GENE THERAPY & MOLECULAR BIOLOGY FROM BASIC MECHANISMS TO CLINICAL APPLICATIONS
Volume 8 Number 2 December 2004 Published by Gene Therapy Press
GENE THERAPY & MOLECULAR BIOLOGY FREE ACCESS www.gtmb.org
!!!!!!!!!!!!!!!!!!!!!!!! ! Editor
Teni Boulikas Ph. D., CEO Regulon Inc. 715 North Shoreline Blvd. Mountain View, California, 94043 USA Tel: 650-968-1129 Fax: 650-567-9082 E-mail: teni@regulon.org
Teni Boulikas Ph. D., CEO, Regulon AE. Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9853849 Fax: +30-210-9858453 E-mail: teni@regulon.org
!!!!!!!!!!!!!!!!!!!!!!!! ! Assistant to the Editor Maria Vougiouka B.Sc., Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9858454 Fax: +30-210-9858453 E-mail: maria@cancer-therapy.org
!!!!!!!!!!!!!!!!!!!!!!!! ! Associate Editors
Aguilar-Cordova, Estuardo, Ph.D., AdvantaGene, Inc., USA Berezney, Ronald, Ph.D., State University of New York at Buffalo, USA Crooke, Stanley, M.D., Ph.D., ISIS Pharmaceuticals, Inc, USA Crouzet, Joël, Ph.D. Neurotech S.A, France Gronemeyer, Hinrich, Ph.D. I.N.S.E.R.M., IGBMC, France Rossi, John, Ph.D., Beckman Research Institute of the City of Hope, USA Shen, James, Ph.D., Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan, Republic of China & University of California at Davis, USA. Webb, David, Ph.D., Celgene Corporation, USA Wolff, Jon, Ph.D., University of Wisconsin, USA
!!!!!!!!!!!!!!!!!!!!!!!! ! Editorial Board Akporiaye, Emmanuel, Ph.D., Arizona Cancer Center, USA Anson, Donald S., Ph.D., Women's and Children's Hospital, Australia Ariga, Hiroyoshi, Ph.D., Hokkaido University, Japan Baldwin, H. Scott, M.D Vanderbilt University Medical Center, USA Barranger, John, MD, Ph.D., University of Pittsburgh, USA Black, Keith L. M.D., Maxine Dunitz Neurosurgical
Institute, Cedars-Sinai Medical Center, USA Bode, Jürgen, Gesellschaft für Biotechnologische Forschung m.b.H., Germany Bohn, Martha C., Ph.D., The Feinberg School of Medicine, Northwestern University, USA Bresnick, Emery, Ph.D., University of Wisconsin Medical School, USA Caiafa, Paola, Ph.D., Università di Roma “La Sapienza”, Italy Chao, Lee, Ph.D., Medical University of South Carolina, USA
Cheng, Seng H. Ph.D., Genzyme Corporation, USA Clements, Barklie, Ph.D., University of Glasgow, USA Cole, David J. M.D., Medical University of South Carolina, USA Chishti, Athar H., Ph.D., University of Illinois College of Medicine, USA Davie, James R, Ph.D., Manitoba Institute of Cell Biology;USA DePamphilis, Melvin L, Ph.D., National Institute of Child Health and Human, National Institutes of Health, USA Donoghue, Daniel J., Ph.D., Center for Molecular Genetics, University of California, San Diego, USA Eckstein, Jens W., Ph.D., Akikoa Pharmaceuticals Inc, USA Fisher, Paul A. Ph.D., State University of New York, USA Galanis, Evanthia, M.D., Mayo Clinic, USA Gardner, Thomas A, M.D., Indiana University Cancer Center, USA Georgiev, Georgii, Ph.D., Russian Academy of Sciences, USA Getzenberg, Robert, Ph.D., Institute Shadyside Medical Center, USA Ghosh, Sankar Ph.D., Yale University School of Medicine, USA Gojobori, Takashi, Ph.D., Center for Information Biology, National Institute of Genetics, Japan Harris David T., Ph.D., Cord Blood Bank, University of Arizona, USA Heldin, Paraskevi Ph.D., Uppsala Universitet, Sweden Hesdorffer, Charles S., M.D., Columbia University, USA Hoekstra, Merl F, Ph.D., Epoch Biosciences, Inc., USA Hung, Mien-Chie, Ph.D., The University of Texas, USA Johnston, Brian, Ph.D., Somagenics, Inc, USA Jolly, Douglas J, Ph.D., Advantagene, Inc.,USA Joshi, Sadhna, Ph.D., D.Sc., University of Toronto Canada Kaltschmidt, Christian, Ph.D., Universität Witten/Herdecke, Germany Kiyama, Ryoiti, Ph.D., National Institute of Bioscience and Human-Technology, Japan Krawetz, Stephen A., Ph.D., Wayne State University School of Medicine, USA Kruse, Carol A., Ph.D., La Jolla Institute for Molecular Medicine, USA Kuo, Tien, Ph.D., The University of Texas M. D. Anderson Cancer USA Kurachi Kotoku, Ph.D., University of Michigan Medical School, USA Kuroki, Masahide, M.D., Ph.D., Fukuoka University School of Medicine, Japan Lai, Mei T. Ph.D., Lilly Research Laboratories USA
Latchman, David S., PhD, Dsc, MRCPath University of London, UK Lavin, Martin F, Ph.D., The Queensland Cancer Fund Research Unit, The Queensland Institute of Medical Research, Australia Lebkowski, Jane S., Ph.D., GERON Corporation, USA Li, Jian Jian, Ph.D., City of Hope National Medical Center, USA Li, Liangping Ph.D., Max-Delbrück-Center for Molecular Medicine, Germany Lu, Yi, Ph.D., University of Tennessee Health Science Center, USA Lundstrom Kenneth, Ph.D. , Bioxtal/Regulon, Inc. Switzerland Malone, Robert W., M.D., Aeras Global TB Vaccine Foundation, USA Mazarakis, Nicholas D. Ph.D., Oxford BioMedica, UK Mirkin, Sergei, M. Ph.D., University of Illinois at Chicago, USA Moroianu, Junona, Ph.D., Boston College, USA Müller, Rolf, Ph.D., Institut für Molekularbiologie und Tumorforschung, Phillips-Universität Marburg, USA Noteborn, Mathieu, Ph.D., Leiden University, The Netherlands Papamatheakis, Joseph (Sifis), Ph.D., Institute of Molecular Biology and Biotechnology Foundation for Research and Technology Hellas, USA Platsoucas, Chris, D., Ph.D., Temple University School of Medicine, USA Rockson, Stanley G., M.D., Stanford University School of Medicine, USA Poeschla, Eric, M.D., Mayo Clinic, USA Pomerantz, Roger, J., M.D., Tibotec, Inc., USA Raizada, Mohan K., Ph.D., University of Florida, USA Razin, Sergey, Ph.D., Institute of Gene Biology Russian Academy of Sciences, USA Robbins, Paul, D, Ph.D., University of Pittsburgh, USA Rosenblatt, Joseph, D., M.D, University of Miami School of Medicine, USA Rosner, Marsha, R., Ph.D., Ben May Institute for Cancer Research, University of Chicago, USA Royer, Hans-Dieter, M.D., (CAESAR), Germany Rubin, Joseph, M.D., Mayo Medical School Mayo Clinic, USA Saenko Evgueni L., Ph.D., University of Maryland School of Medicine Center for Vascular and Inflammatory Diseases, USA Salmons, Brian, Ph.D., (FSG-Biotechnologie GmbH), Austria Santoro, M. Gabriella, Ph.D., University of Rome Tor Vergata, USA Sharrocks, Andrew, D., Ph.D., University of Manchester, USA
Shi, Yang, Ph.D., Harvard Medical School, USA Smythe Roy W., M.D., Texas A&M University Health Sciences Center, USA Srivastava, Arun Ph.D., University of Florida College of Medicine, USA Steiner, Mitchell, M.D., University of Tennessee, USA Tainsky, Michael A., Ph.D., Karmanos Cancer Institute, Wayne State University, USA Sung, Young-Chul, Ph.D., Pohang University of Science & Technology, Korea Taira, Kazunari, Ph.D., The University of Tokyo, Japan Terzic, Andre, M.D., Ph.D., Mayo Clinic College of Medicine, USA Thierry, Alain, Ph.D., National Cancer Institute, National Institutes of Health, France
Trifonov, Edward, N. Ph.D., University of Haifa, Israel Van de Ven, Wim, Ph.D., University of Leuven, Belgium Van Dyke, Michael, W., Ph.D., The University of Texas M. D. Anderson Cancer Center, USA White, Robert, J., University of Glasgow, UK White-Scharf, Mary, Ph.D., Biotransplant, Inc., USA Wiginton, Dan, A., Ph.D., Children's Hospital Research Foundation, CHRF , USA Yung, Alfred, M.D., University of Texas, USA Zannis-Hadjopoulos, Maria Ph.D., McGill Cancer Centre, Canada Zorbas, Haralabos, Ph.D., BioM AG Team, Germany
!!!!!!!!!!!!!!!!!!!!!!!! ! Associate Board Members
Aoki, Kazunori, M.D., Ph.D., National Cancer Center Research Institute, Japan Cao, Xinmin, Ph.D., Institute of Molecular and Cell Biology, Singapore Falasca, Marco, M.D., University College London, UK Gao, Shou-Jiang, Ph.D., The University of Texas Health Science Center at San Antonio, USA Gibson, Spencer Bruce, Ph.D., University of Manitoba, USA Gra•a, Xavier, Ph.D., Temple University School of Medicine, USA
For submission of manuscripts and inquiries: Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org
Gu, Baohua, Ph.D., The Jefferson Center, USA Hiroki, Maruyama, M.D., Ph.D., Niigata University Graduate School of Medical and Dental Sciences, Japan MacDougald, Ormond A, Ph.D., University of Michigan Medical School, USA Rigoutsos, Isidore, Ph.D., Thomas J. Watson Research Center, USA
Instructions to authors: Gene Therapy and Molecular Biology (GTMB) FREE ACCESS www.gtmb.org Scope Gene Therapy and Molecular Biology, bridging various fields is one of the most rapid with free access at gtmb.org. The scope of Gene Therapy and Molecular Biology is to promote interaction between researchers in the fields of Gene Therapy and Molecular Biology providing rapid publication of review articles and research papers. Articles (both invited and submitted) review or report novel findings of importance to a general audience in gene therapy, molecular medicine, gene discovery, and molecular biology with emphasis to molecular mechanisms. The journal will accept papers on all aspects of gene therapy, including gene delivery systems, gene therapy of cancer and other diseases (e.g. CFTR, hemophilia, AIDS, restenosis) at the clinical, preclinical or cell culture stage, gene discovery, cancer immunotherapy, DNA vaccines, use of DNA regulatory elements in gene transfer, cell therapy and transplantation, arraying technologies & DNA chips, peptide libraries and drug discovery related to gene therapy, cell targeting, gene targeting, therapy with oligonucleotides (antisense, ribozymes, triplex). The authors are encouraged to elaborate on the molecular mechanisms that govern a gene therapy approach. Gene Therapy and Molecular Biology will also publish articles on, transcription factors, DNA replication, recombination, repair, chromatin, nuclear matrix, DNA regulatory regions, locus control regions, protein phosphorylation, signal transduction, development, and on molecular mechanism of human disease. To make the publication attractive authors are encouraged to include color figures.
Type of articles Both review articles and original research articles will be considered. In addition, short 1-2 page news & views will also be considered for publication. Original research articles should contain a generous introduction in addition to experimental data. The articles contain information important to a general audience as the volume is also addressed to researches outside the field. There is no limit on the length of the articles provided that the subject is interesting to a general audience and covers exhaustively a field. The typical length of each manuscript is a approximately 4-20 printed page including Figures and Tables. This is 12-60 manuscript pages. Charges, Complimentary reprints & Subscriptions There are no charges for color figures or page numbers. Corresponding authors get a one-year free subscription (hard copy) plus 25 reprints free of charge. The free subscription can be renewed for additional years by having one paper per year accepted for publication. The free electronic access to articles published in " Gene Therapy and Molecular Biology " to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in gene therapy (from molecular mechanisms to clinical trials), the high quality
in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board being assembled are prognostic factors of a big success for GTMB.
Sections of the manuscript Each manuscript should have a Title, Authors, Affiliation, Corresponding Author (with Tel, Fax, and Email), Summary, key words , running title and Introduction; review articles are subdivided into headings I, II, III, etc. (starting with I. Introduction) subdivided into A, B, C, and further subdivided using 1, 2, 3, etc. You can further subdivide into 1, 2, 3, etc. Research articles are divided into Summary; I. Introduction; II. Materials and Methods III. Results; IV. Discussion; Acknowledgments; and References. Please include in your text citations the name of authors and year in parenthesis; for three or more authors use: (name of first author et al, with year); for two authors please use both names. Please delete hidden text for references. In the reference list, please, type references with year and Journal in boldface and provide full title of the article such as: Buschle M, Schmidt W, Berger M, Schaffner G, Kurzbauer R, Killisch I, Tiedemann J-K, Trska B, Kirlappos H, Mechtler K, Schilcher F, Gabler C, and Birnstiel ML (1998) Chemically defined, cell-free cancer vaccines: use of tumor antigen-derived peptides or polyepitope proteins for vaccination. Gene Ther Mol Biol 1, 309-321. To avoid delays it is essential to submit an electronic and a hard copy version of your manuscript via email and mail in a floppy, CD-ROM or ZIP, containing the manuscript that will be used to typeset the paper. Please include in the digital media: Tables, if any, (preferably as a Microsoft Word text) and Figure legends. Please use Microsoft Word, font “Times” (Mac users) or “Times New Roman” (PC users) and insert Greek or other characters using the “Insert/Symbol” function in the Microsoft Word rather than simple conversion to font “Symbol”. Please boldface Figure 1, 2, 3 etc. as well as Table 1, 2, etc. throughout the text. Please provide the highest quality of prints of your Figures; whenever possible, please provide in addition an electronic version of your figures. Article contributors are kindly requested to provide a color (or black/white) photo of themselves (preferably 4x5 cm or any size) or a group photo of the authors, as we shall include these in the publication Submission and reviewing Peer reviewing is by members of the Editorial Board and external referees. Please suggest 2-3 reviewers providing their electronic addresses, mailing addresses and telephone/fax numbers. Authors are sent page proofs. Gene Therapy and Molecular Biology is published in on high quality paper, hardbound, and with excellent reproduction of color figures. Reviewing is completed within 5-15 days from receiving the manuscript. Articles accepted without revisions (i.e., review articles) will be published online (www.gtmb.org) in approximately 1 month following submission.
Please submit an electronic version of full text and figures preferably in jpeg format. The electronic version of the figures will be used for the rapid reviewing process. High quality prints or photograph of the figures and the original with one copy should be sent via express mail to the Editorial Office. Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org The free electronic access to articles published in "GTMB" to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in cancer, the anticipated high quality in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board being assembled are prognostic factors of a big success for the newly established journal.
Table of contents
Gene Therapy and Molecular Biology Vol 8 Number 2, December 2004 Pages
Type of Article
Article title
Authors (corresponding author is in boldface)
319-326
Research Article
Phosphorothioated CpG Oligonucleotide induced hemopoietic changes in mice
Priya Aggarwal, Ruma Ray and Pradeep Seth
327-334
Research Article
Development of HIV-1 subtype C Gag based DNA vaccine construct
Priti Chugh and Pradeep Seth
335-342
Review Article
Targeting retroviral vector entry by host range extension
Katja Sliva and Barbara S.Schnierle
343-350
Review Article
Role of the Brn-3a and Brn-3b POU family transcription factors in cancer
David S. Latchman
351-360
Review Article
Angiogenic gene therapy in the treatment of ischemic cardiovascular diseases
Tamer A. Malik, Cesario Bianchi, Frank W. Sellke
361-368
Review Article
Targeting Myc function in cancer therapy
William L. Walker, Sandra Fernandez and Peter J. Hurlin
369-384
Review Article
Transfection pathways of nonspecific and targeted PEI-polyplexes
Vicent M. Guillem and Salvador F. Ali•o
385-394
Review Article
c-myc: a double-headed Janus that regulates cell survival and death
Rosanna Supino and A. Ivana Scovassi
395-402
Research Article
DNA-based vaccine for treatment of intracerebral neoplasms
Terry Lichtor, Roberta P Glick, InSug O-Sullivan, Edward P Cohen
403-412
Research Article
The involvement of H19 non-coding RNA in stress: Implications in cancer development and prognosis
Suhail Ayesh, Iba Farrah, Tamar Schneider, Nathan de-Groot1 and Abraham Hochberg
413-422
Research Article
PSA promoter-driven conditional replicationcompetent adenovirus for prostate cancer gene therapy
Guimin Chang and Yi Lu
423-430
Research Article
A platform for constructing infectivity-enhanced fiber-mosaic adenoviruses genetically modified to express two fiber types
Marianne G. Rots, Willemijn M. Gommans, Igor Dmitriev, Dorenda Oosterhuis, Toshiro Seki, David T. Curiel, Hidde J. Haisma
431-438
Review Article
Internal ribosome entry sites in cancer Benedict J Yan and Caroline GL Lee gene therapy
439-450
Research
The pathway of uptake of SV40
Chava Kimchi-Sarfaty, Susan Garfield,
Article
pseudovirions packaged in vitro: from MHC class I receptors to the nucleus
Nathan S. Alexander, Saadia Ali, Carlos Cruz, Dhanalakshmi Chinnasamy, and Michael M. Gottesman
451-464
Review Article
The importance of PTHrP for cancer development
J端rgen Dittmer
465-474
Review Article
Gene-based vaccines for immunotherapy of prostate cancer lessons from the past
Milcho Mincheff and Serguei Zoubak
475-486
Research Article
An erythroid-specific chromatin opening element increases "-globin gene expression from integrated retroviral gene transfer vectors
Michael J. Nemeth and Christopher H. Lowrey
487-494
Research Article
Decreased tumor growth using an IL2 amplifier expression vector
Xianghui He, Farha H Vasanwala, Tom C Tsang, Phoebe Luo1, Tong Zhang and David T Harris
495-500
Research Article
Multiple detection of chromosomal gene correction mediated by a RNA/DNA oligonucleotide
Alvaro Galli, Grazia Lombardi, Tiziana Cervelli and Giuseppe Rainaldi
501-508
Review Article
Nitric oxide and endotoxin-mediated sepsis: the role of osteopontin
Philip Y. Wai and Paul C. Kuo
509-514
Research Article
Feasibility to delineate distribution of solution injected intraprostatic using an ex-vivo canine model
Charles J. Rosser, Noriyoshi Tanaka, R. Jason Stafford, Roger E. Price, John D. Hazle, Motoyoshi Tanaka, Ashish M. Kamat, Louis L. Pisters
515-522
Review Article
ER stress and the JNK pathway in insulin resistance
Hideaki Kaneto, Yoshihisa Nakatani, and Munehide Matsuhisa
523-538
Review Article
Molecular insight into human heparanase and tumour progression
Erich Rajkovic, Angelika Rek, Elmar Krieger and Andreas J Kungl
539-546
Research Article
Two dimensional gel electrophoresis analyses of human plasma proteins. Association of retinol binding protein and transthyretin expression with breast cancer
Karim Chahed, Bechr Hamrita, Hafedh Mejdoub, Sami Remadi, Anouar Cha誰eb and Lotfi Chouchane
Gene Therapy and Molecular Biology Vol 8, page 319 Gene Ther Mol Biol Vol 8, 319-326, 2004
Phosphorothioated CpG Oligonucleotide induced hemopoietic changes in mice Research Article
Priya Aggarwal1, Ruma Ray2 and Pradeep Seth1* Departments of Microbiology1 and Pathology2, All India Institute of Medical Sciences, New Delhi-110029, India
__________________________________________________________________________________ *Correspondence: Pradeep Seth MD FAMS FNASc, Professor and Head, Dept of Microbiology, All India Institute of Medical Sciences, New Delhi-110029; Phone: 91-11-26588714; Fax: 91-11-26588641; Email pseth@aiims.aiims.ac.in, sethpradeep@hotmail.com Key words: CpG motifs; 1826-ODN; Splenomegaly; Hemopoiesis Abbreviations: cytotoxic T lymphocyte, (CTL); extramedullary hemopoiesis, (EMH); human immunodeficiency virus, (HIV); oligodeoxynucleotides, (ODNs); pathogen-associated microbial patterns, (PAMPs); reactive follicular hyperplasia, (RFH); Toll like receptors, (TLRs) Received: 17 May 2004; Accepted: 25 May 2004; electronically published: May 2004
Summary Bacterial DNA and the synthetic CpG-oligodeoxynucleotides (ODNs) derived thereof have attracted attention because they activate cells of the adaptive immune system (lymphocytes) and the innate immune system (macrophages). They induce a Th1 biased immune response upon activation of the immune cells. In this paper we addressed whether unmethylated phosphorothioated CpG ODN (for example 1826 CpG-ODNs) affected hemopoiesis. We observed an overall Th1 dominant response upon in-vitro stimulation of naïve splenocytes with 1826-ODN. Immunizing mice with immunostimulatory CpG motifs led to transient splenomegaly, with a maximum increase of spleen weight at 4 weeks post immunization. Thereafter the splenomegaly regressed. The induction of splenomegaly by CpG-ODNs was dose-dependent with the maximum spleen weights recorded at the 250 µg immunizing dosage of 1826-ODN. In addition, the splenomegaly was also associated with dose dependent extramedullary hemopoiesis and reactive follicular hyperplasia in the spleens and lymph nodes, which could be of therapeutic relevance particularly in patients with life threatening chronic and persistent infectious diseases like visceral leishmaniasis and HIV infection. It is known that bacterial stimuli (Lipopolysaccharide or Complete Freunds Adjuvant containing heat-killed mycobacteria) can trigger increased splenic hemopoiesis (McNeill et al, 1970; Apte et al, 1976; Staber et al, 1980), possibly via macrophage-derived hemopoietic growth factors that stimulate the generation and mobilization of the blood cells necessary to combat bacterial infections (Morrison et al, 1995). Here, we show that 1826-CpGODNs displayed the capacity to potentiate hemopoiesis. In addition, we observed that Phosphorothioated-ODNs with CpG motifs cause splenomegaly in Balb/c mice. We conclude that CpG ODN likely exerts systemic effects on spleens and lymph nodes.
I. Introduction CpG oligodeoxynucleotides (ODNs) are a novel pharmacotherapeutic class with profound immunomodulatory properties. CpG ODN shows Th1 biased immune responses and promise as vaccine adjuvant and in the treatment of asthma, allergy, infection, and cancer. Several groups have studied the effect of CpG ODNs on the various arms of the immune system: B cells, T cells, NK cells, and dendritic cells (Krieg et al, 1995; Ballas et al, 1996; Davis et al, 1998). They have also studied its effect on the release of various cytokines important from an immunological standpoint. Overall CpG induces a Th1 like pattern of cytokine production that is dominated by IL-12 and IFN-! with little secretion of Th2 cytokines. Recent work demonstrates the powerful adjuvant effect of CpG-ODNs, which can be used to trigger protective and curative Th1 responses in vivo (Chu et al, 1997; Lipford et al, 1997a, b; Zimmermann et al, 1998). When combined with specific antigen in-vivo, CpG ODNs can serve as a strong stimulus for T-cell activation, as well as for proliferation of antigen specific cytotoxic T lymphocyte (CTL) effectors.
II. Materials and methods A. CpG Motifs (1826-ODN) An unmethylated, phosphorothioated CpG motif, 1826ODN, (5’-TCCATGACGTTCCTGACGTT-3') was synthesized commercially (Biosynthesis, USA). This ODN has 2 CpG motifs separated by 7 bases in between them. The ODN preparation had < 0.1 EU of endotoxin per milligram of ODN as assessed by a Limulus Amebocyte Lysate assay - E-TOXATE (Sigma, USA).
319
Aggarwal et al: CpG oligonucleotide, induced hemopoietic changes in mice
III. Results
B. Animals
A. In vitro stimulatory effect of 1826ODN on naïve murine spleen cells
6-8 weeks old, inbred female Balb/c mice were purchased from National Central for Laboratory Animal Sciences, National Institute of Nutrition, Hyderabad, India.
Nonspecific stimulatory effect of the 1826-ODN was evaluated quantitatively on naïve spleen cells, by evaluating release of Th1 and Th2 cytokines in the culture supernatants (Figure 1). Murine IL-2 was detectable only with 2µg of 1826-ODN. The IL2 level showed a steady increase with the increasing incubation time and was 265 pg/ml at 72 hours. On the other hand, only 20 pg/ml of IL2 was detected at 72 hours with 10 µg dose of the ODN. Similarly, higher amounts of IFN-! levels were also detected with 2-µg dose. Th2 cytokine, IL-10, was secreted in relatively higher amounts at all doses in comparison to the other cytokines. The maximum secretion was seen with 2 µg dose with the values of 115, 490, 405 and 510 pg/ml at 24, 36, 48 and 72 hours time points respectively. The IL-10 cytokine levels were comparatively low with 10 µg dose of ODN. With the increasing dose of ODN to 50 and 250 µg, the IL-10 cytokine secretion levels further decreased. The IL-10 cytokine levels at 250-µg dose were barely detectable. On the other hand, IL-4 cytokine secretion was not detected in the culture supernatants at all doses at all time points. Control wells, incubated without ODN did not show any secretion of either IL-10 or IL-4 cytokines.
C. In vitro stimulatory effect of 1826-ODN on naïve murine spleen cells Normal mice were euthanised with an overdose of pentobarbital and spleens were removed aseptically. The spleen cells were collected, enumerated and resuspended in RPMI medium with 10% FCS to the required concentration. One million naïve spleen cells from unimmunized Balb/c mice, were plated in each well of a six-well tissue culture plate and incubated with different doses on 1826-ODN in duplicate wells (2,10,50 and 250µg/well). The control wells did not contain any ODN. The culture supernatants were collected at 24,36,48 and 72 hours for quantification of secreted IL-2, IFN-!, IL-4 and IL-10 by murine cytokine ELISA kits (R&D Systems) according to the manufacturer's instructions.
D. Immunization of mice Five mice per group were injected with different doses of 1826-ODN (2,10,50 and 250µg/mouse) intradermally. The mice were boosted with the same dose two weeks later. The control mice received normal saline intradermally. Mice were sacrificed at 4, 6, 8 and 24 weeks post-immunization respectively and spleen and lymphnodes were collected for histopathology. For determination of splenomegaly, fat and contiguous tissue around the spleens was trimmed off and the spleens were weighed.
B. Mouse splenomegaly assay
E. Histopathology
Splenomegaly was observed to be highly dose dependent (Figure 2) . There was a significant increase in the spleen weights with the increasing dose of 1826-ODN at all time points. Maximum spleen weights were recorded at 4 weeks time point. Thereafter, the spleen size and weight decreased significantly over time during next 5 months. Massive splenomegaly was observed with the 250-µg dose of 1826-ODN at 4 weeks time point with an average spleen weight of 0.65338 +/- 0.075049 grams,
After removal, the spleens and lymphnodes were fixed in 10% neutral-buffered formalin and subsequently fine sections (5µ thick) were taken for histopathology. The tissue sections were then processed in Histokinette machine (Leica TP1020) for microscopic evaluation. This processing included fixation in 70% ethanol for 1 hour followed by 80% and absolute ethanol for 1 hour each. Then they were treated with acetone and xylene for 1 hour each, for the clearing of tissues. Finally, they were impregnated with melted paraffin wax (60°-62°C) for 1 hour. The tissue sections were mounted on slides, and stained with hematoxylin and eosin.
Figure 1 In-vitro stimulatory effect of 1826-ODN on the naïve splenocytes. Culture supernatants were tested for the presence of secreted murine Th1 (IFN-! and IL-2) and Th2 cytokines (IL-10 and IL-4).
320
Gene Therapy and Molecular Biology Vol 8, page 321 which was 9.6 times more than the average spleen weight of mice injected with normal saline. At 6 months time point also, the average spleen weight for 250-µg dosage was 1.5 folds greater than the average spleen weight of mice injected with normal saline. On the other hand splenic weights of mice immunized with 2µg, 10µg and 50µg doses of 1826-ODN at 4 weeks time point were 4.8, 3.2 and 3 folds more than the spleen weight of mice injected with normal saline, respectively.
megakarycytes (Figure 3c). There was a prominent expansion of white pulp of the spleens and formation of germinal centers with all the doses of 1826-ODN as compared to the spleens of mice injected with normal saline, which were histologically normal (Figure 3e). Spleens of mice injected with 250-µg-1826-ODN showed severe degree of reactive follicular hyperplasia with EMH (Figure 3b). Red pulp showed histiocytes with abundant eosinophilic cytoplasm. There were prominent germinal centers. Numerous megakaryocytes were present in the red pulp. The spleens of mice at 6 months time point also showed EMH but to a lesser degree than that observed at 6 weeks time point. Here also, the degree of reactive hyperplasia increased with the increasing dose of 1826ODN, with maximum at 250 µg CpG ODN dosage. Figure 3(c) shows EMH with megakaryocyte formations in the spleen section of 10-µg dose of ODN. Figure 3(d)
C. Histopathology Histological changes were studied in the spleens at 6 weeks time point and in both spleens and lymph nodes at 6 months time point (Table 1a and b). Spleens showed increasing degree of extramedullary hemopoiesis (EMH) and reactive follicular hyperplasia (RFH) with prominent germinal centers with the increasing doses of 1826-ODN (Figure 3a). EMH was diagnosed by the presence of immature hemopoietic precursors including
Figure 2 Mouse splenomegaly assay. The mice were immunized with different doses of 1826 ODN (2µg (group 1), 10µg (group 2), 50µg (group 3), 250µg (group 4)) intradermally. The control group (group 5) received normal saline. The spleens were harvested at 4 weeks, 6 weeks 8 weeks and 24 weeks post immunization and weighed. Each group had 5 mice. The average spleen weight is expressed in grams.
Table 1a. Observation chart showing the histological changes in the respective spleen and lymph node sections of mice injected with escalating doses of 1826-ODN (a) at 6 weeks time point (b) at 6 months time point post immunization. Spleen
2 µg ODN *Reactive follicles
10 µg ODN *Reactive follicles
*Prominent expansion of white pulp
*Prominent white pulp *Hyperplasia
321
50 µg ODN *Expansion of white pulp with reactive
250 µg ODN *Severe degree of
follicular hyperplasia * Extramedullary hemopoiesis
hyperplasia
reactive follicular
*Red pulp shows histiocytes with abundant eosinophilic cytoplasma *Prominent germinal centers *Formation of Megakaryocytes * Extramedullary hemopoiesis
Normal Saline Histologically normal
Aggarwal et al: CpG oligonucleotide, induced hemopoietic changes in mice Table 1b. 2 µg ODN
10 µg ODN
50 µg ODN
250 µg ODN
Normal Saline
Spleen
Histologically normal
Extramedullary hemopoiesis *Formation of Megakaryocytes
Extramedullary hemopoiesis *Formation of Megakaryocytes *Severe degree of reactive follicular hyperplasia * Formation of germinal centers * Small epitheloid cells granuloma with in center of reactive white pulp.
Extramedullary hemopoiesis *Formation of Megakaryocytes *Severe degree of reactive follicular hyperplasia *Formation of Megakaryocytes in red pulp
Histologically normal
Lymph Node
Histologically normal
Sinus histiocytosis
lymph node not found
* Few reactive secondary follicles with germinal center
Histologically normal
Figure 3 Reactive follicular hyperplasia with the formation of secondary follicle having prominent germinal center in spleen from mice injected with (a) 50µg and (b) 250 µg of 1826-ODN at 6 weeks time point (40X). The arrows are demarcating an expanding follicle.
322
Gene Therapy and Molecular Biology Vol 8, page 323
Figure 3(c) Extramedullary hemopoiesis with the formation of megakaryocytes (arrows) in the spleen from mice injected with 10ug of 1826-ODN at 6 months time point (40X). (d) Granuloma formation (arrows) with small epitheloid cells in the spleen from mice injected with 50 ug of 1826-ODN at 6 months time point (e) Spleen from mice injected with normal saline (40X).
323
Aggarwal et al: CpG oligonucleotide, induced hemopoietic changes in mice
Figure 4(a) Focal sinus histiocytosis in lymph node from mice injected with 10 µg of 1826-ODN at 6 months time point (40X) The arrow is pointing towards a collection of histiocytes. (b) the lymph node from mice injected with normal saline (40X).
shows the spleen section of mice injected with 50 µg ODN dose, at 6 months time point, where granuloma can be seen with small epitheloid cells.
most useful in initially screening CpG-ODN for immunostimulatory activity and to determine its optimizing dosage to use in in vivo models. In our study, CpG-ODN 1826 induced significant Th1 cytokine responses (IFN-! and IL-2) in vitro, on splenocytes from normal mice. The induction of cytokines by the naïve spleen cells can be explained by the presence of Toll like receptors (TLRs) on the cells. These evolutionary conserved receptors, homologues of the Drosophila Toll gene, recognize highly conserved structural motifs only expressed by microbial pathogens, called pathogenassociated microbial patterns (PAMPs). Stimulation of TLRs by PAMPs initiates a signaling cascade that involves a number of proteins, such as MyD88 and IRAK (Medzhitov et al, 1997). TLR9, which is localized
IV. Discussion In this study, we describe and characterize the in vitro cytokine response of spleen cells and in vivo extramedullary hemopoiesis in spleen and lymph nodes in mice induced by CpG-ODNs. Specific CpG sequences appear to be important for elicitation of Th1-type immunity and enhancement of vaccine efficacy. As our understanding about the mechanisms of action of various CpG-ODN improves, it should be possible to predict effects on immune responses in vivo based on the results of in vitro assays. At the present time, in vitro assays are 324
Gene Therapy and Molecular Biology Vol 8, page 325 intracellularly, is involved in the recognition of specific unmethylated CpG-ODN sequences. This signaling cascade leads to the activation of the transcription factor NF-kB that induces the secretion of pro-inflammatory cytokines and effector cytokines that direct the adaptive immune response. There may be physiologic or pathologic conditions where TLR-9 would be expressed in nonimmune cells, in which they would be expected to become CpG responsive. Carlow et al, (1998) has described CpG-induced stimulation of L cells, which are of stromal origin, to produce IFN-! upon transfection with plasmid DNA. Bacterial DNA or a CpG ODN has also been reported to induce human gingival fibroblasts to activate NF"B and secrete IL-6 (Takeshita et al, 1999). The only cells that are directly activated upon exposure to CpG DNA are the TLR-9 expressing cells like B cells and pDC (Bauer et al, 2001; Krug et al, 2001). Klinman et al, (1996) has also shown that a DNA motif consisting of an unmethylated CpG motif rapidly stimulates B cells in a polyclonal and antigen-nonspecific fashion, to produce IL6 and IL-12, CD4+ T cells to produce IL-6 and IFN-!, and NK cells to produce IFN-! in-vitro. CpG PTO (phosphorothioated) was most effective in inducing invitro proliferation of splenocytes. The IL-12 p40 levels peaked at 500nM concentration ODN with cytokine levels of 7500pg/ml after 36 hours of incubation. Similarly, the IL-6 levels peaked to 7000pg/ml at 1000nM concentration of ODN (Zimmermann et al, 2003). Zelenay et al, (2003) have also shown that 1826 ODN induced naïve splenocytes to secrete high levels of IL-6 and IL-12 and modest levels of IFN-! in-vitro. Splenomegaly phenomenon was transient and highly dose dependent. There was a significant increase in the spleen weights with the increasing dose of CpG motifs reaching maximum at 4 weeks post-immunization and thereafter regressing gradually over next 20 weeks. Massive splenomegaly was observed in the mice injected with 250-µg dose of 1826-ODN at 4 weeks time point with a 9.6 fold increase in the splenic weight as compared to that of mice injected with normal spleen. An antisense ODN against the rev gene of the human immunodeficiency virus (HIV) caused a profound degree of B cell proliferation and massive splenomegaly in-vivo in mice (Branda et al, 1993). Mice treated with high doses of immune stimulatory phosphorothioated CpG ODN developed massive splenomegaly and increased spleen granulocyte macrophage colony forming units (GMCFUs) and early erythroid progenitors (burst-forming units-erythroid) (Sparwasser et al, 1999). Treatment of rodents with phosphorothioate oligodeoxynucleotides induces a form of immune stimulation characterized by splenomegaly, lymphoid hyperplasia, hyper-!globulinemia and mixed mononuclear cellular infiltrates in numerous tissues. Splenomegaly and B-lymphocyte proliferation increased with the dose or concentration of oligodeoxynucleotides (Monteith et al, 1997). Splenomegaly appeared to occur, at least in part, as a result of stimulation of B-lymphocyte proliferation. Bhagat et al, (2003) have also reported splenomegaly in Balb/c mice to the extent of 153 mg after 48 hours of
subcutaneous injection of a single dose of 5mg/kg immunomers. In the spleen sections of mice at 6 weeks time point, there was increasing degree of extramedullary hemopoiesis and reactive follicular hyperplasia with prominent germinal centers, with the increasing doses of 1826-ODN. Thus, the transient splenomegaly observed in CpG motifs injected mice was dose dependent and associated with extramedullary hemopoiesis. CpG ODN has a profound effect on hematopoietic function. CpGODNs activate dendritic cells and macrophages to secrete large amounts of hemopoietically active cytokines, including IL-6, GM-CSF, IL-1, IL-12, and TNF-# (Ballas et al, 1996; Aggarwal and Seth, unpublished data). To date, it is unclear which of these cytokines, singly or synergistically, triggers the extramedullary hemopoiesis described here. It is also conceivable that CpG-ODNs target bone marrow stroma cells to release hemopoietically active cytokines. CpG-ODNs, which are operationally similar to LPS, may trigger extramedullary hemopoiesis via the induction of cytokines mobilizing BM progenitor cells to the spleen (Apte et al, 1976; Tokunaga et al, 1992). Even before the identification of the CpG motif, several investigators using antisense ODN noted the induction of sequence-specific extramedullary hematopoiesis and induction of hematopoietic colony formation (Hatzfeld et al, 1991; McIntyre et al, 1993). More recently, these effects were shown to be CpG specific. Histologically, an increased number of large immature blasts and erythroblasts were detected, reaching maximum at day 6, suggesting hemopoietic activity (Sparwasser et al, 1999). Our findings in this study demonstrate that phosphorothioate oligonucleotide 1826-ODN exerts stimulatory effects in mouse model. Recent data from our laboratory also suggest that CpG-ODNs potentiate the immune responses induced by HIV-1 Indian Subtype C vaccine constructs in mice (manuscript under preparation) perhaps by augmenting the hemopoiesis. Thus, it may be possible to use CpG-ODN as therapeutic agents in patients with early or limited HIV disease.
Acknowledgments This study was supported by the research grant from the Department of Biotechnology, Ministry of Science and technology, Govt. of India, under Prime minister's, Jai Vigyan Mission Program.
References Apte R N, Galanos C, Pluznik DH (1976) Lipid A, the active part of bacterial endotoxins in inducing serum colony-stimulating activity and proliferation of splenic granulocyte/macrophage progenitor cells. J Cell Physiol 87, 71-78. Ballas ZK, Rasmussen WL, Krieg AM (1996) Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J Immunol 157, 1840–1845. Bauer S, Kirschning CJ, Hacker H, Redecke V, Hausmann S, Akira S, Wagner H, Lipford GB (2001) Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc Natl Acad Sci USA 98,
325
Aggarwal et al: CpG oligonucleotide, induced hemopoietic changes in mice 9237–9242. Bhagat L, Zhu FG, Yu D, Tang J, Wang H, Ekambar R, Zhang KR, and Agrawal S (2003) CpG penta- and hexadeoxyribonucleotides as potent immunomodulatory agents. Biochem Biophys Res Commun 300, 853-861. Branda RF, Moore AL, Mathews L, Mc- Cormack JJ, Zon G (1993) Immune stimulation by an antisense oligomer complementary to the rev gene of HIV-1. Biochem Pharmacol 45, 2037–2043. Carlow DA, Teh SJ, Teh HS (1998) Specific antiviral activity demonstrated by TGTP, a member of a new family of interferon-induced GTPases. J Immunol 161, 2348–2355. Chu RS, Targoni OS, Krieg AM, Lehmann PV, Harding CV (1997) CpG oligodeoxynucleotides act as adjuvants that switch on T helper (Th1) immunity. J Exp Med 186, 16231631. Davis HL, Weeratna R, Waldschmidt TJ, Tygrett L, Schorr J, Krieg AM, Weeranta R (1998) CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen. J Immunol 160, 870-876. Erratum in: J Immunol (1999) 162, 3103. Weeranta R [corrected to Weeratna R]. Hatzfeld J, Li ML, Brown EL, Sookdeo H, Levesque JP, O’Toole T, Gurney C, Clark SC, Hatzfeld A (1991) Release of early human hematopoietic progenitors from quiescence by antisense transforming growth factor $1 or Rb oligonucleotides. J Exp Med 174, 925–929. Klinman D, Yi A K, Beaucage SL, Conover J and Krieg AM (1996) CpG motifs present in bacterial DNA rapidly induce lymphocytes to secrete Interleukin 6, interleukin 12, and interferon !. Proc Nat Acad Sci USA 93, 2879-2883. Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, Koretzky GA, Klinman DM (1995) CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374, 546–549. Krug A, Towarowski A, Britsch S, Rothenfusser S, Hornung V, Bals R, Giese T, Engelmann H, Endres S, Krieg AM, Hartmann G (2001) Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12. Eur J Immunol 31, 3026–3037. Lipford GB, Bauer M, Blank C, Reiter R, Wagner H, Heeg K (1997a) CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: a new class of vaccine adjuvants. Eur J Immunol 27, 2340-2344. Lipford GB, Sparwasser T, Bauer M, Zimmermann S, Koch ES, Heeg K, Wagner H (1997b) Immunostimulatory DNA: sequence-dependent production of potentially harmful or useful cytokines. Eur J Immunol 27, 3420-3426. McIntyre KW, Lombard-Gillooly K, Perez JR, Kunsch C, Sarmiento UM, Larigan JD, Landreth KT, Narayanan R (1993) A sense phosphorothioate oligonucleotide directed to the initiation codon of transcription factor NF-"B p65 causes sequence-specific immune stimulation. Antisense Res Dev 3, 309–322. McNeill TA (1970) Antigenic stimulation of bone marrow colony-forming cells. Immunology 18, 61-72. Medzhitov R, Preston-Hurlburt P, Janeway CA Jr. (1997) A human homologue of the Drosophila Toll protein signals
activation of adaptive immunity. Nature 388, 394-397. Monteith DK, Henry SP, Howard RB, Flournoy S, Levin AA, Bennett CF, Crooke ST (1997) Immune stimulation--a class effect of phosphorothioate oligodeoxynucleotides in rodents. Anticancer Drug Des 12, 421-432. Morrison SJ, Uchida N, Weissman IL (1995) The biology of hematopoietic stem cells. Annu Rev Cell Dev Biol 11, 3571. Sparwasser T, ltner LH, Koch ES, Luz A, Lipford GB, and Wagner H (1999) Immunostimulatory CpGOligodeoxynucleotides Cause Extramedullary Murine Hemopoiesis. J Immunol 162, 2368–2374. Staber FG, Metcalf D (1980) Cellular and molecular basis of the increased splenic hemopoiesis in mice treated with bacterial cell wall components. Proc Natl Acad Sci USA 77, 43224325. Takeshita A, Imai K, Hanazawa S (1999) CpG motifs in Porphyromonas gingivalis DNA stimulate interleukin-6 expression in human gingival fibroblasts. Infect Immun 67, 4340–4345. Tokunaga T, Yano O, Kuramoto E, Kimura Y, Yamamoto T, Kataoka T, Yamamoto S (1992) Synthetic oligonucleotides with particular base sequences from the cDNA-encoding proteins of Mycobacterium bovis BCG induce interferons and activate natural killer cells. Microbiol Immunol 36, 5566. Zelenay S, Elias F and Flo J (2003) Immunostimulatory effects of plasmid DNA and synthetic oligodeoxynucleotides. Eur J Immunol 33, 1382-1392. Zimmermann S, Egeter O, Hausmann S, Lipford GB, Röcken M, Wagner H, Heeg K (1998) CpG oligonucleotides trigger curative Th1 responses in lethal murine leishmaniasis. J Immunol 160, 3627-3630. Zimmermann S, Heeg K, and Dalpke A (2003) Immunostimulatory DNA as adjuvant: efficacy of phosphodiester CpG oligonucleotides is enhanced by 3’ sequence modifications. Vaccine 21, 990-995.
Dr. Pradeep Seth
326
Gene Therapy and Molecular Biology Vol 8, page 327 Gene Ther Mol Biol Vol 8, 327-334, 2004
Development of HIV-1 subtype C Gag based DNA vaccine construct Research Article
Priti Chugh1 and Pradeep Seth* Department of Microbiology, All India Institute of Medical Sciences, New Delhi-110029
__________________________________________________________________________________ *Correspondence: Pradeep Seth MD FAMS FNASc, Professor and Head, Dept of Microbiology, All India Institute of Medical Sciences, New Delhi-110029; Phone: 91-11-26588714; Fax: 91-11-26588641; Email pseth@aiims.aiims.ac.in, sethpradeep@hotmail.com 1. Current address: Priti Chugh, MSc. Ph.D, University of Texas Southwestern Medical Center, Hamon Center for Therapeutic Oncology Research, 6000 Harry Hines Blvd. NB8.206, Dallas TX 75390-8593 Key words: gag, DNA vaccine, CMV promoter, Virus like particles (VLPs) Abbreviations: cytomegalovirus, (CMV); immediate early, (IE); kilodalton, (kD); phosphate buffered saline, (PBS); room temperature, (RT); virus like particles, (VLPs) Received: 26 April 2004; Accepted: 2 June 2004; electronically published: July 2004
Summary Recently, the success of genetic immunization as a novel means to induce protective immunity has been demonstrated. DNA vaccines mimic antigen presentation closely to the natural history of viral infection. This is particularly relevant in infectious diseases where-in cell mediated immunity plays a larger role in protection, such as HIV-1 infection. In this paper we present the work done towards development of a gag based DNA immunogen for local circulating HIV-1 subtype C viruses in India. Gag gene was cloned under the control of CMV promoter in a mammalian expression plasmid vector. The other main features of the expression cassette in the construct pJWgagprotease49587 are bovine growth hormone polyadenylation signal and a t-PA leader signal. The construct was confirmed for expression in vitro by various means, p24 antigen capture assay, immunoblotting and electron microscopy. The TEM studies on transiently transfected COS-7 cells showed the presence of virus like particles (VLPs) as a consequence of gene expression from the construct pJWgagprotease49587. This finding is the first report of VLPs for a subtype C based gag construct. We expect that this construct will be able to prime a good immune response when used in in-vivo mice studies owing to the formation of virus like particles from the construct in vitro.
The need for developing a potent immunogen from the local circulating types is becoming more and more apparent with the evidence of differences in the rates of transmission and severity of disease among different clades. The current rapid spread of subtype C viruses has raised questions about the role of subtypes on disease progression and transmission. The presence of three NFkB binding sites in subtype C viruses suggests that they might have a replication advantage. In India, infection rate at 0.8% of the total adult population is still low, but due to large population it transforms into large numbers. The use of existing therapies in the developing world is limited owing to their high cost (Dayton et al, 2000). Nucleic acid vaccination offers a simple and effective means of immunization. DNA plasmids encoding foreign proteins have been successfully administered either by direct intramuscular injection or with various adjuvants and excipients, and by biolistic immunization.
I. Introduction Of the various infectious diseases that are responsible for morbidity and mortality, AIDS is deemed to be the fourth-biggest killer. HIV/AIDS is not a homogenous pandemic. Human immunodeficiency virus HIV-1, the causative organism has remained particularly elusive owing to the sheer diversity of viral evolution. The varied subtypes and more varied distribution have had profound impacts on the strategies being devised to control the spread of HIV infection. Most of the world's HIV infection is located in the developing world. Of these, most infections occur within the non-B HIV subtypes. Subtype C accounts for more than 50% of overall infections worldwide (Tatt et al, 2001). It is needed to direct resources towards the research of virus evolution, pathogenesis, treatment and preventive/therapeutic vaccines of different HIV-1 clades. 327
Chugh and Seth: Gag gene construct in mammalian expression vector DNA vaccines have several distinct advantages, presentation of target protein by MHC-I and MHC-II pathways, synthesis of immunogen in their native with appropriate post-translational modifications, ease in manufacturing process and greater shelf life of DNA as compared to proteins. This approach is particularly relevant to tumor antigens and viral immunogens. Gag gene is one of the most conserved regions of HIV-1 genome and hence it is a good target for cross clade immune responses. It encodes for group antigen core protein. 1.5 Kb gene gives rise to a 55-kilodalton (kD) Gag precursor protein, also called pr55, which is expressed from the unspliced viral mRNA and later processed into the respective p24, p17, p6 proteins by the viral encoded protease. In studies with HIV infected individuals, HEPS and LTNPs, helper and cytotoxic responses to gag epitopes have been defined (Gotch et al, 1990; Jhonson et al, 1991; Kalams et al, 1999). Plasmids used as DNA vaccines, in general contain a strong eukaryotic promoter, such as cytomegalovirus (CMV) immediate early (IE) (Chapman et al, 1991) and polyadenylation signal from bovine growth hormone, which increases expression. Immune response elicited by DNA vaccination depends on route of immunization, it is largely Th1 type, and this is particularly beneficial since Th1 type of immune response has been implicated in control of HIV infection. In this study we present the construction of a gag based plasmid immunogen in a mammalian expression vector and verification of its expression.
C. In vitro expression studies COS-7 cells were transfected using lipofectin reagent (Life technologies) according to the manufacturer’s instructions. Briefly, 5µg plasmid DNA was constituted with lipofectin reagent at a concentration of 10µg/ml in DMEM (without FCS and antibiotics) and overlaid on 40-50% confluent COS-7 cells. The cells were incubated with the transfection mix for 6-8 hrs at 37°C, 5% CO2 and then fresh medium was supplemented (DMEM 10% FCS, 2mM glutamine and antibiotics). The cells and supernatants were harvested at different time points 24, 36, 48, 72 and 96 hrs and stored at -20°C for further evaluation. COS-7 cells transfected with vector pJW4304 alone and the plasmid containing envelope gp120 gene, pJWSK3, (Arora et al, 2001) comprised the controls in the study.
D. p24 antigen capture ELISA The supernatants were checked for presence of p24 antigen by p24 antigen capture ELISA (Innogenetics Belgium) performed as per the manufacturer’s instructions. Briefly, 100µl of sample and the standard (provided in the kit) were aliqoted into the wells coated with anti p24 monoclonal antibody and incubated at 37°C in a humidified chamber for an hour. The wells were then washed thoroughly five times and tapped to remove traces of wash buffer. Thereafter 100µl of HRP conjugated anti p24 monoclonal antibody was added to the wells and the plate was incubated for an hour at 37°C followed by 5X washing again. In the next step 100µl of substrate solution was added to the wells and incubated in dark at room temperature for 30 minutes. 50µl of stop solution was added to the wells after the incubation and absorbance was recorded at 450nm. Standard curve was plotted for the absorbance recorded for standard provided in the kit and concentration of the samples was determined from the curve. The negative controls included untransfected cells and cells transfected with vector alone (pJW4304) and mock positive (pJWSK3) control.
II. Materials and methods A. Plasmid, cells and reagents The vector used in the study, pJW4304, was a kind gift from Dr J. I. Mullins, University of Washington, Seattle, USA. COS-7 cells for in vitro expression studies were obtained from NCCS, Pune, India.
E. Western blot analysis The transfected cell lysates were run on a denaturing SDS PAGE and transferred onto nitrocellulose membrane by semidry transfer method. The blot was blocked with 2.5% non-fat dry milk in Tris buffered saline pH 7.4 for two hours at room temperature (RT) and was washed thrice in TTBS (Tween-Tris buffered saline). Immunoblotting was carried out by incubating with HIV-1 positive human serum (at a dilution of 1:50) at RT for 1hr. After washing thrice the blot was returned for incubation with alkaline phosphatase conjugated goat anti-human IgG antibody for an hour at RT. Thereafter, it was washed thrice and the substrate (BCIP-NBT solution) was added. The reaction was then stopped by washing in double distilled water.
B. Cloning of gag gene into pJW4304 The integrated HIV-1 proviral DNA from PBMCs of HIV infected asymptomatic individual (Disease stage: A1, CD4 counts: 534/ µl) was taken as a template for PCR and a 4.35 kb gag-pol (nt139 – nt4495) product was obtained by a set of nested PCRs using forward primers, MSF12: 5’AAATCTCTAGCAGTGGCGCCCGAACAG3’ [1-27], GagFP01: 5’TTTGACTAGCGGAGGCTAGCAGGAGAGAG ATGGGT3’ [139-173] and reverse primers PolRP06: 5’AAAACCATCCATTAGCTCTCCTTGAAACAT3’ [44714500], PolRP01: 5’CATCCATTAGCTCTCCTTGAAACATAC ATA 3’ [4466-4495]. The amplification profile was as follows: denaturation [at 92°C for 15sec], annealing (at 52°C for 30 sec] and extension [at 68°C for 4min] for 25 cycles followed by final extension for 7 minutes at 68°C. The amplification product was cloned into TA cloning pGEMT easy vector (Promega, USA) as per the manufacturer’s instructions (Figure 1A). The construct was verified in pGEMTeasy by PCR and restriction digestions. The construct was double digested with Nhe1 and BamH1 enzymes resulting in the release of a 2.3kb Gag-protease fragment. This fragment was cloned into mammalian expression vector, pJW4304, by directional cohesive ends ligation (Figure 2A). The presence of insert in the plasmid pJWgagprotease49587 was confirmed by PCR for gag and protease genes, restriction digestions and DNA sequencing.
G. Electron microscopy of transfected COS-7 cells Transmission electron microscopy was performed with transfected cells as described earlier (Gheysen et al, 1989) with minor modifications. Briefly, transfected cells were scraped off, washed in phosphate buffered saline (PBS pH 7.4) and then fixed in 1% glutaraldehyde solution for two hours on ice. Thereafter, the cells were washed with PBS thrice and postfixed with 1 % osmium tetroxide in PBS for two hours. After washing with PBS and then with distilled water, the fixed cells were stained with 1% uranyl acetate in 20% acetone for 30 min. The cells were dehydrated by treatment with acetone and cleared with toluene. Thereafter, infiltration was done with toluene araldite mixture first at room temperature and then at 50oC temperature. The
328
Gene Therapy and Molecular Biology Vol 8, page 329 sample was embedded in epoxy resin, sectioned and viewed under TEM (transmission electron microscope).
pGEM-Teasy by PCR based TA cloning (Figure 1A). A 4.3 Kb PCR product was generated by a nested set of primers MSF12 and Pol RP06 and GagFP01 and PolRPO01 (Figure 1B). This product was ligated to pGEM-Teasy vector and the recombinant was screened on the basis of blue white colony selection. The 4.3Kb gagpol insert was confirmed by EcoR1 digestion of the plasmid that releases the complete gene fragment (Figure 1C). PCR products from different regions of the construct, 1.5-Kb gag and 3-Kb pol confirmed the presence of insert, gag-pol, in the clone pGEMTgag-pol. (Figure 1D).
*Footnote: The HIV-1 subytpe C strain 49587 used in this study is from a hemophilic patient who got infected through blood tranfusion in 1989 in India. (patient id# 49587). The PBMC sample was collected in the year 1997 from the northern part of India. The Genbank accession number isAF533140.
III. Results A. Construction of pJWgagprotease49587 In order to clone gag-protease genes of HIV 1 subtype C, a complete gag-pol clone was generated in
Figure 1A Cloning strategy for TA cloning of gagpol gene fragment. A 4.3Kb fragment generated by nested PCR was cloned into pGEM-Teasy vector resulting in a recombinant molecule pGEM-Teasy gag-pol (7.3Kb). B Agarose gel picture showing, 4.3 Kb gag-pol PCR product generated by nested set of PCR with ! Hind III Eco R1 DNA molecular weight marker in the adjacent lane. C Agarose gel picture showing the release of 4.3 Kb gag-pol fragment from pGEMT-easy gag-pol upon EcoR1 digestion. D Complete gag (1.5 Kb) and pol (3.1 Kb) PCR amplification products from the pGEMTeasy gag-pol.
329
Chugh and Seth: Gag gene construct in mammalian expression vector
Figure 2A Strategy for cloning gag-protease fragment into eukaryotic expression vector pJW4304. A double digestion of pGEMT-easy gag-pol with restriction endonucleases Nhe1 and BamH1 releases a 2.3 Kb fragment containing the gag and protease genes. This fragment was then ligated into pJW4304 by cohesive ends ligation. B Agarose gel picture showing 7.4 kb linearised plasmid pJWgagprotease-49587 along with ! Hind III molecular weight marker. C Agarose gel picture showing PCR amplification products for sub-genomic fragments of gag & complete protease genes. The amplification products for gag are 492 bp and 711bp respectively in lanes 1 and 3. The protease gene fragment represented by 290bp PCR product is depicted in lane2.
From this clone the fragment containing gagprotease gene was extracted by double digestion with Nhe1 and BamH1, and ligated into the expression vector pJW4304 (Figure 2A). The recombinant clone obtained was confirmed for the presence of required gene fragment by various digestions and PCR amplification products for gag and protease genes (Figures 2B, C). The right orientation of the insert in the clone was confirmed by
Pst1 digestion, which released a 750 bp product as it should in case of correct orientation of the cloned gene. Further confirmation of the cloned gag-protease gene that it belonged to HIV-1 subtype C gag and protease regions, was obtained with sequencing using primer walking strategy. (GenBank Accession no: AF533140) (data not shown).
330
Gene Therapy and Molecular Biology Vol 8, page 331
B. p24 Antigen Capture ELISA C. Immunoblotting
The amount of protein secreted in the medium by the transfected COS-7 cells was assessed by p24 antigen capture ELISA. p24 antigen was detectable at 24-hrs posttransfection and showed a gradual increase in levels until 48 hrs and thereafter a decline was observed. Such an observation is typical of protein expression in transiently transfected cells. The negative controls included in the study were untransfected cells and cells transfected with vector pJW4304 (without any insert) and mock positive control pJWSK3 (envelope plasmid). None of the control supernates showed any reactivity in the assay. Up to 110pg/ml protein was detected in the supernates (Figure 3A).
The transfection cell lysates were run on SDS PAGE and transferred onto nitro cellulose membrane for immunoblotting using HIV positive sera as a source of polyclonal antibodies to HIV proteins. The 24-kilodalton band representing gag p24 was detected in the 24 and 48 hrs cell lysates indicating that the 55kilodalton-Gag precursor was being cloven into respective products. The negative controls and mock positive cell lysates did not show any such band (Figure 3B).
Figure 3A p24 estimation in transfection supernatants during a time course experiment by p24 antigen capture ELISA plotted for the various dilutions of reference standard p24, provided in the kit (Innogenetics Belgium). Maximum amount of p24 was detected at 48 hrs post-transfection, thereafter the amount of p24 in the medium declined. B Immunoblotting was done with pJWgagprotease-49587 (denoted as gag in the figure) and pJW4304 (denoted as Mock in the figure) transfected cell lysates. SDS PAGE was run and proteins were transferred onto nitrocellulose membrane by semi dry transfer method. The blot was probed with HIV positive human sera (ID no: 757) as a source of polyclonal antibodies to various HIV proteins. In the figure, immunoblot shows 24Kd band representing Gag protein (p24) in the 24 hrs and 48hrs transfected cell lysates. The untransfected cell lysates did not show the presence of any HIV-1 specific band.
331
Chugh and Seth: Gag gene construct in mammalian expression vector
Figure 4A, B. Transmission electron micrographs of COS-7 cells transfected with pJWgagprotease-49587. TEM was done with cells harvested at 24 and 48 hr post-transfection. Budding protrusions from the cell membrane are seen representing VLPs. Average particle size was determined to be in the range of 140 to 160 nm. (magnification (a) 23,000 X and (b) 18,000X) C Transmission electron micrograph of pJW4304 transfected COS7 cells as control. No virus like particles are visible either on the surface or outside the cell membrane. (magnification 14,000 X)
immunogen. Cross clade CTL responses have been demonstrated within the gag region in studies with infected individuals (McAdams et al, 1998). The importance of gag-based responses is also derived from the studies showing the co-relation of Th responses to gag p24 in patients with non-progressive state of HIV-1 infection (Rosenberg et al, 1997). It has also been shown that an early HAART rescues helper responses to gag p24, which enables the immune system to keep the virus under control. The distribution of CTL and Th epitopes in HIV-1 gag reveals presence of 81 CTL and 27 Th epitopes in gag p24, 35 CTL and 5 Th epitopes in p17 and 2 CTL and 6 Th respectively in the nucleocapsid (p15) regions. These data from the HIV molecular immunology database clearly show the relevance of targeting gag gene of HIV-1(Los Alamos Immunology Database). In challenge studies with chimeric virus SHIV 83.6 in primates, SIV gag constructs have been used to immunize the animals. The tetramer binding assays showed that the presence of large frequency of precursor CTL against HIV-1 gag gene was coincident with the clearance of challenge virus. These studies underline the importance of targeting gag gene in a vaccine construct Considering all these factors we set out to design an effective immunogen based on Indian clade C HIV-1 viruses. Our objective was to develop a DNA vaccine construct from local circulating subtype C virus strain, which is the most predominant subtype prevalent in the Indian population. In our strategy for construction of gagprotease plasmid we have cloned the gene fragment in conjunction with the t-PA leader signal sequence present in the vector pJW4304. The use of t-PA leader sequence is
D. Electron microscopy of transfected cells In transmission electron micrographs numerous virus like particles (VLPs) were seen budding out of the cell membrane and lying outside the membrane in the intercellular spaces. The morphology of these particles corresponded to that of a pr55 VLP. These VLPs were observed in pJWGagprotease-49587 transfected COS-7 cells at 24 and 48 hr post transfection. The average size of the particle was determined to be 140 nm-160 nm (Fig 4. a & b). Such particles were not seen in normal untransfected cells and cells transfected with vector alone (pJW4304) and untransfected cells (Figure 4C).
IV. Discussion Both structural (env, gag, pol) and nonstructural genes (rev, nef) have been targeted as candidate immunogens for elicitation of effective immune response to HIV-1. The surface envelope glycoprotein gp 120 has been extensively studied as a potential target for HIV-1 vaccine development. The variable nature of envelope, particularly V3 loop, has proven to be a major hurdle in elicitation of cross-clade responses. The importance of targeting envelope gp120 remains, as it is the first HIV-1 protein that is encountered by the immune system in the natural history of pathogenesis. In our laboratory we have developed an envelope based DNA vaccine construct and tested in mice model for immunogenecity (Arora et al, 2001). However in view of the importance of cross-clade broad immune response we sought to develop a gag based 332
Gene Therapy and Molecular Biology Vol 8, page 333 known to have positive effects on expression of Envelope and Gag proteins as demonstrated in other studies. Use of t-PA leader signal has shown better immune responses as compared to cytoplasmic targeting of gag gene (Qui et al, 2000). The viral protease gene was cloned along with gag gene in order to provide the native protease for proper processing of gag gene products from the precursor pr55 protein into p17, p24, p6, p7, and p2. This gene encodes for an aspartyl protease enzyme that recognizes and cleaves the gag precursor pr55 into respective gene products, p17, p24, p15, p6 and p2. Protease gene is expressed as -1 frameshift from the gag open reading frame in the HIV-1 genome. This frameshift occurs once in twenty times during translation of gag-pol open reading frame. In our cloning strategy the frameshift site was preserved hence allowing the synthesis of both the proteins as in their native infection process of mammalian cells. Another obstacle in over-expression of protease is that it leads to complete processing of gag particles which abolishes VLP formation in cells, hence we considered it beneficial to keep the original frame shift site in the gag protease construct pJWgagprotease-49587. In in-vitro expression studies, we detected upto 110pg/ml of secreted antigen in transfected COS-7 cell supernatants (Figure 3A). In addition, a 24-kilodalton band representing p24 gag (Figure 3B) was observed on immunoblotting. This shows that the viral protease expressed from the construct has been successful in processing the pr55 precursor gag protein into respective products. We also observed formation of virus likeparticles (VLPs) at 24 and 48 hrs post transfection in COS 7 cells (Figures 4A, B). These VLPs were in the size range of 120-160 nm. This is the first report of production of virus like-particles from an HIV-1 subtype C based construct. The production of VLPs from the vaccine construct adds the advantage of particulate antigen to priming with DNA based immunogen. The earlier studies with gag gene examined the particle formation in various expression systems and evaluated the probable use as particulate antigen. Antigens in particulate conformation have been shown to be highly immunogenic in mammals. Expression of gag gene alone has shown that self-assembly of p55 molecules triggers the formation of pseudovirions or VLPs (Nermut et al, 1998). Virus like particles have been described in studies with baculovirus, vaccinia, yeast and mammalian expression systems (Gheysen et al, 1989; Haffar et al, 1990; Wagner et al, 1992). A study by Wagner and coworkers examined particle formation by gag constructs in various expression systems (Wagner et al, 1992). Budding of 100-160 nm pr55 core particles resembling immature virions was observed in eukaryotic systems. They proposed that empty immature gag particles would represent a safe noninfectious and attractive immunogen. Thereafter several studies have been published demonstrating the immunogenicity of the virus like particles. Long-lived cellular immune responses have been elicited upon administration of VLP formulations in murine and monkey models (Paliard et al, 2000; Rovinski et al, 1995; Wagner et al, 1998). The hybrid HIV-1 p17/p24:Ty-VLP vaccine
module that has gone into phase I trials has demonstrated the ability of inducing both cellular and humoral immune responses to p17 and p24 proteins. VLPs have also been designed for inclusion of principal neutralizing domain of gp120 and other regions of envelope proteins for successful elicitation of both neutralizing humoral immune response and cytotoxic T cell response (Brand et al, 1995; Buonangaro et al, 2002). In a recent study immunogenicity of virus like particles consisting of gag, protease and envelope from clade B HIV-1 in rhesus macaques was assessed. In this study three different forms of antigens were delivered, purified VLPs, recombinant DNA and canarypox vectors engineered to express VLPs. It was found that nucleic acid vaccination capable of producing VLPs was more efficient in priming cell-mediated immune responses (Montefiori et al, 2001). It is understood that in order to induce CD8+ T cell memory, the antigen needs to be presented via the MHC class I pathway. It has also been demonstrated that cross presentation of HIV-1 virus like particles by dendritic cells can lead to efficient priming of CTL responses (Bachman et al, 1996). These studies have implicated that recruiting dendritic cells for antigen presentation of exogenous virus like particles in a DNA vaccine module is an added advantage. In view of the above discussion, it can be expected that the production of virus like-particles from our DNA vaccine construct, pJWgagprotease-49587, would have a combined effect of DNA vaccine and particulate antigen in one module.
Acknowledgments This work has been supported through a generous financial grant from the Department of Biotechnology, Ministry of Science and Technology, Government of India under the Prime ministerâ&#x20AC;&#x2122;s Jai Vigyan Mission Programme. Our special thanks are also due to the University Grants commission for providing fellowship support to Ms. Priti Chugh. Our thanks are also due to the Electron Microscopy Department at AIIMS New Delhi for their help in processing the samples.
References Arora A, Fahey JL, Seth P. (2001) DNA vaccine for the induction of immune responses against HIV-1 subtype C envelope gene in mice. Gene Ther Mol Biol. 6, 79-89 Bachmann MF, Lutz MB, Layton GT, Harris SJ, Fehr T, Rescigno M, Ricciardi-Castagnoli P. (1996) Dendritic cells process exogenous viral proteins and virus-like particles for class I presentation to CD8+ cytotoxic T lymphocytes. Eur J Immunol. 26, 2595-600 Barouch DH, Santra S, Kuroda MJ, Schmitz JE, Plishka R, BucklerWhite A, Gaitan AE, Zin R, NamJH, Wyatt LS, Lifton MA, Nickerson CE, Moss B, Montefiori DC, Hirsch VM, Letvin NL.(2001) Reduction of simian-human immunodeficiencyvirus 89.6P viremia in rhesus monkeys by recombinant modified vaccinia virus Ankara vaccination. J. Virol. 75, 5151â&#x20AC;&#x201C; 58 Brand D, Mallet F, Truong C, Roingeard P, Goudeau A, Barin F. (1995) A simple procedure to generate chimeric Pr55gag virus-like particles expressing the principal neutralization
333
Chugh and Seth: Gag gene construct in mammalian expression vector domain of human immunodeficiency virus type 1. J Virol. Methods. 51, 153-68 Buonaguro L, Racioppi L, Tornesello ML, Arra C, Visciano ML, Biryahwaho B, Sempala SD, Giraldo G, Buonaguro FM. (2002) Induction of neutralizing antibodies and cytotoxic T lymphocytes in Balb/c mice immunized with virus-like particles presenting a gp120 molecule from a HIV-1 isolate of clade A. Antiviral Res. 54, 189-201 Chapman BS, Thayer RM, Vincent KA, Haigwood NL. (1991) Effect of intron A from human cytomegalovirus (Towne) immediate-early gene on heterologous expression in mammalian cells. Nucleic Acids Res. 19, 3979-86 Dayton JM, Merson MH. (2000) Global dimensions of the AIDS epidemic, implications for prevention and care. Infect Dis Clin North Am. 14, 791-808. Deml L, Bojak A, Steck S, Graf M, Wild J, Schirmbeck R, Wolf H, Wagner R. (2001) Multiple effects of codon usage optimization on expression and immunogenicity of DNA candidate vaccines encoding the human immunodeficiency virus type 1 Gag protein. J Virol. 75, 10991-1001 Gheysen D, Jacobs E, de Foresta F, Thiriart C, Francotte M, Thines D, De Wilde M. (1989) Assembly and release of HIV-1 precursor Pr55gag virus-like particles from recombinant baculovirus-infected insect cells. Cell. 59, 10312 Gotch FM, Nixon DF, Alp N, McMichael AJ, Borysiewicz LK. (1990) High frequency of memory and effector gag specific cytotoxic T lymphocytes in HIV seropositive individuals. Int Immunol. 2, 707-12 Haffar O, Garrigues J, Travis B, et al. (1990) Human immunodeficiency virus-like, nonreplicating, gag-env particles assemble in a recombinant vaccinia virus expression system. J Virol. 64, 2653-9. Huang Y, Kong WP, Nabel GJ. (2001) Human immunodeficiency virus type 1-specific immunity after genetic immunization is enhanced by modification of Gag and Pol expression. J Virol. , 75, 4947-51 Johnson RP, Trocha A, Yang L, Mazzara GP, Panicali DL, Buchanan TM, Walker BD. (1991) HIV-1 gag-specific cytotoxic T lymphocytes recognize multiple highly conserved epitopes. Fine specificity of the gag-specific response defined by using unstimulated peripheral blood mononuclear cells and cloned effector cells. J Immunol. 147, 3560-7 Kalams SA, Buchbinder SP, Rosenberg ES, Billingsley JM, Colbert DS, Jones NG, Shea AK, Trocha AK, Walker BD. (1999) Association between virus-specific cytotoxic Tlymphocyte and helper responses in human immunodeficiency virus type 1 infection. Leukemia. 13 Suppl 1, S42-7 Los Alamos HIV Molecular Immunology Database. (2002) http://hiv-web.lanl.gov/content/immunology/ McAdam S, Kaleebu P, Krausa P, Goulder P, French N, Collin B, Blanchard T, Whitworth J, McMichael A, Gotch F. (1998)
Cross-clade recognition of p55 by cytotoxic T lymphocytes in HIV-1 infection. Proc Natl Acad Sci USA. 95, 10112-6 Montefiori DC, Safrit JT, Lydy SL, Barry AP, Bilska M, Vo HT, Klein M, Tartaglia J, Robinson HL, Rovinski B. (2001) Induction of neutralizing antibodies and gag-specific cellular immune responses to an R5 primary isolate of human immunodeficiency virus type 1 in rhesus macaques. J Virol 75, 5879-90 Nermut MV, Hockley DJ, Bron P, Thomas D, Zhang WH, Jones IM. (1998) Further evidence for hexagonal organization of HIV gag protein in prebudding assemblies and immature virus-like particles. J Struct Biol. 123, 143-9 Paliard X, Liu Y, Wagner R, Wolf H, Baenziger J, Walker CM. (2000) Priming of strong, broad, and long-lived HIV type 1 p55gag-specific CD8+ cytotoxic T cells after administration of a virus-like particle vaccine in rhesus macaques. AIDS Res. Hum Retroviruses 16, 273-82 Qiu JT, Liu B, Tian C, Pavlakis GN, Yu XF. (2000) Enhancement of primary and secondary cellular immune responses against human immunodeficiency virus type 1 gag by using DNA expression vectors that target Gag antigen to the secretory pathway. J Virol. 74, 5997-6005. Rosenberg ES, Billingsley JM, Caliendo AM, Boswell SL, Sax PE, Kalams SA, Walker BD. (1997) Vigorous HIV1–specific CD4 T cell responses associated with control of viremia. Science. 278, 1447–50 Rovinski B, Rodrigues L, Cao SX, Yao FL, McGuinness U, Sia C, Cates G, ZollaPazner S, Karwowska S, Matthews TJ. (1995) Induction of HIV type 1 neutralizing and env-CD4 blocking antibodies by immunization with genetically engineered HIV type 1-like particles containing unprocessed gp160 glycoproteins. AIDS Res Hum Retroviruses. 11, 1187-95. Seth A, Ourmanov I, Schmitz JE, Kuroda MJ, Lifton MA, Nickerson CE, Wyatt L, Carroll M, Moss B, Venzon D, Letvin NL, Hirsch VM. (2000) Immunization with a modified vaccinia virus expressing simian immunodeficiency virus (SIV) Gag-Pol primes for an anamnestic Gag-specific cy-totoxic T-lymphocyte response and is asso-ciated with reduction of viremia after SIV challenge. J. Virol. 74, 2502–7 Tatt ID, Barlow KL, Nicoll A, Clewley JP. (2001) The public health significance of HIV-1 subtypes. AIDS. 15 Suppl 5, S59-71 Wagner R, Fliessbach H, Wanner G, Motz M, Niedrig M, Deby G, von Brunn A, Wolf H. (1992) Studies on processing, particle formation, and immunogenicity of the HIV-1 gag gene product, a possible component of a HIV vaccine. Arch Virol. 127(1-4) 117-37 Wagner R, Teeuwsen VJ, Deml L. (1998) Cytotoxic T cells and neutralizing antibodies induced in rhesus monkeys by viruslike particle HIV vaccines in the absence of protection from SHIV infection. Virology. 245, 65-74
334
Gene Therapy and Molecular Biology Vol 8, page 335 Gene Ther Mol Biol Vol 8, 335-342, 2004
Targeting retroviral vector entry by host range extension Review Article
Katja Sliva and Barbara S.Schnierle* Institute for Biomedical Research, Georg-Speyer Haus, Paul-Ehrlich-Str. 42-44, 60596 Frankfurt/Main, Germany
__________________________________________________________________________________ *Correspondence: Barbara S.Schnierle, Institute for Biomedical Research, Georg-Speyer Haus, Paul-Ehrlich-Str. 42-44, 60596 Frankfurt/Main, Germany; Tel. +49-69-63395-218; Fax. +49-69-63395-297; E-mail: schnierle@em.uni-frankfurt.de Key words: murine leukemia virus, targeting, vector, envelope, virus entry, host range Abbreviations: endoplasmatic reticulum, (ER); envelope glycoproteins, (Env); epidermal growth factor, (EGF); feline leukemia virus, (FeLV); fusion peptide, (FP); gastrin-releasing protein, (GRP); green fluorescent protein, (GFP); haemagglutinin, (HA); murine leukemia virus, (MLV); proline-rich region, (PRR); receptor-binding domain, (RBD); receptor-binding domain, (RBD); signal peptide, (SP); soluble receptor-binding domains, (sRBD); translocation domain, (TLD) Received: 12 July 2004; Accepted: 27 July 2004; electronically published: July 2004
Summary The dream of vectorologists is a vector with magic bullet properties. This conceptual breakthrough in gene therapy would be a gene transfer vector that could be systemically applied, allowing targeted gene transfer into a predetermined cell type. The host range of a retroviral vector is determined by the interaction between the viral envelope glycoprotein and the retrovirus receptor on the surface of the host cell. Here are summarized current efforts to engineer the envelope glycoprotein of ecotropic murine leukemia virus, which does not infect human cells, in order to extend its host range and accomplish gene delivery in a highly specific manner.
vector. Vector particles are produced by packaging cell lines that provided the viral proteins in trans. These cell lines release vector genomes packaged into infectious particles that are free from contaminating helper virus and replication-competent recombinant virus. Retroviruses and vectors derived thereof acquire cellderived lipid bilayer in which the envelope glycoproteins (Env) are inserted, by budding from the host cell membrane. The Env protein mediates attachment and fusion between the host cell membrane and the viral membrane, which results in the release of the viral capsid particle containing the genetic material into the cytoplasm. Viral entry is initiated by the binding of the envelope protein to an appropriate cellular receptor at the host cell surface. After binding, the Env protein undergoes conformational changes allowing induction of membrane fusion. This is triggered either at the cell surface by the interaction with the receptor (pH-independent entry), or by exposure to low pH following receptor-mediated endocytosis (pH-dependent entry). Induction of fusion under low pH conditions is believed to occur in the absence of receptor binding, suggesting that the binding of pH-dependent envelope proteins serves only as a means of targeting the virus to endosomes.
I. Introduction Targeting retroviral entry is a central theme in the development of vectors for gene therapy. The selective delivery of a therapeutic gene would immensely reduce unfavorable side effects and ease the clinical application of gene therapy. Here one aspect of generating targeted retroviral vectors will be discussed: the extension of the host range of a non human pathogenic virus. Other approaches are summarized in other current reviews (Haynes et al, 2003; Sandrin et al, 2003; Verhoeyen and Cosset, 2004). The ability of viruses to introduce foreign DNA sequences into target cells is being exploited for treating genetic diseases, including cancer (Cavazzana-Calvo et al, 2000; Aiuti et al, 2002). Retroviral vectors are the best understood and the most widely used vectors for gene therapy. They integrate their genomes stably into host cell DNA allowing long-term expression of inserted therapeutic genes. Retroviral entry and genome integration do not require viral protein synthesis, and, therefore, all viral genes in the vector genome can be replaced with foreign sequences. There is no production of viral proteins after transduction, which could lead to immune responses against the vector particle, and no subsequent spread of the
335
Sliva and Schnierle: Host range extension surface SU, and transmembrane TM, subunits. SU and TM are linked in the case of MLV Env by labile disulfide bonds. The cleavage is necessary for Env to gain the active, fusion competent conformation, required for viral entry. From the Golgi apparatus the mature Env is transported to the plasma membrane where it is incorporated into the budding viral particles. Recently, it has been indicated that recruitment of Env by MLV core proteins also occurs in intracellular compartments (Sandrin et al, 2004). The MLV Env is further processed in the viral particle by another cleavage event. A short portion of the cytoplasmic tail (R) of TM is removed by the viral protease. This cleavage is required to activate the fusion potential of Env (Coffin et al, 1997).
II. The murine leukemia virus (MLV) envelope glycoprotein The host range of a retroviral vector is dependent upon its Env, which binds to a specific cell surface receptor protein. The MLV Env protein, like all retroviral Envs, is a type I membrane protein and is synthesized as a precursor protein, which is directed into the lumen of the endoplasmatic reticulum (ER) by its N-terminal signal peptide (SP) (Figure 1A). In the ER, the signal peptide is cleaved off, the protein is N-linked glycosylated and correctly folded proteins assemble into trimers. After transport to the Golgi apparatus, further glycosylation and trimming of the carbohydrates take place and the precursor protein is cleaved by furin or related proteases into the
Figure 1. A. Schematic structure of the Moloney-MLV envelope glycoprotein.SU: Env surface domain; TM: Env transmembrane domain; SP: Signal peptide; VRA: variable region A; VRB: variable region B; RBD: receptor-binding region; PRR: proline-rich region; FP: fusion peptide; HR: helical region; MS: membrane spanning region; R: R peptide. Arrows indicate protease cleavage sites. B. Schematic three dimensional structure of Moloney-MLV envelope glycoprotein.
336
Gene Therapy and Molecular Biology Vol 8, page 337 The receptor-binding domain (RBD) is located in the SU subunit of Env (Figure 1A, B). Two hypervarible regions (VRA and VRB) are believed to be the main determinants of the receptor-binding specificity. The structure of the receptor-binding region has been determined (Fass et al, 1997) and the VRA and VRB regions form parallel !-helices that shape the receptorbinding site. The receptor-binding site is followed by the proline-rich region (PRR), which is thought to have a hinge function. The PRR has a role in stabilizing the overall structure of the protein, affects the SU-TM interactions and functions as a signal which induces the envelope conformational changes leading to fusion (Weimin Wu et al, 1998; Lavillette et al, 1998). The PRR contains a highly conserved N-terminal sequence and a hypervariable C-terminal sequence. The hypervariable region of the PRR has been described to be not absolutely required for envelope protein function (Weimin Wu et al, 1998). The C-terminal domain of SU is believed to mediate the SU-TM interaction (Schulz et al, 1992) (Figure 1B). A conserved motif (SPHQV) at the N-terminus of SU containing the histidine residue H8, has also been shown to be required for membrane fusion. Deletion or mutation of this histidine residue abrogates Envâ&#x20AC;&#x2122;s fusion activity, but not receptor binding. Surprisingly, this fusion defect can be restored by adding soluble fragments of SU, containing the receptor-binding site, to viral particles carrying Envs with a mutated histidine (Zavorotinskaya and Albritton, 1999; Lavillette et al, 2000; Barnett and Cunningham, 2001). TM contains the hydrophobic fusion peptide (FP) at its N-terminus. It is crucial for membrane fusion and becomes exposed and inserted into the host cell membrane after receptor binding and the resulting conformational changes in Env. The fusion process also involves major changes in the membrane proximal region of TM. A sixhelix bundle is formed, which pulls the cellular and viral membrane closer together, driving membrane fusion by permitting membrane merging and pore formation. This finally leads to fusion of the viral and cellular membranes, and eventual delivery of the viral core into the cell (Dutch et al, 2000). The mammalian type C retroviruses, like MLV, can be divided into four different naturally occurring hostrange subtypes according to the distinct cell-surface receptors they recognize among species as well as to the viral interference patterns. MLV"s that recognize receptors found on both rodent cells and cells of other species are classified as amphotropic and dual- or polytropic viruses, while the receptor for viruses with xenotropic host range is present on cells of a variety of species but not on mouse cells. Receptors for ecotropic MLVs are restricted to cells of mouse or rat origin, which makes this envelope to a good candidate for targeting approaches. However, all receptors belong to the family of membrane transporter molecules (Coffin et al, 1997). While this allows different host ranges for the various retrovirus family members, it also implies that the receptorâ&#x20AC;&#x2122;s function might have an important task during viral entry.
The ecotropic MLV envelope protein does not recognizes receptors on human cells. An obvious challenge has been to extend the host range of vectors carrying the ecotropic envelope glycoprotein to a predetermined human cell type. This change in host range requires the inclusion of a novel attachment site and the induction of fusion via a novel receptor interaction.
III. Extension of the ecotropic Env host range A. The search for insertion sites in Env The extension of the host range of ecotropic MLV vectors to specific human cell types was begun with the insertion of new receptor-binding ligands into Env, to redirect binding of viral particles to a predetermined cell type. The insertion of additional sequences into Env very often interferes with its cleavage into the SU and TM subunits and/or incorporation into virions (Schnierle and Groner, 1996; Benedict et al, 1999). Rational determination of the appropriate insertion site in Env has been difficult, since its structure is complex and only limited information is available. Several studies have investigated locations within the ecotropic Env protein which can tolerate the insertion of ligands and the following sites have been mainly determined empirically:
1. The N-terminus of SU Initially ligands were fused to the N-terminus of Env behind aa 7 of the mature Env protein (Russell et al, 1993; Cosset et al, 1995; Schnierle et al, 1996; Hall et al, 1997; Yajima et al, 1998; Benedict et al, 1999). However it was found that sequences between +1 and +7 also influence the fusion activity of the chimeric Env, and N-terminal extension of Env (position +1) is now believed to be superior over the insertion of additional sequences at position +7 (Ager et al, 1996; Valsesia-Wittmann et al, 1996).
2. The proline-rich region (PRR) The hypervariable region of the PRR has been described to be dispensable for Env function and to tolerate insertion of foreign sequences (Weimin Wu et al, 1998). Even large insertions have been introduced (Kayman et al, 1999; Erlwein et al, 2003). We recently generated a fully replication competent Moloney-MLV that bears the green fluorescent protein (GFP) in its PRR and still replicates to the same titers as the parental construct (Erlwein et al, 2003).
3. The receptor-binding domain (RBD) Three studies have reported the stable insertion of sequences into a small disulfide-bonded loop (between Cys 73 and Cys 81) near the native receptor-binding site, which is predicted by the crystal structure exposed to the surface (Lorimer and Lavictoire, 2000; Wu et al, 2000; Katane et al, 2002).
4. Replacement of the RBD with a new ligand In addition to adding new ligands, the insertion of new ligands into Env by the replacement of the entire 337
Sliva and Schnierle: Host range extension receptor binding region of Env has been described (Kasahara et al, 1994; Han et al, 1995; Masood et al, 2001; Nakamura et al, 2001). These targeting approaches however do require the co-expression of wt Env in order to achieve efficient uptake of the chimeric Env and probably also to enhance the fusion process.
B. Host range expansion Insertion of ligands into Env is possible and insertion sites are well established, but not all inserted ligands are tolerated by the ecotropic Env. Unfortunately, it is not yet possible to predict which ligands will allow proper incorporation of Env into vector particles. In the last decade, however, attempts to expand the host range of MLV vectors by redirecting binding to specific human cell types through the attachment of additional cell-binding ligands to the ecotropic MLV Env have met with little success. While binding of Env to the new receptor could be demonstrated frequently, this was not sufficient to catalyze efficient infections (Cosset and Russell, 1996, 1999; Schnierle and Groner, 1996; Benedict et al, 1999; Lavillette et al, 2001b). Recently, a few exceptions have been reported. These include targeting via the human CXCR-4 receptor by incorporation of SDF-1 into the VRA region of the RBD (Katane et al, 2002, 2004) and two approaches using N-terminal extensions of Env to target either the human epidermal growth factor (EGF) receptor family using their ligand heregulin or gastrin-releasing protein (GRP) using short peptide ligands (Gollan and Green, 2002a, 2002b). But the maximum titers reached on human cells were only 104 IU/ml and these vectors are, therefore, not yet useful for gene therapy applications. Why is host range expansion so difficult? The targeted binding of a new receptor presumably fails to induce the conformational changes in Env required for the activation of membrane fusion (Cosset et al, 1995; Zhao et al, 1999; Karavanas et al, 2002). As mentioned above, mammalian type C retroviral receptors belong to the multi-transmembrane domain-containing transporter family. As retroviruses have evolved to use this type of proteins as receptors, it is possible that only this type of surface molecule is able to trigger cellular processes required for retroviral entry. This would only affect pHindependent entry processes, because in this case receptor binding induces the fusion process. Since ecotropic MLV has been described to use the pH-dependent entry route (Nussbaum et al, 1993) it was thought that targeting it to receptors that are internalized after ligand binding should facilitate infection, because the virus is transported to the low pH compartment required for fusion activation. This assumption proved, however, to be too simple. Viral particles containing a chimeric EGF-Env bind to the EGFreceptor but are rapidly trafficked to endosomes and become degraded (sequestration). This effect is dominant over the normal entry pathway, because a strong decrease in infectivity of EGF-Env vectors in mouse cells expressing the EGF-receptor has been observed (Cosset et al, 1995; Yajima et al, 1998; Benedict et al, 1999; Chadwick et al, 1999; Zhao et al, 1999) (Figure 2).
Figure 2. Proposed mechanism of cell entry with targeted vectors using fusion helpers.
IV. Overcoming the fusion defect A. Retroviral libraries The search for an Env integration site and ligands that allow both binding and the induction of the fusion process is continuing. The most promising results come from evolutionary approaches, such as using retroviral libraries with random modifications in the receptorbinding site to select viruses with a desired host range. The selection process takes attachment and induction of fusion into account. Successful examples have already been described for feline leukemia virus (FeLV) subtype A where Env molecules conferring an altered host range have been successfully selected from a retroviral library (Bupp and Roth, 2002, 2003).
B. Adding escape function
pH-dependent
endosome
The post-binding entry process differs among the MLV Envs. Amphotropic MLV fuses with cells at neutral pH, whereas ecotropic MLV entry seems to be acid pH dependent (Coffin et al, 1997). However, following targeting of the ecotropic MLV to the EGF-receptor, the subsequent internalization does not support infection (Cosset et al, 1995), but rather leads to an inactivation of the viral particles. This observation opened the field to new targeting strategies that include insertion of an endosome escape function (fusion helper) into the viral particles (Figure 2). We generated chimeric ecotropic Env proteins containing EGF-receptor ligands and the translocation domain (TLD) of Exotoxin A of Pseudomonas aeruginosa which gives the toxin the ability to translocate from 338
Gene Therapy and Molecular Biology Vol 8, page 339 endosomes to the cytoplasm. These chimeric proteins were successfully produced, chimeric vector particles could bind to the EGF-receptor, but transduction of human cells expressing EGF-receptor was not observed (Erlwein et al, 2002). Since the titers of vectors containing Envs with the TLD were significantly decreased, it is still not clear whether the endosome escape is inefficient or if infectivity of the vectors is below a detectable level. PH-dependent viruses enter cells through receptormediated endocytosis and the subsequent acidification in the endosome produces the conformational changes in the viral envelope protein(s) which lead to membrane fusion. It seems likely that targeting such proteins to a receptor that undergoes endocytosis could result in efficient fusion. These proteins are attractive molecules for co-packaging with ecotropic targeted Envs, and the best studied envelope protein of this type is the haemagglutinin (HA) of influenza A (Skehel and Wiley, 2000). Analogous to retroviral Envs, the mature protein consists of 2 subunits, HA1 and HA2. The major part of HA1 forms the globular head region, containing the receptor-binding domain which binds to the ubiquitously present sialic acid. HA2 contains the fusion peptide and transmembrane domain. For targeting approaches, however, HA has to be modified to eliminate its tropism towards human cells. Point mutations within the receptor-binding pocket have been reported that greatly reduce binding (Martin et al, 1998; Lin and Cannon, 2002). The co-expression of these HA mutants has been reported by Lin et al, (2001). MLV vectors bearing both, the HA mutant and a chimeric, ecotropic MLV Env targeted to the murine Flt-3 receptor show a 10-fold increase in titer on human cells expressing this receptor compared to the parental cells. Although there is still a low residual titer of this HA protein, this study shows that the production of infectious retroviral vectors bearing a targeted binding protein complemented with a fusion active HA is possible.
doubts of some scientists in the field that host range expansion will not be possible, or which will finally facilitate the generation of targeted retroviral vectors.
References Ager S, Nilson BH, Morling FJ, Peng KW, Cosset FL and Russell SJ (1996) Retroviral display of antibody fragments; interdomain spacing strongly influences vector infectivity. Hum Gene Ther 7, 2157-2164. Aiuti A, Slavin S, Aker M, Ficara F, Deola S, Mortellaro A, Morecki S andolfi G, Tabucchi A, Carlucci F, et al (2002) Correction of ADA-SCID by stem cell gene therapy combined with nonmyeloablative conditioning. Science 296, 2410-2413. Barnett AL and Cunningham JM (2001) Receptor binding transforms the surface subunit of the mammalian C-type retrovirus envelope protein from an inhibitor to an activator of fusion. J Virol 75, 9096-9105. Benedict CA, Tun RY, Rubinstein DB, Guillaume T, Cannon PM and Anderson WF (1999) Targeting retroviral vectors to CD34-expressing cells: binding to CD34 does not catalyze virus-cell fusion. Hum Gene Ther 10, 545-557. Bupp K and Roth MJ (2002) Altering retroviral tropism using a random-display envelope library. Mol Ther 5, 329-335. Bupp K and Roth MJ (2003) Targeting a retroviral vector in the absence of a known cell-targeting ligand. Hum Gene Ther 14, 1557-1564. Cavazzana-Calvo M, Hacein-Bey S, de Saint Basile G, Gross F, Yvon E, Nusbaum P, Selz F, Hue C, Certain S, Casanova JL, et al (2000) Gene therapy of human severe combined immunodeficiency (SCID)-X1 disease. Science 288, 669672. Chadwick MP, Morling FJ, Cosset FL and Russell SJ (1999) Modification of retroviral tropism by display of IGF-I. J Mol Biol 285, 485-494. Coffin JM, Hughes SH and Varmus HE ( 1997) Retroviruses, Vol 2, Cold Spring Harbor Press. Cosset FL and Russell SJ (1996) Targeting retrovirus entry. Gene Ther 3, 946-956. Cosset FL, Morling FJ, Takeuchi Y, Weiss RA, Collins MK and Russell SJ (1995) Retroviral retargeting by envelopes expressing an N-terminal binding domain. J Virol 69, 63146322. Dutch RE, Jardetzky TS and Lamb RA (2000) Virus membrane fusion proteins: biological machines that undergo a metamorphosis. Biosci Rep 20, 597-612. Erlwein O, Buchholz CJ and Schnierle BS (2003) The prolinerich region of the ecotropic Moloney murine leukaemia virus envelope protein tolerates the insertion of the green fluorescent protein and allows the generation of replicationcompetent virus. J Gen Virol 84, 369-373. Erlwein O, Wels W and Schnierle BS (2002) Chimeric ecotropic MLV envelope proteins that carry EGF receptor-specific ligands and the Pseudomonas exotoxin A translocation domain to target gene transfer to human cancer cells. Virology 302, 333-341. Fass D, Davey RA, Hamson CA, Kim PS, Cunningham JM and Berger JM (1997) Structure of a murine leukemia virus receptor-binding glycoprotein at 2.0 angstrom resolution. Science 277, 1662-1666. Gollan TJ and Green MR (2002a) Redirecting retroviral tropism by insertion of short, nondisruptive peptide ligands into envelope. J Virol 76, 3558-3563.
C. Targeting by using soluble RBDs Theoretically targeting might be possible using soluble receptor-binding domains (sRBD), which are able to activate fusion-defective Envs. This may allow the local activation of fusion at the cell type of choice might be possible (Lavillette et al, 2000; 2001a, 2002; Barnett and Cunningham, 2001). However, the clinical application of this strategy is questionable, since two proteinous components have to be applied systemically to accomplish their task at a locally restricted area.
V. Conclusions We know now that the initial assumption, that changing the host range of retroviruses is possible by simply modifying the cell-binding specificity, was too simple. However, some of the key problems in engineering Envs to target retroviral vectors have been answered. It is possible to modify ecotropic Env and change its binding specificity, but the efficient triggering of membrane fusion is still missing. As more data about viral assembly and Env structure are becoming available, new strategies might arise, which may substantiate the
339
Sliva and Schnierle: Host range extension Gollan TJ and Green MR (2002b) Selective targeting and inducible destruction of human cancer cells by retroviruses with envelope proteins bearing short peptide ligands. J Virol 76, 3564-3569. Hall FL, Gordon EM, Wu L, Zhu NL, Skotzko MJ, Starnes VA and Anderson WF (1997) Targeting retroviral vectors to vascular lesions by genetic engineering of the MoMLV gp70 envelope protein. Hum Gene Ther 8, 2183-2192. Han X, Kasahara N and Kan YW (1995) Ligand-directed retroviral targeting of human breast cancer cells. Proc Natl Acad Sci U S A 92, 9747-9751. Haynes C, Erlwein O and Schnierle BS (2003) Modified envelope glycoproteins to retarget retroviral vectors. Curr Gene Ther 3, 405-410. Karavanas G, Marin M, Bachrach E, Papavassiliou AG and Piechaczyk M (2002) The insertion of an anti-MHC I ScFv into the N-terminus of an ecotropic MLV glycoprotein does not alter its fusiogenic potential on murine cells. Virus Res 83, 57-69. Kasahara N, Dozy AM and Kan YW (1994) Tissue-specific targeting of retroviral vectors through ligand-receptor interactions. Science 266, 1373-1376. Katane M, Fujita R, Takao E, Kubo Y, Aoki Y and Amanuma H (2004) An essential role for the His-8 residue of the SDF1alpha-chimeric, tropism-redirected Env protein of the Moloney murine leukemia virus in regulating postbinding fusion events. J Gene Med 6, 260-267. Katane M, Takao E, Kubo Y, Fujita R and Amanuma H (2002) Factors affecting the direct targeting of murine leukemia virus vectors containing peptide ligands in the envelope protein. EMBO Rep 3, 899-904. Kayman SC, Park H, Saxon M and Pinter A (1999) The hypervariable domain of the murine leukemia virus surface protein tolerates large insertions and deletions, enabling development of a retroviral particle display system. J Virol 73, 1802-1808. Lavillette D, Boson B, Russell SJ and Cosset FL (2001a) Activation of membrane fusion by murine leukemia viruses is controlled in cis or in trans by interactions between the receptor-binding domain and a conserved disulfide loop of the carboxy terminus of the surface glycoprotein. J Virol 75, 3685-3695. Lavillette D, Maurice M, Roche C, Russell SJ, Sitbon M and Cosset FL (1998) A proline-rich motif downstream of the receptor binding domain modulates conformation and fusogenicity of murine retroviral envelopes. J Virol 72, 9955-9965. Lavillette D, Ruggieri A, Boson B, Maurice M and Cosset FL (2002) Relationship between SU subdomains that regulate the receptor-mediated transition from the native (fusioninhibited) to the fusion-active conformation of the murine leukemia virus glycoprotein. J Virol 76, 9673-9685. Lavillette D, Ruggieri A, Russell SJ and Cosset FL (2000) Activation of a cell entry pathway common to type C mammalian retroviruses by soluble envelope fragments. J Virol 74, 295-304. Lavillette D, Russell SJ and Cosset FL (2001b) Retargeting gene delivery using surface-engineered retroviral vector particles. Curr Opin Biotechnol 12, 461-466. Lin AH and Cannon PM (2002) Use of pseudotyped retroviral vectors to analyze the receptor-binding pocket of hemagglutinin from a pathogenic avian influenza A virus (H7 subtype) Virus Res 83, 43-56. Lorimer IA and Lavictoire SJ (2000) Targeting retrovirus to cancer cells expressing a mutant EGF receptor by insertion of a single chain antibody variable domain in the envelope
glycoprotein receptor binding lobe. J Immunol Methods 237, 147-157. Martin J, Wharton SA, Lin YP, Takemoto DK, Skehel JJ, Wiley DC and Steinhauer DA (1998) Studies of the binding properties of influenza hemagglutinin receptor-site mutants. Virology 241, 101-111. Masood R, Gordon EM, Whitley MD, Wu BW, Cannon P, Evans L anderson WF, Gill P and Hall FL (2001) Retroviral vectors bearing IgG-binding motifs for antibody-mediated targeting of vascular endothelial growth factor receptors. Int J Mol Med 8, 335-343. Nakamura H, Takeda A and Matano T (2001) Postbinding fusion function contributed by a chimeric murine leukemia virus envelope protein. Arch Virol 146, 953-961. Nussbaum O, Roop A and Anderson WF (1993) Sequences determining the pH dependence of viral entry are distinct from the host range-determining region of the murine ecotropic and amphotropic retrovirus envelope proteins. J Virol 67, 7402-7405. Russell SJ and Cosset FL (1999) Modifying the host range properties of retroviral vectors. J Gene Med 1, 300-311. Russell SJ, Hawkins RE and Winter G (1993) Retroviral vectors displaying functional antibody fragments. Nucleic Acids Res 21, 1081-1085. Sandrin V, Muriaux D, Darlix JL and Cosset FL (2004) Intracellular trafficking of gag and env proteins and their interactions modulate pseudotyping of retroviruses. J Virol 78, 7153-7164. Sandrin V, Russell SJ and Cosset FL (2003) Targeting retroviral and lentiviral vectors. Curr Top Microbiol Immunol 281, 137-178. Schnierle BS and Groner B (1996) Retroviral targeted delivery. Gene Ther 3, 1069-1073. Schnierle BS, Moritz D, Jeschke M and Groner B (1996) Expression of chimeric envelope proteins in helper cell lines and integration into Moloney murine leukemia virus particles. Gene Ther 3, 334-342. Schulz TF, Jameson BA, Lopalco L, Siccardi AG, Weiss RA and Moore JP (1992) Conserved structural features in the interaction between retroviral surface and transmembrane glycoproteins? AIDS Res Hum Retroviruses 8, 1571-1580. Skehel JJ and Wiley DC (2000) Receptor binding and membrane fusion in virus entry: the influenza hemagglutinin. Annu Rev Biochem 69, 531-569. Valsesia-Wittmann S, Morling FJ, Nilson BH, Takeuchi Y, Russell SJ and Cosset FL (1996) Improvement of retroviral retargeting by using amino acid spacers between an additional binding domain and the N terminus of Moloney murine leukemia virus SU. J Virol 70, 2059-2064. Verhoeyen E and Cosset FL (2004) Surface-engineering of lentiviral vectors. J Gene Med 6 Suppl 1, S83-94. Weimin Wu B, Cannon PM, Gordon EM, Hall FL and Anderson WF (1998) Characterization of the proline-rich region of murine leukemia virus envelope protein. J Virol 72, 53835391. Wu BW, Lu J, Gallaher TK anderson WF and Cannon PM (2000) Identification of regions in the Moloney murine leukemia virus SU protein that tolerate the insertion of an integrin-binding peptide. Virology 269, 7-17. Yajima T, Kanda T, Yoshiike K and Kitamura Y (1998) Retroviral vector targeting human cells via c-Kit-stem cell factor interaction. Hum Gene Ther 9, 779-787. Zavorotinskaya T and Albritton LM (1999) Suppression of a fusion defect by second site mutations in the ecotropic
340
Gene Therapy and Molecular Biology Vol 8, page 341 murine leukemia virus surface protein. J Virol 73, 50345042. Zhao Y, Zhu L, Lee S, Li L, Chang E, Soong NW, Douer D and Anderson WF (1999) Identification of the block in targeted
retroviral-mediated gene transfer. Proc Natl Acad Sci U S A 96, 4005-4010.
341
Sliva and Schnierle: Host range extension
342
Gene Therapy and Molecular Biology Vol 8, page 343 Gene Ther Mol Biol Vol 8, 343-350, 2004
Role of the Brn-3a and Brn-3b POU family transcription factors in cancer Review Article
David S. Latchman* Institute of Child Health, 30 Guilford Street, London WC1N 1EH & Birkbeck, University of London Malet Street, London WC1E 7HX
__________________________________________________________________________________ *Correspondence: David S. Latchman, Institute of Child Health, 30 Guilford Street, London WC1N 1EH and Birkbeck, University of London, Malet Street, London WC1E 7HX, UK; Tel (+44) 20 7905 2611; Fax (+44) 20 7905 2301; E-mail: d.latchman@bbk.ac.uk Key words: Brn-3a, Brn-3b, POU family transcription factors, neuroblastoma, Ewing's sarcoma, breast cancer, cervical cancer Abbreviations: cervical intra-epithelial neoplasia Type 3, (CIN3) Received: 03 August 2004; Accepted: 04 August 2004; electronically published: August 2004 Contributed by Prof. David Latchman
Summary Brn-3a and Brn-3b are closely-related POU family transcription factors both of which play an important role in the nervous system. However, both these factors were originally isolated from a neuroblastoma cell line and their expression has been shown to be altered in several different human cancers. Interestingly, functional studies have shown that Brn-3b has a growth-stimulating effect in neurobastomas, whereas Brn-3a has a growth-inhibiting effect. Similarly, Brn-3b is over-expressed in human breast cancers and stimulates their growth. However, Brn-3a is strongly over-expressed in human cervical cancer and stimulates cervical tumour growth by activating expression of the human papilloma virus E6 and E7 oncogenes which are essential for development of this tumour. Hence, these closely-related factors play critical but distinct roles in different human cancers. Subsequent studies indicated that these two factors which we named respectively Brn-3a and Brn-3b, were encoded by different genes and, whilst having highly homologous POU domains, were much less homologous outside the POU domain (Lillycrop et al, 1992: Ring and Latchman, 1993). Subsequently, a third closely-related factor Brn-3c was also isolated from the nervous system (Ninkina et al, 1993). All these three factors play essential roles in development of particular aspects of the nervous system. Thus, inactivation of Brn-3a (also known as Brn-3.0) in knock out mice results in extensive death of sensory neurones and is incompatible with survival (McEvilly et al, 1996; Xiang et al, 1996). Although inactivation of Brn3b (also known as Brn-3.2) and Brn-3c (also known as Brn-3.1) is not incompatible with survival of the animal, such inactivation leads respectively to defects in the visual and auditory systems (Erkman et al, 1996; Xiang et al, 1997). Hence, the POU factors Brn-3a, Brn-3b and Brn-3c constitute a closely-related group of factors which are classified together in the POU IV subfamily and are the most closely-related mammalian factors to Unc-86 and like this factor play an essential role in the proper development of the nervous system. However, in terms of cancer it is of particular interest that both Brn-3a and Brn-3b were isolated from a rodent
I. Introduction The POU family of transcription factors was originally defined on the basis of a common DNA binding domain identified in the mammalian transcription factors Pit, Oct-1 and Oct-2 and the nematode regulatory protein Unc-86 (Herr et al, 1988). Subsequently, a large number of other POU family members have been identified in a range of different invertebrates and vertebrates and have been shown to play critical roles in development, particularly in the nervous system (Verrijzer and van der Vliet 1993; Ryan and Rosenfeld 1997; Latchman 1999). For example, He et al, (1989) used degenerate oligonucleotides corresponding to conserved regions of the POU domain to isolate several novel POU factors expressed specifically in the brain. One of these, which they named Brn-3 was highly expressed in sensory neurones of the peripheral nervous system and was particularly closely related to the nematode Unc-86 gene product, indicating the evolutionary conservation of POU proteins. Subsequently however, using a similar approach in a rodent neuroblastoma cell line we isolated two very closely-related POU factors (Lillycrop et al, 1992). One of these was identical to the Brn-3 factor reported by He et al, (1989), whilst the other showed seven amino acid differences in the POU domain from the original factor. 343
Latchman: Role of the Brn-3a and Brn-3b POU family transcription factors in cancer neuroblastoma cell line and were shown to be regulated during its differentiation (Lillycrop et al, 1992). Similarly, Brn-3a was also isolated independently (and named RDC1) as a factor which is expressed by Ewing's sarcomas (Collum et al, 1992) and was subsequently shown to be expressed in a number of aggressive neuroendocrine tumours (Leblond-Francillard et al, 1997). Similarly, Brn3b was shown to be expressed by teratocarcinoma cell lines and to be regulated during their differentiation (Turner et al, 1994). These early expression studies led to the suggestion that these factors may play a particularly critical role in specific cancers (Chiarugi et al, 2002). In this review, I will discuss detailed studies on a few tumour cell types which indicate that this is indeed the case and which demonstrate critical but contrasting roles for Brn-3a and Brn-3b in different types of cancer.
II. Brn-3a neuroblastoma
and
Brn-3b
al, 1997b). The critical difference between Brn-3a and Brn-3b resides at position 22 in the POU-homeodomain (which is one of the two subdomains of the POU domain). Thus, altering the valine found at this position in Brn-3a to the isoleucine found in Brn-3b abolishes its ability to activate neuronal-specific gene expression and induce differentiation, whereas the converse change introducing a valine into Brn-3b allows it to activate neuronal-specific gene expression and induce differentiation, even though only a single amino acid has been changed (Dawson et al, 1996; Smith et al, 1997b). These studies indicate that a small difference between Brn-3a and Brn-3b allows Brn-3a to act as an inducer of differentiation in neuroblastoma cells, whereas Brn-3b opposes this effect. Although these findings were based on in vitro studies of a rodent cell line, they have recently been extended to a human neuroblastoma cell line using both in vitro and in vivo techniques. Thus, overexpression of Brn3b in a human neuroblastoma cell line results in its enhanced proliferation, whereas inhibition of Brn-3b expression correspondingly leads to reduced proliferation. Interestingly, overexpression of Brn-3b also results in the increased ability of these human neuroblastoma cells to show anchorage-independent growth in culture, as well as demonstrating increased invasiveness based on their ability to migrate through an artificial matrigel basement membrane (Irshad et al, 2004). Most importantly, these studies were also extended to the in vivo situation by showing that the human neuroblastoma cells with enhanced Brn-3b showed an increased ability to form tumours when introduced into nude mice compared to control cells, whereas the cells with reduced Brn-3b showed a decreased ability to form tumours (Irshad et al, 2004). These results therefore, extend the initial findings and indicate that Brn-3b appears to be a potent enhancer of tumour growth and invasiveness
in
As indicated above, Brn-3a and Brn-3b were originally isolated from a rodent neuroblastoma cell line (Lillycrop et al, 1992). When these cells are induced to differentiate from a dividing cell type to a non-dividing cell bearing numerous neurite processes, the level of Brn3a was shown to increase dramatically, whilst the level of Brn-3b decreased (Lillycrop et al, 1992; BudhramMahadeo et al, 1994, 1995). A similar increase in Brn-3a and decrease in Brn-3b was also noted when several different human neuroblastoma cell lines were induced to differentiate in culture (Smith and Latchman, 1996). These expression studies were of particular interest since Brn-3a and Brn-3b were shown to have antagonistic effects on their target promoters. Thus, Brn-3a was able to activate the promoters of genes encoding neuronal differentiation markers such as SNAP-25 and the neurofilaments, whereas Brn-3b repressed these promoters and antagonised their activation by Brn-3a (Lakin et al, 1995; Smith et al, 1997c). This led to the idea that Brn-3a may act to promote neuroblastoma differentiation by inducing the activity of neuronal differentiation genes, whilst Brn-3b opposes such an effect and promotes the maintenance of the non-differentiated proliferative phenotype. This idea was directly proven by over-expressing Brn-3a in neuroblastoma cells in the absence of a differentiation stimulus. This resulted in the cells activating neuronal specific genes and undergoing differentiation to a process-bearing cell type (Smith et al, 1997b). Conversely, over-expression of Brn-3b in these cells prevented neuronal differentiation even in response to stimuli which would normally induce it (Smith et al, 1997a). Hence, Brn-3a can indeed promote the differentiation of neuroblastoma cells whereas Brn-3b opposes this effect and promotes their continued proliferation. Interestingly, the ability of full length Brn-3a to activate neuronal-specific genes and induce differentiation can be produced by the isolated POU domain, whereas such effects are not observed with the POU domain of Brn-3b which differs by only seven amino acids (Smith et
III. Brn-3a and Ewing's sarcoma As noted above, Collum et al, (1992), observed expression of Brn-3a (which they referred to as RDC-1) in Ewing's sarcoma/primitive neuroectodermal tumour cells, which like neuroblastomas are tumours derived from the neuroendocrine lineage of neural crest cells (Kovar 1998; da Alva and Gerald, 2000). These tumours are characterised by rearrangement of the gene encoding the EWS regulatory protein to form a fusion protein with a member of the Ets family of transcription factors with the resulting fusion protein acting as a strong transcriptional regulator, which unlike either parental factor can produce cellular transformation. In 85% of cases, the gene rearrangement involves the production of a fusion protein containing the N-terminal part of EWS linked to the Cterminal portion of the Ets family transcription factor Fli-1 (Arvand and Denny, 2001; Ladanyi, 2002). In view of the expression of Brn-3a in these tumours, it is of particular interest that in a yeast two hybrid screen for proteins which interact with Brn-3a, we isolated the EWS protein and subsequently showed that Brn-3a can
344
Gene Therapy and Molecular Biology Vol 8, page 345 interact with both EWS and its oncogenic derivative EWSFli1 (Thomas and Latchman, 2002). Most interestingly however, the interaction between Brn-3a and EWS or EWS-Fli1 has different functional effects. Thus, interaction of Brn-3a with EWS-Fli1
prevents Brn-3a from activating markers of neuronal differentiation and inducing neurite outgrowth and also inhibits its ability to activate the promoter of the p21 cell cycle arrest gene and to induce cell cycle arrest (Gascoyne et al, 2004) (Figure 1).
Figure 1. Effect of EWS or EWS/Fli1 on the ability of Brn-3a to induce the SNAP-25 promoter (panel a), the endogenous SNAP-25 gene (panel b) and neurite outgrowth (panel c). Note the manner in which EWS/Fli1 but not EWS blocks the effect of Brn-3a. In panels a and c, Brn-3a was introduced by transfection, in panel b endogenous Brn-3a expression was induced with differentiation medium.
345
Latchman: Role of the Brn-3a and Brn-3b POU family transcription factors in cancer In contrast, interaction with EWS does not inhibit these effects of Brn-3a. Hence, the rearrangement which results in the production of EWS-Fli1 produces a protein which is able to inhibit the growth arrest and differentiationinducing properties of Brn-3a, thereby promoting tumour cell growth. Interestingly, Brn-3a in addition to its effect on differentiation can also activate genes encoding antiapoptotic proteins such as Bcl-2 and Bcl-x and correspondingly protect neuronal cells from apoptosis (Smith et al, 1998b; Ensor et al, 2001). These effects, unlike the effects on neuronal differentiation require an additional N-terminal domain of Brn-3a (Smith et al, 1998a; 2001). Clearly, this anti-apoptotic effect of Brn-3a has the potential to promote tumour cell survival and may therefore be antagonistic to the effect inducing tumour cell differentiation. Indeed, in an early study, Thiel et al, (1993), reported that Brn-3a could co-operate with the Ras oncogene to induce oncogenic transformation and that this effect was dependent upon the presence of the N-terminal domain. In this regard, it is therefore of particular interest that the interaction of Brn-3a with EWS and EWS-Fli1 appears to affect the anti-apoptotic activity of Brn-3a differently compared to its differentiation/growth arrest effect. Thus, EWS but not EWS-Fli1 can prevent the activation of the Bcl-2 and Bcl-x promoters by Brn-3a and inhibit its antiapoptotic effect (Thomas and Latchman, 2002; Gascoyne et al, 2004). Hence, the oncogenic rearrangement of EWS to produce EWS-Fli1 releases the EWS-mediated block on the anti-apoptotic effect of Brn-3a, thereby promoting tumour cell survival, whilst simultaneously inhibiting its growth arrest/differentiation-inducing effect, thereby promoting tumour growth.
gland tissue (Budhram-Mahadeo et al, 1999). In contrast, no overexpression of Brn-3a was observed. Moreover, expression of Brn-3b in the human breast cancer biopsies correlates inversely with the expression of the BRCA-1 anti-oncogene. This suggests that Brn-3b may repress expression of the BRCA-1 anti-oncogene in sporadic cancers, producing the same effect as the mutation of this anti-oncogene which occurs in inherited breast cancer. In agreement with this idea, Brn-3b can repress the BRCA-1 promoter in co-transfection experiments (Dennis et al, 2001). To further probe the way in which Brn-3b can alter breast cancer cell growth, we also carried out a transcriptomic/gene chip screen to identify novel genes whose expression was altered in Brn-3b overexpressing breast cancer cells compared to cells with reduced expression. This resulted in the identification of a number of different genes whose expression is either increased or decreased in breast cancer cells, when Brn-3b expression is altered (Samady et al, 2004) (Table 1). Most interestingly, one of these encodes the cyclin-dependent kinase 4 (CDK4) which plays a critical role in stimulating cellular growth. Following the initial identification of CDK4 as a putative target gene for Brn-3b, we were able to demonstrate that expression of CDK4 correlates positively with Brn-3b expression in breast cancer biopsy material and that Brn-3b can activate the CDK4 promoter (Samady et al, 2004) As well as demonstrating that Brn-3b is likely to play a stimulatory role in breast cancer as well as in neuroblastoma, these experiments demonstrate the variety of mechanisms by which Brn-3b may act to achieve this effect. Thus, it appears that Brn-3b can repress the expression of the anti-oncogenic protein BRCA-1, whilst stimulating the transcription of the gene encoding the growth-promoting CDK4 protein and interacting with the oestrogen receptor to stimulate its transcriptional activating ability.
IV. Brn-3b in breast cancer Although Brn-3b can also interact with EWS and EWS-Fli1, this interaction is much weaker than that with Brn-3a and its functional significance in Ewing's sarcoma is at present unclear (Gascoyne et al, 2004). Interestingly however, a role for Brn-3b in breast cancer has been defined and appears to be similar to that described above for neuroblastoma. Thus, human MCF-7 breast cancer cells which have been engineered to overexpress Brn-3b, exhibit enhanced proliferation and anchorage-independent growth, whereas cells engineered to have reduced Brn-3b levels show reduced growth and anchorage independence (Dennis et al, 2001). Moreover, overexpression of Brn-3b in MCF-7 cells enhances their responsiveness to oestrogen which is correspondingly reduced in the cells showing reduced Brn3b levels. This is in agreement with previous molecular analysis which showed that Brn-3b can interact directly with the oestrogen receptor via a protein-protein interaction, which results in enhanced transcriptional activity of the receptor (Budhram-Mahadeo et al, 1998). These effects on a human breast cancer cell line in culture are of particular interest since Brn-3b has also been shown to be overexpressed in human mammary tumour biopsies compared to its level in normal human mammary
V. Brn-3a in cervical cancer The studies described so far, have indicated a strong stimulatory role for Brn-3b in both breast cancer and neuroblastoma. Conversely, Brn-3a expression is unchanged in breast cancer and appears to have a predominantly anti-oncogenic role in both neuroblastoma and Ewing's sarcoma. At first sight therefore, it is perhaps surprising that human cervical biopsies demonstrate a 300-fold elevation in Brn3a expression in cervical intra-epithelial neoplasia Type 3 (CIN3) compared to normal biopsies from women with a normal cervix (Ndisang et al, 1998). In contrast, no difference is observed between Brn-3b levels in CIN3 and normal cervix. This paradox is explained by the fact that Brn-3a but not Brn-3b can activate the upstream regulatory region of human papilloma viruses Types 16 and 18 (HPV-16 and HPV-18), which controls the production of the oncogenic E6 and E7 proteins (Morris et al, 1994). In agreement with the idea that Brn-3a acts in cervical cells via stimulating HPV oncogene expression, overexpression of Brn-3a in cervical cell lines containing 346
Gene Therapy and Molecular Biology Vol 8, page 347 HPV enhances their expression of HPV E6 protein, stimulates their cellular growth and their ability to grow in an anchorage-independent manner, whereas none of these effects are observed when Brn-3a is over-expressed in cervical cell lines which do not contain HPV genomes(Ndisang et al, 1999). Most importantly, cervical
cells engineered to have reduced levels of Brn-3a not only exhibit reduced E6 expression and cellular growth in culture, but also show a decreased ability to form tumours in nude mice, demonstrating that Brn-3a is important for tumour growth in vivo (Ndisang et al, 2001).
Table 1. Genes showing altered expression in MCF-7 cells over expressing Brn-3b compared to those with reduced levels of Brn-3b Ratio Up Down Gene 2.4 c-jun proto-oncogene; transcription factor AP-1 8.3 Interferon-inducible protein 9-27 2.0 c-myc oncogene 2.1 c-myc binding protein MM-1 1.7 cell division protein kinase 4; cyclin-dependent kinase 4 (CDK4); PSK-J3 2.3 cyclin-dependent kinase inhibitor 1 (CDKN1A); melanoma differentiation-associated protein 6 (MDA6); CDK-interacting protein 1 (CIP1); WAF1 1.7 cyclin-dependent kinase regulatory subunit 1 (CKS1) 1.8 cdc2-related protein kinase PISSLRE 3.5 G1 to S phase transition protein 1 homologue; GTP-binding protein GST1-HS 1.7 ADP/ATP carrier protein 2.1 protein phosphatase 2C gamma 1.9 rhoC (H9); small GTPase (rhoC) 1.7 B-cell receptor-associated protein (hBAP) 13.7 zyxin + zyxin-2 1.7 c-jun N-terminal kinase 2 (JNK2); JNK55 4.5 junction plakoglobin (JUP); desmoplakin III (DP3) 2.4 DNA ligase 1; polydeoxyribonucleotide synthase (ATP) (DNL1) (LIG1) 1.9 tumour necrosis factor type 1 receptor associated protein (TRAP1) 8.0 TIS11B protein, EGF response factor (ERF1) 5.6 early growth response protein 1 (hEGR1); transcription factor ETR103; KROX24; zinc finger protein 225; AT225 8.3 fuse-binding protein 2 (FBP2) 2.0 transcription factor erf-1; AP2 gamma transcription factor 1.9 integrin beta 4 (ITG84); CD104 antigen 2.1 high mobility group protein HMG2 3.4 paxillin 2.3 alpha 1 catenin (CTNNA1); cadherin-associated protein; alpha Ecatenin 2.0 glutathione-S-transferase (GST) homologue 5.5 78-kDa glucose regulated protein precursor (GRP 78); immunoglobulin heavy chain binding protein (BIP) 2.0 cathepsin D precursor (CTSD) 2.0 interleukin-1 beta precursor (IL-1; IL1B); catabolin 1.8 macrophage migration inhibitory factor (MIF); glycosylation-inhibiting factor (GIF) 2.1 60S ribosomal protein L5 2.6 ornithine decarboxylase 3.9 PM5 protein 1.7 suppressor for yeast mutant 1.8 type 11 cycloskeletal 2 epidermal keratin (KRT2E);cytokeratin 2E 3.5 (K2E;CK2E) 1.8 glycyl tRNA synthetase aminoacylase 1 (ACY1)
347
Latchman: Role of the Brn-3a and Brn-3b POU family transcription factors in cancer Table 2. Brn-3a and E-6 levels in Pap smears from patients categorised on the basis of the histological diagnosis Category
Count (No =)
Percentage
Brn-3a mean value
E-6 mean value
Negative
74
31%
0.201
0125
LGSIL (HPV-CIN1)
83
35%
0.259
0.231
HGSIL (CIN2-CIN3)
79
33%
0.438
0.358
Cancer
2
1%
0.575
0.475
Total
238
100%
-
-
Hence, Brn-3a appears to be of importance as a cellular factor which is required to stimulate HPV gene expression and hence produce oncogenic transformation following initial infection with HPV-16 or HPV-18. Interestingly, Brn-3a levels are also elevated in biopsies from women with CIN3 when the biopsy is taken from a normal region of the cervix (Ndisang et al, 1998; 2000). This suggests therefore, that Brn-3a is not specifically elevated in the tumour cells. Rather, it may be elevated in a subset of women for genetic or environmental reasons and that such women are at enhanced risk of tumour formation following initial infection with HPV. This is of particular importance since the vast majority of women clear HPV infections and do not progress to tumour formation. Although our initial studies on Brn-3a expression were conducted on cervical biopsies, we have recently been able to measure Brn-3a in routinely taken cervical smear samples (Sindos et al, 2003b). As elevated levels of Brn-3a in the smear correlate with the presence of cervical abnormality as determined by subsequent histological analysis (Table 2), its measurement may represent an additional test which could be used to confirm the results of cytological examination and determine the need for further action. Moreover, Brn-3a levels are elevated in cervical smears from women with persistent minor smear abnormalities who were subsequently found by histological examination to have CIN2/3 compared to those with CIN1 or no abnormality (Sindos et al, 2003a). This suggests that Brn-3a could be used as a marker for women who require detailed follow-up in this situation since they would be predicted to be at enhanced risk of disease-progression. Hence, as well as playing a critical role in the development of cervical tumours, Brn-3a may represent a novel prognostic and diagnostic marker of the disease.
tumours such as neuroblastoma and breast cancer, whilst Brn-3a may have an anti-oncogenic role in neuroblastoma and Ewing's sarcoma but is involved in the development of cervical cancer, via its ability to activate human papilloma virus gene expression. These findings suggest that it would be worthwhile to investigate the role of Brn-3 factors in other types of tumour. This is particularly so in view of recent findings using gene chip analysis which have suggested that Brn-3a is specifically overexpressed in leukaemias with the t(8;21) translocation (Schoch et al, 2002; Debernardi et al, 2003). Similarly, it is of interest that the gene encoding Brn-3b has recently been shown to be activated by the Wilms' tumour suppressor protein WT-1 (Wagner et al, 2003), whilst Brn-3c has been shown to be overexpressed in Merkel cell carcinoma (Lennard et al, 2002). The characterisation of the role of Brn-3a, Brn-3b and Brn-3c in different types of tumours is likely therefore to require considerably more effort. It is already clear however, in the case of Brn-3a and Brn-3b that both these factors play a critical role in specific types of human cancer where their expression is altered.
Acknowledgements I thank the Association for International Cancer Research, the BBSRC, Cancer Research U.K. and the Medical Research Council for supporting the work of my laboratory on Brn-3a and Brn-3b.
References Arvand A, Denny CT (2001) Biology of EWS/ETS fusions in Ewing's family tumors. Oncogene 20, 5747-54. Budhram-Mahadeo V, Lillycrop KA, Latchman DS (1995) The levels of the antagonistic POU family transcription factors Brn-3a and Brn-3b in neuronal cells are regulated in opposite directions by serum growth factors. Neurosci Lett 185, 4851 Budhram-Mahadeo VS, Ndisang D, Ward T, Weber BL and Latchman DS (1999) The Brn-3b POU family transcription factor represses expression of the BRCA-1 anti-oncogene in breast cancer cells. Oncogene 18, 6684-6691.
VI. Conclusion The studies described above have characterised the role of Brn-3a and Brn-3b in several different tumours. They have indicated that Brn-3b plays a stimulatory role in
348
Gene Therapy and Molecular Biology Vol 8, page 349 Budhram-Mahadeo VS, Parker M and Latchman DS (1998) The POU Domain factors Brn-3a and Brn-3b interact with the estrogen receptor and differentially regulate transcriptional activity via an ERE. Mol Cell Biol 18, 1029-1041. Budhram-Mahadeo VS, Theil T, Morris PJ, Lillycrop KA, Möröy T and Latchman DS (1994) The DNA target site for the Brn-3 POU family transcription factors can confer responsiveness to cyclic AMP and removal of serum in neuronal cells. Nucleic Acids Res 22, 3092-3098. Chiarugi V, Del Rosso M and Magnelli L (2002) Brn-3a, a neuronal transcription factor of the POU gene family, indications for its involvement in cancer and angiogenesis. Mol Biotechnol 22, 123-127. Collum RG, Fisher PE, Datta M, Mellis S, Thiele C, Huebner K, Croce CM, Israel MA, Theil T, Möröy, T, DePinho R and Alt FW (1992) A novel POU homeodomain gene specifically expressed in cells of the developing nervous system. Nucleic Acids Res 20, 4919-4925. Dawson SJ, Morris PJ, Latchman DS (1996) A single amino acid change converts an inhibitory transcription factor into an activator. J Biol Chem 271, 11631-11633. de Alava E, Gerald WL (2000) Molecular biology of the Ewing's sarcoma/Primitive neuroectodermal tumor family. J Clin Oncol 18, 204-213. Debernardi S, Lillington DM, Chaplin T, Tomlinson S, Amess J, Rohatiner A, Lister TA, Young BD (2003) Genome-wide analysis of acute myeloid leukemia with normal karyotype reveals a unique pattern of homeobox gene expression distinct from those with translocation-mediated fusion events. Genes Chromosomes Cancer 37, 149-158. Dennis JH, Budhram-Mahadeo V, Latchman DS (2001) The Brn3b POU family transcription factor regulates the cellular growth, proliferation and anchorage dependence of human breast cancer cells. Oncogene 20, 4961-4971. Ensor E, Smith MD, Latchman DS (2001) The Brn-3a transcription factor protects sensory but not sympathetic neurones from programmed cell death/apoptosis. J Biol Chem 276, 5204-5212. Erkman L, McEvilly RJ, Luo L, Ryan AK, Hooshmand F, O'Connell SM, Keithley EM, Rapaport DH, Ryan AF, Rosenfeld MG (1996) Role of transcription factors Brn-3.1 and Brn-3.2 in auditory and visual system development. Nature 381, 603-606.. Gascoyne DM, Thomas GR, Latchman DS (2004) The effects of Brn-3a on neuronal differentiation and apoptosis are differentially modulated by EWS and its oncogenic derivative EWS/Fli-1. Oncogene 23, 3830-3840. He X, Treacy MN, Simmons DM, Ingraham HA, Swanson LW, Rosenfeld MG (1989) Expression of a large family of POUdomain regulatory genes in mammalian brain development. Nature 340, 35-42. Herr W, Sturm RA, Clerc RG, Corcoran LM, Baltimore D, Sharp PA, Ingraham HA, Rosenfeld MG, Finney M, Ruvkun G, et al (1988) The POU domain, a large conserved region in the mammalian pit-1 Oct-1 Oct-2 and Caenorhabditis elegans Unc-86 gene products. Genes Dev 2, 1513-1516. Irshad S, Pedley RB, Anderson J, Latchman DS, BudhramMahadeo V (2004) The Brn-3b transcription factor regulates the growth, behaviour and invasiveness of human neuroblastoma cells in vitro and in vivo . J Biol Chem 279, 21617-21627. Kovar H (1998) Ewing's sarcoma and peripheral primitive neuroectodermal tumours after their genetic union. Curr Opin Oncol 10, 334-342. Ladanyi M (2002) EWS-FLI1 and Ewing's sarcoma. Cancer Biol Ther 1, 330-336. Lakin ND, Morris PJ, Theil T, Sato TN, Moroy T, Wilson MC, Latchman DS (1995) Regulation of neurite outgrowth and
SNAP-25 gene expression by the Brn-3a transcription factor. J Biol Chem 270, 15858-15863. Latchman DS (1999) POU Family transcription factors in the nervous system. J Cell Physiol 179, 126-133. Leblond-Francillard M, Picon A, Bertagna X, de Keyzer Y (1997) High Expression of the POU Factor Brn3a in Aggressive Neuroendocrine Tumors. J Clin Endocrinol Metab 82, 89-94. Leonard JH, Cook AL, Van Gele M, Boyle GM, Inglis KJ, Speleman F, Sturm RA (2002) Proneural and proneuroendocrine transcription factor expression in cutaneous mechanoreceptor (Merkel) cells and Merkel cell carcinoma. Int J Cancer 101, 103-110. Lillycrop KA, Budrahan VS, Lakin ND, Terrenghi G, Wood JN, Polak JM, Latchman DS (1992) A novel POU family transcription factor is closely related to Brn-3 but has a distinct expression pattern in neuronal cells. Nucleic Acids Res 20, 5093-5096. McEvilly RJ, Erkman L, Luo L, Sawchenko PE, Ryan AF, Rosenfeld MG (1996) Requirement for Brn-3.0 in differentiation and survival of sensory and motor neurons. Nature 384, 574-577. Morris PJ, Theil T, Ring CJ, Lillycrop KA, Möröy T, Latchman DS (1994) The opposite and antagonistic effects of the closely related POU family transcription factors on the activity of a target promoter are dependent upon differences in the POU domain. Mol Cell Biol 14, 6907-6914. Ndisang D, Budhram-Mahadeo V, Latchman DS (1999) The Brn-3a transcription factor plays a critical role in regulating HPV gene expression and determining the growth characteristics of cervical cancer cells. J Biol Chem 274, 28521-28527. Ndisang D, Budhram-Mahadeo V, Singer A, Latchman DS (2000) Widespread elevated expression of the HPVactivating cellular transcription factor Brn-3a in the cervix of women with CIN3. Clin Sci (Lond) 98, 601-602. Ndisang D, Budhram-Mahadeo V, Pedley B, Latchman DS (2001) The Brn-3a transcription factor plays a key role in regulating the growth of cervical cancer cells in vivo. Oncogene 20, 4899-4903. Ndisdang D, Morris PJ, Chapman C, Ho L, Singer A, Latchman DS (1998) The HPV-activating cellular transcription factor Brn-3a is overexpressed in CIN3 cervical lesions. J Clin Invest 101, 1687-1692. Ninkina NN, Stevens GE, Wood JN, Richardson WD (1993) A novel Brn3-like POU transcription factor expressed in subsets of rat sensory and spinal cord neurons. Nucleic Acids Res 21, 3175-3182. Ring CJ, Latchman DS (1993) The human Brn-3b POU transcription factor shows only limited homology to the Brn3a/RDC-1 factor outside the conserved POU domain. Nucleic Acids Res 21, 2946. Ryan AK and Rosenfeld MG (1997) POU domain family values,- flexibility, partnerships and developmental codes. Genes and Development 11, 1207-1225. Samady L, Dennis J, Budhram-Mahadeo V, Latchman DS (2004) Activation of CDK4 gene expression in human breast cancer cells by the Brn-3b POU family transcription factor. Cancer Biol Ther 3, 317-323. Schoch C, Kohlmann A, Schnittger S, Brors B, Dugas M, Mergenthaler S, Kern W, Hiddemann W, Eils R, Haferlach T (2002) Acute myeloid leukemias with reciprocal rearrangements can be distinguished by specific gene expression profiles. Proc Natl Acad Sci U S A. 99, 1000810013. Sindos M, Ndisang D, Pisal N, Chow C, Deery A, Singer A, Latchman D (2003a) Detection of cervical neoplasia using
349
Latchman: Role of the Brn-3a and Brn-3b POU family transcription factors in cancer measurement of Brn-3a in cervical smears with persistent minor abnormalities. Int J Gynecol Cancer.13, 515-517. Sindos M, Ndisang D, Pisal N, Chow C, Singer A, Latchman DS (2003b) Measurement of Brn-3a levels in Pap smears provides a novel diagnostic marker for the detection of cervical neoplasia. Gynecol Oncol 90, 366-371. Smith MD, Latchman DS (1996) The functionally antagonistic POU family transcription factors Brn-3a and Brn-3b show opposite changes in expression during the growth arrest and differentiation of human neuroblastoma cells. Int J Cancer 67, 653-660. Smith MD, Dawson SJ, Latchman DS (1997a) Inhibition of neuronal process outgrowth and neuronal specific gene activation by the Brn-3b transcription factor. J Biol Chem 272, 1382-1388. Smith MD, Dawson SJ, Latchman DS (1997b) The Brn-3a transcription factor induces neuronal process outgrowth and the co-ordinate expression of genes encoding synaptic proteins. Mol Cell Biol 17, 345-354. Smith MD, Dawson SJ, Boxer LM, Latchman DS (1998a) The N-terminal domain unique to the long form of the Brn-3a transcription factor is essential to protect neuronal cells from apoptosis and for the activation of Bcl-2 gene expression. Nucleic Acids Res 26, 4100-4107. Smith MD, Ensor EA, Coffin RS, Boxer LM, Latchman DS (1998b) Bcl-2 transcription from the proximal P2 promoter is activated in neuronal cells by the Brn-3a POU transcription factor. J Biol Chem 273, 16715-16722. Smith MD, Melton LA, Ensor EA, Packham G, Anderson P, Kinloch RA, Latchman DS (2001) Brn-3a activates the expression of Bcl-X L and promotes neuronal survival in vivo as well as in vitro. Mol Cell Neurosci. 17, 460-470. Smith MD, Morris PJ, Dawson SJ, Schwartz ML, Schlaepfer WW, Latchman DS (1997c) Co-ordinate induction of the three neurofilament genes by the Brn-3a transcription factor. J Biol Chem 272, 21325-21333. Theil T, McLean-Hunter S, Zornig M and Mรถrรถy, T (1993) Mouse Brn-3 family of POU transcription factors, a new amino terminal domain is crucial for the oncogenic activity of Brn-3A. Nucleic Acids Res 21, 5921-5929.
Thomas GR, Latchman DS (2002) The pro-oncoprotein EWS (Ewing's sarcoma protein) interacts with the Brn-3a transcription factor and inhibits its ability to activate transcription. Cancer Biol Ther. 1, 428-432. Verrijzer CP and Van der Vliet PC (1993) POU domain transcription factors. Biochimica et Biophysica Acta 1173, 121. Wagner KD, Wagner N, Schley G, Theres H, Scholz H (2003) The Wilms' tumour suppressor Wt1 encodes a transcriptional activator of the class IV POU-domain factor Pou4f2 (Brn3b). Gene 305, 217-223. Xiang M, Gan L, Li D, Chen ZY, Zhou L, O'Malley BW Jr, Klein W, Nathans J (1997) Essential role of POU domain factor Brn-3c in auditory and vestibular hair cell development. Proc Natl Acad Sci U S A 94, 9445-9450. Xiang M, Gan L, Zhou L, Klein WH, Nathans J (1996) Targeted deletion of the mouse POU domain gene Brn-3a causes a selective loss of neurons in the brainstem and trigeminal ganglion, uncoordinated limb movement and impaired suckling. Proc Natl Acad Sci U S A 93, 11950-11955.
Prof. David S. Latchman
350
Gene Therapy and Molecular Biology Vol 8, page 351 Gene Ther Mol Biol Vol 8, 351-360, 2004
Angiogenic gene therapy in the treatment of ischemic cardiovascular diseases Review Article
Tamer A. Malik, Cesario Bianchi, Frank W. Sellke Beth Israel Deaconess Medical Center, Boston, MA 02215, USA
__________________________________________________________________________________ *Correspondence: Tamer A. Malik, Beth Israel Deaconess Medical Center, Boston, MA 02215, 330 Brookline Ave, East Campus, Dana Building, Room 881; Tel: 617-667-1853/617-632-8385; Fax 617-975-5562; Email: tmalik@bidmc.harvard.edu, fsellke@bidmc.harvard.edu Key words: VEGF, FGF, HGF, Retrovirus, Adenovirus, Adeno-associated virus, Plasmids, Liposomes, MRI, AGENT trials, VEGF trials Abbreviations: basic fibroblast growth factor, (!-FGF); complementary DNA, (cDNA); coronary artery bypass grafting, (CABG); coronary artery disease, (CAD); cytomegalovirus, (CMV); electromechanical mapping, (EMM); extracellular matrix, (ECM); fibroblast growth factor-4, (FGF-4); hepatocyte growth factor, (HGF), herpes simplex virus, (HSV); interventional MRI, (iMRI); kilobases, (kb); left ventricular, (LV); magnetic resonance imaging, (MRI); percutaneous transmural coronary angioplasty, (PTCA); peripheral vascular disease, (PAD); human immunodeficiency virus, (HIV); tumor necrosis factor alpha, (TNF-"). Received: 11 June 2004; Accepted: 30 July 2004; electronically published: July 2004
Summary Encouraging preliminary data suggest that gene therapy may soon be an option for the treatment of patients with advanced coronary artery disease that is not amenable to conventional treatment. A critical consideration in developing cardiovascular gene transfer as a therapy is the ability to deliver the vector, viral or plasmid, to the desired tissue in a safe fashion. Attempts at developing non-viral direct DNA therapy delivered through the intravenous route are currently underway and with the use of advanced technology the possibility of making gene therapy a simple outpatient procedure does not seem out of the realm of possibility. Several clinical trials are currently underway that should help characterize the risk–benefit profile of various products, the optimal dose that should be administered, and the patient population likely to derive greatest benefit. body affecting the desired the cells. Gene therapy is evolving as a new therapeutic alternative for the treatment of patients with advanced coronary artery disease (CAD) not amenable to bypass surgery or catheter based interventions.
I. Introduction Gene therapy is most often defined as the transfer of nucleic materials to the somatic cells of an individual to elicit a beneficial therapeutic effect. A transferred gene can be targeted to specific tissues, organs or to the entire body. The potential advantage of gene therapy over drug administration is the single administration with long lasting beneficial results and minimal systemic toxicity. There are a couple of techniques that need to be developed for the success of gene therapy namely; the isolation and cloning of the desired therapeutic genes, the vectors which are the vehicle for these genes and finally delivery of gene to target tissues. The proposed mechanisms of action of gene therapy are replacement of non-functional genes with functional counterparts, correction of a defective gene, enhancement of normal gene expression and restriction of the expression of certain genes (Clowes et al, 1997). The two types of gene delivery for therapy are the ex vivo where the cells to be transfected by the gene are cultured outside the body under a controlled environment and then re-introduced back into the body and the in vivo where the genetic material is directly delivered into the
II. Development of vectors The transfer of plain DNA known as “naked” DNA directly into the body has yielded less than satisfactory results owing to the fact that only a small fraction of transferred DNA enters the cell and once inside is subjected to destruction by the cytoplasmic enzymes. Therefore, mechanisms of facilitating DNA entry into cells were developed, namely through the use of vectors, which are vehicles carrying the genetic material to the target tissues or cells. The ideal vector would be the one that delivers genetic material efficiently to target tissue producing the desired level of gene expression with minimal systemic and local adverse effects and for the specified duration of time. To fit all these characteristics in one vector is challenging and has not been completely successful. The vectors used in cardiovascular gene 351
Malik et al: Angiogenic gene therapy for ischemic cardiovascular diseases therapy, as well as gene therapies directed at other diseases, include viral vectors, such as retroviruses, adenoviruses and adeno-associated viruses, and nonviral vectors, such as polymers, cationic liposomes, and liposome-viral conjugates. In order to develop clinical gene therapy strategies, a clear understanding of the advantages and shortcomings of current vector systems is mandatory (Zuckerbraun et al, 2002) (Figure 1).
virusesâ&#x20AC;&#x2122; capability to replicate in the host cell is annulled by removing certain genes and replacing them with the desired genes to be incorporated into the hostâ&#x20AC;&#x2122;s genome.
1. Retrovirus This is a class of viruses that have a lipid envelope containing a single stranded RNA genome. Once the virus transfects a cell and enters the cytoplasm, the viral genome is reverse transcribed into double stranded DNA, which integrates into the host genome [called complementary DNA (cDNA)] and is further expressed as proteins (Figure 2, 3).
A. Viral vectors For delivery of the genetic load into cells, viral vectors first must attach to the cell membrane through binding proteins, then fuse with the cell membrane injecting their genetic material into the cytoplasm. The
Figure 1. The vector gets internalized into the cell and releases its nucleic acids (containing transgene). The nucleic acids are translocated into the nucleus, where they may remain distinct or become incorporated into the host DNA. Vector (transgene) messenger RNA (mRNA) is transcribed in the nucleus then translated by ribosomal complexes in the cytoplasm to yield the final transgene protein product. It is the over expression of this protein that is intended to be of therapeutic value. Reproduced from Zuckerbraun and Tzeng, 2002 with kind permission from Archives of Surgery.
Figure 2. From The Online Biology Book hosted by Estrella Mountain Community College Website, in Sunny Avondale, Arizona: Biological Diversity: Viruses (revised 6/18/01).
352
Gene Therapy and Molecular Biology Vol 8, page 353 The viral genome is approximately 10 kilobases (kb), containing mainly these three genes: gag (coding for core proteins), pol (coding for reverse transcriptase) and env (coding for the viral envelope protein), which are replaced with the transgene of interest (Figure 3) (Nabel, 1989, 1990). Retroviruses have the advantage of longer periods of gene expression with relatively minimal stimulation of the immune system and no local inflammatory reactions. But they attack only proliferating cells with a large variety of cells as a target, which explains why they canâ&#x20AC;&#x2122;t be used in in-vivo gene therapy. If the viruses are delivered directly into the body they will be neutralized immediately by the complement system and also the desired target cells are not necessarily in the proliferation phase. The cells desired to undergo the genetic modification are removed from the body and are cultured under controlled conditions then re-transplanted into the body after being transfected by the virus. The retrovirus genome is easily manipulated and replication-deficient retroviruses can hold large transgenes, measuring up to 8 kb (Figure 3). Retroviruses theoretically can cause genetic mutations due to the incorporation of an unfamiliar genetic material in the cellâ&#x20AC;&#x2122;s genome. Major limitations to the use of retroviruses are their low titers (number of virus particles proportional to the gene transfer efficiency) but the development of new retroviruses increased the virus titers with more efficient gene transfer (Weiss et al, 1984; Flugelman et al, 1992). Transfecting endothelial cells with retroviruses to be implanted into vascular stents, grafts or injured arteries for a desired therapeutic effect have been studied. Lentiviruses are a class of retrovirus but unlike retroviruses they can infect non-proliferating, terminally
differentiated cells. These advantages of stable gene expression in non-dividing cells with minimal immunogenicity could be promising for gene therapy in the cardiovascular system. The human immunodeficiency virus (HIV) is a member of this family and, as may be expected, there are some concerns about the possible mutation of these recombinant viruses back to a pathogenic phenotype. The use of lentiviruses for gene therapy is on the horizon, and they may be the preferred vectors of the future.
2. Adenoviruses Adenoviruses are non-enveloped viruses with double-stranded DNA genomes that cause respiratory, intestinal, and eye infections in humans. The virus that causes the common cold is an adenovirus. The virion is spherical and about 70 to 90 nm in size. The genome encodes about thirty proteins and both strands of the DNA encode genes. Some regions of the DNA have to be removed in order to render the virus non-proliferative (Figure 4). Adenoviruses do not incorporate in the hostâ&#x20AC;&#x2122;s genome thereby do not cause mutations. This also explains its short duration of action which is usually for 1 or 2 weeks added to the fact that most people in their lifetime have had a natural adenovirus infection thereby evoking an immune response, both at the cellular and humoral levels, against future encounters with the virus. This short duration of action could be seen as a shortcoming in the treatment of chronic diseases and an advantage in the treatment of diseases where a temporary action is required.
Figure 3. From the Department of Microbiology & Immunology, University of Leicester, UK. MBChB Special Study Module Project Report about Virus Vectors & Gene Therapy Problems, Promises & Prospects by David Peel 1998
353
Gene Therapy and Molecular Biology Vol 8, page 359 Mack CA, Patel SR, Schwarz EA, et al. (1998) Biologic bypass with the use of adenovirus-mediated gene transfer of the complementary deoxyribonucleic acid for vascular endothelial growth factor 121 improves myocardial perfusion and function in the ischemic porcine heart. J Thorac Cardiovasc Surg 115, 168-176. Morishita R, Gibbons GH, Ellison KE, et al. (1994) Intimal hyperplasia after vascular injury is inhibited by antisense CDK 2 kinase oligonucleotides. J Clin Invest. 93, 14581464. Nabel EG, Nabel GJ. (1999) Genetic therapies for cardiovascular disease. In, Topol EJ, ed. Textbook of Interventional Cardiology. 3rd ed. Philadelphia, Pa, WB Saunders Co. Nabel EG, Plautz G, Boyce FM, Stanley JC, Nabel GJ. (1989) Recombinant gene expression in vivo within endothelial cells of the arterial wall. Science 244, 1342-1344. Nabel EG, Plautz G, Nabel GJ. (1990) Site-specific gene expression in vivo by direct gene transfer into the arterial wall. Science. 249, 1285-1288. Rosengart TK, Lee LY, Patel SR, et al. (1999a) Angiogenesis gene therapy, phase I assessment of direct intramyocardial administration of an adenovirus vector expressing VEGF121 cDNA to individuals with clinically significant severe coronary artery disease. Circulation 100, 468-474. Rosengart TK, Lee LY, Patel SR, et al. (1999b) Six-month assessment of a phase I trial of angiogenic gene therapy for the treatment of coronary artery disease using direct intramyocardial administration of an adenovirus vector expressing the VEGF121 cDNA. Ann Surg 230, 466-470. Ruel M, Sellke FW. (2003) Angiogenic protein therapy. Semin Thorac Cardiovasc Surg Jul 15, 222-35. Schiedner G, Morral N, Parks RJ, et al. (1998) Genomic DNA transfer with a high-capacity adenovirus vector results in
improved in vivo gene expression and decreased toxicity. Nat Genet 18, 180-183. Sellke FW, Ruel M, (2003) Vascular growth factors and angiogenesis in cardiac surgery. Ann Thorac Surg 75, S685-90. Sleight P ( 2003) Current options in the management of coronary artery disease. Am J Cardiol 92, 4N-8N. Summerford C, Samulski RJ. (1998) Membrane-associated heparan sulfate proteoglycan is a receptor for adenoassociated virus type 2 virions. J Virol 72, 1438-1445. Taniyama Y, Morishita R, Aoki M et al. (2002) Angiogenic and antifibrotic action of hepatocyte growth factor in cardiomyopathy. Hypertension 40, 47-53. Ueda H, Sawa Y, Matsumoto K, et al. (1999) Gene transfection of hepatocyte growth factor attenuates reperfusion injury in the heart. Ann Thorac Surg 67, 1726-1731. Vale PR, Losordo DW, Milliken CE, et al. (2000) Left ventricular electromechanical mapping to assess efficacy of phVEGF165 gene transfer for therapeutic angiogenesis in chronic myocardial ischemia. Circulation 102, 965-974. Von der Leyen HE, Gibbons GH, Morishita R, et al. (1995) Gene therapy inhibiting neointimal vascular lesion, in vivo transfer of endothelial cell nitric oxide synthase gene. Proc Natl Acad Sci U S A. 92, 1137-1141. Weiss RA, Teich NM, Varmus HE, Coffin JM, eds. RNA Tumor Viruses. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press 1984. Cold Spring Harbor Monograph Series 10C, pt 1. Wolf C, Cai WJ, Vosschulte R, Koltai S, Mousavipour D, Scholz D, Afsah-Hedjri A, Schaper W, Schaper J. (1998) Vascular remodeling and altered protein expression during growth of coronary collateral arteries. J Mol Cell Cardiol 30, 22912305
359
Malik et al: Angiogenic gene therapy for ischemic cardiovascular diseases
360
Malik et al: Angiogenic gene therapy for ischemic cardiovascular diseases
4. Others Several others viruses have been used experimentally for gene transfer namely; Herpes Simplex Virus (HSV), Pertussis Virus, Cytomegalovirus (CMV).
B. Non viral vectors A plasmid is an autonomous, circular, self-replicating and an extra-chromosomal DNA molecule that carries only a few genes and has a single origin of replication. Some plasmids can be inserted into a bacterial chromosome, where they become a permanent part of the bacterial genome. The number of plasmids in a cell generally remains constant from generation to generation. It is here that they provide great functionality in molecular science. Plasmids are easy to manipulate and isolate using bacteria. They can be integrated into mammalian genomes, thereby conferring to mammalian cells whatever genetic functionality they carry. Thus, we can have the ability to introduce genes into a given organism by using bacteria to amplify the hybrid genes that are created in vitro. This tiny but mighty plasmid molecule is the basis of recombinant DNA technology. They were originally discovered by their ability to transfer antibiotic-resistance genes between bacteria, so to make plasmids useful these regions of antibiotic resistance had to be removed and replaced with recombinant genes (Feldman and Steg, 1997). Methods to deliver genecarrying plasmids to mammalian cells for gene therapy include direct microinjection, liposomes, calcium phosphate, electroporation, or DNA-coated particle bombardment. Liposomes are microscopic artificial vesicles, spherical in shape that can be produced from natural nontoxic phospholipids and cholesterol. When mixed in water under low shear conditions, the phospholipids arrange themselves in sheets, the molecules aligning side by side in like orientation, "heads" up and "tails" down (Figure 6). These sheets then join tails-to-tails to form a bilayer membrane enclosing some of the water in that phospholipid sphere. The vesicles can be loaded with a great variety of molecules, such as small drug molecules, proteins, nucleotides and even plasmids. The simplicity of the liposome preparation and lack of disease transmission associated with viral vectors combined with the ease of plasmid construction make liposomes the most common form of non-viral gene transfer. The genetic material transferred by the liposome will enter the nucleus but will not incorporate into the cell’s genome except for a very small amount. However some of its shortcomings are its use only in in vitro due to the instability of this complex (liposome-plasmid DNA) in the circulation, gene expression is for a short duration and the efficiency of gene transfer is low (Morishita et al, 1994). Transfection efficiencies vary with DNA/liposome ratio, cell type, and the proliferation status of cells. (Dzau et al, 1996; Armeanu et al, 2000). The non-selectivity of these liposomes has been partially overcome by the insertion of surface markers that attach to specific cell surface receptors (Von der Leyen et al, 1995).
Figure 4. Adenoviruses are non-enveloped icosahedral particles. The capsid is built up from 252 capsomers of which 240 are hexavalent and 12 (situated at the apices) are pentavalent. From the Department of Medical Microbiology Website, University of Cape Town, written by Linda M Stannard, 1995. Virus Ultra Structure
Unlike retroviruses, adenoviruses can be used in in vivo, infecting replicating and non-replicating cells equally. They also have high transduction efficiencies with high levels of gene expression (Horwitz, 1990; Clemens et al, 1996). Adenoviruses induce a local inflammatory response and have a large complex genome making it difficult to manipulate (Kochanek et al, 1996; Schiedner et al, 1998). So several strategies have been developed to improve the use of adenoviruses, and researchers are creating what is called a “gutless” adenovirus that is devoid of all its native genetic material. It has been shown that this new virus causes less stimulation of the immune system with a longer duration of action and the ability to use larger transgenes (Kibbe et al, 2000; Fisher et al, 2001).
3. Adeno-associated viruses (AAVs) These are small DNA viruses that integrate successfully in one spot of the host’s genome (on chromosome 19 in humans). They can’t replicate by themselves and therefore require a helper virus, either adenovirus or herpes virus. Also they are non-pathogenic in humans, do not cause mutations and once integrated are stable leading to long term genetic expression which makes AAV an attractive tool for the management of chronic diseases from single gene mutation as well as acquired disorders, such as atherosclerosis (Summerford and Samulski, 1998). Other advantages of AAVs are that proliferating cells are not a requirement for transfection, it is relatively non-immunogenic, and the genome is small and easy to manipulate. A disadvantage of the small AAV genome is that the transferred genetic material is limited in size to a maximum of 4.9kb. It is challenging to produce this vector in large amounts without delivering an equally large amount of the contaminating helper virus. These problems with AAV production will soon be overcome, and it is becoming a very attractive vector for human gene therapy (Cheung et al, 1980; Jolly, 1994) (Figure 5).
354
Gene Therapy and Molecular Biology Vol 8, page 355
Figure 5. From the Avigen Company Website. 2001. DNA should be single stranded.
Figure 6. A liposome with showing the lipid bilayer with water inside. From the Collaborative Laboratories Website. Liposomes, controlled delivery systems. Updated April 22nd 2004.
III. New techniques for administering gene-based therapy and assessment of heart function One of the important considerations in developing cardiovascular gene transfer as a therapy is the ability to deliver the vector, viral or plasmid, to the desired tissue in a safe fashion. This is not a problem in peripheral vessels but proves to be quite a challenge in the coronary arteries (Nabel EG and Nabel GJ, 1999). In the peripheral vessels, adequate exposure at the time of surgery makes gene transfer feasible and also these vessels tolerate long periods of ischemia without serious consequences. In contrast, in the coronary bed, we must be able to access the lesion and occlude the vessel for an adequate amount of time to allow vector attachment and uptake without significantly compromising myocardial perfusion (Bailey, 1996) (Figure 7). In angiogenesis direct intramuscular injection of the desired vector into ischemic tissues, such as skeletal muscle or myocardium, allows local angiogenic factor expression to stimulate collateral blood vessel development (Baumgartner et al, 1998; Mack et al, 1998; Rosengart et al, 1999a). Researchers have modified this by injecting microspheres coupled to plasmids or growth factors that in turn can allow for slow release of the recombinant material into the surrounding tissue. (Arras et al, 1998).
Figure 7. From the Arizona Heart Institute Research Website. 2000-2001
355
Malik et al: Angiogenic gene therapy for ischemic cardiovascular diseases remodeling and dilatation of arterioles leading to the development of functional collaterals. Angiogenesis is a process that also occurs in adult tissues whereby new capillaries develop from preexisting vasculature. It is a dynamic, multi-step process and requires interaction of a variety of cells which involves retraction of pericytes from the surface of the capillary, release of proteases from the activated endothelial cells by VEGF family proteins, degradation of the extracellular matrix (ECM) surrounding the pre-existing vessels, endothelial migration towards an angiogenic stimulus and their proliferation, formation of tube-like structures, fusion of the formed vessels and initiation of blood flow. Matrix degradation and endothelial and smooth muscle cell/pericyte migration are modulated by interplay of numerous factors, including plasminogen activators, matrix metalloproteinases and their inhibitors. There are multiple additional regulators of endothelial and smooth muscle cell proliferation that are also important components of the angiogenic process (Ruel and Sellke, 2003). Initial trials with gene therapy using adenovirus have used a replication-deficient virus, serotype 5 (Ad5) in which the E1A and E1B genes have been removed and replaced with fibroblast growth factor-4 (FGF-4) may be promising.
A. Magnetic resonance imaging (MRI) MRI has evolved as a new non-invasive tool of accurately measuring and quantifying myocardial function and perfusion. The distinct advantages of MRI over current conventional nuclear-based cardiac imaging techniques, such as PET or myocardial scintigraphy, include its spatial resolution and lack of exposure of the patient to ionizing radiation. Also, quantification of cardiac morphology and function by MRI is more accurate and image quality is more reproducible than echocardiography, independent of the operatorâ&#x20AC;&#x2122;s skills and experience or each patientâ&#x20AC;&#x2122;s individual anatomy (Lederman et al, 2002). The new interventional MRI (iMRI) provides a realtime guidance for gene and cell delivery into the heart in addition to being a reliable tool in assessing the ventricular remodeling after myocardial infarction (Barbash et al, 2004).
B. Electro-mechanical mapping Left ventricular (LV) electromechanical mapping (EMM) can be used to distinguish among infarcted, ischemic, and normal myocardium. This system uses electromagnetic field sensors to combine and integrate real-time information from percutaneous intracardiac electrograms acquired at multiple endocardial locations. The resulting interrogations can be used to distinguish between infarcted and normal myocardium (Gepstein et al, 1998) and thus permit online assessment of myocardial function and viability (Kornowski et al, 1998). This could be used as a tool for assessing the effects of gene delivery in restoring the myocardial function after an infarct.
B. Regulation of angiogenesis Angiogenesis is held delicately in a balance, well orchestrated by the interplay of many cells and controlled by both positive and negative regulators. In the body, angiogenesis is controlled through a series of "on" and "off" switches. The "on" switches are angiogenesisstimulating factors, and the "off" switches are angiogenesis-inhibiting factors. There are more than 20 known angiogenic growth factors, and 30 known angiogenic inhibitors. Under normal physiological conditions, angiogenesis is "turned off" because there is more production of inhibitors than stimulators. But, this balance is a double-edged sword. Improper regulation of stimulators and inhibitors contributes to more than 70 pathological conditions such as tumor growth, rheumatoid arthritis, psoriasis, and diabetes mellitus (Sellke and Ruel, 2003). VEGF is the most widely studied and used factor for therapeutic angiogenesis. Several studies have been done where VEGF was directly delivered to a patientâ&#x20AC;&#x2122;s leg with known peripheral vascular disease (PAD) in the area surrounding a diseased artery. Within a few days, stimulation of the growth of new blood vessels around the blockage in the ailing blood vessel was found and this obviated the need for an amputation. Improved myocardial perfusion and function after the administration of angiogenic growth factors has been demonstrated in animal models of chronic myocardial ischemia. A recent clinical study reported beneficial long-term effects of therapeutic angiogenesis using FGF-2 protein in terms of freedom from angina and improved myocardial perfusion on nuclear imaging (Ruel and Sellke, 2003). For successful angiogenesis in ischemic heart disease and PAD, a sustained but transient expression of growth factors is required, which makes gene therapy a particular attractive therapeutic option.
IV. Angiogenesis and gene therapy For gene therapy to be successful in angiogenesis, the gene selected should code for a protein with a proven angiogenic activity, the vector used should provide high gene-transfer efficiency, the delivery technique should target the desired ischemic tissues and the procedure should be safe both in the long term and short term.
A. Process of new blood vessel formation A couple of trials have been done using gene therapy in angiogenesis with some promising results. Three different processes (vasculogenesis, arteriogenesis and angiogenesis) contribute to the growth of blood vessels. Vasculogenesis is the primary process responsible for growth of new vasculature during embryonic development and it is characterized by the differentiation of pluripotent endothelial cell precursors into endothelial cells that subsequently form primitive blood vessels (Bussolino et al, 1997). Arteriogenesis is the growth of collateral arteries that possess a fully developed tunica media or the enlargement of existing blood vessels that is seen in adult vessels. Recruited monocytes transform into macrophages, which produce numerous cytokines and growth factors (including tumor necrosis factor alpha (TNF-"), and basic fibroblast growth factor (b-FGF) involved in arteriogenesis (Wolf et al, 1998). These proteins stimulate
356
Gene Therapy and Molecular Biology Vol 8, page 357 high-dose Ad5FGF-4, and placebo) from centers with expertise in multiple vessel percutaneous revascularization procedures (Data on file, Berlex Laboratories, 2000 Report No. A02858) and patients will be followed clinically for up to 5 years and tracked for a further 10 years (Grines et al, 2003). Other potential areas for investigation include the use of Ad5FGF-4 as an adjunct to angioplasty, as well as the value of repeated administration of Ad5FGF-4 (Grines et al, 2003).
V. Gene therapy trials A. FGF trials Initial pre-clinical trials using animal models of chronic myocardial ischemia have shown that adenovirus5 with a gene coding for fibroblast growth factor-4 (Ad5FGF-4) delivery into coronary vessel reverses myocardial dysfunction and increases blood flow with a sustained response of approximately 2-3 months. This ultimately led to the initiation of the multi-center clinical trials known as the AGENT trials.
B. VEGF trials 1. AGENT and AGENT 2 trials
In one of the first human clinical trials, patients with ischemic heart disease were injected with naked plasmid encoding for VEGF directly into diseased myocardium and results showed marked improvement in blood flow and with reduction of symptoms related to ischemia (Losordo et al, 1998; Vale et al, 2000). In a more recent trial, patients (n=13) with symptomatic disease in spite of being treated with conventional modalities of therapy [medications, percutaneous transmural coronary angioplasty (PTCA) and /or coronary artery bypass grafting (CABG)] demonstrated significant reduction in infarct size after direct myocardial injection of phVEGF165 measured by serial single-photon emission CT-sestamibi imaging (Lathi et al, 2001). Also patients with advanced CAD (class 3 or 4 angina) receiving naked DNA-encoding VEGF165 through direct myocardial injection reported to experience reduced angina and sublingual nitroglycerin consumption and this improvement was maintained throughout a whole year of follow-up measured at different time points (Lathi et al, 2001; Fortuin et al, 2003). Following this success, a phase I study using intramuscular injection of adenoviral vector of VEGF121 gene demonstrated clinical safety with no evidence of systemic or cardiac related adverse effects related to the vector (Rosengart et al, 1999a; Hedman et al, 2003). Using the intra-coronary route for gene delivery encoding for VEGF165 produced promising results with significant increase in myocardial perfusion although no differences in clinical restenosis rate or minimal lumen diameter were present after the 6-month follow-up (Aoki et al, 2000).
This was the first multi-center US clinical, randomized, double-blinded, placebo-controlled trial using Ad5-FGF4 for the treatment through the stimulation of angiogenesis of myocardial ischemia. The main focus of this trial was safety of intracoronary route for gene delivery. Patients with chronic stable angina were given incremental doses of ad5fgf-4 to know the optimum dose for use in future trials. It was not powered to evaluate the dose response or the efficacy. Both the treatment and placebo groups were well matched in terms of disease characteristics. Results showed that administration of ad5fgf-4 by intra-coronary route is safe and well tolerated and patients had a significant increase in their exercise tolerance when compared to placebo suggesting an improvement in myocardial dysfunction (Grines et al, 2002). AGENT 2 was designed to evaluate the potential of Ad5FGF-4 in promoting new blood formation thus reversing the ischemic insult and to reassess its safety (Grines et al, 2003). Seventy-nine were included in the first and 52 patients in the second trial. Patients who received Ad5FGF-4 experienced complete resolution of symptoms (30% vs. 13%) and less usage of medications to relieve their angina (43% vs. 17%) when compared to patients who received placebo. In addition, the incidence of worsening/unstable angina and revascularization by coronary artery bypass grafting or angioplasty was considerably lower in the Ad5FGF-4 group (6% and 6%, respectively) compared with those in the placebo group (24% and 16%, respectively). But some of these results did not reach a statistical significance (Data on file, Berlex Laboratories, 1998 Report No. A02854, 2000 Report No. A02856).
C. HGF trials Another angiogenic factor that looks promising is hepatocyte growth factor (HGF), which was reported to promote angiogenesis in animal models of myocardial infarction (Ueda et al, 1999). HGF has been found to inhibit collagen synthesis and through different mechanisms stimulate its degradation and this interesting function can be used as a tool in the treatment of post myocardial infarction fibrotic cardiomyopathy (Taniyama et al, 2002).
2. AGENT 3 and AGENT 4 trials The results from the first two AGENT trials have provided preliminary encouraging data about the safety and anti-ischemic effects of Ad5FGF-4. Larger, long-term trials that could evaluate better the potential risks, benefits and complications looking into the short- and long-term safety and efficacy parameters were needed. AGENT 3 and AGENT 4 are 2 ongoing double-blind, placebo-controlled trials with AGENT 3 is being conducted exclusively in the United States, whereas AGENT 4 is a multinational study (Europe, Canada, United States, and Latin America). Each trial will recruit 450 patients (150 patients each on low-dose Ad5FGF-4,
VI. Conclusion Encouraging preliminary data suggest the possible use of gene therapy in the treatment of advanced coronary
357
Malik et al: Angiogenic gene therapy for ischemic cardiovascular diseases Dzau VJ. (2003) Predicting the future of human gene therapy for cardiovascular diseases, what will the management of coronary artery disease be like in 2005 and 2010? Am J Cardiol 92, 32n-35n. Feldman LJ, Steg G. (1997) Optimal techniques for arterial gene transfer. Cardiovasc Res. 35, 391-404. Fisher KD, Stallwood Y, Green NK, Ulbrich K, Mautner V, Seymour LW. (2001) Polymer-coated adenovirus permits efficient retargeting and evades neutralising antibodies. Gene Ther. 8, 341-348. Flugelman MY, Jaklitsch MT, Newman KD, Casscells W, Bratthauer GL, Dichek DA. (1992) Low level in vivo gene transfer into the arterial wall through a perforated balloon catheter. Circulation. 85, 1110-1117. Fortuin FD, Vale P, Losordo DW, et al. (2003) One-year followup of direct myocardial gene transfer of vascular endothelial growth factor-2 using naked plasmid deoxyribonucleic acid by way of thoracotomy in no-option patients. Am J Cardiol 92, 436-439. Gepstein L, Goldin A, Lessick J, et al. (1998) Electromechanical characterization of chronic myocardial infarction in the canine coronary occlusion model. Circulation 98, 20552064. Grines C, Watkins M, Mahmarian J, Iskandrian A, Rade J, Marrott P, Pratt C, Kleiman N. (2003) A randomized double blind placebo-controlled trial of Ad5FGF-4 gene therapy and its effect on myocardial perfusion in patients with stable angina. J Am Coll Cardiol 42, 1339-1347. Grines CL, Watkins MW, Helmer G, Penny W, Brinker J, Marmur JD, West A, Rade JJ, Marrott P, Hammond HK, Engler RL. (2002) Angiogenic Gene Therapy (AGENT) trial in patients with stable angina pectoris. Circulation 105, 1291-1297. Hedman M, Hartikainen J, Syvanne M, et al. (2003) Safety and feasibility of catheter-based local intracoronary vascular endothelial growth factor gene transfer in the prevention of postangioplasty and in-stent restenosis and in the treatment of chronic myocardial ischemia, phase II results of the Kuopio Angiogenesis Trial (KAT). Circulation 107, 26772683. Horwitz M. ( 1990) The adenoviruses. In, Fields BN, Knipe DM, eds. Virology. New York, NY, Raven Press, 1723. Jolly D. (1994) Viral vector systems for gene therapy. Cancer Gene Ther. 1, 51-64. Kibbe MR, Murdock A, Wickham T, et al. (2000) Optimizing cardiovascular gene therapy, increased vascular gene transfer with modified adenoviral vectors. Arch Surg 135, 191-197. Kochanek S, Clemens PR, Mitani K, Chen HH, Chan S, Caskey CT (1996) A new adenoviral vector, replacement of all viral coding sequences with 28 kb of DNA independently expressing both full-length dystrophin and betagalactosidase. Proc Natl Acad Sci U S A 93, 5731-5736. Kornowski R, Hong MK, Leon MB. (1998) Comparison between left ventricular electromechanical mapping and radionuclide perfusion imaging for detection of myocardial viability. Circulation 98, 1837-1841. Lathi KG, Vale PR, Losordo DW, et al. (2001) Gene therapy with vascular endothelial growth factor for inoperable coronary artery disease, anesthetic management and results. Anesth Analg 92, 19-25. Lederman RJ, Guttman MA, Peters DC, et al. (2002) Catheterbased endomyocardial injection with real-time magnetic resonance imaging. Circulation 105, 1282-4. Losordo DW, Vale PR, Symes JF, et al. (1998) Gene therapy for myocardial angiogenesis, initial clinical results with direct myocardial injection of phVEGF165 as sole therapy for myocardial ischemia. Circulation 98, 2800-2804.
artery disease that is not amenable to conventional treatment options (Dzau et al, 2003; Sleight, 2003). Indeed, larger-scale, clinical trials are currently underway at centers throughout the world. These trials will characterize further the riskâ&#x20AC;&#x201C;benefit profile of various products, the optimal dose that should be administered, and the patient population likely to derive greatest benefit (Dzau, 2003). Attempts at developing non-viral direct DNA therapy delivered through the intravenous route are currently underway and with the use of advanced technology the possibility of making gene therapy a simple outpatient procedure does not seem remote.
References Aoki M, Morishita R, Taniyama Y, et al. (2000) Angiogenesis induced by hepatocyte growth factor in non-infarcted myocardium and infarcted myocardium, up-regulation of essential transcription factor for angiogenesis, ets. Gene Ther 7, 417-427. Armeanu S, Pelisek J, Krausz E, et al. (2000) Optimization of nonviral gene transfer of vascular smooth muscle cells in vitro and in vivo. Mol Ther 1, 366-375. Arras M, Mollnau H, Strasser R, et al. (1998) The delivery of angiogenic factors to the heart by microsphere therapy. Nat Biotechnol 16, 159-162. Bailey SR. (1996) Mechanisms of delivery and local drug delivery technologies. Semin Interv Cardiol 1, 17-23. Barbash IM, Leor J, Feinberg MS, et al. (2004) Interventional magnetic resonance imaging for guiding gene and cell transfer in the heart. Heart 90, 87-91. Baumgartner I, Pieczek A, Manor O, et al. (1998) Constitutive expression of phVEGF165 after intramuscular gene transfer promotes collateral vessel development in patients with critical limb ischemia. Circulation 97, 1114-1123. Bussolino F, Mantovani A, Persico G. (1997) Molecular mechanisms of blood vessel formation. trends Biochem Sci 22, 251-256 Cheung AK, Hoggan MD, Hauswirth WW, Berns KI. (1980) Integration of the adeno-associated virus genome into cellular DNA in latently infected human Detroit 6 cells. J Virol 33, 739-748. Clemens PR, Kochanek S, Sunada Y, et al. (1996) In vivo muscle gene transfer of full-length dystrophin with an adenoviral vector that lacks all viral genes. Gene Ther 3, 965-972. Clowes WA (1997) Vascular Gene Therapy in the 21st Century. Thromb Haemost 78, 605-610 Data on file, Berlex Laboratories, (1998) Report No. A02854 (Ad5FGF-4 dose-response study in ameroid pig) Data on file, Berlex Laboratories, (2000) Report No. A02856 (Chronic efficacy study following single administration of Ad5FGF-4.) Data on file, Berlex Laboratories, (2000) Report No. A02858 (Effect of high anti-Ad5 antibody titer on the efficacy ofAd5FGF-4 in an ameroid model of myocardial ischemia) Data on file, Berlex Laboratories, (2003) Report No. A02950 (Systemic toxicology, distribution and expression following intracoronary or left ventricular administration of Ad5FGF-4 in swine) Dzau VJ, Beatt K, Pompilio G, Smith K. (2003) Current perceptions of cardiovascular gene therapy. Am J Cardiol 92, 18N-23N Dzau VJ, Mann MJ, Morishita R, Kaneda Y. (1996) Fusigenic viral liposome for gene therapy in cardiovascular diseases. Proc Natl Acad Sci U S A. 93, 11421-11425.
358
Gene Therapy and Molecular Biology Vol 8, page 361 Gene Ther Mol Biol Vol 8, 361-368, 2004
Targeting Myc function in cancer therapy Review Article
William L. Walker, Sandra Fernandez and Peter J. Hurlin* Shriners Hospitals for Children and Department of Cell and Developmental Biology, Oregon Health Sciences University, 3101 Sam Jackson Park Road, Portland, Oregon 97201 USA
__________________________________________________________________________________ *Correspondence: Peter J. Hurlin, Shriners Hospitals for Children and Department of Cell and Developmental Biology, Oregon Health Sciences University, 3101 Sam Jackson Park Road, Portland, Oregon 97201 USA; Tel: +1 503 221 3438; Fax: +1 503 221 3451; e-mail: pjh@shcc.org Key words: Myc, Max, Mnt, apoptosis Received: 23 July 2004; Accepted: 23 August 2004; electronically published: August 2004
Summary The development of novel therapeutic strategies to improve the survival rate of patients with cancer requires a better understanding of the critical events that underlie the origins and progression of tumors. The Myc family of transcription factors play important normal roles in regulating cell proliferation and their deregulated or elevated expression is one of the most common features of cancer cells. Here, we review mechanisms thought to underlie Myc-dependent tumor formation and discuss possible strategies for disrupting the oncogenic activity of Myc family proteins.
cells that escape cell death. This type of scenario was shown to play out in cultured primary cells exposed to high c-Myc levels (Zindy et al, 1998). Typically, cells that escaped Myc-driven apoptosis in culture, harbored defects in the p53 tumor suppressor pathway (Zindy et al, 1998), which serves as an important mediator apoptosis in general and of Myc-driven apoptosis specifically (Sherr, 2001). Mutations in the p53 pathway, in theory, help clear the path for Myc-driven tumorigenesis by not only preventing apoptosis (Figure 1), but by also disabling important checkpoints governed by p53 that prevent excessive cell proliferation (Sherr, 2001). Proof of this principal has been obtained in the results of crosses between transgenic mice that overexpress c-Myc and ones that have abrogated p53 pathway function. In this environment, tumorigenesis is typically accelerated, often dramatically (Nilsson and Cleveland, 2003). Taken together, these results demonstrate that Myc deregulation has the potential to function as an early, initiating event in the evolution of tumor cells and, at least theoretically, may be partially responsible for the high proportion of human tumors that exhibit mutations in genes encoding p53 or its positive regulator p19ARF. In addition to mutations that disrupt the p53 pathway, Myc-dependent apoptosis can be disarmed through a variety of other mechanisms (Nilsson and Cleveland, 2003). Most notably, this can be accomplished by overexpression of anti-apoptotic proteins such as Bcl2 and BclXL (Strasser et al, 1990; Pelengaris et al, 2002b) and
I. Introduction Deregulated expression of members of the Myc family of genes is a common feature of diverse malignancies. Myc gene amplification and gene translocation are often responsible, but abnormally high Myc levels are also observed in numerous tumors that show no such defects. Although it is not possible to discriminate between cause and effect when evaluating the role of Myc in human tumors, a large collection of experimental results from cell culture and animal models clearly demonstrate that deregulated Myc expression can function as a root cause of cancer. How do Myc proteins contribute to the tumor phenotype? The use of transgenic mice containing inducible Myc genes or activatable forms of Myc, together with more traditional types of transgenic models, have led to, or confirmed, the identification of several Myc activities that can be a factor in tumor formation. These activities include stimulating cell proliferation, promoting vasculogenesis and, paradoxically, promoting or sensitizing cells to apoptosis. Although Myc driven apoptosis can be regarded as a safeguard or tumor suppressor mechanism (Huebner and Evan, 1998; Pelengaris et al, 2002a), when combined with its affects on cell proliferation and vasculogenesis, this activity has the potential to ultimately have the reverse effect. Because Myc deregulation/overexpression can stimulate both proliferation and apoptosis, it has the capability of applying strong selection pressure for the development of 361
Walker et al: Targeting Myc function in cancer therapy loss of proapoptotic proteins such as Bax (Eischen et al, 1991). Thus, events that cripple Myc-dependent apoptosis, but leave its other proliferation-promoting activities intact, cooperate to drive tumor formation (Figure 1). Based on the model presented above, tumors that exhibit excessively high and/or deregulated Myc expression, must either have lost their apoptotic response
to Myc or are not programmed to respond in this manner. The latter situation appears to exist in certain cell types, such as skin keratinocytes (Gandarillas and Watt, 1997; Pelengaris et al, 1999;Waikel et al; 1999, 2001). When cMyc expression was induced in suprabasal mouse keratinocytes, cells committed to terminal differentiation, they reinitiated cell proliferation and formed highly
Figure 1. Model outlining activities and events associated with Myc-dependent tumor formation. When normal cells (gray) are subjected to Myc deregulation (blue), they become hyperproliferative. In the absence of sufficient growth/survival factors and nutrients to support hyperproliferation, cells are stressed to the point that they undergo apoptosis (purple). Myc overexpressing cells that sustain secondary events allowing escape from an apoptotic fate, such as mutational disruption of p53 pathway function or upregulation of anti-apoptotic proteins such as Bcl2 and BclXL, continue to proliferate (green), In addition to promoting cell proliferation, Myc stimulates vasculogenesis and angiogenesis, activities that ultimately drive tumor formation.
362
Gene Therapy and Molecular Biology Vol 8, page 363 vascularized papillomas (Pelengaris et al, 1999). Although apoptosis appears to be minimal in this setting, the formation of tumors was limited due to the retention and advance of the keratinocyte terminal differentiation program. In other words, Myc seemed to cause suprabasal keratinocytes to revert to a basal-like phenotype that ultimately produced differentiated “squames” that slough off the skin surface (Pelengaris et al, 1999; Waikel et al, 2001). This is a surprising result since Myc has the demonstrated activity of suppressing the differentiation programs of many other cell types while promoting their proliferation (Grandori et al, 2000). Moreover, in terms of the response to deregulated/elevated Myc expression, the lack of increased apoptosis in keratinocytes appears to be the exception rather than the rule. A potential explanation for these results is that skin keratinocytes have a higher threshold for induction of apoptosis. Because of their location at the body surface and therefore frequent exposure to stresses capable of inducing apoptosis (e.g. UV light), a higher apoptosis threshold may have evolved specifically in keratinocytes to help insure the integrity of our skin. For example, keratinocytes may have naturally high levels of certain anti-apoptotic proteins or low levels of proapoptotic proteins compared to other cell types. Clearly, there is still much to be learned about the conditions that determine the response primary cells in vivo have to deregulated and/or overexpressed Myc and mechanisms that ultimately lead to tumorigenesis. Moreover, understanding the detailed molecular mechanisms that underlie Myc-dependent tumorigenesis in different cancers will ultimately provide specific, efficatious targets for the development of therapeutic drugs.
These latter results and the finding that homozygous deletion of c-Myc and N-myc cause mid-gestation lethality, also illustrate the seemingly obvious point that, even if Myc genes could be targeted for downregulation in vivo, this would probably have to be largely confined to the tumor cell population. However, the great majority of tumors occur in adults, which of course contain a much smaller pool of proliferating cells than a fetus or prepubescent individual. Thus, assuming that the only effect of targeting Myc downregulation is decreased proliferation, this strategy may actually be less destructive to normal proliferating cell populations than many standard chemotherapeutic agents that may also negatively impact non-proliferating cells. Moreover, because of the overlapping tissue expression patterns of the three wellcharacterized Myc family genes, c-Myc, L-Myc and NMyc, systemic downregulation of any one of the Myc genes – in an attempt to target its overexpression (or normal expression) in a specific tumor – may have a quite limited deleterious effect overall. This would probably be most true for L-Myc and N-Myc, which exhibit a more limited expression range than c-Myc (Mugrauer et al, 1988; Downs et al, 1989; Hatton et al, 1995). Thus, for example, targeting L-Myc downregulation to treat small cell lung carcinoma, which frequently exhibit L-Myc amplification, by systemic application of L-Myc anti-sense oligos, morpholinos, or siRNA, may have a minimal organism-wide deleterious effect. Further, unlike the lethality caused by N-Myc and c-Myc deletion in mice, mice lacking L-Myc appear normal, supporting the hypothesis that there would be minimal impact outside of a L-Myc-dependent tumor. It has been demonstrated that antisense oligonucleotides targeting c-Myc, L-Myc and N-Myc can be effective at slowing the proliferation of particular tumor cell types in culture and in partially ameliorating tumorassociated phenotypes (Wickstrom et al, 1988; Schmidt et al, 1994; Dosaka-Akita et al, 1995; Smith et al, 1998; Waelti and Gluck, 1998; Iversen et al, 2003; Pastorino et al, 2003). Further, it has been observed that systemic introduction of Myc antisense agents can lead to significant tumor regression in mouse tumor xenografts (Schmidt et al, 1994; Iversen et al, 2003; Pastorino et al, 2003). However, these studies have been largely preliminary in nature and, to date, there has been no follow-up evidence supporting the notion that this type of approach works on human tumors. It seems that the greatest limitation to this approach is instability of antisense agents and consequently an inability for them to effectively reach and enter enough tumor cells to have a significant impact. Perhaps the development of next generation antisense Myc agents that may have a longer half-life in vivo (Iversen et al, 2003) or adjuvant vehicles to better deliver the agents to tumors will aid their effectiveness.
II. Potential therapeutic strategies that target Myc expression and activity A. Turning Myc off The most obvious way to prevent Myc-dependent tumorigenesis is to target its downregulation or inactivation in tumors. Transgenic mice expressing Myc under the control of an inducible promoter or expressing an activatible form of Myc (Myc-estrogen receptor fusions), have clearly demonstrated that tumors induced by ectopic Myc expression typically remain dependent on the artificially deregulated and typically elevated Myc levels (Felsher and Bishop, 1999; Pelengaris et al, 1999, 2002b; D’Cruz et al, 2001). Thus, “turning off” Myc subsequent to tumor formation has been found to lead to rapid tumor regression. Although in some settings a subpopulation of cells ultimately become resistant to Myc downregulation, these results clearly indicate that therapies targeting inactivation of Myc in tumors would at least temporarily slow tumor growth. Indeed, this would most likely be true whether or not a tumor exhibited Myc deregulation/overexpression, as targeted deletion of c-Myc in both primary and “immortal” cells has been demonstrated to cause a dramatic reduction in their ability to proliferate (Mateyak et al, 1997; Trumpp et al, 2001; de Alboran et al, 2001).
B. Restoring Myc-dependent apoptosis in tumors As discussed above, transgenic models of Mycdriven tumor formation using inducible and/or activatible systems have demonstrated that most tumors regress 363
Walker et al: Targeting Myc function in cancer therapy following “inactivation” of Myc. In this setting, a basic assumption had been that reactivating or turning Myc back on would reinitiate tumorigenesis. Surprisingly, this was found not to be the case in osteosarcomas produced in transgenic mice using an inducible c-Myc expression system (Jain et al, 2002). Termination of ectopic c-Myc expression caused restoration of osteocyte differentation and tumor regression and subsequent restoration of ectopic c-Myc expression led to apoptosis and a failure to promote tumor formation (Jain et al, 2002). Mechanisms underlying this unexpected phenomenon have yet to be defined and it is not known whether this is a general response of cells to temporary downregulation of oncogenic levels of Myc. Although many questions remain, reactivation of Myc-driven apoptosis has obvious implications for tumor therapy (Felsher and Bradon, 2003). For example, some tumors might be especially vulnerable to transient downregulation of Myc protein levels using existing antisense and siRNA technologies as discussed above. Such a protocol would ameliorate the potential side effects of sustained systemic delivery of such agents. Further, there transient use, combined with chemotherapeutic drugs known to exacerbate Myc-driven apoptosis, might offer even more promise. Because defective apoptosis appears to be a common mechanism underlying Myc-dependent progression to tumor formation, as well as tumor progression in general, restoring apoptosis in tumors offers great promise as a cancer therapy. The prevalence of p53 pathway defects in tumor cells, has made restoring p53 pathway function the primary focus in this area. Indeed, considerable progress has been made in this effort and drugs with the potential of restoring wildtype p53 function to mutated and defective p53 proteins have been identified and are currently being tested in clinical trials (Wang and El-Diery, 2004). The anti-apoptotic BCL-2 family proteins are also attractive targets for drug design, as they are known to cooperate with ectopic Myc expression in tumorigenesis and are expressed at elevated levels in a wide variety of tumor types (Nilsson and Cleveland, 2003). BCL2-specific antisense oligonucleotides have been developed that show broad anti-cancer activities in pre-clinical models and are currently being tested in several late-stage clinical trials (Hu and Kavanagh, 2003; Manion and Hokenbery, 2004). While drugs that target restoration of apoptotic pathways appear to have general anti-tumor activity, tumors that exhibit deregulation and/or overexpressed of Myc family proteins may be particularly vulnerable to this type of therapy.
conserved tripartite activation domain in the N-terminal half of Myc family proteins (Grandori et al, 2000). Many different proteins have been found that interact within this region and mediate or modulate Myc-dependent transcription. As if this were not complicated enough, Myc proteins can also repress transcription, an activity that involves protein-protein interactions in regions that sometimes overlap with their activation domains (Grandori et al, 2000). Because of the obligate role Max plays in Myc function, interaction between Myc and Max and between Myc:Max heterodimers and DNA offer attractive targets for drug design. The same is true for protein – protein interactions that mediate the transcriptional properties of Myc. Drugs that interfere with either the Myc:Max interaction or with Myc:Max DNA binding would be expected to abolish Myc activity, whereas drugs that interfere with interactions between Myc and coactivator or corepressor proteins may have a more limited or selective affect on Myc function. Because Max interacts with a number of other proteins that contain Myc-like HLHZip regions (Grandori et al, 2000), there is the real problem of specificity in targeting the Myc:Max interaction, as drugs that interfere with Myc:Max interactions may also interfere with other Max - HLHZip interactions, with unknown consequences for the cell. Nonetheless, small molecules have been identified that disrupt Myc:Max heterodimerization using a yeast two-hybrid approach, and they seem to have specific effects in suppressing Myc activities (Yin et al, 2003). Potential problems of specificity may also arise in drugs that target Myc:Max DNA binding, as they may affect DNA binding by members of a large number of additional proteins that contain a “basic” region DNA binding motif. Finally, because the molecular mechanisms that mediate the transcriptional activities of Myc family proteins are still confusing, it is not clear whether targeting any of the many interactions thought to control Myc transcription would cripple its functions in tumorigenesis. However, one potential target is the interaction between Myc and the coactivator TRRAP (McMahon et al, 1998 –Figure 2). Interaction with TRRAP was found to be required for Myc-dependent transformation (McMahon et al, 1998; Park et al, 2001) and regions within these proteins that mediate the interaction have been mapped. Thus small molecules that disrupt this interaction might be effective in blocking tumor-promoting activities of Myc. A second potential target is the interaction between Myc and Miz1 (Wanzel et al, 2003). Miz1 is a transcriptional activator whose activities are repressed by interaction with Myc which causes displacement of the Miz1 coactivator protein CBP (Staller et al, 2001, Herold et al, 2002). Through this mechanism, Myc was found to disrupt Miz1-dependent transcriptional activation of the genes encoding cyclin-dependent kinase inhibitors p15INK4D and p21CIP1 (Herold et al, 2002; Seoane et al, 2002). The p21CIP1 gene is a key transcriptional target of p53, and by suppressing its transcription, Myc appears to suppress the cell cycle arrest functions of p53, but not its pro-apoptotic function. Therefore, in cells that have an intact p53 pathway, the development of drugs that disrupt.
C. Targeting disruption of functional Myc complexes The biological function of Myc family proteins is highly dependent on the integrity of its basic-helix-loophelix leucine zipper motif (bHLHZip – Grandori et al, 2000). The HLHZip motif mediates interaction with another bHLHZip protein, Max, which facilitates binding of the basic regions of the Myc:Max heterodimer to the DNA sequence CACGTG and related “E-box” sites . The Myc:Max heterodimer can activate transcription in reporter assays, an activity mediated primarily through a 364
Gene Therapy and Molecular Biology Vol 8, page 365
Figure 2. Speculative Myc-Mnt antagonism model. Myc (c-Myc, N-Myc and L-Myc) and Mnt compete for interaction with their obligate heterodimerization partner Max and for binding and regulation of shared transcriptional target genes. Myc:Max complexes activate transcription through recruitment of coactivator proteins such as TRRAP and TRRAP-associated GCN5, a histone acetyltransferase. Of note, TRRAP is one of many proteins found to interact with Myc and affect its ability to activate transcription. In contrast to Myc, Mnt represses transcription through its interaction with Sin3 corepressor proteins, which tethers histone deacetylating (HDAC) enzymes. Ubiquitous Mnt:Max complexes are postulated to create a threshold of transcriptional repression at shared Myc/Mnt target genes that is overcome, and proliferation promoted, when Myc levels are expressed at sufficiently high levels.
intact p53 pathway, the development of drugs that disrupt interaction between Myc and Miz1 would theoretically cause increased susceptibility to Myc-dependent apoptosis.
D. Interfering with pathways regulated by Myc
zero in on specific Myc transcriptional targets as candidate drug targets, it may be fruitful to focus on disrupting more downstream events that ultimately contribute to the oncogenic activity of Myc. In many, and perhaps most cases, such events are probably not unique to Myc-driven oncogenesis, but represent general attributes of tumor cells that Myc can provoke or enhance. One example of this is vasculogenesis - the production of new blood vessel networks, and angiogenesis - the remodeling and expansion of this blood vessel networks. Vasculogenesis and angiogenesis provides for the increased blood supply required to support the ever-growing nutritional needs of neoplastic tissues during tumorigenesis. Ectopic expression/activation of Myc in transgenic mice has been found to stimulate angiogenesis and vasculogenesis (Pelengaris et al, 1999, 2002b). Further, the vasculature network formed in neoplastic tissues was dependent on continued ectopic Myc expression. In addition, it was recently revealed that angiogenesis and vasculogenesis is defective in c-Myc null embryos and this deficiency was linked to the inability of c-Myc null embryonic stem cells to form tumors in Skid mice (Baudino et al, 2003). These studies, together with data indicating that Myc can regulate, either directly or indirectly, the expression of a number of important factors involved in angiogenesis and
downstream
Because Myc family proteins are transcriptional regulators, it would seem that disrupting the function of proteins encoded by its transcriptional target genes would offer an effective way at disarming Myc function. However, the identification of bona fide Myc target genes has been at best difficult and at worse, misleading (Eisenman, 2001). Moreover, recent findings support the view that Myc functions are not mediated by itâ&#x20AC;&#x2122;s regulation of a small number of key transcriptional targets, but instead through itâ&#x20AC;&#x2122;s binding and regulation of perhaps thousands of different genes (see http//www.myc-cancergene.org for an updated list). Although it is not clear how many different genes Myc actually regulates, it is clear that it broadly affects the gene expression profile of cells. This is also reflected at the protein level, where changes, up and down, of broad categories of proteins have been observed following ectopic Myc expression (Ishii, et al, 2002). Therefore, instead of - or in addition to - trying to
365
Walker et al: Targeting Myc function in cancer therapy vasculogenesis (Baudino et al, 2003 and references therein), support the idea that drugs that disrupt neovascularization will be effective in disrupting Mycdependent tumorigenesis. Because neovascularization is a common and necessary feature of tumor growth in general, the development and testing of such drugs has been the focus of intense study for several years. However, the drugs that have been developed have, so far, yet to prove effective against human tumors (Siemann et al, 2004). Thus, perhaps models of Myc-driven tumorigenesis may provide a useful setting to more precisely define the critical mechanisms responsible for neo-vasculogenesis and a useful system to test novel drugs designed to disrupt new blood vessel formation. Another pathway modulated by Myc family proteins that is likely generally important in tumorigenesis is cell growth. Cell growth refers to the increased cell size associated with progression through specific phases of the cell cycle. Before cells divide, they increase their cell mass and volume in order to maintain a consistent size of daughter cells (Saucedo et al, 2002). It is hypothesized that Myc regulates cell size by stimulating the expression, directly or indirectly, of genes encoding proteins required for protein synthesis (Jones et al, 1996; Greasly et al, 2000) and by assisting RNA polymerase III in the transcription activation of transfer and ribosomal (5S) RNAs (Gomez-Roman et al, 2003). Although these Myc activities might be considered potential targets for therapeutic intervention in tumors, disrupting fundamental components of the protein synthesis machinery, that are not necessarily coupled to cell proliferation, might be expected to have strong adverse effects on non-tumor tissues as well. However, the activity of mTOR, a central regulator of cell growth, survival and protein translational control is a key target of the drug rapamycin and related compounds that show promise as anticancer agents (Bjornsti and Houghton, 2004). Indeed, rapamycin has been shown to be effective at reversing chemotherapeutic resistance of Myc-dependent mouse lymphomas that express Akt, an important regulator of mTOR activity and cell survival (Wendel et al. 2004). In addition, inhibition of mTOR activity by rapamycin can lead to c-Myc downregulation in some cell types, (Gera et al, 2004), and has been shown to inhibit transcription of the telomerase catalytic subunit hTERT gene (Zhou et al, 2003), a direct target of c-Myc transcriptional activation (Grandori et al, 2000) and putative oncogene. Thus, inhibitors of mTOR activity may ultimately prove efficacious on human tumor subsets that can be defined as exhibiting Myc deregulation, particularly ones showing activation of Akt/mTOR signalling.
III. Stimulating antagonists
endogenous
each of these proteins can suppress the ability of Myc family proteins to transform normal cells in culture to tumor-like cells (Grandori et al, 2000). From these results it has been speculated that this group of proteins normally function as Myc antagonists in cells and would therefore act as tumor suppressors in vivo. Although there is no definitive evidence for a role as tumor suppressors in human cancers for any of these proteins, disruption of mouse Mxi1 (a.k.a. Mad2) and Mnt genes was shown to predispose certain cell types to tumorigenesis (SchreiberAgus et al, 1998; Hurlin et al, 2003). In the case of Mnt, conditional deletion in mammary epithelium led to the formation of breast tumors. A conditional deletion approach was required in these experiments because homozygous germline deletion of Mnt is early postnatal lethal (Hurlin et al, 2003; Toyo-oka et al, 2004) and studies are underway by our group to test whether loss of Mnt leads to tumors in other tissues. Further support for the idea that Mnt functions as a Myc antagonist comes from cell culture experiments. MEFs lacking Mnt were found to exhibit several of the hallmark attributes of cells caused by ectopic Myc expression, including being sensitized to apoptosis, having cell cycle entry defects and showing an enhanced rate of senescence escape (Hurlin et al, 2003). Suppression of Mnt by siRNA also caused increased apoptosis, even in an immortal cell line lacking c-Myc (Nilsson et al, 2004). Although these data generally support the notion that Mnt is a Myc antagonist, because of the complicated transcriptional activities of Myc family proteins, this is somewhat difficult to unequivocally prove and requires much more work. Nonetheless, these data, particularly the finding of increasing sensitivity to apoptosis by Mnt deficiency, raise the possibility that Mnt and possibly other Max-interacting repressor proteins may serve as future cancer therapeutic targets.
IV. Conclusion Myc family proteins serve as essential regulators of cell proliferation and events that uncouple Myc transcriptional gene expression from growth factor signaling, push cells into a proliferative mode and makes them prone to malignant conversion. If the local growth/survival factor and nutrient environment is sufficient, cell proliferation will occur, but when the environment is, or becomes unfavorable to cell proliferation, apoptotic cell death typically ensues. Thus, sustained Myc-driven proliferation, and ultimately tumor formation, is thought to require cooperation with secondary events that either provide a favorable growth factor/nutritional environment or that suppress apoptosis (or both). This understanding of Myc-dependent tumorigenesis has led to efforts to directly suppress Myc expression in tumors and initiatives to restore defective pro-apoptotic pathways in tumors. While these approaches may ultimately be successful, the identification and development of new therapeutic strategies and eventually drugs targeting Myc functions in tumorigenesis will require a more precise understanding of the complicated molecular mechanisms underlying the normal and oncogenic activities of Myc family proteins.
Myc
Besides Myc family proteins, Max interacts with another set of bHLHZip proteins that include the four Mad family proteins (Mad1, Mxi1-Mad2, Mad3 and Mad4), Mnt and Mga (Grandori et al, 2000). Like Myc:Max, these alternative Max complexes bind to E-box sequences, but appear to function as dedicated repressors. Furthermore, 366
Gene Therapy and Molecular Biology Vol 8, page 367 Hueber AO and Evan GI (1998) Traps to catch unwary oncogenes. Trends Genet 14, 364-367. Hurlin PJ, Zhou ZQ, Toyo-oka K, Ota S, Walker WL, Hirotsune S, Wynshaw-Boris A (2003) Deletion of Mnt leads to disrupted cell cycle control and tumorigenesis. Embo J 22, 4584-4596. Iversen PL, Arora V, Acker AJ, Mason DH and Devi GR (2003) Efficacy of antisense morpholino oligomer targeted to c-myc in prostate cancer xenograft murine model and a Phase I safety study in humans. Clin Cancer Res 9, 2510-2519. Jain M, Arvanitis C, Chu K, Dewey W, Leonhardt E, Trinh M, Sundberg CD, Bishop JM and Felsher DW (2002) Sustained loss of a neoplastic phenotype by brief inactivation of MYC. Science 297, 102-104. Jones RM, Branda J, Johnston KA, Polymenis M, Gadd M, Rustgi A, Callanan L, Schmidt EV (1996) An essential E box in the promoter of the gene encoding the mRNA cap-binding protein (eukaryotic initiation factor 4E) is a target for activation by c-myc. Mol Cell Biol 16, 4754-4764. Manion MK and Hockenbery DM (2003) Targeting BCL-2related proteins in cancer therapy. Cancer Biol Ther 2, S105-114. Mateyak MK, Obaya AJ, Adachi S and Sedivy JM (1997) Phenotypes of c-Myc-deficient rat fibroblasts isolated by targeted homologous recombination. Cell Growth Differ 8, 1039-1048. McMahon SB, Van Buskirk HA, Dugan KA, Copeland TD and Cole MD (1998) The novel ATM-related protein TRRAP is an essential cofactor for the c-Myc and E2F oncoproteins. Cell 94, 363-374. Mugrauer G, Alt FW and Ekblom P (1988) N-myc protooncogene expression during organogenesis in the developing mouse as revealed by in situ hybridization. J Cell Biol 107, 1325-1335. Nilsson, JA and Cleveland, JL (2003) Myc pathways provoking cell suicide and cancer. Oncogene 22, 9007-9021. Nilsson, JA, Maclean, KH, Keller, UB, Pendeville, H, Baudino, TA and Cleveland, JL (2004) Mnt loss triggers Myc transcription targets, proliferation, apoptosis, and transformation. Mol Cell Biol 24, 1560-1569. Park J, Kunjibettu S, McMahon SB, Cole MD (2001) The ATMrelated domain of TRRAP is required for histone acetyltransferase recruitment and Myc-dependent oncogenesis. Genes Dev 15, 1619-1624. Pastorino F, Brignole C, Marimpietri D, Pagnan G, Morando A, Ribatti D, Semple SC, Gambini C, Allen TM and Ponzoni M (2003) Targeted liposomal c-myc antisense oligodeoxynucleotides induce apoptosis and inhibit tumor growth and metastases in human melanoma models. Clin Cancer Res 9, 4595-4605. Pelengaris S, Khan M and Evan G (2002a) c-MYC: more than just a matter of life and death. Nat Rev Cancer 2, 764-776. Pelengaris S, Khan M and Evan G (2002b) Suppression of Mycinduced apoptosis in beta cells exposes multiple oncogenic properties of Myc and triggers carcinogenic progression. Cell 109, 321-334. Pelengaris, S, Littlewood, T, Khan, M, Elia, G and Evan, G (1999) Reversible activation of c-Myc in skin: induction of a complex neoplastic phenotype by a single oncogenic lesion. Mol Cell 3, 565-577. Saucedo LJ and Edgar BA (2002) Why size matters: altering cell size. Curr Opin Genet Dev 12, 565-571 Schmidt ML, Salwen HR, Manohar CF, Ikegaki N and Cohn SL 1994 The biological effects of antisense N-myc expression in human neuroblastoma. Cell Growth Differ 5, 171-178. Schreiber-Agus, N, Meng, Y, Hoang, T, Hou, H, Jr, Chen, K, Greenberg, R, Cordon-Cardo, C, Lee, HW and DePinho, RA (1998) Role of Mxi1 in ageing organ systems and the
Acknowledgements PJH is funded by grants from the NIH and Shriners Hospitals for Children.
References Baudino TA, Maclean KH, Brennan J, Parganas E, Yang C, Aslanian A, Lees JA, Sherr CJ, Roussel MF and Cleveland JL (2003) Myc-mediated proliferation and lymphomagenesis, but not apoptosis, are compromised by E2f1 loss. Mol Cell 11, 905-914. Bjornsti MA and Houghton PJ (2004) The TOR pathway: a target for cancer therapy. Nat Rev Cancer 4, 335-348. D'Cruz CM, Gunther EJ, Boxer RB, Hartman JL, Sintasath L, Moody SE, Cox JD, Ha SI, Belka GK, Golant A, Cardiff RD and Chodosh LA (2001) c-MYC induces mammary tumorigenesis by means of a preferred pathway involving spontaneous Kras2 mutations. Nat Med 7,235-239. de Alboran IM, O'Hagan RC, Gartner F, Malynn B, Davidson L, Rickert R, Rajewsky K, DePinho RA and Alt FW (2001) Analysis of C-MYC function in normal cells via conditional gene-targeted mutation. Immunity 14, 45-55. Dosaka-Akita H, Akie K, Hiroumi H, Kinoshita I, Kawakami Y and Murakami A (1995) Inhibition of proliferation by L-myc antisense DNA for the translational initiation site in human small cell lung cancer. Cancer Res 55, 1559-1564. Downs KM, Martin GR and Bishop JM (1989) Contrasting patterns of myc and N-myc expression during gastrulation of the mouse embryo. Genes Dev 3, 860-869. Eischen CM, Roussel MF, Korsmeyer SJ and Cleveland JL (2001) Bax loss impairs Myc-induced apoptosis and circumvents the selection of p53 mutations during Mycmediated lymphomagenesis. Mol Cell Biol 21, 7653-7662. Eisenman, RN (2001) Deconstructing myc. Genes Dev 15, 20232030. Felsher DW and Bradon N (2003) Pharmacological inactivation of MYC for the treatment of cancer. Drug News Perspect 16,370-374. Felsher DW, Bishop JM (1999) Reversible tumorigenesis by MYC in hematopoietic lineages. Mol Cell 4, 199-207 Gandarillas A and Watt FM (1997) c-Myc promotes differentiation of human epidermal stem cells. Genes Dev 11,2869-2882. Gera JF, Mellinghoff IK, Shi Y, Rettig MB, Tran C, Hsu JH, Sawyers CL and Lichtenstein AK (2004) AKT activity determines sensitivity to mammalian target of rapamycin (mTOR) inhibitors by regulating cyclin D1 and c-myc expression. J Biol Chem 279, 2737-46. Gomez-Roman N, Grandori C, Eisenman RN and White RJ (2003) Direct activation of RNA polymerase III transcription by c-Myc. Nature 421, 290-294. Grandori C, Cowley SM, James LP and Eisenman RN (2000) The Myc/Max/Mad network and the transcriptional control of cell behavior. Annu Rev Cell Dev Biol 16, 653-699. Greasley PJ, Bonnard C and Amati B (2000) Myc induces the nucleolin and BN51 genes: possible implications in ribosome biogenesis. Nucleic Acids Res 28, 446-453. Hatton KS, Mahon K, Chin L, Chiu FC, Lee H W, Peng D, Morgenbesser SD, Horner J and DePinho RA (1996) Expression and activity of L-Myc in normal mouse development. Mol Cell Biol 16, 1794-1804. Herold S, Wanzel M, Beuger V, Frohme C, Beul D, Hillukkala T, Syvaoja J, Saluz HP, Haenel F and Eilers M (2002) Negative regulation of the mammalian UV response by Myc through association with Miz-1. Mol Cell 10, 509-521. Hu W and Kavanagh JJ (2003) Anticancer therapy targeting the apoptotic pathway. Lancet Oncol 4, 721-729.
367
Walker et al: Targeting Myc function in cancer therapy regulation of normal and neoplastic growth. Nature 393, 483-487. Seoane J, Le HV and Massague J (2002) Myc suppression of the p21(Cip1) Cdk inhibitor influences the outcome of the p53 response to DNA damage. Nature 419, 729-734. Sherr, CJ (2001) The INK4a/ARF network in tumour suppression. Nat Rev Mol Cell Biol 2, 731-737. Shiio Y, Donohoe S, Yi EC, Goodlett DR, Aebersold R, Eisenman RN (2002) Quantitative proteomic analysis of Myc oncoprotein function. EMBO J 21, 5088-5096 Siemann DW, Chaplin DJ and Horsman MR (2004) Vasculartargeting therapies for treatment of malignant disease. Cancer 100, 2491-2499 Smith JB and Wickstrom E. (1998) Antisense c-myc and immunostimulatory oligonucleotide inhibition of tumorigenesis in a murine B-cell lymphoma transplant model. J Natl Cancer Inst 90, 1146-1154. Staller P, Peukert K, Kiermaier A, Seoane J, Lukas J, Karsunky H, Moroy T, Bartek J, Massague J, Hanel F, Eilers M. (2001) Repression of p15INK4b expression by Myc through association with Miz-1. Nat Cell Biol 3, 392-9. Toyo-oka K, Hirotsune S, Gambello MJ, Zhou ZQ, Olson L, Rosenfeld MG, Eisenman R, Hurlin P and Wynshaw-Boris A (2004) Loss of the Max-interacting protein Mnt in mice results in decreased viability, defective embryonic growth and craniofacial defects: relevance to Miller-Dieker syndrome. Hum Mol Genet 13, 1057-1067. Trumpp A, Refaeli Y, Oskarsson T, Gasser S, Murphy M, Martin GR and Bishop JM (2001) c-Myc regulates mammalian body size by controlling cell number but not cell size. Nature 414, 768-773. Waelti ER and Gluck R (1998) Delivery to cancer cells of antisense L-myc oligonucleotides incorporated in fusogenic, cationic-lipid-reconstituted influenza-virus envelopes (cationic virosomes). Int J Cancer 77, 728-733. Waikel RL, Kawachi Y, Waikel PA, Wang XJ and Roop DR (2001) Deregulated expression of c-Myc depletes epidermal stem cells. Nat Genet 28, 165-168. Waikel RL, Wang XJ, and Roop DR (1999) Targeted expression of c-Myc in the epidermis alters normal proliferation, differentiation and UV-B induced apoptosis. Oncogene 18, 4870-4878. Wang S and El-Deiry WS (2004) The p53 pathway: targets for the development of novel cancer therapeutics. Cancer Treat Res 119, 175-187.
Wanzel, M, Herold, S and Eilers, M (2003) Transcriptional repression by Myc. Trends Cell Biol 13, 146-150. Wendel HG, De Stanchina E, Fridman JS, Malina A, Ray S, Kogan S, Cordon-Cardo C, Pelletier J, Lowe SW (2004) Survival signalling by Akt and eIF4E in oncogenesis and cancer therapy. Nature 428, 332-337. Wickstrom E L, Bacon T A, Gonzalez A, Freeman D L, Lyman G H and Wickstrom E 1988 Human promyelocytic leukemia HL-60 cell proliferation and c-myc protein expression are inhibited by an antisense pentadecadeoxynucleotide targeted against c-myc mRNA. Proc Natl Acad Sci USA 85, 10281032. Yin X, Giap C, Lazo JS and Prochownik EV (2003) Low molecular weight inhibitors of Myc-Max interaction and function. Oncogene 22, 6151-6159. Zhou C, Gehrig PA, Whang YE and Boggess JF (2003) Rapamycin inhibits telomerase activity by decreasing the hTERT mRNA level in endometrial cancer cells. Mol Cancer Ther 2, 789-795. Zindy F, Eischen CM, Randle DH, Kamijo T, Cleveland JL, Sherr CJ, Roussel MF (1998) Myc signaling via the ARF tumor suppressor regulates p53-dependent apoptosis and immortalization. Genes Dev 12. 2424-2433.
Dr. Peter J. Hurlin
368
Gene Therapy and Molecular Biology Vol 8, page 369 Gene Ther Mol Biol Vol 8, 369-384, 2004
Transfection pathways of nonspecific and targeted PEI-polyplexes Review Article
Vicent M. Guillem1 and Salvador F. Aliño2 1
Servei d’ Hematologia i Oncologia. Hospital Clínic Universitari. Facultat de Medicina. Universitat de València. Avda. Blasco Ibañez 17, 46010 – València (Spain) 2 Grup de Teràpia Gènica. Departament de Farmacologia. Facultat de Medicina. Universitat de València. Avda. Blasco Ibañez 15, 46010 – València (Spain)
__________________________________________________________________________________ *Correspondence: Salvador F. Aliño, Departament de Farmacologia. Facultat de Medicina, Universitat de València, Blasco Ibañez 15, 46010 – Valencia (Spain); Phone: (+34) 96 386 46 21; Fax: (+34) 96 386 49 72; E-mail: Salvador.Alino@uv.es Key words: PEI-polyplexes, transfection, DNase degradation, Interactions, cell surface, cell culture medium, specificity, efficacy, cell internalization, Endosome trafficking, proton-sponge effect, Cytoplasm transport, nuclear accession, dissociation Abbreviations: Polyethyleneimine, (PEI); polylysine, (PLL); polyamidoamine dendrimers, (PAMAM dendrimers); epithelial growth factor, (EGF); basic fibroblast growth factor, (bFGF); 2-(dimethylamino)ethylmethacrylate, (pDMAEMA); transferrin-polylysine polyplexes, (Tf-pLL); poly-[N-(2-hydroxypropyl)methacrylamide], (pHPMA) Received: 30 April 2004; Accepted: 24 June 2004; electronically published: September 2004
Summary Polyethyleneimine (PEI) based vectors have become in an important vehicle for nonviral gene transfer. However, despite their extensive use and efficacy in the transfection of several cellular models both in vitro and in vivo, the mechanism by which they transfect cells has not been fully elucidated, and controversy remains over the interpretation of some apparently contradictory findings. A review is made of the studies on PEI polyplexes, focusing on PEI polyplex transfection properties (as physico-chemical characteristics important for transfection) and the mechanistic findings of PEI polyplex transfection comprising cell membrane binding with nonspecific and targeted–PEI polyplexes, the putative internalization pathways (such as the proton sponge hypothesis), the nuclear bioavailability of the transported nucleic acid, and other relevant issues such as the influence of polyplex size in vitro upon transfection activity. vivo, the mechanism by which they transfect cells has not been fully elucidated, and controversy remains over the interpretation of some apparently contradictory findings. The present review discusses the hypothetical transfection pathways of PEI-polyplexes - from vector binding to the cell membrane to nucleic acid arrival in the nucleus, the influence of physico-chemical properties of PEI in transfection activity and other relevant issues such as the influence of polyplex size and cell type upon transfection activity, and the most relevant differences or similarities between PEI and other polymers used in transfection (fundamentally polylysine polyplexes).
I. Introduction Specific and efficient delivery of nucleic acid into targeted cells is a priority objective of gene therapy. To achieve successful modification of the gene expression pattern, the exogenous nucleic acid must overcome a series of obstacles to gain access first to the cell and posteriorly to the intracellular compartments, where the nucleic acid exerts its function. Since nucleic acid uptake by cells is an inefficient process, it has been necessary to develop several strategies to increase nucleic acid delivery. One of the approaches is based on the use of nonviral vehicles such as liposomes (Wong et al, 1980; Alino et al, 1993), lipoplexes or nucleic acid-cationic lipid complexes (Felgner et al, 1997), and polyplexes (Gebhart and Kabanov 2001) - complexes of nucleic acids and cationic polymers such as polyethyleneimine (PEI) (Boussif et al, 1995). Due to its intrinsic transfection properties, PEI has been used to conform the backbone of a great number of vector formulations. Despite their widespread use and demonstrated efficacy in the transfection of several cellular models both in vitro and in
II. Characteristics of PEI-polyplexes A. PEI physico-chemical properties of importance for transfection PEI is a synthetic polymer with a nitrogen-carbon base (32.5% nitrogen). Ethanolamine, the monomeric unit of PEI (CH2-CH2-NH-), confers great PEI solubility in
369
Guillem and Aliño: Transfection pathways of nonspecific and targeted PEI-polyplexes water and most polar solvents. The most prominent characteristic of PEI is its high positive charge density (20-25 mEq/g), which facilitates ionic interaction with negatively charged molecules such as nucleic acids, via the protonation of amine groups taken from the surrounding medium. This implies the existence of a correlation between PEI positive charge density and the pH of the medium, which (as we will see) largely accounts for the transfection properties of PEI. Two types of polyethyleneimine are used in transfection: branched PEI (mainly of molecular weights 25 and 800 KDa) (Boussif et al, 1995) and linear PEI (22 kDa) (Ferrari et al, 1997). Branched PEI has three kinds of amine groups – primary, secondary and tertiary - with an amine ratio of 1:2:1, respectively, while linear PEI amines are exclusively secondary. Thus, while linear PEI acquires its positive charge density through the protonation of secondary groups, branched PEI possesses additional primary amine groups for protonation. Based on the existing protonation profile, only every 5 or 6 amino groups are protonated a physiological pH (Suh et al, 1994). In addition to being most basic and also most reactive, the primary amine groups are amenable to chemical modification and have been used to covalently attach different types of molecules with the aim of conferring additional properties to the vector. Nucleic acid-PEI binding slightly changes the PEI protonation profile, one-half to one-third of the amine groups being protonated at physiological pH. Therefore, in contrast to other polymers such as polylysine (PLL), PEI possesses a great buffering capacity over a very wide pH range (Tang and Szoka 1997).
parameters are relevant to transfection in the degree in which they affect polyplex size. The latter can vary from a few nanometers to several micrometers (Tang and Szoka 1997) - complexes of larger size being aggregates of particles of smaller size. Polyplex size depends on several parameters, such as the cation/anion ratio, DNA and polycation concentration, solution volume, and mixing speed. Moreover, size is greatly influenced by the presence of other electrolytes in the dissolution. Each of these factors will be analyzed separately below.
1. Influence of charge ratio On examining the variation of size with respect to charge ratio, it is seen that under conditions of nonaggregation (preparation in water), low +/- charge ratios yield small particles. Size progressively increases until the neutralization charge is reached, and decreases again as the net positive charge increases – this being thought to favor solubility of the polyplex particles (Kabanov and Kabanov 1995; Tang and Szoka 1997; Pouton et al, 1998). In the case of PEI-polyplexes, complete condensation takes place from a N/P ratio of 2 or 3 (where N is the number of polymer nitrogen atoms and P the number of DNA phosphorus atoms), with the formation of neutral charge particles (Erbacher et al, 1999a). At these ratios, a tendency towards particle aggregation is observed. The compact particles of smaller size are generally obtained at higher N/P ratios, yielding polyplexes of positive net charge (Erbacher et al, 1999a). At N/P ratios generally used to obtain complete condensation (N/P >4), PEI/DNA complexes present a zeta potential of around + 30-35 mV (Kircheis et al, 1999; Ogris et al, 1999). With respect to shape, small polyplexes have revealed toroidal structures measuring between 40-80 nm, according to electron microscopic estimations (Tang and Szoka 1997) and dynamic light scattering studies (Ogris et al, 1998), as well as globular structures of up to 20-40 nm according to estimations of atomic force microscopy (Dunlap et al, 1997). In comparison, large-size polyplexes are generally spherical or aggregates of micrometric size.
B. PEI-polyplex physico-chemical properties of importance for transfection As has been commented, polyplex formation occurs as a result of ionic interaction between negative DNA charges provided by phosphate groups, and the positive charge of the cationic polymer (Kabanov and Kabanov 1995) - provided in the case of PEI by protonated amine groups. The size and shape of the resulting polyplex particles depends on the conditions under which they are prepared. An important part of polyplex transfection activity depends on the polyplex physico-chemical characteristics. Therefore, characterization of the physico-chemical properties and knowledge of the parameters that can modify them could be very useful for predicting and defining the conditions of preparation capable of ensuring optimal transfection performance. The physico-chemical characteristics of polyplexes (structure, size, charge, capability of interaction with biomolecules) are largely dependent on factors inherent to the nature of the polycation (structure, molecular weight, charge density, etc.), but also on properties common to all polymers, such as the charge or mass ratio between polymer and DNA, and also on the characteristics of the solvent used for the electrostatic reaction – such as the ionic force (De Smedt et al, 2000). Of all physico-chemical parameters, the size of the complexes seems to be directly associated to transfection activity (Ogris et al, 1998), while the rest of
2. Influence of preparation conditions The preparation conditions greatly influence polyplex size and structure, mostly at aggregation level. The most relevant factors are salt concentration and the concentration of DNA and PEI before and after preparation. In general, polyplexes formed in saline solutions are larger than those formed in water (low ionic force) (Tang and Szoka 1997; Ogris et al, 1998; Kwoh et al, 1999), and size can moreover change over time (Ogris et al, 1998). In addition, even when polyplexes are formed under conditions of low ionic force, and despite the presence of the strong positive polyplex charge, many polyplexes (such as those composed of PLL) effectively aggregate when added to saline solutions of physiological concentration (Pouton et al, 1998). This aggregation tendency is probably related to a decrease in the real zeta potential due to the presence of saline electrolytes (Tang and Szoka 1997). According to these authors, this behavior is partially dependent on the type of cationic 370
Gene Therapy and Molecular Biology Vol 8, page 371 polymer involved. For example, PLL polyplexes and polyamidoamine dendrimers (PAMAM dendrimers) tend to form aggregates, whereas PEI polyplexes and fractured dendrimers (starburst dendrimers) are more resistant to aggregation (Tang and Szoka 1997). Other authors have demonstrated the importance of DNA and polymer concentration. For example, PLL polyplexes aggregate when the DNA solution is highly concentrated (400 µg/ml), and do not aggregate when the DNA concentration is lower (Duguid et al, 1998). This tendency to aggregate at certain concentrations is frequent in almost all polymers. When equal volumes of prediluted polymer and DNA are used, differences in transfection effectiveness associated to the sequence of the addition of the reagents are scantly relevant (Kircheis et al, 2001c; Wightman et al, 2001), though when the concentrations are high, the mixing order becomes relevant. Thus, transfection activity in vitro was found to be 10-fold greater when the polymer (PEI) was added to the plasmid DNA (drop by drop) than when the inverse approach was adopted, i.e., adding the DNA to the polymer (Boussif et al, 1995, 1996). Such differences were in fact associated to differences in the size of the polyplexes prepared in one or other way (larger polyplexes being the most efficacious) (Ogris et al, 1998).
polyplexes are small and of similar size (Poulain et al, 2000; Wightman et al, 2001).
4. Influence of PEI molecular weight The first studies of the influence of molecular weight in transfection, involving both linear and branched polyplexes, pointed to the existence of an optimum molecular weight (around 20-25 kDa) at which PEI polyplexes show improved transfection performance (Demeneix et al, 1998; Fischer et al, 1999; Godbey et al, 1999b; Jeong et al, 2001). At higher and lower molecular weights transfection efficacy decreases. Some authors have tried to explain this molecular weight dependency. It has been postulated that low molecular weight constructs show poorer transfection either because they are more unstable and more easily dissociable in saline medium (Papisov and Litmanovich 1988) than high weight constructs, or because their endosomal release capacity is less (Boussif et al, 1996; Kircheis et al, 2001c). The slight decreasing tendency in transfection efficacy for molecular weights larger than 20 kDa is attributed to increased polyplex toxicity (Bieber and Elsasser 2001). Nevertheless, the optimum molecular weight range seems to differ from one cell line to another. Such differences are attributed to an increase in toxicity with growing molecular weight, and to variable cell sensitivity to PEI.
3. Influence of PEI type While there do not seem to be important differences in zeta potential between polyplexes formed with the different types from PEI (i.e., linear versus branched and high versus low molecular weight)(Kircheis et al, 2001b), the influence of PEI type upon particle size is remarkable under certain preparation conditions. For example, while at low ionic force the sizes of polyplexes prepared with different types of PEI (linear and branched, with different molecular weights) seem to be quite invariable, the behavior of branched and linear PEI polyplexes clearly diverges when the complexes are formed at physiological ionic force. While complexes formed with branched PEI (25 or 800 kDa, indistinctly) are small (50-80 nm) or medium-sized (100 to some hundreds of nm), depending on the DNA concentration, complexes formed with linear PEI of molecular weight 22 kDa conform large aggregates – the size increasing with incubation time (Kircheis et al, 2001b). The same behavior is observed when linear 22kDa polyplexes initially prepared in a medium without salts are later added to a saline medium (Goula et al, 1998b; Kircheis et al, 2001b; Wightman et al, 2001). As can be expected, these differences in size between linear and branched PEI polyplexes exert a great influence upon transfection activity. In some cell types, the transfection activity of linear PEI of molecular weight 22 kDa is similar to that of branched PEI (Demeneix et al, 1998) (Poulain et al, 2000), whereas in others it is remarkably greater (Poulain et al, 2000; Wightman et al, 2001) – this phenomenon being attributed to the greater size of linear PEI polyplexes when prepared in saline medium. This advantage disappears when the complexes are prepared in nonsaline medium that avoids aggregation (HBG, 5, glucose). In this medium, both linear and branched PEI-
C. Protection against DNase degradation One of the consequences derived from polyplex formation is nucleic acid protection from degradation by nucleases. Practically all cationic polymers are able to afford variable DNA protection against DNase degradation once the polyplex has been formed (De Smedt et al, 2000) - PEI being one of the most protective polymers (Kircheis et al, 2001c; Moret et al, 2001; Guillem et al, 2002b). This property is of vital importance for transfection activity in vitro and in vivo, since it allows protection of the nucleic acid from intracellular (endolysosomal digestion) as well as extracellular degradation (through serum nuclease action).
D. In vitro transfection properties of PEIpolyplexes The in vitro transfection activity of polyplexes is influenced not only by the intrinsic properties of the latter (as described above), but also by other inherent factors associated to the transfection process, such as polyplex concentration, incubation time, polyplex interaction with the culture medium, and the type of cells used (Boussif et al, 1996). It is difficult to establish systematic comparisons between the transfection activities of different polyplexes, since there is a great variety of cationic polymers, and the optimum transfection conditions vary from one polyplex system to another, as well as from one cell line to another. Perhaps two of the most exhaustive studies comparing the transfection activity of nonspecific polyplexes are those carried out in the 3T3 (Demeneix et al, 1998) and Cos-7 cell lines (Gebhart and Kabanov 2001), employing several
371
Guillem and Ali単o: Transfection pathways of nonspecific and targeted PEI-polyplexes polyplexes - including PEI. According to these studies, PEI and PAMAM polyplexes present the best transfection activities, compared with other polymers, at least in these cell lines. In reference to PEI, the transfection activity in vitro has been established in a broad variety of cells. The first form of PEI used for gene transfer was the branched form with a molecular weight of 800 kDa, applied to different cell lines and tissues, as well as in local administration to the brain (Boussif et al, 1995). Posteriorly, these authors described PEI (branched 800 kDa type) mediated transfection in 25 different cell types, including 18 human cell lines as well as primary rat and pig cells (Boussif et al, 1996; Demeneix et al, 1998). Branched PEI of low molecular weight (25 kDa) was introduced soon afterwards (Abdallah et al, 1996), affording superior transfection efficacy and toxicity versus the high molecular weight form. In fact, this form of branched PEI has allowed the transfer and expression of genes incorporated to large gene constructs, as is the case of the artificial 2300-kb chromosomes (Marschall et al, 1999). Such results had not been obtained up until that time with any other type of vector. These two branched forms of PEI have been used with significant efficacy in terms of cell transfection, and have been the standard forms of PEI employed for nucleic acid transference (Godbey et al, 1999a). The linear PEI form was developed soon afterwards (Ferrari et al, 1997). As has been mentioned above, it displays some significant differences in transfection profile (not only in vitro but also in vivo) that can be interesting for certain applications. However, despite the well demonstrated transfection activity of PEI polyplexes and their widespread use as a regular tool for transfection in different laboratories, our understanding of the PEI transfection process remains incomplete. In the following section we review the mechanistic findings of transfection with PEI polyplexes.
increase the transfection activity of some polyplexesconcretely when serum absence or presence produces changes in polyplex size. Some authors (Guo and Lee, 2001) have suggested that the inhibiting role of serum on transfection is associated to the stabilization of small PEI polyplexes (of smaller transfection efficacy), in a way similar to what happens with lipoplexes (Turek et al, 2000). According to this hypothesis, initially large complexes or initially small complexes that increase in size on coming into contact with the culture medium, would be resistant to serum inhibition. The influence of polyplex size upon transfection activity is discussed in greater detail in the following sections.
B. Interactions between polyplexes and the cell surface It can be considered that in vitro transfection begins with polyplex interaction with the cell membrane. Different forms of membrane interaction can be defined: nonspecific interactions with receptors or other components of the cell membrane (such as proteoglycans), and specific interactions with membrane receptors (Godbey and Mikos, 2001). The type of interaction depends on whether the polyplex is targeted or not, and on the cell type involved in transfection.
1. Nonspecific cell interaction of untargeted polyplexes It is generally accepted that the interaction of an untargeted polyplex with the cell essentially consists of an ionic interaction between the positive polyplex charges and the negative charges of the cell membrane (Kabanov and Kabanov, 1995). Specifically, it is thought that polyplex interaction with the cell surface takes place fundamentally with sulfated proteoglycans, which are negatively charged proteins present in the membrane (Kjellen and Lindahl 1991). Evidence to this effect is provided by the fact that cell treatment with heparinase and chondroitinase (enzymes that degrade proteoglycans) or the use of mutant cell lines deficient in proteoglycan production dramatically inhibits transfection with PLL polyplexes (Mislick and Baldeschwieler). A similar mechanism is postulated for other polymers including as PEI polyplexes. Recent studies indicate that such interactions with the membrane proteoglycans are decisive not only in the interaction process, but also in subsequent polyplex internalization (Kircheis et al, 2001a). These studies suggest that the transfection differences observed between different cell types are associated to the levels of proteoglycan expression (Mislick and Baldeschwieler 1996; Labat-Moleur et al, 1996; Godbey and Mikos 2001; Wiethoff et al, 2001). If this were the case, and since several cell types are characterized by low or nil proteoglycan expression (e.g., hematopoietic cells), the latter can be considered difficult to transfect with nonspecific polyplexes (Ogris et al, 2000), and transfection in these cell types would thus require the incorporation of additional elements to the polyplex construct in order to promote cell interaction.
III. Mechanisms of the in vitro transfection process with PEI polyplexes This section describes the pathway of PEI polyplexes in the transfection process, from polyplex addition to the cell culture to arrival of the nucleic acid in the nucleus. To make understanding easier, the section has been divided into different sections referring to the most relevant stages of the polyplex pathway, including interaction with the cell culture medium and the subsequent cellular barriers (cell membrane, endosome-lysosome, cytoplasm and nuclear envelope), and other important issues (influence of particle size, targeting, etc.) in the context of each phase.
A. Interaction with cell culture medium Once the polyplex has been prepared, the next step consists of polyplex incubation with cells. Polyplex interaction with elements of the cell culture medium (ions, anionic proteins from serum) can originate structural changes in size and surface charge that in turn can affect transfection activity. Although polyplexes generally seem to be less sensitive to serum than lipoplexes (Gebhart and Kabanov, 2001), the presence of serum can reduce or even 372
Gene Therapy and Molecular Biology Vol 8, page 373
2. Specific cell interaction of targeted polyplexes. Influence of targeting upon vector properties: specificity, efficacy, cell internalization
interaction. The in vitro transfection results in terms of effectiveness obtained with this procedure are limited, though the main disadvantage is that for further in vivo development, complete vector assembly must be made before administration. Taking these previous studies as reference, we attempted to construct a targeted polyplex (which we have called immunopolyplex), the salient characteristic of which is the possibility of easily replacing the targeting element, leaving the polyplex backbone intact. Streptavidin protein was thought to be attached covalently to PEI, acting as a bridge molecule for direct binding of biotinylated proteins (targeting elements) to the vector. The streptavidin-biotin system is considered to allow targeting element replacement without complicated protocol modifications, avoiding the need for specific synthesis of the vector for each case, and moreover allowing considerable savings in time and money. Since a great amount of biotin-labeled antibodies against membrane antigens are commercially available, they can easily be used to determine the most suitable targeting element for many targeted nucleic acid strategies. Due to the therapeutic interest and difficulty of hematopoietic cell gene transfer, our work with immunopolyplexes has focused on the transference of genes and oligonucleotides to cell lines of hematological origin, which proved hard to transfect through nonspecific pathways. Thus, we selected as targeting elements several biotinylated antibodies that specifically recognize some membrane antigens of hematopoietic cells. Initially we started with a set of commercial biotin labeled antibodies against the following antigens: CD4 and CD3 for T lymphocyte targeting, CD19, CD20, CD21, CD22 for B lymphocyte targeting and CD45 and CD71 for panlymphocytic targeting. The best results were obtained with immunopolyplexes carrying CD3 antibody for T cell transfection (Guillem et al, 2002a, 2002b) and CD19 antibody for B cell transfection (Guillem et al, 2002b) (Figure 1). We found that immunopolyplex activity was fundamentally specific and mediated mainly through specific antigen-antibody interaction, and that anti-CD3 immunopolyplex is more efficacious in T cells than anti-CD19 in B cells (4- or 5fold in terms of the percentage of positive cells, and 6- to 12-fold in terms of fluorescence intensity per cell). In this case, abundance of antigen could be a parameter for partly explaining observed differences in transfection activities: we found CD3 in T cell line (Jurkat) to be about 3-fold more abundant than CD19 in B cell line (Granta 519). However, this is not the only parameter to be taken into account for explaining or predicting transfection activities in general. As some authors have suggested (O'Neill et al, 2001), the efficiency of transgene expression could be affected by signaling events following antibody-antigen interaction. For example, we observed that although CD45 is 4-fold more abundant than CD3 in Jurkat cells, transfection with anti-CD45 immunopolyplexes displayed poor results (data not shown). The lack of transfection is probably related to the notion that CD45 does not internalize upon antibody binding, as previously reported (van der Jagt et al, 1992). In this case, although anti-CD45 immunopolyplex does bind to CD45 membrane antigen,
Considering the need to improve polyplex specificity and efficacy, effort has centered on combining and even exchanging nonspecific interaction between polyplexes and the cell surface via a specific cellular internalization mechanism, by incorporating ligands attached to the vectors. The development of targeted polyplexes has as main aim their application to in vivo therapy, where selectivity in gene delivery is particularly important. Nevertheless, in vitro targeting, in addition to testing the selectivity of a possible ligand for subsequent in vivo use, is especially interesting when transference through nonspecific interaction is very low. This is the case of cells that grow in suspension, such as lymphocyte derived cell lines, whose proteoglycan expression is very low and nonspecific polyplex transfection fails (Ogris et al, 2000). In the case of PEI-polyplexes, it has been demonstrated that the incorporation of targeting elements not only contributes to improve the specificity of delivery but also increases the activity of transfection in different cell lines (Erbacher et al, 1999b). In general, targeted polyplexes have been based on the covalent attachment of a targeting element to the polymer, PLL and PEI being the most commonly used elements. This strategy began with the experiments of Wu et al, (1987), which targeted complexes of asialoorosomucoid-PLL/DNA to the asialoglycoprotein receptors of hepatic cells. Other ligands frequently used for selective nucleic acid delivery are: a) transferrin (Wagner and al.), whose receptor is abundant in tumor cells (Wagner et al, 1990; Cotten et al, 1993); b) galactosylated ligands (Plank et al, 1992) or asialofetuin (Dasi et al,) for hepatocyte targeting; c) epithelial growth factor (EGF) (Chen et al, 1994, Cristiano and Roth 1996) and basic fibroblast growth factor (bFGF) (Sosnowski et al, 1996) for targeting lung cancer cells; and d) antibodies that recognize specific membrane elements, such as antiPECAM (platelet endothelial cell adhesion molecule), for selective transference to endothelial cells (Li et al, 2000). In this last group, one of the best developed models is based on specific gene transfer to T cells using antibodies against membrane antigens that are expressed fundamentally in these cells, such as JL1 (Suh et al, 2001), CD3 (Erbacher et al, 1999a; O'Neill et al, 2001) and CD4 (Puls and Minchin, 1999). Although in some models these targeted polyplexes have produced interesting results, the need for specific synthesis of the vector for each target cell greatly limits their use and increases the economic cost - especially when a monoclonal antibody is used as targeting element. A more versatile targeting method is based on the use of the streptavidin-biotin system, which had been previously used to prepare targeted immunoliposomes (Alino et al, 1999). In this case, targeted gene delivery was based on the attachment of biotinylated antibodies (against membrane antigens) on the cell surface, with the subsequent addition of polyethylenimine-avidin-DNA complexes to interact with cell-attached antibodies (Wojda and Miller, 2000) through the specific avidin-biotin 373
Guillem and Ali単o: Transfection pathways of nonspecific and targeted PEI-polyplexes
Figure 1: Fluorescence imaging of EGFP transfection with immunopolyplexes. Granta 519 B cell line (CD3-/CD19+, up) and Jurkat T cell line (CD3+/CD19-, down) were transfected with p3CEGFP (5 mg/ml), employing anti-CD3(left,up and down) and antiCD19 (right, up and down) immunopolyplexes as vehicles . The imaging shows cells seen under fluorescence microscopy 24 h after transfection.
its internalization might not be promoted. In the case of CD3, the fact that CD3 antibody binding stimulates cell proliferation can be taken to constitute a collateral effect favoring transfection efficacy, since it eliminates the nuclear membrane in the transfection period. Conversely, antibodies that after antigen binding stimulate cell apoptosis, such as CD20 (Cardarelli et al, 2002), would dramatically impair the transfection process by eliminating targeted cells. All these facts should be taken into account when designing a targeting model, though when the antigen-antibody profile is not known, antibody screening could easily be performed with immunopolyplex until the most suitable targeting option is identified.
transferrin-polylysine polyplexes (Tf-pLL)(Cotten et al, 1990; Zenke et al, 1990; Wagner et al, 1991). These authors reported important in vitro transfection with small particles (diameter !100 nm), and suggested that clathrincoated pits were implicated in receptor mediated endocytosis (Wagner et al, 1990). Without further evidence, it was quickly assumed that this mechanism could be the preferential internalization route for other polyplexes and, at the same time, that it should restrict the internalization of complexes greater than 100 nm. This correspondence seemed to be satisfied by PLL (Wagner et al, 1991) and pDMAEMA (2-(dimethylamino)ethyl methacrylate) polyplexes (van de Wetering et al, 1998), since complexes of a few hundreds of nanometers transfected better than those of micrometric size. Subsequent research with PEI-polyplexes (Ogris et al, 1998) demonstrated that polyplexes of great size can also benefit from specific internalization mediated by receptor, resulting in even greater transfection levels than with small constructs (Ogris et al, 1998; Wightman et al, 2001). In an attempt to account for these apparently contradictory findings, some authors have suggested hypotheses to explain the relation between transfection efficacy and construct size. One hypothesis suggests that larger (and therefore heavier) polyplexes settle upon the cells, creating a greater local polyplex concentration which would force interaction with the cells. In contrast, small
C. Polyplex internalization: size does matter Although endocytosis is accepted to be the general mechanism responsible for cellular internalization of polyplexes (Kircheis et al, 1997; Godbey et al, 1999c), the term comprises very different forms of internalization, including fluid phase endocytosis (Remy-Kristensen et al, 2001), nonspecific absorptive endocytosis (Labat-Moleur et al, 1996; Mislick and Baldeschwieler 1996), phagocytosis, macropinocytosis (Remy-Kristensen et al, 2001), and receptor mediated endocytosis (Boussif et al, 1996; Ogris et al, 1998). The first studies of polyplex internalization mechanisms were performed with 374
Gene Therapy and Molecular Biology Vol 8, page 375 polyplexes remain in suspension and their contact with the cells would be more limited (Boussif et al, 1996; Ogris et al, 1998). This hypothesis is sustained by the fact that on promoting sedimentation of small polyplexes over cells by centrifugation, transfection efficacy increases (Boussif et al, 1996). This hypothesis assumes that there are no significant internalization differences between large and small PEI-polyplexes, since if the internalization of large polyplexes were greatly impaired, the effect of the higher local concentration could be neutralized. This explanation by itself, which could help account for the differences with PEI-polyplexes, fails to explain the behaviour of polyplexes in general - since it does not account for PLL polyplexes behaving in exactly the opposite way, i.e., large polyplexes transfect worse than small constructs. It could be argued that the assumption that PEI and PLL polyplexes follow the same internalization pathway has not been demonstrated, since some authors have proposed different internalization pathways for PEI and PLL polyplexes (Godbey et al, 2000), and these could be influenced differently by polyplex size. Moreover, the influence of size upon transfection seems to be strongly dependent on the type of cell involved, though the PEI and PLL polyplex experiments mentioned above were performed in the same cell line model (K562 cells). Another proposed explanation suggests that the reduced transfection efficacy of small PEI-polyplexes is due to their lesser capacity to destabilize the endosomes compared with larger PEI-polyplexes. Since PEI is though to behave as a proton sponge that destabilizes the endosome (Behr 1996)(see the following section), these authors assume that a critical minimum amount of PEI must reach the endosome to cause its rupture, and suggest that small PEI-polyplexes do not contain sufficient polymer to promote endosome disruption as effectively as the larger constructs. This hypothesis is supported by the observation that the transfection efficacy of small particles increases in the presence of lysosomotropic agents (chloroquine or endosomolytic peptides), whereas the efficacy of large particles is not substantially modified (Ogris et al, 1998). In the case of polylysine, and since the latter does not exert an intrinsic destabilizing effect upon the endosome, large particles would not have an advantage over small ones in relation to endosomal release, and transfection efficacy would fundamentally depend on internalization effectiveness - where small polyplexes supposedly would be favored by the possibility of using the clathrin coated pit internalization route. In support of this explanation, some studies of the kinetics of internalization of fluorescent labeled transferrin PEI-polyplexes show that while small polyplexes are rapidly and fully internalized, those of great size remain attached to the membrane and are internalized more slowly (Ogris et al, 2001b). Still, total fluorescence and membrane binding fluorescence are greater in the case of the large polyplexes that for the small particlesâ&#x20AC;&#x201C;thus supporting the hypothesis postulating a greater local concentration of large polyplexes. On the other hand, although relative internalization is less efficient in the case of large polyplexes, the associated transgene expression is eleven times greater than in the
case of the smaller constructs. This supports the hypothesis of an increased endosomal release for large PEI polyplexes. In our studies of PEI polyplex characterization, we have observed that when PEI-polyplexes of different sizes are treated with DNase I, the large complexes (N/P ratios close to charge neutrality) totally protect plasmid DNA from degradation, while the smaller ones (high N/P ratios) experience discrete cuts in the DNA sequence (Guillem et al, 2002b). This would occur because a small particle would have more DNA exposed at the polyplex surface per unit mass than a larger particle â&#x20AC;&#x201C; thereby increasing the probability of exposure of some DNA regions at the polyplex surface, with increased accessibility to nucleases. We hypothesize that this same process may occur at intralysosomal level, and can partly explain the transfection advantage of large polyplexes versus small constructs. Probably the influence upon transfection efficacy of all these processes would be the sum of the contribution of each individual effect, favoring transfection in one of the stages (internalization, endosomal release, access to the nucleus), while impairing it in others. Regarding the upper polyplex size limit for penetrating the cell, there are at least two alternative possibilities. One option is to accept that penetration occurs via the internalization of polyplex particles in large vesicles. This hypothesis receives growing support from many studies that show that polyplexes (targeted or not) with a size of hundreds of nanometers and of micrometric size (Pouton et al, 1998), or even aggregates or precipitates (such as DNA complexes with calcium phosphate or DEAE-dextran), are able to transfect cultured cells (De Smedt et al, 2000). Some authors have even detected the endocytosis of large polyplex particles using electron microscopy (Bieber et al, 2002). Retaining the hypothesis of small particle endocytosis as preferential internalization mechanism, the other possibility would be to admit that large polyplexes might not be internalized entirely, but could remain attached to the external cell membrane surface - as suggested for transfection with large fluorescent labeled transferring PEI polyplexes (Ogris et al, 2001b) - and would then be internalized as smaller fragments detached from the large ones. Both processes could coexist, and the variable predominance of either could depend not only on particle size, but also on polyplex type, and the cell type involved (Kircheis et al, 2001c). In fact, some authors (Remy-Kristensen et al, 2001) have observed that in certain cells (EAhy 926 cells), small PEI-polyplexes, initially homogeneously attached to cell membrane, migrate to particular areas of the cell surface, yielding large aggregates that are further taken up in vesicles several micrometers in size (macropinocytosis). In contrast, in other cells (L929 fibroblasts), the same polyplexes are quickly and homogeneously internalized by submicrometric endosomes (fluid phase endocytosis).
D. Endosome trafficking. The protonsponge effect: influence on the transfection efficacy of PEI-polyplexes It is believed that after internalization, the particles 375
Guillem and AliĂąo: Transfection pathways of nonspecific and targeted PEI-polyplexes are directed towards the lysosomal route to be degraded (Klemm et al, 1998; Lecocq et al, 2000). For most polycations such as polylysine, accumulation and degradation in the endosomal compartment is an important obstacle in the transfection process (Mislick et al, 1995), and explains the relatively low levels of transfection obtained. Different strategies have been developed to overcome this obstacle, such as the addition of lysosomotropic agents (e.g., chloroquine) (Erbacher et al, 1996) to the culture medium, or the use of membrane destabilizing peptides (Plank et al, 1994) or inactivated viral particles possessing endosomolytic activity (Curiel et al, 1991) and which can be added to the medium or bound to the vector. Nevertheless, some polycations such as PEI and PAMAM fractured dendrimers (starburst dendrimers) do not require lysosomotropic agents to exhibit substantial transfection in vitro (Haensler and Szoka 1993; Kukowska-Latallo et al, 1996; Tang et al, 1996; Tang and Szoka 1997). In these cases, the addition of chloroquine has little or no effect. Attempts have been made to explain this behavior through the proton sponge hypothesis, which assumes that PEI and fractured dendrimers are able to buffer the endolysosomal pH and cause endosome disruption via osmotic swelling (Berh 1996). The key to the proton sponge effect would be the degree of protonation of the polycation amine groups. Whereas at physiological pH the amine groups of PLL are fully protonated (pKa between 9 and 10), the amine groups of PEI and the starburst dendrimers are only partially protonated. Consequently, after endocytosis of such polyplexes (PEI or PAMAM), the amine groups are able to uptake protons from the acidic endosomal interior, which is thought to buffer endosomal pH and induce proton accumulation within the endosomeâ&#x20AC;&#x201C;this in turn being coupled to a simultaneous flow of chloride anions towards the interior. The above authors on one hand hypothesize that the net increase in ion concentration would lead to a massive water input, with swelling and ultimately rupture of the endosome, while on the other hand it is postulated that increasing PEI protonation could contribute to its separation from DNA via the repulsion of internal positive charges - thereby contributing to polyplex dissociation (Berh). However, the authors did not take into consideration that the presence of negative DNA charges can compensate the increase in the PEI protonation, and therefore the internal cationic repulsion effect. Besides, other investigators report that the differences in transfection efficacy between PEI and PLL cannot be sustained on the buffering effect of PEI upon lysosomal pH, because according to their measurements the intralysosomal pH of cells transfected with PEI-polyplexes remains unaltered (Godbey et al, 2000; Forrest and Pack 2002). In any case, the different authors interpret their respective findings in different ways. Thus, according to Godbey el al., the increased effectiveness of PEI with respect to PLL is explained by the capacity of PEI to avoid the lysosomal degradation route followed by PLL polyplexes. These authors accordingly proposed different intracellular processing mechanisms for each type of polyplex (Godbey et al, 1999a; Godbey et al, 2000). On
the other hand, Forest et al, maintain that it is necessary for PEI-polyplexes to be exposed to an acidic environment (endosome-lysosome fusion) in order to achieve endosome DNA release. Moreover, they observe no trafficking of PLL-polyplexes towards lysosomes in some cell lines. Again, different routes for PEI and PLL polyplexes are postulated, though in this case the situation is opposite that proposed above. Uncertainty therefore remains about the intracellular fate of polyplexes and their endolysosomal processing. Apart from such discrepancies regarding the particle processing mechanisms, there seems to be general agreement that knowledge of the relation between PEIpolyplexes and intralysosomal pH is critical for understanding PEI polyplex transfection activity. We therefore decided to further investigate the influence of pH upon the interaction between DNA and PEI. To this effect, we added PEI polyplexes to solutions at different pH (from 3.5 to 12) and studied the intensity of the resulting interaction between DNA and PEI based on a fluorescence decay assay (Guillem et al, 2002b). Our results indicate that the intensity of interaction between DNA and PEI decreases at basic pH and is enforced at acid pH values. Considering the physico-chemical properties of PEI, this seems logical, since at acid pH values PEI positive charge increases and its capacity to interact with negatively charged DNA should also increase. In contrast, as pH becomes less acidic, the PEI positive charge decreases, and DNA-PEI ionic interaction can be expected to decrease gradually, releasing DNA. These data suggest that, at intracellular level, an acidic environment, far from stimulating the dissociation of PEI-DNA complexes (which, if lysosomal pH is not modified by PEI polyplexes, would threaten DNA integrity in the lysosome), seems to actually strength PEI-DNA interaction - and this could contribute to protect DNA from lysosomal degradation. Another point still far from being clarified is how polyplexes leave the endosomes. While some authors have used electron microscopy to detect endolysosomal microrupture (Bieber et al, 2002), other investigators have failed to detect any endolysosome vesicle alterations (Remy-Kristensen et al, 2001) - even when transgene expression is subsequently achieved. Again, the results obtained seem to depend on the cell type involved. In any case, if endosome disruption effectively occurs, it appears to be on a non-massive scale, since the phenomenon has been only scarcely detected. Nevertheless, the fact that peptides such as melittin, which has endosomolytic properties (thus contributing to nucleic acid release into the cytoplasm), increase the transfection efficacy of PEI polyplexes (Ogris et al, 2001a) speaks in favor of the convenience of promoting endosomal release.
E. Cytoplasm transport and nuclear accession In reference to cytoplasmic transport, some authors who have studied the dependence of inert particle cytoplasmic diffusion upon size, concluded that particle mobility is effectively dependent upon particle size â&#x20AC;&#x201C; those measuring more than 54 nm presenting impaired diffusion 376
Gene Therapy and Molecular Biology Vol 8, page 377 (Luby-Phelps et al, 1987). Nevertheless, it has been found that large particles can migrate through the cytoplasm not only by diffusion, but also via other mechanisms in which cytoskeletal components such as the microtubuli or actin filaments are involved, thereby facilitating polyplex transport (Meyer et al, 1997). Accordingly, if finally PEI polyplexes are released into the cytoplasm following endosomal disruption, they theoretically could be transported to the nucleus – especially those particles measuring less than 54 nm in size. With respect to the nuclear envelope, one aspect that suggests the latter to be an important barrier for nucleic acid transference to the nucleus is the fact that when cells are allowed to undergo mitosis after adding polylysine (Brunner et al, 2000) or PEI polyplexes (Brunner et al, 2000; Remy-Kristensen et al, 2001), these are transfected much more efficiently than when the cell cycle has been arrested. Thus, it can be concluded that mitosis (and consequently nuclear dismantling) facilitates transfection – this being the reason why superior transfection efficacy is generally obtained with rapidly proliferating cells than in cells that either do not divide or do so only slowly. Nevertheless, since some cells that do not divide can be transfected, there must be mechanisms for penetrating the nucleus in the presence of the nuclear envelope. Some authors have proposed that polyplex entry to the nucleus could involve polyplex fusion with the nuclear membranes, mediated by polyplex interaction with the negatively charged membrane phospholipids (Godbey et al, 1999c). According to these authors, at a certain moment during polyplex trafficking, the particles could establish contact with phospholipids - those synthesized continuously for membrane regeneration or those from the endosomal membrane. In any case, polyplexes could become coated with a lipid envelope and perhaps on interacting with the phospholipids of the nuclear envelope, the coated polyplexes could finally fuse with the nuclear membranes and thus access the interior of the nucleus. Another potential route for polyplex access to the nucleus that would not imply nuclear envelope modification or rupture is based on the existence of the nuclear pores. In this context, while pore diameter is 80 nm, pore structure leaves free only a central water channel of 9 nm - though particles up to 28 nm in diameter can be transported to the nucleus via the activation of transport mechanisms that imply energy consumption (Nigg, 1997). It is therefore theoretically possible for small polyplex particles (less than 28 nm in size) to access the nucleus through the nuclear pores. The nuclear importation of molecules larger than 40,000 Da (generally proteins) is known to be highly selective and depends on the presence of a short amino acid sequence called a nuclear location signal (NLS)(Newmeyer 1993). For this reason, with the aim of facilitating nuclear delivery, and this improving transfection efficacy, many polyplex formulations also incorporate nuclear location sequences (Branden et al, 1999; Zanta et al, 1999) or peptides such as melittin (Ogris et al, 2001a) which in addition to possessing endosomolytic activity also has nuclear targeting properties. Improvements in transfection efficacy associated to the use of NLS suggest that polyplexes can at
least partially benefit from transport mechanisms through nuclear pores.
F. PEI polyplex dissociation within the nucleus: nuclear availability In order for vehiculized nucleic acid to modify gene expression (by means of a transgene or oligonucleotides), it is assumed that the non-nucleic component in general, or the cationic polymer in the case of polyplexes, must separate from the nucleic acid at some point. In the case of lipoplexes, the use of fluorescent labeled DNA and lipids has shown that whereas labeled DNA appears in the nucleus, the cationic lipids do not. This suggests that lipoplex disassembly takes place before the DNA reaches the nucleus (Marcusson et al, 1998). However, in the case of polyplexes, the evidence suggests that the polymer (fundamentally PEI) not only accompanies the nucleic acid to the nucleus but moreover targets it to the latter (Boussif et al, 1995; Pollard et al, 1998; Godbey et al, 1999c; Wightman et al, 2001). Thus, in experiments involving cytoplasmic injection, the DNA vehiculized in polyplexes produced an increase in the portion of DNA released into the nucleus (up to 10-fold in the case of PEIpolyplexes) with respect to naked DNA (Pollard et al, 1998). Internalization experiments in certain cell models involving fluorescent PEI administered either alone or forming part of polyplexes have revealed preferential fluorescence location in the nucleus (Godbey et al, 1999c). With respect to disassembly, the destination seems to depend on the nucleic acid size. Thus, in the case of oligonucleotides, some evidence indicates that the latter separate from the polymer (PEI) once within the nucleus (Dheur et al, 1999; Guillem et al, 2002a). In our transfection experiments with immunopolyplexes or untargeted PEI-polyplexes carrying FITC labeled oligonucleotides in Jurkat (non-adherent cells) and B16 (adherent) cells, respectively, we observed that the initially quenched fluorescence of oligo-FITC in the polyplexes (at 95% to N/P 10) is progressively recovered once polyplex or immunopolyplex has been incorporated into the cell and disassembled - a process which can be seen with fluorescence microscopy (Figure 2). Fluorescence is located mainly in the nucleus in both models (Figure 3), thus indicating that targeting does not alter the intracellular processing of polyplexes - though the kinetics are different (immunopolyplex trafficking being faster). In the case of PEI polyplexes carrying plasmid DNA, it seems that although the former reach the nucleus, most polyplexes remain undissociated. This at least is the interpretation of the experiment conducted by Godbey and coworkers (Godbey et al, 1999c). In effect, when PEI and nucleic acid are labeled with green and red fluorescent probes, respectively, and polyplex is subsequently formed, the fluorescence observed is yellow–thus indicating that the green and red probes are located sufficiently close to allow fluorescence overlapping. When the intracellular route of these labeled PEI-polyplexes is followed, fluorescence labeling in the nucleus is seen to be mainly of a yellow color (undissociated polyplexes) - though some green and red dots (corresponding to dissociated 377
Guillem and AliĂąo: Transfection pathways of nonspecific and targeted PEI-polyplexes
Figure 2. Imaging of B16 cells treated with PEI-polyplexes bearing FITC labeled oligonucleotides. Cells were visualized under fluorescence microscopy at 0 (a) 6(b) and 24 hours(d) after PEI polyplex addition (c ,cells seen under transmitted light).
complexes) appear extranuclearly. However, as mentioned in previous sections, there is evidence to suggest that polyplex destination is strongly dependent upon the cell type involved (Remy-Kristensen et al, 2001; Bieber et al, 2002). In many studies it has not been possible to detect the presence of exogenous DNA in the nucleus (either along or accompanied by PEI), though transgene expression has been detected (Remy-Kristensen et al, 2001; Bieber et al, 2002). This on one hand indicates that it is not possible to know whether in these cases the expressed DNA has reached the nucleus in free form or accompanied by the polymer. On the other hand, it suggests that the presence of many DNA copies is not needed to ensure transgene expression (this being the reason why transgene expression observed in the Godbey nuclear location experiment could be due to the small proportion of DNA dissociated from the polymer). This hypothesis is reinforced by the observations of direct DNA injection experiments: only 10 copies per nucleus sufficed to achieve transgene expression (Pollard et al, 1998). Nevertheless, the fact that direct polyplex injection (PEI or PLL polyplexes with a small number of transgene copies in different cell types) into the nucleus affords transgene expression, and that this does not happen with lipoplexes (Pollard et al, 1998), indicates that polyplex can be disassembled, at least partially, within the nucleus. This in turn generates new questions, however: Is it possible for exogenous gene expression to occur without polyplex disassembly? Without discarding that exogenous gene
expression could originate from a small part of plasmid molecules that can be released, the possibility exists that the transcription machinery (as if PEI were the cationic nuclear proteins associated to genomic DNA), could temporarily separate DNA from polymer â&#x20AC;&#x201C; this in turn being sufficient to allow transgene transcription. To date, the limited experimental evidence in this direction is provided by the work of Bieber and coworkers (Bieber et al, 2002). In order to verify whether PEI-DNA interaction could be a critical stage for transfection, these investigators conducted tests of in vitro transcription with PEI polyplexes, observing that transcription is not altered by the presence of the PEI. This speaks in favor of the hypothesis of transcriptional disassembly.
IV. In vivo transfection of polyplexes Although it was not our aim to conduct an in-depth review of the mechanisms of polyplex in vivo transfection, a summarized account will be provided of some critical aspects of PEI that could be important for understanding the transfection profile of PEI-polyplexes in vivo, compared with other polymers also used in vivo. In vivo gene expression mediated by polyplexes was first reported by Wu and coworkers (Wu et al, 1991) in a murine model of gene transfer to the liver using polyplexes based on galactosylated PLL. Despite the time elapsed since these first results were published, only few subsequent reports have appeared involving the use of
378
Gene Therapy and Molecular Biology Vol 8, page 379
Figure 3: Nuclear localization of oligo-F transferred with PEI based vectors. Imaging of B16 cells (Up) transfected with PEI-oligo polyplexes (24 after trnasfection) and Jurkat cells (down) transfected with anti CD3 immunopolyplexes (6 h after transfection) (left,transmitted light; right , fluorescent light)
polyplexes in vivo, and with limited success (De Smedt et al, 2000). Regarding PEI polyplexes, the more successful systemic administration models refer to lung gene transfer (Goula et al, 1998a), though in this case transfection depends on the formation of aggregates that cause pulmonary capillary obstruction secondary to microthrombus formation (Chollet et al, 2002). One of the important and specific obstacles of in vivo gene transfer is systemic clearance, i.e., polyplex elimination from blood before the particles are able to cross the vascular endothelial fenestrations and interact with the target tissues. The two main characteristics controlling the systemic stability of nonviral vectors in general, and of polyplexes in particular, are particle size and surface charge. In order to overcome this important problem, several works have been conducted with the aim of obtaining small-size polyplexes. By varying the type of polymer, the preparation conditions, the zeta potential, the nucleic acid-cationic polymer ratio, and via the addition of other molecules, it has been possible to reach sizes of under 200 nm for almost all kinds of polyplexes (Erbacher et al, 1998). Even with such small-size polyplexes, interaction of the latter with serum proteins (Dash et al, 1999) and/or later activation of the complement system (Plank et al, 1996), induces the formation of large particles that are recognized by the macrophage elimination system. In order to avoid charge mediated aggregation, covering of
the positively charged surface of the polyplexes has been performed. Some of the more widely used covering molecules are hydrophilic polymers, mainly polyethyleneglycol (Lee et al, 2002; Lim et al, 2000; Ogris et al, 2001b), and to a lesser extent poly-[N-(2hydroxypropyl)methacrylamide] (pHPMA) (Toncheva et al, 1998), anionic lipids (Mastrobattista et al, 2001), and even the targeting elements themselves - as is the case of galactose, (Hashida et al, 1998), the asialoorosomucoids (Kwoh et al, 1999) or transferrin (Ogris et al, 2001b). In general, the coated polyplexes exhibit a neutral or negative zeta potential (surface charge), in addition to much lesser binding to anionic proteins and scant induction of serum aggregation compared with uncovered polyplexes (Kircheis et al, 1999; Ogris et al, 1999). On the other hand, with the purpose of increasing in vivo transfection efficacy and specificity, several targeting elements have been incorporated to the polyplexes. One of the best worked models is the targeting to the liver of PLL polyplexes, with the use mainly of ligands that are recognized and internalized by the hepatic receptors of asialoglycoproteins, such as the asialoorosomucoids (Wu et al, 1991; Chowdhury et al, 1993), natural glycosidic residues like galactose (Perales et al, 1994; Nishikawa et al, 1998; Wu and Wu 1988) or mannose (Nishikawa et al, 2000), and glycopeptides (Merwin et al, 1994). Another of the in vivo systemic administration
379
Guillem and Aliño: Transfection pathways of nonspecific and targeted PEI-polyplexes models affording improved results involves gene transfer to tumors with PLL or PEI polyplexes targeted with transferrin and EGF (Frederiksen et al, 2000; Kircheis et al, 2001b). Polyplex targeting with antibodies has been applied for in vivo transfer to respiratory epithelium. Different targeting elements, such as anti-PECAM, an antibody against PECAM1 (platelet endothelial cell adhesion molecule 1) (Li et al, 2000) attached to a PEI backbone, or the Fab fragment of polyclonal antibodies with specificity for the polymeric Ig receptor abundantly expressed in cells of the pulmonary epithelium, attached to PLL backbone (Ferkol et al, 1995) have been used. Another approach has been the search of alternative routes to systemic administration, including local administration by direct addition of polyplexes over the targeted tissues or organs. One type of polymer used in vivo via local administration is represented by the fractured dendrimers. The latter have been used for the transfer of a gene with immunosuppressor activity, with the purpose of prolonging graft survival in a murine model of heart transplantation (Qin et al, 1998), obtaining good results. Also chitosan has been used in pulmonary local administration with a good toxicity profiles and good transfection efficacy (Koping-Hoggard et al, 2001). However, PEI is the polymer offering the greatest success and efficacy in vivo via local administration. PEIpolyplexes have been used for nucleic acid transfer to different organs including the kidneys (Boletta et al, 1997), brain (Boussif et al, 1995; Lemkine et al, 1999), lungs (Ferrari et al, 1997; Ferrari et al, 1999), and tumors in diverse locations (Coll et al, 1999; Aoki et al, 2001). However, few clinical tests have been conducted based on nucleic acid transfer with polyplexes. This shows that the field is still in its beginnings, and development will depend on the improvement of polyplex formulations for in vivo use.
References Abdallah B, Hassan A, Benoist C, Goula D, Behr JP and Demeneix BA (1996). A powerful nonviral vector for in vivo gene transfer into the adult mammalian brain: polyethylenimine. Hum Gene Ther 7, 1947-54 Alino SF, Bobadilla M, Garcia-Sanz M, Lejarreta M, Unda F and Hilario E (1993). In vivo delivery of human alpha 1antitrypsin gene to mouse hepatocytes by liposomes. Biochem Biophys Res Commun 192, 174-81. Alino SF, Crespo J, Blaya C, Tarrason G, Adán J, Escrig E, Benet M, Crespo A and Piulats J (1999). Oligonucleotideentrapped immunoliposome delivered by mini-osmotic pump improves the survival of SCID mice bearing human leukemia. Tumor Targeting 4, 1-9. Aoki K, Furuhata S, Hatanaka K, Maeda M, Remy JS, Behr JP, Terada M and Yoshida T (2001). Polyethylenimine-mediated gene transfer into pancreatic tumor dissemination in the murine peritoneal cavity. Gene Ther 8, 508-14. Behr JP (1996). [Gene transfer with amino lipids and amino polymers]. C R Seances Soc Biol Fil 190, 33-8. Berh J (1996). Lëponge à protons: un moyen d'entrer dans une cellule auquel les virus n'ont pas pensé. Méd Sci 12, 56-59. Bieber T and Elsasser HP ( 2001). Preparation of a low molecular weight polyethylenimine for efficient cell transfection. Biotechniques 30, 74-7, 80-1. Bieber T, Meissner W, Kostin S, Niemann A and Elsasser H (2002). Intracellular route and transcriptional competence of polyethylenimine-DNA complexes. J Control Release 82, 441. Boletta A, Benigni A, Lutz J, Remuzzi G, Soria MR and Monaco L (1997). Nonviral gene delivery to the rat kidney with polyethylenimine. Hum Gene Ther 8, 1243-51. Boussif O, Lezoualc'h F, Zanta MA, Mergny MD, Scherman D, Demeneix B and Behr JP (1995). A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proc Natl Acad Sci U S A 92, 7297-301. Boussif O, Zanta MA and Behr JP (1996). Optimized galenics improve in vitro gene transfer with cationic molecules up to 1000-fold. Gene Ther 3, 1074-80. Branden LJ, Mohamed AJ and Smith CI (1999). A peptide nucleic acid-nuclear localization signal fusion that mediates nuclear transport of DNA. Nat Biotechnol 17, 784-7. Brunner S, Sauer T, Carotta S, Cotten M, Saltik M and Wagner E (2000). Cell cycle dependence of gene transfer by lipoplex, polyplex and recombinant adenovirus. Gene Ther 7, 401-7. Cardarelli PM, Quinn M, Buckman D, Fang Y, Colcher D, King DJ, Bebbington C and Yarranton G (2002). Binding to CD20 by anti-B1 antibody or F(ab')(2) is sufficient for induction of apoptosis in B-cell lines. Cancer Immunol Immunother 51, 15-24. Chollet P, Favrot MC, Hurbin A and Coll JL (2002). Side-effects of a systemic injection of linear polyethylenimine-DNA complexes. J Gene Med 4, 84-91. Chowdhury NR, Wu CH, Wu GY, Yerneni PC, Bommineni VR and Chowdhury JR (1993). Fate of DNA targeted to the liver by asialoglycoprotein receptor-mediated endocytosis in vivo. Prolonged persistence in cytoplasmic vesicles after partial hepatectomy. J Biol Chem 268, 11265-71. Coll JL, Chollet P, Brambilla E, Desplanques D, Behr JP and Favrot M (1999). In vivo delivery to tumors of DNA complexed with linear polyethylenimine. Hum Gene Ther 10, 1659-66. Cotten M, Langle-Rouault F, Kirlappos H, Wagner E, Mechtler K, Zenke M, Beug H and Birnstiel ML (1990). Transferrinpolycation-mediated introduction of DNA into human leukemic cells: stimulation by agents that affect the survival of transfected DNA or modulate transferrin receptor levels. Proc Natl Acad Sci U S A 87, 4033-7.
V. Conclusions As we have seen, PEI based vectors have become important nonviral gene transfer vehicles, mostly because of the intrinsic properties of PEI. In effect, the latter is positively charged, thus allowing it to interact spontaneously with polyanionic nucleic acids and form stable polyplex particles that can interact with cell membrane; PEI protects DNA from degradation; and it allows linker molecule binding (through its primary amine groups), which in turn facilitates further covalent coupling of several elements that can improve the transfection profile of the vector in terms of efficacy and specificity, such as targeting proteins, nuclear localization sequences, etc. The transfection pathway of PEI polyplexes has not been fully elucidated, but they seem to follow an endocytic route in which PEI protects DNA from lysosomal degradation and promotes accession of DNA to the nucleus. Further efforts are needed to achieve better results with in vivo use, including improvements in the toxicity profile and stability in blood circulation, as well as other aspects involving in vivo nucleic acid transfer efficacy and specificity.
380
Gene Therapy and Molecular Biology Vol 8, page 381 Cotten M, Wagner E and Birnstiel ML (1993). Receptormediated transport of DNA into eukaryotic cells. Methods Enzymol 217, 618-44. Curiel DT, Agarwal S, Wagner E and Cotten M (1991). Adenovirus enhancement of transferrin-polylysine-mediated gene delivery. Proc Natl Acad Sci U S A 88, 8850-4. Dash PR, Read ML, Barrett LB, Wolfert MA and Seymour LW (1999). Factors affecting blood clearance and in vivo distribution of polyelectrolyte complexes for gene delivery. Gene Ther 6, 643-50. Dasi F, Benet M, Crespo J, Crespo A and Alino SF (2001). Asialofetuin liposome-mediated human alpha1-antitrypsin gene transfer in vivo results in stationary long-term gene expression. J Mol Med 79, 205-12. De Smedt SC, Demeester J and Hennink WE (2000). Cationic polymer based gene delivery systems. Pharm Res 17, 11326. Demeneix B, Behr J, Boussif O, Zanta MA, Abdallah B and Remy J (1998). Gene transfer with lipospermines and polyethylenimines. Adv Drug Deliv Rev 30, 85-95. Dheur S, Dias N, van Aerschot A, Herdewijn P, Bettinger T, Remy JS, Helene C and Saison-Behmoaras ET (1999). Polyethylenimine but not cationic lipid improves antisense activity of 3'-capped phosphodiester oligonucleotides. Antisense Nucleic Acid Drug Dev 9, 515-25. Duguid JG, Li C, Shi M, Logan MJ, Alila H, Rolland A, Tomlinson E, Sparrow JT and Smith LC (1998). A physicochemical approach for predicting the effectiveness of peptide-based gene delivery systems for use in plasmidbased gene therapy. Biophys J 74, 2802-14. Dunlap DD, Maggi A, Soria MR and Monaco L (1997). Nanoscopic structure of DNA condensed for gene delivery. Nucleic Acids Res 25, 3095-101. Erbacher P, Roche AC, Monsigny M and Midoux P (1996). Putative role of chloroquine in gene transfer into a human hepatoma cell line by DNA/lactosylated polylysine complexes. Exp Cell Res 225, 186-94. Erbacher P, Zou S, Bettinger T, Steffan AM and Remy JS (1998). Chitosan-based vector/DNA complexes for gene delivery: biophysical characteristics and transfection ability. Pharm Res 15, 1332-9. Erbacher P, Bettinger T, Belguise-Valladier P, Zou S, Coll JL, Behr JP and Remy JS (1999a). Transfection and physical properties of various saccharide, poly(ethylene glycol), and antibody-derivatized polyethylenimines (PEI). J Gene Med 1, 210-22. Erbacher P, Remy JS and Behr JP (1999b). Gene transfer with synthetic virus-like particles via the integrin-mediated endocytosis pathway. Gene Ther 6, 138-45. Felgner PL, Barenholz Y, Behr JP, Cheng SH, Cullis P, Huang L, Jessee JA, Seymour L, Szoka F, Thierry AR, Wagner E and Wu G (1997). Nomenclature for synthetic gene delivery systems. Hum Gene Ther 8, 511-2. Ferkol T, Perales JC, Eckman E, Kaetzel CS, Hanson RW and Davis PB (1995). Gene transfer into the airway epithelium of animals by targeting the polymeric immunoglobulin receptor. J Clin Invest 95, 493-502. Ferrari S, Moro E, Pettenazzo A, Behr JP, Zacchello F and Scarpa M (1997). ExGen 500 is an efficient vector for gene delivery to lung epithelial cells in vitro and in vivo. Gene Ther 4, 1100-6. Ferrari S, Pettenazzo A, Garbati N, Zacchello F, Behr JP and Scarpa M (1999). Polyethylenimine shows properties of interest for cystic fibrosis gene therapy. Biochim Biophys Acta 1447, 219-25. Fischer D, Bieber T, Li Y, Elsasser HP and Kissel T (1999). A novel non-viral vector for DNA delivery based on low molecular weight, branched polyethylenimine: effect of
molecular weight on transfection efficiency and cytotoxicity. Pharm Res 16, 1273-9. Forrest ML and Pack DW (2002). On the kinetics of polyplex endocytic trafficking: implications for gene delivery vector design. Mol Ther 6, 57-66. Frederiksen KS, Abrahamsen N, Cristiano RJ, Damstrup L and Poulsen HS (2000). Gene delivery by an epidermal growth factor/DNA polyplex to small cell lung cancer cell lines expressing low levels of epidermal growth factor receptor. Cancer Gene Ther 7, 262-8. Gebhart CL and Kabanov AV (2001). Evaluation of polyplexes as gene transfer agents. J Control Release 73, 401-16. Godbey WT, Barry MA, Saggau P, Wu KK and Mikos AG (2000). Poly(ethylenimine)-mediated transfection: a new paradigm for gene delivery. J Biomed Mater Res 51, 321-8. Godbey WT and Mikos AG (2001). Recent progress in gene delivery using non-viral transfer complexes. J Control Release 72, 115-25. Godbey WT, Wu KK and Mikos AG (1999a). Poly(ethylenimine) and its role in gene delivery. J Control Release 60, 149-60. Godbey WT, Wu KK and Mikos AG (1999b). Size matters: molecular weight affects the efficiency of poly(ethylenimine) as a gene delivery vehicle. J Biomed Mater Res 45, 268-75. Godbey WT, Wu KK and Mikos AG (1999c). Tracking the intracellular path of poly(ethylenimine)/DNA complexes for gene delivery. Proc Natl Acad Sci U S A 96, 5177-81. Goula D, Benoist C, Mantero S, Merlo G, Levi G and Demeneix BA (1998a). Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther 5, 1291-5. Goula D, Remy JS, Erbacher P, Wasowicz M, Levi G, Abdallah B and Demeneix BA (1998b). Size, diffusibility and transfection performance of linear PEI/DNA complexes in the mouse central nervous system. Gene Ther 5, 712-7. Guillem VM, Tormo M, Moret I, Benet I, Garcia-Conde J, Crespo A and Alino SF (2002a). Targeted oligonucleotide delivery in human lymphoma cell lines using a polyethyleneimine based immunopolyplex. J Control Release 83, 133-46. Guillem VM, Tormo M, Revert F, Benet I, Garcia-Conde J, Crespo A and Alino SF (2002b). Polyethyleneimine-based immunopolyplex for targeted gene transfer in human lymphoma cell lines. J Gene Med 4, 170-82. Guo W and Lee RJ (2001). Efficient gene delivery via noncovalent complexes of folic acid and polyethylenimine. J Control Release 77, 131-8. Haensler J and Szoka FC, Jr. (1993). Polyamidoamine cascade polymers mediate efficient transfection of cells in culture. Bioconjug Chem 4, 372-9. Hashida M, Takemura S, Nishikawa M and Takakura Y (1998). Targeted delivery of plasmid DNA complexed with galactosylated poly(L-lysine). J Control Release 53, 301-10. Jeong JH, Song SH, Lim DW, Lee H and Park TG (2001). DNA transfection using linear poly(ethylenimine) prepared by controlled acid hydrolysis of poly(2-ethyl-2-oxazoline). J Control Release 73, 391-9. Kabanov AV and Kabanov VA (1995). DNA complexes with polycations for the delivery of genetic material into cells. Bioconjug Chem 6, 7-20. Kircheis R, Kichler A, Wallner G, Kursa M, Ogris M, Felzmann T, Buchberger M and Wagner E (1997). Coupling of cellbinding ligands to polyethylenimine for targeted gene delivery. Gene Ther 4, 409-18. Kircheis R, Schuller S, Brunner S, Ogris M, Heider KH, Zauner W and Wagner E (1999). Polycation-based DNA complexes for tumor-targeted gene delivery in vivo. J Gene Med 1, 111-20.
381
Guillem and Ali単o: Transfection pathways of nonspecific and targeted PEI-polyplexes Kircheis R, Blessing T, Brunner S, Wightman L and Wagner E (2001a). Tumor targeting with surface-shielded ligand-polycation DNA complexes. J Control Release 72, 165-70. Kircheis R, Wightman L, Schreiber A, Robitza B, Rossler V, Kursa M and Wagner E (2001b). Polyethylenimine/DNA complexes shielded by transferrin target gene expression to tumors after systemic application. Gene Ther 8, 28-40. Kircheis R, Wightman L and Wagner E (2001c). Design and gene delivery activity of modified polyethylenimines. Adv Drug Deliv Rev 53, 341-58. Kjellen L and Lindahl U (1991). Proteoglycans: structures and interactions. Annu Rev Biochem 60, 443-75. Klemm AR, Young D and Lloyd JB (1998). Effects of polyethyleneimine on endocytosis and lysosome stability. Biochem Pharmacol 56, 41-6. Koping-Hoggard M, Tubulekas I, Guan H, Edwards K, Nilsson M, Varum KM and Artursson P (2001). Chitosan as a nonviral gene delivery system. Structure-property relationships and characteristics compared with polyethylenimine in vitro and after lung administration in vivo. Gene Ther 8, 1108-21. Kukowska-Latallo JF, Bielinska AU, Johnson J, Spindler R, Tomalia DA and Baker JR, Jr. (1996). Efficient transfer of genetic material into mammalian cells using Starburst polyamidoamine dendrimers. Proc Natl Acad Sci U S A 93, 4897-902. Kwoh DY, Coffin CC, Lollo CP, Jovenal J, Banaszczyk MG, Mullen P, Phillips A, Amini A, Fabrycki J, Bartholomew RM, Brostoff SW and Carlo DJ (1999). Stabilization of polyL-lysine/DNA polyplexes for in vivo gene delivery to the liver. Biochim Biophys Acta 1444, 171-90. Labat-Moleur F, Steffan AM, Brisson C, Perron H, Feugeas O, Furstenberger P, Oberling F, Brambilla E and Behr JP (1996). An electron microscopy study into the mechanism of gene transfer with lipopolyamines. Gene Ther 3, 1010-7. Lecocq M, Wattiaux-De Coninck S, Laurent N, Wattiaux R and Jadot M (2000). Uptake and intracellular fate of polyethylenimine in vivo. Biochem Biophys Res Commun 278, 414-8. Lee H, Jeong JH and Park TG (2002). PEG grafted polylysine with fusogenic peptide for gene delivery: high transfection efficiency with low cytotoxicity.. J Control Release 79, 283-91. Lemkine GF, Goula D, Becker N, Paleari L, Levi G and Demeneix BA (1999). Optimisation of polyethyleniminebased gene delivery to mouse brain. J Drug Target 7, 30512. Li S, Tan Y, Viroonchatapan E, Pitt BR and Huang L (2000). Targeted gene delivery to pulmonary endothelium by antiPECAM antibody. Am J Physiol Lung Cell Mol Physiol 278, L504-11. Lim DW, Yeom YI and Park TG (2000). Poly(DMAEMANVP)-b-PEG-galactose as gene delivery vector for hepatocytes. Bioconjug Chem 11, 688-95. Luby-Phelps K, Castle PE, Taylor DL and Lanni F (1987). Hindered diffusion of inert tracer particles in the cytoplasm of mouse 3T3 cells. Proc Natl Acad Sci U S A 84. 4910-3 Marcusson EG, Bhat B, Manoharan M, Bennett CF and Dean NM (1998). Phosphorothioate oligodeoxyribonucleotides dissociate from cationic lipids before entering the nucleus. Nucleic Acids Res 26, 2016-23. Marschall P, Malik N and Larin Z (1999). Transfer of YACs up to 2.3 Mb intact into human cells with polyethylenimine. Gene Ther 6, 1634-7. Mastrobattista E, Kapel RH, Eggenhuisen MH, Roholl PJ, Crommelin DJ, Hennink WE and Storm G (2001). Lipidcoated polyplexes for targeted gene delivery to ovarian carcinoma cells. Cancer Gene Ther 8, 405-13.
Merwin JR, Noell GS, Thomas WL, Chiou HC, DeRome ME, McKee TD, Spitalny GL and Findeis MA (1994). Targeted delivery of DNA using YEE(GalNAcAH)3, a synthetic glycopeptide ligand for the asialoglycoprotein receptor. Bioconjug Chem 5, 612-20. Meyer B, Uyech L and Szoka F (1997). Manipulating the intracellular trafficking of nucleic acids. Gene Therapy for diseases of the Lung. Brigham. New York, Marcel Dekker: 135-180. Mislick KA, Baldeschwieler JD, Kayyem JF and Meade TJ (1995). Transfection of folate-polylysine DNA complexes: evidence for lysosomal delivery. Bioconjug Chem 6, 512-5. Mislick KA and Baldeschwieler JD (1996). Evidence for the role of proteoglycans in cation-mediated gene transfer. Proc Natl Acad Sci U S A 93, 12349-54. Moret I, Esteban Peris J, Guillem VM, Benet M, Revert F, Dasi F, Crespo A and Alino SF (2001). Stability of PEI-DNA and DOTAP-DNA complexes: effect of alkaline pH, heparin and serum. J Control Release 76, 169-81. Newmeyer DD (1993). The nuclear pore complex and nucleocytoplasmic transport. Curr Opin Cell Biol 5, 395407. Nigg EA (1997). Nucleocytoplasmic transport: signals, mechanisms and regulation. Nature 386, 779-87. Nishikawa M, Takemura S, Takakura Y and Hashida M (1998). Targeted delivery of plasmid DNA to hepatocytes in vivo: optimization of the pharmacokinetics of plasmid DNA/galactosylated poly(L-lysine) complexes by controlling their physicochemical properties. J Pharmacol Exp Ther 287, 408-15 Nishikawa M, Takemura S, Yamashita F, Takakura Y, Meijer DK, Hashida M and Swart PJ (2000). Pharmacokinetics and in vivo gene transfer of plasmid DNA complexed with mannosylated poly(L-lysine) in mice. J Drug Target 8, 2938. Ogris M, Steinlein P, Kursa M, Mechtler K, Kircheis R and Wagner E (1998). The size of DNA/transferrin-PEI complexes is an important factor for gene expression in cultured cells. Gene Ther 5, 1425-33. Ogris M, Brunner S, Schuller S, Kircheis R and Wagner E (1999). PEGylated DNA/transferrin-PEI complexes: reduced interaction with blood components, extended circulation in blood and potential for systemic gene delivery. Gene Ther 6, 595-605. Ogris M, Wagner E and Steinlein P (2000). A versatile assay to study cellular uptake of gene transfer complexes by flow cytometry. Biochim Biophys Acta 1474, 237-43. Ogris M, Carlisle RC, Bettinger T and Seymour LW (2001a). Melittin enables efficient vesicular escape and enhanced nuclear access of nonviral gene delivery vectors. J Biol Chem 276, 47550-5. Ogris M, Steinlein P, Carotta S, Brunner S and Wagner E (2001b). DNA/polyethylenimine transfection particles: influence of ligands, polymer size, and PEGylation on internalization and gene expression. AAPS PharmSci 3, E21. O'Neill MM, Kennedy CA, Barton RW and Tatake RJ (2001). Receptor-mediated gene delivery to human peripheral blood mononuclear cells using anti-CD3 antibody coupled to polyethylenimine. Gene Ther 8, 362-8. Papisov IM and Litmanovich A (1988). Molecular "recognition" in interpolymer interactions and matrix polymerization. Adv. Polym. Sci. 90, 139-179. Perales JC, Ferkol T, Beegen H, Ratnoff OD and Hanson RW (1994). Gene transfer in vivo: sustained expression and regulation of genes introduced into the liver by receptortargeted uptake. Proc Natl Acad Sci U S A 91, 4086-90.
382
Gene Therapy and Molecular Biology Vol 8, page 383 Plank C, Zatloukal K, Cotten M, Mechtler K and Wagner E (1992). Gene transfer into hepatocytes using asialoglycoprotein receptor mediated endocytosis of DNA complexed with an artificial tetra-antennary galactose ligand. Bioconjug Chem 3, 533-9. Plank C, Oberhauser B, Mechtler K, Koch C and Wagner E (1994). The influence of endosome-disruptive peptides on gene transfer using synthetic virus-like gene transfer systems. J Biol Chem 269, 12918-24. Plank C, Mechtler K, Szoka FC, Jr. and Wagner E (1996). Activation of the complement system by synthetic DNA complexes: a potential barrier for intravenous gene delivery. Hum Gene Ther 7, 1437-46. Pollard H, Remy JS, Loussouarn G, Demolombe S, Behr JP and Escande D (1998). Polyethylenimine but not cationic lipids promotes transgene delivery to the nucleus in mammalian cells.. J Biol Chem 273, 7507-11. Poulain L, Ziller C, Muller CD, Erbacher P, Bettinger T, Rodier JF and Behr JP (2000). Ovarian carcinoma cells are effectively transfected by polyethylenimine (PEI) derivatives. Cancer Gene Ther 7, 644-52. Pouton CW, Lucas P, Thomas BJ, Uduehi AN, Milroy DA and Moss SH (1998). Polycation-DNA complexes for gene delivery: a comparison of the biopharmaceutical properties of cationic polypeptides and cationic lipids. J Control Release 53, 289-99. Puls R and Minchin R (1999). Gene transfer and expression of a non-viral polycation-based vector in CD4+ cells. Gene Ther 6, 1774-8. Qin L, Pahud DR, Ding Y, Bielinska AU, Kukowska-Latallo JF, Baker JR, Jr. and Bromberg JS (1998). Efficient transfer of genes into murine cardiac grafts by Starburst polyamidoamine dendrimers. Hum Gene Ther 9, 553-60. Remy-Kristensen A, Clamme JP, Vuilleumier C, Kuhry JG and Mely Y (2001). Role of endocytosis in the transfection of L929 fibroblasts by polyethylenimine/DNA complexes. Biochim Biophys Acta 1514, 21-32. Sosnowski BA, Gonzalez AM, Chandler LA, Buechler YJ, Pierce GF and Baird A (1996). Targeting DNA to cells with basic fibroblast growth factor (FGF2). J Biol Chem 271, 33647-53. Suh J, Paik H and Hwang B (1994). Ionization of polyethylenimine and polyallylamine at various pHs. Bioorg. Chem 22, 318-327. Suh W, Chung JK, Park SH and Kim SW (2001). Anti-JL1 antibody-conjugated poly (L-lysine) for targeted gene delivery to leukemia T cells. J Control Release 72, 171-8. Tang MX, Redemann CT and Szoka FC, Jr. (1996). In vitro gene delivery by degraded polyamidoamine dendrimers. Bioconjug Chem 7, 703-14. Tang MX and Szoka FC (1997). The influence of polymer structure on the interactions of cationic polymers with DNA and morphology of the resulting complexes. Gene Ther 4, 823-32. Toncheva V, Wolfert MA, Dash PR, Oupicky D, Ulbrich K, Seymour LW and Schacht EH (1998). Novel vectors for gene delivery formed by self-assembly of DNA with poly(Llysine) grafted with hydrophilic polymers. Biochim Biophys Acta 1380, 354-68. Turek J, Dubertret C, Jaslin G, Antonakis K, Scherman D and Pitard B (2000). Formulations which increase the size of lipoplexes prevent serum-associated inhibition of transfection. J Gene Med 2, 32-40. van de Wetering P, Cherng JY, Talsma H, Crommelin DJ and Hennink WE (1998). 2-(Dimethylamino)ethyl methacrylate based (co)polymers as gene transfer agents. J Control Release 53, 145-53.
van der Jagt RH, Badger CC, Appelbaum FR, Press OW, Matthews DC, Eary JF, Krohn KA and Bernstein ID (1992). Localization of radiolabeled antimyeloid antibodies in a human acute leukemia xenograft tumor model. Cancer Res 52, 89-94. Wagner E, Zenke M, Cotten M, Beug H and Birnstiel ML (1990). Transferrin-polycation conjugates as carriers for DNA uptake into cells. Proc Natl Acad Sci U S A 87, 34104. Wagner E, Cotten M, Foisner R and Birnstiel ML (1991). Transferrin-polycation-DNA complexes: the effect of polycations on the structure of the complex and DNA delivery to cells. Proc Natl Acad Sci U S A 88, 4255-9. Wagner E et al, (1994). Delivery of drugs, proteins and genes into cells using transferrin as a ligand for receptor-mediated endocytosis. Adv. Drug. Deliv. Rev 14, 113-136. Wiethoff CM, Smith JG, Koe GS and Middaugh CR (2001). The potential role of proteoglycans in cationic lipid-mediated gene delivery. Studies of the interaction of cationic lipidDNA complexes with model glycosaminoglycans. J Biol Chem 276, 32806-13. Wightman L, Kircheis R, Rossler V, Carotta S, Ruzicka R, Kursa M and Wagner E (2001). Different behavior of branched and linear polyethylenimine for gene delivery in vitro and in vivo. J Gene Med 3, 362-72. Wojda U and Miller JL (2000). Targeted transfer of polyethylenimine-avidin-DNA bioconjugates to hematopoietic cells using biotinylated monoclonal antibodies. J Pharm Sci 89, 674-81. Wong TK, Nicolau C and Hofschneider PH (1980). Appearance of beta-lactamase activity in animal cells upon liposomemediated gene transfer. Gene 10, 87-94. Wu GY, Wilson JM, Shalaby F, Grossman M, Shafritz DA and Wu CH (1991). Receptor-mediated gene delivery in vivo. Partial correction of genetic analbuminemia in Nagase rats.PG - 14338-42. J Biol Chem 266. Wu GY and Wu CH (1987). Receptor-mediated in vitro gene transformation by a soluble DNA carrier system. J Biol Chem 262, 4429-32. Wu GY and Wu CH (1988). Receptor-mediated gene delivery and expression in vivo. J Biol Chem 263, 14621-4. Zanta MA, Belguise-Valladier P and Behr JP (1999). Gene delivery: a single nuclear localization signal peptide is sufficient to carry DNA to the cell nucleus. Proc Natl Acad Sci U S A 96, 91-6. Zenke M, Steinlein P, Wagner E, Cotten M, Beug H and Birnstiel ML (1990). Receptor-mediated endocytosis of transferrin-polycation conjugates: an efficient way to introduce DNA into hematopoietic cells. Proc Natl Acad Sci U S A 87, 3655-9.
Dr. Salvador F. Ali単o and Dr.Vicent M. Guillem
383
Guillem and Ali単o: Transfection pathways of nonspecific and targeted PEI-polyplexes
384
Gene Therapy and Molecular Biology Vol 8, page 385 Gene Ther Mol Biol Vol 8, 385-394, 2004
c-myc: a double-headed Janus that regulates cell survival and death Review Article
Rosanna Supino1 and A. Ivana Scovassi2* 1
Istituto Nazionale per lo Studio e la Cura dei Tumori, Via Venezian 1, 20133 Milano, and 2Istituto di Genetica Molecolare CNR, Via Abbiategrasso 207, 27100 Pavia, Italy
__________________________________________________________________________________ *Correspondence: A. Ivana Scovassi, Istituto di Genetica Molecolare CNR, Via Abbiategrasso 207, 27100 Pavia, Italy; Tel +39-0382546334; Fax +39-0382-422286; E-mail: scovassi@igm.cnr.it Key words: Antisense, apoptosis, cancer, c-myc, phosphorylation, TFO Abbreviations: antisense oligonucleotides, (AS-ODN); disialoganglioside, (GD2); Oligonucleotides, (ODNs); Ribonucleoprotein, (RNP); triple helix-forming oligonucleotides, (TFOs) Received: 05 August 2004; Accepted: 07 September 2004; electronically published: September 2004
Summary A paradox for cancer biology is represented by the fact that some oncogenes, including c-myc, provide an advantage to cancer cells by stimulating uncontrolled proliferation while, at the same time, they exert a pro-apoptotic activity. The prominent roles of c-myc and the relevance of phosphorylation and subcellular compartmentalization of c-Myc protein are described in this review, which focuses also the possible strategies to modulate (i.e. up- and downregulate) the c-myc level. The gene expression targeted approach of c-myc modulation as anticancer therapeutic treatment is discussed. Deregulation of c-myc occurring in a broad range of human cancers is often associated with poor prognosis (Pelengaris et al, 2002). The molecular mechanisms for the frequently observed deregulation of c-myc in human cancers could depend on the fact that c-myc overexpression may antagonize the pro-apoptotic function of p53 (Ceballos et al, 2000). c-myc controls or affects other processes relevant to tumorigenesis, e.g. it can promote transformation by its ability to induce the expression of telomerase, thus bypassing telomere erosion and facilitating immortalization (Drissi et al, 2001). Different factors may regulate in distinct ways cmyc-promoted cell transformation (O’Hagan et al, 2000). Among them, Bim acts as a suppressor of Myc-induced lymphomagenesis (Egle et al, 2004); non-peptide antagonists of Myc/Max dimerization inhibit c-mycinduced transformation (Berg et al, 2002); the ATMrelated domain of TRRAP protein, which is involved in transcriptional regulation and chromatin structure, modulates c-myc-dependent oncogenesis (Park et al, 2001).
I. Introduction A. c-myc: a proto-oncogene with many functions It is generally assumed that the efficacy of anticancer drugs may be related to cell proliferation control and/or to the activation of the apoptotic pathway(s). Among the mediators of such processes, the c-myc proto-oncogene controls the balance between proliferation and death, thus playing a crucial role in different cell pathways leading to opposite effects (Prendergast, 1999; Amati et al, 2001; Eisenman, 2001; Nasi et al, 2001; Pelengaris et al, 2002; Pelengaris and Khan, 2003). In this respect, c-myc could be represented as Janus, the old Roman deity with two faces who presides over everything by regulating cell proliferation and cell death (Figure 1). A simplified view of the activities of c-myc is shown in Figure 2. In normal cells, c-myc expression is tightly controlled by mitogenic stimuli and appears to be necessary, and in some instances sufficient, to induce cells to enter the S phase of cell cycle and to proliferate, and to respond to differentiative stimuli (Hoffman and Liebermann, 1994). Translocation and amplification of the c-myc gene as well as increased half-life and overexpression of the oncoprotein, which have been observed in many tumors, promote tumorigenesis (Spencer and Groudine, 1991; Marcu et al, 1992).
B. c-Myc-interacting proteins c-Myc protein is a member of the helix-loop-helix leucine zipper family of transcription factors that bind to a DNA motif called “E-box”, which consists of the consensus sequence CACGTG. Efficient binding of c-Myc 385
Supino and Scovassi: Strategies to modulate the different functions of c-myc to an E-box requires the heterodimerization with its partner Max, another member of this family. Myc function is antagonized by the Mad protein, which can also dimerize with Max and bind to E-boxes (Amati et al, 2001; Baudino and Cleveland, 2001; Zhou and Hurlin, 2001). Since the main activities of Myc strictly depend on its dimerization with Max, the inhibition of such interaction may affect different processes. Indeed, small molecules acting as inhibitors of Myc/Max dimerization
were effective in counteracting the oncogenic activity of Myc (Berg et al, 2002). c-myc initiates a transcriptional program that controls hundred of genes belonging to different functional categories of myc targets. Some of them can be considered as direct targets, others are indirectly regulated. The investigation of the nature of the interaction among c-Myc network members revealed that it could be modulated through the formation of distinct sub-nuclear structures localized in specific compartments (Yin et al, 2001).
Figure 1. Representation of the oncogene c-myc as the double-headed Janus deity. Looking in the direction of both cell proliferation and death, c-myc controls the basic life processes.
Figure 2. Regulation of different processes by c-myc in normal cells. Effect of c-myc deregulation in promoting cancer.
386
Gene Therapy and Molecular Biology Vol 8, page 387 To date, the search for c-myc targets did not provide conclusive data. A still growing list of proteins regulated by c-Myc is reported and discussed in many reviews (Dang, 1999; Sakamuro and Prendergast, 1999; O’Hagan et al, 2000; Eisenman 2001; Levens, 2002, 2003; Fernandez et al, 2003; Nilsson and Cleveland, 2003, 2004; Patel et al, 2004). A variety of molecular, biological and genetic approaches were devised to identify the mRNAs induced or repressed by c-myc. Recent advances in proteomics and microarray technology allowed genomewide studies of mRNA transcripts responsive to c-Myc (Schuhmacher et al, 2001; Shiio et al, 2002; Watson et al, 2002; Fernandez et al, 2003; Orian et al, 2003).
2003). The analysis of the apoptosis induced in melanoma cells after c-myc down-regulation revealed that this process occurs through the specific depletion of the levels of glutathione (Biroccio et al, 2002). In contrast to the pro-apoptotic function usually ascribed to c-myc, it has been shown that c-myc could contribute to block apoptosis under some conditions. In lymphoid CEM cells, treatment with oxysterols reduces cMyc protein expression level before promoting apoptosis (Ayala-Torres et al, 1999), thus suggesting that the negative regulation of c-Myc does not inhibit the activation of apoptosis by steroid compounds.
D. c-Myc protein
C. Regulation of apoptosis by c-myc
c-Myc is a highly unstable phosphoprotein with a half-life of about 15-30 minutes. The phosphorylation sites Thr58 and Ser62 exert opposite effects on the control of cMyc degradation through the ubiquitin-proteasome pathway (Flinn et al, 1998; Sears et al, 2000; Amati, 2004; Herbst et al, 2004; Welcker et al, 2004; Yeh et al, 2004). Recent data indicate that the stability of c-Myc is regulated by different sequence elements, i.e. the N-terminal “degron” that signals Myc ubiquitination and degradation, and the C-terminal “stabilon” that promotes its sequestration and stabilization into a subnuclear compartment (Herbst et al, 2004). The N-terminal domain of c-Myc, which is essential for transcriptional and transforming activity, binds to !tubulin (Alexandrova et al, 1995) and is released from it during mitosis to facilitate microtubule disassembly. The release of c-Myc from !-tubulin is regulated by c-Myc phosphorylation state (Noguchi et al, 1999; Gregory and Hann, 2000; Niklinski et al, 2000). c-Myc protein shows a predominant localization in the cytoplasm of interphase cells, while in proliferating cells its nuclear distribution is similar to that of some ribonucleoprotein (RNP)containing structures (Spector et al, 1987), or is confined to large amorphous nuclear globules (Henriksson et al, 1988; Koskinen et al, 1991). The existence of a dynamic modification of c-Myc is suggested by the competition of phosphorylation and glycosylation for the same site, i.e. Thr58 (Kamemura et al, 2002). The search for the precise intracellular localization of c-Myc in tumor cells, where its degradation is deregulated with a resulting abnormal stability of the protein in the nucleus (Flinn et al, 1998; Salghetti et al, 1999; Gregory and Hann, 2000; Niklinski et al, 2000; Herbst et al, 2004), revealed that phosphorylated c-Myc accumulates in the nucleus of tumor cells. Phosphorylated c-Myc is distributed in the form of spots of different sizes throughout the nucleus and in the nucleolus (Soldani et al, 2002), where c-myc transcripts were described (Bond and Wold, 1993). As clearly demonstrated in HeLa cells (Soldani et al, 2002), phosphorylated c-Myc does accumulate in large amorphous globules (Henriksson et al, 1998) and its distribution pattern is not reminiscent of the distribution of non-nucleolar RNP-containing structures, as reported by Spector et al (1987). Remarkably, in tumor cells treated with the antimitotic drug paclitaxel, the immunolabeling for phosphorylated c-Myc changed, and became more diffused throughout the nucleoplasm
The observation that c-myc null fibroblasts are resistant to apoptosis highlighted the essential proapoptotic role of this oncogene (Chang et al, 2000). It is generally assumed that c-myc promotes apoptosis by sensitizing cells to a variety of insults rather than by acting as a direct death effector. Yu et al (2002) carried out a genome-wide survey for myc-mediated gene expression under apoptotic conditions. Isogenic Rat-1 cell lines that either overexpress or lack c-myc, were treated with etoposide, which induced apoptosis at an extent that depend upon the level of c-myc. The analysis provided the identification of a cluster of genes that respond to etoposide and are highly dependent on the cellular myc status. Moreover, the results revealed also that the existence of c-myc-independent genes involved in the apoptotic pathway. Although a detailed understanding of the signalling pathways by which c-myc elicits apoptosis is still lacking, different factors have been shown to modulate c-mycinduced apoptosis. As first shown by Fanidi et al (1992) and Bissonnette et al (1992), the ability of c-myc to promote apoptosis can be suppressed by the overexpression of bcl-2; the same effect was obtained by the suppression of the pro-apoptotic factor Bax (Mitchell et al, 2000). Ionizing radiation-induced apoptosis can be increased by the activity of c-Myc in suppressing BclXL, thus suggesting a strategy in desensitizing tumor cells to DNA damage-induced apoptosis (Maclean et al, 2003). The transcriptional repressor Mad1, which regulates negatively cell proliferation, has an inhibitory effect on cmyc-mediated apoptosis and proliferation (Gehring et al, 2000). Using RNA stable interference (siRNA), Nilsson and Cleveland (2004) showed that Mnt, a myc antagonist (Hurlin et al, 2004), triggers apoptosis via the myc target ODC. A similar indirect effect was described for the complex formed by the c-myc-negative regulator MBP-1 (c-myc promoter-binding protein 1), and MIP-2A (MBP-1interacting protein), which in turn regulates negatively the MBP-1 activity and the induction of apoptosis (Ghosh et al, 2001). A synergy between c-myc and different death receptors, leading to the release of cytochrome c from mitochondria, was shown (Klefstrom et al, 2002). Remarkably, it has been reported that the gene for cytochrome c, which is required for apoptosis, is a direct target of c-myc and that c-Myc binds to it (Morrish et al,
387
Supino and Scovassi: Strategies to modulate the different functions of c-myc (Bottone et al, 2003; Supino et al, unpublished observations). A typical example of the nuclear distribution of phosphorylated c-Myc in tumor cells is shown in Figure 3.
colon carcinoma cell line. 12A1 cells (tumorigenic clone) harbor an endogenous high level of amplification of the cmyc gene, whereas B3 cells (non-tumorigenic clone) have a small number of copies of this gene (Lavialle et al, 1988). We found that only cells with endogenous c-myc overexpression activate the apoptotic machinery in response to serum deprivation (Donzelli et al, 1999) and after the treatment with etoposide, doxorubicin and vitamin D 3, which induce Fas-mediated apoptosis (Gorrini et al, 2003). The low levels of c-myc expression present in SW613-B3 cells were unable to activate Fas-mediated apoptosis, thus suggesting that only a high c-myc expression can bypass the lack of Fas receptor. Apoptosis driven by DNA damage and long term-culture was independent of c-myc expression (Gorrini et al, 2003). The same experimental system was used to define the effect of c-myc amplification on the response to the antimitotic drug paclitaxel. A high c-myc amplification level potentiates paclitaxel cytotoxicity, confers a multinucleated phenotype and promotes apoptosis to a high extent, thus suggesting that c-myc expression level is relevant in modulating the cellular responses to paclitaxel (Bottone et al, 2003). In conclusion, the overexpression of c-myc could be a strategy for therapeutic applications, possibly by modulating myc levels, thus sensitising tumor cells to therapy. As an example of the clinical potential of the analysis of the c-myc expression level in tumors, recent data obtained on patients with ovarian cancer suggest that a high c-myc expression level could improve the chemotherapy response (Iba et al, 2004).
II. Strategies to modulate the c-myc level A. Overexpression The most common alteration affecting c-myc in human tumors is gene amplification (Nesbit et al, 1999), which can range from a single gene duplication to hundreds of copies. Many experiments based on the enforced expression of an exogenously introduced c-myc gene provided the evidence that c-myc amplification could sensitize tumor cells to apoptosis. The pro-apoptotic role for c-myc has been first shown in serum-starved primary or immortalized fibroblasts (Evan et al, 1992; Fanidi et al, 1992) and in IL-3-dependent myeloid cells upon withdrawal of the cytokine (Askew et al, 1991) and this role was further confirmed (Alarcon et al, 1996; Dong et al, 1977; Rupnow et al, 1998). Promising results have been obtained by Peltenburg et al (2004), who demonstrated that the stable transfection of IGR39D melanoma cells with c-myc causes a sensitization of tumor cells toward apoptosis. Although it is well established that apoptosis can be induced by the enforced expression of exogenously introduced c-myc genes in several experimental systems, it is interesting to investigate whether constitutive overexpression of the resident c-myc gene in tumor cells is sufficient to induce apoptosis. A positive correlation between endogenous high level of c-myc and apoptosis propensity was found in lymphoblastic leukemic CEM cells, which harbor constitutive activation of c-myc and undergo serum starvation-induced apoptosis (Tiberio et al, 2001). We addressed this question by examining the effect of different apoptogenic stimuli on tumorigenic and nontumorigenic clones isolated from the SW613-S human
B. Inhibition 1. The gene expression targeted therapy The identification of genes that are important for the development and maintenance of malignant phenotype opened new perspectives for eventually inducing a reversion to normal phenotype. In this view, diseaseassociated proteins can be targets of a selective therapy that would lead to less toxic side effects than the conventional, often cytotoxic, therapeutic treatment. In fact, the main limitation to conventional cancer chemotherapy derives from the lack of specificity of the drugs, and from pharmacokinetic and manufacturing problems, which can lead to systemic, and organ toxicity. This impairs the use of high-dose intensity therapy, giving rise to a high rate of tumor relapse. The identification of fundamental genetic differences between malignant and normal cells resulting, for example, from activated oncogenes and inactivated tumor suppressor genes, has made it possible to consider such genes as specific targets for antitumor therapy. In this respect, many genes have been selected for antisense therapy, including HER-2/neu, PKA, TGF-!, EGFR, TGF-Ă&#x;, IGFIR, P12, MDM2, BRCA, Bcl-2, ER, VEGF, MDR, ferritin, transferrin receptor, IRE, c-fos, HSP27, c-myc, c-raf and metallothioneins. Similar effects can be obtained with triple helix-forming oligonucleotides (TFOs) that are synthesized as to bind with a high affinity and specificity to double stranded DNA.
Figure 3. Nuclear localization of phosphorylated c-Myc in HeLa cells. Immunofluorescence experiments were carried out according to Bottone et al (2003). Red fluorescence: !-tubulin; green fluorescence: phosphorylated c-Myc.
388
Gene Therapy and Molecular Biology Vol 8, page 389 reduce the transcription and the expression of target genes, by blocking binding of transcriptional activators and/or formation of initiation complexes. TFOs can be used to mediate site-specific genome modification. Indeed, TFOs are effective by binding as third strands with sequence specificity and the resulting triple helices, or TFOmutagen complexes, are able to provoke repair and recombination (Faruqi et al, 2000), leading to directed mutagenesis, recombination, and, potentially, gene correction. TFO against p53, c-myc, bcl-2, HER/neu EGFR, etc have been successfully synthesized (Thomas et al, 1995; Basye et al, 2001; Shen et al, 2003; Re et al, 2004).
2. Rational for the use of a therapy targeted against c-myc Several genes known to be of importance in the regulation of apoptosis, cell growth, metastatization and angiogenesis provide a tantalizing prospect for the development of anticancer agents. Impaired apoptosis is a crucial step in tumorigenesis but is also a significant impediment to cytotoxic therapy (Hu and Kavanagh, 2003). Thus, agents targeted to interfere with appropriate molecules which regulate the apoptotic response to cell damage (spontaneous or induced by antitumor drugs) appear as a more rational therapeutic approach. As above reported, c-myc and bcl-2 are important regulators of tumor progression and of apoptotic response to chemotherapy. Conflicting results have been reported on the role of c-myc expression in drug resistance (Leonetti et al, 1999; Knapp et al, 2003; Grassilli et al, 2004). Implication of c-myc in sensitizing cells to apoptosis in p53-mutant small cell lung carcinoma (Supino et al, 2001) and in prostate carcinoma cells (Cassinelli et al, 2004) has been reported. Thus, in tumors where overexpression of cmyc is related to drug resistance, a combined treatment with antitumor drugs and antisense oligonucleotides (ASODN) against c-myc could improve the therapeutic effects. Additional approaches to modify c-myc expression consist of peptides, PNA (peptide nucleic acids) and siRNA (Cutrona et al, 2000; Hosono et al, 2004). Remarkably, it has been shown that c-Myc expression can be lowered by affecting the stabilization of a Gquadruplex structure present in the c-myc promoter (Grand et al, 2004).
4. Effectiveness of antisense approach i. Experimental validation The effectiveness of AS-ODN in the reduction of target gene expression has been differently reported in preclinical and clinical studies. In vitro studies show that ODNs are effective in the selective inhibition of gene expression (Monia et al, 1996; Eberle et al, 2002; HeereRess et al, 2002) and their application in clinical trials is attractive (Crooke, 1993; Hu and Kavanagh, 2003; Stephens and Rivers, 2003). Many experimental studies have been performed with AS-ODNs against several genes and successful chemosensitization and radiosensitization was found in combination treatments both in vitro and in vivo (Bcl-2/Bcl-xL and TRAIL, MDM2, HER-2, adhesion molecules; Del Bufalo et al, 2003; Rait et al, 2003; Zangemeister-Wittke, 2003; Wang et al, 2003; Tang et al, 2004). Recently, inhibition of c-myc and cyclin D1, resulting in a decrease in cell growth, increase of apoptotic index, inhibition of colony formation mediated by a decrease of E2F1 mRNA and protein production has been reported in hepatoma (Simile et al, 2004) and melanoma cells (Eberle et al, 2002). In an androgen-independent human prostate cancer xenograft murine model, an ASODN showed inhibition of c-myc translation and tumor growth and induction of apoptosis. In vivo studies on distribution of c-myc AS-ODN locally delivered by gelatin-coated platinum-iridium stents in rabbits indicated an induction of apoptosis in vascular smooth muscle cells, suggesting the efficacy of a local treatment (Zhang et al, 2004). TFOs directed to regulatory sequences in the c-myc gene have been shown to inhibit transcription factor binding and transcription in vitro as well as promoter activity and gene expression in HeLa and MCF-7 cells (Postel et al, 1991; Thomas et al, 1995; Kim et al, 1998). Moreover, GT-rich TFOs directed to a sequence near the P2 promoter were particularly effective in inhibiting c-myc expression in leukemic and cancer cells (Catapano et al, 2000; McGuffie et al, 2000); daunomycin-conjugated GTTFOs showed an increased stability of triple-helix and thus a higher activity of the TFO in human prostate (DU145) and breast cancer (MCF-7 and MDA-MB-231) cells (Carbone et al, 2004).
3. Mechanism of action of antisense oligonucleotides and triple helix forming oligonucleotides AS-ODN are able to inhibit specifically the synthesis of a particular protein by binding to protein-encoding RNA, thereby preventing RNA function and thus inhibiting the action of the gene. Antisense therapy should correct the mutations and abnormal expression of genes of tumor cells by decreasing their expression, inducing RNA degradation, and causing a premature termination of RNA transcription (Head et al, 2002). Oligonucleotides (ODNs) are short pieces of DNA; their size ranges generally from 18 to 21 nucleotides. They hybridize to a specific target mRNA and their action can be mediated by the cleavage of the target DNA or by blocking the translation of RNA. In the first case, once the AS-ODN is bound to the specific RNA target, cellular RNase H cleaves the RNA/ODN complex, cleaving the RNA strand and releasing the ODN which can bind another specific RNA strand. Alternatively, ODNs ribozymes can be designed to hybridize and cleave the target RNA, thus to sterically bind RNA, with a resulting arrest of translation process. TFOs are synthesized as to bind with a high affinity and specificity to the purine strand in the major groove of homopurine-homopyrimidine sequences in double stranded DNA. They can bind to DNA by parallel or antiparallel orientation. TFOs directed against the purine-rich tracts of gene promoter regions are able to selectively
ii. Clinical results Although ODNs are under clinical investigation in different diseases, the majority of them are exploited
389
Supino and Scovassi: Strategies to modulate the different functions of c-myc against cancer for which this form of molecular therapeutics seems particularly suitable (Biroccio et al, 2003). ODNs are systemically administered and their toxicities, similar for all compounds, include thrombocytopenia, hypotension, fever and fatigue. ASODNs against c-myc are currently in phase I study in humans. The lack of toxicity together with the results obtained in a large amount of preclinical results (Iversen et al, 2003; Bayes et al, 2004) support their temptative therapeutic use. It should be remembered that many other antisense approaches, including for example antisenses against BCL2, XIAP, PKA type I, EGFR, COX-2 inhibitors, gave, alone or in combination with antitumor agents, preclinical encouraging results in patients with advanced solid malignancies (Mani et al, 2003). Indeed this treatment is well tolerated and it is now in Phase III trials on chronic lymphocytic leukaemia, non-small-cell lung cancer, advanced malignant melanoma, multiple myeloma and prostate carcinoma (Hu and Kavanagh, 2003; Kim et al, 2004). Moreover, the effectiveness also of the oral administration of this kind of treatment makes this strategy very promising in cancer therapy (Tortora and Ciardiello, 2003).
limit therapeutic applications of AS-ODNs and TFOs (Wagner, 1995) (Figure 4). For this reason, many delivery systems such as viral vectors and liposomes to carry the AS-ODN through the cell membrane and the cytoplasm into the nucleus have been developed (Head et al, 2002). The use of lipid-based delivery systems represents a technological tool for increasing the stability of AS-ODNs in vivo (Gutierrez-Puente et al, 1999; Leonetti et al, 2001). The main advantage of liposomes entrapment of AS-ODN is their large carrying capacity, allowing the delivery of a large number of asODN molecules for each binding event. A second advantage is the long circulation longevity of liposome-entrapped drugs in different animal models (Webb et al, 1995; Leonetti et al, 2001) mainly due to a delay of antisense loss by extracellular nucleases. c-myc-AS-ODN efficiency was increased by delivering the ODN in sterically stabilized liposomes targeted against the disialoganglioside (GD2) epitope (highly expressed in melanoma cells). Encapsulation of AS-ODNs in GD2-targeted liposomes can protect nontargeted cells from potential deleterious effects of the ASODNs, and simultaneously enhance the toxicity of the molecule toward the target cell population. In these conditions, the down-modulation of c-myc determined a reduction of cell proliferation and tumorigenicity and an increased apoptotic rate of human melanoma (Pastorino et al, 2003). To increase the specificity, a selective delivery of immunoliposomes has been obtained with cell surfacedirected antibodies grafted on their exteriors (Allen and Moase, 1996) which, however, lose their advantage in the treatment of advanced solid tumors (Allen and Moase, 1996; Lopez De Menezes et al, 1998), likely because the "binding site barrier" restricts the penetration into the tumor (Yuan et al, 1994). Another strategy to increase the
iii. Limits of the ODNs approach and attempts to their overcoming Low physiological stability, intracellular degradation, in vivo instability, unfavorable pharmacokinetics (the lack of transfer across cell membranes), low cellular uptake, insufficient nuclear accumulation and accessibility to the target, and the need to deliver AS-ODNs selectively to diseased tissues to maximize their action and to minimize their side effect, together with dissociation of DNA binding, due to changes in DNA or chromatin dynamics,
Figure 4. Factors that can limit the use of antisense oligonucleotides (AS-ODN) or triple helix forming oligonucleotides (TFO). Sites 13 define where the factors reported in the respective boxes can interfere.
390
Gene Therapy and Molecular Biology Vol 8, page 391
References
residence time of the oligonucleotides on the target and to increase their stability was to modify ODNs and TFOs as phosphorothioate oligonucleotides, which show a binding affinity similar to that of the phosphodiester oligonucleotide. A marked inhibition of c-myc transcription in HeLa cells has been demonstrated (Kim et al, 1998). Advantages in the affinity and the half-life of the binding of TFO to DNA were taken by the daunomycin-conjugated TFO; with this approach c-myctargeted TFO showed a high stability and biological activity in mammary and prostate carcinoma cells (Carbone et al, 2004).
Alarcon RM, Rupnow BA, Graeber TG, Knox SJ, and Giaccia AJ (1996) Modulation of c-Myc activity and apoptosis in vivo. Cancer Res 56, 4315-4319. Alexandrova N, Niklinski J, Bliskovsky V, Otterson GA, Blake M, Kaye FJ, and Zajac-Kaye M (1995) The N-terminal domain of c-Myc associates with "-tubulin and microtubules in vivo and in vitro. Mol Cell Biol 15, 5188-5195. Allen TM, and Moase EH (1996) Therapeutic opportunities for targeted liposomal drug delivery. Adv Drug Del Rev 21, 117-133. Amati B (2004) Myc degradation: dancing with ubiquitin ligases. Proc Natl Acad Sci USA 101, 8843-8844. Amati B, Frank SR, Donjerkovic D, and Taubert S (2001) Function of the c-Myc oncoprotein in chromatin remodeling and transcription. Biochim Biophys Acta 1471, M135M145. Askew DS, Ashmun RA, Simmons BC, and Cleveland JL (1991) Constitutive c-myc expression in an IL-3-dependent myeloid cell line suppresses cell cycle arrest and accelerates apoptosis. Oncogene 6, 1915-1922. Ayala-Torres S, Zhou F, and Thompson EB (1999) Apoptosis induced by oxysterol in CEM cells is associated with negative regulation of c-Myc. Exp Cell Res 246, 193-202. Basye J, Trent JO, Gao D, and Ebbinghaus SW (2001) Triplex formation by morpholino oligodeoxyribonucleotides in the HER-2/neu promoter requires the pyrimidine motif. Nucl Acids Res 29, 4873-4880. Baudino TA, and Cleveland JL (2001) The Max network gone Mad. Mol Cell Biol 21, 691-702. Bayes M, Rabasseda X, and Prous JR (2004) Gateways to clinical trials. Methods Find Exp Clin Pharmacol 26, 211244. Berg T, Cohen SB, Desharnais J, Sonderegger C, Maslyar DJ, Goldberg J, Boger DL, and Vogt PK (2002) Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts. Proc Natl Acad Sci USA 99, 3830-3835. Biroccio A, Benassi B, Filomeni G, Amodei S, Marchini S, Chiorino G, Rotilio G, Zupi G, and Ciriolo MR (2002) Glutathione influences c-Myc-induced apoptosis in M14 human melanoma cells. J Biol Chem 277, 43763-43770. Biroccio A, Leonetti C, and Zupi G (2003) The future of antisense therapy: combination with anticancer treatments. Oncogene 22, 6579-6588. Bissonnette RP, Echeverri F, Mahboubi A, and Green DR (1992) Apoptotic cell death induced by c-myc is inhibited by bcl-2. Nature 359, 552-554. Bond VC, and Wold B (1993). Nucleolar localization of myc transcripts. Mol Cell Biol 13, 3221-3230. Bottone MG, Soldani C, Tognon GL, Gorrini C, Lazzè MC, Brison O, Ciomei M, Pellicciari C, and Scovassi AI (2003) Multiple effects of paclitaxel are modulated by a high c-myc amplification level. Exp Cell Res 290, 49-59. Carbone GM, McGuffie E, Napoli S, Flanagan CE, Dembech C, Negri U, Arcamone F, Capobianco ML, and Catapano CV (2004) DNA binding and antigene activity of a daunomycinconjugated triplex-forming oligonucleotide targeting the P2 promoter of the human c-myc gene. Nucl Acids Res 32, 2396-2410. Cassinelli G, Zuco V, Supino R, Lanzi C, Scovassi AI, Semple SC, and Zunino F (2004) Role of c-myc protein in hormone refractory prostate carcinoma: cellular response to paclitaxel. Biochem Pharmacol 68, 923-931. Catapano CV, McGuffie EM, Pacheco D, and Carbone GM (2000) Inhibition of gene expression and cell proliferation by triple helix-forming oligonucleotides directed to the c-myc gene. Biochemistry 39, 5126-5138.
III. Discussion The oncogene c-myc plays essential roles in controlling cell cycle and proliferation, differentiation, tumorigenesis and apoptosis. For its crucial involvement in the development of cancer as well as in driving tumor cells to apoptosis, c-myc is a good candidate for the development of strategies aimed at modulating its activity in tumor cells. In this respect, it is generally assumed that an increased level of c-myc could confer a propensity to apoptosis to a tumor cell, which is effective in potentiating the effects of clinical treatments. Even if this pro-apoptotic effect could be cell- and drug-dependent, promising results have been obtained in c-myc-overexpressing tumor cells derived from therapy-resistant tumors, such as melanomas and colon carcinomas. An opposite strategy to face tumor development is the inhibition of the activity of factors that control cell proliferation and transformation, including c-myc. This goal is mainly achievable by the use of AS-ODN or TFO. The increasing amount of preclinical data on the effect of AS-ODN to c-myc encourages their temptative therapeutic use. However, potential limitation to gene-targeted therapies may exist, e.g. the development of resistant tumor cell populations that lose their sensitivity toward cmyc inhibition over time. In addition, since c-myc is a factor involved in determining the fate of normal cells and tissues, the side effects of its inactivation have to be considered. In parallel with the antisense approach, the use of PNA and siRNA could provide an alternative way of down-regulating c-myc. The modulation of the functional interaction of c-Myc with its partners as well as the development of molecular tools to block the c-myc promoter could contribute to improve the anticancer therapy. Further in vitro experiments on different cancer cell lines will help in developing clinical trials aimed at obtaining a beneficial up- and down-regulation of c-myc in human tumors.
Acknowledgments The research at the laboratory of RS and AIS is supported respectively by AIRC (Associazione Italiana Ricerca sul Cancro) and MIUR (FIRB Project RBNE0132MY).
391
Supino and Scovassi: Strategies to modulate the different functions of c-myc Ceballos E, Delgado MD, Gutierrez P, Richard C, Muller D, Eilers M, Ehinger M, Gullberg U, and Leon J (2000) c-Myc antagonizes the effect of p53 on apoptosis and p21WAF1 transactivation in K562 leukemia cells. Oncogene 19, 21942204. Chang DW, Claassen GF, Hann SR, and Cole MD (2000) The cMyc transactivation domain is a direct modulator of apoptotic versus proliferative signals. Mol Cell Biol 20, 4309-4319. Crooke ST (1993) Therapeutic applications of oligonucleotides. Annu Rev Pharmacol Toxicol 32, 329-376. Cutrona G, Carpaneto EM, Ulivi M, Roncella S, Landt O, Ferrarini M, and Boffa LC (2000) Effects in live cells of a cmyc anti-gene PNA linker to a nuclear localization signal. Nat Biotechnol 18, 300-303. Dang CV (1999) c-Myc target genes involved in cell growth, apoptosis, and metabolism. Mol Cell Biol 19, 1-11. Del Bufalo D, Trisciuoglio D, Scarsella M, Zangemeister-Wittke U, and Zupi G (2003) Treatment of melanoma cells with a bcl-2/bcl-xL antisense oligonucleotide induces antiangiogenic activity. Oncogene 22, 8441-8447. Dong J, Naito M, and Tsuruo T (1997) c-Myc plays a role in cellular susceptibility to death receptor-mediated and chemotherapy-induced apoptosis in human monocytic leukemia U937 cells. Oncogene 15, 639-647. Donzelli M, Bernardi R, Negri C, Prosperi E, Padovan L, Lavialle C, Brison O, and Scovassi AI (1999) Apoptosisprone phenotype of human colon carcinoma cells with a high level amplification of the c-myc gene. Oncogene 18, 439448. Drissi R, Zindy F, Roussel MF, and Cleveland JL (2001) c-Mycmediated regulation of telomerase activity is disabled in immortalized cells. J Biol Chem 276, 29994-30001. Eberle J, Fecker LF, Brittner JU, Orfanos CE, and Geilen CC (2002) Decreased proliferation of human melanoma cell lines caused by antisense RNA against translation factor ELF4A1. Br J Cancer 86, 1957-1962. Egle A, Harris AW, Bouillet P, and Cory S (2004) Bim is a suppressor of Myc-induced mouse B cell leukemia. Proc Natl Acad Sci USA 101, 6164-6169. Eisenman RN (2001) Deconstructing Myc. Genes Dev 15, 20232030. Evan GI, Wyllie AH, Gilbert CS, Littlewood TD, Land H, Brooks M, Waters CM, Penn LZ, and Hancock DC (1992) Induction of apoptosis in fibroblasts by c-myc protein. Cell 69, 119-128. Fanidi A, Harrington EA, and Evan GI (1992) Cooperative interaction between c-myc and bcl-2 proto-oncogenes. Nature 359, 554-556. Faruqi AF, Datta HJ, Carroll D, Seidman MM, Glazer PM (2000). Triple-helix formation induces recombination in mammalian cells via a nucleotide excision repair-dependent pathway. Mol Cell Biol 20, 990-1000. Fernandez PC, Frank SR, Wang L, Schroeder M, Liu S, Greene J, Cocito A, and Amati B (2003) Genomic targets of the human c-Myc protein. Genes Dev 17, 1115-1129. Flinn EM, Busch CMC, and Wright APH (1998) myc boxes, which are conserved in myc family proteins, are signals for protein degradation via the proteasome. Mol Cell Biol 18, 5961-5969. Gehring S, Rottmann S, Menkel AR, Mertsching J, KrippnerHeidenreich A, and Luscher B (2000) Inhibition of proliferation and apoptosis by the transcriptional repressor Mad1. Repression of Fas-induced caspase-8 activation. J Biol Chem 275, 10413-10420. Ghosh AK, Majumder M, Steele R, White RA, and Ray RB (2001) A novel 16-kilodalton cellular protein physically
interacts with and antagonizes the functional activity of cmyc promoter-binding protein 1. Mol Cell Biol 21, 655-662. Gorrini G, Donzelli M, Torriglia A, Supino R, Brison O, Bernardi R, Negri C, Denegri M, Counis M-F, Ranzani GN, and Scovassi AI (2003). Effect of apoptogenic stimuli on colon carcinoma cell lines with a different c-myc expression level. Int J Mol Med 11, 737-742. Grand CL, Powell TJ, Nagle RB, Bearss DJ, Tye D, GleasonGuzman M, and Hurley LH (2004) Mutations in the Gquadruplex silencer element and their relationshipo to cMYC overexpression, NM23 repression, and therapeutic rescue. Proc Natl Acad Sci USA 101, 6140-6145. Grassilli E, Ballabeni A, Maellaro E, Del Bello B, and Helin K (2004) Loss of Myc confers resistance to doxorubicininduced apoptosis by preventing the activation of multiple serine protease- and caspase-mediated pathways. J Biol Chem 279, 21318-21326. Gregory MA, and Hann SR (2000) c-Myc proteolysis by the ubiquitin-proteasome pathway, stabilization of c-Myc in Burkitt's lymphoma cells. Mol Cell Biol 20, 2423-2435. Gutierrez-Puente Y, Tari AM, Stephens C, Rosenblum M, Guerra RT, and Lopez-Berestein G (1999) Safety, pharmacokinetics, and tissue distribution of liposomal Pethoxy antisense oligonucletotides targeted to Bcl-2. Pharmacol Exp Ther 291, 865-869. Head JF, Elliott RL, and Yang DC (2002) Gene targets of antisense therapies in breast cancer. Exp Opin Ther Targets 6, 375-385. Heere-Ress E, Thallinger C, Lucas T, Schlagbauer-Wadl H, Wacheck V, Monia BP, Wolff K, Pehamberger H, and Jansen B (2002) Bcl-X(L) is a chemoresistance factor in human melanoma cells that can be inhibited by antisense therapy. Int J Cancer 99, 29-34. Henriksson M, Classon M, Ingvarsson S, Koskinen P, Sumegi J, Klein G, and Thyberg J (1988) Elevated expression of c-myc and N-myc produces distinct changes in nuclear fine structure and chromatin organization. Oncogene 3, 587-593. Herbst A, Salghetti SE, Kim SY, and Tansey WP (2004) Multiple cell-type-specific elements regulate Myc protein stability. Oncogene 23, 3863-3871. Hoffman B, and Liebermann DA (1994) Molecular controls of apoptosis: differentiation/growth arrest primary response genes, proto-oncogenes, and tumor suppressor genes as positive and negative modulators. Oncogene 9, 1807-1812. Hosono T, Mizuguchi H, Katayama K, Xu ZL, Sakurai F, IshiiWatabe A, Kawabata K, Yamaguchi T, Nakagawa S, Mayumi T, and Hayakawa T (2004) Adenovirus vectormediated doxycycline-inducible RNA interference. Hum Gene Ther 15, 813-819. Hu W, and Kavanagh JJ (2003) Anticancer therapy targeting the apoptotic pathway. Lancet Oncol 4, 721-729. Hurlin PJ, Zhou ZQ, Toyo-Oka K, Ota S, Walker WL, Hirotsune S, and Wynshaw-Boris A (2004) Evidence of mnt-myc antagonism revealed by mnt gene deletion. Cell Cycle 3, 9799. Iba T, Kigawa J, Kanamori Y, Itamochi H, Oishi T, Simada M, Uegaki K, Naniwa J, and Terakawa N (2004) Expression of the c-myc gene as a predictor of chemotherapy response and a prognostic factor in patients with ovarian cancer. Cancer Sci 95, 418-423. Iversen PL, Arora V, Acker AJ, Mason DH, and Devi GR (2003) Efficacy of antisense morpholino oligomer targeted to c-myc in prostate cancer xenograft murine model and a Phase I safety study in humans. Clin Cancer Res 9, 2510-2519. Kamemura K, Hayes BK, Comer FI, and Hart GW (2002) Dynamic interplay between O-glycosylation and Ophosphorylation of nucleocytoplasmic proteins: alternative glycosylation/phosphorylation of THR-58, a known
392
Gene Therapy and Molecular Biology Vol 8, page 393 mutational hot spot of c-Myc in lymphomas, is regulated by mitogens. J Biol Chem 277, 19229-19235. Kim HG, Reddoch JF, Mayfield C, Ebbinghaus S, Vigneswaran N, Thomas S, Jones DE, and Miller DM (1998) Inhibition of transcription of the human c-myc protooncogene by intermolecular triplex. Biochemistry 37, 2299-2304. Kim R, Tanabe K, Emi M, Uchida Y, and Toge T (2004) Potential roles of antisense therapy in the molecular targeting of genes involved in cancer. Int J Oncol 24, 5-17. Klefstrom J, Verschuren EW, and Evan G (2002) c-Myc augments the apoptotic activity of cytosolic death receptor signaling proteins by engaging the mitochondrial apoptotic pathway. J Biol Chem 277, 43224-43232. Knapp DC, Mata JE, Reddy MT, Devi DR, and Iversen PL (2003) Resistance to chemotherapeutic drugs overcome by cMyc inhibition in a Lewis lung carcinoma murine model. Anticancer Drugs 14, 39-47. Koskinen PJ, Sistonen L, Evan G, Morimoto R, and Alitalo K (1991) Nuclear colocalization of cellular and viral myc proteins with HSP70 in myc-overexpressing cells. J Virol 65, 842-851. Lavialle C, Modjtahedi N, Cassingena R, and Brison O (1988) High c-myc amplification level contributes to the tumorigenic phenotype of the human breast carcinoma cell line SW613-S. Oncogene 3, 335-339. Leonetti C, Biroccio A, Benassi B, Stringaro A, Stoppacciaro A, Semple SC and Zupi G (2001) Encapsulation of c-myc antisense oligodeoxynucleotides in lipid particles improves antitumoral efficacy in vivo in a human melanoma line. Cancer Gene Ther 8, 459-468. Leonetti C, Biroccio A, Candiloro A, Citro G, Fornari C, Mottolese M, Del Bufalo D, and Zupi G (1999) Increase of cisplatin sensitivity by c-myc antisense oligodeoxynucleotides in a human metastatic melanoma inherently resistant to cisplatin. Clin Cancer Res 5, 25882595. Levens D (2002) Disentangling the MYC web. Proc Natl Acad Sci USA 99, 5757-5759. Levens DL (2003) Reconstructing MYC. Genes Dev 17, 10711077. Lopez De Menezes DE, Pilarski LM, and Allen TM (1998) In vitro and in vivo targeting of immunoliposomal doxorubicin to human B-cell lymphoma. Cancer Res 58, 3320-3330. Maclean KH, Keller UB, Rodriguez-Galindo C, Nilsson JA, and Cleveland JL. (2003) c-Myc augments gamma irradiationinduced apoptosis by suppressing Bcl-XL. Mol Cell Biol 23, 7256-7270. Mani S, Goel S, Nesterova M, Martin RM, Grindel JM, Rothenberg ML, Zhang R, Tortora G, and Cho-Chung YS (2003) Clinical studies in patients with solid tumors using a second-generation antisense oligonucleotide (GEM 231) targeted against protein kinase A type I. Ann N Y Acad Sci 1002, 252-262. Marcu KB, Bossone SA, and Patel AJ (1992) Myc function and regulation. Annu Rev Biochem 61, 809-860. McGuffie EM, Pacheco D, Carbone GM, and Catapano CV (2000) Antigene and antiproliferative effects of a c-myctargeting phosphorothioate triple helix-forming oligonucleotide in human leukemia cells. Cancer Res 60, 3790-3799. Mitchell KO, Ricci MS, Miyashita T, Dicker DT, Jin Z, Reed JC, and El-Deiry WS (2000) Bax is a transcriptional target and mediator of c-myc-induced apoptosis. Cancer Res 60, 63186325. Monia BP, Johnston FJ, Geiger T, Muller M, and Fabbro D (1996) Antitumor activity of a phosphorotioate antisense oligodeoxynucleotide targeted against C-raf kinase. Nat Med 2, 668-675.
Morrish F, Giedt C, and Hockenbery D (2003) c-MYC apoptotic function is mediated by NRF-1 target genes. Genes Dev 17, 240-255. Nasi S, Ciarapica R, Jucker R, Rosati J, and Soucek L (2001) Making decision through Myc. FEBS Lett 490, 153-162. Nesbit CE, Tersak JM, and Prochownik EV (1999) MYC oncogenes and human neoplastic disease. Oncogene 18, 3004-3016. Niklinski J, Claassen G, Meyers C, Gregory MA, Allegra CJ, Kaye FJ, Hann SR, and Zajac-Kaye M (2000) Disruption of Myc-tubulin interaction by hyperphosphorylation of c-Myc during mitosis or by constitutive hyperphosphorylation of mutant c-Myc in Burkitt's lymphoma. Mol Cell Biol 20, 5276-5284. Nilsson JA, and Cleveland JL (2003) Myc pathways provoking cell suicide and cancer. Oncogene 22, 9007-9021. Nilsson JA, and Cleveland JL (2004) Mnt: master regulator of the max network. Cell Cycle 3, 588-590. Noguchi K, Kitanaka C, Yamana H, Kokubu A, Mochizuki T, and Kuchino Y (1999) Regulation of c-Myc through phosphorylation at Ser-62 and Ser-71 by c-Jun N-terminal kinase. J Biol Chem 274, 32580-32587. O'Hagan RC, Schreiber-Agus N, Chen K, David G, Engelman JA, Schwab R, Alland L, Thomson C, Ronning DR, Sacchettini JC, Meltzer P, and DePinho RA (2000) Genetarget recognition among members of the myc superfamily and implications for oncogenesis. Nat Genet 24, 113-119. Orian A, van Steensel B, Delrow J, Bussemaker HJ, Li L, Sawado T, Williams E, Loo LW, Cowley SM, Yost C, Pierce S, Edgar BA, Parkhurst SM, and Eisenman RN (2003) Genomic binding by the Drosophila Myc, Max, Mad/Mnt transcription factor network. Genes Dev 17, 1101-1114. Park J, Kunjibettu S, McMahon SB, and Cole MD (2001) The ATM-related domain of TRRAP is required for histone acetyltransferase recruitment and Myc-dependent oncogenesis. Genes Dev 15, 1619-1624. Pastorino F, Brignole C, Marimpietri D, Pagnan G, Morando A, Ribatti D, Sample SC, Gambini C, Allen TM, and Ponzoni M (2003) Targeted liposomal c-myc antisense oligodeoxynucleotides induce apoptosis and inhibit tumor growth and metastases in human melanoma models. Clin Cancer Res 9, 4595-4605. Patel JH, Loboda AP, Showe MK, Showe LC, and McMahon SB. (2004) Analysis of genomic targets reveals complex functions of MYC. Nat Rev Cancer 4, 562-568. Pelengaris S, Khan M, and Evan G (2002) c-Myc, more than just a matter of life and death. Nat Rev Cancer 2, 764-776. Pelengaris S, and Khan M (2003) The many faces of c-Myc. Arch Biochem Biophys 416, 129-136. Peltenburg LTC, de Bruin EC, Meersma D, Wilting S, Jurgensmeier JM and Schrier PI (2004) c-Myc is able to sensitize human melanoma cells to diverse apoptotic triggers. Melanoma Res 14, 3-12. Postel EH, Flint SJ, Kessler DJ, and Hogan ME (1991) Evidence that a triplex-forming oligodeoxyribonucleotide binds to the c-myc promoter in HeLa cells, thereby reducing cmyc mRNA levels. Proc Natl Acad Sci USA 88, 8227-8231. Prendergast G (1999) Mechanisms of apoptosis by c-Myc. Oncogene 18, 2967-2987. Rait AS, Pirollo KF, Ulick D, Cullen K, and Chang EH (2003) Her-2-targeted antisense oligonucleotide results in sensitization of head and neck cancer cells to chemotherapeutic agents. Ann N Y Acad Sci 1002, 79-89. Re RN, Cook JL, and Giardina JF (2004) The inhibition of tumor growth by triplex-forming oligonucleotides. Cancer Lett 209, 51-53. Rupnow BA, Alarcon RM, Giaccia AJ, and Knox SJ (1998) p53 mediates apoptosis induced by c-Myc activation in hypoxic
393
Supino and Scovassi: Strategies to modulate the different functions of c-myc or gamma irradiated fibroblasts. Cell Death Differ 5, 141147. Sakamuro D, and Prendergast GC (1999) New Myc-interacting proteins: a second Myc network emerges. Oncogene 18, 2942-2954. Salghetti SE, Kim SY, and Tansey WP (1999). Destruction of Myc by ubiquitin-mediated proteolysis, cancer-associated and transforming mutations stabilize Myc. EMBO J 18, 717726. Schuhmacher M, Kohlhuber F, Holzel M, Kaiser C, Burtscher H, Jarsch M, Bornkamm GW, Laux G, Polack A, Hudle UH, and Eick D (2001) The transcriptional program of a human B cell line in response to Myc. Nucl Acids Res 29, 397-406. Sears R, Nuckolls F, Haura E, Taya Y, Tamai K, and Nevins JR (2000) Multiple Ras-dependent phosphorylation pathways regulate Myc protein stability. Genes Dev 14, 2501-2514. Shen C, Rattat D, Buck A, Mehrke G, Polat B, Ribbert H, Schirrmeister H, Mahren B, Matuschek C, and Reske SN (2003) Targeting bcl-2 by triplex-forming oligonucleotide-a promising carrier for gene-radiotherapy. Cancer Biother Radiopharm18, 17-26. Shiio Y, Donohoe S, Yi EC, Goodlett DR, Aebersold R, and Eisenman RN (2002) Quantitative proteomic analysis of Myc oncoprotein function. EMBO J 21, 5088-5096. Simile MM, De Miglio MR, Muroni MR, Frau M, Asara G, Serra S, Muntoni MD, Seddaiu MA, Daino L, Feo F, and Pascale RM (2004) Down-regulation of c-myc and Cyclin D1 genes by antisense oligodeoxy nucleotides inhibits the expression of E2F1 and in vitro growth of HepG2 and Morris 5123 liver cancer cells. Carcinogenesis 25, 333-341. Soldani C, Bottone MG, Biggiogera M, Alpini C, Scovassi AI, Martin T, and Pellicciari C (2002) Nuclear localization of phosphorylated c-Myc protein in human tumor cells. Eur J Histochem 46, 377-380. Spector DL, Watt RA, and Sullivan NF (1987) The v- and c-myc oncogene proteins colocalize in situ with small nuclear ribonucleoprotein particles. Oncogene 1, 5-12. Spencer CA, and Groudine M (1991) Control of c-myc regulation in normal and neoplastic cells. Adv Cancer Res 56, 1-48. Stephens AC, and Rivers RP (2003) Antisense oligonucleotide therapy in cancer. Curr Opin Mol Ther 5, 118-122. Supino R, Perego P, Gatti L, Caserini C, Leonetti C, Colantuono M, Zuco V, Carenini N, Zupi G, and Zunino F (2001) A role for c-myc in DNA damage-induced apoptosis in a human TP53-mutant small-cell lung cancer cell line. Eur J Cancer 37, 2247-2256. Tang NH, Chen YL, Wang XQ, Li XJ, Yin FZ, and Wang XZ (2004) Cooperative inhibitory effects of antisense oligonucleotide of cell adhesion molecules and cimetidine on cancer cell adhesion. World J Gastroenterol 10, 62-66. Thomas TJ, Faaland CA, Gallo MA, and Thomas T (1995) Suppression of c-myc oncogene expression by a polyaminecomplexed triplex forming oligonucleotide in MCF-7 breast cancer cells. Nucl Acids Res 23, 3594-3599. Tiberio L, Maier JAM, and Schiaffonati L (2001) Downmodulation of c-myc expression by phorbol ester protects CEM T leukaemia cells from starvation-induced apoptosis: role of ornithine decarboxylase and polyamines. Cell Death Differ 8, 967-976. Tortora G, and Ciardiello F (2003) Antisense targeting protein kinase A type I as a drug for integrated strategies of cancer therapy. Ann N Y Acad Sci 1002, 236-243. Wagner RW (1995) The state of the art in antisense research. Nat Med 1, 1116-1118.
Wang H, Oliver P, Zhang Z, Agrawal S, and Zhang R (2003) Chemosensitization and radiosensitization of human cancer by antisense anti-MDM2 oligonucleotides: in vitro and in vivo activities and mechanisms. Ann NY Acad Sci 1002, 217-235. Watson JD, Oster SK, Shago M, Khosravi F, and Penn LZ (2002) Identifying genes regulated in a Myc-dependent manner. J Biol Chem 277, 36921-36930. Webb MS, Harasym TO, Masin D, Bally MB, and Mayer LD (1995) Sphingomyelin-cholesterol liposomes significantly enhance the pharmacokinetic and therapeutic properties of vincristine in murine and human tumor models. Br J Cancer 72, 896-904. Welcker M, Orian A, Jin J, Grim JA, Harper JW, Eisenman RN, and Clurman BE (2004) The Fbw7 tumor suppressor regulates glycogen synthase kinase 3 phosphorylationdependent c-Myc protein degradation. Proc Natl Acad Sci USA 101, 9085-9090. Yeh E, Cunningham M, Arnold H, Chasse D, Monteith T, Ivaldi G, Hahn WC, Stukenberg PT, Shenolikar S, Uchida T, Counter CM, Nevins JR, Means AR, and Sears R (2004) A signalling pathway controlling c-Myc degradation that impacts oncogenic transformation of human cells. Nat Cell Biol 6, 308-318. Yin X, Landay MF, Han W, Levitan ES, Watkins SC, Levenson RM, Farkas DL, and Prochownik EV (2001) Dynamic in vivo interactions among Myc network members. Oncogene 20, 4650-4664. Yu Q, He M, Lee NH, and Liu ET (2002) Identification of Mycmediated death response pathways by microarray analysis. J Biol Chem 277, 13059-13066. Yuan F, Leunig M, Huang SK, Berk DA, Papahadjopoulos D, and Jain RK (1994) Microvascular permeability and interstitial penetration of sterically stabilized (stealth) liposomes in a human tumor xenograft. Cancer Res 54, 3352-3356. Zangemeister-Wittke U (2003) Antisense to apoptosis inhibitors facilitates chemotherapy and TRAIL-induced death signalling. Ann NY Acad Sci 1002, 90-94. Zhang XX, Cui CC, Xu XG, Hu XS, Fang WH, and Kuang BJ (2004) In vivo distribution of c-myc antisense oligodeoxynucleotides local delivered by gelatine-coated platinum-iridium stents in rabbits and its effect on apoptosis. Chin Med J 117, 258-263. Zhou ZQ, and Hurlin PJ (2001) The interplay between Mad and Myc in proliferation and differentiation. Trends Cell Biol 11, S10-14.
From left to right: Rosanna Supino and A. Ivana Scovassi
394
Gene Therapy and Molecular Biology Vol 8, page 395 Gene Ther Mol Biol Vol 8, 395-402, 2004
DNA-based vaccine for treatment of intracerebral neoplasms Research Article
Terry Lichtor1,3*, Roberta P Glick1,3, InSug O-Sullivan2, Edward P Cohen2,4 1
Department of Neurological Surgery, Rush University Medical Center and John H Stroger Hospital of Cook County Department of Microbiology and Immunology, University of Illinois at Chicago; Chicago, Illinois
2
__________________________________________________________________________________ *Correspondence: Terry Lichtor, MD, PhD, Department of Neurosurgery, 1900 West Polk Street, Chicago, Illinois 60612; Telelphone: 312-864-5120; Fax: 312-864-9606; E-Mail: Terry_Lichtor@rush.edu Key words: Gene Therapy, Breast Cancer, Brain Tumors, Tumor Vaccine Abbreviations: cytotoxic T-lymphocyte, (CTL); intracerebrally, (i.c.); Mean survival time, (MST); phenazine methosulfate, (PMS); spontaneous breast neoplasm, (SB-5b); tumor associated antigens, (TAA) 3
Supported in part by a grant from CINN Foundation awarded to Drs. Lichtor and Glick Supported in part by NIDCR grant number RO1DE013970-01A2 awarded to Dr. Cohen
4
Received: 8 July 2004; revised: 14 September 2004 Accepted: 20 September 2004; electronically published: September 2004
Summary Antigenic differences between normal and malignant cells of the cancer patient form the rationale for clinical immunotherapeutic strategies. Because the antigenic phenotype of neoplastic cells varies widely among different cells within the same malignant cell-population, immunization with a vaccine that stimulates immunity to the broad array of tumor antigens expressed by the cancer cells is likely to be more efficacious than immunization with a vaccine for a single antigen. A vaccine prepared by transfer of DNA from the tumor into a highly immunogenic cell line can encompass the array of tumor antigens that characterize the patient’s neoplasm. Poorly immunogenic tumor antigens, characteristic of malignant cells, can become strongly antigenic if they are expressed by highly immunogenic cells. A DNA-based vaccine was prepared by transfer of genomic DNA from a breast cancer that arose spontaneously in a C3H/He mouse into a highly immunogenic mouse fibroblast cell line, where genes specifying tumor-antigens were expressed. The fibroblasts were modified in advance of DNA-transfer to secrete an immune augmenting cytokine and to express allogeneic MHC class I-determinants. In an animal model of breast cancer metastatic to the brain, introduction of the vaccine directly into the tumor bed stimulated a systemic cellular anti-tumor immune response and prolonged the lives of the tumor-bearing mice.
techniques have been designed to increase the antigenic properties of tumor cells. The immunogenic properties of tumor cells were increased by modifying neoplastic cells to secrete immune-augmenting cytokines, or by “feeding” antigen presenting (dendritic) apoptotic bodies from tumor cells or tumor cell lysates. Anti-tumor immune responses followed immunization with such vaccines as well as vaccine prepared by introducing tumor cell-derived RNA into dendritic cells. Immunization with dendritic cells “fed” derivates of tumor cells or transfected with tumorRNA can result in the induction of immune responses against the broad array of tumor antigens expressed by the population of malignant cells including tumors of neuroectodermal origin. In one pre-clinical study, intraperitoneal injection of bone marrow-derived dendritic
I. Introduction An emerging strategy in the treatment of cancer involves stimulation of an immune response against the unique antigens expressed by the neoplastic cells. The expectation is that effectively stimulated, the immune system can be called upon to destroy the malignant cells. In most instances, proliferating tumors do not provoke anti-tumor immune responses, which are capable of controlling tumor growth. The neoplastic cells escape recognition by the immune system in spite of the fact that they form weakly immunogenic tumor associated antigens (TAA). The successful induction of immunity to TAA could result in tumor cell destruction and prolongation of the survival of cancer patients. A number of different
395
Lichtor et al: DNA-Based Vaccine for intracerebral neoplasms cells pulsed with the RNA derived from the GL261 glioma cells induced a T cell response against intracerebrally implanted GL261 cells (O et al, 2002). The efficacy of the vaccine was improved further by administration of recombinant interleukin-12 into the vaccine regimen. In patients, immunization with autologous dendritic cells transfected with mRNA from malignant glioma elicited a tumor specific CD8+ cytotoxic T-lymphocyte (CTL) response against the patient’s malignant cells (Kobayashi et al, 2003). Immunotherapy can result in the selective destruction of the neoplasm with minimal or non-existent toxic effects. Selective tumor regression was observed in experimental animals and patients receiving immunotherapy alone, suggesting the potential effectiveness of this type of treatment for patients with malignant disease (Valmori et al, 2000). Antigenic differences between normal and malignant cells form the rationale for clinical immunotherapy protocols. Because the antigenic phenotype varies widely among different cells within the same tumor-cell population, immunization with a vaccine that stimulates immunity to multiple TAA expressed by the entire population of malignant cells is likely to be more effective than immunization with a vaccine for a single antigen. Variants that fail to express the antigen chosen for therapy can avoid destruction. Here, in a mouse model, we describe the application of a novel immunotherapeutic strategy to intracerebral breast cancer. The vaccine was prepared by transfer of genomic DNA from breast cancer cells into a highly immunogenic fibroblast cell line, where genes specifying breast cancer antigens are expressed (Cohen, 2001). The vaccine encompasses the array of TAA that defines the patient’s neoplasm. Poorly immunogenic TAA, characteristic of malignant cells, become strongly antigenic if they are expressed by highly immunogenic cells. In animal models of melanoma and breast cancer, immunization with DNA-based vaccine was sufficient to deter tumor growth and to prolong the lives of tumor-bearing mice (Cohen, 2001; Whiteside et al, 2002). Previous studies indicated that transfection of genomic DNA from the malignant cells into the cell line resulted in stable integration and expression of the transferred DNA altering both the genotype and the phenotype of the cells that took up the exogenous DNA. The genetically engineered cells were effective stimulators of the antitumor immune response. Immunization of tumor-bearing mice with the DNA-based vaccine resulted in the induction of cell mediated immunity directed toward the type of cell from which the DNA was obtained, and prolongation of survival. This was the case for mice with melanoma, squamous cell carcinoma and in mice with breast cancer (de Zoeten et al, 1999). Multiple undefined genes specifying TAA that characterize the malignant cell population were expressed by cells that took up DNA from the tumor. Among other advantages, only microgram quantities of DNA from small amounts of tumor tissue were required to prepare the vaccine. As the transferred DNA is integrated into the genome of the recipient cells, and is replicated as the cells divide, the number of vaccine cells can be expanded as required for multiple
immunizations. The recipient cells can also be modified before DNA transfer to increase their immunogenic properties, as for example, to secrete immune-augmenting cytokines or to express allogeneic MHC-determinants. In animal models, injection of cytokine-secreting allogeneic fibroblasts into the tumor bed of intracerebral neoplasms was also effective in the treatment of mice with established brain tumors (Lichtor et al, 2002). Although immunotherapy with a vaccine prepared by transfer of tumor-DNA into a highly immunogenic cell line has its advantages, there are potential concerns. Genes that specify normal cellular constituents are also expressed by the transfected cells. They may be recognized as ‘foreign’ by the immune system, provoking an autoimmune disease. Autoimmune disease has not been observed, however, following extensive immunization with the tumor-DNA-transfected fibroblasts. The immune system is normally tolerant to “self” antigens. Mice immunized with DNA-based vaccines have not exhibited adverse effects; they lived their anticipated life spans without evidence of disease. Cellular infiltrates into normal organs or tissues have not been detected. It is also conceivable that the vaccine itself may grow in the recipient, forming a tumor or provoking a neoplasm. However in multiple studies, tumor growth at the vaccination site or elsewhere in the body has not been observed.
II. Materials and methods A. Preparation of a vaccine for use in the treatment of intracerebral breast cancer by transfection of cytokine-secreting syngeneic /allogeneic fibroblasts with DNA from a breast carcinoma that arose spontaneously in a C3H/He mouse (SB-5b cells) Cytokine-secreting syngeneic/allogeneic fibroblasts were prepared as described previously (Lichtor et al, 2002). The cells were further modified by transferring DNA from mouse SB-5b breast cancer cells into the fibroblasts (Figure 1). Sheared, unfractionated DNA isolated (Qiagen, Chatsworth, CA) from a spontaneous mammary adenocarcinoma (SB-5b) that arose in a C3H/He mouse taken directly from in vitro cultured cells, was used to transfect mouse fibroblasts modified to express allogeneic H-2Kb-determinants and to secrete IL-2 (LM-IL-2Kb cells), IL-18 (LM-IL-18Kb cells) or GM-CSF (LM-GMCSFKb cells) or to express H-2K b-determinants alone (LMK b cells) using the methods described in (Wigler et al, 1979) as modified. Briefly, high molecular weight DNA from each cell type was sheared by passage through the DNA isolation column. The approximate size of the DNA at the time it was used in the experiments was 25 kb. Afterward, 100 µg of sheared DNA was mixed with 10 µg pCDNA6/V5-HisA, a plasmid which gives resistance to the antibiotic Blasticidin, for use in selection. The sheared DNA and plasmid (DNA : plasmid ratio = 10 : 1) were then mixed with Lipofectamine 2000, according to the manufacturer’s instructions (Life Technologies, Carlsbad, CA). The DNA/Lipofectamine mixture was added to a population of 1 X 107 actively proliferating LM-IL-2Kb, LM-IL18Kb, LMGMCSFKb cells, or non-cytokine secreting LMKb cells divided into ten dishes containing an original inoculum of 1 X 106 cells. Eighteen hours afterward, the medium was replaced with fresh growth medium. The fibroblasts were maintained for 14 days in growth medium containing 2-5 µg/ml Blasticidin HCl
396
Gene Therapy and Molecular Biology Vol 8, page 397
Figure 1. Preparation of the DNA-based vaccine. DNA-based vaccines were prepared by transfection of the fibroblast cell line LM with DNA from mouse breast carcinoma. Briefly, high-molecular weight DNA from SB-5b cells was sheared by passage through the DNA isolation column. Next, 100 µg of the sheared DNA was mixed with 10 µg pCDNA6/V5-HisA, a plasmid that confers resistance to Basticidin. The sheared DNA and the plasmid were then mixed with lipofectamine to facilitate DNA uptake. The DNA-lipofectamine mixture was added to a population of 1 X 107 LM fibroblasts modified previously by retroviral transduction to secrete IL-2 and to express H-2Kb-determinants (LM-IL-2Kb cells). The transfected fibroblasts were grown on a tissue culture plate, and Blasticidin was added to the medium to select for cells that had taken up the foreign plasmid DNA. Histopaque (Sigma) density gradient (Kim and Cohen, 1994) were co-cultured at 370 C for 18 hrs with mitomycin C-treated (50 µg/ml for 45 min at 370 C) SB-5b target cells. The ratio of spleen cells to SB-5b cells was 30:1. Afterward, the non-adherent cells were removed, washed and viable SB-5b cells were added at various E:T ratios for 4 hrs at 370C. Negative control wells were treated with 2% Triton-100 to cause total lysis of the cells. Positive control wells contained SB-5b cells alone. Next 20 µl of MTS and 1 µl of phenazine methosulfate (PMS), an electron coupling reagent, were mixed and added to each well, followed by incubation at 37°C for 1-4 hrs in a 7% CO2/air atmosphere after which the absorbance was read. The percent specific lysis was calculated from the absorbance using the formula as follows:
(Invitrogen, Carlsbad, CA). One hundred percent of the cells transfected with tumor-DNA alone maintained in the Basticidin growth medium died within this period. The surviving colonies in each of the plates (a total of at least 2.5 X 104) were pooled and maintained as a cell line for use in the experiments.
B. Intracerebral injection of C3H/He mice with SB-5b breast cancer cells As a model of intracerebral metastatic breast cancer in patients, C3H/He mice were injected intracerebrally with a mixture of SB-5b breast cancer cells and the DNA-transfected modified fibroblasts. Anesthetized mice were placed into a stereotactic frame. A 1 mm burr hole was introduced into the right frontal lobe in the region of the coronal suture using a D#60 drill bit (Plastics One, Roanoke, VA). A Hamilton syringe containing a 26 gauge needle with a small 2-3 mm piece of solder placed 3-4 mm from the tip of the needle to maintain a uniform depth of injection was used to introduce the breast cancer cells and vaccine into the brain. The total injection volume was 5-10 µl. After injection, the incision over the burr hole was closed with a single 5-O Dexon absorbable suture.
Experimental Group – Negative Control X 100 Positive Control – Negative Control
D. ELISPOT IFN-! Assay Spleen cells from C3H/He mice injected i.c. with the various cell constructs were analyzed in ELISPOT IFN-! assays. This determines the proportion of T cells reactive with SB-5b cells. T cells from the spleens were recovered by Histopaque density gradient and co-incubated with SB-5b tumor cells (the spleen cell: SB-5b cell ratio = 10:1) for 16 hours at 37°C in wells precoated with a high-affinity monoclonal antibody for INF-! according to the manufacturer’s instructions (BD Pharmingen, San Diego, CA). The cells were washed before the addition of biotinylated anti-IFN-! detection antibody and horse radish peroxidase labeled streptavidin (Streptavidin-HRP). The spots were counted using computer-assisted image analysis (ImmunoSpot Series 2 analyzer: Cellular Technology Limited, Cleveland, OH).
C. T cell mediated cytotoxicity toward breast cancer cells A CellTiter 96 aqueous non-radioactive cell proliferation assay kit (Promega, Madison WI) was used to measure T cell mediated cytotoxicity toward the breast cancer cells in mice injected intracerebrally with the transfected fibroblasts. T cells from the spleens of mice injected with the transfected cells were co-incubated for 18 hr with SB-5b cells. Afterward, the number of remaining viable cells was measured by MTS, which is bioreduced by cells into a formazan product that can be detected at 490 nm. Effector T cells recovered from the spleens by
397
Lichtor et al: DNA-Based Vaccine for intracerebral neoplasms
E. Statistical analysis
SB-5b cells and non-secreting transfected cells. The experiment was repeated twice with equivalent results. Thus syngenic/allogeneic fibroblasts modified to secrete IL-2 or GM-CSF that were transfected with DNA from breast cancer cells were effective in prolonging the survival of mice with intracerebral breast cancer. Transfected fibroblasts modified to secrete IL-18 were not effective.
Student’s t test was used to determine the statistical differences between the survival of mice in various experimental and control groups. A P value less than 0.05 was considered significant.
III. Results A. Treatment of mice bearing an intracerebral breast cancer with DNAtransfected syngeneic/allogeneic fibroblasts modified to secrete immune augmenting cytokines
B. T cell mediated toxicity toward breast cancer in mice injected intracerebrally with syngeneic/allogeneic transfected fibroblasts modified to secrete IL-2, GM-CSF or IL-18
The immunotherapeutic properties of the modified fibroblasts transfected with DNA from a breast cancer that arose spontaneously in a C3H/He mouse were determined in mice with intracerebral breast cancer. C3H/He mice were injected intracerebrally (i.c.) with a mixture of 1.0 X 104 SB-5b breast carcinoma cells and 1.0 X 106 cytokinesecreting syngeneic/allogeneic fibroblasts transfected with DNA from the breast cancer cells. The results (Figure 2) indicated that mice injected i.c. with a mixture of breast cancer cells and transfected syngeneic/allogeneic fibroblasts modified to secrete IL-2 survived significantly longer than mice injected i.c. with a mixture of breast cancer cells and non cytokine-secreting, transfected fibroblasts (P < 0.005). Analogous results were obtained for mice injected i.c. with a mixture of breast cancer cells and transfected fibroblasts modified to secrete GM-CSF (P < 0.05). The survival of mice injected i.c. with SB-5b cells and transfected fibroblasts modified to secrete IL-18 was not significantly different than that of mice injected with
An MTS cytotoxicity assay was used to detect the presence of cytotoxic T lymphocytes towards breast cancer in mice injected i.c. with the mixture of SB-5b breast cancer cells and the modified DNA-transfected fibroblasts. The T cells, obtained from the spleens of the injected mice, were analyzed two weeks after the i.c. injection of the cell mixture. The results (Figure 3) indicated that, like the survival of mice with i.c. breast cancer treated with the cytokine-secreting fibroblasts, the cytotoxic response of greatest magnitude was in mice injected i.c. with the mixture of SB-5b cells and transfected fibroblasts modified to secrete IL-2 or GMCSF. Lesser cytotoxic effects were present in mice injected i.c. with SB-5b cells and transfected fibroblasts modified to secrete IL-18. An Elispot-IFN-! assay was used to determine the proportion of T cells in the spleen that were reactive with
Figure 2. Treatment of C3H/He mice with intracerebral SB-5b breast carcinoma with cytokine-secreting allogeneic fibroblasts transfected with DNA from a spontaneous breast neoplasm (SB-5b). C3H/He mice (nine animals/group) were injected with a mixture of 1.0 X 104 SB-5b cells and 1.0 X 106 cytokine secreting fibroblasts transfected with tumor DNA or with an equivalent number of nonsecreting cells transfected with tumor DNA (LMKb/SB5b). Mean survival time (MST) in days: Media control, 23.0 ± 1.9; LMK b/SB5b, 27.3 ± 6.3; LMKbGMCSF/SB5b, 30.0 ± 9.5; LMKbIL-2/SB5b, 36.6 ± 7.0; LMKbIL-18/SB5b, 28.4 ± 4.8. Probability values were as follows: LMKbIL-2/SB5b vs LMKb/SB5b or media control, P < 0.005; LMKbIL-2/SB5b vs LMKbIL-18/SB5b, P < 0.025; LMKbIL2/SB5b vs LMKbGMCSF/SB5b, P < 0.05; LMKbGMCSF/SB5b vs media control, P < 0.05.
398
Gene Therapy and Molecular Biology Vol 8, page 399
Figure 3. MTS proliferation assay from spleen cells taken from the animals two weeks following a single intracerebral injection of a mixture of tumor and treatment cells. The target cells used in this study were SB-5b breast cancer cells, and the effector (spleen cell) to target cell ratios (E/T) were 50:1 and 100:1. Mononuclear cells from the spleens of the immunized mice obtained through Histopaque centrifugation were used for this assay. The error bars represent one standard deviation.
Figure 4. ELISPOT assay detecting INF-! secretion by spleen cells in the animals that have survived for six weeks following the initial injection of SB-5b tumor cells and allogeneic fibroblasts transfected with tumor DNA. Mononuclear cells from the spleens of the immunized mice obtained through Histopaque centrifugation were used in this assay. The assay was done in the presence (SB-5b stimulated) and absence (unstimulated) of SB-5b tumor cells. The error bars represent one standard deviation.
399
Lichtor et al: DNA-Based Vaccine for intracerebral neoplasms SB-5b cells in mice immunized with transfected fibroblasts modified to secrete IL-2 or GM-CSF. The assay was performed six weeks after the i.c. injection of the mixture of SB-5b cells and the transfected fibroblasts. The results indicated that the highest proportion of T cells reactive with SB-5b cells was in surviving mice injected with fibroblasts modified to secrete IL-2 (Figure 4). Lesser numbers of spots were found in T cells from mice injected with SB-5b cells and non-secreting transfected fibroblasts or SB-5b cells and transfected fibroblasts modified to secrete GM-CSF. The analysis of cells from mice injected i.c. with SB-5b cells and transfected fibroblasts modified to secrete IL-18 was not performed because there were no surviving mice.
reasons. The cells, maintained as a cell line under conventional laboratory conditions were readily transfected with sheared, genomic DNA from the breast cancer cells. Since the transferred DNA was integrated, and replicated as the recipient cells divided (the transfected fibroblasts were maintained through multiple rounds of cell division before they were used in the experiments), the number of transfected cells could be expanded as necessary. In addition, the fibroblasts could be modified in advance of DNA-transfer to augment their immunogenic properties. In the experiments reported here, the cells were modified to express allogeneic MHC class Ideterminants and to secrete IL-2, IL-18 or GM-CSF. Allogeneic class I-determinants are strong immune adjuvants. IL-2 and GM-CSF are growth and activation factors for CTLs. IL-18 stimulates CTLs and augments NK cell mediated cytotoxicity. The immune-augmenting properties of IL-2 and GM-CSF exceeded that of IL-18 in this unique model system. In addition, like dendritic cells, fibroblasts are efficient antigen presenting cells. In particular they express class I-determinants and costimulatory molecules required for T cell activation constitutively. The cells used as DNA-recipients expressed H-2k-determinants and B7.1. Systemic class I restricted cellular breast cancer immune responses were generated in mice injected i.c. with the transfected cells. Transfection of DNA from the breast cancer cells into a highly immunogenic cell line has additional important advantages. A tumor cell line derived from a primary breast neoplasm does not have to be established if the patientâ&#x20AC;&#x2122;s own tumor is genetically modified to prepare a vaccine for immunization. Preparation of a cell line from a primary neoplasm is technically challenging and, especially in the case of breast cancer, cannot always be accomplished. Surprisingly, the proportion of the transfected cell population that expressed the products of genes specifying TAA was sufficient to induce the anti-breast cancer immune response. Our observation that the anti-tumor immune response that were sufficient to deter the growth of intracerebral breast cancer, resulting in prolongation of survival may be an indication that multiple and possible large numbers of immunologically distinct TAA, the products of multiple mutant/dysregulated genes were present within the population of breast cancer cells. The results presented in this study raise the possibility that a human fibroblast cell line that shares identity with the patient at one or more MHC class I alleles may be readily modified to provide immunologic specificity for TAA expressed by the patientâ&#x20AC;&#x2122;s neoplastic cells. Transfection of a highly characteristic fibroblast cell line with DNA prepared from the tumor may capture the array of genes that characterize the neoplasm. It is conceivable that the prolongation of survival noted in the treated animals in this study may be largely due to the expression of potent immunostimulatory cytokines in close proximity to tumor cells and independent of the expression of genomic breast cancer DNA. However in the clinical situation where the treatment cells will be injected into the tumor cavity following surgical resection,
IV. Discussion The prognosis for patients with breast cancer metastatic to the brain is poor, with the survival ranging from eight to thirteen months (Bendell et al, 2003; Ogura et al, 2003). Breast cancer is the second leading cause of cancer-related death in American women, and conventional treatments such as surgery, radiation therapy and chemotherapy have provided little benefit to affect long-term survival. Given the poor prognosis associated with metastatic tumors to the brain, there is urgent need for the development of therapies that can impact on clinical survival rates. Here, we report the generation of cell mediated immune responses toward breast cancer in mice immunized i.c. with cytokine-secreting syngeneic /allogeneic mouse fibroblasts transfected with DNA from a breast neoplasm that arose spontaneously in a C3H/He mouse (SB-5b cells). Mice injected i.c. with breast cancer cells and the transfected fibroblasts survived significantly longer than mice injected with the breast cancer cells alone, pointing toward the potential of this form of therapy in breast cancer patients whose neoplasm has metastasized to the brain. Further evidence for the efficacy of the transfected fibroblasts to stimulate an anti-tumor immune response was provided by the results of the in vitro studies. Spleen cells from mice injected i.c. with the DNA-based vaccine were responsive to SB-5b breast cancer cells both in ELISPOT IFN-! and cytolytic T lymphocyte assays. Coincubation of breast cancer cells and T cells from the spleens of the i.c. injected mice stimulated both CTLmediated lysis of the breast cancer cells as well as the number of activated T cells as determined by ELISPOT IFN-! assays. Prior studies by this laboratory have indicated that the introduction of high m.w. genomic DNA from one cell type, using the techniques described in this manuscript, altered both the genotype and the phenotypic characteristics of the cells that took up the exogenous DNA (de Zoeten et al, 1999). No attempt has been made to identify the tumor associated antigens expressed by the transfected cells. The identification of tumor antigens is technically challenging and may not be required in the treatment of breast cancer patients. Mouse fibroblasts were chosen as recipients of the DNA from the breast cancer cells for several compelling 400
Gene Therapy and Molecular Biology Vol 8, page 401 Kim TS and Cohen EP (1994) Interleukin-2-secreting mouse fibroblasts transfected with genomic DNA from murine melanoma cells prolong the survival of mice with melanoma. Cancer Res 54(10), 2531-2535. Kobayashi T, Yamanaka R, Homma J, Tsuchiya N, Yajima N, Yoshida S, Tanaka R (2003) Tumor mRNA-loaded dendritic cells elicit tumor-specific CD8+ cytotoxic T cells in patients with malignant glioma. Cancer Immunol Immunother 52, 632-637. Lichtor T, Glick RP, Tarlock K, Moffett S, Mouw E, Cohen EP (2002) Application of interleukin-2-secreting syngeneic/allogeneic fibroblasts in the treatment of primary and metastatic brain tumors. Cancer Gene Ther 9, 464-469. O I, Ku G, Ertl HCJ, Blaszczyk-Thurin M (2002) A dendritic cell vaccine induces protective immunity to intracranial growth of glioma Anticancer Res 22, 613-622. Ogura M, Mitsumori M, Okumura S, Yamauchi C, Kawamura S, Oya N, Nagata Y, Hiraoka M (2003) Radiation therapy for brain metastases from breast cancer. Breast Cancer 10, 349355. Valmori D, Levy F, Miconnet I, Zajac P, Spagnoli GC, Rimoldi D, Lienard D, Cerundolo V, Cerottini JC, Romero P (2000) Induction of potent antitumor CTL responses by recombinant vaccinia encoding a melan-A peptide analogue. J Immunol 164, 1125-1131. Whiteside TL, Gambotto A, Albers A, Stanson J, Cohen EP (2002) Human tumor derived genomic DNA transduced into a recipient cell induces tumor-specific immune responses ex vivo. Proc Natl Acad Sci USA 99, 9415-9420. Wigler M, Pellicer A, Silverstein S, Axel R, Urlaub G, Chasin L (1979) DNA-mediated transfer of the adenine phosphoribosyltransferase locus into mammalian cells. Proc Natl Acad Sci USA 76, 1373-1376.
the expression of tumor antigens by the vaccine cells will be more critical. One concern related to therapy with fibroblasts transfected with DNA from the tumor is that multiple genes specifying normal â&#x20AC;&#x153;selfâ&#x20AC;? antigens are likely to be expressed by the transfected cells. There is a theoretical danger that autoimmune disease might develop in breast cancer patients. Vaccines derived from tumor cell-extracts, peptide elutes of tumor cells, or mRNA fed to APCs including dendritic cells are subject to the same concern. However, toxic effects have not been observed. Tumorfree mice injected i.c. with cell-based vaccines including those prepared by transfection of fibroblasts with DNA from the breast cancer cells failed to exhibit adverse effects. They lived their anticipated life spans without evidence of disease. The ultimate goal of cancer therapy is the elimination of every remaining tumor cell from the patient. It is unlikely that a single form of therapy is capable of achieving this goal. However immunotherapy in combination with surgery, radiation therapy and chemotherapy will likely find a place as a new and important means of treatment for patients with brain tumors.
Acknowledgments This work was supported in part by a grant from the CINN foundation awarded to Drs. Lichtor and Glick, and by NIDCR grant number RO1DE013970-01A2 awarded to Dr. Cohen.
References Bendell JC, Domchek SM, Burstein HJ, Harris L, Younger J, Kuter I, Bunnell C, Rue M, Gelman R, Winer E (2003) Central nervous system metastases in women who receive trastuzumab-based therapy for metastatic breast carcinoma. Cancer 97, 2972-2977. Cohen EP (2001) DNA-based vaccines for the treatment of cancer_an experimental model. Trends Mol Med 7, 175179. de Zoeten E, Carr-Brendel V, Markovic D, Taylor-Papadimitriou J, Cohen EP (1999) Treatment of breast cancer with fibroblasts transfected with DNA from breast cancer cells. J Immunol 162, 6934-6941.
Terry Lichtor, MD, PhD.
401
Lichtor et al: DNA-Based Vaccine for intracerebral neoplasms
402
Gene Therapy and Molecular Biology Vol 8, page 403 Gene Ther Mol Biol Vol 8, 403-412, 2004
The involvement of H19 non-coding RNA in stress: Implications in cancer development and prognosis Research Article
Suhail Ayesh 1,2*, Iba Farrah 1, Tamar Schneider 1, Nathan de-Groot 1 and Abraham Hochberg1 1
The Department of Biological Chemistry, the Silberman Institute of Life Sciences. The Hebrew University of Jerusalem, Jerusalem, Israel 2 Molecular Genetics Lab, Makassed Islamic Charitable Hospital, Jerusalem, Israel
__________________________________________________________________________________ *Correspondence: Suhail Ayesh, Tel: +972-2-6585455; Fax:+ 972-2-6510250; E-mail: Suhail@mail.Ls.huji.ac.il Key words: Human cDNA expression assay, Bladder carcinoma cell lines, serum deprivation, hypoxia, Angiogenesis Abbreviations: active cyclin dependent kinase 2, (CDK2); angiopoietin 1 receptor precursor, (TIE-2); c-jun N-terminal kinase, (JNK); dimethyl sulphoxide, (DMSO); extracellular signal-regulated protein kinase, (ERK); fas-activated serine, (FAS); fetal calf serum, (FCS); fibroblast growth factor receptor 1 precursor, (FGFR1); Focal adhesion kinase, (FAK); Hanks' Balanced Salt Solution, (HBSS); lipidactivated protein kinase 2, (PRK2); mitogen-activated protein kinase and extracellular signal-regulated protein kinase, (MEK2); mitogen-activated protein, (MAP); NF-kB-inducing kinase, (NIK); nuclear factor !-B, (NF-!B); phytohemagglutinin M, (PHA); placenta growth factor, (PIGF); placental plasminogen activator inhibitor 2, (PAI-2); polymerase chain reaction, (PCR); Protein kinase C ", (PKCA); protein kinase C-#, (PKC-#); receptor-associated kinase, (IRAK IL1); reverse transcriptase-polymerase chain reaction, (RTPCR); Tumor necrosis factor-", (TNF-"); Urokinase plasminogen activator receptor, (uPAR); vascular endothelial growth factor receptor 1, (VEGFR1); vascular permeability factor/vascular endothelial growth factor, (VPF/VEGF)
Received: 18 September 2004; Accepted: 27 September 2004; electronically published: October 2004
Summary The H19 gene is an imprinted gene expressed from the maternal allele. It is known to function as an RNA molecule, cDNA microarray hybridization was used in an attempt to identify novel kinases participating in cellular response to hypoxia and serum deprivation. The expression of H19 RNA was examined in embryonic cells (Human amniocytes) that normally express H19 RNA basal level. At low serum (0.1% FCS) medium or hypoxia: 100µM CoCl2; or both: without serum (0.1% FCS) and 100µM CoCl2 for 16hr the fold increase of H19 RNA expression was: 1.9 ±0.11, 1.73 ± 0.2 and 2.0 ± 0.18 folds respectively. Significant increase in expression and induced (up) expression of certain genes were observed in TA31 cell line that highly expresses H19 RNA. Using the human cDNA atlas microarray, we detected differentially expressed genes modulated by the presence of H19 RNA in certain conditions: serum deprivation, hypoxia and both serum deprivation and hypoxia which may resemble the stress conditions in cancer. Some of the key genes that had increased or induced (up) expression mainly in serum deprivation are: CDK2, FGFR1, IRAK, JNK1, uPAR and PRK2. In hypoxia the key genes are PKC-#, cot-proto oncogene, PKC-", FAK and MEK2. In serum deprivation and hypoxia these genes are: Tie2, JNK2, ERK2 and VEGFR1. Using Atlas Array and observing the genes that had increased or induced (up) expression, a good indication for certain genes and pathways was found to be involved in tumor progression and angiogenesis. The major angiogenesis genes include FGFR1, VEGF, TIE2, uPA, and PKC-#. Other signal molecules associated with the invasive and migratory potential include JNK2, uPAR and FAK.
exons with a very low mutation rate and having significant expression levels in certain human cells and tissues, must have a function, if not having several vital functions (Hurst and Smith, 1999). H19 expression increases in certain conditions and tissues (Tycko and Morison, 2002). It increases in the
I. Introduction H19 is the first imprinted gene with no protein product described to have oncofetal properties (Ariel et al, 1997). Little is known about the function of this imprinted gene, though it is expressed abundantly in the human placenta and in several embryonic tissues. A gene lying in
403
Ayesh et al: The role of H19 gene during cancer development carotid artery after injury, suggesting its role during wound healing. During embryogenesis H19 RNA level is highly elevated. Previous studies showed that H19 fulfills an important role in the process of tumorigenesis (Looijenga and Verkerk, 1997). H19 is expressed abundantly in many cancer types, but is only marginally expressed in nearly all normal adult tissues. In some cases of breast adenocarcinoma with poor prognosis, H19 is over expressed in epithelial cells (Lottin et al, 2002). Our observations that ectopic expression of H19 RNA alters expression profiles of (certain) genes involved in metastasis and blood vessel development, support the notion of a role for this gene in tumor invasion and angiogenesis. This role seems to be triggered by stress conditions that accompany tumor growth (better to be in Discussion not here. It is especially noteworthy that many of the genes modulated by H19 RNA are also hypoxia responsive (Ayesh et al, 2002) The realization that a lot of us carry in situ tumors (microscopic tumors), but do not develop the disease, suggests that these microscopic tumors are mostly dormant and need additional signals to grow and become lethal tumors (Folkman and Kalluri, 2004). H19 is considered a tumor marker that combines prognostic and predictive value in patients with refractory superficial cancer (Ariel et al, 2000). The search for key genes which convert the non-lethal tumors into the expanding mass of tumor cells that is potentially lethal to an individual became a very important issue. To investigate more about the function of H19, we transfected cells from the bladder carcinoma cell line T24P, which does not express H19, with an episomal construct in which H19 expression is under the control of the cytomegalovirus promoter in either a sense full-length cDNA construct (TA31 cells), or an anti-sense construct covering 800 bp that extended from the 3' end direction (TA11 cells). We aimed to identify kinases and genes that showed altered expression between the TA31 (H19+) and TA11 (H19-) cell lines with the Atlas human cDNA expression array, containing cDNA from 350 all kinases. We also compared the effect of the presence of H19 RNA on the proliferation capacity of cells, and plotted out key genes that were noticeably up regulated or over expressed both in normal and poor serum conditions. Some of the differentially expressed kinases are among those promoting invasion, migration, angiogenesis and notably apoptosis. These findings and results support the suggestion of H19 functioning in cancer progression by overcoming stress conditions thereby enabling cells to survive and proliferate.
conditions (0.1% FCS) and 100µM CoCl 2 for 16hr before RNA extraction.
1. Human amniocytes Human amniocytes were cultured in sterile flasks grown to confluence in RPMI medium supplement. It contained 10% FCS, 1% Penicillin/ Streptomycin, 1% L-glutamate, and 1.3% phytohemagglutinin M(PHA). They were grown at 370C in a humidified incubator (95% air, 5% CO2), according to cytogenetics laboratory procedure manual (Genetics Division LAC/USA medical center,1990). When the cells reached confluence, they were washed with Hanks' Balanced Salt Solution (HBSS). Then trypsinized with EDTA-trypsin, and neutralized with Bio-amf media (biological industries, Israel). The media with the cultured cells were collected and subcultured in 4 different flasks according to the previous culture conditions for 48h. Later on, the flasks were washed with HBSS and incubated for 16h with four different types of media. These media are: medium A: the same medium mentioned above; medium B: low serum conditions (0.1% FCS); medium C: 100µM CoCl2; medium D: low serum conditions (0.1% FCS) and 100µM CoCl2.
B. RNA Extraction and RT-PCR Conditional media were collected; the cells were lysed, and neutralized. Then total RNA was extracted by RNA STAT-60$ (TEL-TEST INC, Friends wood, TX) according to manufacturer instructions. For RT-PCR reaction, the synthesis of cDNA was performed using p(dT)15 primer (Boehringer, Mannheim, Germany) to initiate reverse transcription of 2 µg total RNA with 400U of M-MLV reverse transcriptase (GibcoBRL® Gaithersburg, MD). The cDNA was used as a template for PCR to amplify the tested genes, H19 and Histone H3.3. The amplification was performed in a final volume of 25 µl reaction mixture. It contained 2µl of cDNA, 0.625 units of Taq DNA polymerase (Takara, Otsu, Japan), its 1X buffer (50 mM KCI, 2 mM MgCl2, 10 mM Tris-HCl), 0.2 mM dNTP mix, and 0.15µg of each primer. DMSO (4.5%) was also used in the amplification of H19 transcript. Thermal cycling parameters for H19 were: denaturation at 98 °C for 15sec, annealing at 58°C for 30sec, and extension at 72°C. In all the PCR assays, the number of cycles was calibrated to ensure that PCR amplification was in the linear phase. Each PCR was repeated 3 times. The integrity of the cDNA was assayed by PCR analysis with the ubiquitous cell cycle independent histone variant H3.3, as described by Futscher et al, (1993). Photographs of the PCR products were scanned with a PowerLook II scanner and quantified with ImageGague version 3.41 software (Fuji Photo Film Co., Tokyo, Japan).
C. The custom Atlas array The custom Atlas kinase array (Clontech Labs Inc) includes 359 human complementary DNAs of known kinases and phosphotase genes, divided into categories. In addition, the array includes 9 housekeeping genes for internal control of gene expression; genomic DNA spots as orientation markers and controls of labeling efficiency; and negative controls immobilized in duplicate dots on a nylon membrane.
II. Materials and methods A. Cell culture The human bladder carcinoma cell line T24P was obtained from the American Type Culture Collection (Manassas, VA). Cells from the T24P cell line were stably transfected with an episomal vector that has an H19 full-length cDNA placed in either the sense direction, creating TA31, or the antisense direction (800 bp from 3’ end), creating TA11. The cells were grown as previously described (Kopf et al, 1998). For serum deprivation and hypoxia, these cells were grown in low serum conditions (0.1% fetal calf serum (FCS)) medium or hypoxia: 100µM CoCl2 (Wang et al, 2000); or both: in low serum
D. RNA labeling and hybridization The Atlas array kit contains all necessary ingredients for RNA labeling, probe purification, and hybridization. Total DNA-free RNA (5 µg) from each tissue sample were labeled by "32-PdATP. The complementary DNA probe was purified on a special column provided in the kit. Equal amounts of labeled probe (about 10 7 cpm) for each cell line were hybridized to the array.
404
Gene Therapy and Molecular Biology Vol 8, page 405 After several washings the arrays were exposed to radiographs at -80°C for 7, 10, and 16 hours. The whole analysis was carried out twice. The difference between pattern and degree of gene expression was calibrated using household genes in the two independent experiments.
III. Results A. H19 expression at different stress conditions H19 expression in human amniocytes: the level of H19 RNA was examined in embryonic cells (Human amniocytes) that normally express H19 at basal level. The change in H19 RNA expression was measured by RT-PCR after different stress conditions and the results are as shown below. Figure 1 shows that there is an increase in H19 RNA level in low serum (0.1% FCS) medium or hypoxia: 100µM CoCl2; or both: low serum conditions (0.1% FCS) and 100µM CoCl2 for 16h. The increase of H19 RNA expression was: 1.9 ± 0.11, 1.73 ± 0.2 and 2.0 ± 0.18 folds respectively. H19 expression in T24P, TA 11 and TA 31 cell lines was examined at low serum (0.1% FCS) medium, or hypoxia: 100µM CoCl2; or both: low serum conditions (0.1% FCS) and 100µM CoCl2for 16h by northern blot. As shown in Figure 2, the H19 level was slightly increased in T24p cell line at hypoxia (100µM CoCl2), while no H19 induction in TA 11 cell line, which contains the plasmid that expresses the anti-sense for H19.
E. RNA identification and comparison Signals of exposure were scanned and quantified with software for digital image analysis (Atlas-image, v. 2; Clontech Labs Inc). This program is designed to compare gene expression profiles and generate a detailed report. Briefly, after alignment of the 2 arrays to the grid template, the background calculation was performed. The program generates intensity values (the average of the total signal from the left and right spots in double-spotted arrays) and the normalization coefficient is calculated first for array 1 and then applied to the adjusted intensity of each of the genes on array 2. The adjusted intensity for a gene is the intensity value minus background value multiplied by the normalization coefficient. The ratio and difference values were calculated. Comprehensive information on the genes included in the array is found at Clontech Labs Inc's Atlas info bioinformatics database (atlasinfo.clontech.com).
Figure 1. H19 expression in human ammniocytes. H19 RNA expression in usual medium (10% FCS) lane 1, low serum (0.1% FCS) medium lane 2, hypoxia: 100µM CoCl 2 lane 3; or both: low serum conditions(0.1% FCS) and 100µM CoCl 2 lane 4 for 16hand blank lane 5. The increase of H19 RNA expression was: 1.9 ± 0.11, 1.73 ± 0.2 and 2.0 ± 0.18 folds respectively.
Figure 2. Northern blot analysis of H19 expression in T24P, TA11 and TA31 cell lines at normal and different stress conditions. The H19 RNA expression in normal conditions lane1, in low serum (0.1% FCS) medium lane2, or hypoxia: 100µM CoCl 2 lane3; or both: low serum conditions (0.1% FCS) and 100 µM CoCl2 for 16hr lane 4, examined by northern blot in the three cell line: T24p cell line, TA 11 cell line, TA 31 cell line.
405
Ayesh et al: The role of H19 gene during cancer development expression at low serum (0.1% FCS) medium. Table 2 contains the genes that increased or induced expression (up) in hypoxia (100ÂľM CoCl 2); 3 contains the genes that increased or induced (up) at double stress conditions (low serum conditions (0.1% FCS) and 100ÂľM CoCl2 for 16h.
1. Gene expression analysis The results of microarray gene analysis after different stress conditions were as follows: The genes listed in these Tables (1, 2, 3) are those increased significantly (more than 1.5 fold) or induced (up) in TA31 cell line compared to TA 11 and T24p cell lines. Table 1 contains the genes with increased and induced (up)
Table 1. Genes that had increased or induced (up) expression with a ratio of more than 1.5 fold at low serum (0.1% FCS) medium in TA 31 cell line compared to TA11 and T24p cell lines B6e 2.31673 serine/threonine-protein kinase PCTAIRE 3 (PCTK3) X66362 B5a 2.346823 Ribose phosphophate pyrophosphokinase M57423 A7a 2.531401 fibroblast growth factor receptor1 precursor (FGFR1) X66945 C2d 2.64694 checkpoint kinase 1 (CHK1) AF016582 C1a 2.702954 hint protein; protein kinase C inhibitor 1 (PKCI1) U51004 Diacylglycerol kinase " B1a 3.088425 AF064771 B3k 3.276213 protein kinase A anchoring protein AF037439 D3e 3.287641 CDC28 protein kinase 2 AA010065 A2m 3.387337 DRAK2 AB011421 A6e 3.873097 neurotrophic tyrosine kinase receptor type 1 (NTRK1) X03541 A1f 5.618388 cyclin-dependent protein kinase 2 (CDK2) M68520 protein kinase C " polypeptide (PKC-") A7d 5.633224 M22199 A3f Up c-jun N-terminal kinase 1 (JNK1) L26318 A3n Up Protein-tyrosine kinase transmembrane M97639 A4d Up cyclin-dependent kinase 10 (CDK10) L33264 A4k Up mitogen-activated protein kinase kinase 6 (MAP kinase kinase 6) U39657 A5d Up urokinase-type plasminogen activator precursor (uPAR) M15476 A5m Up SHK1 kinase binding protein 1 AF015913 A6a Up angiopoietin 1 receptor precursor L06139 A7n Up Muscle specific tyrosine kinase receptor AF006464 B1b Up Selenide water dikinase 1 U34044 B1n Up Lipid-activated protein kinase 2 (PRK2) U33052 B3d Up cell division protein kinase 4 M14505 ribosomal protein S6 kinase II "3 (S6KII-"3) B4m Up U08316 cAMP-dependent protein kinase %-catalytic subunit (PKA C-%) B5l Up M34182 B5m Up serine/threonine-protein kinase (NEK2) U11050 B6h Up Bruton's tyrosine kinase (BTK) U10087 B7a Up A kinase anchor protein U17195 C2c Up serine/threonine-protein kinase (NEK3) Z29067 C3f Up adenylate kinase 3 (AK3) X60673 C5c Up phosphatidylinositol 3-kinase catalytic subunit delta isoform U86453 C5e Up protein tyrosine kinase U02680 C5j Up activin receptor type I precursor (ACTRI) L02911 C7b Up serine/threonine protein kinase (SAK) Y13115 D6f Up serine/threonine-specific protein kinase minibrain U58496 Table 2. Genes that that had increased or induced (up) expression with a ratio of more than 1.5 fold at hypoxia in TA 31 cell line compared to TA11 and T24p cell lines Gene bank Gene code Ratio Protein/gene accession B1i 1.505267 ephrin type-B receptor 1 precursor L40636 Protein kinase C " polypeptide (PKC-") A7d 1.510266 M22199 A1m 1.512111 ntak protein (neural and thymus derived activator for erbb kinases AB005060 ribosomal protein S6 kinase II "1 (S6KII-"1) B6k 1.52491 L07597 A6d 1.528496 Placental plasminogen activator inhibitor 2 (PAI-2) M18082 D3h 1.544107 mitogen-activated protein kinase 9 L31951 B6e 1.555473 serine/threonine-protein kinase PCTAIRE 3 (PCTK3) X66362 406
Gene Therapy and Molecular Biology Vol 8, page 407 C2d D1d C3k A4c B7f A7c A2m B2j D4a B2e C5k B3l D3e
1.568302 1.596408 1.600221 1.604381 1.623765 1.635135 1.641395 1.671949 1.689245 1.805216 1.833114 1.882828 1.933686
C4l B3k B1c A6e D1b B2k B4k C4i C7d A6a B1g B3d B5c B5l B5m B6i B6l B6m B7a C2n C3f C3i C5h C5j C5n C6e C6h C7e D1c
1.940017 2.143857 2.209804 2.553698 2.59454 2.730018 2.73525 2.925536 3.366751 Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up
checkpoint kinase 1 (CHK1) protein kinase C # (PKC-#) 6-phosphofructokinase focal adhesion kinase (FAK) NIK serine/threonine protein kinase protein serine/threonine kinase (STK1) DRAK2 nucleoside diphosphate kinase A (NDKA) calmodulin (CALM) cell division control protein 2 homolog (CDC2) putative diacylglycerol kinase eta (DAG kinase eta) cAMP-dependent protein kinase I " regulatory subunit (PRKAR1) CDC28 protein kinase 2 guanine nucleotide-binding protein & subunit 2-like protein 1 (GNB2L1) protein kinase A anchoring protein tyrosine-protein kinase ctk neurotrophic tyrosine kinase receptor type 1 (NTRK1) Creatin kinase B chain STE20-like kinase 3 (MST3) cot proto-oncogene mevalonate kinase serine/threonine protein kinase minibrain homolog (DYRK) angiopoietin 1 receptor precursor (TIE-2) mitogen-activated protein kinase kinase 2 (MAP kinase kinase 2) cell division protein kinase 4; cyclin-dependent kinase 4 (CDK4) tyrosine-protein kinase itk/tsk cAMP-dependent protein kinase gamma-catalytic subunit serine/threonine-protein kinase (NEK2) serine/threonine-protein kinase PLK1 (STPK13) c-ros-1 tyrosine-protein kinase proto-oncogene STE20-like kinase (MST2) A-kinase anchor protein mitochondrial thymidine kinase 2 adenylate kinase 3 (AK3) phosphomevalonate kinase (PMKase) dual-specificity protein phosphatase 9 activin receptor type I precursor (ACTRI) 1D-myo-inositol-trisphosphate 3-kinase B MAP kinase-activating death domain protein myotonic dystrophy protein kinase-like protein serine kinase 9 (SRPK2) calcium/calmodulin-dependent protein kinase type II
AF016582 Z15108 D25328 L13616 Y10256 L20320 AB011421 X17620 J04046 X05360 D73409 M33336 AA010065 M24194 AF037439 L18974 X03541 L47647 AF024636 D14497 M88468 D86550 L06139 L11285 M14505 D13720 M34182 U11050 U01038 M34353 U26424 U17195 U77088 X60673 L77213 Y08302 L02911 X57206 U77352 Y12337 U88666 U50359
Table 3. Genes that had increased or induced (up) expression with a ratio of more than 1.5 fold at low serum (0.1% FCS) medium and hypoxia in TA 31 cell line compared to TA11 and T24p cell lines Gene code Ratio Protein/gene guanine nucleotide-binding protein & subunit 2-like protein 1 (GNB2L1) C4l 1.576539 M24194 C6j 1.590471 myotonin-protein kinase; myotonic distrophy protein kinase (MDPK) L19268 A1h 1.680315 DNA-dependent protein kinase (DNA-PK) U35835 B7c 1.715803 cell division protein kinase 8 (CDK8) X85753 D4a 1.73196 calmodulin (CALM) J04046 A7a 1.762276 fibroblast growth factor receptor1 precursor (FGFR1) X66945 B4k 1.7795 cot proto-oncogene D14497 407
Ayesh et al: The role of H19 gene during cancer development C5k A2m B5h D3h A1j C5i A1m D3e B2e A7d A1f C4i A1d A2b A2f A2i A3b B3d B5c B5l B5m B6b B7l B7m C2c C4f D1h D2e D2f
1.864683 2.046678 2.072661 2.303345 2.307026 2.396003 2.504037 2.706103 2.782374 2.892207 2.971199 4.024127 Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up
putative diacylglycerol kinase eta (DAG kinase eta) DRAK2 ephrin type-A receptor 5 precursor (EHK1) mitogen-activated protein kinase 9 vascular endothelial growth factor receptor 3 precursor (VEGFR3); flt-4 phosphatidylinositol 3 kinase catalytic subunit % isoform ntak protein (neural and thymus derived activator for erbb kinases) CDC28 protein kinase 2 cell division control protein 2 homolog (CDC2) protein kinase C " polypeptide (PKC-") cyclin-dependent protein kinase 2 (CDK2) mevalonate kinase serine/threonine-protein kinase (STK2) related to receptor tyrosine kinase (RYK) protein kinase C ' (PKC-') fas-activated serine/threonine kinase (FAST) vascular endothelial growth factor receptor 1 (VEGFR1); Flt-1 cell division protein kinase 4; cyclin-dependent kinase 4 (CDK4) tyrosine-protein kinase itk/tsk cAMP-dependent protein kinase %-catalytic subunit (PKA C-%) serine/threonine-protein kinase NEK2 B-lymphocyte kinase (BLK) deoxycytidine kinase 58-kDa inhibitor of the RNA-activated protein kinase serine/threonine-protein kinase NEK3 phosphorylase B kinase % catalytic subunit skeletal muscle isoform c-jun N-terminal kinase 1 (JNK1) hematopoietic progenitor kinase (HPK1) Adenylate kinase isoenzyme 2
D73409 AB011421 X95425 L31951 X68203 X83368 AB005060 AA010065 X05360 M22199 M68520 M88468 L20321 S59184 L07032 X86779 X51602 M14505 D13720 M34182 U11050 Z33998 M60527 U28424 Z29067 X80590 L26318 U66464 U39945
While taking a closer look at all the genes that had an increase or induced (up) expression in the hypoxia and serum stress conditions, which may resemble the stress conditions in cancer, certain important genes may be playing important roles in cell survival and the mitogenic activities of the tumor.
IV. Discussion H19 was described to have oncofetal properties; it is expressed abundantly in the human placenta and in several embryonic tissues (Ariel et al, 1997). We cultured human amniocytes, which express H19 under normal conditions, at different stress condition i.e. hypoxia and serum stress (Figure 1). The increase in H19 expression (about 2 folds) in both serum deprivation and hypoxia was a strong indication that H19 is involved in the physiological response to different stress conditions. The H19 level was slightly increased in T24p cell line at hypoxia (100ÂľM CoCl2) as shown in Figure 2. While no H19 induction was found in TA 11 cell line, which contains the plasmid that expresses the anti-sense for H19, was found. It seems very likely that H19 RNA is involved in the induction of the expression of the kinases which increased significantly (more than 1.5 fold) or induced (up) in TA31 cell line compared to TA 11 and T24p cell lines. Significant increase in expression and induced (up) expression of certain genes was observed in TA31 cell line which is H19+ and after growing these cells with stress conditions: which are serum deprivation, hypoxia and both serum deprivation and hypoxia together.
A. Serum deprivation Elevated expression of active cyclin dependent kinase 2 (CDK2) is critical for promoting cell cycle progression and unrestrained proliferation of tumor cells. CDK2 is retained in the cytoplasm of cells by serum deprivation (Bresnahan et al, 1997). Apoptosis of human endothelial cells after growth factor deprivation and stress accompanied by cancer is associated with rapid and dramatic induced (up) expression of CDK2 activity. CDK2 activation, through caspase-mediated cleavage of cdk inhibitors, may be instrumental in the execution of apoptosis following caspase activation (Levkau et al, 1998). One of the stress kinases which we found to have induced (up) expression in serum deprivation is fibroblast growth factor receptor 1 precursor (FGFR1). FGFR1 may be a specific target for MMP2 on the cell surface, yielding a soluble FGF receptor that may modulate the mitogenic and angiogenic activities 408
Gene Therapy and Molecular Biology Vol 8, page 409 of FGF. MMP2 is a key gene in angiogenesis (Levi et al, 1996). Binding of interleukin-1 (IL1) to its receptor and by the association of IRAK (IL1 receptor-associated kinase), triggers activation of nuclear factor !-B (NF-!B), a family of related transcription factors that regulates the expression of genes bearing cognate DNA binding sites such as PCNA which we also found to have induced (up) expression in pervious study (Ayesh et al, 2002). Another gene that had induced (up) expression was JNK1 (c-jun Nterminal kinase 1) which is involved in the initiation of the apoptosis process (Ch et al, 1996; Yu et al, 1996). JNK1 is activated by various stimuli, including UV light, Ha-Ras, TNF-" (Tumor necrosis factor-"), IL-1 and CD28 costimulation (Derijard et al, 1994; Ch et al 1996). JNK1 phosphorylates Elk-1 on the same major sites recognized by ERK1/2 (extracellular-regulated kinase), thus potentiating its transcriptional activity (Cavigelli et al, 1995). A critical gene involved in the mitogenic and invasive pathways and up regulated under stress conditions is uPA (Urokinase plasminogen activator). uPA is secreted as an enzymatically inactive proenzyme (prouPA). Urokinase plasminogen activator receptor (uPAR) mediates the binding of the zymogen, pro-uPA, to the plasma membrane where trace amounts of plasmin will initiate a series of events referred to as reciprocal zymogen activation where plasmin converts pro-uPA to the active enzyme, uPA, which in turn converts plasma membraneassociated plasminogen to plasmin (Dear et al, 1998, Plesner et al, 1997). Urokinase-type plasminogen activator receptor (uPAR) is known to play important roles in tumor cell migration, invasion, and metastasis (Ayesh et al, 2002). High levels of u-PA, PAI-1 (placental plasminogen activator inhibitor 2) and u-PAR in many tumor types predict poor patient prognosis (Fazioli and Blasi, 1994; Andreasen et al, 1997). PRK2 (lipid-activated protein kinase 2) is necessary for apoptosis, during FAS-induced apoptosis (Cryns et al, 1997) which can form a complex with adaptor proteins made up of src domains (Braverman and Quilliam, 1999).
differentiation, proliferation or apoptosis of mammalian cells. Sp1 promotes the transcription of vascular permeability factor/vascular endothelial growth factor (VPF/VEGF), a potent angiogenic factor, by interacting directly and specifically with protein kinase C # (PKC #) isoform in renal cell carcinoma. PKC # binds and phosphorylates the zinc finger region of Sp1 (Pal et al, 1998). One of the genes that had increased expression was cot-proto oncogene (c-cot/TPL-2) which encodes a MAP3K related serine threonine kinase and plays a critical role in TNF-" production. An increase in cot kinase expression promotes TNF-" promoter-driven transcription. Cot kinase is partially mediated by MEK/ERK kinase pathway which includes many up regulated genes in the stress conditions in order to survive. Cot kinase increases at least the AP-1 and AP-2 response elements (Ballester et al, 1998). It also plays a role in IL-2 production which is an important angiogenesis-associated secreted protein (Ballester et al, 1997). TPL-2 is a component of a signaling pathway that controls proteolysis of NF-!B1 p105 generating, at the end, active nuclear NF!B. Furthermore, kinase-inactive TPL-2 blocks the degradation of p105 induced by (TNF-") (Belich et al, 1999). Cot assembles physically with NF-!B-inducing kinase (NIK) and phosphorylate it in vivo (Lin et al, 1999). Protein kinase C- " is the major protein kinase C isoenzyme of a signal transduction cascade regulating IL-2 receptor expression and which is over expressed in the experiment (Szamel et al, 1997). Focal adhesion kinase (FAK) is centrally implicated in the regulation of cell motility and adhesion (Zachary, 1997) and is induced by adhesion of cell surface integrins to extracellular matrix and other factors (Guan 1997; Zachary 1997). Activated FAK leads to its binding to a number of intracellular signaling molecules including SCr, Grb2 and PI 3-kinse. Integrin signaling through FAK causes increased cell migration and potentially regulates cell prolifration and survival (Guan 1997). FAK is involved in the progression of cancer to invasion and metastasis and overexpression of FAK in tumor cells leads to a high propensity toward invasion and metastasis and increased cell survival under anchorage-independent conditions (Kornberg 1998). Other genes as MEK2 (MAPK and ERK kinase) contribute to the activation of the oxidative burst and phagocytosis, and participate in cytokine regulation of apoptosis in cells under stress (Downey et al, 1998).
B. Hypoxia stress Many key genes in the main pathway of tumorgenesis were found to have increased or induced (up) expression. The proliferation of new tumor cells instead could take place. PKC-# (protein kinase C-#) is important in NF-!B activation (Folgueira et al, 1996) and takes a central position in TNF signal pathways acting as a molecular switch between mitogenic and growth inhibitory signals of TNF-". (Muller et al, 1995). The role of TNF-" in angiogenesis is thought to be indirect through its ability to induce angiogenic factors. TNF-路 mediates its action through NF-!B transcription factor (Ayesh et al, 2002). In serum-free media, NF-!B is activated promoting survival of cells while inhibiting PKC-# results in cell death (Wang et al, 1999). PKC-# was implicated in tumor angiogenesis (Pal et al, 1998). It is highly over expressed in tumors and is involved in apoptosis, angiogenesis, and several signal transduction pathways regulating
C. Serum stresses
deprivation
and
hypoxia
Tie2 had an increased expression in all stresses and is known to play a role in tumor angiogenesis (Lin et al, 1998). Tie2 and its ligand angiopiotin-1 represent key signal transduction systems involved in the regulation of embryonic vascular development. The expression of these molecules correlates with phases of blood vessel formation needed in angiogenesis (Breier et al, 1997). Three distinct groups of MAP kinases have been identified in mammalian cells (ERK, JNK, and p38). 409
Ayesh et al: The role of H19 gene during cancer development Ayesh S, Matouk I, Schneider T et al (2002) A. Possible physiological role of H19 RNA. Mol Carcinog 35, 63-74. Ballester A, Tobena R, Lisbona C, Calvo V, Alemany S (1997) Cot kinase regulation of IL-2 production in Jurkat T cells. J Immunol 159, 1613-8. Ballester A, Velasco A, Tobena R, Alemany S (1998) Cot kinase activates tumor necrosis factor-" gene expression in a cyclosporin A-resistant manner. J Biol Chem 273, 14099106. Belich MP, Salmeron A, Johnston LH, Ley SC (1999) TPL-2 kinase regulates the proteolysis of the NF-!B-inhibitory protein NF-!B1 p105. Nature 397, 363-8. Braverman LE, Quilliam LA (1999) Identification of Grb4/Nck&, a src homology 2 and 3 domain-containing adapter protein having similar binding and biological properties to Nck. J Biol Chem 274, 5542-9. Breier G, Damert A, Plate KH, Risau W (1997) Angiogenesis in embryos and ischemic diseases. Thromb Haemost 78, 67883. Bresnahan WA, Thompson EA, Albrecht T (1997) Human cytomegalovirus infection results in altered Cdk2 subcellular localization. J Gen Virol 78, 8. Cavigelli M, Dolfi F, Claret FX, Karin M (1995) Induction of cfos expression through JNK-mediated TCF/Elk-1 phosphorylation. EMBO J 14, 5957-64. Chen YR, Meyer CF, Tan TH (1996) Persistent activation of cJun N-terminal kinase 1 (JNK1) in % radiation-induced apoptosis. J Biol Chem 271, 631-4. Cheung CY (1997) Vascular endothelial growth factor, possible role in fetal development and placental function. J Soc Gynecol Investig 4, 169-77 Cryns VL, Byun Y, Rana A et al (1997) Specific proteolysis of the kinase protein kinase C-related kinase 2 by caspase-3 during apoptosis. Identification by a novel, small pool expression cloning strategy. J Biol Chem 272, 29449-53. Davis RJ (1995) Transcriptional regulation by MAP kinases. Mol Reprod Dev 42, 459-67 Dear AE, Medcalf RL (1998) The urokinase-type-plasminogenactivator receptor (CD87) is a pleiotropic molecule. Eur J Biochem 252, 185-93. Derijard B, Hibi M, Wu IH et al (1994) a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 76, 102537. Downey GP, Butler JR, Tapper H, Fialkow L, Saltiel AR, Rubin BB, Grinstein S (1998) Importance of MEK in neutrophil microbicidal responsiveness. J Immunol 160, 434-43. Fazioli F, Blasi F (1994) Urokinase-type plasminogen activator and its receptor, new, targets for anti-metastatic therapy. Trends Pharmacol Sci 15, 25-9. Folgueira L, McElhinny JA, Bren GD et al (1996) Protein kinase C-# mediates NF- !B activation in human immunodeficiency virus-infected monocytes. J Virol 70, 223-31. Folkman J, Kalluri R (2004) Cancer without disease. Nature 427, 787 Futscher BW, Blake LL, Gerlach JH, Grogan TM, Dalton WS (1993) Quantitative polymerase chain reaction analysis of mdr1 mRNA in multiple myeloma cell lines and clinical specimens. Anal Biochem 213, 414-421. Gerber HP, Condorelli F, Park J, Ferrara N (1997) Differential transcriptional regulation of the two vascular endothelial growth factor receptor genes. Flt-1, but not Flk-1/KDR, is up-regulated by hypoxia. J Biol Chem 272, 23659-67. Guan JL (1997) Focal adhesion kinase in integrin signaling. Matrix Biol 16, 195- 200. Hurst LD, Smith NG (1999) Molecular evolutionary evidence that H19 RNA is functional. Trends Genet 15, 134-135.
These MAP kinases are mediators of signal transduction from the cell surface to the nucleus (Whitmarsh and Davis, 1996). Jun kinase (JNK1 and JNK2) is selectively mediating signal transduction of the pro-inflammatory cytokines IL-1 and TNF as well as of cellular stress (Uciechowski et al, 1996). JNK2 was found to be over expressed in both serum deprivations and hypoxia. IL-1, TNF, UV light and osmotic stress, are able to stimulate jun kinase activity (including JNK2) in humans (Uciechowski et al, 1996). JNK2 (also called Elk-1 activation domain kinase) phosphorylates the NH2-terminal activation domain of the transcription factor c-Jun, and the activity of JNK2 was approximately 10-fold greater than that of JNK1 (Sluss et al, 1994). JNK2 phosphorylates Elk-1 in extracts of UV-irradiated cells on the same major sites recognized by ERK1/2 that potentiate its transcriptional activity (Cavigelli et al, 1995). The mitogen-activated protein (MAP) kinase also known as (ERK2) is proline-directed serine/threonine kinases that are activated in response to a variety of extracellular signals, including growth factors, hormones and, neurotransmitters. MAPK/ERK is a key molecule in intracellular signal transducing pathways that transport extracellular stimuli from cell surface to nuclei. MAPK/ERK has been revealed to be involved in the physiological proliferation of mammalian cells and also to potentiate them to transform and thus increase in amounts in tumor cells (Davis 1995). ERK2 is activated by many oncogenes, such as RAS and RAF, and they induce cell proliferation (Mishima et al, 1998). Vascular endothelial growth factor receptor 1 (VEGFR1) also called FLT-1 gene encodes a transmembrane tyrosine kinase that is involved in angiogenesis and migration which is a high-affinity receptor for VEGF and placenta growth factor (PIGF). Flt1 plays important roles in the angiogenesis required for embryogenesis and in monocyte/macrophage migration (Gerber et al, 1997). VEGF/PIGF functions via flt-1 in an autocrine manner to perform a role in invasion and differentiation (Shore et al, 1997). The Flt-1 receptor gene had direct induced (up) expression by hypoxia via hypoxia-inducible enhancer on the Flt-1 promoter (Gerber et al, 1997), and has been implicated in the regulation of blood vessel growth during angiogenesis (Breier et al, 1997; Cheung 1997). The VEGF signal transduction system has been implicated in the regulation of pathological blood vessel growth during certain angiogenesis-dependent diseases that are often associated with tissue ischemia, such as tumorgenesis (Shibuya et al, 1994; Breier 1997).
References Andreasen PA, Kjoller L, Christensen L, Duffy MJ (1997) The urokinase-type plasminogen activator system in cancer metastasis, a review. Int J Cancer 72, 1-22 Ariel I, Ayesh S, Perlman EJ et al (1997) The product of the imprinted H19 gene is an oncofetal RNA. Mol Pathol 50, 34-44. Ariel I, Sughayer M, Fellig Y, et al (2000) The imprinted H19 gene is a marker of early recurrence in human bladder carcinoma. Mol Pathol 53, 320-323.
410
Gene Therapy and Molecular Biology Vol 8, page 411 Kopf E, Bibi O, Ayesh S et al (1998) The effect of retinoic acid on the activation of the human H19 promoter by a 3â&#x20AC;&#x2122; downstream region. FEBS Lett 432, 123-127. Kornberg LJ (1998) Focal adhesion kinase and its potential involvement in tumor invasion and metastasis. Head Neck 20, 745-52. Levi E, Fridman R, Miao HQ et al (1996) Matrix metalloproteinase 2 releases active soluble ectodomain of fibroblast growth factor receptor 1. Proc Natl Acad Sci 93, 7069-74. Levkau B, Koyama H, Raines EW et al (1998) Cleavage of p21Cip1/Waf1 and p27Kip1 mediates apoptosis in endothelial cells through activation of Cdk2, role of a caspase cascade. Mol Cell 1, 553-63. Lin P, Buxton JA, Acheson A et al (1998) Antiangiogenic gene therapy targeting the endothelium-specific receptor tyrosine kinase Tie2. Proc Natl Acad Sci 95, 8829-34. Lin X, Cunningham ET Jr, Mu Y, Geleziunas R, Greene WC (1999) The proto-oncogene Cot kinase participates in CD3/CD28 induction of NF-!B acting through the NF-!Binducing kinase and I!B kinases. Immunity 10, 271-80. Looijenga LH, Verkerk AJ, de-Groot N, Hochberg A, Oosterhuis JW (1997) H19 in normal development and neoplasia. Mol Reprod Dev 46, 419-439. Lottin S, Adriaenssens E, Dupressoir T, Berteaux N, Montpellier C, Coll J, Dugimont T, Curgy JJ (2002) Overexpression of an ectopic H19 gene enhances the tumorigenic properties of breast cancer cells. Carcinogenesis 23, 1885-95. Mishima K, Yamada E, Masui K et al. Shimokawara T, Takayama K, Sugimura M, Ichijima K (1998) Overexpression of the ERK/MAP kinases in oral squamous cell carcinoma. Mod Pathol 11, 886-91. Muller G, Ayoub M, Storz P, Rennecke J, Fabbro D, Pfizenmaier K (1995) PKC-# is a molecular switch in signal transduction of TNF-", bifunctionally regulated by ceramide and arachidonic acid. EMBO J 14, 1961-9. Pal S, Claffey KP, Cohen HT, Mukhopadhyay D (1998) Activation of Sp1-mediatedvascular permeability factor/vascular endothelial growth factor transcription requires specific interaction with protein kinase C-#. J Biol Chem 273, 26277-80. Plesner T, Behrendt N, Ploug M (1998) Structure, function and expression on blood and bone marrow cells of the urokinasetype plasminogen activator receptor, uPAR. Stem Cells 15(6, 398-408.
Suhail Ayesh,
Iba Farrah,
Shibuya M, Seetharam L, Ishii Y et al (1994) Possible involvement of VEGF- FLT tyrosine kinase receptor system in normal and tumor angiogenesis. Princess Takamatsu Symp. 24, 162-70. Shore VH, Wang TH, Wang CL, Torry RJ, Caudle MR, Torry DS (1997) Vascular endothelial growth factor, placenta growth factor and their receptors in isolated human trophoblast. Placenta 18, 657-65. Sluss HK, Barrett T, Derijard B, Davis RJ (1994) Signal transduction by tumor necrosis factor mediated by JNK protein kinases. Mol Cell Biol 14, 8376-84. Szamel M, Ebel U, Uciechowski P, Kaever V, Resch K (1997) T cell antigen receptor dependent signalling in human lymphocytes, cholera toxin inhibits interleukin-2 receptor expression but not interleukin-2 synthesis by preventing activation of a protein kinase C isotype, PKC-". Biochim Biophys Acta 1356, 237-48. Tycko B, Morison IM (2002) Physiological functions of imprinted genes. J Cell Physiol 192, 245-258. Uciechowski P, Saklatvala J, von der Ohe J, Resch K, Szamel M, Kracht M (1996) Interleukin 1 activates jun N-terminal kinases JNK1 and JNK2 but not extracellular regulated MAP kinase (ERK) in human glomerular mesangial cells. FEBS Lett 394, 273-8. Wang G, Hazra TK, Mitra S, Lee HM, Englander EW (2000) Mitochondrial DNA damage and a hypoxic response are induced by CoCl2 in rat neuronal PC12 cells. Nucleic Acids Res 28, 2135-40. Wang YM, Seibenhener ML, Vandenplas ML, Wooten MW (1999) Atypical PKC-# is activated by ceramide, resulting in coactivation of NF-!B/JNK kinase and cell survival. J Neurosci Res 55, 293-302. Whitmarsh AJ, Davis RJ (1996) Transcription factor AP-1 regulation by mitogen-activated protein kinase signal transduction pathways. J Mol Med 74, 589-607. Yu R, Shtil AA, Tan TH, Roninson IB, Kong AN (1996) Adriamycin activates c-jun N-terminal kinase in human leukemia cells, a relevance to apoptosis. Cancer Lett 107, 73-81 Zachary I (1997) Focal adhesion kinase. Int J Biochem Cell Biol 29, 929-34.
Tamar Schneider,
411
Nathan de-Groot
Abraham Hochberg
Ayesh et al: The role of H19 gene during cancer development
412
Gene Therapy and Molecular Biology Vol 8, page 413 Gene Ther Mol Biol Vol 8, 413-422, 2004
PSA promoter-driven conditional replicationcompetent adenovirus for prostate cancer gene therapy Research Article
Guimin Chang2 and Yi Lu1,2* Department of 1Medicine and 2Urology, University of Tennessee Health Science Center, Memphis, Tennessee, USA
__________________________________________________________________________________ *Correspondence: Yi Lu, Ph.D., Department of Medicine, University of Tennessee Health Science Center, 956 Court Avenue, H300, Memphis, TN 38163, USA; Tel: (901) 448-5436; Fax: (901) 448-5496; E-mail: ylu@utmem.edu Key words: adenovirus, PSA, E1, replication-competent, prostate cancer Abbreviations: !-galactosidase, (lacZ); adenovirus type 5, (Ad5); Dulbeccoâ&#x20AC;&#x2122;s modified Eagle medium, (D-MEM); early region 1, (E1); Fetal bovine serum, (FBS); prostate specific antigen, (PSA); Rous sarcoma virus, (RSV) Received: 24 August 2004; revised: 22 September 2004 Accepted: 6 October 2004; electronically published: October 2004
Summary A conditional, replication-competent adenovirus (AdPSAE1) carrying the adenoviral E1 region under the control of a prostate specific antigen (PSA) promoter was generated in an effect to target the prostate for cancer gene therapy. The anti-prostate tumor efficacy and specificity of AdPSAE1 were examined in vitro and in vivo in prostate and nonprostate cancer models. In vitro at multiplicity of infection (moi) of 1, AdPSAE1 effectively killed the human prostate cancer cell lines PPC-1 and LNCaP, but had no effect on nonprostate cancer cells including the human bladder cancer cell line RT4, human breast cancer cell line MCF-7, and rat gliosarcoma cell line 9L. As a control, an adenovirus expressing the Ă&#x;-galactosidase transgene under the control of the same PSA promoter (AdPSAlacZ) was used in parallel in all experiments. The in vivo tissue-specific expression driven by this PSA promoter was examined in a xenograft tumor model. Intratumoral injection of AdPSAlacZ resulted in PSA promoter-driven expression of lacZ in xenograft tumors in nude mice derived from human prostate cancer PPC-1 cells, but not in tumors derived from human bladder cancer RT4 cells. Intratumoral injection of AdPSAE1 effectively inhibited in vivo growth (61.8% reduction in tumor size) of xenograft PPC-1 prostate tumors compared to untreated or AdPSAlacZ treated tumors. Conversely, intratumoral injection of AdPSAE1 had no effect on the growth of xenograft RT4 bladder tumors when compared to untreated control group. These results indicate that prostatetargeted conditional replication-competent adenoviruses may be useful in gene therapy of prostate cancer. (including E1a-deleted) adenoviruses are replicationdefective and are commonly used as viral vectors to carry therapeutic genes for gene therapy. The conventional way of producing an E1-deleted adenovirus is to use cells that are able to supply replication-enabling proteins. One such example is HEK 293 cells which were transformed by human adenovirus type 5 (Ad5) and express E1 protein (Graham et al, 1977). E1-deleted viruses infect host cells and express the transgene but they cannot replicate and undergo lysis due to the lack of the E1 protein. Thus, E1deleted recombinant adenoviruses are a safe viral vehicle for gene transfer. However, E1-deleted, replicationdefective adenoviruses have several common problems with respect to in vivo transduction: a low transduction rate, time-limited expression of the transgene, and host immune responses to repeated viral administration.
I. Introduction Prostate cancer is the most frequently diagnosed cancer and the second leading cause of cancer deaths in men today. It is estimated that there will be approximately 230,110 new cases and 29,900 deaths of prostate cancer in American men in 2004 (Jemal et al, 2004). Unfortunately for those patients diagnosed with advanced prostate cancer, there is no effective current treatment modality and their prognosis is poor. Although viral based gene therapy is a promising new strategy to combat advanced prostate cancer, its current effectiveness is limited by inefficient cellular transduction in vivo. The adenovirus early region 1 (E1) gene, which comprises E1a and E1b, encodes the viral early proteins that are necessary for adenoviral replication and the consequent oncolysis of permissive host cells. E1-deleted
413
Chang and Lu: Prostate-specific conditional oncolytic adenovirus with 10% FBS. Rat gliosarcoma 9L cells were grown in D-MEM medium with 10% FBS. All cells were grown in medium containing 100 units/ml penicillin, 100 µg/ml streptomycin at 37°C in a 5% CO2 atmosphere.
An alternative means of producing E1-deleted adenoviruses is to provide the E1 protein in the targeted cells. Codelivery of an E1-deleted adenovirus along with an E1-expressing plasmid allows one round of viral replication. This limited replication significantly increases in vivo delivery efficiency of adenovirus to cancer cells (Goldsmith et al, 1994; Han et al, 1998). This trans complementation of a replication-defective adenovirus with E1 protein in targeted cells may provide a means of amplifying gene transduction in vivo. However, the resultant adenovirus itself is not replication-competent and only one round of viral replication is possible. Therefore, transduction of tumor cells by this approach is still limited. Replication-competent viruses, also known as oncolytic viruses, replicate within transduced cells and force these cells into a lytic cycle. Released virus is then able to infect neighboring cells until all susceptible cells are eliminated. Theoretically a large tumor burden could be effectively eradicated using a small dose of an oncolytic virus. Therefore, strategies to use conditional oncolytic virus, or so-called attenuated replicationcompetent viruses, to specifically target prostate tissue have been developed (Rodriguez et al, 1997; Yu et al, 1999a, 1999b). The idea behind this study is to place the Ad5 E1 region in cis complementation (i.e., use E1 as a transgene) back into an E1-deleted, replication-defective adenovirus under the control of a prostate-specific promoter. Thus, E1 protein expression will be confined strictly to prostate tissues and render this a conditional oncolytic virus within the prostate. Our previous study showed that a prostatespecific adenovirus, AdPSAlacZ, which contains a ßgalactosidase (lacZ) reporter gene under the control of the PSA promoter, transduced a high level of lacZ transgene expression in the prostate after intraprostatic injection in an animal model. The virus did disseminate to tissues beyond the prostate after injection, however, AdPSAlacZ did not express the transgene in these nonprostate tissues (Steiner et al, 1999). This result suggests that the PSA promoter effectively and specifically drives lacZ transgene expression in prostate cells transduced by AdPSAlacZ. In this study we replaced the lacZ transgene in AdPSAlacZ with the Ad5 E1 region to generate a prostate-specific replication-competent adenovirus AdPSAE1, in which E1 expression is under the control of the PSA promoter. The efficacy and specificity of AdPSAE1 as a potential therapeutic vector for prostate cancer gene therapy were analyzed.
B. Construction of AdPSAlacZ and AdPSAE1
adenoviral
vector
The generation of AdPSAlacZ, an E1-deleted recombinant adenovirus expressing the lacZ reporter gene under the control of a 680-bp PSA promoter, has been described previously (Steiner et al, 1999). AdPSAE1 was generated by replacing the lacZ transgene in AdPSAlacZ with the wild-type Ad5 E1 gene. Briefly, an approximately 3-kb E1 fragment was generated by PCR using DNA extracted from the E1-containing adenovirus Ad-dl327 (Genetic Therapy Inc., Gaithersburg, MD) as a template, and primers specific to both the 5’ and 3’ region of the Ad5 E1 gene. In addition, a restriction site was introduced in each of the 5’ and 3’ primers to facilitate subsequent subcloning. The resultant PCR product included 4 bp upstream of the E1a gene start codon, the entire E1a and E1b regions, and 7 bp downstream of E1b stop codon, as well as the introduced BamH I and EcoR I site at 5’- and 3’- end, respectively. This PCR product was digested with BamH I and EcoR I, and subcloned into the corresponding sites in pBluescript (Stratagene, La Jolla, CA) and the E1 fragment was re-released with Spe I and EcoR V digestions. The prostate-specific adenoviral shuttle vector pPSAlacZ (used to generate AdPSAlacZ, Steiner et al, 1999) was digested with Xba I and Cel II to remove the lacZ gene, and was then ligated with the above-mentioned modified E1 fragment to generate the shuttle vector pPSAE1. This pPSAE1 shuttle vector was cotransfected with pJM17, an adenoviral genome plasmid, in 293 cells as described previously (Steiner et al, 2000a) to generate AdPSAE1. The resultant AdPSAE1 was genomically similar to Ad-dl327 except that the E1 gene in AdPSAE1 is under the control of a 680-bp PSA promoter rather the endogenous E1 promoter in Ad-dl327. Positive recombinant plaques were isolated by a direct plaque-screening PCR method (Lu et al, 1998) using primers specific to the recombinant construct, i.e., using one primer specific for the PSA promoter and the other primer specific for the E1 gene. Amplification and titration of adenoviruses were performed as described previously (Graham and Prevec, 1991).
C. Analysis of potential oncolytic effects of AdPSAE1 on various cell lines by crystal violet staining Cells (5#104 per well) were plated in six-well plates, the next day the cells were either untreated or transduced with AdPSAlacZ or AdPSAE1 at moi of 1. After 6 days of transduction, the media was removed and the plates were washed twice with PBS. The wells were then completely covered with 2 ml of 1% crystal violet (Sigma, St. Louis, MO) and the plate was allowed to sit 5 min with gentle rocking. After washing with water, the plate was allowed to dry at room temperature overnight before they were photographed.
II. Materials and methods A. Cell culture and medium Dulbecco’s modified Eagle medium (D-MEM) was purchased from Gibco BRL (Gaithersburg, MD). RPMI 1640 medium and McCoy’s 5" medium were purchased from Cellgro (Herndon, VA). Fetal bovine serum (FBS) was from Hyclone Laboratories (Logan, UT). All cell lines were purchased from ATCC (Rockville, MD) and were grown in D-MEM with 10% heat inactivated FBS. The human prostate cancer cell lines PPC1 and LNCaP, both secret PSA (Dr. J. Norris of MUSC, personal communication), were grown in RPMI 1640 medium with 10% FBS. The human breast carcinoma MCF-7 cells and human bladder cancer RT4 cells were grown in McCoy’s 5" medium
D. In vitro growth inhibition assay by AdPSAE1 Cells (5#104 per well) were plated in six-well plates, the next day the cells were divided into three groups: (a) control uninfected, (b) control virus AdPSAlacZ infected, and (c) AdPSAE1 infected. After viral infection at moi of 1, cell numbers were counted daily through day 6 post viral infection.
414
Gene Therapy and Molecular Biology Vol 8, page 415
E. X-gal staining of AdPSAlacZ transduced xenograft tumors
expression of E1 protein under the control of a prostate specific promoter (PSA), enabling the adenovirus to replicate and enter the oncolytic cycle only in prostate cells. To analyze the oncolytic cell-killing effects and tissue specificity of AdPSAE1, various cancer cell lines including prostate and nonprostate cells were used in both in vitro and in vivo models.
The recombinant adenovirus, AdRSVlacZ, which contains a !-galactosidase reporter gene under the control of a Rous sarcoma virus (RSV) promoter, was used as a positive control to demonstrate in vivo transduction efficiency within tumors. Xenograft tumors were established by injecting 5 x 106 various cancer cells subcutaneously into the flank of male Balb/c nu/nu athymic nude mice (Harlan Sprague Dawley, Inc., Indianapolis, IN). When tumors reached about 50 mm3 volume, 5 x 109 pfu AdRSVlacZ, or 1x1010 pfu AdPSAlacZ were injected directly into the tumor site. The mice were sacrificed 3 days post injection and the tumors were harvested and processed to cryosections as described previously (Lu et al, 1999). For tumor section staining, samples were fixed in 4% paraformaldehyde for 30 min, then in 30% sucrose in PBS at 4째C until the samples sank to the bottom of the vial. The samples were then snapfrozen in liquid nitrogen in O.C.T. medium (Tissue-Tek/Sakura, Torrance, CA) and processed to cryosections using a Cryostat. The cryosections were fixed in formalin for 30 sec then processed for X-gal staining as a measure of lacZ expression as described (Eastham et al, 1996).
A. AdPSAE1 effectively and specifically inhibited prostate cancer cell growth in vitro The potential oncolytic cell-killing effects of AdPSAE1 were analyzed in various cancer cells. The human prostate cancer lines PPC-1 and LNCaP and nonprostate cancer cell lines RT4 (human bladder cancer), MCF-7 (human breast cancer), and 9L (human glioma) were infected with AdPSAE1 or control virus AdPSAlacZ at moi of 1. Viable cells were stained with crystal violet 6 days after infection and were compared to untreated control cells (Figure 2). As dead cells typically detach, crystal violet stains only those viable cells that remain attached to the culture dish. As shown in Figure 2A and 2B, AdPSAE1 (right well) almost completely wiped out all PPC-1 and LNCaP cells, whereas AdPSAlacZ (middle well) had no cell-killing effects as compared to the untreated control (left well), respectively. On the other hand, AdPSAE1 had no cell-killing effects on RT4 (Figure 2C), MCF-7 (Figure 2D) and 9 L (Figure 2E) cells. These results clearly demonstrate that AdPSAE1 selectively replicates (thus goes through the oncolytic cycle and kills the host cells) in cancer cells derived from the prostate (PPC-1 and LNCaP), but not in nonprostate cancer cells (RT4, MCF-7 and 9L). To analyze the time-course of the growth inhibition effects of AdPSAE1 on prostate cancer cells, PPC-1 and LNCaP cells were either untreated or transduced with AdPSAE1 or control virus AdPSAlacZ at moi of 1 in vitro, and the cell numbers were monitored. As shown in Figure 3, significant growth inhibition was observed starting at day 4 post AdPSAE1 infection, with complete growth inhibition at day 6 for both prostate cancer cell
F. In vivo tumor growth inhibition by AdPSAE1 PPC-1 cells (1#107 cells in 0.2 ml of PBS) or RT4 cells (5.7#106 cells in 0.2 ml of PBS) were injected subcutaneously into the flank of male Balb/c nu/nu athymic nude mice (Harlan Sprague Dawley, Indianapolis, IN). For each tumor cell model, three groups of mice were formed with 8 mice in each group. Group I was used as an untreated control. Group II and group III were for intratumoral viral injection of AdPSAE1 and control virus AdPSAlacZ, respectively. When tumors reached about 200 mm3 volume, a single dose of 5#106 pfu AdPSAE1 or AdPSAlacZ were injected directly into each tumor mass. Tumor volume was measured every 3 days until the animals were sacrificed. All of the animals were sacrificed at day 35 after viral injection, when several mice of group III showed distress or had tumor burdens > 15% of their total body weight.
III. Results A prostate-specific, conditional oncolytic adenovirus, AdPSAE1, was generated by replacing the lacZ transgene of AdPSAlacZ (Steiner et al, 1999) with the wild-type Ad5 E1 region (Figure 1). This strategy allows the
Figure 1. Design of a prostate-specific conditional replication-competent adenovirus. The native Ad5 early region 1 (E1) gene that is required for adenoviral replication, is replaced by an expression cassette which contains an Ad5 E1 gene under the control of a 860-bp PSA promoter.
415
Chang and Lu: Prostate-specific conditional oncolytic adenovirus
Figure 2. Conditional oncolytic effects of AdPSAE1 in prostate cancer cells. The human prostate cancer cell lines PPC-1 (A) and LNCaP (B), human bladder cancer cell line RT4 (C), human breast cancer cell line MCF-7 (D), and human glioma cell line 9L (E) were transduced with AdPSAE1 or AdPSAlacZ at moi of 1. Attached viable cells were stained with crystal violet 6 days after viral infection and were compared to the untreated controls.
416
Gene Therapy and Molecular Biology Vol 8, page 417
Figure 3. Time-course of the growth inhibition effects of AdPSAE1 on prostate cancer cells. Prostate cancer cells PPC-1 (A) and LNCaP (B) were transduced with AdPSAE1 at moi of 1. Cell numbers were determined daily from day 1 to 6 after viral transduction. Untreated and AdPSAlacZ transduced cells were used as controls. The data represent the results from two independent experiments each performed in duplicate. Some error bars are too small to show.
lines PPC-1 and LNCaP. AdPSAlacZ transduction did not cause significant growth inhibition in either of these cell lines (Figure 3A and 3B). The differential sensitivity of various cancer cells to AdPSAE1-mediated oncolytic killing and growth inhibition is presented in Figure 4. On day 6 after in vitro viral transduction at moi of 1, AdPSAE1 transduction significantly reduced numbers of PPC-1 and LNCaP cells to 81.6% and 96.9% of untreated control values, whereas the control virus AdPSAlacZ transduction resulted in minor and insignificant growth inhibition (Figure 4). In contrast, AdPSAE1 had no significant cell-killing or growth inhibition effects towards the nonprostate cancer cells RT4, MCF-7 and 9L when compared to the untreated control and control virus AdPSAlacZ transduced groups (Figure 4). These results suggest that, in vitro, AdPSAE1 effectively leads to prostate-specific oncolytic killing. To ensure that selective viral replication accounted for the cell-killing in AdPSAE1 transduced cells, RT-PCR was performed using primers specific to Ad5 E1a gene and followed by Southern blot hybridization (Steiner et al, 1999) to examine the E1a mRNA expression in AdPSAE1-transduced cells. We found that only LNCaP and PPC-1 cells had positive E1a RT-PCR product whereas RT4, MCF-7 and 9L cells did not (not shown), indicating that E1a was selectively expressed in prostate cancer cells. We also performed RCA (replication complement adenovirus) assay by sequential infection of target cells (prostate and nonprostate cells) with AdPSAE1 and consequently collected supernatant of target cells to infect 293 cells. We only found plaques in 293 cells infected by supernatant from LNCaP and DU145 cells that
Figure 4. Differential growth inhibition of AdPSAE1 with respect to prostate and nonprostate cancer cells. Prostate cancer cells (PPC-1 and LNCaP) and nonprostate cancer cells (RT4, MCF-7 and 9L) were transduced with AdPSAE1 or AdPSAlacZ at moi of 1. Cell numbers were determined six days later and compared to that of untreated control. The data represent the results from two independent experiments each performed in duplicate. Some error bars are too small to show.
417
Chang and Lu: Prostate-specific conditional oncolytic adenovirus had been initially infected by AdPSAE1, not by supernatant from nonprostate cancer cells infected by AdPSAE1 (not shown). These results indicate that only
AdPSAE1-transduced prostate cancer cells generate progeny viruses.
Figure 5. Specific transgene expression driven by a PSA promoter in prostate cancer cells. Xenograft tumors were established by subcutaneous injection of cancer cells into the flank of nude mice. When tumors reached about 50 mm3, each of the adenoviral constructs (1x1010 pfu AdPSAlacZ or 5x109 pfu AdRSVlacZ) was injected directly into the tumor. The tumors were harvested 72 hr later and processed to cryosections. Shown are X-gal staining of tumor sections derived from prostate cancer PPC-1 cells (A, C, E) and bladder cancer RT4 cells (B, D, F). A and B are tumors transduced by AdPSAlacZ (1x1010 pfu). C and D are untreated control tumors to serve as negative controls. E and F are tumors transduced by AdRSVlacZ (5x109 pfu) to serve as positive controls.
418
Gene Therapy and Molecular Biology Vol 8, page 419
B. Specific expression of transgene driven by the PSA promoter in the xenograft prostate tumors in animal model
C. dPSAE1 specifically inhibited prostate tumor growth in vivo To determine whether AdPSAE1 causes similar tumor growth inhibition in vivo as was shown in vitro (Figure 2, 3 and 4), human prostate cancer PPC-1 cells and human bladder cancer RT4 cells were injected subcutaneously into the flank of nude mice to establish the xenograft tumors. When tumors developed to about 200 mm3, a single dose of AdPSAE1 was injected directly into the tumor in both cancer cell models. As shown in Figure 6A for the PPC-1 tumor model, both untreated tumors and tumors treated with control virus AdPSAlacZ grew rapidly and at a similar rate. In contrast, the AdPSAE1-treated group showed an effective suppression of this rapid growth. By day 35 post viral injection, the group treated with AdPSAE1 had a remarkable 61.8% reduction of tumor size as compared to the untreated group (Figure 6A). On the other hand, the same single dose of AdPSAE1 injected into the RT4 xenograft tumors failed to result in significant growth inhibition, as compared to the untreated RT4 tumor group (Figure 6B). These results suggest that AdPSAE1 is able to specifically inhibit prostate tumor growth in vivo.
To determine the in vivo specificity of a 680-bp PSA promoter that was used tin the AdPSAE1 construct, a parallel adenovirus, AdPSAlacZ, containing a lacZ reporter gene under the control of the same 680-bp PSA promoter was used to analyze specificity in xenograft tumors grown in nude mice. A dose of 1x1010 pfu AdPSAlacZ was injected into subcutaneous xenograft tumors derived from human prostate cancer PPC-1 cells or human bladder cancer RT4 cells. As a positive control, AdRSVlacZ (Lu et al, 1999), an adenovirus containing the lacZ gene under the control of a constitutively active RSV promoter, was injected into xenograft tumors at a dose of 5x109 pfu. LacZ expression was determined through X-gal staining of cryosections of the tumors 72 h following viral injection. Untransduced control PPC-1 (Figure 5C) and RT4 (Figure 5D) tumors did not express detectable endogenous lacZ. AdPSAlacZ transduced PPC-1 tumors contained X-gal positive (blue stained) cells (Figure 5A), whereas AdPSAlacZ transduced RT4 tumors did not (Figure 5B). In contrast, both PPC-1 (Figure 5E) and RT4 (Figure 5F) tumors transduced by AdRSVlacZ showed X-gal positive cells. These results demonstrate that expression of the lacZ transgene driven by this PSA promoter occurred only in xenograft prostate tumors, but not in xenograft bladder tumors. However, the activity of the PSA promoter is much lower than that of the constitutively active RSV promoter (Compare Figure 5A and 5E with the blue stained cells and the viral dose injected, respectively).
IV. Discussion Most currently used gene therapy vectors are engineered to prevent viral self-replication. These replication deficient viruses represent a safer gene transfer vehicle. They deliver therapeutic transgenes without exposing host cells to the viral lytic cycle. The transduction of replication-defective viral vectors in vivo confines transgene expression to those cells along the
Figure 6. AdPSAE1 specifically inhibits prostate tumor growth in vivo. (A) The human prostate cancer line PPC-1 and (B) human bladder cancer line RT4 were injected subcutaneously into the flank of nude mice. When tumors reached an average volume of 200 mm3, tumors were either untreated (control) or treated with intratumoral injection (day 0) with 5x106 pfu of AdPSAlacZ (control virus) or 5x106 pfu AdPSAE1. The tumor sizes were periodically measured after viral injection. Each point represents the average tumor volume from 8 mice. Some error bars are too small to show.
419
Chang and Lu: Prostate-specific conditional oncolytic adenovirus injection track due an inability to pass the transgene to neighboring cells. Consequently, the effectiveness of a viral vector is directly correlated to its transduction efficiency. Although bystander effect of certain therapeutic transgenes in the suicide gene therapy strategy helps to increase some therapeutic index, its effect is limited. Tumor cells cannot be 100% transduced with a single treatment. Untransduced tumor cells survive, divide and eventually offset the therapeutic effects posed by the initial viral transduction. Therefore, repeated viral injections aimed at infecting those tumor cells not infected in the first round of viral transduction is required to maximize the therapeutic effect in vivo. However, adenoviral vectors cause strong immunogenic responses. Consequently, second and subsequent rounds of adenoviral administration possess significantly reduced therapeutic effects in vivo (Berkner, 1988; Russell, 2000). To overcome this obstacle, an alternative approach is to employ conditional oncolytic viruses, also called attenuated replication-competent viruses, for cancer gene therapy. Conditional oncolytic viruses are altered such that they specifically target a desired cell type or modified such that the desired target cells are several orders of magnitude more sensitive to oncolytic cell lysis than are nontargeted cells. By taking advantage of prostate-specific promoter, an Ad5 E1a gene, was reintroduced to E1a/E3-deleted adenovirus under the control of PSA enhancer/promoter (5322 to â&#x20AC;&#x201C;3729/-580 to +12) (PSE). The resultant adenovirus, CN706, specifically replicates in, and thus kills, PSA-producing cells such as LNCaP but not in nonPSA-producing cells such as DU145 (Rodriguez et al, 1997). Likewise, CN764, an adenoviral vector containing the Ad5 E1a gene driven by PSE and the Ad5 E1b gene driven by a hK2 enhancer/promoter (-5155 to â&#x20AC;&#x201C;3387/-324 to +33), has a high therapeutic index with a cell specificity of 10,000:1 for prostate cancer LNCaP cells, compared to ovarian cancer OVCAR-3, SK-OV-3 and PA-1 cells (Yu et al, 1999a). A similar approach was used to generate another prostate-specific replication-competent adenovirus, CV787. CV787 contains the E1a transgene driven by a prostate-specific probasin promoter, an E1b gene driven by the PSE promoter and a wild-type E3 region that suppresses the host immune system. CV787 destroys PSA-producing cells 10,000 times more efficiently than non-PSA-producing cells. A single tail vein injection of CV787 has been shown to eliminate distant LNCaP xenograft tumors (Yu et al, 1999b). This indicates that CV787 could be a powerful therapeutic vector to treat metastatic prostate cancer. Unlike other groups as mentioned above in which they used much longer PSA promoter region (above 1.6 kb), our current study shows that a 680-bp PSA promoter is sufficient enough to drive a prostate-specific transgene expression. This 680-bp PSA promoter drives expression of the lacZ transgene specifically in xenograft tumors derived from prostate but not in those derived from nonprostate cancer cells (Figure 5A and 5B). This demonstrates specific expression of transgene by the PSA promoter only in prostate derived cells. Our previous publication demonstrated that the same PSA promoter drives expression of the reporter transgene in a prostate-
specific manner when AdPSAlacZ was directly injected into the prostate (Steiner et al, 1999). The majority of injected virus was retained within the prostate gland, whereas a minor portion spread to distant tissues. Despite nonprostate infection by the adenovirus as detected by Southern blot of PCR using primers specific to the Ad5 adenovirus, the lacZ transgene was not expressed as detected by Southern blot of RT-PCR using primers specific to bacterial lacZ gene. Together, these data strongly demonstrate that the 680-bp PSA promoter drives transgene expression exclusively in the prostate in vivo. In this study we used xenograft prostate tumors derived from a primary prostate cancer cell line PPC-1 (Brothman et al, 1989), rather from a metastatic prostate cancer line (such as LNCaP or DU145 as other groups did), for analyzing the efficacy of AdPSAE1. We believe that the intratumoral injection of viral vector into a primary prostate tumor setting reflects much closer to the real clinical situation for prostate cancer gene therapy. Moreover, to our knowledge, we are the first group to use a bladder xenograft tumor model (RT4) for analyzing the specificity of PSA promoter-driven E1 expression (Figure 6B), it seems to make more sense to us to pay attention whether AdPSAE1 would cause damage to the bladder, which is anatomically close to the prostate during the prostate cancer gene therapy application, rather than to the ovarian and breast as used by other group (Yu et al, 1999a). While the PSA promoter maintains faithful tissuespecific expression, its promoter activity is relatively weak compared to the constitutive active RSV promoter (compare Figure 5A and 5E). This implies that as a tradeoff for the tissue specificity, the expression of a therapeutic transgene driven by the PSA promoter will be lower than that of a constitutively active promoter. This may not seem to be a major issue because we are using a conditional oncolytic strategy in which the therapeutic transgene itself is the Ad5 E1 gene. Theoretically, only low levels of E1 expression are required to initiate and maintain the viral oncolytic cycle to eradicate all the prostate cells. In this study, we have demonstrated that at an moi of 1, AdPSAE1 was able to completely eradicate all cancerous prostate cells in vitro (Figure 2, 3 and 4). Similarly, in our in vivo study, at viral doses (i.e., intratumoral injection of 5x106 pfu AdPSAE1 per tumor of 200 mm3 size, Figure 6) much lower than that of the typical E1-deleted adenoviral vectors we have routinely used (i.e., intratumoral injection of 5x109 pfu E1-deleted adenovirus containing a therapeutic gene per tumor of 100 mm3 size, Steiner et al, 2000b, 2000c), AdPSAE1 exhibited an equivalent inhibition ability for xenograft prostate tumor growth as those by E1-deleted adenovirus at a much higher dose. However, we were still unable to completely eradicate tumors using AdPSAE1 treatment in vivo (Figure 6A). This failure may be due to insufficient production of the E1 protein in vivo by the relatively weak prostate-specific promoter. The limitation of this strategy by a PSA promoter driven, prostate-specific gene expression is that it only works effectively in PSA-producing prostate cells (such as LNCaP and PPC-1 as shown in this report), but not in
420
Gene Therapy and Molecular Biology Vol 8, page 421 PSA-negative prostate cells such as DU145 and PC3 (Rodriguez et al, 1997; Yu et al, 1999b). Therefore, other prostate-specific promoters (such as probasin) should be explored for their abilities to drive transgene expression in PSA-negative prostate cancer cells. Our ongoing research showed that a 456-bp probasin promoter is able to drive transgene specifically expressed in both PSA-positive and PSA-negative prostate cancer cells. It implies that this 456-bp 5â&#x20AC;&#x2122; region of the probasin gene might be a good candidate to function as a prostate-specific promoter to drive the E1 transgene expression in prostate cancer. The idea of using conditional oncolytic viruses is an attractive strategy that may hold the promise of 100% eradication of primary tumor cells and of targeting tumor metastases. However, significant effort should be undertaken to evaluate the tissue specificity and ensure the safety of each new viral construct. A study to evaluate the biodistribution and toxicity of a replication-competent adenovirus following intraprostatic injection showed that although the virus persisted in the urogenital tract and liver, most toxicity was minimal and self-limiting. Most importantly, there was no germ-line transmission of viral genes (Paielli et al, 2000). One way to control viral spread is to design a conditional oncolytic virus containing a prodrug enzyme gene, so the prodrug can be used as desired to suppress viral replication effectively. A replication-competent, E1b-attenuated adenovirus containing a cytosine deaminase/herpes simplex virus type 1-thymidine kinase (CD/HSV-TK) fusion gene was constructed (Freytag et al, 1998). Not only the suicide gene system allows for the utilization of double-suicide gene therapy, but also it provides a means to eliminate the virus itself by destroying the host cells in situ and controls viral spread whenever needed (Freytag et al, 1998). Recent development in this field has brought the hope closer to generate the ideal conditional replicationcompetent adenovirus for prostate cancer gene therapy. It appears that PSA prompter/enhancer has more activity and specificity in helper-dependent adenoviral vector (almost devoid of all adenoviral sequences) than in traditional E1deleted adenoviral vector (Shi et al, 2002). Moreover, this promoter specificity can also be influenced by other constitutively active promoter/enhancer in the vector backbone (Shi et al, 2002). To overcome the obstacle that PSA promoter is active only in PSA-producing prostate cancer cells, a strategy of cotransduction of another adenovirus expressing androgen receptor (AR) and combination with dihydrotestosterone (DHT) treatment should be worth exploration. Because PSA promoterdriven transgene can be induced by DHT in PC-3 cells (a non-PSA-producing prostate cancer cell line) transfected with AR expression vector (Kizu et al, 2004). Moreover, a novel TARP (T cell receptor gamma-chain alternate reading frame protein) promoter with PSA enhancer has shown a high prostate-specific activity in both hormonedependent and hormone-refractory prostate cancer cells (Cheng et al, 2004). With significant ongoing efforts of better understanding and improvement in these aspects, we expect that ideal conditional replication-competent adenoviruses will be generated and become an effective
means for the treatment of prostate cancer in the near future.
Acknowledgments This research was supported in part by NIH grant DK65962 (Y.L.), in part by Elsa U. Pardee Foundation (Y.L.), and in part by Cancer Research and Prevention Foundation (Y.L.). We thank Dr. Dan Baker of the Department of Medicine, University of Tennessee Health Science Center for his critical review of this manuscript.
References Berkner KL (1988) Development of adenovirus vectors for the expression of heterologous genes. Biotechniques 6, 616-629. Brothman AR, Lesho LJ, Somers KD, Wright GL Jr, and Merchant DJ (1989) Phenotypic and cytogenetic characterization of a cell line derived from primary prostatic carcinoma. Int J Cancer 44, 898-903. Cheng WS, Kraaij R, Nilsson B, van der Weel L, de Ridder CM, Totterman TH, and Essand M (2004) A novel TARPpromoter-based adenovirus against hormone-dependent and hormone-refractory prostate cancer. Mol Ther 10, 355-364. Eastham JA, Chen S-H, Sehgal I, Yang G, Timme TL, Hall SJ, Woo SLC, and Thompson TC (1996) Prostate cancer gene therapy, herpes simplex virus thymidine kinase gene transduction followed by ganciclovir in mouse and human prostate cancer models. Hum Gene Ther 7, 515-525. Freytag SO, Rogulski KR, Paielli DL, Gilbert JD, and Kim JH (1998) A novel three-pronged approach to kill cancer cells selectively, concomitant viral, double suicide gene, and radiotherapy. Hum Gene Ther 9, 1323-1333. Goldsmith KT, Curiel DT, Engler JA, and Garver Jr, RI (1994) Trans complementation of an E1a-deleted adenovirus with codelivered E1A sequences to make recombinant adenoviral producer cells. Hum Gene Ther 5, 1341-1348. Graham FL, Smiley J, Russell WC, and Nairn R (1977) Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol 36, 59-72. Graham FL. and Prevec L (1991) Manipulation of adenovirus vectors. In Methods in Molecular Biology. E.J. Murray, ed, Vol. 7, Gene transfer and expression protocols. (The Human Press Inc, Clifton) pp. 109-128. Han JS, Qian D, Wicha MS, and Clarke MF (1998) A method of limited replication for the efficient in vivo delivery of adenovirus to cancer cells. Hum Gene Ther 9, 1209-1216. Jemal A, Timari RC, Murray T, Ghafoor A, Samuels A, Ward E, Feuer EJ, and Thun MJ, A (2004) Cancer Statistics, 2004. CA Cancer J Clin 54, 8-29. Kizu R, Otsuki N, Kishida Y, Toriba A, Mizokami A, Burnstein KL, Klinge CM, and Hayakawai K (2004) A new luciferase reporter gene assay for the detection of androgenic and antiandrogenic effects based on a human prostate specific antigen promoter and PC3/AR human prostate cancer cells. Anal Sci 20, 55-59. Lu Y, Carraher J, Zhang Y, Armstrong J, Lerner J, Roger W, and Steiner MS (1999) Delivery of adenoviral vectors to the prostate for gene therapy. Cancer Gene Ther 6, 64-72. Lu Y, Zhang Y, and Steiner MS (1998) Efficient identification of recombinant adenoviruses by direct plaque-screening. DNA Cell Biol 17, 643-645. Paielli DL, Wing MS, Rogulski KR, Gilbert JD, Kolozsvary A, Kim JH, Hughes J, Schnell M, Thompson T, and Freytag SO (2000) Evaluation of the biodistribution, persistence, toxicity, and potential of germ-line transmission of a
421
Chang and Lu: Prostate-specific conditional oncolytic adenovirus replication-competent human adenovirus following intraprostatic administration in the mouse. Mol Ther 1, 263274. Rodriguez R, Schuur ER, Lim HY, Henderson GA, Simons JW, and Henderson DR (1997) Prostate attenuated replication competent adenovirus (ARCA) CN706, a selective cytotoxic for prostate-specific antigen-positive prostate cancer cells. Cancer Res 57, 2559-2563. Russell WC (2000) Update on adenovirus and its vectors. J Gen Virol 81, 2573-2604. Shi CX, Hitt M, Ng P,and Graham FL (2002) Superior tissuespecific expression from tyrosinase and prostate-specific antigen promoters/enhancers in helper-dependent compared with first-generation adenoviral vectors. Hum Gene Ther 13, 211-224. Steiner MS, Zhang X, Wang Y, and Lu Y (2000b) Growth inhibition of prostate cancer by adenovirus expressing a novel tumor suppressor gene pHyde. Cancer Res 60, 44194425. Steiner MS, Zhang Y, and Lu Y (2000a) A fast way to generate recombinant adenovirus, a high-frequency-recombination system. J Industr Microbiol Biotechnol 24, 198-202. Steiner MS, Zhang Y, Carraher J, and Lu Y (1999) In vivo expression of prostate specific adenoviral vectors in a canine model. Cancer Gene Ther 6, 456-464. Steiner MS, Zhang Y, Farooq F, Lerner J, Wang Y, and Lu Y (2000c) Adenoviral vector containing wild type p16 suppresses prostate cancer growth and prolongs survival by inducing cell senescence. Cancer Gene Ther 7, 360-372. Yu DC, Chen Y, Seng M, Dilley J, and Henderson DR (1999b) The addition of adenovirus type 5 region E3 enables calydon
virus 787 to eliminate distant prostate tumor xenografts. Cancer Res 59, 4200-4203. Yu DC, Sakamoto GT, and Henderson DR ( 1999a) Identification of the transcriptional regulatory sequences of human kallikrein 2 and their use in the construction of calydon virus 764, an attenuated replication competent adenovirus for prostate cancer therapy. Cancer Res 59, 1498-1504.
Dr. Yi Lu
422
Gene Therapy and Molecular Biology Vol 8, page 423 Gene Ther Mol Biol Vol 8, 423-430, 2004
A platform for constructing infectivity-enhanced fiber-mosaic adenoviruses genetically modified to express two fiber types Research Article
Marianne G. Rots1*, Willemijn M. Gommans1, Igor Dmitriev2, Dorenda Oosterhuis1, Toshiro Seki2, David T. Curiel2, Hidde J. Haisma1 1
Therapeutic Gene Modulation, Groningen University Institute for Drug Exploration, University of Groningen, A. Deusinglaan 1, 9713 AV Groningen, the Netherlands 2 Division of Human Gene Therapy, Departments of Medicine, Pathology and Surgery, University of Alabama at Birmingham, Birmingham, AL 35291, USA
__________________________________________________________________________________ *Correspondence: Marianne G. Rots, Department of Therapeutic Gene Modulation; Groningen University Institute for Drug Exploration; A. Deusinglaan 1; 9713 AV Groningen; The Netherlands; Tel: +31-50-363 8514 7866; Fax: +31-50-363 3247; e-mail: m.g.rots@farm.rug.nl Key words: gene therapy, adenovirus, fiber, infectivity enhancement Abbreviations: adenovirus type 3, (Ad3); coxsackie adenovirus receptor, (CAR); fetal bovine serum, (FBS); Green Fluorescent Protein, (GFP); Head and neck squamous cell carcinoma, (HNSCC); plaque forming units, (pfu); relative light units, (RLU); viral particle, (vp) Received: 27 September 2004; Accepted: 6 October 2004; electronically published: October 2004
Summary Adenoviruses type 5 have been successfully exploited as gene transfer vectors and numerous vectorological improvements have contributed to increasing efficiency and specificity of adenoviral gene therapy. Despite these improvements, inefficient gene transfer still is an important limitation and is, at least in part, due to the low expression of the primary receptor (CAR) on target cells. Combining two different fiber types (the fiber of Ad5 for CAR-dependent uptake and the fiber of Ad3 for CAR-independent uptake) on an Ad5-based capsid would increase the options for improvement of specificity and efficiency. In this study, we present an approach to engineer fibermosaic adenoviruses by cloning the fiber of Ad3 into the Ad5 genome under the control of the Major Late Promoter using native splicing signals. Such fiber-mosaic viruses were efficiently rescued using conventional 293 cells and demonstrated good infection profiles. Pre-incubation with recombinant fiber knob (either derived from Ad5 or Ad3) indicated different mechanisms of entry for the fiber-mosaic viruses. The introduction of an additional entry pathway can be further exploited to overcome low infection efficiency due to low CAR expression. In addition, the technology will be of value in increasing the specificity of adenoviral gene therapy since this approach allows the incorporation of two different retargeting ligands per capsid. Such infectivity enhancement will also prove powerful in the context of replicative agents. for adenoviruses (coxsackie adenovirus receptor (CAR)) (Douglas et al, 2001). Redirecting viruses to specific receptors on target cells will improve specificity and possibly also efficiency (Glasgow and Curiel, 2004). Such transductional retargeting has been exploited through complexing the virus to targeting moieties (eg bispecific antibodies) (Rots et al, 2003) or through genetic modification of the knob or penton base (Nicklin and Baker, 2002). Alternatively, several genetic strategies have been developed to stably incorporate retargeting moieties directly into the viral capsid. For fiber modifications, the HI-loop or C-terminal
I. Introduction Adenoviruses are widely used as gene transfer vehicles in gene therapy for several reasons including the easy production to high titers and their efficient infection of both dividing and non-dividing cells. Even though adenoviruses are among the most efficient vectors in vivo to date, accounting for 40% of all clinical gene therapy trials (Marshall, 2001), adenoviral cancer gene therapy is limited by the low efficiency of gene transfer. This low gene transfer might at least partially be explained by no/low expression or accessibility of the primary receptor
423
Rots et al: Constructing fiber-mosaic adenoviruses end have been exploited, and several polypeptides have been successfully incorporated (Belousova et al, 2002). Although successful in improving the characteristics of the vector in vitro, the retargeting moiety generally is only expressed by specific tumor types in vivo. In this respect, we reasoned that both efficiency and specificity of adenoviral gene transfer would be improved by allowing a virus to infect cells via two ways of entry. Adenoviruses belonging to subgroup C mainly bind to the CAR receptor and will be internalized after binding of the penton base to integrins. However, subgroup B adenoviruses do not bind to CAR but to other receptor(s), like CD46 (Gaggar et al, 2003), before internalization via integrin-mediated endocytosis takes place (Cuzange et al, 1994). These subgroup B viruses display a different infection profile as has been described in detail for adenovirus type 3 (Ad3) (Stevenson et al, 1997; Kanerva et al, 2002), Ad7 (Gall et al, 1996), Ad17 (Chillon et al, 1997) and Ad35 (Shayakhmetov et al, 2000). Based on the improved infection of primary cancer cells described for Ad3 versus Ad5 (Kanerva et al, 2002; Volk et al, 2003), we choose to exploit the infection mechanism of Ad3. To this end, the Ad3 fiber was cloned into the Ad5 genome using the native fiber splicing signals thus creating a virus expressing both fibers onto the capsid of Ad5 (fibermosaic virus). We demonstrate that such fiber-mosaic viruses (AdF3F5) can be rescued and that this virus infects cells through two different mechanisms; one CAR mediated entry which can be blocked by recombinant knob 5 protein and one entry pathway which can be blocked by preincubation with recombinant knob 3 protein. This technology of introducing an additional fiber type in adenoviral gene therapy vectors will contribute to optimizing adenoviral gene therapy efficiency (Figure 1). Specificity can subsequently be achieved by introducing targeting ligands into the knob of Ad5 (Dmitriev et al, 1998) and/or the knob of Ad3 (Uil et al, 2003). Alternatively, the use of tumor specific promoters will
restrict transgene expression or viral replication specifically to target cells (Rots et al, 2003). Especially in the context of replication competent adenoviruses, the fiber-mosaic approach will be beneficial since secondary infection efficiency is thought to be a major problem hampering therapeutic outcome of replicative agents.
II. Materials and methods A. Cells Human cervical cancer cells (HeLa) and embryonic kidney cells (293), both expressing high levels of CAR and integrins, were purchased from the American Type Culture Collection (ATCC, Rockville, MD). Head and neck squamous cell carcinoma (HNSCC) cell lines (FaDu and SCC25), glioma lines (U373 and U118) and ovarian cancer cell lines (SKOV) were included for their differential expression of the receptor for Ad3 and Ad5. Cells were cultured at linear phase in recommended media.
B. Construction of recombinant adenoviral plasmid encoding the fiber-mosaic adenovirus AdF3F5 Since incorporation of the fiber monotrimer into the viral capsid is dependent on the tail domain of the fiber, we constructed a chimeric fiber by fusing the tail of Ad5 to the shaft of Ad3. Oligos encoding the first 15 amino acids of the tail of the fiber of Ad5 (based on Ad sequence nts 31042 to 31087 containing the KRAR nuclear localization signal) (Hong and Engler, 1991) were constructed to contain a NdeI- 3’end. The shaft and the knob region of Ad3 were obtained by PCR using Pfu-polymerase (Stratagene) resulting in a NdeI-5’end (underlined) using the following primers: 5’GTACCCATATGAAGATGAAAGCAGCTC-3’ (forward) and 5’-GGGAAGGGGGAGGCAAAATAACTAC-3’ (reverse). The tail of Ad5 was then genetically fused to the gene coding for the shaft and the knob of Ad3 and introduced upstream of the wild type Ad5 fiber by cloning into the PacI site of pAd70-100dlE3 (kindly provided by Dr. Falck-Pederson, Cornell, New York) (Gall et al, 1996). Digestion with NdeI results in a NdeI-NdeI fragment containing the shaft and knob of Ad3 followed by
Figure 1. Schematic representation of infectivity-enhancement by fiber mosaic adenoviruses. Adenoviruses expressing two different fiber types on one capsid can make use of two different mechanisms of entry. This approach will circumvent the low expression of the primary receptor, CAR, as described for numerous primary cancer cell types. The technology allows for introduction of two targeting moieties in the same virion.
424
Gene Therapy and Molecular Biology Vol 8, page 425 upstream sequence of wild type Ad5 fiber and the starting genetic sequence encoding the Ad5 tail. This fragment was subcloned into the NdeI site of the adenoviral transfer plasmid pNEBpkFSP (Krasnykh et al, 1996) to ensure optimal splicing conditions for the second chimeric fiber. Cloning strategy and resulting construct is shown in Figure 2. Enzymes used were obtained from LifeTechnologies and New England Biolabs. Homologous recombination with the adenoviral backbone pVK50 (Krasnykh et al, 1996) containing genes encoding luciferase and Green Fluorescent Protein (GFP) in the E1-region (Seki et al, 2002) resulted in a plasmid encoding AdF3F5. Subsequent virus production was performed according to the pAdEasy protocol (He et al, 1998). Expression of the two fibers was detected by western blot analysis of 1010 boiled viral particles separated on a 10% SDS-PAGE gel using the anti-tail antibody 2D4 (Hong and Engler, 1991) generated at the University of Alabama at Birmingham Hybridoma Core Facility.
D. Inhibition of viral mediated gene transfer by recombinant fiber proteins Monolayers were grown to 70% confluency in 24 wells plates and incubated with recombinant Ad3 knob (10 µg/ml PBS), Ad5 knob (2 or 10 µg/ml), a combination of both knobs or with plain PBS for 10 minutes at room temperature. Recombinant proteins were obtained as described previously (Krasnykh et al, 1996). Viruses (100 vp/cell) were added in 100 µl cell growth medium containing 2% fetal bovine serum (FBS, hospital pharmacy University Hospital Groningen) and cells were incubated for 1 hour at 37°C. Then, 500 µl growth medium containing 10% FBS was added and cells were incubated for 2 days. Cells were lysed using Cell Culture Lysis Buffer and luciferase activity was measured using a luminometer (Packard, Groningen, the Netherlands), according to manufacturers conditions (Luciferase Assay System, Promega, Leiden, the Netherlands). Data are expressed as relative light units (RLU).
C. Viruses To compare the infection efficiency of AdF3F5 with unretargeted Ad5, AdTL was used containing luciferase and GFP in the E1 region (wild type Ad5 fiber, AdF5) (Alemany and Curiel, 2001). To investigate the infection efficiency relative to knob 3 mediated infection, Ad5/3Luc1 was used expressing a chimeric fiber containing the knob of Ad3 in a Ad5 backbone (AdK3) (Krasnykh et al, 2001). AdK3 encodes luciferase from a different expression cassette and can therefore not be directly compared to AdF5 and AdF3F5. Adenovirus type 3 was obtained from the American Type Culture Collection. All viruses were CsCl purified and quantified for viral particle (vp) number and plaque forming units (pfu) according to standard procedures. The vp/pfu ratios were 3.1, 3.7 and 2.2 for AdF3F5, AdF5 and AdK3, respectively.
E. Infectivity assays To compare infection efficiency of the fiber-mosaic adenovirus AdF3F5 with Ad5 infection (AdF5) and with infection of Ad3 (Ad5/3-Luc1), different cell lines were grown to 70% confluent monolayers in 24 wells plates. Viruses were diluted in 100 µl medium containing 2% FBS and cells were infected at 100 vp/cell. After 1 hour of incubation at 37°C, medium containing 10% FBS was added. After 2 days, cells were lysed and luciferase activity was determined. Data are represented as means of triplicates of representative experiments. Students t-Tests were performed to analyze the differences between infection efficiencies of AdF5 and AdF3F5.
Figure 2. Cloning strategy for the transfer plasmid pNEBpkFSP.F3F5 for construction of fiber-mosaic adenoviruses AdF3F5. The chimeric fiber F3 was made by ligating the 5’ part of the tail of Ad5 (T5) to the PCR product of the Shaft and the Knob of Ad3 (SK3). Subsequently, this fragment (5T3SK) was ligated into pAd70-100dlE3 containing wild type fiber (F5). Restriction with NdeI of plasmid pAd70-100(5T3SK) results in a fragment containing: 1) 3SK, 2) the wild type splicing sequences (*) upstream of fiber 5 and 3) the initial portion of the tail of wild type fiber 5. Subcloning of this NdeI-fragment into pNEBpkFSP resulted in a transfer vector for introduction of an additional fiber-encoding gene into the adenoviral backbone. Both fibers are under the control of the Major Late Promoter, with the tripartite leader marked as black boxes and the wild type splicing sites denoted as *.
425
Rots et al: Constructing fiber-mosaic adenoviruses
III. Results
B. Infectivity assays 1. Functional validation of AdF3F5.
A. Construction of recombinant adenoviral plasmid encoding the fiber-mosaic adenovirus AdF3F5
To identify the pathway of entry of AdF3F5, different cell lines (HeLa cells (expressing high levels of both CAR and the receptor for Ad3), FaDu and SCC25 cells (both expressing low levels of CAR and high levels of Ad3 receptor)) were incubated with AdF3F5, AdF5 and AdK3 after preincubation with recombinant knob 3 and/or knob 5 protein as described in Material and Methods. Presence of knob 3 did slightly inhibit infection of AdF3F5 (expressing both Ad3 and Ad5 fibers) and of AdK3 (expressing the knob of Ad3, displaying an Ad3 infection spectrum) on HeLa cells (14 and 10% inhibition, respectively) (Figure 4). However, more pronounced inhibition of knob 3 mediated infection was observed on FaDu (AdF3F5: 31% and AdK3: 58% inhibition) and SSC25 (27 and 77%, respectively). Preincubation with recombinant knob 5 protein efficiently inhibited infection of AdF3F5 and AdF5 (wild type Ad5 fiber) on all cell lines, especially on HeLa cells (over 90%). Combination of both recombinant knob proteins inhibited the infection efficiency of AdF3F5 even further on FaDu and SCC25 cells. Preincubation with knob 3 occasionally increased infection efficiency of AdF5, whereas knob 5 could marginally inhibit infection of AdK3 (shown for FaDu in Figure 4b).
To circumvent low infection efficiency which is hampering gene therapy approaches in vivo, we constructed an adenovirus with two different fiber types allowing two different mechanisms of cellular entry. Since adenovirus type 5 is the most commonly used vector for adenoviral gene therapy, we developed an approach to incorporate the additional fiber into the capsid of Ad5. To retain the trimerisation properties of adenoviral fiber molecules, we focused on subgroup B viruses which do not use the CAR receptor for entry. Optimal incorporation of the chimeric additional fiber protein into the capsid of Ad5, is ensured by cloning the Shaft and the Knob of Ad3 (3SK fragment) downstream of the initial coding sequence for the Tail of Ad5 (5T) (Figure 2). To achieve equal expression levels of the chimer fiber compared to the wild type fiber, the chimeric fiber (5T3SK) was cloned under the control of the same promoter as the wild type fiber (the native adenoviral Major Late Promoter). To this end, however, the splicing signals of the wild type fiber 5 sequence also needed to be retained. This has been achieved through subcloning of the Ad3ShaftKnob-Ad5Tail Nde-fragment into another fiber shuttle plasmid (see Materials and Methods). The fibermosaic AdF3F5 viruses could be rescued on 293 cells as efficiently as other first generation adenoviruses (up to 1012 viral particles/ml). Western blot analysis subsequently confirmed the presence of both fiber types onto the CsClpurified virus material. The protein levels, however, were not equal and higher levels of Ad5 fiber were detected compared to Ad3 fiber (Figure 3).
2. Determination of infection efficiency of AdF3F5 on cancer cells. Some cancer types are known to be less susceptible to infection with Ad5 compared to others due to low CAR levels. To test improved infectivity of the fiber-mosaic AdF3F5 on different cancer cell types, cell lines were infected with AdF3F5, AdF5 and AdK3 (Figure 5). Infection with AdF3F5 was as efficient as AdF5 on HeLa and FaDu, while an 2- to 3-fold increase in efficiency was observed for AdF3F5 compared to AdF5 on U373, U118
Figure 3. Western blot detecting adenoviral fiber molecules. Boiled CsCl-purified viruses (1010 viral particles) were separated on SDS-PAGE gel, transferred to PVDF membrane and stained with 2D4 anti-tail antibody. Ad3 virions showed a band for the fiber molecule at 35 kDa, whereas the fiber of Ad5 was detected around 65 kDa. For the fiber-mosaic AdF3F5, two bands were detectable: one strong band at the size of the fiber of Ad5, whereas a weaker band could be detected at the size of Ad3 fibers.
426
Gene Therapy and Molecular Biology Vol 8, page 427
Figure 4. Functional validation of AdF3F5. a) HeLa, FaDu and SCC25 cells were infected with AdF5, AdF3F5 and AdK3 (100 vp/cell) after pre-incubation with recombinant knob 3 (10 µg/ml) and/or knob 5 (2µg/ml). After 2 days, luciferase readings were performed. Data are expressed as percentage of relative light units, 100% being no knob block present. b) to investigate cross-inhibition of the knobs, FaDu cells were infected with AdF5, AdF3F5 and AdK3 (100 vp/cell) after pre-incubation with recombinant knob 3 or knob 5 (10µg/ml).
427
Rots et al: Constructing fiber-mosaic adenoviruses
Figure 5. Absolute and relative infection efficiencies of fiber-mosaic Ad on Ad3 receptor positive cells. Different cell lines were incubated with AdF5, AdF3F5 and AdK3 viruses (100 vp/cell) and after two days infectivity efficiency was measured by determining luciferase activity. Data are represented as mean values of triplicates + SD. To directly compare the different viruses, infectivity on HeLa cells has been set at 100% in Figure 5b.
and on SKOV cells (p!0.01). Since the receptor levels of Ad3 and Ad5 receptors on HeLa cells is similar, the infection of the three viruses on HeLa cells was set at 100% to determine the relative infection efficiency of AdF3F5 compared to AdK3. Although AdF3F5 showed improved infection efficiency over AdF5, infection efficiency of AdF3F5 was not improved compared to AdK3 for any of the cell lines tested.
of type 5 adenoviruses in addition to the wild type Ad5 fiber. We demonstrated that two different fiber proteins can be incorporated into one viral capsid and that such fibermosaic viruses can be efficiently rescued using conventional methods. Although the additional fiber was cloned under the control of the same Major Late Promoter, using the same upstream splicing sequences as the wild type fiber, incorporation of the chimeric fibers onto the capsid was less efficient then for the wild type fiber, as detected by western blot. This might be explained by a packaging bias of one fiber type over the other as previously described for naturally occurring fiber-mosaic adenoviruses (Schoggins et al, 2003). However, in our approach the tail of both fiber types starts with the first amino acids of the tail of wild type Ad5 to avoid inefficient incorporation. The imbalanced incorporation most likely is explained by the low protein expression of fiber observed after infection by Ad3 (Albiges-Rizo et al, 1991). However, we continued with this fiber chimera since the shorter size of the fiber of Ad3 allowed easy biochemical discrimination with the wild type Ad5 fiber. Blocking experiments demonstrated that these fibermosaic viruses exploit two ways of entry. Importantly, infection efficiency was not impaired by incorporation of the additional fiber into the capsid. As both the knob of Ad5 (Belousova et al, 2002) as well as the knob of Ad3 (Uil et al, 2003) can be exploited to introduce targeting moieties, fiber-mosaic viruses represents a powerful platform for constructing efficient, but specific gene therapy agents. Improved gene transfer efficiency by introducing two retargeting moieties onto the viral capsid has previously been obtained by incorporation of both the RGD and a polylysine motif into the fiber (Wu et al, 2002), supporting our hypothesis. Previously, we obtained fiber-mosaic adenoviruses expressing both the fiber of Ad5 and a chimeric fiber consisting of the tail and the shaft of Ad5 fiber and the
IV. Discussion Low infection efficiency is hampering cancer gene therapy from showing its full potential and vectorological improvements are warranted. Moreover, virotherapy (the conditional viral replication resulting in oncolysis) would greatly benefit from infectivity enhanced agents as shown by incorporation of different targeting moieties in fibers of replication competent viruses (Hemminki et al, 2001; Bauerschmitz et al, 2002; Kawakami et al, 2003). These studies, however, again are limited to the expression of one receptor type on tumor cells. In this study, we describe the feasibility to grow fiber-mosaic adenoviral agents targeting two different receptors simultaneously. We showed that infection with this fiber-mosaic virus shows advantage over AdF5 infection. Although no increase in efficiency was observed compared to infection with AdK3 for low CAR cell lines, the technology provides a flexible platform allowing increase of specificity by introduction of two different targeting ligands. Tropism of adenoviruses is determined by the knob of the fiber protein and the penton base. We hypothesized that the introduction of an additional different fiber type provides a way of introducing an additional mechanism of cellular entry of virus, thereby increasing efficiency of infection and/or broadening the infection spectrum. Since Ad3 has been demonstrated to efficiently infect several CAR deficient (primary) tumor types (Stevenson et al, 1995; Kanerva et al, 2002; Volk et al, 2003), we choose the Ad3 fiber molecule to be incorporated into the capsid 428
Gene Therapy and Molecular Biology Vol 8, page 429 knob of Ad3 by co-culture of Ad5 and AdK3. The resulting viruses incorporated both fibers on the same virion as has also been described for co-culture of other serotypes in the early 70s (Norrby and Gollmar, 1971). These AdF5:AdK3 fiber-mosaic viruses demonstrated an expanded infection spectrum (Takayama et al, 2003). Interestingly, the viruses also showed an improved infection efficiency on various cell types tested compared to Ad5, suggesting synergism between knob 5 and knob 3. In this study, we did not observe such profound synergism, probably since the knob of Ad3 is expressed on the short shaft of Ad3; Binding to the receptor of Ad3 through the short shaft might prevent simultaneous binding to the CAR via the long shaft. Any receptor-cross talk resulting in synergism will therefore be prevented. Although co-infection results in fiber-mosaic viruses, the production is laborious and most likely not very reproducible. The approach to genetically construct a fiber-mosaic virus expressing two different fibers is therefore preferred. Naturally occurring human fibermosaic adenoviruses have been identified and belong to subgroup F enteric viruses. These viruses (serotype 40 and 41) contain two separate genes encoding a short fiber of 200A (41 kDa) and a long fiber of 340A (61 kDa) (Kidd et al, 1993; Favier et al, 2002). These viruses therefore are very similar to the one described here as the fiber of Ad3 is 160A and the fiber of Ad5 is 370A. The long fiber of Ad40 and Ad41 binds to the CAR receptor whereas binding of the short fiber is CAR-independent (Roelvink et al, 1998). The concept of tandem fiber genes to construct fiber-mosaic viruses had previously been shown feasible (Schoggins et al, 2003; Pereboeva et al, 2004). In an elegant approach, Perebouva et al, introduced the option of binding targeting ligands to the second fiber type through a biotin-acceptor peptide (Pereboeva et al, 2004). Schoggins et al, reported on the construction of a fibermosaic adenovirus type 5 co-expressing the fiber of Ad7 either with the fiber of Ad5 or with the short fiber of Ad41. Like AdF3F5, the fiber-mosaic F7F5 virus showed similar infection efficiencies compared to Ad5 (Schoggins et al, 2003). The infectivity of the Ad5 based fiber-mosaic adenovirus expressing the fiber of Ad7 and the short fiber of Ad41 virus was dramatically impaired in vitro. Also in vivo, a 2-log lower transduction of the liver was observed. Similarly, a 10-fold reduction in liver transduction has been reported for an Ad5 based adenovirus expressing the shaft and the knob of Ad3 on its capsid (Vigne et al, 2003). In this respect, fiber-mosaic viruses based on Ad5 show promise as a platform for engineering efficient gene therapy agents with a liver-off profile. In conclusion, we demonstrated that viruses expressing two different fiber types can be constructed and efficiently rescued. Both fiber types are functional in infecting cells, which opens the way for infecting a broader spectrum of tumors. The next step is to increase the specificity of this potent vector by introducing targeting moieties and/or tumor specific promoters to selectively express a trangene or to restrict viral replication.
Acknowledgments We want to thank Dr Falck-Pederson from the Department of Microbiology, Weill Medical College of Cornell University, New York, USA for providing us with pAd70-100dlE3. The study was supported by NIH grant #5 P50 CA89019 (Breast Cancer SPORE) and NIH grant #1 R01 CA94084 (Pancreatic Cancer).
References Alemany R and Curiel DT (2001) CAR-binding ablation does not change biodistribution and toxicity of adenoviral vectors. Gene Ther 8, 1347-1353. Bauerschmitz GJ, Lam JT, Kanerva A, Suzuki K, Nettelbeck DM, Dmitriev I, Krasnykh V, Mikheeva GV, Barnes MN, Alvarez RD, Dall P, Alemany R, Curiel DT and Hemminki A (2002) Treatment of ovarian cancer with a tropism modified oncolytic adenovirus. Cancer Res 62, 1266-1270. Belousova N, Krendelchtchikova V, Curiel DT and Krasnykh V (2002) Modulation of adenovirus vector tropism via incorporation of polypeptide ligands into the fiber protein. J Virol 76, 8621-8631. Chillon M, Bosch A, Zabner J, Law L, Armentano D, Welsh MJ and Davidson BL (1999) Group D adenoviruses infect primary central nervous system cells more efficiently than those from group C. J Virol 73, 2537-40. Cuzange A, Chroboczek J and Jacrot B (1994) The penton base of human adenovirus type 3 has the RGD motif. Gene 146, 257-259. Dmitriev I, Krasnykh V, Miller CR, Wang W, Kashentseva E, Mikheeva G, Belousova N and Curiel DT (1998) An adenovirus vector with genetically modified fibers demonstrates expanded tropism via utilization of a coxsackievirus and adenovirus receptor-independent cell entry mechanism. J Virol 72, 9706-9713. Douglas JT, Kim M, Sumerel LA, Carey DE and Curiel DT (2001) Efficient oncolysis by a replicating adenovirus (ad) in vivo is critically dependent on tumor expression of primary ad receptors. Cancer Res 61, 813-817. Favier AL, Schoehn G, Jaquinod M, Harsi C and Chroboczek J (2002) Structural studies of human enteric adenovirus type 41. Virology 293, 75-85. Gaggar A, Shayakhmetov DM and Lieber A (2003) CD46 is a cellular receptor for group B adenoviruses. Nat Med 9, 1408-1412. Gall J, Kass-Eisler A, Leinwand L and Falck-Pedersen E (1996) Adenovirus type 5 and 7 capsid chimera, fiber replacement alters receptor tropism without affecting primary immune neutralization epitopes. J Virol 70, 2116-2123. Glasgow JN, Bauerschmitz GJ, Curiel DT, Hemminki A (2004) Transductional and transcriptional targeting of adenovirus for clinical applications Curr Gene Ther 4,1-14. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW and Vogelstein B (1998) A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA 95, 2509-2514. Hemminki A, Dmitriev I, Liu B, Desmond RA, Alemany R and Curiel DT (2001) Targeting oncolytic adenoviral agents to the epidermal growth factor pathway with a secretory fusion molecule. Cancer Res 61, 6377-6381. Hong JS and Engler JA (1991) The amino terminus of the adenovirus fiber protein encodes the nuclear localization signal. Virology 185, 758-767. Kanerva A, Mikheeva GV, Krasnykh V, Coolidge CJ, Lam JT, Mahasreshti PJ, Barker SD, Straughn M, Barnes MN, Alvarez RD, Hemminki A and Curiel DT (2002) Targeting adenovirus to the serotype 3 receptor increases gene transfer
429
Rots et al: Constructing fiber-mosaic adenoviruses efficiency to ovarian cancer cells. Clin Cancer Res 8, 275280. Kawakami Y, Li H, Lam JT, Krasnykh V, Curiel DT and Blackwell JL (2003) Substitution of the adenovirus serotype 5 knob with a serotype 3 knob enhances multiple steps in virus replication. Cancer Res 63, 1262-1269. Kidd AH, Chroboczek J, Cusack S and Ruigrok RW (1993) Adenovirus type 40 virions contain two distinct fibers. Virology 192, 73-84. Krasnykh VN, Mikheeva GV, Douglas JT and Curiel DT (1996) Generation of recombinant adenovirus vectors with modified fibers for altering viral tropism. J Virol 70, 6839-6846. Krasnykh V, Belousova N, Korokhov N, Mikheeva G and Curiel DT (2001) Genetic targeting of an adenovirus vector via replacement of the fiber protein with the phage T4 fibritin. J Virol 75, 4176-4183. Marshall E (2001) Gene therapy. Viral vectors still pack surprises. Science 294, 1640. Nicklin SA and Baker AH (2002) Tropism-modified adenoviral and adeno-associated viral vectors for gene therapy. Curr Gene Ther 2, 273-293. Norrby E and Gollmar Y (1971) Mosaics of Capsid Components Produced by Cocultivation of Certain Human Adenoviruses in Vitro. Virology 44, 383-395. Pereboeva L, Komarova S, Mahasreshti PJ and Curiel DT (2004) Fiber-Mosaic Adenovirus as a novel approach to design genetically modified adenoviral vectors. Vir Res 105, 35-46. Roelvink PW, Lizonova A, Lee JG, Li Y, Bergelson JM, Finberg RW, Brough DE, Kovesdi I and Wickham TJ (1998) The coxsackievirus-adenovirus receptor protein can function as a cellular attachment protein for adenovirus serotypes from subgroups A, C, D, E and F. J Virol 72, 7909-7915. Rots MG, Curiel DT, Gerritsen WR and Haisma HJ (2003) Targeted cancer gene therapy, the flexibility of adenoviral gene therapy vectors. J Control Release 87, 159-165. Schoggins JW, Gall JG and Falck-Pedersen E (2003) Subgroup B and F fiber chimeras eliminate normal adenovirus type 5 vector transduction in vitro and in vivo. J Virol 77, 10391048. Seki T, Dmitriev I, Kashentseva E, Takayama K, Rots M, Suzuki K and Curiel DT (2002) Artificial extension of the adenovirus fiber shaft inhibits infectivity in coxsackievirus
and adenovirus receptor-positive cell lines. J Virol 76, 11001108. Shayakhmetov DM, Papayannopoulou T, Stamatoyannopoulos G and Lieber A (2000) Efficient gene transfer into human CD34(+) cells by a retargeted adenovirus vector. J Virol 74, 2567-2583. Stevenson SC, Rollence M, White B, Weaver L and McClelland A (1995) Human adenovirus serotypes 3 and 5 bind to two different cellular receptors via the fiber head domain. J Virol 69, 2850-2857. Stevenson SC, Rollence M, Marshall-Neff J and McClelland A (1997) Selective targeting of human cells by a chimeric adenovirus vector containing a modified fiber protein. J Virol 71, 4782-4790. Takayama K, Reynolds PN, Short JJ, Kawakami Y, Adachi Y, Glasgow JN, Rots MG, Krasnykh V, Douglas JT and Curiel DT (2003) A mosaic adenovirus possessing serotype Ad5 and serotype Ad3 knobs exhibits expanded tropism. Virology 309, 282-293. Uil TG, Seki T, Dmitriev I, Kashentseva E, Douglas JT, Rots MG, Middeldorp JM and Curiel DT (2003) Generation of an adenoviral vector containing an addition of a heterologous ligand to the serotype 3 fiber knob. Cancer Gene Ther 10, 121-124. Vigne E, Dedieu JF, Brie A, Gillardeaux A, Briot D, Benihoud K, Latta-Mahieu M, Saulnier P, Perricaudet M, Yeh P (2003) Genetic manipulations of adenovirus type 5 fiber resulting in liver tropism attenuation. Gene Ther 10, 153-162. Volk AL, Rivera AA, Kanerva A, Bauerschmitz G, Dmitriev I, Nettelbeck DM and Curiel DT (2003) Enhanced adenovirus infection of melanoma cells by fiber-modification, incorporation of RGD peptide or Ad5/3 chimerism. Cancer Biol Ther 2, 511-515. Wu H, Dmitriev I, Kashentseva E, Seki T, Wang M and Curiel DT (2002) Construction and characterization of adenovirus serotype 5 packaged by serotype 3 hexon. J Virol 76, 1277512782.
Group picture of the Department of Therapeutic Gene Modulation. Dr. Marianne G. Rots is the third person shown in the first row from right to left.
430
Gene Therapy and Molecular Biology Vol 8, page 431 Gene Ther Mol Biol Vol 8, 431-438, 2004
Internal ribosome entry sites in cancer gene therapy Review Article
Benedict J Yan1 and Caroline GL Lee1,2,* 1
Department of Biochemistry, National University of Singapore, Singapore Division of Medical Sciences, National Cancer Center, Singapore
2
__________________________________________________________________________________ *Correspondence: Caroline G. Lee, Ph.D., Division of Medical Sciences, National Cancer Center, Level 6, Lab 5, 11 Hospital Drive, Singapore 169610; Tel: 65-6436-8353; Fax: 65-6224-1778; Email: bchleec@nus.edu.sg Key words: cancer gene therapy, Tumor-directed therapy, Host-directed therapy, Internal ribosome, Abbreviations: 5â&#x20AC;&#x2122; untranslated region, (5â&#x20AC;&#x2122;UTR); cationic amino acid transporter, (Cat-1); dihydrofolate reductase, (DHFR); hypoxiainducible factor-1!, (HIF-1!); internal ribosome entry site, (IRES); methylguanine methyltransferase, (MGMT); multidrug-resistance 1 gene, (MDR1); open reading frames, (ORF); vascular endothelial growth factor, (VEGF) Received: 14 October 2004; Accepted: 21 October 2004; electronically published: October 2004
Summary Cancer gene therapy is a promising treatment modality. Strategies in cancer gene therapy include tumor-directed therapy (e.g. the delivery of suicide, immunomodulatory, anti-angiogenic, apoptotic genes or oncolytic viruses or genes to reinstate tumor suppressor activity) and host-directed therapy (e.g. the delivery of genes encoding factors that enhance the antigen presenting function of dendritic cells or protect the patient against myelosuppression). As cancer, a complex disorder, often results from several defective genes, efficacy of cancer gene therapy can be improved by a combination approach whereby several different genes are targeted simultaneously. Of several methods to effect co-expression of multiple genes, the employment of internal ribosome entry sites (IRES) represents a promising approach. This review examines the various preclinical and clinical studies employing IRESs for cancer gene therapy, as well as properties of various IRESs that could be exploited for cancer gene therapy.
efficacy have not been impressive (Zeimet and Marth, 2003; McNeish et al, 2004). One conceivable reason could be that modifying the expression of a single gene alone is insufficient to prohibit cancer growth because of numerous diverse pathways that still permit cancer progression. This, in theory, could be countered by the delivery of multiple genes that act on different pathways, such that a complementary or synergistic effect is obtained. Other major themes in tumor-directed therapy include the delivery of suicide, immunomodulatory, antiangiogenic, apoptotic genes and oncolytic viruses. Suicide genes encode enzymes that convert prodrugs to their cytotoxic form, and the herpes simplex virus thymidine kinase, which converts ganciclovir to ganciclovir phosphate, falls under this category. The immunomodulatory genes employed often code for cytokines, an example being interleukin 2, and these serve to mobilize the immune system to effect tumor cell killing. Strategies involving suicide and immunomodulatory genes are a popular combination in cancer gene therapy (Pizzato et al, 1998; Soler et al, 1999; Wen et al, 2001; Barzon et al, 2002).
I. Introduction Efforts to combat cancer with gene therapy have been underway for more than a decade (Gottesman, 2003), with several clinical trials having been conducted with varying success (Schuler et al, 2001; Buller et al, 2002; Kuball et al, 2002; Pagliaro et al, 2003). Because cancer pathogenesis stems in part from genetic mutations, gene therapy is, in concept, a viable approach to cancer treatment. Gene therapy is also of considerable utility on several fronts not directly pertaining to tumor-specific therapy, for example the delivery of drug resistance genes to mitigate myelotoxicity of chemotherapeutic agents.
II. Strategies in cancer gene therapy A. Tumor-directed therapy Fundamental tenets in cancer biology are that deregulated growth is due to a combination of the activation of oncogenes and inhibition of tumor suppressor genes, both of which present as obvious targets for cancer gene therapy. To date, most of the clinical trials have centered on reinstating tumor suppressor activity, in particular p53. However, the results concerning clinical 431
Yan and Lee: Internal ribosome entry sites in cancer gene therapy Tumor cells actively induce the formation of new blood vessels, and a recent paradigm in oncology is the use of agents to impede this process, with a number of ongoing clinical trials evaluating the effectiveness of such agents. Gene therapy has been proposed to have several advantages over protein-based inhibitors, including the sustained expression of antiangiogenic molecules and the ability to deliver multiple transgenes (Kleinman and Liau, 2001). The induction of apoptosis in cancer cells is another strategy, and studies involving the delivery of genes coding for pro-apoptotic factors, such as TRAIL, Bax and Smac/Diablo, have been conducted (Waxman and Schwartz, 2003). With an increasing recognition that most anticancer treatment modalities such as chemotherapy or radiotherapy trigger apoptosis of cancer cells, gene therapy may also prove useful in sensitizing the cells to the effects of conventional agents. Oncolytic viruses selectively replicate in and kill tumor cells, and this specificity has contributed to their favorable safety profile. However, clinical trials have
demonstrated an over-attenuation of these agents to the extent that efficacy has been compromised. Hence there has been a move to arm them with therapeutic genes to improve their tumor-killing capabilities (Hermiston and Kuhn, 2002).
B. Host-directed therapy Myelosuppression is an extremely frequent complication of treatment utilizing conventional chemotherapeutic agents, and this at times may prove fatal. Hence a leading paradigm in cancer gene therapy is the delivery of genes to protect susceptible haemopoietic cells from the effects of these cytotoxic agents. Commonly employed drug-resistance genes include the multidrugresistance 1 gene (MDR1), dihydrofolate reductase (DHFR) gene and methylguanine methyltransferase (MGMT) gene (Sorrentino, 2002).
Figure 1. Strategies in Cancer Gene Therapy to date utilizing IRESs
432
Gene Therapy and Molecular Biology Vol 8, page 433 Tumor vaccines are another promising modality (Berzofsky et al, 2004), and there are a variety of methods to induce tumor immunity. Naked DNA expression plasmids encoding tumor antigens have been shown to generate immune responses. Another approach is to deliver genes coding factors that enhance the antigen presenting function of dendritic cells.
III. Multiple gene attendant problems
delivery
such that a corresponding number of proteins are generated from a single mRNA transcript.
V. Application of IRESs in cancer gene therapy IRESs have been employed in a number of preclinical and clinical studies with some success, and selected ones, that span the gamut of cancer gene therapy, are displayed in Table 1.
and
VI. Choice of IRES?
As noted above, the ability to co-express multiple genes would be of immense value in cancer gene therapy because complementary or synergistic effects could lead to improved efficacy. Viruses are popular vectors for gene delivery because of their higher transduction efficiency, but this advantage is offset by the constraints placed on the vector size. Because most therapeutic genes are quite large, a polycistronic vector must be designed in such fashion that the system of effecting multigene delivery is modest in scale. There are several methods available to effect multiple gene expression. One could be the incorporation of multiple promoters such that different proteins are produced from separate mRNAs. A major drawback of this approach is the possibility of promoter suppression (Emerman and Temin, 1984), a phenomenon whereby expression of any gene may be attenuated for ill-defined reasons. Other methods including splicing, fusion proteins and proteolytic processing have been reviewed by de Felipe (2002).
Most of the studies detailed in Table 1 employ the EMCV IRES, but a number of studies have reported that other IRESs may possess greater activity than the EMCV IRES, for example the eIF4G IRES (Wong et al, 2002). IRESs display a huge variation in their activity in various contexts, and given the burgeoning number of IRESs, it might be possible to tailor an IRES for a particular purpose, for example in the treatment of a certain type of cancer. However, current data is too sparse to allow a meaningful decision making process as to the best IRES for a given tumor type. Some factors governing the choice of IRES are discussed, and Table 2 displays known properties of IRESs that might be useful in developing an effective polycistronic vector.
A. Tissue/Cell type specificity IRESs have not been shown to display a narrow tissue/cell type specificity, and therefore cannot be employed in situations where this property is requisite for expression of the 3’ cistron, in contrast to tumor-specific promoters.
IV. Internal ribosome entry sites In eukaryotes, initiation of translation of most mRNAs begins by a cap-dependent mechanism whereby a 43S complex (comprising a 40S subunit, the initiator methionine-tRNA and other initiation factors) is recruited to the 5’ methylguanosine cap. Recognition of the 5’ end is mediated through the cap-binding protein complex eIF4F, which comprises three subunits eIF4E, eIF4A and eIF4G subunits. The 43S complex then scans in a 5’ to 3’ direction until an initiation codon is encountered, following which the initiation factors dissociate and a larger 60S ribosomal subunit binds to form the 80S ribosome. Protein synthesis then commences. IRESs are RNA structures capable of initiating ribosome binding and translation in the absence of a 5’ cap. Most commonly found in the 5’ untranslated region (5’UTR) of mRNAs, they were first documented in poliovirus and other viral RNA sequences (Pelletier and Sonenberg, 1988), but were subsequently shown to exist in cellular mRNAs as well. To date there have been more than 50 reported viral and cellular IRESs in total, and the list is steadily expanding. The subject of IRESs has been extensively reviewed, both in the academic (Hellen and Sarnow, 2001; Stoneley and Willis, 2004) and applied (Ngoi et al, 2004) setting. In utilizing this system for multiple gene coexpression, an internal ribosome entry site (IRES) is placed between two or more open reading frames (ORF),
B. Tissue/Cell type activity Unfortunately not much is know about the tissue / cell type specificity of the different IRESs. Most IRES studies have investigated the activity of a particular IRES in different cell types, but the most valuable information pertaining to gene therapy application can only be gleaned from studies that have compared the activity of different IRESs in a particular tumor type. Nevertheless, known properties of some IRESs are detailed in Table 2.
C. Milieu-dependent activity Certain stressful conditions are known to suppress cap-dependent translation, for example hypoxia, starvation or apoptosis, leading to a general decrease in protein synthesis. In this regard, IRESs possess a theoretical advantage over other modalities such as promoters, because some IRESs continue to operate under such conditions - conditions that are typically experienced by tumor cells. For example, the vascular endothelial growth factor (VEGF) IRES (Stein et al, 1998) and hypoxiainducible factor-1! (HIF-1!) IRES (Lang et al, 2002) maintain activity during hypoxia; and the cationic amino acid transporter (Cat-1) IRES (Fernandez et al, 2001) exhibits increased activity during amino acid starvation. Where an IRES, such as the BCL-2 IRES (Sherrill et al, 2004), displays increased activity following cytotoxic drug
433
Yan and Lee: Internal ribosome entry sites in cancer gene therapy Table 1. Preclinical and Clinical Studies to date utilizing IRESs Year published
Strategy/Aim of Study
IRES employe d
Arming an oncolytic virus with a suicide gene
EMCV
Suicide gene delivery
EMCV
Preclinical Studies (Tumor-directed therapy) Therapeutic/market/re Vector porter genes encoded
yCD
1. P450 2. NADPH-cytochrome P450 reductase
Human adenovirus 5
Replicationdefective adenovirus
2004
1. SW480
Colon cancer
2. HCT116
Colon cancer
3.HT29
Colon cancer
1. A549 2. EKVX 3. HT29 4. IGROV1
Lung cancer Lung cancer Colon cancer Ovarian cancer Breast cancer Breast cancer Lung cancer
5. MDAMB-231 6. MDAMB-435 7. NCIH226 8. NCIH522 9. PC-3 10. RXF393 11. T47-D 12. U251
Fusion of reporter gene to various oncolytic viral genes
EMCV
Luciferase reporter gene
Antiangiogenes is
EMCV
1. Angiostatin 2. Endostatin 3. GFP
Conditionally replicative adenovirus
13. 786-0 1. A549
1. 293
Charecterizatio n of activity of different IRESs in varying contexts using reporter assays
1. EMCV 2. BIP 3. eIF4G 4. MYC 5. VEGF
Recombinant adenovirusassociated virus
2. SKOV3.ipl 1. KB-3-1
1. CAT 2. GAL
Plasmid
2. 293 3. HepG2 4. N2a 1. WRO 2. FTC-133
Suicide and immunomodula ting gene delivery
EMCV
1. HSV-tk 2. IL-2
Retrovirus 3. C8305 4. ARO 5. HeLa
2002
6. AoU373 7. HepG2 1. Cwr22Rv1 2. Dul45 Induction of apoptosis
EMCV
1. TRAIL 2. GFP
Adenovirus
3. DuPro 4. JCA-1 5. LNCaP 6. PC-3
434
Cell Lines
References
Human
(Fuerer and Iggo, 2004)
Human
(Jounaidi and Waxman, 2004)
Human
(Rivera et al, 2004)
Lung cancer Prostate cancer Renal cancer Breast cancer Glioblastoma multiforme Renal cancer Lung cancer
Embryonic kidney Ovarian cancer Cervical cancer Embryonic kidney Liver cancer Neuroblasto ma Thyroid cancer Thyroid cancer Thyroid cancer Thyroid cancer Cervical cancer Astrocytoma Liver cancer Prostate cancer Prostate cancer Prostate cancer Prostate cancer Prostate cancer Prostate cancer
Human
Human
(Ponnazhaga n et al, 2004)
(Wong et al, 2002)
Mouse
Human
(Barzon et al, 2002)
Human (VoelkelJohnson et al, 2002)
Gene Therapy and Molecular Biology Vol 8, page 435 7. PPC-1 8. TsuPr1 9. PrEC
2001
1999 1998
2001 1999
Year published 1999
Immunotherapy
1. EMCV 2. FMDV
Tumor cell vaccine Suicide and immunomodula ting gene delivery
EMCV
Myeloprotecti on Myeloprotecti on and cellsurface marking Strategy/Aim of Study Suicide and immunomodul ating gene delivery
EMCV
EMCV
1. IL-12p40 2.IL-12p35 3. CD80
1. Retrovirus 2. Adenovirus
1. HSV-tk 2. IL-4 3. Neomycin 4. phosphotransferase 1. IL-2
1. U266 2. OCIMy5 3. ANBL-6 4. K562 5. Namalwa
Human
(Wen et al, 2001)
Myeloma Leukemia Myeloma
1. 9L
Gliosarcoma
Rat
(Okada et al, 1999)
1. Al72
Glioblastoma
Human
2. AoU373
Astrocytoma
Human
Retrovirus Retrovirus
2. HSV-tk
Preclinical Studies (Host-directed therapy) 1. ALDH-1 Retrovirus 1. NIH3T3 Fibroblast 2. Primary CD34+ cells 1. MDR1 Retrovirus 1. K562 Leukemia 2. "LNGFR 2. Primary CD34+ cells
EMCV
IRES employed EMCV
Prostate cancer Prostate cancer Primary prostate epithelial cells Myeloma Myeloma
Therapeutic/market/re porter genes encoded 1. IL-2
Mouse Human Human
(Pizzato et al, 1998)
(Takebe et al, 2001) (Hildinger et al, 1999)
Vector
Tumor type
References
Retrovirus
Glioblastoma mulriforme
(Palu et al, 1999)
2. HSV-tk
ALDH-1 (aldehyde dehydrogenase), CAT (chioramphenicol acetyltransferase), F/S DHFR (doubly mutated dihydrofolate reductase), GAL (beta-galactosidase), GFP (green fluorescent protein), HSV-TK (herpes simplex virus thymidine kinase), IL2 (interleukin 2), IL 12 (interleukin 12), "LNGFR (truncated human low-affinity nerve growth factor receptor), yCD (yeast cytosine deaminase)
Table 2. Known properties of some IRESs IRES BCL-2
Cat-1
Connexin43 DAP5
eIF4G Gtx
HIF- 1! N-myc
VEGF
Properties Reported to exhibit 3.4-fold greater activity following 8h treatment with 80ÂľM etoposide compared to untreated cells. Reported to exhibit 7-fold greater activity following 12h amino acid starvation compared to fed cells. Activity compared to the EMCV TRES unknown Reported to exhibit 18-fold greater activity than the EMCV IRES. Reported to exhibit at least 2-fold greater activity than the EMCV IRES following 48h etoposide treatment. Reported to exhibit at least 200-fold greater activity than the EMCV IRES 9-nucleotides in length. 10 linked copies reported to exhibit 63-fold greater activity than the EMCV IRES. Activity maintained during hypoxia. Activity compared to the EMCV IRES unknown. Reported to exhibit 5-7 fold greater activity than the c-myc IRES. 3-fold greater activity compared to the EMCV IRES. Activity maintained during hypoxia. Activity compared to the EMCV IRES during hypoxia unknown.
1. 293T
Cell lines Embryonic kidney
Human
References (Sherrill et al, 2004)
1. C6
Glioma
Rat
(Fernandez et al, 2001)
1. HeLa
Cervical cancer
Human
(Schiavi et al, 1999)
1. 293T
Embryonic kidney
Human
(Nevins et al, 2003)
1. KB-3- 1
Cervical cancer
Human
(Wong et al, 2002)
2. HepG2
Liver cancer
Human
1. N2a
Neuroblastoma
Mouse
(Chappell et al, 2000)
1. NIH3T3
Fibroblast
Mouse
(Lang et al, 2002)
1. NB2a
Neuroblastoma
Mouse
2. SH-SY5Y 3. HeLa
Neuroblastoma Cervical cancer
Human Human
(Jopling and Willis, 2001)
1. C6
Glioma
Rat
(Stein et al, 1998)
435
Yan and Lee: Internal ribosome entry sites in cancer gene therapy Chappell SA, Edelman GM, Mauro VP (2000) A 9-nt segment of a cellular mRNA can function as an internal ribosome entry site (IRES) and when present in linked multiple copies greatly enhances IRES activity. Proc Natl Acad Sci U S A 97, 1536-1541. de Felipe P (2002) Polycistronic viral vectors. Curr Gene Ther 2, 355-378. Emerman M, Temin HM (1984) Genes with promoters in retrovirus vectors can be independently suppressed by an epigenetic mechanism. Cell 39, 449-467. Fernandez J, Yaman I, Mishra R, Merrick WC, Snider MD, Lamers WH, Hatzoglou M (2001) Internal ribosome entry site-mediated translation of a mammalian mRNA is regulated by amino acid availability. J Biol Chem 276, 12285-12291. Fuerer C, Iggo R (2004) 5-Fluorocytosine increases the toxicity of Wnt-targeting replicating adenoviruses that express cytosine deaminase as a late gene. Gene Ther 11, 142-151. Gottesman MM (2003) Cancer gene therapy: an awkward adolescence. Cancer Gene Ther 10, 501-508. Hellen CU, Sarnow P (2001) Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev 15, 1593-1612. Hennecke M, Kwissa M, Metzger K, Oumard A, Kroger A, Schirmbeck R, Reimann J, Hauser H (2001) Composition and arrangement of genes define the strength of IRES-driven translation in bicistronic mRNAs. Nucleic Acids Res 29, 3327-3334. Hermiston TW, Kuhn I (2002) Armed therapeutic viruses: strategies and challenges to arming oncolytic viruses with therapeutic genes. Cancer Gene Ther 9, 1022-1035. Hildinger M, Schilz A, Eckert HG, Bohn W, Fehse B, Zander A, Ostertag W, Baum C (1999) Bicistronic retroviral vectors for combining myeloprotection with cell-surface marking. Gene Ther 6, 1222-1230. Jopling CL, Willis AE (2001) N-myc translation is initiated via an internal ribosome entry segment that displays enhanced activity in neuronal cells. Oncogene 20, 2664-2670. Jounaidi Y, Waxman DJ (2004) Use of replication-conditional adenovirus as a helper system to enhance delivery of P450 prodrug-activation genes for cancer therapy. Cancer Res 64, 292-303. Kleinman HK, Liau G (2001) Gene therapy for antiangiogenesis. J Natl Cancer Inst 93, 965-967. Kuball J, Wen SF, Leissner J, Atkins D, Meinhardt P, Quijano E, Engler H, Hutchins B, Maneval DC, Grace MJ, Fritz MA, Storkel S, Thuroff JW, Huber C, Schuler M (2002) Successful adenovirus-mediated wild-type p53 gene transfer in patients with bladder cancer by intravesical vector instillation. J Clin Oncol 20, 957-965. Lang KJ, Kappel A, Goodall GJ (2002) Hypoxia-inducible factor-1! mRNA contains an internal ribosome entry site that allows efficient translation during normoxia and hypoxia. Mol Biol Cell 13, 1792-1801. McNeish IA, Bell SJ, Lemoine NR (2004) Gene therapy progress and prospects: cancer gene therapy using tumour suppressor genes. Gene Ther 11, 497-503. Mizuguchi H, Xu Z, Ishii-Watabe A, Uchida E, Hayakawa T (2000) IRES-dependent second gene expression is significantly lower than cap-dependent first gene expression in a bicistronic vector. Mol Ther 1, 376-382. Nevins TA, Harder ZM, Korneluk RG, Holcik M (2003) Distinct regulation of internal ribosome entry site-mediated translation following cellular stress is mediated by apoptotic fragments of eIF4G translation initiation factor family members eIF4GI and p97/DAP5/NAT1. J Biol Chem 278, 3572-3579. Ngoi SM, Chien AC, Lee CG (2004) Exploiting internal ribosome entry sites in gene therapy vector design. Curr Gene Ther 4, 15-31.
administration, the design of therapeutic regimes to exploit this property, for example to augment cytotoxicity, is conceivable.
D. Size Most IRESs tend to be relatively large, and this may limit the number of transgenes that can be incorporated into a polycistronic vector. A 9-nucleotide long IRES residing in the 5â&#x20AC;&#x2122;UTR of the Gtx homeodomain RNA has been reported (Chappell et al, 2000), and appears to function in a modular fashion, such that multiple linked copies increase the expression of the downstream cistron. Besides the advantages of its small size, it also allows for regulated expression of the downstream cistron by varying the number of intercistronic modules.
VII. Current problems with IRESs in gene therapy A traditional problem concerning the use of IRESs is that expression levels of the gene downstream of the IRES is often significantly lower than that of the upstream gene, typically around 20-50% (Mizuguchi et al, 2000) in bicistronic plasmid vectors in relation to the upstream gene, and even lower in retroviral vectors (de Felipe, 2002). Another major stumbling block is the inconsistency of gene expression depending on the composition and arrangement of genes in the vector (Hennecke et al, 2001).
VIII. Future directions The vast majority of cancers result from defects in multiple pathways, and hence an effective gene therapeutic approach will probably have to be multipronged, requiring delivery of different transgenes that target the different pathways. The studies detailed in Table 1 have demonstrated proof of concept for employing IRESs to effect the co-expression of multiple genes in diverse fields of cancer gene therapy. As noted above more information concerning the activity of various IRESs in a tissue/cell-type, both in vivo and in vitro, is required to facilitate decision-making in the choice of IRES. It is envisaged that the incorporation of IRESs with desirable properties will result in polycistronic vectors with improved downstream gene expression, and consequently result in enhanced clinical efficacy.
References Barzon L, Bonaguro R, Castagliuolo I, Chilosi M, Gnatta E, Parolin C, Boscaro M, Palu G (2002) Transcriptionally targeted retroviral vector for combined suicide and immunomodulating gene therapy of thyroid cancer. J Clin Endocrinol Metab 87, 5304-5311. Berzofsky JA, Terabe M, Oh S, Belyakov IM, Ahlers JD, Janik JE, Morris JC (2004) Progress on new vaccine strategies for the immunotherapy and prevention of cancer. J Clin Invest 113, 1515-1525. Buller RE, Runnebaum IB, Karlan BY, Horowitz JA, Shahin M, Buekers T, Petrauskas S, Kreienberg R, Slamon D, Pegram M (2002) A phase I/II trial of rAd/p53 (SCH 58500) gene replacement in recurrent ovarian cancer. Cancer Gene Ther 9, 553-566.
436
Gene Therapy and Molecular Biology Vol 8, page 437 Okada H, Giezeman-Smits KM, Tahara H, Attanucci J, Fellows WK, Lotze MT, Chambers WH, Bozik ME (1999) Effective cytokine gene therapy against an intracranial glioma using a retrovirally transduced IL-4 plus HSVtk tumor vaccine. Gene Ther 6, 219-226. Pagliaro LC, Keyhani A, Williams D, Woods D, Liu B, Perrotte P, Slaton JW, Merritt JA, Grossman HB, Dinney CP (2003) Repeated intravesical instillations of an adenoviral vector in patients with locally advanced bladder cancer: a phase I study of p53 gene therapy. J Clin Oncol 21, 2247-2253. Palu G, Cavaggioni A, Calvi P, Franchin E, Pizzato M, Boschetto R, Parolin C, Chilosi M, Ferrini S, Zanusso A, Colombo F (1999) Gene therapy of glioblastoma multiforme via combined expression of suicide and cytokine genes: a pilot study in humans. Gene Ther 6, 330-337. Pelletier J, Sonenberg N (1988) Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature 334, 320-325. Pizzato M, Franchin E, Calvi P, Boschetto R, Colombo M, Ferrini S, Palu G (1998) Production and characterization of a bicistronic Moloney-based retroviral vector expressing human interleukin 2 and herpes simplex virus thymidine kinase for gene therapy of cancer. Gene Ther 5, 1003-1007. Ponnazhagan S, Mahendra G, Kumar S, Shaw DR, Stockard CR, Grizzle WE, Meleth S (2004) Adeno-associated virus 2mediated antiangiogenic cancer gene therapy: long-term efficacy of a vector encoding angiostatin and endostatin over vectors encoding a single factor. Cancer Res 64, 1781-1787. Rivera AA, Wang M, Suzuki K, Uil TG, Krasnykh V, Curiel DT, Nettelbeck DM (2004) Mode of transgene expression after fusion to early or late viral genes of a conditionally replicating adenovirus via an optimized internal ribosome entry site in vitro and in vivo. Virology 320, 121-134. Schiavi A, Hudder A, Werner R (1999) Connexin43 mRNA contains a functional internal ribosome entry site. FEBS Lett 464, 118-122. Schuler M, Herrmann R, De Greve JL, Stewart AK, Gatzemeier U, Stewart DJ, Laufman L, Gralla R, Kuball J, Buhl R, Heussel CP, Kommoss F, Perruchoud AP, Shepherd FA, Fritz MA, Horowitz JA, Huber C, Rochlitz C (2001) Adenovirus-mediated wild-type p53 gene transfer in patients receiving chemotherapy for advanced non-small-cell lung cancer: results of a multicenter phase II study. J Clin Oncol 19, 1750-1758.
Sherrill KW, Byrd MP, Van Eden ME, Lloyd RE (2004) BCL-2 translation is mediated via internal ribosome entry during cell stress. J Biol Chem. 279, 29066-29074. Soler MN, Milhaud G, Lekmine F, Treilhou-Lahille F, Klatzmann D, Lausson S (1999) Treatment of medullary thyroid carcinoma by combined expression of suicide and interleukin-2 genes. Cancer Immunol Immunother 48, 9199. Sorrentino BP (2002) Gene therapy to protect haematopoietic cells from cytotoxic cancer drugs. Nat Rev Cancer 2, 431441. Stein I, Itin A, Einat P, Skaliter R, Grossman Z, Keshet E (1998) Translation of vascular endothelial growth factor mRNA by internal ribosome entry: implications for translation under hypoxia. Mol Cell Biol 18, 3112-3119. Stoneley M, Willis AE (2004) Cellular internal ribosome entry segments: structures, trans-acting factors and regulation of gene expression. Oncogene 23, 3200-3207. Takebe N, Zhao SC, Adhikari D, Mineishi S, Sadelain M, Hilton J, Colvin M, Banerjee D, Bertino JR (2001) Generation of dual resistance to 4-hydroperoxycyclophosphamide and methotrexate by retroviral transfer of the human aldehyde dehydrogenase class 1 gene and a mutated dihydrofolate reductase gene. Mol Ther 3, 88-96. Voelkel-Johnson C, King DL, Norris JS (2002) Resistance of prostate cancer cells to soluble TNF-related apoptosisinducing ligand (TRAIL/Apo2L) can be overcome by doxorubicin or adenoviral delivery of full-length TRAIL. Cancer Gene Ther 9, 164-172. Waxman DJ, Schwartz PS (2003) Harnessing apoptosis for improved anticancer gene therapy. Cancer Res 63, 85638572. Wen XY, Mandelbaum S, Li ZH, Hitt M, Graham FL, Hawley TS, Hawley RG, Stewart AK (2001) Tricistronic viral vectors co-expressing interleukin-12 (1L-12) and CD80 (B71) for the immunotherapy of cancer: preclinical studies in myeloma. Cancer Gene Ther 8, 361-370. Wong ET, Ngoi SM, Lee CG (2002) Improved co-expression of multiple genes in vectors containing internal ribosome entry sites (IRESes) from human genes. Gene Ther 9, 337-344. Zeimet AG, Marth C (2003) Why did p53 gene therapy fail in ovarian cancer? Lancet Oncol 4, 415-422
Benedict J Yan
Caroline GL Lee
437
Yan and Lee: Internal ribosome entry sites in cancer gene therapy
438
Gene Therapy and Molecular Biology Vol 8, page 439 Gene Ther Mol Biol Vol 8, 439-450, 2004
The pathway of uptake of SV40 pseudovirions packaged in vitro: from MHC class I receptors to the nucleus Research Article
Chava Kimchi-Sarfaty1, Susan Garfield2, Nathan S. Alexander1, Saadia Ali1, Carlos Cruz1, Dhanalakshmi Chinnasamy3, and Michael M. Gottesman1* 1
Laboratory of Cell Biology, 2Laboratory of Experimental Carcinogenesis, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892, USA 3 Vince Lombardi Gene Therapy Laboratory, Immunotherapy Program, St. Luke’s Medical Center, Milwaukee, WI 53215, USA
__________________________________________________________________________________ *Correspondence: Michael M. Gottesman, M.D., Laboratory of Cell Biology, National Cancer Institute, NIH, 37 Convent Drive, Room 2108, Bethesda, MD 20892-4256, USA, Tel: (301) 496-1530; Fax: (301) 402-0450, Email: mgottesman@nih.gov Key words: Gene delivery; SV40 in vitro packaging; pathway of SV40 pseudovirions; MHC I receptors Abbreviations: 5-Aza-2’-deoxycytidine, (DAC); bovine albumin, (BSA); Brefeldin A, (BFA); central polypurine tract sequence, (cPPT); central polypurine tract, (cPPT); cholera toxin, (CT); Dulbecco’s modified Eagle medium, (DMEM); elongation factor 1(EF1); endoplasmic reticulum, (ER); enhanced green fluorescent protein, (EGFP); fetal bovine serum, (FBS); green fluorescent protein, (GFP); multidrug resistance gene, (MDR1); nuclear extracts, (NE); nuclear localization sequences, (NLS); paraformaldehyde, (PFA); phosphate-buffered saline, (PBS); pigment epithelium derived factor, (PEDF); polyethyleneimine, (PEI); polyethyleneglycol, (PEG); Propidium iodide, (PI); Trichostatin A, (TSA); trichostatin A, (TSA) Received: 14 October 2004; Revised: 27 October 2004 Accepted: 16 November 2004; electronically published: November 2004
Summary SV40 vectors packaged in vitro are an efficient delivery system in vitro and in vivo using plasmids up to 17.7 kb, with or without SV40 sequences. Using confocal microscopy, we followed the pathway of SV40 pseudovirions in human lymphoblastoid cells, which are rich in MHC I receptors, using fluorescence-tagged DNA and an antibody against the main capsid protein, VP1. The wild-type SV40 virus as well as the pseudovirions enter the cells after binding to MHC I. However, the MHC I route is not the only way that SV40 pseudovirions enter cells. From the cell surface, the vectors progress through the Golgi to the ER, where they are unpackaged. Only the reporter DNA proceeds to the nucleus; VP1 remains at the ER. Results indicate that some of the reporter DNA, carried by these vectors, is trapped in the ER. Delivery of DNA plasmids which harbor nuclear localization sequences, such as the enhancer of wild-type SV40 or the cPPT sequence from the HIV-1 virus upstream from the GFP cDNA, did not improve GFP expression. However, improved expression from the EGFP reporter gene carried by SV40 vectors was achieved using the histone deacetylase inhibitor, TSA. The efficiency of the system is very high, as almost every cell is transduced. The expression is transient, and relatively low compared to retroviral transduction (Kimchi-Sarfaty et al, 2003). SV40 pseudovirions can deliver DNA plasmids to a variety of cell lines (nondividing as well as cycling cells), and appear to be nonimmunogenic. SV40 pseudovirion vectors very efficiently deliver reporter genes such as green fluorescent protein (GFP), ABC transporter genes such as the multidrug resistance gene (MDR1), a suicide gene (the Pseudomonas exotoxin) and antiangiogenic genes (the pigment
I. Introduction Packaging of SV40 pseudovirions in vitro results in a non-viral delivery system which satisfies the criteria for a successful gene transfer system: high efficiency, shortterm expression with no integration, non-immunogenic, and relatively safe (Kimchi-Sarfaty et al, 2004b). The SV40 wild-type virus capsid is composed of three viral proteins: VP1, VP2, and VP3 (Tooze, 1981). The SV40 in vitro packaging system uses nuclear extracts from Sf9 cells, transduced with VP1 baculovirus, to form SV40 capsids around any reporter gene up to 17.7 kb in length. 439
Kimchi-Sarfaty et al: In vitro-packaged SV40 vector pathway from Cambrex (East Rutherford, NJ) were plated in HMSGM medium with 10% FBS from Cambrex, but were grown in DMEM, and were a gift of Louis Scavo, NIDDK, NIH. Mesenchymal stem cells from teeth were grown in !MEM (Invitrogen) with 20% fetal bovine serum (FBS) and were a gift of Pamela Robey, NIDCR, NIH. All other media were supplemented with 10% FBS (Hyclone, Logan, UT), 5 mM Lglutamine, 50 µg/ml penicillin, and 50 µg/ml streptomycin (Quality Biological, Gaithersburg, MD). All cell lines were cultured at 37°C, in 5% CO2.
epithelium derived factor, PEDF) (Kimchi-Sarfaty et al, 2004b). Although the pseudovirions are an excellent vehicle for gene transfer, it is important to understand how DNA packaged in SV40 capsids is delivered to the nucleus in order to improve expression levels. The entry of wild-type SV40 is thought to begin with the virus binding to major histocompatibility complex class I molecules that cover the cell surface (Norkin, 2001). The virus then enters via caveolin-1-containing vesicles, and is transported to the endoplasmic reticulum (ER). This pathway is similar to that taken by cholera toxin (CT), which enters the Golgi via caveolae and is then transported to the ER (Norkin, 1999, 2001, 2002; Parton and Lindsay, 1999). However, it is possible that this pathway bypasses the Golgi (Pelkmans et al, 2001; Pelkmans and Helenius, 2002). Tsai and colleagues (2003) showed that wild-type SV40 enters the cell using specific ganglioses as receptors. Most other viruses enter through the clathrin-coated, pit-mediated endosomal pathway. Viruses which enter cells by endocytosis generally disassemble in endosomes, where the pH is low. However, since the SV40 wild-type entry pathway does not lead to endosomes (Colomar et al, 1993; Khalili and Stoner, 2001), SV40 disassembly is not dependent on low pH in the endosomal compartment. For a number of years it was believed that SV40 virions enter the nucleus and disassemble there, but more recently it has been shown that disassembly occurs in the ER. However, most of the SV40 wild-type DNA does not enter the nucleus (Parton and Lindsay, 1999; Norkin, 1999, 2001; Khalili and Stoner, 2001; Norkin et al, 2002; Pelkmans et al, 2001, 2002). Some viral delivery systems overcome low efficiency and expression using viral sequences which can target the nucleus, such as nuclear localization sequences of wildtype SV40 or the cPPT sequence from the HIV-1 virus. In a non-viral delivery system, the addition of polyethyleneimine (PEI) or polyethyleneglycol (PEG) increased delivery, mostly through the cell membrane, but also to the nucleus (Ross and Hui, 1999). In this study, we examined the pathway of entry of SV40 pseudovirions packaged in vitro in human lymphoblastoid cells. We tested different stages of the pathway to find the limiting step responsible for the relatively low expression found with SV40 pseudovirions for gene delivery. Our findings indicate that disassembly of the pseudovirions is not the rate-limiting step for gene expression. We suggest that two steps in the pseudovirion’s pathway are rate-limiting: DNA is trapped in the ER so that it does not reach the nucleus, and inefficient transcription from the DNA histone complex.
B. Infection of Sf9 cells with baculovirus, preparation of nuclear extracts (NE) from Sf9 cells, and preparation of in vitro packaging vectors Infecting Sf9 cells, preparing NE and preparing in vitro packaging vectors were as previously described (Kimchi-Sarfaty et al, 2002, 2003) .The nuclear extract contained VP1, one of the four viral late proteins (VP1, VP2, VP3, and agno). Packaged DNA in this study included the pEGFP-C1 construct (4.7Kb; Clontech, Palo Alto, CA), the pLUC construct (6.7Kb, Gene Therapy Systems, Inc., San Diego, CA), and pGeneGrip Fluorescein/ Luciferase (Gene Grip) (6.7Kb; Gene Therapy Systems, Inc., San Diego, CA). In vitro vector titers were calculated to be 5 " 10 4-5 " 10 5 particles per 1 ml, using CMT4 cells as previously described (Sandalon et al, 1997). In all the experiments empty capsids, DNA only, and non-transduced cells were used as controls.
C. Construction of plasmid DNAs carrying the SV40 enhancer element or the central polypurine tract (cPPT) sequence of HIV-1 as a nuclear localization signal To compare the effectiveness of the SV40 enhancer sequence in translocating the plasmid, we used the pVitro2GFP/LacZ (InvivoGen, San Diego, CA) plasmid encoding the enhanced green fluorescent protein (EGFP) cDNA under transcriptional control of a human ferritin heavy chain (hFerH) promoter in which the 5’UTR had been replaced by the 5’ UTR of mouse elongation factor 1(EF1). This plasmid also contained a 72 bp repeat from the SV40 enhancer upstream from the hFerH promoter to enhance gene expression and nuclear localization of plasmid DNA. For comparison, we constructed a plasmid with a similar backbone but devoid of the SV40 enhancer (pVitrop2GFP#NLS). To construct pVitrop2-GFP#NLS, we deleted the SV40 enhancer sequence by digesting the pVitro2-GFP/LacZ vector plasmid with NotI/PacI restriction enzymes. The E.coli origin of replication (pMB1 ori) released from the pVitro2GFP/LacZ plasmid during NotI/PacI digestion (as ~720 bp PacI/PacI fragment) was reinserted into the vector by blunt end ligation. To generate the plasmid containing cPPT, a 118-bp fragment of the central polypurine tract was amplified from plasmid pCMV#R 8.91 (Naldini et al, 1996) utilizing the primers cPPT 5’(5’-GCGGGGATCCTTTTAAAAGAAAAGGGGGG3’) and cPPT 3’ (5’-GCGGAGATCTAAA ATTTTGAATTTTTGTAATTTG-3’), digested with BamHI and BglII, and inserted at the BamHI site upstream of the internal CMV promoter used to drive the transcription of GFP cDNA in the lentiviral vector plasmid pCS-CG (Miyoshi et al, 1998).
II. Materials and methods A. Cell lines and cell culture .45 cells, human lymphoblastoid cells with high levels of MHC I, .221 cells, human lymphoblastoid cells with low MHC I receptors, and K562 human erythroleukemia cells were maintained in RPMI media (Invitrogen, Carlsbad, CA). HeLa cells and the HeLa subclone, KB-3-1 (Akiyama et al, 1985), were maintained in Dulbecco’s modified Eagle medium (DMEM) (Invitrogen, Carlsbad, CA). Bone marrow stem cells
D. Transduction of .45, .221, and K562 cells with in vitro-packaged vectors and transfection of HeLa and KB-3-1 cells with Lipofectamine-Plus At concentrations indicated in each figure, cells were transduced in suspension with the in vitro-packaged SV40
440
Gene Therapy and Molecular Biology Vol 8, page 441 vectors in 10 tubes (104 cells each) or in a 60 mm culture dish (105 cells in each). The dishes were then placed on an orbital shaker at a constant speed for 2.5 h (at 37°C, 5% CO2), after which the infection was stopped by the addition of RPMI medium supplemented as before (Invitrogen, Carlsbad, CA) (Kimchi-Sarfaty et al, 2004a). Every in vitro packaging transduction experiment was done 3-6 times, and all the results were comparable. Control transfections of HeLa and KB-3-1 cells (Akiyama et al, 1985) with the plasmid DNAs using lipofectamine-plus were done according to the protocol provided by ‘Lipofectamine-Plus’ (Invitrogen, Carlsbad, CA) without modification. Every transfection experiment was done 4-6 times, each with a similar resulting pattern.
Alexa 488 (green)-conjugated donkey anti-goat IgG (Molecular Probes, Inc., Eugene) were used as secondary antibodies. All secondary antibodies were used at a dilution of 1:250. In all experiments, cells were stained using a secondary antibody alone to determine non-specific staining. All serum, antiserum, and antibody incubations were performed for 1 h at room temperature. After the last antibody incubation, the cells were washed with PBS/ 0.1% BSA as before, dropped onto lysinecoated microscope slides (Erie Scientific Co., Portsmouth, NH), and allowed to dry. Fluorescent mounting medium (DAKO Corp., Carpinteria, CA) was then used to affix a glass coverslip to the microscope slide, and the slides were stored in the absence of light at 4°C.
H. Propidium iodide (PI) nuclear staining of .45 and KB-3-1 cells for confocal imaging
E. GFP and multidrug resistance (MDR1) expression detection
KB-3-1 cells were seeded on glass coverslips in wells of a 6-well plate, while .45 cells were grown in suspension in a T-25 flask. .45 cells were transduced with in vitro-packaged pGeneGrip Fluorescein/Luciferase (pGeneGrip) (GeneTherapySystems, San Diego, CA) DNA and KB-3-1 cells (Akiyama, 1985) were lipo–transfected with the same construct using the transduction protocols described above. Cells were washed three times with PBS/ 0.1% BSA and then fixed with 70% ethanol for 15 minutes at -20°C. Cells were washed again three times in PBS/ 0.1% BSA and then stained for 1 hour at room temperature with 100 µl PI staining solution, which was composed of 5 µl PI stock (100 µg/mL), 2 µl of RNAse (10mg/ml), and 5 ml of PBS without Ca or Mg. Cells were then washed three times with PBS/ 0.1% BSA. Coverslips with KB-3-1 cells were dried, inverted, and mounted on lysine-coated microscope slides. .45 cells were applied to slides as described above.
The GFP reporter gene that was used in this study was EGFP-C1 from Clontech (Palo Alto, CA). Two to forty days post-infection, 2 x 105 cells were washed and suspended in 200 µl phosphate-buffered saline (PBS) (Invitrogen, Carlsbad, CA), 0.1% bovine albumin (BSA) (Sigma-Aldrich, St. Louis, MO) at 4°C and analyzed by FACS (FL1) for GFP as previously described (Cormack et al, 1996) or studied by confocal microscopy (detailed in Collection of confocal images below). pHaMDR1 plasmid DNA, 15.2 kb in size, carried the multidrug resistance gene (MDR1). Detection of the MDR protein was done using a specific cell surface monoclonal antibody, MRK16, as described previously (Kimchi-Sarfaty et al, 2003).
F. Brefeldin A (BFA), 5-Aza-2’-deoxycytidine (DAC), and Trichostatin A (TSA) treatments of .45 human lymphoblastoid and HeLa cells BFA, which inhibits transport into the ER from the Golgi, was used at 0.5-2.5 µg/ml 24 hours and 2 hours prior to transduction, at the same time as transduction, and 2 1/2 hours after transduction, to determine whether the pathway of entry of pseudovirions is exclusively through the ER. TSA was added to cells at a concentration of 0.1, 1, 10, 100 and 1000 ng/ml prior to transduction. 5-Aza-2’-deoxycytidine (DAC) (Sigma, St. Louis, MO) was added to cells at a concentration of 1-10 µM 24-72 hours prior to transduction.
I. Collection of confocal images Confocal fluorescent images were collected with a Bio-Rad MRC 1024 confocal scan head mounted on a Nikon Optihot microscope with a 60X planapochromat lens. Excitation at 488 nm and 568 nm was provided by a krypton-argon laser. Emission filters of 598/40 and 522/32 were used for sequentially collecting red and green fluorescence, respectively, in channel one and two while phase contrast images of the same cell(s) were collected in the third channel using a transmitted light detector. Z-sections were taken at ~0.7 µm intervals at each wavelength, where applicable, and after sequential excitation, red and green fluorescent images of the same cell were merged for colocalization using LaserSharp software (Bio-Rad, Hercules, CA), and animation sequences were produced.
G. Preparation of cells for confocal imaging Prior to immunostaining and between each immunostaining step, transduced cells were washed twice with PBS (Invitrogen, Carlsbad, CA) supplemented with 0.1% BSA (Sigma-Aldrich, St. Louis, MO). Transduced cells were first fixed for 0.5 h with 4% paraformaldehyde (PFA) (SigmaAldrich, St. Louis, MO) or with additional fixation for 0.5 h with 70% ethanol at room temperature. Ethanol fixation could not be performed when it was necessary to observe GFP in cells. The presence of MHC I was detected using FITC – Anti-Human HLA – A,B,C (1:100, Becton, Dickinson, and Co., Franklin Lakes, NJ). The Golgi was detected using monoclonal antibody, #G2404 (Sigma, St. Louis, MO). For ER staining, fixed cells at 37°C were treated with 10% normal donkey serum (Sigma-Aldrich, St. Louis, MO). Cells were then washed once with PBS / 0.1% BSA and stained with a primary antibody (calregulin, goat, 1:100, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) against the lumen endoplasmic reticulum (also called calreticulin). Primary immunostaining was done with a polyclonal VP1 antiserum (rabbit, 1:40) to detect the presence of the VP1 protein. Following each primary immunostain, cells were washed and incubated with an appropriate secondary immunostain. For VP1, Alexa 568 (red) conjugated goat anti-rabbit IgG (Molecular Probes, Inc., Eugene, OR) and for the ER or the Golgi antibodies,
III. Results A. Entry of VP1 does not always correlate with levels of MHC I receptors It has previously been shown that SV40 wild-type binds MHC I receptors (Norkin, 1999). We investigated whether the level of MHC I expression is a limiting factor in gene expression in different cell lines, using the SV40based pseudovirion delivery system after in vitro packaging. The results shown here, and our extensive experience with other cell lines (data not shown), do not demonstrate a direct correlation between MHC I levels and GFP expression. Four different cell lines expressing different levels of MHC I (Figure 1, a,b,c,d left column) as detected by FACS were tested for transduction using GFP DNA
441
Kimchi-Sarfaty et al: In vitro-packaged SV40 vector pathway encapsidated in VP1 (right column). We used one full reaction of 660 Âľl (as defined by Kimchi-Sarfaty et al, 2004a), which saturates the cellular receptors (multiplicity of infection of 0.5-5). This is the maximum volume of pseudovirions enough to transduce cells without reducing their viability. As can readily be seen, there was no correlation between the levels of MHC I and GFP expression (compare Figure 1, left and right columns). Some cells with high MHC I levels (Figure 1d, left column) had little or no GFP expression (Figure 1d, right column), while other cells with low MHC I levels (Figure 1c, left column) showed strong GFP expression (Figure 1 c, right column).
To determine if the site of VP1 entry into cells is coincident with the location of MHC I receptors, we stained simultaneously for VP1 and MHC I in the human lymphoblastoid cell line .45, which has high MHC I levels (Figure 2). MHC I receptors appeared fairly uniformly around the plasma membrane (panel b), but VP1 (panel a) appeared in scattered locations around the membrane. Some colocalization of VP1 and MHC I is seen (panel c), but it is clear that the presence of MHC I (green fluorescence) does not predict binding of VP1. A similar phenomenon was observed in .221 stained cells although less MHC I staining was observed, it was also not colocalized with VP1 staining (data not shown). All the experiments in this section were repeated 4 times, and each resulted in a similar pattern of staining.
Figure 1. Expression of major histocompatability complex I (MHC I) receptors and of Green Fluorescent Protein (GFP) using FACS analysis in different cell lines. Cell lines were: H190 stem cells (a), .45 human lymphoblastoid cells (b), .221 human lymphoblastoid cells (c), and Human Mesenchymal Stem Cells (d). Cells were tested for their MHC I receptor levels (grey) and background fluorescence was detected using control antibody IGg2a (black) (left column). Expression studies of the EGFP-C1 reporter gene were done using FACS two to four days after transduction (grey) (right column). All control cells, cells transduced with DNA only, mocktransduction without reporter DNA, and untreated cells were tested for GFP expression in the same way as the experimental cells in all the experiments described in this paper (black).
442
Gene Therapy and Molecular Biology Vol 8, page 443
Figure 2. Expression of major histocompatability complex I (MHC I) receptors using confocal microscopy. Immediately after transduction, cells for confocal analysis were fixed as described in the Materials and Methods section, and the following parallel treatments were applied to cells: (1) VP1 polyclonal antibody staining with a secondary Texas Red antibody staining; (2) MHC I antibody staining conjugated to a secondary FITC antibody; (3) VP1 polyclonal antibody staining with its secondary Texas Red antibody, together with MHC I antibody staining conjugated to a secondary FITC antibody. No background was seen in secondary antibody staining only. (a) .45 cell immunostained for SV40 VP1 using rabbit anti-SV40 polyclonal antiserum, followed by a Alexa-568conjugated (red) goat anti-rabbit IgG secondary antiserum. (b) .45 cells immunostained for MHC-I receptors using FITC-conjugated to anti-human MHC-I (HLA-A, -B, -C). (c) Merge of panels a and b.
Figure 3. VP1 entry relative to Golgi apparatus in .45 cells. The following parallel treatments were applied to cells: (1) Same as in Fig. 2; (2) Monoclonal mouse anti-Golgi 58K protein antiserum staining, followed by a Alexa–488-conjugated (green) goat anti-mouse IgG secondary antiserum staining; (3) VP1 polyclonal antibody staining with its secondary Texas Red antibody, together with monoclonal mouse anti-Golgi 58K protein antiserum staining, with a Alexa–488-conjugated (green) goat anti-mouse IgG secondary antibody. No background was seen in secondary antibody staining only. .45 cells were fixed and immunostained for SV40 VP1 capsid protein using rabbit anti-SV40 polyclonal antiserum, followed by a Alexa-568-conjugated (red) goat anti-rabbit IgG secondary antiserum (a); then cells were immunostained with monoclonal mouse anti-Golgi 58K protein antiserum, followed by a Alexa-488-conjugated (green) goat anti-mouse IgG secondary antiserum (b). Panel c is a merge of panels a and b. Left top white arrow indicates Golgi staining only, Left bottom white arrow indicates costaining of VP1 and Golgi and right white arrow indicate VP1 staining only. Scale bar, 5 µm.
experiments were repeated five times with comparable results.
B. Some of the VP1 capsid protein is localized to the Golgi thirty minutes after transduction
C. Initial colocalization of VP1 with calregulin, an ER marker, 30 minutes after transduction
.45 human lymphoblastoid cells (105 cells) were transduced with in vitro-packaged GFP, and were harvested immediately after transduction, and 10, 30, and 120 minutes later, as described in Materials and Methods. Figure 3 demonstrates partial colocalization of VP1 and the Golgi apparatus 30 minutes after transduction; some of the VP1 (red) sites are costained with the Golgi (green) and appear dark yellow (lower left arrow), while other VP1 are not in the Golgi and appear red (right arrow). Some of the Golgi staining is not covered by VP1 (upper left arrow). The same pattern is seen at the other harvest time-points full colocalization was not found. In 60% of the cells there was no costaining of VP1 and the Golgi, and in 40% there was some colocalization. All these
Thirty minutes after transduction, VP1 staining appears throughout the cell, but not in the nucleus. To verify the location of VP1 staining, .45 human lymphoblastoid cells (105 cells) were transduced with in vitro-packaged GFP, and were harvested immediately after transduction, and at 10, 30, 120, and 240 minutes, 1, 2, 4, and 7 days later, as described in Materials and Methods. Figure 4 is a panel of Z sections of a cell seen via confocal microscopy, as described in Materials and Methods. We demonstrated that in 60% of the cells, 30 minutes after transduction, all VP1 (red) is colocalized to
443
Kimchi-Sarfaty et al: In vitro-packaged SV40 vector pathway
Figure 4. Z stacks of sections of .45 cells stained for VP1 and ER. .45 cells were harvested and fixed at 30 minutes post-transduction before immunostaining. The confocal microscope Z sections were collected at 0.3 µm intervals using sequential excitation for each fluorophore. The following parallel treatments were applied to cells: (1) Same as in Fig. 2; (2) Monoclonal mouse ER lumen protein, calregulin staining, against calreticulin, an ER membrane protein, followed by a Alexa–488-conjugated (green) donkey anti-goat IgG secondary antiserum staining; (3) VP1 polyclonal antibody staining with its secondary Texas Red antibody, together with a monoclonal ER lumen protein, calregulin, with a Alexa–488-conjugated (green) donkey anti-goat IgG secondary antiserum staining. No background was seen with secondary antibody staining only.
the ER (green), where it appears as yellow. The same phenomena is observed in the other 40% of the cells, but later in the time course at the 120-minute time point, we could observe green and yellow staining only. The same pattern of full co-localization is seen at the other harvest time-points beginning at 120 minutes. All these experiments were repeated 6 times, and the results were all similar.
SV40 vectors. .45 cells were treated with different concentrations of BFA (0.5-2.5 µg/ml) according to Norkin and colleagues, (2002), 24, and 2 hours before transduction, at the time of transduction, or at the end of the transduction process, when fresh medium is added to the cells. The effect of BFA treatment on GFP expression was monitored in transduced cells at various time points between 0-6 days post-transduction and compared with that of BFA-untreated GFP-transduced cells. We found a reduction in GFP expression in cells treated with 2.5 µg/ml BFA, but not a complete inhibition of GFP expression. Even very high concentrations of BFA (25 µg/ml) did not completely inhibit GFP expression. A concentration of 2.5 µg/ml led to a 50% reduction in GFP expression on day one. However, 48 hours after transduction, the reduction in GFP expression was less than 20% compared to untreated cells. From day three onward, decreasing the concentration of BFA (from 2.5
D. EGFP expression is reduced in BFAtreated cells transduced with SV40 in vitropackaged DNA Since all VP1 was co-localized with calregulin to the ER lumen, we wanted to determine whether VP1 transit through the ER is essential for gene expression. This was determined by blocking retrograde entry into the ER using BFA, and monitoring the expression of EGFP delivered by
444
Gene Therapy and Molecular Biology Vol 8, page 445 Âľg/ml to 0.6 Âľg/ml) actually increased the GFP expression by 100% as compared to untreated cells (data not shown). BFA experiments were repeated 6 times, and the results were comparable in all experiments.
was in the nucleus or just close to it. Figure 6a-c demonstrates 3 stages of entry of the Grip-DNA into the nucleus, taken from the animated movies, 4.5, 22.5, and 53 hours post-transduction. By 53 hours (Figure 6c), the DNA (green) appears to be in the nucleus, stained with propidium iodide (red). We compared DNA entry into the nucleus using in vitro-packaged SV40 pseudovirions and using a non-viral delivery system Lipofectamine-Plus from Invitrogen. Since lipofection of cells in suspension is not an efficient process, we transfected KB-3-1 (HeLa) adherent cells. At the same time points (4.5, 22.5, and 53 hours posttransduction) we examined GeneGrip DNA entry to the nucleus using lipofection as demonstrated in Figure 6d-f. It is important to note that the only valid comparison between the methods is the proportion of DNA in the cytoplasm vs. in the nucleus, since the amount of DNA used in the SV40 delivery system is approximately 103 lower compared to the Lipofectamine-Plus method. DNA is delivered to the nucleus earlier using the LipofectaminePlus delivery system. Based on our observation of 200 cells, 53 hours after transduction 59% of the DNA was still located in the ER.
E. Dissociation of VP1 from fluorescentlabeled DNA occurs in the ER 20 hours after transduction .45 human lymphoblastoid cells (105 cells) were transduced with SV40 vectors carrying fluorescent pGeneGrip DNA and were harvested immediately after transduction and at 2.5, 5.5, 10, 20, 30, 120, and 240 minutes, 1, 2, 4, and 7 days later, as described in Materials and Methods. Several investigators (Oppenheim et al, 1986; Oppenheim and Peleg, 1989; Dalyot-Herman et al, 1999; Strayer, 1999, 2000; Strayer and Zern, 1999; Kimchi-Sarfaty et al, 2002, 2003) have determined that all types of SV40 delivery systems are able to deliver DNA which is expressed in virtually all cells of many different cell types that have been tested. In the present study, using confocal microscopy to detect fluorescent-tagged DNA, every .45 cell contains a label 3.5 hours after transduction. These results clearly indicate that entry into cells is a very efficient process using VP1 only for encapsidation in the SV40-based delivery system. Cells shown in Figure 5a are 5.5 hours post transduction. The yellow staining clearly shows that VP1 (red) and the green Grip signal are co-localized, which suggests that disassembly has not yet occurred at this time point. However, 20 hours post-transduction (Figure 5b), some of the red and the green staining is no longer colocalized, which indicates that disassembly has occurred and the DNA is no longer trapped within the VP1. 50 randomly chosen cells were examined thoroughly for each time point.
G. Neither nuclear localization sequences (NLS) from SV40 wild-type, nor cPPT sequences from the HIV-1 virus facilitated DNA entry into the nucleus using the SV40 delivery system Previously it has been shown that an SV40 enhancer comprised of a 72-base pair repeat could direct nuclear localization of plasmids and allows the enhancement of gene expression in a broad range of hosts (Dean, 1997, 1999; Vacik et al, 1999; Li et al, 2001). Similarly, the 188 bp central polypurine tract sequence (cPPT), a part of the polymerase gene of HIV-1 virus, has been shown to facilitate nuclear entry of HIV-1 preintegration complexes in the context of wild-type HIV-1 virus as well as HIV-1based replication defective lentiviral vectors (Sirven et al, 2000; Zennou et al, 2000). To examine whether the inclusion of these sequences could improve the nuclear transfer of plasmid DNAs encapsidated in SV40 pseudovirions, we constructed plasmid DNAs encoding
F. Twenty hours post-transduction and thereafter, Grip-DNA can be visualized in the nucleus Does disassociation of the DNA from VP1, starting at 20 hours post-transduction, enable it to enter the nucleus? .45 cells were harvested 2.5, 4, 5, 20, 24, 26, 28 hours after transduction. Grip-DNA and confocal sections of cells were used to distinguish whether the green signal
Figure 5. VP1 and SV40 IVP-DNA colocalization and disassembly in .45 cells. .45 cells transduced with IVPpGeneGrip (green), fixed and immunostained for VP1 (red) at 5.5 hours post transduction (a) and at 20 hours post transduction (b).
445
Kimchi-Sarfaty et al: In vitro-packaged SV40 vector pathway
Figure 6. pGeneGrip-DNA entry to the nucleus followed by PI staining. .45 cells transduced with SV40 IVP-pGeneGrip (panels a-c), and KB-3-1 cells transduced with the same DNA using lipofectamine-plus (panels d-f) were fixed and immunostained at 5.5, 22.5, and 53 hours post-transduction. The nucleus is labeled with propidium iodide (PI).
the GFP reporter gene with an SV40 enhancer or HIV-1 cPPT sequences placed upstream of the promoter used to drive transcription of GFP cDNA. We also constructed identical plasmids without these sequences and used these as controls for comparison. A time course (1, 2, 3, 4, 5, and 6 days after transduction) analysis of GFP expression from these two constructs delivered to .45 cells by the SV40 system was carried out using flow cytometry. As clearly seen in Figure 7a (3 days post-transduction), there was no detectable difference in GFP expression from constructs in the presence or absence of the SV40 enhancer. As a control, we compared the expression of GFP in HeLa and KB-3-1 cells that were transfected with the same constructs using Lipofectamine-Plus reagent and analyzed at the same time points as before. Interestingly, in this case, the plasmid carrying the SV40 enhancer sequence clearly revealed higher GFP expression than that lacking the NLS (Figure 7b – 4 days post transfection). Similar experiments were carried out using two other GFP DNA plasmids constructed with or without the cPPT sequence from HIV-1 downstream to the GFP gene. As expected, neither the in vitro-packaged SV40 vector (Figure 7c – 4 days after transduction), nor the transfection delivery system carrying these DNA plasmids revealed any differences in GFP expression over time (Figure 7d – 5 days post-transfection). These experiments were repeated 8 times, with similar results.
deacetylase inhibitor, TSA. In order not to saturate the cells, and to see the effect of TSA, only 2/3 of a pseudovirion reaction (Kimchi-Sarfaty et al, 2004) was used. Acetylation of histones allows DNA to be more accessible to transcription factors by separating basic Ntermini of histones. This makes histone-DNA interaction looser which results in gene activation. GFP expression was monitored every day for 6 days. Expression was higher starting 48 hours after transduction in treated cells. An 8.6-fold increase in GFP expression (4.39 in cells transduced with in vitro-packaged GFP as compared to 37.73 in cells treated with TSA and transduced with in vitro-packaged GFP-median fluorescence intensity, arbitrary units) was observed in cells treated with 10 ng/ml 6 days after transduction. A similar experiment using the pHaMDR1 plasmid packaged in vitro revealed similar results expression using the MRK16 monoclonal antibody was 30% higher 48 hours post transduction after treating the cells with 10 ng/ ml 24 prior to transduction. TSA treatment (0.1, 1, 10 ng/ml) was used on KB-31 and HeLa cells 24 hours prior to transfection with EGFP using Lifofectamine-Plus reagent. Measuring 24 and 48 hours post transduction, we found that treatment with 0.1 and 1 ng/ml slightly increased GFP expression (1627.48 in cells transduced with GFP as compared to 1968.52 in cells treated with 0.1 ng/ml TSA and transduced with GFPmedian fluorescence intensity, arbitrary units), A higher concentration of 10 ng/ml did not change GFP expression level. Treating cells with the DNA methylase inhibitor, DAC which incorporates into the DNA in place of cytosine but cannot be methylated, results in loss of DNA methylation, and in some cases, gene reactivation. In contrast to TSA treatment, treatment of cells with DAC prior to transduction (24, 48, 72 hours prior to
H. DNA histone acetylation, but not DNA demethylation, promotes DNA expression via SV40 in vitro vectors In order to increase gene expression, we treated .45 cells prior to transduction using the SV40 delivery system with various concentrations of the DNA histone
446
Gene Therapy and Molecular Biology Vol 8, page 447
Figure 7. GFP expression via Lipofectamine-Plus or SV40 delivery system using NLS sequences. (a) – .45 cells transduced with in vitro packaged-EGFP-C1 plasmid DNA which carries the SV40 enhancer as NLS sequence (-__-), or with no NLS sequence (–––) 3 days after transduction. Mock transduced cells are indicated with a solid line. (b) – HeLa cells transduced with GFP plasmid DNA which carries the NLS sequence (-__-), or with no NLS (–––) sequence using lipofectamine-plus 4 days after transduction. Mock transduced cells appear as a solid line . (c) – .45 cells transduced with in vitro packaged-GFP plasmid DNA which carries the HIV-1 cPPT sequence (-__-), or with no cPPT (–––) sequence 4 days after transduction. Mock transduced cells appear as a solid line. Panel (d – HeLa cells transduced with GFP plasmid DNA which carries the cPPT sequence (-__-), or with no cPPT (–––) sequence using lipofectamine-plus 5 days after transduction. Mock transduced cells appear as a solid line .
transduction) at different concentrations (1-10 µM) did not change the reporter gene expression (data not shown).
step in the pathway of entry of SV40 pseudovirions in order to improve expression of packaged DNA. Studying the SV40 pseudovirion pathway in a human lymphoblastoid cell line, we show here that the pseudovirions colocalized to MHC I receptors as does the wild-type SV40 virus, but a high level of MHC I is neither necessary nor sufficient for entry. Over a period of several hours, VP1 protein as well as packaged plasmid DNA labeled with a fluorescent tag was detected by confocal microscopy, and were shown to move from the surface of the cell into the Golgi, eventually accumulating in the ER. Initial disassembly of the packaged DNA from VP1 occurs
IV. Discussion Vectors which use the SV40 major capsid protein VP1 can be used to package supercoiled plasmids up to 17.7 kb in size in vitro without an SV40 viral sequence (Kimchi-Sarfaty et al, 2003). Previously we have shown the high efficiency of delivery of SV40 pseudovirions, but expression from in vitro encapsidated DNA is lower than retroviral delivery systems (Kimchi-Sarfaty et al, 2003). One of the aims of this work was to identify the limiting 447
Kimchi-Sarfaty et al: In vitro-packaged SV40 vector pathway in the ER, with some of the tagged DNA appearing in or near the nucleus 53 hours post transduction. No staining of VP1 was observed within the nucleus. Trapping of some of the DNA in the cytoplasm might explain the known limitation in expression of in vitro packaged virions. To overcome these limitations, we constructed GFP reporter DNAs harboring the enhancer repeat of the SV40 early promoter or the cPPT sequence from the HIV-1 virus, but saw no effect on gene expression. However, GFP expression was elevated when cells were treated with a histone deacetylase inhibitor TSA prior to transduction.
and its entry is not inhibited by BFA. The majority of the polyomavirus viral DNA is also not delivered to the nucleus, but moves back to the cytosol, and possibly degrades (Mannova and Forstova, 2003). An earlier study examining the pathway of the poly(ethylenimine)/DNA complexes also revealed similar results: some of the DNA was trapped in the cytoplasm and did not reach the nucleus (Godbey et al, 1999).
C. The known NLS sequences, the enhancer of SV40 wild-type virus and cPPT sequence from lentivirus do not improve gene expression using the SV40 pseudovirion vectors
A. Entry of pseudovirions into cells The efficiency of the entry of pseudovirions was monitored here using a GRIP-fluorescent DNA, with which we were able to demonstrate a fluorescent tag in every cell. Wild-type SV40 utilizes MHC I as a receptor (Norkin, 1999). Increased SV40 wild-type entry to cells can be achieved by transfecting more MHC I molecules into these cells (Breau et al, 1992). The results shown here, and our extensive experience with other cell lines (data not shown), do not demonstrate a direct correlation between MHC I levels and GFP expression. These results indicate that the MHC I level is not the limiting factor for reporter gene expression using the SV40 in vitro packaging delivery system. In some cell lines we found high levels of MHC I receptors, but GFP expression was low. These observations confirm our previous conclusions about in vitro packaging, that enhancing MHC I receptor levels in cells using interferon-$ does not enhance GFP expression via the SV40 delivery system. Previously we also measured MHC I receptors of .45 cells after multiple pseudovirion transductions, and we found that even after the third transduction, more than 60% of the cells still express MHC I (unpublished data of the authors). We speculate that other coreceptor(s) are needed for the entry of the pseudovirions, and without these coreceptors even high levels of MHC I are not sufficient for the entry of the pseudovirions. SV40 vectors transit from the cell membrane to the ER in .45 cells. However, blocking the pathway to the ER did not completely inhibit GFP expression, suggesting that alternative pathways are available under these conditions.
The function of the nuclear membrane as a barrier against macromolecules was described in the 1970s (Dingwall and Laskey, 1992). However, according to Whittaker and colleagues (2000), polyoma and papilloma virus particles (up to 60 nm) are able to pass into the nucleus. Previously, we have shown that the size of the pseudovirions did not exceed 55 nm (while SV40 wildtype is 45 nm). Therefore, it was surprising that we did not find any VP1 staining within the nucleus. NLS were used previously as peptides delivered in trans to the DNA or in cis carried by the plasmid DNA that needed to be delivered to the nucleus (Akuta et al, 2002). In the latter, fusion protein was expressed initially in the cytosol, but moved to the nucleus under the influence of the NLS. The enhancer repeat of the SV40 early promoter has been shown to increase the nuclear transport of transfected plasmid DNAs and also enhance the expression of transgenes in several cell types (Dean, 1997; Dean et al, 1999; Vacik et al, 1999; Li et al, 2001). We could only detect a marked increase in GFP expression when the same plasmid was tranfected into cells. It has been shown that the SV40 enhancer contains binding sites for several transcription factors. Several cellular transcription factors have been demonstrated to form nucleoprotein complexes after binding to their specific DNA sequences in the SV40 enhancer. The DNA sequences could interact with NLS receptors and enter the nucleus using the normal nuclear protein import machinery (Nigg, 1997). Other SV40 delivery systems such as the one developed by Vera et al, (2004) always imprint the NLS sequence of wild-type SV40. The failure to obtain nuclear delivery of the plasmid DNA harboring the SV40 enhancer using in vitro-packaged SV40 vectors, and our success using a Lipofectamine-Plus delivery system in the current study suggests that the NLS sequences or binding sites of cellular transcriptional factors in the SV40 enhancer might have been blocked or inactive due to conformational changes when packaged in the SV40 delivery system. Alternatively, we could speculate that the cellular factor(s) necessary to facilitate the SV40 enhancer-mediated nuclear transport is absent in cell lines used in this study. The cPPT sequence of HIV-1 virus pol gene virus has been shown to increase nuclear transport of preintegration DNA complexes formed after reverse transcription of wild type HIV-1 genome or replication
B. The pathway of SV40 pseudovirions from the ER to the nucleus The process of DNA entry to the nucleus is slower using the SV40 delivery system compared to transfection using Lipofectamine-Plus, another type of non-viral gene delivery. Godbey and colleagues (1999) used poly(ethylenimine)/DNA complexes and showed that the DNA initially appeared in the nucleus 4-5 hours posttransfection. Similarly, our study showed that transfection using lipids initially delivered the DNA to the nucleus 4.5 hours post-transduction. Using the SV40 system, the DNA reporter plasmid appeared in the nucleus later, and a small amount of DNA was localized in the nucleus 20 hours post transduction. It was clear that most of the DNA did not move to the nucleus, but was trapped in the ER. For mouse polyomavirus, VP1 accumulates on nuclear membranes,
448
Gene Therapy and Molecular Biology Vol 8, page 449 defective HIV-1-based vectors in infected cells (Sirven et al, 2000; Zennou et al, 2000). Although the nuclear transport function of the cPPT sequence has been well documented in the context of the wild type HIV-1 viral infection or transduction with HIV-1-based vector systems, its effectiveness in the context of plasmid DNA delivery and/or gene expression has not been studied. Not surprisingly, in the present study we were unable to detect any differences in GFP expression when we used plasmid DNA carrying or not carrying the cPPT sequence. However, these results suggest that the SV40 system could effectively package the HIV-1 based vectors and generate pseudovirions capable of delivering the vector plasmid into cells.
Acknowledgments We thank Ariella Oppenheim (The Hebrew University, Hadassah Medical School and Hadassah University Hospital, Jerusalem, Israel) for fruitful collaboration on the SV40 vectors, and for providing us the VP1, and VP2/3 polyclonal antibodies. We thank Pamela Robey, and Sergei Kuznetsov, National Institutes of Dental and Craniofacial Research, NIH, and Louis Scavo, National Institute of Diabetes and Digestive and Kidney Diseases, NIH for providing us with adult stem cells, and George Leiman for insightful editorial assistance.
References Akiyama S, Fojo A, Hanover JA, Pastan I, Gottesman MM (1985) Isolation and genetic characterization of human KB cell lines resistant to multiple drugs. Somat Cell Mol Genet 11, 117-126. Akuta T, Eguchi A, Okuyama H, Senda T, Inokuchi H, Suzuki Y, Nagoshi E, Mizuguchi H, Hayakawa T, Takeda K, Hasegawa M, Nakanishi M (2002) Enhancement of phagemediated gene transfer by nuclear localization signal. Biochem Biophys Res Commun 297, 779-786. Breau WC, Atwood WJ, Norkin LC (1992) Class I major histocompatibility proteins are an essential component of the simian virus 40 receptor. J Virol 66, 2037-2045. Colomar MC, Degoumois-Sahli C, Beard P (1993) Opening and refolding of simian virus 40 and in vitro packaging of foreign DNA. J Virol 67, 2779-2786. Cormack BP, Valdivia RH, Falkow S (1996) FACS-optimized mutants of the green fluorescent protein (GFP). Gene 173, 33-38. Dalyot-Herman N, Rund D, Oppenheim A (1999) Expression of beta-globin in primary erythroid progenitors of betathalassemia patients using an SV40-based gene delivery system. J Hematother Stem Cell Res 8, 593-599. Dean DA (1997) Import of plasmid DNA into the nucleus is sequence specific. Exp Cell Res 230, 293-302. Dean DA, Dean BS, Muller S, Smith LC (1999) Sequence requirements for plasmid nuclear import. Exp Cell Res 253, 713-722. Dingwall C, Laskey R (1992) The nuclear membrane. Science 258, 942-947. Follenzi A, Ailles LE, Bakovic S, Geuna M, Naldini, L (2000) Gene transfer by lentiviral vectors is limited by nuclear translocation and rescued by HIV-1 pol sequences. Nat Genet 25, 217-222. Godbey WT, Wu KK, Mikos AG (1999) Tracking the intracellular path of poly(ethylenimine)/DNA complexes for gene delivery. Proc Natl Acad Sci U S A 96, 5177-5181. Khalili KAS, Stoner GL (2001) Human Polyomaviruses. New York: Wiley-Liss, Inc. Kimchi-Sarfaty C, Ben-Nun-Shaul O, Rund D, Oppenheim A, Gottesman MM (2002) In Vitro-Packaged SV40 Pseudovirions as Highly Efficient Vectors for Gene Transfer. Hum Gene Ther 13, 299-310. Kimchi-Sarfaty C, Arora M, Sandalon Z, Oppenheim A, Gottesman MM (2003) High cloning capacity of in vitro packaged SV40 vectors with no SV40 virus sequences. Hum Gene Ther 14, 167-177. Kimchi-Sarfaty C, Alexander NS, Brittain S, Ali S, Gottesman MM (2004a) Transduction of multiple cell types using improved conditions for gene delivery and expression of SV40 pseudovirions packaged in vitro. BioTechniques 37, 270-275.
D. Inhibition of histone deacetylation increases GFP expression delivered via SV40 pseudovirions These results led us to search for different ways to increase the reporter gene expression via the SV40 delivery system. In this work, we show that inhibition of histone deacetylation, but not DNA demethylation, dramatically improves GFP expression delivered by the SV40 in vitro packaging vectors. Treatment of cultured cells with trichostatin A (TSA), a specific histone 4 deacetylase inhibitor, was shown to change gene expression, probably by inducing hyperacetylation of histones. Sowa and colleagues, (1997) and others (Schuettengruber et al, 2003) demonstrated activation of genes or gene promoters using TSA, but others (Siddiqui et al, 2003) showed that TSA might repress transcription. Treating other cell lines (KB-3-1 and HeLa) prior to transduction using another delivery systemLipofectamine-Plus-produced only very slightly higher GFP expression, as compared to delivery using the SV40 vectors. Therefore, we suggest that treatment with TSA might not be a useful method to increase gene expression for other delivery systems. White and Strayer, (2003) found that DNA methylation can occur during SV40 production in the packaging cell line and this may explain the relatively low expression of transgenes using other SV40 virions for gene delivery. Our results, however, indicated that inhibition of DNA methylation did not increase transgene expression. The SV40 in vitro packaging pathway characterized in this study has many similarities to the wild-type pathway. Both pathways are very efficient, both use MHC I for entry, in both the virions are delivered to the ER, and in both the efficiency of the delivery to the nucleus is not very high. However, some differences were observed. MHC I is not an exclusive pathway for the pseudovirions, not all the pseudovirions travel through the Golgi, and a large proportion of the reporter DNA is trapped in the ER. Although we were not successful in improving the efficiency of DNA delivery to the nucleus, blocking acetylation of histone H4 appears to substantially increase expression of DNA delivered by SV40 pseudovirions, and this approach may prove useful in exploiting SV40-based delivery systems.
449
Kimchi-Sarfaty et al: In vitro-packaged SV40 vector pathway Kimchi-Sarfaty C., Garfield, S., Alexander, N. S., Ali, S., Brittain, S., Cruz, C., Chinnasamy, D., and Gottesman, M. M. (2004b) SV40 pseudovirions as highly efficient vectors for gene transfer and their potential application in cancer therapy. Curr Pharm Biotech 5, 451-458, Li S, Maclaughlin FC, Fewell JG, Gondo M, Wang J, Nicol F, Dean DA, Smith, LC (2001) Muscle-specific enhancement of gene expression by incorporation of SV40 enhancer in the expression plasmid. Gene Ther 8, 494-497. Mannova P, Forstova J (2003) Mouse polyomavirus utilizes recycling endosomes for a traffic pathway independent of COPI vesicle transport. J Virol 77, 1672-1681. Miyoshi H, Blomer U, Takahashi M, Gage FH, Verma IM (1998) Development of a self-inactivating lentivirus vector. J Virol 72, 8150-8157. Naldini L, Blomer U, Gage FH, Trono D, Verma IM (1996) Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc Natl Acad Sci U S A 93, 1138211388. Nigg EA (1997) Nucleocytoplasmic transport: signals, mechanisms and regulation. Nature 386, 779-787. Norkin LC (1999) Simian virus 40 infection via MHC class I molecules and caveolae. Immunol Rev 168, 13-22. Norkin LC (2001) Caveolae in the uptake and targeting of infectious agents and secreted toxins. Adv Drug Deliv Rev 49, 301-315. Norkin LC, Anderson HA, Wolfrom SA, Oppenheim A (2002) Caveolar endocytosis of simian virus 40 is followed by brefeldin A-sensitive transport to the endoplasmic reticulum, where the virus disassembles. J Virol 76, 5156-5166. Oppenheim A, Peleg A, Fibach E, Rachmilewitz EA (1986) Efficient introduction of plasmid DNA into human hemopoietic cells by encapsidation in simian virus 40 pseudovirions. Proc Natl Acad Sci U S A 83, 6925-6929. Oppenheim A, Peleg A (1989) Helpers for efficient encapsidation of SV40 pseudovirions. Gene 77, 79-86. Parton RG, Lindsay M (1999) Exploitation of major histocompatibility complex class I molecules and caveolae by simian virus 40. Immunol Rev 168, 23-31. Pelkmans L, Kartenbeck J, Helenius A (2001) Caveolar endocytosis of simian virus 40 reveals a new two-step vesicular-transport pathway to the ER. Nat Cell Biol 3, 473483. Pelkmans L, Helenius A (2002) Endocytosis via caveolae. Traffic 3, 311-320. Ross PC and Hui SW (1999) Polyethylene glycol enhances lipoplex-cell association and lipofection, Biochim Biophys Acta 1421, 273-83 Schuettengruber B, Simboeck E, Khier H, Seiser C (2003) Autoregulation of mouse histone deacetylase 1 expression. Mol Cell Biol 23, 6993-7004. Siddiqui H, Solomon DA, Gunawardena RW, Wang Y, Knudsen ES (2003) Histone deacetylation of RB-responsive promoters: requisite for specific gene repression but dispensable for cell cycle inhibition. Mol Cell Biol 23, 77197731.
Sirven A, Pflumio F, Zennou V, Titeux M, Vainchenker W, Coulombel L, Dubart-Kupperschmitt A, Charneau P, (2000) The human immunodeficiency virus type-1 central DNA flap is a crucial determinant for lentiviral vector nuclear import and gene transduction of human hematopoietic stem cells. Blood 96, 4103-4110. Sowa Y, Orita T, Minamikawa S, Nakano K, Mizuno T, Nomura H, Sakai, T (1997) Histone deacetylase inhibitor activates the WAF1/Cip1 gene promoter through the Sp1 sites. Biochem Biophys Res Commun 241, 142-150. Strayer DS, Zern MA (1999) Gene delivery to the liver using simian virus 40-derived vectors. Semin Liver Dis 19, 71-81. Strayer DS (1999) Gene delivery to human hematopoietic progenitor cells to address inherited defects in the erythroid cellular lineage [editorial; comment]. J Hematother Stem Cell Res 8, 573-574. Strayer DS (2000) Effective gene transfer using viral vectors based on SV40. Methods Mol Biol 133, 61-74. Tsai B, Gilbert JM, Stehle T, Lencer W, Benjamin TL, Rapoport TA (2003) Gangliosides are receptors for murine polyoma virus and SV40. EMBO J 22, 4346-55. Tooze J (1981) DNA Tumor Viruses. New York: Cold Spring Harbor Laboratory. Vacik J, Dean BS, Zimmer WE, Dean DA (1999) Cell-specific nuclear import of plasmid DNA. Gene Ther 6, 1006-1014. Vera M, Prieto J, Strayer DS, Fortes P (2004) Factors Influencing the Production of Recombinant SV40 Vectors. Mol Ther 10, 780-91. White MK and Strayer DS (2003) DNA methylation modulates expression of transgenes transduced by recombinant SV40 vectors. Molecular Therapy, Abstracts from the Sixth Annual Meeting of the American Society of Gene Therapy, 7, S473. Whittaker GR, Kann M, Helenius A (2000) Viral entry into the nucleus. Annu Rev Cell Dev Biol 16, 627-651. Zennou V, Petit C, Guetard D, Nerhbass U, Montagnier L, Charneau P (2000) HIV-1 genome nuclear import is mediated by a central DNA flap. Cell 101, 173-185.
Michael M. Gottesman
450
Gene Therapy and Molecular Biology Vol 8, page 451 Gene Ther Mol Biol Vol 8, 451-464, 2004
The importance of PTHrP for cancer development Review Article
Jürgen Dittmer Universität Halle-Wittenberg, Universitätsklinik und Poliklinik für Gynäkologie, Ernst-Grube-Str. 40, 06097 Halle (Saale), Germany
__________________________________________________________________________________ *Correspondence: Jürgen Dittmer, Universität Halle-Wittenberg, Universitätsklinik und Poliklinik für Gynäkologie, Ernst-Grube-Str. 40, 06097 Halle (Saale), Germany; Tel: +49-345-557-1338; Fax: +49-345-557-5261; e.mail: juergen.dittmer@medizin.uni-halle.de Key words: PTHrP for cancer development, cancer proliferation, invasion, metastasis, apoptosis, osteolysis, ets transcription factors, regulating factors Abbreviations: adenovirus protein E1A, (AdV E1A); adult T-cell leukemia/lymphoma, (ATLL); calcium-sensing receptor, (CaR); cAMP-responsive element, (CRE); epidermal growth factor, (EGF)); extracellular matrix, (ECM); G-protein coupled receptors, (GPCR); human T lymphotropic virus type I, (HTLV-I); hypercalcaemia of malignancy, (HHM); interleukin-6, (IL-6); nuclear localization sequence, (NLS); parathyroid hormone 1 receptor, (PTH1R); parathyroid hormone, (PTH); Parathyroid hormone-related protein, (PTHrP); protein kinase A, (PKA); protein kinase C, (PKC); receptor activator of NF-!B ligand, (RANKL); transforming growth factor "2, (TGF"2); urokinase type plasminogen activator, (uPA); vascular smooth muscle, (VSM) Received: 2 November 2004; Revised: 15 November 2004; Accepted: 19 November 2004; electronically published: November 2004
Summary Parathyroid hormone-related protein (PTHrP) is expressed by many cells and usually acts as an autocrine, paracrine and/or intracrine factor to play numerous roles in embryonic development and normal physiology. Evidence has been accumulated suggesting that PTHrP may also serve important functions in tumor development. PTHrP has the potential to cause humoral hypercalcaemia of malignancy and is able to induce local osteolysis which facilitates growth of tumor cells that have metastasized to bone. Furthermore, PTHrP has been shown to stimulate proliferation as well as invasiveness of cancer cells and to protect cancer cells from apoptosis. In this review, I summarize the current knowledge about the role of PTHrP in cancer development and about the factors that control PTHrP expression in cancer. mammary gland and bone development (Vortkamp et al, 1996, Wysolmerski et al, 1998). Disruption of the PTHrP gene in mice leads to fatal skeletal dysplasia (Karaplis et al, 1994; Karaplis and Deckelbaum, 1998). Rescued PTHrP k.o. mice, carrying a transgenic PTHrP gene under the control of a bone-specific promoter, lack mammary epithelial ducts (Wysolmerski et al, 1998). The actions of PTHrP in the developing bone and breast are paracrine in nature and depend on PTH1R. In the developing bone, PTHrP secreted from periarticular perichondrium activates PTH1R on chondrocytes, thereby preventing premature ossification (Vortkamp et al, 1996). In the developing mammary gland, PTHrP from embryonic mammary epithelial cells stimulates the mammary mesenchyme via interaction with PTH1R to differentiate into mammaryspecific mesenchyme which then triggers ductal morphogenesis (Dunbar et al, 1998).
I. Discovery of PTHrP PTHrP was originally discovered as a systemic humoral factor that is released by tumor cells and causes hypercalcaemia of malignancy (HHM) (Suva et al, 1987; Wysolmerski and Broadus, 1994; Rankin et al, 1997; Grill et al, 1998). The hypercalcaemic activity of PTHrP is based on its partial homology to parathyroid hormone (PTH) (Horiuchi et al, 1987; Kemp et al, 1987), a protein that regulates calcium homeostasis. By being able to bind to the parathyroid hormone 1 receptor (PTH1R) with equal affinity as PTH (Juppner et al, 1991), PTHrP mimics PTH action and stimulates cAMP production in bone and kidney (Mannstadt et al, 1999). This results in bone resorption and renal calcium retention eventually leading to HHM. It became clear that PTHrP is also expressed by nontransformed cells in almost all tissues (dePapp and Stewart, 1993) where it serves specific functions as an autocrine or paracrine factor (Moseley and Gillespie; 1995, Philbrick et al, 1996; Strewler, 2000). In embryogenesis, PTHrP plays an essential role in
II. The functional domains of PTHrP The PTHrP transcripts are translated into three different isoforms, PTHrP (-36/139), PTHrP (-36/141) and
451
!"##$%&'()$*+&#,-.%(+/(012&0(/+&(.,-.%&(3%4%5+*$%-#( !
! "#$%&'!()!!"#$%&'()*+',-$.+/,*'0$+%$)"#$"&/,'$1!231$43+)#*'$,'.$*)0$*')#3,()*+'$4,3)'#305$6#),*-0$,3#$7*8#'$*'$)"#$)#9)5$!:1$.#'+)#0$ 4"+04"+3;-,)*+'$+%$!"3<=5$>>!>$0),'.0$%+3$3#0*.&#0$>#3??@A$>#3?BCA$!"3?BD$,'.$>#3?B<$,'.$EEEE$.#'+)#0$)"#*3$3#4-,(#/#')0$F;$,-,'*'#05$ G6H$ I$ (;(-*':.#4#'.#')$ J*',0#A$ K1GL$ I$ K:43+)#*'$ (+&4-#.$ 3#(#4)+35$ K3##'$ F,30$ 0"+M$ #9)#')*+'$ +%$ )"#$ 1!231$ 43+)#*'$ *'$ 04-*(*'7$ 8,3*,')0$NBOP?Q?$,'.$NBOP?RB5$ $ $
1!231$ S:BOP?RBT$ S"#$%&'! (T5$ !"#;$ ,--$ (+'),*'$ )"#$ U: )#3/*',-$ 0*7',-$ 0#V&#'(#$ %+3$ #')3,'(#$ *')+$ )"#$ #'.+4-,0/,)*($ 3#)*(&-&/$ ,'.$ )"#$ (+.*'7$ 3#7*+'$ F#)M##'$ 3#0*.&#0$ ?$ ,'.$ ?B@$ SW,3)*'$ #)$ ,-A$ ?@@?X$ 1"*-F3*(J$ #)$ ,-A$ ?@@OX$ >)3#M-#3A$ DCCCT5$ !"#$ %*30)$ ???$ ,/*'+$ ,(*.0$ +%$ )"#$ (+.*'7$3#7*+'$,3#$"*7"-;$(+'0#38#.$F#)M##'$/*(#A$3,)0$,'.$ "&/,'0$ 0&77#0)*'7$ )",)$ )"#;$ ,3#$ (3&(*,-$ %+3$ 1!231$ %&'()*+'5$ Y'$ (+')3,0)A$ )"#$ G:)#3/*'&0$ *0$ "*7"-;$ 8,3*,F-#5$ !"#$ *0+%+3/0$ 1!231$ S:BOP?Q?T$ ,'.$ )"#$ "&/,':04#(*%*($ 1!231$S:BOP?RBT$43+.&()$%#,)&3#$#9)#'.#.$G:)#3/*'*5$!"#$ 1!231$43+)#*'$*0$4+0):)3,'0-,)*+',--;$(-#,8#.$,)$,$'&/F#3$ +%$.*F,0*($0*)#0$S6*#%#'F,(":Z,77#3$#)$,-A$?@@=X$6*)/#3$#)$ ,-A$?@@OX$[&$#)$,-A$?@@OT$-#,.*'7$)+$)"#$3#/+8,-$+%$)"#$43#: 43+$ 0#V&#'(#$ F#)M##'$ NBO$ ,'.$ N?$ ,'.$ )+$ ,$ -*/*)#.$ %3,7/#'),)*+'$+%$)"#$43+)#*'5$!"#0#$%3,7/#')0$(+'),*'$+'#$ +3$/+3#$+%$)"#$)"3##$%&'()*+',-$.+/,*'0$M"*("$,3#$)"#$U: )#3/*',-$S1!231$?:BOTA$)"#$/*.:3#7*+'$S1!231$B<:@QT$,'.$ )"#$G:)#3/*',-$.+/,*'$S1!231$?CR:?B@T5$ !"#$U:)#3/*',-$.+/,*'A$1!231$S?:BOTA$*0$3#04+'0*F-#$ %+3$)"#$1!2:-*J#$,()*8*);$+%$1!231$,'.$*0$,F-#$)+$F*'.$,'.$ ,()*8,)#$ 1!2?L5$ E()*8,)*+'$ +%$ )"*0$ K:43+)#*'$ (+&4-#.$ 3#(#4)+3$ SK1GLT$ -#,.0$ )+$ )"#$ 0)*/&-,)*+'$ +%$ )"#$ 43+)#*'$ J*',0#$E$S1HETA$43+)#*'$J*',0#$G$S1HGT$,'.P+3$(,-(*&/: .#4#'.#')$ 4,)"M,;0$ SW,''0),.)$ #)$ ,-A$ ?@@@X$ G,),*00+'$ #)$ ,-A$DCCCX$W,*+-*$,'.$\+3)*'+A$DCCQ,T5$$ W,';$+%$)"#$1!2?L:.#4#'.#')$1!231$#%%#()0$(,'$F#$ /*/*(J#.$F;$(EW1$*'.*(,)*'7$)",)$1HE$*0$,$/,]+3$),37#)$ +%$,()*8,)#.$1!2?L5$$ !"#$ /*.:3#7*+'$ .+/,*'$ *0$ ,F-#$ )+$ #')#3$ )"#$'&(-#&05$ Y)$(+'),*'0$,$F*4,3)*)#$'&(-#,3$-+(,-*^,)*+'$0#V&#'(#$SU_>T$ (+'0*0)*'7$ +%$ 3#0*.&#0$ <<:@?$ ,'.$ ?CD:?CO$ SW,00%#-.#3$ #)$ ,-A$?@@RT5$!"*0$0#V&#'(#$,-0+$,--+M0$1!231$)+$,((&/&-,)#$ *'$ )"#$ '&(-#+-&0$ S2#'.#30+'$ #)$ ,-A$ ?@@=T$ ,'.$ )+$ F*'.$ )+$ LUE$SE,3)0$#)$,-A$?@@@T5$U&(-#,3$),37#)*'7$(,'$F#$%&3)"#3$ ,("*#8#.$ F;$ 3#0*.&#0$ OO:@Q$ M"*("$ *0$ 3#(+7'*^#.$ F;$ */4+3)*'$!$S_,/$#)$,-A$?@@@,X$G*'7+-,'*$#)$,-A$DCCDT5$!"#$
/*.3#7*+'$ 0#V&#'(#$ ,-0+$ "+-.0$ ,$ G6H?S(.(DTPG6HD$ 4"+04"+3;-,)*+'$ 0*)#$ S_,/$ #)$ ,-A$ ?@@@FT5$ \+--+M*'7$ *)0$ 4"+04"+3;-,)*+'A$ 1!231$ *0$ 3#),*'#.$ *'$ )"#$ (;)+4-,0/$ 0&77#0)*'7$)",)$)"#$,()*8*);$+%$'&(-#,3$1!231$*0$3#7&-,)#.$ F;$)"#$(#--$(;(-#5$$ !"#$ G:)#3/*',-$ .+/,*'A$ ,-0+$ (,--#.$ +0)#+0),)*'A$ *0$ ,F-#$ )+$ *'"*F*)$ F+'#$ 3#0+34)*+'$ ,'.A$ )"#3#F;A$ ,'),7+'*^#0$ )"#$,()*+'$+%$)"#$U:)#3/*',-$.+/,*'$+%$1!231$S\#')+'$#)$ ,-A$ ?@@QX$ G+3'*0"$ #)$ ,-A$ ?@@RT5$ !"*0$ *'"*F*)+3;$ #%%#()$ +%$ +0)#+0),)*'$ /,;$ F#$ F,0#.$ +'$ )"#$ ,F*-*);$ +%$ )"*0$ 43+)#*'$ )+$ 4";0*(,--;$*')#3,()$M*)"$!:E33#0)*'$SG+'-,'$#)$,-A$DCCDT5$!: E33#0)*'0$ ,3#$ J'+M'$ )+$ 3#7&-,)#$ *')#3',-*^,)*+'$ ,'.$ .#0#'0*)*^,)*+'$ +%$ -*7,'.:0)*/&-,)#.$ K1GL0A$ 0&("$ ,0$ 1!231:,()*8,)#.$ 1!2?L$ S\#33,3*$ #)$ ,-A$ ?@@@T5$ !"#$ G: )#3/*',-$ .+/,*'$ ,-0+$ ",3F+30$ %+&3$ 4+)#')*,-$ ),37#)0$ %+3$ J*',0#0$,)$3#0*.&#0$??@A$?BCA$?BD$,'.$?B<$M"+0#$/&),)*+'$ %3+/$ ,$ 0#3*'#$ +3$ )"3#+'*'#$ )+$ ,'$ ,-,'*'#$ ,F3+7,)#.$ )"#$ /*)+7#'*($ ,()*8*);$ +%$ 1!231$ *'$ 8,0(&-,3$ 0/++)"$ /&0(-#$ (#--0$S\*,0("*:!,#0("$#)$,-A$DCCQT$ E'+)"#3$.+/,*'$0##/0$)+$F#$-+(,)#.$*'$)"#$#9)#'.#.$ G:)#3/*'&0$ +%$ )"#$ 1!231$ S:BOP?RBT$ )3,'0(3*4)*+',-$ 43+.&()5$!"#$0#V&#'(#$F#)M##'$3#0*.&#0$?QC$,'.$?RB$",0$ F##'$ 0"+M'$ )+$ *')#3%#3#$ M*)"$ )"#$ '&(-#,3$ -+(,-*^,)*+'$ +%$ 1!231$SK++/#3$#)$,-A$DCCCT$,'.$)+$3,*0#$)"#$(EW1$-#8#-$ S2,0)*'70$#)$,-A$DCCQT5$$ >;')"#0*^#.$*'$)"#$#'.+4-,0/*($3#)*(&-&/A$1!231$*0$ ,$ 0#(3#)+3;$ 43+)#*'$ M"*("$ '##.0$ )+$ *')#3,()$ M*)"$ 04#(*%*($ (#--$/#/F3,'#$3#(#4)+30$*'$+3.#3$)+$#9#3)$*)0$%&'()*+'5$>+$ %,3A$ +'#$ 0&("$ 3#(#4)+3A$ 1!2?LA$ ",0$ F##'$ *.#')*%*#.$ )",)$ 3#(+7'*^#0$ )"#$ 1!231$ U:)#3/*',-$ .+/,*'5$ L#(#4)+30$ )",)$ 04#(*%*(,--;$*')#3,()$M*)"$+'#$+%$)"#$+)"#3$1!231$.+/,*'0$ /,;$ #9*0)$ ,0$ M#--5$ !"*0$ *0$ *'.*(,)#.$ F;$ )"#$ +F0#38,)*+'0$ )",)$ %3,7/#')0$ '+)$ (+'),*'*'7$ )"#$ U:)#3/*',-$ .+/,*'$ ,3#$ 43#0#')$+&)0*.#$+%$(#--0$S>+*%#3$#)$,-A$?@@DX$[&$#)$,-A$?@@OT$ ,'.$)",)$)"+0#$%3,7/#')0$,3#$,F-#$)+$*')#3%#3#$M*)"$(#--&-,3$ %&'()*+'$M"#'$,..#.$#9+7#'+&0-;$SW,00%#-.#3$#)$,-A$?@@RX$ Q=D$
Gene Therapy and Molecular Biology Vol 8, page 453 Luparello et al, 2001). In particular, the mid-regional PTHrP (67-86) peptide, devoid of a functional NLS, has been shown to mobilize calcium through a phospholipase C-dependent pathway in squamous carcinoma cells (Orloff et al, 1996). For NLS-containing mid-region fragments, an intracrine way of action has been discussed. In order for PTHrP to enter the nucleus, PTHrP is supposed to be either synthesized directly in the cytosol or produced in the endoplasmic reticulum and then re-translocated to the cytosol (Fiaschi-Taesch and Stewart, 2003).
correlate with increased mortality (Hiraki et al, 2002; Truong et al, 2003).
IV. PTHrP and metastasis It is generally accepted that PTHrP plays a role in bone metastasis. By inducing local osteolysis PTHrP facilitates growth of osteotropic tumors, such as breast cancer, in the dense bony tissue (Goltzman et al, 2000; Guise, 1997; Kakonen and Mundy, 2003). PTHrP triggers osteolysis by stimulating osteoblasts to produce osteoclastogenesis-activating factors, such as receptor activator of NF-!B ligand (RANKL) or interleukin-11 (Morgan et al, 2004; Thomas et al, 1999). However, PTHrP does not appear to directly interfere with the metastastic potential of tumor cells, at least not in mice (Wysolmerski et al, 2002). The importance of PTHrP for bone metastasis has been demonstrated by a number of studies. A correlation between PTHrP expression and formation of bone metastasis was shown for breast and lung cancer cell lines in nude mice (Guise et al, 1996; Miki et al, 2000). Moreover, colonialization of bone tissue by MDA-MB231 breast cancer cells could be inhibited in nude mice by PTHrP-specific antibodies (Guise et al, 1996). Similarly, the formation of bone metastases, but not metastases in other organs by SBC-5 small-lung cancer cells could be reduced by anti-PTHrP antibodies in immunocompromised SCID mice (Miki et al, 2004). The propensity of metastastic tumors in bone to express PTHrP could further been shown for human breast cancer: the highest frequency of PTHrP expression (73-92%) was found in bone metastatic lesions, whereas only a minority (17-20%) of breast cancer metastases at non-bone sites produced PTHrP (Powell et al, 1991; Vargas et al, 1992). PTHrP induces osteolysis in cooperation with other factors, such as TGF" (Yin et al, 1999). TGF", a factor that can either inhibit or promote tumor growth (Blobe et al, 2000; Roberts and Wakefield, 2003), is present in the bone matrix and is activated upon PTHrP-induced osteolysis. The activation of TGF" initiates a vicious cycle as active TGF" stimulates MDA-MB-231 cells to produce more PTHrP. This, in turn, leads to more osteolysis and, thus, higher levels of activated TGF" (Yin et al, 1999). Another study compared the features of bone-seeking and brain-seeking MDA-MB-231 sublines. The brain-seeking subline expressed less PTHrP than the bone-seeking one and also showed a much higher sensitivity to the growthinhibitory activity of TGF" (Yoneda et al, 2001). The latter feature may have precluded survival of the brainseeking subline in the TGF"-rich environment of the bone. Another support for a link between PTHrP and bone metastasis comes from two studies with MCF-7 breast cancer cells. Both down- and upregulation of the endogenous PTHrP production interfered with the ability of this cell line to form metastasic lesions in the bone (Kitazawa and Kitazawa, 2002; Thomas et al, 1999). In addition to TGF", also interleukin-6, tumor necrosis factor # or transforming growth factor #, have been shown to be able to enhance the bone destructive effect of PTHrP (de la Mata et al, 1995; Guise et al, 1993;
III. PTHrP and cancer growth There is evidence that PTHrP has a tumor growth effect. Mammary gland specific overexpression of PTHrP led to a higher incidence of tumor formation in mice (Wysolmerski et al, 2002). Also, a polymorphic PTHrP variant is associated with increased incidence of skin cancer in mice (Manenti et al, 2000). Furthermore, the growth of rat pituitary cancer cells in the brain of rats was found to be decreased upon treatment with anti-sense oligonucleotides against PTHrP-RNA (Akino et al, 1996). Similarly, the tumor volume formed by H-500 Leydig cells inoculated into rats was reduced after PTHrP antisense RNA had been administered to the animals (Rabbani et al, 1995). And, treatment of tumor-bearing mice with PTHrP-specific antibodies was shown to suppress growth of human breast cancer metastasized to bone and renal carcinoma injected into the skin (Guise et al, 1996; Massfelder et al, 2004). Furthermore, PTHrP overexpressing prostate cancer cells grew faster in MatLyLu rats than control cancer cells (Dougherty et al, 1999) while, in athymic mice, the level of PTHrP expression in human squamous cancer cells increased with tumor growth (Yamato et al, 1995). As for the value of PTHrP as a prognostic marker for cancer, especially for breast cancer, the data are conflicting. On the one hand, a study of Martin and collegues showed that, in a cohort of 367 breast cancer patients, immunoreactivity against N-terminal PTHrP in paraffin sections of the primary tumor tissues correlated with improved survival (Henderson et al, 2001). In contrast, Linforth et al reported that, in a cohort of 176 breast cancer patients, positive immunohistochemical staining for N-terminal PTHrP in primary tumors was associated with a reduced disease-free survival (Linforth et al, 2002). In the same study, it was shown that the RNA level of PTH1R correlated with a decreased survival as well and, interestingly, that co-expression of PTHrP with its receptor predicted the worst clinical outcome. In another study including 177 breast cancer patients, tumoral PTHrP protein expression was found to be a marker of poor prognosis (Yoshida et al, 2000). The reason for the discrepancy between the outcomes of these studies is not yet known. In other human cancers, PTHrP expression seems to correlate with advanced disease. E.g., a study on a cohort of 108 colorectal tumor patients showed that positive staining for PTHrP in the tumor was associated with an increased incidence of lymph nodes and liver metastasis (Nishihara et al, 1999). Increased PTHrP serum levels in cancer patients were also found to
453
Dittmer: Importance of PTHrP for cancer development Tumber et al, 2001; Uy et al, 1997). In some cases, PTHrP may not be the major factor that facilitates colonialization of breast cancer cells in the bone. Prostaglandine E2, interleukin-6 and interleukin-8 may well substitute for PTHrP (Bendre et al, 2003; Martin, 2002). E.g., interleukin-8 has been shown to mediate osteolysis of the highly metastatic MDA-MET cell line that produces less PTHrP, but higher amounts of interleukin-8 than the MDA-MB-231 parental cell line (Bendre et al, 2002). On the other hand, PTHrP and interleukin-8 expression may be connected. This was shown for prostate cancer cells, where PTHrP increased interleukin-8 production via its intracrine pathway (Gujral et al, 2001). In contrast to PTHrP, interleukin-8 can directly activate osteoclast formation.
(1-34) alone could induce proliferation, which was accompanied by an increase in the intracellular cAMP level (Birch et al, 1995). The same peptide was also shown to be able to stimulate growth of PC-3 and LnCaP prostate cancer cells (Asadi et al, 2001) as well as of lung squamous BEN-57 cancer cells (Burton and Knight, 1992). In the latter case, the effect of PTHrP (1-34) could be reversed by addition of a PTHrP antibody. Furthermore, proliferation of clear cell renal carcinoma in nude mice could be equally inhibited by antibodies against PTHrP or by a PTH1R antagonist (Massfelder et al, 2004). These examples show that cancer cells can use the PTHrP/PTH1R interaction to stimulate their own proliferative activity.
2. Intracrine actions
V. Biological effects of PTHrP on cancer cells
Some reports also show anti-proliferative effects of PTHrP on MCF-7 breast cancer and vascular smooth muscle (VSM) cells (Massfelder et al, 1997; Falzon and Du, 2000; Luparello et al, 2001; Pasquini et al, 2002). Interestingly, in two of these cases, the anti-proliferative activity of PTHrP was only observed when PTHrP peptides (1-34, 1-36, 1-86, 1-108, 1-139, 1-141) were exogenously administered to the cells (Massfelder et al, 1997; Falzon and Du, 2000). When PTHrP (1-139) was transfected into the cells instead, proliferation was increased (Massfelder et al, 1997; Falzon and Du, 2000; Tovar Sepulveda et al, 2002). This mitogenic effect required the integrity of the NLS suggesting that here the mitogenic activity of PTHrP was entirely dependent on the intracrine nuclear pathway of PTHrP. In VSM cells, the mitogenic effect of PTHrP via the intracrine pathway was also dependent upon three serines and one threonine residues between positions 119 and 138 of the C-terminus (Fiaschi-Taesch et al, 2004) suggesting that certain phosphorylation events are essential for this PTHrP activity. The results by Falzon and Du (2000) showing an anti-proliferative effect of the PTHrP (1-34) peptide on MCF-7 breast cancer cells contradict the data obtained by two other groups demonstrating a mitogenic effect of the same peptide on these cells (Birch et al, 1995; Hoey et al, 2003) This discrepancy may be explained by the genetic variability in MCF-7 sublines (Nugoli et al, 2003). In different MCF-7 sublines, PTH1R may activate PKA, PKC and the Ca2+ pathway to a different extent which may lead to different proliferative activities (Maioli and Fortino, 2004b). Alternatively, the PKA/cAMP pathway may have different effects on proliferation in different MCF-7 sublines. It is noteworthy in this respect that B-Raf is able to convert cAMP from an anti-mitogenic to a mitogenic factor (Fujita et al, 2002). Overall, PTHrP seems to predominantly act as a mitogenic factor on cancer cells. However, under certain conditions (certain type of tumor, certain features of the individual cell clone, the particular way PTHrP was administered) PTHrP may also inhibit proliferation. How easily PTHrP can switch from a mitogenic to an antimitogenic agent is nicely demonstrated for a C-terminal PTHrP peptide (Whitfield et al, 1992). This peptide was found to inhibit proliferation of dividing keratinocytes, yet
Numerous studies have been conducted to analyze the impact of PTHrP on proliferation, invasiveness and resistance to apoptosis, biological activities that are crucial for survival and growth of cancer cells. The results of these studies are discussed below.
A. PTHrP and cancer proliferation During murine endochondrial ossification PTHrP serves an important function by preventing chondrocytes to prematurely differentiate into hypertrophic cells (Vortkamp et al, 1996). In a positive feedback loop, prehypertrophic chondrocytes secrete Indian hedgehog (Ihh) that, by activating transforming growth factor "2 (TGF"2) (Alvarez et al, 2002), stimulates the periarticular perichondrium to produce PTHrP (Vortkamp et al, 1996; Karp et al, 2000; Kobayashi et al, 2002). PTHrP, in turn, induces proliferation of the chondrocytes by interacting with PTH1R. The activated receptor induces a decline in the expression of cell cycle inhibitor p57kip2 (MacLean et al, 2004) and an increase in the production of cyclin D1 (Beier et al, 2001). This well-studied example shows that PTHrP can play a role in the regulation of the cell cycle. This notion is further supported by a detailed study on keratinocytes showing that PTHrP expression increases when cells in G1-Phase enter S-Phase, an event that is accompanied by relocation of PTHrP from the nucleolus to the cytoplasm (Lam et al, 1997). Strikingly, PTHrP expression in squamous cancer cells is constantly high throughout the cell cycle (Lam et al, 1997) suggesting that PTHrP expression becomes dysregulated in the course of carcinogenesis.
1.Autocrine actions via PTH1R There are a number of reports suggesting that PTHrP may contribute to the high proliferative activity of cancer cells. One report demonstrated that, in breast cancer, PTH1R expression correlates well with the expression of the proliferation marker Ki67 (Downey et al, 1997). In another study, the mitogenic effect of PTHrP on MCF-7 breast cancer cells was found to be increased when PTH1R was overexpressed (Hoey et al, 2003). In a third study using the same cell line, the PTH1R ligand PTHrP
454
Gene Therapy and Molecular Biology Vol 8, page 455 it was shown to trigger cell cycle entrance of quiescent cells.
expression of anti-apoptotic proteins Bcl-2 and Bcl-xL (Tovar Sepulveda et al, 2002). In both cases, the antiapoptotic PTHrP effect was mediated by the nuclear pathway of PTHrP. Also exogenous PTHrP peptides are potent anti-apoptotic factors. Treatment of chondrocytes with PTHrP (1-37) stimulated the expression of Bcl-2 in a PKA-dependent manner (Amling et al, 1997). PTHrP (134) and PTHrP (140-173), but not PTHrP (38-64), PTHrP (67-86) or PTHrP (107-139), were shown to protect lung cancer cells from UV-induced caspase 3 activation and apoptosis (Hastings et al, 2003). PTHrP (140-173) also prevented Fas-dependent apoptosis in these cells. Both PTHrP (1-37) and PTHrP (140-173) exerted their antiapoptotic effects by activating PKA (Amling et al, 1997, Hastings et al, 2004). PTH1R-interacting peptides, namely PTH (1-34), can also promote apoptosis. This was demonstrated for confluent PTH1R-expressing mesenchymal stem cells (Chen et al, 2002). Interestingly, at lower cell density, the same peptide induced the inverse effect. Both effects were dependent upon cAMP demonstrating again the dual character of the cAMP signaling system. Also Ca2+ can be involved in proapoptotic effects of PTH1R ligands, as was found for the apoptosis-inducing PTH effect on PTH1R overexpressing human embryonal kidney 293 cells (Turner et al, 2000).
B. PTHrP and invasion Invasive behavior is a hallmark of metastasizing cancer cells. For the acquisition of an invasive phenotype, cancer cells need to coordinate the interaction of many proteins involved in adhesion, migration and proteolysis of the extracellular matrix (ECM) (Price et al, 1997). PTHrP has been found to interfere with the expression of some of those proteins. In MCF-7 breast cancer cells and PC3 prostate cancer cells, overproduction of PTHrP induced the expression of a number of integrins, in particular integrins #6 and "4 (Shen and Falzon, 2003; Shen et al, 2004). Elevated levels of these integrins correlated with an enhanced ability of PTHrP-treated MCF-7 cells to migrate on the integrin #6/"4 ligand laminin and to invade extracellular matrix. Integrin #6/"4 has also been shown to increase invasiveness of MDA-MB-435 breast cancer cells (Shaw et al, 1997). Modulation of invasiveness and integrin expression by PTHrP in PC-3 and MCF-7 cells required the integrity of the PTHrP-NLS suggesting that PTHrP regulates invasiveness in these cells through the intracrine pathway. Effects of PTHrP on cellular invasiveness and on proteins involved in this process were also observed when PTHrP peptides were added exogenously. Administered to chondrocytes, PTHrP (1-141) and (1-84) peptides induced an increased expression of matrix metalloproteases MMP2, MMP3 and MMP9 (Kawashima-Ohya et al, 1998). Added to 8701-BC breast cancer cells, the PTHrP (67-86) peptide increased invasion and, at the same time, upregulated urokinase type plasminogen activator (uPA) (Luparello et al, 2003). This serine protease is involved in cancer mediated ECM degradation (Price et al, 1997) and has prognostic value for the survival of breast cancer patients (Harbeck et al, 2002). On the other hand, PTHrP (38-94) was found to reduce the ECM degrading activities of a number of breast cancer cell lines (Luparello et al, 2001). A single-nucleotide polymorphism in the C-terminal region of the murine PTHrP revealed that also the Cterminal part of PTHrP is important for invasion. Mice carrying the Pthlh Pro allele at amino acid 130 of the mature protein showed a higher susceptibility to skin tumorigenesis than mice harboring the PthlhThr allele (Manenti et al, 2000). When transfected into the human squamous cell carcinoma line NCI-H520, PthlhPro conferred to these cells a much greater ability to migrate than PthlhThr (Benelli et al, 2003).
VI. Regulation of PTHrP expression in cancer Given the evidence that links PTHrP expression to cancer progression, it is important to understand the mechanism(s) by which PTHrP is(are) regulated in cancer cells. PTHrP expression is mainly regulated on the transcriptional level (Inoue et al, 1993; Wysolmerski et al, 1996; Falzon, 1997; Lindemann et al, 2001). In humans, transcription of the PTHrP gene can be driven by three different promoters, P1, P2 and P3 (Figure 2). Of these promoters, the distal (P1) and proximal promoters (P3) were identified first (Suva et al, 1989; Mangin et al, 1990) and subsequently called P1 and P2, respectively. Later, when a third GC-rich promoter was found inbetween P1 and P2 (Vasavada et al, 1993), the GC-rich promoter became P2 and the proximal was renamed P3. The PTHrP transcripts that are generated by each promoter can easily be distinguished by certain non-coding exons that they specifically contain (Southby et al, 1995; Lindemann et al, 2001). This allows to assess the contribution of each promoter to the PTHrP expression in a given cell population. In solid cancers, the P3 promoter was found to be always active (Southby et al, 1995) and to increase its activity when breast cancers metastasize (Bouizar et al, 1999).
C. PTHrP and apoptosis Escaping apoptosis enables tumor cells to survive and proceed in the neoplastic process (Naik et al, 1996). By interfering with the apoptotic machinery, PTHrP may contribute to this important step in carcinogenesis. Overexpression of rat PTHrP rendered chondrocytes resistant to serum starvation-induced apoptosis (Henderson et al, 1995). Similarly, ectopic expression of PTHrP (-5/139) protected MCF-7 breast cancer cells from apoptosis which was accompanied by a rise in the
A. Regulation by Ets transcription factors One of the first proteins that have been shown to activate the P3 promoter was HTLV-I Tax1 (Dittmer et al, 1993). HTLV-I Tax1 is a unique viral protein encoded by the human T lymphotropic virus type I (HTLV-I) that causes adult T-cell leukemia/lymphoma (ATLL) (Franchini, 1995). In almost all ATLL patients, the PTHrP
455
!"##$%&'()$*+&#,-.%(+/(012&0(/+&(.,-.%&(3%4%5+*$%-#( !
! ! "#$%&'!*)!`37,'*^,)*+'$+%$)"#$"&/,'$1!231$7#'#5$!"#$/,7'*%*#.$,3#,$0"+M0$)"#$/,]+3$%&'()*+',-$#-#/#')0$+%$)"#$1!231$1B$43+/+)#3$ ,'.$)"#$)3,'0(3*4)*+'$%,()+30$)",)$",8#$F##'$0"+M'$)+$*')#3,()$M*)"$)"#0#$6UE$0#V&#'(#05$!"#$;#--+M$F,30$*'.*(,)#$M"*("$6UE$F*'.*'7$ /+)*%P8#0$*0P,3#$#00#')*,-$%+3$3#7&-,)*+'$+%$)"#$1B$43+/+)#3$F;$!K\!A$2!_a:Y$!,9A$3#)*'+*($,(*.A$4"+3F+-$#0)#3A$,.#'+8*3&0$43+)#*'$b?E$ SE.a$b?ET$+3$bK\5$6#),*-0$,3#$7*8#'$*'$)"#$)#9)5$ $ $
43+)#*'$ -#8#-$ *'$ )"#$ F-++.$ *0$ *'(3#,0#.$ Sc,/,7&("*$ #)$ ,-A$ ?@@QT$ ,'.$ 1!231$ *0$ .#)#(),F-#$ *'$ )"#$ -#&J#/*($ (#--0$ S[,),',F#$#)$,-A$?@@CT5$!,9?$*0$,$)3,'0(3*4)*+',-$,()*8,)+3$ )",)$ F;$ *)0#-%$ *0$ &',F-#$ )+$ F*'.$ )+$ 6UE$ ,'.A$ *'0)#,.A$ *')#3,()0$ M*)"$ )3,'0(3*4)*+'$ %,()+30$ )+$ /,'*4&-,)#$ )"#$ )3,'0(3*4)*+',-$ /,("*'#3;$ SK*)-*'$ #)$ ,-A$ ?@@BX$ _#'^/#*#3$ ,'.$U;F+37A$?@@@T5$[#$%+&'.$)",)$!,9?$)#)"#30$)+$b)0?A$,$ /#/F#3$+%$)"#$b)0$%,/*-;$+%$)3,'0(3*4)*+'$%,()+30$S6*))/#3A$ DCCBTA$)+$,()*8,)#$)"#$1!231$1B$43+/+)#35$!"#$*')#3,()*+'$ +%$ b)0?$ M*)"$ )"#$ 43+/+)#3$ ),J#0$ 4-,(#$ ,)$ ,$ );4*(,-$ b)0$ KKEE:(+'),*'*'7$ F*'.*'7$ 0*)#$ *'$ (-+0#$ 43+9*/*);$ )+$ ,$ GGGEG$ #-#/#')5$ !"#$ GGGEG$ #-#/#')$ M,0$ 0"+M'$ )+$ 3#(3&*)$>4?$)+$)"#$43+/+)#3$)+$%+3/$,'$b)0?P>4?$(+/4+0*)#$ #-#/#')$ )+7#)"#3$ M*)"$ )"#$ b)0$ 3#(+7'*)*+'$ /+)*%$ ,--+M*'7$ b)0?$ ,'.$ >4?$ )+$ (++4#3,)*8#-;$ ,()*8,)#$ )"#$ 43+/+)#3$ S6*))/#3$ #)$ ,-A$ ?@@QT5$ !,9?$ *0$ ,F-#$ )+$ %+3/$ ,$ )#3',3;$ (+/4-#9$ M*)"$ F+)"$ )3,'0(3*4)*+'$ %,()+30$ )+$ %&3)"#3$ 0)*/&-,)#$ )3,'0(3*4)*+'$ %3+/$ )"#$ 1B$ 43+/+)#3$ S6*))/#3$ #)$ ,-A$?@@RT5$$ b)0$ ,'.$ >4?$ F*'.*'7$ 0*)#0$ ,-0+$ 4-,;$ ,$ 3+-#$ *'$ 1B: .#4#'.#')$ 1!231$ )3,'0(3*4)*+'$ *'$ F3#,0)$ (,'(#3$ (#--05$ Y'$ W6E:Wd:DB?$(#--0A$!K\!:*'.&(#.$)3,'0(3*4)*+'$%3+/$)"#$ 1B$ 43+/+)#3$ 3#V&*3#0$ )"#$ 3#04+'0*8#$ #-#/#')0$ %+3$ b)0?A$ >4?$ ,'.$ ,'$ EKEG$ F*'.*'7$ 0*)#A$ M"*("$ M,0$ %+&'.$ )+$ 3#(3&*)$)"#$!K\!$#%%#()+30$>/,.BP>/,.Q$)+$)"#$43+/+)#3$ S_*'.#/,''$ #)$ ,-A$ DCC?T5$ Y'$ )"#$ 43#0#'(#$ +%$ !K\!A$ b)0?$ M,0$ 0"+M'$ )+$ 0;'#37*0)*(,--;$ ,()*8,)#$ )"#$ 1!231$ 1B$ 43+/+)#3$ *'$ (+'(#3)$ M*)"$ >/,.B5$ Y'$ ,73##/#')$ M*)"$ )"*0$ %*'.*'7A$ 0),F-#$ )3,'0%#()*+'$ +%$ W6E:Wd:DB?$ (#--0$ M*)"$ >/,.$ 43+)#*'0$ M#3#$ %+&'.$ )+$ *'(3#,0#$ !K\!:.#4#'.#')$
1!231$ 0#(3#)*+'$ SH,J+'#'$ #)$ ,-A$ DCCDT5$ G+'8#30#-;A$ 43#8#')*'7$ !K\!:/#.*,)#.$ >/,.B$ '&(-#,3$ */4+3)$ F;$ *'"*F*)*'7$4B<$WE1$J*',0#$,F+-*0"#.$)"#$!K\!$#%%#()$+'$ 1!231$#943#00*+'$SH,J+'#'$#)$,-A$DCCDX$_*'.#/,''$#)$,-A$ DCCB(T5$$ !K\!:.#4#'.#')$ 1!231$ #943#00*+'$ (+&-.$ ,-0+$ F#$ .*/*'*0"#.$ F;$ 1HG$ *'"*F*)+30$ S_*'.#/,''$ #)$ ,-A$ DCC?T5$ 1,3)*(&-,3-;A$ 1HG"$ M,0$ %+&'.$ )+$ F#$ */4+3),')$ %+3$ )"#$ !K\!:.#4#'.#')$ ,()*8,)*+'$ +%$ )"#$ 1B$ 43+/+)#3$ *'$ F3#,0)$ (,'(#3$ (#--05$ !"*0$ J*',0#$ *0$ 3#V&*3#.$ )+$ ,--+M$ b)0?$ )+$ ,()*8,)#$)"#$1B$43+/+)#3$*'$F3#,0)$(,'(#3$(#--0$S_*'.#/,''$ #)$,-A$DCCB,T$,'.$)+$/,*'),*'$b)0?$43+)#*'$#943#00*+'$*'$,$ 8,3*#);$ +%$ (,'(#3$ (#--0$ Sa#))#3$ #)$ ,-A$ DCCQT5$ \&3)"#3$ #8*.#'(#$ %+3$ 1HG0$ F#*'7$ *'8+-8#.$ *'$ 1B:.3*8#'$ 1!231$ #943#00*+'$ *0$ 43+8*.#.$ F;$ 0)&.*#0$ &0*'7$ 4"+3F+-$ #0)#3$ S1WET$ )+$ &43#7&-,)#$ 1!231$ #943#00*+'$ *'$ b)0?:.#%*(*#')$ WG\:R$ (#--0$ S_*'.#/,''$ #)$ ,-A$ DCCBFT5$ E$ 0;'#37*0)*($ #%%#()$ F#)M##'$ b)0DA$ ,$ (-+0#$ 3#-,)*8#$ +%$ b)0?A$ ,'.$ 1HG#$ M,0$ %+&'.$ )+$ /#.*,)#$ )"#$ 1WE:*'.&(#.$ ,()*8,)*+'$ +%$ )"#$ 1!231$ 1B$ 43+/+)#35$ E7,*'$ )"#$ *')#73*);$ +%$ )"#$ >4?$ F*'.*'7$0*)#$M,0$3#V&*3#.5$$ b)0?$ ,'.P+3$ b)0D$ ",8#$ ,-0+$ F##'$ %+&'.$ )+$ F#$ 4+)#')$ ,()*8,)+30$ +%$ )"#$ 1!231$ 43+/+)#3$ *'$ 43*/,3;$ "&/,'$ J#3,)*'+(;)#0$ SG"+$ #)$ ,-A$ DCCQTA$ *'$ 1?@$ #/F3;+',-$ (,3(*'+/,$ (#--0$ SH,34#3*#'$ #)$ ,-A$ ?@@RT$ ,'.$ )&/+3*7#'*($ F3#,0)$ #4*)"#-*,-$ (#--$ -*'#$ U>D!DE?$ SG,),*00+'$ #)$ ,-A$ DCCBT5$Y'$,..*)*+'A$)"#$b)0$F*'.*'7$0*)#$",0$F##'$3#4+3)#.$ )+$ /#.*,)#$ ,)$ -#,0)$ *'$ 4,3)$ )"#$ #%%#()$ +%$ 3#)*'+*($ ,(*.$ SH,34#3*#'$ #)$ ,-A$ ?@@RT$ ,'.$ ,.#'+8*3&0$ b?E$ +'$ 1B$ 43+/+)#3$ ,()*8*);$ S\+-#;$ #)$ ,-A$ ?@@@T5$ E-0+$ 0)*/&-,)*+'$ +%$ Q=O$
Gene Therapy and Molecular Biology Vol 8, page 457 PTHrP expression by epidermal growth factor (EGF)-like factors may involve the Ets binding site (Cho et al, 2004). EGF and EGF-like factors, such as transforming growth factor # and amphiregulin, are potent activators of PTHrP expression in a variety of cells (Allinson and Drucker, 1992; Burton and Knight, 1992; Ferrari et al, 1994; Heath et al, 1995; Cramer et al, 1996b; Cho et al, 2004). They are ligands of the EGF receptor (EGF-R, ErbB1) which is aberrantly expressed in many cancers (Kolibaba and Druker, 1997) and plays an important role in regulating proliferation in estrogen receptor-negative breast carcinoma cells (Biswas et al, 2000). Ets1 and Ets2 are both involved in carcinogenesis (Dittmer, 2003; Foos and Hauser, 2004) and are targets of the Ras/MEK1/Erk1/2 pathway (Yang et al, 1996; Seidel and Graves, 2002). Activation of this pathway leads to phosphorylation and superactivation of these Ets proteins. The Ras/MEK1/Erk1/2 pathway has shown to play a role in the regulation of PTHrP expression. E.g. in rat Leydig tumor H-500 cells, activation of the Ras/MEK/Erk pathway stimulated PTHrP expression (Aklilu et al, 2000) and, in keratinocytes, dominant negative versions of the Ras and Raf protein downregulated PTHrP P3 promoter activity (Cho et al, 2004). In addition, transfection with Ras alone or in combination with Src increased PTHrP production in fibroblasts (Li and Drucker, 1994; Motokura et al, 1995; Aklilu et al, 1997). Also cotransfection of fibroblasts with Ras and mutant p53 activated PTHrP expression (Motokura et al, 1995). In particular, the Ras/mutant p53 cooperative effect might have been mediated by Ets1, as mutant p53 has been shown to physically and functionally interact with this Ets protein (Sampath et al, 2001). Given the importance of Ets1 for PTHrP expression and the involvement of both proteins in invasion, it is reasonable to suggest that Ets1 may exert part of the invasion-promoting function through PTHrP.
mice (Endo et al, 1994; Cohen-Solal et al, 1995; El Abdaimi et al, 1999). There are conflicting data about the effect of estrogen, an important mitogen in mammary carcinogenesis (Keshamouni at al, 2002), on the regulation of PTHrP expression in breast cancer cells. In MCF-7 cells, both estrogen and anti-estrogen tamoxifen where shown to increase PTHrP mRNA levels in MCF-7 breast cancer cells (Funk and Wei, 1998), whereas, in KPL-3C breast cancer cells, estrogen inhibited and tamoxifen stimulated PTHrP secretion (Kurebayashi and Sonoo, 1997). Estrogen has also been demonstrated to interfere with PTHrP action by inhibiting PTHrP-induced bone resorption (Kanatani et al, 1998). PTHrP and calcium seem to be linked in several ways. Not only can PTHrP increase the blood calcium level and intracellularly activate the calcium-signalling pathway, but it also can respond to extracellular calcium (Buchs et al, 2000; Tfelt-Hansen et al, 2003). Extracellular calcium is an important regulator of proliferation and differentiation of normal cells. Deregulation of its receptor, the calcium-sensing receptor (CaR), in cancer cells can lead to cancer progression (Rodland, 2004). CaR was shown to be responsible for the calcium-dependent activation of PTHrP transcription in H-500 cells (TfeltHansen et al, 2003). CaR has also been found to upregulate PTHrP synthesis and secretion in astrocytomas, menigiomas and breast cancer cells (Chattopadhyay et al, 2000; Sanders et al, 2000). Overexpression and activation of CaR in HEK293 cells revealed that MAP kinases ERK1/2 and p38 are involved in the CaR effect on PTHrP expression (MacLeod et al, 2003). PTHrP expression is also influenced by the substratum cells are attached to. Depending on the extracellular matrix protein pancreatic adenocarcinoma cells were grown on, PTHrP expression was either up- or downregulated (Grzesiak et al, 2004). Reduced expression of PTHrP was found when cells were plated on type I and IV collagen or laminin, whereas higher expression was observed with fibronectin or vitronectin. Gene silencing may be another way by which PTHrP abundance is regulated. Gene silencing can be epigenetically induced by CpG island methylation which appear to occur in cancer cells in an increased rate (Jones and Laird, 1999). In the PTHrP gene, a single CpG island is located upstream of the P3 promoter (Ganderton et al, 1995; Holt et al, 1993). In lung cancer biopsies, PTHrP expression was found to be independent of the methylation status of this CpG island (Ganderton and Briggs, 2000). However, Methylation of certain CpG dinucleotides upstream of the CpG island were shown to influence PTHrP expression in renal carcinoma cell lines (Holt et al, 1993). PTHrP expression seems also be controlled on the post-trancriptional level. Von Hippel-Landau tumor suppressor gene has been demonstrated to negatively regulate PTHrP in clear cell renal carcinoma via a posttranscriptional mechanism (Massfelder et al, 2004). In oral squamous carcinoma cells, TGF" has been shown to stimulate expression of PTHrP in part by increasing the stability of its RNA (Sellers et al, 2002). In osteosarcoma
B. Other PTHrP regulating factors A variety of other proteins have been shown to stimulate PTHrP expression in cancer cells. In lung cancer cells, PTHrP production is increased in response to tumor necrosis factor # (TNF#) and interleukin-6 (IL-6) (Rizzoli et al, 1994). In HTLV-I infected MT-2 leukaemic cells and in the human lung cancer cell line BEN, PTHrP expression can be augmented by agents that raise the cAMP level (Ikeda et al, 1993b; Chilco et al, 1998). Calcitonin and cAMP have been shown to activate the P1 and the P3 promoter (Chilco et al, 1998). In the P1 promoter, a cAMP-responsive element (CRE) could be identified that mediates these effects. Steriods, such as 1,25-dihydroxyvitamin D3, dexamethasone and androgens, have been found to inhibit PTHrP expression in cancer cells on the transcriptional level (Ikeda et al, 1993a; Inoue et al, 1993; Glatz et al, 1994; Rizzoli et al, 1994; Falzon, 1997; Tovar Sepulveda and Falzon, 2002; Pizzi et al, 2003). Vitamin D was shown to affect P3 and upstream PTHrP promoters (Endo et al, 1994). Dexamethasone and non-calcaemic vitamin D analogues were also demonstrated to inhibit tumordependent hypercalcaemia and to reduce tumor burden in
457
Dittmer: Importance of PTHrP for cancer development expression reduces malignant pituitary tumor progression and metastases in the rat. Cancer Res 56, 77-86. Aklilu F, Gladu J, Goltzman D and Rabbani SA (2000) Role of mitogen-activated protein kinases in the induction of parathyroid hormone-related peptide. Cancer Res 60, 17531760. Aklilu F, Park M, Goltzman D and Rabbani SA (1997) Induction of parathyroid hormone-related peptide by the Ras oncogene: role of Ras farnesylation inhibitors as potential therapeutic agents for hypercalcemia of malignancy. Cancer Res 57, 4517-4522. Allinson ET and Drucker DJ (1992) Parathyroid hormone-like peptide shares features with members of the early response gene family: rapid induction by serum, growth factors and cycloheximide. Cancer Res 52, 3103-3109. Alvarez J, Sohn P, Zeng X, Doetschman T, Robbins DJ and Serra R (2002) TGF2 mediates the effects of hedgehog on hypertrophic differentiation and PTHrP expression. Development 129, 1913-1924. Amling M, Neff L, Tanaka S, Inoue D, Kuida K, Weir E, Philbrick WM, Broadus AE and Baron R (1997) Bcl-2 lies downstream of parathyroid hormone-related peptide in a signaling pathway that regulates chondrocyte maturation during skeletal development. J Cell Biol 136, 205-213. Asadi F, Faraj M, Malakouti S and Kukreja SC (2001) Effect of parathyroid hormone related protein and dihydrotestosterone on proliferation and ornithine decarboxylase mRNA in human prostate cancer cell lines. Int Urol Nephrol 33, 417422. Bakre MM, Zhu Y, Yin H, Burton DW, Terkeltaub R, Deftos LJ and Varner JA (2002) Parathyroid hormone-related peptide is a naturally occurring, protein kinase A-dependent angiogenesis inhibitor. Nat Med 8, 995-1003. Beier F, Ali Z, Mok D, Taylor AC, Leask T, Albanese C, Pestell RG and LuValle P (2001) TGF" and PTHrP control chondrocyte proliferation by activating cyclin D1 expression. Mol Biol Cell 12, 3852-3863. Bendre MS, Gaddy-Kurten D, Mon-Foote T, Akel NS, Skinner RA, Nicholas RW and Suva LJ (2002) Expression of interleukin 8 and not parathyroid hormone-related protein by human breast cancer cells correlates with bone metastasis in vivo. Cancer Res 62, 5571-5579. Bendre MS, Montague DC, Peery T, Akel NS, Gaddy D and Suva LJ (2003) Interleukin-8 stimulation of osteoclastogenesis and bone resorption is a mechanism for the increased osteolysis of metastatic bone disease. Bone 33, 28-37. Benelli R, Peissel B, Manenti G, Gariboldi M, Vanzetto C, Albini A and Dragani TA (2003) Allele-specific patterns of the mouse parathyroid hormone-related protein: influences on cell adhesion and migration. Oncogene 22, 7711-7715. Birch MA, Carron JA, Scott M, Fraser WD and Gallagher JA (1995) Parathyroid hormone (PTH)/PTH-related protein (PTHrP) receptor expression and mitogenic responses in human breast cancer cell lines. Br J Cancer 72, 90-95. Biswas DK, Cruz AP, Gansberger E and Pardee AB (2000) Epidermal growth factor-induced nuclear factor kappa B activation: A major pathway of cell-cycle progression in estrogen-receptor negative breast cancer cells. Proc Natl Acad Sci U S A 97, 8542-8547. Blobe GC, Shiemann WP and Lodish HF (2000) Role of Transforming growth factor in Human Disease. N. Eng. J. Med. 342, 1350-1358. Bouizar Z, Spyratos F and De vernejoul MC (1999) The parathyroid hormone-related protein (PTHrP) gene: use of downstream TATA promotor and PTHrP 1-139 coding pathways in primary breast cancers vary with the occurrence of bone metastasis. J Bone Miner Res 14, 406-414.
cells, serum increased PTHrP expression by both upregulation of transcription and stabilization of PTHrP RNA (Falzon, 1996). There is also evidence, that in prostate cancer, PSA inactivates PTHrP by proteolytic cleavage (Cramer et al, 1996a; Iwamura et al, 1996).
VII. Concluding remarks Originally identified as a tumor-derived factor that induces the paraneoplastic syndrome HHM, it is now generally accepted that PTHrP also plays a role in stimulating local osteolysis, thereby, facilitating growth of metastatic cancer in the bony tissue. In addition, PTHrP has the potential to regulate proliferation, invasion and apoptosis in cancer cells in a way that is beneficial for tumor growth. On the other hand, PTHrP has shown to have anti-mitogenic effects and to inhibit angiogenesis (Bakre et al, 2002) suggesting that PTHrP may also act as an anti-tumor factor. Which of these activities of PTHrP prevail might depend on the type of tumor and tumor stage. While the prognostic value of PTHrP in human cancer is still unclear, PTHrP may be a useful predictive marker for anti-PTHrP treatment response in bone metastasis. A number of attempts have been made to suppress PTHrP expression in cancer cells. Factors that downregulate PTHrP transcription, such as vitamin D analogues and modified guanosine nucleotides, have been successfully used to inhibit PTHrP expression, hypercalcaemia, osteolysis and bone metastasis in mice (El Abdaimi et al, 1999; Gallwitz et al, 2002). PKC inhibitors, novel anti-cancer drugs that have entered clinical trials (Roychowdhury and Lahn, 2003), may also be suitable to attenuate PTHrP synthesis on the transcriptional level (Lindemann et al, 2001). By a different mechanism, prostate secretory protein PSP-94 was found to suppress the ability of prostate cancer cells to synthesize PTHrP, to grow and to form skeletal metastases in rats (Shukeir et al, 2004). In another approach, PTHrP activity is inhibited by an anti-PTHrP antibody, originally shown by Guise et al (1996) to reduce formation of bone metastasis in tumor-bearing mice and now being humanized (Sato et al, 2003) for the use in clinical trials. Further analysis of the mechanism underlying the regulation of PTHrP expression in cancer is needed to identify further targets for an anti-PTHrP therapy. It is also important to identify the PTHrP-responsive genes and to clarify the role of nuclear PTHrP in order to understand the action of PTHrP in cancer.
Acknowledgments This work was supported by BMBF grant NBL3 FKZ 6/07.
References Aarts MM, Levy D, He B, Stregger S, Chen T, Richard S and Henderson JE (1999) Parathyroid hormone-related protein interacts with RNA. J Biol Chem 274, 4832-4838. Akino K, Ohtsuru A, Yano H, Ozeki S, Namba H, Nakashima M, Ito M, Matsumoto T and Yamashita S (1996) Antisense inhibition of parathyroid hormone-related peptide gene
458
Gene Therapy and Molecular Biology Vol 8, page 459 Buchs N, Manen D, Bonjour JP and Rizzoli R (2000) Calcium stimulates parathyroid hormone-related protein production in Leydig tumor cells through a putative cation-sensing mechanism. Eur J Endocrinol 142, 500-505. Burton PB and Knight DE (1992) Parathyroid hormone-related peptide can regulate the growth of human lung cancer cells and may form part of an autocrine TGF-" loop. FEBS Lett 305, 228-232. Cataisson C, Gordon J, Roussiere M, Abdalkhani A, Lindemann RK, Dittmer J, Foley J and Bouizar Z (2003) Ets-1 activates parathyroid hormone-related protein gene expression in tumorigenic breast epithelial cells. Mol. Cell. Endocrinol 204, 155-168 Cataisson C, Lieberherr M, Cros M, Gauville C, Graulet AM, Cotton J, Calvo F, de Vernejoul MC, Foley J and Bouizar Z (2000) Parathyroid hormone-related peptide stimulates proliferation of highly tumorigenic human SV40immortalized breast epithelial cells. J Bone Miner Res 15, 2129-2139. Chattopadhyay N, Evliyaoglu C, Heese O, Carroll R, Sanders J, Black P and Brown EM (2000) Regulation of secretion of PTHrP by Ca(2+)-sensing receptor in human astrocytes, astrocytomas and meningiomas. Am J Physiol Cell Physiol 279, C691-C699. Chen HL, Demiralp B, Schneider A, Koh AJ, Silve C, Wang CY and McCauley LK (2002) Parathyroid hormone and parathyroid hormone-related protein exert both pro- and antiapoptotic effects in mesenchymal cells. J Biol Chem 277, 19374-19381. Chilco PJ, Leopold V and Zajac JD (1998) Differential regulation of the parathyroid hormone-related protein gene P1 and P3 promoters by cAMP. Mol Cell Endocrinol 138, 173-184. Cho YM, Lewis DA, Koltz PF, Richard V, Gocken TA, Rosol TJ, Konger RL, Spandau DF and Foley J (2004) Regulation of parathyroid hormone-related protein gene expression by epidermal growth factor-family ligands in primary human keratinocytes. J Endocrinol 181, 179-190. Cingolani G, Bednenko J, Gillespie MT and Gerace L (2002) Molecular basis for the recognition of a nonclassical nuclear localization signal by importin ". Mol Cell 10, 1345-1353. Cohen-Solal ME, Bouizar Z, Denne MA, Graulet AM, Gueris J, Bracq S, Jullienne A and de Vernejoul MC (1995) 1,25 dihydroxyvitamin D and dexamethasone decrease in vivo Walker carcinoma growth, but not parathyroid hormone related protein secretion. Horm Metab Res 27, 403-407. Conlan LA, Martin TJ and Gillespie MT (2002) The COOHterminus of parathyroid hormone-related protein (PTHrP) interacts with "-arrestin 1B. FEBS Lett 527, 71-75. Cornish J, Callon KE, Nicholson GC and Reid IR (1997) Parathyroid hormone-related protein-(107-139) inhibits bone resorption in vivo. Endocrinology 138, 1299-1304. Cramer SD, Chen Z and Peehl DM (1996a) Prostate specific antigen cleaves parathyroid hormone-related protein in the PTH-like domain: inactivation of PTHrP-stimulated cAMP accumulation in mouse osteoblasts. J Urol 156, 526-531. Cramer SD, Peehl DM, Edgar MG, Wong ST, Deftos LJ and Feldman D (1996b) Parathyroid hormone--related protein (PTHrP) is an epidermal growth factor-regulated secretory product of human prostatic epithelial cells. Prostate 29, 2029. de la Mata J, Uy HL, Guise TA, Story B, Boyce BF, Mundy GR and Roodman GD (1995) Interleukin-6 enhances hypercalcemia and bone resorption mediated by parathyroid hormone-related protein in vivo. J Clin Invest 95, 28462852.
dePapp AE and Stewart AF (1993) Parathyroid hormone-related protein: a peptide of diverse physiologic functions. Trends Endocrinol Metab 4, 181-183. Diefenbach-Jagger H, Brenner C, Kemp BE, Baron W, McLean J, Martin TJ, and Moseley JM (1995) Arg21 is the preferred kexin cleavage site in parathyroid-hormone-related protein. Eur J Biochem 229, 91-8. Ditmer LS, Burton DW, and Deftos LJ (1996) Elimination of the carboxy-terminal sequences of parathyroid hormone-related protein 1-173 increases production and secretion of the truncated forms. Endocrinology 137, 1608-17. Dittmer J (2003) The Biology of the Ets1 Proto-Oncogene. Mol Cancer 2, 29. Dittmer J, Gegonne A, Gitlin SD, Ghysdael J and Brady JN (1994) Regulation of parathyroid hormone-related protein (PTHrP) gene expression. Sp1 binds through an inverted CACCC motif and regulates promoter activity in cooperation with Ets1. J Biol Chem 269, 21428-21434. Dittmer J, Gitlin SD, Reid RL and Brady JN (1993) Transactivation of the P2 promoter of parathyroid hormonerelated protein by human T-cell lymphotropic virus type I Tax1: evidence for the involvement of transcription factor Ets1. J Virol 67, 6087-6095. Dittmer J, Pise-Masison CA, Clemens KE, Choi KS and Brady JN (1997) Interaction of human T-cell lymphotropic virus type I Tax, Ets1 and Sp1 in transactivation of the PTHrP P2 promoter. J Biol Chem 272, 4953-4958. Dougherty KM, Blomme EA, Koh AJ, Henderson JE, Pienta KJ, Rosol TJ and McCauley LK (1999) Parathyroid hormonerelated protein as a growth regulator of prostate carcinoma. Cancer Res 59, 6015-6022. Downey SE, Hoyland J, Freemont AJ, Knox F, Walls J and Bundred NJ (1997) Expression of the receptor for parathyroid hormone-related protein in normal and malignant breast tissue. J Pathol 183, 212-217. Dunbar ME, Young P, Zhang JP, McCaughern-Carucci J, Lanske B, Orloff JJ, Karaplis A, Cunha G and Wysolmerski JJ (1998) Stromal cells are critical targets in the regulation of mammary ductal morphogenesis by parathyroid hormonerelated protein. Dev Biol 203, 75-89. El Abdaimi K, Papavasiliou V, Rabbani SA, Rhim JS, Goltzman D and Kremer R (1999) Reversal of hypercalcemia with the vitamin D analogue EB1089 in a human model of squamous cancer. Cancer Res 59, 3325-3328. Endo K, Ichikawa F, Uchiyama Y, Katsumata K, Ohkawa H, Kumaki K, Ogata E and Ikeda K (1994) Evidence for the uptake of a vitamin D analogue (OCT) by a human carcinoma and its effect of suppressing the transcription of parathyroid hormone-related peptide gene in vivo. J Biol Chem 269, 32693-32699. Falzon M (1996) Serum stimulation of parathyroid hormonerelated peptide gene expression in ROS 17/2.8 osteosarcoma cells through transcriptional and posttranscriptional mechanisms. Endocrinology 137, 3681-3688. Falzon M (1997) The noncalcemic vitamin D analogues EB1089 and 22-oxacalcitriol interact with the vitamin D receptor and suppress parathyroid hormone-related peptide gene expression. Mol Cell Endocrinol 127, 99-108. Falzon M and Du P (2000) Enhanced growth of MCF-7 breast cancer cells overexpressing parathyroid hormone-related peptide. Endocrinology 141, 1882-1892. Fenton AJ, Martin TJ and Nicholson GC (1994) Carboxylterminal parathyroid hormone-related protein inhibits bone resorption by isolated chicken osteoclasts. J Bone Miner Res 9, 515-519. Ferrari SL, Behar V, Chorev M, Rosenblatt M and Bisello A (1999) Endocytosis of ligand-human parathyroid hormone receptor 1 complexes is protein kinase C-dependent and
459
Dittmer: Importance of PTHrP for cancer development human breast cancer-mediated osteolysis. J Clin Invest 98, 1544-1549. Guise TA, Yoneda T, Yates AJ and Mundy GR (1993) The combined effect of tumor-produced parathyroid hormonerelated protein and transforming growth factor-a enhance hypercalcemia in vivo and bone resorption in vitro. J Clin Endocrinol Metab 77, 40-45. Gujral A, Burton DW, Terkeltaub R and Deftos LJ (2001) Parathyroid hormone-related protein induces interleukin 8 production by prostate cancer cells via a novel intracrine mechanism not mediated by its classical nuclear localization sequence. Cancer Res 61, 2282-2288. Harbeck N, Schmitt M, Kates RE, Kiechle M, Zemzoum I, Janicke F and Thomssen C (2002) Clinical utility of urokinase-type plasminogen activator and plasminogen activator inhibitor-1 determination in primary breast cancer tissue for individualized therapy concepts. Clin Breast Cancer 3, 196-200. Hastings RH, Araiza F, Burton DW, Bedley M and Deftos LJ (2004) Parathyroid Hormone-Related Protein Regulates Apoptosis in Lung Cancer Cells through Protein Kinase A. Am J Physiol Cell Physiol, in press Hastings RH, Araiza F, Burton DW, Zhang L, Bedley M and Deftos LJ (2003) Parathyroid hormone-related protein ameliorates death receptor-mediated apoptosis in lung cancer cells. Am J Physiol Cell Physiol 285, C1429-C1436. Heath JK, Southby J, Fukumoto S, O'Keeffe LM, Martin TJ and Gillespie MT (1995) Epidermal growth factor-stimulated parathyroid hormone-related protein expression involves increased gene transcription and mRNA stability. Biochem J 307 ( Pt 1), 159-167. Henderson JE, Amizuka N, Warshawsky H, Biasotto D, Lanske BM, Goltzman D and Karaplis AC (1995) Nucleolar localization of parathyroid hormone-related peptide enhances survival of chondrocytes under conditions that promote apoptotic cell death. Mol Cell Biol 15, 4064-4075. Henderson M, Danks J, Moseley J, Slavin J, Harris T, McKinlay M, Hopper J and Martin T (2001) Parathyroid hormonerelated protein production by breast cancers, improved survival and reduced bone metastases. J Natl Cancer Inst 93, 234-237. Hiraki A, Ueoka H, Bessho A, Segawa Y, Takigawa N, Kiura K, Eguchi K, Yoneda T, Tanimoto M and Harada M (2002) Parathyroid hormone-related protein measured at the time of first visit is an indicator of bone metastases and survival in lung carcinoma patients with hypercalcemia. Cancer 95, 1706-1713. Hoey RP, Sanderson C, Iddon J, Brady G, Bundred NJ and Anderson NG (2003) The parathyroid hormone-related protein receptor is expressed in breast cancer bone metastases and promotes autocrine proliferation in breast carcinoma cells. Br J Cancer 88, 567-573. Holt EH, Vasavada RC, Bander NH, Broadus AE and Philbrick WM (1993) Region-specific methylation of the parathyroid hormone-related peptide gene determines its expression in human renal carcinoma cell lines. J Biol Chem 268, 2063920645. Horiuchi N, Caulfield MP, Fisher JE, Goldman ME, McKee RL, Reagan JE, Levy JJ, Nutt RF, Rodan SB, Schofield TL, et al (1987) Similarity of synthetic peptide from human tumor to parathyroid hormone in vivo and in vitro. Science 238, 15661568. Ikeda K, Charles L, Weir EC, Mangin M and Broadus AE (1993a) Transcriptional regulation of the parathyroid hormone-related gene by glucocorticoids and vitamin D in a human C-cell line. J Biol Chem 264, 15743-15746. Ikeda K, Okazaki R, Inoue D, Ogata E and Matsumoto T (1993b) Transcription of the gene for parathyroid hormone-related
involves "-arrestin2. Real-time monitoring by fluorescence microscopy. J Biol Chem 274, 29968-29975. Ferrari SL, Rizzoli R and Bonjour JP (1994) Effects of epidermal growth factor on parathyroid hormone-related protein production by mammary epithelial cells. J Bone Miner Res 9, 639-644. Fiaschi-Taesch N, Takane KK, Masters S, Lopez-Talavera JC and Stewart AF (2004) Parathyroid hormone-related protein as a regulator of pRb and the cell cycle in arterial smooth muscle. Circulation 110, 177-185. Fiaschi-Taesch NM and Stewart AF (2003) Minireview: parathyroid hormone-related protein as an intracrine factor-trafficking mechanisms and functional consequences. Endocrinology 144, 407-411. Foley J, Wysolmerski JJ, Missero C, King CS and Philbrick WM (1999) Regulation of parathyroid hormone-related protein gene expression in murine keratinocytes by E1A isoforms: a role for basal promoter and Ets-1 site. Mol Cell Endocrinol 156, 13-23. Franchini G (1995) Molecular mechanisms of human T-cell leukemia/lymphotropic virus type I infection. Blood 86, 3619-3639. Fujita T, Meguro T, Fukuyama R, Nakamuta H and Koida M (2002) New signaling pathway for parathyroid hormone and cyclic AMP action on extracellular-regulated kinase and cell proliferation in bone cells. Checkpoint of modulation by cyclic AMP. J Biol Chem 277, 22191-22200. Funk JL, and Wei H (1998) Regulation of parathyroid hormonerelated protein expression in MCF-7 breast carcinoma cells by estrogen and antiestrogens. Biochem Biophys Res Commun 251, 849-54. Gallwitz WE, Guise TA and Mundy GR (2002) Guanosine nucleotides inhibit different syndromes of PTHrP excess caused by human cancers in vivo. J Clin Invest 110, 15591572. Ganderton RH and Briggs RS (2000) Increased upstream methylation has no influence on the overexpression of the parathyroid hormone-related protein gene in squamous cell carcinoma of the lung. Eur J Cancer 36, 2128-2136. Ganderton RH, Day IN and Briggs RS (1995) Patterns of DNA methylation of the parathyroid hormone-related protein gene in human lung carcinoma. Eur J Cancer 31A, 1697-1700. Glatz JA, Heath JK, Southby J, O'Keeffe LM, Kiriyama T, Moseley JM, Martin TJ and Gillespie MT (1994) Dexamethasone regulation of parathyroid hormone-related protein (PTHrP) expression in a squamous cancer cell line. Mol Cell Endocrinol 101, 295-306. Goltzman D, Karaplis AC, Kremer R and Rabbani SA (2000) Molecular basis of the spectrum of skeletal complications of neoplasia. Cancer 88, 2903-2908. Goomer RS, Johnson KA, Burton DW, Amiel D, Maris TM, Gurjal A, Deftost LJ and Terkeltaub R (2000) The tetrabasic KKKK(147-150) motif determines intracrine regulatory effects of PthrP 1-173 on chondrocyte PPi metabolism and matrix synthesis. Endocrinology 141, 4613-4622. Grill V, Rankin W and Martin TJ (1998) Parathyroid hormonerelated protein (PTHrP) and hypercalcaemia. Eur J Cancer 34, 222-229. Grzesiak JJ, Clopton P, Chalberg C, Smith K, Burton DW, Silletti S, Moossa AR, Deftos LJ and Bouvet M (2004) The extracellular matrix differentially regulates the expression of PTHrP and the PTH/PTHrP receptor in FG pancreatic cancer cells. Pancreas 29, 85-92. Guise TA (1997) Parathyroid hormone-related protein and bone metastases. Cancer 80, 1572-1580. Guise TA, Yin JJ, Taylor SD, Kumagai Y, Dallas M, Boyce BF, Yoneda T and Mundy GR (1996) Evidence for a causal role of parathyroid hormone-related protein in the pathogenesis of
460
Gene Therapy and Molecular Biology Vol 8, page 461 peptide from the human is activated through a cAMPdependent pathway by prostaglandin E1 in HTLV-I-infected T cells. J Biol Chem 268, 1174-1179. Inoue D, Matsumoto T, Ogata E and Ikeda K (1993) 22Oxacalcitriol, a noncalcemic analogue of calcitriol, suppresses both cell proliferation and parathyroid hormonerelated peptide gene expression in human T cell lymphotrophic virus, type I-infected T cells. J Biol Chem 268, 16730-16736. Iwamura M, Hellman J, Cockett AT, Lilja H and Gershagen S (1996) Alteration of the hormonal bioactivity of parathyroid hormone-related protein (PTHrP) as a result of limited proteolysis by prostate-specific antigen. Urology 48, 317325. Jones PA and Laird PW (1999) Cancer epigenetics comes of age. Nat Genet 21, 163-167. Juppner H, Abou-Samra AB, Freeman M, Kong XF, Schipani E, Richards J, Kolakowski LF, Jr., Hock J, Potts JT, Jr., Kronenberg HM, et al (1991) A G protein-linked receptor for parathyroid hormone and parathyroid hormone-related peptide. Science 254, 1024-1026. Kakonen SM and Mundy GR (2003) Mechanisms of osteolytic bone metastases in breast carcinoma. Cancer 97, 834-839. Kakonen SM, Selander KS, Chirgwin JM, Yin JJ, Burns S, Rankin WA, Grubbs BG, Dallas M, Cui Y and Guise TA (2002) Transforming growth factor-" stimulates parathyroid hormone-related protein and osteolytic metastases via Smad and mitogen-activated protein kinase signaling pathways. J Biol Chem 277, 24571-24578. Kanatani M, Sugimoto T, Takahashi Y, Kaji H, Kitazawa R, and Chihara K (1998) Estrogen via the estrogen receptor blocks cAMP-mediated parathyroid hormone (PTH)-stimulated osteoclast formation. J Bone Miner Res 13, 854-62. Karaplis AC and Deckelbaum RA (1998) Role of PTHrP and PTH-1 receptor in endochondral bone development. Front Biosci 3, D795-D803. Karaplis AC, Luz A, Glowacki J, Bronson RT, Tybulewicz VL, Kronenberg HM and Mulligan RC (1994) Lethal skeletal dysplasia from targeted disruption of the parathyroid hormone-related peptide gene. Genes Dev 8, 277-289. Karp SJ, Schipani E, St-Jacques B, Hunzelman J, Kronenberg H and McMahon AP (2000) Indian hedgehog coordinates endochondral bone growth and morphogenesis via parathyroid hormone related-protein-dependent and independent pathways. Development 127, 543-548. Karperien M, Farih-Sips H, Lowik CW, de Laat SW, Boonstra J and Defize LH (1997) Expression of the parathyroid hormone-related peptide gene in retinoic acid-induced differentiation: involvement of ETS and Sp1. Mol Endocrinol 11, 1435-1448. Kawashima-Ohya Y, Satakeda H, Kuruta Y, Kawamoto T, Yan W, Akagawa Y, Hayakawa T, Noshiro M, Okada Y, Nakamura S and Kato Y (1998) Effects of parathyroid hormone (PTH) and PTH-related peptide on expressions of matrix metalloproteinase-2, -3 and -9 in growth plate chondrocyte cultures. Endocrinology 139, 2120-2127. Kemp BE, Moseley JM, Rodda CP, Ebeling PR, Wettenhall RE, Stapleton D, Diefenbach-Jagger H, Ure F, Michelangeli VP, Simmons HA, et al (1987) Parathyroid hormone-related protein of malignancy: active synthetic fragments. Science 238, 1568-1570. Keshamouni VG, Mattingly RR, and Reddy KB (2002) Mechanism of 17-"-estradiol-induced Erk1/2 activation in breast cancer cells. A role for HER2 AND PKC-delta. J Biol Chem 277, 22558-65. Kitazawa S and Kitazawa R (2002) RANK ligand is a prerequisite for cancer-associated osteolytic lesions. J Pathol 198, 228-236.
Kobayashi T, Chung UI, Schipani E, Starbuck M, Karsenty G, Katagiri T, Goad DL, Lanske B and Kronenberg HM (2002) PTHrP and Indian hedgehog control differentiation of growth plate chondrocytes at multiple steps. Development 129, 2977-2986. Kolibaba KS and Druker BJ (1997) Protein tyrosine kinases and cancer. Biochim Biophys Acta 1333, F217-F248. Kurebayashi J, and Sonoo H (1997) Parathyroid hormone-related protein secretion is inhibited by oestradiol and stimulated by antioestrogens in KPL-3C human breast cancer cells. Br J Cancer 75, 1819-25. Lam MH, Briggs LJ, Hu W, Martin TJ, Gillespie MT and Jans DA (1999a) Importin " recognizes parathyroid hormonerelated protein with high affinity and mediates its nuclear import in the absence of importin. J Biol Chem 274, 73917398. Lam MH, House CM, Tiganis T, Mitchelhill KI, Sarcevic B, Cures A, Ramsay R, Kemp BE, Martin TJ and Gillespie MT (1999b) Phosphorylation at the cyclin-dependent kinases site (Thr85) of parathyroid hormone-related protein negatively regulates its nuclear localization. J Biol Chem 274, 1855918566. Lam MH, Olsen SL, Rankin WA, Ho PW, Martin TJ, Gillespie MT and Moseley JM (1997) PTHrP and cell division: expression and localization of PTHrP in a keratinocyte cell line (HaCaT) during the cell cycle. J Cell Physiol 173, 433446. Lenzmeier BA and Nyborg JK (1999) Molecular mechanisms of viral transcription and cellular deregulation associated with the HTLV-I Tax protein. Gene Ther Mol Biol 3, 327-345. Li X and Drucker DJ (1994) Parathyroid hormone-related peptide is a downstream target for ras and src activation. J Biol Chem 269, 6263-6266. Lindemann RK, Ballschmieter P, Nordheim A and Dittmer J (2001) Transforming growth factor " regulates parathyroid hormone-related protein expression in MDA-MB-231 breast cancer cells through a novel Smad/Ets synergism. J Biol Chem 276, 46661-46670. Lindemann RK, Braig M, Ballschmieter P, Guise TA, Nordheim A and Dittmer J (2003a) Protein kinase C regulates Ets1 transcriptional activity in invasive breast cancer cells. Int J Oncol 22, 799-805. Lindemann RK, Braig M, Hauser CA, Nordheim A and Dittmer J (2003b) Ets2 and PKCepsilon are important regulators of parathyroid hormone-related protein expression in MCF-7 breast cancer cells. Biochem J 372, 787-797. Lindemann RK, Nordheim A and Dittmer J (2003c) Interfering with TGF"-induced Smad3 nuclear accumulation differentially affects TGF"-dependent gene expression. Mol Cancer 2, 20. Linforth R anderson N, Hoey R, Nolan T, Downey S, Brady G, Ashcroft L and Bundred N (2002) Coexpression of parathyroid hormone related protein and its receptor in early breast cancer predicts poor patient survival. Clin Cancer Res 8, 3172-3177. Luparello C, Romanotto R, Tipa A, Sirchia R, Olmo N, Lopez de Silanes I, Turnay J, Lizarbe MA and Stewart AF (2001) Midregion parathyroid hormone-related protein inhibits growth and invasion in vitro and tumorigenesis in vivo of human breast cancer cells. J Bone Miner Res 16, 21732181. Luparello C, Sirchia R and Pupello D (2003) PTHrP [67-86] regulates the expression of stress proteins in breast cancer cells inducing modifications in urokinase-plasminogen activator and MMP-1 expression. J Cell Sci 116, 2421-2430. MacLean HE, Guo J, Knight MC, Zhang P, Cobrinik D and Kronenberg HM (2004) The cyclin-dependent kinase
461
Dittmer: Importance of PTHrP for cancer development inhibitor p57(Kip2) mediates proliferative actions of PTHrP in chondrocytes. J Clin Invest 113, 1334-1343. MacLeod RJ, Chattopadhyay N and Brown EM (2003) PTHrP stimulated by the calcium-sensing receptor requires MAP kinase activation. Am J Physiol Endocrinol Metab 284, E435-E442. Maioli E and Fortino V (2004a) The complexity of parathyroid hormone-related protein signalling. Cell Mol Life Sci 61, 257-262. Maioli E and Fortino V (2004b) PTHrP on MCF-7 breast cancer cells: a growth factor or an antimitogenic peptide? Br J Cancer 90, 1293-1294 Manenti G, Peissel B, Gariboldi M, Falvella FS, Zaffaroni D, Allaria B, Pazzaglia S, Rebessi S, Covelli V, Saran A and Dragani TA (2000) A cancer modifier role for parathyroid hormone-related protein. Oncogene 19, 5324-5328. Mangin M, Ikeda K, Dreyer BE and Broadus AE (1990) Identification of an up-stream promoter of the human parathyroid hormone-related peptide gene. Mol Endocrinol 4, 851-858. Mannstadt M, Juppner H and Gardella TJ (1999) Receptors for PTH and PTHrP: their biological importance and functional properties. Am J Physiol 277, F665-F675. Martin TJ (2002) Manipulating the environment of cancer cells in bone: a novel therapeutic approach. J Clin Invest 110, 1399-1401. Martin TJ, Moseley JM and Gillespie MT (1991) Parathyroid hormone-related protein: biochemistry and molecular biology. Crit Rev Biochem Mol Biol 26, 377-395. Massfelder T, Dann P, Wu TL, Vasavada R, Helwig JJ and Stewart AF (1997) Opposing mitogenic and anti-mitogenic actions of parathyroid hormone-related protein in vascular smooth muscle cells: a critical role for nuclear targeting. Proc Natl Acad Sci U S A 94, 13630-13635. Massfelder T, Lang H, Schordan E, Lindner V, Rothhut S, Welsch S, Simon-Assmann P, Barthelmebs M, Jacqmin D and Helwig JJ (2004) Parathyroid hormone-related protein is an essential growth factor for human clear cell renal carcinoma and a target for the von Hippel-Lindau tumor suppressor gene. Cancer Res 64, 180-188. Miki T, Yano S, Hanibuchi M and Sone S (2000) Bone metastasis model with multiorgan dissemination of human small-cell lung cancer (SBC-5) cells in natural killer celldepleted SCID mice. Oncol Res 12, 209-217. Miki T, Yano S, Hanibuchi M, Kanematsu T, Muguruma H and Sone S (2004) Parathyroid hormone-related protein (PTHrP) is responsible for production of bone metastasis, but not visceral metastasis, by human small cell lung cancer SBC-5 cells in natural killer cell-depleted SCID mice. Int J Cancer 108, 511-515. Morgan H, Tumber A and Hill PA (2004) Breast cancer cells induce osteoclast formation by stimulating host IL-11 production and downregulating granulocyte/macrophage colony-stimulating factor. Int J Cancer 109, 653-660. Moseley JM and Gillespie MT (1995) Parathyroid hormonerelated protein. Crit Rev Clin Lab Sci 32, 299-343. Motokura T, Endo K, Kumaki K, Ogata E and Ikeda K (1995) Neoplastic transformation of normal rat embryo fibroblasts by a mutated p53 and an activated ras oncogene induces parathyroid hormone-related peptide gene expression and causes hypercalcemia in nude mice. J Biol Chem 270, 30857-30861. Naik P, Karrim J and Hanahan D (1996) The rise and fall of apoptosis during multistage tumorigenesis: down-modulation contributes to tumor progression from angiogenic progenitors. Genes Dev 10, 2105-2116. Nishihara M, Ito M, Tomioka T, Ohtsuru A, Taguchi T and Kanematsu T (1999) Clinicopathological implications of
parathyroid hormone-related protein in human colorectal tumours. J Pathol 187, 217-222. Nugoli M, Chuchana P, Vendrell J, Orsetti B, Ursule L, Nguyen C, Birnbaum D, Douzery EJ, Cohen P and Theillet C (2003) Genetic variability in MCF-7 sublines: evidence of rapid genomic and RNA expression profile modifications. BMC Cancer 3, 13. Orloff JJ, Ganz MB, Nathanson MH, Moyer MS, Kats Y, Mitnick M, Behal A, Gasalla-Herraiz J and Isales CM (1996) A midregion parathyroid hormone-related peptide mobilizes cytosolic calcium and stimulates formation of inositol trisphosphate in a squamous carcinoma cell line. Endocrinology 137, 5376-5385. Pasquini GM, Davey RA, Ho PW, Michelangeli VP, Grill V, Kaczmarczyk SJ and Zajac JD (2002) Local secretion of parathyroid hormone-related protein by an osteoblastic osteosarcoma (UMR 106-01) cell line results in growth inhibition. Bone 31, 598-605. Philbrick WM, Wysolmerski JJ, Galbraith S, Holt E, Orloff JJ, Yang KH, Vasavada RC, Weir EC, Broadus AE and Stewart AF (1996) Defining the roles of parathyroid hormone-related protein in normal physiology. Physiol Rev 76, 127-173. Pizzi H, Gladu J, Carpio L, Miao D, Goltzman D and Rabbani SA (2003) Androgen regulation of parathyroid hormonerelated peptide production in human prostate cancer cells. Endocrinology 144, 858-867. Powell GJ, Southby J, Danks JA, Stillwell RG, Hayman JA, Henderson MA, Bennett RC and Martin TJ (1991) Localization of parathyroid hormone-related protein in breast cancer metastases: increased incidence in bone compared with other sites. Cancer Res 51, 3059-3061. Price JT, Bonovich MT and Kohn EC (1997) The biochemistry of cancer dissemination. Crit Rev Biochem Mol Biol 32, 175-253. Rabbani SA, Gladu J, Liu B and Goltzman D (1995) Regulation in vivo of the growth of Leydig cell tumors by antisense ribonucleic acid for parathyroid hormone-related peptide. Endocrinology 136, 5416-5422. Rankin W, Grill V and Martin TJ (1997) Parathyroid hormonerelated protein and hypercalcemia. Cancer 80, 1564-1571. Rizzoli R, Feyen JH, Grau G, Wohlwend A, Sappino AP and Bonjour JP (1994) Regulation of parathyroid hormonerelated protein production in a human lung squamous cell carcinoma line. J Endocrinol 143, 333-341. Roberts AB, and Wakefield LM (2003) The two faces of transforming growth factor _ in carcinogenesis. Proc Natl Acad Sci U S A 100, 8621-3. Rodland KD (2004) The role of the calcium-sensing receptor in cancer. Cell Calcium 35, 291-295. Roychowdhury D and Lahn M ( 2003) Antisense therapy directed to protein kinase C (Affinitak, LY900003/ISIS 3521): potential role in breast cancer. Semin Oncol 30, 30-33. Sampath J, Sun D, Kidd VJ, Grenet J, Gandhi A, Shapiro LH, Wang Q, Zambetti GP and Schuetz JD (2001) Mutant p53 cooperates with ETS and selectively up-regulates human MDR1 not MRP1. J Biol Chem 276, 39359-39367. Sanders JL, Chattopadhyay N, Kifor O, Yamaguchi T, Butters RR and Brown EM (2000) Extracellular calcium-sensing receptor expression and its potential role in regulating parathyroid hormone-related peptide secretion in human breast cancer cell lines. Endocrinology 141, 4357-4364. Sato K, Onuma E, Yocum RC, and Ogata E (2003) Treatment of malignancy-associated hypercalcemia and cachexia with humanized anti-parathyroid hormone-related protein antibody. Semin Oncol 30, 167-73. Seidel JJ and Graves BJ (2002) An ERK2 docking site in the Pointed domain distinguishes a subset of ETS transcription factors. Genes Dev 16, 127-137.
462
Gene Therapy and Molecular Biology Vol 8, page 463 Sellers RS, Capen CC and Rosol TJ (2002) Messenger RNA stability of parathyroid hormone-related protein regulated by transforming growth factor-"1. Mol Cell Endocrinol 188, 37-46. Shaw LM, Rabinovitz I, Wang HH, Toker A and Mercurio AM (1997) Activation of phosphoinositide 3-OH kinase by the 6"4 integrin promotes carcinoma invasion. Cell 91, 949-60. Shen X and Falzon M (2003) Parathyroid hormone-related protein upregulates integrin expression via an intracrine pathway in PC-3 prostate cancer cells. Regul Pept 113, 1729. Shen X, Qian L and Falzon M (2004) PTH-related protein enhances MCF-7 breast cancer cell adhesion, migration and invasion via an intracrine pathway. Exp Cell Res 294, 420433. Shukeir N, Arakelian A, Chen G, Garde S, Ruiz M, Panchal C and Rabbani SA (2004) A synthetic 15-mer peptide (PCK3145) derived from prostate secretory protein can reduce tumor growth, experimental skeletal metastases and malignancy-associated hypercalcemia. Cancer Res 64, 5370-5377. Soifer NE, Dee KE, Insogna KL, Burtis WJ, Matovcik LM, Wu TL, Milstone LM, Broadus AE, Philbrick WM and Stewart AF (1992) Parathyroid hormone-related protein. Evidence for secretion of a novel mid-region fragment by three different cell types. J Biol Chem 267, 18236-18243. Southby J, O'Keeffe LM, Martin TJ and Gillespie MT (1995) Alternative promoter usage and mRNA splicing pathways for parathyroid hormone-related protein in normal tissues and tumours. Br J Cancer 72, 702-707. Strewler GJ (2000) The physiology of parathyroid hormonerelated protein. N Engl J Med 342, 177-185. Suva LJ, Mather KA, Gillespie MT, Webb GC, Ng KW, Winslow GA, Wood WI, Martin TJ and Hudson PJ (1989) Structure of the 5' flanking region of the gene encoding human parathyroid-hormone-related protein (PTHrP). Gene 77, 95-105. Suva LJ, Winslow GA, Wettenhall RE, Hammonds RG, Moseley JM, Diefenbach-Jagger H, Rodda CP, Kemp BE, Rodriguez H, Chen EY, et al (1987) A parathyroid hormone-related protein implicated in malignant hypercalcemia: cloning and expression. Science 237, 893-896. Tfelt-Hansen J, MacLeod RJ, Chattopadhyay N, Yano S, Quinn S, Ren X, Terwilliger EF, Schwarz P and Brown EM (2003) Calcium-sensing receptor stimulates PTHrP release by pathways dependent on PKC, p38 MAPK, JNK and ERK1/2 in H-500 cells. Am J Physiol Endocrinol Metab 285, E329E337. Thomas RJ, Guise TA, Yin JJ, Elliott J, Horwood NJ, Martin TJ and Gillespie MT (1999) Breast cancer cells interact with osteoblasts to support osteoclast formation. Endocrinology 140, 4451-4458. Tovar Sepulveda VA and Falzon M (2002) Regulation of PTHrelated protein gene expression by vitamin D in PC-3 prostate cancer cells. Mol Cell Endocrinol 190, 115-124. Tovar Sepulveda VA, Shen X and Falzon M (2002) Intracrine PTHrP protects against serum starvation-induced apoptosis and regulates the cell cycle in MCF-7 breast cancer cells. Endocrinology 143, 596-606. Truong NU, de BEMD, Papavasiliou V, Goltzman D and Kremer R (2003) Parathyroid hormone-related peptide and survival of patients with cancer and hypercalcemia. Am J Med 115, 115-121. Tumber A, Morgan HM, Meikle MC and Hill PA (2001) Human breast-cancer cells stimulate the fusion, migration and resorptive activity of osteoclasts in bone explants. Int J Cancer 91, 665-672.
Turner PR, Mefford S, Christakos S and Nissenson RA (2000) Apoptosis mediated by activation of the G protein-coupled receptor for parathyroid hormone (PTH)/PTH-related protein (PTHrP). Mol Endocrinol 14, 241-254. Uy HL, Mundy GR, Boyce BF, Story BM, Dunstan CR, Yin JJ, Roodman GD and Guise TA (1997) Tumor necrosis factor enhances parathyroid hormone-related protein-induced hypercalcemia and bone resorption without inhibiting bone formation in vivo. Cancer Res 57, 3194-3199. Vargas SJ, Gillespie MT, Powell GJ, Southby J, Danks JA, Moseley JM and Martin TJ (1992) Localization of parathyroid hormone-related protein mRNA expression in breast cancer and metastatic lesions by in situ hybridization. J Bone Miner Res 7, 971-979. Vasavada RC, Wysolmerski JJ, Broadus AE and Philbrick WM (1993) Identification and characterization of a GC-rich promoter of the human parathyroid hormone-related peptide gene. Mol Endocrinol 7, 273-282. Vetter M, Blumenthal SG, Lindemann RK, Manns J, Wesselborg S, Thomssen C and Dittmer J (2004) Ets1 is a downstream effector of protein kinase C in cancer cells. Oncogene in press Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM and Tabin CJ (1996) Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein. Science 273, 613-622. Watanabe T, Yamaguchi K, Takatsuki K, Osame M and Yoshida M (1990) Constitutive expression of parathyroid hormonerelated protein gene in human T cell leukemia virus type 1 (HTLV-1) carriers and adult T cell leukemia patients that can be trans-activated by HTLV-1 tax gene. J Exp Med 172, 759-765. Whitfield JF, Chakravarthy BR, Durkin JP, Isaacs RJ, Jouishomme H, Sikorska M, Williams RE and Rixon RH (1992) Parathyroid hormone stimulates protein kinase C but not adenylate cyclase in mouse epidermal keratinocytes. J Cell Physiol 150, 299-303. Wu TL, Vasavada RC, Yang K, Massfelder T, Ganz M, Abbas SK, Care AD and Stewart AF (1996) Structural and physiologic characterization of the mid-region secretory species of parathyroid hormone-related protein. J Biol Chem 271, 24371-24381. Wysolmerski JJ and Broadus AE (1994) Hypercalcemia of malignancy: the central role of parathyroid hormone-related protein. Annu Rev Med 45, 189-200. Wysolmerski JJ, Dann PR, Zelazny E, Dunbar ME, Insogna KL, Guise TA and Perkins AS (2002) Overexpression of parathyroid hormone-related protein causes hypercalcemia but not bone metastases in a murine model of mammary tumorigenesis. J Bone Miner Res 17, 1164-1170. Wysolmerski JJ, Philbrick WM, Dunbar ME, Lanske B, Kronenberg H and Broadus AE (1998) Rescue of the parathyroid hormone-related protein knockout mouse demonstrates that parathyroid hormone-related protein is essential for mammary gland development. Development 125, 1285-1294. Wysolmerski JJ, Vasavada R, Foley J, Weir EC, Burtis WJ, Kukreja SC, Guise TA, Broadus AE and Philbrick WM (1996) Transactivation of the PTHrP gene in squamous carcinomas predicts the occurrence of hypercalcemia in athymic mice. Cancer Res 56, 1043-1049. Yamaguchi K, Kiyokawa T, Watanabe T, Ideta T, Asayama K, Mochizuki M, Blank A and Takatsuki K (1994) Increased serum levels of C-terminal parathyroid hormone-related protein in different diseases associated with HTLV-1 infection. Leukemia 8, 1708-1711. Yamato H, Nagai Y, Inoue D, Ohnishi Y, Ueyama Y, Ohno H, Matsumoto T, Ogata E and Ikeda K (1995) In vivo evidence
463
Dittmer: Importance of PTHrP for cancer development for progressive activation of parathyroid hormone-related peptide gene transcription with tumor growth and stimulation of osteoblastic bone formation at an early stage of humoral hypercalcemia of cancer. J Bone Miner Res 10, 36-44. Yang BS, Hauser CA, Henkel G, Colman MS, Van Beveren C, Stacey KJ, Hume DA, Maki RA and Ostrowski MC (1996) Ras-mediated phosphorylation of a conserved threonine residue enhances the transactivation activities of c-Ets1 and c-Ets2. Mol Cell Biol 16, 538-547. Yin JJ, Selander K, Chirgwin JM, Dallas M, Grubbs BG, Wieser R, Massague J, Mundy GR and Guise TA (1999) TGF" signaling blockade inhibits PTHrP secretion by breast cancer cells and bone metastases development. J Clin Invest 103, 197-206. Yoneda T, Williams PJ, Hiraga T, Niewolna M and Nishimura R (2001) A bone-seeking clone exhibits different biological properties from the MDA-MB-231 parental human breast cancer cells and a brain-seeking clone in vivo and in vitro. J Bone Miner Res 16, 1486-1495. Yoshida A, Nakamura Y, Shimizu A, Harada M, Kameda Y, Nagano A, Inaba M and Asaga T (2000) Significance of the parathyroid hormone-related protein expression in breast carcinoma. Breast Cancer 7, 215-220.
J端rgen Dittmer
464
Gene Therapy and Molecular Biology Vol 8, page 465 Gene Ther Mol Biol Vol 8, 465-474, 2004
Gene-based vaccines for immunotherapy of prostate cancer - lessons from the past Review Article
Milcho Mincheff* and Serguei Zoubak The George Washington University Medical Center
__________________________________________________________________________________ *Correspondence: Milcho Mincheff, Head, Tumor Immunology Laboratory, Department of Medicine, The George Washington Medical Center, 2300 Eye Street, N.W., Ross Hall 705, Washington, DC 20037; Tel: 202 994 7765; fax: 202 994 0465; e-mail: mcamsm@gwumc.edu Key words: PSMA, Gene-based vaccine, immunodominance, CTLA-4 Abbreviations: activation-inducible TNF receptor, (AITR); antigen-presenting cells, (APCs); cytotoxic T lymphocyte antigen 4, (CTLA-4); delayed type hypersensitivity, (DTH); glucocorticoid-induced tumor necrosis factor receptor, (GITR); GITR ligand, (GITRL); prostate acidic phosphatase, (PAP); prostate-specific membrane antigen, (PSMA); â&#x20AC;&#x153;secretedâ&#x20AC;? prostate-specific membrane antigen, (sPMSA); T cell receptor, (TCR); truncated prostate-specific membrane antigen, (tPSMA); tumor-infiltrating lymphocytes, (TILs); tyrosinase-related protein-1, (TRP-1)
Supported in part by the American Foundation for Biolological Research and by the Bulgarian Foundation for Biomedical Research. Supported in part by grant N00014-00-1-0787 from the Office of Naval Research. Supported in part by award No DAMD17-02-1-0239. The U.S. Army Medical Research Acquisition Activity, 820 Chandler Street, Fort Detrick, MD 21702-5014 is the awarding and administering acquisition office. The content of the information does not necessarily reflect the position or the policy of the Government, and no official endorsement should be inferred. For purpose of this article, information includes news releases, articles, manuscripts, brochures, advertisements, still and motion pictures, speeches, trade association proceedings etc. Received: 15 October 2004; Accepted: 15 November 2004; electronically published: November 2004
Summary Gene-based vaccination in its current mode of application is effective in breaking tolerance to a self- or tumorassociated antigen, but the response is narrow and restricted to few of the potential epitopes due to immunodominance. In cancer, immunodominance carries the risk of inefficient immune surveillance due to loss of MHC alleles or point mutations in the recognized sequences. We have found that a T cell response to sub-dominant epitopes can be primed with transfected dendritic cells in which the newly expressed antigen is purposefully targeted for proteasomal degradation. Beginning in May 1998, we performed a phase I/II clinical trial for immunotherapy of prostate cancer that targeted the prostate-specific membrane antigen (PSMA). The primary objective of the study was to determine the safety of the described vaccines after repeated intradermal injections (Mincheff et al., 2000a; Mincheff et al., 2000b), since using PSMA as a target could be seriously offset by the development of autoimmunity (Gilboa, 1999b; Overwijk and Restifo, 2000). So far, six years since the study has begun, no patient has experienced any short- or long-term side effects, including anti-DNA antibody. Twenty-nine patients from this random population were treated solely by immunotherapy. Eighteen of them had biochemical recurrence following radical prostatectomy and eleven responded to the therapy with a PSA drop exceeding 50% of pre-therapy value. Patients with advanced disease and distant metastases were not influenced by the immunotherapy despite the fact that they all showed signs of T cell immunity towards PSMA. We found, however, that the post-vaccination T cell response was directed against only two of the potential 4 PSMA epitopes that had high affinity for binding. At least in vitro, priming with one of our vaccines led to a poly-epitope response. Unfortunately, even in such instances, consequent exposure to poly-epitope expressing dendritic cells during reimmunization led to selection of an immunodominant clone. To alleviate immunodominance and decrease tumor evasion due to loss of antigenic determinants, a poly-epitope T cell response would need to be maintained. Ensuring 465
Mincheff and Zoubak: DNA vaccines for prostate cancer such a cytotoxic T cell response, therefore, would require either construction of separate epitope encoding vectors for boosting, an approach with limited therapeutic application, or identifying conditions during boosting that would restrict immunodominance. CD4 T cell depletion, GITR-L signaling or CTLA-4 all show promise in achieving this goal. cell responses from tumor bearing patients or animals may be misleading. It also shows the shortcomings of using a single peptide derived from a tissue specific antigen for raising sustained autoimmunity sufficient to eradicate tumor. A cancer vaccine against a multitude of peptides against a tissue-specific antigen will definitely offer some advantages. This approach is strengthened by the discovery that, as is the case with different animal strains, particular autoantigen in different people may manifest different ability to break tolerance and induce autoimmunity (Hammer et al, 1997).
I. Introduction A. Tumor antigen recognition Evidence that the immune system recognizes tumor antigens is supported by the existence of tumor infiltrating lymphocytes but, since cancer cells fail to establish and support an effective immune milieu, tumors often prevail and survive. Worsening the problem is the fact that recognition of cancer antigens on tumor cells seems to evoke a tolerant state by induction of anergy in antigenreactive T cells. In the past few years it has become increasingly evident that induction of tissue-specific autoimmunity can lead to tumor destruction. Initially Coulie and colleagues (Coulie et al, 1994) discovered that the target for a melanoma-specific CD8+ T cell clone grown from a melanoma patient was wild-type tyrosinase, a melanosomal enzyme selectively expressed in melanocytes. Subsequently, a number of investigators found that their melanoma-specific CD8+ T cells indeed recognized melanocyte-specific antigens rather than melanoma-specific antigens (Bakker et al, 1994; Cox et al, 1994; Kawakami et al, 1994). Most of these antigens appear to be normal melanosomal proteins, and a number of them, including tyrosinase, tyrosinase-related protein-1 (TRP-1), TRP-2, and glycoprotein 100 (gp100), are involved in melanin biosynthesis. Other melanosomal proteins such as MART1/Melan A have no known function but are nonetheless melanocyte-specific tissue differentiation antigens. As time progressed, evidence accumulated that the dominant targets of immune responses against tumors were tissue-specific or differentiation antigens. In contrast, recognition of peptides derived from unique tumor-specific mutations represented infrequent reactivities (Coulie et al, 1995; Wolfel et al, 1995; Robbins et al, 1996). Similar analysis of the specificities of tumor-infiltrating lymphocytes (TILs) in prostate cancer biopsies also revealed responses against tissue-specific antigens (McNeel and Disis, 2000). Possible targets included the prostate-specific membrane antigen (PSMA) (Murphy et al, 1996; Eder et al, 2000), the prostate-specific antigen (PSA) (Kim et al, 1998; Sanda et al, 1999) and prostate acidic phosphatase (PAP) (Fong et al, 2001). The findings that the existing anti-tumor immune responses are predominantly targeting tissue-specific antigens open a new venue for cancer immunotherapy. In practical terms, however, harnessing autoimmunity for cancer therapy presents several problems:
ii. The prostate-specific membrane antigen (PSMA) is a type II integral membrane glycoprotein with a molecular weight of ~100 kDa (Israeli et al, 1993). It has a folate hydrolase, as well as neuropeptidase activity. PSMA is highly expressed in benign prostate secretoryacinar epithelium, prostatic intraepithelial neoplasia and prostate adenocarcinoma (Murphy et al, 1998). There is good evidence that PSMA expression is increased in high Gleason score tumors and in hormone-refractory tumor cells (Troyer et al, 1995), which makes it an excellent target for immunotherapy. More recently, weak expression has been described in several normal tissues such as a subset of proximal renal tubules, duodenal and colonic mucosa. A shorter, alternatively spliced cytosolic form of PSMA, named PSMâ&#x20AC;&#x2122;, is the predominant form expressed in benign prostate epithelium (Grauer et al, 1998). Recently PSMA expression has been detected in tumor neovasculature (Chang et al, 1999), as well as in other healthy tissues both in human (Renneberg et al, 1999) and in mice (Bacich et al, 2001).
II. Clinical trial Breaking of tolerance to tissue-specific antigens requires presentation of antigen to T cells by specialized, antigen presenting cells: the dendritic cells. This can be performed by a procedure known as naked DNA immunization. We have already performed a clinical trial on immunotherapy of prostate cancer using this approach and we have demonstrated its safety. Beginning in May 1998, we performed in Sofia, Bulgaria, a phase I/II clinical trial for immunotherapy of prostate cancer that targeted the prostate-specific membrane antigen (PSMA). The primary objective of the study was to determine the safety of the described vaccines after repeated intradermal injections (Mincheff et al, 2000a, b, 2001), since using PSMA as a target could be seriously offset by the development of autoimmunity (Overwijk and Restifo, 2000; Gilboa, 2001). Sixty-five patients were accessed into the study and were repeatedly immunized. Fifty-nine of them were in the study for a period between 2.5 and 3 years. No patient experienced short or long-term side effects including the development of anti-DNA antibody (Mincheff et al,
i. Identification of a target antigen or a combination thereof that will confer protection. In a recent study performed in mice, anti-TRP-1 but not anti-TRP-2 or antigp-100 specific T cells induced vitiligo and anti-tumor immunity (Overwijk et al, 1999). This may have been true for the particular mouse strain in that study but it does show that targeting a single antigen based on analysis of T
466
Gene Therapy and Molecular Biology Vol 8, page 467 2000a). We also found that repeated local intradermal injection of rHuGM-CSF (Sargramostim) was a safe procedure and was well tolerated. Heterologous immunization regimen that consisted of two initial intradermal immunizations at 3-week intervals with a cocktail consisting of 200 µg plasmid DNA and 9 IU/m2 b.s.a., followed by a recombinant adenoviral boost (5x108 PFUs of Ad5PSMA) led to uniform immunization as judged by the development of delayed type hypersensitivity reaction (DTH) to PSMA. DTH was measured 24 and 48 hours following intradermal injection of the plasmid immunization cocktail and was compared to reactions developing after intradermal injection at two separate sites of plasmid cocktail that contained the empty plasmid backbone instead, or of GM-CSF only. The patients were heterogeneous with regard to local advancement of disease, presence of distant metastases, or hormone treatment and refractoriness, which does not permit unequivocal interpretation of the results. Nevertheless, several responders to the immunotherapy could be identified. Twenty-nine patients from this random population were treated solely by immunotherapy (Table 1). Eighteen of them had biochemical recurrence following radical prostatectomy and eleven responded to the therapy with a PSA drop exceeding 50% of pretherapy value (Table 1). In contrast, only one of the 11 patients with advanced metastatic disease was influenced by IT with the PSA remaining flat at 10-13 ng/ml and a decrease in bone pains. The remaining 10 patients experienced disease progression despite immunizations. The PSA curve of a typical responder to immunotherapy is shown on Figure 3. The patient was prostatectomized in January, 1996, Gleason score 5, negative margins. Biochemical recurrence was first detected in February, 1999. Immunotherapy, consisting of two plasmid immunizations followed by a recombinant adenoviral boost was initiated in March, 1999. Regular boosts were performed at 3-4 month intervals alternating between the plasmid DNA and the adenoviral vector. Patients with advanced disease and distant metastases were not influenced by the immunotherapy despite the fact that they all showed signs of T cell immunity towards PSMA. Anti-PSMA immunity was assayed by the presence of PSMA-reactive, !IFN-producing T cells in their peripheral blood (Figure 2). The escape of tumor cells from immune surveillance despite presence of anti-PSMA T cell immunity in those patients could be mediated through a number of mechanisms:
and T cell function (Ohm et al, 1999; Shah and Lee, 2000; Beck et al, 2001; Pasche, 2001; Dunn et al, 2002; Koyama et al, 2002). Fas-L and other apoptosis inducing agents are expressed on tumor cells and induce programmed cell death in infiltrating lymphocytes (Cefai et al, 2001; Koyama et al, 2002).
Figure 1. Serum PSA of a patient following radical prostatectomy (1996), biochemical recurrence (January, 1999) and immunotherapy (March 1999 – August 2000). SDs represent three separate determination of PSA in serum derived from three venipunctures on three consecutive days. (P-thPSMA plasmid; Ad5 – Ad5PSMA)
III. Tumor evasion A. Tumor evasion Especially in advanced disease with a big tumor load, can be mediated through multiple pathways (Gilboa, 1999a; Ohm et al, 1999; Shah and Lee, 2000; Beck et al, 2001; Cefai et al, 2001; Garrido and Algarra, 2001; Pasche, 2001; Smyth et al, 2001; Carbone and Ohm, 2002; Dunn et al, 2002; Koyama et al, 2002; Ng et al, 2002; Schreiber et al, 2002). Tumor cells secrete lymphokines such as TGF-" and VEGF which suppress dendritic cell
Figure 2. . !-interferon-positive CD8+T cells following 6-hour stimulation of peripheral blood from HLA-A2+ cancer patients with HLA-A2-specific, PSMA-derived peptide (MMNDQLMFL). Cells were stained using the FastImmune CD8 intracellular cytokine detection kit. Diamonds – prior to immunization (control), squares – post immunization. Data are from five different experiments involving five patients.
467
Mincheff and Zoubak: DNA vaccines for prostate cancer Immunodominance ensures the tight specificity of the immune reaction and prevents untoward autoimmunity (Yewdell and Bennink, 1999; Rodriguez et al, 2002). However, it carries the risk of inefficient immune surveillance in cases such as cancer in which mutations of the epitope or downregulation of MHC alleles occur (Hicklin et al, 1998; Hiraki et al, 1999; Dunn et al, 2002; Schreiber et al, 2002). Malignant transformation and tumor progression are frequently associated with loss of HLA class I antigens. For example, a recent review of the literature (Ferrone and Marincola, 1995) reported that ~15% and ~55% of surgically removed primary and metastatic melanoma lesions, respectively, were not stained in immunohistochemical reactions by monoclonal antibodies to monomorphic determinants of HLA class I antigens. Loss or reduced HLA class I antigen expression enables tumor cells to evade the host's immune response (Cordon-Cardo et al, 1991; Rivoltini et al, 1995; Hicklin et al, 1998; de la Salle et al, 1999; Hiraki et al, 1999) and downregulation of HLA class I antigens in metastases from patients with malignant melanoma is associated with poorer prognosis (van Duinen et al, 1988). Numerous factors combine to establish an immunodominance hierarchy (Yewdell and Bennink, 1999). They include among others: 1. Lack of T cells that are responsive to a subdominant epitope (Baldwin et al, 1999) 2. Low affinity of the epitope for binding to MHC (Ma and Kapp, 2001) 3. Ineffective generation and transport of subdominant epitopes by APCs (Mo et al, 2000) 4. Intrinsic control of CD8 T cells to respond to subdominant epitopes (Noel et al, 1996; Boise and Thompson, 1996; Rabinowitz et al, 1996; Kersh et al, 1998; Schwartz et al, 2001; Guntermann and Alexander, 2002) 5. Extrinsic regulatory networks (T regulatory cells) (Suri-Payer et al, 1998; Thornton and Shevach, 1998; Thornton and Shevach, 2000; Levings et al, 2001; Piccirillo and Shevach, 2001; Shevach, 2001; SanchezFueyo et al, 2002; Sakaguchi, 2003). We concentrated our efforts on studying the effects of the extrinsic regulatory networks, particularly CTLA-4 and GITR-L signaling and T regulatory cell influence on the establishment of immunodominance during priming and boosting with a gene-based vaccine.
B. Immunodominance The response of the host immune system to only a few of the many possible epitopes in an antigen, additionally exacerbates the problem (Zinkernagel and Doherty, 1979; Yin et al, 1993; Yewdell and Bennink, 1999; Wherry et al, 1999; Belz et al, 2000; Chen et al, 2000; Hislop et al, 2002; Palmowski et al, 2002; Rodriguez et al, 2002). We find gene-based vaccination in its current mode of application effective in breaking tolerance to a self-antigen, but the boosting narrows and restricts the response to few of the potential epitopes (Mincheff et al, 2003). For example, the post-vaccination T cell response of some of the HLA A2 patients from the clinical trial performed by us was directed against only two of the potential 4 PSMA peptide motifs that had high affinity for binding (Figure 3). Table 1. Results from a clinical trial on DNA immunization for immunotherapy of prostate cancer Outcome
Immunotherapy only PostDistant Prostatectomy metastases 7 10 11 1
Disease Progression Improvement (Responders* to Therapy) Total Number of 18 11 Patients Responders* – Decrease of PSA exceeding 50% of initial value, decrease in bone pains (where applicable).
1. Immunodominance and CTLA-4 inhibition A homologue of CD28, CTLA-4 also binds to the B-7 family members (Greene et al, 1996; Sanchez-Fueyo et al, 2002) but inhibits T cell activation (van der Merwe et al, 1997). Mice lacking CTLA-4 reveal a striking phenotype of polyclonal T cell activation and tissue infiltration which results in death by 3-4 weeks of age, indicating a powerful regulatory role for CTLA-4 (Thompson and Allison, 1997; Waterhouse et al, 1995). Weak signals through the T cell receptor (TCR) are prompt to inhibition (Manzotti et al, 2002) and, at least in vitro, no CTL stimulation to subdominant epitopes occurs if CTLA-4 is not inhibited (Mincheff et al, 2004). Alternatively, CTLA-4 may act as a non-signaling "decoy" receptor reducing the available ligand for CD28 costimulation (Masteller et al, 2000;
Figure 3. !-IFN-positive CD3+ T cells following 6-hour stimulation of peripheral blood of HLA-A2+ prostate cancer patients. The following PSMA peptides were identified by BIMAS to bind with high affinity to HLA A2, synthesized and tested in an in vitro assay: MMNDQLMFL (PSMA663), ALFDIESKV (PSMA711), LMFLERAFI (PSMA668) and GIUDALFDI (PSMA707). Legend: Stimulation was performed by a) squares – PSMA663, b) diamonds – PSMA711, c) triangles – PSMA668. Results with PSMA707 are not shown but are comparable to pre-immunization values (see Figure 1). Data are from three separate experiments with blood from one patient. Cells were stained using the FastImmune CD8 intracellular cytokine detection kit.
468
Gene Therapy and Molecular Biology Vol 8, page 469 Doyle et al, 2001; Mincheff et al, 2004). No matter what the mechanism is, inhibition of CTLA-4 may alleviate immunodominance and thus improve the efficacy of antitumor vaccines.
expressed following transfection with this vector, is retained in the cytosol and is degraded by the proteasomes. For the “secreted” (sPMSA) vaccine, a signal peptide sequence was added to the expression cassette. The expressed protein following transfection with such vaccines is glycosylated and directed to the secretory pathway. Dendritic cells transfected in vitro with tVacs primed T cells to both dominant and subdominant epitopes (Mincheff et al, 2003). Subsequent boosting with antigenpresenting cells (APCs) that expressed both dominant and sub-dominant epitopes, however, narrowed the immune response to the dominant ones (Mincheff et al, 2003). Research from other groups has gained similar results (Firat et al, 1999; Mateo et al, 1999; Loirat et al, 2000; Smith et al, 2001; Palmowski et al, 2002). In all these instances, boosting with polyepitope encoding constructs resulted in failure to expand polyepitope CTLs. A likely explanation is that competition between T cells for antigen on individual APC leads to obscuring of responses to subdominant epitopes when both the dominant and subdominant epitopes are present on the same APC (Palmowski et al, 2002; Kedl et al, 2003). New vaccines (separate DNA vaccines encoding isolated dominant and subdominant epitopes (Barouch et al, 2001) might maximize epitope dispersal among APCs thus inducing broad immunity against numerous epitopes, dominant and subdominant. Due to the HLA polymorphism of the human population, however, construction of such separate vaccines is mainly of academic interest and will have limited therapeutic application. Different approaches for the maintenance of a poly-epitope CTL response following repeated boosting, therefore, are necessary. Some of those are listed below:
2. CD4+CD25+ T cell depletion and cancer immunodominance Enhanced priming to sub-dominant epitopes by CTLA-4 inhibition is at least partially mediated through the inhibition of CD4+CD25+ T cell function (Mincheff et al, 2004). These CD4+ T cells are a minor subpopulation (10%) that co-expresses the IL-2 receptor #-chain (CD25) (Sakaguchi et al, 1995) and they can prevent both the induction and effector function of autoreactive T cells (Suri-Payer et al, 1998; Shevach, 2001; Levings et al, 2001). Additionally, they suppress polyclonal T cell activation in vitro by inhibiting IL-2 production (Thornton and Shevach, 1998). Based on these data, we speculate that immunodominance that develops after reimmunization may be reduced by CD4+CD25+ T cell depletion prior to boosting.
3. CD4+CD25+ T cell regulation Very little is known of the physiologic regulation of CD4+CD25+ T cells in vivo (McHugh et al, 2002). Recent reports suggest that glucocorticoid-induced tumor necrosis factor receptor (GITR), also known as TNFRSF18 – a member of the TNF-nerve growth factor receptor gene superfamily – is predominantly expressed on CD4+CD25+ T cells (McHugh et al, 2002; Shimizu et al, 2002) and stimulation of GITR abrogates CD4+CD25+ T cellmediated suppression (Shimizu et al, 2002). The gene encoding the natural ligand of murine GITR has been cloned and characterized. The putative GITR ligand (GITR-L) is composed of 173 amino acids with features resembling those of type II membrane proteins and is 51% identical to the human activation-inducible TNF receptor (AITR) ligand, TL6. Expression of the GITR-L is restricted to immature and mature splenic dendritic cells. GITR-L binds GITR expressed on HEK 293 cells and triggers NF-$B activation. Functional studies reveal that soluble CD8-GITR-L prevents CD4+CD25+ regulatory Tcell-mediated suppressive activities (Kim JD et al, 2003). Stimulation through this receptor has been shown to break immunologic tolerance (Shimizu et al, 2002), i.e. it acts similarly to CD4+CD25+ T cell depletion (Kwon et al, 2003).
IV. Immunodominance priming and boosting
B. CTLA-4 inhibition and immunodominance. Addition of anti-CTLA-4 antibodies during priming alleviates immunodominance We find that in vitro priming to subdominant responses is enhanced by CTLA-4 inhibition (Mincheff et al, 2003). Will similar CTLA-4 inhibition during in vivo re-immunization (boosting) preserve a poly-epitope CTL response (Mincheff et al, 2004)? What will be the cytokine production profile of the sub-dominant T cell clones? T1/T2 polarization (!-IFN vs. IL-4 secretion) has been shown to depend on the amount of the antigen and on the affinity of the peptide for MHC (Kumar et al, 1995), with weaker signals promoting IL-4 secretion. CTLA-4 inhibition may promote T cell activation at instances of weak T cell receptor engagement (Manzotti et al, 2002). Will there be a difference in the cytokine profile of the sub-dominant clones raised by either minigene reimmunization or CTLA-4 inhibition? Will sub-dominant clones be cytotoxic to tumor cells?
during
A. “Truncated” vs. secreted vaccines (tVacs vs. sVacs). Dendritic cells transfected with truncated vaccines primes to both dominant and subdominant epitopes of the target antigen
C. CD4+CD25+ T cell prior to priming reduces immunodominance
To enhance priming to sub-dominant epitopes, we designed a vaccine (hPSMAT; truncated (tPSMA); tVac)(Mincheff et al, 2003) whose product encoded for only the extracellular domain of PSMA. The product,
Results from our laboratory show that the enhanced priming to sub-dominant epitopes by CTLA-4 inhibition is at least partially mediated through the inhibition of 469
Mincheff and Zoubak: DNA vaccines for prostate cancer frequency cytotoxic T-lymphocyte responses against both dominant and subdominant simian-human immunodeficiency virus epitopes by DNA vaccination of rhesus monkeys. J Virol 75, 2462-2467. Beck C, Schreiber H and Rowley D (2001) Role of TGF-" in immune-evasion of cancer. Microsc Res Tech 52, 387-395. Belz GT, Stevenson PG and Doherty PC (2000) Contemporary analysis of MHC-related immunodominance hierarchies in the CD8+ T cell response to influenza A viruses. J Immunol 165, 2404-2409. Boise LH and Thompson CB (1996) Hierarchical control of lymphocyte survival. Science 274, 67-68. Carbone JE and Ohm DP (2002) Immune dysfunction in cancer patients. Oncology (Huntingt) 16, 11-18. Cefai D, Favre L, Wattendorf E, Marti A, Jaggi R and Gimmi CD (2001) Role of Fas ligand expression in promoting escape from immune rejection in a spontaneous tumor model. Int J Cancer 91, 529-537. Chang SS, Reuter VE, Heston WD, Bander NH, Grauer LS and Gaudin PB (1999) Five different anti-prostate-specific membrane antigen (PSMA) antibodies confirm PSMA expression in tumor-associated neovasculature. Cancer Res 59, 3192-3198. Chen W, Anton LC, Bennink JR and Yewdell JW (2000) Dissecting the multifactorial causes of immunodominance in class I-restricted T cell responses to viruses. Immunity 12, 83-93. Cordon-Cardo C, Fuks Z, Drobnjak M, Moreno C, Eisenbach L and Feldman M (1991) Expression of HLA-A,B,C antigens on primary and metastatic tumor cell populations of human carcinomas. Cancer Res 51, 6372-6380. Coulie PG, Brichard V, Van Pel A, Wolfel T, Schneider J, Traversari C, Mattei S, De Plaen E, Lurquin C and Szikora JP (1994) A new gene coding for a differentiation antigen recognized by autologous cytolytic T lymphocytes on HLAA2 melanomas. J Exp Med 180, 35-42. Coulie PG, Lehmann F, Lethe B, Herman J, Lurquin C, Andrawiss M and Boon T (1995) A mutated intron sequence codes for an antigenic peptide recognized by cytolytic T lymphocytes on a human melanoma. Proc Natl Acad Sci U S A 92, 7976-7980. Cox AL, Skipper J, Chen Y, Henderson RA, Darrow TL, Shabanowitz J, Engelhard VH, Hunt DF and Slingluff CL, Jr (1994) Identification of a peptide recognized by five melanoma-specific human cytotoxic T cell lines. Science 264, 716-719. de la Salle H, Zimmer J, Fricker D, Angenieux C, Cazenave JP, Okubo M, Maeda H, Plebani A, Tongio MM, Dormoy A and Hanau D (1999) HLA class I deficiencies due to mutations in subunit 1 of the peptide transporter TAP1. J Clin Invest 103, R9-R13. Doyle AM, Mullen AC, Villarino AV, Hutchins AS, High FA, Lee HW, Thompson CB and Reiner SL (2001) Induction of cytotoxic T lymphocyte antigen 4 (CTLA-4) restricts clonal expansion of helper T cells. J Exp Med 194, 893-902. Dunn GP, Bruce AT, Ikeda H, Old LJ and Schreiber RD (2002) Cancer immunoediting: from immunosurveillance to tumor escape. Nat Immunol 3, 991-998. Eder JP, Kantoff PW, Roper K, Xu GX, Bubley GJ, Boyden J, Gritz L, Mazzara G, Oh WK, Arlen P, Tsang KY, Panicali D, Schlom J and Kufe DW (2000) A phase I trial of a recombinant vaccinia virus expressing prostate-specific antigen in advanced prostate cancer. Clin Cancer Res 6, 1632-1638. Ferrone S and Marincola FM (1995) Loss of HLA class I antigens by melanoma cells: molecular mechanisms, functional significance and clinical relevance. Immunol Today 16, 487-494.
CD4+CD25+ T cell function (Mincheff et al, 2004). For obvious reasons, CD4+CD25+ T cell depletion prior to in vivo boosting may lead to serious side effects (Sakaguchi et al, 2001). Could alleviation of immunodominance be achieved by means other than CD4+CD25+ T cell depletion?
D. In some cases, GITR-signaling during priming reduces immunodominance We find that while CD4+CD25+ T cell depletion prior to in vitro priming with sVacDCs alleviates immunodominance, co-transfection of dendritic cells with GITR-L does so in some but not all cases(Mincheff et al, 2004). Could immunodominance in vivo be restricted by GITR signaling? Could this be achieved by the coadministration of anti-GITR antibodies or by enhanced GITR-L co-expression during re-immunization? Preliminary results from our laboratory (Mincheff et al, 2004) suggest that in some cases in vitro, co-transfection of dendritic cells with GITR-L alleviate immunodominance.
V. Conclusion Immunotherapy is a safe, non-invasive, relatively inexpensive procedure that can avoid side effects that often result from surgical, cryosurgical or radiation therapy. Gene based vaccination is effective in breaking tolerance to tumor-associated antigens, but the response is directed towards few of the potential epitopes due to immunodominance. Tumor cells that have lost the immunodominant epitope due to mutations are no-longer recognized and evade immune surveillance. Designing a protocol for immunotherapy, therefore, necessitates stimulation of an immune response directed against a multitude of epitopes. Increasing the number of epitopes available for presentation to T cells is the initial step. It mandates increased degradation of the antigen following DNA immunization and we have already initiated experimentation directed at this (Mincheff et al, 2003). A logical continuation to the current work involves manipulation of the intimate mechanisms controlling the processes of stimulation and/or suppression of T cells recognizing the â&#x20AC;&#x153;sub-dominantâ&#x20AC;? epitopes.
References Bacich DJ, Pinto JT, Tong WP and Heston WD (2001) Cloning, expression, genomic localization, and enzymatic activities of the mouse homolog of prostate-specific membrane antigen/NAALADase/folate hydrolase. Mamm Genome 12, 117-123. Bakker AB, Schreurs MW, de Boer AJ, Kawakami Y, Rosenberg SA, Adema GJ and Figdor CG (1994) Melanocyte lineagespecific antigen gp100 is recognized by melanoma-derived tumor-infiltrating lymphocytes. J Exp Med 179, 1005-1009. Baldwin KK, Trenchak BP, Altman JD and Davis MM (1999) Negative selection of T cells occurs throughout thymic development. J Immunol 163, 689-698. Barouch DH, Craiu A, Santra S, Egan MA, Schmitz JE, Kuroda MJ, Fu TM, Nam JH, Wyatt LS, Lifton MA, Krivulka GR, Nickerson CE, Lord CI, Moss B, Lewis MG, Hirsch VM, Shiver JW and Letvin NL (2001) Elicitation of high-
470
Gene Therapy and Molecular Biology Vol 8, page 471 Firat H, Garcia-Pons F, Tourdot S, Pascolo S, Scardino A, Garcia Z, Michel ML, Jack RW, Jung G, Kosmatopoulos K, Mateo L, Suhrbier A, Lemonnier FA and Langlade-Demoyen P (1999) H-2 class I knockout, HLA-A2.1-transgenic mice: a versatile animal model for preclinical evaluation of antitumor immunotherapeutic strategies. Eur J Immunol 29, 31123121. Fong L, Brockstedt D, Benike C, Breen JK, Strang G, Ruegg CL and Engleman EG (2001) Dendritic cell-based xenoantigen vaccination for prostate cancer immunotherapy. J Immunol 167, 7150-7156. Garrido F and Algarra I (2001) MHC antigens and tumor escape from immune surveillance. Adv Cancer Res 83, 117-158. Gilboa E (1999a) How tumors escape immune destruction and what we can do about it. Cancer Immunol Immunother 48, 382-385. Gilboa E (1999b) The makings of a tumor rejection antigen. Immunity 11, 263-270. Gilboa E (2001) The risk of autoimmunity associated with tumor immunotherapy. Nat Immunol 2, 789-792. Grauer LS, Lawler KD, Marignac JL, Kumar A, Goel AS and Wolfert RL (1998) Identification, purification, and subcellular localization of prostate-specific membrane antigen PSM' protein in the LNCaP prostatic carcinoma cell line. Cancer Res 58, 4787-4789. Greene JL, Leytze GM, Emswiler J, Peach R, Bajorath J, Cosand W and Linsley PS (1996) Covalent dimerization of CD28/CTLA-4 and oligomerization of CD80/CD86 regulate T cell costimulatory interactions. J Biol Chem 271, 2676226771. Guntermann C and Alexander DR (2002) CTLA-4 suppresses proximal TCR signaling in resting human CD4(+) T cells by inhibiting ZAP-70 Tyr(319) phosphorylation: a potential role for tyrosine phosphatases. J Immunol 168, 4420-4429. Hammer J, Sturniolo T and Sinigaglia F (1997) HLA class II peptide binding specificity and autoimmunity. Adv Immunol 66, 67-100. Hicklin DJ, Wang Z, Arienti F, Rivoltini L, Parmiani G and Ferrone S (1998) "2-Microglobulin mutations, HLA class I antigen loss, and tumor progression in melanoma. J Clin Invest 101, 2720-2729. Hiraki A, Kaneshige T, Kiura K, Ueoka H, Yamane H, Tanaka M and Harada M (1999) Loss of HLA haplotype in lung cancer cell lines: implications for immunosurveillance of altered HLA class I/II phenotypes in lung cancer. Clin Cancer Res 5, 933-936. Hislop AD, Annels NE, Gudgeon NH, Leese AM and Rickinson AB (2002) Epitope-specific evolution of human CD8(+) T cell responses from primary to persistent phases of EpsteinBarr virus infection. J Exp Med 195, 893-905. Israeli RS, Powell CT, Fair WR and Heston WD (1993) Molecular cloning of a complementary DNA encoding a prostate-specific membrane antigen. Cancer Res 53, 227230. Kawakami Y, Eliyahu S, Delgado CH, Robbins PF, Sakaguchi K, Appella E, Yannelli JR, Adema GJ, Miki T and Rosenberg SA (1994) Identification of a human melanoma antigen recognized by tumor-infiltrating lymphocytes associated with in vivo tumor rejection. Proc Natl Acad Sci U S A 91, 6458-6462. Kedl RM, Kappler JW and Marrack P (2003) Epitope dominance, competition and T cell affinity maturation. Curr Opin Immunol 15, 120-127. Kersh EN, Shaw AS and Allen PM (1998) Fidelity of T cell activation through multistep T cell receptor zeta phosphorylation. Science 281, 572-575.
Kim JD, Choi BK, Bae JS, Lee UH, Han IS, Lee HW, Youn BS, Vinay DS and Kwon BS (2003) Cloning and characterization of GITR ligand. Genes Immun 4, 564-569. Kim JJ, Trivedi NN, Wilson DM, Mahalingam S, Morrison L, Tsai A, Chattergoon MA, Dang K, Patel M, Ahn L, Boyer JD, Chalian AA, Schoemaker H, Kieber-Emmons T, Agadjanyan MA, Weiner DB and Shoemaker H (1998) Molecular and immunological analysis of genetic prostate specific antigen (PSA) vaccine. Oncogene 17, 3125-3135. Koyama S, Koike N and Adachi S (2002) Expression of TNFrelated apoptosis-inducing ligand (TRAIL) and its receptors in gastric carcinoma and tumor-infiltrating lymphocytes: a possible mechanism of immune evasion of the tumor. J Cancer Res Clin Oncol 128, 73-79. Kumar V, Bhardwaj V, Soares L, Alexander J, Sette A and Sercarz E (1995) Major histocompatibility complex binding affinity of an antigenic determinant is crucial for the differential secretion of interleukin 4/5 or interferon g by T cells. Proc Natl Acad Sci U S A 92, 9510-9514. Kwon B, Kim BS, Cho HR, Park JE and Kwon BS (2003) Involvement of tumor necrosis factor receptor superfamily(TNFRSF) members in the pathogenesis of inflammatory diseases. Exp Mol Med 35, 8-16. Levings MK, Sangregorio R and Roncarolo MG (2001) Human cd25(+)cd4(+) t regulatory cells suppress naive and memory T cell proliferation and can be expanded in vitro without loss of function. J Exp Med 193, 1295-1302. Loirat D, Lemonnier FA and Michel ML (2000) Multiepitopic HLA-A*0201-restricted immune response against hepatitis B surface antigen after DNA-based immunization. J Immunol 165, 4748-4755. Ma H and Kapp JA (2001) Peptide affinity for MHC influences the phenotype of CD8(+) T cells primed in vivo. Cell Immunol 214, 89-96. Manzotti CN, Tipping H, Perry LC, Mead KI, Blair PJ, Zheng Y and Sansom DM (2002) Inhibition of human T cell proliferation by CTLA-4 utilizes CD80 and requires CD25+ regulatory T cells. Eur J Immunol 32, 2888-2896. Masteller EL, Chuang E, Mullen AC, Reiner SL and Thompson CB (2000) Structural analysis of CTLA-4 function in vivo. J Immunol 164, 5319-5327. Mateo L, Gardner J, Chen Q, Schmidt C, Down M, Elliott SL, Pye SJ, Firat H, Lemonnier FA, Cebon J and Suhrbier A (1999) An HLA-A2 polyepitope vaccine for melanoma immunotherapy. J Immunol 163, 4058-4063. McHugh RS, Whitters MJ, Piccirillo CA, Young DA, Shevach EM, Collins M and Byrne MC (2002) CD4(+)CD25(+) immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16, 311-323. McNeel DG and Disis ML (2000) Tumor vaccines for the management of prostate cancer. Arch Immunol Ther Exp (Warsz) 48, 85-93. Mincheff M, Altankova I, Zoubak S, Tchakarov S, Botev C, Petrov S, Krusteva E, Kurteva G, Kurtev P, Dimitrov V, Ilieva M, Georgiev G, Lissitchkov T, Chernozemski I and Meryman HT (2001) In vivo transfection and/or crosspriming of dendritic cells following DNA and adenoviral immunizations for immunotherapy of cancer--changes in peripheral mononuclear subsets and intracellular IL-4 and IFN-g lymphokine profile. Crit Rev Oncol Hematol 39, 125-132. Mincheff M, Tchakarov S, Zoubak S, Loukinov D, Botev C, Altankova I, Georgiev G, Petrov S and Meryman HT (2000a) Naked DNA and adenoviral immunizations for immunotherapy of prostate cancer: a phase I/II clinical trial. Eur Urol 38, 208-217.
471
Mincheff and Zoubak: DNA vaccines for prostate cancer Mincheff M, Zoubak S, Altankova I, Tchakarov S, Makogonenko Y, Botev C, Ignatova I, Dimitrov R, Madarzhieva K, Hammett M, Pomakov Y, Meryman H and Lissitchkov T (2003) Human dendritic cells genetically engineered to express cytosolically retained fragment of prostate-specific membrane antigen prime cytotoxic T-cell responses to multiple epitopes. Cancer Gene Ther 10, 907917. Mincheff M, Zoubak S, Altankova I, Tchakarov S, Pogribnyy P, Makogonenko Y, Botev C and Meryman HT (2004) Depletion of CD25+ cells from human T-cell enriched fraction eliminates immunodominance during priming and boosting with genetically modified dendritic cells. Cancer Gene Ther, (accepted). Mincheff M, Zoubak S and Meryman HT (2000b) Use of in Vitro and in Vivo Genetically Manipulated Cells for Immunotherapy of Cancer. In: Th Smit Sibinga C (ed). Proceedings of the 25th International Symposium of Blood Transfusion, Groningen, The Netherlands, 1999. Kluwer Academic Publishers: Dordrecht, Boston and London, pp. 11-19. Mo AX, van Lelyveld SF, Craiu A and Rock KL (2000) Sequences that flank subdominant and cryptic epitopes influence the proteolytic generation of MHC class Ipresented peptides. J Immunol 164, 4003-4010. Murphy G, Tjoa B, Ragde H, Kenny G and Boynton A (1996) Phase I clinical trial: T-cell therapy for prostate cancer using autologous dendritic cells pulsed with HLA-A0201-specific peptides from prostate-specific membrane antigen. Prostate 29, 371-380. Murphy GP, Elgamal AA, Su SL, Bostwick DG and Holmes EH (1998) Current evaluation of the tissue localization and diagnostic utility of prostate specific membrane antigen. Cancer 83, 2259-2269. Ng CS, Novick AC, Tannenbaum CS, Bukowski RM and Finke JH (2002) Mechanisms of immune evasion by renal cell carcinoma: tumor-induced T-lymphocyte apoptosis and NFkB suppression. Urology 59, 9-14. Noel PJ, Boise LH and Thompson CB (1996) Regulation of T cell activation by CD28 and CTLA4. Adv Exp Med Biol 406, 209-217. Ohm JE, Shurin MR, Esche C, Lotze MT, Carbone DP and Gabrilovich DI (1999) Effect of vascular endothelial growth factor and FLT3 ligand on dendritic cell generation in vivo. J Immunol 163, 3260-3268. Overwijk WW, Lee DS, Surman DR, Irvine KR, Touloukian CE, Chan CC, Carroll MW, Moss B, Rosenberg SA and Restifo NP (1999) Vaccination with a recombinant vaccinia virus encoding a "self" antigen induces autoimmune vitiligo and tumor cell destruction in mice: requirement for CD4(+) T lymphocytes. Proc Natl Acad Sci U S A 96, 2982-2987. Overwijk WW and Restifo NP (2000) Autoimmunity and the immunotherapy of cancer: targeting the "self" to destroy the "other". Crit Rev Immunol 20, 433-450. Palmowski MJ, Choi EM, Hermans IF, Gilbert SC, Chen JL, Gileadi U, Salio M, Van Pel A, Man S, Bonin E, Liljestrom P, Dunbar PR and Cerundolo V (2002) Competition between CTL narrows the immune response induced by prime-boost vaccination protocols. J Immunol 168, 4391-4398. Pasche B (2001) Role of transforming growth factor " in cancer. J Cell Physiol 186, 153-168. Piccirillo CA and Shevach EM (2001) Cutting edge: control of CD8+ T cell activation by CD4+CD25+ immunoregulatory cells. J Immunol 167, 1137-1140. Rabinowitz JD, Beeson C, Wulfing C, Tate K, Allen PM, Davis MM and McConnell HM (1996) Altered T cell receptor ligands trigger a subset of early T cell signals. Immunity 5, 125-135.
Renneberg H, Friedetzky A, Konrad L, Kurek R, Weingartner K, Wennemuth G, Tunn UW and Aumuller G (1999) Prostate specific membrane antigen (PSM) is expressed in various human tissues: implication for the use of PSM reverse transcription polymerase chain reaction to detect hematogenous prostate cancer spread. Urol Res 27, 23-27. Rivoltini L, Barracchini KC, Viggiano V, Kawakami Y, Smith A, Mixon A, Restifo NP, Topalian SL, Simonis TB, Rosenberg SA and et al (1995) Quantitative correlation between HLA class I allele expression and recognition of melanoma cells by antigen-specific cytotoxic T lymphocytes. Cancer Res 55, 3149-3157. Robbins PF, El-Gamil M, Li YF, Kawakami Y, Loftus D, Appella E and Rosenberg SA (1996) A mutated "-catenin gene encodes a melanoma-specific antigen recognized by tumor infiltrating lymphocytes. J Exp Med 183, 1185-1192. Rodriguez F, Harkins S, Slifka MK and Whitton JL (2002) Immunodominance in virus-induced CD8(+) T-cell responses is dramatically modified by DNA immunization and is regulated by g interferon. J Virol 76, 4251-4259. Sakaguchi S (2003) Regulatory T cells: mediating compromises between host and parasite. Nat Immunol 4, 10-11. Sakaguchi S, Sakaguchi N, Asano M, Itoh M and Toda M (1995) Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor #-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155, 1151-1164. Sanchez-Fueyo A, Weber M, Domenig C, Strom TB and Zheng XX (2002) Tracking the immunoregulatory mechanisms active during allograft tolerance. J Immunol 168, 22742281. Sanda MG, Smith DC, Charles LG, Hwang C, Pienta KJ, Schlom J, Milenic D, Panicali D and Montie JE (1999) Recombinant vaccinia-PSA (PROSTVAC) can induce a prostate-specific immune response in androgen-modulated human prostate cancer. Urology 53, 260-266. Schreiber H, Wu TH, Nachman J and Kast WM (2002) Immunodominance and tumor escape. Semin Cancer Biol 12, 25-31. Schwartz JC, Zhang X, Fedorov AA, Nathenson SG and Almo SC (2001) Structural basis for co-stimulation by the human CTLA-4/B7-2 complex. Nature 410, 604-608. Shah AH and Lee C (2000) TGF-"-based immunotherapy for cancer: breaching the tumor firewall. Prostate 45, 167-172. Shevach EM (2001) Certified professionals: CD4(+)CD25(+) suppressor T cells. J Exp Med 193, F41-46. Shimizu J, Yamazaki S, Takahashi T, Ishida Y and Sakaguchi S (2002) Stimulation of CD25(+)CD4(+) regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol 3, 135-142. Smith SG, Patel PM, Porte J, Selby PJ and Jackson AM (2001) Human dendritic cells genetically engineered to express a melanoma polyepitope DNA vaccine induce multiple cytotoxic T-cell responses. Clin Cancer Res 7, 4253-4261. Smyth MJ, Godfrey DI and Trapani JA (2001) A fresh look at tumor immunosurveillance and immunotherapy. Nat Immunol 2, 293-299. Suri-Payer E, Amar AZ, Thornton AM and Shevach EM (1998) CD4+CD25+ T cells inhibit both the induction and effector function of autoreactive T cells and represent a unique lineage of immunoregulatory cells. J Immunol 160, 12121218. Thompson CB and Allison JP (1997) The emerging role of CTLA-4 as an immune attenuator. Immunity 7, 445-450. Thornton AM and Shevach EM (1998) CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 188, 287-296.
472
Gene Therapy and Molecular Biology Vol 8, page 473 Thornton AM and Shevach EM (2000) Suppressor effector function of CD4+CD25+ immunoregulatory T cells is antigen nonspecific. J Immunol 164, 183-190. Troyer JK, Beckett ML and Wright GL, Jr (1995) Detection and characterization of the prostate-specific membrane antigen (PSMA) in tissue extracts and body fluids. Int J Cancer 62, 552-558. van der Merwe PA, Bodian DL, Daenke S, Linsley P and Davis SJ (1997) CD80 (B7-1) binds both CD28 and CTLA-4 with a low affinity and very fast kinetics. J Exp Med 185, 393-403. van Duinen SG, Ruiter DJ, Broecker EB, van der Velde EA, Sorg C, Welvaart K and Ferrone S (1988) Level of HLA antigens in locoregional metastases and clinical course of the disease in patients with melanoma. Cancer Res 48, 10191025. Waterhouse P, Penninger JM, Timms E, Wakeham A, Shahinian A, Lee KP, Thompson CB, Griesser H and Mak TW (1995) Lymphoproliferative disorders with early lethality in mice deficient in Ctla-4. Science 270, 985-988. Wherry EJ, Puorro KA, Porgador A and Eisenlohr LC (1999) The induction of virus-specific CTL as a function of increasing epitope expression: responses rise steadily until excessively high levels of epitope are attained. J Immunol 163, 3735-3745. Wolfel T, Hauer M, Schneider J, Serrano M, Wolfel C, Klehmann-Hieb E, De Plaen E, Hankeln T, Meyer zum Buschenfelde KH and Beach D (1995) A p16INK4ainsensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma. Science 269, 12811284.
Yewdell JW and Bennink JR (1999) Immunodominance in major histocompatibility complex class I-restricted T lymphocyte responses. Annu Rev Immunol 17, 51-88. Yin L, Poirier G, Neth O, Hsuan JJ, Totty NF and Stauss HJ (1993) Few peptides dominate cytotoxic T lymphocyte responses to single and multiple minor histocompatibility antigens. Int Immunol 5, 1003-1009. Zinkernagel RM and Doherty PC (1979) MHC-restricted cytotoxic T cells: studies on the biological role of polymorphic major transplantation antigens determining Tcell restriction-specificity, function, and responsiveness. Adv Immunol 27, 51-177.
Milcho Mincheff
473
Serguei Zoubak
Mincheff and Zoubak: DNA vaccines for prostate cancer
474
Gene Therapy and Molecular Biology Vol 8, page 481
Figure 4. Effect of the HSFE on retroviral !-globin promoter DNase I sensitivity. (a) r!G, rH!G, and r2H!G construct maps showing EcoR I (E), Asc I (A), and Sst I (S), and restriction sites, location of Southern blot probe, and size of parental band. (b) DNase I assays of r!G, rH!G, and r2H!G pools. Intact nuclei were incubated with increasing concentrations of DNase I. Genomic DNA was digested with the appropriate restriction enzymes. Parental bands are indicated by P, DNase I hypersensitive sites by arrows. (c) Locations of the DNase I HSs for r!G, rH!G, and r2H!G. An approximately 110 bp HS maps over 20% of the promoter of integrated r!G constructs. In the rH!G pool, the HS is approximately 230 bp in size and maps to the HSFE and the first 20 bp of the promoter. The HS in the r2H!G pool is approximately 190 bp in size and maps to the promoter and 3' HSFE.
481
Nemeth and Lowrey: A chromatin opening element increases !-globin expression The Bln I concentration at which maximum promoter digestion was achieved was in excess of 80 units per reaction (data not shown). Pools were digested with 100 units of Bln I and representative Southern blot analyses are shown in Figure 5b. In pools containing the r!G vector,
45% of the promoters were digested by Bln I (Figure 5c). When a single HSFE or the enhancer plus an HSFE were added, the proportion of accessible promoters increased by 5%. Tandem copies of the HSFE were able to increase the percentage of open promoters to 56% (p < .01).
Figure 5. Quantitative effects of the HSFE on retroviral !-globin promoter accessibility. (a) r!G, rH!G, rEH!G, and r2H!G construct maps showing EcoR I (E), Sst I (S), Xma I and Xho I restriction sites, site of Bln I digestion (arrow) and sizes of parental and Bln I digestion products. (b) Representative Southern blots from r!G, rH!G, rEH!G, and r2H!G pools. Three pools for each construct are shown. Intact nuclei were incubated with 100 units of Bln I. Genomic DNA was then isolated and digested with the appropriate restriction enzymes for Southern blotting. Parental bands are indicated by P and sub-bands resulting from Bln I digestion are indicated with arrowheads. (c) Mean percentage cutting +/- 1 SD for all constructs (n=4). The p-values were determined by Student's t-test.
482
Gene Therapy and Molecular Biology Vol 8, page 483 shown that both HSFE elements can establish distinct HSs. Overall, the structural characteristics of the HSFE are still intact in the context of a retroviral vector. The incorporation of the HSFE did not increase the percentage of open promoters. This was a somewhat surprising result, as we had previously observed that the addition of the HSFE resulted in a 20% increase in the
B. The effect of the HSFE on human !globin gene expression To address the effects of the HSFE on gene expression, we chemically induced globin gene expression with hexamethylene bisacetamide (HMBA) and performed ribonuclease protection assays on the isolated RNA (Figure 6a). Human !-globin expression was normalized to mouse "-globin expression and corrected for both the average copy number of the pool and the different specific activities of the probes. In pools containing the r!G vector, human !-globin expression was 2.6% +/- 0.8% of mouse !-globin (Figure 6b). Upon incorporation of the HSFE, !globin expression increased to 9.6%, a significant increase of nearly 4-fold (p < .01) and incorporation of tandem copies of the HSFE resulted in a 5-fold increase in !globin expression (p < .001). With the addition of the 36 bp HS2 enhancer 5' to the HSFE, human !-globin expression also increased 4-fold compared to the promoter alone (p = .01). When the positions of the HSFE and enhancer were exchanged, !-globin expression was increased only 3-fold (p = .01). There was no observable difference between placing the enhancer element 5’ to the HSFE compared to 3’.
IV. Discussion We have demonstrated that the HSFE is able to form its characteristic structure in the context of a retroviral vector and that tandem HSFEs increased the extent of DNase I accessible promoter chromatin structure. Furthermore, the HSFE, when present as single or tandem copies, is able to increase retroviral !-globin expression up to 5-fold compared to the promoter alone. These results indicate a tissue-specific chromatin-opening element such as the HSFE is able to significantly increase gene expression in the context of a retroviral vector. Additionally, an advantage of using the 101 bp HSFE with a retroviral vector is that the probability of genetic rearrangement and other technical barriers associated with the use of larger LCR fragments vectors is reduced By itself, the integrated human !-globin promoter can form a weak hypersensitive site. The formation of this site is consistent with previous reports describing the formation of a weak hypersensitive site by the globin promoters alone (Tuan et al, 1985; Forrester et al, 1986; Dhar et al, 1990; Iler et al, 1999). The inclusion of the HSFE doubled the region of hypersensitive chromatin in the neighborhood of the !-globin promoter to approximately 230 bp. However, the larger HS is almost entirely localized to the HSFE sequence, encompassing approximately 20% of the !-globin promoter. Although the majority of promoter region is not hypersensitive for either construct, the two critical CACCC boxes, which bind EKLF, do reside within the HS (Miller and Bieker, 1993). However, when tandem copies of the HSFE were used, the detected HS mapped to a region that included the entire minimal promoter. This HS is formed by the 3’ HSFE. We observed a similar localization of the 3’ HS when we stably transfected the tandem HSFE cassette into MEL cells. We were unable to observe the HS formed by the proximal HSFE, although in earlier studies we have
Figure 6. Effect of the HSFE on retroviral !-globin expression. (a) Representative ribonuclease protection assays for each set of pools for all constructs. Human bone marrow and mouse fetal liver controls are indicated. Experimental samples are underneath the black bar. Protected human !-globin (H!) and mouse "-globin (M") mRNAs are indicated by arrows. Copy numbers for each pool is shown in the top row of numbers beneath each assay. Human !-globin gene expression for each pool is shown in the second row of numbers. Expression was quantified using densitometry. (b) Mean human b-globin expression of each construct (n = 4). P-values were determined by t-test.
483
Nemeth and Lowrey: A chromatin opening element increases !-globin expression percentage of open promoters (Iler et al, 1999). However, tandem HSFEs (r2H!G) were able to significantly increase the number of accessible promoters by 10%. The question remains whether such an increase is physiologically meaningful. Thus, it appears that our elements have the capability to increase the size of the region of hypersensitive chromatin but not the proportion of promoters in an open configuration. Even though inclusion of the HSFE did not cause formation of hypersensitive chromatin along the entire promoter, its presence resulted in a significant four-fold increase in human !-globin expression compared to the promoter alone. This increase was comparable to that observed when we stably transfected the HSFE into MEL cells (Nemeth et al, 2001). Novak et al, demonstrated a similar 6-fold increase in clones containing a !-globin retroviral vector incorporating the entire HS4 (Novak et al, 1990). Overall, we observed significant increases in gene expression with all combinations tested. Combining the HS2 enhancer element with the HSFE did not increase gene expression compared to a single HSFE. Since the 36 bp enhancer has been shown to double expression in a !globin retroviral vector and the HSFE alone leads to a 4fold increase, the addition of the enhancer may be redundant as the HSFE has already augmented expression in all the permissive cells in the pool population (Liu et al, 1992). The mechanism by which the HSFE augments gene expression is still not clear. Our original hypothesis was that the HSFE would increase the opportunity for critical transcription factors to interact with the minimal !-globin promoter resulting in increased transcription regardless of the chromatin structure in which the vector was integrated. However, our results, combined with other studies, indicate that expression levels do not always correlate with chromatin accessibility (Milot et al, 1996; Pikaart et al, 1998; Nemeth et al, 2001). A simple model of increased transcription factor accessibility does not explain the increased expression observed with the HSFE. HS4, where the HSFE was first mapped, has been shown to contain no classical enhancer activity when studied in transient assays (Tuan et al, 1989). The HSFE may be inducing more subtle changes in chromatin structure such as alterations in promoter nucleosome acetylation or methylation patterns by bringing important factors in these processes in proximity to the promoter. For example, NF-E2, which binds to the HSFE, has been shown to play a role in histone hyperacetylation (Kiekhaefer et al, 2002). HSFE-bound proteins may also recruit factors, such as CBP and p300, which have endogenous histone acetyltransferase activity and have been implicated in hematopoietic transcription (reviewed in Blobel et al, 2000). In order to meet the minimum level of in vivo expression (roughly 15 to 20% of endogenous globin expression) that could be therapeutically beneficial, ciselements in addition to the HSFE will have to be considered. One candidate is the 1.2 kb fragment from HS4 of the chicken !-globin LCR that has been shown to act as a chromatin insulator in several in vitro and in vivo systems (Chung et al, 1993; Pikaart et al, 1998). In
retroviral vectors, it has been shown that the insulator increases gene expression by increasing the probability of transcription (Rivella et al, 1998; Emery et al, 2000). Another example is the inclusion of scaffold attachment regions in retroviral vectors to achieve increased expression (Murray et al, 2000). Potentially, the use of different chromatin remodeling elements to achieve specific molecular effects will be a useful strategy in the development of vectors capable of long-term, high-level therapeutic gene expression.
Acknowledgments The authors wish to thank Drs. Brian Sorrentino, Elio Vanin, Steve Fiering, Phillipe Leboulch and Jane McInerney for reagents and helpful discussion. This research was supported by grants HL52243 and HL73442 (CHL). MN was the recipient of Ryan Foundation and Rosalind Borison Memorial Pre-Doctoral Fellowships.
References Barklis E, Mulligan RC and Jaenisch R (1986) Chromosomal position or virus mutation permits retrovirus expression in embryonal carcinoma cells. Cell 47, 391-399. Blobel GA (2000) Creb-binding protein and p300: Molecular integrators of hematopoietic transcription. Blood 95, 745755. Challita P-MandKohn DB (1994) Lack of expression from a retroviral vector after transduction of murine hematopoietic stem cells is associated with methylation in vivo. Proc Natl Acad Sci U S A 91, 2567-2571. Chang JC, Liu D and Kan YW (1992) A 36-base-pair core sequence of locus control region enhances retrovirally transferred human !-globin gene expression. Proc Natl Acad Sci U S A 89, 3107-3110. Chen WYandTownes TM (2000) Molecular mechanism for silencing virally transduced genes involves histone deacetylation and chromatin condensation. Proc Natl Acad Sci U S A 97, 377-382. Chung JH, Whiteley M and Felsenfeld G (1993) A 5' element of the chicken !-globin domain serves as an insulator in human erythroid cells and protects against position effect in drosophila. Cell 74, 505-514. Dhar V, Nandi A, Schildkraut CL and Skoultchi AI (1990) Erythroid-specific nuclease-hypersensitive sites flanking the human b-globin domain. Mol. Cell Biol. 10, 4324-4333. Emery DW, Yannaki E, Tubb J, Nishino T, Li Q and Stamatoyannopoulos G (2002) Development of virus vectors for gene therapy of ! chain hemoglobinopathies: Flanking with a chromatin insulator reduces #-globin gene silencing in vivo. Blood 100, 2012-2019. Emery DW, Yannaki E, Tubb J and Stamatoyannopoulos G (2000) A chromatin insulator protects retrovirus vectors from chromosomal position effects. Proc Natl Acad Sci U S A 97, 9150-9155. Epner E, Reik A, Cimbora D, Telling A, Bender MA, Fiering S, Enver T, Martin DI, Kennedy M, Keller G and Groudine M (1998) The !-globin lcr is not necessary for an open chromatin structure or developmentally regulated transcription of the native mouse !-globin locus. Molecular Cell 2, 447-455. Forrester W, Thompson C, Elder J and Groudine M (1986) A developmentally stable chromatin structure in the human !-
484
Gene Therapy and Molecular Biology Vol 8, page 485 globin gene cluster. Proc Natl Acad Sci U S A 83, 13591363. Goodwin AJ, McInerney JM, Glander MA, Pomerantz O and Lowrey CH (2001) In vivo formation of a human b-globin locus control region core element requires binding sites for several factors including gata-1, nf-e2, eklf, and sp-1. J Biol Chem 276, 26883-26892. Grosveld F, Blom van Assendelft G, Greaves D and Kollias G (1987) Position-independent, high-level expression of the human !-globin gene in transgenic mice. Cell 51, 975-985. Hardison R, Slightom JL, Gumucio DL, Goodman M, Stojanovic N and Miller W (1997) Locus control regions of mammalian !-globin gene clusters: Combining phylogenetic analyses and experimental results to gain functional insights. Gene 205, 73-94. Hawley RG, Lieu FH, Fong AZ and Hawley TS (1994) Versatile retroviral vectors for potential use in gene therapy. Gene Ther 1, 136-138. Hoeben RC, Migchielsen AAJ, van der Jagt RCM, van Ormondt H and van der Eb AJ (1991) Inactivation of the moloney murine leukemia virus long terminal repeat in murine fibroblast cell lines is associated with methylation and dependent on its chromosomal position. J Virol 65, 904-912. Iler N, Goodwin A, McInerney J, Nemeth M, Pomerantz O, Layon M and Lowrey C (1999) Targeted remodeling of human !-globin promoter chromatin structure produces increased expression and decreased silencing. Blood Cells Mol. Dis. 25, 47-60. Imren S, Payen E, Westerman KA, Pawliuk R, Fabry ME, Eaves CJ, Cavilla B, Wadsworth LD, Beuzard Y, Bouhassira EE, Russell R, London IM, Nagel RL, Leboulch P and Humphries RK (2002) Permanent and panerythroid correction of murine ! thalassemia by multiple lentiviral integration in hematopoietic stem cells. Proc Natl Acad Sci U S A 99, 14380-14385. Jahner DandJaenisch (1985) Retrovirus-induced de novo methylation of flanking host sequences correlates with gene activity. Nature 315, 594-597. Karlsson S, Papayannopoulou T, Schweiger S, Stamatoyannopoulos G and Nienhuis A (1987) Retroviralmediated transfer of genomic globin genes leads to regulated production of rna and protein. Proc Natl Acad Sci U S A 84, 2411-2415. Karpen G (1994) Position-effect variegation and the new biology of heterochromatin. Curr. Opin. Gen. Dev. 4, 281-291. Kiekhaefer CM, Grass JA, Johnson KD, Boyer ME and Bresnick EH (2002) Hematopoietic-specific activators establish an overlapping pattern of histone acetylation and methylation within a mammalian chromatin domain. Proc Natl Acad Sci U S A 99, 14309-14314. Leboulch P, Huang GM, Humphries RK, Oh YH, Eaves CJ, Tuan DY and London IM (1994) Mutagenesis of retroviral vectors transducing human !-globin gene and !-globin locus control region derivatives results in stable transmission of an active transcriptional structure. EMBO J 13, 3065-3076. Liu D, Chang JC, Moi P, Liu W, Kan YW and Curtin PT (1992) Dissection of the enhancer activity of !-globin 5' dnase ihypersensitive site 2 in transgenic mice. Proc Natl Acad Sci U S A 89, 3899-3903. Lowrey CH, Bodine DM and Nienhuis AW (1992) Mechanism of dnase i hypersensitive site formation within the human globin locus control region. Proc Natl Acad Sci U S A 89, 1143-1147. Miller IJandBieker JJ (1993) A novel, erythroid cell-specific murine transcription factor that binds to the caccc element and is related to the kruppel family of nuclear proteins. Mol. Cell. Biol. 13, 2776-2786.
Milot E, Strouboulis J, Trimborn T, Wijgerde M, de Boer E, Langeveld A, Tan-Un K, Vergeer W, Yannoutsos N, Grosveld F and Fraser P (1996) Heterochromatin effects on the frequency and duration of lcr-mediated gene transcription. Cell 87, 105-114. Murray L, Travis M, Luens-Abitorabi K, Olsson K, Plavec I, Forestell S, Hanania EG and Hill B (2000) Addition of the human interferon ! scaffold attachment region to retroviral vector backbones increases the level of in vivo transgene expression among progeny of engrafted human hematopoietic stem cells. Hum Gene Ther 11, 2039-2050. Nemeth MJ, Bodine DM, Garrett LJ and Lowrey CH (2001) An erythroid-specific chromatin opening element reorganizes !globin promoter chromatin structure and augments gene expression. Blood Cells Mol Dis 27, 767-780. Novak U, Harris E, Forrester W, Groudine M and Gelinas R (1990) High-level !-globin expression after retroviral transfer of locus activation region-containing human !globin gene derivatives into murine erythroleukemia cells. Proc Natl Acad Sci U S A 87, 3386-3390. Orkin SH and Motulsky AG (1995) Report and recommendations of the panel to assess the nih investment in research on gene therapy, pp. Office of Recombinant DNA activities website. Persons DA, Allay ER, Sawai N, Hargrove PW, Brent TP, Hanawa H, Nienhuis AW and Sorrentino BP (2003a) Successful treatment of murine !-thalassemia using in vivo selection of genetically modified, drug-resistant hematopoietic stem cells. Blood 102, 506-513. Persons DA, Hargrove PW, Allay ER, Hanawa H and Nienhuis AW (2003b) The degree of phenotypic correction of murine !-thalassemia intermedia following lentiviral-mediated transfer of a human #-globin gene is influenced by chromosomal position effects and vector copy number. Blood 101, 2175-2183. Philipsen S, Pruzina S and Grosveld F (1993) The minimal requirements for activity in transgenic mice of hypersensitive site 3 of the ! globin locus control region. EMBO J 12, 1077-1085. Philipsen S, Talbot D, Frase P and Grosveld F (1990) The !globin dominanat control region: Hypersensitive site 2. EMBO J 9, 2159-2167. Pikaart MJ, Recillas-Targa F and Felsenfeld G (1998) Loss of transcriptional activity of a transgene is accompanied by DNA methylation and histone deacetylation and is prevented by insulators. Genes and Development 12, 2852-2862. Pomerantz O, Goodwin AJ, Joyce T and Lowrey CH (1998) Conserved elements containing nf-e2 and tandem gata binding sites are required for erythroid-specific chromatin structure reorganization within the human !-globin locus control region. Nucleic Acids Res 26, 5684-5691. Pruzina S, Hanscombe O, Whyatt D, Grosveld F and Philipsen S (1991) Hypersensitive site 4 of the human ! globin locus control region. Nucleic Acids Res 19, 1413-1419. Ramezani A, Hawley TS and Hawley RG (2003) Performanceand safety-enhanced lentiviral vectors containing the human interferon-! scaffold attachment region and the chicken !globin insulator. Blood 101, 4717-4724. Reik A, Telling A, Zitnik G, Cimbora D, Epner E and Groudine M (1998) The locus control region is necessary for gene expression in the human !-globin locus but not the maintenance of an open chromatin structure in erythroid cells. Mol. Cell. Biol. 18, 5992-6000. Rivella S, Callegari J, May C and Sadelain M (1998) The insulator element chs4 increases expression and prevents promotor methylation of integrated retroviral vectors. Blood Cells, Molecules and Diseases 24, 483.
485
Nemeth and Lowrey: A chromatin opening element increases !-globin expression Stamatoyannopoulos JA, Goodwin A, Joyce T and Lowrey CH (1995) Nf-e2 and gata binding motifs are required for the formation of dnase i hypersensitive site 4 of the human !globin locus control region. EMBO J 14, 106-116. Talbot D, Philipsen S, Fraser P and Grosveld F (1990) Detailed analysis of the site 3 region of the human !-globin dominant control region. EMBO J. 9, 2169-2178. Tuan D, Solomon W, Li Q and London I (1985) The "!-likeglobin" gene domain in human erythroid cells. Proc Natl Acad Sci U S A 82, 6384-6388.
Tuan DYH, Solomon WB, London IM and Lee DP (1989) An erythroid-specific, developmental- stage- independent enhancer far upstream of the human "!-like globin" genes. Proc Natl Acad Sci U S A 86, 2554-2558. Wang L, Robbins PB, Carbonaro DA and Kohn DB (1998) Highresolution analysis of cytosine methylation in the 5long terminal repeat of retroviral vectors. Human Gene Therapy 9, 2321-2330.
486
Gene Therapy and Molecular Biology Vol 8, page 475 Gene Ther Mol Biol Vol 8, 475-486, 2004
An erythroid-specific chromatin opening element increases !-globin gene expression from integrated retroviral gene transfer vectors Research Article
Michael J. Nemeth1 and Christopher H. Lowrey2,3,4,* 1
Hematopoiesis Section, Genetics and Molecular Biology Branch, National Human Genome Research Institute, Bethesda, MD, USA, 2 Departments of Medicine 3 Pharmacology/Toxicology 4 The Norris Cotton Cancer Center, Dartmouth Medical School, Hanover, NH 03755, USA
__________________________________________________________________________________ *Correspondence: Christopher H. Lowrey, M.D., Norrris Cotton Cancer Center, Dartmouth-Hitchcock Medical Center, Lebanon, NH 03756; Phone: 603-653-9967; Fax: 603-653-3543; e-mail: c.lowrey@dartmouth.edu Key words: chromatin structure, !-globin, retrovirus, DNase I hypersensitive site, locus control region Abbreviations: Fetal Bovine Serum, (FBS); green fluorescent protein, (GFP); hexamethylene bisacetamide, (HMBA); hypersensitive sites, (HS); locus control region, (LCR); multiple cloning site, (MCS); murine stem cell virus, (MSCV) Received: 14 November 2004; Accepted: 29 November 2004; electronically published: December 2004
Summary Gene therapy strategies requiring long-term high-level expression from integrated genes are currently limited by inconsistent levels of expression. This may be observed as variegated, silenced or position-dependent gene expression. Each of these phenomena involve suppressive chromatin structures. We hypothesized that by actively conferring an open chromatin structure on integrated vectors would increase transgene expression. To test this idea we used a 100bp element from the !-globin locus control region (LCR) which is able to independently open local chromatin structure in erythroid tissues. This element includes binding sites for GATA-1, NF-E2, EKLF and Sp-1 and is evolutionarily conserved. We constructed a series of MSCV-based vectors containing the !-globin gene driven by a minimal !-globin promoter with combinations of the HSFE and LCR derived enhancer elements. Pools of MEL clones containing integrated vectors were analyzed for chromatin structure and !-globin gene expression. The HSFE increased the extent of nuclease sensitive chromatin over the promoters of the constructs. The most effective vector included tandem copies of the HSFE and produced a 5-fold increase in expression compared to the promoter alone. These results indicate that the HSFE is able to augment the opening of !-globin promoter chromatin structure and significantly increase gene expression in the context of an integrated retroviral vector. variegation, where local chromatin structure affects the probability that a given cell within a population will express the integrated gene (Karpen, 1994). Viral integration into transcriptionally favorable chromatin structure increases the probability of expression but some cells within a clonal population will still not express the transferred gene. Furthermore, integration could occur initially into a region that is transcriptionally favorable but becomes less permissive over time due to repressive alterations in local chromatin structure. The resultant transcriptional silencing is not due to a gradual decrease in expression of all cells but rather the complete loss of expression in an increasing proportion of cells (Hoeben et al, 1991) Changes in chromatin structure, specifically
I. Introduction Clinical applications of gene therapy that require long-term expression have been limited by an inability to achieve consistent, high-level expression from integrated gene therapy vectors such as retroviruses (Orkin and Motulsky, 1995). These vectors exhibit highly variable or position-dependent expression, which is proposed to be due in part to the formation of highly condensed, suppressive local chromatin structures at sites of integration. In this model, transgene expression can range from high to non-existent depending upon whether integration occurs into a region of transcriptionally active or inactive chromatin structure (Barklis et al, 1986). The wide range in expression is often due to position effect
475
Nemeth and Lowrey: A chromatin opening element increases !-globin expression increased DNA methylation and histone deacetylation, are often associated with transcriptional silencing (Jahner and Jaenisch, 1985; Hoeben et al, 1991; Challita and Kohn, 1994; Wang et al, 1998; Chen and Townes, 2000). Chromatin structure can affect the ability of the integrated retroviral vector to achieve therapeutically relevant levels of gene expression. Overcoming this barrier is especially critical since retroviral vectors are the most frequently used vector in clinical and scientific applications where long-term gene expression is desired. Recent generation lenteviral vectors are still subject to these chromatin-related effects (Persons et al, 2003b). While strategies such as drug selection (Persons et al, 2003a) and methods to achieve improved rates of transduction (Imren et al, 2002) have been applied to overcome low levels of expression from retrovirally transduced globin genes, most approaches have focused on combining various fragments of the LCR and testing them to see which ones give optimal expression. Recently genetic insulators and scaffold attachment regions have been used to protect globin genes from the negative effects of surrounding chromatin and enhance expression (Emery et al, 2000,2003; Ramezani et al, 2003). Our approach has been to investigate development of gene transfer vectors that are able to autonomously open and maintain surrounding domains of active chromatin structure regardless of their site of integration within the genome (Iler et al, 1999; Nemeth et al, 2001). In this study, we have examined the strategy of incorporating a relatively small cis-acting element which is able to alter local chromatin structure in an erythroid-specific manner within a globin-expressing retroviral vector. The HSFE is an erythroid-specific chromatin remodeling element derived from the human !-globin LCR. The LCR is comprised of five DNase I hypersensitive sites (HS) located 5 to 25 kb upstream of the !-globin locus and is necessary for high-level expression of the !-globin genes (Tuan et al, 1985; Grosveld et al, 1987; Epner et al, 1998; Reik et al, 1998). Originally, the HSFE was derived as a 101 bp element from the core of HS4 and was found to be both necessary and sufficient for the formation of a DNase I HS typical of the LCR HS core structures (Lowrey et al, 1992). The HSFE contains binding sites for the erythroid-specific factors NF-E2, GATA-1, and EKLF and the ubiquitous factor Sp-1, all of which are necessary to establish a hypersensitive chromatin domain (Pruzina et al, 1991; Lowrey et al, 1992; Stamatoyannopoulos et al, 1995; Goodwin et al, 2001). Similar clusters of binding sites are found within the other erythroid-specific LCR HS cores where they are also required for HS formation and are evolutionarily conserved (Philipsen et al, 1990; Talbot et al, 1990; Philipsen et al, 1993; Hardison et al, 1997; Pomerantz et al, 1998). Previously, we have demonstrated that the HSFE can mediate functional tissue-specific "opening" of a minimal human !-globin promoter and increase expression of a linked human !-globin gene in both MEL cell clones and in transgenic mice (Iler et al, 1999; Nemeth et al, 2001). We hypothesized that incorporation of the HSFE into a !-globin retroviral vector would result in a similar remodeling of human !-globin
promoter chromatin structure and a subsequent increase in expression.
II. Materials and methods A. !-globin retroviral vectors All retroviral !-globin constructs were generated using a parent murine stem cell virus (MSCV) vector (Hawley et al, 1994). A 1.3 kb EcoR I-Hind III fragment was removed and replaced with a multiple cloning site (MCS) that contained 5' EcoR I/Sal I/Xho I/Hind III-3'. A 1.3 kb Xho I-Sal I fragment containing an IRES-GFP sequence was inserted into the Sal I site of MSCV-MCS to create MSCV-GFP. To construct r!G, a human !-globin gene vector (p141) containing a 372 bp deletion within the second intern was provided by Dr. Phillipe Leboulch (Harvard University, Boston, MA). A BamH I-Eco R I fragment from p141 containing the intern deletion (Genbank #U01317.1; bp 62718-63092) was then subcloned into a wild-type human !-globin sequence between the BamH I and EcoR I sites. The modified human !-globin gene and minimal 110 bp human b-globin promoter was then inserted into MSCV-GFP as an intact Xho I – Sal I fragment in an antisense orientation with regards to viral transcription. To construct rH!G, a 190 bp PCR fragment containing the HSFE was synthesized (Genbank #U01317.1; bp 1060-1222) and inserted into the Xho I site of r!G. This fragment also serves as the 5' HSFE in the r2HbG construct. Both rEH!G and r2H!G were constructed by inserting Xho I-Bgl II fragments excised from the previously described pEH!G and p2H!G constructs that contain the cis-acting elements as well as 10 bp of the minimal promoter into the corresponding Xho I and Bgl II sites located within the minimal !-globin promoter in r !G (Nemeth et al, 2001). rHE!G was constructed by inserting a 220 bp Xho IBgl II fragment containing the 36 bp enhancer sequence upstream of the HSFE into the Xho I and Bgl II sites of r!G. rE'H!G was constructed by inserting a 385 bp PCR fragment from HS2 (Genbank #U01317.1; nucleotides 8480-8865) into rH!G at the Xho I site upstream of the HSFE.
B. Retroviral transduction Briefly, 3 µg of each retroviral construct was transiently co-transfected along with 3 µg pVPack-GP vector and 3 µg pVPack-VSV-G vector (Stratagene, La Jolla, CA) into 2 x 106 293T cells by CaPO4 transfection using the CellPhect transfection kit (Amersham Biosciences, Piscataway, NJ). The 293T cells were maintained in Dulbecco’s Modified Eagle Medium supplemented with 10% Fetal Bovine Serum (FBS) (Invitrogen Gibco, Carlsbad, CA). Cells were incubated under cell culture conditions with the DNA precipitate for 8 hours. Media was then removed and the cells treated with 15% glycerol in isotonic HEPES (pH 7.5) for 3 minutes. The glycerol/HEPES solution was then removed and the cells washed once with media before being replenished with media and returned to culture conditions. Twenty-four hours later, the media was removed from the 293T cells and replaced with pre-warmed media and collection of viral particles begun. Media containing viral particles was collected 48 hours later and added to 1 x 105 MEL cells. Pre-warmed media was then added to the packaging cells, collected 24 hours later, and added to the MEL cells. Viral transduction was facilitated through the addition of 6 ng/ml hexamethedrine bromide (Polybrene$; Sigma, St. Louis, MO) to MEL cells co-cultured with viral supernatant. MEL cells were then cultured for 48 hours before FACS analysis. Transduced MEL cells were collected and assayed for GFP expression. Approximately 1.5 x 10 4 GFP+ cells per experimental vector were sorted in 1 ml FBS. The cells were then centrifuged and resuspended in 10 ml Improved MEM Zinc Option media
476
Gene Therapy and Molecular Biology Vol 8, page 477 (Invitrogen Gibco) supplemented with 10% FBS and maintained at 37°C. To determine intact transfer of the !-globin and associated LCR sequence to the MEL cell, 10 µg of genomic DNA from each pool was digested with Xho I and Sal I. Digestion products were detected by Southern blotting as described. The bamboo-EcoR I region of the !-globin gene was used as the probe. To determine the multiplicity of infection, 10 µg genomic DNA from pools containing the r!G and rH!G vectors were digested with EcoR I. Digestion products were detected by Southern blotting using the same !-globin probe. Copy number for each pool was determined by slot-blot analysis.
III. Results We subcloned the HSFE element upstream of a minimal human !-globin promoter and gene in the context of a MSCV vector (Figure 1a). This vector also contains the enhanced green fluorescent protein (GFP) gene, which is transcribed from the viral 5' LTR. In order to prevent removal of the !-globin introns, which are necessary for high-level expression, the LCR, promoter, and gene sequences are oriented in an antisense direction with respect to viral transcription (Karlsson et al, 1987). A 372 bp region from the second intern of the !-globin gene was also removed, which has been shown that this deletion improves both viral titer and the genetic stability of the vector without adversely affecting !-globin gene expression (Leboulch et al, 1994). Altogether, six !-globin vectors were made (Figure 1b). Briefly, r!G contains the 110 bp minimal human !-globin promoter alone, rH!G contains the HSFE upstream of the promoter, rEH!G contains a 36 bp erythroid-specific enhancer derived from HS2 located at the 5' end of the HSFE (Chang et al, 1992), r2H!G contains tandem HSFE elements separated by approximately 150 bp, rHE!G contains the 36 bp enhancer and the HSFE in reverse order, and rE'H!G contains a 374 bp fragment from HS2 (which contains the 36 bp enhancer) upstream of the HSFE. These constructs were transduced into MEL cells using a transient VSV-G packaging cell line. FACS analysis was then used to select GFP+ MEL cells (Figure 2). After transduction of MEL cells with either r!G or rH!G, approximately 1-3% of MEL cells were positive for GFP expression. Similar percentages were observed for the other constructs (data not shown). GFP+ cells were sorted and separated into three to four pools per construct. To ensure the intact transfer of the human !-globin gene and any associated regulatory elements, genomic DNA was isolated from the transduced pools and analyzed for copy number and the integrity of the !-globin gene sequence (Figure 3a). The !-globin gene, promoter, and any associated LCR elements were integrated intact into the MEL genome for all constructs except rE'H!G. This vector, which contains a 374 bp HS2 enhancer, was genetically rearranged as indicated by loss of the !-globin gene. To determine whether our retroviral pools contained multiple integration sites, genomic DNA was digested with EcoR I, which cuts the human !-globin gene at a single site in all vectors. A representative analysis is shown in Figure 3b for the r!G and rH!G vectors. For both constructs, each pool contained multiple integration sites, as indicated by " smearing" of the Southern blot signal over a wide range.
C. Nuclease sensitivity assays DNase I hypersensitivity assays were performed on nuclei isolated from transduced pools as previously described (Iler et al, 1999). Pools were maintained in culture conditions until they reached log phase growth (8 x 105 - 1 x 106 cells/ml). Nuclei corresponding to approximately 200 µg per reaction were incubated with DNase I (Worthington Biochemical, Lakewood, NJ) at concentrations ranging from 0 to 4.0 mg/ml DNase I for 10 minutes at 37°C. Regions of DNase I hypersensitivity were mapped by plotting the migration distance of the molecular weight markers versus the logarithm of their size in base pairs for each blot. These data points were then fitted to the equation: i %( migration d i s t a n c in e cm ) ( fragment size ( bp) = m % '& e )
This produces a straight line where "m" is the slope of the line and "i" is the y-intercept. By measuring the migration distances of the upper and lower limits of each DNase I HS and applying the above formula, the size, and therefore location, of the HS boundaries within the parental fragment was determined. Restriction endonuclease sensitivity assays using Bln I were performed on intact nuclei as described (Iler et al, 1999). For initial experiments, nuclei (200 µg DNA/reaction) were digested with Bln I at amounts of 0, 10, 20, 40, 80 and 160 units at 37°C for 20 minutes. In subsequent experiments Bln I amounts of 0 and 100 units were used because complete cutting was consistently obtained above 80 units per reaction. Relative band intensities were determined by densitometry performed on images captured on a Phosphor Screen and resolved with the PhosphorImager 445 SI (Molecular Dynamics, Sunnyvale, CA). The percentage of restriction enzyme digestion was determined by dividing the intensity of the sub-band by the sum of the intensities of the sub-band and the parental band (S/(P+S)). Statistical analysis was performed using Student's t-test.
D. Human !-globin RNA analysis For all pools, globin expression was induced by 3mM HMBA for 4 days. RNA was isolated with Trizol (Invitrogen) Human !-globin and mouse "-globin expression were quantified using ribonuclease protection analysis using the RPA III kit (Ambion, Austin, TX). RNA probes were synthesized using the T7 MaxiScript kit (Ambion). pT7M" and pT7!M were used to generate probes for mouse "-globin and human !-globin respectively and were a kind gift from Dr. Qiliang Li (University of Washington, Seattle, WA). pT7M" protects a 128 bp fragment and pT7!M protects a 206 bp fragment. Each hybridization reaction consisted of approximately 1 µg of RNA and 1 x 106 cpm of both probes (the specific activity of each probe generally ranged from 1-2 x 106 cpm/ng). Hybridization products were electrophoresed on an 8.0% acrylamide/6 M urea gel and relative expression levels were quantified by PhosphorImager analysis. Human !-globin expression was corrected for both copy number and the different specific activities of the probes and normalized to mouse "-globin. Statistical analysis was performed using Student's t-test.
A. Chromatin structure of the integrated human !-globin promoter To determine the extent of the hypersensitive domain in our retroviral constructs, we performed DNase I sensitivity assays on the retroviral pools and mapped the size and location of detected HSs (Figure 4). Representative Southern blot analyses depicting formation 477
Nemeth and Lowrey: A chromatin opening element increases !-globin expression of the hypersensitive sites are shown in Figure 4b. The integrated r!G vector, which contains the minimal promoter by itself, contained a hypersensitive site approximately 110 bp long and included the first 20 bp of the promoter itself (Figure 4c). The addition of the HSFE approximately doubled the region of hypersensitive
chromatin from 110 bp to 230 bp. In both the presence and absence of the HSFE, only approximately 20bp of the distal promoter was hypersensitive. However, while the incorporation of tandem HSFE elements created a similarly sized 190 bp HS, this HS was shifted to include most of the minimal !-globin promoter.
Figure 1. Retroviral !-globin vectors used to evaluate HSFE activity. (a) Design of the !-globin retroviral vector. The parent vector is the murine stem cell retrovirus (MSCV). The vector contains a GFP gene transcribed from the 5' LTR and the human !-globin gene transcribed from the minimal human !-globin promoter in an anti-sense orientation. A 372 bp region of the second !-globin intron has been deleted. The chromatin opening elements are subcloned 3' of the promoter in an anti-sense orientation. (b) !-globin retroviral vectors. Construction of vectors is described in Methods. Elements used to construct the vectors include the 110 bp minimal human !globin promoter (Pro), HSFE, the 36 bp erythroid-specific HS2 enhancer (Enh), and a 385 bp fragment from HS2, containing which the 36 bp enhancer (Enhâ&#x20AC;&#x2122;).
478
Gene Therapy and Molecular Biology Vol 8, page 479
Figure 2. Generation of !-globin retroviral vector pools. GFP-FACS analysis of transduced MEL cells. Representative histograms displaying the percentage of GFP expressing MEL cells after transduction with r!G and rH!G vectors. Wild-type MEL cells and a MEL clone that expresses GFP served as negative and positive controls respectively.
479
Nemeth and Lowrey: A chromatin opening element increases !-globin expression
Figure 3. Analysis of integrated !-globin vector DNA. (a) Top: Vector schematic displaying Xho I (X) and Sal I (S) restriction sites and the range of sizes of the digestion products. Bottom: Integrity of retroviral vectors. Southern blot displaying intact !globin sequences for 5 out of 6 vectors. Human bone marrow DNA (H!) was digested with Pst I/Bgl II as a positive control. Genomic DNA from each pool was isolated and digested with Xho I/Sal I. (b) Multiple integration sites of retroviral pools. Genomic DNA isolated from r!G and rH!G pools was digested with Eco RI which cuts once within the vector.
To quantify the proportion of !-globin promoters accessible to restriction endonuclease digestion, and therefore in an open chromatin configuration, we performed restriction endonuclease assays on all pools generated from selected constructs. Intact nuclei were
performed restriction endonuclease assays on all pools generated from selected constructs. Intact nuclei were digested with Bln I, which uniquely digests at a single site within the !-globin promoter (Figure 5a).
480
Gene Therapy and Molecular Biology Vol 8, page 487 Gene Ther Mol Biol Vol 8, 487-494, 2004
Decreased tumor growth using an IL-2 amplifier expression vector Research Article
Xianghui He1, Farha H Vasanwala2, Tom C Tsang1, Phoebe Luo1, Tong Zhang3 and David T Harris1 1
Gene Therapy Group, Department of Microbiology and Immunology, University of Arizona, Tucson, Arizona 85724, USA 2 Department of Microbiology and Immunology, Indiana University, Indianapolis, IN 46202 3 Department of Microbiology and Immunology, Dartmouth Medical School, Dartmouth-Hitchcock Medical Center, Lebanon, NH 03766
__________________________________________________________________________________ *Correspondence: Dr. David T. Harris, Gene Therapy Group, Department of Microbiology and Immunology, PO Box 245049, 1501 N. Campbell Ave, Life Sciences North, University of Arizona, Tucson, AZ 85724; Tel: +1-520-626-5127; Fax: +1-520-626-2100; E-mail address: davidh@u.arizona.edu Key words: Cancer, interleukin-2, amplifier vector, gene therapy Abbreviations: cytomeglovirus, (CMV); enzyme-linked immunosorbent assay, (ELISA); horseradish peroxidase, (HRP); interferon-!, (IFN-!); interleukin-2, (IL-2) Received: 3 December 2004; Accepted: 10 December 2004; electronically published: December 2004
Summary The success of gene therapy relies on sufficient gene expression in the target tissue. The application of non-viral vectors, such as plasmid DNA, is limited by low in vivo transfection efficiency compared to viral vectors. Strategies to enhance gene transcription should augment target gene expression and make the vector more efficient. In the present study we describe a transcription factor- based amplifier strategy to enhance transgene expression. Our data showed that compared to CMV promoter driven IL-2 expression, expression of TAT in the same plasmid downstream of the HIV LTR significantly enhanced the expression level of IL-2 (up to 20-fold). Gene-modification of murine B16 melanoma with the amplifier IL-2 expression vector resulted in decreased tumor growth and prolonged animal survival in vivo. Klibanov, 2003; Jaroszeski et al, 2004; Recillas-Targa et al, 2004). Currently, the most widely used promoter in gene therapy trials is the cytomeglovirus (CMV) promoter, which is considered to be the strongest of the commonly used promoters (Yew et al, 1997). However, therapeutic levels of transgene expression are not achieved in many cases, especially for cytokine-based cancer immuno-gene therapy. Because of its prevalence and tendency to recur after traditional therapy, cancer has been targeted by two-thirds of gene therapy clinical trials. Cytokine-based immunogene therapy is a major player and one quarter of genes transferred in clinical trails are cytokine genes (Jaroszeski et al, 2004). Cytokines such as interleukin-2 (IL-2) and interferon-! (IFN-!) can augment immune responses. IL-2 gene therapy experiments with laboratory mice have shown cures of up to 100% of established tumors (Porgador et al, 1993; Toloza et al, 1996), but the level of success in human clinical trials has lagged behind. Similar
I. Introduction Gene therapy is one of the newest strategies for treating human disease. Since Rosenberg et al. performed the first human gene therapy trial in 1989, over 900 clinical trials have been completed or are ongoing worldwide (Edelstein et al, 2004). Non-viral vectors have been used in approximately 25% of the trails performed to date. Non-viral vectors are safe and easy to manufacture. However, their application is hindered by the lower levels of transgene expression compared to viral vectors. Efforts to increase transgene production are of great interest. Strategies explored to increase transgene production include improvement in the efficiency of gene delivery through application of new technologies such as electroporation and polycations, and enhancement in the activity of gene transcription and translation by manipulation of expression cassettes such as the use of strong promoters, proper introns and even chromatin regulatory elements (Xu et al, 2001; Thomas and 487
He et al: Gene therapy using amplifier IL-2 expression vectors cloned into the same site as IL-2 in these vectors to generate pCIEGFP, pHi2-EGFP-neo-C-TAT, and pHi1-EGFP-neo-C-TAT.
results have been seen for other stimulatory cytokines in cancer therapy. Low levels of transgene expression have been thought to be a limiting factor in these trails. In a previous study we developed amplifier gene expression plasmid vectors to achieve high levels of IL-2 expression (Tsang et al, 2000). Here, we compare these vectors with traditional CMV promoter-based vectors and apply them for immuno-gene therapy of murine melanoma.
C. Cell transfection Tumor cells were transfected with plasmid DNA using cationic lipid DMRIE-C (Invitrogene, Carlsbad, CA) according to the manufacturer’s protocol. Briefly, 1µg DNA of DNA and 4µl of lipid were mixed separately with 500µl of OPTI-MEM media (GIBCO, Rockville, MD). The two solutions were then mixed together and allowed to incubate for 45 min. at room temperature to form lipid/DNA complexes. The target cells were washed once with OPTI-MEM media, the transfection mixture added and the cells were incubated with lipid/DNA complexes for 4 hours. The medium was then replaced with fresh culture medium. While selecting stable transgene expressing clones, the tumor cells were selected in 600µg/ml Geneticin containing medium 48 hours after transfection, and cloned by limiting dilution in 96-well plates. The transfection efficiency was determined by measuring the percent of GFP positive cells within the EGFP-expressing plasmids transfected groups by flow cytometry.
II. Materials and Methods A. Mice and cell lines C57BL/6J mice (aged 6-12 weeks) mice were purchased from Jackson Laboratories (Bar Harbor, ME). Animals were maintained under specific pathogen-free conditions in the animal facility at the University of Arizona. Human lung carcinoma A549 cells, the human breast carcinoma cell line MCF-7, mouse melanoma B16 cells and mouse mammary carcinoma 4T1 cells were obtained from American Type Culture Collection (Manassas, VA). All cells were maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum (Irvine Scientific, CA), 2mM glutamine, 1mM pyruvate, 50µM 2mercaptoethanol, penicillin (200units/ml), and streptomycin (200µg/ml) at 37 °C in a 5% CO2/95% air atmosphere. For genemodified cells, Geneticin (G418, 600µg/ml, Invitrogen, Carlsbad, CA) was added to the medium.
D. Cytokine expression and bioactivity assays IL-2 expression was tested by enzyme-linked immunosorbent assay (ELISA) using either the IL-2 EASIA kit (Medgenix Diagnostic, Fleurus, Belgium) or the OptEIA Human IL-2 Set (Pharmingen, San Diego, CA) according to the manufacturer’s protocol. Briefly, after washing, a standardized IL-2 solution and cell culture supernatants were then added to the wells of capture monoclonal antibody-coated 96 well plate. Following two hours of incubation, the plate was washed. A biotin-labeled detection antibody and avidin-horseradish peroxidase (HRP) was then added. After another 1-hour incubation and washing, the substrate solution was added and then read at 450nm. A standard curve was plotted and IL-2 concentrations were determined by interpolation from the standard curve. Results were calculated as IU/ml of IL-2 and the values of IL-2 were reported as per million cells per ml. The biological activity of the IL-2 in the culture supernatants of IL-2 expressing plasmid transfected cells was determined by stimulation of cell proliferation with a mouse cytotoxic T cell line, CTLL-2, which requires IL-2 for growth (Gillis and Smith, 1977).
B. Genetic constructs The following plasmid vectors were constructed (Figure 1): (1) pCI-IL2-neo: CMV promoter driving the expression of human IL-2. (2) pHi1-IL2-neo-C-TAT: HIV1 long terminal repeat driving the expression of human IL-2, and the CMV promoter driving the expression of HIV Tat. (3) pHi2-IL2-neoC-TAT: HIV2 long terminal repeat driving the expression of human IL-2, and the CMV promoter driving the expression of HIV TAT. To construct pCI-IL-2-neo, the human IL-2 gene (a gift from Dr. Evan Hersh, University of Arizona, Tucson, AZ) was adapted for the EcoR I site of pCI-neo (Promega, Madison, WI) with the Sac-Kiss-Lambda vector (Tsang et al, 1996). The IL-2 gene was then excised from pSac-Kiss-IL2 as an EcoR I fragment and inserted into the EcoR I site of pCI-neo. To construct pHi2-IL2-neo-C-TAT, the HIV2 LTR was excised from pGL2-HIV2 (a gift from Dr. Gunther Krauss, Vienna University Medical School, Austria) by Bgl II digestion followed by partial digestion with Hind III. The 0.8 kb Bgl II-Hind III fragment containing the HIV2 promoter then replaced the CMV promoter in Bgl II and Hind III digested pCI-neo to create pHIV2-neo. The IL-2 gene excised from pSac-Kiss-IL2 with EcoR I was inserted into the EcoR I site of pHIV2-neo to yield the plasmid, pHIV2-IL2 neo. A pCEP4 (Invitrogen, Carlsbad, CA) –derived CMV promoter was then inserted at the BamH I site of pHIV2-IL2 neo to create pHi2-IL-2-neo-C. The tat gene was excised from the plasmid pTAT (Arya et al, 1985) with Xba I and ligated with Xba I digested Kpn-Kiss-Lambda to create Kpn-Kiss-TAT. The tat gene was then cut back out with Not I and inserted into the Not I site following the CMV promoter in pHi2-IL2-neo-C and resulted in the pHi2-IL2-neo-C-TAT. Similarly, the HIV1 LTR was excised with Hind III from pGL2HIV1 (obtained from Dr. L. Luznick, University of Arizona, Tucson, AZ) and replaced the HIV-2 promoter in the Hind III site of pHIV2-IL2 –neo to generate pHIV1-IL2-neo. The CMV promoter was then inserted into pHIV1-IL2-neo to generate pHi1-IL2-neo-C. pHi1-IL2-neo-C-TAT was created by inserting the Not I fragment from Kpn-Kiss-TAT into the Not I site of pHi1-IL2-neo-C. In addition, to assess transfection efficiencies, the EGFP (Enhanced Green Fluorescence Protein) gene was also
E. In vivo tumor growth studies C57BL/6 mice were injected subcutaneously in the hind flank with either 0.5 x 106 B16 cells, 0.5 x 106 B-10 cells (B16 cells transfected with the pCI-IL2 plasmid) or 0.5 x 106 BB-15 cells (B16 cells transfected with the pHi2-IL2-neo-C-TAT plasmid) in 100µl of PBS. Tumor growth was monitored over time and tumor size was measured with vernier calipers.
III. Results A. Construction expression vectors
of
amplifier
gene
The CMV promoter is the most commonly used promoter in gene therapy. We constructed the plasmid pCI-IL2-neo, in which the CMV promoter drives human IL-2 gene expression, as a control to develop high level gene expression vectors. We first replaced the CMV promoter with either the HIV-1 or the HIV-2 LTR to drive IL-2 expression (plasmids pHi1-IL2-neo-C and pHi-IL2neo-C, respectively). The CMV promoter was placed downstream of the neo gene, to drive second gene 488
Gene Therapy and Molecular Biology Vol 8, page 489 expression in these plasmids. The HIV transcriptional activator, the tat gene, was then introduced into these plasmids under the control of the CMV promoter, resulting in pHi1-IL2-neo-C-TAT and pHi2-IL2-neo-C-TAT (Figure 1). The expression of the tat gene should enhance the transcriptional activity of the LTR and result in enhanced gene product. In addition, to assess transfection efficiencies, the EGFP gene was also cloned into these vectors replacing the IL-2 gene, resulting in plasmids termed pCI-EGFP, pHi2-EGFP-neo-C-TAT, and pHi1EGFP-neo-C-TAT.
HIV promoter and tat gene were active in these mouse cell lines. The IL-2 levels obtained from the pHi1-IL2-neo-CTAT (60 pg/ml in B16 cells) were also higher than IL-2 levels from the pCI-IL2-neo plasmid, but lower than pHi2IL2-neo-C-TAT. In addition, the biological activity of the transgenic IL-2 harvested from the culture supernatants of IL-2 expressing plasmid transfected cells was confirmed by CTLL-2 assay (data not shown).
C. Gene-modification of B16 melanoma B16 cells were transfected with either the pCI-IL2neo or the pHi2-IL2-neo-C-TAT plasmid and neomycinresistant clones were obtained 14 days after selection with G418. The clones were assayed for IL-2 secretion by ELISA. Figure 5 shows four representative clones. Clone B-10 (9.6 pg/ml) was derived from cells transfected with pCI-IL2-neo, in which the IL-2 gene is under the control of CMV promoter. Clone BB-15 (165 pg/ml) was derived from cells transfected with pHi2-IL2-neo-C-TAT, in which the IL-2 gene is driven by HIV2 LTR and the tat gene is under the control of CMV promoter. These two clones had the same doubling time in vitro as the parental (untransfected) B16 cells and were used in the in vivo study.
B. High level gene expression through coexpression of a transcription factor within the same plasmid The IL-2 expression plasmids and the EGFP expression plasmids were transfected individually into two different human cell lines, A549 and MCF-7. Supernatants were collected 24 hours after transfection to measure IL-2 secretion, and the cells transfected with the EGFP expression plasmids were harvested to assess EGFP expression by flow cytometry as a measure of transfection efficiency. Figure 2 shows that higher levels of IL-2 were achieved by the pHi2-IL2-neo-C-TAT and pHi1-IL2-neoC-TAT plasmids, as compared to the plasmid pCI-IL-2neo, after transfection of both A549 and MCF-7 cells. In A549 cells, pHi2-IL2-neo-C-TAT and pHi1-IL2-neo-CTAT transfection resulted in 357 IU/ml and 182 IU/ml of IL-2 respectively, whereas pCI-IL2 resulted in 18 IU/ml. The EGFP flow cytometry data indicated that the three different plasmids had similar transfection efficiencies (around 70%) in A549 cells (Figure 3). Thus, the differences observed in the IL-2 levels must therefore have resulted from differences in transcriptional activity of these plasmids. The IL-2 expression plasmids were also tested in mouse tumor cells. B16 melanoma and breast carcinoma 4T1 cells were transfected and IL-2 levels were measured 24 hours post-transfection. As shown in Figure 4 , higher levels of IL-2 were obtained from the pHi2-IL2-neo-CTAT plasmid (140 pg/ml in B16 cells and 136 pg/ml in 4T1 cells) than from the CMV IL-2 plasmid (14 pg/ml in B16 cells and 18.5 pg/ml in 4T1 cells), indicating that the
D. Decreased tumorigenicity of amplified IL-2 expressing B16 tumors The same number of parental B16, B-10 and BB-15 cells (0.5 x 106 per mouse) were injected subcutaneously into syngeneic C57BL/6 mice in the hind flank. Tumor size was monitored for 46 days. Figure 6A shows the average tumor growth in each group of mice over time. The results demonstrated that tumor cells transfected with the highest IL-2 producing clone, BB-15 (B16 cells transfected with pHi2-IL2-neo-C-TAT) showed slower tumor growth, although it did not prevent tumor development. The tumor sizes were smaller for B-10 injected mice (B16 cells transfected with pCI-IL2-neo) than mice injected with the parental B16 tumor. Mice injected with the BB-15 cells had smaller tumors than the mice injected with the B-10 cells.
Figure 1. Diagrammatic representation of the different IL-2 constructs. The expression cassettes of plasmids pCI-IL-2-neo, pHi1-IL2neo-C-TAT, and pHi2-IL2-neo-C-TAT are shown. CMV: cytomegalovirus; HIV1 LTR: human immunodeficiency virus 1 long terminal repeat; HIV2 LTR: human immunodeficiency virus 2 long terminal repeat; pA: polyadenylation signal; SVneo: SV40 promoter driving the neomycin resistant gene. TAT: HIV tat (trans-activator of transcription).
489
He et al: Gene therapy using amplifier IL-2 expression vectors On day 18 after injection, the average tumor size for the B16 injected group was 327mm2, while the average tumor size of the B-10 group was 119mm2 and that of the BB-15 group was 41mm2. The mean survival time for each group of mice is shown in Figure 6B. There was an increase in survival
time in mice that had been injected with tumor cells transfected with the pHi2-IL2-neo-C-CMV plasmid 46 days (BB-15) as compared to the group of mice injected with either the parental B16 tumor (21 days) or the group of mice injected with the clone B10 tumor (36 days).
Figure 2. IL-2 levels secreted by transfected MCF-7 and A549 cells. MCF-7 and A549 cells were transfected with DMRIE-C and cell culture supernatants were harvested 24 hours later. IL-2 secretion was determined using an IL-2 EASIA kit. Data represent the IL-2 production in IU/ml from 1 "106 MCF-7 and 1"106 A549 cells transfected with pHi2-IL2-neo-C-TAT, pHi1-IL2-neo-C-TAT or the pCIIL2-neo plasmid. Data is representative of three experiments.
490
Gene Therapy and Molecular Biology Vol 8, page 491
Figure 3. Flow cytometric analysis of EGFP expression by transfected A549 cells. A549 cells were transfected with either the pCIEGFP ( B), pHi1-EGFP-neo-C-TAT (D) or pHi2-EGFP-neo-C-TAT (C) plasmid. Cells were harvested 24 hours after transfection and analyzed by flow cytometry. Wild type A559 cells (A) were used as control.
Figure 4. IL-2 production by transfected B16 and 4T1 tumor cells. 1 "106 B16 (A) and 4T1 tumor (B) cells were transfected with pHi2IL2-neo-C-TAT, pHi1-IL2-neo-C-TAT or the pCI-IL2-neo plasmid. Supernatants were analyzed 48 hours after transfection for IL-2 levels by ELISA and are reported as pg/ml IL-2. (*p<0.05). Data is representative of three experiments.
491
He et al: Gene therapy using amplifier IL-2 expression vectors
Figure 5. Decreased growth of IL-2 expressing B16 tumors in C57BL/6 mice. Three groups of C57BL/6 mice were injected with either B16 cells, clone B-10 (pCI-IL2-neo gene-modified B16 cells) or clone BB-15 (pHi2-IL2-neo-C-TAT gene-modified B16 cells), and tumor growth was monitored. Each group consisted of four mice. Average tumor sizes with standard deviations within each group are shown in mm2 (*p<0.05).
Figure 6. Survival curves of mice challenged with wild type B16 or IL-2 gene-modified B16 tumor cells. Three group of mice (four mice per group) were injected with either parental B16 tumor cells, clone B-10 (pCI-IL2-neo gene-modified B16 cells) or clone BB-15 (pHi2-IL2-neo-C-TAT gene-modified B16 cells), and the survival of injected mice was monitored.
492
Gene Therapy and Molecular Biology Vol 8, page 493 absence/modification of such host factors in murine cell lines may account for the lower IL-2 levels observed. IL-2 is a T-cell growth factor capable of stimulating antigen-specific cytotoxic T lymphocytes (CTL) and nonspecific immune responses such as those mediated by natural killer (NK) cells. Recombinant IL-2 (rIL-2) has been used to treat malignant melanoma and renal cell carcinoma (Parkinson et al, 1990; Toloza et al, 1996). However, systemic administration of IL-2 can cause serious side-effects such as pulmonary vascular leak and liver toxicity (Siegel and Puri, 1991). IL-2 gene therapy provides a promising alternative. Animal models have shown that tumor cells genetically engineered to express the IL-2 gene can cause rejection of IL-2 â&#x20AC;&#x201C;modified and unmodified tumor cells (Porgador et al, 1993). In addition, vaccination with IL-2 gene-modified tumor cells can induce rejection of pre-established metastatic lesions (Palu et al, 1999). Clinical trials including vaccination with tumor cells engineered to express IL-2 or direct intratumoral injection of IL-2 expressing plasmid vectors (with or without lipid) have shown that these IL-2 gene therapy approaches had very low toxicity and in some cases, there was evidence that anti-tumor immunity was induced (Galanis et al, 1999; Palmer et al, 1999; Walsh et al, 2000). Unfortunately, few patients showed significant clinical responses. One reason for the lack of clinical responses may be insufficient IL-2 production. In the present study, we developed new vectors that can produce higher levels of IL-2 than the CMV promoter-based vectors. Our animal data showed that the amplifier IL-2 expression vectors resulted in decreased tumor growth and prolonged animal survival compared to CMV promoterbased vectors. In summary, we developed a high level IL-2 expression plasmid vector though a HIV LTR and TATbased amplifier strategy. Increased IL-2 expression resulted in decreased tumor growth of gene-modified mouse melanoma cells. The amplifier strategy described here resulted in significantly increased transgene expression. The application of the amplifier strategy is not limited to non-viral systems. In a viral system, increasing transgene expression could help to decrease the amount of viral vector required to achieve a clinical effect as well as any side effects. In addition, other than expressing cytokines for immunotherapy, the amplifier strategy can be used to express other therapeutic molecules, such as small interfering RNA (siRNA) directed against cancer or infectious diseases. This strategy may also apply to mammalian expression systems to more efficiently produce large molecules such as antibodies or growth factors.
IV. Discussion The success of gene therapy relies on sufficient gene expression in the target tissue. Non-viral vectors, such as plasmid DNA are safe, ease to produce and administer, and low in immunogenicity. However, the application of non-viral vectors is limited by the relatively low target gene expression in vivo. Although improved gene delivery protocols, such as electroporation can increase the overall amount of gene product by increasing transfection efficiency, strategies to enhance gene transcription should further augment target gene expression. In the present study, we describe a transcriptional amplifier strategy to enhance IL-2 gene expression through co-expression of a transactivator gene in the plasmid vector. Applying this gene-modification to mouse melanoma resulted in decreased tumor growth and prolonged animal survival in vivo. The expression levels of a transgene depend primarily on the strength of transcription and the gene delivery efficiency (McKnight and Tjian, 1986). Great efforts have been made to develop gene transfer vectors. Viral vectors are widely used in gene therapy clinical trails because of their relatively high gene delivery efficiency. However, their efficiency may be compromised by the immune responses induced after repeated administration. Non-viral vectors are less immunogenic, but need to be improved in order to achieve sufficient gene expression. Traditionally, extensive efforts have been made in search of gene promoters capable of the highest levels of expression (Pasleau et al, 1985; Martin-Gallardo et al, 1988). Studies comparing different cellular and viral gene promoters have generally concluded that the CMV promoter is the strongest available promoter (Boshart et al, 1985; Oellig and Seliger, 1990). Indeed, the CMV promoter is the most commonly available commercial promoter and is widely used in human clinical trails. Other transcriptional regulatory elements, such as introns and polyadenylation signal sequences have also been evaluated (Xu et al, 2001), and with the latter found to have significant effects on transgene expression. In the present study, we describe a HIV promoter and transcription factor-based amplifier strategy to enhance transgene expression. HIV Tat (trans-activator of transcription) protein binds to the TAR (transactivation response element) in the R region of HIV LTR (long terminal repeat) to greatly increase the efficiency of transcription elongation (Cullen, 1991). Our data showed that compared to CMV promoter driven IL-2 expression, expression of TAT in the same plasmid downstream of the HIV LTRdriven IL-2 expression cassette significantly enhanced the expression level of IL-2. pHi1-IL2-neo-C-TAT, which has the HIV1 LTR driving IL-2 expression, gave rise to an over 20-fold increase of IL-2 expression in human A549 cells (357 IU/ml of HIV1 LTR vs. 18 IU/ml of CMV in A549 cells). Of note, lower levels of IL-2 secretion were seen upon transfection of these plasmids into murine cell lines as compared to the absolute IL-2 levels obtained in human cell lines. This result may be due to the fact that the tat gene is known to interact with human cellular factors needed for HIV transcription (Wang et al, 2000). The
References Arya SK, Guo C, Josephs SF, and Wong-Staal F (1985) Transactivator gene of human T-lymphotropic virus type III (HTLV-III) Science 229, 69-73. Boshart M, Weber F, Jahn G, Dorsch-Hasler K, Fleckenstein B, and Schaffner W (1985) A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 41, 521-530. Cullen BR (1991) Human immunodeficiency virus as a prototypic complex retrovirus. J Virol 65, 1053-1056.
493
He et al: Gene therapy using amplifier IL-2 expression vectors Edelstein ML, Abedi M R, Wixon J, and Edelstein RM (2004) Gene therapy clinical trials worldwide 1989-2004-an overview. J Gene Med 6, 597-602. Galanis E, Hersh EM, Stopeck AT, Gonzalez R, Burch P, Spier C, Akporiaye ET, Rinehart JJ, Edmonson J, Sobol RE, Forscher C, Sondak VK, Lewis BD, Unger EC, O'Driscoll M, Selk L, and Rubin J (1999) Immunotherapy of advanced malignancy by direct gene transfer of an interleukin-2 DNA/DMRIE/DOPE lipid complex: phase I/II experience. J Clin Oncol 17, 3313-3323. Gillis S and Smith KA (1977) Long term culture of tumourspecific cytotoxic T cells. Nature 268, 154-156. Jaroszeski MJ, Heller LC, Gilbert R, and Heller R (2004) Electrically mediated plasmid DNA delivery to solid tumors in vivo. Methods Mol Biol 245, 237-244. Martin-Gallardo A, Montoya-Zavala M, Kelder B, Taylor J, Chen H, Leung FC, and Kopchick JJ (1988) A comparison of bovine growth-hormone gene expression in mouse L cells directed by the Moloney murine-leukemia virus long terminal repeat, simian virus-40 early promoter or cytomegalovirus immediate-early promoter. Gene 70, 51-56. McKnight S and Tjian R (1986) Transcriptional selectivity of viral genes in mammalian cells. Cell 46, 795-805. Oellig C and Seliger B (1990) Gene transfer into brain tumor cell lines: reporter gene expression using various cellular and viral promoters. J Neurosci Res 26, 390-396. Palmer K, Moore J, Everard M, Harris J.D, Rodgers S, Rees RC, Murray AK, Mascari R, Kirkwood J, Riches PG, Fisher C, Thomas JM, Harries M, Johnston SR, Collins MK, and Gore ME (1999) Gene therapy with autologous, interleukin 2secreting tumor cells in patients with malignant melanoma. Hum Gene Ther 10, 1261-1268. Palu G, Cavaggioni A, Calvi P, Franchin E, Pizzato M, Boschetto R, Parolin C, Chilosi M, Ferrini S, Zanusso A, and Colombo F ( 1999) Gene therapy of glioblastoma multiforme via combined expression of suicide and cytokine genes: a pilot study in humans. Gene Ther. 6, 330-337. Parkinson DR, Abrams JS, Wiernik PH, Rayner AA, Margolin KA, Van Echo DA, Sznol M, Dutcher JP, Aronson FR, and Doroshow JH (1990) Interleukin-2 therapy in patients with metastatic malignant melanoma: a phase II study. J Clin Oncol 8, 1650-1656. Pasleau F, Tocci M.J, Leung F, and Kopchick JJ (1985) Growth hormone gene expression in eukaryotic cells directed by the
Rous sarcoma virus long terminal repeat or cytomegalovirus immediate-early promoter. Gene 38, 227-232. Porgador A, Gansbacher B, Bannerji R, Tzehoval E, Gilboa E, Feldman M, and Eisenbach L (1993) Anti-metastatic vaccination of tumor-bearing mice with IL-2-gene-inserted tumor cells. Int J Cancer 53, 471-477. Recillas-Targa F, Valadez-Graham V, and Farrell CM (2004) Prospects and implications of using chromatin insulators in gene therapy and transgenesis. Bioessays 26, 796-807. Siegel JP and Puri RK (1991) Interleukin-2 toxicity. J Clin Oncol 9, 694-704. Thomas M and Klibanov AM (2003) Non-viral gene therapy: polycation-mediated DNA delivery. Appl Microbiol Biotechnol 62, 27-34. Toloza EM, Hunt K, Swisher S, McBride W, Lau R, Pang S, Rhoades K, Drake T, Belldegrun A, Glaspy J, and Economou JS (1996) In vivo cancer gene therapy with a recombinant interleukin-2 adenovirus vector. Cancer Gene Ther. 3, 1117. Tsang TC, Brailey JL, Vasanwala FH, Wu RS, Liu F, Clark PR, Meade-Tollin L, Luznick L, Stopeck AT, Akporiaye ET, and Harris DT (2000) Construction of new amplifier expression vectors for high levels of IL-2 gene expression. Int J Mol Med 5, 295-300. Tsang TC, Harris DT, Akporiaye ET, Schluter SF, Bowden G.T, and Hersh EM (1996) Simple method for adapting DNA fragments and PCR products to all of the commonly used restriction sites. Biotechniques 20, 51-52. Walsh P, Gonzalez R, Dow S, Elmslie R, Potter T, Glode LM, Baron AE, Balmer C, Easterday K, Allen J, and Rosse P (2000) A phase I study using direct combination DNA injections for the immunotherapy of metastatic melanoma. University of Colorado Cancer Center Clinical Trial. Hum Gene Ther 11, 1355-1368. Wang WK, Chen MY, Chuang CY, Jeang KT, and Huang LM (2000) Molecular biology of human immunodeficiency virus type 1. J Microbiol Immunol Infect 33, 131-140. Xu ZL, Mizuguchi H, Ishii-Watabe A, Uchida E, Mayumi T, and Hayakawa T (2001) Optimization of transcriptional regulatory elements for constructing plasmid vectors. Gene 272, 149-156. Yew NS, Wysokenski DM, Wang KX, Ziegler RJ, Marshall J, McNeilly D, Cherry M, Osburn W, and Cheng SH (1997) Optimization of plasmid vectors for high-level expression in lung epithelial cells. Hum Gene Ther 8, 575-584.
From the left to the right: Dr. Xianghui He, Dr. David T Harris, Dr. Tom C Tsang
494
Gene Therapy and Molecular Biology Vol 8, page 495 Gene Ther Mol Biol Vol 8, 495-500, 2004
Multiple detection of chromosomal gene correction mediated by a RNA/DNA oligonucleotide Research Article
Alvaro Galli, Grazia Lombardi, Tiziana Cervelli and Giuseppe Rainaldi* Laboratorio di Terapia Genica e Molecolare, Istituto di Fisiologia Clinica CNR , Area della Ricerca CNR, via G. Moruzzi 1, 56124 Pisa, Italy
__________________________________________________________________________________ *Correspondence: Giuseppe Rainaldi, Laboratorio di Terapia Genica e Molecolare, Istituto di Fisiologia Clinica CNR, Area della Ricerca CNR, via G. Moruzzi 1, 56124 Pisa, Italy; Tel +39 050 3153108; Fax + 39 050 3153328; e-mail: g.rainaldi@ifc.cnr.it Key words: chimeric RNA/DNA oligonucleotide, gene correction, chromosomal target, HeLa cells, HygB/EGFP fusion gene. Abbreviations: Dulbeccoâ&#x20AC;&#x2122;s medium, (DMEM); enhanced green fluorescence gene, (EGFP); Restriction fragment length polymorphism, (RFLP); RNA/DNA oligonucleotide, (RDO); Received: 25 November 2004; Revised: 10 December 2004 Accepted: 15 December 2004; electronically published: December 2004
Summary Chimeric RNA/DNA oligonucleotide (RDO)-mediated gene correction of a single base mutation in a gene of an eukaryotic cell is still a controversial strategy. To better define the potential and applicability of this strategy, new systems, that allow to detect RDO-mediated gene correction in the chromosomal DNA of human cells, are needed. Here, we developed a construct containing hygromycin resistance mutant gene fused to the EGFP gene as target for correction. HeLaS3 cells were transfected with the fusion gene and clones, which had integrated one or two copies of the mutated fusion gene, were isolated and expanded. These cells were transfected with a RDO with a mismatch at the position 336 of the bacterial hygromycin resistance gene. If the gene correction occurs, the expression of both hygromycin resistance and EGFP genes is recovered. The RFLP and FACS analysis demonstrated that hygromycin resistance phenotype was due to the correction of the mutation. proposed that the DNA strand of RDO is responsible for gene correction activity and that the active DNA strand has to be generated inside the cell nearby the target site of correction (Andersen et al, 2002; Liu et al, 2003; Igoucheva et al, 2004). The stimulation of gene correction was also observed after DNA damage induction and following the activation of homologous recombination indicating that in mammalian cells the efficiency of gene correction may depend on the ability of the cells to undergo homologous recombination (Ferrara and Kmiec, 2004; Ferrara et al, 2004). However, the frequency of gene correction still remains highly variable and the reason for these differences is not yet clear. The lack of standardized assays for evaluating the gene correction at phenotypic level without the PCR analysis and the not yet proved mechanism that can direct the RDO-mediated correction of a chromosomal gene are the two main concerns about the applicability (Zhang et al, 1998; Rice et al, 2001; Yoon et al, 2002; Kmiec 2003). In this work, we generated two HeLaâ&#x20AC;&#x201C;derivative cell lines that contain in the genome a fusion construct composed by a mutated antibioticresistance gene (Hygromycin B) and the enhanced green fluorescence gene (EGFP). We report that, when gene
I. Introduction A chimeric RNA/DNA oligonucleotide (RDO) is a double stranded molecule consisting of RNA and DNA residues, usually 70-80 bases in length, capped at both ends by sequences which fold in a hairpin (Kmiec et al, 1994; Cervelli et al, 2002). The chimeric RDO contains a single nucleotide that differs from the target sequence and, therefore, forms a specific mismatch. The method of targeted gene correction by specific RDO or modified DNA oligonucleotide was developed to generate or correct point mutations (Rice et al, 2001; Brachman and Kmiec, 2002; Liu et al, 2003). This strategy has been successfully used in several genetic systems both in vitro using mammalian cells or mammalian and plant cell free extracts, and in vivo using several animal models (Cole-Strauss et al, 1996; Yoon et al, 1996; Kren et al, 1997, 1999; Xiang et al, 1997; Alexeev and Yoon, 1998; Bartlett et al, 2000; Gamper et al, 2000; Rando et al, 2000; Liu et al, 2001; Kenner et al, 2002, 2004; Parekh-Olmedo and Kmiec, 2003). Recent data have contributed to understand the mechanisms and the genetic requirements of gene correction (Rice et al, 2001; Liu et al, 2001, 2002a, b; Parekh-Olmedo et al, 2002). It has been 495
Galli et al: Chromosomal gene correction by a RNA/DNA oligonucleotide The chimeric RDO, named Ch867, was obtained by using the standard phosphoramidite chemistry in an automatic synthesizer Expedite 8909 (Millipore). After ammonia deprotection, Ch867 was purified, desalted and stocked at –20°C. The structure of Ch867 is depicted in Figure 1C. Cells of HeLa S3/G418R clones were seeded at density of 4x105 cells per 30 mm diameter dish in 3 ml of growth medium. 18 µg of Ch867 were diluted with DMEM without serum and antibiotics to a total volume of 100 µl and incubated with 22 µl of PolyFect Lipofection Reagent (Qiagen). The lipofection complex was added according to the manufacture’s recommendation. Each transfected clone was grown for 96 h in normal medium to allow the correction and the expression of hyg gene. At that time, 3x105 cells were seeded on 100 mm diameter dish in selective medium containing 300 µg/ml hygromycin (Roche), a selective dose derived from dose response curve carried out for HeLaS3 (data not shown). The selective medium was changed every 4 days and after 12 days, hygromycin resistant colonies were harvested, expanded as polyclonal population in complete growth medium without hygromycin, and analyzed by RFLP and FACS analysis.
correction was measured following RDO transfection, cells both resistant to hygromycin and expressing EGFP were recovered indicating that RDO is able to induce gene correction at chromosomal level.
II. Materials and methods A. Cell line and culture conditions HeLaS3 cells (from Margherita Bignami, ISS, Rome, Italy) were routinely cultured in Dulbecco’s medium (DMEM) supplemented with 10% fetal calf serum, 100UI/ml penicillin and 100 µg/ml streptomycin at 37°C in a humidified atmosphere containing 6% CO2.
B. Construction of the plasmid pHygNSNeo, transfection and Southern analysis Plasmid pHygNSNeo was constructed from pHygEGFP (Clontech) (Figure 1A) and pMC1neo (Stratagene). pHygEGFP was restricted with HindIII and SalI. This resulted in 2 fragments that are 2123 bp and 3669 bp long, respectively. The 2123 bp fragment was further digested with NcoI obtaining 2 fragments that are 714 bp and 1409 bp long. The 714 bp NcoI-HindIII fragment was PCR amplified from pHygEGFP. The forward primer, 5'-TAGAAGCTTTATTGCGGTAGTTTATCACAG-3', was designed with HindIII restriction site at 5’end. The reverse primer, 5'-TTTCCATGGCCTCCGCGACCGGCTACA-3', was designed with NcoI restriction site at the 5’end such to introduce a point mutation (A) at the position 336 of hygB gene. This mutation produces a stop codon and the loss of the PstI restriction site. Amplification was performed by denaturation at 94°C for 3 min, followed by 35 cycles of 94°C for 30 sec, 67°C for 45 sec, and then extension at 72°C for 2 min. The direct ligation of the new 714 bp NcoI-HindIII fragment containing the stop codon with the 1409 bp NcoI-SalI fragment and the 3669 bp HindIII-SalI fragment formed the plasmid pHygNS. Afterward, the neomycin resistance gene (neo) was inserted into the SalI site of pHygNS by cloning the 1100 bp XhoI-SalI fragment from pMC1neo. The new vector containing a stop codon 336 bases downstream to the ATG of the hygB-EGFP fusion and the neo marker was named pHygNSNeo. The presence of the stop codon was confirmed by sequence analysis. Plasmid pHygNSNeo was transfected in HeLaS3 by electroporation. A sample of 3.5x10 6 exponentially growing cells and 10 µg of pHygNSNeo linearized with restriction enzyme ClaI were resuspended in 250 µl DMEM without serum and antibiotics. The suspension was then transferred to 50 x 4 mm cuvette (Equibio) and incubated on ice for 10 min. Afterward, the cuvette was exposed to one pulse (330 V, 1000 µF, 200 !) using the Electroporator II apparatus (Invitrogen) connected to a power supply (330 V, 25 mA, 25 W). The cell suspension was then cooled for 15 min on ice, resuspended in complete medium and seeded in four 100 mm diameter dishes at density of 5x105 cells per dish. After 24 hours, 1000 µg/ml G418 (Invitrogen) were added to every dish. After 15-21 days, one G418 resistant (G418R) colony per dish was isolated, expanded to clonal population and analyzed for the presence of pHygNSNeo as follows. Genomic DNA was digested with HindIII and analyzed by standard Southern blot procedures. Briefly, 10µg DNA per sample was electrophoresed on 0.8% agarose gel, transferred to nylon positively charged membrane (Roche) and hybridized with digoxigenin labeled HygEGFP as probe. The labeling was carried out by Random primed DNA labeling kit (Roche).
D. Flow cytometry The count of fluorescent HeLaS3 cells was performed by flow-cytometry on a fluorescence-activated cell sorting apparatus (FACScan, Lysys II software, Becton Dickinson, San Jose, CA). Briefly, 5x105 cells were resuspended in 100 µl PBS and the fluorescence of 104 cells was determined.
E. Restriction fragment length polymorphism (RFLP) Genomic DNA extracted from polyclonal populations was amplified by PCR. The forward and reverse primers sequences were 5’-TGATGCAGCTCTCGGAGG-3’ and 5’AGTGTATTGACCGATTCCTTG-3’ respectively. The PCR conditions to generate a 361-bp fragment were 94°C for 30 sec, 54°C for 30 sec, 72°C for 45 sec for 35 cycles. 10 µl PCR product was incubated overnight with PstI in a final volume of 20 µl. Later on, 10 µl were loaded onto 2% agarose gel (1X TBE, EtBr 1 µg/ml), electrophoresed for 2 h at 50 V, and the migration profile analyzed. 40 ng of 361 bp PCR product were submitted to the automatic sequencing to verify the occurrence of base correction.
III. Results To study the chimeric RDO-mediated gene correction in the chromosomal DNA of HeLaS3 cells we first constructed the plasmid pHygNSNeo containing a point mutation within the coding region of bacterial hygB gene at the position 336 (C"T) generating a stop codon (TAG) and the loss of PstI restriction site (Figure 1A). Therefore, the hygB gene is not functional and the fused EGFP gene is not translated. Thereafter, we transfected HeLaS3 cells with pHygNSNeo and then selected them in medium containing G418. Two independent G418 resistant colonies were isolated, expanded to clonal population and analyzed for the presence of hygB gene. Genomic DNA was digested with HindIII, which cuts only once in pHygNSNeo, blotted and hybridized with DIGlabeled HygEGFP fusion gene as probe. As shown in the Figure 1B, the clone 20105.3A (lane 3) has at least 2 copies and the clone 20105.6A (lane 4) only one copy of the integrated vector. Furthermore, the migration profile
C. Synthesis and transfection of the chimeric RNA/DNA oligonucleotide (Ch867)
496
Gene Therapy and Molecular Biology Vol 8, page 497
Figure 1. Plasmid pHygNSNeo and chimeric RNA/DNA oligonucleotide Ch867. (A) Diagram of the pHygNSNeo plasmid containing a single point mutation, thymine, at the position 336 in the coding region of hygB gene (bold letter). (B) Southern blot analysis of G418 resistant clones. Sample of DNA (10 µg) were digested with HindIII and analyzed by Southern blotting. The fused gene was used as probe. Lane 1: pHygNSNeo, lane 2: HeLaS3, lane 3: 20105.3A and lane 4: 20105.6A. (C) Sequences of the target site before and after correction by Ch867. Ch867 consists of a 35 bp long duplex bracket by 4 base long hairpin loops. Each RNA residue (small letters) is modified by the inclusion of a 2’-O-methyl group on ribose sugar. The DNA (capital letters) contains the designed base for correction.
analysis indicated that the integration occurred at different genomic sites. A chimeric RDO, named Ch867, was designed according to Gamper and colleagues who demonstrated that the most efficient chimeric RDO has one strand containing 2’-O-methyl RNA homologous to the target site and a DNA strand bearing the mismatched base (Figure 1C)(Gamper et al, 2000). A gene correction event mediated by Ch867 not only will recover the hygB wild type sequence, but also restore the PstI site and, consequently, the right frame leading to the expression of the fusion HygEGFP. We then transfected the chimeric RDO Ch867 in the two clones 20105.3A and .6A according to the transfection protocol that gives high level of nuclear localization of the RDO (Cervelli et al, 2002). The Ch867 transfection increased significantly (p#0.01) the frequency of hygR clones by 6.7 fold (20105.3A) and 3.7 fold (20105.6A) above the spontaneous level (Table 1). Vice versa, 20105.3A and 20105.6A cells transfected with an unrelated RDO showed no increase in hygromycin
resistance frequency as compared to the non-transfected control has been observed (data not shown) (Cervelli et al, 2002). To test whether the enhancement of hygromycin resistance frequency was due to the correction of the stop mutation of hygB gene, hygromycin resistant colonies formed after 12 days of growth in selective medium were analyzed as a whole population (pools of 10-20 clones) for the presence of PstI restriction site in the integrated hygB target. Therefore, genomic DNA extracted from polyclonal hygR populations was subjected to PCR and the amplification products were digested with PstI. The digestion of the 361 bp PCR fragment with PstI yielded a fragment of 98 bp and one of 263 bp as shown by the PstI digestion of pHygNSNeo (Figure 2A, panel 1). As shown in the Figure 3A, the PstI site was present in the two populations 20105.3A and 20105.6A transfected with Ch867 (Figure 2A panel 3 and 4). On the other hand, the PstI site is not present in 361bp hygB fragment amplified
497
Galli et al: Chromosomal gene correction by a RNA/DNA oligonucleotide Table 1. Effect of Ch867 on hygromycin resistance frequency in HeLaS3 cells hygromycin resistance frequency x 10-5 a G418R clones
- Ch867
+ Ch867
Fold increaseb
20105.3A
0.78±0.66
5.25±0.98**
6.7
20105.6A
2.08±1.39
7.75±2.06**
3.7
Results are reported as mean±standard deviation of at least 3 independent experiments. Results are statistically analysed with the Student “t” test; ** p#0.01 a hygromycin resistance frequency has been calculated dividing the number of hygR colonies by the number of viable cells. b Fold increase represents the ratio between the two hygR frequencies obtained with and without transfection of Ch867.
Figure 2. (A) RFLP analysis of the 361 bp PCR fragment from pHygNSNeo (panel 1), from hygR polyclonal population of 20105.3A and .6A transfected with Ch867 (panel 3 and 4), and from hygR polyclonal population of non transfected 20105.3A (panel 2). 500-600ng DNA were digested with PstI and loaded in each lane (+). The same amount of DNA was loaded as control (-). ( B) Sequence of the PCR fragment from a PstI positive polyclonal population. Only the region flanking the nucleotide 336 is shown. Arrow indicates the targeted base for correction.
by genomic DNA extracted from the polyclonal hygromycin resistant population derived from 20105.3A non transfected (Figure 2A, panel 2) and 20105.6A (data not shown). Moreover, PstI restriction of PCR fragment from pHygNSNeo was complete, whereas, PstI restriction of PCR fragments from polyclonal transfected populations was only partial (Figure 2A, panel 1, 3 and 4). This observation was also confirmed by the sequencing of a PstI-positive polyclonal population that showed a mixture of T (mutated nucleotide) and C (correct wild type nucleotide) at position 336 of hygB gene (Figure 2B). This indicated that Ch867 corrected the mutant sequence. To ascertain whether the base correction, which restored the PstI site, allows the expression of the fused EGFP gene, spontaneous and Ch867-induced hygromycin
resistant clones were analyzed by FACS. Fluorescence profile of PstI negative clone (thick line) was overlapped that of parental population (thin line), whereas that PstI positive clone was only in part overlapped that of parental population (Figure 3A and 3B). Thus, the fluorescence of the PstI positive clone was higher than PstI negative clone demonstrating that the correction also restored the EGFP expression.
IV. Discussion The reason for the differences in the gene correction rate observed in several experiments is not yet elucidated (Santana et al, 1998; Rice et al, 2001; Brachman and
498
Gene Therapy and Molecular Biology Vol 8, page 499
Figure 3. Flow cytometry of spontaneous PstI negative hygR clone (A) and PstI positive hygR clone of 20105.3A cells (B). The fluorescence profile of both clones (red area) (thick line) is compared to the profile of the parental cell population (thin line).
mutant sequences in hygR polyclonal populations derived from Ch867 transfected cells. Fluorescence intensity of a PstI positive hygR clone obtained from Ch867 transfection was significantly higher than that of PstI negative hygR clone. All these results demonstrated that Ch867 precisely corrected the base mutation given that the expression of the fused HygEGFP gene was obtained. Therefore, a system in which the gene correction is tested by multiple detection, such as hygromycin resistance, RFLP and FACS analysis, may be useful to select for accurate correction event. The results of this study confirm that the chimeric RDO strategy may be feasible to correct single base mutation and, therefore, useful to treat single gene diseases.
Kmiec 2002). The major concerns on the chimeric RDO mediated-gene correction derive from the use of PCR amplification as primary screen for the detection of the correction event (Zhang et al, 1998). The set up of new systems where the gene correction events leads to the reversion of a mutation in a gene conferring more than one phenotype is ideal to overcome the problem. Here, we described an additional eukaryotic assay to study chromosomal gene correction in human cells in which the gene correction event is screened by multiple detection. A fusion HygEGFP gene was mutated by the insertion of a stop codon in the HygB sequence. Therefore, cells having this construct integrated in the genome are hygromycin sensitive and do not express EGFP. We designed a chimeric RDO, named Ch867, to correct the stop mutation of the hygB gene. After transfection with Ch867, HeLaS3 containing the hygB mutated gene integrated as single or multiple copies showed an enhancement of hygromycin resistance frequency over the spontaneous baseline, and restored both PstI site and EGFP expression. The RDO transfection increased 6.7 fold the frequency of gene correction in the cells containing at least two copies of the hygB mutated gene, and 3.7 fold in cells with one copy of the hygB mutated gene suggesting that the copy number of the integrated target may have an influence on gene correction. However, the direct comparison of the frequencies demonstrated that the difference is not statistically significant (p= 0.114). A confounding effect in the detection of gene correction is represented by the presence of hygR spontaneous clones. For that, we were forced to carry out the analyses in the polyclonal populations. To rule out the possibility to get false positive results due to PCR artifact, in other words, to exclude that chimeric RDO itself could serve as primer and template in the PCR amplification (Zhang et al, 1998), we analyzed hygR polyclonal population of transfected and non transfected cells after growing them for 12 days in presence of hygromycin. The RFLP analysis (Figure 2A) and the sequencing of PCR fragments (Figure 2B) revealed a mixture of correct and
Acknowledgements Authors wish to thank Margherita Bignami for HeLaS3 cell line, Antonio Piras and Federica Mori for their technical support, and Lorenzo Citti for RDO synthesis.
References Alexeev V and Yoon K (1998) Stable and inheritable changes in genotype and phenotype of albino melanocytes induced by an RNA-DNA oligonucleotide. Nat Biotechnol 16, 13431346. Andersen MS, Sorensen CB, Bolund L and Jensen TG (2002) Mechanisms underlying targeted gene correction using chimeric RNA/DNA and single-stranded DNA oligonucleotides. J Mol Med 80, 770-781. Bartlett RJ, Stockinger S, Denis MM, Bartlett WT, Inverardi L, Le TT, thi Man N, Morris GE, Bogan DJ, Metcalf-Bogan J and Kornegay JN (2000) In vivo targeted repair of a point mutation in the canine dystrophin gene by a chimeric RNA/DNA oligonucleotide. Nat Biotechnol 18, 615-622. Brachman EE and Kmiec EB (2002) The 'biased' evolution of targeted gene repair. Curr Opin Mol Ther 4, 171-176. Cervelli T, Lombardi G, Citti L, Galli A, Locci MT and Rainaldi G (2002) Targeting of A701G nucleotide at the human
499
Galli et al: Chromosomal gene correction by a RNA/DNA oligonucleotide ATP1A1 locus using a RNA/DNA chimera. Nucleosides Nucleotides Nucleic Acids 21, 775-784. Cole-Strauss A, Yoon K, Xiang Y, Byrne BC, Rice MC, Gryn J, Holloman WK and Kmiec EB (1996) Correction of the mutation responsible for sickle cell anemia by an RNA-DNA oligonucleotide. Science 273, 1386-1389. Ferrara L and Kmiec EB (2004) Camptothecin enhances the frequency of oligonucleotide-directed gene repair in mammalian cells by inducing DNA damage and activating homologous recombination. Nucleic Acids Res 32, 52395248. Ferrara L, Parekh-Olmedo H and Kmiec EB (2004) Enhanced oligonucleotide-directed gene targeting in mammalian cells following treatment with DNA damaging agents. Exp Cell Res 300, 170-179. Gamper HB, Jr., Cole-Strauss A, Metz R, Parekh H, Kumar R and Kmiec EB (2000) A plausible mechanism for gene correction by chimeric oligonucleotides. Biochemistry 39, 5808-5816. Gamper HB, Parekh H, Rice MC, Bruner M, Youkey H and Kmiec EB (2000) The DNA strand of chimeric RNA/DNA oligonucleotides can direct gene repair/conversion activity in mammalian and plant cell-free extracts. Nucleic Acids Res 28, 4332-4339. Igoucheva O, Alexeev V and Yoon K (2004) Oligonucleotidedirected mutagenesis and targeted gene correction: a mechanistic point of view. Curr Mol Med 4, 445-463. Kenner O, Kneisel A, Klingler J, Bartelt B, Speit G, Vogel W and Kaufmann D (2002) Targeted gene correction of hprt mutations by 45 base single-stranded oligonucleotides. Biochem Biophys Res Commun 299, 787-792. Kenner O, Lutomska A, Speit G, Vogel W and Kaufmann D (2004) Concurrent targeted exchange of three bases in mammalian hprt by oligonucleotides. Biochem Biophys Res Commun 321, 1017-1023. Kmiec EB (2003) Targeted gene repair -- in the arena. J Clin Invest 112, 632-636. Kmiec EB, Cole A and Holloman WK (1994) The REC2 gene encodes the homologous pairing protein of Ustilago maydis. Mol Cell Biol 14, 7163-7172. Kren BT, Cole-Strauss A, Kmiec EB and Steer CJ (1997) Targeted nucleotide exchange in the alkaline phosphatase gene of HuH-7 cells mediated by a chimeric RNA/DNA oligonucleotide. Hepatology 25, 1462-1468. Kren BT, Parashar B, Bandyopadhyay P, Chowdhury NR, Chowdhury JR and Steer CJ (1999) Correction of the UDPglucuronosyltransferase gene defect in the gunn rat model of crigler-najjar syndrome type I with a chimeric oligonucleotide. Proc Natl Acad Sci U S A 96, 1034910354. Liu L, Cheng S, van Brabant AJ and Kmiec EB (2002a) Rad51p and Rad54p, but not Rad52p, elevate gene repair in Saccharomyces cerevisiae directed by modified singlestranded oligonucleotide vectors. Nucleic Acids Res 30, 2742-2750. Liu L, Parekh-Olmedo H and Kmiec EB (2003) The development and regulation of gene repair. Nat Rev Genet 4, 679-689.
Liu L, Rice MC and Kmiec EB (2001) In vivo gene repair of point and frameshift mutations directed by chimeric RNA/DNA oligonucleotides and modified single-stranded oligonucleotides. Nucleic Acids Res 29, 4238-4250. Liu L, Rice MC, Drury M, Cheng S, Gamper H and Kmiec EB (2002b) Strand bias in targeted gene repair is influenced by transcriptional activity. Mol Cell Biol 22, 3852-3863. Parekh-Olmedo H and Kmiec EB (2003) Targeted nucleotide exchange in the CAG repeat region of the human HD gene. Biochem Biophys Res Commun 310, 660-666. Parekh-Olmedo H, Drury M and Kmiec EB (2002) Targeted nucleotide exchange in Saccharomyces cerevisiae directed by short oligonucleotides containing locked nucleic acids. Chem Biol 9, 1073-1084. Rando TA, Disatnik MH and Zhou LZ (2000) Rescue of dystrophin expression in mdx mouse muscle by RNA/DNA oligonucleotides. Proc Natl Acad Sci U S A 97, 5363-5368. Rice MC, Bruner M, Czymmek K and Kmiec EB (2001) In vitro and in vivo nucleotide exchange directed by chimeric RNA/DNA oligonucleotides in Saccharomyces cerevisae. Mol Microbiol 40, 857-868. Rice MC, Czymmek K and Kmiec EB (2001) The potential of nucleic acid repair in functional genomics. Nat Biotechnol 19, 321-326. Santana E, Peritz AE, Iyer S, Uitto J and Yoon K (1998) Different frequency of gene targeting events by the RNADNA oligonucleotide among epithelial cells. J Invest Dermatol 111, 1172-1177. Xiang Y, Cole-Strauss A, Yoon K, Gryn J and Kmiec EB (1997) Targeted gene conversion in a mammalian CD34+-enriched cell population using a chimeric RNA/DNA oligonucleotide. J Mol Med 75, 829-835. Yoon K, Cole-Strauss A and Kmiec EB (1996) Targeted gene correction of episomal DNA in mammalian cells mediated by a chimeric RNA.DNA oligonucleotide. Proc Natl Acad Sci U S A 93, 2071-2076. Yoon K, Igoucheva O and Alexeev V (2002) Expectations and reality in gene repair. Nat Biotechnol 20, 1197-1198. Zhang Z, Eriksson M, Falk G, Graff C, Presnell SC, Read MS, Nichols TC, Blomback M and Anvret M (1998) Failure to achieve gene conversion with chimeric circular oligonucleotides: potentially misleading PCR artifacts observed. Antisense Nucleic Acid Drug Dev 8, 531-536.
Giuseppe Rainaldi
500
Gene Therapy and Molecular Biology Vol 8, page 501 Gene Ther Mol Biol Vol 8, 501-508, 2004
Nitric oxide and endotoxin-mediated sepsis: the role of osteopontin Review Article
Philip Y. Wai and Paul C. Kuo* Department of Surgery, Duke University Medical Center, Durham, NC 27710
__________________________________________________________________________________ *Correspondence: Paul C. Kuo, M.D., Department of Surgery, 110 Bell Building, Duke University Medical Center, Durham, NC 27710; Tel: 919-668-1856; Fax: 919-684-8716; e-mail: kuo00004@mc.duke.edu Key words: osteopontin, hnRNP A/B, sepsis, endotoxin, LPS, nitric oxide Abbreviations: bactericidal/permeability-increasing, (BPI); basic fibroblast growth factor, (bFGF); cardiac index, (CI); cholesterol ester transfer protein, (CETP); chromatin immunoprecipitation, (ChIP); c-Jun N-terminal kinase, (JNK); cyclic monophosphate, (cGMP); endothelial NOS, (eNOS); Gly-Arg-Gly-Asp-Ser, (GRGDS); glycosylphosphatidyinositol, (GPI); heterogeneous ribonucleoprotein A/B, (hnRNP A/B); inducible NO synthase, (iNOS); interferon gamma, (IFN-!); interleukin-1, (IL-1); lipopolysaccharide, (LPS); mean arterial pressure, (MAP); neuronal NOS, (nNOS); NG-nitro-L-arginine methyl ester, (L-NAME); Nitric oxide, (NO); NO synthase, (NOS); osteopontin, (OPN); phorbol 12-myristate 13-acetate, (PMA); phospholipid transfer protein, (PLTP); platelet activating factor, (PAF); poly-ADP ribose synthase, (PARS); protein kinase RNA-regulated, (PKR); pulmonary vascular resistance, (PVR); reactive oxygen species, (ROS); suppression subtractive hybridization, (SSH); systemic inflammatory response syndrome, (SIRS); systemic vascular resistance, (SVR); TNF" receptor-associated factor-6, (TRAF6); Toll-like receptor 4, (TLR4); tumor necrosis factor-", (TNF") Received: 2 November 2004; Revised: 9 December 2004 Accepted: 10 December 2004 electronically published: December 2004
Summary Septic shock continues to be a life threatening complication of systemic infection despite advances in the clinical care of these patients. The incidence of severe sepsis in critically ill patients has increased annually by 8.7% and mortality rates are excessive, ranging from 30%-60%. Nitric oxide plays a central role in the molecular biology and biochemistry of septic shock. In endotoxin-mediated sepsis and septic shock, pro-inflammatory cytokines are elaborated and inducible nitric oxide synthase is systemically expressed in multiple cell types. The sustained production of nitric oxide in high concentration regulates multiple cellular and biochemical functions. Multiple studies have investigated the role of nitric oxide synthase antagonists in the treatment of septic shock in both animal models of endotoxemia and human clinical trials. However, cumulative data from these studies have not provided definitive evidence for a survival benefit in the use of these agents in humans. While the signalling pathways that activate iNOS expression or activity are well characterized, little is known about the endogenous molecular determinants that decrease NO. In this regard, osteopontin, recently identified as an intrinsic regulator of iNOS expression in endotoxin-stimulated macrophages, represents a novel target in the understanding of nitric oxide pathobiology in sepsis. The purpose of this review is to discuss the S-nitrosylation of heterogeneous ribonucleoprotein A/B in the transcriptional regulation of osteopontin in nitric oxide- mediated sepsis.
from systemic inflammatory response syndrome (SIRS) to sepsis, severe sepsis, shock, and multiple organ dysfunction (Brun-Buisson, 2000). Risk factors identified as independently associated with severe sepsis include age, male sex, the presence of indwelling catheters or devices, chronic liver insufficiency, immunodepression, or severe underlying disease (Brun-Buisson et al, 1995, 2004; Balk, 2004). Septic shock continues to be a life threatening complication of systemic infection despite advances in the clinical care of these patients. The incidence of severe sepsis in critically ill patients has increased annually by
I. Introduction Sepsis refers to a heterogeneous group of inflammatory syndromes that represent various stages involved in the host-response to infection. Septic shock has been previously defined as sepsis-induced hypotension that persists despite adequate fluid resuscitation with characteristic clinical manifestations such as lactic acidosis, oliguria or coagulopathy (Bone et al, 1992; Levy et al, 2003). There is a continuum and natural progression between the different stages of the inflammatory response
501
Wai and Kuo: Regulation of NO in sepsis by OPN 8.7% (Balk, 2004) with mortality rates ranging from 30%60% (Brun-Buisson et al, 1995, 2004; Martin et al, 2003; Balk, 2004). Nitric oxide (NO) plays a central role in the molecular biology and biochemistry of septic shock. In endotoxin-mediated sepsis and septic shock, proinflammatory cytokines are elaborated and inducible NO synthase (iNOS) is systemically expressed in multiple cell types. The sustained production of NO in high concentration regulates multiple cellular and biochemical functions, including inotropic and chronotropic cardiac responses, systemic vasomotor tone, intestinal epithelial permeability, endothelial activation, and microvascular permeability (Finkel et al, 1992; Kilbourn et al, 1997; Chavez et al, 1999). In the decade since the discovery of NO as endothelium derived relaxing factor, multiple studies have investigated the role of NO synthase (NOS) antagonists in the treatment of septic shock in both animal models of endotoxemia and human clinical trials. The cumulative data from these studies do not reach consensus and conflict on whether NOS antagonists decrease sepsisrelated mortality. Certainly, substantial evidence supports that NOS inhibition improves physiological endpoints during septic shock (Vincent et al, 2000; Cobb, 2001; Feihl et al, 2001). The non-selective and non-physiologic effects of these inhibitors used in model systems may account for some of the adverse effects observed in these studies and for the failure of these agents in increasing survival in clinical studies. Few studies have attempted to modulate iNOS expression by manipulating the intrinsic, homeostatic mechanisms that lead to iNOS downregulation. Interestingly, while the signalling pathways that activate iNOS expression or activity are well characterized, little is known about the endogenous molecular determinants that decrease NO. In this regard, the recent discovery of osteopontin (OPN) as an intrinsic regulator of iNOS expression in endotoxin-stimulated macrophages represents an area of investigation that may yield novel targets for the therapeutic modulation of NO during sepsis. In this discussion, we review the lipopolysaccharide (LPS) signalling pathways that lead to upregulation of iNOS expression and the biochemistry and physiology of NO in septic shock. In addition, we will describe the role of OPN in the regulation of NO and the identification of heterogeneous ribonucleoprotein A/B (hnRNP A/B) as an endogenous, NO-dependent, transcriptional regulator of OPN.
cytokines including interleukin-1 (IL-1), IL-6, IL-8, tumor necrosis factor-" (TNF-") and NO. However, overstimulation of the monocytic signalling pathways with LPS can lead to systemic inflammation resulting in sepsis or shock. The LPS signalling cascade involves the complex cooperation of a multitude of receptors, cofactors and messenger proteins (Figure 1). The processing of LPS for signal transduction begins in the extracellular space with the ligation of LPS by LPSbinding protein (LBP). Derived from hepatic synthesis, LBP is secreted into the serum, and responds to LPS stimulation with a 5- to 20- fold increase in LBP concentration (Lazaron and Dunn, 2002). Sequence analysis and cloning of LBP cDNA has led to the identification of a family of related proteins that include bactericidal/permeability-increasing protein (BPI), cholesterol ester transfer protein (CETP), and phospholipid transfer protein (PLTP). The glycosylphosphatidyinositol (GPI)-linked membrane protein, CD14, is a myeloid surface antigen that lacks a transmembrane domain. A non-GPI-containing soluble form of CD14 is also secreted into the serum (Lazaron and Dunn, 2002). CD14 functions by recognizing the LPSLBP complex (Figure 1). Loss-of-function studies have demonstrated that LBP and CD14 are necessary for the rapid and sensitive induction of the monocyte/macrophage inflammatory response to LPS (Diks et al, 2001). These cofactors appear to enhance the function of Toll-like receptor 4 (TLR4), the putative signalling receptor for LPS. Studies using murine macrophages with a targeted loss-of-function in TLR4 resulted in the ablation of the physiologic response to LPS (Guha and Mackman, 2001). TLR4 activity was found to be dependent on MD-2, a secreted protein that associates with TLR4 and enhances TLR4-dependent signalling pathways (Figure 1). TLR4 regulates multiple intracellular, inflammatory signalling cascades including the NF-#B, ERK, JNK and p38 pathways. Cumulative data suggests that MyD88, IL-1 receptor-associated kinase (IRAK) and TNF" receptorassociated factor-6 (TRAF6) mediate TLR4 activation of NF-#B by enhancing phosphorylation of IKK$, which in turn phosphorylates I#B and leads to the translocation of NF-#B p50 and p65 into the nucleus (Diks et al, 2001; Guha and Mackman, 2001). LPS also activates the extracellular signal-regulated kinase (ERK1/2) signalling pathway. LPS-mediated activation of MEK-ERK1/2 appears to occur via diverse mechanisms as both Ras/cRaf -dependent and -independent pathways have been identified (Guha and Mackman, 2001). One downstream target of the MEK-ERK1/2 pathway is the transcription factor Elk-1, which co-operates with SRF to activate target genes. The c-Jun N-terminal kinase (JNK) signalling pathway can also be activated by LPS. Upstream activators of JNK include mPAK3, hPAK1, GCK, MEKK1 and MKK4/7 and the targeted transcription factors consist of c-Jun, ATF-2 and Elk-1 (Guha and Mackman, 2001). The p38 signalling pathway is yet another unique signalling pathway that is regulated by LPS. Cdc42, PAK , Rac1, protein kinase RNA-regulated (PKR) and MKK3/6 are some of the upstream signalling
II. The LPS signalling pathway in sepsis LPS endotoxin is the principal component of the outer membrane of Gram-negative bacteria. The structural components of LPS include an outer O-antigen polysaccharide region; outer, intermediate, and inner core polysaccharide regions; and the toxic lipid A moiety embedded deep within the outer membrane (Alexander and Rietschel, 2001; Lazaron and Dunn, 2002). Stimulation with LPS activates the cells of the innate immune system to produce a variety of inflammatory 502
Gene Therapy and Molecular Biology Vol 8, page 503
Figure 1. The LPS signalling pathway regulates transcription of the inflammatory mediator genes IL1, IL-6, IL-8, TNF-", and iNOS (Alexander and Rietschel, 2001; Diks et al, 2001; Guha and Mackman, 2001; Lazaron and Dunn, 2002). Please see text for details. Partialy reproduced from Guha and Mackman, 2001 with kind permission from Cellular Signalling.
molecules that activate p38. Target transcription factors activated by p38 include ATF-2, Elk-1, CHOP, MEF2C, Sap1a, CREB and ATF-1 (Guha and Mackman, 2001). Terminal signalling events from these different cascades regulate gene expression of TNF-", IL-1, IL-6, IL-8, GCSF, GM-CSF, MCP-1, IL-2 R" and iNOS.
However, a variety of stimuli, including microbes, IL-1, IL-6, IL-12, TNF, interferon-!, "/$ and platelet activating factor (PAF), can promote iNOS expression (Nathan and Xie, 1994; Nathan, 1997; Taylor and Geller, 2000). During sepsis, these agents act synergistically to induce iNOS gene transcription through complex signalling pathways that involve the NF-#b, cyclic AMP-CREBC/EBP and Jak-Stat pathways (Nathan and Xie, 1994; Nathan, 1997; Taylor and Geller, 2000; Diks et al, 2001). Secondary auxiliary signalling pathways include AP-1, phospholipase C, protein kinase C, Ras-MAP kinase, and hypoxia inducible factor-1.
III. Increased nitric oxide production in sepsis A. NO biosynthesis, mechanism of action, and pathophysiology An important downstream effector of LPS signalling is iNOS, the primary regulator of NO production in sepsis. NO is a ubiquitous biological molecule produced by several cell types. The terminal guanidino group of the amino acid L-arginine gives rise to NO under redoxregulation by NOS in a calmodulin-dependent manner (Figure 2) (Nathan and Xie, 1994). The three known isoforms of NOS have been identified as neuronal NOS (nNOS/NOS-I), inducible NOS (iNOS/NOS-II), and endothelial NOS (eNOS/NOS-III). While the expression of nNOS and eNOS are constitutive, iNOS expression can be significantly upregulated in response to bacterial products and pro-inflammatory cytokines. NO production and iNOS expression play a central role in the pathobiology of sepsis. In the preceding section, we briefly reviewed some of the signalling pathways by which LPS signalling transcriptionally activates iNOS.
Figure 2. NO is produced by iNOS under redox conditions in a calmodulin-dependent manner. L-arginine and oxygen are catalytic substrates for iNOS during the production of NO and Lcitrulline. The reaction occurs with the oxidation of NAPDH to NADP+.
503
Wai and Kuo: Regulation of NO in sepsis by OPN NO is a pleuripotent regulator of multiple cellular and biochemical functions, including allosteric receptor modification, enzymatic activity and transcriptional regulation (Crapo and Stamler, 1994; Morris and Billiar, 1994; Simon et al, 1996). NO, a highly-diffusable, gaseous free-radical, binds to heme-containing proteins such as guanylate cyclase which it activates to release guanosine 3'5'-cyclic monophosphate (cGMP), a potent intracellular second-messenger. NO also mediates S-nitrosylation of key target molecules in many biological processes (Feihl et al, 2001). Using these different mechanisms, NO can generate a variety of downstream activators. NO and its derivatives also possess innate biochemical properties as reactive oxygen species (ROS). ROS species include NO, its metabolic products (nitrite, nitrate and peroxynitrite) and other related-molecules such as superoxide anion, hydroxyl anion and hydrogen peroxide. Production of ROS is enhanced in sepsis and these products exert toxic effects on nucleic acids, lipids, and proteins (Symeonides and Balk, 1999). In particular, peroxynitrite impairs mitochondrial respiration, activates poly-ADP ribose synthase (PARS), reduces NAD pools, cellular glycolysis, electron transport, and limits ATP generation (Vincent et al, 2000). These free-radical species are thought to be responsible for significant cellular damage during severe sepsis. In endotoxin-mediated sepsis and septic shock, the sustained production of NO in high concentration in multiple cell types modifies inotropic and chronotropic cardiac responses, systemic vasomotor tone, pulmonary vasomotor tone, intestinal epithelial permeability, endothelial activation, microvascular permeability, renal tubular-glomerular feedback, platelet adhesion and aggregation, and insulin metabolism (Finkel et al, 1992; Kilbourn et al, 1997; Chavez et al, 1999; Symeonides and Balk, 1999; Vincent et al, 2000). The natural history of septic shock stems from the combination of negative inotropic cardiac effects, pulmonary vasoconstriction and hypertension, decreased vasomotor tone and profound vasodilation with resultant hyperdynamic-cardiovascular collapse, leading to overwhelming tissue hypoxia and multiple organ dysfunction (Symeonides and Balk, 1999).
pulmonary vascular resistance (PVR), renal vascular resistance and decreased renal blood flow (Vincent et al, 2000). The use of NOS inhibitors in animal models of endotoxemia has been associated with a decrease in cardiac index (CI) and tissue oxygen delivery and an increase in lactic acidosis and hepatic toxicity (Vincent et al, 2000; Cobb, 2001). In several studies, non-selective NOS inhibition was found to be associated with increased mortality (Symeonides and Balk, 1999; Vincent et al, 2000; Cobb, 2001). Clinical trials in human subjects have been performed and they revealed similar effects on SVRI, MAP, PVRI, CI, PCWP and CVP as those found in animal models of sepsis (Symeonides and Balk, 1999; Vincent et al, 2000; Cobb, 2001). Many of these studies utilize compounds that are added exogenously to model systems. The investigation of in situ, homeostatic mechanisms that regulate iNOS expression and NO production represents a novel approach to understanding the complex biology of iNOS regulation and may yield new therapeutic targets. In contrast to iNOS activation pathways, the endogenous counter-regulatory pathways which inhibit iNOS expression and activity in a biologically relevant manner are largely unknown. Certainly, glucocorticoids, IL-4, IL-8, IL-10, transforming growth factor (TGF-$1, $2, $3), NAP110, kalirin and macrophage deactivating factor are among identified inhibitors of iNOS activation (Nathan and Xie, 1994; Nathan, 1997; Taylor and Geller, 2000). While TGF-$exerts transcriptional and post-translational control of iNOS (Nathan and Xie, 1994), kalirin and NAP110 inhibit iNOS activity by preventing iNOS homodimer formation (Ratovitski et al, 1999a, b). Substrate and cofactor availability can also modulate iNOS activity (Nathan and Xie, 1994). Studies investigating these inhibitors have underscored the immense complexity and species-, signaland cell-dependent nature of iNOS regulation. Moreover, the biological relevance of many of these inhibitors is unknown as their effects on iNOS activity have largely been determined in model systems in which they have been exogenously administered. In addition, the underlying signal transduction pathway for each inhibitory agent has not well characterized. An interesting and unique feature of iNOS counter-regulation is the negative feedback characteristic of NO (DelaTorre et al, 1997). NO, as the end-product of iNOS activity, can both directly and indirectly feedback inhibit iNOS expression. These endogenous inhibitory pathways by which NO feedback regulates iNOS expression remain poorly understood. NO may downregulate expression or activity of an iNOS inducing stimulus or conversely, upregulate expression or activity of an iNOS repressor. One example of how NO can biochemically trigger iNOS regulators is the Snitrosylation of intermediary proteins. The biochemical kinetics of NO-mediated S-nitrosylation of NF-#B has been investigated and NO decreases the dissociation constant by four-fold. This suggests that NO modifies NF#B active site-thiols and inhibits NF-#B DNA binding and subsequent iNOS gene transcription (DelaTorre et al, 1997). Critical thiol and non-heme iron groups which may serve as targets for NO are not limited to NF-#B. Snitrosylation targets of NO include p53, caspase-8,
B. The negative feedback regulation of NO Over the past decade, studies utilizing NOS antagonists to treat the deleterious effects of septic shock have produced conflicting results (Symeonides and Balk, 1999; Vincent et al, 2000; Cobb, 2001; Feihl et al, 2001). NOS antagonists can be categorized as amino-acid- or non-amino-acid-based competitive analogs whose members primarily exert either iNOS -selective or -nonselective effects (Vincent et al, 2000). In preclinical animal models of septic shock, the use of NOS inhibitors have shown that mean arterial pressure (MAP) and systemic vascular resistance (SVR) can be significantly increased (Symeonides and Balk, 1999; Vincent et al, 2000). Benefit on survival, however, has been less clear. Moreover, there are several potential detrimental effects to non-specific NOS inhibition including decreased organ perfusion, elevation of mean pulmonary artery pressure, 504
Gene Therapy and Molecular Biology Vol 8, page 505 transglutaminase, glyceraldehyde-3-phosphate dehydrogenase, and glutiathione reductase (Calmels et al, 1997). The ubiquity of negative feedback regulation as a mechanism for modulation of protein activity suggests that inhibitory mechanisms for iNOS may be NO-dependent and that there exists a pool of NO-regulated genes and proteins, which potentially serve as mediators in NOfeedback regulation. Using suppression subtractive hybridization (SSH), we have recently identified OPN as a regulator of iNOS that is itself NO-dependent (Guo et al, 2001). In ANA-1 murine macrophages, we hypothesized that endotoxin (LPS)-mediated NO production induces a specific set of genetic programs that may serve to alter cellular NO metabolism. To identify genes differentially expressed in LPS-stimulated cells producing NO, RNA from LPStreated cells was used as a "tester" and RNA from LPS plus NG-nitro-L-arginine methyl ester (L-NAME) was used as a "driver". Individual cDNA clones generated by SSH were used as probes in Northern blot analysis to identify differentially expressed genes. Using SSH, OPN was found to be specifically induced in the presence of LPSinduced NO synthesis.
and cytotoxicity toward the NO-sensitive mastocytoma cells. Their work suggested that OPN in extracellular fluid protects certain tumor cells from the macrophagemediated destruction by inhibiting the synthesis of NO. Singh et al, (1995, 1999) reported that a synthetic 20amino acid OPN peptide analogue decreased iNOS mRNA and protein levels in ventricular myocytes and cardiac microvascular endothelial cells. Transfection of cardiac microvascular endothelial cells with an antisense OPN cDNA increased iNOS mRNA in response to IL-$ and IFN-!, suggesting that endogenous OPN inhibits NO production. Using an antibody directed against the OPN "v$3 integrin receptor, Attur et al, (2001) demonstrated that ligand binding results in trans-dominant inhibition of NO production in human cartilage. Hwang et al, (1994a, b) found that OPN suppressed NO synthesis induced by interferon and LPS in primary mouse kidney proximal tubule epithelial cells. These studies clearly demonstrate that endogenous OPN can inhibit induction of iNOS and that OPN is an important regulator of the NO signalling pathway and NO-mediated cytoregulatory processes. However, the converse relationship, the role of NO in the induction of OPN synthesis, has not been well studied. In our laboratory, we have recently demonstrated that LPS-induced NO synthesis up-regulates OPN promoter activity and protein expression (Guo et al, 2001). We have shown that LPS-treated ANA-1 and RAW 264.7 macrophages express high levels of OPN protein while untreated macrophages show no detectable level of immunoreactive OPN protein. The addition of L-NAME (competitive NOS inhibitor) to LPS-treated cells ablates OPN protein expression whereas the co-addition of the NO donor, S-nitroso-N-acetylpencillamine (SNAP), restores OPN expression in LPS + L-NAME treated cells. These data suggest that LPS-mediated NO production is associated with significantly increased OPN protein secretion in both ANA-1 and RAW 264.7 macrophages. Using nuclear run-on analysis, we showed that the NOmediated increase in macrophage-OPN mRNA levels was the result of increased gene transcription. Transient transfection of plasmid constructs containing an 865-bp OPN promoter cloned upstream from a luciferase reporter gene, demonstrated that LPS-induced NO production increased OPN promoter activity by ~7-fold compared with controls (Guo et al, 2001). Together these data provide evidence to suggest that NO expression induced by LPS increases OPN promoter activity, and OPN mRNA and protein levels. We have also shown that blockade of the OPN-integrin cell surface receptor with GRGDSP increases macrophage NO production in response to LPS stimulation while the addition of exogenous OPN with LPS to ANA-1 cells maximally decreased nitrite levels by 50%. Together, these data suggest that OPN plays a functional role in regulating LPS-mediated NO production.
IV. Osteopontin, nitric oxide synthase and hnRNP A/B A. OPN structure, receptors and function OPN is a hydrophilic and negatively charged sialoprotein of ~298 amino acids that contains a Gly-ArgGly-Asp-Ser (GRGDS) integrin-binding motif and additional domains for calcium-binding, phosphorylation and glycosylation (Wai and Kuo, 2004). Post-translational modifications account for cell-type and condition-specific OPN-isoforms, which can be measured between 41-75 kD (Wai and Kuo, 2004). This secreted phosphoprotein mediates diverse regulatory functions, including cell adhesion, migration, tumor growth and metastasis, atherosclerosis, aortic valve calcification, and repair of myocardial injury. Many of these functions appear to be regulated by signalling through the integrin and CD44 families of receptors (Wai and Kuo, 2004). OPN expression is tissue-specific and subject to regulation by many factors (Hijiya et al, 1994; Guo et al, 1995; Chellaiah et al, 1996; Wai and Kuo, 2004). Constituitive expression of OPN exists in several cell types but induced expression is found in T lymphocytes, epidermal cells, bone cells and macrophages in response to phorbol 12myristate 13-acetate (PMA), 1,25-dihydroxyvitamin D, basic fibroblast growth factor (bFGF), TNF-", IL-1, interferon gamma (IFN-!) and endotoxin. Interestingly, OPN and iNOS are induced in response to many of the same agents such as TNF-", IL-1$, IFN-!, and LPS (Nathan and Xie, 1994).
B. OPN and inflammation Recently the relationship between OPN, NO and inflammation has been examined by a number of investigators. Rollo et al, (1996) demonstrated that exogenous recombinant OPN protein was effective in blocking RAW264.7 murine macrophage NO production 505
Wai and Kuo: Regulation of NO in sepsis by OPN acids 67-159, 67-75, and 147-159 are absolute requirements for binding activity (Saitoh et al, 2002). This 67-159-amino acid region contains the S-nitrosylation target Cys 104, which was found to be responsible for NOmediated inhibition of DNA binding in our experiments. Using OPN promoter deletion constructs cloned upstream from a luciferase reporter gene we localized a NO-sensitive cis-acting element in the OPN promoter (174 to -209 nt). Deletion of this segment resulted in > 4fold increase in OPN promoter activity (Gao et al, 2004). Electromobility shift assay demonstrated that nuclear protein is bound to the OPN promoter in the region of nt 183 to nt -196 in unstimulated control cells. In the presence of LPS and NO, binding is ablated, and OPN promoter activity is increased. Utilizing the biotinstreptavidin DNA affinity technique with the identified DNA-binding sequence, the candidate repressortranscription factor was then purified and isolated from nuclear extract isolated from unstimulated control RAW 264.7 macrophages. The purified proteins were separated by SDS-PAGE and analyzed after tryptic digestion and yielded results that matched with hnRNP A/B (GenBankTM accession number NM 010448). Supershift assays confirmed the identity of the gel-shift band and chromatin immunoprecipitation (ChIP) -assay analysis demonstrated in vivo binding of hnRNP A/B to the OPN promoter (Gao et al, 2004). This binding was inhibited in the presence of NO that was either endogenously induced by LPS or exogenously delivered. Finally, we demonstrated that S-nitrosylation of hnRNP A/B p37 is significantly enhanced in the presence of LPS-mediated NO synthesis and that S-nitrosylation of the p37 cysteine residue at position 104 is associated with diminished DNA binding in gel shift assays. Together these data suggest that LPS-induced S-nitrosylation of hnRNP A/B inhibits its activity as a constitutive repressor of the OPN promoter (Figure 3).
C. S-nitrosylation of hnRNP A/B regulates OPN transcription during endotoxin stimulation Cloning of the human, porcine and murine OPN promoters has uncovered numerous consensus regulatory sequences (Wai and Kuo, 2004). Early investigations with the human OPN promoter revealed multiple candidate elements that contain consensus sequences for known transcription factors including TATA-like (-27 to -22 nt) and CCAAT-like (-73 to -68 nt) sequences, vitamin-Dresponsive (VDR)-like motifs (-1892 to -1878 and -698 to -684 nt), GATA-1 (-851 to -847 nt), AP-1 (TGACACA, 78 to -72 nt), PEA3 (-1695 to -1690 and -1418 to -1413 nt) and Ets-1 (-47 to -39 nt) binding sequences and multiple TCF-1 sites (31). Craig and Denhardt identified similar sequences in the murine OPN promoter: a characteristic TATA box (-27 to -22 nt), an inverted CCAAT box (-53 to -49 nt), a positive transcription element (-543 to -253 nt) and a negative transcription element (-777 and -543 nt) (Craig and Denhardt, 1991). Several investigators have since shown that transcriptional regulation of OPN is complex and involves multiple pathways. Several interrelated signalling pathways and transcription factors regulate the OPN promoter including AP-1, Myc, Oct-1, USF, v-Src, Runx/CBF, TGF-B/BMPs/Smad/Hox, Wnt/Ă&#x; catenin/APC/GSK-3Ă&#x;/Tcf-4, Ras/RRF and TP53 (Wai and Kuo, 2004). Recently, we have identified heterogeneous nuclear ribonucleoprotein A/B (hnRNP A/B) as a constitutive transcriptional repressor of OPN whose DNA binding activity is decreased by LPS-mediated S-nitrosylation of a key cysteine thiol. hnRNPs were originally described as a group of chromatin-associated RNA-binding proteins that form complexes with RNA polymerase II transcripts. The hnRNP family is a collection of more than 20 proteins that contribute to the complex around nascent pre-mRNA and are thus able to modulate RNA processing (Krecic and Swanson, 1999). Members of the group are characterized by their ability to bind to RNA with limited specificity, and they are among the most abundant of all of the nuclear proteins. Despite its function in RNA handling, the precise physiological role of hnRNPs has yet to be fully defined and may include trans-regulatory effects. Recent studies have shown that the hnRNPs D0B, E2BP, and K are able to bind to double-stranded DNA motifs within the complement receptor 2, hepatitis B virus, and c-myc promoters, respectively (Tay et al, 1992; Tomonaga and Levens, 1995; Tolnay et al, 1999). hnRNP K possesses both transcriptional activator and repressor functions (Michelotti et al, 1996). hnRNP A/B is a unique member of the hnRNP family in that it possesses a DNA-binding sequence domain that is separate from the repression domain. The p40 isoform contains 331 amino acid residues, whereas p37 contains 284. The amino acid sequences are identical with the exception of an additional 47 amino acids at the C-terminal region of p40. In this regard, Yabuki et al, (2001) found that hnRNP A/B p40 binds to the rat aldolase B promoter to inhibit activity, whereas hnRNP A/B p37 had no effect. Further studies by this group found that the DNA-binding region for both isoforms reside with amino
Figure 3. S-nitrosylation of hnRNP A/B relieves transcriptional repression of OPN during LPS-mediated production of NO and serves as a negative feedback mechanism for iNOS regulation.
506
Gene Therapy and Molecular Biology Vol 8, page 507 Cobb JP (2001) Nitric oxide synthase inhibition as therapy for sepsis, a decade of promise. Surg Infect (Larchmt) 2, 93100; discussion 100-1. Craig AM, Denhardt DT (1991) The murine gene encoding secreted phosphoprotein 1 (osteopontin), promoter structure, activity, and induction in vivo by estrogen and progesterone. Gene 100, 163-71 Crapo JD and Stamler JS (1994) Signaling by nonreceptor surface mediated redox active biomolecules. J Clin Invest 93, 2304. DelaTorre A, Schroeder RA, Kuo PC (1997) Alteration of NF#B p50 binding kinetics by S-nitrosylation. Biochem Biophys Res Commun 238, 703-706 Diks SH, van Deventer SJ, Peppelenbosch MP (2001) Lipopolysaccharide recognition, internalisation, signalling and other cellular effects. J Endotoxin Res 7, 335-48 Feihl F, Waeber B, Liaudet L (2001) Is nitric oxide overproduction the target of choice for the management of septic shock? Pharmacol Ther 91, 179-213 Finkel MS, Oddis CV, Jacob TD, Watkins SC, Hattler BG, Simmons RL (1992) Negative inotropic effects of cytokines on the heart mediated by nitric oxide. Science 257, 387-9 Gao C, Guo H, Wei J, Mi Z, Wai P, Kuo PC (2004) Snitrosylation of heterogeneous nuclear ribonucleoprotein A/B regulates osteopontin transcription in endotoxin-stimulated murine macrophages. J Biol Chem 279, 11236-43 Guha M, Mackman N (2001) LPS induction of gene expression in human monocytes. Cell Signal 13, 85-94 Guo H, Cai CQ, Schroeder RA, Kuo PC (2001) Osteopontin is a negative feedback regulator of nitric oxide synthesis in murine macrophages. J Immunol 166, 1079-86 Guo X, Zhang YP, Mitchell DA, Denhardt DT, Chambers AF (1995) Identification of a ras-activated enhancer in the mouse osteopontin promoter and its interaction with a putative ETSrelated transcription factor whose activity correlates with the metastatic potential of the cell. Mol Cell Biol 15, 476-87 Hijiya N, Setoguchi M, Matsuura K, Higuchi Y, Akizuki S, Yamamoto S (1994) Cloning and characterization of the human osteopontin gene and its promoter. Biochem J 303, 255-62 Hwang SM, Lopez CA, Heck DE, Gardner CR, Laskin DL, Laskin JD, Denhardt DT (1994a) Osteopontin inhibits induction of nitric oxide synthase gene expression by inflammatory mediators in mouse kidney epithelial cells. J Biol Chem 269, 711-5 Hwang SM, Wilson PD, Laskin JD, Denhardt DT (1994b) Age and development-related changes in osteopontin and nitric oxide synthase mRNA levels in human kidney proximal tubule epithelial cells, contrasting responses to hypoxia and reoxygenation. J Cell Physiol 160, 61-8 Kilbourn RG, Traber DL, Szabo C (1997) Nitric oxide and shock. Dis Mon, 277-348 Krecic AM, Swanson MS (1999) hnRNP complexes, composition, structure, and function. Curr Opin Cell Biol 11, 363-71 Lazaron V, Dunn DL (2002) Molecular biology of endotoxin antagonism. World J Surg 26, 790-8. Epub 2002 Apr 15 Levy MM, Fink MP, Marshall JC, Abraham E, Angus D, Cook D, Cohen J, Opal SM, Vincent JL, Ramsay G; SCCM/ESICM/ACCP/ATS/SIS (2003) 2001 SCCM/ESICM/ACCP/ATS/SIS International Sepsis Definitions Conference. Crit Care Med 31, 1250-6 Martin GS, Mannino DM, Eaton S, Moss M (2003) The epidemiology of sepsis in the United States from 1979 through 2000. N Engl J Med 348, 1546-54 Michelotti EF, Michelotti GA, Aronsohn AI, Levens D (1996) Heterogeneous nuclear ribonucleoprotein K is a transcription factor. Mol Cell Biol 16, 2350-60
V. Conclusion In sepsis, endotoxin-mediated production of NO involves complex signalling pathways that regulate iNOS expression. NO has wide-ranging biochemical and physiologic effects in multiple organ systems and mediates some of the processes that lead to cardiovascular collapse, tissue hypoxia and organ failure in the septic patient. While many studies have focused on the modulation of NO production as a means of reducing the mortality associated with septic shock, little is known about the endogenous, homeostatic pathways that lead to downregulation of NO synthesis. Our current findings suggest that LPS-induced S-nitrosylation of hnRNP inhibits its activity as a constitutive repressor of the OPN promoter. This represents a novel target for S-nitrosylation regulatory functions as hnRNP proteins are better characterized as participants in telomere biogenesis, splicing, and mRNA transport. Further study to determine the potential role of S-nitrosylation in these other hnRNPdependent functions may expand the known regulatory roles for NO and S-nitrosylation.
References Alexander C, Rietschel ET (2001) Bacterial lipopolysaccharides and innate immunity. J Endotoxin Res 7, 167-202 Attur MG, Dave MN, Stuchin S, Kowalski AJ, Steiner G, Abramson SB, Denhardt DT, Amin AR (2001) Osteopontin, an intrinsic inhibitor of inflammation in cartilage. Arthritis Rheum 44, 578-84 Balk RA (2004) Optimum treatment of severe sepsis and septic shock, evidence in support of the recommendations. Dis Mon 50, 168-213 Bone RC, Balk RA, Cerra FB, Dellinger RP, Fein AM, Knaus WA, Schein RM, Sibbald WJ (1992) Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. The ACCP/SCCM Consensus Conference Committee. American College of Chest Physicians/Society of Critical Care Medicine. Chest. 101, 1644-55. Brun-Buisson C (2000) The epidemiology of the systemic inflammatory response. Intensive Care Med 26 Suppl 1, S64-74. Brun-Buisson C, Doyon F, Carlet J, Dellamonica P, Gouin F, Lepoutre A, Mercier JC, Offenstadt G, Regnier B (1995) Incidence, risk factors, and outcome of severe sepsis and septic shock in adults. A multicenter prospective study in intensive care units. French ICU Group for Severe Sepsis. JAMA 274, 968-74 Brun-Buisson C, Meshaka P, Pinton P, Vallet B; EPISEPSIS Study Group (2004) EPISEPSIS, a reappraisal of the epidemiology and outcome of severe sepsis in French intensive care units. Intensive Care Med 30, 580-8. Calmels S, Hainaut P, Ohshima H (1997) Nitric oxide induces conformational and functional modifications of wild-type p53 tumor suppressor protein. Cancer Research 57, 33653369 Chavez AM, Menconi MJ, Hodin RA, Fink MP (1999) Cytokineinduced intestinal epithelial hyperpermeability, role of nitric oxide. Crit Care Med 27, 2246-51 Chellaiah M, Fitzgerald C, Filardo EJ, Cheresh DA, Hruska KA (1996) Osteopontin activation of c-src in human melanoma cells requires the cytoplasmic domain of the integrin alpha vsubunit. Endocrinology 137, 2432-40
507
Wai and Kuo: Regulation of NO in sepsis by OPN Morris SM and Billiar TR (1994) New insights into the regulation of inducible nitric oxide synthesis. Am J Physiol 266, 829-839. Nathan C (1997) Inducible nitric oxide synthase, what difference does it make? J Clin Invest 100, 2417-2423 Nathan C and Xie QW (1994) Regulation of biosynthesis of nitric oxide. J Biol Chem 269, 13725-13728 Ratovitski EA, Alam MR, Quick RA, McMillan A, Bao C, Kozlovsky C, Hand TA, Johnson RC, Mains RE, Eipper BA, Lowenstein CJ (1999a) Kalirin inhibition of inducible nitricoxide synthase. J Biol Chem 274, 993-9 Ratovitski EA, Bao C, Quick RA, McMillan A, Kozlovsky C, Lowenstein CJ (1999b) An inducible nitric-oxide synthase (NOS) -associated protein inhibits NOS dimerization and activity. J Biol Chem 274, 30250-7 Rollo EE, Laskin DL, Denhardt DT (1996) Osteopontin inhibits nitric oxide production and cytotoxicity by activated RAW264.7 macrophages. J Leukoc Biol 60, 397-404 Saitoh Y, Miyagi S, Ariga H, Tsutsumi K (2002) Functional domains involved in the interaction between Orc1 and transcriptional repressor AlF-C that bind to an origin/promoter of the rat aldolase B gene. Nucleic Acids Res 30, 5205-12 Simon DI, Mullins ME, Jia L, Gaston B, Singel DJ, Stamler JS (1996) Polynitrosylated proteins, characterization, bioactivity, and functional consequences. Proc Natl Acad Sci 93, 4736-4741 Singh K, Balligand JL, Fischer TA, Smith TW, Kelly RA (1995) Glucocorticoids increase osteopontin expression in cardiac myocytes and microvascular endothelial cells. Role in
regulation of inducible nitric oxide synthase. J Biol Chem 270, 28471-8 Singh K, Sirokman G, Communal C, Robinson KG, Conrad CH, Brooks WW, Bing OH, Colucci WS (1999) Myocardial osteopontin expression coincides with the development of heart failure. Hypertension 33, 663-70 Symeonides S, Balk RA (1999) Nitric oxide in the pathogenesis of sepsis. Infect Dis Clin North Am 13, 449-63 Tay N, Chan SH, Ren EC (1992) Identification and cloning of a novel heterogeneous nuclear ribonucleoprotein C-like protein that functions as a transcriptional activator of the hepatitis B virus enhancer II. J Virol 66, 6841-8 Taylor BS and Geller DA (2000) Molecular regulation of the human inducible nitric oxide synthase (iNOS) gene. Shock 13, 413-424. Tolnay M, Vereshchagina LA, Tsokos GC (1999) Heterogeneous nuclear ribonucleoprotein D0B is a sequence-specific DNAbinding protein. Biochem J 338, 417-25 Tomonaga T, Levens D (1995) Heterogeneous nuclear ribonucleoprotein K is a DNA-binding transactivator. J Biol Chem 270, 4875-81 Vincent JL, Zhang H, Szabo C, Preiser JC (2000) Effects of nitric oxide in septic shock. Am J Respir Crit Care Med 161, 1781-5 Wai PY, Kuo PC (2004) The role of Osteopontin in tumor metastasis. J Surg Res 121, 228-241 Yabuki T, Miyagi S, Ueda H, Saitoh Y, Tsutsumi K (2001) A novel growth-related nuclear protein binds and inhibits rat aldolase B gene promoter. Gene 264, 123-9)
508
Gene Therapy and Molecular Biology Vol 8, page 509 Gene Ther Mol Biol Vol 8, 509-514, 2004
Feasibility to delineate distribution of solution injected intraprostatic using an ex-vivo canine model Research Article
Charles J. Rosser1, Noriyoshi Tanaka1, R. Jason Stafford2, Roger E. Price3, John D. Hazle2, Motoyoshi Tanaka1, Ashish M. Kamat1, Louis L. Pisters1* 1
Department of Urology, Department of Imaging Physics, 3 Department of Veterinary Medicine and Surgery, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 2
__________________________________________________________________________________ *Correspondence: Louis L. Pisters, M.D., Department of Urology, Unit 446, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Houston, TX 77030; Phone: 713-792-3250; Fax: 713-794-4824; Email: lpisters@mdanderson.org Key words: prostate, gadolinium, magnetic resonance imaging, gene therapy Abbreviations: dilution of gadolinium DTPA, (Gd-DTPA); Institutional Animal Care and Use Committee, (IACUC); magnetic resonance, (MR)
Charles J. Rosser and Noriyoshi Tanaka contributed equally to the manuscript Supported by the Cancer Center Support Grant CA16672 from the National Cancer Institute and a grant from the American Foundation of Urologic Disease. Received: 5 October 2004; Accepted: 3 November 2004; electronically published: December 2004
Summary We sought to identify an injection scheme and amount of solution injected resulting in optimal distribution of an injected solution into the prostate and to determine whether magnetic resonance (MR) imaging is suitable for evaluating intraprostatic distribution of an injected solution. Freshly excised canine prostates mounted in gelatin were injected under ultrasound guidance with a standard volume (3 ml) of 1:10 dilution of gadolinium DTPA (GdDTPA) and a 1:10 dilution of 1% methylene blue in phosphate-buffered saline. Three different schemes were used: three-core, 10-core, and 20-core injection schemas. The prostates were subsequently imaged by MR imaging. After imaging, samples were fixed in formalin, sectioned transversely, and digitally photographed. The distributions of injected solution on photographs and MR images were compared. Findings on MR images correlated well with photographic findings. Regions of injected solution were generally seen as hyperintense on the T1-weighted images. A 20-core injection scheme distributed the injected solution better than a three-core or 10-core scheme. A 20-core injection scheme resulted in optimal distribution within the prostate of injected methylene blueâ&#x20AC;&#x201C;Gd-DTPA solution. MR imaging may be useful for imaging the distribution of solution injected into the prostate. the use of ineffective genes or the inability to transduce the desired gene into a sufficient number of tumor cells. Since various genes have been shown to inhibit prostate tumor growth in vitro, (Issacs et al, 1991; Moody, et al, 1994; Vieweg et al, 1994; Gotoh et al, 1997; Steiner et al, 2000) we believe the disappointing clinical results are due to the inability to transduce genes into a sufficient number of tumor cells. In several reports on prostate cancer gene therapy, there is no mention of gene transduction, indicating that transduction may have been low or may not have occurred (Eder et al, 1998; Gulley et al, 1998; Herman et al, 1999; Lu et al, 1999; Pisters et al, 1999; Simons et al, 1999; Belldegrun et al, 2001).
I. Introduction Intraprostatic injection of a therapeutic solution is not a new concept. Specifically, gene therapy for localize/locally advanced prostate cancer routinely relies on intraprostatic injection of vector. Since 1995, more than 55 gene therapy trials have been initiated in patients with prostate cancer (Recombinant DNA Advisory Committee, 2003; Steiner and Gingrich, 2001). The few data we have from such trials demonstrate the feasibility and safety of gene therapy for prostate cancer, but show minimal if any therapeutic benefit (Harrington et al, 2001; Steiner and Gingrich, 2001). The disappointing results may be due to
509
Rosser et al: Intraprostatic injection to mimic gene therapy was 1.6 mm with 0.5-mm gaps, and three-dimensional images were 0.60 mm thick with no gap. T1-weighted spin-echo images were acquired using TR/TE = 300 ms/15 ms, NEX (excitations) = 6, and bandwidth = +/-16 kHz. T2-weighted fast spin-echo images were acquired using TR/TE = 4,400 ms/84 ms, NEX = 8, bandwidth = +/-16 kHz, and echo train = 8. Proton-densityweighted images were acquired using a fast spin-echo with TR/TE = 4400 ms/17.4 ms, NEX = 4, bandwidth = +/-25 kHz, and echo train = 4. T2*-weighted images were acquired using a gradient-recalled acquisition in the steady state with TR/TE = 650 ms/20 ms, flip angle = 60°, NEX = 6, and bandwidth = +/-16 kHz. The T1-weighted three-dimensional sequence was acquired using a fast spoiled gradient-recalled echo with TR/TE = 13.4 ms/4.2 ms, flip angle = 20°, NEX = 6, bandwidth = +/-16 kHz, and 72 scan locations per block. After MR imaging, prostates were removed from their containers and gelatin molds and fixed in 10% formalin. Subsequently, samples were transversely sectioned in 3-mmthick sections and digitally photographed. The distribution of methylene blue seen on photographs was then compared with the distribution of gadolinium seen on MR imaging. Furthermore, the distribution of methylene blue on photographs was quantitated using Image Pro Plus 4 software (Media Cybernetics, Carlsbad, CA). Statistical analyses were performed using the Bonferroni Multiple Comparison Test. Differences with P values ! 0.05 were considered significant. Cell Line and Recombinant Adenovirus Vector. LNCaP prostatic tumor cells, purchased from American Type Culture Collection (Manassas, VA), were maintained in RPMI supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 100 µg/ml streptomycin, and 4 mM glutamine. All cells were incubated at 370C in a humidified atmosphere of 5% CO2 in air. Recombinant adenovirus vector Ad-X-gal, which expresses the X-gal reporter gene under the control of the human cytomegalovirus immediate-early promoter/enhancer was provided by Introgen, Inc. (Houston, TX). The titer of Ad-X-gal was 1.5 x 1011 plaque-forming units per milliliter. All in vitro experiments were performed in triplicate using a MOI of 10. Xgal staining was performed by standard protocol (Zhang et al, 2003).
Initiation of further studies relying on injection of a therapeutic solution into the prostate will be pointless until we determine: a) how to inject the solution into the prostate, b) how much to inject into the prostate, and c) can we visualize where the injected solution is in the prostate. We believe that if we could increase the exposure of the prostate to therapeutic solutions such as viral vectors used in gene therapy, we could increase the gene transduction rate and demonstrate a therapeutic response. In this feasibility study of assessing distribution of injectate, we set out to determine in an ex vivo model a) the injection scheme and b) the amount of solution injected that gives the widest distribution. We also will compared c) the distributions of this injected solution as observed on MR imaging and gross histologic examination to determine whether MR imaging is suitable for evaluating the distribution of solutions injected into the prostate.
II. Materials and methods Twelve random-source adult male dogs housed in the animal care facility at The University of Texas M. D. Anderson Cancer Center were included in this study. All the animals were originally a part of other investigators’ protocols that had been approved by the institution’s Institutional Animal Care and Use Committee (IACUC). Dogs were euthanized by induction of anesthesia, exsanguinated, and then the prostates were resected. Then the prostate was removed as follows. A lower midline incision was made. The peritoneal contents were reflected superiorly, and the bladder was visualized and palpated. Inferior to the bladder, the prostate, which is intra-abdominal, was palpated. The urethra just distal to the prostate was sharply transected and reflected superiorly. Then the prostate was sharply transected at the bladder, and the specimen was placed in normal saline. The prostates were embedded in gelatin (Knox Gelatin, Camden, NJ). A 5/7.5-MHz biplanar linear array transrectal ultrasound probe (UST 664, Wallingford, CT) was used to visualize the embedded prostates. Then a standard volume (3 ml) of an injectable solution composed of a 1:10 dilution of GdDTPA (Magnavista) and a 1:10 dilution of 1% methylene blue in phosphate-buffered saline was injected into the prostate according to one of three injection schemes (3-core, 10-core, or 20-core injection schema). Our choice of methylene blue was supported by a previous study in which an adenoviral vector with methylene blue was injected into muscles and showed that the areas of gene transduction correlated well with the distribution of methylene blue on gross histologic examination (O’Hara et al, 2001). For each injection of methylene blue-Gd–DTPA solution, a 3-inch-long, 22-gauge spinal needle connected to a standard 1ml Luer-Lok syringe containing the appropriate aliquot for injection was guided into the prostate according to the appropriate injection scheme. The needle tip was localized within the prostatic parenchyma with ultrasound guidance. All experiments were performed on a 1.5 T scanner (Signa Echospeed, General Electric Medical Systems, Milwaukee, WI). The scanner is equipped with a high-performance gradient hardware package (SR120) and fast-receiver hardware. The maximum achievable slew rate is 120 mT/m/s, and the maximum amplitude is 23 mT/m. The fast receiver has a bandwidth of +/500 MHz. Gel-mounted samples were placed in a custom 16element, 10-cm-diameter birdcage transmit-receive radiofrequency coil designed in house and imaged at high resolution (234 x 234 µm) over a 60-mm field-of-view using a 256 x 256 acquisition matrix. Two-dimensional slice thickness
III. Results Figure 1 shows the distribution of methylene blue on histologic examination and the distribution of gadolinium on MR imaging for a representative prostate from each of the three injection scheme groups. The mean volume of the prostates was 22.9 ml ± 7.9 ml. The mean proportion of the prostate to which methylene blue was distributed was 28.5 ± 3.8% for the 3core technique. The 3-core injection scheme left multiple untreated areas in the lateral horns of the prostate as well as in the anterior portion of the prostate. The mean proportion of the prostate to which methylene blue was distributed was 28.7% ± 3.4 for the 10-core technique and 53.5 ± 4.0% for the 20-core technique. The 20-core injection technique provided the greatest coverage of prostatic volume (P < 0.001). The distribution of methylene blue on photographs correlated well with the distribution of Gd-DTPA on MR images. In general, regions of injected material were observed as hyperintense on the T1-weighted spin-echo and spoiled gradient-recalled echo images because of the shortening of the spin-lattice relaxation time (T1) due to Gd-DTPA. In regions where the concentration of GdDTPA was high, such as the injection site fistulae, signal 510
Gene Therapy and Molecular Biology Vol 8, page 511 was sometimes hypointense on the T1-weighted spin-echo images because of shortening of T2. This effect was rarely observed on the T1-weighted three-dimensional fast spoiled gradient-recalled echo images because of the short echo time. Regions of high Gd-DTPA concentration appeared hypointense on the T2-weighted and proton-
density-weighted images as well (Figure 2). These hypointense regions on T2- and T2*-weighted images correlated well with the distribution of methylene blue seen on whole-mount examination, but did not demonstrate the same level of contrast seen in the T1weighted images.
Figure 1. Distribution of methylene blue on whole-mount histologic evaluation from each of the three injection schemes. Comparison of 3-core vs. 10-core, p > 0.05; 3-core vs. 20-core, p < 0.001; and 10-core vs. 20-core, p < 0.001. Figure 2. Appearance of tissue sections from the same prostate on gross pathologic examination and on MR imaging. (a) Distribution of methylene blue seen on whole-mount examination. (b) Distribution of Gd-DTPA observed best on three-dimensional T1-weighted MR imaging. (c) T1-weighted spin-echo images show enhancement with regions of reduced signal intensity corresponding to large concentrations of Gd. (d) Proton-density-weighted and (e) T2weighted images demonstrate the effect of shortened T2 values. (f) T2*-weighted images show additional darkening due to Gd-DTPA susceptibility.
511
Rosser et al: Intraprostatic injection to mimic gene therapy Subsequent studies demonstrated two key points. First, in the ex-vivo model we determined that for every 5 grams of prostatic tissue, 1 ml of solution should be injected for best coverage (data not shown). In addition, LNCaP prostatic tumors cell lines were grown under standard conditions and treated with various concentrations of gadolinium combined with 10 MOI of nonreplicating adenovirus with a cytomegalovirus reporter and X-gal gene. Standard concentrations of gadolinium were not toxic to the adenovirus and did not affect gene transduction rates (data not shown).
In conclusion, the limited therapeutic effects seen in previous studies when a solution is injected into the prostate, specifically gene therapy for prostate cancer may be due in part to inadequate treatment of the entire prostate. In this pilot study, we demonstrated that a 20core injection scheme resulted in wider intraprostatic distribution of a standard volume of material injected into canine prostates than did a 3-core or 10-core scheme and that for every 5 grams of prostatic tissue 1 ml of solution should be injected. Furthermore, these preliminary results indicate that MR imaging, particularly T1-weighted threedimensional imaging, may be useful as a noninvasive method for evaluating the distribution of intraprostatic injections. Finally, subsequent studies should confirm that 1 mL of solution can cover 5 grams of prostatic tissue thus achieving optimal distribution.
IV. Discussion Localized prostate cancer is a multifocal disease, and the inability to deliver a therapeutic solution to the entire prostate would make intraprostatic injection unlikely to succeed. Indeed, despite promising preclinical findings with gene therapy, the reported clinical trials of gene therapy for prostate cancer have found little or no therapeutic effect (Harrington et al, 2001; Steiner and Gingrich, 2001). However initiation of further studies relying on injection of a therapeutic solution into the prostate will be pointless until we further study the distribution of a solution when injected into the prostate. We have demonstrated that when a standard volume of solution is injected into a canine prostate ex vivo, a 20core injection scheme results in greater coverage of the prostate than a 3-core or 10-core injection scheme. The 3and 10-core injection scheme resulted in a more intense, localized distribution of the methylene blue, which left multiple untreated areas in the lateral horns of the prostate as well as in the anterior portion of the prostate. As previous research has demonstrated, a significant number of tumors are found in the lateral horn of the prostate. Thus, treatment of these areas is of the utmost importance. Two other very important concepts were discovered in subsequent studies. When a prostate is evaluated prior to injection of a solution, we believe a transrectal sonographic volume study should be performed initially and that for every 5 grams of prostate, 1 ml of solution should be injected for best coverage (data no shown). In addition, in another subsequent study, prostatic epithelium tumors in vitro were treated with various concentrations of gadolinium combined with 10 MOI of nonreplicating adenovirus with a cytomegalovirus reporter and X-gal gene. Standard concentrations of gadolinium were not toxic to the adenovirus and did not affect gene transduction rates (data not shown). Thus, gadolinium can be used in combination with viral vectors to monitor vector distribution without affecting gene transfer. This study has several limitations. First and foremost, the injections were performed in an ex vivo setting. In vivo injection with ongoing diffusion and perfusion may result in an even greater distribution of injected solution. Second, the canine prostate does not exactly mimic the human prostate. The canine prostate has multiple vertical septations, which may affect the distribution of the injected solution. Finally, on the basis of a subsequent study in which we determined that 1 ml of solution should be injected for every 5 grams of prostate tissue to achieve optimal distribution within the prostate.
References Belldegrun A, Tso CL, Zisman A, Naitoh TJ, Said J, Pantuck AJ, Hinkel A, deKernion J, Figlin R (2001) Interleukin 2 gene therapy for prostate cancer: phase I clinical trial and basic biology. Hum Gene Ther 12, 883-892. Eder JP, Kantoff PW, Bubley GJ (1998) A phase I trial of recombinant vaccinia virus, PROSTVAC, that expresses prostate specific antigen (rV-PSA) as a vaccine in men with advanced prostate cancer. Presented at the annual meeting of the American Society of Clinical Oncology, Los Angeles, 1998. Available at: http://www.asco.org/ac/1,1003,_12002326-00_18-001998-00_19-0013825-00_29-00A,00.asp. Accessed April 11, 2003. Gotoh A, Kao C, Ko SC, Hamada K, Liu TJ, Chung LW (1997) Cytotoxic effects of recombinant adenovirus p53 and cell cycle regulator genes (p21 and p16) in human prostate cancers. J Urol 158, 636-641. Gulley J, Chen AP, Dahut W, Arlen PM, Bastian A, Steinberg SM, Tsang K, Panicali D, Poole D, Schlom J, Michael Hamilton J (1998) A phase I study of recombinant vaccinia virus (RV) that expresses prostate specific antigen (PSA) in adult patients with adenocarcinoma of the prostate. Presented at the annual meeting of the American Society of Clinical Oncology, Los Angeles, 1998. Available at: http://www.asco.org/ac/1,1003,_12-002326-00_18-00199800_19-0013429-00_29-00A,00.asp. Accessed April 11, 2003. Harrington KJ, Spitzweg C, Bateman AR, Morris JC, Vile RG (2001) Gene therapy for prostate cancer: current status and future prospects. J Urol 166, 1220-1233. Herman JR, Adler HL, Aguilar-Cordova E, Rojas-Martinez A, Woo S, Timme TL, Wheeler TM, Thompson TC, Scardino PT (1999) In situ gene therapy for adenocarcinoma of the prostate: a phase I clinical trial. Hum Gene Ther 10, 12391249. Issacs WB, Carter BS, Ewing CM (1991) Wild-type p53 suppresses growth of human prostate cancer cells containing mutant p53 alleles. Cancer Res 51, 4716-4720. Lu Y, Carraher J, Zhang Y, Armstrong J, Lerner J, Rogers WP, Steiner MS (1999) Delivery of adenoviral vectors to the prostate for gene therapy. Cancer Gene Ther 6, 64-72. Moody DB, Robinson JC, Ewing CM, Lazenby AJ, Issacs WB (1994) Interleukin-2 transfected prostate cancer cells generate a local antitumor effect in vivo. Prostate 24, 244251. Oâ&#x20AC;&#x2122;Hara AJ, Howell JM, Taplin RH, Fletcher S, Lloyd F, Kakulas B, Lochmuller H, Karpati G (2001) The spread of transgene
512
Gene Therapy and Molecular Biology Vol 8, page 513 expression at the site of gene construct injection. Muscle Nerve 24, 488-495. Pisters LL, Pettaway CA, Hossan E, Evans R, Steiner MS, Wood CG, Troncoso P, McDonnell TJ, Fenstenmacher MJ, Logothetis CJ (1999) Intraprostatic AD-p53 gene therapy followed by radical prostatectomy: feasibility and preliminary results. Prostate Cancer Prostatic Dis 2, (S3):S27. Recombinant DNA Advisory Committee. Office of Biotechnology Activities. National Institutes of Health. Clinical Trials in Human Gene Transfer. Available at: http://www4.od.nih.gov/oba/rac/clinicaltrial.htm. Accessed April 10, 2003. Simons JW, Mikhak B, Chang JF, Demarzo AM, Carducci MA, Lim M, Weber CE, Baccala AA, Goemann MA, Clift SM, Ando DG, Levitsky HI, Cohen LK, Sanda MG, Mulligan RC, Partin AW, Carter HB, Piantadosi S, Marshall FF, Nelson WG (1999) Induction of immunity to prostate cancer antigens: results of a clinical trial of vaccination with irradiated autologous prostate tumor cells engineered to secrete granulocyte-macrophage colony-stimulating factor using ex vivo gene transfer. Cancer Res 59, 5160-5168. Steiner MS, Gingrich JR (2001) Gene therapy for prostate cancer: where are we now? J Urol 164, 1121-1136. Steiner MS, Zhang Y, Farooq F, Lerner J, Wang Y, Lu Y (2000) Adenoviral vector containing wild-type p16 suppresses prostate cancer growth and prolongs survival by inducing cell senescence. Cancer Gene Ther 7, 360-372.
Vieweg J, RosenthaI FM, Bannerji R, Heston WD, Fair WR, Gansbacher B, Gilboa E (1994) Immunotherapy of prostate cancer in the Dunning rat model: use of cytokine gene modified tumor vaccines. Cancer Res 5, 1760-1765. Zhang X, Multani AS, Zhou JH, Shay JW, McConkey D, Dong L, Kim CS, Rosser CJ, Pathak S, Benedict WF (2003) Adenoviral-mediated Rentinoblastoma 94 Produces Rapid Telomere Erosion, Chromosomal Crisis, and Caspasedependent Apoptosis in Bladder Cancer and Immortalized Human Urothelial Cells but not in Normal Urothelial Cells. Cancer Res 63, 760-765.
Charles J. Rosser
513
Rosser et al: Intraprostatic injection to mimic gene therapy
514
Gene Therapy and Molecular Biology Vol 8, page 515 Gene Ther Mol Biol Vol 8, 515-522, 2004
ER stress and the JNK pathway in insulin resistance Review Article
Hideaki Kaneto*, Yoshihisa Nakatani, and Munehide Matsuhisa Department of Internal Medicine and Therapeutics, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan
__________________________________________________________________________________ *Correspondence: Hideaki Kaneto, MD, PhD, Department of Internal Medicine and Therapeutics, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan; Tel. (81-6) 6879-3633; Fax (81-6) 6879-3639; e-mail: kaneto@medone.med.osaka-u.ac.jp Key words: diabetes JNK pathway, ER stress, insulin resistance Abbreviations: ! subunit of translation initiation factor 2, (eIF2!); antisense ORP150 expressing adenovirus,(Ad-AS-ORP); c-Jun Nterminal kinase, (JNK); disappearance rate, (Rd); dominant-negative JNK expressing adenovirus, (Ad-DN-JNK); dominant-negative type, (DN); endoplasmic reticulum, (ER); fluorescein isothiocyanate, (FITC); GFP expressing control adenovirus, (Ad-GFP); glucose infusion rate, (GIR); glucose-6-phosphatase, (G6Pase); hepatic glucose production, (HGP); human immunodeficiency virus, (HIV-1); insulin receptor substrate-1, (IRS-1); intraperitoneal glucose tolerance test, (IPGTT); intraperitoneal insulin tolerance test, (IPITT); isletbrain-1, (IB-1); JNK-interacting protein-1, (JIP-1); mouse embryo fibroblasts, (MEFs); oxygen-regulated protein 150, (ORP150); pancreatic ER kinase, (PERK); phosphoenolpyruvate carboxykinase, (PEPCK); protein transduction domains, (PTDs); sense ORP150 expressing adenovirus,(Ad-S-ORP); wild type, (WT); X-boxâ&#x20AC;&#x201C;binding proteinâ&#x20AC;&#x201C;1, (XBP-1) Received: 29 November 2004; Revised: 9 December 2004 Accepted: 14 December 2004; electronically published: January 2005
Summary The endoplasmic reticulum (ER) is an organelle which synthesizes various secretory and membrane proteins. These proteins are correctly folded and assembled by chaperones in the ER. During stressful conditions such as upon an increase in the misfolded protein level, the chaperons become overloaded and the ER fails to fold and export newly synthesized proteins, leading to ER stress. Under diabetic conditions ER stress is induced and the JNK pathway is subsequently activated, which is involved in the insulin resistance. Increase of ER stress and activation of the JNK pathway interferes with insulin action. In reverse, reduction of ER stress and suppression of the JNK pathway in obese diabetic mice markedly improve insulin resistance and ameliorate glucose tolerance. Taken together, increase of ER stress and subsequent activation of the JNK pathway play a crucial role in the progression of insulin resistance found in diabetes and thus could be a potential therapeutic target for diabetes. These proteins are correctly folded and assembled by chaperones in the ER. During stressful conditions such as upon an increase in the misfolded protein level, the chaperons become overloaded and the ER fails to fold and export newly synthesized proteins, leading to ER stress (Aridor et al, 1999; Harding et al, 1999; Ron et al, 2002; Tirasophon et al, 1998; Wang et al, 1998). Once ER stress is provoked in the cells, various pathways are activated (Figure 1). The pancreatic ER kinase (or PKR-like kinase) (PERK) is an ER transmembrane protein kinase that phosphorylates the ! subunit of translation initiation factor 2 (eIF2!) in response to ER stress, and eIF2! phosphorylation leads to reduction of translation and induction of apoptosis (Shi et al, 1998; Harding et al, 1999; Shi et al, 2003). It is also known that ER stress activates the c-Jun N-terminal kinase (JNK) pathway, leading to induction of apoptosis in various cells (Urano et al, 2000). Furthermore, ER stress is known to trigger X-
I. Involvement of ER stress in insulin resistance Type 2 diabetes is the most prevalent and serious metabolic disease affecting people all over the world. The hallmark of the disease is insulin resistance as well as pancreatic "-cell dysfunction. Under diabetic conditions, various insulin target tissues such as liver, muscle, and fat become less responsive or resistance to insulin. This state is also often linked to other common diseases such as obesity, hyperlipidemia, hypertension, and atherosclerosis. The pathophysiology of insulin resistance involves a complex network of insulin signaling pathways. After insulin binds to insulin receptor on cell surface, insulin receptor and its substrates are phosphorylated, which leads to activation of various insulin signaling pathways. The endoplasmic reticulum (ER) is an organelle which synthesizes various secretory and membrane proteins. 515
Kaneto et al: ER stress and the JNK pathway in insulin resistance box-binding protein-1 (XBP-1) splicing. XBP-1 is a transcription factor that modulates the ER stress response, and its spliced form is a key molecule in ER stress response through transcriptional regulation of various genes including molecular chaperones (Figure 1) (Yoshida et al, 2001; Iwawaki et al, 2003). It was previously reported that ER stress is involved in pancreatic "-cell apoptosis (Figure 2) (Inoue et al, 1998, Harding et al, 2001, 2002; Oyadomari et al, 2001, 2002). Oxygenregulated protein 150 (ORP150), a molecular chaperone found in the ER, has been shown to protect cells from ER stress (Kuwabara et al, 1996; Tamatani et al, 2001). We recently reported that ORP150 overexpression markedly improved insulin resistance and ameliorated glucose tolerance in diabetic animals, indicating that ER stress plays a crucial role in insulin resistance (Figure 2) (Nakatani et al, 2004). To examine whether ER stress is increased in the liver under diabetic conditions, we evaluated the ER stress level in the livers of 10 week-old obese diabetic C57BL/KsJ-db/db mice. Expression levels of KDEL and Bip, both of which are ER stress markers, were much higher in the obese diabetic mice compared to 10 week-old non-diabetic C57BL6 mice, indicating that ER stress is actually increased under diabetic conditions (Figure 2) (Nakatani et al, 2004). It was also reported that expression levels of several ER stress markers are increased in dietary (high-fat diet-induced) and genetic (ob/ob) models of obesity. PERK and eIF2! phosphorylation was increased in the liver of obese mice compared with lean controls. Furthermore, it was recently reported that increase of free
fatty acids, one of the contributory mechanisms for insulin resistance in obesity and type 2 diabetes, causes pancreatic "-cell apoptosis via ER stress (Kharroubi et al, 2004). Taken together, ER stress is induced in various tissues under diabetic conditions. Consistent with earlier observations (Hirosumi et al, 2002), total JNK activity was also dramatically elevated in the obese mice (Ozcan et al, 2004). It was reported that when Fao liver cells were treated with tunicamycin or thapsigargin, agents commonly used to induce ER stress, insulin-stimulated tyrosine phosphorylation of insulin receptor substrate 1 (IRS-1) was significantly decreased. IRS-1 is a substrate for insulin receptor tyrosine kinase, and serine phosphorylation of IRS-1, particularly mediated by JNK, reduces insulin receptor signaling. Indeed, pretreatment of Fao cells with tunicamycin produced a significant increase in serine phosphorylation of IRS-1. Tunicamycin pretreatment also suppressed insulin-induced Akt phosphorylation (Figure 3) (Ozcan et al, 2004). Furthermore, inhibition of JNK activity with the synthetic inhibitor, SP600125, reversed the ER stress-induced serine phosphorylation of IRS-1. Pretreatment of Fao cells with a highly specific inhibitory peptide derived from the JNKbinding protein, JIP, also completely preserved insulin receptor signaling in cells exposed to tunicamycin. Similar results were obtained with the synthetic JNK inhibitor, SP600125. These results indicate that ER stress promotes a JNK-dependent serine phosphorylation of IRS-1, which in turn inhibits insulin receptor signaling (Figure 3) (Ozcan et al, 2004).
Figure 1. ER stress signaling. Once ER stress is induced in the cells, various pathways are activated. Induction of ER stress leads to eIF2! phosphorylation, JNK activation and XBP-1 splicing
516
Gene Therapy and Molecular Biology Vol 8, page 517
Figure 2. Role of ER stress in diabetes. ER stress is induced under diabetes conditions, which is involved in insulin resistance and pancreatic "-cell apoptosis.
Figure 3. ER stress and the JNK pathway in insulin resistance. The JNK pathway is activated under diabetic cinditions, which increases insulin resistance and worsens glucose tolerance
To examine a role of ER stress in insulin resistance in vivo, we prepared sense ORP150 expressing adenovirus (Ad-S-ORP), and a GFP expressing control adenovirus (Ad-GFP), and delivered each adenovirus to 8 week-old C57BL/KsJ-db/db obese diabetic mice from the cervical vein. We confirmed an increase in ORP150 expression in the liver upon adenovirus injection, but not in other tissues such as muscle and adipose tissue. In addition, expression levels of KDEL and Bip in Ad-S-ORP-treated mice were lower compared to those in Ad-GFP treated db/db mice, indicating that ORP150 is actually acting to decrease ER stress in the liver. There was no difference in body weight and food intake between Ad-S-ORP-treated- and Ad-GFP-
treated-db/db mice. When C57BL/KsJ-db/db mice were treated with Ad-S-ORP, nonfasting blood glucose levels were markedly reduced, whereas no such effects were observed in Ad-GFP-treated mice. Fasting blood glucose concentrations were also significantly lower in Ad-SORP-treated mice compared to Ad-GFP-treated mice. To examine the effects of ORP150 overexpression in the liver on insulin resistance, we performed the intraperitoneal insulin tolerance test (IPITT). The hypoglycemic response to insulin was larger in Ad-S-ORP-treated C57BL/KsJdb/db mice compared to Ad-GFP-treated mice. To investigate this point further, we performed the euglycemic hyperinsulinemic clamp test. The GIR of Ad-
517
Kaneto et al: ER stress and the JNK pathway in insulin resistance S-ORP-treated mice were significantly higher compared to Ad-GFP-treated mice, indicating that ORP150 overexpression in the liver reduces insulin resistance and thus ameliorates glucose tolerance in C57BL/KsJ-db/db mice. We also evaluated endogenous hepatic glucose production (HGP) in Ad-S-ORP-treated mice using tracer methods. HGP was significantly lower in Ad-S-ORPtreated mice compared to Ad-GFP-treated mice. These results indicate that the reduction of insulin resistance and amelioration of glucose tolerance by Ad-S-ORP overexpression are mainly due to the suppression of HGP (Figure 3) (Nakatani et al, 2004). Similarly, to examine the effects of antisense ORP150 expression in the liver on insulin sensitivity and glucose tolerance in non-diabetic animals, we prepared an antisense ORP150 expressing adenovirus (Ad-AS-ORP) and delivered each adenovirus to 8 week-old C57BL6 mice. The intraperitoneal glucose tolerance test (IPGTT) revealed that glucose tolerance is markedly worsened upon antisense ORP150 expression. Furthermore, in the euglycemic hyperinsulinemic clamp study, glucose infusion rate (GIR) of Ad-AS-ORP-treated C57BL6 mice were significantly lower compared to Ad-GFP-treated mice, indicating that ER stress in the liver reduces insulin sensitivity in C57BL6 mice. Furthermore, we evaluated HGP in Ad-AS-ORP-treated mice using tracer methods. HGP in Ad-AS-ORP-treated mice was significantly greater compared to Ad-GFP-treated mice. These results indicate that antisense ORP150 expression decreases insulin sensitivity at least in part by increasing HGP in non-diabetic mice (Nakatani et al, 2004). To examine the molecular mechanisms involved in the alteration of insulin action by ER stress in our experiments, we evaluated the phosphorylation state of IRS-1 and Akt in the liver, which are key molecules for insulin signaling. IRS-1 tyrosine phosphorylation was markedly increased in Ad-S-ORP-treated C57BL/KsJdb/db mice compared to Ad-GFP-treated mice. Concomitantly, an increase in Akt serine 473 phosphorylation was observed in Ad-S-ORP-treated C57BL/KsJ-db/db mice compared to Ad-GFP-treated mice (Figure 3). We next examined the expression levels of the key gluconeogenic enzymes phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (G6Pase), both of which are known to be regulated by insulin signaling. Both the expression of PEPCK and G6Pase was markedly decreased by Ad-S-ORP treatment in C57BL/KsJ-db/db mice. These results indicate that reduction of ER stress enhances insulin signaling which leads to a decrease in gluconeogenesis and amelioration of glucose tolerance (Nakatani et al, 2004). Taken together, sense ORP150 overexpression decreased insulin resistance and markedly improved glycemic control in diabetic model animals, and in contrast antisense ORP150 expression induced insulin resistance in nondiabetic control mice, indicating that ER stress plays a crucial role in the insulin resistance found in diabetes (Figures 2, 3). Furthermore, it was reported that mice deficient in XBP-1, a transcription factor that modulates the ER stress response, develop insulin resistance. The spliced form of XBP-1 is a key molecule in ER stress response through
transcriptional regulation of various genes including molecular chaperones (Figure 1). In mouse embryo fibroblasts (MEFs) derived from XBP-1–/– mice, tunicamycin treatment resulted in increase of PERK phosphorylation. In these cells, there was also a rapid and robust activation of JNK in response to ER stress. When spliced XBP-1 expression was induced, there was a dramatic reduction in both PERK phosphorylation and JNK activation after tunicamycin treatment, indicating that XBP-1–/– cells are prone to ER stress. Thus, it is likely that alteration in the levels of spliced XBP-1 protein results in alteration in the ER stress responses. Furthermore, tunicamycin-induced IRS-1 serine phosphorylation was significantly reduced in fibroblasts exogenously expressing spliced XBP-1. The extent of IRS-1 tyrosine phosphorylation was significantly higher in cells overexpressing spliced XBP-1. In contrast, IRS-1 serine phosphorylation was strongly induced in XBP-1–/– MEFs compared with XBP-1+/+ controls even at low doses of tunicamycin treatment. After insulin stimulation, the amount of IRS-1 tyrosine phosphorylation was significantly decreased in tunicamycin-treated XBP-1–/– cells compared with tunicamycin-treated wild-type controls (Ozcan et al, 2004). Since complete XBP-1 deficiency results in embryonic lethality, BALB/c-XBP-1+/– mice with a null mutation in one XBP-1 allele were used in order to investigate the role of XBP-1 in insulin resistance and diabetes in vivo. XBP-1+/– mice treated with high fat diet developed continuous and progressive hyperinsulinemia. Blood glucose levels were also increased in the XBP-1+/– mice treated with high fat diet. During insulin tolerance test, the hypoglycemic response to insulin was also significantly lower in XBP-1+/– mice compared with XBP1+/+ littermates (Ozcan et al, 2004). PERK phosphorylation was increased in the liver of obese XBP-1+/– mice compared with wild-type controls treated with high fat diet. There was also a significant increase in JNK activity in XBP-1+/– mice compared with wild type controls. Consistently, Ser307 phosphorylation of IRS-1 was increased in XBP-1+/– mice compared with wild-type controls. There was no detectable difference in any of the insulin receptor signaling components in liver and adipose tissues between genotypes taking regular diet. However, after treatment with high fat diet, major components of insulin receptor signaling in the liver, including IRS-1 tyrosine- and Akt serine-phosphorylation, were decreased in XBP-1+/– mice compared with wild type controls. A similar suppression of insulin receptor signaling was also evident in the adipose tissues of XBP-1+/– mice compared with XBP-1+/+ mice (Ozcan et al, 2004). Taken together, induction of ER stress or reduction in the compensatory capacity through down-regulation of XBP-1 leads to suppression of insulin receptor signaling in intact cells via IRE-1!-dependent activation of the JNK pathway. Experiments with mouse models also yielded data consistent with the link between ER stress and systemic insulin action. Deletion of an XBP-1 allele in mice leads to enhanced ER stress, activation of the JNK pathway, reduced insulin receptor signaling, systemic insulin resistance, and type 2 diabetes. Therefore, ER stress is
518
Gene Therapy and Molecular Biology Vol 8, page 519 involved in progression of insulin resistance and thus could be a potential therapeutic target for diabetes (Figures 2, 3).
together, these findings suggest that suppression of the JNK pathway in the liver exerts greatly beneficial effects on insulin resistance status and glucose tolerance in both genetic and dietary models of diabetes (Figure 3) (Nakatani et al, 2004). It has been also reported recently that JNK activity is abnormally elevated in the liver, muscle and adipose tissues in obese type 2 diabetic mouse models and that insulin resistance is substantially reduced in mice homozygous for a targeted mutation in the JNK1 gene (JNK-KO mice) (Hirosumi et al, 2002). When the JNKKO mice were placed on a high-fat / high-caloric diet, obese wild type mice developed mild hyperglycemia compared to lean wild type control mice. In contrast, blood glucose levels in obese JNK-KO mice was significantly lower compared to those in obese wild type mice. In addition, serum insulin levels in obese JNK-KO mice were significantly lower compared to those in obese wild type mice. IPITT showed that hypoglycemic response to insulin in obese wild type mice was lower compared to that in obese JNK-KO mice. Also, IPGTT revealed a higher degree of hyperglycemia in obese wild type mice than in obese JNK-KO mice (Hirosumi et al, 2002). These results indicate that the JNK-KO mice are protected from the development of dietary obesity-induced insulin resistance. Furthermore, targeted mutations in JNK were introduced in genetically obese mice (ob/ob). Blood glucose levels in ob/ob-JNK-KO mice were lower compared to those in ob/ob wild type mice, and the ob/ob wild type mice displayed a severe and progressive hyperinsulinemia. Thus, JNK deficiency can provide partial resistance against obesity, hyperglycemia and hyperinsulinemia in both genetic and dietary models of diabetes. Taken together, obese type 2 diabetes is associated with activation of the JNK pathway, and the absence of JNK results in substantial protection from obesity-induced insulin resistance. These results strongly suggest that activation of the JNK pathway plays a crucial role in progression of insulin resistance found in type 2 diabetes (Figure 3). Furthermore, activation of the JNK pathway is involved in pancreatic "-cell dysfunction as well as insulin resistance. Indeed, it was reported that activation of the JNK pathway leads to reduction of insulin gene expression and that suppression of the JNK pathway can protect "cells from oxidative stress and some of the toxic effects of hyperglycemia (Kaneto et al, 2002; Kawamori et al, 2003). When isolated rat islets were exposed to oxidative stress, JNK, p38 MAPK, and PKC pathways were activated, preceding the decrease of insulin gene expression. Adenovirus-mediated overexpression of DN-JNK, but not the p38 MAPK inhibitor SB203580 nor the PKC inhibitor GF109203X, protected insulin gene expression and secretion from oxidative stress. Moreover, wild type (WT) JNK overexpression suppressed both insulin gene expression and secretion (Kaneto et al, 2002). These results were correlated with changes in the binding of the important transcription factor PDX-1 to the insulin promoter; adenoviral overexpression of DN-JNK preserved PDX-1 DNA binding activity in the face of oxidative stress, while WT-JNK overexpression decreased
II. Involvement of the JNK pathway in insulin resistance The JNK pathway (Hibi et al, 1993; Derijard et al, 1994; Davis et al, 2000; Chang et al, 2001) is known to be activated by ER stress (Urano et al, 2000) and thus is possibly involved in the progression of insulin resistance. We have recently examined the effects of modulation of the JNK pathway in the liver on insulin resistance and glucose tolerance (Nakatani et al, 2004). Overexpression of dominant-negative type (DN) JNK in the liver of obese diabetic mice dramatically improved insulin resistance and markedly decreased blood glucose levels. When C57BL/KsJ-db/db mice were treated with Ad-DN-JNK, nonfasting blood glucose levels were markedly reduced, whereas no such effect was observed in Ad-GFP-treated mice. IPITT, the hypoglycemic response to insulin was larger in Ad-DN-JNK-treated C57BL/KsJ-db/db mice compared to Ad-GFP-treated mice. To investigate this point further, we performed the euglycemic hyperinsulinemic clamp test. GIR in Ad-DN-JNK-treated mice was higher than that in Ad-GFP-treated mice, indicating that suppression of the JNK pathway in the liver reduces insulin resistance and thus ameliorates glucose tolerance in C57BL/KsJ-db/db mice. Furthermore, HGP was significantly lower in Ad-DN-JNK-treated mice. In contrast, there was no difference in the glucose disappearance rate (Rd) between these two groups. These results indicate that reduction of insulin resistance and amelioration of glucose tolerance by DN-JNK overexpression are mainly due to suppression of HGP (Figure 3) (Nakatani et al, 2004). It has been reported that serine phosphorylation of IRS-1 inhibits insulin-stimulated tyrosine phosphorylation of IRS-1, leading to an increase in insulin resistance (Aguirre et al, 2000). IRS-1 serine 307 phosphorylation was markedly decreased in Ad-DN-JNK-treated mice. We also found an increase in IRS-1 tyrosine phosphorylation in Ad-DN-JNK-treated mice compared to control mice. Reduction of Akt serine 473 phosphorylation was observed in Ad-DN-JNK-treated C57BL/KsJ-db/db mice (Nakatani et al. 2004). Therefore, an increase in IRS-1 serine phosphorylation may be closely associated with the development of insulin resistance induced by JNK overexpression (Figure 3). Next, we examined the expression levels of the key gluconeogenic enzymes, PEPCK and glucose-6-phosphatase (G6Pase), both of which are known to be regulated by insulin signaling. Expression levels of both enzymes were markedly decreased by Ad-DN-JNK treatment in C57BL/KsJ-db/db mice (Nakatani et al, 2004). These results indicate that suppression of the JNK pathway enhances insulin signaling which leads to a decrease in gluconeogenesis and amelioration of glucose tolerance. Similar effects were observed in high-fat / high-sucrose diet-induced diabetic mice. Conversely, expression of wild type JNK in the liver of normal mice decreased insulin sensitivity. Taken
519
Kaneto et al: ER stress and the JNK pathway in insulin resistance PDX-1 DNA binding activity. Thus, it is likely that JNKmediated suppression of PDX-1 DNA binding activity accounts for some of the suppression of insulin gene transcription and of "-cell function, which fits with the phenomenon that PDX-1 expression DNA binding activity is decreased in association with reduction of insulin gene transcription after chronic exposure to a high glucose concentration. Thus, it is likely that activation of JNK pathway leads to decreased PDX-1 activity and subsequent suppression of insulin gene transcription in the diabetic state (Kaneto et al, 2002). To examine whether DN-JNK can protect "-cells from the toxic effects of hyperglycemia and to explore the potential therapeutic application for islet transplantation, we performed islet transplantation into diabetic mice. Isolated rat islets were infected with Ad-DN-JNK or AdGFP and cultured for 2 days; then 500 islets were transplantated under kidney capsules of STZ-induced diabetic Swiss nude mice. Blood glucose levels were not sufficiently decreased by transplantation of islets infected with Ad-GFP, which was probably due to toxic effects of hyperglycemia upon a marginal islet number, but were markedly decreased by Ad-DN-JNK. Four weeks after transplantation of islets infected with Ad-GFP, insulin mRNA levels in islet grafts were clearly decreased compared with those before transplantation, but relatively preserved by DN-JNK overexpression (Kaneto et al, 2002). These results suggest that DN-JNK can protect "cells from some of the toxic effects of hyperglycemia during this transplant period, providing new insights into the mechanism through which oxidative stress suppresses insulin gene transcription in "-cells.
acid carrier peptide derived from the HIV-TAT sequence (GRK KRR QRR R); then to monitor peptide delivery, this JIP-1-HIV-TAT peptide was further conjugated with fluorescein isothiocyanate (FITC). First, to examine the effectiveness of the JNK inhibitory peptide in vivo, C57BL/KsJ-db/db obese diabetic mice were injected intraperitoneally with the JIP-1-HIV-TAT-FITC peptide. The FITC-conjugated peptide showed fluorescence signals in insulin target organs (liver, fat, muscle) and in insulin secreting tissue (pancreatic islets). Next, we examined whether the JNK pathway is inhibited after the treatment with JIP-1-HIV-TAT-FITC. In various tissues (liver, fat, and muscle), the JNK activity was actually suppressed by JIP-1-HIV-TAT-FITC in a dose-dependent manner (Kaneto et al, 2004). To investigate whether suppression of the JNK pathway exerts beneficial effects on diabetes, we treated C57BL/KsJ-db/db mice with the intraperitoneal injection of the JNK inhibitory peptide, JIP-1-HIV-TAT-FITC. There was no difference in body weight and food intake between the JIP-1-HIV-TAT-FITC-treated and untreated mice. Glucose tolerance test performed showed that glucose tolerance in JIP-1-HIV-TAT-FITC-treated mice was significantly ameliorated compared to untreated or the scramble peptide-treated mice. These data indicate that the JNK pathway is involved in the exacerbation of diabetes and that suppression of the JNK pathway could be a therapeutic target for diabetes (Kaneto et al, 2004). To investigate the possible effects of the JNK inhibitory peptide on insulin action, we performed insulin tolerance test. Reduction of blood glucose levels in response to injected insulin was much larger in JIP-HIV-TAT-FITCtreated mice compared to untreated mice, indicating that the peptide treatment improves the insulin sensitivity. To further investigate the effect of the peptide on insulin resistance, we performed the euglycemic hyperinsulinemic clamp test. The steady-state GIR in JIP-1-HIV-TATFITC-treated mice was significantly higher than that in untreated mice, indicating that JIP-1-HIV-TAT-FITC reduces insulin resistance in C57BL/KsJ-db/db mice (Kaneto et al, 2004). Furthermore, we evaluated endogenous HGP and glucose Rd in the JNK inhibitory peptide-treated mice. It is noted that Rd reflects glucose utilization in the peripheral tissues. HGP in JIP-1-HIVTAT-FITC-treated mice was significantly lower than that in untreated mice. In addition, Rd in JIP-1-HIV-TATFITC-treated mice was significantly higher than that in untreated mice (Kaneto et al, 2004). These results indicate that JIP-1-HIV-TAT-FITC treatment reduces insulin resistance through decreasing HGP and increasing Rd. These data provide strong evidence that JNK is indeed a crucial component of the biochemical pathway responsible for insulin resistance in vivo. Furthermore, IRS-1 serine 307 phosphorylation was decreased in JIP-1-HIV-TATFITC-treated mice compared to control mice. We also found the increase of IRS-1 tyrosine phosphorylation in the peptide-treated mice compared to control mice. Concomitantly, increase of Akt serine 473 and threonine 308 phosphorylation both of which are known to be important for activation of the Akt pathway was observed in JIP-1-HIV-TAT-FITC-treated mice (Kaneto et al,
III. The JNK pathway as a therapeutic target for diabetes Protein transduction domains (PTDs) such as the small PTD from the TAT protein of human immunodeficiency virus (HIV-1), the VP22 protein of Herpes simplex virus, and the third !-helix of the homeodomain of Antennapedia, a Drosophila transcription factor, are known to allow various proteins and peptides to be efficiently delivered into cells through the plasma membrane, and thus there has been increasing interest in their potential usefulness for the delivery of bioactive proteins and peptides into cells (Elliott et al, 1997; Frankel et al, 1988; Nagahara et al, 1998; Schwarze et al, 1999; Rothbard et al, 2000;Noguchi et al, 2003, 2004). We have recently evaluated the potential usefulness of a JNK inhibitory peptide in the treatment of type 2 diabetes and found that the cell permeable JNK inhibitory peptide (amino acid sequence: GRK KRR QRR RPP RPK RPT TLN LFP QVP RSQ DT) is very effective. This peptide is derived from the JNK binding domain of JNK-interacting protein-1 (JIP-1), also known as islet-brain-1 (IB-1), and has been reported to function as a dominant inhibitor of the JNK pathway (Bonny et al, 2001). To convert the minimal JNK-binding domain into a bioactive cellpermeable compound, a 20-amino acid sequence derived from the JNK-binding domain of JIP-1 (RPK RPT TLN LFP QVP RSQ DT) was covalently linked to a 10-amino
520
Gene Therapy and Molecular Biology Vol 8, page 521 Harding HP, Zhang Y and Ron D (1999) Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 397, 271-274. Hibi M, Lin A and Karin M (1993) Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-Jun activation domain. Genes Dev 7, 2135-2148. Hirosumi J, Tuncman G, Chang L, Karin M and Hotamisligil GS (2002) A central role for JNK in obesity and insulin resistance. Nature 420, 333-336. Inoue H, Tanizawa Y, Wasson J, Behn P, Kalidas K, BernalMizrachi E, Mueckler M, Marshall H, Donis-Keller H, Crock P, Rogers D, Mikuni M, Kumashiro H, Higashi K, Sobue G, Oka Y and Permutt MA (1998) A gene encoding a transmembrane protein is mutated in patients with diabetes mellitus and optic atrophy (Wolfram syndrome). Nature Genet 20, 143-148. Iwawaki T, Akai R, Kohno K, Miura M (2004) A transgenic mouse model for monitoring endoplasmic reticulum stress. Nature Med 10, 98-102 Kaneto H, Nakatani Y, Miyatsuka T, Kawamori D, Matsuoka T, Matsuhisa M, Kajimoto Y, Ichijo H, Yamasaki Y and Hori M (2004) Possible novel therapy for diabetes with cellpermeable JNK inhibitory peptide. Nature Med 10, 11281132. Kaneto H, Xu G, Fujii N, Kim S, Bonner-Weir S and Weir GC (2002) Involvement of c-Jun N-terminal kinase in oxidative stress-mediated suppression of insulin gene expression. J Biol Chem 277, 30010-30018. Kawamori D, Kajimoto Y, Kaneto H, Umayahara Y, Fujitani Y, Miyatsuka T, Watada H, Leibiger IB, Yamasaki Y and Hori M (2003) Oxidative stress induces nucleo-cytoplasmic translocation of pancreatic transcription factor PDX-1 through activation of c-Jun N-terminal kinase. Diabetes 52, 2896-2904. Kharroubi I, Ladriere L, Cardozo AK, Dogusan Z, Cnop M, Eizirik DL (2004) Free fatty acids and cytokines induce pancreatic "-cell apoptosis by different mechanisms: role of nuclear factor-#B and endoplasmic reticulum stress. Endocrinology. 145, 5087-96. Kuwabara K, Matsumoto M, Ikeda J, Hori O, Ogawa S, Maeda Y, Kitagawa K, Imuta N, Kinoshita T, Stern DM, Yanagi H and Kamada T (1996) Purification and characterization of a novel stress protein, the 150-kDa oxygen-regulated protein (ORP150), from cultured rat astrocytes and its expression in ischemic mouse brain. J Biol Chem 271, 5025-5032. Nagahara H, Vocero-Akbani AM, Snyder EL, Ho A, Latham D.G, Lissy NA, Becker-Hapak M, Ezhevsky SA and Dowdy SF (1998) Transduction of full-length TAT fusion proteins into mammalian cells:TAT-p-27Kip1 induces cell migration. Nature Med 4, 1449-1452. Nakatani Y, Kaneto H, Kawamori D, Hatazaki M, Miyatsuka T, Matsuoka T, Kajimoto Y, Matsuhisa M, Yamasaki Y and Hori M (2004) Modulation of the JNK pathway in liver affects insulin resistance status. J Biol Chem 279, 4580345809. Nakatani Y, Kaneto H, Kawamori D, Yoshiuchi K, Hatazaki M, Matsuoka T, Ozawa K, Ogawa T, Hori M, Yamasaki Y and Matsuhisa M (2004) Involvement of ER stress in insulin resistance and diabetes. J Biol Chem (in press). Noguchi H, Kaneto H, Weir GC and Bonner-Weir S (2003) PDX-1 protein containing its own Antennapedia-like protein transduction domain can transduce pancreatic duct and islet cells. Diabetes 52, 1732-1737. Noguchi H, Matsushita M, Okitsu T, Moriwaki A, Tomizawa K, Kang S, Li ST, Kobayashi N, Matsumoto S, Tanaka K, Tanaka N and Matsui H (2004) A new cell-permeable
2004). In addition, to examine the effect of JIP-1-HIVTAT-FITC treatment on insulin biosynthesis, we measured insulin mRNA level and content in pancreata of C57BL/KsJ-db/db mice which had been treated with the peptide. Insulin mRNA level and insulin content were significantly higher in the peptide-treated mice. Thus, we assume that the JNK inhibitory peptide exerted some beneficial effects on the pancreatic islets (Kaneto et al, 2004). Taken together, the cell-permeable JNK inhibitory peptide, JIP-1-HIV-TAT-FITC, improves insulin resistance and ameliorates glucose intolerance, indicating the critical involvement of the JNK pathway in diabetes and the usefulness of the cell-permeable JNK inhibitory peptide as a novel therapeutic agent for diabetes.
IV. Conclusion Under diabetic conditions ER stress is induced and the JNK pathway is subsequently activated, which is involved in the insulin resistance. Increase of ER stress and activation of the JNK pathway interfere with insulin action. In reverse, reduction of ER stress and suppression of the JNK pathway in obese diabetic mice markedly improve insulin resistance and ameliorate glucose tolerance. Taken together, increase of ER stress and subsequent activation of the JNK pathway play a crucial role in the progression of insulin resistance found in diabetes and thus could be a potential therapeutic target for diabetes.
References Aguirre V, Davis R and White MF (2000) The c-Jun NH2terminal kinase promotes insulin resistance during association with insulin receptor substrate-1 and phosphorylation of Ser307. J Biol Chem 275, 9047-9054. Aridor M and Balch WE (1999) Integration of endoplasmic reticulum signaling in health and disease. Nature Med 5, 745-751. Bonny C, Oberson A, Negri S, Sause C and Schorderet DF (2001) Cell-permeable peptide inhibitors of JNK: novel blockers of "-cell death. Diabetes 50, 77-82. Chang L and Karin M (2001) Mammalian MAP kinase signalling cascades. Nature 410, 37-40. Davis RJ (2000) Signal transduction by the JNK group of MAP kinases. Cell 103, 239-252. Derijard B, Hibi M, Wu IH, Barrett T, Su B, Deng T, Karin M and Davis RJ (1994) JNK1: a protein kianse stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 76, 1025-1037. Elliott G and Oâ&#x20AC;&#x2122;Hare P (1997) Intracellular trafficking and protein delivery by a herpesvirus structure protein. Cell 88, 223-233. Frankel AD and Pabo CO (1988) Cellular uptake of the tat protein from human immunodeficiency virus. Cell 55, 11891193. Harding HP and Ron D (2002) Endoplasmic reticulum stress and the development of diabetes: a review. Diabetes 51, S455461. Harding HP, Zeng H, Zhang Y, Jungries R, Chung P, Plesken H, Sabatini DD and Ron D (2001) Diabetes mellitus and exocrine pancreatic dysfunction in perk-/- mice reveals a role for translational control in secretory cell survival. Mol Cell 7, 1153-1163.
521
Kaneto et al: ER stress and the JNK pathway in insulin resistance peptide allows successful allogeneic islet transplantation in mice. Nature Med 10. 305-309. Oyadomari S, Koizumi A, Takeda K, Gotoh T, Akira S, Araki E and Mori M (2002) Targeted disruption of the Chop gene delays endoplasmic reticulum stress-mediated diabetes. J Clin Invest 109, 525-532. Oyadomari S, Takeda K, Takiguchi M, Gotoh T, Matsumoto M, Wada I, Akira S, Araki E and Mori M (2001) Nitric oxideinduced apoptosis in pancreatic beta cells is mediated by the endoplasmic reticulum stress pathway. Proc Natl Acad Sci USA 98, 10845-10850. Ozcan U, Cao Q, Yilmaz E, Lee AH, Iwakoshi NN, Ozdelen E, Tuncman G, Gorgun C, Glimcher LH and Hotamisligil GS (2004) Endoplasmic reticulum stress links obesity, insulin action and type 2 diabetes. Science 306: 457-461. Ron D (2002) Translational control in the endoplasmic reticulum stress response. J Clin Invest 110, 1383-1388. Rothbard JB, Garlington S, Lin Q, Kirschberg T, Kreider E, McGrane PL, Wender PA and Khavari PA (2000) Conjugation of arginine oligomers to cyclosporin A facilitates topical delivery and inhibition of inflammation. Nature Med 6, 1253-1257. Schwarze SR, Ho A, Vocero-Akbani AM and Dowdy SF (1999) In vivo protein transduction: delivery of a biologically active protein into the mouse. Science 285, 1569-1572. Shi Y, Taylor SI, Tan S.-L and Sonenberg N (2003) When Translation Meets Metabolism: Multiple Links to Diabetes. Endocr Rev 24, 91-101. Shi Y, Vattem KM, Sood R, An J, Liang J, Stramm L and Wek RC (1998) Identification and Characterization of Pancreatic Eukaryotic Initiation Factor 2!-Subunit Kinase, PEK, Involved in Translational Control. Mol Cell Biol 18, 74997509. Tamatani M, Matsuyama T, Yamaguchi A, Mitsuda N, Tsukamoto Y, Taniguchi M, Che YH, Ozawa K, Hori O, Nishimura H, Yamashita A, Okabe M, Yanagi H, Stern DM, Ogawa S and Tohyama M (2001) ORP150 protects against
hypoxia/ischemia-induced neuronal death. Nature Med 7, 317-323. Tirasophon W, Welihinda AA and Kaufman RJ (1998) A stress response pathway from the endoplasmic reticulum to the nucleus requires a novel bifunctional protein kinase/endoribonuclease (Ire1p) in mammalian cells. Genes Dev 12, 1812-1824. Urano F, Wang X, Bertolotti A, Zhang Y, Chung P, Harding HP and Ron D (2000) Coupling of Stress in the ER to Activation of JNK Protein Kinases by Transmembrane Protein Kinase IRE1. Science 287, 664-666. Wang XZ, Harding HP, Zhang Y, Jolicoeur EM, Kuroda M and Ron D (1998) Cloning of mammalian Ire1 reveals diversity in the ER stress responses. EMBO J 17, 5708-5717. Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K (2001) XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107, 881-91.
Hideaki Kaneto
522
Gene Therapy and Molecular Biology Vol 8, page 523 Gene Ther Mol Biol Vol 8, 523-538, 2004
Molecular insight into human heparanase and tumour progression Review Article
Erich Rajkovic, Angelika Rek, Elmar Krieger and Andreas J Kungl* Institute of Pharmaceutical Sciences, Proteinchemistry- and Biophysics-Group, Karl-Franzens-University of Graz
__________________________________________________________________________________ *Correspondence: Andreas J Kungl, PhD, Institute of Pharmaceutical Sciences, Proteinchemistry- and Biophyiscs-Group, Universitaetsplatz 1, A-8010 Graz, Austria; Tel: + 43 316 380 5373; Fax: + 43 316 382 541; Email: andreas.kungl@uni-graz.at Key words: human heparanase, angiogenesis, tumour progression, metastasis, angiogenic factors, molecular modeling Abbreviations: basic fibroblast growth factor, (bFGF); chinese hamster ovary, (CHO); complex extracellular matrix, (ECM); connective-tissue-activating peptide III, (CTAP III); endothelial cells, (ECs); glycosaminoglycan, (GAG); heparan sulfate proteoglycans, (HSPGs); heparan sulfate, (HS); human heparanase 1, (Hpa 1); human heparanase 2, (Hpa2); matrix metalloproteinase, (MMP); plateletderived growth factor, (PDGF); transforming growth factor- !, (TGF-!); tumour necrosis factor-", (TNF-"); vascular endothelial growth factor, (VEGF) Received: 13 December 2004; Accepted: 10 January 2005; electronically published: January 2005
Summary The human heparanase is a key enzyme in tumour vascularisation and metastasis. Here we review the current molecular knowledge on this protein and present a model of its active domain. response associated with many pathological phenomena (e.g. cancer metastasis, Kaposi`s sarcoma, rheumatoid arthritis, psoriasis) probably involves both the continuous release of potent angiogenic signals, as well as downregulation or even the removal of natural antiangiogenic effectors. Angiogenesis takes place in a structurally heterogenous and complex extracellular matrix (ECM) environment and is therefore strongly influenced by the ECM organisation and composition. Remodelling of the extracellular matrix in terms of modulating endothelial and vascular cell behaviours (Kalluri, 2003) is a major prerequisite for the growth (formation) of new blood vessels. This involves an initial breakdown of the subendothelial basement membrane, an amorphous, dense, sheet-like structure, which is 50 to 100 nm thick (Kalluri, 2003), as well as the turn over of the intercellular matrix components during new vessel outgrowth. These modifications, which obviously necessitate a finely controlled interplay of proteinases and proteinase inhibitors, remove physical barriers (e.g. basement membrane, ECM macromolecules) and prepare states that may stimulate endothelial cell migration (Iozzo and San Antonio, 2001; Cleaver and Melton, 2003) (Figure 1). The series of tissue-cell-matrix interactions of all invasive cell types is generally divided into three phases (Stetler-Stevenson, 1993): (i) modification of cell-cell contacts and establishing new cell-matrix contacts (Sasisekharan et al, 2002; Sanderson, 2001); (ii) proteolytic modification of the ECM that removes barriers,
I. Introduction A. Angiogenesis-A key event in tumour progression from its cellular aspects Angiogenesis or neovascularization is denoted as the process of the formation of new capillaries and vessels from preexisting blood vessels during the development as well as during the maintenance of all organ systems. This is in clear contrast to arteriogenesis or vasculogenesis, which is characterised by the assembly of new vessels from endothelial precursor cells. On the one hand angiogenesis is known to occur in selected physiological processes during the development of the vasculature, e.g. ovulation or wound healing, but on the other hand it also plays a significant role in pathophysiology, for example by mediating the vascularization of tumours. In both cases it is a very tightly regulated and complex cascade of multiple interrelating processes involving endothelial cell activation and migration, proliferation, extracellular proteolysis, multicellular organisation and differentiation including final branching and stabilisation (Nicosia and Madri, 1987; Buschmann and Schaper, 1999; Jain 1999). A delicate balance between positive angiogenic stimuli and endogenous inhibitors (Folkman, 1995) has to exist since observations of new ("de novo") blood vessel formation initiated in vivo by a local application of an exogenous angiogenesis factor, showed abnormal rapid involution due to the discontinuation of the angiogenic stimulus (interruption of the exogenous factor) (Liotta et al, 1991; Benett and Stetler-Stevenson, 2001). Thus, the angiogenic 523
Rajkovic et al: Molecular insight into human heparanase and tumour progression restructures cell-matrix contacts, and prepares the matrix to facilitate cell movement (Sharma et al, 1998; Iozzo and San Antonio, 2001); (iii) migration of the invasive cell through the proteolysed matrix to establish new matrix contacts (Carmeliet and Jain, 2000). This cycle is repeated until the new blood vessel is fully developed (Seftor et al, 1992; Ray and Stetler-Stevenson, 1994).
protein part determines the localisation of the proteoglycan in the cell membrane or in the ECM, the GAG component mediates the broad functional interactions with a great variety of ligands (Guimond et al, 1993; Walker and Gallagher, 1996). GAGs are complex, linear polysaccharides consisting of a disaccharide repeat unit of glucosamine linked to either an iduronic or a glucuronic acid. Further modification of the individual backbone introduces additional structural complexity. The variations can occur at the 2-O position of the uronic acid and the 6-O and 3-O positions of the glucosamine. The N-position can either be sulphated or acetylated but can also stay unmodified (Sasisekharan et al, 2002). The polysaccharide chains are flexible in a certain way, but cannot fold up into the compact globular structures that polypeptide chains typically form. Moreover, they are highly negatively charged and strongly hydrophilic. Thus GAGs tend to adopt extended conformations that occupy a huge volume and enable cellcell-interactions over extensive regions inside of tissues. On the basis of their structural composition GAG chains are classified into different groups, i.e. heparan sulfate (HS)/heparin, keratan sulfate, chondroitin sulfate and some more (Esko and Lindahl, 2001). Most important for angiogenesis are heparan sulfate proteoglycans (HSPGs) as they are predominantly found on cell surfaces and in the ECM. Particular sulfation patterns in their GAG
B. Proteoglycans-Bridging macromolecules in cell-cell communication and cell-growth The enormous heterogeneity of the extracellular matrix is probably one of its most important properties and therefore responsible for its functional diversity in relationship to angiogenesis (Mecham, 1998). Some components are designed to be rigid (e.g. collagens), others elastic (e.g. elastin); some wet, others sticky. These diverse modular designs impart diverse roles, yet allow for highly specialized functions. Beside collagen-proteins, which are designed to provide structure and resilience to tissues, and the microfibrillar proteins like elastin and fibrillin, that ensure the structural integrity and function of tissues in which reversible extensibility or deformability are crucial, proteoglycans complete the complexity of the ECM. Proteoglycans - found in most mammalian cells and tissues - are composed of glycosaminoglycan (GAG) chains covalently linked to a core protein. While the
524
Gene Therapy and Molecular Biology Vol 8, page 525
Figure 1. A rough scheme of angiogenesis (I) and tumour metastasis (II) (I) (A) Most tumours start growing as nodules provided with nutrients by diffusion processes until they reach a steady-state size of proliferating and apoptosing cells. Massive tumour growth however necessitates the process of angiogenesis. In the first steps, pericytes detach from the vessel, the blood vessel dilates to a limited extent (B) before the basement membrane and the extracellular matrix undergo degradative and structural changes as a result of the release of matrix metalloproteinases (MMPs) and growth factors. The growth factors, for example vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), and platelet-derived growth factor (PDGF) are released from the basement membrane, but also produced by tumour cells, fibroblasts and immune cells. This induces the endothelial cells to emigrate into the intercellular space towards the angiogenic stimuli triggered by the tumour-nodule. (C) The endothelial cells proliferate and start forming the sprout into a new blood vessel, which is guided and supported by pericyte-cells. At the same time new intermediate basement membranes are built up. (D) Finally, the endothelial cells adhere tightly to each other to strengthen the new lumen, the intermediate basement membrane matures and pericytes attach again to the blood vessel (not shown in the picture). Thus the new blood vessel is in working order and is integrated in the circulatory system by flooding. The blood-vessel formation will continue as long as the tumour grows and the hypoxic and necrotic areas of the tumour are provided with essential nutrients and oxygen. (II) (E) The metastasis of tumour cells starts with the destruction of heparan sulfate rich basement membrane by the release of heparanase into the microenvironment of the tumour. This is the prerequisite for the tumour cells for invading the underlying extra cellular space towards the endothelial cells. The extracellular matrix is degraded and heparan sulfate chains are presented on cell surfaces. The resulting fragments of the heparan sulfate chains activate growth and motility factors in the surrounding area of the tumour. (F) Prior to "invasion", the entry of tumour cells in the blood vessel, the basement membrane has to be fully disrupted and in addition the tight junctions between the endothelial cells have to be loosened. (G) Finally the tumour cells pass into the blood vessel and are transported by the blood-system through the whole organism.
chains allow interactions with a series of bioactive molecules, such as growth factors, chemokines, morphogenes, lipoproteins and enzymes. These interactions are mainly driven by electrostatic forces of the HS-sulfate groups with the basic amino acids, like lysine, arginine or histidine of the protein counterpart. Van-derWaals- and hydrophobic forces may also affect the process of ligand binding to a significant extent (Thompson et al, 1994).
Among the signalling molecules which influence normal and pathologic processes like tissue repair, neurite outgrowth, inflammation and autoimmunity, there are growth factors including fibroblast growth factor 1 and 2 (FGF1 and 2), vascular endothelial growth factor (VEGF), transforming growth factor-! (TGF-!) and other factors, which have not been identified yet (Sasisekharan and Venkataraman, 2000; Turnbull et al, 2001), that are important for tumour development and angiogenesis. 525
Rajkovic et al: Molecular insight into human heparanase and tumour progression Binding to HS can modulate a tethered molecule's biological activity or protect it from proteolytic cleavage and inactivation. Due to the multifaceted roles of HSPGs in cell physiology, their cleavage is likely to alter the integrity and functional state of tissues and to provide a mechanism by which cells can respond rapidly to changes in the extracellular environment. It is a fact that cancer cells, as part of the transformation process, do not only alter their HSPGs profile, including differential expression of particular proteoglycan protein-core sequences, as well as alter the heparan sulfate glycosaminoglycan fine structure of given proteoglycans, but also change their protein expression levels. Thus higher amounts of angiogenic differentiation and development factors (Burnfield et al, 1999; Tumova et al, 2000; Esko and Lindahl, 2001) are available and increased enzymatic degradation of such HSPGs plays a crucial role at the beginning stages of angiogenesis. Invading cells, particularly metastatic tumour cells and leukocytes, traverse ECM barriers and basement membranes by liberating masses of degradative enzymes. A large number of proteases (e.g. matrix metalloproteinases, serine, cysteine and aspartatic protease families) have been described that can disassemble the extracellular matrix (Vlodavsky et al, 1999; Parish et al, 2001). However, for efficient degradation of the extracellular environment, a cooperative action of proteases and HSPG cleaving enzymes is indispensable. The crucial enzyme for HS degradation is the human heparanase.
(Hoogewerf et al, 1995). Further findings of a full length rat heparanase cDNA and a partial mouse heparanase (Miao et al 2002) cDNA sequence in combination with reported amino acid sequences in rat and chicken (Goldshmidt et al 2001; Podyma-Inoue et al, 2002; Kizaki et al, 2003) indicate that all these proteins are highly conserved, as confirmed by 80 % identity in the amino acid sequence between the human and murine protein and nearly 93 % identity between mouse and rat sequences (Hulett et al, 1999). The 214 amino acids encoding cDNA fragment of bovine heparanase is to 82 % identical with the human heparanase. Only recently a human cDNA fragment encoding a novel human protein, namely human heparanase 2 (Hpa 2), with significant homology to heparanase was cloned (McKenzie et al, 2000). However, differences in expression profiles, predicted cellular locations and tissue distributions suggest that human heparanase 1 (Hpa 1) and Hpa2 may somehow be related but clearly exhibit distinct biological functions and represent members of two dissimilar mammalian heparanase families (McKenzie et al, 2000). In addition, some more heparanases (C1A, C1B, C2A, C2B) of different molecular weights have been partially purified from chinese hamster ovary cells (CHO cells) and have been preliminarily characterised (Bame et al 1998; Bame, 2001). Despite the existence of several heparanases the hypothesis of multiple enzymes with similar biological function has never really been established. More likely is the assumption of the Hpa1 enzyme being unique and being the only transcript used by invading cells to degrade heparan sulfate proteoglycans. In summary, its molecular characteristics are described as follows. The complete human heparanase cDNA contains 1629 bp and encircles an open reading frame that encodes a polypeptide of 543 amino acids with a calculated molecular weight of 61,2 kDa which appears as a ~65 kDa band in the SDS-PAGE analysis.
II. Human heparanaseâ&#x20AC;&#x201C;Molecular biology and structure A. Genetic organisation of the human heparanase The cloning of only one single human heparanase cDNA sequence was independently published by several groups, resulting in an identical sequence being obtained from a human placental cDNA library and a human T- cell lymphoma cell line (Hulett et al, 1999; Kussie et al, 1999; Toyoshima and Nakajima, 1999; Vlodavsky et al, 1999). The human gene of the heparanase-enzyme is located on the chromosome 4q21.3, contains 50 kilo base pairs and encircles 14 exons and 13 introns. As a consequence of alternative splicing the gene-information may either be translated as 2,0 kb or as 4,4 kb mRNA (Hulett et al, 1999). While the 50 kb species contains 14 exons and 13 introns, the 1,7 kb form is created with the first and fourteenth exon remaining untranslated. Nonetheless both transcripts contain the same open reading frame, producing the single heparanase enzyme, which is also abbreviated as Hpa1 (Dong et al, 2000; Parish et al, 2001). Early, rather controversial, developments determined heparanase activity for several proteins ranging from 8 kDa, over 50 kDa up to 134 kDa in molecular mass (Oosta et al, 1982; Freeman and Parish, 1998). There have also been claims that the enzyme is a heat shock protein (Graham et al, 1994) or might even be related to the CXC chemokine, !-thromboglobuline, also known as connective-tissue-activating peptide III (CTAP III)
B. Protein heparanase
function
of
the
human
Discussing the features of the heparanase at protein level will give insights into the specific mechanism of its biological function. The hydropathic profile (Vlodavsky et al, 1998) of the heparanase protein indicates a hydrophobic region at the N-terminus (Met1 to Ala35) which is assumed to function as signal peptide for secretion. Conversely, the chicken heparanase signal peptide which spans 19 amino acids and which shows only 39 % homology (Goldshmidt et al, 2001) to the human analogue, ensures that the chicken enzyme is readily secreted. These findings suggest that human heparanase is primarily localised in perinuclear acidic endosomal and lysosomal cellular granules before it is secreted/ translocated to the extracellular space (Mollinedo et al, 1997; Bame, 2001; Goldshmidt et al, 2001). The Cterminus is a highly conserved and hydrophobic stretch ranging from Pro 515 to Ile 543. One could argue that this part defines the putative transmembrane domain or a GPI anchor which could be responsible for the enzyme's retention on the cell surfaces (Bartlett et al, 1995; Hulett et 526
Gene Therapy and Molecular Biology Vol 8, page 527 Ala35) (Figure 2). This pro-form undergoes further proteolytic processing which is likely occur within the hydrophilic region at two potential cleavage sites, Glu 109 to Ser110 and Gln157 to Lys158, yielding an 8 kDa polypeptide at the N-terminus and a 50 kDa polypeptide at the Cterminus. Subsequent complexation of the two obtained subunits finally forms the active, mature heparanase protein and an intervening 6 kDa linker peptide (Ser110 to Gln157) (Fairbanks et al, 1999; Parish et al, 2001; Vlodavsky et al, 2001; Levy-Adam et al, 2003; Nardella et al, 2004). Additionally, the region Glu288 â&#x20AC;&#x201C; Lys417 in the 50 kDa large fragment is believed to facilitate the physical association to the 8 kDa subunit (Levy-Adam et al, 2003). Assumptions that the active heparanase enzyme is a noncovalently linked heterodimer were confirmed by several cloning- and expression attempts in mammalian systems and insect cells showing that neither the 8 kDa nor the 50 kDa fragment on their own were able to digest substrate (Vlodavsky et al, 1999; McKenzie et al, 2003). Additional attempts to obtain active protein by reconstituting the small and large units after expressing them separately failed, proposing that active folding needs
al, 1999; Parish et al, 2001). Further prediction of a hydrophilic region between the amino acids 110 and 170 indicates that this fragment is exposed at the protein's surface and therefore accessible for proteases (Vlodavsky et al, 1999). The active form of the human heparanase has long been thought to be a 50 kDa polypeptide, isolated and purified from various tissues. However, several attempts to obtain heparanase activity after expression of the 50 kDa subunit in insect cells as well as in mammalian systems (Vlodavsky et al, 1999; McKenzie et al, 2003) failed, suggesting that the N-terminal part including an 8 kDa fragment is important for enzymatic activity. More likely is that the isolated 50 kDa fragment represents a processed form of the native, full-length 65 kDa heparanase (Freeman and Parish, 1998; Toyoshima and Nakajima, 1999) as it always appears together with the 8 kDa peptide when analysing the purified enzyme on a SDS-PAGE gel. This observation supports the hypothesis that the 65 kDa full length protein represents the immature, inactive enzyme, which is subsequently called pro-heparanase (Gln36 to Ile543) originating from a pre-pro-form (Met1 to Ile543) after removal of the putative signal peptide (Met1 to
Figure 2 . The processing of the human heparanase. A scheme of the predicted domain structure of the human heparanase and the processing procedure towards the active form of the enzyme: the non covalent association of the 8 kDa and 50 kDa subunit after the processing of an intervening 6 kDa propeptide. The pre-proheparanase is believed to be translated, first, and is subsequently processed by removal of the propeptide (from amino acid 110 to 157) and by the removal of the signal peptide at the N-terminus of the protein from the residue 1 to 35. Final cleavage results in the 8 kDa subunit from Gln36 to Glu109 and the 50 kDa subunit from Lys158 to Ile543. The six putative N-linked glycosylation sites (N 162, N 178, N 200, N 217, N 238, N 459) are located on the large subunit, from which five cluster in the first 80 amino acids, and the putative catalytic proton donor on Glu225 and proton acceptor on Glu343.
527
Rajkovic et al: Molecular insight into human heparanase and tumour progression amino acid residues, the putative proton donor Glu225 and the putative proton acceptor (nucleophile) Glu343. Conserved basic residues are found in proximity to the proposed catalytic proton donor (KK residues 231 and 232) and nucleophile (KK residues 337 and 338) responsible for additional, adhesive interactions with GAGs, i.e. HS (Hulett et al, 2000). The heparan sulfate glycosaminoglycans are cleaved by the enzyme at only a few sites, creating fragments of 10 to 20 sugar units. This observation confirms the thesis that the heparanase enzyme recognizes particular and quite rare heparan sulfate motifs (Freeman and Parish, 1998; Pikas et al, 1998). On the one hand, it has been shown that a 6-Osulfate group on a glucosamine residue, located two monosaccharide units away from the cleavage site at its non-reducing end, and a 2-sulfated glucosamine-structure on the reducing side are essential for substrate recognition (Figure 3). Substrate cleavage, on the other hand, was found to require a hexuronic carboxyl group (Bai et al, 1997; Vlodavsky and Friedmann, 2001; Okada et al, 2002) and heparan sulfate comprising unsubstituted glucosamine residues is not processed (Parish et al, 1999; Dempsey et al, 2000). Structurally related heparin, however, has a high inhibitory effect on the enzyme's activity (Bar-Ner et al, 1987; Vlodavsky et al, 1994) due to the predominant existence of the [IdoUA(2-OSO3)-GlcNSO3(6-OSO3)-]n repeat structure. In contrast to the proposed endolytic cleavage mechanism, it has recently been postulated that human heparanase can also cleave defined oligosaccharide structures in an exolytic action (Gong et al, 2003). Thus the precise localisation of sulfation patterns and the sequences of heparan sulfate residues required for recognition as well as for subsequent cleavage are yet uncertain.
a cellular environment. In contrast co-expressed 8 kDa and 50 kDa polypeptides showed high levels of activity. Also notable is the fact that insect expression of the unprocessed 65 kDa precursor form produced little or no active enzyme, respectively, concluding that the mammalian cell facilities are needed to process the human heparanase to its active heterodimer (McKenzie et al, 2003). The involvement of one or even several proteases for this activation-degradation process is highly likely but yet not confirmed as so far they have not been isolated. Deglycosylation of the sugar-residues attached to the six putative N-glycosylation sites, five of which cluster within the first 80 amino acids of the 50 kDa mature protein, had no detectable effect on the enzymatic activity (Vlodavsky et al, 1999). Nevertheless they seem to be responsible for proper translocation and secretion of the enzyme (Simizu et al, 2004).
C. Regulation of the human heparanase expression Due to the fact that inadvertent cleavage and modeling of heparan sulfate causes potential tissue damage, it is obvious that the expression of the heparanase enzyme has to be tightly regulated. However, very little is known about factors influencing its expression and activity in normal and in malignant cells. Inflammatory cytokines, endothelial cells, leukocytes, tumour necrosis factor " (TNF ") are known to enhance the expression-levels (Bartlett et al, 1995; Parish et al, 1998). Latest experiments showed effects of fatty acids, especially oleic acid on the activation of the Sp1 binding site, which is located 192 to 201 bp upstream from the initial ATG codon (Cheng et al, 2004) of the heparanase coding sequence. In the context of breast cancer, putative estrogen response elements in the regulatory sequence of the heparanase gene were identified. Estrogen- induced mRNA transcription could be demonstrated in estrogenreceptor positive, but not in estrogen-receptor negative breast cancer cells, confirming this finding (Elkin et al, 2003).
IV. Human heparanase â&#x20AC;&#x201C; Involvement in physiological and patho-physiological processes and its inhibition A. Physiology Most studies particularly underline the involvement of the heparanase enzyme in pathophysiology with a strong leaning towards cancer. Although only little is known about the enzyme`s contribution to normal cell and tissue function it is strongly suggested that the heparanase plays a crucial role in embryo implantation, which involves invasive cell immigration and interaction between HS-binding proteins (i.e. growth factors) and heparan sulfate proteoglycans in order to ensure normal development (Selleck, 1999; Dempsey et al, 2000; Reiland et al, 2004). In many facets the embryonic cell migration, proliferation and differentiation is similar to its involvement in tumour metastasis, angiogenesis and inflammation. There have been lines of transgenic mice generated which ubiquitously overexpress the human heparanase (Zcharia et al, 2004). Biochemical analysis of isolated heparan sulfate oligosaccharides of transgenic mice revealed a decrease in the size of the HS chains compared to HS from control mice. This is interpreted as an enhanced heparanase cleavage activity in almost every tissue (Zcharia et al, 2004).
D. Putative substrate recognition sites for the human heparanase Characterising the heparanase interaction with its natural glycosaminoglycan substrates, the human heparanase, which constitutes a !-endoglucuronidase, cleaves glycosidic bonds with a hydrolase mechanism and is thus distinct from bacterial heparinases which depolymerise heparin and heparan sulfate by eliminative cleavage generating unsaturated bonds. Secondary structure predictions suggest that the heparanase enzyme consists of a ("/!)8-TIM-barrel architecture. This fold is frequently observed in glycosylases and is also proposed for this protein. As the 50 kDa subunit on its own forms 6 "/! units, the missing structural elements have to be completed by the 8 kDa polypeptide, showing a predicted secondary structure of a !/"/! element (Nardella et al, 2004), thereby generating the native fold. The heparanase exhibits the common catalytic mechanism typical for the family of glycosylhydrolases, involving two conserved
528
Gene Therapy and Molecular Biology Vol 8, page 529
Figure 3. Substrate of the human heparanase (A) The lower part of this figure encircles schematically the localisation and role of heparan sulfate proteoglycans in vascularisation and metastasis. HSPGs are predominantly found on cell surfaces and everywhere in the extracellular-matrix. With their core-proteins they are anchored in the cell membrane. The number and composition of the covalently linked heparan sulfate chains varies enormously depending on the tissue and cell functions, respectively, and the state of cell differentiation - different heparan sulfate expression patterns. Particular the sulfation patterns in the carbohydrate-chains allow interactions with a series of bioactive molecules (e.g. growth factors). Heparanase secreted by the surrounding tumour cells is responsible for the degradation of this heparan sulfate chains and for the release of tethered molecules by cleaving at certain sites. (B) The upper part of this figure summerizes the structural characteristics of the minimal human heparanase cleavage site, known so far. It is composed of the trisaccharide sequence between the brackets and occurs quite rarely in HS chains. The arrow indicates the glucuronidic bond cleaved by the heparanase. Highly sulfated structures seem to be essential for the enzymes activity. The N-sulfation on the reducing side, the 6-O-sulfation of the glucosamine on the non reducing side, both indicated in green, and the carboxy-group (hold in red font) on the glucuronic-acid seem to be essential for the enzyme's activity. The additional 2-N-sulfate group on the nonreducing GlcN and the 6-O-sulfate group on the reducing GlcN both have a promoting effect on the heparanase activity (magenta colored). The function of the 3-O-sulfate group in blue remains controversial. In principle it is thought to inhibit the enzyme, but it may also have a promoting effect due to its negative charge.
529
Rajkovic et al: Molecular insight into human heparanase and tumour progression Although the mice appeared normal, fertile, and exhibited a normal life span, pregnant transgenic mice had a significant increase in the number of implanted embryos compared with control mice. There also was a higher miscarriage and embryonic lethality confirming the necessity of normal HS structures during embrionic growth and morphogenesis (Lin et al, 2000; Zcharia et al, 2004). Because of less intact HS, thereby also affecting the basement membrane structure, the kidney function was insufficient. Elevated levels of proteins were found in the urine, indicating that heparanase is able to disrupt the filtration barrier as well as to have an impact on the reabsorption function of the kidneys (Weinstein et al, 1992; Levidiotis et al, 2001; Katz et al, 2002; Zcharia et al, 2004). The mammary glands of virgin transgenic mice showed similar development and maturation to the ones of normal mice at day 12 of pregnancy. An even more pronounced development was observed when those transgenic mice became pregnant, most probably due to heparanase-induced overbranching, hyperplasia and widening of ducts (Zcharia et al, 2004). Furthermore, the heparanase overexpressing mice showed accelerated hair growth by enhancing the vascularization and maturation of the hair follicle (Yano et al, 2001; Zcharia et al, 2004). Upon aging the expression levels of the heparanase become negligibly low. In an adult organism the enzyme only appears during wound repair (Vlodavsky and Friedmann, 2001), fracture repair (Saijo et al, 2003), tissue regeneration (Dempsey et al, 2000), and immune surveillance (Zcharia et al, 2001). In addition, following vascular injury, it is believed that heparanase, probably secreted from infiltrating and extravasating leukocytes, degrades heparan sulfate to induce smooth muscle cell proliferation, which is normally inhibited by the intact HS chains (Campbell et al, 1992; Francis et al 2003).
breast cancer (Maxhimer et al, 2002), oral cancer, oesophageal cancer (Ikuta et al, 2001), pancreatic cancer (Koliopanos et al, 2001; Kim et al, 2002; Rohloff et al, 2002), brain cancer (Marchetti et al, 2001), endometrial cancer (Watanabe et al, 2003) and acute myeloid leukemia (Bitan et al, 2002; Vlodavsky et al, 2002; Sanderson et al, 2004). Moreover, the expression of the human heparanase correlates with the metastatic potential of human tumour cells. Since this is also the case for other extracellular matrix degrading enzymes, i.e. for the group of matrix metalloproteinases (MMPs) - the feature of inducing angiogenesis in addition to the initiation of cell invasion becomes more obvious (Hulett et al, 1999; Parish et al, 2001; Goldshmidt et al, 2002; Takaoka et al, 2003; Watanabe et al, 2003). Together with the degradation of ECM components (collagens, laminins, fibronectin, vitronectin etc) a continuous cleavage of heparan sulfate proteoglycans by the human heparanase is fulfilled. This process increases the bioavailability and activity of growth factors and other bioactive molecules, which have been tethered and inactivated by binding to heparan sulfate structures, and promotes the migration and proliferation of endothelial cells (ECs) to form vascular sprouts. Heparanase has also been implicated in the degradation of subendothelial basement membrane by leucocytes (Naparstek et al, 1984; Parish et al, 2001). During chronic inflammation leukocytes enter and accumulate in inflammatory areas by the continous extravasation through the blood vessel wall. Several in vitro studies have confirmed this assumption (Vlodavsky et al, 1992; Bartlett et al, 1995; Parish et al, 1998; Hulett et al, 1999). Both tumour masses and inflammatory sites provide the acidic environment which human heparanase requires for degradation of heparan sulfate structures. The enzyme has its maximal endoglycosidase activity between pH 5,0 and 6,0 (more precisely from pH 5,6 to 5,8) and is inactivated at pH greater than 8,0. Under physiological conditions (pH 7,4) heparanase binds heparan sulfate but does not degrade its substrate. This is in accordance with the findings that inactive recombinant heparanase enzyme still binds to HS molecules without subsequent degradation and therefore enables the adhesion of cells (Goldshmidt et al, 2003).
B. Pathophysiology With regard to the specific structural interaction of HSPGs with various extracellular matrix and basement membrane macromolecules, they play a key role in selfassembly, modeling and insolubility of ECM components, as well as cell adhesion, harvesting and locomotion (Kjellen and Lindahl, 1991; Iozzo, 1998; Vlodavsky et al 1999). Cleavage of the HS sidechains by HS-degrading enzymes, such as heparanase, therefore results in disassembly of the extracellular matrix and in the permeability of the underlying basement membranes, occurring as a crucial triggering process in the extravasation of blood borne cells (Parish et al, 1987; Vlodavsky et al, 1992, 1994; Nakajima et al, 1988; Parish et al, 1999). Immunohistochemical investigations revealed that the heparanase enzyme appeared primarily in neutrophils, macrophages, platelets, keratinocytes, capillary endothelium and neurons, but very seldom in normal epithelia. While the expression levels of the enzyme in normal tissues are very low and its incidence is restricted to the placenta and to lymphoid organs, elevated levels of heparanase were observed in tumour bearing animals and cancer patients suffering for example from bladder cancer (Gohji et al, 2001), colon cancer (Friedmann et al, 2000), gastric cancer (Tang et al, 2002),
C. Inhibition The knowledge of heparanase biological function collected so far, is sufficient for its consideration as a promising target for cancer therapy. Great efforts are being made in order to develop a potent inhibitor, and sulfated polysaccharides, like heparin, dextran sulfate, xylan sulfate, fucoidan, carageenan-gamma and laminaran sulfate, which have primarily anticoagulant activity, are already known to be effective inhibitors of tumour metastasis. Their inhibitory effect in experimental metastasis is more related to their ability to inhibit the heparanase enzyme than to their anticoagulant properties (Parish et al, 1987; Nakajima et al, 1988; Vlodavsky et al, 1994; Miao et al, 1999; Parish et al, 1999). In addition, other polyanionic molecules, such as phosphomannopentaose sulfate (PI-88) and maltohexaose sulfate, have proven to be as potent as heparin concerning the inhibition of heparanase activity (IC50 ~ 1 â&#x20AC;&#x201C; 2 Âľg/ml), 530
Gene Therapy and Molecular Biology Vol 8, page 531 confirming the assumption that the oligosaccharide chain length and the degree of sulfation are more important than sugar composition and type of linkage (N- or O-sulfated) (Vlodavsky et al, 1994, 2001; Lapierre et al, 1996; Parish et al, 1999). PI-88 has successfully passed through the preclinical studies as its application confirmed the inhibition of tumour growth and tumour angiogenesis. It is currently being tested on cancer patients in a Phase II clinical trial (Parish et al 1999). Furthermore, in a parallel study, by screening 10000 culture broths of microorganisms (actinomycetes, fungi and bacteria), a specific actinomycete-strain (RK99-A234) emerged for the reason of compensating heparanase enzyme activity. The responsible neutralizing interaction partner was identified as RK-682 (IC50 ~ 17ÂľM), already known to inhibit protein tyrosine phosphatases (Hamaguchi et al, 1995; Ishida et al, 2004). Using RK-682 as a lead compound structure a more selective heparanase inhibitor was designed, namely 4-Benzyl-RK-682 (Ishida et al, 2004). Finally, Suramin (IC50 < 10ÂľM in vitro), a polysulfonated naphthylurea, and Trachyspic acid (IC50 ~ 50ÂľM), isolated from Talaromyces trachyspermus, have to be mentioned in order to complete the short enumeration of potent heparanase inhibitors known so far. The inhibitory mechanisms of both are as yet unknown, although the structure of Trachyspic acid is similar to 4Benzyl-RK-682 concluding that both of the substances bind and block as mimic substrates the heparanase's cleavage site (Nakajima et al, 1991; Shiozawa et al, 1995; Hirai et al, 2002).
IV. Biophysical conclusions
remarks
Besides, the definition of the heparanase specific substrate turned out to be difficult, because most of the HS molecules purified from diverse tissues have already been cleaved and the unprocessed oligosaccharide chain could not be reconstructed. In some cases heparin has been used, but because it is highly modified, it does not fullfill the domain structure of heparan sulfate (Oosta et al, 1982; Lyon and Gallagher, 1998). Despite difficulties in the beginning, major progress in the development of different heparanase activity assays could be reported in the last few years. Radioactive- (35S) and fluorescence- (FITC) labeled HS substrates were used to detect the size-shift of the degraded glycosaminoglycan to smaller fragments upon incubation with active heparanase. The thus obtained cleavage products were finally analysed by gel filtration chromatography (Toyoshima and Nakajima, 1999; Vlodavsky et al, 1999). These assays are highly sensitive but not suitable for screening large amounts of substrate samples. In addition the handling of the single separated steps of the reaction procedure as well as the detection were quite laborious but nevertheless were accepted. When it came to attempts to searching for an inhibitor, however, a simple and efficient heparanase assay method became absolutely indispensable in order to guarantee a promising high throughput analysis. This approach became possible by forming polyacrylamide tablets containing defined amounts of HS stained with Alcian blue. The colour density of the tablets correlates with the HS concentration and is quantified. After adding active heparanase, degraded fragments are excluded out of the tablets which results in a decrease of the colour density, a process which can easily be visually detected (Ishida et al, 2004). Another assay method is described on the principle of ultrafiltration. Based on limited cleavage sites of HS chains, the degradation of radioactively labeled glycosaminoglycans with approximately 30 kDa molecular size results in products ranging from 7 to 10 kDa is exploited. A subsequent separation of the cleaved fragments is performed by using a special molecular weight cutoff, which exhibits minimal permeability to the undigested HS, while permitting maximum permeability to the digested products which can then be detected by radioactive scintillation counting (Nakajima et al, 1988; Tsuchida et al 2004). Several reasons retarded the research progress for the human heparanase, among which the already well characterised growth factors with a great potential for interference in angiogenesis and the lack of a powerful enzymatic assay played a decisive role. In addition, the protein is not very abundant in vivo and therefore getting enough material to purify adequate amounts of enzyme for characterisation is still a challenge. Beside the very small amounts of protein, another difficulty is related to the unstable nature of the heparanase. Several attempts to purify human heparanase or heparanase subunits from diverse tissues to homogeneity resulted in the loss of enzymatic activity. The cloning of the full length cDNA and of the two subunits in diverse expression systems (mammalian cells or insect cells) is reported by various groups (Hulett et al, 1999; Vlodavsky et al, 1999; Elkin et
and
A. Development of heparanase activity assays described in the literature Although the human heparanase and its role in regulating proteoglycan function in angiogenesis have been known for many years, the enzyme as a potential pharmaceutical target has not yet received as much attention as other angiogenetic factors, like for example FGF and VEGF. The main starting point for interfering in non physiological angiogenic processes has so far been the synthesis of specific heparan sulfate glycosaminoglycan sequences with high affinity for growth factor binding, thereby silencing downstream signalling in angiogenesis. One reason for the lack of interest in designing a heparanase inhibitor is mainly determined by initial major difficulties in the establishment of an assay that could easily monitor enzyme activity by following the degradation of its HS substrate, unlike bacterial lyases which cleave HS- or heparin chains by an elimination mechanism, a reaction that can be detected spectroscopically as unsaturated products are generated (Linhardt et al, 1986). The human as well as the mammalian heparanases in general constitute hydrolases cleaving without double bond formation. Thus more sophisticated assays for activity determination had to be developed in order to facilitate heparanase purification from tissues for subsequent protein characterisation. 531
Rajkovic et al: Molecular insight into human heparanase and tumour progression al, 2001; Nardella et al, 2004) and delivers sufficient amounts of active heparanase but exact details concerning the nature of the active complex, formed by the respective subunits after posttranslational processing are so far unknown.
kDa polypeptide on their own showed cleavage activity when being incubated with HS. But the reconstitution of both subunits in crude lysates led to an active recombinant human heparanase, which can now be exactly characterised with regard to its biophysical properties. For the further development of structure and substrate specific inhibitors it is absolutely essential to resolve the 3 dimensional structure of the active heterodimer with and without ligands. As this project may turn out to be time consuming regarding the size and the difficult handling of the protein we will further support this aim of structure determination by performing biophysical techniques to study the molecular properties of the human heparanase. In addition we have performed a more theoretical approach to mimic the possible structure of the human heparanase in vivo, namely the molecular modeling. BLAST (NCBI tools) searches with the full length amino acid sequence of the human protein resulted in a few significant sequences. The mouse-, rat- and chickenheparanase show high similarity to the human sequence. Less similar to the query are two putative proteins from Arabidopsis thaliana, with as yet unknown functions. Some further proteins of glycosyl hydrolases from bacteria have been found, but these similarities seem to be rather unreliable. Although secondary predictions (Hulett et al, 2000; Nardella et al, 2004; and our findings) result in an alternating "/! series, similar to the ("/!) TIM barrel protein fold, “swiss-model”, or “SDSC1” - programmes on the expasy homepage for protein structure homology modeling - and some others could not design a three dimensional structure of the human protein (“sorry, no suitable template for modeling could be found”). With the knowledge of the identified active residues (E225 and E343) and putative basic amino acids near to these sites we started to calculate a possible structure for the human heparanase (Figure 4).
B. Novel aspects in the molecular characterisation of the human heparanase The design of specific inhibitors seems to make only slow progress. With the exception of PI-88 which is currently being tested in phase II clinical trials in Australia, there are no other heparanase inhibitors in clinical studies to our knowledge. Furthermore, a multitude of existing inhibiting molecules, like suramin, are not suitable for in vivo experiments because of severe side effects and toxicity (Parish et al, 2001). Added to this, the mechanisms of inhibition are yet unknown or cannot precisely be correlated with heparanase action, as for example PI-88 also shows high binding affinities to growth factors, like FGF-1, FGF-2 and VEGF (Cochran et al, 2003). In the literature, no paper describes a structure based design of heparanase inhibitors and the protein itself remains a structurally uncharacterised enzyme. In addition nearly no published article investigates the structure of human heparanase or its biophysical properties. Encouraged by this gap in heparanase characterisation and in order to provide information for structure based drug design, a method which has been successfully applied for other proteins, we decided to produce this enzyme in our labs using a different cloning strategy to that reported so far. We cloned the respective subunits, 8 kDa and the 50 kDa, known to form the active heterodimer, separately. Rather laborious efforts were made to purify the two fragments after several purification attempts had failed. But finally, the activity of the enzyme could be tested, as mentioned above, by analysing degraded FITC labeled heparan sulfate. Neither the 8 kDa fragment nor the 50
Figure 4. Molecular Model of the human heparanase Molecular modeling of the 50 kDa subunit of the human heparanase (amino acid residue 158 to 514) without its putative transmembrane domain. Functionally important amino acids are indicated in green: the two acitve sites Glu225 and Glu343, positive loaded amino acids near to the proton donor and acceptor, that can bind heparan sulfate, Lys231, Lys232 and Lys337, Lys338. Sectors of basic amino acid residues from Gln157 to Asn162 and Pro271 to Met278 may also interact in the substrate binding towards the enzymatic active site.
532
Gene Therapy and Molecular Biology Vol 8, page 533 Bernfield M, Gotte M, Park PW, Reizes O, Fitzgerald ML, Lincecum J, and Zako M (1999) Functions of cell surface heparan sulfate proteoglycnas. Annu Rev Biochem 68, 729777. Bitan M, Polliack A, Zecchina G, Nagler A, Friedmann Y, Nadav L, Deutsch V, Pecker I, Eldor A, Vlodavsky I, Katz BZ (2002) Heparanase expression in human leukemias is restricted to acute myeloid leukemias. Exp Hematol 30, 3441 Buschmann I and Schaper W (1999) Arteriogenesis versus Angiogenesis: Two mechanisms of vessel growth. News Physiol Sci 14, 121-125. Campbell JH, Rennick RE, Kalevitch SG, and Campbell GR (1992) Heparan sulfate-degrading enzymes induce modulation of smooth muscle phenotype. Exp Cell Res 200, 156-167. Carmeliet P and Jain RK (2000) Angiogenesis in cancer and other diseases. Nature 407, 249-257. Chen G, Wang D, Vikramadithyan R, Yagyu H, Saxena U, Pillarisetti S, and Goldberg IJ (2004) Inflammatory cytokines and fatty acids regulate endothelial cell heparanase expression. Biochemistry 43, 4971-4977. Chen XP, Liu YB, Rui J, Peng SY, Peng CH, Zhou ZY, Shi LH, Shen HW, and Xu B (2004) Heparanase mRNA expression and point mutation in hepatocellular carcinoma. World J Gastroenterol 10, 2795-2799. Cleaver O and Melton DA (2003) Endothelial signaling during development. Nat Med 9, 661-668. Cochran S, Li C, Fairweather JK, Kett WC, Coombe DR, and Ferro V (2003) Probing the interaction of phosphosulfomannans with angiogenic growth factors by surface plasmon resonance. J Med Chem 46, 4601-4608. Dempsey LA, Brunn GJ, and Platt JL (2000) Heparanase, a potential regulator of cell-matrix interactions. Trends Biochem Sci 25, 349-351. Dong J, Kukula AK, Toyoshima M, and Nakajima M (2000) Genomic organization and chromosome localization of the newly identified human heparanase gene. Gene 253, 171178. Elkin M, Cohen I, Zcharia E, Orgel A, Guatta-Rangini Z, Peretz T, Vlodavsky I, and Kleinman HK (2003) Regulation of heparanase gene expression by estrogen in breast cancer. Cancer Res 63, 8821-8826. Elkin M, Ilan N, Ishai-Michaeli R, Friedmann Y, Papo O, Pecker I, and Vlodavsky I (2001) Heparanase as mediator of angiogenesis: mode of action. FASEB J 15, 1661-1663. Esko JD and Lindahl U (2001) Molecular diversity of heparan sulfate. J Clin Invest 108, 169-173. Fairbanks MB, Mildner AM, Leone JW, Cavey GS, Mathews WR, Drong RF, Slightom JL, Bienkowski MJ, Smith CW, Bannow CA, and Heinrikson RL (1999) Processing of the human heparanase precursor and evidence that the active enzyme is a heterodimer. J Biol Chem 274, 29587-29590. Falsone SF, Kurkela R, Charandini G, Vihko P, and Kungl AJ (2001) Ligand affinity, homodimerization, and ligandinduced secondary structural change of the human vitamin D receptor. Biochem Biophys Res Commun 285, 1180-1185. Falsone SF, Weichel M, Crameri R, Breitenbach M, and Kungl AJ (2002) Unfolding and double-stranded DNA binding of the cold shock protein homologue Cla h 8 from Cladosporium herbarum. J Biol Chem 277, 16512-16516. Folkman J (1995) Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med 1, 27-31. Francis DJ, Parish CR, McGarry M, Santiago FS, Lowe HC, Brown KJ, Bingley JA, Hayward IP, Cowden WB, Campbell
The model should facilitate and illustrate - together with the biophysical characterisation - investigations on intramolecular and molecular effects and interactions of the human heparanase with its surrounding environment.
C. Future perspectives Even if the three dimensional structure of the protein heterodimer is established in the near future by X-ray diffraction or NMR-methods, the biophysical techniques particularly allow studying exactly the dynamics and conformational effects of the human heparanase in context with ligands. With the resulting findings it would be possible to understand better the affinities and activities of this enzyme in its immediate environment, to search for natural compounds which inhibit more efficiently and to design a specific, competitive heparanase-action-inhibitor to establish a new promising cancer therapy.
Acknowledgments This work was supported by OENB Jubil채umsfondsprojekt No 10855 and by the Austrian Science Fund project No P15969.
References Bai X, Bame KJ, Habuchi H, Kimata K, and Esko JD (1997) Turnover of heparan sulfate depends on 2-O-sulfation of uronic acids. J Biol Chem 272, 23172-23179. Baldwin GS, Curtain CC, and Sawyer WH (2001) Selective, high-affinity binding of ferric ions by glycine-extended gastrin(17). Biochemistry 40, 10741-10746. Bame KJ (2001) Heparanases: endoglycosidases that degrade heparan sulfate proteoglycans. Glycobiology 11, 91R-98R. Bame KJ, Hassall A, Sanderson C, Venkatesan I, and Sun C (1998) Partial purification of heparanase activities in chinese hamster ovary cells: evidence for multiple intracellular heparanases. Biochem J 336, 191-200. Bar-Ner M, Eldor A, Wasserman L, Matzner Y, Cohen IR, Fuks Z, and Vlodavsky I (1987) Inhibition of heparanase-mediated degradation of extracellular matrix heparan sulfate by nonanitcoagulant heparin species. Blood 70, 551-557. Bartlett MR, Cowden WB, and Parish CR (1995) Differential effects of the anti-inflammatory compounds heparin, mannose-6-phosphate, and castanospermine on degradation of the vascular basement membrane by leukocytes, endothelial cells, and platelets. J Leukoc Biol 57, 207-213. Bartlett MR, Underwood PA, and Parish CR ( 1995) Comparative analysis of the ability of leucocytes, endothelial cells and platelets to degrade the subendothelial basement membrane: evidence for cytokine dependence and detection of a novel sulfatase. Immunol Cell Biol 73, 113-124. Baud S, Margeat E, Lumbroso S, Paris F, Sultan C, Royer C and Poujol N (2002) Equilibrium binding assays reveal the elevated stoichiometry and salt dependence of the interaction between full-length human sex-determining region on the Y chromosome (SRY) and DNA. J Biol Chem 277, 1840418410. Bennet TA and Stetler-Stevenson WG (2001) Matrix metalloproteinases (matrixins) and their inhibitors (TIMPs) in angiogenesis. In: Tumor Angiogenesis and Microcirculation. Ed by Emile E Voest and Patricia A D`Amore. Marcel Dekker Inc. New York 2001, 29-58.
533
Rajkovic et al: Molecular insight into human heparanase and tumour progression JH, Campbell GR, Chesterman CN, and Khachigian LM (2003) Blockade of vascular smooth muscle cell proliferation and intimal thickening after balloon injury by the sulfated oligosaccharide PI-88. Phosphomannopentaose sulfate directly binds FGF-2, blocks cellular signaling, and inhibits proliferation. Circ Res 92, e70-e77. Freeman C and Parish CR (1998) Human platelet heparanase: purification, characterization and catalytic activity. Biochem J 330, 1341-1350. Friedmann Y, Vlodavsky I, Aingorn H, Aviv A, Peretz T, Pecker I, and Pappo O (2000) Expression of heparanase in normal, dysplastic, and neoplastic human colonic mucosa and stroma. Evidence for its role in colonic tumorigenesis. Am J Pathol 157, 1167-1175. Goger B, Halden Y, Rek A, Mรถsl R, Pye D, Gallagher J, and Kungl AJ (2002) Different affinities of glycosaminoglycan oligosaccharides for monomeric and dimeric interleukin-8: A model for chemokine regulation at inflammatory sites. Biochemistry 41, 1640-1646. Gohji K, Okamoto M, Kitazawa S, Toyoshima M, Dong J, Kasuoka Y, and Nakajima M (2001) Heparanase protein and gene expression in bladder cancer. J Urol 166, 1286-1290. Goldshmidt O, Zcharia E, Abramovitch R, Metzger S, Aingorn H, Friedmann Y, Schirrmacher V, Mitrani E, and Vlodavsky I (2002) Cell surface expression and secretion of heparanase markedly promote tumor angiogenesis and metastasis. Proc Natl Acad Sci 99, 10031-10036. Goldshmidt O, Zcharia E, Aingorn H, Guatta-Rangini Z, Atzmon R, Michal I, Pecker I, Mitrani E, and Vlodavsky I (2001) Expression pattern and secretion of human and chicken heparanase are determined by their signal peptide sequence. J Biol Chem 276, 29178-29187. Goldshmidt O, Zcharia Y, Cohen M, Aingorn H, Cohen I, Nadav L, Katz BZ, Geiger B, and Vlodavsky I (2003) Heparanase mediates cell adhesion independent of its enzymatic activity. FASEB J 17, 1015-1025. Gong F, Jemth P, Escobar Galvis ML, Vlodavsky I, Horner A, Lindahl U, and Li JP (2003) Processing of macromolecular heparin by heparanase. J Biol Chem 278, 35152-35158. Graham LD (1994) Tumor rejection antigens of the hsp90 family (GP96) closely resemble tumour-associated heparanase enzymes. Biochem J 301, 917-918. Guimond S, Maccarana M, Olwin BB, Lindahl U, and Rapraeger AC (1993) Activating and inhibitory heparin sequences for FGF-2 (basic FGF). Distinct requirements for FGF-1, FGF-2, and FGF-4. J Biol Chem 268, 23906-23914. Hamaguchi T, Sudo T, and Osada H (1995) RK-682, a potent inhibitor of tyrosine phosphatase, arrested the mammalian cell cycle progression of G1phase. FEBS Lett 372, 54-58. Harley MJ, Toptygin D, Troxler T, and Schildbach JF (2002) R150A mutant of F TraI relaxase domain: reduced affinity and specificity for single-stranded DNA and altered fluorescence anisotropy of a bound labeled oligonucleotide. Biochemistry 41, 6460-6468. Hirai K, Ooi H, Esumi T, Iwabuchi Y, and Hatakeyama S (2003) Total synthesis of (+/-)-trachyspic acid and determination of the relative configuration. Org lett 5, 857-859. Hoogewerf AJ, Leone JW, Reardon IM, Howe WJ, Asa D, Heinrikson RL and Ledbetter SR (1995) CXC chemokines connective tissue activating peptide-III and neutrophil activating peptide-2 are heparin/heparan sulfate-degrading enzymes. J Biol Chem 270, 3268-3277. Hulett MD, Freeman C, Hamdorf BJ, Baker RT, Harris MJ, and Parish CR (1999) Cloning of mammalian heparanase, an
important enzyme in tumor invasion and metastasis. Nat Med 5, 803-809. Hulett MD, Hornby JR, Ohms SJ, Zuegg J, Freeman C, Gready JE, and Parish CR (2000) Identification of active-site residues of the pro-metastatic endoglycosidase heparanase. Biochemistry 39, 15659-15667. Ikeguchi M, Hirooka Y, and Kaibara N (2003) Heparanase gene expression and its correlation with spontaneous apoptosis in hepatocytes of cirrhotic liver and carcinoma. Eur J Cancer 39, 86-90. Ikuta M, Podyma KA, Maruyama K, Enomoto S, and Yanagishita M (2001) Expression of heparanase in oral cancer cell lines and oral cancer tissues. Oral Oncol 37, 177184. Iozzo RV (1998) Matrix proteoglycans: from molecular design to cellular function. Annu Rev Biochem 67, 609-652. Iozzo RV and San Antonio JD (2001) Heparan sulfate proteoglycans: heavy hitters in the angiogenesis arena. J Clin Invest 108, 349-355. Ishida K, Teruya T, Simizu S, and Osada H (2004) Exploitation of heparanase inhibitors from microbial metabolites using an efficient visual screening system. J Antiobiot 57, 136-142. Jain RK (2003) Molecular regulation of vessel maturation. Nat Med 9, 685-693. Kalluri R (2003) Basement membranes: structure, assembly and role in tumour angiogenesis. Nat Rev Cancer 3, 422-433. Katz A, Van-Dijk DJ, Aingorn H, Erman A, Davies M, Darmon D, Hurvitz H, and Vlodavsky I (2002) Involvement of human heparanase in the pathogenesis of diabetic nephropathy. Isr Med Assoc J 4, 996-1002. Kelly SM and Price NC (1997) The application of circular dichroism to studies of protein folding and unfolding. Biochim Biophys Acta 1338, 161-185. Kelly T, Miao HQ, Yang Y, Navarro E, Kussie P, Huang Y, MacLeod V, Casciano J, Joseph L, Zhan F, Zangari M, Barlogie B, Shaughnessy J, and Sanderson RD (2003) High heparanase activity in multiple myeloma is associated with elevated microvessel density. Cancer Res 63, 8749-8756. Kim AW, Xu X, Hollinger EF, Gattuso P, Godellas CV, and Prinz RA (2002) Human heparanse-1 gene expression in pancreatic andenocarcinoma. J Gastrointest Surg 6, 167172. Kizaki K, Yamada O, Nakano H, Takahashi T, Yamauchi N, Imai K, and Hashizume K (2003) Cloning and localization of heparanase in bovine placenta. Placenta 24, 424-430. Kjellen L and Lindahl U (1991) Proteoglycans: structures and interactions. Annu Rev Biochem 60, 443-475. Koliopanos A, Friess H, Kleeff J, Shi X, Liao Q, Pecker I, Vlodavsky I, Zimmermann A, and Buchler MW (2001) Heparanase expression in primary and metastatic pancreatic cancer. Cancer Res 61, 4655-4659. Kristl S, Zhao S, Knappe B, Sommerville RL, and Kungl AJ (2000) The influence of ATP on binding of aromatic amino acids to the ligand response domain of the tyrosine repressor of Haemophilus influenzae. FEBS Lett 467, 87-90. Kussie PH, Hulmes JD, Ludwig DL, Patel S, Navarro EC, Seddon AP, Giorgio NA, and Bohlen P (1999) Cloning and functional expression of a human heparanase gene. Biochem Biophys Res Comm 261, 183-187. Lapierre F, Holme K, Lam L, Tressler RJ, Storm N, Wee J, Stack RJ, Castellot J, and Tyrrell DJ (1996) Chemical modifications of heparin that diminish its anticoagulant but preserve its heparanase-inhibitory, angiostatic, anti-tumor and anit-metastatic properties. Glycobiology 6, 355-366.
534
Gene Therapy and Molecular Biology Vol 8, page 535 LeTilly V and Royer CA (1993) Fluorescence anisotropy assays implicate protein-protein interactions in regulating trp repressor DNA binding. Biochemistry 32, 7753-7758. Levidiotis V, Kanellis J, Ierino FL, and Power DA (2001) Increased expression of heparanase in puromycin aminonucleoside nephrosis. Kidney Int 60, 1287-1296. Levy-Adam F, Miao HQ, Heinrikson RL, Vlodavsky I, and Ilan N (2003) Heterodimer formation is essential for heparanase enzymatic activity. Biochem Biophys Res Commun 308, 885-891. Lin X, Wei G, Shi Z, Dryer L, Esko JD, Wells DE, and Matzuk MM (2000) Disruption of gastrulation and heparan sulfate biosynthesis in EXT1-deficient mice. Dev Biol 224, 299-311. Linhardt RJ, Galliher PM, and Cooney CL (1986) Polysaccharide lyases. Appl Biochem Biotechnol 12, 135-176. Liotta LA, Steeg PS, and Stetler-Stevenson WG (1991) Cancer metastasis and angiogenesis: an imbalance of positive and negative regulation. Cell 64, 327-336. Lopez MM, Yutani K, and Makhatadze GI (2001) Interactions of the cold shock protein CspB from Bacillus subtilis with single-stranded DNA. Importance of the T base content and position within the template. J Biol Chem 276, 1551115518. Lusti-Narasimhan M, Chollet A, Power CA, Allet B, Proudfoot AE, and Well TN (1996) A molecular switch of chemokine receptor selectivity. Chemical modification of the interleukin-8 Leu25 â&#x20AC;&#x201C;> Cys mutant. J Biol Chem 271, 31483153. Lyon M and Gallagher JT (1998) Bio-specific sequences and domains in heparan sulphate and the regulation of cell growth and adhesion. Matrix Biol 17, 485-493. Manavalan P and Johnson WC Jr (1987) Variable selction method improves the prediction of protein secondary structure from circular dichroism spectra. Anal Biochem 167, 76-85. Marchetti D and Nicolson GL (2001) Human heparanse: a molecular determinant of brain metastasis. Adv Enzyme Regul 41, 343-359. Maxhimer JB, Quiros RM, Stewart R, Dowlatshahi K, Gattuso P, Fan M, Prinz RA, and Xu X (2002) Heparanase-1 expression is associated with metastatic potential of breast cancer. Surgery 132, 326-333. McKenzie E, Tyson K, Stamps A, Smith P, Turner P, Barry R, Hircock M, Patel S, Barry E, Stubberfield C, Terrett J, and Page M (2000) Cloning and expression profiling of Hpa2, a novel mammalian heparanase family member. Biochem Biophys Res Commun 276, 1170-1177. McKenzie E, Young K, Hircock M, Bennett J, Bhaman M, Felix R, Turner P, Stamps A, McMillan D, Saville G, Ng S, Mason S, Snell D, Schofield D, Gong H, Townsend R, Gallagher JT, Page M, Parekh R, and Stubberfield C (2003) Biochemical characterization of the active heterodimer form of human heparanase (Hpa1) protein expressed in insect cells. Biochem J 373, 423-435. Mecham RP (1998) Overview of extracellular matrix. Current Protocols in Cell Biology. John Wiley & Sons, Inc, 10.1.110.1.14. Miao HQ, Elkin M, Aingorn E, Ishai-Michaeli R, Stein CA, and Vlodavsky I (1999) Inhibition of heparanase activity and tumor metastasis by laminarin sulfate and synthetic phosphorothioate oligodeoxynucleotides. Int J Cancer 83, 424-431. Miao HQ, Navarro E, Patel S, Sargent D, Koo H, Wan H, Plata A, Zhou Q, Ludwig D, Bohlen P, and Kussie P (2002)
Cloning, expression, and purification of mouse heparanase. Protein Expr Purif 26, 425-431. Mikami S, Ohashi K, Usui Y, Nemoto T, Katsube K, Yanagishita M, Nakajima M, Nakamura K, and Koike M (2001) Loss of syndecan-1 and increased expression of heparanase in invasive esophageal carcinomas. Jpn J Cancer Res 92, 1062-1073. Mollinedo F, Najajima M, Llorens A, Barbosa E, Callejo S, Gajate C, and Fabra A (1997) Major co-localization of the extracellular-matrix degradative enzymes heparanase and gelatinase in tertiary granules of human neutrophils. Biochem J 327, 917-923. Nakajima M, DeChavigny A, Johnson CE, Hamada J, Stein CA, and Nicolson GL (1991) Suramin. A potent inhibitor of melanoma heparanase and invasion. J Biol Chem 266, 96619666. Nakajima M, Irimura T, and Nicolson GL (1988) Heparanases and tumor metastasis. J Cell Biochem 36, 157-167. Naparstek Y, Cohen IR, Fuks Z, and Vlodavsky I (1984) Activated T lymphocytes produce a matrix-degrading heparan sulphate endoglycosidase. Nature 310, 241-244. Nardella C, Lahm A, Pallaoro M, Brunetti M, Vannini A, and Steinkuhler C (2004) Mechanism of activation of human heparanase investigated by protein engineering. Biochemistry 43, 1862-1873. Nicosia RF and Madri JA (1987) The microvascular extracellular matrix. Developmental changes during angiogenesis in the aortic ringplasma clot model. Am J Pathol 128, 78-90. Nikov GN, Eshete M, Rajnarayanan RV, and Alworth WL (2001) Interactions of synthetic estrogens with human estrogen receptor. J Endocrinol 170, 137-145. Okada Y, Yamada S, Toyoshima M, Dong J, Nakajima M, and Sugahara K (2002) Structural recognition by recombinant human heparanase that plays critical roles in tumor metastasis. Hierarchical sulfate groups with differential effects and the essential target disulfated trisaccharide sequence. J Biol Chem 277, 42488-42495. Oosta GM, Favreau LV, Beeler DL, and Rosenberg RD (1982) Purification and properties of human platelet heparitinase. J Biol Chem 257, 11249-11255. Parish CR, Coombe DR, Jakobsen KB, Bennett FA, and Underwood PA (1987) Evidence that sulphated polysaccharides inhibit tumour metastasis by blocking tumour-cell-derived heparanases. Int J Cancer 40, 511-518. Parish CR, Freeman C, and Hulett MD (2001) Heparanase: a key enzyme involved in cell invasion. Biochim Biophys Acta 1471, M99-M108. Parish CR, Freeman C, Brown KJ, Francis DJ, and Cowden WB (1999) Identification of sulfated oligosaccharide-based inhibitors of tumor growth and metastasis using novel in vitro assays for angiogenesis and heparanase activity. Cancer Res 59, 3433-3441. Parish CR, Hindmarsh EJ, Bartlett MR, Staykova MA, Cowden WB, and Willenborg DO (1998) Treatment of central nervous system inflammation with inhibitors of basement membrane degradation. Immunol Cell Biol 76, 104-113. Parker GJ, Law TL, Lenoch FJ, and Bolger RE (2000) Development of high throughput screening assays using fluorescence polarization: nuclear receptor-ligand-binding and kinase/phosphatase assays. J Biomol Screen 5, 77-88. Perczel A, Park K, and Fasman GD (1992) Analysis of the circular dichroism spectrum of proteins using convex constraint algorithm: a practical guide. Anal Biochem 203; 83-93.
535
Rajkovic et al: Molecular insight into human heparanase and tumour progression Pikas DS, Li JP, Vlodavsky I, and Lindahl U (1998) Substrate specificity of heparanases from human hepatoma and platelets. J Biol Chem 273, 18770-18777. Podyma-Inoue KA, Yokote H, Sakaguchi K, Ikuta M, and Yanagishita M (2002) Characterization of heparanase from a rat parathyroid cell line. J Biol Chem 277, 32459-32465. Ray JM and Stetler-Stevenson WG (1994) The role of matrix metalloproteinases and their inhibitors in tumor invasion, metastasis and angiogensis. Eur Respir J 7, 2062-2072. Reiland J, Sanderson RD, Waguespack M, Barker SA, Long R, Carson DD, and Marchetti D (2004) Heparanase degrades syndecan-1 and perlecan heparan sulfate: functional implications for tumor cell invasion. J Biol Chem 279, 8047-8055. Rek A, Geretti E, Goger B, and Kungl A (2002) The biophysics of chemokine/glycosaminoglycan interactions. Res Devel Biophys Biochem 2, 319-340. Rohloff J, Zinke J, Schoppmeyer K, Tannapfel A, Witzigmann H, Mossner J, Wittekind C, and Caca K (2002) Heparanase expression is a prognostic indicator for postoperative survival in pancreatic adenocarcinoma. Br J Cancer 86, 1270-1275. Saijo M, Kitazawa R, Nakajima M, Kurosaka M, Maeda S, and Kitazawa S (2003) Heparanase mRNA expression during fracture repair in mice. Histochem Cell Biol 120, 493-503. Sanderson RD (2001) Heparan sulfate proteoglycans in invasion and metastasis. Semin Cell Dev Biol 12, 89-98. Sanderson RD, Yang Y, Suva LJ, Kelly T (2004) Heparan sulfate proteoglycans and heparanase--partners in osteolytic tumor growth and metastasis. Matrix Biol 23, 341-52 Sasisekharan R and Venkataraman G (2000) Heparin and heparan sulfate: biosynthesis, structure and function. Curr Opin Chem Biol 4, 626-631. Sasisekharan R, Shriver Z, Venkataraman G, and Narayanasami U (2002) Roles of heparan-sulphate glycosaminoglycans in cancer. Nat Rev Cancer 2, 521-528. Seftor RE, Seftor EA, Gehlsen KR, Stetler-Stevenson WG, Brown PD, Ruoslahti E, and Hendrix MJ (1992) Role of the " v ! 3 integrin in human melanoma cell invasion. Proc Natl Acad Sci USA 89, 1557-1561. Selleck SB (1999) Overgrowth syndromes and the regulation of signaling complexes by proteoglycans. Am J Hum Genet 64, 372-377. Sharma B, Handler M, Eichstetter I, Whitelock JM, Nugent MA, and Iozzo RV (1998) Antisense targeting of perlecan blocks tumor growth and angiogenesis in vivo. J Clin Invest 102, 1599-1608. Shiozawa H, Takahashi M, Takatsu T, Kinoshita T, Tanzawa K, Hosoya T, Furuya K, Takahashi S, Furihata K, and Seto H (1995) Trachyspic acid, a new metabolite produced by Talaromyces trachyspermus, that inhibits tumor cell heparanase: taxonomy of the producing strain, fermentation, isolation, structural elucidation, and biological activity. J Antibiot (Tokyo) 48, 357-362. Simizu S, Ishida K, Wierzba M, and Osada H (2004) Secretion of heparanase protein is regulated by glycosylation in human tumor cell lines. J Biol Chem 279, 2697-2703. Simizu S, Ishida K, Wierzba MK, Sato TA, and Osada H (2003) Expression of heparanase in human tumor cell lines and human head and neck tumors. Cancer Lett 193, 83-89. Sreerama N and Woody RW (1994) Protein secondary structure form circular dichorism spectroscopy. Combining variable selection principle and cluster analysis with neural network, ridge regression and self-consistent methods. J Mol Biol 242, 497-507.
Stetler-Stevenson WG, Liotta LA, and Kleiner DE Jr (1993) Extracellular Matrix 6: role of matrix metalloproteinases in tumor invasion and metastasis. FASEB J 7, 1434-1441. Takaoka M, Naomoto Y, Ohkawa T, Uetsuka H, Shirakawa Y, Uno T, Fujiwara T, Gunduz M, Nagatsuka H, Nakajjima M, Tanaka N, and Haisa M (2003) Heparanase expression correlates with invasion and poor prognosis in gastric cancers. Lab Invest 83, 613-622. Tang W, Nakamura Y, Tsujimoto M, Sato M, Wang X, Kurozumi K, Nakahara M, Nakao K, Nakamura M, Mori I, and Kakudo K (2002) Heparanase: a key enzyme in invasion and metastasis of gastric carcinoma. Mod Pathol 15, 593598. Thompson LD, Pantoliano MW, and Springer BA (1994) Energetic characterization of the basic fibroblast growth factor-heparin interaction: identification of the heparin binding domain. Biochemistry 33, 3831-3840. Toyoshima M and Nakajima M (1999) Human heparanase. Purification, characterization, cloning, and expression. J Biol Chem 274, 24153- 24160. Tsuchida S, Podyma-Inoue KA and Yanagishita M (2004) Ultrafiltration-based assay for heparanase activity. Anal Biochem 331, 147-152. Tudan C, Willick GE, Chahal S, Arab L, Law P, Salari H, and Merzouk A (2002) C-terminal cyclization of an SDF-1 small peptide analogue dramatically increases receptor affinity and activation of the CXCR4 receptor. J Med Chem 45, 20242031. Tumova S, Woods A, and Couchmann JR (2000) Heparan sulfate proteoglycans on the cell surface: versatile coordinators of cellular functions. Int J Biochem Cell Biol 32, 269-288. Turnbull J, Powell A, and Guimond S (2001) Heparan sulfate: decoding a dynamic multifunctional cell regulator. Trends Cell Biol 11, 75-82. Vlodavsky I and Friedmann Y (2001) Molecular properties and involvement of heparanase in cancer metastasis and angiogenesis. J Clin Invest 108, 341-347. Vlodavsky I, Eldor A, Haimovitz-Friedman A, Matzner Y, IshaiMichaeli R, Lider O, Naparstek Y, Cohen IR, and Fuks Z (1992) Expression of heparanase by platelets and circulating cells of the immune systeme: possible involvement in diapedesis and extravasation. Invasion Metastasis 12, 112127. Vlodavsky I, Friedmann Y, Elkin M, Aingorn H, Atzmon R, Ishai-Michaeli R, Bitan M, Pappo O, Peretz T, Michal L, Spector L, and Pecker I (1999) Mammalian heparanase: gene cloning, expression and function in tumor progression and metastasis. Nature Medicine 5, 793-802. Vlodavsky I, Goldshmidt O, Zcharia E, Atzmon R, RanginiGuatta Z, Elkin M, Peretz T, and Friedmann Y (2002) Mammalian heparanase: involvement in cancer metastasis, angiogenesis and normal development. Semin Cancer Biol 12, 121-129. Vlodavsky I, Goldshmidt O, Zcharia E, Metzger S, Chajek-Shaul T, Atzmon R, Guatta-Rangini Z, and Friedmann Y (2001) Molecular properties and involvement of heparanase in cancer progression and normal development. Biochimie 83, 831-839. Vlodavsky I, Moshen M, Lider O, Svahn CM, Ekre HP, Vigoda M, Ishai-Michaeli R, and Peretz T (1994) Inhibition of tumor metastasis by heparanase inhibiting species of heparin. Invasion Metastasis 14, 290-302. Walker A and Gallagher JT (1996) Structural domains of heparan sulphate for specific recognition of the C-terminal
536
Gene Therapy and Molecular Biology Vol 8, page 537 heparin-binding domain of human plasma fibronectin (HEPII). Biochem J 317, 871-877. Watanabe M, Aoki Y, Kase H, and Tanaka K (2003) Heparanase expression and angiogenesis in endometrial cancer. Gynecol Obstet Invest 56, 77-82. Weinstein T, Cameron R, Katz A, and Silverman M (1992) Rat glomerular epithelial cells in culture express characteristics of parietal, not visceral, epithelium. J Am Soc Nephrol 3, 1279-1287. Yang YJ, Zhang YL, Li X, Dan HL, Lai ZS, Wang JD, Wang QY, Cui HH, Sun Y, and Wang YD (2003) Contribution of eIF-4E inhibition to the expression and activity of heparanase in human colon adenocarcinoma cell line: LS-174T. World J Gastroenterol 9, 1707-1712. Yano K, Brown LF, and Detmar M (2001) Control of hair growth and follicle size by VEGF-mediated angiogenesis. J Clin Invest 81, 409-417.
Zcharia E, Metzger S, Chajek-Shaul T, Aingorn H, Elkin M, Friedmann Y, Weinstein T, Li JP, Lindahl U, and Vlodavsky I (2004) Transgenic expression of mammalian heparanase uncovers physiological functions of heparan sulfate in tissue morphogenesis, vascularization, and feeding behavior. FASEB J 18, 252-263. Zcharia E, Metzger S, Chajek-Shaul T, Friedmann Y, Pappo O, Aviv A, Elkin M, Pecker I, Peretz T, and Vlodavsky I (2001) Molecular properties and involvement of heparanase in cancer progression and mammary gland morphogenesis. J Mammary Gland Biol Neoplasia 6, 311-322. Zetser A, Bashenko Y, Miao HQ, Vlodavsky I, and Ilan N (2003) Heparanase affects adhesive and tumorigenic potential of human glioma cells. Cancer Res 63, 7733-7741.
537
Rajkovic et al: Molecular insight into human heparanase and tumour progression
538
Gene Therapy and Molecular Biology Vol 8, page 539 Gene Ther Mol Biol Vol 8, 539-546, 2004
Two dimensional gel electrophoresis analyses of human plasma proteins. Association of retinol binding protein and transthyretin expression with breast cancer Research Article
Karim Chahed1,2, Bechr Hamrita1, Hafedh Mejdoub3, Sami Remadi1,4, Anouar Chaïeb5 and Lotfi Chouchane1,* 1
Laboratoire d’Immuno-Oncologie Moléculaire, Faculté de Médecine de Monastir, Tunisia Institut supérieur de Biotechnologie de Monastir, Tunisia 3 Faculté des Sciences de Sfax, Tunisia 4 Laboratoire Cytopath, Sousse, Tunisia 5 Service d’Obstétrique et des maladies féminines, Hôpital Universitaire Farhat Hached, Sousse Tunisia. 2
__________________________________________________________________________________ *Correspondence: Prof. Lotfi Chouchane, Laboratoire d’Immuno-oncologie Moléculaire, Faculté de Médecine de Monastir, 5019 Monastir, Tunisie; Tel: 216-73-462-200; Fax: 216-73-460-737; e-mail: lotfi.chouchane@planet.tn Key words: Two dimensional gel electrophoresis. Breast cancer. Acute phase proteins. Abbreviations: carcinoembryonic antigen, (CEA); cellular retinol, (CRBP); isoelectrofocalisation, (IEF); National Center for Biotechnology Information, (NCBI); prostate specific antigen, (PSA); retinoic acid, (RA); retinol binding protein, (RBP); Serum amyloid P, (SAP); transthyretin, (TTR)
This work was supported by le Ministère de la Recherche Scientifique et de Technologie, le Ministère de l’Enseignement Supérieur and le Ministère de la Santé Publique de la République Tunisienne. Received: 10 December 2004; Revised: 11 January 2005 Accepted: 17 January 2005; electronically published: March 2005
Summary The identification of markers for either early diagnosis, treatment response or for survival of breast cancer is of critical importance. The plasma carries an archive of important histological information whose determination may help to improve early disease detection. Using two dimensional gel electrophoresis and protein sequencing we investigated the changes in protein expression profiles derived from analysis of plasma from healthy Tunisian women and patients with breast carcinoma. We have found an association between retinol binding protein, transthyretin expression and breast cancer. The levels of acute phase proteins known to accompany both acute and chronic inflammatory disorders comprising haptoglobin, serum amyloid P, apolipoprotein A1, !1-antitrypsin and !1-acidic glycoprotein were also intimately associated with this neoplastic disease. symptoms appear (Brenner, 2002). However, since a tumor should be at least a few millimeters in size, it is already late when breast cancer is detected. So, there is a considerable need for the identification of useful pathological markers that can help not only in early detection but also for typing and treatment. It is well established that changes that occur in disease versus normal tissues at either the gene (genomic) or protein (proteomic) level are regarded as an appropriate way to identify markers of pathologies that could be correlated with drug response and patient survival.
I. Introduction Breast cancer is the most frequent malignancy among women representing a major health problem in many countries. Considering the cellular complexity and the dynamic structures of mammary tumors breast cancer is mainly classified according to the cellular origin of the cancer cells and on the evolution of the disease (Hondermarck, 2003). Current methods used to detect breast tumors are based on mammography. It is a widely used and clinically screening method that is effective in detecting early stage breast cancer before clinical 539
Chahed et al: Association of retinol binding protein and transthyretin expression with breast cancer Proteomics with the recent advances in mass spectrometry has brought with it the hope of discovering novel biomarkers that could be used to diagnose diseases. Probably, the most widely used proteomic technology is the identification of alterations in protein expression between two samples through comparative 2-DE (Conrads et al, 2003). In such investigation a biomarker is defined as a protein having more or less intensity on one gel compared with the other and should be particularly associated with the disease. The search for biomarkers and specific alterations using proteomic methods largely focus upon plasma or serum (Anderson and Anderson, 1977; Hoogland et al, 1999). These biological fluids are clinically relevant since they could be obtained in sufficient quantities from patients. It is well known that during necrosis and apoptosis content of cells could be released into the plasma. In addition, plasma may contain proteins or peptides that are aberrantly shed or secreted from cells in response to a disease (Adkins et al, 2002). It might be expected that the presence of a disease could be determined by measuring the altered presence or abundance of the constituant molecular species and reinforces the benefits of using a 2-DE approach for identifying biomarkers for disease states (Wrotnowski, 1998). Blood plasma like cells contains many high abundant proteins. The major constituents include albumine, haptoglobin, immunoglobulins, transferrin, lipoproteins, fibrinogene B and fibrinogene ". Other very low abundant proteins are commonly present in plasma (Wrotnowski, 1998; Anderson and Anderson, 2002). They represent the low molecular weight plasma proteome and could be generated from larger proteins by proteolysis within the circulatory system or in the environment of the tumors. Searching for human plasma alterations using 2-DE with regard to neoplastic disease has been extensively investigated. As early as 1974, 2-DE was carried to look for differences between protein patterns of individuals suffering cancer (Wright, 1974). Since, several markers were characterized and are currently used for diagnosis. As an example, increased levels of molecular markers such as prostate specific antigen (PSA) and CA 125 are now routinely used for the detection of cancer in the prostate and ovary respectively (Charrier et al, 2001; Petricoin et al, 2002). Other markers are effective for diagnosing primary or advanced neoplastic diseases. The carcinoembryonic antigen (CEA) is used for detecting colorectal cancer, Her2/neu, CA 15-3 and CA 27-29 for advanced breast cancer (Diamandis, 1996; Buzdor and Hortobagy, 1999). Kallikreins, a family of secreted serine proteases were highly associated with ovarian carcinoma as well as with breast and prostate cancers (Yousef and Diamandis, 2001). The plasma carries an archive of important histological information whose determination could help to improve early disease detection. In the present study, by using 2-DE investigations of human plasma proteins we have found an association between the levels of retinol binding protein (RBP), transthyretin (TTR) and breast carcinoma among Tunisian women.
II. Materials and methods A. Patients and controls Plasma samples were collected from six untreated patients diagnosed with infiltrating breast ductal carcinoma. Control subjects (16) were healthy blood donors having no evidence of any personal or family history of cancer (or other serious illness). Controls and patients were selected from the same population living in the middle coast of Tunisia. All the samples were collected with informed consent according to protocols approved by the institutional review boards of the respective hospitals. Plasma samples were stored at -80°C before analysis.
B. Two dimensional gel electrophoresis and evaluation of 2D data 1. Isoelectrofocalisation of proteins (first dimension) and SDS-PAGE To the plasma, four volumes of cold acetone (-20°C) were added and the solution was incubated for 1 Hour at -20°C. The pellet was washed with cold acetone (80%), dried under partial vacuum and solubilised in 7.0 M urea, 2.0 M Thiourea, 4% (w/v) CHAPS, 0,5% w/v DTT and 2% ampholytes (1 part pH 3/10, 1 part pH 5/7, 2parts pH 6/8). Acetone precipitation led to a better resolution of abundant plasma proteins, but there has been significant loss in lower molecular weight proteins. Protein contents were determined according to the procedure described by Bradford (Bradford, 1976) and modified by Ramagli and Rodriguez (Ramagli and Rodriguez, 1985). Bovine serum albumin (Fraction V, Sigma) was used as a standard. Analytical 2D-PAGE was carried out in a Bio-Rad system (Miniprotean II). Equal amounts of proteins issued from control or breast cancer samples were subjected simultaneously to isoelectrofocalisation (IEF) and SDS-PAGE analysis. Extraction of proteins, solubilisation, IEF, SDS-PAGE and staining were carried under very similar conditions for the different samples. Each experiment was repeated for at least three times. Focused strips were equilibrated in SDS equilibration buffer and were then loaded onto SDS gel slabs for separation in the second dimension (Laemmli, 1970).
2. Gel staining After separation in SDS-PAGE gels, the proteins were visualised by a sensitive colloidal coomassie G-250 stain (Neuhoff et al, 1985). The dye solution contained 17% (w/v) ammonium sulfate, 3% (v/v) phosphoric acid, 0,1% (w/v) coomassie G250 and 34% (v/v) methanol. The staining solution was changed once after 12 hours staining and the gel slabs subjected to a 24 hours cycle for increasing dye deposition on low abundance proteins. The detection was then increased by placing the gel into 1% v/v acetic acid for producing a better contrast between spots and gel. Silver staining was done according to Oakley et al, (1980). All coomassie and silver–stained gels were scanned into adobe photoshop 6.0. Alterations in protein levels defined as clear differences in size and/or density of the protein spot on the gel were confirmed through differential analyses using melanie 3.0 software tools. Comparison of the 2D patterns with published human plasma protein 2D-PAGEs of the Swiss-2DPAGE database (Sanchez et al, 1995) allowed characterization of the indicated plasma proteins.
3. N-terminal amino acid sequencing As the experimental and theoretical positions of a protein may differ significantly, the identity of proteins of interest was confirmed by sequencing. Plasma proteins (500 µg) were
540
Gene Therapy and Molecular Biology Vol 8, page 541 fractionated on 12 cm IEF rod gels (1.5 mm diameter) at 300 volts for 1 hour, 450 volts for 2 hours and 650 volts for 15 hours. SDS-PAGE was performed under constant current intensity (35 mA/gel). Following electrophoresis, proteins were electroblotted on Immobilon P using a semi-dry blotter system (Millipore) and stained with coomassie blue according to the manufacturerâ&#x20AC;&#x2122;s instructions. Spots on Immobilon membranes, corresponding to polypeptides of interest were collected ans subjected to Edman degradation using an applied biosystem modele (Procise). Amino acid sequence analysis and data base search were performed at the National Center for Biotechnology Information (NCBI) and comparison with the Swiss Prot data bases.
al, 1991) and heart disease (Cassler et al, 1992). The levels of other acute phase proteins such as serum amyloid A were altered after a severe head injury (Choukaite et al, 1989) or viral infections (Bini et al, 1996). By comparative proteome analysis, Vejda et al (2002) found elevated levels of degradation products of antiplasmin and laminin "-chain in cancer samples. They also found significantly elevated levels of the acute phase proteins !1-acidic glycoprotein, !1-antitrypsin, !1-antichymotrypsin and haptoglobin. The !1-antitrypsin and laminin "-chain were described as being anti-apoptotic factors (Yoshida et al, 2001; Vejda et al, 2002). Kuhajda et al, (1989) reported that haptoglobins could be associated with phenotypically aggressive neoplasia and serve as mediators of some malignant processes in breast cancer. They were also found to stimulate collagen synthesis in fibroblasts from cancerous body fluids (Viellard et al, 1974). Detection and quantification of haptoglobins could also be a useful diagnostic procedure in cancer. A recent study of haptoglobin polymorphism in breast cancer patients demonstrates that haptoglobin 1 and 2 alleles were overrepresented in patients with familial and non familial breast cancer respectively (Awadallah and Atoum, 2004). Other studies provided evidence that the haptoglobin ! subunit is specifically increased in sera of ovarian cancer patients. It has been postulated that Hp! might affect the immune response as a potent immunosuppressant (Bini et al, 2003). The study we carried out showed an increase in the levels of haptoglobin (# chain) in all breast cancer samples (Figure 1). However, we were unable to draw conclusions concerning !1 and !2 chains because of the genetic polymorphism associated with the corresponding gene. In the case of two other protein family members, !1acidic glycoprotein and !1-antitrypsin, showing elevated levels in our breast cancer samples, a direct anti-apoptotic mode of action has been demonstrated on tumor necrosis factor-induced apoptosis of hepatocytes (Van Molle et al, 1997). The increase in the levels of protease inhibitors in plasma such as !1-antitrypsin and !1-antichymotrypsin could be related to the high proteolytic activity mediated by proteases such as plasmin in cancer samples (Anderson et al, 1993; Vejda et al, 2002). These two related glycoprotein protease inhibitors, present in plasma could also neutralize proteases released by leucocytes in response to trauma and inflammatory stimuli (Bergman et al, 1993). Serum amyloid P (SAP), a plasma glycoprotein, shows also a slight increase in breast cancer samples (Figure 1). This pentraxin protein has been shown to bind chromatin in apoptotic and necrotic cells, thus preventing antinuclear auto-immunity (Bickerstaff et al, 1990). The SAP protein recognizes ligands from necrotic cells, binds to late apoptotic cells and is involved in their phagocytosis by human monocyte derived macrophages (Familian et al, 2001; Bijl et al, 2002). A second set of proteins designed as negative acute phase proteins comprising TTR and retinol binding protein (RBP) displayed interestingly increased intensities in all the breast cancer samples (Figure 1). A lower amount of RBP and TTR was found in all control samples regardless to the age. This result suggests that the association
III. Results and Discussion Plasma proteomic analysis of six malignant breast cancer samples and 16 samples from human healthy donors were compared by high resolution two dimensional gel electrophoresis. Several proteins were up-regulated in all of the breast cancer samples compared to that of healthy controls. The majority of the protein identifications appeared to represent differences in overall abundance. 2-DE investigations showed elevated levels of acute phase proteins such as haptoglobin (#-chain), serum amyloid P, !1-antitrypsin, !1-antichymotrypsin and !1acidic glycoprotein in plasma from patients diagnosed with breast cancer (Figure 1). Two other proteins, highly elevated in cancer plasma, were identified as RBP and TTR. The first group of proteins designed as positive acute phase proteins is known to accompany both acute and chronic inflammatory disorders (Doherty et al, 1998). During tumoral growth, acute phase proteins have also been described to accumulate at high levels and could be used to distinguish tumor type and prognosis (Negishi et al, 1987; Schmid et al, 1995; Alaiya et al, 2000). This is well described for prostate cancer where the association of antichymotrypsin and PSA is well investigated to help in the differential diagnosis of prostate cancer from benign prostate hyperplasia (Charrier et al, 2001). In a recent study, Cho W C et al, (2004) identified serum amyloid A as a serum biomarker that could be useful in the diagnosis of relapse in nasopharyngeal cancer. As our investigation, several studies have examined aspects of the acute phase response in which many high abundant plasma proteins increase or decrease following a range of inflammatory insults or cancer (Bini et al, 1992). In acute inflammatory responses and in rheumatoid arthritis, differences in the levels of 19 acute phase proteins were reported to be affected. These studies, based on quantitative serum analysis, showed that high abundant acute phaseâ&#x20AC;&#x201C;related proteins could be good prognostic markers of inflammation (Doherty et al, 1998). Gianazza and co-workers (Miller et al, 1999, Eberini et al, 2000) identified, using 2-DE, 34 proteins with human homologues showing changes in protein abundance and were associated with inflammatory diseases. Several other 2-DE studies have examined aspects of the acute phase response following an inflammatory insult. Changes in haptoglobin levels were reported in duchenne muscular dystrophy (John and Purdom, 1989), human gonadotropin isoforms in patients with trophoblastic tumors (Hoemann et al, 1993) and ApoA-1 during parturition (Del Piore et
541
Chahed et al: Association of retinol binding protein and transthyretin expression with breast cancer
Figure 1. Two dimensional gel electrophoresis analyses of plasma proteins derived from (A) a healthy donor and (B) a breast cancer patient. Partial 2-DE images from a control gel (A) and from a breast cancer sample (B) are shown. Abr: STF: serotransferrin ; ALB: albumin ; ACT: anti-chymotrypsin ; ATR: anti-trypsin ; AGP: acidic glycoprotein ; Hp: haptoglobin ; Fb: fibrinogen beta chain ; ApoAI: apoAI lipoprotein ; SAP: serum amyloid P ; RBP: retinol binding protein.
between RBP and TTR expression in plasma and breast cancer is unlikely to be related to the age. Further characterization of the RBP and TTR spots was performed by protein sequencing. The two spots were electroblotted on immobilon P and subjected to N-terminal amino acid sequence analyses. The deduced sequences (RBP:1ERDCRVSSFRVKENFDKARF20;TTR:1GPTGTGE SKCPLMVKVLDAV20) were compared with the Swiss Prot data bases and found to correspond, respectively, to retinol binding protein and transthyretin. The high levels of RBP and TTR found in plasma of Tunisian patients with breast cancer as revealed by 2D-
PAGE were not reported for other populations (Mehta et al, 1987; Basu et al, 1988;1989; Russell et al, 1988; Vejda et al, 2002). This may be attributable to differences in study design, to the analyzed populations, as well as to the presence of different confounding factors. The retinol binding protein is a member of the lipocalins family and has been used as a marker of diseases associated with inflammation and cancer (Xu and Venge, 2000). It is synthesized predominantly by the liver and is the principal carrier of all-trans retinol (vitamin A) in the blood stream (Goodman, 1984). Transthyretin acts as a transport protein for thyroxin T4 and is the primary 542
Gene Therapy and Molecular Biology Vol 8, page 543 indirect carrier of vitamin A through its interaction with retinol binding protein. It is well established that the metabolism of RBP and TTR is highly associated with that of vitamin A (Rosales et al, 2000). In the blood, the retinol/ RBP complex further binds to transthyretin at a ratio of 1:1:1 and is then transported to the target cells. Retinol is then metabolized to its active form, retinoic acid (RA), which is an important transcription modulator that acts in the regulation of proliferation and differenciation of many cell types (Blomhoff, 1994). Retinoids act also as cancer chemopreventive and chemotherapeutic agents (Honk and Sporn, 1997). They were also reported to inhibit the growth of several breast cancer cell lines (Chen et al, 1997). The action of retinol and RA is mediated by their binding to cellular retinol (CRBP) and retinoic acid binding proteins (CRABPI and CRABPII) and through two different families of nuclear RA receptors. The latters behave as ligand-activated–trans-acting transcription factors that can regulate the expression of several retinoidresponsive genes and hence alters the growth of normal and cancer cells (Mangelsdorf et al, 1994). Recent studies indicate that the metabolism of retinol to retinoids is greatly reduced in several human carcinoma cell lines and tumor specimens (Guo and Gudas, 1998; Guo et al, 2000, 2001). Carcinoma cells from the breast showed a decrease in their ability to esterify retinol to retinyl esters (Chen et al, 1997). It has been suggested that this could lead to an inappropriate growth and to the loss of normal differenciation processes (Mira-Y-Lopez et al, 2000). Another frequent event in a subset of human breast cancers is the loss of CRBP expression. This protein is postulated to regulate the formation of retinyl esters and the synthesis of retinoic acid (Ong et al, 1994). It was suggested that CRBP down regulation occurs through DNA hypermethylation in human breast cancer and contributes to breast tumor progression (Arapshian et al, 2004). The decrease in the levels of CRBP leads to a restriction of the effects of intracellular vitamin A levels on breast cells (Kuppumbatti et al, 2000; Arapshian et al, 2004). Furthermore, it has been shown that increasing the levels of CRABPII, an intracellular lipid-binding protein that associates with retinoic acid, in mammary carcinoma cells (MCF7) strongly enhances their sensitivity to retinoic acid-induced growth inhibition (Budhu and Noy, 2002). These data provide the evidence that increasing the intracellular levels of retinyl esters in malignant cells could be a good approach to treat patients with breast cancer. The increase in the plasma levels of RBP and TTR could thus be linked to the lack of sufficient internal retinyl ester stores necessary to regulate retinoid responsive genes in malignant cells. In conclusion, the present study showing the high production of RBP and TTR in plasma of patients with breast cancer suggests that overproduction of these proteins could correlate with a decrease of retinyl esters in tumor cells.
l’Enseignement Supérieur and le Ministère de la Santé Publique de la République Tunisienne.
References Adkins JN, Varnum SM, Auberry KJ, Moore RJ, Angell NH, Smith RD, Springer DL and Pounds JG (2002) Toward a human blood serum proteome: Analysis by multidimensional separation coupled with mass spectrometry. Mol Cell Proteomics 1, 917-955. Alaiya AA, Franzen B, Hagman A, Slitversward C, Moberger B, Linder S and Aner G (2000) Classification of human ovarian tumors using multivariate data analysis of polypeptide expression patterns. Int JCancer 86, 731-736. Anderson C, Gelin J, Iresjo BM and Lundholm K (1993) Acute phase proteins in response to tumor growth. J Surg Res 55, 807-814. Anderson L and Anderson N.G (1977) High resolution twodimensional gel electrophoresis of human plasma proteins. Proc Natl Acad Sci USA 74, 5421-5425. Anderson NL and Anderson NG (2002) The human plasma proteome. Mol Cell Proteomics, 845-867. Arapshian A, Bertran S, Kuppumbatti YS, Nakajo S and Lopez RM (2004) Epigenetic CRBP down regulation appears to be an evolutionarily conserved (human and mouse) and oncogene specific phenomenon in breast cancer. Molecular Cancer, 3-13. Awadallah SM and Atoum MF (2004) Haptoglobin polymorphism in breast cancer patients from jordan. Clin Chim Acta 341, 17-21. Basu TK and Sasmal P (1988) Plasma vitamin A, retinol-binding protein, and prealbumin in postoperative breast cancer patients. Int J Vitam Nutr Res 58 , 281-3. Basu TK, Hill GB, Ng D, Abdi E and Temple N (1989) Serum vitamins A and E, beta-carotene, and selenium in patients with breast cancer. J Am Coll Nutr 8, 524-529. Bergman D, Kadner SS, Cruz MR, Esterman AL, Tahery MM, young BK and Finlay TH (1993) Synthesis of !1antichymotrypsin and !1-antitrypsin by human trophoblast. Pediatr Res 34, 312-7. Bickerstaff MC, Botto M, Hutchinson WL, Herbert J, Tennent GA, Bybee A, Mitchell DA, Cook HT, Butler PJ, Walport MJ and Pepys MB, (1990) Serum amyloid P component controls chromatin degradation and prevents antinuclear autoimmunity. Nat Med 5, 694-697. Bijl M, Horst G, Bootsma H, Limburg PC and Kallenberg CGM (2002) Serum amyloid P component (SAP) binds to late apoptotic cells and mediates their phagocytosis by macrophages. Arthritis Res 4, 8. Bini L, Magi B, Cellesi C, Rossolini A and Pallini V (1992) Two dimensional electrophoresis analysis of human serum proteins during the acute-phase response. Electrophoresis 13, 743-746. Bini L, Nagi B, Marzocchi B, Celiesi C, Berti B, Raggiaschi R, Rossolini A and Pallini V (1996) Two dimensional electrophoretic patterns of acute-phase human serum proteins in the course of bacterial and viral diseases. Electrophoresis 17, 612-616. Bini Ye, Cramer DW, Skates SJ, Gygi SP, Pratomo V, Fu LF, Horick NK, Licklider LJ, Schorge JO, Berkowitz RS and Mok SC (2003) Haptoglobin !-subunit as potential biomarker in ovarian cancer. Clinical Cancer Res 9, 29042911. Blomhoff R, (1994) Overview of vitamin A metabolism and function, in Blomhoff R (Ed)-Vitamin A in health and disease, Marcel Dekker, New York, 1-35.
Acknowledgments This work was supported by le Ministère de la Recherche Scientifique et de Technologie, le Ministère de 543
Chahed et al: Association of retinol binding protein and transthyretin expression with breast cancer Bradford M (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 72, 248-254. Brenner DJ, Sawant SG, Hande MB, Miller RC, Elliston CD, Fu Z, Randers-pehrson G and Marino SA (2002) Routine screening mammography: how important is the radiation-risk of the benefit-risk equation?. Int J radia Biol 78, 1065-1067. Budhu AS and Noy N (2002) Direct channeling of retinoic acid between cellular retinoic acid-binding protein II and retinoic acid receptor sensitizes mammary carcinoma cells to retinoic acid-induced growth arrest. Mol Cell Biol 22, 2632-2641. Buzdor AU and Hortobagy CN (1999) Breast cancer: in Pinedo HM, Londo DL, Chabner BA eds- Cancer chemotherapy and biological response modifiers. Annual 18, Amsterdam. Elsevier-Sciences B V, 435-69. Cassler AB, Johansen JJ and Kendrick NC (1992) Two dimensional gel analysis of serum apolipoprotein A-1 isoforms. Preliminary analysis suggests altered ratios in individuals with heart disease. Appl Theor Electrophoresis 3, 41-46. Charrier JP, Tournel C, Michel C, Comby S, Reynaud CJ, Passagot J, Alban PD, Chauvard D and Jolivet M (2001) Differential diagnosis of prostate cancer and benign prostate hyperplasia using two dimensional electrophoresis. Electrophoresis 22, 1861-1866. Chen AC, Guo X, Derguini F and Gudas LJ (1997) Human breast cancer cells and normal mammary epithelial cells: retinol metabolism and growth inhibition by the retinol metabolite 4-oxoretinol. Cancer Res 57, 4642-4651. Cho WC, Yi PC, Yip V, Thulasiraman V, Ngan RK, Yip TT, Lan WH, Au JS, Law SC, Cheng WW, Nja VW and Lim CK (2004) Identification of serum amyloid A protein as a potentially useful bio-marker to monitor relapse of nasopharyngeal cancer by serum proteomic profiling. Clin Cancer Res 10, 45-52. Choukaite A, Visvikis S, Steihmetz J, Calteau MM, Kabbaj O, Ferard G, Melais R and Siest G (1989) Two dimensional electrophoresis of plasma proteins and high density lipoproteins during inflammation. Electrophoresis 10, 781784. Conrads TP, Zhou M, Petricoin EF, Liotta L and Veenstra TD (2003) Cancer diagnosis using proteomic patterns. Expert Rev Mol Diagn 3, 411-420. Del Piore G, Chatterton R, Lee C, Silver R, Berg L and Lee MJ (1991) Comparison of mononuclear cell proteins and plasma proteins before and during parturition by two dimensional electrophoresis. J Perinat Med 19, 373-377. Diamandis EP (1996) Prognostic markers in breast cancer. Clin Lab News 22, 235-9. Doherty NS, Lillman BI, Reilly K, Swindell AC, Buss JM and Anderson NI (1998) Analysis of changes in acute-phase plasma proteins in an acute inflammatory response and in rheumatoid arthritis using two dimensional gel electrophoresis. Electrophoresis 19, 355-363. Eberini I, Agnallo D, Miller I, Villa P, Fratelli M, Ghezzi P, Gemeiner M, Chau J, Aebersold R and Gianazza E (2000) Protein of rat serum V: Adjuvant arthritis and its modulation by non steroidal anti-inflammatory drugs. Electrophoresis 21, 2170-2179. Familian A, Zwart B, Huisman HG, Rensink I, Roem D, Hordijk PL, Aarden LA and Harck CE (2001) Chromatinindependent binding of serum amyloid P Component to apoptotic cells. J Immunol 167, 647-654. Goodman DS, (1984) In th retinoids (Sporn MB, Roberts AB and Goodman DS eds). Academic Press, New York 2, 41-88. Guo X and Gudas LJ (1998) Metabolism of all-trans retinol in normal human cell strains and squamous cell carcinoma (SCC) lines from the oral cavitiy and skin: reduced
esterification of retinol in SCC lines. Cancer Res 58, 166176. Guo X, Nanus DM, Ruiz A, Rando RR, Lorraine DB and Gudas LJ (2001) Reduced levels of retinyl esters and vitamin A in human renal cancers. Cancer Res 61, 2774-2781. Guo X, Ruiz A, Rando RR, Bok D and Gudas LJ (2000) Esterification of all-trans-retinol in normal human epithelial cell strains and carcinoma lines from the oral cavity, skin and breast: reduced expression of lecithin retinol acyltransferase (LRAT) in the carcinoma lines. Carcinogenesis (Lond) 21, 1925-1933. Hoemann R, Spoetti C, Crossmann M, Saller B and Mann K (1993) Molecular heterogeneity of human chorionic gonadotropin in serum and urine from patients with trophoblastic tumors. Clin Investig 71, 953-960. Hondermarck H (2003) Breast cancer: when proteomics challenges biological complexity. Mol Cell Proteomics, 281-291. Honk WK and Sporn MB (1997) Recent advances in chemoprevention of cancer. Science 278, 1073-1077. Hoogland C, Sanchez JC, Tonella L, Bairoch A, Hochstrasser OF and Appel RD (1999) The Swiss 2D-PAGE database: what has changed during the last year. Nucl Acid Res 27, 289291. John H and Purdom IF (1989) Elevated plasma levels of haptoglobin in duchenne muscular dystrophy: electrophoretic variants in patients with a severe form of the disease. Electrophoresis 10, 489-493. Kuhajda FP, Katumuluwa AI and Pasternack GR (1989) Expression of haptoglobin-related protein and it’s potential rôle as a tumor antigen. Proc Natl Acad Sci USA 86, 11881192. Kuppumbatti YS, Bleiweiss IJ, Mandeli JP, Waxman S and Lopez RMY (2000) Cellular retinol-binding protein expression and breast cancer. J Natl Cancer Inst 92, 475480. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680685. Mangelsdorf DJ, Umesono K and Evans RM (1994) The retinoids receptors, sporn MB, Roberts AB, Goodman DS eds. The retinoids: Biology, chemistry and medicine, Raven Press, 319-350. Mehta RR, Hart G, Beattie CW and Das Gupta TK (1987) Significance of plasma retinol binding protein levels in recurrence of breast tumors in women. Oncology 44 (6) 3505 Miller I, Haynes P, Eberini I, Gemeiner M, Aebersold R and Gianazza E (1999) Proteins of rat serum. III.Gender-related differences in protein concentration under base line conditions and upon experimental inflammation as evaluated by two dimensional electrophoresis. Electrophoresis 20, 836-845. Mira-Y-Lopez R, Zheng WL, Kuppumbatti YS, Rexer B, Jing Y, Ong DE (2000) Retinol conversion to retinoic acid is impaired in breast cancer cell lines relative to normal cells. J Cell Physiol 185, 302-9. Negishi Y, Furukawa T, Oka T, Sakamodo M, Hirata T, Okabe K, Matayoshi K, Akiya K and Soma H (1987) Clinical use of CA125 and its combination assay with other tumor markers in patients with ovarian carcinoma. Gynecol Obstet Investig 23, 200-207. Neuhoff V, Stamm R and Elbl H (1985) Clear background and highly sensitive protein staining with coomassie blue dyes in polyacrylamide gels: a systematic analysis. Electrophoresis 6, 427-448.
544
Gene Therapy and Molecular Biology Vol 8, page 545 Oakley BR, Kirsch DR and Morris NR (1980) A simplified ultrasensitive silver stain for detecting proteins in polyacrylamide gels. Anal Biochem 105, 361-363. Ong DE, Newcomer ME and Chytil F (1994) Cellular retinoidbinding proteins, Sporn MB, Roberts AB, Goodman DS eds. The retinoids: Biology, chemistry and medicine, Raven Press, 283-317. Petricoin LI, Ardekani AM, Hitt BA, Levine PJ, Fusaro VA, Steinberg SM, Mills GB, Simone C, Fishman DA, Kohn EC and Liotta LA (2002) Use of proteomic patterns in serum to identify ovarian cancer. Lancet 359, 572-577. Ramagli LS and Rodriguez LU (1985) Quantitation of microgram amounts of proteins in two-dimensional polyacrylamide gel electrophoresis sample buffer. Electrophoresis 6, 559-563. Rosales JF, Topping JD, Smith JE, Shankar AH and Ross C (2000) Relation of serum retinol to acute phase proteins and malarial morbidity in papua new guinea children. Am J Clin Nutr 71, 1582-8. Russell MJ, Thomas BS and Bulbrook RD (1988) A prospective study of the relationship between serum vitamins A and E and risk of breast cancer. Br J Cancer 57, 213-5. Sanchez JC, Appel RD, Golaz O, Pasquali C, Ravier F, Bairoch A and Hochstrasser DF (1995) inside swiss 2D-PAGE data base. Electrophoresis 16, 1131-1151. Schmid HR, Schmiller D, Blum P, Miller M and Vonderschmill D (1995) Lung tumor cells. A multivariate approach to cell classification using two dimensional protein paterns. Electrophoresis 16, 1961-1968.
Van Molle W, Libert C, Fiers W and Brouckaert P (1997) !1antitrypsin inhibit TNF-induced but not anti-Fas induced apoptosis of hepatocytes in mice. J Immunol 159, 35553564. Vejda S, Posovszky C, Zelzer S, Peter B, Bayer E, Gelbmann D, Hermann RS and Gerner C (2002) Plasma from cancer patients featuring a characteristic protein composition mediated protection against apoptosis. Mol Cell Proteomics, 387-393. Viellard A, Lonbart C, Borel JP and Jayle MF (1974) In-vitro influence of haptoglobin and its complex with hemoglobin on the biosynthesis of collagen. Pathol Biol 22, 741-742. Wright GL (1974) Two dimensional acrylamide gel electrophoresis of cancer patient serum proteins. Ann Lab Sci 4, 281-293. Wrotnowski C (1998) the future of plasma proteins. Genet Engl News, 18 14. Xu S and Venge P (2000) Lipocalins as biochemical markers of disease. Biochim Biophys Acta 1482, 298-307. Yoshida Y, Hosokawa K, Dantes A, Kotsuji F, Kleinman HK and Amsterdam (2001) A Role of laminin in ovarian cancer tumor growth and metastasis via regulation of mdm2 and Bcl2 expression. Int J Oncol. 18, 913-921. Yousef GM and Diamandis FP (2001) The new human tissue kallikrein gene family: structure, function and association to disease. Endocr Rev 22, 148-204.
545
Chahed et al: Association of retinol binding protein and transthyretin expression with breast cancer
546