated from two asymptomatic HIV-1 seropositive individuals by Ficoll-Hypaque density gradient method. Genomic DNA was extracted using Qia amp blood kit (Qiagen Inc. Stanford, CA) following manufacturer's instructions. DNA encoding the gp120 region of the HIV-1 was molecularly cloned using a nested PCR approach. First, a 1531 bp fragment containing gp 120 gene was amplified using following primers: Sense primer (E00) - 5' -TAGAAAGAGCAGAAGACAG TGGCAATGA-3' (-24-2) Antisense primer (E75) - 5'-GCGCCCATAGTGCTT CCTGCTGCTCCC-3' (1507-1481) This fragment was further amplified using a second set of primers to generate a 1436 bp gp120 fragment: Sense primer (APpcr501)- 5'-GTCGCTCCGCTAGC TTGTGGGTCACAGTCTATTATGGGGTACC-3' (84-118) Antisense primer (APpcr505)- 5'-GGTCGGATCC ttaCTCCACCACTCTCCTTTTTGCC-3' (1469-1448) Nhe I and BamH I sites (underlined) were introduced in the sense and antisense primers, respectively in order to clone the gp120 sequence in frame with the tPA signal sequence in pJW4304. A stop codon (in lower case) was introduced preceding the BamH I site in the antisense primer. PCR amplified fragments were cloned directly into pCRScript Amp SK (+) cloning vector following manufacturer's instructions. HIV-1 gp120 from two isolates was then excised from pCR-Script by cleavage with Nhe I and BamH I and cloned into mammalian expression vector pJW4304 to produce pJWCh18 and pJWSK3. DNA constructs pJWCh18 and pJWSK3, therefore expressed gp120 (amplified from the PBMCs of two HIV infected individuals) under the control of cytomegalovirus (CMV)

Arora et al: DNA Vaccination against HIV-1 subtype C envelope gene

immediate-early promoter and polyadenylation sequences from bovine growth hormone (BGH).

G. Lymphocyte proliferation assay One hundred microliters of the splenocyte suspension (2x106 cells/ml ) was added to each well of a 96-well flat bottom tissue culture plate. Cells were stimulated in triplicate with V3 peptides (either pep09 or pep10) at a concentration of 20µg/ml or recombinant gp120 at a concentration of 1µg/ml. The cells were incubated at 37o C in 5% CO2 for a total of 72 hrs. 16-18 hrs prior to harvesting one µCi of 3H thymidine (Bhabha Atomic Research Centre, Mumbai, India) was added to each well. The cells were harvested and the amount of 3H thymidine incorporated was measured in a 1211 Minibeta liquid scintillation counter (LKB Wallac, Finland). Splenocytes from vector inoculated mice served as negative controls. Con A was used as a polyclonal stimulator positive control. Basal levels of 3H-thymidine uptake by the splenocytes were obtained by culturing the cells in medium alone. Stimulation Index (SI) was calculated by the following formula:

D. Subtyping Heteroduplex mobility assay was performed using Heteroduplex Mobility Analysis HIV-1 env subtyping kit (Delwart et al, 1994) provided by the NIH AIDS Research and Reference Reagent Program, Bethesda, MD as per kit instructions. Briefly, a nested PCR approach was used to generate 0.7-kb env gene fragments. Initially, a 1436 bp-gp120 fragment was amplified using outer primers APpcr501 and APpcr505. This amplified product was then used as a template DNA to amplify 0.7-kb env gene fragment using inner primers ES7 and ES8, which spans V3V5 coding domain of gp120. Sense primer (ES7) - 5' CTG TTA AAT GGC AGT CTA GC 3' (771-790) Antisense primer (ES8) - 5' CAC TTC TCC AAT TGT CCC TCA 3' (1392-1372) The same size fragments were also amplified from a series of plasmids containing HIV-1 env genes from different subtypes used as references. Heteroduplexes formed between the sample and the most closely related reference sequence exhibited the fastest mobility and thus indicated the likely subtype of that strain.

m ean c.p.m . Of (3H) t hymi dine i ncor por at ed in the presence of st i mulat ed anti gen

SI= ______________________________________________________________________________ m ean c.p.m . of (3H)t hymi dine i ncor por at ed in the unsti m ul at ed m edi um cont r ol cell cult ur es

S.I. greater than 3 was taken as a positive response.

E. In vitro expression

H. Cytokine assay

In vitro expression of plasmids (pJWCh18 and pJWSK3) was tested in transiently transfected HeLa cells. Lipofectin (Life Technologies, Gaithersberg, USA) was used as a transfection reagent. At 48-72 hr post transfection, cell free supernatants were collected and cells were harvested by washing with PBS (pH7.2) and detaching with 0.1%EDTA. Expression was studied by western blot analysis of the transfected cells. HIV-1 positive human polyclonal serum was used as a source of antibody. Cells transfected with pJW4304 served as the controls.

Pooled splenocytes (2x105 cells) were cultured with 20µg/ml V3 peptides (pep 09 and pep10) or recombinant Gp120 at a concentration of 1µg/ml in a total volume of 200µl of RPMI 1640 containing 10%FCS in a 96 well tissue culture plate for 72 hrs at 37oC. The supernatants were harvested and assayed for the presence of IL-2, IFN-!, IL-4 and IL-5 using commercially available ELISA kits as per manufacturer's instructions.

I. Cytotoxic T lymphocyte assay F. DNA inoculation

Cytotoxic T lymphocyte (CTL) assays were performed as described earlier (Corr et al, 1996) with minor modifications. Briefly, stimulator cells were prepared by incubating 2x107 normal syngeneic BALB/c splenocytes with 20µg/ml pep09 for 2 h at 37oC followed by irradiation (2500 rads) in a gamma cell irradiator (Gamma cell 3000 Elan, MDS Nordion). The effector cells were prepared by stimulating 5x107 splenocytes from immunized mice with 1x107 peptide pulsed and irradiated stimulator cells in 40 ml of RPMI 1640 containing 10% FCS, glutamine, antibiotics and 5x10-5 M 2-mercaptoethanol (Sigma Chemicals Co.,) and 10U/ml recombinant murine IL-2 (Roche Molecular Biochemicals, Manheim, Germany). The splenocytes were incubated at 37oC in 5% CO2 for 5 days and then they were washed and used as effector cells. Mouse mastocytoma cell line P815 was used as target cells. These cells were pulsed overnight with 20µg/ml of either pep 09 or pep10 peptides at 37oC in 5%CO2. Thereafter, the target cells were resuspended in RPMI 1640 to a final concentration of 2x105 cells/ml and 100µl of it were added to each well of a 96 well U bottom tissue culture plate. This was followed by addition of 100µl of effector cells to each well in triplicate at graded effector to target ratio. After a 4-hr incubation at 37 oC in 5%CO 2, 50µl of supernatant was harvested from each well and transferred to a flat bottom 96 well plate. Lysis was measured by lactate dehydrogenase (LDH) release using the Cytotox 96-assay kit (Promega corp. Madison, WI). Controls were included in each plate for spontaneous LDH release from

A facilitated DNA immunisation protocol was followed which resulted in increased protein expression levels from plasmids delivered genes in vivo (Wang et al, 1993). Specifically, the quadriceps muscles of BALB/c mice (seven mice per group) were injected with 50µl of 0.5% bupivacaine hydrochloride and 0.1% methyl paraben (Sigma Chemicals Co., St. Louis, and CT) in normal saline using a 27-gauge needle. Forty-eight hrs later, 100µg of DNA construct was injected into the same region of the muscle as the bupivacaine injection. Mice were injected with DNA thrice at 4-week intervals. In a typical experiment, 7 mice in each of three groups were inoculated with DNA constructs including vector, pJW4304, alone (as control) or vector with gp20 insert from 2 different isolates of HIV-1 subtype C, pJWCh18 and pJWSK3. Blood was collected from each mouse for antibody assay just prior to immunisation, at the end of second and fourth week following first dose and then after 4 weeks of subsequent doses. For determination of cell mediated immune response, spleens from immunised mice four weeks after the final boost were aseptically removed and single cell suspensions were prepared. The cells from the same group of mice were pooled. RBC’s were removed by treating the spleen cells with 0.9%NH4Cl for 1 min at 37oC, followed by two washes in HBSS containing 2%FCS and resuspended at a concentration of 2x106 cells/ml in RPMI 1640 with 10% FCS, antibiotics and glutamine.

Gene Therapy and Molecular Biology Vol 6, page 87

target and effector cells. Percent cytotoxicity was calculated by the following formula as per manufacturer’s instructions:

Boyer JD, Cohen AD, Vogt S, Schumann K, Nath B, Ahn L, Lacy K, Bagarazzi ML, Higgins TJ, Baine Y, Ciccarelli RB, Ginsberg

E xper i ment al- E ff ect or spontaneous Tar get spont aneous

RS,

MacGregor

RR,

Weiner

(2000)

Vaccination of seronegative volunteers with a human

% Cytotoxicity = ________________________________________________x 100

immunodeficiency virus type 1 env/rev DNA vaccine

T ar get Maxi mum- T ar get S pontaneous

induces

J. ELISA

antigen-specific

proliferation

and

lymphocyte

production of beta-chemokines. J Infect Dis 181, 476-483

High binding 96 well microtiter ELISA plates (Costar corp. Cambridge, USA) were coated with one µg of V3 peptide (pep 10) or recombinant Gp120 per well in 100 µl of carbonate- bicarbonate buffer (pH 9.6) at 37oC for 1 hr followed by blocking with 0.8 %BSA in phosphate buffer saline (pH 7.2) at room temperature for 2 hrs. 1 in 10 dilution of mouse serum collected at various time intervals as indicated above, was allowed to react with the antigen at 37oC for 60 minutes. Wells were washed 6 times with PBS Tween 20 (pH-7.2) and incubated with goat anti mouse Ig conjugated with horseradish peroxidase (DAKO A/S, Denmark) for 30 min at 37oC followed by washing. Then the substrate (H2O2) with 0.1 mg/ml of chromogen (3,3',5,5' tetramethylbenzidine dihydrochloride, (TMB), Sigma Chemicals Co., St. Louis, CT) in citrate acetate buffer (pH 5.6), was added to each well and incubated for 30 min at room temperature in dark. The reaction was stopped with the addition of 50µl of 1N H2SO4. The plate was read on a Labsystems Multiskan plus plate reader at OD 450nm.

Cherpelis S, Shrivastava I, Gettie A, Jin X, Ho DD, Barnett SW, Stamatatos L (2001) DNA vaccination with the human immunodeficiency virus type 1 SF162DeltaV2 envelope elicits immune responses that offer partial protection from simian/human immunodeficiency virus infection to CD8(+) T-cell-depleted rhesus macaques. J Virol 75, 1547-1550 Clerici M, Sison AV, Berzofsky JA, Rakusan TA, Brandt CD, Ellaurie M, Villa M, Colie C, Venzon D J, Sever JL, et al, (1993a) Cellular immune factors associated with mother-toinfant transmission of HIV. AIDS 7, 1427-1433. Clerici M and Shearer G (1993b) A Th1- Th2 switch is a critical step in the aetiology of HIV infection: New insights. Immunol Today 14, 107-111.

Acknowledgements

Clerici M, Levin JM, Kessler HA, Harris A, Berzofsky JA, Landay

Ms. Alka Arora was supported by a fellowship from the University Grants Commission (Government of India). HIV1 Gp120 was obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH. pJW4304 vector was obtained from Dr. Mullins, University of Washington, Seattle, WA.

AL, and Shearer GM (1994) HIV specific T helper activity in seronegative health care workers exposed to contaminated blood. J Am Med Assoc 271, 42-46. Corr M, Lee DJ, Carson DA, and Tighe H (1996) Gene vaccination with naked plasmid DNA: Mechanism of CTL priming. J Exp Med 184, 1555-1560.

References Baba TW, Jeong YS, Pennick D, et al, (1995) Pathogenicity of

Delwart EL, Sheppard HW, Walker BD, Goudsmit J, Mullins JI

live, attenuated SIV after mucosal infection of neonatal

(1994) HIV-1 evolution in vivo tracked by DNA heteroduplex mobility assays. J Virol 68, 6672-6683.

macaques. Science 267, 1820-1825.

Desrosiers RC (1998) Prospects for live attenuated HIV. Nat

Baba TW, Liska V, Khimani AH, Ray NB, Dailey PJ, Penninck

Med 4, 982.

D, Bronson R, Greene MF, McClure HM, Martin LN, Ruprecht RM (1999) Live attenuated, multiply deleted

Fauci AS, Pantaleo G, Stanley S, and Weissman D (1996)

simian immunodeficiency virus causes AIDS in infant and

Immunopathogenic mechanisms of HIV-1 infection. Ann

adult macaques. Nat Med 5, 194-203.

Internal Med 124, 654-663. Fowke K, Nagelkerke N, Kimani N, Simonsen N, Anzala AO,

Berger PB. (1996) Hope and caution: report from the XI International Conference on AIDS. CMAJ 155, 717-721

Bwayo J, Oyugi J, MacDonald K, Ngugi E, and Plummer F

Betts MR, Krowka J, Santamaria C, Balsamo K, Gao F, Mulundu

(1996) Resistance to HIV-1 infection amongst prostitutes. Lancet 348, 1347-51.

G, Luo C, Gandu NN, Sheppard H, Hahn BH, Allen S and Frelinger JA (1997) Cross-clade Human Immunodeficiency

Fuller DH, Haynes JR. (1994) A qualitative progression in HIV

virus (HIV)-specific cytotoxic T lymphocyte responses in HIV

type 1 gp 120-specific cytotoxic cellular and humoral immune

infected Zambians. J Virol 71, 8908-8911.

responses in mice receiving a DNA based gp 120 vaccine. AIDS Res Hum Retroviruses 10, 1433-1441.

Arora et al: DNA Vaccination against HIV-1 subtype C envelope gene

Golden A, Austen DA, van Schravendijk MR, Sullivan BJ,

infection : A longitudinal analysis of rapid progressors and

Kawasaki ES, Osburne MS (1998) Effect of promoters and

long term asymptomatics. J Exp Med 181, 1365-1372.

signal sequences on the production of secreted HIV-1 gp120

Koup RA, Safrit JT, Cao Y, Andrews CA, McLeod G, Borkowsky

protein in the baculovirus system. Protein Expr Purif 14, 8-

W, Farthing C and Ho DD (1994) Temporal association of

12.

cellular immune responses with the initial control of viremia in

Harrer T, Harrer E, Kalams S, Trocha A, Jhonson RP, Elbeik T,

primary human immunodeficiency virus type 1 syndrome. J

Feinberg MB, Cao H, Ho DD, Buchbinder SP, and Walker BD

Virol 68, 4650-4655.

(1996) Strong cytotoxic T cells and weak neutralizing

Li Y, Luo L, Thomas DY, Kang CY (1994) Control of

antibodies in long term non progressing HIV-1 infection.

expression, glycosylation, and secretion of HIV-1 gp120 by

AIDS Res Hum Retroviruses 12, 585-592.

homologous and heterologous signal sequences. Virology

Haynes BF, Arthur LO, Frost P, Matthews TJ, Langlois AJ,

204, 266-278.

Palker TJ, Hart MK, Scearce RM, Jones DM, McDanal C, et al,

(1993)

Conversion

immunogenic

Li Y, Luo L, Thomas DY, Kang CY (2000) The HIV-1 Env

human

protein signal sequence retards its cleavage and down-

immunodeficiency virus (HIV) envelope synthetic peptide to

regulates the glycoprotein folding. Virology 272, 417-428

a tolerogen in chimpanzees by the fusogenic domain of HIV

Lozes E, Huygen K, Content J, Denis O, Montgomery DL,

gp41 envelope protein. J Exp Med 177, 717-27

Yawman AM, Vandenbussche P, Vooren J, Jeffrey AD, Ulmer

Hoffman SL, Doolan DL, Sedegah M, Aguiar JC, Wang R, Malik A, Gramzinski RA, Weiss WR,

Hobart P,

B and Liu MA. (1997) Immunogenicity and efficacy of a

Norman JA,

tuberculosis DNA vaccine encoding the components of the

Margalith M and Hedstrom RC (1997) Strategy for

secreted antigen 85 complex. Vaccine 15, 830-833.

development of a pre-erythrocytic Plasmodium falciparum

Lu S, Santoro JC, Fuller DH, Haynes JR, Robinson HL (1995) Use

DNA vaccine for human use. Vaccine 15, 842-845.

of DNAs expressing HIV-1 Env and noninfectious HIV-1

Hogg RS, Weber AE, Craib KJ, Anis AH, O'Shaughnessy MV,

particles to raise antibody responses in mice. Virology 209,

Schechter MT, Montaner JS (1998) One world, one hope: the

147-154.

cost of providing antiretroviral therapy to all nations. AIDS

MacGregor RR, Boyer JD, Ciccarelli RB, Ginsberg RS, Weiner

12, 2203-2209.

DB (2000) Safety and immune responses to a DNA-based

Inchauspe G, Major ME, Nakano I, Vitvitski L and Trepo C

human immunodeficiency virus (HIV) type I env/rev vaccine

(1997) DNA vaccination for the induction of immune

in HIV-infected recipients: follow-up data. J Infect Dis 181,

responses against hepatitis C virus proteins. Vaccine 15,

406.

853-856.

Melnick JA (1994) in Vaccines, eds. Plotkin, S. A., Mortimer, E.

Joint United Nations Programme on HIV /AIDS and World

A. & Saunders, W. B. (Academic, San Diego) , pp. 155-204.

Health Organization: Report on the Global AIDS/HIV

Moreno A, Perez-Elias M, Casado J, Navas E, Pintado V, Fortun

epidemic, Geneva, World Health Organization, Dec 2000.

J, Quereda C, Guerrero A (2000) Role of antiretroviral

Johnson RP (1999) Live attenuated AIDS vaccines: hazards and

therapy in long-term survival of patients with AIDS-related

hopes. Nat Med 5,154-155

pulmonary aspergillosis. Eur J Clin Microbiol Infect Dis.

Kim JJ, Ayyavoo W, Bagarazzi ML, Chattergoon M, Boyer JD,

19, 688-93.

Wang B and Weiner DB (1997) Development of a

Murphy CI, McIntire JR, Davis DR, Hodgdon H, Seals JR,

multicomponent candidate vaccine for HIV-1. Vaccine 15,

Young E (1993) Enhanced expression, secretion, and large-

879-883.

scale purification of recombinant HIV-1 gp120 in insect cell

Klein MR, Van BCA, Holwerda AM, Garde SRK, Bende RJ, Keet

using the baculovirus egt and p67 signal peptides. Protein

IP, Eeftinck SJKM, Osterhaus ADME, Schuitemaker H, and

Expr Purif 4, 349-357.

Miedema F (1995) Kinetics of gag specific cytotoxic T

Otten GR, Doe B, Schaefer M, Chen M, Selby MJ, Goldbeck C,

lymphocyte responses during the clinical course of HIV-1

Hong M, Xu F, Ulmer JB (2000) Relative potency of cellular

Gene Therapy and Molecular Biology Vol 6, page 89

and

humoral

immune

responses

induced

DNA

Uggen KE, Nyland SB, Boyer JD, Vidal C, Lera L, Rasheid S,

vaccination. Intervirology 43, 227-232.

Chattergoon M, Bagarazzi ML, Ciccarelli R, Higgins T, Baine

Pantaleo G, and Fauci AS (1995) New concepts in the

Y, Ginsberg R, Macgregor RR and Weiner DB (1998) DNA

immunopathogenesis of HIV infection. Annu. Rev. Immunol

vaccination with HIV-1 expressing constructs elicits immune

13, 487-512.

response in humans. Vaccine 16, 1818-1821.

Poumbourios P, Ahmar El W, McPhee DA, and Kemp BE

Wang B, Boyer J, Srikantan V, Coney L, Carrano R, Phan C,

(1995) Determinants of human immunodeficiency virus type

Merva M, Dang K, Agadmanyan MG, Gilbert L, Ugen KE,

1 envelope glycoprotein oligomeric structure. J Virol 69,

Williams WV, Weiner DB (1993a) DNA inoculation induces

1209â&#x20AC;&#x201C;1218.

neutralizing

Richmond JFL, Mustafa F, Lu S, Santoro JC, Weng J, Connell

immune

responses

against

human

immunodeficiency virus type 1 in mice and non-human

MO, Fenyo EM, Hurwitz JL, Montefiori DC, and Robinson

primates. DNA and Cell Biology 12, 799-805.

HL (1997) Screening of HIV-1 Env glycoproteins for the

Wang B, Ugen EK, Srikantan V, Agadunayan M, Dang K, Refaeli

ability to raise neutralizing antibody using DNA immunization

Y, Sato AI, Boyer J, Williams WV, and Weiner DB (1993b)

and recombinant vaccinia virus boosting. Virology 230, 265-

Gene inoculation generates immune responses against human

274.

immunodeficiency virus type 1. Proc. Natl. Acad. Sci. USA;

Shiver JW, Perry HC, Davies ME, and Lieu MA (1995a) Immune

90, 4156-4160.

responses to HIV gp120 elicited by DNA vaccination.

Wang B, Boyer J, Srikantan V, Ugen K, Agadjanian M, Merva M,

Vaccines 95 Cold Spring Harbor Laboratory Press.

Gilbert L, Dang K, McCallus D, Moelling K, Williams RW,

Shiver JW, Perry HC, Davies ME, Freed DL, Liu MA (1995b)

Conie L and Weiner DB (1995) DNA inoculation induces

Cytotoxic T lymphocyte and helper T cell responses following

cross clade anti-HIV-1 responses DNA Vaccines 772, 186-

HIV polynucleotide vaccination. DNA Vaccines 772, 198-

197.

208.

Weiss CD, Levy JA, and White JM (1990) Oligomeric

Shiver JW, Davies ME, Yasutomi Y, Perry HC, Freed DC, Letvin

organization

gp120

infectious

human

NL and Liu MA (1997) Anti-HIV env immunities elicited by

immunodeficiency virus type 1 particles. J Virol 64,

nucleic acid vaccines. Vaccine 15, 884-887.

5674â&#x20AC;&#x201C;5677.

Arora et al: DNA Vaccination against HIV-1 subtype C envelope gene

Gene Therapy and Molecular Biology Vol 6, page 91

Gene Ther Mol Biol Vol 6, 91-99, 2001

Sustained tissue -specific transgene expression from a vl30 retrotransposon-derived vector in vivo Research Article

James A. Grunkemeyer1,2, Clague P. Hodgson2,3*, and Dominic Cosgrove1 1

Boys Town National Research Hospital, Omaha, NE 68131 Creighton University School of Medicine, Dept. of Biomedical Sciences/Cancer Center, Omaha, NE, 68178

_________________________________________________________________________________________________ *Correspondence: Clague Hodgson, Ph.D., Nature Technology Corporation 4701 Innovation Drive, Lincoln, NE 68521; Tel. (402) 472-6530; Fax (402) 472-6532; email: Hodgson@natx.comc Current Address: Nature Technology Corporation, 4701 Innovation Drive, Lincoln, NE 68521 Key words: VL30 retrotransposon, transgenic, sustained expression Abbreviations: !-galactosidase,, (!-gal); 4,6 Diamidino-2-phenylindole, (DAPI); 5-bromo-deoxyuridine, (BrdU); Fluorescence in situ hybridization, (FISH); Fluoroscein isothiocyanate, (FITC); internal ribosome entry site, (IRES); long terminal repeat, (LTR); Moloney murine leukemia virus, (MoMLV); paraformaldehyde, (PFA); reverse transcriptase polymerase chain reaction, (RT-PCR); vector producer cells, (VPCs) Received: 28 June 2001; accepted: 17 July 2001; electronically published: February 2004

Summary Previous attempts to generate transgenic mice via retroviral transduction of pre-implantation embryos have usually not resulted in stable transgene expression. In these cases, inactivation of the retroviral LTR is associated with passage through the germ line. A subset of endogenous murine retrovirus-like retrotransposons (VL30â&#x20AC;&#x2122;s) are constitutively expressed in virtually all tissues, with no deleterious effects to the health of the animal. We surmised that these VL30s might be useful as vectors for stable lineage-specific transgene expression. A mouse VL30-derived retro-vector engineered to express a reporter gene (LacZ) was used to generate transgenic mice via transduction of embryonic stem (ES) cells. A single copy of the vector was stably integrated into a unique site in the mouse genome. Sustained tissue specific expression was observed at both the mRNA and protein levels for several generations. Transgene expression was observed in distinct sub-populations of cells in both lung and spleen. In the lung, cells expressing the vector were identified as type II pneumocytes. These data illustrate for the first time that a VL30 LTR (NVL-3) is unique from its retroviral counterparts in that it can pass through the germ line repeatedly without undergoing transcriptional inactivation. Thus, VL30 vectors may be useful for both transgenesis and as alternatives to existing retroviral vectors for gene therapy. (MoMLV), illustrated that these viruses failed to be expressed in the resulting animals. Infection of postimplantation embryos, however, does provide long-term expression of the transgene (Jahner et al, 1982). Failure of transgene expression in pre-implantation embryos is linked to lack of LTR enhancer activity (Brinster et al, 1981; Linney et al, 1984), binding of transcriptional repressors to the retrovirus tRNA primer binding site (Loh et al, 1987, 1988; Peterson et al, 1991), and possibly to DNA methylation of retroviral sequences as well as DNA flanking the integration site (Jahner et al, 1985; Barker et al, 1991; Hoeben et al, 1991). Related to the murine type C retroviruses is a family of long terminal repeat(LTR) bearing

I. Introduction Currently, methods for deriving transgenic animals rely predominantly on the direct injection of DNA into the pronuclei of oocytes (Palmiter et al, 1982; Lacy et al 1983). This method results in the integration of random concatamers of the original construct with varying copy number. This characteristic frequently confounds the interpretation of the results, requiring the analysis of a large number of founders to ensure correct interpretation of the data (Si-Hoe et al, 1999). An alternative approach was envisioned over two decades ago, involving the integration of a single copy retroviral vector into the germ line (Jaenisch, 1976). These studies, which employed Moloney murine leukemia virus

Grunkemeyer et al: VL30 transgene expression

Figure 1. Production of a transgenic mouse line harboring the VLSAIBAG retrotransposon construct. The synthetic retrotransposon, VLSAIBAG, engineered for these studies is illustrated in panel A. Positions of the NVL-3 long terminal repeats (NVL-3 LTR), Psi packaging sequences ("), splice acceptor site (s.a.), internal ribosome entry site (IRES), b-galactosidase expression cassette (Lac-Z), SV40 virus early region promoter (SV) and neomycin phosphotransferase expression cassette (neo) are shown. The positional locations of probes used are indicated by bars. Key restriction endonuclease recognition sites are indicated by letters: H= HindIII; Z= XhoI; B=BamHI. Panel B is a Southern blot illustrating single copy integration of an intact vector in the ES cell clone used to generate transgenic animals. Lanes: M, marker; l-HindIII; 1, XhoI digest hybridized with lacZ probe; 2, HindIII digest hybridized with lacZ probe; 3, HindIII digest hybridized with neo probe; 4, untransduced ES cell DNA; 5, EcoRV digest hybridized with Lac-Z probe. Panel C illustrates typical results for genotype analysis by Southern blot of a litter of pups derived by crossing two mice heterozygous for the transgene. Genotypes are listed above each lane. ++ = normal mouse; +Z = hemizygous for the transgene; ZZ = homozygous for the transgene.

Figure 2. Cytogenetic analysis of VLSAIBAG integration site. (A and B) FISH signal showing vector integration site in two different metaphase spreads from splenocytes of homozygous transgenic mice. (C) G-banding analysis of same spread as in A. Chromosomes with fluorescent signal are indicated by arrows. (D) Typical mouse idiogram as reference for panel C.

Gene Therapy and Molecular Biology Vol 6, page 93

retrotrotransposable elements (VL30â&#x20AC;&#x2122;s) present at 100 to 200 copies in the genomes of most species (Keshet et al, 1980; Courtney et al, 1982). Subsets of these endogenous elements are naturally expressed in many tissues (Norton et al, 1988; Nilsson and Bohm, 1994). During retroviral infections, mouse VL30 RNA is efficiently transmitted by pseudotyping (co-packaging) into retrovirus particles (Howk et al, 1978; Besmer et al, 1979; Scolnick et al, 1979). Vectors derived from murine VL30â&#x20AC;&#x2122;s are expressed in a variety of mammalian cell types, both primary and transformed (Chakraborty et al, 1993, 1995). These characteristics of VL30 suggested that vectors derived from these elements might give sustained expression in vivo. To test this hypothesis, a construct expressing LacZ from a VL30 LTR was packaged using a standard retroviral packaging cell line, and the resulting virions were used to transduce murine embryonic stem cells. Selected transductants were used to derive a transgenic animal via injection of ES cells into 3.5 day blastocysts and surgical reimplantation. Sustained and tissue specific expression was observed in the resulting transgenic mouse line. These results illustrate the utility of VL30 derived retro-vectors for obtaining transgene expression in vivo.

tissue from four and 15 week old animals. Figure 3A illustrates that a 194 bp protected fragment (corresponding to a portion of the lacZ structural gene) was present in both lung and spleen tissue. Significant amounts of vector RNA were observed in samples derived from both young (29 day old) and mature (99 day old) mice, illustrating that expression of the reporter gene is stable. To verify that the probe was detecting full-length transcripts of the appropriate molecular size, RNA blot analysis was performed using total RNA from lung tissue. Figure 3B demonstrates that the appropriate sized transcript (6.6 kb) was expressed in lung. Vector-derived transcript levels in the spleen were too low to be detected by this method. Expression of vector-derived transcripts in RNA preparations from whole tissues might be derived from a specific cellular compartment within the tissue. To delineate transgene expression at the cellular level, we employed a histochemical staining technique for enzymatically active !-gal protein. Results shown in Figure 4 demonstrated significant transgene expression in a subset of cells in both lung (Figure 4B, and D) and spleen (Figure 4F). Neither the number of cells nor the intensity of staining appeared to vary significantly between lung tissue derived from animals of two-weeks (Figure 4B) versus 10-weeks (Figure 4D) of age. No staining was observed in these same tissues from agematched non-transgenic littermates (Figure 4A, C and E). Based upon the morphology, frequency, and localization of !-gal positive staining cells of the lung, we surmised that they may be either macrophages or type II pneumocytes. To resolve this issue, tissues were first stained with X-gal, followed by staining of sections with antibodies specific for either macrophages or type II pneumocytes. The same fields were observed by both light and fluorescence microscopy to determine the identity of !-gal positive cells. Analysis of Figure 5A, and 5B clearly illustrates that cells staining positive for the macrophage marker are not positive for !-galactosidase activity. Similar analysis was carried out using an antibody specific for the pro-peptide form of human surfactant protein C, which is an established marker for type II pneumocytes (Vorbroker et al, 1995). Comparison of Figure 5C with Figure 5D illustrates that all blue cells were also positive for surfactant protein C, identifying these !-gal positive cells as type II pneumocytes. It should be noted, however, that not all antibody positive cells were blue, suggesting the transgene was expressed in a sub-population of type II pneumocytes in the lung. Similar attempts to identify the Lac-Z positive cells in the spleen were inconclusive.

II. Results A. derivation of vector and construction of the transgenic mouse line The vector used in these studies, which is referred to as VLSAIBAG (Figure 1A), was derived from the endogenous VL30 element NVL-3 (Carter et al, 1983). It contains a LacZ reporter gene expressed from the NVL-3 LTR. As VL30 RNA is poorly translated into protein (unpublished observations), an internal ribosome entry site (IRES) from encephalomyocarditis virus (EMCV) was cloned 5â&#x20AC;&#x2122; of the LacZ open reading frame to ensure efficient translation of the reporter construct (Grunkemeyer et al, submitted). Embryonic stem cells were transduced using viral supernatants from PA317/VLSAIBAG vector producer cells (VPCs). A number of clonal cell lines were obtained by G418 drug selection. One such clone was selected for micro-injection into mouse blastocysts, resulting in the production of a single transgenic mouse line. The transgene was integrated as a single copy, without rearrangements, in both the ES cells (Figure 1B) and in the resulting transgenic animals (Figure 1C). Fluorescence in situ hybridization (FISH) analysis demonstrated that a single autosomal integrant was stable through several mouse generations (Figure 2).

B. Analysis of vector expression in vivo

III. Discussion

Preliminary screening was carried out by reverse transcriptase polymerase chain reaction (RT-PCR) on total RNA from various embryonic and adult tissues. These analyses indicated expression in both spleen and lung (data not shown). RNase protection analysis was then performed using total RNA isolated from lung and spleen

The results described herein demonstrate that transgenic animals can be derived via transduction of mouse embryonic stem cells using retro-vectors engineered to express heterologous gene products from at

Grunkemeyer et al: VL30 transgene expression

least one VL30 promoter (NVL-3). In the example described, a stably transduced ES cell clone was used to generate a transgenic mouse which expressed theVL30 vector, VLSAIBAG, in a tissue-specific manner. The retro-vector was integrated in single copy, and shown to pass through the germ-line several times (>5) without affecting either the expression levels or the cellular specificity of expression. Earlier attempts to derive transgenic mice from embryonic cells transduced with retroviral vectors resulted in inactivation of expression after passage through the germ line (Jahner and Jaenisch, 1985). Inactivation was attributed to methylation of both the retroviral genome and the DNA surrounding the site of integration, based on direct studies as well as experiments where the retroviral genome was activated by chemical demethylation of the DNA with 5-azacytidine (Jahner et al, 1982; Jahner and Jaenisch, 1985). Thus, this method for producing transgenic animals has been largely abandoned. VL30-derived vectors offer the opportunity to revisit this strategy. The use of retroviral transduction of embryonic stem cells as a means of generating transgenic animals has obvious advantages over methods currently employed. The vector can be inserted in a single copy, avoiding complications due to concatamerization of the transgene. It allows for testing of gene therapy vectors in vivo, allowing quick assessment of tissue specificity and toxicity. There are more than 100 copies of VL30 in the mouse genome with wide ranging developmental and

tissue specific expression patterns (Sanes et al, 1986; Norton and Hogan, 1988; Nilsson and Bohm, 1994), and inducibility (Rodland et al, 1986, 1988; Lenormand et al, 1992), suggesting that their use in transgenics might have broad applicability. In an earlier report, Nilsson and Bohm, (1994) examined the endogenous expression patterns for a number of the known VL30 elements in mouse tissues. They demonstrated expression of the subclass of VL30 LTRâ&#x20AC;&#x2122;s that includes NVL-3 are expressed in the lung and spleen. Our construct employed the NVL-3 LTR, and as reported herein, was expressed in both the lung and the spleen. Nilsson and Bohm did not resolve expression at the cellular level in these tissues. Our results suggest that the NVL-3 LTR is regulated in the appropriate developmental and tissue specific manner in the transgenic mouse line. However, because only one transgenic line was analyzed, it is not possible to say with certainty that the transgene functioned in a position-independent manner. Generation and analysis of more transgenic lines, derived from indepentdently-transduced ES cell clones, are necessary to resolve this issue. Indeed, expression of other retro-vectors have been shown to be sensitive to position effects (Hoeben et al, 1991). However, the fact that expression was observed in the same two tissues as observed previously by Nilsson and Bohm, (1994) strongly suggests that the LTRs are specific for these tissues.

Figure 3. Expression of LTR-driven transcripts from lung and spleen in transgenic mice. Panel A is RNase protection analysis of total cellular RNA from both lung and spleen. Total RNA from either 29 day-old (p29) or 99 day-old (p99) mice were analyzed using a 213 base pair riboprobe. The expected size of the protected fragment was 194 base pairs. Probe (RNase +) is probe digested with ribonuclease; probe (RNase -) is undigested probe. (++) are wild type controls; (ZZ) are mice homozygous for the transgene. Panel B represents a northern blot of total lung RNA from either 29 day-old (p29) or 99 day-old (p99) transgenic mice hybridized with a probe derived from the LacZ structural gene (Figure 1A). The expected size band is visible at 6.6 kb.

Gene Therapy and Molecular Biology Vol 6, page 95

Figure 4. Expression of the VL30 transgene at the cellular level in lung and spleen. Tissues were stained histochemically for !galactosidase expression, then embedded in historesin plastic, and cut at 2.5 ÂľM. Sections were counter-stained with eosin and hematoxylin and photographed at 200 X magnification. Panels A and B show lung from 15 day old normal (A) and homozygous transgenic (B) mouse. Panels C and D show lung from 71 day old non-transgenic (C) and homozygous transgenic (D) mice. Panels E and F show spleen from 71 day old normal (E) and homozygous transgenic (F) mice. Figure 5. Identification of !galactosidase positive cells in the lung as type II pneumocytes. Lung tissue from a 71 day old homozygote was stained for !-gal expression, embedded in aqueous mounting medium, and cryosections stained with either #-Mac (a cell surface marker for macrophages, panel B), or anti-human surfactant protein C pro-peptide (#-hpro-SP-C, a marker for type II pneumocytes, panel D). The same field was recorded by light microscopy (panels A and C) for !gal staining, and fluorescence microscopy (panels B and D) for the specific cell markers to allow identificaiton of dual positive cells as type II pneumocytes (indicated by arrows in panels C and D), and not macrophages (lack of dual positive cells indicated by non-overlapping asterisks and arrows in panel B).

Grunkemeyer et al: VL30 transgene expression

added to ES cell cultures which had been passed onto gelatinized plates. The following day, the cells were washed twice with PBS and allowed to grow for 48 hours. Transduced ES cells were selected in 175 µg/ml G418 for 10 days. G418 resistant clones were expanded, and DNA (Puregene kit; Gentra Systems, Inc., Research Triangle Park, NC) was isolated for determination of vector integrity (no major rearrangements or deletions) and copy number. Clonal cell lines with correct morphology and a single integrated copy of VLSAIBAG were expanded for injection into pre-implantation embryos.

This is the first time that tissue-specific expression of a transgene has been demonstrated using a VL30-derived vector. These findings point toward the use of VL30derived vectors for the generation of transgenic animals expressing a heterologous gene in a tissue-specific or developmental stage-specific pattern. The large number of endogenous VL30 LTRs which have been shown to be expressed in distinct tissues at various times of development, may serve as a reservoir of promoters for transgenic constructs as well as potentially being useful for gene therapy. Expression of the retro-vector in type II pneumocytes illustrates highly specific cellular expression of the NVL-3 LTR promoter. Indeed, only a subset of pro-SPC-positive type II pneumocytes were positive for !-gal staining. Currently, pro-SPC is an accepted marker for the identification of type II pneumocytes (Vorbroker et al, 1995). Our data suggests that the capacity to express the retro-vector may delineate a subtype of type II pneumocyte or simply that vector expression in some type II pneumocytes is too low to be detected by the employed methods. Targeting expression to type II pneumocytes might provide therapeutic angles for diseases such as pulmonary emphysema, forms of which have been attributed to defects in matrix metalloproteinase expression (Ohnishi et al, 1998).

C. Genetic typing Hemizygote (designated +Z) males and females were maintained as breeders in the colony so that each litter had a likelihood of providing wild-type (++) and homozygous (ZZ) animals for experimentation. DNA was isolated from tail DNA according to the following method: an approximately 1 cm piece of tail was clipped with a sterile scalpel and incubated in 0.5 ml digestion buffer (50mM Tris-Cl, pH 7.5; 50 mM EDTA; 1% SDS and 10 µg/ml Proteinase K, Boehringer Mannheim) overnight at 37 oC and purified as described previously (Hogan et al, 1994). Tail DNA was digested with HindIII, electrophoresed, and hybridized to 32P-labelled probes for both the lacZ and neo coding sequences. After exposure of autoradiographic film, blots were exposed to a phospor screen to quantify the amount of signal in each lane and enable the distinction of hemi- and homozygous animals.

D. Fluorescence in situ hybridization analysis Cells were prepared for FISH and G-banding (Figure 2C) analysis as previously described (Takashi et al, 1991). Briefly, splenocytes were cultured for 2-4 days in the presence of concanavalin A and lipopolysaccharide to stimulate cell division. Metaphase spreads were prepared by synchronizing the cells with 300 Ìg/ml thymidine, culturing in 5-bromo-deoxyuridine (BrdU) and arresting them at metaphase with colchicine. The spreads were subjected to FISH analysis as described. The spreads were heat denatured and hybridized to a digoxigenin-labelled probe (dig-dUTP; Boehringer Mannheim), which was generated by nick translation of the lacZ probe (used for Southern and Northern analyses). After hybridization, slides were washed and incubated with a fluorescein-conjugated antidigoxigenin antibody. The slides were viewed on an Olympus BH-2 microscope equipped for epi-illumination. DAPI (4,6 Diamidino-2-phenylindole) was used as a counterstain for the chromosomes (excitation = 367 nm, emission = 453 nm). FITC (Fluoroscein isothiocyanate) was used to label the probe (excitation = 497 nm, emission = 524 nm). Low light level fluorochrome signals were captured and enhanced using the Cytovision system (Applied Imaging Inc., Pittsburgh, PA).

IV. Materials and Methods A. Vector construction All plasmids were constructed according to standard protocols (Ausubel et al, 1995). Plasmid pVLBAG was generated by cloning a blunted lacZ/simian virus-40 (SV40) early region transcriptional promoter/neomycin phosphotransferase resistance cassette from pDOL (Price et al, 1987) into the unique NotI site of plasmid pVLPP (Chakrablrty et al, 1993). Plasmid pVLPP is a synthetic VL30 vector containing the LTRs and psi packaging signal from the murine retrotransposon, NVL-3 Carter et al, 1983). Plasmid pVLIBAG was then constructed using pVLBAG as vector. A blunted 601 bp NcoI-SalI fragment (from pG1IL2EN) (Treisman et al, 1995), containing the IRES sequence from encephalomyocarditis virus (Jang et al, 1988), was ligated into the unique PacI site in pVLBAG immediately 5’ of the !-gal initiator AUG codon.This clone was used as vector for cloning pVLSAIBAG, the vector used in these studies. A 26 bp splice acceptor fragment was cloned immediately 5’ of the IRES. The splice acceptor was found to be non-functional both in vitro and in vivo (unpublished observation). For RNase protection assays, plasmid pRIBOGAL was constructed by cloning 194 bp of the lacZ coding sequence into pBluescriptII (Stratagene, La Jolla, CA). All clones were verified by restriction and sequence analysis.

E. Northern blot and RNase protection analyses Isolation of RNA from tissues was done using TRIzoltm reagent (InVitrogen Corp, Gaithesburg, MD) according to the manufacturers instructions. Total RNA was fractionated by electrophoresis on agarose-formaldehyde gels (20 µg sample/lane). Blots were UV-crosslinked, air-dried and hybridized to a probe for the lacZ coding sequence. RNase protection assays were performed using the same total cellular RNA used for Northern analyses with a kit (RPA II kit) from Ambion, Inc. (Austin, TX) according to the manufacturer’s instructions. Antisense riboprobes were synthesized in vitro

B. Viral transductions The embryonic cell line RW4 (Genome Systems, St. Louis, MO) was cultured according to the method of Robertson, 1987. ES cells were transduced by supernatants according to standard protocols (Cepko et al, 1995). Viral supernatants were harvested from rapidly growing (just confluent) cultures of PA317s, filtered through 0.2 µ filter (Nalgene, Milwaukee, WI), and

Gene Therapy and Molecular Biology Vol 6, page 97

using T3 RNA polymerase (Boehringer Mannheim), labeled #32P-UTP (Amersham), and linearized plasmid pRIBOGAL. The riboprobe contains extra vector sequences, so undigested probe (213 bases) can be differentiated from fully protected probe (194 bases) on a denaturing acrylamide gel.

microscope fitted with a digital camera and imaging system (Cytovision, Applied Imaging, Pittsburgh, PA). For the #-hpro-SP-C polyclonal, sections were blocked (2% normal goat serum; 0.2% Triton X-100 in PBS) for 90 minutes at room temperature before the addition of #-hpro-SP-C (dilution of 1:1000 in 2% normal goat serum; 0.2% Triton X-100 in PBS). Primary antibody was incubated overnight at 4oC. The next morning, the slides were washed with 0.2% Triton X-100 in PBS before addition of the FITC-conjugated secondary diluted 1:100 in PBS containing 0.2% Triton X-100. After 2.5 hours at room temperature in the dark, slides were washed with 0.2% Triton X-100 in PBS (1 wash for 5 minutes), PBS alone (2 washes for 5 minutes each) mounted with Vectashield, coverslipped and imaged.

F. Histochemical stain for !-gal activity and visualization Histochemical staining of tissues with X-gal was performed as previously described (Sanes et al, 1986). Tissues were fixed in 4% paraformaldehyde (PFA, Sigma Chemical Co.) for 1-2 hours at room temperature. After fixation, tissues were rinsed four times in PBS and incubated overnight at 30oC in Xgal stain solution [5.0 mM K3Fe(CN)6; 5.0 mM K4Fe(CN)6; 1.5 mM MgCl2; 0.02% NP-40; 0.01% sodium deoxycholate with 1.0 mg/ml X-gal (in DMSO) in PBS]. After staining, tissues were rinsed in PBS and embedded in Historesin using the methods described by the manufacturer (Leica; Heidelberg, Germany). Tissue blocks were sectioned at 2.5 µm with a Sorvall JB-4 microtome (Ivan Sorvall, Inc., Newton, CT) using a glass knife. To visualize cell morphology of cells stained blue (due to !-gal activity) in the context of the surrounding cells, each section was stained with Harris’ hematoxylin and counterstained in alcoholic eosin according to standard protocols (Allen et al, 1992). Sections were coverslipped with an organic mounting medium (Curtin Matheson Scientific, Inc., Houston, TX) and visualized on an Olympus BH2 oil immersion microscope fitted with a digital camera and imaging system (Cytovision, Applied Imaging, Pittsburgh, PA).

G. Immunohistochemical visualization

staining

Acknowledgements JAG was supported by an NIH graduate fellowship through the BTNRH RTC P60 DC00982 from the NIDCD. Work was supported by NIH R01 DK55000 and NIH P01 DC01813 to D.C., and by R29 GM41314 and a state of Nebraska Smoking and Tobacco-Related Disease grant to C.P.H. We acknowledge the kind gifts from Dr. C. Cepco (pDOL) and Jeffery Whitsett (anti-human proSP-C antibody). We are grateful to Jeffery Pinnt for FISH analysis and to John (Skip) Kennedy for artwork.

References Allen TC (1992) In Laboratory methods in histotechnology (E. Prophet, B. Mills, J. G. Arrington and L. H. Sobin, eds.), pp. 56-57, American Registry of Pathology, Washington, D.C.

and

Tissues stained with X-gal were also prepared for immunohistochemical analysis. After staining, tissues were rinsed in PBS and embedded in Tissue-Tektm (Miles Inc., Elkhart, IN) embedding medium. Tissues were frozen and stored at -150 oC and warmed to -25oC prior to sectioning. Blocks were sectioned at 3 µ on a Microm HM 505 N cryostat (Carl Zeiss, Inc., Thornwood, NY) Various antibodies/antisera were used to identify the specific cell types that express the vector VLSAIBAG in vivo. A polyclonal antisera against mouse macrophages (#-mac; Accurate Chemical and Scientific Corp., Westbury, NY), and a polyclonal antibody against the pro-peptide of human surfactant protein C (#-hpro-SP-C, Vorbroker et al, 1995) were used for immunohistochemical analysis on X-gal stained tissue sections. The basic method is as described (Watkins, 1989). For the #-mac antisera, normal goat immunoglobulin G (Rabbit IgG, Vector Laboratories, Inc., Burlingame, CA) was diluted to 12.5 µg/ml in 7% non-fat dry milk in PBS (milk/PBS) and incubated on the section for 10-30 minutes at room temp. Next, the primary antibody (polyclonal antibody/antisera) was diluted (1:300 dilution) in milk/PBS and placed on each section. Sections were incubated with the primary antibody overnight at 4oC. After incubation with the primary antibody, the sections were washed three times in PBS before the FITC-conjugated (fluorescein isothiocyanate) secondary antibody was applied to the sections. The secondary antibody was diluted 1:100 in milk/PBS and incubated on each section for 2.5-3.5 hours at room temperature in the dark. Finally, the slides were washed three times in PBS and coverslipped with Vectashieldtm (Vector Laboratories, Inc., Burlingame, CA) mounting medium. The slides were documented with an Olympus BH2 oil immersion

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, and Struhl K, eds. 1995. Current protocols in molecular biology. Wiley and Sons, New York. Barker DD, Wu H, Hartung S, Breindl M, Jaenisch R (1991) Retrovirus-induced insertional mutagenesis: mechanism of collagen mutation in mov13 mice. Mol. Cell. Biol. 11, 51545163. Besmer P, Olshevsky U, Baltimore D, Dolberg D, Fan H (1979) Virus-like 30S RNA in mouse cells. J. Virol. 29, 1168-1176. Bohm S (1991) Identification of protein-binding sequences mediating constitutive and 12-o-tetradecanoylphorbol-13acetate-induced VL30 transcription in cultured mouse and human keratinocytes. J. Biol. Chem. 266, 24834-24841. Brinster RL, Chen HY, Trumbauer M, Senear AW, Warren R, Palmiter RD ( 1981) Somatic expression of herpes thymidine kinase in mice following injection of a fusion gene into eggs. Cell 1, 223-31. Brown T and Mackey K (1997) Analysis of RNA by Northern and slot blot hybridization. Current Protocols in Molecular biology (F. M. Ausubel, R. Brent, R. Kingston, D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl, eds.), pp. 4.9.14.9.16, Wiley and Sons, Inc., New York, NY. Carter AT, Norton JD, Avery RJ (1983) A novel approach to cloning transcriptionally active retrovirus-like genetic elements from mouse cells. Nucleic Acids Res. 11, 62436454. Cepko C (1995) Preparation of a specific retrovirus producer cell line. Current Protocols in Molecular Biology (F. M. Ausubel,

Grunkemeyer et al: VL30 transgene expression

R. Brent, R. Kingston, D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl, eds.), 1995. pp. 9.10.1-9.10.13, Wiley and Sons, Inc., New York, NY.

Loh TP, Sievert LL and Scott RW (1988) Negative regulation of retrovirus expression in embryonal carcinoma cells mediated by an intragenic domain. J. Virol. 62, 4086-4095.

Chakraborty AK, Zink MA, Hodgson CP (1995) Expression of VL30 vectors in human cells that are targets for gene therapy. Biochem. Biophys. Res. Commun. 209, 677-683.

Matsuda Y, Harada YN, Natsuume-Sakai S, Lee K, Shiomi T, Chapman VM (1992) M. Location of the mouse complement factor H gene (cfh) by FISH analysis and replication R- lines is associated with methylation and dependent on its chromosomal position. Cytogen. Cell. Genet. 61, 282-285.

Chakraborty AK, Zink MA, Boman BM, Hodgson CP (1993) Synthetic retrotransposon vectors for gene therapy. FASEB J. 7, 971-977. Courtney MG, Schmidt LJ, Getz MJ (1982) Organization and expression of endogenous virus-like (VL30) DNA sequences in nontransformed and chemically transformed mouse embryo cells in culture. Cancer Res. 42, 569-576. Hoeben RC, Migchielsen AA, van der Jagt RC, van Ormondt H, van der Eb AJ (1991) Inactivation of the moloney murine leukemia virus long terminal repeat in murine fibroblast cell. J. Virol. 65, 904-912.

Nilsson M and Bohm S (1994) Inducible and cell type-specific expression of VL30 U3 subgroups correlate with their enhancer design. J. Virol. 68, 276-288. Norton JD and Hogan BLM (1988) Temporal and tissue-specific expression of distinct retrovirus-like (VL30) elements during mouse development. Devel. Biol.125, 226-228. Ohnishi K, Takagi M, Kurokawa Y, Satomi S, Konttinen YT (1998) Matrix metalloproteinase-mediated extracellular matrix protein degradation in human pulmonary emphysema. Lab. Invest. 78, 1077-1087. Palmiter RD, Chen HY and Brinster RL (1982) Differential regulation of metallothionine-thymidine kinase fusion genes in transgenic mice and their offspring. Cell 29, 701-710. Petersen R, Kempler G and Barklis E (1991) A stem cell-specific silencer in the primer-binding site of a retrovirus. Mol. Cell. Biol. 11, 1214-1221.

Hogan B, Beddington R, Costantini F and Lacy E (1994) Manipulating the mouse embryo, a laboratory manual, Second ed., Cold Spring Harbor Press, Plainview, NY. Howk RS, Troxler DH, Lowy D, Duesberg PH, Scolnick EM (1978). Identification of a 30S RNA with properties of a defective type c virus in murine cells. J. Virol. 25, 115-123. Jaenisch R (1976). Germ line integration and Mendelian transmission of the exogenous Moloney leukemia virus. Proc. Natl. Acad. Sci. 73, 1260-1264.

Price J, Turner D and Cepko C (1987) Lineage analysis in the vertebrate nervous system by retrovirus-mediated gene transfer. Proc. Natl. Acad. Sci. USA 84, 156-160.

Jahner D and Jaenisch R (1985) Retrovirus-induced de novo methylation of flanking host sequences correlates with gene inactivity. Nature 315, 594-597.

Robertson EJ, ed. Teratocarcinomas and embryonic stem cells: a practical approach. 1987. pp 71-151, IRL Press Limited, Oxford. Rodland KD, Jue SF and Magun BE (1986) Regulation of VL30 gene expression by activators of protein kinase C. J. Biol. Chem. 261, 5029-5033.

Jahner D, Stuhlmann H, Stewart CL, Harbers K, Lohler J, Simon I, Jaenisch R (1982) De novo methylation and expression of retroviral genomes during mouse embryogenesis. Nature 298, 623-628. Jang SK, Krausslich HG, Nicklin MJ, Duke GM, Palmenberg AC, Wimmer E (1988) A segment of the 5’ nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J. Virol. 62, 2636-2643.

Rodland KD, Muldoon LL, Dinh TH and Magun BE (1988) Independent transcriptional regulation of a single VL30 element by epidermal growth factor and activators of protein kinase C. Mol. Cell. Biol. 8, 2247-2250. Sanes JR, Rubenstein JLR, Nicolas JF (1986) Use of a recombinant retrovirus to study post-implantation cell lineage in mouse embryos. EMBO J. 5, 3133-3142.

Keshet E, Shaul Y, Kaminchik J, Aviv H (1980) Heterogeneity of ‘virus-like’ genes encoding retrovirus-associated 30S RNA and their organization within the mouse genome. Cell 20, 431-439. Lacy E, Roberts S, Evans EP, Burtenshaw MD, Costantini FD (1983) A foreign !-globin gene in transgenic mice: integration at abnormal chromosomal positions and expression in inappropriate tissues. Cell 34, 343-358. Lenormand P, Pribnow D, Rodland KD, Magun BE (1992) Identification of a novel enhancer element mediating calcium-dependent induction of gene expression in response to either epidermal growth factor or activation of protein kinase C. Mol. Cell. Biol. 12, 2793-2803. Linney E, Davis B, Overhauser J, Chao E, Fan H (1984) Nonfunction of a Moloney murine leukaemia virus regulatory sequence in F9 embryonal carcinoma cells. Nature 308, 470472. Loh TP, Sievert LL and Scott RW (1987) Proviral sequences that restrict retroviral expression in mouse embryonal carcinoma cells. Mol. Cell. Biol. 7, 3775-3784.

Scolnick EM, Vass WC, Howk RS, and Duesberg PH (1979) Defective retrovirus-like 30S RNA species of rat and mouse cells are infectious if packaged by type c helper virus. J. Virol. 29, 964-972. Si-Hoe SL and Murphy D (1999) Production of transgenic rodents by the microinjection of cloned DNA into fertilized one-cell eggs. Methods Mol. Biol. 97, 61-100. Takashi E, Hori T, O’Connell PO, Leppert M, and White R (1991) Mapping of the MYC gene to band 8p24.12-q24.13 by R-banding and distal to fra(8)(q24.11), FRA8E, by fluorescence in situ hybridization. Cytogen Cell Genet. 57, 109-111. Treisman J, Hwu P, Minamoto S, Shafer GE, Cowherd R, Morgan RA and Rosenberg SA (1995) Interleukin-2transduced lymphocytes grow in an autocrine fashion and remain responsive to antigen. Blood 85, 139-145. Vorbroker DK, Profitt SA, Nogee LM and Whitsett JA (1995) Aberrant processing of surfactant protein C (SP-C) in hereditary SP-B deficiency. Am. J. Physiol. 268, 647-656.

Gene Therapy and Molecular Biology Vol 6, page 99

Watkins S, (1989) Current Protocols in Molecular biology (Ausubel, R. M., Brent, R., Kingston, R., Moore, D.,

Seidman, J. G., Smith, J. A., and Struhl, K., eds.) 1989. pp. 14.6.1-14.6.13, Wiley and Sons, Inc., New York, NY..

Grunkemeyer et al: VL30 transgene expression

100

Gene Therapy and Molecular Biology Vol 6, page 101

Gene Ther Mol Biol Vol 6, 101-119, 2001

Cytokine gene transduced T cells in the treatment of allergic encephalomyelitis and airway hypersensitivity Research Article

Lizhen Chen1, Rosemarie DeKruyff4, Dale Umetsu4, Jae-Won Oh4, Jeanette Thorbecke1,3 and Gerald Hochwald2,* Depts. of 1Pathology and 2Neurology, 3Kaplan Comprehensive Cancer Center, NYU School of Medicine, New York, NY 10016 4

Division of Immunology and Transplantation Biology, Dept. of Pediatrics, Stanford University, Stanford, CA 94305

_________________________________________________________________________________________________ *Correspondence: Gerald Hochwald, Dept. of Neurology, New York University, School of Medicine, New York, NY 10016; FAX 212-2638211; e-mail: hochwg01@med.nyu.edu Supported by The National Multiple Sclerosis Society Grants #RG-2602A5 and RG3059A1. Key words: autoimmunity, cytokines, gene therapy, experimental allergic encephalomyelitis, Th1/Th2. Abbreviations: encephalomyelitis, (EAE); expiratory time, (Te); inflammatory bowel disease, (IBD); Keyhole limpet hemocyanin, (KLH); latency associated protein, (LAP); myelin basic protein, (MBP); ovalbumin, (OVA); peak expiratory flow, (PEF); plasminogen activator inhibitor-1, (PAI-1); proteolipid protein, (PLP); relaxation time, (RT); spleen, (spl); Staphylococcus enterotoxin B, (SEB) Received: 20 July 2001; accepted: 10 August 2001; electronically published: February 2004

Summary TGF-!1 or IL-10 transduced myelin basic protein (MBP)-specific BALB/c cloned Th1 cells were injected into SJL x BALB/c F1 mice 11-15 days after immunization with proteolipid protein to induce EAE. TGF-!1/MBP T cells significantly ameliorated the EAE, while IL-10/MBP T cells were less effective. TGF-!1 transduced ovalbumin (OVA)-specific Th1 clones did not influence EAE, even when re-activated by OVA in vivo. However, TGF-!1/OVA T cells did protect against OVA-specific Th2-cell mediated airway hyper-reactivity induced by inhaled OVA. TGF!1/KLH T cells did not prevent OVA-induced airway hyper-reactivity in mice sensitized and challenged with OVA alone, but did protect mice challenged with KLH + OVA. Thus, the antigen specificity of the Th1 cells allows sitespecific delivery of therapeutic TGF-!1 to both Th1 and Th2 cell-mediated inflammatory infiltrates. EAE relapses, induced by bacterial superantigen or endotoxin within 2 weeks, but not >6 weeks, after transfer of TGF-!1 or IL10/MBP T cells, were reduced. Relapses induced 5 weeks after immunization with PLP could be prevented by simultaneously injected TGF-!1/MBP cells. Spinal cords taken 12-50 days after TGF-!1/MBP cells contained TGF!1 cDNA. Spinal cords from the majority of mice receiving IL-10/MBP cells contained IL-10 cDNA up to 2 weeks, but not 50 days after cell transfer. Thus, TGF-!1-transduced T cells may be useful in the therapy of autoimmune and allergic inflammatory diseases, but in the EAE model, the same approach with IL-10-transduced T cells appears less effective. induced prior to induction of the experimental autoimmune disorder by mucosal or systemic exposure to auto-antigens (Karpus and Swanborg, 1991; Khoury et al, 1992), or may be present spontaneously and expanded during the course of the disease. In the latter case, spontaneous recovery from an initial disease episode and subsequent resistance to reinduction of the disease is

I. Introduction Resistance to the induction of experimental autoimmune diseases, such as allergic encephalomyelitis (EAE), inflammatory bowel disease (IBD) and collagen induced arthritis (CIA), is often attributed to the presence of immune-regulatory T cells. Such T cells may either be

101

Chen et al: T cells in allergic encephalomyelitis

attributed to the expansion of these immune-regulatory T cells (Ellerman et al, 1988; Kumar and Sercarz, 1993). One of the mechanisms by which such T cells are thought to curb inflammatory lesions characteristic of these autoimmune diseases is by producing and inducing antiinflammatory cytokines, among which TGF-!, IL-10 and IL-4 have been implicated as very important. Indeed, under certain conditions, neutralization of these cytokines aggravates autoimmune diseases and/or interferes with the activity of immune-regulatory T cells (Kuruvilla et al, 1991; Racke et al, 1992; Johns and Sriram, 1993; Santambrogio et al, 1993; Santos et al, 1994; Stevens et al, 1994; Crisi et al, 1995, 1996; Powrie et al, 1996; Burkhart et al, 1999; Stohlman et al, 1999). Administration of TGF-!, IL-10 or IL-4, however, only partially protects against autoimmunity. Treatment with active TGF-! is most effective when given during the latter part of the induction phase of EAE (Santambrogio et al, 1993) or CIA (Thorbecke et al, 1992), or at the time of passive induction of EAE with myelin protein-sensitized T cells (Racke et al, 1991; Stevens et al, 1994). This cytokine can also prevent the occurrence of relapses from EAE (Racke et al, 1993; Santambrogio et al, 1993). However, TGF-! cannot cause recovery from EAE or CIA, once the disease has developed. It is of interest that TGF-!1-/- and TGF-!RII-/- mice exhibit generalized and fatal T lymphocyte infiltrations in various organs (Diebold et al, 1995; Gorelik and Flavell, 2000). This indicates that TGF-!1 is a cytokine with significant anti-inflammatory and immunosuppressive properties, a key regulator in the maintenance of immunological homeostasis. Injections of IL-4 or IL-10 are even less effective in modulating autoimmune diseases. These cytokines are reported to have either no effect or to offer protection only when administered early during disease induction (Rott et al, 1994; Santambrogio et al, 1995; Cannella et al, 1996). However, IL-10 knockout (IL-10-/-) mice are very susceptible to induction of EAE, developing a more severe and persistent form of EAE than do IL-4-/- or wild-type mice (Bettelli et al, 1998; Samoilova et al, 1998). Moreover, IL-10 transgenic mice are resistant (Bettelli et al, 1998; Cua et al, 1999), while IL-4 transgenic and wild type mice are equally susceptible to induction of the disease. Treatment with IL-10, particularly when administered via the nasal route early during the induction of EAE decreases the severity of the disease (Xiao et al, 1998), but no such effect is observed when administration of IL-10 is delayed until after the initial induction phase or when it is given with sensitized T-cells, at the time of adoptive transfer of EAE (Rott et al, 1994; Nagelkerken et al, 1997). Similarly, neutralization of IL-10 in IL-10 transgenic mice prior to immunization with myelin proteins is needed to completely abolish the resistance of IL-10 transgenic mice to EAE (Cua et al, 1999). Thus, it seems that IL-10 may prevent the sensitization of encephalitogenic T-cells, but that it cannot reverse T-cell sensitization and EAE symptoms. It has also been shown

that the local administration of the cDNA encoding viral IL-10 into knee-joints of rabbits can reduce the inflammatory lesions provoked by the intra-articular injection of ovalbumin into ovalbumin pre-sensitized animals (Lechman et al, 1999). T cells from multiple sclerosis patients reportedly produce less TGF-!1 in culture than do T cells from normal individuals (Mokhtarian et al, 1994). If TGF-! producing T cells are important in the curtailment of autoimmunity, as also suggested by the observations on TGF-!-/- mice (Diebold et al, 1995), treatment with autoreactive T cells which have been engineered to produce excess TGF- ! might be beneficial. To determine whether auto-reactive T cells which produce IL-10 or TGF-!1 are capable of down-regulating autoimmune disease, we have artificially increased the ability of myelin basic protein (MBP)-specific BALB/c cloned T cells to produce either IL-10 or latent TGF-!1 by transducing them with a recombinant retrovirus engineered to contain the cDNA for one of these cytokines. In previous studies (Chen et al, 1998), we showed that TGF-!1-transduced myelin basic protein (MBP)-specific T cells lose the capacity to provoke EAE in BALB/c mice, and gain instead the ability to protect against EAE, induced in (SJL x BALB/c) F1 mice by immunization with proteolipid protein (PLP). In similar studies on EAE with IL-4 transduced T hybridoma cells (Shaw et al, 1997) and IL-10 transduced T cells (Mathisen et al, 1997) protective effects were also reported. In the latter report, the transduced T cell clone also showed a high level of endogenous IL-10 production, and was not examined for production of other cytokines. It is therefore not certain whether or not the human IL-10, used for the transduction of these cells, was responsible for the protective effect against EAE. Most of the autoimmune diseases for which a protective role for immunosuppressive cytokines, such as TGF-! and IL-10, has been described are Th1 cell mediated diseases. To determine whether typical Th2 cell induced inflammatory diseases, such as airway hyperreactivity or asthma, are also down regulated by these cytokines, a similar approach was used in an animal model for asthma. TGF-!1-transduced OVA-specific Th1 cells were found to protect against OVA-specific Th2 cellinduced airway hyper-reactivity (Hansen et al, 2000). Thus, use is made of the migratory properties of antigenspecific activated cloned T cells to obtain enhanced local production of an immune-regulatory cytokine within inflammatory infiltrates, and thereby ameliorate the inflammation. In the present study, a comparison was made of the relative effectiveness of IL-10 and TGF-!1 transduced MBP-specific T cells in protecting against EAE and relapses of EAE induced by bacterial superantigen or lipopolysaccharide. In addition, the requirement for antigen specificity in exerting protection was further examined for TGF-!1 transduced T cells in both the mouse model of asthma and in EAE.

102

Gene Therapy and Molecular Biology Vol 6, page 103

Table 1 CYTOKINE PRODUCTION BY TRANSDUCED TH1 CELLS

Cells Tested

TGF-!1 (ng/ml)*

IL-10 (ng/ml)**

--------------------------------------

---------------------------------

--------------------------------

Untransduced MBP/Th1

0.037

< 0.03

TGF-!1 Transduced MBP/Th1

2.3

IL-10 Transduced MBP/Th1

3.0

TGF-!1 Transduced KLH/Th1

3.5

TGF-!1 Transduced OVA/Th1

3.6

* TGF-!1 content of media collected after 24 h of culture of 106 cloned T cells/ml. The medium was supplemented with 1% Nutridoma and contained no serum. ELISA was used to assay the TGF-!1 after activation with acid. No active TGF-! was detected when the activation step was omitted. ** IL-10 contents as assayed by ELISA on culture fluids from 10 6 cells/ml, incubated for 24 h in ISCOVEâ&#x20AC;&#x2122;s medium with 10% fetal calf serum. The assay was performed a few times during the course of these experiments with similar results (range of 1.1-3 ng/ml), suggesting that the rate of IL-10 production did not vary significantly.

increase in TGF-!1 mRNA. The results obtained with the other set of cytokine probes showed an absence of mRNA for IL-4, IL-5, IL-6 or IL-10 before and after transduction in the TGF-!1 transduced clone (Chen et al, 1998). The IL-10 transduced clone was examined similarly. Again, no difference in the representation of mRNA for any of the other cytokines was found, even after prolonged propagation of these IL-10 transduced Th1 cells, but a marked increase in the mRNA for IL-10 was seen (data not shown). The transduced MBP-specific T cells were also characterized with respect to their ability to proliferate in response to antigen (MBP peptide 59-76) in vitro. For both TGF-!1/MBP and IL-10/MBP cells, the dilution of carboxy fluorescein diacetate (succinimidyl ester, CFSE (Lyons and Parish, 1994)) used as label was similar to that in control (untransduced) cells over a period of 3 days in culture after exposure to MBP, and the incorporation of 3 H-thymidine at the end of the 3-day culture period was also comparable to that in control cells (data not shown).

II. Results A. Characterization of transduced T cell clones Transduced T cell clones were identified by the presence of cDNA for latent TGF-!1 or IL-10 as determined by PCR. TGF-!1 or IL-10 transduced and untransduced T cell clones were then compared with respect to their ability to produce the relevant cytokine. Acid treated and untreated serum-free tissue culture medium from antigen activated and resting TGF-! transduced and control T cell clones (106 cells/ml, 24 h at 37Â°C) were analyzed for latent and active TGF-!1 contents, respectively. All three of the latent TGF-!1 transduced clones, MBP-, OVA-, and KLH-specific T cells, exhibited 1.5-4 ng/ml of latent TGF-! in their supernatants, whether or not they had been activated by antigen (Table 1). Supernatants from untransduced T cell clones showed barely detectable amounts of TGF-!1 above the serum-free medium background (< 0.1 ng). Serum containing supernatants from untransduced T cells contained <0.05 ng of IL-10 per ml, while the supernatants from IL-10 transduced T cells contained 1.05-3.0 ng/ml. To determine whether the production of latent TGF!1 caused a change in the cytokine pattern produced by the MBP-specific T cell clone, a ribonuclease protection assay was performed on RNA prepared from the untransduced and the TGF-!1-transduced MBP-specific T cell clone 2-3 days after activation of the cells by antigen, using two sets of cytokine probes. The mRNA distribution for LT", LT!, TNF-", IFN-#, TGF-!2, TGF-!3 and MIF, expressed as a percentage of mRNA for the housekeeping gene, GAPDH, was the same for the untransduced and transduced clones. However, transduction caused an

B. Comparisons of TGF-! and IL-10 transduced MBP specific T cells in vivo In previous work we showed that TGF-!1 transduced MBP-specific T cells were able to ameliorate the course of actively induced EAE when transferred approximately at the time of first appearance of disease symptoms, i.e. 1115 days after immunization with PLP in CFA. In order to compare the effects of IL-10/MBP and TGF-!1/MBP T cells, both transduced cells from the same original Th1 clone were activated in vitro by exposure to MBP and then injected into SJL x BALB/c mice, 11-13 days after the mice had been immunized with PLP in CFA. The results in Figure 1A show that there was an immediate effect of

103

Chen et al: T cells in allergic encephalomyelitis

the TGF-!1 transduced cells, such that the severity of EAE that had already developed in these recipients did not increase any further. In contrast, both groups of mice that either received no cells or IL-10 transduced T cells showed a marked increase in EAE severity until day 15. In this experiment there was no protective effect of the IL-10 transduced cells, but in a repeat of this experiment (Figure 1B), the severity of EAE in the mice receiving no cells remained higher between days 16 and 21 than in the mice receiving IL-10 transduced T cells, although this effect was not statistically significant. It should also be noted that untransduced T cells caused a significant increase in severity of EAE symptoms between days 14 and 16, which

was not seen in recipients of IL-10 transduced cells, indicating that the augmented production of IL-10 in these cells prevented them from increasing the severity of the EAE. It was possible that the IL-10/MBP T cells did not reverse EAE because they failed to enter the CNS and/or failed to proliferate locally. We, therefore, analyzed recipients' spinal cords and lymphoid tissue to determine whether cDNA for IL-10 could be detected. The results in Figure 2 show that, indeed, IL-10 cDNA was detectable in the spinal cord of the majority of recipients killed during the first two weeks, but could no longer be detected 50 days after T cell transfer.

Figure 1. Effect of IL-10 and TGF-! transduced and untransduced MBP-specific cloned Th1 cells on EAE severity. SJL x BALB/c F1 mice were immunized with PLP peptide (139-151) in CFA on day 0. On day 12, 3 x 106 Th1 cells were injected iv. A): Comparison of IL-10 and TGF-! transduced cells. !$! No cell control (n=14); "---" IL-10/MBP Th1 (n=15); #---# TGF-!/MBP Th1 (n=15). Statistical significance (Student T test):* p<0.05; ** p<0.01; *** p<0.001. B): Comparison of IL-10 transduced and untransduced cells. !$! No cell control, n=4; "---" IL-10/MBP Th1 (n=4); $---$ Untransduced MBP Th1 cells (n=4).

104

Gene Therapy and Molecular Biology Vol 6, page 105

Figure 2 . Detection of cDNA of TGF-!1 or IL-10 in spinal cords from mice receiving transduced Th1 cells after induction of EAE. Total DNA was extracted from the spinal cords of mice at different intervals after IL-10/MBP or TGF-!1/MBP T cells had been injected. PCR was used to identify the IL-10 or TGF-! cDNA in the total DNA from individual spinal cords. A) Percentage of mice in which cDNA could be detected in spinal cord at different intervals upon cell transfer on day 11-15 after induction of EAE. !$! IL10/MBP T cells (n=18); #---# TGF-!1/MBP T cells (n=28). B) Percentage of mice in which cDNA could be detected in spinal cord at different intervals upon cell transfer on day 34 after induction of EAE (at time of LPS injection). !$! IL-10/MBP T cells (n=9); %---% TGF-!1/MBP T cells (n=9). C) Typical PCR products found in DNA from spinal cord (sc), but not in DNA from spleen (spl) at various days after T cell transfer (D11, 15, 50).

105

Chen et al: T cells in allergic encephalomyelitis

Figure 3. TGF-! transduced ovalbumin (OVA) specific T cells have no inhibitory effect on EAE development, even when the cells are reactivated in vivo by injection of OVA iv. &$& TGF-!1/OVA Th1 cells on day 11, followed by iv injection of 50 µg of OVA (n=4); !$! Injection of 50 µg OVA alone on day 11 (n=4).

In contrast, the majority of mice receiving TGF!1/MBP cells still had detectable cDNA for that cytokine in their spinal cords at 6 weeks after transfer. Thereafter, however, TGF-!1 cDNA also became undetectable. Neither cDNA was detectable in lymphoid tissue (spleen) either early or late after T cell transfer. Thus, a relatively effective accumulation of the transduced cells in the CNS occurred followed by their gradual disappearance.

Figure 3, there was no effect from these OVA specific T cells, whether the mice were injected with OVA or not (not shown). Since the TGF-!1/MBP T cells enter the CNS, it is possible that the continued local stimulation in the spinal cord within local inflammatory lesions allows for activation of the latent TGF-!1 that they produce constitutively. However, in the EAE model, it is impossible to provide T cells of other specificities such as OVA or KLH with the antigen to which they respond locally within the CNS. The aspect of bystander effect was therefore further analyzed in the model of airway hyperreactivity, where local exposure to any antigen can readily be performed by adding that antigen to the challenge inhalation. Indeed, when KLH was added to the OVA used for the challenge inhalation, TGF-!1/KLH Th1 cells could protect against airway hyper-reactivity in mice immunized to OVA (Figure 4A), although they were still less effective than TGF-!1/OVA Th1 cells (Figure 4B).

C. Requirement for antigen specificity of TGF-!1 transduced T cells We previously showed that, in order for TGF-!1 transduced T cells to have a protective effect against EAE development, they had to be specific for a myelin antigen (Chen et al, 1998). TGF-!1 transduced KLH or OVA specific Th1 cells did not have such an effect. Similarly, in the experiments on airway hyper-reactivity induced by OVA, TGF-!1/OVA cells protected but TGF-!1/KLH cells did not. In the present study, we analyzed this requirement for antigen specificity in more detail. In the experiments on EAE, in addition to exposing the T cells in vitro to the relevant antigen (OVA) a few days prior to transfer, we also injected the recipients on day 14 with 100 µg OVA ip to obtain additional activation of these cells in the mice. However, as can be seen from the results in

106

Gene Therapy and Molecular Biology Vol 6, page 107

Figure 4. A protective effect of TGF-!1/KLH Th1 cells against OVA induced airway hyper-reactivity can be obtained if KLH is added to the challenge inhalation of antigen. BALB/c mice were immunized with OVA i.p. (50 µg) complexed with alum on day 1, and challenged intranasally on days 7, 8 and 9 with either 50 µg OVA alone or with 25 µg KLH + 50 µg OVA. A): !$! TGF!1/KLH Th1 cells + OVA alone; $---$ No cells + OVA; %---% No cells + OVA and KLH; O---O TGF!1/KLH Th1 cells + OVA and KLH, * p vs TGF!1/KLH cells + OVA alone <0.05 (n=3); B): %$% No cells + KLH; !$! No cells + OVA; $$$ TGF-!1/OVA Th1 cells + KLH; O$O TGF-!1/OVA Th1 cells + OVA, ** p vs TGF!1/OVA cells + KLH <0.01 (n = 3).

107

Chen et al: T cells in allergic encephalomyelitis

Figure 5: Anti-TGF-! mAb (2G7, 0.5 mg/mouse, ip), injected on the same day as the T cells (day 13) reduces the inhibitory effects of TGF-! MBP cells on EAE development. !$! No cells control (n=6); $$$ TGF-! 1/MBP Th1 cells with anti-TGF-! mAb (n=6); O$O TGF-! 1/MBP Th1 cells alone (n=5).

Table 2 EFFECT OF TGF-!1/MBP T CELLS ON EAE RELAPSE INCIDENCE INDUCED BY SEB OR LPS

Expt. # 1

2 2

TGF-!/MBP-Specific

Relapse Induced With

EAE Relapse Incidence*

T Cells Injected

SEB or LPS

Day 13 (after PLP in CFA)

SEB on Day 26

0/11

None

SEB on Day 26

3/8

Day 12 (after PLP in CFA)

SEB on Day 58

5/10

None

SEB on Day 58

11/14

Day 12 (after PLP in CFA)

LPS on Day 70

7/9

None

LPS on Day 70

9/13

* Mice were considered to have relapsed when their disease incidence had increased by 0.5 or more for at least two consecutive readings within 3 days after injection of the SEB or LPS.

D. Influence of IL-10 and TGF-!1 transduced T cells on sensitivity to induction of EAE relapses.

symptoms, relapses, in mice recovering from an initial EAE episode. These relapses may resemble very much the relapsing and remitting form of multiple sclerosis in man. Such mice provide, therefore, an excellent opportunity for the study of the effect of therapeutic measures.

It is known that both bacterial superantigens, such as SEB, and TNF-" induce temporary increases in EAE

108

Gene Therapy and Molecular Biology Vol 6, page 109

mice in this experiment received an injection of SEB ip. The incidence of relapses in control mice under such circumstances was previously shown to be ~50% (Crisi et al, 1995). In the experiment shown in Table 2, 3 out of 8 control mice relapsed, and 0 out of 11 in the TGF-!1/MBP T cell treated mice, indicating that recipients of TGF!1/MBP T cells were protected from SEB-induced relapse at this time In another experiment, the SEB injection was given much later after recovery from EAE, i.e., 6-7 weeks after T cell transfer. The results in Figure 6A show that the EAE severity in the control (no T cells) group had recovered to a mean of ~1.3, while barely any remaining disease was seen in the TGF-!1/MBP T cell treated recipients. Nevertheless, on injection of SEB, relapses of similar incidence (Table 2) and severity (Figure 6A) were induced in both groups.

E. SEB-induced EAE relapses The effect of TGF-!1/MBP T cells on SEB-induced relapses was first investigated. Since the severity of the initial EAE episode might influence the relapse rate, we compared control mice receiving no T cells with mice receiving both TGF-!1/MBP T cells and anti-TGF-!1, a mAb that at least temporarily neutralizes the protective effect of the TGF-!1/MBP T cells. Similar to the previously used specific anti-TGF-!1 (4A11) (Chen et al, 1998), the mAb that neutralizes all three TGF-!s (2G7) prevented the protective effect of the T cells seen immediately after transfer. A single injection at the time of TGF-!1/MBP T cell administration partially transiently reversed the protective effect of the T cells, but the protection by the T cells became significant again after the effect of the mAb wore off and the EAE severity in this group of mice became like that of the mice receiving the T cells alone (Figure 5). Two weeks after T cell transfer, the

Figure 6. Comparison of the effects of IL-10 and TGF-!1/MBP T cells on SEB and LPS induced EAE relapses. A): T cells were injected 12 days after immunization with PLP and the mice treated with anti-TGF-! mAb as described for Figure 5. SEB (0.5 µg /mouse, ip) and LPS (1 µg/mouse, ip) were given 45 and 56 days after T cell transfer, respectively. O$O No cell control (n=13); !$! TGF-!1/MBP Th1 cells (n=10). B): TGF-!1/MBP Th1 cells were injected 11 days after PLP in CFA. LPS (1 µg/mouse, ip) was injected 10 days after cell transfer. !$! No cell control (n=5); %$% IL-10/MBP Th1 cells (n=5); #$# TGF-!1/MBP Th1 cells (n=5).* Statistically different from control (no cells) group, p<0.05.

109

Chen et al: T cells in allergic encephalomyelitis

Figure 7. Effect on LPS induced EAE relapses of IL-10 or TGF-!1/MBP Th1 cells injected 5 weeks after induction of EAE. After partial recovery from EAE, mice were injected on day 34 with LPS (1 µg, ip) and with 3 x 106 cytokine transduced MBP Th1 cells. On day 42, all the mice were again injected with LPS (5 µg, ip). '$' No cells (n=8); #$# IL-10/MBP T cells (n=8); %$% TGF-!1/MBP T cells (n=8); !$! Mice prior to injections of T cells (n=24). Statistical significance: * p<0.05; ** p<0.01; *** p<0.001, compared to mice not injected with T cells.

groups and failed to show a significant effect after LPS injection (Figure 6B and Table 2). An additional group of mice received both IL-10/MBP and TGF-!1/MBP T cells, but the protective effects of these combined transduced T cells were not additive (not shown). In the experiment shown in Figure 6A, LPS was injected 8 weeks after T cell transfer. As seen in Table 2 and in Figure 6A, under these conditions LPS induced similar relapses in control and TGF-!1/MBP T cells treated mice. Thus, in these mice, in which cDNA for TGF-!1 could no longer be detected in spinal cords (Figure 2), there was no protection against EAE relapses. In an additional experiment, shown in Figure 7, TGF-!1/MBP or IL-10/MBP T cells were injected at the same time as LPS into mice that had partially recovered from PLP induced EAE. Cells (2x106, iv) and LPS (1 µg, ip) were injected on day 34 after immunization with PLP in CFA. A second injection of LPS (5 µg) was given 1 week later. In the control group, each injection of LPS induced a slight increase in the EAE score, which lasted only a few days. In the mice receiving TGF-!1 transduced cells, no relapse of the EAE could be detected. In the mice receiving IL-10 transduced T cells, the EAE relapses were somewhat less marked than in the control mice. The

F. LPS induced EAE relapses In previous studies, we have shown that TNF-" induced relapses were prevented by injection of IL-10, while SEB induced relapses were more effectively prevented by TGF-! injections (Crisi et al, 1995). Since gram negative bacterial endotoxin, LPS, induces the rapid release of TNF-", we studied the effect of IL-10/MBP and TGF-!1/MBP T cells on the incidence and severity of EAE relapses induced by LPS. As can be seen from the results in Figure 6B and in Table 2, LPS (1 µg), injected on day 21 after immunization with PLP in CFA (or 10 days after transduced T cell transfer), caused an exacerbation of EAE severity in control (no T cells) mice. In this experiment the overall EAE severity was somewhat greater and the rate of recovery somewhat slower than in most other experiments. An additional group that received untransduced MBP specific T cells (not shown) had a slightly higher severity of EAE than the no T cell control and all of these mice died after injection of LPS. At the time of LPS injection, recipients of IL-10/MBP T cells were beginning to show a somewhat lowerEAE severity than the controls and the effect of LPS was minimal (Figure 6B and Table 2). The TGF-!1/MBP T cell recipients had significantly less disease than the other

110

Gene Therapy and Molecular Biology Vol 6, page 111

recovery after day 45 was accelerated in both the transduced T cell-treated as compared to the control group of mice (Figure 7). On day 9-16 after cell transfer, the cDNA of the transduced cytokine was detectable in the spinal cord of a large percentage of the mice receiving TGF-!1/MBP cells and again a somewhat lower percentage of the mice receiving IL-10/MBP cells (Figure 2B). These results show that TGF-!1/MBP T cells can enter the CNS and protect against exacerbations of EAE, even when given late during the course of the disease.

Lodge and Sriram, 1996); 4) cytokine enhanced class II MHC expression (Epstein et al, 1991); and 5) migration of T cells into the CNS (Santambrogio et al, 1993; Fabry et al, 1995). TGF-! induces the synthesis of IL-10 by macrophages (Maeda et al, 1995; Kitani et al, 2000), but the present results suggest that this is unlikely to be the mechanism by which TGF-!1/MBP T cells protect against EAE, since IL-10/MBP T cells are less effective. TGF-! also stimulates its own production (Fiorelli et al, 1994) and, therefore, a few TGF-!1/MBP T cells retained in an infiltrate on the basis of their specificity for myelin protein, may cause oligodendrocytes and macrophages in their vicinity to produce more TGF-!. An additional mechanism by which TGF-! may influence autoimmunity is through the promotion of immunoregulatory CD8+ T cell development (Quere and Thorbecke, 1990; Rich et al, 1995; Powrie et al, 1996; Thorbecke et al, 1999). The primary mechanism by which IL-10 protects against the development of autoimmune diseases, such as CIA, is thought to be through inhibition of the production of pro-inflammatory cytokines such as TNF-", IL-1 and IL-6 (Walmsley et al, 1996; Kim et al, 2000) and of chemokines, such as MIP-1" and MIP-2 (Kasama et al, 1995). Moreover, IL-10 directs T cells away from harmful Th1 responses and associated IgG2a antibody formation, into the direction of Th2 (Kim et al, 2000; Stevens et al, 1988). Indeed, the resistance of IL-10 transgenic mice to induction of EAE is attributed to the inhibition of Th1 responses in such mice (Cua et al, 1999). Similar to TGF!, IL-10 counteracts the activation of macrophages and in this respect synergizes with TGF-! (Oswald et al, 1992). In contrast to TGF-!, however, IL-10 fails to inhibit NO production by macrophages induced by an extraneous source of TNF-" (Bogdan et al, 1991; Corradin et al, 1993). Both cytokines counteract the upregulation of class II MHC and of FASL expression by IFN-# (de Waal Malefyt et al, 1991; Epstein et al, 1991; Arnold et al, 1999), and inhibit the expression of contact sensitization in sensitized mice (Epstein et al, 1991; Ferguson et al, 1994). It is, therefore, not immediately clear why TGF!1/MBP T cells are much more effective in our model of EAE than IL-10/MBP T cells, and why the effects of these cells given simultaneously are not additive. Neither of the transduced cloned T cells has been affected in its ability to proliferate in response to MBP, and both are detectable in spinal cords after transfer, although the persistence of the IL-10/MBP cells is somewhat shorter. In the airway hyper-reactivity model, transfer of OVA-specific IL-10transduced T cells results in pronounced inhibition of airway hyper-reactivity (Oh et al, unpublished observations). The differences in the effectiveness of OVA-transduced cells in these systems may reflect differences in the effects of IL-10 on the Th2 effector cells mediating the airway hyper-reactivity vs the Th1 cells mediating EAE, or in the effects of IL-10 on APCs in the two sites. Another possibility is that the IL-10 produced by the transduced T cells inhibits antigen presentation (van

III. Discussion The present results confirm our previous findings (Chen et al, 1998) that latent TGF-!1 transduced MBPspecific Th1 cells protect against PLP-induced EAE in (SJL x BALB/c) F1 mice, even when injected shortly after the onset of disease. When left untransduced, the same Th1 cells slightly increase the severity of actively induced EAE (Chen et al, 1998), and induce adoptive EAE in BALB/c mice (Abromson-Leeman et al, 1995). It should be noted that PLP in CFA was used for the induction of EAE, so as to avoid having MBP depots present in any other sites of the body, possibly detaining MBP-specific T cells from reaching the CNS (Chen et al, 1998). Clearly, the only difference between the transduced and the untransduced cloned T cells is the enhanced production of TGF-!1. The transduced cells remain Th1, because they produce mRNA for TNF, LT", LT! and IFN-#, and not for IL-4 or IL-10 (Chen et al, 1998). Even though this Th1 cytokine profile is unaltered after transduction with TGF-!1, the cells lose their capacity to aggravate EAE in the recipients, and instead significantly ameliorate the development of EAE. Therefore, the functional properties of these cells in vivo have been changed by the engineered production of latent TGF-!1. In both EAE and experimental asthma, the protective effect of TGF-!1 transduced T cells is abrogated by the simultaneous injection of neutralizing anti-TGF-!, which only interacts with active TGF-! (Chen et al, 1998; Hansen et al, 2000). It should be noted that, under normal conditions, most cells including T cells only produce latent TGF-!, i.e., TGF-! from which the latency associated protein (LAP) must be removed to uncover the receptor binding region before it exerts any biological activity (Wakefield et al, 1988). In inflammatory infiltrates this most likely occurs by enzymes such as plasmin and/or acidification in macrophages (Nunes et al, 1995; Godar et al, 1999). In addition, several other proteins have been shown to be capable of removing the LAP from TGF-!, such as thrombospondulin (Ribeiro et al, 1999) and the integrin "v!6 (Munger et al, 1999). TGF-! may affect autoimmune disease through down regulation of: 1) TNF-" and LT production (Espevik et al, 1987; Stevens et al, 1994); 2) responses to IL-12 (Pardoux et al, 1997); 3) macrophage and microglia activation (Nelson et al, 1991; Vodovotz et al, 1993;

111

Chen et al: T cells in allergic encephalomyelitis

der Veen and Stohlman, 1993; Frei et al, 1994; de Vries, 1995) to themselves in vivo, resulting in a reduced proliferation of these T cells which affects their performance in the more chronic situation of the EAE model, but is less important in acute airway hyperreactivity. It has been reported that, unlike TGF-!, IL-10 also has immune-stimulating effects on CD8 T cells (Chen and Zlotnik, 1991; Balasa et al, 1998; Groux et al, 1999) and B cells (Briere et al, 1993). Moreover, while IL-10 inhibits pro-inflammatory cytokine production in macrophages, it does not affect endothelial cells (Sironi et al, 1993) or dendritic cells from rheumatoid synovial fluid (MacDonald et al, 1999). It is possible that the greater inhibition of NO production exerted by TGF-!1 is of importance, as NO has been linked to damage of the CNS in EAE in various studies (Lin et al, 1993; Okuda et al, 1995; Waldburger et al, 1996). It should also noted that in transgenic mice, IL-10 expressed under control of an MHC class II promoter causes enhanced susceptibility to Leishmania infection, while IL-10 expressed only in T cells does not have this effect (Groux et al, 1999). In this respect it is perhaps relevant that in the present studies, the enhanced cytokine production is only in a small population of transferred T cells. While the transduced cytokines, latent TGF-B1 and IL-10, were produced by the T cells to approximately the same levels (in ng amounts), it is not sure what the effective concentrations required in vivo might be for each of these cytokines, or how much of the latent TGF-!1 produced by the cells becomes activated at the sites where it exerts its effect. We have not been able to obtain a higher production of IL-10 in the T cells. In view of the consideration that clinical application of transduced T-cell therapy in humans would have to be performed after initiation of disease, the possibility of affecting relapses of EAE was also investigated in these studies. The relapses studied here were induced by injection of TNF-" and IFN-# inducing agents, which may mimic clinical situations in which relapses of demyelinating disease are known to occur, such as during infections (Edwards et al, 1998; Metz et al, 1998). Both SEB and LPS induce a burst of TNF-" production and, although unlike IL-10, TGF-! cannot overcome the effects of injected TNF-", TGF-! does inhibit TNF-" production (Espevik et al, 1987), which may be an important aspect of the inhibitory effect on these relapses. SEB, in addition, stimulates V!3 and V!8 T cells (Marrack and Kappler, 1990), and causes production of large amounts of T cell cytokines. In previous studies on EAE with injected cytokines, we found that IL-10 protected against TNF-" induced relapses, while TGF-! was more effective against SEB induced relapses (Crisi et al, 1995). In the present study, TGF-!1/MBP T cells prevent both the SEB- and LPSinduced increments in EAE scores, and both IL-10/MBP and TGF-!1/MBP T cells ameliorate EAE relapses induced by injection of LPS during the interval when the

transduced T cells are still detectable in the CNS. More importantly, injection of the MBP-specific T cells at the time of the induction of the EAE relapse also results in significant protection, particularly by the TGF-!1 transduced cells. It is of interest that, even though TGF-!1 producing cells are known to be relatively abundant in mucosal linings in the lung (Magnan et al, 1997; Vignola et al, 1997), injection of TGF-!1/OVA T cells nevertheless significantly protects against the local inflammatory responses accompanying airway hyper-reactivity (Hansen et al, 2000). Apparently, a protective effect can only be obtained with these transduced T cells if they localize at the site of the inflammation. In the EAE model, this can only be obtained with T cells specific for a myelin component and activated in vitro prior to cell transfer. It has been shown that activated T cells which penetrate the blood-brain-barrier during EAE have upregulated adhesion molecules on their surfaces, such as VLA-4 and LFA-1, and that the presence of adhesion molecules on cloned T cells influences their capacity to transfer EAE to recipient mice (Kuchroo et al, 1993; Barten et al, 1995). In addition, contact of microvascular endothelial cells with activated T cells causes the enhancement of VCAM-1 and ICAM-1 expression on the endothelial cells (Lou et al, 1996). Thus, antigen stimulation of MBP-specific T cells is needed before they can either transfer EAE (Kuchroo et al, 1993) or protect against EAE, when transduced with TGF-! (Chen et al, 1998). It is somewhat surprising that activated T cells of unrelated specificity (KLH or OVA), with the numbers of cells used in the present study, cannot protect against EAE, even though they produce large amounts of latent TGF-! in vitro. In previous experiments it was shown that the TGF-! cDNA from OVA/TGF-!1 cells was barely detectable in the spinal cord 12 days after cell transfer (Chen et al, 1998). The results suggest that, in the absence of specific antigen within the CNS, T cell numbers, proliferation and/or continued localization within infiltrates during the course of the EAE must have been insufficient when compared to those of MBP-specific cells. In the asthma model, however, the accumulation in the lung of T cells of any specificity can be obtained by allowing the mice to inhale the relevant antigen (Tsuyuki et al, 1997). Therefore, while there is no protective effect of TGF-!1/KLH cells against airway hyperreactivity in OVA sensitized and challenged mice, partial protection with such cells is obtained in mice sensitized by inhalation of OVA alone and challenged with OVA + KLH. Prolonged systemic treatment with active TGF-! is contraindicated in patients, because it induces liver fibrosis and glomerulosclerosis (Calabresi et al, 1998), as also seen in transgenic mice (Clouthier et al, 1997). A major advantage of the present approach to control autoimmune disease is that the TGF-!1 constitutively produced in the transferred cells is latent rather than active, and is therefore unlikely to have these side effects. Under normal conditions, latent TGF-! is present

112

Gene Therapy and Molecular Biology Vol 6, page 113

control cloned T cells (2-3 days after activation with the relevant

ubiquitously, in platelet " granules (Fava et al, 1990), as well as attached to the matrix of connective tissue (Heine et al, 1990; Munger et al, 1997; Evanko et al, 1998) and to #-globulin in the serum of mice (Rowley et al, 1995) and humans (GJT, CH and GMH, unpublished observations). The latent TGF-!1 produced by the antigen specific T cells in inflammatory infiltrates in the CNS is apparently activated, possibly by neighboring macrophages in the lesions (Nunes et al, 1995). Indeed, an increase in active TGF-!1 can be detected in the asthma model in bronchoalveolar lavage fluid harvested from mice receiving TGF-!1/OVA T cells one day after measurement of airway hyper-reactivity (Hansen et al, 2000). In contrast, levels of active TGF-! are low in bronchoalveolar lavage fluid from OVA-immunized mice receiving KLH/TGF-! rather than OVA/TGF-! Th1 cells. These data indicate that the TGF-!1 transduced OVAspecific T cells reach the lung in mice that have been challenged intranasally with OVA and that the latent TGF!1 secreted by the T cells is activated in the inflammatory environment created by OVA-specific Th2 cells, either by macrophages via interaction with plasmin (Munger et al, 1997; Godar et al, 1999) and/or betaglycan (Chong et al, 1999), or by interaction with other known TGF-! activating moieties, such as thrombospondin-1 (Ribeiro et al, 1999) or "v!6 (Munger et al, 1999), the latter of which is prominently represented in epithelial cells in the lung. The results so far obtained with TGF-!1 transduced T cells indicate that production of TGF-!1 confers immune-modulating properties on auto-reactive T cells, that allow them to control the behavior of other inflammatory cells in their immediate vicinity. We propose that the genetic engineering of auto-reactive T cells with latent TGF-!, or up-regulating their ability to produce TGF-! by other means, such as through inhibition of CD26 (dipeptidyl peptidase IV) (Kahne et al, 1999) may represent a clinically viable approach to the treatment of autoimmune diseases.

antigen in vitro , 3 x 106 cells/mouse) were injected iv into mice which had been immunized with PLP 12 days earlier. Differences

between groups of mice for mean EAE severity were evaluated by Student’s t test; for EAE incidence by Chi2 test.

C. T cell clones The MBP-specific cloned T cells were derived from BALB/c mice immunized with MBP in CFA (AbromsonLeeman et al, 1995) and were donated by Dr. M. Dorf (Dept. of Pathology, Harvard U. Med. School). Cells were activated by exposure to MBP peptide 59-76 (10µg/106 cells, Peptide Synthesis, Keck Biotechnology Resource Center, New Haven, CT) in the presence of antigen presenting cells (APC, 5 x 106 #irradiated spleen cells). Keyhole limpet hemocyanin (KLH) specific (D3) and ovalbumin (OVA) specific (BOT.A3) BALB/c Th1 cell clones were grown and activated as described previously (Rizzo et al, 1992). For experiments in which TGF-! contents of supernatants were to be measured, cells received 1% Nutridoma (Boehringer Mannheim, Indianapolis, IN) instead of serum in the medium. All the T cell clones were stimulated every 2-3 weeks by the corresponding antigens: MBP (10 µg/ml), KLH (1 µg/ml), OVA (10 µg/ml).

D. Studies on airway hyper-reactivity: Immunization Protocol of Normal BALB/c Mice to Induce Airway Hyper-reactivity. TGF-! producing cells Th1 cells were also transferred into OVA-immunized BALB/c mice. BALB/c mice were immunized with OVA i.p. (50 µg) complexed with aluminum potassium sulfate (alum) on day 0, and intranasally with 50 µg OVA in 50 µl of PBS or 50 µg OVA and 25 µg KLH in 50 µl of PBS on days 7, 8 and 9. Some mice received TGF-!1 producing OVA or KLH specific Th1 cells iv (2.5 x 106 cells/mouse) on day 7. Airway hyper-reactivity to inhaled methacholine was measured 24 h after the last intranasal dose of OVA (day 10). Lung fixation was performed the following day.

E. Measurement of airway responsiveness Airway responsiveness was assessed as described previously (Hansen et al, 2000) by methacholine-induced airflow obstruction from conscious mice placed in a whole body plethysmograph (model PLY 3211, Buxco Electronics Inc., Troy, NY). Pulmonary airflow obstruction was measured by Penh using the following formula: Penh = (Te/RT-1) x (PEF/PIF), where Penh=enhanced pause (dimensionless), Te=expiratory time, RT=relaxation time, PEF = peak expiratory flow (ml/s), and PIF = peak inspiratory flow (ml/s). Enhanced pause (Penh), minute volume, tidal volume, and breathing frequency were obtained from chamber pressure, measured with a transducer (model TRD5100) connected to preamplifier modules (model MAX2270) and analyzed by system XA software (model SFT 1810). Measurements of methacholine responsiveness were obtained by exposing mice for 2 min to NaCl 0.9% (Portable Ultrasonic, 5500D, DeVilbiss Health Care, Inc. Sommerset, Pennsylvania), followed by incremental doses (2.5-40 mg/ml) of aerosolized methacholine and monitoring Penh. Results were expressed for each methacholine concentration as the percentage above baseline Penh values after NaCl 0.9 % exposure.

IV. Materials and Methods A. Mice (SJL x BALB/c) F1 hybrid mice, 6-8 weeks old females, were purchased from the Jackson Lab. (Bar Harbor, ME).

B. Studies on EAE SJL x BALB/c mice were injected sc. with 200 µg PLP peptide 139-151 (Molecular Dynamics, Sunnyvale, CA), emulsified in incomplete Freund’s adjuvant containing 200 µg killed H37RA Mycobacteria tuberculosa. The mice received 200 ng pertussigen iv, 24 and 48 h later. The EAE was scored (double blind read) as follows: 1 = limp tail; 2 = partial hind leg paralysis; 3 = total hind leg paralysis; 4 = hind and front limb paralysis; 5 = moribund (Santambrogio et al, 1993). Predictable EAE relapses (Crisi et al, 1995) were induced by injection of Staphylococcus enterotoxin B (SEB, Toxin Technology, Sarasota, FL), 0.5 µg ip, or of LPS (lipopolysaccharide B, E. coli 0111:B4 , Difco Labs, Detroit, MI), 1-5 µg ip. Transduced and

F. Transduction of T cell clones The cDNA (base pairs 352-1550) encoding murine TGF!1 (generously provided by DNAX, Palo Alto, CA) was

113

Chen et al: T cells in allergic encephalomyelitis

subcloned into the pMFG retroviral vector as previously described (Dranoff et al, 1993). The cDNA of murine IL-10 (base pairs 77-623) was similarly subcloned into the pMFG vector. CRIP-TGF-! and CRIP-IL-10 packaging cells, producing the replication defective retrovirus, were generated as reported previously (Danos and Mulligan, 1988). The titers of the retroviruses were 0.5 copies as determined by Southern analysis. No replication competent virus was detected using the his mobilization assay (Hartman and Mulligan, 1988). Transduction of T cell clones was done by co-culture with packaging cells for 48 h in the presence of 2 µg polybrene per ml (Cepko and Pear, 1997). The packaging cells were #-irradiated (2800 r) and plated in a 24-well plate (2 x 105 cells/well). Four h later, when the fibroblasts had completely adhered to the well, recently activated cloned T cells (106/well) were added. The T cells were then cloned by limiting dilution in 96-well plates, using #-irradiated BALB/c spleen cells (5 x 105/ml) as feeder cells. Clones were expanded until sufficient amounts of DNA could be obtained for PCR analysis.

from Dr. D. B. Rifkin (Dept. Cell Biology, NYU School of Medicine). Samples were assayed with and without activation of latent TGF-! by treatment with acid (0.1M HCL at 4°C for 60 min). The protein content of TGF-!1 was assayed by ELISA in Immulon 4 flat bottom plates, coated with 5 µg/well of a monoclonal anti-TGF-!{12H5 (Lucas et al, 1990)}, donated by Dr. B. M. Fendly, Genentech Inc.), using natural TGF-!1 (Genzyme, Cambridge, MA) as a standard, and biotinylated mAb. to TGF-!1 (R&D systems, Minneapolis, MN), streptavidin-peroxidase (Zymed, South San Francisco, CA) and OPD substrate (Sigma, St. Louis, MO) as developing reagents. IL-10 was assayed by ELISA with the use of the Endogen kit (Woburn, MA).

Acknowledgements The donations of packaging cell lines, help and advise from Dr. D. G. Dranoff (Dana Farber Cancer Center, Harvard Med. School, Boston, MA) are gratefully acknowledged. We are also greatly indebted to Drs. S. Abromson-Leeman and M. E. Dorf (Harvard Medical School, Boston, MA) for giving us the MBP-specific T cell clone. The anti-TGF-! was provided by Dr. B. M. Fendly (Genentech Inc., South San Francisco, CA). Dr. D. Rifkin (Dept. of Cell Biology, NYU School of Medicine) gave valuable help in the biological assay for TGF-! activity. We thank Ching Huang for excellent technical assistance.

H. PCR for detection of cytokine cDNA DNA extraction was done according to the instructions in the Promega Wizard Genomic DNA purification kit. Primers used for the detection of TGF-!1 cDNA (Clontech, Palo Alto, CA) were: FP, (5’) GCCCTGGACACCAACTATTGCT and RP, (3’) AGGCTCCAAATGTAGGGGCAGG. They correspond closely (with one base pair difference) to the mouse TGF-!1 sequences, 1187-1208 and 1347-1326, respectively. The PCR program followed was: 95°C 5 min; 94°C 30’, 55°C 30’,72°C 1 min, 40 cycles; 72°C 10 min, using 1 µg sample DNA per reaction. Approximately 3% of the cloned T cells proved positive for the cDNA of TGF-!1. Primers used for the detection of IL-10 cDNA were FP, (5') TCCTTAATGCAG GACTTTAAGGGTTACTTG and RP, (3') GACACCTTGGTCTTGG AGCTTATTAAAATC, which correspond to the cDNA sequences 270-309 and 527-508, respectively. The same PCR program was used as for amplification of TGF-!1 cDNA. For both TGF-!1 and IL-10, the primers were chosen to span an intron, such that endogenous DNA would not be amplified. Positive and negative controls were always included(Chen et al, 1998). To control for PCR conditions and DNA quality, PCR for MMTV-LTR was performed on spinal cord samples using the forward primer: (5’) CTACACTTAG GAGAGAAGCAGCCA and the reverse primer: (3’) CTTACTTAAACCTTGGGAACCG CAAG (Zhang et al, 1996).

References Abe M, Harpel JG, Metz CN, Nunes I, Loskutoff DJ, Rifkin DB. (1994) An assay for transforming growth factor-beta using cells transfected with a plasminogen activator inhibitor-1 promoter-luciferase construct. Anal Biochem 216, 276-284. Abromson-Leeman

Bronson

Dorf

ME.

(1995)

Experimental autoimmune peripheral neuritis induced in BALB/c mice by myelin basic protein-specific T cell clones. J Exp Med 182, 587-592. Arnold R, Seifert M, Asadullah K, Volk HD. (1999) Crosstalk between keratinocytes and T lymphocytes via Fas/Fas ligand

I. Cytokine production

interaction: modulation by cytokines. J Immunol 162, 7140-

RNA was extracted from 2 x 106 cloned T cells, 2-3 days after stimulation with antigen, using the RNA STAT-60 isolation kit (Tel-Test, Inc., Friendswood, TX). Cytokine mRNAs produced by antigen activated cloned T cells were quantified by multiprobe ribonuclease protection assay, using two sets of cytokine probes according to the manufacturer’s instructions (PharMingen, San Diego, CA). The biological activity of TGF-! was assayed in supernatants from 106 cells per ml, cultured for 24 h in serumfree medium, by its activating effect on the plasminogen activator inhibitor-1 (PAI-1) promotor linked to the firefly luciferase reporter gene, transfected into mink lung epithelial cells(Abe et al, 1994). The assay cells were a generous donation

7147. Balasa B, Davies JD, Lee J, Good A, Yeung BT, Sarvetnick N. (1998) IL-10 impacts autoimmune diabetes via a CD8+ T cell pathway circumventing the requirement for CD4+ T and B lymphocytes. J Immunol 161, 4420-4427. Barten DM, Clark RB and Ruddle NH (1995) Presence of T cells with activated and memory phenotypes in inflammatory spinal cord lesions. J Immunol 155, 5409-5418.

114

Gene Therapy and Molecular Biology Vol 6, page 115

Bettelli E, Das MP, Howard ED, Weiner HL, Sobel RA and

syndrome in PEPCK-TGF-beta1 transgenic mice. J Clin

Kuchroo VK (1998) IL-10 is critical in the regulation of

Invest 100, 2697-2713.

autoimmune encephalomyelitis as demonstrated by studies of

Corradin SB, Fasel N, Buchmuller-Rouiller Y, Ransijn A, Smith

IL-10- and IL-4-deficient and transgenic mice. J Immunol

J and Mauel J (1993) Induction of macrophage nitric oxide

161, 3299-3306.

production by interferon-gamma and tumor necrosis factor-

Bogdan C, Vodovotz Y and Nathan C (1991) Macrophage

alpha is enhanced by interleukin-10. Eur J Immunol 23,

deactivation by interleukin 10. J Exp Med 174, 1549-1555.

2045-2048.

Briere F, Bridon JM, Servet C, Rousset F, Zurawski G and

Crisi GM, Katz IR, Zucker MB and Thorbecke GJ (1996)

Banchereau J (1993) IL-10 and IL-13 as B cell growth and

Induction of inhibitory activity for B cell differentiation in

differentiation factors. Nouv Rev Fr Hematol 35, 233-235.

human CD8 T cells with pokeweed mitogen, dimaprit and cAMP upregulating agents: countersuppressive effect of

Burkhart C, Liu GY, Anderton SM, Metzler B and Wraith DC

platelet factor 4. Cell Immunol 172, 205-216.

(1999) Peptide-induced T cell regulation of experimental autoimmune encephalomyelitis: a role for IL-10. Int

Crisi GM, Santambrogio L, Hochwald GM, Smith SR, Carlino

Immunol 11, 1625-1634.

JA and Thorbecke GJ (1995) Staphylococcal enterotoxin B and

Calabresi PA, Fields NS, Maloni HW, Hanham A, Carlino J,

tumor-necrosis

factor-alpha-induced

relapses

Moore J, Levin MC, Dhib-Jalbut S, Tranquill LR, Austin H,

experimental allergic encephalomyelitis: protection by

McFarland HF and Racke MK (1998) Phase 1 trial of

transforming growth factor-beta and interleukin-10. Eur J Immunol 25, 3035-3040.

transforming growth factor beta 2 in chronic progressive MS. Neurology 51, 289-292.

Cua DJ, Groux H, Hinton DR, Stohlman SA and Coffman RL

Cannella B, Gao YL, Brosnan C and Raine CS (1996) IL-10 fails

(1999) Transgenic interleukin 10 prevents induction of

to abrogate experimental autoimmune encephalomyelitis. J

experimental autoimmune encephalomyelitis. J Exp Med

Neurosci Res 45, 735-746.

189, 1005-1010.

Cepko C and Pear W (1997) Transduction of genes using

Danos O and Mulligan RC (1988) Safe and efficient generation

retrovirus vectors. Retrovirus infection of cells in vitro and in

of recombinant retroviruses with amphotropic and ecotropic

vivo. In Current Protocols in Molecular Biology, vol. 1. F.

host ranges. Proc Natl Acad Sci U S A 85, 6460-6464.

M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G.

de Vries JE (1995) Immunosuppressive and anti-inflammatory

Seidman, J. A. Smith and K. Struhl, eds. John Wiley & Sons.

properties of interleukin 10. Ann Med 27, 537-541.

Inc., New York, p. 9.14.11-16.

de Waal Malefyt R, Abrams J, Bennett B, Figdor CG and de

Chen LZ, Hochwald GM, Huang C, Dakin G, Tao H, Cheng C,

Vries JE (1991) Interleukin 10(IL-10) inhibits cytokine

Simmons WJ, Dranoff G and Thorbecke GJ (1998) Gene

synthesis by human monocytes: an autoregulatory role of IL-

therapy in allergic encephalomyelitis using myelin basic

10 produced by monocytes. J Exp Med 174, 1209-1220.

protein- specific T cells engineered to express latent

Diebold RJ, Eis MJ, Yin M, Ormsby I, Boivin GP, Darrow BJ,

transforming growth factor-beta1. Proc Natl Acad Sci U S

Saffitz JE and Doetschman T (1995) Early-onset multifocal

A 95, 12516-12521.

inflammation in the transforming growth factor beta 1-null

Chen WF and Zlotnik A (1991) IL-10: a novel cytotoxic T cell

mouse is lymphocyte mediated. Proc Natl Acad Sci U S A

differentiation factor. J Immunol 147, 528-534.

92, 12215-12219.

Chong H, Vodovotz Y, Cox GW and Barcellos-Hoff MH (1999)

Dranoff G, Jaffee E, Lazenby A, Golumbek P, Levitsky H, Brose

Immunocytochemical localization of latent transforming

K, Jackson V, Hamada H, Pardoll D and Mulligan RC (1993)

growth factor- beta1 activation by stimulated macrophages. J

Vaccination with irradiated tumor cells engineered to secrete

Cell Physiol 178, 275-283.

murine granulocyte-macrophage colony-stimulating factor stimulates potent, specific and long-lasting anti-tumor

Clouthier DE, Comerford SA and Hammer RE (1997) Hepatic fibrosis,

glomerulosclerosis

and

immunity. Proc Natl Acad Sci U S A 90, 3539-3543.

lipodystrophy-like

115

Chen et al: T cells in allergic encephalomyelitis

Edwards S, Zvartau M, Clarke H, Irving W and Blumhardt LD

of cytokines depends on the inducing signals and the type of

(1998) Clinical relapses and disease activity on magnetic

cell analyzed. J Immunol 152, 2720-2728.

resonance imaging associated with viral upper respiratory

Godar S, Horejsi V, Weidle UH, Binder BR, Hansmann C and

tract infections in multiple sclerosis. J Neurol Neurosurg

Stockinger

Psychiatry 64, 736-741.

urokinase receptor and plasminogen for activation of

Ellerman KE, Powers JM and Brostoff SW (1988) A suppressor

(1999)

M6P/IGFII-receptor

complexes

transforming growth factor-beta1. Eur J Immunol 29, 1004-

T-lymphocyte cell line for autoimmune encephalomyelitis.

1013.

Nature 331, 265-267.

Gorelik L and Flavell RA (2000) Abrogation of TGFbeta

Epstein SP, Baer RL, Thorbecke GJ and Belsito DV (1991)

signaling in T cells leads to spontaneous T cell

Immunosuppressive effects of transforming growth factor

differentiation and autoimmune disease. Immunity 12, 171-

beta: inhibition of the induction of Ia antigen on Langerhans

181.

cells by cytokines and of the contact hypersensitivity

Groux H, Cottrez F, Rouleau M, Mauze S, Antonenko S, Hurst

response. J Invest Dermatol 96, 832-837.

S, McNeil T, Bigler M, Roncarolo MG and Coffman RL

Espevik T, Figari IS, Shalaby MR, Lackides GA, Lewis GD,

(1999) A transgenic model to analyze the immunoregulatory

Shepard HM and Palladino MA, Jr (1987) Inhibition of

role of IL-10 secreted by antigen-presenting cells. J

cytokine production by cyclosporin A and transforming

Immunol 162, 1723-1729.

growth factor beta. J Exp Med 166, 571-576.

Hansen G, McIntire JJ, Yeung VP, Berry G, Thorbecke GJ, Chen

Evanko SP, Raines EW, Ross R, Gold LI and Wight TN (1998)

L, DeKruyff RH and Umetsu DT (2000) CD4(+) T helper

Proteoglycan distribution in lesions of atherosclerosis

cells engineered to produce latent TGF-beta1 reverse

depends on lesion severity, structural characteristics and the

allergen-induced airway hyperreactivity and inflammation. J

proximity of platelet-derived growth factor and transforming

Clin Invest 105, 61-70.

growth factor-beta. Am J Pathol 152, 533-546.

Hartman SC and Mulligan RC (1988) Two dominant-acting

Fabry Z, Topham DJ, Fee D, Herlein J, Carlino JA, Hart MN and

selectable markers for gene transfer studies in mammalian

Sriram S (1995) TGF-beta 2 decreases migration of

cells. Proc Natl Acad Sci U S A 85, 8047-8051.

lymphocytes in vitro and homing of cells into the central

Heine UI, Wahl SM, Munoz EF, Allen JB, Ellingsworth LR,

nervous system in vivo. J Immunol 155, 325-332.

Flanders KC, Roberts AB, Sporn MB (1990) Transforming

Fava RA, Casey TT, Wilcox J, Pelton RW, Moses HL and

growth factor-beta 1 specifically localizes in elastin during

Nanney LB (1990) Synthesis of transforming growth factor-

synovial inflammation: an immunoelectron microscopic

beta

study. Arch Geschwulstforsch 60, 289-294.

megakaryocytes

and

its

localization

megakaryocyte and platelet alpha-granules. Blood 76, 1946-

Johns

1955.

LD,

Sriram

(1993)

Experimental

allergic

encephalomyelitis: neutralizing antibody to TGF beta 1

Ferguson TA, Dube P and Griffith TS (1994) Regulation of

enhances

contact hypersensitivity by interleukin 10. J Exp Med 179 ,

the

clinical

severity

the

disease.

Neuroimmunol 47, 1-8.

1597-1604.

Kahne T, Lendeckel U, Wrenger S, Neubert K, Ansorge S,

Fiorelli G, Ballock RT, Wakefield LM, Sporn MB, Gori F, Masi

Reinhold D (1999) Dipeptidyl peptidase IV: a cell surface

L, Frediani U, Tanini A, Bernabei PA and Brandi ML (1994)

peptidase involved in regulating T cell growth (review) Int J

Role for autocrine TGF-beta 1 in regulating differentiation of

Mol Med 4, 3-15.

a human leukemic cell line toward osteoclast-like cells. J

Karpus WJ, Swanborg RH (1991) CD4+ suppressor cells inhibit

Cell Physiol 160, 482-490.

the function of effector cells of experimental autoimmune

Frei K, Lins H, Schwerdel C and Fontana A (1994) Antigen

encephalomyelitis

through

mechanism

involving

presentation in the central nervous system. The inhibitory

transforming growth factor-beta. J Immunol 146, 1163-

effect of IL-10 on MHC class II expression and production

1168.

116

Gene Therapy and Molecular Biology Vol 6, page 117

Kasama T, Strieter RM, Lukacs NW, Lincoln PM, Burdick MD,

Lin RF, Lin TS, Tilton RG, Cross AH (1993) Nitric oxide

Kunkel SL (1995) Interleukin-10 expression and chemokine

localized to spinal cords of mice with experimental allergic

regulation during the evolution of murine type II collagen-

encephalomyelitis: an electron paramagnetic resonance

induced arthritis. J Clin Invest 95, 2868-2876.

study. J Exp Med 178, 643-648.

Khoury SJ, Hancock WW, Weiner HL (1992) Oral tolerance to

Lodge PA, Sriram S (1996) Regulation of microglial activation

myelin basic protein and natural recovery from experimental autoimmune

encephalomyelitis

are

associated

by TGF-beta, IL-10 and CSF-1. J Leukoc Biol 60, 502-508.

with

Lou J, Dayer JM, Grau GE, Burger D (1996) Direct cell/cell

downregulation of inflammatory cytokines and differential

contact with stimulated T lymphocytes induces the

upregulation of transforming growth factor beta, interleukin

expression of cell adhesion molecules and cytokines by

4 and prostaglandin E expression in the brain. J Exp Med

human brain microvascular endothelial cells. Eur J

176, 1355-1364.

Immunol 26, 3107-3113.

Kim KN, Watanabe S, Ma Y, Thornton S, Giannini EH, Hirsch

Lucas C, Bald LN, Fendly BM, Mora-Worms M, Figari IS,

R (2000) Viral IL-10 and soluble TNF receptor act

Patzer EJ, Palladino MA (1990) The autocrine production of

synergistically to inhibit collagen-induced arthritis following

transforming growth factor-beta 1 during lymphocyte

adenovirus- mediated gene transfer. J Immunol 164 , 1576-

activation. A study with a monoclonal antibody-based

1581.

ELISA. J Immunol 145, 1415-1422.

Kitani A, Fuss IJ, Nakamura K, Schwartz OM, Usui T, Strober

Lyons AB, Parish CR (1994) Determination of lymphocyte

W (2000) Treatment of experimental (Trinitrobenzene

division by flow cytometry. J Immunol Methods 171, 131-

sulfonic acid) colitis by intranasal administration of

137.

transforming growth factor (TGF)-beta1 plasmid. tgf-beta1-

MacDonald KP, Pettit AR, Quinn C, Thomas GJ, Thomas R

mediated suppression of t helper cell type 1 response occurs

(1999) Resistance of rheumatoid synovial dendritic cells to

by interleukin (il)-10 induction and il-12 receptor beta2 chain

the immunosuppressive effects of IL-10. J Immunol 163,

downregulation. J Exp Med 192, 41-52.

5599-5607.

Kuchroo VK, Martin CA, Greer JM, Ju ST, Sobel RA, Dorf ME

Maeda K, Kosco-Vilbois MH, Burton GF, Szakal AK, Tew JG

(1993) Cytokines and adhesion molecules contribute to the

(1995) Expression of the intercellular adhesion molecule-1

ability of myelin proteolipid protein-specific T cell clones to

on high endothelial venules and on non-lymphoid antigen

mediate experimental allergic encephalomyelitis. J Immunol

handling cells: interdigitating cells, antigen transporting cells

151, 4371-4382.

and follicular dendritic cells. Cell Tissue Res 279, 47-54.

Kumar V, Sercarz EE (1993) The involvement of T cell receptor

Magnan A, Retornaz F, Tsicopoulos A, Brisse J, Van D, P Pee,

peptide-specific regulatory CD4+ T cells in recovery from

A Gosset, Tonnel AB, Vervloet D (1997) Altered

antigen-induced autoimmune disease. J Exp Med 178, 909-

compartmentalization of transforming growth factor-beta in

916.

asthmatic airways. Clin Exp Allergy 27, 389-395.

Kuruvilla AP, Shah R, Hochwald GM, Liggitt HD, Palladino

Marrack P, Kappler J (1990) The staphylococcal enterot oxins

MA, Thorbecke GJ (1991) Protective effect of transforming

and their relatives. Science 248, 705-707.

growth factor beta 1 on experimental autoimmune diseases in

Mathisen PM, Yu M, Johnson JM, Drazba JA, Tuohy VK (1997)

mice. Proc Natl Acad Sci U S A 88, 2918-2921.

Treatment of experimental autoimmune encephalomyelitis

Lechman ER, Jaffurs D, Ghivizzani SC, Gambotto A, Kovesdi I,

with genetically modified memory T cells. J Exp Med 186,

Mi Z, Evans CH, Robbins PD (1999) Direct adenoviral gene

159-164.

transfer of viral IL-10 to rabbit knees with experimental

Metz LM, McGuinness SD, Harris C (1998) Urinary tract

arthritis ameliorates disease in both injected and contralateral

infections may trigger relapse in multiple sclerosis. Axone

control knees. J Immunol 163, 2202-2208.

19, 67-70.

117

Chen et al: T cells in allergic encephalomyelitis

Mokhtarian F, Shi Y, Shirazian D, Morgante L, Miller A, Grob

colitis by CD45RB(low) CD4+ T cells. J Exp Med 183,

D (1994) Defective production of anti-inflammatory

2669-2674.

cytokine, TGF-beta by T cell lines of patients with active

Quere P, Thorbecke GJ (1990) Multiple suppressive effects of

multiple sclerosis. J Immunol 152, 6003-6010.

transforming growth factor beta 1 on the immune response in

Munger JS, Harpel JG, Gleizes PE, Mazzieri R, Nunes I, Rifkin

chickens. Cell Immunol 129, 468-477.

DB (1997) Latent transforming growth factor-beta: structural

Racke MK, Cannella B, Albert P, Sporn M, Raine CS, McFarlin

features and mechanisms of activation. Kidney Int 51, 1376-

DE (1992) Evidence of endogenous regulatory function of

1382.

transforming growth factor-beta 1 in experimental allergic

Munger JS, Huang X, Kawakatsu H, Griffiths MJ, Dalton SL,

encephalomyelitis. Int Immunol 4, 615-620.

Wu J, Pittet JF, Kaminski N, Garat C, Matthay MA, Rifkin

Racke MK, Dhib-Jalbut S, Cannella B, Albert PS, Raine CS,

DB, Sheppard D (1999) The integrin alpha v beta 6 binds

McFarlin DE (1991) Prevention and treatment of chronic

and activates latent TGF beta 1: a mechanism for regulating

relapsing

pulmonary inflammation and fibrosis. Cell 96, 319-328.

transforming growth factor-beta 1. J Immunol 146, 3012-

Nagelkerken L, Blauw B, Tielemans M (1997) IL-4 abrogates

experimental

allergic

encephalomyelitis

3017.

the inhibitory effect of IL-10 on the development of

Racke MK, Sriram S, Carlino J, Cannella B, Raine CS, McFarlin

experimental allergic encephalomyelitis in SJL mice. Int

DE (1993) Long-term treatment of chronic relapsing

Immunol 9, 1243-1251.

experimental allergic encephalomyelitis by transforming

Nelson BJ, Ralph P, Green SJ, Nacy CA (1991) Differential

growth factor-beta 2. J Neuroimmunol 46, 175-183.

susceptibility of activated macrophage cytotoxic effector

Ribeiro SM, Poczatek M, Schultz-Cherry S, Villain M, Murphy-

reactions to the suppressive effects of transforming growth

Ullrich

factor-beta 1. J Immunol 146, 1849-1857.

thrombospondin-1 interacts with the latency- associated

Nunes I, Shapiro RL, Rifkin DB (1995) Characterization of latent

TGF-beta

activation

murine

(1999)

The

activation

sequence

peptide to regulate activation of latent transforming growth

peritoneal

factor-beta. J Biol Chem 274, 13586-13593.

macrophages. J Immunol 155, 1450-1459.

Rich S, Seelig M, Lee HM, Lin J (1995) Transforming growth

Okuda Y, Nakatsuji Y, Fujimura H, Esumi H, Ogura T,

factor beta 1 costimulated growth and regulatory function of

Yanagihara T, Sakoda S (1995) Expression of the inducible

staphylococcal enterotoxin B-responsive CD8+ T cells. J

isoform of nitric oxide synthase in the central nervous system

Immunol 155, 609-618.

of mice correlates with the severity of actively induced

Rizzo LV, DeKruyff RH, Umetsu DT (1992) Generation of B

experimental allergic encephalomyelitis. J Neuroimmunol

cell memory and affinity maturation. Induction with Th1 and

62, 103-112.

Th2 T cell clones. J Immunol 148, 3733-3739.

Oswald IP, Gazzinelli RT, Sher A, James SL (1992) IL-10

Rott O, Fleischer B, Cash E (1994) Interleukin-10 prevents

synergizes with IL-4 and transforming growth factor-beta to

experimental allergic encephalomyelitis in rats. Eur J

inhibit macrophage cytotoxic activity. J Immunol 148,

Immunol 24, 1434-1440.

3578-3582.

Rowley DA, Becken ET, Stach RM (1995) Autoantibodies

Pardoux C, Asselin-Paturel C, Chehimi J, Gay F, Mami-Chouaib

produced

spontaneously

young

1pr

mice

carry

F, Chouaib S (1997) Functional interaction between TGF-

transforming growth factor beta and suppress cytotoxic T

beta and IL-12 in human primary allogeneic cytotoxicity and

lymphocyte responses. J Exp Med 181, 1875-1880.

proliferative response. J Immunol 158, 136-143.

Samoilova EB, Horton JL, Chen Y (1998) Acceleration of

Powrie F, Carlino J, Leach MW, Mauze S, Coffman RL (1996)

experimental autoimmune encephalomyelitis in interleukin-

A critical role for transforming growth factor-beta but not

10-deficient mice: roles of interleukin-10 in disease

interleukin 4 in the suppression of T helper type 1-mediated

progression and recovery. Cell Immunol 188, 118-124.

118

Gene Therapy and Molecular Biology Vol 6, page 119

Santambrogio L, Crisi GM, Leu J, Hochwald GM, Ryan T,

encephalomyelitis via secretion of IL-10. J Immunol 163,

Thorbecke GJ (1995) Tolerogenic forms of auto-antigens and

6338-6344.

cytokines in the induction of resistance to experimental

Thorbecke GJ, Schwarcz R, Leu J, Huang C, Simmons WJ

allergic encephalomyelitis. J Neuroimmunol 58, 211-222.

(1999) Modulation by cytokines of induction of oral

Santambrogio L, Hochwald GM, Leu CH, Thorbecke GJ (1993)

tolerance to type II collagen. Arthritis Rheum 42, 110-118.

Antagonistic effects of endogenous and exogenous TGF-beta and

TNF

auto-immune

diseases

Thorbecke GJ, Shah R, Leu CH, Kuruvilla AP, Hardison AM,

mice.

Palladino MA (1992) Involvement of endogenous tumor

Immunopharmacol Immunotoxicol 15, 461-478.

necrosis factor alpha and transforming growth factor beta

Santambrogio L, Hochwald GM, Saxena B, Leu CH, Martz JE,

during induction of collagen type II arthritis in mice. Proc

Carlino JA, Ruddle NH, Palladino MA, Gold LI, Thorbecke

Natl Acad Sci U S A 89, 7375-7379.

GJ (1993) Studies on the mechanisms by which transforming

Tsuyuki S, Tsuyuki J, Einsle K, Kopf M, Coyle AJ (1997)

growth factor-beta (TGF-beta) protects against allergic

Costimulation through B7-2 (CD86) is required for the

encephalomyelitis. Antagonism between TGF-beta and

induction of a lung mucosal T helper cell 2 (TH2) immune

tumor necrosis factor. J Immunol 151, 1116-1127.

response and altered airway responsiveness. J Exp Med 185,

Santos LM, al-Sabbagh A, Londono A, Weiner HL (1994) Oral

1671-1679.

tolerance to myelin basic protein induces regulatory TGF-

van der, RC Veen, Stohlman SA (1993) Encephalitogenic Th1

beta- secreting T cells in Peyer's patches of SJL mice. Cell

cells are inhibited by Th2 cells with related peptide

Immunol 157, 439-447.

specificity: relative roles of interleukin (IL)-4 and IL-10. J

Shaw MK, Lorens JB, Dhawan A, DalCanto R, Tse HY, Tran

Neuroimmunol 48, 213-220.

AB, Bonpane C, Eswaran SL, Brocke S, Sarvetnick N,

Vignola AM, Chanez P, Chiappara G, Merendino A, Pace E,

Steinman L

Rizzo A, la Rocca AM, Bellia V, Bonsignore G, Bousquet J

Steinman, GP Nolan and CG Fathman (1997) Local delivery of

(1997) Transforming growth factor-beta expression in

interleukin 4 by retrovirus-transduced T lymphocytes

mucosal biopsies in asthma and chronic bronchitis. Am J

ameliorates experimental autoimmune encephalomyelitis. J

Respir Crit Care Med 156, 591-599.

Exp Med 185, 1711-1714.

Vodovotz Y, Bogdan C, Paik J, Xie QW, Nathan C (1993)

Sironi M, Munoz C, Pollicino T, Siboni A, Sciacca FL,

Mechanisms of suppression of macrophage nitric oxide

Bernasconi S, Vecchi A, Colotta F, Mantovani A (1993)

release by transforming growth factor beta. J Exp Med 178,

Divergent effects of interleukin-10 on cytokine production

605-613.

by mononuclear phagocytes and endothelial cells. Eur J

Wakefield LM, Smith DM, Flanders KC, Sporn MB (1988)

Immunol 23, 2692-2695.

Latent transforming growth factor-beta from human platelets.

Stevens DB, Gould KE, Swanborg RH (1994) Transforming

A high molecular weight complex containing precursor

growth factor-beta 1 inhibits tumor necrosis factor-

sequences. J Biol Chem 263, 7646-7654.

alpha/lymphotoxin production and adoptive transfer of

Waldburger KE, Hastings RC, Schaub RG, Goldman SJ,

disease by effector cells of autoimmune encephalomyelitis. J

Leonard JP (1996) Adoptive transfer of experimental allergic

Neuroimmunol 51, 77-83.

encephalomyelitis after in vitro treatment with recombinant

Stevens TL, Bossie A, Sanders VM, Fernandez-Botran R,

murine interleukin-12. Preferential expansion of interferon-

Coffman RL, Mosmann TR, Vitetta ES (1988) Regulation of

gamma-producing

antibody isotype secretion by subsets of antigen-specific

macrophage-associated inducible nitric oxide synthase as

helper T cells. Nature 334, 255-258.

immunomodulatory mechanisms. Am J Pathol 148, 375-

regulatory

cells

suppresses

experimental

and

increased

expression

382.

Stohlman SA, Pei L, Cua DJ, Li Z, Hinton DR (1999) Activation of

cells

allergic

Walmsley M, Katsikis PD, Abney E, Parry S, Williams RO, Maini RN, Feldmann M (1996) Interleukin-10 inhibition of

119

Chen et al: T cells in allergic encephalomyelitis

the progression of established collagen- induced arthritis. Arthritis Rheum 39, 495-503. Xiao BG, Bai XF, Zhang GX, Link H (1998) Suppression of acute

and

protracted-relapsing

experimental

allergic

encephalomyelitis by nasal administration of low-dose IL-10 in rats. J Neuroimmunol 84, 230-237. Zhang DJ, Tsiagbe VK, Huang C, Thorbecke GJ (1996) Control of endogenous mouse mammary tumor virus superantigen expression in SJL lymphomas by a promoter within the env

Gerald M. Hochwald, Dept. of Neurology, New York University, School of Medicine, New York, NY 10016; FAX 212-2638211; e-mail: hochwg01@med.nyu.edu

region. J Immunol 157, 3510-3517.

120

Gene Therapy and Molecular Biology Vol 6, page 121

Gene Ther Mol Biol Vol 6, 121-131, 2001

The adenine nucleotide translocator as a potential therapeutic target Review Article

Anne-Sophie Belzacq1, Helena L.A. Vieira2, Marjorie Perrimon1, Florence Verrier1, Isabel Cohen2, Guido Kroemer2, and Catherine Brenner1,2 1

Centre National de la Recherche Scientifique, UMR 6022, Université de Technologie de Compiègne, 60205 Compiègne, France; 2

Centre National de la Recherche Scientifique, UMR 1599, Institut Gustave Roussy, 39 rue Camille Desmoulins, 94805 Villejuif, France. _________________________________________________________________________________________________ *Correspondence: Dr. C. Brenner Centre National de la Recherche Scientifique, UMR 6022, Université de Technologie de Compiègne, Royallieu, BP20529 60205 Compiègne, France; Tel. 33-3-44-23-44-16; Fax 33-3-44-20-39-10; E-mail: catherine.brenner@utc. Key words: Bcl-2, drug design, gene therapy, liposome, mitochondrion, oncogene Abbreviations: 4-hydroxynonenal, (HNE); 4-methylumbelliferone, (MU); 4-methylumbelliferyl phosphate, (MUP); adenine nucleotide translocator, (ANT); apoptosis inducing factor, (AIF); bongkrekic acid, (BA); cyclosporin A, (CsA); inner membrane, (IM); lonidamine, (LND); methyl-valine cyclosporin A, (m-val-CsA); mitochondrial membrane permeabilization, (MMP); mitochondrial transmembrane potential, (D !m); nitric oxide, (NO); outer membrane, (OM); peripheral benzodiazepin receptor, (PBR); permeability transition pore complex, (PTPC); reactive oxygen species, (ROS); short chain fatty acids, (sCFA); tert-butylhydroperoxide, (t-BHP); viral mitochondria-localized inhibitor of apoptosis,vMIA); viral protein R(VpR); voltage-dependent anion channel);(VDAC) Received: 5 August 2001; accepted: 17 August 2001; electronically published: Febraury 2004

Summary Identification of new targets for development of apoptosis-modulating drugs has become possible from the unraveling of the basic apoptosis mechanisms. Thus, mitochondrial membrane permeabilization has been recently recognized as a central rate-limiting step of apoptosis and its study has led to the identification of the adenine nucleotide translocator (ANT) as a potential therapeutic target. Three arguments support this possibility. First, ANT is a bi-functional protein, an ADP/ATP translocator and a non-specific pore, which contributes to apoptosis via its capacity to form a lethal pore under the control of the Bax/Bcl-2 family members. Second, the pore-forming activity of ANT is directly modulated by agents as diverse as proteins, lipids, ions, pro-oxidants or chemotherapeutic agents. Third, loss of ANT function is involved in several human pathologies, such as cardiomyopathy and aging, while reduced ANT expression or ANT mutation may lead to renal cancer and ophtalmoplegia. Hypothetically, ANT may thus constitute a new target for therapeutic intervention on apoptosis.

induction. Recent advances in cell biology have led to a better understanding of the basic mechanisms of apoptosis (Kroemer and Reed, 2000) and to the emergence of apoptosis modulation as a promising therapeutic strategy to correct pathological apoptosis (Costantini et al, 2000; Huang and Oliff, 2001; Reed, 2001). In many pathophysiological models, the apoptosis process is composed of three phases, induction (premitochondrial), decision (mitochondrial) and degration (post-mitochondrial) (Kroemer et al, 1997). Heterogenous

I. Introduction Apoptosis is a regulated physiological process of cell death. It is devoted to the maintenance of cell number homeostasis and the elimination of unwanted, mutated or damaged cells during the whole life, from embryonic development to adult state (Thompson, 1995). Apoptosis deregulation can cause numerous pathologies, as various as cancer, autoimmune diseases, neurodegenerative diseases and AIDS, and resistance to therapeutic cell death

121

Belzacq et al: The adenine nucleotide translocator as a potential therapeutic target

induction pathways triggered by various stimuli such as radiation, receptor ligation or xenobiotic agents converge to the mitochondrion, which, in turn, behaves as a central rate-limiting integrator/coordinator of the cell decision to die (Brenner and Kroemer, 2000; Kroemer and Reed, 2000). Integration corresponds to mitochondrial membrane permeabilization (MMP), a process which may involve the opening of the permeability transition pore complex (PTPC) (Zamzami et al, 1995). As a result of MMP, harmfull intermembrane soluble proteins are released into the cytosol (Von Ahsen et al, 2000; Joza et al, 2001; Parrish et al, 2001). Proteins participating in the various phases can be classified as (i) death initiators such as TNF or Fas receptors, transcription factors (e.g. p53, fos, jun, myc) or phosphatases/kinases (e.g. calcineurin, AKT) which activate the induction phase, (ii) MMP modulators such as the Bax/Bcl-2 family members and the proteins from the PTPC, (iii) intermembrane proteins such as cytochrome c (a caspase activator) (Green and Reed, 1998), certain pro-caspases (Susin et al, 1999), Smac/DIABLO (an inhibitor of caspases inhibitors of the IAP family) (Verhagen et al, 2000), apoptosis inducing factor (AIF, a nuclease activator) (Joza et al, 2001), as well as endonuclease G (Parrish et al, 2001), which mediate the integration/coordination role of mitochondria and lead to caspase-dependent and -independent pathways, and (iv) post-mitochondrial hydrolases such as caspases 3 and 6, and caspase-activated DNAse (Figure 1). The adenine nucleotide translocator (ANT) is an inner membrane mitochondrial protein, which belongs to the polyprotein complex PTPC (Zoratti and Szabo, 1995). PTPC is located at the contact site between the outer membrane (OM) and the inner membrane (IM) and is composed of, at least, hexokinase (in the cytosol), the peripheral benzodiazepin receptor (PBR, in the OM), VDAC (voltage dependent anion channel or porin, in the OM), ANT and cyclophilin D (in the matrix) (Zoratti and Szabo, 1995; Bernardi, 1996; Crompton, 1999; Kroemer and Reed, 2000) (Figure 2). Previously, PTPC has been shown to be a target for apoptosis regulation by Bcl-2related proteins (Marzo et al, 1998a). As true for several apoptosis-associated proteins, ANT is a bifunctional protein endowed with vital and lethal characteristic depending on the cellular context. In physiological conditions, ANT catalyzes the stoechiometric exchange of ADP and ATP across the IM (Pfaff and Klingenberg, 1968; Pfaff et al, 1969). In contrast, during apoptosis, ANT forms a lethal non-specific pore in cooperation with the Bax-like proteins, and thus, contributes to MMP (Marzo et al, 1998a, 1998b; Brenner et al, 2000; Vieira et al, 2000). In this review, we will discuss the role of ANT in apoptosis, its potential as a therapeutic target, and its putative implication in various pathologies.

bongkrekic acid (BA), an ANT ligand, cyclosporin A (CsA), a cyclophilin D ligand, and m-Val-CsA, a nonimmunosuppressive derivative of CsA, protect cells from apoptosis in several in vivo models, such as ischemia/reperfusion (Cao et al, 2001), brain traumas (Sullivan et al, 1999), fulminant hepatocyte apoptosis induced by injection of anti-CD95 antibodies (Feldmann et al, 2000) or gluthathione depletion (Haouzi et al, 2001). Second, nuclear apoptosis is preceded by a loss of the mitochondrial transmembrane potential "!m) that can be prevented in vitro by the above-mentioned inhibitors. This applies to several cell types, including neurons, fibroblasts, B and T lymphocytes, pre-B cells, thymocytes, myelomonocytic cells, carcinoma cell lines and to various apoptosis inducers including growth factor withdrawal, tumor necrosis factor, ceramide, glucocorticoids, genotoxic stress, and hyperexpression of Bax (Kroemer et al, 1997). Third, numerous death inducers can act directly on isolated mitochondria to stimulate concomitantly a loss of the "!m, matrix swelling and release of cytochrome c and AIF (Kroemer and Reed, 2000). Fourth, when purified PTPC or ANT are reconstituted into liposomes or planar lipid bilayers, they exhibit strongly similar properties to the whole PTPC in mitochondria or cells and can form non-specific pores accounting for the diffusion of solutes of MM<1500Da (Marzo et al, 1998a, 1998b; Brenner et al, 2000). Opening of the PTPC pore is inhibited by Bcl-2, CsA and BA. Moreover, Bcl-2, BA, ATP and ADP prevent the formation of pore in proteoliposomes containing purified ANT. Altogether, these studies indicate that ANT has two opposed functions; it is an ADP/ATP translocator in physiological conditions and a lethal pore in apoptosis.

III ANT as a pharmacological target To investigate whether ANT could be a pharmacological target for apoptosis induction/or prevention, we developped a screening assay to measure the capacity of an agent to stimulate ANT to convert into a non-specific pore. To this end, ANT was purified from rat heart mitochondria and reconstituted into phosphatidyl/cardiolipin liposomes. Then, various molecules, such as calcein, 3H-glucose, 3H -inulin, malate, or 4-methylumbelliferyl phosphate (MUP) were encapsulated into liposomes and their release was determined as a quantitative measure of ANT pore opening (Beutner et al, 1996; Marzo et al, 1998a, 1998b; Brenner et al, 2000路, 2000; Belzacq et al, 2001a) (Figure 3). Alternatively, ANT was incorporated in planar lipid bilayers to determine its electrophysiological properties such as single channel activity or macroscopic conductance, opening frequency and ionic specificity (Brenner et al, 2000; Zamzami et al, 2000; Jacotot et al, 2001). In these experimental systems, a number of proapoptotic agents capable of inducing MMP in isolated mitochondria were found to elicit ANT-dependent nonspecific channel formation (Table 1). This applies to

II. ANT in apoptosis Four lines of evidence support the role of ANT in apoptosis. First, inhibitors of PTPC opening, such as

122

Gene Therapy and Molecular Biology Vol 6, page 123

endogenous molecules participating in the apoptosis activation cascade (proteins, lipids, ions such as Ca2+) as well as xenobiotic agents (pro-oxidants, reactive oxygen species (ROS) donors and chemotherapeutic agents) (Hortelano et al, 1997, Larochette et al, 1999, Ravagnan et al, 1999, Marchetti et al, 1999, Granville and Hunt, 2000) (Figure 4).

2000). In many studies, it has been established that they regulate the apoptosis process at the mitochondrial level, by increasing MMP (the case of pro-apoptotic Bax/Bcl-2 family members) or by stabilizing the barrier function of mitochondrial membranes (the case of anti-apoptotic Bax/Bcl-2 family members) respectively. We found that after mitochondrial translocation, Bax interacts with ANT to form a non-specific lethal pore, this process being inhibited by BA and CsA, the two inhibitors of the PTPC (Marzo et al, 1998b). Immunodepletion of Bax from the PTPC or the use of PTPC purified from Bax-/- mice, revealed that the presence of Bax within PTPC is required for an optimal pore formation response to atractyloside, an ANT ligand classically used as MMP inducer (Marzo et al, 1998b). Direct physical interactions between ANT, Bax and Bcl-2 were demonstrated by co-immunoprecipitation in cancer cell lines and confirmed by means of the yeast two hybrid system (Marzo et al, 1998b).

A. The Bax/Bcl-2 family The Bax/Bcl-2 family is composed of pro-apoptotic proteins (Bax, Bak, Bad, Bid...) acting as tumor suppressors and of anti-apoptotic proteins (Bcl-2, BclXLâ&#x20AC;Ś) participating in oncogenesis. Several hypotheses have been proposed to explain their mode of action. They could regulate apoptosis via their capacity of homo- and hetero-oligomerization, via channel formation, and/or by increasing the level of cell tolerance to ROS damage (Harris and Thompson, 2000, Voehringer and Meyn,

Figure 1. The four classes of proteins involved in the apoptotic process. The death initiators represent TNF or Fas receptors, transcription factors (e.g. p53, fos, jun, myc) or phosphatases/kinases (e.g. calcineurin, AKT) which activate the induction phase of apoptosis. The mitochondrial membrane permeabilization modulators are the Bax/Bcl-2 family members and the PTPC components. Intermembrane proteins consist in cytochrome c, apoptosis inducing factor (AIF), certains pro-caspases, Smac/DIABLO as well as endonuclease G. The postmitochondrial hydrolases are responsible for the degradation phase such as caspases and DNAses. ANT, adenine nucleotide translocator, Cyt c, cytoc14hrome c, MMP, mitochondrial membrane permeabilization.

123

Belzacq et al: The adenine nucleotide translocator as a potential therapeutic target

"Dose" corresponds to the dose of a molecule inducing a permeabilization response. The dose is expressed as a molar ratio of protein: ANT, when proteins are co-reconstituted with ANT in artificial membranes, or as concentrations when molecules are incubated with ANT-containing liposomes. P, permeabilization response via ANT pore opening; -, no permeabilizing effect; ND, not determined.

Figure 2. Scheme of the putative PTPC organization at the contact site of mitochondrial membranes. PTPC is a polyprotein complex located at the contact site of the mitochondrial membranes. ANT, adenine nucleotide translocator; VDAC, voltage dependent anion channel; PBR, peripheral benzodiazepin receptor; CyD, cyclophilin D. HK, hexokinase; CK, creatine kinase. OM, outer membrane; IM, inner membrane;?, unknown protein; -/+, "!m

When ANT and Bax were reconstituted together into liposomes or planar lipid bilayers, we obtained a more efficient permeabilizing and pore-inducing effect of atractyloside than for each protein alone (Marzo et al, 1998b; Brenner et al, 2000). ANT-Bax channels (30 et 80pS) possessed an higher opening frequency than those formed by ANT (30pS) or by Bax alone (200pS). The selectivity of ANT-Bax channels was cationic, whereas Bax channel selectivity was anionic. Bcl-2, BA, ATP and

ADP, the natural ligands of ANT, closed the atractylosideelicited ANT-Bax channels (Marzo et al, 1998b; Brenner et al, 2000). Inactive mutants of Bax or Bcl-2, which reportedly have lost their apoptosis-modulatory function failed to affect the formation of channel by ANT (Marzo et al, 1998b; Brenner et al, 2000). It thus appears the ANT/Bax pair permeabilizes artificial lipid bilayers in response to an atractyloside-induced conformational change of ANT, whereas the ANT/Bcl-2 pair does not.

124

Gene Therapy and Molecular Biology Vol 6, page 125

The endogenous signals (pH alteration, ATP loss, and/or oligomerizationâ&#x20AC;Ś), which render ANT sensitive to Bax regulation in vivo remain elusive. Altogether, these results suggest that Bax and Bcl-2 can cooperate with ANT to convert it as a non-specific pore and to regulate MMP.

prevent thiol modification of ANT. These data indicate that thiol cross-linkers cause a covalent modification of ANT which, beyond any control by Bcl-2, leads to ANT pore opening, MMP and cell death. In contrast, tertbutylhydroperoxide (t-BHP), a ROS donor, was found to induce MMP and apoptosis in a fashion that was inhibited by Bcl-2 (Costantini et al, 2000). t-BHP also permeabilizes ANT proteoliposomes without causing Cys 56 oxidation, in a Bcl-2 inhibitable fashion. Previously, nitric oxide (NO), peroxynitrite and 4-hydroxynonenal (HNE) have been shown to induce physiological or pathological apoptosis via various mechanisms such as ceramide formation, induction of surface receptors for lethal ligands and presumably, MMP (Kristal et al, 1996; Hortelano et al, 1997; Nicotera et al, 1999). Recently, we found that these three agents induced MMP when added

B. Pro-oxidants Costantini et al showed that a series of different thiol cross-linking agents (diazenedicarboxylic acid bis 5N, Ndimethylamide (diamide), dithiodipyridine (DTDP), bismaleimido-hexane (BMH) and phenylarsine oxide) induced MMP and cell death irrespective of the expression level of Bcl-2 (Costantini et al, 2000). The same agents conferred a membrane permeabilization response when added to ANT-containing liposomes due to the oxidation of a critical cysteine residue (Cys 56) of ANT (Costantini et al, 2000). Concomitantly, recombinant Bcl-2 failed to

Figure 3. Experimental devices for the evaluation of the capacity of agents to convert ANT into a non-specific pore. ANT is purified from rat heart and reconstituted in phosphatidyl/cardiolipin liposomes (A) or planar lipid bilayers (B). Depending on the compound encapsulated in liposomes, the opening of ANT pore is detected by UV (the case of malate release), radioactivity (the case of radiolabelled compound release such as glucose) or fluorescence (the case of 4-methylumbelliferone, MU). The reconstitution of ANT in planar lipid bilayers allows the estimation of ANT channels activity by electrophysiology.

125

Belzacq et al: The adenine nucleotide translocator as a potential therapeutic target

to mitochondria (Vieira et al, 2001). In intact cells, MMP was prevented by overexpression of Bcl-2, vMIA or preincubation with CsA (Vieira et al, 2001). Moreover, NO, peroxynitrite and HNE permeabilize ANT-containing liposomes. These effects are partially inhibited by Bcl-2 in proteoliposomes. Depending on the inducer, some carbonylation (the case of NO donors), tyrosylnitrosylation (the case of NO donors and peroxynitrite), thiol derivatization of ANT (tha case of NO donors, HNE and peroxynitrite) or lipid peroxidation (peroxynitrite) were detected. This indicates that ANT can be one of the targets of NO, HNE and peroxynitrite.

D. Chemotherapeutic agents An increasing number of experimental chemotherapeutic agents induce apoptosis by directly triggering MMP (Costantini et al, 2000). Indeed, both in intact cells and in isolated mitochondria, MMP is induced by lonidamine (LND), an agent used in Phase II clinical trials for breast, ovarian, lung and colon cancers), arsenic trioxide (arsenite, a therapeutic agent for acute promyelocytic leukemia), betulinic acid (an agent which kills neuroectodermal cells), CD437 (a retinoid derivative which kills various cancer cell lines) and the photosensitizer verteporfin (an agent studied in phase I/II of melanoma treatment) (Fulda et al, 1998a, 1998b; Larochette et al, 1999; Marchetti et al, 1999; Ravagnan et al, 1999; Belzacq et al, 2001a). Cells overexpressing the cmv-encoded protein vMIA or the oncoprotein Bcl-2 were strongly protected against the MMP-inducing and apoptogenic effects of the four chemotherapeutic drugs, LND, arsenite, CD437 and verteporfin (Belzacq et al, 2001b). In ANT-containing liposomes, they induce the membrane permeabilization via the conversion of ANT into a non-specific channel (Belzacq et al, 2001b). The ANT-dependent membrane permeabilization is inhibited by the two ANT ligands ATP and ADP, as well as by recombinant Bcl-2 protein. Although LND, arsenite, CD437 and verteporfin could interact with other endogenous targets, ANT pore function can be modulated by these anticancer agents to induce apoptosis.

C. Viral proteins Viral protein R (Vpr) is an apoptogenic accessory protein encoded by HIV-1. Vpr has been shown to induce MMP via a specific interaction with PTPC (Jacotot et al, 2000). A synthetic Vpr-derived peptide (Vpr 52-96), corresponding to the C-terminal moiety of the protein, uncouples the respiratory chain and induces a rapid inner MMP to protons and NADH. This inner MMP preceded cytochrome c release. In isolated mitochondria, Vpr52-96 induces matrix swelling and inner MMP, which both are prevented by pre-incubation of mitochondria with recombinant Bcl-2 protein (Jacotot et al, 2001). Recently, we observed that Vpr52-96 and purified ANT cooperatively form large conductance channels in artificial membranes (ANT-containing liposomes or planar lipid bilayers) and that Vpr 52-96 specifically binds to the intermembrane face of the ANT with an affinity in the nanomolar range (Jacotot et al, 2001). This cooperative channel formation relies on a direct protein-protein interaction since it is abolished by the addition of a peptide corresponding to the Vpr binding site of ANT (amino acids 104-116). Bcl-2 inhibits channel formation by the ANT-Vpr complex in synthetic membranes and reduces the ANT-Vpr interaction, as determined by affinity purification and plasmon resonance studies (Jacotot et al, 2001). Accordingly, Vpr modulates MMP through a direct structural and functional interaction with ANT. Human cytomegalovirus (CMV) is a herpes virus that causes opportunistic infections in immunocompromised individuals. CMV inhibits apoptosis mediated by death receptors and encodes a viral mitochondria-localized inhibitor of apoptosis, namely vMIA, capable of suppressing apoptosis induced by diverse stimuli (Goldmacher et al, 1999). vMIA, inhibits Fas-mediated apoptosis at a point downstream of caspase8 activation and Bid cleavage but upstream of cytochrome c release. vMIA is localized in mitochondria and associates with ANT. These functional properties resemble those ascribed to Bcl-2. However, the absence of sequence similarity to Bcl-2 or any other known cell death suppressors suggests that vMIA defines a previously undescribed class of anti-apoptotic proteins preventing cell death by a direct interaction with ANT.

E. Lipids The genus Propionibacterium is composed of dairy and cutaneous bacteria which produce short-chain fatty acids (SCFA), mainly propionate and acetate, by fermentation. Recently, we showed that P. acidipropionici and freudenreichii, two species which can survive in the human intestine, can kill two human colorectal carcinoma cell lines by apoptosis (Jan et al, 2001). Propionate and acetate were identified as the major cytotoxic components secreted by these bacteria. Bacterial culture supernatants as well as pure SCFA induced typical signs of apoptosis including a loss of the "!m, generation of ROS, caspase3 processing, and nuclear chromatin condensation. Bcl-2 and vMIA, both inhibited cell death induced by SCFA, suggesting that mitochondria and ANT are involved in the cell death pathway (Jan et al, 2001). Accordingly, propionate and acetate induce mitochondrial swelling when added to purified mitochondria in vitro. Moreover, they specifically permeabilize ANT-containing proteoliposomes, indicating that ANT can mediate SCFAinduced apoptosis.

IV. ANT-related pathologies Circumstantial evidence has implicated ANT in several human pathologies.

126

Gene Therapy and Molecular Biology Vol 6, page 127

(Schultheiss et al, 1996; Dorner and Schultheiss, 2000). To elucidate the pathophysiological importance of these antibodies, they studied the function and the expression of ANT in the heart muscle tissue of these patients and observed a strongly lowered ADP/ATP transport capacity of the translocator accompanied by an elevation in total ANT protein content. The alteration in ANT protein amount resulted from an ANT isoform expression modification, i.e. an increase in ANT 1 isoform protein associated with a decrease in ANT 2 isoform and an unchanged ANT 3 content. Since it is known from enzymatic studies in yeast that ANT2 exchange rate is higher whose of ANT1 and ANT3, the isoform shift may explain the lowered capacity of the carrier expressed in the myocardial tissue of patients with dilated cardiomyopathy. This isoform shift was not a progressive process during the disease period but occurred early in the illness and became permanent. In contrast, ANT implication was not observed in patients suffering from ischemic or valvular heart diseases (Schultheiss et al, 1996; Dorner and Schultheiss, 2000). However, no clear explanation of the mechanism by which an antibody might affect the function of an integral membrane protein located in the mitochondrial IM has been proposed limiting the relevance of these observations.

A. Ophtalmoplegia Human ANT exists as three isoforms, which are encoded by distinct genes (Figure 5). The isoform 1 (ANT1) gene is located on the chromosome 4, band 4q35; the isoform 2 (ANT2) gene on chromosome X, band Xq24-q26 and the isoform 3 (ANT3) gene on chromosome X band Xp22.32. Kaukonen et al, (2000) identified a mutation of the ANT1 gene in which a transversion in exon 2, codon 114, produced an Ala#Pro substitution (Kaukonen et al, 2000). The associated disease was found to be an autosomal dominant progressive ophtalmoplegia, characterized by exercise intolerance mimicking mitochondrial myopathy, proliferation of mitochondria and reduced rates of mitochondrial ADP-stimulated repiration. Despite the absence of genealogical confirmation, this study suggested a founder mutation and common ancestry (Kaukonen et al, 2000). All these symptoms were previously observed in mice with targeted inactivation of ANT1 which, in addition, manifest an hypertrophic cardiomyopathy and multiple deletions of mitochondrial DNA (Graham et al, 1997).

B. Cardiomyopathies In several long-term investigations, Shultheiss and Dรถrner, found autoantibodies against the ANT in sera of patients with myocarditis and dilated cardiomyopathy

Figure 4. Regulation of ANT functions. ANT is a bifunctional protein, a physiologic ADP/ATP translocator and a pro-apoptotic pore. Atractyloside, Ca2+, Bax, thiol cross-linkers, reactive oxygen donors (ROS), Vpr from HIV-1, short-chain fatty acids, or chemotherapeutic agents such as lonidamine, arsenic trioxide, CD437, or verteporfin can convert ANT into a non-specific pore. In contrast, bongkrekic acid (BA), Bcl-2, vMIA, a cytomegalovirus-encoded protein, the peptide ANT104-116, ATP and ADP, inhibit the pore formation.

127

Belzacq et al: The adenine nucleotide translocator as a potential therapeutic target

Figure 5. Alignement of the three human isoforms of ANT. The primary sequences alignement of the three isoforms of ANT has been obtained using the software CLUSTAL W 1.74 multiple sequence alignment. Amino acids 105-156, which correspond to the binding site of Bax and Bcl-2 to ANT are underlined. Similarly, Cys 56 which is cross-linked by prooxidants such as diamide, BMH and DTDP is underlined. The localization of the six putative transmembrane helices of ANT is indicated in bold.

C. Cancer

D. Aging

The investigation of the gene regulation encoding for the proteins involved in energy metabolism in cancer cells (a cell carcinoma, an oncocytoma, and urothelial tumors at two different stages) showed that different transcript patterns of ANT were observed in each of the tumoral and transformed cell lines. According to authors hypothesis, this could explain the difference in metabolism between the different tumors and the tumoral or transformed cell lines (Faure-Vigny et al, 1996, Heddi et al, 1996). In particular, a high transcript level for the ANT2 gene, which is usually not expressed in differentiated cells, was detected in oncocytoma and malignant urothelial renal tumor. This phenomenon was also shown in renal carcinoma cell lines and transformed cells. These data argued for the involvement of the ANT2 protein in glycolytic ATP uptake in cancer cell mitochondria. Subsequently, the growth-dependence expression of the ANT2 gene in mouse embryo fibroblasts was demonstrated to be regulated at the level of transcription and proposed as a marker of cell proliferation (Barath et al, 1999a, 1999b). If confirmed by additional studies, these results may open the way to an ANT2 antisense strategy for cancer therapy.

It is well known that mitochondria are main targets for aging-associated oxidative damage resulting in significant function loss (Salvioli et al, 2001). Indeed, during progressive aging, alterations accumulate at organism and cellular levels, molecular impairments affecting notably oxidative energy metabolism, i.e. the oxidative phosphorylation and the ADP/ATP translocation. Thus, Nohl et al observed that rat heart mitochondria from 30-month-old animals are 40% less active in translocating adenine nucleotides across the inner membrane than 3-month-old rats although the number of sites available for binding the specific ligands to the adenine nucleotide carrier were unchanged during aging (Nohl and Kramer, 1980, Nohl, 1982). In addition, the endogenous pool of the adenine nucleotides exhibited an age-dependent fall by more than 25%, essentially at the expense of ATP. Furthermore, Yan and Sohal identified an increase in carbonyl content of ANT after exposure of housefly flight muscles to 100% oxygen or during aging (Yan and Sohal, 1998). The oxygen-related damage appeared to be selective of ANT within mitochondrial membrane proteins and accompanied by loss of functional activity suggesting that ANT was altered by the aging process, at least, in the house fly. More recently, Rottenberg et al found that aging increases the

128

Gene Therapy and Molecular Biology Vol 6, page 129

susceptibility to calcium-dependent cell death in the brain, liver, and possibly other murine tissues via a facilitated activation of PTPC opening (Mather and Rottenberg, 2000). However, these observations still await for a confirmation in human models to identify the human ANT as an aging target.

Association pour la Recherche sur le Cancer (to C.B.), and French Ministry of Science (to C.B. and F.V.). A-S. B. received a Fondation pour la Recherche Médicale fellowship. H.L.A. V. receives a fellowship from the Fundação para a Ciência e a Tecnologia PRAXIS XXI, Portugal.

V. Conclusion and perspectives

References

Identification of new targets for drug development of molecules having the capacity to modulate apoptosis has become possible due to the unraveling of basic apoptosis mechanisms. Thus, MMP has been recently recognized as a central rate-limiting step of apoptosis and its study has led to the identification of ANT as a potential therapeutic target (Kroemer and Reed, 2000, Vieira et al, 2000). Indeed, ANT is a bi-functional protein, which can trigger MMP by forming a non-specific lethal pore under the control of the Bax/Bcl-2 family members (Vieira et al, 2000). The opening of the ANT pore causes water and ion movements across the IM, loss of the "!m, swelling of the mitochondrial matrix and release of intermembrane proteins through the OM. These events activate the coordination of downstream degradation pathways culminating in cell. In vitro, ANT can respond to multiple stimuli and can be a direct target for agents affecting its pore forming activity, as diverse as proteins, lipids, ions, or chemotherapeutic agents (Brenner et al, 2000, Costantini et al, 2000, Belzacq et al, 2001a, 2001b; Jan et al, 2001; Vieira et al, 2001). This suggests that various molecules may modulate ANT pore function in a therapeutic perspective. Therefore, the success of ANT-based drug discovery will require the identification of molecules capable of converting ANT into a non-specific pore, but without affecting the physiological function of ANT, i.e. the ATP/ADP translocation. ANT has been involved in various human pathologies, due to mutations, deficient expression or acquired loss-of-function. This suggests that ANT could be a candidate for gene therapy to correct defects at the transcription level or to re-introduce a functional gene to preserve cells. Various therapeutic strategies based on proteins belonging to the apoptosis core machinery (Bcl-2, TNF-family death ligand TRAIL, caspases …etc) are already in preclinical phases studies (Huang and Oliff, 2001; Reed, 2001). Next advances will determine whether ANT can serve to create a new class of drugs such as small molecules, peptidomimetics or anti-sense oligonucleotides, modulating apoptosis via an action on the ANT pore function.

Barath P, Albert-Fournier B, Luciakova K, Nelson BD (1999) Characterization of a silencer element and purification of a silencer protein that negatively regulates the human adenine nucleotide translocator 2 promoter J Biol Chem 274, 337884 Barath P, Luciakova K, Hodny Z, Li R, Nelson BD (1999) The growth-dependent expression of the adenine nucleotide translocase-2 (ANT2) gene is regulated at the level of transcription and is a marker of cell proliferation Exp Cell Res 248, 583-8 Belzacq A, El Hamel C, Vieira HLA, Cohen I, Haouzi D, Métivier D, Marchetti P, Goldmacher V, Brenner C, Kroemer G (2001a) Apoptosis induction by the photosensitizer verteporfin: identification of mitochondrial adenine nucleotide translocator as a critical target Cancer Res 61, 1260-4 Belzacq AS, Jacotot E, Vieira HL, Mistro D, Granville DJ, Xie Z, Reed JC, Kroemer G, Brenner C (2001b) Adenine Nucleotide Translocator Mediates the Mitochondrial Membrane Permeabilization Induced by Lonidamine, Arsenite and CD437. Oncogene in press. Bernardi P (1996) The permeability transition pore. Control points of a cyclosporin A-sensitive mitochondrial channel involved in cell death Biochim Biophys Acta 1275, 5-9 Beutner G, Rück A, Riede B, Welte W, Brdiczka D (1996) Complexes between kinases, mitochondrial porin, and adenylate translocator in rat brain resemble the permeability transition pore FEBS Lett. 396, 189-195 Brenner C, Cadiou H, Vieira HL, Zamzami N, Marzo I, Xie Z, Leber B*rews D, Duclohier H, Reed JC, Kroemer G (2000a) Bcl-2 and Bax regulate the channel activity of the mitochondrial adenine nucleotide translocator Oncogene 19, 329-36 Brenner C, Kroemer G (2000b) Apoptosis. Mitochondria--the death signal integrators Science 289, 1150-1 Brenner C, Marzo I, de Araujo Vieira HL, Kroemer G (2000c) Purification and liposomal reconstitution of permeability transition pore complex Methods Enzymol 322, 243-52 Cao G, Minami M, Pei W, Yan C, Chen D, O'Horo C, Graham SH, Chen J (2001) Intracellular bax translocation after transient cerebral ischemia: implications for a role of the mitochondrial apoptotic signaling pathway in ischemic neuronal death J Cereb Blood Flow Metab 21, 321-33. Costantini P, Belzacq AS, Vieira HL, Larochette N, de Pablo MA, Zamzami N, Susin SA, Brenner C, Kroemer G (2000) Oxidation of a critical thiol residue of the adenine nucleotide translocator enforces Bcl-2-independent permeability transition pore opening and apoptosis Oncogene 19, 307-14 Costantini P, Jacotot E, Decaudin D, Kroemer G (2000) Mitochondrion as a novel target of anticancer chemotherapy J Natl Cancer Inst. 92, 1042-1053 Crompton M (1999) The mitochondrial permeability transition pore and its role in cell death Biochem J 341, 233-249 Dorner A, Schultheiss HP (2000) The myocardial expression of

Acknowledgements This work has been supported by a special grant from the French National League against Cancer as well as grants from Agence Nationale pour la Recherche sur le SIDA, and European Commission (to G.K.), Fondation pour la Recherche Médicale (to G. K., and C. B.),

129

Belzacq et al: The adenine nucleotide translocator as a potential therapeutic target

the adenine nucleotide translocator isoforms is specifically altered in dilated cardiomyopathy Herz 25, 176-80. Faure Vigny H, Heddi A, Giraud S, Chautard D, Stepien G (1996) Expression of oxidative phosphorylation genes in renal tumors and tumoral cell lines Mol Carcinog 16, 16572. Feldmann G, Haouzi D, Moreau A, Durand-Schneider AM, Bringuier A, Berson A, Mansouri A, Fau D, Pessayre D (2000) Opening of the mitochondrial permeability transition pore causes matrix expansion and outer membrane rupture in Fas-mediated hepatic apoptosis in mice Hepatology 31, 67483. Fulda S, Scaffidi C, Susin SA, Krammer PH, Kroemer G, Peter ME, Debatin KM (1998b) Activation of mitochondria and release of mitochondrial apoptogenic factors by betulinic acid J Biol Chem 273, 33942-8 Fulda S, Susin SA, Kroemer G, Debatin KM (1998a) Molecular ordering of apoptosis induced by anticancer drugs in neuroblastoma cells Cancer Res 58, 4453-60 Goldmacher VS, Bartle LM, Skaletskaya A, Dionne CA, Kedersha NL, Vater CA, Han J, Lutz RJ, Watanabe S, McFarland ED, Kieff ED, Mocarski ES, Chittenden T ( 1999) A cytomegalovirus-encoded mitochondria-localized inhibitor of apoptosis structurally unrelated to Bcl-2 Proc Natl Acad Sci U S A 96, 12536-41 Graham BH, Waymire KG, Cottrell B, Trounce IA, MacGregor GR, Wallace DC (1997) A mouse model for mitochondrial myopathy and cardiomyopathy resulting from a deficiency in the heart/muscle isoform of the adenine nucleotide translocator Nat Genet 16, 226-34. Granville DJ, Hunt DW (2000) Porphyrin-mediated photosensitization-Taking the apoptosis fast lane Curr Opin in Drug Disc Dev 3, 232-243 Green DR, Reed JC (1998) Mitochondria and apoptosis Science 281, 1309-1312 Haouzi D, Lekehal M, Tinel M, Vadrot N, Caussanel L, Letteron P, Moreau A, Feldmann G, Fau D, Pessayre D (2001) Prolonged, but not acute, glutathione depletion promotes Fas-mediated mitochondrial permeability transition and apoptosis in mice Hepatology 33, 1181-8. Harris MH, Thompson CB (2000) The role of the Bcl-2 family in the regulation of outer mitochondrial membrane permeability Cell Death Differ 7, 1182-91. Heddi A, Faure-Vigny H, Wallace DC, Stepien G (1996) Coordinate expression of nuclear and mitochondrial genes involved in energy production in carcinoma and oncocytoma Biochim Biophys Acta 1316, 203-9. Hortelano S, Dallaporta B, Zamzami N, Hirsch T, Susin SA, Marzo I, Bosca L, Kroemer G (1997) Nitric oxide induces apoptosis via triggering mitochondrial permeability transition FEBS Letters 410, 373-377 Huang PS, Oliff A (2001) Signalliing pathways in apoptosis as potential targets for cancer therapy Trends Cell Biol 11, 343-348. Jacotot E, Ferri KF, El Hamel C, Brenner C, Druillennec S, Hoebeke J, Rustin P, Metivier D, Lenoir C, Geuskens M, Vieira HL, Loeffler M, Belzacq AS, Briand JP, Zamzami N, Edelman L, Xie ZH, Reed JC, Roques BP, Kroemer G (2001) Control of Mitochondrial Membrane Permeabilization by Adenine Nucleotide Translocator Interacting with HIV-1 Viral Protein R and Bcl-2 J Exp Med 193, 509-520. Jacotot E, Ravagnan L, Loeffler M, Ferri KF, Vieira HL, Zamzami N, Costantini P, Druillennec S, Hoebeke J, Briand JP, Irinopoulou T, Daugas E, Susin SA, Cointe D, Xie ZH,

Reed JC, Roques BP, Kroemer G (2000) The HIV-1 viral protein R induces apoptosis via a direct effect on the mitochondrial permeability transition pore J Exp Med 191, 33-46 Jan G, Belzacq A, Haouzi D, ARouault A, MĂŠtivier D, Kroemer G, Brenner C (2001) Propionibacteria induce apoptosis of colorectal carcinoma cells via short-chain fatty acids acting on mitochondria. Cell Death Diff in press. Joza N, Susin SA, Daugas E, Stanford WL, Cho SK, Li CY, Sasaki T, Elia AJ, Cheng HY, Ravagnan L, Ferri KF, Zamzami N, Wakeham A, Hakem R, Yoshida H, Kong YY, Mak TW, Zuniga-Pflucker JC, Kroemer G, Penninger JM (2001) Essential role of the mitochondrial apoptosis-inducing factor in programmed cell death Nature 410, 549-54. Kaukonen J, Juselius JK, Tiranti V, Kyttala A, Zeviani M, Comi GP, Keranen S, Peltonen L, Suomalainen A (2000) Role of adenine nucleotide translocator 1 in mtDNA maintenance Science 289, 782-5 Kristal BS, Park BK, Yu BP (1996) 4-Hydroxyhexenal is a potent inducer of the mitochondrial permeability transition J. Biol. Chem. 271, 6033-6038 Kroemer G, Reed JC (2000) Mitochondrial control of cell death Nat Med 6, 513-9 Kroemer G, Zamzami N, Susin SA (1997) Mitochondrial control of apoptosis Immunol Today 18, 44-51 Larochette N, Decaudin D, Jacotot E, Brenner C, Marzo I, Susin SA, Zamzami N, Xie Z, Reed J, Kroemer G (1999) Arsenite induces apoptosis via a direct effect on the mitochondrial permeability transition pore Exp Cell Res 249, 413-21 Marchetti P, Zamzami N, Joseph B, Schraen-Maschke S, Mereau-Richard C, Costantini P, Metivier D, Susin SA, Kroemer G, Formstecher P (1999) The novel retinoid 6-[3(1-adamantyl)-4-hydroxyphenyl]-2-naphtalene carboxylic acid can trigger apoptosis through a mitochondrial pathway independent of the nucleus Cancer Res 59, 6257-66 Marzo I, Brenner C, Zamzami N, Jurgensmeier JM, Susin SA, Vieira HLA, Prevost MC, Xie Z, Matsuyama S, Reed JC, Kroemer G (1998b) Bax and Adenine Nucleotide Translocator Cooperate in the Mitochondrial Control of Apoptosis Science 281, 2027-2031 Marzo I, Brenner C, Zamzami N, Susin SA, Beutner G, Brdiczka D, Remy R, Xie ZH, Reed JC, Kroemer G (1998a) The permeability transition pore complex: a target for apoptosis regulation by caspases and bcl-2-related proteins J Exp Med 187, 1261-71 Mather M, Rottenberg H (2000) Aging enhances the activation of the permeability transition pore in mitochondria Biochem Biophys Res Commun 273, 603-8. Nicotera P, Bernassola F, Melino G (1999) Nitric oxide (NO), a signaling molecule with a killer soul Cell Death Diff 6, 931933 Nohl H (1982) Age-dependent changes in the structure-function correlation of ADP/ATP-translocating mitochondrial membranes Gerontology 28, 354-9. Nohl H, Kramer R (1980) Molecular basis of age-dependent changes in the activity of adenine nucleotide translocase Mech Ageing Dev 14, 137-44. Parrish J, Li L, Klotz K, Ledwich D, Wang X, Xue D (2001) Mitochondrial endonuclease G is important for apoptosis in C. Elegans Nature 412, 90-94 Pfaff E, Klingenberg M (1968) Adenine nucleotide translocation of mitochondria. 1. Specificity and control Eur J Biochem 6, 66-79. Pfaff E, Heldt HW, Klingenberg M (1969) Adenine nucleotide

130

Gene Therapy and Molecular Biology Vol 6, page 131

translocation of mitochondria. Kinetics of the adenine nucleotide exchange Eur J Biochem 10, 484-93. Ravagnan L, Marzo I, Costantini P, Susin SA, Zamzami N, Petit PX, Hirsch F, Goulbern M, Poupon MF, Miccoli L, Xie Z, Reed JC, Kroemer G (1999) Lonidamine triggers apoptosis via a direct, Bcl-2-inhibited effect on the mitochondrial permeability transition pore Oncogene 18, 2537-46 Reed JC (2001) Apoptosis-regulating proteins as targets for drug discovery Trends Mol Med 7, 314-9. Salvioli S, Bonafe M, Capri M, Monti D, Franceschi C (2001) Mitochondria, aging and longevity--a new perspective FEBS Lett 492, 9-13. Schultheiss HP, Schulze K, Dorner A (1996) Significance of the adenine nucleotide translocator in the pathogenesis of viral heart disease Mol Cell Biochem 163-164, 319-27. Sullivan PG, Thompson MB, Scheff SW (1999) Cyclosporin A attenuates acute mitochondrial dysfunction following traumatic brain injury Exp Neurol 160, 226-234 Susin SA, Lorenzo HK, Zamzami N, Marzo I, Brenner C, Larochette N, Prevost MC, Alzari PM, Kroemer G (1999) Mitochondrial release of caspase-2 and -9 during the apoptotic process J Exp Med 189, 381-393 Thompson CB (1995) Apoptosis in the pathogenesis and treatment of disease Science 267, 1456-62 Verhagen AM, Ekert PG, Pakusch M, Silke J, Connolly LM, Reid GE, Moritz RL, Simpson RJ, Vaux DL (2000) Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins Cell 102, 43-53. Vieira HL, Belzacq AS, Haouzi D, Bernassola F, Cohen I, Jacotot E, Ferri KF, El Hamel C, Bartle LM, Melino G, Brenner C, Goldmacher V, Kroemer G

(2001) The adenine nucleotide translocator: a target of nitric oxide, peroxynitrite, and 4-hydroxynonenal Oncogene 20, 4305-16. Vieira HL, Haouzi D, Hamel CE, Jacotot E, Belzacq AS, Brenner C, Kroemer G (2000) Permeabilization of the mitochondrial inner membrane during apoptosis: impact of the adenine nucleotide translocator Cell Death Differ 7, 1146-1154. Voehringer DW, Meyn RE (2000) Redox aspects of Bcl-2 function Antioxid Redox Signal 2, 537-50. Von Ahsen O, Waterhouse NJ, Kuwana T, Newmeyer DD, Green DR (2000) The 'harmless' release of cytochrome c Cell Death Differ 7, 1192-9. Yan L, Sohal R (1998) Mitochondrial adenine nucleotide translocase is modified oxidatively during aging Proc Natl Acad Sci U S A 95, 12896-12901 Zamzami N, Hamel CE, Maisse C, Brenner C, Munoz-Pinedo C, Belzacq AS, Costantini P, Vieira H, Loeffler M, Molle G, Kroemer G (2000) Bid acts on the permeability transition pore complex to induce apoptosis Oncogene 19, 6342-6350. Zamzami N, Marchetti P, Castedo M, Decaudin D, Macho A, Hirsch T, Susin SA, Petit PX, Mignotte B, Kroemer G (1995) Sequential reduction of mitochondrial transmembrane potential and generation of reactive oxygen species in early programmed cell death J. Exp. Med. 182, 367-377 Zoratti M, Szabo I (1995) The mitochondrial permeability transition Biochim Biophys Acta 1241, 139-76

131

Belzacq et al: The adenine nucleotide translocator as a potential therapeutic target

132

Gene Therapy and Molecular Biology Vol 6, page 133

Gene Ther Mol Biol Vol 6, 133-141, 2001

Reticuloendotheliosis virus-derived vectors for human gene therapy Review Article

Ralph Dornburg The Dorrance H. Hamilton Laboratories, Center for Human Virology, Division of Infectious Diseases, Jefferson Medical College. Thomas Jefferson University, Jefferson Alumni Hall, 1020 Locust Street, Room 329, Philadelphia, PA 19107 _________________________________________________________________________________________________ *Correspondence: Ralph Dornburg, The Dorrance H. Hamilton Laboratories, and Center for Human Virology, Division of Infectious Diseases, Jefferson Medical College. Thomas Jefferson University, Jefferson Alumni Hall, 1020 Locust Street, Room 329, Philadelphia, PA 19107. phone: 215-503-3117; fax: 215-923-1956; e-mail: ralph.dornburg@mail.tju.edu Key words: spleen necrosis virus, reticuloendotheliosis virus, retroviral vectors, helper cells, gene therapy Abbreviations: 3'-azido-3'-deoxythymidine, (AZT); American Type Culture Collection, (ATCC); avian leukemia virus, (ALV); colony units per ml, (cfu/ml); deoxyribonucleoside triphosphate, (dNTP); gibbon ape leukemia virus, (GaLV); internal ribosomal entry site, (IRES); long terminal repeats, (LTRs); murine leukemia virus, (MLV); nuclear localization sequence, (NLS); nucleocapsid, (NC); replication competent retroviruses, (RCR); reticuloendotheliosis virus strain-A, (REV-A); reticuloendotheliosis viruses, (REV); simian retroviruses, (SRVs); single chain antibody, (scA); Spleen necrosis virus, (SNV); vesicular stomatitis virus, (VSV); vesicular stomatitis virus, (VSV) Received: 25 September 2001, accepted: 4 October 2001; electronically published: February 2004

Summary Spleen necrosis virus (SNV) and reticuloendotheliosis virus strain-A (REV-A) belong to the family of avian reticuloendotheliosis viruses (REV). These amphotropic retroviruses infect a large variety of cells of avian and some mammalian species. SNV or REV-A with wild-type envelope does not infect human cells. However, they efficiently infect and integrate their genome into that of human cells when they are pseudotyped with the envelope protein of other mammalian retroviruses or the G protein of vesicular stomatitis virus (VSV). Moreover, SNV-derived retroviral vectors, which display single chain antibodies on the viral surface, enable cell-type-specific gene delivery into various human cells. In particular, the SNV cell-type-specific gene delivery vector system appears to be very well suited to transduce genes into cells of the human hematopoietic system. Moreover, my laboratory has developed genetically engineered SNV vectors, which are capable of infecting non-dividing cells such as quiescent human T-cells and primary monocyte-derived macrophages. Thus, REV-derived vectors appear to be very interesting candidates for the development of vectors for human gene therapy. The biology, genomic organization, and replication of these viruses have been reviewed in detail previously (Dornburg, 1995). Thus, this review focuses on the recent progress in the developments of REV-derived vectors for gene transfer into human cells. human cells for many years. In fact, the finding that REVs are unable to infect human cells led to the vigorous development of MLV-derived vectors for gene transfer into human cells. However, protein sequence comparisons revealed that the envelope proteins of REVs are more closely related to that of D-type retroviruses such as simian retroviruses (SRVs) than to that of MLVs. Further it has been suggested that SNV uses the same receptor for viral entry as SRVs (Kewalramani et al, 1992; Koo et al, 1992). Moreover, Koo et al. reported that vectors produced by an REV-A derived packaging cell line (termed D17.2G) are able to efficiently infect human cells

I. REV morphology and host range Reticuloendotheliosis viruses are avian C-type retroviruses which are more closely related to mammalian C-type retroviruses than to other avian retroviruses belonging to the avian leukemia / sarcoma virus group (Dornburg, 1995). E.g., the genomic organization of REV proviruses is simple and similar to that of murine leukemia virus (MLV). However, electron micrographs of SNVderived vectors reveal that REVs contain a hectameric core different from that of mammalian C-type retroviruses (Figure 1). REVs have been considered to be not infectious in

133

Dornburg: Development of REV-derived vectors for human gene therapy

(Koo et al, 1991). In contrast, similar experiments performed with vectors produced from an SNV-derived packaging cell line (termed DSH134G, ref (Martinez and Dornburg, 1995)) led to opposite conclusions (Chu and Dornburg, 1995, 1997; Jiang et al, 1998; Engelstadter et al, 2000). These contradictory findings recently prompted the reevaluation of the tropism of REVs. A systematic comparison of the tropism of REV vectors produced by two REV-A derived and two SNV derived packaging cell lines revealed that only vectors produced from the D17.2G packaging line displayed the capacity to infect 15 different human cell lines or primary cultures. However, none of these human cells could be infected by vector viruses harvested from the three other packaging lines. FACS analysis and immunocytochemical approaches revealed that D17.2G cells used in these studies express and produce an amphotropic MLV envelope. Moreover, fresh D17.2G helper cells obtained from the American Type Culture Collection (ATCC) and which had been deposited soon after D17.2G cells had been constructed did not produce vector virus capable of infecting human cells (Gautier et al, 2000). These recent results clearly demonstrate that REV-A or SNV are not capable of infecting human cells and that D17.2G helper cells used in infectivity studies of human cells were contaminated with an ampho-MLV of unknown origin (Gautier et al, 2000). However, these data also show that REVs can be pseudotyped with the envelope protein of other retroviruses such as MLV. My laboratory has found that SNV-derived vectors can not only be efficiently

pseudotyped with the envelope of MLV, but also that of gibbon ape leukemia virus (GaLV) or the G protein of vesicular stomatitis virus (VSV) (Parveen et al, manuscript in preparation). Recently, a cDNA has been identified, which appears to code for a cell surface protein, which is used as a receptor for feline endogenous retrovirus RD114 and all strains of simian immunosuppressive type D retroviruses (Rasko et al, 1999). The cloned cDNA, which has been denoted RDR, is an allele of a previously cloned neutral amino acid transporter termed ATB0. Both RDR and ATB0 serve as retrovirus receptors and both act as transporters of neutral amino acids. However, in the light that REVs are not infectious in human cells, it will be interesting to test whether either one of these receptors is also utilized by SNV or whether the failure of SNV to infect human cells is due to the lack of an additional coreceptor.

II. Genome and replication The molecular biology and replication of REVs has been reviewed in detail previously (Dornburg, 1995; Witter, 1997; Fadly, 1997). Briefly, the genomes of REVs code only for structural proteins which are necessary for retroviral particle formation and replication and no genes coding for accessory or regulatory proteins have been described (Figure 2). However, recent investigations indicate that SNV contains several unique cis-acting

Figure 1. Electron micrograph of retroviral vector particles.derived from spleen necrosis virus, SNV

134

Gene Therapy and Molecular Biology Vol 6, page 135

constructs allowing homologous recombinations, which ultimately led to the generation of RCR. However, this problem has been addressed by the construction of gag-pol and env gene expression vectors which have no homology to the retroviral gene transduction vector (Martinez and Dornburg, 1995, 1996). In fact, the retroviral packaging line DSH134G (Martinez and Dornburg, 1995) has now been kept in tissue culture since 1994 and remained free of RCR over the past six years (Figure 2, Martinez and Dornburg, 1996, and unpublished data). Retroviral vector titers obtained from the DSH134G helper cells, which produced a vector transducing the bacterial beta-galactosidase gene were about 106 to 5 x 10e6 colony units per ml supernatant medium (cfu/ml) and could be increased by concentration through ultrafiltration to up to 10e8 cfu/ml (Chu and Dornburg, 1997). My laboratory found that the level of gag-pol expression in the packaging cell was the major limiting step in reaching high vector virus titers (Martinez and Dornburg, 1995). Further, it has been shown that chimeric SNV viruses which contained the gag region of REV-A infected mammalian cells at least ten times more efficiently that wild-type SNV (Casella and Panganiban, 1993). We recently constructed novel gag-pol gene expression vectors, which contain gag of REV-A and pol of SNV. Preliminary data indicate that vector virus titers can be increased up to 100-fold using such constructs (Krupetski et al, unpublished observation). It has been reported earlier that SNV can efficiently encapsidate MLV-based vectors, but not vice versa (Embretson and Temin, 1987). Using chimeric gag-pol expression constructs and a competitive packaging system, it has been shown recently that Gag is solely responsible for the selection of viral RNAs. Furthermore, the nucleocapsid (NC) domain in the SNV Gag is responsible for its ability to interact with both the SNV encapsidation sequence (E) and that of MLV (termed Psi). However, MLV proteins cannot efficiently package SNV-based vector RNA. Replacement of the SNV NC with the MLV NC generated a chimeric Gag that could not package SNV RNA but retained its ability to package MLV RNA. Moreover, a construct combining the SNV gag and the MLV pol gene supported the replication of SNV gag and the MLV pol gene supported the replication of both MLV and SNV vectors, indicating that the gag and pol gene products from these two different retroviruses can functionally cooperate. However, viral titer data suggest that SNV cis-acting elements are not ideal substrates for MLV pol gene products since infectious viruses were generated at a lower efficiency (Yin and Hu, 1997; Certo et al, 1998, 1999).

elements, which compensate for the lack of accessory proteins involved in RNA nuclear export and/or translation. E.g., it has been reported that SNV long terminal repeats (LTRs) are associated with Rex/Rexresponsive element-independent expression of bovine leukemia virus RNA and it has been hypothesized that SNV RNA contains a cis-acting element that interacts with cellular Rex-like proteins (Boris-Lawrie and Temin, 1995). Recent data indicate that sequences located in the 5â&#x20AC;&#x2122; RU3 region contain a cis-acting posttranscriptional control element that interacts with hypothetical REV-like proteins to facilitate RNA nuclear export and efficient translation (Butsch et al, 1999). It has also been reported that an internal ribosomal entry site (IRES) is present within the 5' leader of avian reticuloendotheliosis virus type A (REV-A) genomic RNA. This IRES element was located downstream of the packaging / dimerization (E/DLS) sequence and the minimal IRES sequence appears to be within a 129 nt fragment (nucleotides 452580) immediately upstream of the gag AUG codon (Lopez-Lastra et al, 1997). The REV-A IRES has been successfully used in the construction of novel high titer MLV-based retroviral vectors, containing IRES elements. Sequences downstream of the envelope gene appear to be evolved in the regulation of Env translation (Yin and Hu, 1999). However, the SNV Env protein can be efficiently expressed without such downstream sequences in standard eucaryotic gene expression vectors (Martinez and Dornburg, 1995).

III. Retroviral packaging lines and vectors derived from REVs REV-A and SNV were the first retroviruses from which a retroviral vector system has been derived (Watanabe and Temin, 1983). Due to the fact that REV-A and SNV are closely related (90% sequence homology) and that parts of their genome are interchangeable, the first vector systems consisted of parts derived from both viruses. [Earlier REV-derived vector systems are described in detail elsewhere (Dornburg, 1995)]. However, due to earlier findings that REVs do not infect human cells, REV-derived vectors have been used mainly to study various aspects of retroviral replication, such as retroviral recombination, mutation rates, transduction of cellular genes (pseudogene formation), the generation of transgenic chicken, and much more. As MLV-based vectors became the standard retroviral vectors for human gene therapy, no specific vectors for human gene therapy applications have been developed from REVs. The first generation of REV-derived packaging cells spontaneously released replication competent retroviruses (RCR), which arose by recombination between the retroviral vector and DNA constructs expressing the retroviral structural protein (Hu et al, 1987). In such early packaging lines, there were considerable stretches of sequence homology among the different plasmid

IV. Stability and recombination of REV-derived vectors Retroviral particles contain two identical RNA genomes, which recombine with rather high frequencies. Moreover, the retroviral enzyme reverse transcriptase

135

Dornburg: Development of REV-derived vectors for human gene therapy

appears to lack faithful proof-reading functions and mutations are introduced into the retroviral genome at each cycle of replication with a rather high frequency. SNV-based vectors served as the first system to study retroviral mutation rates and recombination (Hu and Temin, 1990a, 1990b; Pathak and Temin, 1990; Dougherty and Temin, 1991). In the past years, SNV vector systems have been used extensively to further quantitatively determine these processes in vitro and in vivo. Using SNV-based vector systems, the mutation rate of SNV has been investigated in great detail. It has been found that the SNV reverse transcriptase incorporates approximately one wrong nucleotide per 10,000 bases (Dougherty and Temin, 1986, 1988; Pathak and Temin, 1990). Similar mutation rate studies have been expanded recently and various factors influencing the mutation rate, e.g., deoxyribonucleoside triphosphate (dNTP) pool imbalances, and the presence of nucleotide analogs, have been studied in detail. It has been found that deoxyribonucleoside triphosphate (dNTP) pool imbalances are associated with an increase in the rate of misincorporation and hypermutation during in vitro reverse transcription reactions approximately 4-fold. In addition, 3'-azido-3'-deoxythymidine (AZT) also increases the retroviral mutation rates by a mechanism not involving

alterations in dNTP pools (Pathak and Temin, 1992; Kim et al, 1996; Julias et al, 1997; Julias and Pathak, 1998). Reverse transcription involves at least two cDNA transfer reactions to produce a full-length DNA copy of the retroviral RNA genome. Since one retrovirus particle contains two identical RNA genomes, the transfers can occur in an intramolecular or intermolecular manner. The mechanism of the first transfer step (minus-strand strongstop cDNA transfer) has been studied previously in detail with spleen necrosis virus vectors containing genetic markers. Different results have been reported with respect to the type of strand transfer mechanism (Hu and Temin, 1990b). Overall the homologous recombination rate in one retroviral replication cycle has been determined to be 4% for markers 1.0 kb apart. These results led to the calculation that approximately 30 to 40% of the replication-competent viruses with 7- to 10-kb genomes undergo one recombination event. However, these estimates were based on the assumption that recombination occurs randomly in a linear manner. Recent similar studies indicate that the recombination rate increases when the marker distance increases from 1.0 to 1.9 kb. However, the recombination rates with marker distances of 1.9 and 7.1 kb appear not to be significantly different. Thus, retroviral recombination appears not to be

Figure 2. Constructs to build a SNV-derived retroviral packaging cell line. A SNV provirus is shown at the top. SNV (and REV-A) express gag-pol proteins from genomic RNA and Env from a spliced mRNA (sd: splice donor site; sa: splice acceptor site). The reading frames of gag-pol and env overlap by about 160 bases. The encapsidation sequence (E) does not extent into gag and the env gene does not overlap with 3â&#x20AC;&#x2122; regulatory sequences. Thus, packaging cells can be constructed which express retroviral gag-pol and env proteins without sequence homology to retroviral vectors transducing non-retroviral genes (bottom) (Martinez and Dornburg, 1995). pRD136 and pRD134 are plasmid constructs to express gag-pol or env proteins, respectively, and have ben used to make the retroviral packaging line DSH134G (Martinez and Dornburg, 1995). In both constructs, the retroviral proteins are expressed from the murine leukemia virus promoter (MLV-U3pro) followed by the adenovirus tripartite leader sequence (AVtl) for enhanced translation. SV40poly(A): polyadenylation signal sequence of simian virus 40.

136

Gene Therapy and Molecular Biology Vol 6, page 137

et al, 1996). My group has performed extensive studies using the envelope of SNV (Chu et al, 1994; Chu and Dornburg, 1995, 1997; Jiang et al, 1998, 1999). Stephen Russell in Greg Winterâ&#x20AC;&#x2122;s laboratory and my laboratory were the first groups which developed retroviral vector particles that display the antigen binding site of an antibody on the viral surface (Russell et al, 1993; Chu et al, 1994). This has been achieved using single chain antibody (scA) technology (Figure 3). First, using hapten model systems, Dr. Russell and our group were able to show that such particles are competent for infection (Russell et al, 1993; Chu et al, 1994). Using SNV retroviral vectors and a scA directed against a human CEA-related cell surface protein (B6.2), we were able to show that such scA-displaying particles are infectious as well (Chu and Dornburg, 1995, 1997; Chu et al, 1995). We found that the presence of wild-type Env was necessary to confer infection of such targeting vectors in human cells (Chu and Dornburg, 1995; Chu and Dornburg, 1997) (Figure 4). However, many studies with single chain antibodies directed against various other human cell surface proteins indicate that most scAdisplaying vectors derived from eco-MLV are not or only minimally infectious (Marin et al, 1996; Nilson et al, 1996; Schnierle et al, 1996; Valsesia-Wittmann et al, 1996). To further test, whether other scAs displayed on SNV-derived retroviral vector particles are competent for infection, we developed vector particles that displayed three other scAs derived from monoclonal antibodies. These were: an scA directed against the Her2neu antigen, an scA against the stem-cell antigen CD34, and an scA against the transferrin receptor. The results with vectors displaying the anti-Her2neu scA can be summarized as follows (Table 1): Stable packaging lines produced more than 105 infectious particles per ml supernatant medium titered on human cells expressing Her2neu (e.g., COLO320DM cells, BRK-SK cells, HeLa, etc.). Her2neunegative cells (HT1080 or A431 cells) could not be infected. The level of Her2neu expression on the target cells did not play a role in the level of infectivity. Particles displaying both, the chimeric and the wild-type Env, were more infectious in human cells than particles displaying the chimeric Env alone. Furthermore, they were more stable than vector particles containing wild-type Env alone. The infectivity on human cells could be inhibited by pre-incubating the target cells with the original monoclonal antibodies or by saturating the vector particle with soluble antigen recognized by the scA (e.g., soluble Her2neu) (Jiang et al, 1998). Retroviral particles that displayed a scA against the human stem cell marker CD34 or the transferrin receptor were competent for infection as well (Table 1). The efficiency of infection of particles displaying anti-CD34scAs (harvested from stable packaging lines) was determined in various human cell lines. The virus titer in human KG-1a cells (a CD34-positive hematopoietic cell

proportional to marker distance. Additional studies revealed that the recombination rate of SNV is very similar to that of MLV. In another recent study, an SNV vector-based recombination system was used to investigate whether a known hot spot for mutation was also a hot spot for retroviral recombination. PCR and restriction enzyme analysis of 228 proviral sequences revealed a higher frequency of recombination in the regions immediately following the hot spot of mutation. Moreover, the overall pattern of recombination appears to be nonrandom and one region was recombination-prone. More recent studies suggest that retroviral recombination in vivo is similar to that determined in in vitro experiments (Bowman et al, 1996, 1998; Hu et al, 1997; Anderson et al, 1998; Wooley et al, 1998).

V. Cell-type-specific retroviral vectors The host range of retroviruses is determined by the nature of the retroviral envelope protein (Hunter and Swanstrom, 1990). The envelope protein of all retroviruses studied until today consists of two peptides, which are derived from a single precursor protein by proteolytic cleavage (for a detailed review, see (Hunter and Swanstrom, 1990)). The larger peptide, termed SU (surface unit) binds to a specific cellular receptor, and, therefore, determines the host range of the virus. Like in mammalian retroviruses, SU of REVs are non-covalently bound to the second peptide, termed TM. TM is a transmembrane peptide, which anchors the envelope protein in the viral lipid membrane. The amino terminus of TM is involved in the membrane fusion of the viral and cellular membranes. The carboxy terminal and cytoplasmic part of TM appears to be involved in interactions with the retroviral core at various stages of the retroviral life cycle. Although the protein sequences of envelopes of different retrovirus species differ markedly, the functional organization of the envelope protein into a SU and TM unit with these defined functions has been conserved among all retroviruses investigated. The SU domains of most retroviruses utilize house-keeping cell surface proteins as receptors. Thus, the host-range and of most retroviruses is very broad and many different celltypes of one or many species can be infected by a particular retrovirus. However, for most, if not all future in vivo gene therapy applications, it will be necessary to have vectors available which infect only one particular cell type (or a very few selected cell-types). To make vectors specific for one particular human cell type, several groups have modified the SU domain of the envelope protein of ecotropic Moloney MLV, which is infectious only on mouse cells, or the envelope of avian leukemia virus (ALV) (Roux et al, 1989; Young et al, 1990; Etienne-Julan et al, 1992; Russell et al, 1993; Kasahara et al, 1994; Cosset et al, 1995a, 1995b; Han et al, 1995; Somia et al, 1995; Cosset and Russell, 1996; Marin et al, 1996; Nilson et al, 1996; Valsesia-Wittmann

137

Dornburg: Development of REV-derived vectors for human gene therapy

Figure 3. Retroviral vector particles displaying a single chain antibody.

Figure 4. Example of a retroviral packaging cell to target specific human cells. Such packaging cells contain a plasmid expressing the chimeric (targeting) envelope in addition to the plasmids for the expression of retroviral core and envelope proteins (see Figure 2). pTC53-7A5 is a gene expression vector, which contains a scA directed against a T-cell surface antigen fused to TM of SNV.

line) was above 105 cfu/ml. This titer was about 1,000 fold higher than that obtained with SNV vector particles pseudotyped with the envelope of ampho-MLV. However, SNV vector particles pseudotyped with ampho-MLV

envelopes infected HeLa cells with titers up to 106 cfu/ml. This data show that SNV targeting vectors are excellent candidates for gene delivery into human hematopoietic cells. Surprisingly several other tissue culture cell lines

138

Gene Therapy and Molecular Biology Vol 6, page 139

(e.g., Daudi-, HeLa-, and COLO320DM cells), which we expected to be negative for CD34 could also be infected efficiently. FACS analysis did not indicate the presence of CD34 on the cell surface of such cells. However, RT-PCR revealed that such cells do express CD34, although at extremely low levels (Jiang et al, 1998). At this point, it is unclear, whether low level antigen expression would be sufficient to obtain infection in vivo. Thus, thorough in vivo studies will be necessary to address such issues. Recently, the group of Dr.Cichutek at the Paul Ehrlich Institute has made the Pharmacia scA phagedisplay library system compatible with the SNV targeting system (Engelstadter et al, 2000). Now, a large variety of scAs created with this phage display system can be easily transferred from the phage genome for SNV vector display. Using this scA phage display system, a scA library directed against human T-cell surface antigens has been generated. In the first step, mice were immunized with a human T-cell line. Next, mRNAs were isolated from immune cells and a library of scA display phages was prepared. Only those phages binding to the cell surface of the human T-cells used for immunization were selected by panning. This first screening led to the identification of about 150 scAs capable of binding to membrane proteins of human T-cells. Next, all such scAs were displayed on SNV retroviral vector particles. Transient transfection and infection protocols as described (Chu and Dornburg, 1995) led to the identification of six scAs capable of transducing a marker gene into human Tcells. Using such six scA-SNV-Env expression vectors, stable packaging lines were made and high-producer clones were selected. Virus particles produced from one packaging line were not only able to infect human tissue culture T-cells, but also primary cells with titers up to 2 x 106 cfu/ml. These data show that SNV-derived retroviral vector particles which display a sCA on the viral surface are a valuable tool to deliver genes into specific target cells.In all experiments, the co-presence a fully functional envelope was necessary to act as an efficient helper for targeting vector virus entry. We hypothesize, that the targeting envelope binds the virus to the cell surface receptor. Human cells may still contain a receptor for the wild-type SNV envelope, to which, however, the wildtype envelope does not have sufficient affinity to trigger all events required for virus entry. High affinity to the cell surface is restored by the targeting envelope. Now the wild-type envelope can interact with its natural receptor and trigger membrane fusion (Dornburg, 1997). To further test this hypothesis, my laboratory constructed retroviral vector particles which display chimeric HIV-1-SU-SNV-TM proteins plus wild-type SNV envelope on the viral surface. Such particles allowed efficient infection of CD4-positive human T-lymphocytes, and, at a lower efficiency, also cells expressing CXCR4 without CD4 (Jiang et al, 1999). These data coincide with the hypothesis that the chimeric envelope is only required

to bind the vector particle to a cell surface receptor of the target cell, while membrane fusion is mediated by wildtype Env, which alone is not sufficient to enable infection of human cells.

VI. Cell-type-specific gene delivery in vivo To test cell-type-specific gene delivery in vivo, my laboratory recently developed a SCID mouse model system (Jiang and Dornburg, 1999). Antibiotic resistant human target and non-target cells were injected into the peritoneum of SCID mice. Subsequently, a vector solution containing 106 infectious particles, which display scAs against the human her2neu cell surface protein, was injected. Cells were recovered from the peritoneum, subjected to antibiotic selection, and tested for the expression of a lacZ gene transduced by the retroviral vector. We found that human target cells, which express her2neu, were infected in vivo. However, neither human cells that do not express her2neu nor normal mouse cells were infected by such viral particles. These data give proof of principle that retroviral vector-mediated, celltype-specific gene delivery can be obtained in vivo.

VII. Vectors for non-dividing cells The application of retroviral vectors derived from Ctype retroviruses for human gene therapy has been limited to introducing genes into dividing target cells. Recently, we developed genetically engineered C-type retroviral vectors, derived from spleen necrosis virus, SNV, which are capable of infecting non-dividing cells. This has been achieved by introducing a nuclear localization sequence (NLS) into the matrix protein (MA) of SNV by sitedirected mutagenesis. The introduction of the NLS increased the efficiency of infection of non-dividing cells and was sufficient to endow the virus with the capability to efficiently infect growth arrested human T-lymphocytes and quiescent primary monocyte-derived macrophages. This is the first report that a genetically engineered C-type retroviral vector can actively penetrate the nucleus of a target cell and can be used as a gene therapeutic vector to transduce genes into non-dividing cells (Parveen et al, 2000).

Acknowledgements I would like to thank Dr. Jan M. Orenstein, George Washington University, Washington DC, for the EM pictures of our SNV vectors. The work of RD is supported by NIH grants R01AI41899

References Anderson JA, Bowman EH and Hu WS (1998) Retroviral recombination rates do not increase linearly with marker distance and are limited by the size of the recombining subpopulation. J. Virol. 72, 1195-1202.

139

Dornburg: Development of REV-derived vectors for human gene therapy

Boris-Lawrie K and Temin HM (1995) Genetically simpler bovine leukemia virus derivatives can replicate independently of Tax and Rex. J. Virol. 69, 1920-1924. Bowman EH, Pathak VK and Hu WS (1996) Efficient initiation and strand transfer of polypurine tract-primed plus-strand DNA prevent strand transfer of internally initiated plusstrand DNA. J. Virol. 70, 1687-1694. Bowman RR, Hu WS and Pathak VK (1998) Relative rates of retroviral reverse transcriptase template switching during RNA- and DNA-dependent DNA synthesis. J. Virol. 72, 5198-5206. Butsch M, Hull S, Wang Y, Roberts TM and Boris-Lawrie K (1999) The 5' RNA terminus of spleen necrosis virus contains a novel posttranscriptional control element that facilitates human immunodeficiency virus Rev/RREindependent Gag production. J. Virol. 73, 4847-4855. Casella C and Panganiban AT (1993) The matrix region is responsible for the differential ability of two retroviruses to function as helpers for vector propagation. Virol. 192, 458464. Certo JL, Kabdulov TO, Paulson ML anderson JA and Hu WS (1999) The nucleocapsid domain is responsible for the ability of spleen necrosis virus (SNV) Gag polyprotein to package both SNV and murine leukemia virus RNA. J Virol. 73, 9170-9177. Certo JL, Shook BF, Yin PD, Snider JT and Hu WS (1998) Nonreciprocal pseudotyping: murine leukemia virus proteins cannot efficiently package spleen necrosis virus-based vector RNA. J. Virol. 72, 5408-5413. Chu T-H and Dornburg R (1995) Retroviral vector particles displaying the antigen-binding site of an antibody enable cell-type-specific gene transfer. J.Virol. 69, 2659-2663. Chu T-H and Dornburg R (1997) Towards highly-efficient celltype-specific gene transfer with retroviral vectors that display a single chain antibody. J.Virol 71, 720-725. Chu T-H, Martinez I, Olson P and Dornburg R (1995) Highly efficient eucaryotic gene expression vectors for peptide secretion. Biotechniq. 18, 890-899. Chu T-H, Martinez I, Sheay WC and Dornburg R (1994) Cell targeting with retroviral vector particles containing antibodyenvelope fusion proteins. Gene.Ther. 1, 292-299. Cosset FL and Russell SJ (1996) Targeting retrovirus entry. Gene Ther. 3, 946-956. Cosset F-L, Morling FJ, Takeuchi Y, Weiss RA, Collins MKL and Russell SJ (1995) Retroviral retargeting by envelopes expressing an N-terminal binding domain. J.Virol. 69, 63146322. Dornburg R (1995) Reticuloendotheliosis viruses and derived vectors. Gene Ther. 2, 301-310. Dornburg R (1997) From the natural evolution to the genetic manipulation of the host range of retroviruses. Biol.Chem. 378, 457-468. Dougherty JP and Temin HM (1986) High mutation rate of a spleen necrosis virus-based retrovirus vector. Mol.Cell.Biol. 168, 4387-4395. Dougherty JP and Temin HM (1988) Determination of the rate of base-pair substitution and insertion mutations in retrovirus replication. J.Virol. 62, 2817-2822. Dougherty JP and Temin HM (1991) Determination of retroviral mutation rates using spleen necrosis virus-based vectors and helper cells. Biotechnology 16, 21-33. Embretson JE and Temin HM (1987) Lack of competition results in efficient packaging of heterologous murine retroviral RNAs and reticuloendotheliosis virus encapsidation- minus

RNAs by the reticuloendotheliosis virus helper cell line. J.Virol. 61, 2675-2683. Engelstadter M, Bobkova M, Baier M, Stitz J, Holtkamp N, Chu TH, Kurth R, Dornburg R, Buchholz CJ and Cichutek K (2000) Targeting human T cells by retroviral vectors displaying antibody domains selected from a phage display library. Human.Gene Ther. 11, 293-303. Etienne-Julan M, Roux P, Carillo S, Jeanteur P and Piechaczyk M (1992) The efficiency of cell targeting by recombinant retroviruses depends on the nature opf the receptor and the composition of the artificial cell-virus linker. J.Gen.Virol. 73, 3251-3255. Fadly AM (1997) Avian retroviruses. Veterinary. Clinics. North America. -.Food. Animal. Practice. 13, 71-85. Gautier R, Jiang A, Rousseau V, Dornburg R and Jaffredo T (2000) Avian reticuloendotheliosis virus strain A and spleen necrosis virus do not infect human cells. J. Virol. 74, 518522. Han XL, Kasahara N and Kan YW (1995) Ligand-directed retroviral targeting of human breast cancer cells. Proc.Natl.Aca.Sci.(USA) 92, 9747-9751. Hu S, Bruszewski J, Nicolson M, Tseng J, Hsu RY and Bosselman R (1987) Generation of competent virus in the REV helper cell line C3. Virol. 159, 446-449. Hu W-S and Temin HM (1990a) Retroviral recombination and reverse transcription. Science 250, 1227-1233. Hu W-S and Temin HM (1990b) Genetic consequences of packaging two RNA genomes in one retroviral particle: pseudodiploidy and high rate of genetic recombination. Proc.Natl.Acad.Sci.USA 87, 1556-1560. Hu WS, Bowman EH, Delviks KA and Pathak VK (1997) Homologous recombination occurs in a distinct retroviral subpopulation and exhibits high negative interference. J.Virol. 71, 6028-6036. Hunter E and Swanstrom R (1990) Retrovirus envelope glycoproteins. Curr.Top.Microbiol.Immunol. 157, 187-253. Jiang A and Dornburg R (1999) In vivo cell type-specific gene delivery with retroviral vectors that display single chain antibodies. Gene Ther. 6, 1982-1987. Jiang A, Chu T-HT, Nocken F, Cichutek K and Dornburg R (1998) Cell-type-specific gene transfer into human cells with retroviral vectors that display single-chain antibodies. J.Virol. 72, 10148-10156. Jiang A, Fisher H, Pomerantz RJ and Dornburg R (1999) A genetically engineered spleen necrosis virus-derived retroviral vector that displays the HIV type 1 glycoprotein 120 envelope peptide. Human.Gene Ther. 10, 2627-2636. Julias JG and Pathak VK (1998) Deoxyribonucleoside triphosphate pool imbalances in vivo are associated with an increased retroviral mutation rate. J. Virol. 72, 7941-7949. Julias JG, Kim T, Arnold G and Pathak VK (1997) The antiretrovirus drug 3'-azido-3'-deoxythymidine increases the retrovirus mutation rate. J Virol 71, 4254-4263. Kasahara N, Dozy AM and Kan YW (1994) Tissue-specific targeting of retroviral vectors through ligand-receptor interactions. Science 266, 1373-1376. Kewalramani VN, Panganiban AT and Emerman M (1992) Spleen necrosis virus, an avian immunosuppressive retrovirus, shares a receptor with the type D simian retroviruses. J.Virol. 66, 3026-3031. Kim T, Mudry RA,Jr., Rexrode CA and Pathak VK (1996) Retroviral mutation rates and a-to-g hypermutations during different stages of retroviral replication. J Virol 70, 75947602.

140

Gene Therapy and Molecular Biology Vol 6, page 141

Koo HM, Brown AM, Ron Y and Dougherty JP (1991) Spleen necrosis virus, an avian retrovirus, can infect primate cells. J.Virol. 65, 4769-4776. Koo HM, Gu J, Varela-Echavarria A, Ron Y and Dougherty JP (1992) Reticuloendotheliosis type C and primate type D oncoretrovirueses are members of the same receptor interference group. J.Virol. 66, 3448-3454. Lopez-Lastra M, Gabus C and Darlix JL (1997) Characterization of an internal ribosomal entry segment within the 5' leader of avian reticuloendotheliosis virus type A RNA and development of novel MLV-REV-based retroviral vectors. Hum. Gene Ther. 8, 1855-1865. Marin M, Noel D, Valsesia-Wittman S, Brockly F, Etienne-Julan M, Russell S, Cosset F-L and Piechaczyk M (1996) Targeted infection of human cells via major histocompatibility complex class I molecules by Moleney leukemia virusderived viruses displaying single chain antibody fragmentenvelope fusion proteins. J.Virol. 70, 2957-2962. Martinez I and Dornburg R (1995) Improved retroviral packaging lines derived from spleen necrosis virus. Virol. 208, 234-241. Martinez I and Dornburg R (1996) Partial reconstitution of a replication-competent retrovirus in helper cells with partial overlaps between vector and helper cell genomes. Hum.Gene Ther. 7, 705-712. Nilson BHK, Morling FJ, Cosset F-L and Russell SJ (1996) Targeting of retroviral vectors through protease-substrate interactions. Gene Ther. 3, 280-286. Parveen Z, Krupetsky A, Engelst채dter M, Cichutek K, Pomerantz RJ and Dornburg R (2000) Spleen necrosis virus-derived Ctype retroviral vectors for gene transfer to quiescent cells. Nature Biotechnology 18, 623-629. Pathak VK and Temin HM (1990) Broad spectrum of in vivo forward mutations, hypermutations and mutational hotspots in a retroviral shuttle vector after a single replication cycle: deletions and deletions with insertions. Proc.Natl.Acad.Sci.(USA) 87, 6024-6028. Pathak VK and Temin HM (1992) 5-azacytidine and rna secondary structure increase the retrovirus mutation rate. J. Virol 66, 3093-3100. Rasko JE, Battini JL, Gottschalk RJ, Mazo I and Miller AD (1999) The RD114/simian type D retrovirus receptor is a neutral amino acid transporter. Proc.Natl.Acad.Sci.(USA) 96, 2129-2134.

Roux P, Jeanteur P and Piechaczyk M (1989) A versatile and potentially general approach to the targeting of specific cell types by retroviruses: application to the infection of human by means of major histocompatibility complex class I and class II antigens by mouse ecotropic murine leukemia virusderived viruses. Proc.Natl.Acad.Sci.(USA) 86, 9079-9083. Russell SJ, Hawkins RE and Winter G (1993) Retroviral vectors displaying functional antibody fragments. Nucl.Acid.Res. 21, 1081-1085. Schnierle BS, Moritz D, Jeschke M and Groner B (1996) Expression of chimeric envelope proteins in helper cell lines and integration into Moloney murine leukemia virus particles. Gene Ther. 3, 334-342. Somia NV, Zoppe M and Verma IM (1995) Generation of targeted retroviral vectors by using single-chain variable fragment: an approach to in vivo gene delivery. Proc.Natl.Acad.Sci.(USA) 92, 7570-7574. Valsesia-Wittmann S, Morling F, Nilson B, Takeuchi Y, Russell S and Cosset F-L (1996) Improvement of retroviral retargeting by using acid spacers between an additional binding domain and the N terminus of Moloney leukemia virus SU. J.Virol. 70, 2059-2064. Watanabe S and Temin HM (1983) Construction of a helper cell line for avian reticuloendotheliosis virus cloning vectors. Mol.Cell Biol. 3, 2241-2249. Witter RL (1997) Avian tumor viruses: persistent and evolving pathogens.. Acta Veterinaria.Hungarica. 45, 251-266. Wooley DP, Bircher LA and Smith RA (1998) Retroviral recombination is nonrandom and sequence dependent. Virology. 243, 229-234. Yin PD and Hu WS (1997) RNAs from genetically distinct retroviruses can copackage and exchange genetic information in vivo. J.Virol71, 6237-6242. Yin PD and Hu WS (1999) Insertion of sequences into the 3' untranslated region of a replication-competent spleen necrosis virus vector disrupts env gene expression. Archives.of.Virology. 144, 73-87. Young JAT, Bates P, Willert K and Varmus HE (1990) Efficient incorporation of human CD4 protein into avian leukosis virus particles. Science 250, 1421-1423.

141

Dornburg: Development of REV-derived vectors for human gene therapy

142

Gene Therapy and Molecular Biology Vol 6, page 143

Gene Ther Mol Biol Vol 6, 143-148, 2001

Design of methacrylate-based polyplexes for tumor targeting Review Article

Gert Storm*, Enrico Mastrobattista, Ferry J. Verbaan, Daan J.A. Crommelin and Wim E. Hennink Department of Pharmaceutics, Utrecht Institute for Pharmaceutical Sciences (UIPS), Faculty of Pharmacy, Utrecht University, P.O. Box 80.082, 3508 TB Utrecht, The Netherlands _________________________________________________________________________________________________ *Correspondence: Gert Storm Tel: +31 30 253 7306; Fax: +31 30 251 7839; E-mail: g.storm@pharm.uu.nl Key words: dimethylamino)ethyl methacrylate, transfection Abbreviations: fetal calf serum, (FCS); gene-directed enzyme prodrug therapy, (GDEPT); immuno-LPP, (ILPP); lipopolyplexes, (LPP); mononuclear phagocyte system, (MPS); poly(aspartic acid), (p(Asp); polyethylene glycol, (PEG); polymer poly(2-(dimethylamino)ethyl methacrylate), (p(DMAEMA)) Received: 15 November 2001; accepted: 19 November, 2001; electronically published: February 2004

Summary A non-viral gene delivery vector has been developed in our laboratory based on the cationic polymer poly(2(dimethylamino)ethyl methacrylate) (p(DMAEMA)). This contribution deals with the design of pDMAEMA-based polyplexes for tumor targeting. The first part is concerned with their use for the intraperitoneal therapy of ovarian cancer, the second part with their use for intravenous targeting of solid tumors. It is demonstrated that cell-specific gene delivery to in vitro cultured ovarian carcinoma cells can be obtained by coating p(DMAEMA)-based polyplexes with an anionic lipid layer bearing conjugated antibody fragments. As the lipid coat around the so-called lipopolyplexes (LPP) efficiently shields the positive charge of polyplexes, the predominant electrostatic interaction with cell membranes could be avoided. As LPP without antibody did not show transfection, it can be concluded that the presence of a targeting ligand is essential. In addition, the lipid coat around the LPP provided protection of the polyplexes against destabilization by polyanions such as poly(aspartic acid) and hyaluronic acid. This is expected to be essential for in vivo application of antibody-targeted LPP as naturally occurring polyanions have been shown to have detrimental effects on plain polyplexes after intraperitoneal administration. After intravenous administration in mice, p(DMAEMA)/[32P]-pLuc complexes distributed primarily to the lungs. The gene expression profile matched the biodistribution profile. In vitro evidence was collected pointing to aggregate formation and trapping of the formed aggregates in the lung capillary bed as a primary mechanism explaining the dominant lung uptake and transfection. Therefore, it was investigated whether shielding of the surface positive charge of the polyplexes can increase colloidal stability and prevent dominant lung uptake. Recent mice experiments yielded successful results with surface modification of the p(DMAEMA)-based polyplexes with polyethylene glycol (PEG). Prolonged circulation and avoidance of dominant lung localization were observed after intravenous administration of the PEGylated polyplexes. Most importantly, a significant degree of tumor targeting was observed in the subcutaneous C26 colon carcinoma mouse model. polymer poly(2-(dimethylamino)ethyl methacrylate (p(DMAEMA)) as polymeric transfectant is currently under investigation. p(DMAEMA) (Figure 1) is able to bind and condense DNA (Cherng et al, 1996; Van de Wetering et al, 1997, 1998). In vitro p(DMAEMA) was shown to be an efficient transfection agent for a variety of cell types (Van

I. Introduction The future of cancer gene therapy is dependent on the development of efficient gene delivery systems. Within the realm of non-viral gene delivery systems are complexes of plasmid DNA with cationic lipids or polymers, called lipoplexes or polyplexes, respectively. Within our laboratory, the application of the cationic

143

Storm et al: Methacrylate-based polyplexes for tumor targeting

Figure 1. (p(DMAEMA))

Poly(2-(dimethylamino)ethyl

vitro with an overall transfection efficiency of 10%. Cells grown in vivo can be transfected ex vivo with p(DMAEMA)/plasmid complexes with an overall transfection efficiency of 1-2%. However, cells grown in vivo were very difficult to transfect in vivo: transfection of intraperitoneally localized OVCAR-3 cells was negligible after i.p. injection of the transfection complexes into nude mice bearing OVCAR-3 cells in the peritoneal cavity (Van de Wetering et al, 1999a). The following reasons might explain this discrepancy: (i) The polyplexes may have formed aggregates induced by one or more components of the ascites fluid. We have previously observed that large-sized polyplexes are less efficient in transfection (Van de Wetering et al, 1997). (ii) A potential reason for the differences found in vitro and in vivo transfection experiments may be sought in the clustering of cells growing in the peritoneal cavity. OVCAR-3 cells cultured in vitro grow adherently while in vivo cells grow in suspension in the peritoneal cavity. Clusters of cells are formed with consequent reduced accessibility of a major fraction of the cells. In order to investigate whether declustering of the cells would result in improved accessibility and consequently higher transfection efficiency ex vivo, cells isolated from mice were treated with trypsin before incubation with the transfection complexes. Trypsin-mediated declustering did not improve transfection. (iii) Another difference between the in vitro and the in vivo situation is the presence of body fluids, peritoneal ascites fluid in case of the particular tumor used here. The influence of ascites fluid on the transfection activity of the polyplexes was investigated in vitro. In parallel, the influence of fetal calf serum (FCS) was studied in the same experiment. When ascites and FCS are absent during the experiment, the transfection optimum was observed at a polymer/plasmid ratio of 1.6/1 (w/w). With an increasing ascites or FCS concentration, the optimum polymer/plasmid ratio shifted to higher values. This is in good agreement with the results obtained by Yang and Huang (Yang and Huang, 1997) who showed that the inhibitory effect of serum on lipofection could be overcome by increasing the cationic lipid/DNA ratio. The transfection activity was increased 2-fold in the presence of FCS at the optimum ratio which is possibly caused by a stimulating effect of certain FCS components on the interaction of the polyplexes with the cells. However, the in vitro transfection activity was strongly reduced in the presence of ascites fluid. To elucidate which component(s) of ascites had such a detrimental effect on the in vitro transfection activity, the influence of hyaluronic acid, which has been reported to be present in relatively high concentrations in ascites (Veatch et al 1995; Catterall et al, 1997), on the transfection activity was studied. Hyaluronic acid, a polymer consisting of a regular repeating sequence of disaccharide units (glucuronic acid and N-

methacrylate

de Wetering et al, 1997). The size and zeta potential of the polyplexes were shown to be dependent on the polymer/plasmid ratio and important parameters determining the in vitro transfection activity and cytotoxicity. Polyplexes with a positive zeta potential (around 30 mV) and a mean size around 0.2 Âľm possessed the highest transfection activity. p(DMAEMA) polymers with a high molecular weight (> 300 kD) are better transfection agents than low molecular weight polymers (Van de Wetering et al, 1998). Recently, we initiated studies to investigate the application of p(DMAEMA) as a gene carrier in gene-directed enzyme prodrug therapy (GDEPT) (Fonseca et al, 1999). This contribution deals with the design of pDMAEMA-based polyplexes for tumor targeting. The first part is concerned with their use for the intraperitoneal therapy of ovarian cancer, the second part with their use for intravenous targeting of solid tumors.

II. Intraperitoneal administration A. p(DMAEMA)-based polyplexes Ovarian cancer is one of the most common fatal gynecological malignancies. The OVCAR-3 human ovarian carcinoma cell line growing i.p. in nude mice provides a model system suitable for studying ovarian cancer (Hamilton et al, 1984). Since ovarian cancer remains confined to the peritoneal cavity throughout most of its lifetime, it has been considered that ready access to the peritoneal cavity and containment of the disease progress within the peritoneal cavity favor development of anticancer gene therapy strategies. Therefore, we have defined intraperitoneally localized OVCAR-3 cells as transfection targets which should be accessible to DNA delivery systems injected directly into the peritoneal cavity (Van de Wetering et al, 1999b). The approach taken to investigate whether OVCAR3 cells can be transfected in vivo was a comparative in vitro - ex vivo - in vivo study utilizing similiar exposure conditions of the cells to the p(DMAEMA) transfection complexes in vitro and in vivo. The transfection results can be summarized as follows: p(DMAEMA)/plasmid (pCMVLacZ) complexes can transfect OVCAR-3 cells in

144

Gene Therapy and Molecular Biology Vol 6, page 145

Figure 2. Influence of hyaluronic acid (HyAc) on the transfection efficiency of polyplexes vs ILPP. OVCAR-3 cells (1.1!104 cells/well) were exposed for 1 hour at 37°C to (A) polyplexes or (B) ILPP in the absence (-HyAc) or presence (+HyAc) of 2.5 mg/ml hyaluronic acid. Gene carriers were removed by washing and cell culture was continued for another 47 h prior to evaluation for "-galactosidase expression.

acetylglucosamine), interacts withcells and is studied for its potential role in metastases proliferation. Due to its polyanionic character, hyaluronic acid might have interacted with the positively charged polyplexes resulting in a reduction of the transfection activity, as has been reported for the effect of heparin on lipoplexes (Xu and Szoka, 1996; Mounkes et al, 1998). As shown in Figure 2, indeed, the in vitro transfection activity was strongly reduced in the presence of hyaluronic acid in concentrations which are in the range (up to 11 mg/ml) observed to be present in peritoneal effusions from cancer patients (Roboz et al, 1985; Catterall et al, 1997). No negative effect of hyaluronic acid on cell viability was observed. This outcome suggests that one of the components of ascites fluid, hyaluronic acid, may have induced a negative effect on the transfection capability of p(DMAEMA)-based polyplexes.

B. Protection and targeting p(DMAEMA)-based polyplexes

DNase I-induced degradation (Arigita et al, 1999). We investigated whether polyplexes present in LPP are protected against destabilization with p(Asp). LPP and polyplexes admixed with empty anionic liposomes were incubated with DNase I in the presence of a large excess of p(Asp). Before and after the addition of DNase I samples were analyzed by gel electrophoresis for the presence of non-degraded plasmid DNA (Figure 4). It was demonstrated that there is no difference in DNA staining intensity between LPP before (lane 2) and after (lane 1) treatment with DNase I, indicating that a large amount (if not all) of the polyplexes within LPP is protected from destabilization with p(Asp). In contrast, polyplexes that were admixed with empty preformed liposomes with the same lipid composition as in the LPP coat appeared very sensitive to destabilization with p(Asp), as DNase I completely degraded complexed DNA (lanes 3 and 4). These results indicate that coating of polyplexes with lipids protects the polyplexes from destabilization by p(Asp). Unfortunately, besides the positive effect of conferring protection, the presence of a negatively charged lipid coat had a strong negative impact on the transfection capability of the LPP. This negative effect is likely due to loss of cationic charge-mediated electrostatic interaction with the cells. This problem could be overcome by coupling specific antibody fragments to the LPP surface (Figure 3). Targeting of LPP to OVCAR-3 cells was realized by coupling Fab’-fragments of the mAb 323/A3 (anti-EGP-2 receptor) to the surface of LPP (immuno-LPP (ILPP)). It was demonstrated that the presence of the targeting ligand mediates cellular binding and uptake of the coated particles and compensates for the loss of electrostatic interaction with the cell membrane by the introduction of the lipid coating on the polyplex surface. It is also noteworthy that – in sharp contrast with the plain polyplexes – ILPP did not induce any cytotoxicity to the cells (as monitored with the XTT assay). An important observation from the ovarian carcinoma application point of view is the stability of the ILPP system in the

Clearly, in order to obtain effective gene transfer to OVCAR-3 cells under in vivo conditions, the p(DMAEMA)-based polyplexes need to be protected from the inactivating effects of tumor ascitic components. For achieving protection we developed a detergent removal method to coat the cationic polyplexes with anionic lipids (Figure 3) (Mastrobattista et al, 2001). Lipid-coated polyplexes (further referred to as lipopolyplexes (LPP)) were formed by adding p(DMAEMA)-based polyplexes (3:1 w/w ratio of polymer:DNA) to a mixture of lipids (with egg-phosphatidylglycerol as the anionic component) solubilized in 150 mM octylglucoside and subsequent slow removal of the detergent by adsorption to hydrophobic polystyrene BioBeads. With this method spherical particles of about 120 nm and bearing a negative charge were obtained. Previous work from our group has demonstrated that p(DMAEMA)-based polyplexes are destabilized when exposed to poly(aspartic acid) (p(Asp)), which liberates the DNA from the polyplexes and making it susceptible to

145

Storm et al: Methacrylate-based polyplexes for tumor targeting

Figure 3. Schematic representation of lipopolyplex formation. (1) Plasmid DNA is condensed by adding the cationic polymer p(DMAEMA) to the DNA at a weight/weight ratio of 3:1, respectively. The formed polyplexes (2) are added to mixed micelles containing the detergent OG and a total amount of 3 µmol detergent-solubilized lipids (3). Upon slow removal of detergent by adsorption to hydrophobic BioBeads, lipid coats are preferentially formed around positively charged polyplexes due to electrostatic interactions (4).

mimicking the in vivo situation and therefore show promise for use in plasmid-based approaches to gene therapy of ovarian cancer. At present, ILPP are being investigated for their efficiency to deliver genes to ovarian carcinoma cells for GDEPT purposes.

III. Intravenous administration It is obvious that direct injection of gene medicines in the cavity containing the tumor burden, like in the case of intraperitoneally localized ovarian carcinoma metastases, represents a simpler task than targeted delivery to tumor tissue from the systemic circulation. For systemic gene delivery mediated by polyplexes additional biological barriers have to be considered: non-specific interactions with blood components, colloidal instability, rapid uptake by the cells of the mononuclear phagocyte system (MPS), and limited extravasation into tumor tissue. The intravenous fate of the cationic p(DMAEMA)-based polyplexes is in line with other reports describing the location and extent of gene expression after intravenous administration of DNA complexes and can be summarized as follows. Plasmid DNA (encoding for the firefly luciferase enzyme) was labelled with [#-32P]-dCTP by nick translation. Approximately six-week-old, female Balb/c mice received positively charged polyplexes (polymer/DNA ratio 3:1 w/w) labelled with trace amounts of radioactivity, in an injection volume of 200 µl by tail vein injection. At various time points, blood was collected from the vena cava under ether anaesthesia and subsequently the mice were killed. Radioactivity levels in each organ were determined. It was observed that the positively charged pDMAEMA/[32P]-DNA polyplexes

Figure 4. Nuclease resistance assay of DNA in polyplexes and in LPP in the presence of p(Asp). LPP (lanes 1 and 2) and polyplexes admixed with empty liposomes (lanes 3 and 4) were incubated with DNase I in the presence (lanes 1 and 3) or absence (lanes 2 and 4) of p(Asp) (1 mg/ml) for 30 min at 37°C and subsequently analysed by gel electrophoresis to visualize the presence of intact plasmid DNA. Image colors have been inverted for clarity.

presence of hyaluronic acid (Figure 2B). Whereas the transfection efficiency of polyplexes is drastically reduced in the presence of hyaluronic acid, this reduction is not observed with ILPP, indicating that hyaluronic acid does not negatively affect the transfection efficiency of ILPP. In conclusion, the ILPP system features colloidal stability and transfection capability under conditions

146

Gene Therapy and Molecular Biology Vol 6, page 147

Table 1. Overview of circulation time properties of shielded polyplex systems

distributed primarily to the lungs. Within minutes 80 percent of the injected dose was recovered from the lungs. In a second set of experiments, distribution of transfection activity was studied. Twenty-four hours after i.v. administration of pDMAEMA-based polyplexes (polymer/DNA ratio 3:1 w/w), luciferase levels were determined in lungs, liver, spleen, kidneys and heart. The results showed that the gene expression profile matched the biodistribution profile of the administered positively charged polyplexes. Most of the expression was seen primarily in the lungs. A third set of experiments was designed to shed more light on the mechanism involved in the dominant lung uptake of polyplexes. In vitro turbidity experiments in serum were performed providing evidence for severe aggregation occurring upon addition of the polyplexes to the serum. Hemaglutination experiments provided evidence that positively charged complexes induce the formation of extremely large structures upon addition to erythrocytes. If formed in vivo, such large aggregates are likely to block the blood flow in the lungs. Another potential in vivo factor may be electrostatic interaction between the cationic polyplexes and the negatively charged lung cell membranes. However, incubation of polyplexes with serum albumin showed that the zeta potential of the complexes drops to negative values, making the possibility of electrostatic interactions less likely. The â&#x20AC;&#x2DC;first passâ&#x20AC;&#x2122; distribution of polyplexes to the lungs severely impedes the utility of cationic polymers for gene delivery. Therefore, we and other groups (Table 1) are currently investigating whether shielding of the surface positive charge of the polyplexes can prevent dominant lung uptake and increase colloidal stability. Recent experiments yielded some success with surface modification of the p(DMAEMA)-based polyplexes with PEG. Aggregation in serum as demonstrated for nonPEGylated polyplexes in turbidity experiments in vitro

could be prevented by coupling covalently PEG to the surface of the polyplexes. Also, PEGylation yielded a drop in the zetapotential of the complexes to almost neutral. Severe hemagglutination was not observed when washed erythrocytes were incubated with the PEGylated complexes. Most importantly, in vivo experiments showed prolonged circulation and avoidance of dominant lung localization in case of intravenous administration of PEGylated polyplexes. So far, the best results were obtained when PEG with a high molecular weight (20,000) was used: at 30 min after intravenous administration into Balb/c mice about 50% of the injected dose was still circulating in the bloodstream which is substantially higher when compared to the 2% of injected dose still circulating in case of the uncoated polyplexes. Localization and gene expression in the lungs is almost absent, which is likely related to the improved colloidal stability of the complexes. For evaluating tumor targeting, we have utilized the subcutaneous C26 colon carcinoma mouse model. In this tumor model, the degree of tumor accumulation amounted to about 4% of injected dose per gram tumor tissue. A comparison of our best results with those reported in the literature (Table 1) tells us that we are well underway towards our goal to develop a nonviral carrier system for systemic gene delivery to a distant tumor. As the approach taken appears realistic, our research is continued with the ultimate aim to adopt this delivery.

References Arigita C, Zuidam NJ, Crommelin DJA and Hennink WE (1999) Association and dissociation characteristics of polymer/DNA complexes used for gene delivery. Pharm Res 16, 15341541. Boussif O, Lezoualc'h F, Zanta MA, Mergny MD, Scherman D, Demeneix B and Behr JP (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethyleneimine. Proc Natl Acad Sci USA 92, 7297-

147

Storm et al: Methacrylate-based polyplexes for tumor targeting

7301.Catterall JB, Gardner MJ, Jones LMH and Turner GA (1997) Binding of ovarian cancer cells to immobilized hyaluronic acid. Glycoconj J 14, 867-869. Cherng JY, Van de Wetering P, Talsma H, Crommelin DJA and Hennink WE (1996) Effect of size and serum proteins on transfection efficiency of (poly(2-dimethylamino)ethyl methacrylate)-plasmid nanoparticles. Pharm Res 13, 10381042. Collard WT, Yang Y, Kwok KY, Park Y and Rice KG (2000) Biodistribution, metabolism, and in vivo gene expression of low molecular weight glycopeptide polyethylene glycol peptide DNA co-condensates. J Pharm Sci 89, 499-512. Fonseca MJ, Storm G, Hennink WE, Gerritsen WR and Haisma HJ (1999) Cationic polymeric gene delivery of betaglucuronidase for doxorubicin prodrug therapy. J Gene Medicine 1, 404-417. Hamilton TC, Young RC, Louie KG, Behrens BC, McKoy WM, Grotzinger KR and Ozols RF (1984) Characterization of a xenograft model of human ovarian carcinoma which produces ascites and intraabdominal carcinomatosis in mice. Cancer Res 44, 5286-5290. Howard KA, Dash PR, Read ML, Ward K, Tomkins LM, Nazarova O, Ulbrich K and Seymour LW (2000) Influence of hydrophilicity of cationic polymers on the biophysical properties of polyelectrolyte complexes formed by selfassembly with DNA. Biochim Biophys Acta 1475, 245-55. Kircheis R, Wightman L, Schreiber A, Robitza B, Rossler V, Kursa M and Wagner E (2001) Polyethylenimine/DNA complexes shielded by transferrin target gene expression to tumors after systemic application. Gene Ther 8, 28-40. Mao HQ, Roy K, Troung-Le VL, Janes KA, Lin KY, Wang Y, August JT and Leong KW (2001) Chitosan-DNA nanoparticles as gene carriers: synthesis, characterization and transfection efficiency. J Control Release 70, 399-421. Mastrobattista E, Kapel RH, Eggenhuisen MH, Roholl PJ, Crommelin DJA, Hennink WE and Storm, G (2001) Lipidcoated polyplexes for targeted gene delivery to ovarian carcinoma cells. Cancer Gene Ther 8, 405-413. Mounkes LC, Shong W, Cipres-Palacin G, Heath TD and Debs R (1998) Proteoglycans mediate cationic liposome-DNA complex-based gene delivery in vitro and in vivo. J Biol Chem 273, 26164-26170. Mullen PM, Lollo CP, Phan QC, Amini A, Banaszczyk MG, Fabrycki JM, Wu D, Carlo AT, Pezzoli P, Coffin CC and Carlo DJ (2000) Strength of conjugate binding to plasmid DNA affects degradation rate and expression level in vivo. Biochim Biophys Acta 1523, 103-10. Nguyen HK, Lemieux P, Vinogradov SV, Gebhart CL, Guerin N, Paradis G, Bronich TK, Alakhov VY and Kabanov AV (2000) Evaluation of polyether-polyethyleneimine graft copolymers as gene transfer agents. Gene Ther 7, 126-38. Niculescu-Duvaz I, Spooner R, Marais R and Springer C (1998) Gene-directed enzyme prodrug therapy. Bioconjugate Chem 9, 4-22. Ogris M, Brunner S, Schuller S, Kircheis R and Wagner E (1999) PEGylated DNA/transferrin-PEI complexes: reduced interaction with blood components, extended circulation in blood and potential for systemic gene delivery. Gene Ther 6, 595-605. Oupicky D, Konak C, Dash PR, Seymour LW and Ulbrich K

(1999) Effect of albumin and polyanion on the structure of DNA complexes with polycation containing hydrophilic nonionic block. Bioconjug Chem 10, 764-72. Oupicky D, Howard KA, Konak C, Dash PR, Ulbrich K and Seymour LW (2000) Steric stabilization of poly-LLysine/DNA complexes by the covalent attachment of semitelechelic poly[N-(2-hydroxypropyl)methacrylamide]. Bioconjug Chem 11, 492-501. Oupicky D, Carlisle RC and Seymour LW (2001) Triggered intracellular activation of disulfide crosslinked polyelectrolyte gene delivery complexes with extended systemic circulation in vivo. Gene Ther 8,713-24. Roboz J, Greaves J, Chaninian AP and Holland JF (1985) Hyaluronic acid content of effusions as a diagnosis aid for malignant mesothelia. Cancer Res 45, 1850-1854. Van de Wetering P, Cherng JY, Talsma H and Hennink WE (1997) Relation between transfection efficiency and cytotoxicity of poly(2-dimethylamino)ethyl methacrylate)/plasmid complexes. J Controlled Release 49, 59-69. Van de Wetering P, Cherng JY, Talsma H, Crommelin DJA and Hennink WE (1998) poly(2-dimethylamino)ethyl methacrylate based (co)polymers as gene transfer agents. J Controlled Release 53, 145-153. Van de Wetering P, Schuurmans-Nieuwenbroek NME, Hennink WE and Storm G (1999a) Comparative transfection studies of human ovarian carcinoma cells in vitro, ex vivo and in vivo with poly(2-(dimethylamino) ethyl methacrylate)-based polyplexes. J Gene Med 1, 1-10. Van de Wetering P, Moret EE, Schuurmans-Nieuwenbroek NME, Van Steenbergen MJ and Hennink WE (1999b) Structure-activity relationships of water-soluble cationic methacrylate/methacrylamide polymers for nonviral gene delivery. Bioconjugate Chem 10, 687-692. Veatch AL, Carson LF and Ramakrishnan S (1995) Phenotypic variations and differential migration of NIH:OVCAR-3 carcinoma cells isolated from athymic mice. Clin. Exp. Metastasis 13, 165-172. Xu Y and Szoka FC (1996) Mechanism of DNA release from cationic liposome/DNA complexes used in cell transfection. Biochemistry 35, 5616-5623. Yang JP and Huang L (1997) Overcoming the inhibitory effect of serum on lipofection by increasing the charge ratio of cationic liposome to DNA. Gene Ther 4, 950-960.

Storm Gert, Ph.D.

148

Gene Therapy and Molecular Biology Vol 6, page 149

Gene Ther Mol Biol Vol 6, 149-157, 2001

Regulation of globin genes expression: New findings made with the chicken domain of ! globin genes Research Article

Elena S. Ioudinkova1,2, Olga V. Iarovaia1,2, Klaus Scherrer1 and Sergey V. Razin1,2* 1

Institut Jacques Monod, UniversitĂŠ de Paris 7, 2 place Jussieu 75251 Cedex 05 Paris, France Institute of Gene Biology RAS, Vavilov Str. 34/5, 117334 Moscow, Russia

_________________________________________________________________________________________________ *Correspondence: Razin, Sergey, Ph.D, Institute of Gene Biology RAS, Vavilov Str. 34/5, 117334 Moscow, Russia e-mail: razin@biogen.msk.su, razin@ijm.jussieu.fr,sergey.v.razin@usa.net Key words: globin genes expression, chicken domain, !-globin genes Abbreviations: Avian erythroblastosis virus, (AEV); chloramphenicol-acetyl-transferase, (CAT); isoquinolinylsulphonil-2methylpiperasine-dichloride, (IMD); Locus Control Region, (LCR) Received: 18 September 2001; accepted: 19 October 2001; electronically published: February 2004

Summary The domain of chicken ! globin genes represents one of the best studied genomic domains in higher eukaryotes. Nevertheless, many questions concerning the nature of mechanisms regulating coordinated expression of globin genes in the course of development remain open. Here we show, that the whole cluster of ! globin genes is preceded by a CpG-rich region which colocalises with the replication origin and the permanent site of DNA attachment to the nuclear matrix. In non-erythroid cells the upstream CpG-rich area of the !-globin gene domain is selectively methylated. In model experiments, methylation of this sequence element exerted a strong negative effect on the activity of globin gene promoters. We suggest that the upstream CpG rich area of the !-globin gene domain constitute a molecular switch which regulate expression of ! globin genes in cells of different lineage. !-globin genes are found to be transcribed in both proliferating (premature) and differentiated (mature) erythroid cells. However, only the latter express globins at a protein level. We found that the block of productive expression of globins in premature erythroid cells occurs at post-transcriptional level. In these cells the transcripts of !-globin genes are retained in nuclei. Induction of proliferating erythroid cells to differentiation is accompanied by a release of globin gene transcripts to the cytoplasm. changed (Forrester et al, 1990). The necessity of the LCR for maintaining the open chromatin configuration of the mouse "-globin gene domain has been, however, questioned by some resent results (Epner et al, 1998; Higgs, 1998; Bender et al, 2000). As for domains of !-globin genes, they were found in open ("DNase-sensitive") chromatin configuration in both erythroid and non-erythroid cells (Vyas et al, 1992; Craddock, 1995). The fact possibly reflects the presence of an apparently house-keeping gene that overlaps the upstream part of the !-globin genes domains in mammals and chickens (Vyas, 1995; Razin et al, 1999; Sjakste et al, 2000). This gene is transcribed opposite to the direction of globin gene transcription (Vyas, 1995). The major positive regulatory elements of human and mouse ! globin gene

I. Introduction Recent evidence suggests that clusters of ! and " globin genes in vertebrates are organized and regulated in a different fashion. The "-globin genes domains in mammals and chickens are packed in closed (DNase I "non-sensitive") chromatin in all cells except the erythroid ones where the globin genes are expressed (Forrester et al, 1990; Felsenfeld, 1993; Craddock, 1995). The transcription status of "-globin clusters in all organisms studied so far is regulated by so-called Locus Control Region (LCR) (Forrester et al, 1987, 1993; Grosveld et al, 1987; Li et al, 1990; Moon and Ley, 1990). Naturally occurring deletions of the LCR block expression of "globin genes. At the same time the replication timing and the mode of "-globin genes packaging in chromatin is

149

Ioudinkova et al: Regulation of globin genes expression

domains (Higgs et al, 1990; Gourdon et al, 1995) reside within one of the introns of the above gene (Vyas, 1995). Although the major positive regulatory elements of the ! globin gene domains (in human known as HS-40) share some properties of the LCR of "-globin genes, as shown in experiments with transgenic mice (Sharpe et al, 1992), the similarity is limited. Mammalian ! globin genes reside within CpG islands which are not methylated in a variety of cells (Bird et al, 1987; Shewchuk and Hardison, 1997). Being transfected to cultured cells, the a-globin genes are expressed in erythroid and non-erythroid cells both transiently (even in the absence of enhancer) and after integration into genome (Whitelaw et al, 1989; Brickner et al, 1991; James-Pederson et al, 1995; Shewchuk and Hardison, 1997). Hence, the promoters of !-globin genes are not tissue-specific. Yet, normally, these genes are expressed only in erythroid cells. Thus, it is likely that there should be some negative regulators which suppress the expression of !-globin genes in non-erythroid cells. The aim of our study was to identify and to characterise the regulatory elements of this kind.

II Results A. Mapping of DNase I hypersensitive sites in the upstream area of the domain of !globin genes Positions of DNaseI hypersensitive sites in chromatin usually mark the sites of interaction of different regulatory factors with the target sequences on DNA. analysis of distribution of DNaseI hypersensitive sites in a given genomic area may thus give good indications of the positions of regulatory elements. To map the positions of DNase I hypersensitive sites in the upstream area of the domain of !-globin genes, an indirect end-labelling approach was used. In parallel experiments, positions of DNase I hypersensitive sites were mapped in chicken erythroid cell (line HD3; clone A6 of line LSCC (Beug et al, 1979)) and chicken lymphoid cell (line HP50 (Dhar et al, 1990)) nuclei. The strategy of the labelling experiments and the results obtained are represented schematically in Figure 1. Two clusters of DNase I hypersensitive sites were identified in the upstream area of the domain of !globin genes at distances of 11-16 and 3-6 kb

Figure 1. Distribution of the DNase I hypersensitive sites in the upstream area of the chicken domain of !-globin genes. In the upper part of the figure, the restriction map of the area under study and the strategy used to map DHSs are shown. The rectangles indicated by capital letters A - D show positions of hybridization probes. The horizontal arrows show the full-sized restriction fragments recognised by each of the probes. Positions of DNase I hypersensitive sites found in cultured lymphoid cells (HP50), normal chicken erythrocytes (CYTES) and cultured chicken erythroid cells (HD3) are shown below the restriction map. The two clusters of DNaseI hypersensitive sites are outlined by broken line rectangles.

150

Gene Therapy and Molecular Biology Vol 6, page 151

upstream to the pi gene. The DNA region including the first cluster of DNase I hypersensitive sites have been studied in our previous work (Razin et al, 1999). This region was found to contain several transcription silencers, MAR element and transcription termination sites. The group of DNase I hypersensitive sites located 3-6 kb upstream to the # gene mark positions of the DNA loop anchorage site (Razin et al, 1991) and of the replication origin (Razin et al, 1986; Verbovaia and Razin, 1995). The data presented below suggests that a negative regulator of transcription may also be located in this area.

B. The cluster of DNase I hypersensitive sites located 3-6 kb upstream to the # gene colocalizes with a CpG island which is partially methylated in non-erythroid cells Computer analysis of the DNA sequence of the upstream area of chicken !-globin gene domain has permitted to identify a CpG-rich region in about the same position where one of the clusters of DNase I hypersensitive sites was found (Figure 2).

Figure 2. Compositional characteristics of the chicken domain of ! globin genes. (A) Accession numbers of DNA sequences analysed; (B) The scale of distances (in Kb). (C) Positions of globin genes. (D) Percentage of GC pairs Each column shows composition of a 0.5 kb fragment. (E) Ration of CpG to GpC. The CpG rich area is shown by broken line rectangle

151

Ioudinkova et al: Regulation of globin genes expression

Figure 3. Analysis of methylation pattern of ! globin gene domain upstream CpG reach region. (A) A scheme demonstrating distribution of Msp I/Hpa II recognition sites within the area under study. Below the scheme the position of the probe used and the position of the area showing selective methylation in non-erythroid cells are shown. The Msp I/Hpa II recognition site methylated at all C residues is shown by asterisk. (B) Results of hybridization. Note different patterns of Hpa II and Sma I digestion products visualised upon hybridization of the probe with HD3 and HP50 DNA digested by the above mentioned enzymes

152

Gene Therapy and Molecular Biology Vol 6, page 153

Figure 4. Analysis of the activity of CAT gene present in constructs with methylated and non-methylated CpG-rich fragment inserted upstream to the non-methylated promoter of the ! D gene. The figures were normalised versus activity observed in experiment with transfection of construct without CpG-rich fragment. All figures represent an average of results obtained in five independent transfection experiments. In the upper part of the figure the map of the construct is shown

In order to check whether CpG dinucleotides within this region are non-methylated (as normally in CpG islands), the digestion with isoshizomeres of restriction enzymes sensitive and non-sensitive to the CpG methylation was carried out. The results of this analysis (Figure 3) have permitted to conclude that the downstream part of the CpG area under study is selectively methylated in non-erythroid cells. The obvious correlation between the expression of globin genes in erythroid cells and the demethylation of the 0.65 Kbp CpG-rich DNA fragment, in the upstream area of the domain of !-globin genes made it reasonable to check whether the DNA sequence elements present in this fragment (either methylated or non-methylated) can influence the activity of globin gene promoters. With this aim we constructed a recombinant plasmid with the CpGrich fragment inserted upstream to the CAT reporter gene expressed from the promoter of the chicken ! D globin gene. The CpG-rich fragment was cut from this construct, methylated in vitro, using the Sss I methylase, and religated back. In control experiments, the same manipulations were carried out with the mock-methylated fragment, which was incubated with Sss I methylase in the absence of S-adenosylmethionine. The same amounts of methylated and non-methylated construct were then transfected into HD3 cells, and the activity of the CAT gene was assayed after 72 h of cell cultivation. The results

presented in Figure 4 show, that methylation of the cytosine residues within all CpG dinucleotides of the CpG-rich fragment suppresses significantly (5 times) the activity of the CAT gene, expressed from the nonmethylated promoter

C. The globin genes are transcribed in non-differentiated cultured erythroid cells, but their transcripts are not transported to cytoplasm The HD3 cells used in the present study (AEVtransformed chicken erythroblasts) can normally proliferate for many generations. In this state they do not express haemoglobin's, although previous observations indicate that the globin genes are transcribed in proliferating AEV cells (Therwath, 1982). Under special conditions (cultivation at elevated temperature and treatment with an inducer of differentiation) these cells undergo typical steps of terminal differentiation into erythrocytes, resulting in proliferation arrest and the start of haemoglobin synthesis. As the globin genes are transcribed both before and after the terminal differentiation of AEV cells, the possibility exist that important steps of erythroid cell differentiation are controlled at post-transcriptional level. In order to test this supposition we have studied the cellular distribution of the

153

Ioudinkova et al: Regulation of globin genes expression

Figure 5. In situ hybridization of the globin probe on exponentially growing (A, B) and induced to differentiation (C-C'', D) AEV cells. Cells cultivated in vitro to medium density were deposited in cytospin centrifuge onto microscopical slides and processed for in situ hybridisation as detailed in the Methods section. All micrographs shown are single confocal sections. Panels (A,A') show a typical uninduced cell with a very large and diffuse nucleolus (see phase contrast in A'). Panels B,B' show a partially differentiated cell with a more compact nucleolus (see phase contrast in B') and an already formed "nuclear spots" where the globin transcripts are accumulated. Panels C-C'' show three consecutive confocal sections of a differentiated cell. Another typical differentiated cell is shown in panel D. Note the intensive spots in cell nuclei.

transcripts of ! A globin gene in proliferating and differentiated AEV cells. To induce differentiation, the proliferating HD3 cells were incubated with the IMD inducer at 42째C (see Methods section for details). Aliquots were taken from the cell suspension at different time intervals after the beginning of induction and the percentage of cells producing haemoglobins was calculated using benzidine staining. It was found to be correspondingly $1%, 18%, 30% and 42% in the samples taken 24, 48, 52 and 76 h after the beginning of induction. The percentage of the dead cells present at the same samples was calculated using trypan blue staining and was found to be correspondingly 9%, 11%, 18% and 40%. Hence, four days after the start of induction, about 70% of cells still alive produced haemoglobins. The morphology of these cells was checked by light microscopy after staining with Giemsa. Proliferating cells are big, with huge nuclei, and more or less oval in shape. After incubation for 4 days under conditions favouring differentiation, one could observe a number of differentiated (small almost square) cells with picnotic nuclei originating, apparently, from large (precursor ?) cells and from cell clusters (not shown). The RNA probe recognising the transcripts of the ! A globin gene was prepared as described in "Methods" and used for hybridisation in situ on the non-induced cultured chicken erythroblasts (line HD3). The results of

our experiments show that the ! A gene is indeed transcribed in proliferating HD3 cells (Figure 5 A, B). This globin RNA is not randomly distributed within the nuclear volume. There is a clear concentration of the hybridisation signal around nucleoli clearly visible in phase contrast (Figure 5 A', B') and also, in some instances, at the nuclear periphery, in addition to faint tracks in the nucleoplasm. When HD3 cells were induced to differentiate the situation changed drastically. The strongest signal was then present in the cytoplasm (Figure 5 C-C'', D) in an apparently homogeneous manner. The pattern of nuclear transcripts had also changed: their distribution differed extensively from that observed in non-differentiated cells. Most of the RNA identified by the ! A globin probe could be observed within one or two intensively stained spots (Figure 5 C-C'', D). These might represent the processing centres of pre-mRNA. The confocal series (Figure 5 CC'') and DAPI staining (not shown) indicate that these, apparently spherical bodies are distinct from the nucleoli, outlined by globin RNA in the uninduced cells (Figure 5 A,A', B,B'). It seems evident that the amount of nuclear staining in proliferating and differentiated HD3 cells is almost the same, whereas the pattern of distribution changes drastically. It is hence likely that after induction, the expression of globin proteins commences in AEV cells, because the pre-mRNA is released from the nuclei.

154

Gene Therapy and Molecular Biology Vol 6, page 155

suspension in Dulbecco modified Eagle's medium supplemented with 8% fetal bovine serum and 2% chicken serum. Transfection of DNA into these cells was performed with the "lypofectin" transfection reagent (Gibco-BRL), as described in the manufacturer's manual. In standard experiments, 106 cells were transfected with either 1 µg of methylated or non-methylated constructs or with equimolar amount of vector DNA. To monitor the efficiency of transfection, the cells were cotransfected with pSV-"-Galactosidase Control Vector (Promega). The activity of the CAT (chloramphenicol-acetyl-transferase) and "-gal genes was assayed in cellular extracts 60 h after transfection. To induce erythroid differentiation of growing HD3 cells, the inducer (IMD, isoquinolinylsulphonil-2-methylpiperasine-dichloride) was added to the cell suspension up to a final concentration of 20 mM and, thereafter, the cells were cultivated at elevated temperature (42°C instead of 37°C). At the beginning of differentiation the concentration of cells in suspension was adjusted to 5x105 per ml.

III. Discussion Although the domains of "-globin genes in human and chicken have been extensively studied over past 25 years, many questions concerning the regulation of "globin gene expression (including switching from the embryonic to the adult expression pattern) remain unsolved. Here we have demonstrated that in AEVtransformed erythroid cells expression of globins is regulated in both transcriptional and post-transcriptional levels. Although it was shown previously, that an LCRlike positive regulatory element (in human cells known as HS -40 (Higgs et al, 1990)) is essential for expression of "-globin genes, the correct expression in erythroid cells may depend on a negative regulatory element described here. We have demonstrated that, being methylated, this regulatory element ensure 5X suppression of the activity of ! D gene promoter in a model experiment with !Dpromoter-CAT gene cassette transfected to cultured chicken erythroid cells. In a normal chromatin context this effect is likely to be even more profound. Indeed, the gene silencing by CpG methylation may depend on a certain reorganization of the chromatin structure (Razin, 1998) and it is known that transfected plasmids do not fully acquire the normal chromatin organization. An interesting observation made in the present study is that ! A gene-specific transcripts are virtually absent from cytoplasm of immature erythroid cells although they can be easily detected in the nuclei. Hence it is likely that beginning of expression of globin proteins upon differentiation of erythroid cells becomes possible because pre-m-RNA is released to undergo processing and to leave nuclei. This suggests that there is a special control mechanism that regulates the destination of the primary transcripts, by targeting them to special nuclear compartments placed, possibly, on the processing and transport pathways. Looking at the distribution of globin RNA in non-differentiated cells, one can propose that the peri-nucleolar area serves for the temporary storage (and possibly for subsequent destruction) of transcripts that were unable to pass to the processing centres. Conversely one may simply observe a compartment on the normal processing pathway, which is blown-up due to a block in the transport system downstream. Indeed, Chan and Ingram [Chan, 1973 #509] showed many years back that nuclei of in vitro cultivated chicken blood islands contain globin mRNA many hours before the latter starts to show up in the cytoplasm. Furthermore, there was always a suspicion that the nucleoli might be involved somehow in gene expression, beyond the mere contribution of ribosomes to the protein biosynthesis machinery (e.g.: cf. [Deak, 1972 #511; Pederson, 1999 #527])

B. Preparation of DNA constructs All manipulations with recombinant DNA were carried out as described (Maniatis, 1982). The initial vector containing the CAT gene expressed under the control of !D globin gene promoter !DpCAT3) has been described previously (Razin et al, 1999). The DNA fragment showing different methylation pattern in erythroid and non-erythroid cells (0.65 kb fragment of the upstream area of chicken !-globin gene domain) was excised from the insertion of the previously described recombinant clone !5HR ((Razin et al, 1991), Gene Bank accession number: X54965) by double digestion with Fak I and Hae II restriction endonucleases. This fragment was inserted into Mlu I site of !DpCAT3 vector after the ends of both the vector and the insertion were made blunt. The clone bearing the recombinant plasmid with the CpG-rich DNA fragment inserted in the same orientation (versus promoter) as in the genomic chicken DNA was selected and used in further experiments. From this recombinant construct the CpG-rich DNA fragment was excised by cleavage with Sac I and Nhe I restriction endonucleases. The excised fragment was methylated in vitro using SssI methylase (Biolabs). The degree of methylation was monitored by digestion of aliquots of reaction mixture with Hpa II restriction enzyme. Methylated DNA fragment was reinserted into dephosphorylated vector DNA and circular DNA was purified by preparative agarose gel electrophoresis.

C. Analysis of chloramphenicol-acetyltrancferase and "-glactosidase activities in cell extracts Promega assay systems were used in both cases, and enzyme activity was determined exactly as described in the manufacturer's manuals. To determine the activity of chloramphenicol-acetyl-transferase, thin layer chromatography was used. After chromatographic separation, the spots containing non-modified chloramphenicol and butyrylated forms were scraped from the chromatographic plate and the radioactive signal was quantified in a liquid scintillation counter.

IV. Materials and Methods

D. DNA hybridization (Southern analysis)

A. Cell culture and DNA transfection

Chicken genomic DNA from HP50 or HD3 cells was digested with either Msp I or Hpa II or Sma I restriction enzymes, and additionally with Pst I. The digestion products were separated in 1.5% agarose gels and transferred on nylon

Avian erythroblastosis virus (AEV)-transformed chicken erythroblasts of the line HD3 (clone A6 of line LSCC (Beug et al, 1979)) and chicken lymphoid cells (line Hp50) were grown in

155

Ioudinkova et al: Regulation of globin genes expression

filters "NYTRAN-PLUS" (Schleicher&Schuel). Hybridization was carried out in "Rapid-hyb" buffer (Amersham), as described in manufacturer's manual. The probes were labelled with !32P dCTP using Megaprime DNA labelling system (Amersham).

Beug H, Von Kirchbach A, Doderlin J, Conscience JF and Graf T ( 1979) Chicken hematopoietic cells transformed by seven strains of defective avian leukemia viruses display three distinct phenotypes of differentiation. Cell 18, 375-390. Bird AP, Taggart MH, Nicholls RD and Higgs D (1987) Nonmethylated CpG-rich islands at the human a-globin locus: implications for evolution of the "-globin pseudogene. EMBO J 6, 999-1004. Brickner HE, Zhu XX and Atweh GF (1991) A novel regulatory element of the human a-globin gene responcible for its constitutive expression. J. Biol. Chem. 266, 15363-15368. Craddock CF, Vyas P, Sharpe JA, Ayyub H, Wood WG and Higgs DR (1995) Contrasting effects of ! and " globin regulatory elements on chromatin structure may be related to their different chromosomal environments. EMBO J. 14, 1718-1726. Dhar V, Nandi A, Schildkraut CL and Skoultchi AI (1990) Erythroid-specific nuclease-hypersensitive sites flanking the human "-globin domain. Mol. Cell Biol. 10, 4324-4333. Epner E, Reik A, Climbara D, Telling, A, Bender MA, Fiering S, Enver T, Martin DI, Kennedy M, Keller G and Groudine M (1998) The "-globin LCR is not necessary for an open chromatin structure ordevelopmentally regulated transcription of the native mouse "-globinlocus. Mol. Cell 2, 447-455. Felsenfeld G (1993) Chromatin structure and the expression of globin-encoding genes. Gene 135, 119-24. Forrester WC, Epner E, Driscoll MC, Enver T, Brice M, Papayannopoulou T and Groudine M (1990) A deletion of the human "-globin locus activation region causes a major alteration in chromatin structure and replication across the entire "-globin locus. Genes Dev 4, 1637-1649. Forrester WC, Takegawa S, Papayannopoulou T, Stamatoyannopoulos G and Groudine M (1987) Evidence for a locus activating region: the formation of developmentally stable hypersensitive sites in globin expressing hybrids. Nucl. Acids Res. 15, 10159-10175. Gourdon G, Sharpe JA, Higgs DR and Wood WG (1995) The mouse "-globin locus regulatory elements. Blood 86, 766775. Grosveld F, van Assandelt GB, Greaves DR and Kollias B (1987) Position-independent, high-level expression of the human "-globin gene in transgenic mice. Cell 51, 975-985. Higgs DR (1998) Do LCRs open chromatin domains? Cell 95, 299-302. Higgs DR, Wood WG, Jarman AP, Sharpe J, Lida J, Pretorius IM and Ayub H (1990) A major positive regulatory region located far upstream of the human "-globin gene locus. Genes Dev. 4, 1588-1601. James-Pederson M, Yost S, Shewchuk B, Zeigler T, Miller R and Hardison R (1995) Flanking and intragenic sequences regulating the expression of the rabit !-globin gene. J. Biol. Chem. 270, 3965-3973. Li Q, Zhou B, Powers P, Enver T and Stamatoyannopoulos G (1990) "-globin locus activations regions: conservation of organization, structure and function. Proc. Natl. Acad. Sci. USA 87, 8207-8211. Maniatis T, Fritsch EF, Sambrook J (1982) Molecular Cloning: a laboratory manual: Cold Spring Harbor, New York). Moon AM and Ley TJ (1990) Conservation of the primary structure, organization, and function of the human and mouse b-globin locus-activating regions. Proc. Natl. Acad. Sci. USA 87, 7693-7697.

E. In situ hybridization To prepare a strand-specific probe, the 1.8 kb chicken genomic DNA fragment containing the !A gene (for a genomic map see [Recillas Targa, 1994 #459]), was cloned into the pSP73 Vector (Promega). The fragment was then transcribed in the direction opposite to that of globin gene transcription with the T7 RNA polymerase, using the Boehringer (Mannheim) kit for preparation of digoxigenin-labelled RNA. Hybridization in situ was carried out according to the Boehringer (Mannheim) manual as described before [De Conto, 1999 #502]. Briefly, HD3 cells were fixed in 1% paraformaldehyde in PBS for 20 min at r.t. before treatment with a solution of 70% ethanol and 3% H2O2, to suppress endogenous peroxidases. Cells were then permeabilized with 0,2% Triton X-100 in PBS for 10 min, washed carefully in PBS and immersed in 0,1 M glycine in PBS for 5 min. After rincing in PBS, cells were treated with 0,25% acetic anhydride in 0.1M triethanolamine buffer for 10 min, prior to incubation at 42°C for 16 hours with the ribo-probe (0.5 ng/ml) in hybridization buffer (50% de-ionized formamide, 5x SSC, 10% dextran sulphate, 2.5x Denhardt's solution, 10 mM dithiothreitol, 20 mM vanadyl ribonucleotide complex). After hybridization, the digoxigenin-labelled probe was detected by incubation with anti-digoxigenin-AP, FAB fragments (Boehringer (Mannheim)), followed by incubation with tyramide, as described in the manual for the TSA-DIRECT (tyramide signal amplification) kit (DuPont, NEN).

F. Confocal Laser Scanning Microscopy and image analysis Analysis of patterns of globin RNA localization in HD3 cells was performed using the TCS (Leica Germany) confocal imaging system, equipped with a 63X objective (plan apo; NA 1.4). For Cy3 excitation, an Argon-Kripton ion laser adjusted at 488 nm was used. The signal was treated using line averaging, to integrate the signal collected over 8 lines in order to reduce noise. For high resolution, we defined a set of acquisition parameters, which took into account Nyquist's principle. The confocal pinhole was closed to yield a minimum field depth (about 0.6 µm), and focal series were collected for each specimen. The focus step between these sections was generally 0.3 µm and the XY pixelization was set to 100 nm.

Acknowledgements This work was supported by grant N 097 from the Russian State Program "Frontiers in Genetics", by RFFI grants 99-04-49204 and 00-15-97772 (Scientific Schools) by EMBO fellowship given to Olga Iarovaia and by "Chaire Internationale de Recherche Blaise Pascal de l'Etat et de la Région d'Ile-de-France, gérée par la Fondation de l'Ecole Normale Supérieure", given to Sergey Razin.

References Bender MA, Bulger M, Close J and Groudine M (2000) "-globin gene switching and DNase I sensitivity of the endogenous bglobin locus in mice do not require the locus control region. Mol. Cell 5, 387-393.

156

Gene Therapy and Molecular Biology Vol 6, page 157

Razin A (1998) CpG methylation, chromatin structure and gene silencing-a three-way connection. EMBO J 17, 4905-4908. Razin SV, Kekelidze MG, Lukanidin EM, Scherrer K and Georgiev GP (1986) Replication origins are attached to the nuclear skeleton. Nucl. Acids Res. 14, 8189-8207. Razin SV, Petrov P and Hancock R (1991) Precise localization of the "-globin gene cluster within one of the 20- to 300Kilobase DNA fragment released by cleavage of chicken chromosomal DNA at topoisomerase II site in vivo: evidence that the fragment are DNA loops or domains. Porc. Natl. Acad. Sci. USA 88, 8515-8519. Razin SV, Shen K, Ioudinkova E and Scherrer K (1999) Functional analysis of DNA sequences located within a cluster of DNase I hypersensitive sites colocalising with MAR element at the upstream border of the chicken a-globin gene domain. J. cell. Biochem 74, 48-49. Razin SV, Shen K, Ioudinkova E and Scherrer K (1999). Functional analysis of DNA sequences located within a cluster of DNase I hypersensitive sites colocalizing with a MAR element at the upstream border of the chicken !-globin gene domain. J. Cell. Biochem. 74, 38-49. Razin SV, Vassetzky YS, Kvartskhava AI, Grinenko NF and Georgiev GP (1991) Transcriptional enhancer in the vicinity of replication origin within the 5' region of the chicken "globin gene domain. J. Mol. Biol. 217, 595-598. Sharpe JA, Chan-Thomas PS, Lida J, Ayyub H, Wood WG and Higgs DR (1992) Analysis of the human ! globin upstream regulatory element (HS-40) in transgenic mice. EMBO J 11, 4565-4572.

Shewchuk BM and Hardison RC (1997) CpG islands from the !globin gene cluster increase gene expression in an integration-dependent manner. Mol. Cell. Biol. 17, 58565866. Sjakste N, Iarovaia OV, Razin SV, Linares-Cruz G, Sjakste T, Le Gac V, Zhao Z and Scherrer K (2000) A novel gene is transcribed in the chicken "-globin gene domain in the direction opposite to the globin genes. Mol. Gen. Genet. 262, 1012-1021. Therwath A and. Scherrer K (1982) Precursors of distinct size for chicken !A, !D and " globin mRNA. FEBS Lett. 142, 1216. Verbovaia L, and Razin SV (1995) Analysis of the replication direction through the domain of "-globin-encoding genes. Gene 166, 255-259. Vyas P, Vickers MA, Picketts DJ and Higgs DR (1995) Conservation of position and sequence of a novel, widely expressed gene containing the major human !-globin regulatory element. Genomics 29, 679-689. Vyas P, Vickers MA, Simmons DL, Ayyub H, Craddock CF and Higgs DR (1992) Cis-acting sequences regulating expression of the human "-globin cluster lie within constitutively open chromatin. Cell 69, 781-793. Whitelaw E, Hogben P, Hansombe O and Proudfoot NJ (1989) Transcriptional promiscuity of the human a-globin gene. Mol. Cell. Biol. 9, 241-251.

157

Ioudinkova et al: Regulation of globin genes expression

158

Gene Therapy and Molecular Biology Vol 6, page 159

Gene Ther Mol Biol Vol 6, 159-167, 2001

Surface-shielded polycation-based systems targeting reporter and therapeutic genes to distant tumors Review Article

Ralf Kircheis1*, Lionel Wightman1, Malgorzata Kursa1, Birgit Smrekar1, Elinborg Ostermann1, and Ernst Wagner1,2 1

Boehringer Ingelheim Austria, Dr. Boehringer Gasse 5-11, A-1121 Vienna, Austria Current address: Pharmaceutical Biology - Biotechnology, Ludwig-Maximilians- Universit채t M체nchen, Butenandtstr. 513, D-81377 Munich, Germany 2

_________________________________________________________________________________________________ *Correspondence: Ralf Kircheis, MD, Ph.D., Cancer Vaccines & Gene Therapy, Boehringer Ingelheim Austria GmbH Dr. BoehringerGasse 5-11, A-1121 Vienna, Austria Tel.: +43-(1)-80105 2790, Fax: +43-(1)-80105 2683; e-mail: ralf.kircheis@vie.boehringeringelheim.com Key words: gene therapy, tumor targeting, non-viral gene transfer, polyethylenimine, PEI, polyplex, transferrin, tumor necrosis factor, TNF! Abbreviations: polyethylene glycol, (PEG); polyethylenimine, (PEI); transferrin, (Tf); transferrin-polyethylenimine, (Tf-PEI); tumor necrosis factor, (TNF!) Received: 15 September 2001; accepted: 17 September 2001; electronically published: February 2004 2002

Summary We have developed surface-shielded transferrin-polyethylenimine (Tf-PEI) - based gene delivery systems which are able to target gene expression to distant tumors after systemic application in murine models. For systemic in vivo application the biophysical parameters of transfection complexes, such as particle size, stability, surface charge, and modification with targeting ligand, were found to be critical for DNA biodistribution, toxicity, and gene transfer efficacy. Two major mechanisms may contribute to the tumor-specific targeting: active targeting via receptormediated cell binding and passive targeting via shielding of the surface charge of the complexes. Shielding reduces plasma protein and erythrocyte binding, resulting in prolonged blood circulation and extravasation of DNA complexes in areas of vascular leakiness of the tumor tissue. Shielding of surface charges can be achieved by coating polycation/DNA complexes with either polyethylene glycol (PEG) or by incorporating Tf ligand at high densities. Systemic application of surface-shielded transferrin-polyethylenimine-based DNA complexes coding for tumor necrosis factor (TNF!) localized gene expression to distant tumors, resulting in pronounced hemorrhagic tumor necrosis and inhibition of tumor growth. TNF! activity was confined to the tumor without systemic TNF-related toxicity. utilizing biological amplification mechanisms (e.g. during transcription / translation, bystander effects, triggering immune effector mechanism). However, the lack of effective and target-specific vectors is a major bottleneck for somatic gene therapy to date. Non-viral vectors are increasingly being utilized as gene delivery vehicles because of advantages such as stability, low cost, and high flexibility regarding the size of the transgene delivered. However, major limitations for non-viral gene delivery vectors include unspecific binding to non-target tissues, inefficient uptake into the target cells, limited release from

I. Introduction Gene therapy has become an attractive concept for a broad variety of biomedical applications. The potential of gene therapy for directing the expression of therapeutic genes to the target cells makes it particularly attractive for treatment of cancer. Multiple levels of target specificity are attainable: by exploiting specific delivery mechanisms to target the tumor (biochemical or physical targeting), specific intracellular characteristics of the target cells (e.g. preferential targeting of proliferating cells), controlled tissue-specific expression (transcriptional targeting), and

159

Kircheis et al: Tumor-targeted gene delivery

endosomes, and inefficient import into the nucleus of target cells. Recently we have developed surface-shielded transferrin-polyethylenimine (Tf-PEI) - based gene delivery systems which are able to target gene expression to distant tumors after systemic application in murine models (Kircheis et al, 1999, 2001a,b). For target specificity cell-binding ligands, such as transferrin, EGF, or antibodies, can be coupled to polyethylenimine (PEI) (Kircheis et al, 1997; Zanta et al, 1997; Erbacher et al, 1999; Blessing et al, 2001), resulting in vectors that combine the intrinsic activities of PEI (Boussif et al, 1995) with specific receptor-mediated uptake mechanism (Wagner et al, 1994). Furthermore, DNA biodistribution and gene transfer efficacy after systemic application in vivo is determined by the biophysical parameters of transfection complexes, such as particle size, stability and surface charge (Kircheis et al, 1999, 2001a). Shielding of the transfection complexes from unspecific interaction combined with active targeting mechanisms resulted in specific uptake in tumors. Shielding the surface charge of transfection complexes was achieved by coating polycation/DNA complexes with polyethylene glycol (PEG) (Kircheis et al, 1999; Ogris et al, 1999) or by incorporating Tf ligand at high densities (Kircheis et al, 2001a). Surface-shielded transferrin-polyethylenimine-based gene delivery systems were used in syngeneic murine tumor models to deliver a therapeutic gene, coding for tumor necrosis factor (TNF!). TNF! is a highly potent pleiotropic cytokine, and is well known for its ability to

induce hemorrhagic tumor necrosis and tumor regression (Old, 1985). However, the clinical application of TNF! is hampered by its high systemic toxicity (Beutler et al, 1985). In contrast, systemic application of surfaceshielded Tf-PEI complexes with the TNF! gene resulted in pronounced hemorrhagic tumor necrosis and inhibition of tumor growth without systemic TNF-related toxicity due to the localization of the activity of the cytokine to the tumor. These data indicate that targeted gene delivery to tumors may be an attractive strategy applicable to highly active, yet, toxic molecules in cancer treatment.

II. Results A. Ligand-polycation based receptormediated gene transfer Condensation of DNA by electrostatic interactions with polycations is being used to protect DNA from degradation by nucleases, resulting in formation of compact particles that can be taken up by the cells via natural processes such as adsorptive endocytosis or phagocytosis. Among the synthetic vectors, PEI shows particularly promising efficacy in transfection in cell culture as well as in a variety of applications in vivo (Boussif et al, 1995; Abdallah et al, 1996; Goula et al, 1998). Beside its DNA condensing activity PEI has an intrinsic endosomolytic activity mediating, by a â&#x20AC;&#x2DC;proton sponge mechanismâ&#x20AC;&#x2122;, the escape of DNA from the endosomal department (Boussif et al, 1995; Kichler et al, 2001).

Figure 1. Ligand-polycation based receptor-mediated gene transfer

160

Gene Therapy and Molecular Biology Vol 6, page 161

spleen which are specialized in removal of foreign particles pose obstacles particularly for systemic application of transfection complexes. Furthermore, the particles have to be small enough to leave the vascular system and to diffuse through the tissues to reach their target (Figure 2). Another major problem are unspecific interactions with blood components, extracellular matrix and nontarget cells. Positively charged polycation/DNA complexes were found to aggregate in physiological salt, to interact with components of the coagulation and complement systems, and to cause aggregation of erythrocytes which can result in occlusion of capillaries e.g. in the lungs, leading to lung embolism (Plank et al, 1996; Ogris et al, 1999; Kircheis and Wagner, 2000). Furthermore, recognition and uptake by cells of the reticuloendothelial system will cause rapid removal from the circulation (Figure 3). We have shown that unspecific interaction with plasma components or erythrocytes can be prevented by shielding the surface of transfection particles by covalent modification with PEG without affecting the targetspecific transferrin ligand - receptor interactions (Kircheis et al, 1999; Ogris et al, 1999) (Figure 4). More recently we have employed an alternative strategy for masking the surface charge of DNA complexes. It was found that transferrin in the complex not only can serve as a cellbinding ligand but also mediate efficient shielding of the surface charge. In fact, incorporation of Tf at higher densities into the complex was shown to shield the positive surface charge of PEI/DNA complexes formed with low molecular weight PEIs (e.g. 25kDa, 22kDa) also in the absence of PEGylation (Kircheis et al, 2001a).

To combine the high gene transfer efficacy of PEI/DNA complexes with the target-specific mechanism of receptormediated uptake, we have incorporated cell-binding ligands (Kircheis et al, 1997; Blessing et al, 2001), such as transferrin (Tf) or EGF into the complex by chemical coupling to PEI. Binding of the Tf ligand-coated DNA complexes to the Tf receptor on the target cells, followed by endocytosis into vesicles, escape of the DNA from the endosomal compartment, and nuclear entry are critical steps for efficient transfection (Figure 1). The efficacy of these intracellular steps is influenced by the cell-binding ligand, the type of the polycationic carrier, and the physical characteristics such as the size of the transfection complex. Large particles (from several hundred nm up to Âľm) generated at physiological salt concentrations were found to have higher transfection efficacy compared to small sized complexes (~50nm) formed in salt-free buffers (Ogris et al, 1998). Particle size is also dependent on the DNA (and polycation) concentration during complex formation and on polycation to DNA ratio. Compact particles of small size are usually obtained at higher polycation/DNA ratios (i.e. N/P ratios), resulting in complexes with a strong net positive charge, i.e. high zetapotential. At neutrality polycation/DNA complexes have the tendency for particle aggregation. The requirement to have excessive positive charge for efficient DNA complexation, however, can cause major problems particularly for in vivo applications.

B. Systemic application in vivo Compared to cell culture applications gene delivery in vivo has to overcome a variety of additional problems. Passing blood circulation and organs such as liver and

Figure 2. Multiple barriers for polycation/DNA complexes for targeted gene expression following systemic in vivo application

161

Kircheis et al: Tumor-targeted gene delivery

Figure 3. Unspecific interactions of positively charged polycation/DNA complexes

Figure 4. Shielding transfection complexes from non-specific interactions and incorporation of targeting mechanisms DNA is condensed into compact positively charged particles by excessive polycation. Incorporation of cell-binding ligands provides the possibility for specific binding to the target cells. At the same time also non-specific interactions with blood components and non-target cells are possible. Non-specific interactions can be blocked by shielding the surface of the transfection complexes either by covalent coupling of polyethylene glycol (PEG) or by incorporating the ligand transferrin at sufficiently high densities.

162

Gene Therapy and Molecular Biology Vol 6, page 163

Wagner, 2000). Further studies on the biodistribution of transfection complexes showed a significant accumulation of shielded transfection complex in the tumor compared to non-shielded complexes (Kircheis et al, 1999; 2001b). Beside the passive targeting obviously also active targeting mechanisms such as enhanced uptake by Tfreceptor expressing (Wagner et al, 1994; Kircheis et al, 1997) and highly proliferating tumor cells (Brunner et al, 2000) are contibuting to the preferential gene expression in the tumor.

Shielding of the surface charge of PEI/DNA complexes, generating particles with a near neutral zeta-potential, blocks the aggregation of erythrocyte. In contrast, nonshielded complexes induce massive erythrocyte aggregation (Figure 5). Systemic application of nonshielded luciferase reporter gene complexes into tumorbearing mice resulted in high gene expression in the lungs, lower expression in other organs, such as the heart and liver, but was often accompanied by considerable toxicity Particularly when high molecular PEI800/DNA complexes were used approximately half of the animals died with signs of lung embolism (Kircheis et al, 1999). Complexes using the lower molecular weight PEIs (e.g. 25kDa or 22kDa) showed generally lower toxicity, particularly when the linear PEI22 was used (Goula et al, 1998; Wightman et al, 2001). With all PEIs lung expression was prominent with varying expression levels in other major organs or the tumor. In contrast Tf-PEI/DNA complexes shielded either by PEG or high densitiy Tf resulted in preferable reporter gene expression in the tumor. Furthermore, expression in the lungs or in the other organs was dramatically reduced (Figure 6). Shielding of the transfection complexes from unspecific interactions was shown to lead to longer circulation times in the blood (Ogris et al, 1999) resulting in extravasation in areas of higher vascular permeability such as tumors (passive targeting) (Gerlowski and Jain, 1986; Kircheis and

C. Tumor-targeted gene delivery of TNF! We were particularly interested in applying this tumor-targeted gene delivery system for delivering a highly active effector molecule TNF!. TNF! is a cytokine with pronounced antitumor activity (Old, 1985). It is known to act on a broad variety of cells, particularly damaging the vascular system of the tumor. The problem with conventional TNF! rotein therapy has been its high systemic toxicity (Beutler et al, 1985). Since both, antitumor activity and systemic toxicity seem to share common pathophysiological mechanisms, the only possibility to separate the antitumor activity from its systemic toxicity is to localize TNF! ctivity to the tumor.

Figure 5. Shielding of the surface charge of transfection complexes blocks aggregation of erythrocytes.Non-shielded positively charged polycation/DNA complexes induce aggregation of erythrocytes. Shielding of the surface charge by incorporation of the ligand transferrin at high densities in the complex blocks the aggregation of erythrocytes.

163

Kircheis et al: Tumor-targeted gene delivery

Figure 6. Reporter gene expression after systemic gene delivery into tumor-bearing mice. Positively charged PEI/DNA complexes (a), or high density transferrin incorporation (b), or charge-shielded Tf-PEI/DNA complexes after PEGylation (c) were injected into the tail vein of A/J mice bearing subcutaneously growing Neuro2a tumors. Zeta potential of the complexes was measured using a Malvern Zetasizer and is shown in mV. Gene expression in the major organs and tumor was measured by luciferase assay 24 h after application. Mean values Âą SEM are shown.

164

Gene Therapy and Molecular Biology Vol 6, page 165

Surface-shielded transfection complexes containing an expression plasmid coding for murine TNF! were repeatedly applied systemically into the tail vein of BALB/c mice bearing subcutaneously growing MethA fibrosarcoma on their flank. After a few days the majority of the animals developed pronounced hemorrhagic tumor necrosis, which is one of the hallmarks of the antitumor activity of TNF! Figure 7). Moreover, hemorrhagic necrosis was focused specifically to the tumor, and no systemic toxicity was seen. Induction of hemorrhagic tumor necrosis was associated by visible inhibition of tumor growth. In approximately 60% of the TNF! treated animals finally a complete tumor regression was seen (Figure 7). These animals were also protected from subsequent tumor rechallenge. In untreated animals or control animals, which received similar transfection complexes containing

the "-alactosidase gene, no hemorrhagic necrosis and only occationally sponteneous tumor regressions were observed.TNF!-specific induction of hemorrhagic tumor necrosis was also demonstrated in another tumor model, the Neuro2a neuroblastoma. Surface-shielded transfection complexes coding for TNF! were systemically applied into Neuro2a bearing A/J mice, resulting in significant TNF! gene expression (as measured by ELISA) within the tumor, without detectable serum levels (data not shown). After one week of treatment 85% of the TNF! treated animals developed hemorrhagic tumor necrosis while in animals without treatment or treated with similar transfection complexes containing the "-galactosidase reporter gene or the non-expressing pSP65 plasmid tumor necrosis was found only in 5%, 16%, or 12%, respectively. Induction of hemorrhagic tumor necrosis

Figure 7. Tumor-targeted gene delivery of TNF! leads to hemorrhagic tumor necrosis and tumor regression. Surface-shielded transfection complexes containing an expression plasmid coding for murine TNF! were repeatedly applied systemically into the tail vein of BALB/c mice bearing subcutaneously growing MethA fibrosarcoma on their flank. 60% of the animals developed pronounced hemorrhagic tumor necrosis (upper left), no systemic toxicity was seen. Induction of hemorrhagic tumor necrosis was associated by inhibition of tumor growth resulting in more than half of the TNF! treated animals in complete tumor regression (upper right). Control animals treated with similar transfection complexes containing the "-galactosidase gene did not develop hemorrhagic tumor necrosis (lower panel).

165

Kircheis et al: Tumor-targeted gene delivery

Figure 8. TNF! specific induction of hemorrhagic tumor necrosis and inhibition in tumor growth in the Neuro2a tumor model. Surfaceshielded transfection complexes coding for TNF! were systemically applied into Neuro2a bearing A/J mice. After one week of treatment 85% of the TNF! treated animals developed hemorrhagic tumor necrosis in contrast to animals treated with similar transfection complexes having the "-galactosidase reporter gene. Induction of hemorrhagic tumor necrosis resulted in a significant inhibition of tumor growth in the TNF! treated animals as compared to the control groups. Mean values Âą SEM of groups of 6 animals are shown.

elements (Dachs et al, 1997) should ensure that the gene of interest is only expressed at the desired target site. The presented data using reporter and therapeutic genes indicate that targeted gene delivery to tumors may be an attractive strategy applicable to highly active, yet toxic molecules such as TNF! in cancer treatment.

resulted in a significant inhibition of tumor growth in the TNF! treated animals as compared to the control groups (Figure 8).

III. Conclusions A therapeutically applicable non-viral gene delivery vector should comprise a number of essential functions including condensation and protection of DNA, uptake into the target cells, and expression of the desired gene at the target site. Incorporation of cell-binding ligands, endosomal release enhancers, and nuclear localization signals can enable specific and efficient gene delivery and expression. For in vivo application the physical and colloidal parameters of transfection complexes, such as particle size, surface charge, and stability are critical factors which determine DNA biodistribution and gene expression. Knowing these parameters and their complex interplay will provide the basis for the rational design of gene delivery systems applicable for in vivo application. Finally, shielding transfection complexes from unspecific interactions, incorporation of active cell targeting mechanisms, combined with transcriptional targeting by using tissue-specific promotors or hypoxia-responsive

References Abdallah B, Hassan A, Benoist C, Goula D, Behr JP, and Demeneix BA (1996) A powerful nonviral vector for in vivo gene transfer into the adult mammalian brain: polyethylenimine. Hum Gene Ther 7, 1947-1954. Beutler B, Milsark IW, and Cerami A (1985) Passive immunization against Cachectin/Tumor Necrosis Factor protects mice from lethal effect of endotoxin. Science 229, 869-871. Blessing T, Kursa M, Holzhauser R, Kircheis R, and Wagner E (2001) Different strategies for formation of PEGylated EGFconjugated PEI/DNA complexes for targeted gene delivery. Bioconjugate Chem 12, 529-537. Boussif O, Lezoualc'h F, Zanta MA, Mergny MD, Scherman D, Demeneix B, and Behr JP (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo polyethylenimine. Proc Natl Acad Sci USA 92, 7297-7301.

166

Gene Therapy and Molecular Biology Vol 6, page 167

Brunner S, Sauer T, Carotta S, Cotton M, Saltik M, and Wagner E (2000) Cell cycle dependence of gene transfer by lipoplex, polyplex and recombinant adenovirus. Gene Ther 7, 401407. Dachs GU, Patterson AV, Firth JD, Ratcliffe PJ, Townsend KMS, Stratford IJ, and Harris AL (1997) Targeting gene expression to hypoxic tumor cells. Nature Med 3, 515-520. Erbacher P, Remy JS, and Behr JP (1999) Gene transfer with synthetic virus-like particles via the integrin-mediated endocytosis pathway. Gene Ther 6, 138-145.

for tumor-targeted gene delivery in vivo. J Gene Medicine 1, 111-120. Kircheis R, Wightman L, Schreiber A, Robitza B, Rössler V, Kursa M, and Wagner E (2001) Polyethylenimine/DNA complexes shielded by transferrin target gene expression to tumors after systemic application. Gene Ther 8, 28-40. Ogris M, Brunner S, Schüller S, Kircheis R, and Wagner E (1999) PEGylated DNA/Transferrin-PEI complexes: Reduced interaction with blood components, extended circulation in blood and potential for systemic gene delivery. Gene Ther 6, 595-605. Ogris M, Steinlein P, Kursa M, Mechtler K, Kircheis R, and Wagner E (1998) The size of DNA/transferrin-PEI complexes is an important factor for gene expression in cultured cells. Gene Ther 5, 1425-1433.

Gerlowski LE, and Jain RK (1986) Microvascular permeability of normal and neoplastic tissue. Microvasc Res 31, 288-305. Goula D, Benoist C, Mantero S, Merlo G, Levi G, and Demeneix BA (1998) Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther 5, 1291-1295. Kichler A, Leborgne C, Coeytaux E, and Danos O (2001) Polyethylenimine-mediated gene delivery: a mechanistic study. J Gene Med 3, 135-144. Kircheis R and Wagner E (2000) Polycation/DNA complexes for in vivo gene delivery. Gene Therapy and Regulation 1, 95114. Kircheis R, Blessing T, Wightman L, Brunner S, and Wagner E (2001) Tumor targeting with surface-shielded ligandpolycation DNA complexes. J Controlled Rel 72, 165-170.

Old LJ (1985) Tumor Necrosis Factor (TNF). Science 230, 630632.

Kircheis R, Kichler A, Wallner G, Kursa M, Ogris M, Felzmann T, Buchberger M, and Wagner E (1997) Coupling of cellbinding ligands to polyethylenimine for targeted gene delivery. Gene Ther 4, 409-418. Kircheis R, Schüller S, Brunner S, Ogris M, Heider KH, Zauner W, and Wagner, E (1999) Polycation-based DNA complexes

Wightman L, Kircheis R, Roessler V, Carotta S, Ruzicka R, Kursa M, and Wagner E (2001) Different behavior of branched and linear polyethylenimine for gene delivery in vitro and in vivo. J Gene Med 3, 362-372. Zanta MA, Boussif O, Adib A, and Behr JP (1997) In vitro gene delivery to hepatocytes with galactosylated polyethylenimine. Bioconjugate Chem 8, 841-844 .

Plank C, Mechtler K, Szoka F, and Wagner E (1996) Activation of the complement system by synthetic DNA complexes: A potential barrier for intravenous gene delivery. Hum Gene Ther 7, 1437-1446. Wagner E, Curiel D, Cotten M (1994) Delivery of drugs, proteins and genes into cells using transferrin as a ligand for receptormediated endocytosis. Adv Drug Del Rev 14, 113-136.

167

Kircheis et al: Tumor-targeted gene delivery

168

Gene Therapy and Molecular Biology Vol 6, page 169

Gene Ther Mol Biol Vol 6, 169-181, 2001

A retroviral model for tissue-specific transcription: lessons for gene therapy Review Article

Quan Zhu and Jaquelin P. Dudley* Section of Molecular Genetics and Microbiology and Institute for Cellular and Molecular Biology, The University of Texas at Austin, Austin, TX _________________________________________________________________________________________________ *Correspondence: Jaquelin P. Dudley Address: Section of Molecular Genetics and Microbiology, The University of Texas at Austin, 100 W. 24th Street, Austin, TX 78705; Telephone: (512) 471-8415; Fax: (512) 471-7088; E-mail: jdudley@uts.cc.utexas.edu Key words: MMTV, T-cell lymphoma, steroid reseptor Abbreviations: !-chain, (V!); envelope proteins, (Env); GA-binding protein, (GABP); glucocorticoid receptor, (GR); homeodomain, (HD); hormone responsive elements, (HREs); long terminal repeats, (LTRs); major histocompatibility complex, (MHC); Mouse mammary tumor virus, (MMTV); negative regulatory elements, (NREs); nuclear factor 1, (NF1); Nucleosome A, (Nuc-A); octamer, (OCT); splice acceptor, (SA); Splice donor, (SD); T-cell receptor, (TCR) Received: 31 October 2001; accepted: 12 November 2001; electronically published: February 2004

Summary Mouse mammary tumor virus (MMTV) induces breast cancer in mice by transmission of virus from infected mothers to susceptible offspring through milk. During milk-borne MMTV transmission, virus must be transferred to B and T cells in the gut-associated lymphoid tissue, and these lymphocytes carry the infection to the mammary gland. Wild-type MMTV strains have been selected for optimal virus expression in lactating mammary gland cells, while minimizing gene expression and integration in other cell types. In particular, the MMTV transcriptional control region contains binding sites for both transcriptional repressor proteins, e.g., SATB1 and CDP, and positive factors, e.g., glucocorticoid receptor. Studies of MMTV transcriptional regulation may provide important lessons for the design of effective and safe gene therapy vectors. release of cytokines and proliferation of bystander B and T cells (Acha-Orbea, 1992). It is widely thought that this proliferation allows MMTV infection of additional lymphoid cells that provide a means for viral trafficking to epithelial cells in the mammary gland (Golovkina et al, 1992; Held et al, 1993; Beutner et al, 1994). Viral replication in mammary gland epithelial cells of female mice results in release of high levels of MMTV particles into the milk (Nandi and McGrath, 1973). Genetically engineered mice that lack B cells or Sag-reactive T cells cannot be infected by milk-borne viruses (Golovkina et al, 1992; Held et al, 1993), and MMTV proviruses carrying a frameshift mutation within the sag gene are not infectious by the milk-borne route (Golovkina et al, 1995). These results are consistent with a role for B and T cells in Sagmediated amplification of MMTV-infected lymphoid cells. However, experiments also have shown that both B cells and Sag-reactive T cells are required for MMTV dissemination within the mammary gland

I. Introduction Mouse mammary tumor virus (MMTV) is a betaretrovirus that was shown in the 1930s to induce breast cancer in mice (Bentvelzen et al, 1972; Nandi and McGrath, 1973; Dudley, 1999). Female mice derived from high-mammary-cancer incidence strains transmit the virus to their offspring through the milk (Figure 1). More recent experiments have shown that MMTV traverses the gastrointestinal tract until the specialized M cells of the small intestine take up the virus (Golovkina et al, 1999). MMTV then infects B cells in the gut-associated lymphoid tissue (Karapetian et al, 1994). These infected B cells express a virally-encoded protein, called superantigen or Sag, at the surface in conjunction with major histocompatibility complex (MHC) class II antigen (AchaOrbea et al, 1991; Choi et al, 1991; Janeway, Jr., 1991). Sag is a type II transmembrane glycoprotein (Korman et al, 1992) that, upon recognition by the variable region of the !-chain (V!) of the T-cell receptor (TCR), causes the

169

Zhu and Dudley: MMMS: Lessons for gene therapy

Figure 1: Life cycle of MMTV. MMTV is produced in the mammary glands of infected female mice and is transmitted to newborn pups through the motherâ&#x20AC;&#x2122;s milk. The ingested virus infects B and T cells in the gut-associated lymphoid tissues. The infected B cells express a superantigen (Sag) that activates subsets of T cells and provide more targets for viral infection. In mammary gland, hormonal stimulation during pregnancy and lactation dramatically increases MMTV replication and allows insertional mutagenesis of protooncogenes and the development of mammary tumors.

(Golovkina et al, 1998), although the mechanism for transmission is not clear. Therefore, the MMTV life cycle requires virus replication in B cells, T cells, and mammary gland cells.At the cellular level, MMTV particles bind to a cell surface receptor that is believed to mediate viral fusion with the plasma membrane. Two such receptors (MTVR1 and MTVR2) have been described, but little is known about the exact nature of the receptors or the process of viral internalization (Hilkens et al, 1983; Golovkina et al, 1998). The incoming viral genome, consisting of two identical copies of single-stranded, positive-sense RNA, is replicated using a virally-encoded RNA-dependent DNA polymerase or reverse transcriptase (Telesnitsky and Goff, 1997). The process of reverse transcription in the cytoplasm generates a double-stranded DNA or provirus that has characteristic long terminal repeats (LTRs) that are not present in genomic RNA (Figure 2). The provirus then enters the nucleus through an unknown mechanism and integrates into the host cell chromosomes at sites that are believed to be relatively random (Pryciak et al, 1992; Withers-Ward et al, 1994; Weidhaas et al, 2000). Entry into the nucleus is probably dependent, or at least accelerated by nuclear envelope breakdown during mitosis, and this may explain why Saginduced proliferation of lymphoid cells is necessary for efficient viral dissemination during milk-borne infection (Figure 1). A preintegration complex consisting of some virion proteins, including the integrase protein or IN, mediates integration. IN catalyzes cleavage of the ends of

the linear double-stranded DNA as well as a staggered break in cellular DNA (Brown, 1997). Following integration, the proviral 5â&#x20AC;&#x2122; LTR is recognized by host RNA polymerase II and is transcribed into a full-length RNA that is structurally identical to virion RNA. Thus, complete retroviral replication requires both the retrovirally-encoded reverse transcriptase and host enzymes (Rabson and Graves, 1997). The full-length MMTV RNA may take one of several different pathways in infected cells. The RNA may be spliced to give a sub-genomic RNA that encodes the viral Env, yet a fraction of the genome-length RNA always is exported directly to the cytoplasm. In the cytoplasm, genomic RNA is translated into virion structural proteins as well as the reverse transcriptase and IN. Genomic RNA also is used directly for packaging by the virion or Gag proteins, and for betaretroviruses, the initial assembly into particles occurs in the cytoplasm (Dickson and Peters, 1983). Envelope proteins are translated on membrane-bound ribosomes, while processing and glycosylation of Env proteins occurs in the endoplasmic reticulum and Golgi prior to budding of assembled particles (Swanstrom and Wills, 1997). Synthesis of the Sag protein reportedly occurs using viral RNAs originating from four different promoters, including two within the LTR and two within the env gene (Wheeler et al, 1983; Elliott et al, 1988; Miller et al, 1992; Jarvis et al, 1994; Reuss and Coffin, 1995; Arroyo et al, 1997) (Figure 2). However, mutagenesis of a unique

170

Gene Therapy and Molecular Biology Vol 6, page 171

Figure 2: MMTV provirus structure and transcripts Yellow boxes represent the proviral long terminal repeats (LTRs) and arrows represent viral transcripts. Portions of arrows that are interrupted by V-shaped structures indicate regions removed by splicing. Reported MMTV promoters are shown by ovals. The sag open reading frame in the 5â&#x20AC;&#x2122; LTR lacks a promoter. The thinner gray boxes show viral open reading frames. Splice donor sites (SD) and splice acceptor sites (SA) are denoted by slashes. (Adapted from Mustafa et al, 2000.)

splice donor site within the viral env gene of an infectious MMTV provirus is sufficient to eliminate production of the Sag (Mustafa et al, 2000). These results indicate that only the spliced mRNA originating within the env region is required for Sag production. Since the promoter controlling virion protein synthesis is located within the LTR and an intragenic env promoter regulates Sag levels (Mustafa et al, 2000), MMTV may dissociate these two functions in some cell types (Wrona et al, 1998).

Such co-operativity between the Wnt-1 and fgf-3 genes has been confirmed by the detection of dual insertions in MMTV-induced breast cancers (Clausse et al, 1993) and by experiments with transgenic mice (Shackleford et al, 1993; van Leeuwen and Nusse, 1995). Mice carrying the Wnt-1 transgene display mammary gland hyperplasia, with approximately 50% of the animals developing mammary cancer (Brown et al, 1986; Rijsewijk et al, 1987). MMTV infection of Wnt-1 transgenic mice increases the frequency of mammary tumors, and these tumors often have proviral insertions near fgf-3 and hst (Shackleford et al, 1993), confirming their ability to co-operate with Wnt-1. Mice carrying both fgf-3 and Wnt-1 transgenes also have an increased incidence of mammary tumors compared to mice carrying either transgene alone (Li et al, 2000).

II. Factors that influence tissuespecific MMTV transcription and disease A. MMTV-induced mammary cancers MMTV is known to induce mammary cancers in mice, and the tumor incidence increases with increasing numbers of pregnancies (Nandi and McGrath, 1973). The relationship between tumor frequency and pregnancies appears to be related to the higher numbers of proviral insertions that occur with longer times for active MMTV replication. If each single insertion has a relatively low probability of affecting a given oncogene, then additional insertions will improve the chance of oncogene activation. Analysis of MMTV-induced mammary tumors has shown that proviral insertions are frequently detected near a subset of oncogenes, including Wnt-1/int-1, fgf-3/int-2, notch-like/int-3, fgf-4/hst, aromatase/intH/int-5, int-6, Wnt-10b, and fgf-8 (Morris et al, 1991; Kwan et al, 1992; Lee et al, 1995; MacArthur et al, 1995; Marchetti et al, 1995). Since the probability of MMTV insertion near any one gene is relatively small, the presence of proviral insertions near two different oncogenes in a clonal tumor population suggests that there is cooperativity between such genes for tumor growth (Jonkers and Berns, 1996).

B. MMTV-induced T-cell lymphomas A number of MMTV variants induce T-cell lymphomas in mice rather than mammary cancer (Michalides et al, 1982; Dudley and Risser, 1984; Ball et al, 1985; Lee et al, 1987). These MMTVs invariably have a 350 to 500-bp deletion within the U3 region of the LTR that overlaps with the transcriptional control region that regulates the synthesis of virion structural genes as well as the coding region for superantigen (Michalides et al, 1985; Lee et al, 1987; Hsu et al, 1988; Ball et al, 1988) (Figure 3). Substitution of the U3 region converts a mammotropic MMTV into a lymphomagenic virus, indicating that this region is necessary and sufficient to alter the type of tumor produced (Yanagawa et al, 1993). What then is the molecular basis for this change in disease specificity? Many experiments indicate that the MMTV U3 region has negative regulatory elements (NREs) that

171

Zhu and Dudley: MMMS: Lessons for gene therapy

suppress viral transcription from the standard LTR promoter (Morley et al, 1987; Hsu et al, 1988; Lee et al, 1991; Bramblett et al, 1995). At least two types of NREs have been described that map within the region deleted in lymphomagenic MMTVs (Lee et al, 1991; Bramblett et al, 1995). The first type of NRE has been mapped to several elements localized between –364 and –427 and between the proximal and distal hormone response elements (HRE) (ca. –160 to –140) relative to the start of genomic RNA (Langer and Ostrowski, 1988; Mink et al, 1990; Lee et al, 1991). Deletion of these elements has been shown to elevate MMTV LTR-reporter gene expression in fibroblast cells, but its effect in lymphoid cells is unknown (Lee et al, 1991). The NRE region between –433 and –418 has been reported to bind to a nuclear protein of approximately 100 kDa purified from HeLa cells (Kang and Peterson, 1999). A second type of NRE also was identified using deletion analysis of an MMTV LTR-reporter construct (Bramblett et al, 1995). In transient transfection experiments in mink lung cells, sequential deletions revealed that there were at least two NREs (called promoter-proximal and promoter-distal) located between –655 and –165 relative to the start of the genomic RNA, a region encompassing the deletions found in lymphomagenic MMTVs (Bramblett et al, 1995). Transgenic animals expressing MMTV LTR-reporter constructs have been shown to recapitulate the tissuespecific expression of endogenous MMTV proviruses resident within most mouse genomes (Ross et al, 1990). A subset of LTR deletion constructs was used in transgenic mouse experiments to confirm the presence of two NREs. Deletion of either region was sufficient to allow MMTV transcription in tissues where the wild-type virus was not expressed (i.e., brain, heart, skeletal muscle, and liver) (Henrard and Ross, 1988). Both wild-type and NREdeletion mutants were highly expressed in the most permissive tissue, lactating mammary gland, and at lower levels in a variety of semi-permissive tissues, including lymphoid and reproductive tissues (Ross et al, 1990). These experiments confirmed that deletion of specific LTR sequences could dramatically alter MMTV transcriptional specificity. Such results also suggested that relief of MMTV transcriptional suppression in specific tissues, e.g., lymphoid cells, could lead to increased mutagenic insertions that result in leukemias (Bramblett et al, 1995; Liu et al, 1997).

elements controls transcription (Beato, 1996). Since retroviruses, including MMTV, have relatively simple genomes that encode few genes, cellular protein factors must mediate the majority of transcriptional events (Rabson and Graves, 1997).

1. Steroid receptors The MMTV LTR has served as a model transcriptional element for many years, and early studies indicated that viral transcription is inducible by glucocorticoids and several other steroid hormones (Parks et al, 1974; Payvar et al, 1981). Addition of glucocorticoid hormones to MMTV-infected cells typically gives 10- to 50-fold increases in the level of viral RNA (Ringold et al, 1977). Subsequently, the HRE has been mapped upstream of the transcription initiation site for genomic RNA (Figure 3) (Groner et al, 1982; Majors and Varmus, 1983). Linkage of the HRE to heterologous promoters is sufficient to confer hormone responsiveness (Hynes et al, 1983; Chandler et al, 1983). The HRE consists of several independent receptorbinding sites that have a similar consensus sequence, TGTTCT (Buetti and Kuhnel, 1986; Kuhnel et al, 1986). Ligand binding to the receptor (e.g., glucocorticoid receptor or GR) allows entry into the nucleus and binding to the HRE. Binding of hormone receptor to the MMTV HRE results in nucleosomal changes near the promoter that then lead to binding of nuclear factor 1 (NF1) (Beato, 1996) and recruitment of the basal transcription machinery. Nucleosome A (Nuc-A) has been mapped over the TATA box and the transcription start site, whereas the octamer (OCT) motifs (see below) are located between Nuc-A and Nuc-B (Figure 3). Upon addition of the synthetic glucocorticoid, dexamethasone, transcription from the MMTV LTR is increased and the DNA encompassed by Nuc-B becomes hyper-sensitive to many reagents, such as restriction enzymes, nucleases or chemical probes (Zaret and Yamamoto, 1984; Archer et al, 1992), suggesting that Nuc-B acquires a more “open” configuration. The hormone-induced MMTV promoter also shows increased binding by NF1, Oct-1 (OTF-1), and TBP (Lee and Archer, 1994), whereas in the absence of hormone the positioning of Nuc-A and -B excludes ubiquitous transcription factors from the promoter. Hormone-activated GR modifies Nuc-B to allow binding of NF1 and other factors, leading to formation of the transcription initiation complex (Hager et al, 1993; Archer, 1993). NF1 binds strongly to sites on free DNA but is unable to bind in a nucleosomal context (Archer et al, 1991). Conversely, GR has a lower affinity for sites in free DNA than the same sites bound to nucleosomes. However, in vivo footprinting experiments have not been able to reproducibly detect GR bound to the HREs in the presence of hormone (Lee and Archer, 1994). These results suggest that GR interacts with its cognate sites in a “hit and run” manner (Lee and Archer, 1994).

C. Molecular basis for disease specificity Studies of MMTV disease variants indicated that a key region within the LTR was responsible for tissuespecific transcription and disease specificity (Michalides and Wagenaar, 1986; Bramblett et al, 1995; Mertz et al, 2001). What is the molecular basis for tissue-specific transcription and how can this affect the type of tumor induced? Experiments in a variety of genetic systems suggest that the binding of proteins to DNA regulatory

172

Gene Therapy and Molecular Biology Vol 6, page 173

Figure 3: Transcription factors that bind the MMTV LTR A. Ovals and circles represent different transcription factors that bind to different regions in the MMTV LTR. The maximal deletion observed in acquired MMTV proviruses from T-cell tumors is shown above the LTR. Numbers below the LTR refer to the distance (in bp) from the transcriptional start site of genomic RNA (+1) (Brandt-Carlson et al, 1993). Circles do not indicate the size of the proteins or their interactions with each other. Abbreviations: GR (glucocorticoid receptor), TFIID (transcription factor IID), RNAP (RNA polymerase II), Oct-1 (octamer-binding protein 1), NF1 (nuclear factor 1), NF1*, a member of the NF1 family, CDP (CCAAT displacement protein), SATB1 (special AT-rich binding protein 1), GABP (GA-binding protein), hormone responsive elements (HREs), and NREs. There appear to be at least eight CDP-binding sites, two SATB1-binding sites, and six GR binding sites in the LTR U3 region. B. Relative positions of nucleosomes in the MMTV LTR. Nucleosomes A to F are indicated as ovals. (Adapted from Fletcher et al, 2000.)

Hormone receptor binding is thought to contribute to the high levels of MMTV RNA and virions produced in the lactating mammary gland during milk-borne transmission (Dudley, 1999). However, since functional glucocorticoid receptors are found in many tissues, including liver where MMTV RNA is not expressed (Henrard and Ross, 1988; Ross et al, 1990), these receptors do not explain the tissue-specific nature of MMTV expression.

present in all extracts tested. Purification of the NBP complex showed that it was composed of a previously identified protein, special AT-rich binding protein 1 or SATB1, that was enriched in thymocytes and T-cells (Dickinson et al, 1992; Liu et al, 1997). SATB1 originally was isolated as a protein that binds to nuclear matrix- or scaffold-associated regions (MARs or SARs) localized in the immunoglobulin heavy chain intronic enhancer (Dickinson et al, 1992); this factor appears to bind to the MARs associated with the bases of chromatin loops (de Belle et al, 1998). MARs are AT-rich stretches of DNA that have been associated with binding to the nuclear framework in the nucleus and serve to regulate cellular processes such as transcription and DNA replication (Boulikas, 1995). In addition to the MMTV LTR, SATB1 binds to the regulatory elements of the CD8, TCR!, gp-phox, and immunoglobulin heavy chain genes

2. Special AT-rich binding protein 1 The LTR region deleted from leukemogenic MMTVs has served as a starting point for the isolation of tissue-specific transcription factors. Using probes derived from the LTR NREs, gel shift experiments revealed the presence of two DNA-binding complexes that were referred to as NBP and UBP (Bramblett et al, 1995). The NBP complex was present in both T-cell and lung-cell extracts, but was absent in mammary cell extracts, whereas UBP was

173

Zhu and Dudley: MMMS: Lessons for gene therapy

Figure 4: CDP and SATB1 protein structure The Cut-like repeats A and B, atypical homeodomain (HD), and a MAR-binding domain are shown in SATB1. The three Cut repeats (CR1, CR2, and CR3), a HD, and a leucine-zipper region are indicated within the human CDP protein. The ovals show the C-terminal repression domains.

(Dickinson et al, 1992; Banan et al, 1997; Chattopadhyay et al, 1998; Hawkins et al, 2001) and has been described variously as a transcriptional repressor (Bramblett et al, 1997; Kohwi-Shigematsu et al, 1997; Liu et al, 1997) or activator (Banan et al, 1997), depending on the regulatory element analyzed. SATB1 contains three DNA-binding domains, consisting of two Cut-like repeats (A and B) and an atypical homeodomain (Dickinson et al, 1997) (Figure 4). However, the major MAR-binding domain appears to be localized in the region of Cut-like repeat A (Nakagomi et al, 1994). SATB1 has been shown to bind to the proximal MMTV NRE, and mutation of the binding site at +924 (271 from the start of genomic RNA) upregulates MMTV transcription from the standard LTR promoter (Liu et al, 1997). MMTV LTR-reporter genes that contain the SATB1-binding mutation at +924 have been used for the construction of transgenic mice that show the highest levels of expression in lymphoid tissues, in contrast to wild-type MMTV LTRs that have optimal expression in lactating mammary gland (Ross et al, 1990; Liu et al, 1997). SATB1-null mice have stunted growth, small thymi and spleens, and thymocyte development is blocked at the CD4+CD8+ stage of differentiation (Alvarez et al, 2000). Thus, SATB1 binding to the MMTV LTR appears to be a major determinant of tissue-specific expression in lymphoid cells.

3) and a homeodomain (HD)], and two C-terminal repression domains (Figure 4). Expression of individual binding domains as GST-fusion proteins indicated that each region bound to a slightly different AT-rich sequence (Aufiero et al, 1994). More recent experiments suggest that the DNA-binding domains function in pairs and that CR1 and CR2 interact to induce the originally described displacement activity for the CCAAT-binding factor (CBF) on the sperm histone H2B-1 gene in sea urchin embryos (Moon et al, 2000). Such results emphasize the diversity of sites that may be recognized by CDP. The CUTL1 gene (encoding CDP) is also known as cut in Drosophila, Clox in dogs, and Cux-1 in mice (Blochlinger et al, 1988; Andres et al, 1992; Valarche et al, 1993), and murine and avian cells contain a second gene referred to as Cux-2 (Quaggin et al, 1996). The Drosophila Cut protein is expressed in a variety of embryonic and adult tissues, including the peripheral and central nervous systems, Malpighian tubules, ovarian follicle cells, cells of the wing margin, adepithelial cells of the wing and leg discs, muscle cells, and cone cells of the eye (Bodmer et al, 1987). Both lethal and viable cut mutations have been identified, and the best characterized of these mutations are the embryonic lethal type that allow the transformation of external sensory organs into internal chordotonal organs (Bodmer et al, 1987). Such mutations indicate that Cut is a major determinant of cell-type specification in Drosophila (Bodmer et al, 1987). Similarly, a role for CDP in cell-type specification has been suggested by experiments in mammalian cells, and human CDP or murine Cux-1 can at least partially rescue some of the cut mutations in flies (Ludlow et al, 1996). The role of Cux/CDP in mammals has been investigated by germ line manipulations of the gene in mice. Initial attempts to knockout the gene yielded an exon skipping mutant that produced a truncated form of

3. CCAAT-displacement protein The second major DNA-binding activity localized to the MMTV NRE, initially called UBP (Liu et al, 1997), was identified as the murine equivalent of the human CCAAT-displacement protein or CDP (Neufeld et al, 1992). CDP is a 180 to 190 kDa protein that contains a leucine-zipper region near the N-terminus, four DNAbinding domains [three Cut repeat domains (CR1, 2, and

174

Gene Therapy and Molecular Biology Vol 6, page 175

the CUTL1 gene that lacked 246 amino acids in the CR1 DNA-binding domain ("CR1), but was capable of binding to DNA (Tufarelli et al, 1998). Mice homozygous for this mutation had curly whiskers and wavy hair and exhibited a failure to thrive among pups born to mutant females. Although the exact nature of the defect was not determined, preliminary experiments indicated a defect in maternal milk that was associated with a decrease in #casein expression (Tufarelli et al, 1998). More recently, the CR3 and HD of the murine Cux gene have been replaced by an in-frame lacZ gene to give homozygous mutant mice that lack nuclear Cux expression and the ability to repress a target reporter gene in transient assays (Ellis et al, 2001). Mice homozygous for the CR3-HD mutation died after birth due to defects in maturation of the lung epithelium. The mutant phenotype was more severe in an inbred background, and homozygous mutant mice on an outbred background showed growth retardation and defects of the hair follicles (Ellis et al, 2001). Our experiments using the "CR1 mice also suggest that breeding of this mutation onto the BALB/c background exacerbates the lethality of the CDP-mutant phenotype (Zhu, Lozano, and Dudley, unpublished results). Such data confirm the essential role of Cux/CDP in the normal developmental program of several tissues, including the lungs, hair follicles, and mammary glands. CDP is a transcriptional repressor of multiple cellular genes, including gp91-phox, TCR!, CD8, immunoglobulin heavy chain, and c-myc, as well as several viral genomes, including MMTV and human papilloma viruses (Skalnik et al, 1991; Dufort and Nepveu, 1994; Banan et al, 1997; Pattison et al, 1997; Chattopadhyay et al, 1998; Ai et al, 1999; Wang et al, 1999; Zhu et al, 2000). Several reports indicate that CDP is expressed at high levels in undifferentiated cells, and that upon terminal differentiation, CDP-mediated repression is lost (Nepveu, 2001). Since MMTV is expressed at high levels in differentiated cells of the lactating mammary gland and at much lower levels in virgin glands, we examined CDP binding to the NRE using nuclear extracts derived from several different developmental stages. These results showed that CDP binding to the MMTV LTR was highest in virgin mammary extracts, but was undetectable in extracts from the lactating mammary glands (Liu et al, 1997; Zhu et al, 2000). Sp1 binding to a consensus sequence actually increased during murine mammary development, indicating that nuclear extracts from lactating mammary gland were not degraded (Zhu et al, 2000). These results suggested that there was an inverse relationship between the presence of CDP and the transcriptional activity of the MMTV LTR. Transient transfection assays in mouse mammary cells showed that the activity of an MMTV LTR-reporter construct was diminished in a dose-dependent manner, depending on the amount of CDP-expression vector present (Zhu et al, 2000). Further experiments also

revealed that CDP could repress both basal and glucocorticoid-induced levels of LTR-reporter expression (Zhu and Dudley, in press). These data suggested that MMTV RNA levels are highest in the lactating mammary gland due to the presence of active steroid hormone receptors to promote nucleosomal rearrangements near the viral promoter and the absence of CDP that may interfere with the function of steroid receptors and other positivelyacting factors. Further experiments were performed to determine if CDP-mediated repression of MMTV expression was a direct result of DNA binding to the viral negative regulatory elements. Multiple CDP-binding sites have been mapped on the MMTV LTR by DNase I footprinting and direct DNA-binding experiments (Zhu et al, 2000; Zhu and Dudley, in press) (Figure 3). Mutation of two independent binding sites, one in the proximal and one in the distal NRE, were shown to greatly diminish CDP binding to the MMTV LTR, and such mutations were sufficient to elevate MMTV LTR-reporter gene activity in both transient and stable transfection assays (Zhu et al, 2000; Zhu and Dudley, in press). If CDP is a transcriptional repressor in undifferentiated mammary gland, then CDP-binding site mutations should increase virus transcription and replication in early stages of breast development, thus decreasing the latency of tumor development. Two of these mutations, one at +692 (-503) and another at +838 (-357), have been transferred into the LTR of an infectious MMTV provirus (Shackleford and Varmus, 1988) and used for the inoculation of susceptible BALB/c mice. Preliminary results indicate that the latency of mammary tumors induced by CDP-mutant viruses is reduced compared to tumors induced by the wild-type virus. In addition, the growth rate and number of tumors induced by the CDP mutants is accelerated relative to that observed for the wild-type virus (Zhu, Lozano and Dudley, in preparation). These results confirm that CDP is a developmentally regulated transcription factor that suppresses MMTV expression in early stages of mammary gland development. CDP-binding sites in the LTR presumably are retained to minimize the number of mutagenic integration events in the life of the mouse, thus allowing transmission to increased numbers of offspring.

4. Other factors affecting tissue-specific MMTV expression Cell-type specific and ubiquitous factors also have been shown to control MMTV expression in mammary cells. Stewart et al first reported the ability of the MMTV LTR to direct mammary-specific transcription (Stewart et al, 1984). One enhancer-like element that localized to the 5â&#x20AC;&#x2122; end of the LTR (-1072 to -1052) bound to a mammaryspecific factor called MP-4. Deletion of this region decreased both glucocorticoid-induced and basal transcription from the MMTV promoter (Haraguchi et al, 1997). Transgenic mouse experiments defined a region

175

Zhu and Dudley: MMMS: Lessons for gene therapy

between –1166 and –987 that directed MMTV LTRtransgene expression in mammary and salivary gland tissues (Mok et al, 1992). This enhancer functioned in both lactating and non-lactating mammary glands. At least six functional cis-acting elements have been mapped to this enhancer, including mp4 and mp5 (Lefebvre et al, 1991; Mellentin-Michelotti et al, 1994) and F2, F3, F11, and F12 (Mink et al, 1992). Some of the transcription factors that bind to these elements appear to be related to AP-2 and NF1/CTF (Mellentin-Michelotti et al, 1994; Kusk et al, 1996). The 5’ end of the LTR also contains a sequence motif TTCGGAGAA that potentially binds to mammary gland factor (MGF) (Gouilleux et al, 1994). MGF (otherwise known as Stat5a) is a transcription factor regulated by prolactin through phosphorylation by the JAK family of tyrosine kinases (Wakao et al, 1994). Stat5 or a related protein may also bind to an MMTV LTR sequence near +520 (-675 relative to the start of MMTV genomic RNA) (Qin et al, 1999). Several transcription factors have been shown to participate in T-cell or lymphoid-specific MMTV transcription. Some MMTV variants that induce T-cell lymphomas, e.g., type B leukemogenic virus or TBLV, have both the characteristic LTR deletion that removes the negative regulatory elements as well as a triplication of sequences flanking the deletion (Ball et al, 1988). The structure of the triplicated region is reminiscent of many retroviral enhancer elements, and transient transfection experiments have shown that the triplicated region in the TBLV LTR allows greatly enhanced expression in T-cell lines, but not other cell types tested (Mertz et al, 2001). Linker scanning mutations within the LTR triplication revealed a critical region for T-cell specific expression in transient assays, and this region was used for the identification of cellular DNA-binding factors. At least three DNA-binding activities were identified within this region, including two unknown factors called NF-A and NF-B, and AML-1/Runx1 (Mertz et al, 2001). Overexpression of the transcriptionally active form of AML-1 in mammary cells increased the activity of TBLV LTR-reporter constructs, suggesting that AML-1 contributes to the T-cell specific nature of the TBLV enhancer. Other regulatory elements that affect tissue-specific MMTV transcription also have been described. Several cellular binding activities have been mapped upstream of the distal HRE and downstream of the known CDPbinding sites; these activities have been referred to as DRa and DRc (Cavin and Buetti, 1995). DRa was present in tissues that were permissive for MMTV transcription, whereas DRc was ubiquitously expressed (Cavin and Buetti, 1995). One factor that binds to two areas located between –139 and –164 appears to be the heterodimeric Ets factor GA-binding protein (GABP). GABP was shown to increase the hormone-responsiveness of an MMTV LTR-reporter gene in transient assays performed in B cells (Aurrekoetxea-Hernandez and Buetti, 2000).

The MMTV LTR also contains three overlapping sites related to the consensus octamer sequence ATGCAAAT (Bruggemeier et al, 1991; Huang et al, 1993), and it has been suggested that the transcription factor Oct-2 participates in B-cell specific MMTV transcription (Kim and Peterson, 1995).

III. Implications for gene therapy One of the many important issues of gene therapy is tissue-specific expression of therapeutic genes. The MMTV LTR is a well-characterized retroviral transcriptional unit, and it is suitable for further manipulations in both tissue culture and in mouse model systems. In particular, the MMTV LTR clearly has been subject to selection so that virus expression is optimal in lactating mammary cells, but not in other cell types or undifferentiated mammary cells. Although MMTV must be transmitted through B and T lymphocytes to developing epithelial cells in the mammary glands of offspring, expression is suppressed in these cell types to minimize potential mutagenic events that will shorten the life of the infected mother. Furthermore, the LTR of an MMTV variant (TBLV) shows high levels of expression in lymphocytes. Such naturally occurring variants selected in vivo can serve as potential tools for cell-type specific gene delivery systems. Recent data have indicated that the expression pattern of the MMTV promoter during cellular differentiation appears to result from overlapping and sophisticated positive and negative elements in the LTR. The dissection of viral cis-elements and identification of cellular trans-factors, such as SATB1 and CDP that are in turn developmentally regulated, make the MMTV LTR amenable to further manipulation for specific purposes. For example, inclusion or enhancement of MMTV negative regulatory elements should minimize viral expression in the majority of tissues, other than mammary tissue. Conversely, disruption of negative regulation may be required before the MMTV LTR can be used in directing therapeutic gene expression in mammary tumor cells that are relatively undifferentiated. In conclusion, further studies of fundamental gene expression should allow the development of additional strategies for the design of effective and safe gene therapy vectors.

Acknowledgements We acknowledge the helpful comments by members of the Dudley lab. This work was supported by grants CA34780, CA52646, and CA7760 from the National Institutes of Health.

References Acha-Orbea H (1992) Retroviral superantigens. Chem Immunol 55, 65-86. Acha-Orbea H, Shakhov AN, Scarpellino L, Kolb E, Muller V, Vessaz-Shaw A, Fuchs R, Blochlinger K, Rollini P, Billotte J, Sarafidou M, MacDonald HR and Diggelmann H (1991)

176

Gene Therapy and Molecular Biology Vol 6, page 177

transmission, but not for presentation of endogenous superantigens. J Exp Med 179, 1457-1466. Blochlinger K, Bodmer R, Jack J, Jan LY and Jan YN (1988) Primary structure and expression of a product from cut, a locus involved in specifying sensory organ identity in Drosophila. Nature 333, 629-635. Bodmer R, Barbel S, Sheperd S, Jack JW, Jan LY and Jan YN (1987) Transformation of sensory organs by mutations of the cut locus of D. melanogaster. Cell 51, 293-307. Boulikas T (1995) Chromatin domains and prediction of MAR sequences. Int Rev Cytol 162A, 279-388. Bramblett D, Hsu CL, Lozano M, Earnest K, Fabritius C and Dudley J (1995) A redundant nuclear protein binding site contributes to negative regulation of the mouse mammary tumor virus long terminal repeat. J Virol 69, 7868-7876. Bramblett D, Liu J, Lozano M, Xu L, Wrona T, Rajan L, Ross SR and Dudley J (1997) Mouse mammary tumor virus: a virus that exploits the immune system. Leukemia 11 Suppl 3, 183-186. Brandt-Carlson C, Butel JS and Wheeler D (1993) Phylogenetic and structural analyses of MMTV LTR ORF sequences of exogenous and endogenous origins. Virology 193, 171-185. Brown AM, Wildin RS, Prendergast TJ and Varmus HE (1986) A retrovirus vector expressing the putative mammary oncogene int-1 causes partial transformation of a mammary epithelial cell line. Cell 46, 1001-1009. Brown PO (1997) Integration. In Retroviruses. J.M. Coffin, S.H. Hughes, and H.E. Varmus, eds. (Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press), 161-204. Bruggemeier U, Kalff M, Franke S, Scheidereit C and Beato M (1991) Ubiquitous transcription factor OTF-1 mediates induction of the MMTV promoter through synergistic interaction with hormone receptors. Cell 64, 565-572. Buetti E and Kuhnel B (1986) Distinct sequence elements involved in the glucocorticoid regulation of the mouse mammary tumor virus promoter identified by linker scanning mutagenesis. J Mol Biol 190, 379-389. Cavin C and Buetti E (1995) Tissue-specific and ubiquitous factors binding next to the glucocorticoid receptor modulate transcription from the mouse mammary tumor virus promoter. J Virol 69, 3759-3770. Chandler VL, Maler BA and Yamamoto KR (1983) DNA sequences bound specifically by glucocorticoid receptor in vitro render a heterologous promoter hormone responsive in vivo. Cell 33, 489-499. Chattopadhyay S, Whitehurst CE and Chen J (1998) A nuclear matrix attachment region upstream of the T cell receptor beta gene enhancer binds Cux/CDP and SATB1 and modulates enhancer-dependent reporter gene expression but not endogenous gene expression. J Biol Chem 273, 2983829846. Choi Y, Kappler JW and Marrack P (1991) A superantigen encoded in the open reading frame of the 3' long terminal repeat of mouse mammary tumour virus. Nature 350, 203207. Clausse N, Baines D, Moore R, Brookes S, Dickson C and Peters G (1993) Activation of both Wnt-1 and Fgf-3 by insertion of mouse mammary tumor virus downstream in the reverse orientation: a reappraisal of the enhancer insertion model. Virology 194, 157-165.

Clonal deletion of V ! 14-bearing T cells in mice transgenic for mammary tumour virus. Nature 350, 207-211. Ai W, Toussaint E and Roman A (1999) CCAAT displacement protein binds to and negatively regulates human papillomavirus type 6 E6, E7, and E1 promoters. J Virol 73, 4220-4229. Alvarez JD, Yasui DH, Niida H, Joh T, Loh DY and KohwiShigematsu T (2000) The MAR-binding protein SATB1 orchestrates temporal and spatial expression of multiple genes during T-cell development. Genes Dev 14, 521-535. Andres V, Nadal-Ginard B and Mahdavi V (1992) Clox, a mammalian homeobox gene related to Drosophila cut, encodes DNA-binding regulatory proteins differentially expressed during development. Development 116, 321-334. Archer TK (1993) Nucleosomes modulate access of transcription factor to the MMTV promoter in vivo and in vitro. Ann N Y Acad Sci 684, 196-198. Archer TK, Cordingley MG, Wolford RG and Hager GL (1991) Transcription factor access is mediated by accurately positioned nucleosomes on the mouse mammary tumor virus promoter. Mol Cell Biol 11, 688-698. Archer TK, Lefebvre P, Wolford RG and Hager GL (1992) Transcription factor loading on the MMTV promoter: a bimodal mechanism for promoter activation [published erratum appears in Science 1992 Apr 10;256(5054):161]. Science 255, 1573-1576. Arroyo J, Winchester E, McLellan BS and Huber BT (1997) Shared promoter elements between a viral superantigen and the major histocompatibility complex class II-associated invariant chain. J Virol 71, 1237-1245. Aufiero B, Neufeld EJ and Orkin SH (1994) Sequence-specific DNA binding of individual cut repeats of the human CCAAT displacement/cut homeodomain protein. Proc Natl Acad Sci U S A 91, 7757-7761. Aurrekoetxea-Hernandez K and Buetti E (2000) Synergistic action of GA-binding protein and glucocorticoid receptor in transcription from the mouse mammary tumor virus promoter. J Virol 74, 4988-4998. Ball JK, Arthur LO and Dekaban GA (1985) The involvement of a type-B retrovirus in the induction of thymic lymphomas. Virology 140, 159-172. Ball JK, Diggelmann H, Dekaban GA, Grossi GF, Semmler R, Waight PA and Fletcher RF (1988) Alterations in the U3 region of the long terminal repeat of an infectious thymotropic type B retrovirus. J Virol 62, 2985-2993. Banan M, Rojas IC, Lee WH, King HL, Harriss JV, Kobayashi R, Webb CF and Gottlieb PD (1997) Interaction of the nuclear matrix-associated region (MAR)-binding proteins, SATB1 and CDP/Cux, with a MAR element (L2a) in an upstream regulatory region of the mouse CD8a gene. J Biol Chem 272, 18440-18452. Beato M (1996) Chromatin structure and the regulation of gene expression: remodeling at the MMTV promoter. J Mol Med 74, 711-724. Bentvelzen P, Daams JH, Hageman P, Calafat J and Timmermans A (1972) Interactions between viral and genetic factors in the origin of mammary tumors in mice. J Natl Cancer Inst 48, 1089-1094. Beutner U, Kraus E, Kitamura D, Rajewsky K and Huber BT (1994) B cells are essential for murine mammary tumor virus

177

Zhu and Dudley: MMMS: Lessons for gene therapy

de Belle I, Cai S and Kohwi-Shigematsu T (1998) The genomic sequences bound to special AT-rich sequence-binding protein 1 (SATB1) in vivo in Jurkat T cells are tightly associated with the nuclear matrix at the bases of the chromatin loops. J Cell Biol 141, 335-348. Dickinson LA, Dickinson CD and Kohwi-Shigematsu T (1997) An atypical homeodomain in SATB1 promotes specific recognition of the key structural element in a matrix attachment region. J Biol Chem 272, 11463-11470. Dickinson LA, Joh T, Kohwi Y and Kohwi-Shigematsu T (1992) A tissue-specific MAR/SAR DNA-binding protein with unusual binding site recognition. Cell 70, 631-645. Dickson C and Peters G (1983) Proteins encoded by mouse mammary tumour virus. Curr Top Micro Immunol 106, 134. Dudley J and Risser R (1984) Amplification and novel locations of endogenous mouse mammary tumor virus genomes in mouse T-cell lymphomas. J Virol 49, 92-101. Dudley JP (1999) Mouse mammary tumor virus. In Encyclopedia of Virology. R.G. Webster and A. Granoff, eds. (London, UK: Academic Press Ltd.), 965-972. Dufort D and Nepveu A (1994) The human Cut homeodomain protein represses transcription from the c- myc promoter. Mol Cell Biol 14, 4251-4257. Elliott JF, Pohajdak B, Talbot DJ, Shaw J and Paetkau V (1988) Phorbol diester-inducible, cyclosporine-suppressible transcription from a novel promoter within the mouse mammary tumor virus env gene. J Virol 62, 1373-1380. Ellis T, Gambardella L, Horcher M, Tschanz S, Capol J, Bertram P, Jochum W, Barrandon Y and Busslinger M (2001) The transcriptional repressor CDP (Cutl1) is essential for epithelial cell differentiation of the lung and the hair follicle. Genes Dev 15, 2307-2319. Fletcher TM, Ryu BW, Baumann CT, Warren BS, Fragoso G, John S and Hager GL (2000) Structure and dynamic properties of a glucocorticoid receptor-induced chromatin transition. Mol Cell Biol 20, 6466-6475. Golovkina TV, Chervonsky A, Dudley JP and Ross SR (1992) Transgenic mouse mammary tumor virus superantigen expression prevents viral infection. Cell 69, 637-645. Golovkina TV, Dudley JP and Ross SR (1995) Mouse mammary tumor viruses with functional superantigen genes are selected during in vivo infection. Proc Natl Acad Sci U S A 92, 4828-4832. Golovkina TV, Dudley JP, Jaffe AB and Ross SR (1998) B and T cells are required for mouse mammary tumor virus spread within the mammary gland. J Immunol 161, 2375-2382. Golovkina TV, Dzuris J, van den Hoogen B, Jaffe AB, Wright PC, Cofer SM and Ross SR (1998) A novel membrane protein is a mouse mammary tumor virus receptor. J Virol 72, 3066-3071. Golovkina TV, Shlomchik M, Hannum L and Chervonsky A (1999) Organogenic role of B lymphocytes in mucosal immunity. Science 286, 1965-1968. Gouilleux F, Wakao H, Mundt M and Groner B (1994) Prolactin induces phosphorylation of Tyr694 of Stat5 (MGF), a prerequisite for DNA binding and induction of transcription. EMBO J 13, 4361-4369. Groner B, Herrlich P, Kennedy N, Ponta H, Rahmsdorf U and Hynes NE (1982) Delimitation of a DNA sequence which

confers inducibility by glucocorticoid hormones. J Cell Biochem 20, 349-357. Hager GL, Archer TK, Fragoso G, Bresnick EH, Tsukagoshi Y, John S and Smith CL (1993) Influence of chromatin structure on the binding of transcription factors to DNA. Cold Spring Harbor Symp Quant Biol 58, 63-71. Haraguchi S, Good RA, Engelman RW, Greene S and Day NK (1997) Prolactin, epidermal growth factor or transforming growth factor-_ activate a mammary cell-specific enhancer in mouse mammary tumor virus-long terminal repeat. Mol Cell Endocrinol 129, 145-155. Hawkins S, Kohwi-Shigematsu T and Skalnik DG (2001) The matrix attachment region-binding protein SATB1 interacts with multiple elements within the gp91phox promoter and is down regulated during myeloid differentiation. J Biol Chem (276, 44472-44480. Held W, Waanders GA, Shakhov AN, Scarpellino L, AchaOrbea H and MacDonald HR (1993) Superantigen-induced immune stimulation amplifies mouse mammary tumor virus infection and allows virus transmission. Cell 74, 529-540. Henrard D and Ross SR (1988) Endogenous mouse mammary tumor virus is expressed in several organs in addition to the lactating mammary gland. J Virol 62, 3046-3049. Hilkens J, van der Zeijst B, Buijs F, Kroezen V, Bleumink N and Hilgers J (1983) Identification of a cellular receptor for mouse mammary tumor virus and mapping of its gene to chromosome 16. J Virol 45, 140-147. Hsu CL, Fabritius C and Dudley J (1988) Mouse mammary tumor virus proviruses in T-cell lymphomas lack a negative regulatory element in the long terminal repeat. J Virol 62, 4644-4652. Huang M, Lee JW and Peterson DO (1993) Functional redundancy of octamer elements in the mouse mammary tumor virus promoter. Nucleic Acids Res 21, 5235-5241. Hynes N, van Ooyen AJ, Kennedy N, Herrlich P, Ponta H and Groner B (1983) Subfragments of the large terminal repeat cause glucocorticoid-responsive expression of mouse mammary tumor virus and of an adjacent gene. Proc Natl Acad Sci U S A 80, 3637-3641. Janeway CA, Jr (1991) Selective elements for the V ! region of the T cell receptor: Mls and the bacterial toxic mitogens. Adv Immunol 50, 1-53. Jarvis CD, Germain RN, Hager GL, Damschroder M and Matis LA (1994) Tissue-specific expression of messenger RNAs encoding endogenous viral superantigens. J Immunol 152, 1032-1038. Jonkers J and Berns A (1996) Retroviral insertional mutagenesis as a strategy to identify cancer genes. Biochim Biophys Acta 1287, 29-57. Kang CJ and Peterson DO (1999) Identification of a protein that recognizes a distal negative regulatory element within the mouse mammary tumor virus long terminal repeat. Virology 264, 211-219. Karapetian O, Shakhov AN, Kraehenbuhl JP and Acha-Orbea H (1994) Retroviral infection of neonatal Peyer's patch lymphocytes: the mouse mammary tumor virus model. J Exp Med 180, 1511-1516. Kim MH and Peterson DO (1995) Oct-1 protein promotes functional transcription complex assembly on the mouse mammary tumor virus promoter. J Biol Chem 270, 2782327828.

178

Gene Therapy and Molecular Biology Vol 6, page 179

Kohwi-Shigematsu T, Maass K and Bode J (1997) A thymocyte factor SATB1 suppresses transcription of stably integrated matrix-attachment region-linked reporter genes. Biochemistry 36, 12005-12010. Korman AJ, Bourgarel P, Meo T and Rieckhof GE (1992) The mouse mammary tumour virus long terminal repeat encodes a type II transmembrane glycoprotein. EMBO J 11, 19011905. Kuhnel B, Buetti E and Diggelmann H (1986) Functional analysis of the glucocorticoid regulatory elements present in the mouse mammary tumor virus long terminal repeat. A synthetic distal binding site can replace the proximal binding domain. J Mol Biol 190, 367-378. Kusk P, John S, Fragoso G, Michelotti J and Hager GL (1996) Characterization of an NF-1/CTF family member as a functional activator of the mouse mammary tumor virus long terminal repeat 5' enhancer. J Biol Chem 271, 31269-31276. Kwan H, Pecenka V, Tsukamoto A, Parslow TG, Guzman R, Lin TP, Muller WJ, Lee FS, Leder P and Varmus HE (1992) Transgenes expressing the Wnt-1 and int-2 proto-oncogenes cooperate during mammary carcinogenesis in doubly transgenic mice. Mol Cell Biol 12, 147-154. Langer SJ and Ostrowski MC (1988) Negative regulation of transcription in vitro by a glucocorticoid response element is mediated by a trans-acting factor. Mol Cell Biol 8, 38723881. Lee FS, Lane TF, Kuo A, Shackleford GM and Leder P (1995) Insertional mutagenesis identifies a member of the Wnt gene family as a candidate oncogene in the mammary epithelium of int-2/Fgf-3 transgenic mice. Proc Natl Acad Sci U S A 92, 2268-2272. Lee HL and Archer TK (1994) Nucleosome-mediated disruption of transcription factor-chromatin initiation complexes at the mouse mammary tumor virus long terminal repeat in vivo. Mol Cell Biol 14, 32-41. Lee JW, Moffitt PG, Morley KL and Peterson DO (1991) Multipartite structure of a negative regulatory element associated with a steroid hormone-inducible promoter. J Biol Chem 266, 24101-24108. Lee WT, Prakash O, Klein D and Sarkar NH (1987) Structural alterations in the long terminal repeat of an acquired mouse mammary tumor virus provirus in a T-cell leukemia of DBA/2 mice. Virology 159, 39-48. Lefebvre P, Berard DS, Cordingley MG and Hager GL (1991) Two regions of the mouse mammary tumor virus long terminal repeat regulate the activity of its promoter in mammary cell lines. Mol Cell Biol 11, 2529-2537. Li Y, Hively WP and Varmus HE (2000) Use of MMTV-Wnt-1 transgenic mice for studying the genetic basis of breast cancer. Oncogene 19, 1002-1009. Liu J, Bramblett D, Zhu Q, Lozano M, Kobayashi R, Ross SR and Dudley JP (1997) The matrix attachment region-binding protein SATB1 participates in negative regulation of tissuespecific gene expression. Mol Cell Biol 17, 5275-5287. Ludlow C, Choy R and Blochlinger K (1996) Functional analysis of Drosophila and mammalian cut proteins in flies. Dev Biol 178, 149-159. MacArthur CA, Shankar DB and Shackleford GM (1995) Fgf-8, activated by proviral insertion, cooperates with the Wnt-1 transgene in murine mammary tumorigenesis. J Virol 69, 2501-2507.

Majors J and Varmus HE (1983) A small region of the mouse mammary tumor virus long terminal repeat confers glucocorticoid hormone regulation on a linked heterologous gene. Proc Natl Acad Sci U S A 80, 5866-5870. Marchetti A, Buttitta F, Miyazaki S, Gallahan D, Smith GH and Callahan R (1995) Int-6, a highly conserved, widely expressed gene, is mutated by mouse mammary tumor virus in mammary preneoplasia. J Virol 69, 1932-1938. Mellentin-Michelotti J, John S, Pennie WD, Williams T and Hager GL (1994) The 5' enhancer of the mouse mammary tumor virus long terminal repeat contains a functional AP-2 element. J Biol Chem 269, 31983-31990. Mertz JA, Mustafa F, Meyers S and Dudley JP ( 2001) Type B leukemogenic virus has a T-cell-specific enhancer that binds AML-1. J Virol ___ 2174-2184. Michalides R and Wagenaar E (1986) Site-specific rearrangements in the long terminal repeat of extra mouse mammary tumor proviruses in murine T-cell leukemias. Virology 154, 76-84. Michalides R, Wagenaar E and Weijers P (1985) Rearrangements in the long terminal repeat of extra mouse mammary tumor proviruses in T-cell leukemias of mouse strain GR result in a novel enhancer-like structure. Mol Cell Biol 5, 823-830. Michalides R, Wagenaar E, Hilkens J, Hilgers J, Groner B and Hynes NE (1982) Acquisition of proviral DNA of mouse mammary tumor virus in thymic leukemia cells from GR mice. J Virol 43, 819-829. Miller CL, Garner R and Paetkau V (1992) An activationdependent, T-lymphocyte-specific transcriptional activator in the mouse mammary tumor virus env gene. Mol Cell Biol 12, 3262-3272. Mink S, Hartig E, Jennewein P, Doppler W and Cato AC (1992) A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor. Mol Cell Biol 12, 4906-4918. Mink S, Ponta H and Cato AC (1990) The long terminal repeat region of the mouse mammary tumour virus contains multiple regulatory elements. Nucleic Acids Res 18, 20172024. Mok E, Golovkina TV and Ross SR (1992) A mouse mammary tumor virus mammary gland enhancer confers tissue-specific but not lactation-dependent expression in transgenic mice. J Virol 66, 7529-7532. Moon NS, Berube G and Nepveu A (2000) CCAAT displacement activity involves CUT repeats 1 and 2, not the CUT homeodomain. J Biol Chem 275, 31325-31334. Morley KL, Toohey MG and Peterson DO (1987) Transcriptional repression of a hormone-responsive promoter. Nucleic Acids Res 15, 6973-6989. Morris VL, Rao TR, Kozak CA, Gray DA, Chan ECML, Cornell TJ, Taylor CB Jones RF and McGrath CM (1991) Characterization of Int-5, a locus associated with early events in mammary carcinogenesis. Oncogene Res 6, 53-63. Mustafa F, Lozano M and Dudley JP (2000) C3H mouse mammary tumor virus superantigen function requires a splice donor site in the envelope gene. J Virol 74, 9431-9440. Nakagomi K, Kohwi Y, Dickinson LA and Kohwi-Shigematsu T (1994) A novel DNA-binding motif in the nuclear matrix

179

Zhu and Dudley: MMMS: Lessons for gene therapy

attachment DNA-binding protein SATB1. Mol Cell Biol 14, 1852-1860. Nandi S and McGrath CM (1973) Mammary neoplasia in mice. Adv Cancer Res 17, 353-414. Nepveu A (2001) Role of the multifunctional CDP/Cut/Cux homeodomain transcription factor in regulating differentiation, cell growth and development. Gene 270, 115. Neufeld EJ, Skalnik DG, Lievens PM and Orkin SH (1992) Human CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut. Nat Genet 1, 50-55. Parks WP, Scolnick EM and Kozikowski EH (1974) Dexamethasone stimulation of murine mammary tumor virus expression: a tissue culture source of virus. Science 184, 158-160. Pattison S, Skalnik DG and Roman A (1997) CCAAT displacement protein, a regulator of differentiation-specific gene expression, binds a negative regulatory element within the 5' end of the human papillomavirus type 6 long control region. J Virol 71, 2013-2022. Payvar F, Wrange O, Carlstedt-Duke J, Okret S, Gustafsson JA and Yamamoto KR (1981) Purified glucocorticoid receptors bind selectively in vitro to a cloned DNA fragment whose transcription is regulated by glucocorticoids in vivo. Proc Natl Acad Sci U S A 78, 6628-6632. Pryciak PM, Sil A and Varmus HE (1992) Retroviral integration into minichromosomes in vitro. EMBO J 11, 291-303. Qin W, Golovkina TV, Peng T, Nepomnaschy I, Buggiano V, Piazzon I and Ross SR (1999) Mammary gland expression of mouse mammary tumor virus is regulated by a novel element in the long terminal repeat. J Virol 73, 368-376. Quaggin SE, Heuvel GV, Golden K, Bodmer R and Igarashi P (1996) Primary structure, neural-specific expression, and chromosomal localization of Cux-2, a second murine homeobox gene related to Drosophila cut. J Biol Chem 271, 22624-22634. Rabson AB and Graves BJ (1997) Synthesis and processing of viral RNA. In Retroviruses. J.M. Coffin, S.H. Hughes, and H.E. Varmus, eds. (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press), 205-261. Reuss FU and Coffin JM (1995) Stimulation of mouse mammary tumor virus superantigen expression by an intragenic enhancer. Proc Natl Acad Sci U S A 92, 9293-9297. Rijsewijk F, van Deemter L, Wagenaar E, Sonnenberg A and Nusse R (1987) Transfection of the int-1 mammary oncogene in cuboidal RAC mammary cell line results in morphological transformation and tumorigenicity. EMBO J 6, 127-131. Ringold GM, Yamamoto KR, Bishop JM and Varmus HE ( 1977) Glucocorticoid-stimulated accumulation of mouse mammary tumor virus RNA: increased rate of synthesis of viral RNA. Proc Natl Acad Sci U S A 74, 2879-2883. Ross SR, Hsu CL, Choi Y, Mok E and Dudley JP (1990) Negative regulation in correct tissue-specific expression of mouse mammary tumor virus in transgenic mice. Mol Cell Biol 10, 5822-5829. Shackleford GM and Varmus HE (1988) Construction of a clonable, infectious, and tumorigenic mouse mammary tumor virus provirus and a derivative genetic vector. Proc Natl Acad Sci U S A 85, 9655-9659.

Shackleford GM, MacArthur CA, Kwan HC and Varmus HE (1993) Mouse mammary tumor virus infection accelerates mammary carcinogenesis in Wnt-1 transgenic mice by insertional activation of int-2/Fgf-3 and hst/Fgf-4. Proc Natl Acad Sci U S A 90, 740-744. Skalnik DG, Strauss EC and Orkin SH (1991) CCAAT displacement protein as a repressor of the myelomonocyticspecific gp91-phox gene promoter. J Biol Chem 266, 1673616744. Stewart TA, Pattengale PK and Leder P (1984) Spontaneous mammary adenocarcinomas in transgenic mice that carry and express MTV/myc fusion genes. Cell 38, 627-637. Swanstrom R and Wills JW (1997) Synthesis, assembly, and processing of viral proteins. In Retroviruses. J.M. Coffin, S.H. Hughes, and H.E. Varmus, eds. (Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press), 263-334. Telesnitsky A and Goff SP (1997) Reverse transcriptase and the generation of retroviral DNA. In Retroviruses. J.M. Coffin, S.H. Hughes, and H.E. Varmus, eds. (Cold Spring Harbor,N.Y.: Cold Spring Harbor Laboratory Press), 121160. Tufarelli C, Fujiwara Y, Zappulla DC and Neufeld EJ (1998) Hair defects and pup loss in mice with targeted deletion of the first cut repeat domain of the Cux/CDP homeoprotein gene. Dev Biol (Orlando) 200, 69-81. Valarche I, Tissier-Seta JP, Hirsch MR, Martinez S, Goridis C and Brunet JF (1993) The mouse homeodomain protein Phox2 regulates Ncam promoter activity in concert with Cux/CDP and is a putative determinant of neurotransmitter phenotype. Development 119, 881-896. van Leeuwen F and Nusse R (1995) Oncogene activation and oncogene cooperation in MMTV-induced mouse mammary cancer. Semin Cancer Biol 6, 127-133. Wakao H, Gouilleux F and Groner B (1994) Mammary gland factor (MGF) is a novel member of the cytokine regulated transcription factor gene family and confers the prolactin response. [erratum appears in EMBO J 1995 Feb 15;14(4):854-5]. EMBO J 13, 2182-2191. Wang Z, Goldstein A, Zong RT, Lin D, Neufeld EJ, Scheuermann RH and Tucker PW (1999) Cux/CDP homeoprotein is a component of NF-muNR and represses the immunoglobulin heavy chain intronic enhancer by antagonizing the bright transcription activator. Mol Cell Biol 19, 284-295. Weidhaas JB, Angelichio EL, Fenner S and Coffin JM (2000) Relationship between retroviral DNA integration and gene expression. J Virol 74, 8382-8389. Wheeler DA, Butel JS, Medina D, Cardiff RD and Hager GL (1983) Transcription of mouse mammary tumor virus: identification of a candidate mRNA for the long terminal repeat gene product. J Virol 46, 42-49. Withers-Ward ES, Kitamura Y, Barnes JP and Coffin JM (1994) Distribution of targets for avian retrovirus DNA integration in vivo. Genes Dev 8, 1473-1487. Wrona TJ, Lozano M, Binhazim AA and Dudley JP (1998) Mutational and functional analysis of the C-terminal region of the C3H mouse mammary tumor virus superantigen. J Virol 72, 4746-4755. Yanagawa S-I, Kakimi K, Tanaka H, Murakami A, Nakagawa Y, Kubo Y, Yamada Y, Hiai H, Kuribayashi K, Masuda T and Ishimoto A (1993) Mouse mammary tumor virus with

180

Gene Therapy and Molecular Biology Vol 6, page 181

rearranged long terminal repeats causes murine lymphomas. J Virol 67, 112-118. Zaret KS and Yamamoto KR (1984) Reversible and persistent changes in chromatin structure accompany activation of a glucocorticoid-dependent enhancer element. Cell 38, 29-38. Zhu Q, Gregg K, Lozano M, Liu J and Dudley JP (2000) CDP is a repressor of mouse mammary tumor virus expression in the mammary gland. J Virol 74, 6348-6357.

Jaquelin P. Dudley Ph.D. Section of Molecular Genetics and Microbiology, The University of Texas at Austin, 100 W. 24th Street, Austin, TX 78705; Telephone: (512) 471-8415; Fax: (512) 4717088; E-mail: jdudley@uts.cc.utexas.edu

181

Zhu and Dudley: MMMS: Lessons for gene therapy

182

Gene Therapy and Molecular Biology Vol 6, page 183

Gene Ther Mol Biol Vol 6, 183-194, 2001

Integrating vector and stem cell-based strategies for gene therapy of Duchenne muscular dystrophy Review Article

Michael L. Roberts1*, Steve Patterson2, and George Dickson1 1

Centre for Biomedical Sciences, School of Biological Sciences, Royal Holloway-University of London, Egham, Surrey, TW20 0EX, United Kingdom. 2 Department of Immunology, Imperial College of Science, Technology and Medicine, Chelsea and Westminster Hospital, London SW10 9NH. _________________________________________________________________________________________________ *Correspondence: Michael L. Roberts, Division of Biochemistry, Royal Holloway - University of London, Egham, Surrey TW20 0EX, United Kingdom, Tel: +44 (0)1784 443873, Fax: +44 (0)1784 434326, e-mail:M.L.Roberts@rhul.ac.uk Key words: muscular dystrophy, hybrid virus, adenovirus, retrovirus, macrophage, and stem cell Abbreviations: Duchenne Muscular Dystrophy, (DMD); green fluorescent protein, (GFP); herpes simplex virus type 1, (HSV-1); Tibialis Anterior, (TA) Received: 11 October 2001; accepted: 5 November 2001; electronically published: February 2004

Summary We review novel gene transfer strategies proposed to be suitable for the treatment Duchenne Muscular Dystrophy (DMD): use of hybrid adeno-retroviral vectors to stably replace dystrophin ultimately in patients lacking this gene and the potential intravenous application of stem cells and monocytes for targeted gene transfer. We discuss the limitations of current vector technology and demonstrate the need for continual evolution of vector design that is required before gene therapy of complex monogenic diseases such as DMD becomes a reality. contraction. In the absence of dystrophin muscle fibres are disorganised, degenerate and after several cycles of regeneration are replaced by fatty tissue resulting in loss of contractile strength. There are a number mouse models available for this disease, but the most commonly used is the naturally occurring mdx mouse, which contains a point mutation on exon 23 encoding a stop codon resulting in the termination of gene expression (Rydercook et al, 1988). It is the scope of this review to discuss some of the evolving genetic therapeutic techniques that may be applicable to the treatment of this otherwise incurable disease.

I. Introduction DMD is a debilitating X-linked muscle wasting disease affecting 1 in 3500 newborn boys, about one-third of these cases arise from spontaneous mutations (Emery, 1993). The dystrophin gene is one of the largest known spanning some 2.5 Mb (hence the high rate of spontaneous mutations) and comprises 79 exons spliced into a 14 kb cDNA. The encoded protein has a molecular mass of 427 kDa and is located in the sarcolemmal membrane (Figure 1). The primary functions of dystrophin are the maintenance of myofibre integrity and the mediation of intracellular signal transduction (Brenment et al, 1995; Grady et al, 1999; Bredt, 1999). The N-terminus of dystrophin binds actin, anchoring the protein to the intracellular matrix, whereas the C-terminus binds to the Dystrophin Associated Glycoprotein (DAG) complex, thought to be involved in signalling. The DAG complex in turn spans the sarcolemmal membrane binding the basal lamina and forms the link to the extracellular matrix. The intervening region is made up of actin-like rod domains and hinge regions that serve as a buffer during muscle

II. Current viral-based gene therapy of DMD Due to its large size it is difficult to construct viral vectors expressing the full-length dystrophin gene. However, there are truncated forms available, lacking some of the rod and hinge regions (England et al, 1990; Yuasa et al, 1998, Wang and Xiao, 2000). The most

183

Roberts et al: Gene therapy of Duchenne muscular dystrophy

Figure 1. Schematic diagram of the dystrophin associated glycoprotein complex. Dystrophin confers structural integrity upon muscle fibres by linking the surrounding extracellular matrix to the cytoskeleton via the dystrophin associated glycoprotein complex. The long intervening region comprising of rod and hinge repeat regions absorbs stress induced during muscle contraction

widely used is mini-dystrophin (6.3 kb) isolated from a patient suffering from Becker Muscular Dystrophy (a mild form of DMD) (England et al, 1990). Overexpression of this mini-gene has been shown to restore expression of the DAG complex at the sarcolemma (Vincent et al, 1993; Rafael et al, 1994), reduce the extent muscle degeneration (Vincent et al, 1993; Decrouy et al, 1997), maintain myofibre integrity (Decrouy et al, 1997) and increase the force generating capacity of dystrophic muscle (Yang et al, 1998). In recent years shorter micro-dystrophin constructs ranging from 3.7-4.5kb have been developed and shown to provide a few of these therapeutic benefits (Yuasa et al, 1998; Wang and Xiao, 2000). A number of the current viral vectors incorporating full-length and truncated dystrophin genes in their design with potential application for the treatment of DMD are listed below. (a) Adenovirus. Recombinant viral vectors based on the adenovirus are the most extensively used vectors for gene transfer in skeletal muscle (Quantin et al, 1992; Alameddine et al, 1994; Ascadi et al, 1996; Clemens et al, 1996; Petrof et al, 1996; Floyd et al, 1998; Yuasa et al, 1998; van Deutekom et al, 1999). However, first generation adenoviral-mediated mini-dystrophin expression in the muscle is short-term in nature, only lasting up to two months post-injection (Ascadi et al, 1996), although this can be extended by treatment with FK506 (Lochmuller et al, 1996). It is generally accepted that adenoviral-mediated expression elicits a powerful cytotoxic T-cell response resulting in the clearance of transduced fibres and a reduction in the force generating capacity of the muscle (Lochmuller et al, 1996, Petrof et al, 1996). Moreover, first and second generation vectors

are limited in that they are only able to accommodate the 6.3kb mini-dystrophin construct with a simple promoter/enhancer element. However, their ease of use, ability to replicate to high titres in complementing cell lines and high infectivity of a number of cell types has led to the further development of this vector. Newer generations of adenoviral vectors have all viral genes deleted and comprise only the cis elements (ITRs) required for replication with the packaging signal and a stuffer fragment of DNA (Ascadi et al, 1996; Clemens et al, 1996; Chen et al, 1997; Balkir et al, 1998). These vectors have the capacity to express the full-length dystrophin gene driven by complex muscle specific promoters and a second reporter gene (Chen et al, 1997). Development of third generation vectors has led to a marked improvement in the duration of transgene expression in vivo due to their ability to evade the immune response (Chen et al, 1997). Although these recent developments in adenoviral vectorology have been promising this vector is not well suited to DMD because its genome is maintained episomally. As the vector is nonintegrating it is likely the therapeutic gene would be lost during pathological turnover of muscle cells in dystrophic tissue, notwithstanding the stability of mature muscle fibres expressing dystrophin (Vincent et al, 1993). (b) Adeno-Associated Virus. Vectors based on this virus hold great promise for gene therapy of a number of diseases where the defective gene is relatively small. In its wild-type form the virus is non-pathogenic and integrates at a specific site within chromosome 19 (Linden et al, 1996). However, rep-deleted recombinant AAV vectors do not integrate into this specific region (Ponnazhagan et al,

184

Gene Therapy and Molecular Biology Vol 6, page 185

1997). In order to solve this problem hybrid AAV/Adenoviral (Lieber et al, 1999; Recchia et al, 1999; Ueno et al, 2000) and AAV/Herpes virus (Fraefel et al, 1997; Johnston et al, 1997; Costantini et al, 1999) vectors have been constructed to provide the rep gene in trans. Interestingly, the long-term gene expression obtainable from AAV is not associated with a deleterious immune response making them ideal vectors to express small heterologous secreted proteins, e.g. ApoE3 and clotting Factor IX, using skeletal muscle as an expression platform (Athanasopoulos et al, 2000). Although AAV vectors are efficient at infecting both mature and immature muscle (Pruchnic et al, 2000), their small size is a major drawback for the treatment of DMD. The maximum insert capacity is only 5.0 kb thus restricting the type of gene that can be inserted to synthetic micro-dystrophin constructs whose application to the treatment of DMD is expected to be limited (Yuasa et al, 1998). (c) Retrovirus. During the life cycle of the retrovirus its genome integrates into the infected cell subsequent to cell division. As such retroviral vectors hold great promise for the treatment of DMD due to the capacity of degenerated muscle tissue to regenerate, a process mediated by muscle satellite stem cells (Fassati et al, 1995). However, injection of neat retroviral suspensions into dystrophic muscle is not an efficient means of delivery because the administration of low viral titres achievable during the vector preparation stage is insufficient to transduce the relatively low proportion of dividing myoblasts in dystrophic tissue (Fassati et al, 1995). This can be overcome by implanting retroviral producer cells into the target muscle resulting in efficient stable transduction of fibres provided muscle degeneration is induced (Fassati et al, 1996), and has even been shown to be an efficient means of introducing mini-dystrophin into dystrophic tissue for long-term expression (Dunckley et al, 1993; Fassati et al, 1997). However, there are major safety limitations in implanting such a cell line into patients considering the severe inflammatory response and formation of palpable tumours derived from producer cells observed in mdx mice treated in this manner (Fassati et al, 1996). (d) Lentivirus. Lentiviral vectors have two distinct advantages over retroviral vectors; firstly, they are able to stably transduce non-dividing cells and secondly, they can be produced to much higher titres enabling them to be efficiently applied in vivo (Sakoda et al, 1999). A number of researchers have shown that lentiviral vector can mediate expression of transgene in skeletal, cardiac and smooth muscle cells in vivo for up to one year with minimal cytotoxicity (Kafri et al, 1997; Sakoda et al, 1999; Seppen et al, 2001). Despite these studies the application of lentiviral vectors to muscle-related disease has not occurred at the rate one would anticipate. This is likely a consequence of concerns over safety as most current vectors are based on Human Immunodeficiency

Virus. This scenario is likely to change as lentiviral vector technology evolves into systems based on forms of the virus that are restricted to productive life cycles in other species. Indeed vectors based on Feline Immunodeficiency Virus have now been shown to efficiently transduce a number of human cell types (Johnson et al, 1999; Curren et al, 2000) and even hamster skeletal muscle (Johnson et al, 1999). If these studies can be extended into human skeletal muscle then there may be a significant future for lentiviral-mediated gene therapy of DMD. (e) Herpesvirus. Vectors based on the herpes simplex virus type 1 (HSV-1) represent a potentially useful system for the treatment of DMD. The virus is able to accommodate up to 30 kb of heterologous DNA, making it an ideal vector to express full-length dystrophin. Indeed, replication defective HSV-1 vectors with single and triple mutations in the immediate early genes have been shown to efficiently deliver both mini- and full length dystrophin to muscle fibres in vivo (Akkaraju et al, 1999), although the long-term efficacy of HSV-1-mediated gene transfer is yet to be examined. Given the well-established link to cytotoxicity further disabled HSV-1 vectors may have to be developed in order to obtain prolonged expression. Each of the vectors listed above have features that are advantageous to gene therapy but no one comprises all the elements required for an ideal gene transfer vector e.g. large insert capacity, capability to evade the immune response, ability to integrate safely into the host genome and with minimum toxicity to target cells. In order to address this issue a number of researchers have developed hybrid viral vectors. These include gene delivery systems based on Adenovirus/Retrovirus (Feng et al, 1997; Lin, 1998; Ramsey et al, 1998; Caplen et al, 1999; Duisit et al, 1999; Roberts et al, 2001), Adeno-Associated Virus/Herpes Simplex Virus (Fraefel et al, 1997; Johnston et al, 1997; Costantini et al, 1999), Adenovirus/AdenoAssociated Virus (Recchia et al, 1999; Lieber et al, 1999; Ueno et al, 2000), Semliki Forest Virus/Retrovirus (Li and Garoff, 2001), Epstein-Barr virus/Retrovirus (Tan et al, 1999), Herpes Simplex Virus/Retrovirus (Parrish et al, 1999), and Poxvirus/Retrovirus (Holzer et al, 1999). The hybrid adeno-retroviral vector system may be particularly applicable to the treatment of DMD. Both dividing and non-dividing muscle cells are efficiently infected with adenoviral vectors and the retrovirus confers an integrative capacity to transduced cells (Reynolds et al, 1999). Production of functional retroviral vector using this hybrid system is a two-step process; target cells are infected with adenoviruses expressing retrovirus structural genes and proviral sequences. Infected cells release functional retroviral vector, which then tranduces neighbouring cells, resulting in the stable integration of the therapeutic gene (Figure 2). Using adenovirus templates to produce retroviral vector in this manner offers an opportunity to produce retroviral vector in situ, thus reducing complement-mediated lysis and increasing the efficiency

185

Roberts et al: Gene therapy of Duchenne muscular dystrophy

Figure 2. Hybrid adeno-retroviral vector system. Putative producer cells are infected with adenoviral vectors expressing the retroviral genome (AdLXIN), Gag-Pol (Adgagpol) and amphitrophic envelope protein (Ad10A1env). The infected cells assemble retroviral vector, which is released into the surrounding environment and transduces neighbouring cells. The proviral genome integrates during cell division creating a stable cell line expressing therapeutic transgene.

of retroviral vector transduction at the target site. Vectors constructed using this approach have already been used in two rodent models of cancer and shown to efficiently transduce rapidly dividing cancer cells (Feng et al, 1997; Caplen et al, 1998). One aspect of DMD pathology makes it an ideal target for gene therapy by in situ delivery of retroviral vector. Muscle fibres not expressing dystrophin degenerate and are subsequently replaced by proliferating myoblast stem cells during regeneration. If existing muscle fibres were allowed to act as a platform for retroviral production then regenerating myoblasts could be transduced by newly produced retroviral vector in the surrounding milieu.

encoding retroviral genome with gene of interest). The triple vector system has been shown to be a more efficient means of producing retroviral vector when compared to the two vector system, where gag, pol and env are expressed from one adenoviral vector (Lin, 1998, Roberts et al, 2001a). Myoblasts are able to generate retroviral vector titres of 5x104 cfu/ml after 48 hours, which drops significantly after a couple of days. Interestingly, postmitotic myotubes generate higher titres of retroviral vector (up to 3x105 cfu/ml) and production from these mature muscle cells does not drop over time (Roberts et al, 2001a). This would suggest that post-mitotic cells are more efficient at sustained production of retroviral vectors compared to dividing cells. This postulation was confirmed when cell division was inhibited in immature cultures of myotubes proposed to contain a higher proportion of myoblasts as an increase in retroviral vector production was observed (Roberts et al, 2001a). It is likely that proliferating myoblasts sequester retroviral vector subsequent to its production resulting in the generation of lower levels of vector for harvesting. Moreover, as the adenovirus is episomal, during proliferation of the producer cell all the components required for retroviral vector production are lost, thus over

III. Novel strategies for the treatment of DMDA. Muscle as a platform for retroviral vector production Proliferating myoblasts and mature differentiated myotubes have been shown to act as efficient retroviral producer cells in vitro when using hybrid adeno-retroviral vectors (Figure 3; Roberts et al, 2001a). The most efficient hybrid adeno-retroviral vector system comprises three adenoviral vectors expressing retroviral components; Adgag-pol, Ad10A1env and AdLXIN (adenoviral vector

Adenoviral Vector Only

Hybrid Adeno-Retroviral

186

Gene Therapy and Molecular Biology Vol 6, page 187

Figure 3. Cultures of myoblasts and myotubes produce retroviral vector. Proliferating immature myoblasts and post-mitotic differentiated myoblasts were infected with adenoviral vector alone or with the hybrid adeno-retroviral system expressing GFP. After two days medium was harvested from infected myocytes and used to transduce semi-confluent cultures of NIH 3T3 cells. One day subsequent to transduction geneticin was added and the transduced 3T3 cells were cultured for several weeks. Only NIH 3T3 cells treated with medium isolated from hybrid adeno-retroviral infected myoblasts and myotubes survived in the presence of geneticin, thus indicating the successful production of retroviral vector.

time fewer myoblasts will contain the elements required for retroviral vector production. These observations suggested that mature skeletal muscle might serve as an efficient long-term production platform for retroviral vector production given that the majority of cells in the muscle are post-mitotic myofibres. The ability of muscle cells in vitro to produce relatively high titres of retroviral vector holds great

promise for the gene therapy of DMD. Particularly since these results have recently been reproduced in vivo. In a recent study Tibialis Anterior (TA) muscle from mdx mice was injected with the adeno-retroviral vector system expressing the LacZ gene (Roberts et al, submitted). Retroviral vector production was allowed to occur for one week and primary muscle cultures were prepared from the infected tissue. After the primary myoblast cultures had

187

Roberts et al: Gene therapy of Duchenne muscular dystrophy

fused to form myotubes LacZ expression was analysed revealing that colonies of transduced myotubes only formed in cultures isolated from TA muscles infected with all the components required to make a retroviral vector (Roberts et al, submitted). Moreover, there was a ten-fold increase in the overall number of cells expressing !galactosidase. We then examined the effect of retroviral production on the overall number of myofibres expressing LacZ in a TA muscle. After one week in normal mdx mice,retroviral vector production led to a two-fold increase in the number of myofibres expressing LacZ (Roberts et al, submitted). However, after four weeks the number of fibres expressing LacZ had fallen significantly suggesting an immune response to vector and transgene sequences had resulted in the destruction of transduced fibres (Roberts et al, submitted). Similar analysis in immunodeficient nude mdx mice revealed that by allowing the TA to act as a factory of retroviral vector production for four weeks there was a five-fold increase in the total number of LacZ-expressing myofibres (Roberts et al, submitted). These data suggest that provided muscle regeneration is induced, the hybrid adeno-retroviral vector system may be a good way to stably transduce skeletal muscle provided the issues of adenoviral-mediated immunogenicity and retroviral promoter shutdown are

addressed.The hybrid adeno-retroviral vector system has also been used to slow the progression of muscular dystrophy in mdx mice. Neonates treated with hybrid adeno-retroviral vectors comprising a 3.7kb microdystrophin construct expressed the therapeutic transgene throughout most of the treated muscle (Figure 4). This efficient micro-dystrophin expression resulted in the restoration of components of the DAG complex (!dystroglycan, "-sarcoglycan and !-sarcoglycan) that would otherwise be absent in dystrophic tissue (Roberts et al, submitted). Moreover, expression of micro-dystrophin decreased the total number of degenerating myofibres in the TA muscle of mdx mice. Taken with the data indicating restoration of the DAG complex, it is likely that expression of micro-dystrophin from hybrid adenoretroviral vectors partially corrects the dystrophic phenotype. Moreover, the authors developed a novel nested PCR method to monitor retroviral integration (Figure 5). By using this procedure a specific product indicative of integration was detected only in animals injected with all the components required to produce retroviral vector, indicating that LTR duplication had occurred and the retroviral provirus had integrated into the muscle cell genome (Roberts et al, submitted).

Figure 4. Adeno-retroviral-mediated expression of microdystrophin in muscle. Muscle injected with components required for the production of retroviral vector expressing micro-dystrophin (lower section) or uninjected (upper section) and stained with antibody against the C-terminus of dystrophin. Note the efficient expression of the micro-dystrophin construct localises to the sarcolemmal membrane conferring structural integrity to the muscle.

B. Strategies Based on Cell-Mediated Gene Transfer

188

Gene Therapy and Molecular Biology Vol 6, page 189

As an alternative to viral vector-based strategies it has been proposed that intravenous transplantation of bone marrow stem cells from healthy individuals may serve to act as a stable source of dystrophin-expressing muscle satellite stem cells provided sufficient numbers of cells locate to the muscle (Gussoni et al, 1999). Intravenous transplantation of whole bone marrow, haematopoietic and muscle-derived stem cells from wild-type C57BL/10 mice can reconstitute lethally irradiated mdx recipients with all myeloid cell lineages. Moreover, up to 10% of muscle fibres from the TA muscle in recipient mice were found to express dystrophin derived from donors after three months (Gussoni et al, 1999). In a separate study a similar level of dystrophin expression (12%) in mdx mice intra-arterially transplanted with muscle-derived cells was only shown to occur subsequent to severe muscle damage in muscle groups near the injected artery (Torrente et al, 2001). Although stem cell-mediated therapy of DMD holds great promise a recent study has demonstrated the extremely low efficiency of this technique in the mdx4cv mouse model (Ferarri et al, 2001). The mdx4cv model has a stop codon mutation in exon 53 of the dystrophin gene preventing the formation of revertant dystrophinexpressing fibres that arise after exon skipping and allow for the expression of truncated functional forms of dystrophin. Less than one percent of muscle fibres were found to express dystrophin at any time over ten months in mdx4cv mice injected with whole bone marrow cells. The cumulative data from these studies would suggest that stem cell mediated recruitment of dystrophin-expressing

myoblasts to dystophic muscle might only occur through revertant fibres. If this were indeed proven to be the case then the application of this type of therapy to the treatment of DMD will be extremely limited. It has also been proposed that circulating monocytes may be able to deliver dystrophin constructs to the site of muscle degeneration provided they can be induced to produce retroviral vector (Parrish et al, 1996). During the degeneration of skeletal muscle large numbers of monocytes and macrophages that act to clear muscle cell debris infiltrate the damaged tissue (Figure 6). Using a hybrid HSV-1 amplicon/retroviral vector system Parrish and colleagues were able to convert a monocyte/macrophage cell line into retroviral producing cells releasing retroviral vector capable of transducing dividing myoblasts (Parrish et al, 1999). However, the overall efficiency of this technique was found to be extremely low as less than 0.1 % of myoblasts were transduced by retroviral vector produced from macrophages. This was likely a consequence of the toxicity that the HSV-1 vector conferred on the producer monocytes coupled with the low level of HSV-1-mediated monocyte infection (approximately 1% of monocytes were proposed to be producer cells). Given the high efficiency of adenoviral-mediated human monocyte/macrophage transduction (Figure 7), we proposed to use the hybrid adeno-retroviral vector system in a similar monocytemediated targeting approach. In preliminary studies we used monocyte/macrophages infected with hybrid adenoretroviral vectors expressing green fluorescent protein

Figure 5. Novel PCR-based technique to detect integrated retroviral sequences in genomic DNA. During retroviral reverse transcription of genomic RNA and subsequent integration into the host genome the 3’-LTR U3 sequence duplicates to form the 5’-LTR U3 sequence of the proviral integrant. Forward primer 1 binds to both the 5’ and 3’ LTR and is used in conjunction with reverse primer 2, which binds to the retroviral packaging signal, to amplify target sequences. Nested PCR is then employed using identical reverse primer 2 with forward primer 3 that specifically binds the retroviral 3’LTR. Therefore, amplicon only accumulates subsequent to retroviral LTR duplication and is indicative reverse transcription and integration.

189

Roberts et al: Gene therapy of Duchenne muscular dystrophy

Figure 6. Monocyte localisation to dystrophic tissue. A 10 Âľm muscle section is stained with antibody recognising the Mac-1 cell surface marker present only on murine monocyte/macrophages. Note the accumulation of signal around a number of myofibres (indicated by arrowhead) that are likely to be degenerating.

Figure 7. Adenoviral-mediated expression of transgene in human monocytes. FACS analysis of human monocyte infected with adenoviral vector expressing green fluorescent protein (GFP). Dose response indicates some 60 % of cells can be transduced by using a relatively low dose of vector (approximately 100 plaque forming units per monocyte).

190

Gene Therapy and Molecular Biology Vol 6, page 191

Figure 8. Gene transfer to muscle cells using monocytes as delivery vehicles. Mouse monocytes were infected with adenoviral vector alone (A) or with adeno-retroviral vector capable of producing retrovirus expressing GFP ( B). Infected monocytes were co-cultured with primary cultures from mdx muscle at the myoblast stage. After two weeks post-mitotic myotubes formed and were analysed for GFP expression by fluorescent microscopy. A four-fold increase in GFP expression amongst myotubes was observed in cultures infected with hybrid adeno-retroviral vector

(GFP) to transduce proliferating cultures of primary myoblasts from the mdx mouse (Roberts et al, 2000). We achieved a four-fold increase in GFP expression in myotubes co-cultured with macrophages producing retroviral vector over negative controls (Figure 8). However, retroviral vector production was also found to be inefficient in monocyte/macrophages when using the adeno-retroviral vector system, presumably because adenoviral infection of macrophages results in the release of cytokines (Kristofersson et al, 1997; Zhang et al, 2001), which may attenuate expression from the retroviral LTR (Kitamura, 1999). It will be necessary to optimise this method by employing retroviral elements with hybrid CMV/LTR promoters and adenoviral vectors with increased deletions and lower cytotoxicity to improve the efficiency of this approach before examining its feasibility in vivo.

patients it is essential that an effective therapy should involve the targeted delivery of therapeutic transgene so that it is expressed for life. In order to achieve this goal gene transfer systems based on integrating viral vectors and muscle stem cells must be further developed. Indeed, future studies may reveal that successful gene therapy of DMD will only arise from a marriage between viral and cell-mediated gene transfer techniques.

References Akkaraju GR, Huard J, Hoffman EP, Goins WF, Pruchnic R, Watkins SC, Cohen JB, and Glorioso JC (1999) Herpes simplex virus vector-mediated dystrophin gene transfer and expression in MDX mouse skeletal muscle. J. Gene Med. 1, 280-289. Alameddine HS, Quantin B, Cartaud A, Dehaupas M, Mandel JL, and Fardeau M (1994) Expression of a recombinant dystrophin in mdx mice using adenovirus vector. Neuromusc. Disord. 4, 193-203. Ascadi G, Jani A, Massie B, Simoneau M, Holland P, Blaschuk K, and Karpati G (1994) Cultured human myoblasts and myotubes show markedly different transducibility by replication-defective adenovirus recombinants. Gene Ther. 3, 579-584. Ascadi G, Lochmuller H, Jani A, Huard J, Massie B, Prescott S, Simoneau M, Petrof BJ, and Karparti G (1996) Dystrophin expression in muscles of mdx mice after adenovirusmediated in vivo gene transfer. Hum. Gene Ther. 7, 129140. Athanasopoulos T, Fabb SA, Dickson JG (2000) Gene therapy vectors based on adeno-associated virus: Characteristics and applications to acquired and inherited diseases (Review). Int. J. Mol. Med. 6, 363-375. Bredt DS (1999) Knocking signalling out of the dystrophin complex. Nat. Cell Biol. 1, E89-E91. Brenmen JE, Chao DS, Xia H, Aldape K, and Bredt DS (1995) Nitrogen-oxide synthase complexed with dystrophin and absent from skeletal-muscle sarcolemma in Duchenne Muscular-Dystrophy. Cell 82, 743-752.

IV. Conclusions Considering that researchers are yet to discover the perfect gene transfer vector a number of groups have started to combine the favourable elements from different viral vectors to construct chimeras. One such hybrid viral system has particular application for the treatment of DMD. Using a hybrid adeno-retrovirus, differentiated myotubes have been shown to efficiently produce retroviral vector. Moreover, skeletal muscle acts as an efficient platform for retroviral vector production resulting in increased transduction of myofibres in vivo. These observations have direct applications for the treatment of DMD. Indeed, expression of micro-dystrophin mediated from a hybrid adeno-retroviral vector partially corrects the dystrophic phenotype of mdx mice. Furthermore, expression of transgene was shown to be stable as indicated by the detection of retroviral vector sequences in genomic DNA isolated from transduced muscle fibres. Due to the high rate of muscle turnover observed in DMD

191

Roberts et al: Gene therapy of Duchenne muscular dystrophy

Caplen NJ, Higginbotham JN, Scheel JR, Vahanian N, Yoshida Y, Hamada H, Blaese RM, and Ramsey WJ (1999) Adenoretroviral chimeric viruses as in vivo transducing agents. Gene Ther. 6, 454-459. Chen HH, Mack LM, Kelly R, Ontell M, Kochanek S, and Clemens PR (1997) Persistence in muscle of an adenoviral vector that lacks all viral genes. Proc. Nat. Acad. Sci. USA. 95, 1645-1650. Clemens PR, Kochanek S, Sunada Y, Chan S, Chen HH, Campbell KP, and Caskey CT (1996) In vivo muscle gene transfer of full-length dystrophin with an adenoviral vector that lacks all viral genes. Gene Ther. 3, 965-72. Costantini LC, Jacoby DR, Wang S, Fraefel C, Breakefield XO, and Isacson O (1999) Gene transfer to the nigrostriatal system by hybrid herpes simplex virus/adeno-associated virus amplicon vectors. Hum. Gene Ther. 10, 2527-2537. Culver KW, Ram Z, Walbridge S, Ishii H, Oldfield EH, and Blease RM (1992) In vivo gene transfer with retroviral vector-producer cells for treatment of experimental brain tumors. Science 256, 1550-1552. Curran MA, Kaiser SM, Achacoso PL, and Nolan GP (2000) Efficient transduction of nondividing cells by optimized feline immunodeficiency virus vectors. Mol. Ther. 1, 31-38. Decrouy A, Renaud JM, Davis HL, Lunde JA, Dickson G, and Jasmin BJ (1997) Mini-dystrophin gene transfer in mdx4cv diaphragm muscle fibers increases sarcolemmal stability. Gene Ther. 4, 401-408. Duisit G, Salvetti A, Moullier P, and Cosset FL (1999) Functional characterization of adenoviral/retroviral chimeric vectors and their use for efficient screening of retroviral producer cell lines. Hum. Gene Ther. 10, 189-200. Dunckley MG, Wells DJ, Walsh FS, and Dickson G (1993) Direct retroviral-mediated transfer of a dystrophin minigene into mdx mouse muscle in vivo. Hum. Mol. Genet. 2, 717723. Emery AE (1993) Duchenne muscular dystrophy - Meryon's disease. Neuromuscul. Disord. 3, 263-6. England SB, Nicholson LVB, Johnson MA, Forrest SM, Love DR, Zubrzyckagaarn EE, Bulman DE, Harris JB, Davies KE (1990) Very mild muscular-dystrophy associated with the deletion of 46 % of dystrophin. Nature 343, 180-182. Fassati A, Wells DJ, Serpente PAS, Walsh FS, Brown SC, Strong PN, and Dickson G (1997) Genetic correction of dystrophin deficiency and skeletal muscle remodelling in adult mdx mouse via transplantation of retroviral producer cells. J. Clin. Invest. 100, 620-628. Fassati A, Wells DJ, Walsh F, and Dickson G (1996) Transplantation of retroviral producer cells for in vivo gene transfer into mouse skeletal muscle. Hum. Gene Ther. 7, 595-602. Fassati A, Wells DJ, Walsh FS, and Dickson G (1995) Efficiency of in vivo gene transfer using murine retroviral vectors is strain dependent in mice. Hum. Gene Ther. 6, 1177-1183. Feng M, Jackson WH, Goldman CK, Rancourt C, Wang M, Dusing SK, Siegal G, and Curiel DT (1997) Stable in vivo gene transduction via a novel adenoviral/retroviral chimeric vector. Nature Biotech. 15, 866-870. Ferrari G, Stornaiuolo A, and Mavilio F (2001) Failure to correct murine muscular dystrophy. Nature 411, 1014-1015. Floyd SS, Clemens PR, Ontell MR, Kochanek S, Day CS, Yang J, Haushka SD, Balkir R, Morgan J, Moreland MS, Feero GW, Epperly M, and Huard J (1998) Ex vivo gene transfer using adenovirus-mediated full-length dystrophin delivery to dystrophic muscles. Gene Ther. 5, 19-30.

Fraefel C, Jacoby DR, Lage C, Hilderbrand H, Chou JY, Alt FW, Breakefeild XO, and Majzoub JA (1997) Gene transfer into hepatocytes mediated by helper virus-free HSV/AAV hybrid vectors. Mol. Med. 3, 813-825. Grady RM, Grange RW, Lau KS, Maimone MM, Michol MC, Stull JT, and Sanes JR (1999) Role for alpha-dystrobrevin in the pathogenesis of dystrophin-dependent muscular dystrophies. Nat. Cell Biol. 1, 215-220. Gussoni E, Soneoka Y, Strickland CD, Buzney EA, Khan MK, Flint AF, Kunkel LM, and Mulligan RC (1997) Dystrophin expression in the mdx mouse restored by stem cell transplantation. Nature 401, 390-394. Holzer GW, Mayrhofer JA, Gritschenberger W, Domer F, and Falkner FG (1999) Poxviral/retroviral chimeric vectors allow cytoplasmic production of transducing defective retroviral particles. Virology 253, 107-114. Johnston JC, Gasmi M, Lim LE, Elder JH, Yee JK, Jolly DJ, Campbell KP, Davidson BL, and Sauter SL (1999) Minimum requirements for efficient transduction of dividing and nondividing cells by feline immunodeficiency virus vectors. J. Virol. 73, 4991-5000. Johnston KM, Jacoby D, Pechan PA, Fraefel C, Borghesani P, Schuback D, Dunn RJ, Smith FI, and Breakefield XO (1997) HSV/AAV hybrid amplicon vectors extend transgene expression in human glioma cells. Hum. Gene Ther. 8, 359370. Kafri T, Blomer U, Peterson DA, Gage FH, and Verma IM (1997) Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors. Nat. Genet. 17, 314317. Kafri T, Morgan D, Krahl T, Sarvetnick N, Sherman L, and Verma I (1998) Cellular immune response to adenoviral vector infected cells does not require de novo viral gene expression: Implications for gene therapy. Proc. Nat. Acad. Sci. USA. 95, 11377-11382. Kitamura M (1999) Bystander macrophages silence transgene expression driven by the retroviral long terminal repeat. Biochem. Biophys. Res. Commun. 257, 74-78. Kristoffersen AK, Sindre H, Mandi Y, Rollag H, and Degre M (1997) Effect of adenovirus 2 on cellular gene activation in blood-derived monocytes and macrophages. APMIS. 105, 402-409. Li KJ and Garoff H (1998) Packaging of intron containing genes into retrovirus vectors by alpha virus vectors. Proc. Nat. Acad. Sci. U S A. 95, 3650-3654. Lieber A, Steinwaerder DS, Carlson CA, and Kay MA (1999) Integrating adenovirus-adeno-associated virus hybrid vectors devoid of all viral genes. J. Virol. 73, 9314-9324. Lin X ( 1998) Construction of new retroviral producer cells from adenoviral and retroviral vectors. Gene Ther. 5, 1251-1258. Linden RM, Ward P, Giraud C, Winocour E, and Berns KI (1996) Site-specific integration by adeno-associated virus. Proc. Nat. Acad. Sci. USA. 93, 11288-11294. Lochmuller H, Petrof BJ, Pari G, Larochelle N, Dodelet V, Wang Q, Allen C, Prescott S, Massie B, Nalbabtoglu J, and Karpati G (1996) Transient immunosuppression by FK506 permits a sustained high-level dystrophin expression after adenovirusmediated dystrophin minigene transfer to skeletal muscles of adult dystrophic (mdx) mice. Gene Ther. 3, 706-716. Parrish E, Peltekian E, Dickson G, Epstein AL, and Garcia L (1999) Cell engineering for muscle gene therapy: Extemporaneous production of retroviral vector packaging macrophages using defective herpes simplex virus type 1

192

Gene Therapy and Molecular Biology Vol 6, page 193

vectors harbouring gag, pol, env genes. Cytotechnology 30, 173-180. Parrish EP, Cifuentes-Diaz C, Li ZL, Vicart P, Paulin D, Dreyfus PA, Peschanski M, Harris AJ, and Garcia L (1996) Targeting widespread sites of damage in dystrophic muscle: engrafted macrophages as potential shuttles. Gene Ther. 3, 13-20. Petrof BJ, Lochmuller H, Massie B, Yang L, Macmillan C, Zhao JE, Nalbantoglu J, and Karpati G ( 1996) Impairment of force generation after adenovirus-mediated gene transfer to muscle is alleviated by adenoviral gene inactivation and host CD8+ T cell deficiency. Hum. Gene Ther. 7, 1813-1826. Ponnazhagan S, Erikson D, Kearns WG, Zhou SZ, Nahreini P, Wang XS, and Srivastava A (1997) Lack of site-specific integration of the recombinant adeno-associated virus 2 genomes in human cells. Hum. Gene Ther. 8, 275-284. Pruchnic R, Cao BH, Peterson ZQQ, Xiao X, Li J, Samulski RJ, Epperly M, and Huard J (2000) The use of adeno-associated virus to circumvent the maturation-dependent viral transduction of muscle fibers. Hum. Gene Ther. 11, 521536. Quantin B, Perricaudet LD, Tajbakhsh S, and Mandel JL (1992) Adenovirus as an expression vector in muscle cells in vivo. Proc. Nat. Acad. Sci. USA. 89, 2581-2584. Rafael JA, Sunada Y, Cole NM, Campbell KP, Faulkner JA, and Chamberlain JS (1994) Prevention of dystrophic pathology in mdx mice by a truncated dystrophin isoform. Hum. Mol. Genet. 3, 1725-1733. Ramsey WJ, Caplen NJ, Li Q, Higginbotham JN, Shah M, and Blaese RM (1998) Adenovirus vectors as transcomplementing templates for the production of replication defective retroviral vectors. Biochem. Biophys. Res. Commun. 246, 912-919. Recchia A, Parks RJ, Lamartina S, Toniatti C, Pieroni L, Palombo F, Ciliberto G, Graham FL, Cortese R, La Monica N, and Colloca S (1999) Site-specific integration mediated by a hybrid adenovirus/adeno-associated virus vector. Proc. Nat. Acad. Sci. USA. 96, 2615-2620. Reynolds PN, Feng M, and Curiel DT (1999) Chimeric viral vectors â&#x20AC;&#x201C; the best of both worlds? Mol. Med. Today 5, 2531. Roberts M, Patterson S, and Dickson G (2000) Novel strategies for the treatment of DMD: evaluating the feasibility of using macrophages as retrovirus-producing cells. Mol. Ther. 1, S331. Roberts ML, Athanasopoulos T, Pohlschmidt M, Duisit G, Cosset FL, and Dickson G (2001) Post-mitotic, differentiated myotubes efficiently produce retroviral vector from adenoretrovirus templates. Gene Ther. 8, 1580-1586. Rydercook AS, Sicinski P, Thomas K, Davies KE, Worton RG, Barnard EA, Darlison MG, and Barnard PJ (1988) Localization of the mdx mutation within the mouse dystrophin gene. EMBO. J. 7, 3017-3021. Sakoda T, Kasahara N, Hamamori Y, and Kedes L (1999) A high-titer lentiviral production system mediates efficient transduction of differentiated cells including beating cardiac myocytes. J. Mol. Cell. Cardiol. 31, 2037-2047. Seppen J, Barry SC, Harder B, and Osborne WR (2001) Lentivirus administration to rat muscle provides efficient sustained expression of erythropoietin. Blood 98, 594-596.

Tan BT, Wu L, and Berk AJ (1999) An adenovirus-Epstein-Barr virus hybrid vector that stably transforms cultured cells with high efficiency. J. Virol. 73, 7582-7589. Torrente Y, Tremblay JP, Pisati F, Belicchi M, Rossi B, Sironi M, Fortunato F, El Fahime M, Dâ&#x20AC;&#x2122;Angelo MG, Caron NJ, Constantin G, Paulin D, Scarlato G, and Bresolin N (2001) Intraarterial injection of muscle-derived CD34(+)Sca-1(+) stem cells restores dystrophin in mdx mice. J. Cell Biol. 152, 335-348. Ueno T, Matsumura H, Tanaka K, Iwasaki T, Ueno I, Fujinaga K, Asada K, and Kato I (2000) Site-specific integration of a transgene mediated by a hybrid adenovirus/adeno-associated virus vector using the Cre/loxP-expression switching system. Biochem. Biophys. Res. Commun. 273, 473-478. Van Deutekom JCT, Cao B, Pruchnic R, Wickham TJ, Kovesdi I., and Huard J (1999) Extended tropism of an adenoviral vector does not circumvent the maturation-dependent transducibility of mouse skeletal muscle. J. Gene Med. 1, 393-399. Vincent N, Ragot T, Gilgenkrantz H, Couton D, Chafey P, Gregoire A, Briand P, Kaplan JC, Kahn A, and Perricaudet M (1993) Long-term correction of mouse dystrophic degeneration by adenovirus-mediated transfer of a minidystrophin gene. Nature Genet. 5, 130-134. Wang B, Li J, and Xiao X (2000) Adeno-associated virus vector carrying human minidystrophin genes effectively ameliorates muscular dystrophy in mdx mouse model. Proc. Nat. Acad. Sci. USA. 97, 13714-13719. Yang L, Lochmuller H, Luo J, Massie B, Nalbantoglu J, Karpati G, and Petrof BJ (1998) Adenovirus-mediated dystrophin minigene transfer improves muscle strength in adult dystrophic (MDX) mice. Gene Ther. 5, 369-379. Yuasa K, Miyagoe Y, Yamamoto K, Nabeshima Y, Dickson G, and Takeda S (1998) Effective restoration of dystrophinassociated proteins in vivo by adenovirus-mediated transfer of truncated dystrophin cDNAs. FEBS. Letts. 425, 329-336. Zhang Y, Chirmule N, Gao GP, Qian R, Croyle M, Joshi B, Tazelaar J, and Wilson JM (2001) Acute cytokine response to systemic adenoviral vectors in mice is mediated by dendritic cells and macrophages. Mol. Ther. 3, 697-707.

Michael L. Roberts Division of Biochemistry, Royal Holloway - University of London, Egham, Surrey TW20 0EX, United Kingdom, Tel: +44 (0)1784 443873, Fax: +44 (0)1784 434326, e-mail:M.L.Roberts@rhul.ac.uk

193

Roberts et al: Gene therapy of Duchenne muscular dystrophy

194

Gene Therapy and Molecular Biology Vol 6, page 195

Gene Ther Mol Biol Vol 6, 195-200, 2001

Bifidobacterium longum as a gene delivery system for cancer gene therapy Research Article

Minoru Fujimori1, Toshiyuki Nakamura1, Takayuki Sasaki1, Kazuyuki Yazawa1, Jun Amano1, Yasunobu Kano3, Shunâ&#x20AC;&#x2122;ichiro Taniguchi2 1

Department of Surgery and 2Molecular Oncology and Angiology, Angio-Aging Research Division, Center on Aging and Adaptation, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto, Japan 3 Department of Molecular Genetics, Institute of Molecular and Cellular Biology for Pharmaceutical Science, Kyoto Pharmaceutical University, 1 Shichono-cho, Misasagi, Yamashina-ku, Kyoto, Japan _________________________________________________________________________________________________ *Correspondence: Minoru Fujimori, M.D., Ph.D.; Department of Surgery;Shinshu University School of Medicine; 3-1-1 Asahi, Matsumoto 390-8621, Japan; Telephone: 81-263-37-2657; Fax: 81-263-37-2721; e-mail address: minoru1@hsp.md.shinshu-u.ac.jp Key words: cancer, prodrug-enzyme therapy Abbreviations: 5-fluorocytosine, (5FC); 5-fluorouracil, (5FU) Received: 15 November 2001; accepted: 28 November 2001; electronically published: February 2004

Summary A fundamental obstacle in cancer gene therapy is the specific targeting of therapy directly to a solid tumor, and no systemic delivery system yet exists. A strain of domestic bacteria, Bifidobacterium longum, which is nonpathogenic and anaerobic, selectively localized to and proliferated in solid tumors after systemic application. We propose a novel approach to cancer gene therapy in which anaerobic bacteria of the genus Bifidobacterium longum (B. longum) are used to achieve tumor specific gene delivery and prodrug-enzyme therapy. This is the first demonstration that Bifidobacterium longum can be utilized as a specific gene delivery vector for gene therapy on solid tumors.

propose a novel approach to cancer gene therapy in which anaerobic bacteria of the genus Bifidobacterium longum (B. longum) are used to achieve tumor specific gene delivery and prodrug-enzyme therapy.

I. Introduction A fundamental obstacle in cancer gene therapy is the specificity to a solid tumor, and yet no systemic delivery system exists. Hypoxic or necrotic regions are characteristic of solid tumors in many murine and human tumors, including the majority of primary tumors of the breast, uterine cervix (Moulder et al, 1984). Hypoxic regions are characteristic of many solid tumors and gene therapy that targets to hypoxic tumor cells is currently being investigated (Dachs et al, 1997). Kimura and colleagues demonstrated that anaerobic bacteria of the genus Bifidobacterium could selectively germinate and grow in the hypoxic regions of solid tumors after intravenous injection (Kimura et al, 1980). The genus Bifidobacterium is a Gram-positive anaerobe and is one of the domestic, nonpathogenic bacteria found in the lower small intestine and large intestine of humans and some other mammalian animals (Gorbach et al, 1967). We

II. Results A. Selective growth of B. longum in tumor tissues The number of two kinds of B. longum organisms per gram of various tissue at various time intervals after intravenous administration of bacilli into mice bearing Lewis lung cancer. At 168 hour, tumors had approximately sixty thousands bacilli per gram of tumor tissue regardless of the bacterial strain. In contrast, the number of bacilli in non-malignant tissues, such as the liver, spleen, kidney and lung, began to decrease immediately after injection and were below detectable

195

Fujimori et al: Bifidobacterium longum for cancer gene therapy

Figure 1. Organ distribution of B.longum 105-A and 108-A after a single i.v. adminisyration of 5-6 x 106 viable bacilli into Lewis lung cancer-bearig mice.

Figure 2. Comparison of the number of genetically engineered B. longum 105-A in both tumor and normal tissues from rats after 168 hr injected of about 2x108 viable bacilli. After homogenization of removed tumor and tissues, 100 Âľl samples were plated on each of the dishes and cultivated for 3 days

196

Gene Therapy and Molecular Biology Vol 6, page 197

Figure 3. Molecular structure of pBLES100-S-eCD

levels after 168 hours with B. longum 105-A and after 96 hours with 108-A (Figure 1). Colonies were recognized on the agar plate inoculating the tumor tissue only. Same result obtained DMBA induced mammary tumor of rats (Figure 2).

B. Prodrug-enzyme therapy genetically engineered B.longum

time-dependent 5FU concentration in the culture solution. In transfected B. longum, 5FU concentration rises with the passage of the time. It was confirmed that produced cytosine deaminase had the enzyme activity.Wild and transfected B. longum were injected into the DMBA induced mammary tumor of rats directly. Figure 6 is intratumoral concentration of 5FU. In transfected B. longum injected group, 5FU concentration was significantly more high-dense compare with control group. 55 days after injection of wild type B. longum, size of

using

B. longum is effective as hypoxic tumor specific vector, and it seems to be able to utilize for prodrugenzyme therapy. We chose to use the combination of cytosine deaminase and 5-fluorocytosine (5FC) in initial studies of the feasibility of this strategy. The cellular toxicities of 5FC are a results of its deamination by the enzyme cytosine deaminase to give 5-fluorouracil (5FU). We constructed pBLES100-S-eCD that includes HU gene promoter and cytosine deaminase gene in shuttle vector pBLES100. It has been proven that HU gene that encodes histon like DNA binding protein highly express in B. longum. Cytosine deaminase gene was ligated with HU gene prompter, and inserted into pBLES100. Figure 3 is molecular structure of pBLES100-S-eCD. B. longum were cultured anaerobically, and expression of the cytosine deaminase was analyzed by western blot method. Figure 4 is western blot analyzation of cytosine deaminase. The lane in the left is recombinant cytosine deaminase as positive control. The expression of cytosine deaminase is recognized only in transfected B. longum. 5-fluorocytosine (5FC) was added in the culture solution of wild and transfected B. longum, the 5-fluorouracil (5FU) concentration was measured time-dependent. Figure 5 is

Figure 4. Western blot analyzation of cytosine deaminase. Lane 1, recombinant cytosine deaminase as positive control; Lane 2,3,4,5, transfected B. longum; Lane 6,7,8,9, wild type B. longum

197

Fujimori et al: Bifidobacterium longum for cancer gene therapy

Figure 5. Time-dependent 5FU concentration in the culture solution of wild and trasfected B. longum

Figure 6. Intratumoral concentration of 5FU.

tumor increased remarkably. In transfected B. longum injected group, the tumor size decreased (Figure 7). Hematoxylin-eosin staining of the tumor in wild type B. longum injected group indicated that tumor cells were viable and proliferated. In transfected B. longum injected group, there are fibrosis and cytoplasm contains vacuoles and eosinophilic granules. Cancer cells tend to shrink away from stroma (Figure 8).

should be the presence of hypoxia in the treated tumors. This gene delivery system is not only tumor specific, but also nontoxic. Some investigators have described the availability of anaerobic bacteria such as clostridia (Fox et al, 1996; Lemmon et al, 1997) or Salmonella (Low et al, 1999) as a gene delivery vectors, but the pathogenicity of these organisms in humans likely precludes their use (Hone et al, 1992). Conversely, Bifidobacterium strains constitute almost the entire flora of the stools of breast-fed infants and are widely used for the preparation of fermented milk products. The nonpathogenicity and importance of these microorganisms are now generally acknowledged. To be able to exploit the potential of these organisms for cancer gene therapy, detailed knowledge is required about such basic biological phenomena as cellular metabolism, gene expression, protein secretion and genetics. However, studies on Bifidobacterium at the molecular level are severely limited in the absence of an efficient

III. Discussion A crucial difficulty for cancer gene therapy is the lack of specificity of current delivery systems. In this report, we observed a distribution of viable bacilli throughout the body, but after 96 to 168 hr they were detectable only in the tumor tissue after i.v. inoculation of B. longum to tumor-bearing mice and DMBA-induced mammary carcinoma in rats. It has been suggested that the only requirement for success of this gene therapy strategy

198

Gene Therapy and Molecular Biology Vol 6, page 199

Figure 7. Tumor of DMBA induced rat mammary tumors. Left, Day0 and 55 days after injection of wild type B. longum; Right, Day0 and 55 days after injection of transfected B. longum.

Figure 8. Hematoxylin-eosin staining of DMBA induced mammary tumor. Left, Wild type B. longum injected; Right, Transfected B. longum injected group.

transformation system. Recently, Matsumura and colleagues developed a system for convenient and reproducible genetic transformation of B. longum (Matsumura et al, 1997). We have demonstrated the tumor-specific germination of Bifidobacteria with transfected B. longum. These results strongly suggest that B. longum can be utilized as a highly specific gene delivery vector for cancer therapy. One of the major limitations of conventional chemotherapy is the toxicity associated with the lack of specificity of drugs for tumor cells over normal tissues. We proposed a new approach involving the genetically engineered B. longum for prodrug-enzyme therapy to use the combination of cytosine deaminase and 5fluorocytosine (5FC).

In summary, B. longum is accumulated in the hypoxic tumor, and it is effective as novel gene delivery system. Transfected B. longum by pBLES100-S-eCD produced cytosine deaminase in the hypoxic tumor, and it was confirmed to be effective for prodrug-enzyme therapy.

IV. Materials and Methods A. Animals Male C57BL6 mice, 6 to 8 weeks old, and female SpragueDawley rats ,6 weeks old were used in this study. As transplanted tumors, Lewis lung cancer and B16-F10 melanoma were used in mouse model. About 5 hundreds thousands tumor cells were inoculated into the right thigh muscle of mice. The solid tumors were obtained two weeks after. As autochthonous tumor, the rats were administered 10 mg of 7,12-dimethylbenz[a]anthracene (DMBA) by intragastric gavage weekly for two weeks. At 23

199

Fujimori et al: Bifidobacterium longum for cancer gene therapy

weeks after the first dose of DMBA, 89% rats developed mammary tumors.

of 5-fluorocytosine by genetically engineered clostridia. Gene Ther 3, 173-178. Gorbach SL, Plaut AG, Nahas L, Weinstein L, Spanknebel G, Levitan R (1967) Studies in intestinal microflora. II. Microorganisms of the small intestine and their relations to oral and fecal flora. Gastroenterology 53, 856-867. Hone DM, Tacket CO, Harris AM, Kay B, Losonsky G, Levine MM (1992) Evaluation in volunteers of a candidate live oral attenuated Salmonella typhi vector vaccine. J Clin Invest 90, 412-420. Kimura NT, Taniguchi S, Aoki K (1980) Selective localization and growth of Bifidobacterium bifidum in mouse tumors following intravenous administration. Cancer Res 40; 20612068. Lemmon MJ, van Ziji P, Fox ME, Mauchline ML, Giaccia AJ, Minton NP, Brown JM (1997) Anaerobic bacteria as a gene delivery system that is controlled by the tumor microenvironment. Gene Ther 4, 791-796, Low KB, Ittensohn M, Le T, Platt J, Sodi S, Amoss M, Ash O, Carmichael E, Chakraborty A, Fischer J, Lin SL, Luo X, Miller SI, Zheng LM, King I, Pawelek JM, Bermudes D (1999) Lipid A mutant Salmonella with suppressed virulence and TNF induction retain tumor-targeting in vivo. Nat Biotech 17, 37-41. Moulder JE, Rockwell S (1984) Hypoxic fractions of solid tumors: experimental techniques, methods of analysis, and survey of existing data. Int J Radiat Oncol Biol Phys 10, 695-712. Matsumura H, Takeuchi A, Kano Y, (1997) Construction of Escherichia coli-Bifidobacterium longum shuttle vector transforming B. longum 105-A and 108-A. Biosci Biotechnol Biochem 61, 1211-1212.

B. Bacteria B. longum 105-A and 108-A were anaerobically cultured and five to six millions bacilli were injected intravenously.

C. Selective growth of B.longum in tumor tissues Animals were injected B. longum into tail vein. This number was generally five to six million bacilli per mouse, and two hundreds million per rat. At 24, 48, 96, 168 hours after injection of B. longum, mice were killed. Tumor and normal tissues were excised and homogenized thoroughly. The diluted tissue homogenates were cultured under anaerobic conditions. On day 3 of culture, the number of colonies per dish was determined.

D. Prodrug-enzyme therapy using genetically engineered B.longum pBLES100-S-eCD that includes HU gene promoter and cytosine deaminase gene in shuttle vector pBLES100 was constructed. It has been proven that HU gene that encodes histon like DNA binding protein highly express in B. longum. Cytosine deaminase gene was ligated with HU gene prompter, and inserted into pBLES100. pBLES100-S-eCD were transfected directly into B. longum 105-A by electroporation. Transfected B. longum were cultured anaerobically, and expression of the cytosine deaminase was analyzed by western blot method. 5FC was added in the culture solution, and the 5FU) concentration was measured time-dependent. Add 5FC quantity was 25 mg per five to six millions bacilli. Wild and transfected B. longum were injected into the DMBA induced mammary tumor of rats directly. Both wild type and transfected B. longum injected group, rats were administered 500 mg per day of 5FC by intragastric gavage. Intratumoral concentration of 5FU was measured, and size of the tumor was compared wild type B. longum injected group with transfected group.

References Dachs GU, Patterson AV, Firth JD, Ratcliffe PJ, Townsend KMS, Stratford IJ, Harris AL (1997) Targeting gene expression to hypoxic tumor cells. Nat Med 3, 515-520. Fox ME, Lemmon MJ, Mauchline ML, Davis TO, Giaccia AJ, Minton NP, Brown JM (1996) Anaerobic bacteria as a delivery system for cancer gene therapy: in vitro activation

Minoru Fujimori, M. D., Ph. D.

200