Biology 4th Edition Sample: ISBN 9781921917233 by IBID PRESS

INTERNATIONAL BACCALAUREATE

Biology FOURTH EDITION

Minka Peeters Weem with Christopher Talbot Antony Mayrhofer 4th Edition

All rights reserved except under the conditions described in the Copyright Act 1968 of Australia and subsequent amendments. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, without the prior permission of the publishers.

While every care has been taken to trace and acknowledge copyright, the publishers tender their apologies for any accidental infringement where copyright has proved untraceable. They would be pleased to come to a suitable arrangement with the rightful owner in each case.

www.ibid.com.au First published in 2013 by IBID Press, Victoria

Library Catalogue:

This material has been developed independently by the publisher and the content is in no way connected with nor endorsed by the International Baccalaureate Organization.

All copyright statements, ‘© IBO 20013’ refer to the Chemistry guide published by the International Baccalaureate Organization in 2013. IBID Press express their thanks to the International Baccalaureate Organization for permission to reproduce its intellectual property.

Peeters Weem M., Talbot C., Mayrhofer A. 1. Biology 4th Edition

Cover design by Key-Strokes.

2. International Baccalaureate. Series Title: International Baccalaureate in Detail

ISBN: 978 – 1 – 921917 – 23 – 3

Published by IBID Press, 36 Quail Crescent, Melton, 3337, Australia.

Printed by KHL Printing.

TABLE OF CONTENTS CORE Chapter 1 – Cell biology 1.1 Introduction to cells 1.2 Ultrastructure of cells 1.3 Membrane structure 1.4 Membrane transport 1.5 The origin of cells 1.6 Cell division

Chapter 2 – Molecular biology 2.1 Molecules to metabolism 2.2 Water 2.3 Carbohydrates and lipids 2.4 Proteins 2.5 Enzymes 2.6 Structure of DNA and RNA 2.7 DNA replication, transcription and translation 2.8 Cell respiration 2.9 Photosynthesis

Chapter 3 – Genetics 3.1 Genes 3.2 Chromosomes 3.3 Meiosis 3.4 Inheritance 3.5 Genetic modification and biotechnology

Chapter 4 – Ecology 4.1 Species, communities and ecosystems 4.2 Energy flow 4.3 Carbon cycling 4.4 Climate change

Chapter 5 – Evolution and biodiversity 5.1 Evidence for evolution 5.2 Natural selection 5.3 Classification of biodiversity 5.4 Cladistics

Chapter 6 – Human physiology 6.1 Digestion and absorption 6.2 The blood system 6.3 Defence against infectious disease 6.4 Gas exchange 6.5 Neurons and synapses 6.6 Hormones, homeostasis and reproduction AHL

Chapter 7 – Nucleic acids 7.1 DNA structure and replication 7.2 Transcription and gene expression 7.3 Translation

Chapter 8 – Metabolism, cell respiration and photosynthesis 8.1 Metabolism 8.2 Cell respiration 8.3 Photosynthesis

Chapter 9 – Plant biology 9.1 Transport in the xylem of plants 9.2 Transport in the phloem of plants 9.3 Growth in plants 9.4 Reproduction in plants

Chapter 10 – Genetics and evolution 10.1 Meiosis 10.2 Inheritance 10.3 Gene pools and speciation

Chapter 11 – Animal physiology 11.1 Antibody production and vaccination 11.2 Movement 11.3 The kidney and osmoregulation 11.4 Sexual reproduction

OPTIONS Chapter 12 (Option A)

Chapter 15 (Option D) Human

Neurobiology and behaviour

physiology

Core topics A.1 Neural development A.2 The human brain A.3 Perception of stimuli Additional higher level topics A.4 Innate and learned behaviour A.5 Neuropharmacology A.6 Ethology

Core topics D.1 Human nutrition D.2 Digestion D.3 Functions of the liver D.4 The heart Additional higher level topics D.5 Hormones and metabolism D.6 Transport of respiratory gases

Chapter 13 (Option B) Biotechnology and bioinformatics Core topics B.1 Microbiology: organisms in industry B.2 Biotechnology in agriculture B.3 Environmental protection Additional higher level topics B.4 Medicine B.5 Bioinformatics

Chapter 14 (Option C) Ecology and conservation Core topics C.1 Species and communities C.2 Communities and ecosystems C.3 Impacts of humans on ecosystems C.4 Conservation of biodiversity Additional higher level topics C.5 Population ecology C.6 Nitrogen and phosphorus cycles

1. Cell biology 1.1

Introduction to cells

1.2

Ultrastructure of cells

1.3

Membrane structure

1.4

Membrane transport

1.5

The origin of cells

1.6

Cell division

Chapter 1

CORE

1.1.1

According to the cell theory, living organisms are composed of cells © IBO 2014

For a very long time, people did not know cells existed. The discovery of cells was linked to the developments in technology, in particular the ability to produce high quality lenses for microscopes. A series of steps led to the discovery of cells, most of them being related to the advances in technology. It involves a sequence of discoveries, often made by scientists in different countries.

• 1675-Antonie van Leeuwenhoek another Dutchman discovers unicellular organisms. • 1838-Mathias Schleiden from Germany suggests that all plants were made of cells. • 1839-Theodor Schwann, also from Germany, suggests that all animals were also made of cells. • 1840-The Czech Jan Evangelista Purkinje names the cell content ‘protoplasm’. • 1855-Rudolf Virchow from Germany suggests that ‘all cells come from cells’. • 1859-Louis Pasteur proved that spontaneous generation (of living matter from non-living matter) did not occur. The cell theory was developed and includes the following elements: • All living organisms are composed of cells, and the products of cells (e.g. nails, hair and scales). • Cells are the smallest units of life. • Cells only come from pre-existing cells.

• The chemical composition of cells is similar. The cell theory is widely accepted and advances in technology have allowed us to greatly increase our knowledge of cells. In particular the development of the electron microscope (EM) has allowed us to study the ultrastructure of cells in more detail than Robert Hooke could ever have imagined. They have also led to the discovery of some cells which differ from most of our generalised models of plant or animal cells. Although different, these cells still support the cell theory.

What is living and non-living?

EORY TH OF

•

• 1665-The Englishman Robert Hooke studies cork with a compound microscope and names the structures ‘cells’.

• Genetic information (DNA) is found in a cell and passed to its daughter cells,

• 1590-The Dutch optician Zacharias Jansen invents the compound microscope. A compound microscope has 2 lenses which provides greater magnification.

• Energy flows within cells

The evolution of multicellular organisms allowed cell specialisation and cell replacement.

More modern thinking also includes some other aspects:

•

1.1 Introduction to cells

LED

Intuition usually tells us if something is living or nonliving, but the Natural Sciences have used reason to develop lists of characteristics of organisms that distinguish them from their non-living environment. This reductionist approach (reducing a complex concept to a series of parts or a list) is powerful in assisting Biologists in determining what is and is not alive. However, both ways of understanding knowledge have their flaws. Intuition is dependent upon and therefore limited by our sense perception, memory and preconceptions. Natural sciences’ reductionist lists are limited by the complexity of life and exceptions to its lists. Viruses and prions are a challenge as they have some characteristics of living organisms as well as those of the non-living environment. To illustrate this challenge, you could make a list of ‘characteristics of living things’, compare with others in your class and discuss any differences between lists.

1. Muscle cells

IL LS

A combination of muscles and bones allows us to move: the bones provide the structure and the muscles can become shorter which moves the bones relative to each other. Generally, two main types of muscle are distinguished: smooth muscle and striated muscle. Striated muscles are usually involved in voluntary movement.

LICATI AND

IL LS

Acetabularia transports mRNA in inactive form from one side of the cell to the other to be activated and translated there. Refer to Figures 104 and 105. Cap

CORE

Questioning the cell theory (cont.)

• APP

AND

S • ON

LICATI

S • ON

Questioning the cell theory

• APP

Cell biology

The cells of striated muscle are called myocytes and they originate from the fusion of several myoblasts. Each myoblast has a nucleus so myocytes have several nuclei. Refer to Figures 101, 102.

Stalk

Whorl Scar Nucleus (2n)

FIgure 104, 105 Acetabularia

3. Fungi Figure 101 Striated muscle

sarcolemma peripheral nucleus

Hyphae are the threads that make up some fungi. In aseptate (or coenocytic) hyphae, the usual cross walls, separating the cells, in their hyphae are lacking. Instead there are a number of nuclei in a continuous cytoplasm. The advantage to being aseptate is the greater ease and speed of transport (no cross walls) but when damage occurs to a part of the hypha, a coenocyte will suffer more extensive damage. Pore Septum

mitochondria

sarcoplasm myofibril

Nuclei

Cell wall

Figure 102 Striated muscle cells Refer to Figure 106 (a) and (b).

2. Giant algae Several species of giant algae exist which have their own adaptations to their size. Valonia ventricosa (bubble algae) is a large cell with several nuclei. Refer to Figure 103.

Nuclei

Cell wall

Figure 103 Bubble algae

Figure 106 (a) Many cell walls Figure 106 (b) Fewer cell walls

IL LS

All unicellular organisms need to carry out all functions of life inside their one cell. Two examples will be considered to illustrate this point.

CORE

1. Scendesmus Scenedesmus is a unicellular but sometimes colonial photosynthetic organism. This green algae is found in fresh water in most parts of the world. See Figure 107.

2. Paramecium

Food vacuole

Unicellular organisms are fully functioning individual organisms so they need to be able to carry out all functions of life. The functions of life include:

Anterior contractile vacuole

Pellicle Micronucleus Macronucleus Gullet Posterior contractile vacuole

• metabolism which includes respiration and excretion • response to stimuli: this is also known as sensitivity • growth includes both in cell size and number • reproduction, whether sexual or asexual • homeostasis which means maintaining relatively stable conditions inside the body

Cytoproct Cilia

• nutrition which means the source of food A comparison of these two organisms is shown in Figure 110.

IL LS

Paramecium is a unicellular organism in the kingdom of the Protista. These single celled eukaryotic organisms live in water and feeds on other organisms such as bacteria. Refer to Figures 108 and 109.

Ciliate - Paramecium

Organisms consisting of only one cell carry out all functions of life in that cell © IBO 2014

AND

Figure 107 Scendesmus

1.1.2

LICATI

Paramecium and Scenedesmus (contY) • APP

AND

S • ON

LICATI

S • ON

Paramecium and Scenedesmus

• APP

Chapter 1

Figures 108, 109 Paramecium

Cell biology Characteristic

Paramecium

Scenedesmus

Metabolism

Take up dissolved oxygen from the surrounding water via diffusion through its cell membrane. Carbon dioxide will leave the cell in the same way.

Take up dissolved carbon dioxide from the surrounding water via diffusion through the cell membrane. Oxygen will leave in the same way.

Excretion

Response to stimuli/ sensitivity

Growth Cell size Number Reproduction Sexual Asexual

Homeostasis

Nutrition

Ammonia (nitrogenous waste) is excreted via the contractile vacuole. At night (no light, no photosynthesis) carbon dioxide will be excreted via the cell membrane Carbon dioxide diffuses out via the cell membrane. (diffusion) Paramecium uses its cilia to swim through water. When it Scenedesmus will respond to a light stimulus by hits an obstacle, it will reverse the beat of its cilia and swim growing towards the light. backwards for a little while before swimming forwards again. If necessary, the procedure will be repeated until it has avoided the obstacle. In general, Paramecium will go towards light and away from heat. A Paramecium derived from binary fission will simply regrow to its original size. These cells will experience a loss of vitality (clonal aging) but can be rejuvenated when it undergoes sexual reproduction

Scenedesmus from asexual reproduction is created as a daughter colony of small cells. The individual cells will grow to adult size.

Paramecium has a large nucleus which controls day to day function. The smaller nucleus is involved in sexual reproduction. Paramecium can reproduce asexually via binary fission or it can exchange genetic material of the micronucleus with another Paramecium.

Scenedesmus reproduces asexually by repeated divisions within one cell, forming a daughter colony which is released.

Living in a fresh water environment, the concentration of dissolved particles in the cytoplasm of Paramecium will constantly have water coming in through osmosis. The canals arranged around the contractile vacuoles will collect water, pass it to the vacuole which will contract to expell the surplus water. Paramecium is a heterotroph so it does not make its own food. It uses its cilia to create a water current which sweeps its food (mainly bacteria) into its gullet where they are taken up via endocytosis. Enzymes from the cell will enter the formed food vacuole and digest the food. The digested food will diffuse from the vacuole into the cytoplasm.

CORE

Respiration

It rarely reproduces sexually, usually this process would be stress induced. Depending on circumstances, Scenedesmus can form colonies. In water with low phosphorus and salt concentration, Scedemesmus is unicellular.

Scenedesmus is an autotroph which uses photosynthesis to produce its own food. Each cell has one chloroplast. Scenedesmus produced starch inside the chloroplast and stores it.

Figure 110 Comparison of Paramecium and Scenedesmus

1.1.3 Surface area to volume ratio is important in the limitation of cell size

ÂŠ IBO 2014

The size of a cell is limited by its need to exchange materials with its environment. If a cell becomes too large, its diffusion distance becomes too long to be efficient (diffusion through a liquid such as cytoplasm is a slow process) and its surface to volume ratio becomes too small to allow the necessary exchange. The rate with which a cell produces heat/waste and consumes resources (food and oxygen) is directly proportional to its volume. However, since the uptake of resources and the removal of heat/waste goes via the cell membrane, the rate of uptake/removal is proportional to its surface area.

Chapter 1 As a structure (such as a cell) increases in size, the volume increases faster than the surface area as the following calculation will show.

CORE

A cube with sides of 1 cm has a surface area of 6 × 1 cm × 1 cm = 6 cm2 and a volume of 1 cm × 1 cm × 1 cm = 1 cm3 which means a surface area: volume ratio of 6:1. This means that every 1 cm3 of volume has 6 cm2 of surface area. A cube with sides of 10 cm has a surface area of 6 × 10 cm × 10 cm = 600 cm2 and a volume of 10 cm × 10 cm ×10 cm = 1000 cm3 which gives a surface area: volume ratio of 600:1000 = 0.6/1. Refer to Figure 111.

1.1.4

10 cm cube 2 Surface area = 600cm 3 Volume = 1000cm

Figure 111 Comparing SA and V

This means that every 1cm3 of volume has 0.6 cm2 of surface area. This is one tenth of the surface area per cm3 volume if you compare it with the smaller cube. As can be seen, the volume increases more rapidly than the surface area which eventually creates a problem for the cell because it may not be able to take up all it needs or give off all its waste (both often occur via diffusion/active transport through the cell membrane). It is even possible that not enough heat can be given off. Evolutionary solutions to this are to increase the surface area by protruding extensions or by flattening the cell. Multicellular organisms face the same problem. This is why, for example, we have lungs (structures in lungs increase the surface area available for gaseous exchange) and a circulatory system (blood carries materials round the body, reducing the diffusion distance).

The contraction of one muscle cell has very little effect. The contraction of all the cells in a muscle causes e.g. a limb to move. This is not an unexpected property but rather an expansion of the property of one cell. In populations or other biological systems, the system can have properties that may not have been expected by looking at the individual. Individuals vary, both within and between populations and the result their interaction is not always predictable: the whole is greater than the sum of its parts.

1.1.5

1 cm cube 2 Surface area = 6cm Volume = 1cm3

Multicellular organisms have properties that emerge from the interaction of their cellular components

Specialised tissues can develop by cell differentiation in multicellular organisms © IBO 2014

While every cell contains all the genetic information to carry out every function, only a small portion of the genetic material is activated. A cell in your toe has the information on how to make the pigment which colours your eyes, but will not use it.

1.1.6

Differentiation involves the expression of some genes and not others in a cell’s genome © IBO 2014

Cells differentiate by expression of some of their genes and not others. The genes which are not expressed by the cell, remain present in the nucleus but are packed away so tightly that they cannot be accessed. Euchromatin is light grey when viewed with an EM and heterochromatin is dark grey. Euchromatin often represents the genes that are used (transcribed), while heterochromatin tends to contain the inactive genes. Cells affect each other. The differentiation of any one cell is determined by the cell’s position relative to others and by chemical gradients. As a result of differentiation and specialisation, the structure of the cell will change to best suit its specialised function, which will make it more effective and efficient. The relationship between structure and function is an important aspect of Biology. Specialised cells with a similar structure can work together. They are called a tissue. Several tissues can form an organ which, with other organs, can form an organ system. An individual has several organ systems.

Embryonic development Stem cells are unspecialised cells. An embryo is a source of stem cells because the cells can become any type of cell and are ‘totipotent’. After many divisions, the zygote has become a ball of cells or blastocyst. These cells can become almost any type of tissue and are considered ‘pluripotent’. The “embryonic disk” in the blastocyst will develop into three germ layers : the ectoderm, the mesoderm and the endoderm. Refer to Figure 112. From these germ layers, different tissues and organs will develop as shown below. At this stage, the embryo is only a few days old and the cells of the germ layers are no longer totipotent. Germ Layers Ectoderm Mesoderm

Endoderm

Tissues and Organs skin+hair+nails,brain+spinal cord+neurons cartilage, bone, muscle, heart, blood, blood vessels, reproductive organs, kidneys stomach and colon, liver and gall bladder, pancreas, respiratory system, glands : thymus, thyroid, parathyroid

Figure 112 How tissues and organs develop

Therapeutic use of stem cells

LICATI AND

IL LS

Stem cells are different from ‘normal’ cells in two ways: 1. Stem cells are undifferentiated This means that they have not yet specialised into a certain type of cell. As a result, all (or most) of their genes can still be expressed.

CORE

The capacity of stem cells to divide and differentiate along different pathways is necessary in embryonic development and also makes stem cells suitable for therapeutic uses © IBO 201

S • ON

1.1.7

• APP

Cell biology

2. Stem cells are self-sustaining They can divide and replicate for long periods of time. The most interesting characteristic of stem cells is their ability to differentiate into specialised cells when given a certain chemical signal. Theoretically, you could make a stem cell replicate and then differentiate into liver cells and grow a new liver this way but this is not (yet?) possible. The therapeutic use of stem cells is sometimes referred to as cell therapy. In cell therapy, cells that do not work well are replaced with healthy, functioning cells. The most common example of cell therapy is a bone marrow transplant. This technique has been used for more than 40 years. Cells in the bone marrow produce blood cells. People with leukemia can receive a transplant of healthy, functioning bone marrow which may cure their disease. The simplified technique for the use of Stem Cells is shown in Figure 113.

Experiments to study development and gene control

Drug development and toxicity tests Cultured pluripotent stem cells Tissues/Cells for therapy

Bone marrow

Nerve cells

Heart muscle cells

Pancreatic islet cells

Figure 113 The uses of stem cells

Chapter 1 A case study: Adam’s Journey The following account has been extracted directly from an online blog and is published with the consent of Adam and his family in the hope that it may inspire others. (Editor’s comments such as this are in italic) Background (2001-2010)

CORE

Adam’s struggle with cancer has been going on for 9 years now since first diagnosed at the age of 17 months. The most recent battle began on the 3rd of August 2010 when his bone marrow biopsy came back positive again for Acute Lymphoblastic Leukaemia. Adam is ready to face the ongoing treatment to try and eliminate his leukaemia once and for all. Adam needs a bone marrow or ‘cord blood’ (containing stem cells) transplant to try to successfully cure his leukaemia. His past two chemotherapy treatments, although successful in eliminating his leukaemia for periods of time (2 ½ years off treatment after the first treatment and 22 months after the second treatment), have obviously not got rid of the disease for good. Unfortunately, he and his family need to travel to the specialist transplant unit at the Children’s Hospital in Randwick, Sydney, Australia. Irradiation (November 2010) Three days of Total Body Irradiation was an experience. (Adam needed 3 days of total body irradiation to destroy all of the cancerous cells including his own stem cells that give rise to his blood cells and the cancerous cells.) Adam did really well, he was a champion, letting the radiotherapy team do their job ‘packing him up’ ready to treat and then staying still for the 45 minutes of radiation. He managed all 6 treatments very well and only had challenging side effects on the evening of the first day. After conditioning over the last eight days, we finally arrived at day zero. Transplant (December 2010) With four nurses to ensure the procedure was done properly, Adam received his lifesaving donation of blood from an umbilical cord from a (compatible) newborn baby by transfusion (pic). (This is to introduce new stem cells into Adam’s body). Adam did really well with the transplant and has had an afternoon sleep which was really nice. He has worked so hard mentally over the last few days and it was great to see him relax a little. We now wait for the cord blood stem cells to en graft, which could be weeks away. So lots of waiting and praying that he stays ‘bug free’ (i.e. no bacterial infections). Cord blood remains in the umbilical cord of a baby after birth and contains a rich source of cells called ‘stem cells’. These cells have the unique ability to differentiate or develop into a range of different cell types. In receiving cord blood it enables the donated stem cells in the blood to rebuild Adam’s immune system because these stem cells differentiate into red and white cells and platelets. As a result of growing a whole new set of bone marrow cells from the donor, Adam now has a new blood type! Recovery (2011- ) Since returning home, Adam has been enjoying getting back into some normal activities, like his usual household jobs, such as emptying the recycling, setting the table, walking the dog (pic) and emptying the dishwasher. This has been great for smooth family dynamics and nice to see Adam coming out of ‘patient’ mode. We have been on a family bike ride every Saturday, not a long way, but a good ride. School work is back on the agenda a bit more consistently, with work from the hospital school and soon some work from Adam’s class this year. It all takes a bit of time to get organised and back into a routine. Graduation (December 2013) At the time of writing this book (January 2014) Adam has graduated from Primary School (pic) and is preparing to begin his secondary schooling. He is actively involved in many sports and won a school award for Leadership and Involvement. As a result of this ‘journey’ Adam has been inspired to study hard to become a Doctor and help others, as medical staff have helped him. His friends and family will continue to support him and we wish him the very best as his journey continues.

IL LS

Stargardt’s disease is a condition found where the macula (the centre of the retina which is the layer of light sensitive cells we need to see) degenerates. While a certain amount of degeneration is common in the elderly, people with Stargardt’s disease experience macular degeneration from childhood and can be seriously visually impaired by the time they are twenty.

The uses of stem cells

The condition has a strong genetic component so it will affect both eyes. Research in rats and mice, using embryonic stem cells showed a considerable improvement in their vision. Small scale trials with human embryonic stem cells are being carried out in 2013 and at least one patient’s vision has improved drastically.

Stems cells are very malleable, making them ideal for experimentation. Their development can be channelled to replace body tissue that has been damaged or does not function as it should. Examples of uses include growth of replacement heart valves, treatment of diabetes mellitus and Parkinson’s disease. In the future they may be able to be used to repair damaged organs. However, to treat such conditions, significant scientific hurdles such as immune system rejection of stem cells will need to be overcome. There is also the risk that manipulated cells could follow pathways that are unexpected, such as the development of tumours. Use of human embryonic stem cells for experimentation requires the destruction of a human embryo. To many people destruction of the embryo means the death of a human individual. This is unacceptable to most cultures and religious traditions. Where such cultures and religious traditions are influential, such experimentation is limited or not possible. Today scientists are divided in their ability to research the ability of stem cells by cultural and religious as well as legal borders. Do you know someone who has, or could possibly make use of this technology? Does this personal relevance influence your ethical perspective? Should it?

LICATI AND

IL LS

While stem cells have already been used effectively and research is done into further applications of this exciting technology, there are also drawbacks to consider. This often poses an ethical dilemma, weighing up arguments for and against or more simply potential ‘gain’ with possible ‘pain’.

CORE

Ethics

• APP

AND

S • ON

LICATI

S • ON

Stargardt’s disease

• APP

Cell biology

In adult stem cell therapy, the cells of an adult (donor) are used to replace e.g. bone marrow of a leukemia patient. In other cases, it might be possible to use stem cells from the patient, e.g. to help repair cartilage damaged in an injury. The success rate is high, when the patient’s own cells are used there is no risk of rejection and the ethical concerns are minor compared to the use of embryonic stem cells. Embryonic stem cells are harvested from blastocysts which are destroyed in the process. Embryos left over from IVF treatments, due for destruction can be used in some countries. Not only does the use of embryonic stem cells cause ethical concerns but the reason for their use (undifferentiated, able to divide) also makes them more difficult to control. In addition, there may be issues with rejection. Both in adult and embryonic stem cell therapy, there is an increased risk of the recipient developing cancer. China and Mexico are among countries which have the most liberal approach to embryonic stem cell research and therapy. Stem cell research is progressing and promises great benefits in the years ahead. It depends on the work of teams of scientists in many countries who share results in a variety of ways thereby speeding up the rate of progress. Of course, national governments are influenced by local, cultural traditions which have a profound effect on the work of scientists and the application of stem cells in therapy. or a very long time, people did not know cells existed. The discovery of cells was linked to the developments in technology, in particular the ability to produce high quality lenses for microscopes. A series of steps led to the discovery of cells, most of them being related to the advances in technology. You can see that it involves a sequence of discoveries, often made by scientists in different countries.

Chapter 1

1.2 Ultrastructure of cells

Cell wall

Eukaryotes have a much more complex cell structure than prokaryotes

CORE

1.2.1

Prokaryotes have a simple cell structure without compartmentalisation

ÂŠ IBO 2014

All cells are prokaryotes or eukaryotes. Prokaryotes are considered to be more primitive than eukaryotes and have a simple cell structure. See Figure 115. Characteristic Prokaryotes

Eukaryotes

Cell structure

simple cell compartmentalised structure without cell structure compartmentalisation.

Membrane bound nucleus Cell type

absent

present

usually unicellular

Size DNA

small (1-10 Îźm) circular, no histones (naked DNA)

Ribosomes Cell division

70S binary fission (simple form of dividing) absent

unicellular or multicellular larger (>10 Îźm) linear, arranged in chromosomes with the help of histones 80S mitosis

Mitochondria and chloroplasts

present (chloroplasts in plants)

Figure 115 Comparing Prokaryotes and Eukaryotes

Refer to Figure 116 which diagrammatically represents a prokaryotic cell. Pili

Ribosome

Capsule

Plasma membrane

The cell wall is made of protein-sugars whereas plant cell walls are made of cellulose. It gives the cell its shape, protects the bacterium from external damage and prevents bursting if the cell has taken up excess water (e.g. in a hypotonic medium). It also anchors the pili and flagella which help some bacteria move.

Plasma membrane The plasma membrane controls which materials enter and leave the cell, either by active or passive transport. It is selectively permeable.

Cytoplasm Cytoplasm is a watery fluid that contains enzymes that control metabolic reactions in the cell and also contains the organelles of the cell.

Pili Pili are thin protein tubes. They are found on the outside of the plasma membrane. Pili can be used to attach the prokaryote cell to a surface or in the process of bacterial conjugation (exchange of genetic material)

Flagella Flagellae are long thread-like structures, made of protein. They are attached to the cell surface and they allow the bacterium to move in a fluid environment.

Ribosome Ribosomes consist of RNA and proteins, they play a key role in protein synthesis. The process is called translation. Prokaryotic ribosomes are 70S. This means that they are slightly less dense and smaller than eukaryotic ribosomes which are 80S.

Nucleoid region The nucleoid region of the cell contains the DNA which contains the genetic material. It is the area from which all processes in the cell are controlled. See Figure 117 (a) and (b) which show several electron Cell wall

Cytoplasm

Nucleoid region (DNA) Flagellum

micrographs (EM) of prokaryotic cells. You may need to do some further research and then should practise drawing a labelled diagram of a prokaryotic cell.

Prokaryotes divide by binary fission Fig 212 f

Figure 116 A Prokarytoic cell

Prokaryotic cells divide by binary fission. The process of binary fission starts with DNA replication which is followed by the separation of the two circular strands of DNA to either side of the cell. Then cytokinesis occurs,

Cell biology

CORE

where the cell divides into two. Each new cell receives about half of the cytoplasm. Subsequent growth will restore each cell to full size. Figure 119 shows an EM of bacterial binary fission which is almost complete. Figure 118 shows this process of binary fission using diagrams.

Figure 119 A Prokarytic cell dividing Figure 117(a) A Prokaryotic cell

1.2.2

Eukaryotes have a compartmentalised cell structure © IBO 2014

The following table (Figure 120) shows the ‘typical’ sizes of most common organelles in cells.

Figure 117(b) A Prokaryotic cell (higher magnification)

plasma membrane bacterial DNA cell wall Bacterial DNA is duplicated

The cell continues to grow

Eukaryotic cell Prokaryotic cell Nucleus Chloroplast Mitochondrion Bacteria Large virus (HIV) Ribosome Cell membrane DNA double helix Hydrogen atom

10 - 100 μm 1 - 5 μm 10 - 20 μm 2 - 10 μm 0.5 - 5 μm 1 - 4 μm 100 nm

= 10 - 100 × 10-6 m = 1 - 5 × 10-6 m = 10 - 20 × 10-6 m = 2 - 10 × 10-6 m = 0.5 - 5 × 10-6 m = 1 × 10-6 m = 100 × 10-9 m

25 nm 7.5 nm thick 2 nm diameter

= 25 × 10-9 m = 7.5 × 10-9 m = 2 × 10-9 m

0.1 nm = 0.1 × 10-9 m N.B. 1000 nm = 1 μm, 1000 μm = 1mm, 1000 mm = 1m.

Figure 120 Typical sizes of cell organelles

The structure of cell organelles, but also of cells, tissues, organs, organ systems and even organisms, is related to their function. If the function of a certain structure changes, this is usually reflected in a change in structure. The relationship between structure and function of exocrine pancreatic cells and of palisade mesophyll cells are explained later in this section. The relationship between structure and function is a key concept in Biology and should be kept in mind at all times. Refer Figure 121.

The cell divides in two

Figure 118 A diagram of binary fission

CORE

Chapter 1 Cell organelle

Structure

Function

Comment

(free) Ribosome 80S Rough endoplasmic reticulum - RER

2 subunits, made of protein and RNA

Site of protein synthesis

Free ribosomes make proteins that are used in the cell

Flattened sacs of membrane, studded with ribosomes

Site of protein synthesis, proteins produced by RER ribosome pass into the lumen of the RER which forms vesicles for exocytosis

Lysosome

Vesicle containing (digestive) Fuses with and digests old cell enzymes which break down organelles and material taken food and waste materials in via endocytosis (intracellular digestion); it also can burst and cause autolysis of a cell.

RER makes proteins that are exported via exocytosis in order to be used outside the cell e.g. proteases, lipase and amylase which are digestive enzymes secreted from the pancreas into the small intestine Contains hydrolytic enzymes called lysozymes which can break down substances in the cell, lysosome content is pH 5 (cytoplasm usually around pH 7) which is optimum for its enzymes.

Golgi apparatus Stack of flattened, membrane Intracellular transport and bound sacs, forming an extensive network in the cell

Mitochondrion

Contain an outer membrane, Involved in the release of energy inter membrane space, inner from organic molecules membrane folded into cristae and matrix (space enclosed by inner membrane)

Nucleus

Largest cell organelle, contains DNA

Plasma membrane

Made from proteins in a phospholipid bilayer which combines hydrophobic and hydrophilic elements which support the selective permeability Watery solution containing many components such as suspended organelles, enzymes, tRNA etc Made of cellulose in plants

Cytoplasm

Cell wall

Chloroplasts

processing and packaging for exocytosis

Outer membrane, inner membrane, grana and thylakoid membranes, stroma

Found in animal cells and possibly in plants and fungi The sacs contain golgi enzymes which modify proteins (from RER) which are transported. Creates lysosomes. â&#x20AC;&#x153;Powerhouseâ&#x20AC;? of the cell.

The link reaction and the Krebs cycle take place in the matrix; the electron transport chain is found on the cristae of the inner membrane and depends on a proton gradient across the inner membrane Contains DNA with histones, mRNA and tRNA are produced in the nucleus. controls the activity of the cell by These control production of enzymes (proteins) transcribing certain genes and required for all reactions. not others Separates the cell from the Lipids give flexibility; proteins transfer molecules outside, selectively permeable to (active transport or facilitated diffusion), plasma control what enters and leaves membranes are involved in process of cell the cell recognition (e.g. rejection of transplanted organ)

Site for metabolic pathways e.g. glycolysis, cytoplasmic streaming moves chloroplasts so they take turns being nearest to the light Maintains the shape of the cell by preventing over expansion of the cell due to uptake of water.

Contains chlorophyll which converts light energy into chemical energy by photosynthesis

Mainly water, some salts and organic molecules e.g. amino acids. Contains cytoskeleton

Found in plant cells Compare the cell wall to a cardboard box and the cell to a water filled balloon. When you add more water to the balloon, it will push against the cardboard and become a sturdy structure. Found in plant cells, not all plant cells have chloroplasts The light-dependent reactions takes place across the thylakoid membrane and depends on an electron gradient across the thylakoid membrane. The light independent reaction takes place in the stroma.

Figure 121 The structure and function of organelles

Cell biology • APP

Recognising organelles

LICATI

S • ON

Comparing plant and animal cells

AND

IL LS

AND

IL LS

Use the information above to see if you can identify and draw the organelles in the electron micrographs in Figures 124 (a)-(f). Answers are given beneath Figure 130.

CORE

LICATI

S • ON

• APP

Relating structure to function is important in Biology. Cells from the pancreas of an animal will be compared to cells from a leaf to illustrate this very important point.

Example: an extensive RER, like in the EM (Figure 124 (a)), suggests a cell which produces proteins for export, such as an exocrine cell in the digestive system, producing digestive enzymes. microvillus

Figures 124 (a) pinocytotic vesicle smooth endoplasmic reticulum glycogen granule vesicle Golgi apparatus

lysosome

free ribosomes

nuclear envelope nuclear pore nucleus

chromatin rough endoplasmic reticulum

mitochondrion ribosomes

plasma membrane

Figure 122 A ‘general’ animal cell Endoplasmic reticulum

Figures 124 (b) Cell wall Ribosomes

Mitochondrion Cell membrane Vacuole

Chloroplast Nuclear pore

Nuclear membrane Nucleus Nucleolus Chromosome

Endoplasmic reticulum

Golgi complex Leucoplast (starch storage)

Figures 124 (c)

Figure 123 A ‘general’ plant cell

Chapter 1

CORE

The function of an exocrine cell in the pancreas is to produce enzymes for digestion (proteases, lipase and amylase â&#x20AC;&#x201C; released into the small intestine via the pancreatic duct). An extensive RER can be seen which produces these proteins. The large black dots are vesicles which contain the digestive enzyme. Only one nucleolus is seen in this EM photograph but as the nucleolus codes for the ribosomal RNA, it would not be usual to find more than one in a cell which uses as many ribosomes as this exocrine pancreatic cell. palisade mesophyll

Figures 124 (d)

Figure 125 (a) A leaf cross-section

Figures 124 (e)

nucleus

Figure 125 (b) A leaf cross-section (magnified)

Figures 124 (f)

The palisade mesophyll cell is a narrow cell, closely packed with its neighbours to expose as many chloroplasts as possible to the light. The large vacuole helps keep the cell turgid and streaming of the cytoplasm with the chloroplasts around the vacuole rotates their position so they take turns being at the top of the cell where there is the most light. The nucleus can be seen as much larger than the chloroplasts. Refer to Figures 125 (a) and (b)

The development of the (light) microscope led to the discovery of the cell. The magnification of the light microscope is limited by the wavelength of visible light (400 – 750 nm). The theoretical maximum resolution (ability to see two separate lines as separate) is half the wavelength which, using light, is 250 nm or 0.25 μm. In reality, the resolving power of most microscopes will not achieve this value. School microscopes usually will show a cell’s nucleus (10-20 μm) and possibly some chloroplasts but to study the ultrastructure of the organelles, an electron microscope is needed.

A light microscope

Size and Magnification

LICATI AND

IL LS

Diagrams and photographs can be shown larger or smaller than reality. To indicate the real size of the object, the magnification can be indicated next to the diagram or picture or a scale bar can be given. Calculating magnification using the scale bar

CORE

Electron microscopes have a much higher resolution than light microscopes © IBO 2014

S • ON

1.2.3

• APP

Cell biology

The scale bar has a size indicated with it. This is the size it would really be but it would then be too small to see. So the image below has been magnified to the picture you see. You can use a ruler to measure the (magnified) scale bar in the picture.

An electron microscope

An electron microscope uses beams of electrons instead of beams of light. The wavelength of the electrons is much smaller and the resolving power of some electron microscopes is less than 1 nm which makes it possible see ribosomes. While lenses were developed over the centuries, the concept of a compound microscope was developed in 1590 (see section 1.1.1). Gradual improvement such as the quality of the lenses caused a sharper image at higher magnification but the limits of the resolving power of the light microscope are linked to the wavelength of the light. However, this only became known in the late 19th century. Although the existence of electrons was suspected, they were not demonstrated until around 1900 and their wave properties took another 25 years. Very soon after that, it became clear that beams of electrons, with a short wavelength, could be directed using magnets, in a similar way that light can be focussed using glass lenses. In 1931, Knoll and Ruska invented the electron microscope although resolution was still low and the image poor. Improvements over the next years included increasing the voltage of the electron beam and increasing the accuracy of the magnets which focussed the beam greatly improved both resolution and quality of the image.

The two sizes of the scale bar are related via the formula: magnified size = real size × magnification Once you know the magnification, you can calculate the actual size of a cell organelle. You can use the same formula to calculate the real size from the measured, magnified size and the magnification. magnified size = real size × magnification Worked example Refer to Figure 124 (a) which shows an electron micrograph of a liver cell. The real size of the scale bar is given as 10 μm but you can measure the scale bar and find that it is 20 mm (approx.). magnified size so using Magnification = real size Magnification = 20000/10 = 2000×

Chapter 1 The history of microscopes

CORE

Although there is no record, a number of people at different times and places, must have discovered that looking through a piece of glass shaped like a lentil, makes things look bigger and that it also focusses the Sun’s light so much that it can be used to start a fire. Eventually, at some time in the Middle Ages, this lead to the invention of the first spectacles. About 3 centuries later, Zaccharias Janssen from the Netherlands discovered that putting 2 lenses in a row, greatly increased the magnification, much more than each lens on its own. This was the first primitive compound microscope. A few years later, Galileo (from Italy) improved on the original idea by adding a way to focus the instrument. Galileo was familiar with the original design of the microscope. It is apparent that microscopes were developed simultaneously in different parts of the world at a time when information travelled slowly. Modern-day communications have allowed for improvements in the ability to collaborate with knowledge and skills thereby enriching scientific endeavour. With advances in technology, lenses became better and the limit of the light microscope was reached. The limit is related to the wavelength of the light used to see the object. The wavelength of light visible to humans Early microscopes is between approx. 400 - 700 nm. The resolving power of a microscope is the ability to distinguish between two lines which are separate. The laws of Physics dictate that the maximum resolving power is half the wavelength of the light used. This means that with the best light microscope humans will not be able to tell apart two lines (or dots) that are closer together than 200 nm (=0.2 μm or 0.0002 mm). This means that we cannot see the two layers of the phospholipid bilayer of a cell membrane, using a light microscope. The membrane is only 7 nm thick so to see the separate layers within the membrane cannot be done with a light microscope. Since the problem is with the wavelength of light, the only solution is to find another way to ‘see’ using radiation other than light. The wavelength of electrons is much shorter than light and the resolving power of a transmission electron microscope is up to approximately 0.05 nm. Since the human eye is not sensitive to the wavelength of electrons, the electron microscope has a screen which lights up when exposed to electrons. Structures which absorb or scatter electrons are shown as dark (black), while structures that transmit electrons show as white. The electron microscope uses magnets to focus the beams of electrons in a way that is similar to the lenses used to focus the light in a light microscope. Despite its limited resolving power, the light microscope is still widely used, partly due to the costs of an electron microscope but also because the light microscope allows us to observe living cells in their natural colours. The electron microscope was invented in the 1930s by Ernst Ruska and Max Knoll from Germany following the first electromagnetic lens which was built in 1926 by Hans Busch, also from Germany. The original electron microscope was a transmission electron microscope (TEM) which sends beams of electrons through the specimen. The scanning electron microscope (SEM) sends beams of electrons at a specimen’s surface where it loses energy. This energy is converted into e.g. low-energy secondary electrons which are detected by the SEM. Their intensity will produce an SEM image of an object. These microscopes are commercially very valuable, not only in scientific research but in a variety of industries.

Cell biology 1.3.1

The structure of biological membranes makes them fluid and dynamic Membrane of endoplasmic reticulum

Plasma membrane Outer nuclear membrane

Thylakoid membrane

Inner nuclear membrane

Thylakoid lumen

Cristae Matrix space

Inner chloroplast membrane

Inner mitochondrial membrane

Stromal Space

Outer mitochondrial membrane

Outer chloroplast membrane

Intermembrane space

Single membrane of peroxisome

Phospholipids form bilayers in water due to the amphipathic properties of phospholipid molecules © IBO 2014

This is the basic structure of a membrane. The function of the plasma membrane is to keep the cell content separate from the outside so that the cell can have a higher or lower concentration of certain molecules, e.g. glucose or enzymes. In order to achieve this function, the plasma membrane must be able to control which substances enter and leave the cell. The phospholipid bilayer is quite effective in stopping molecules from going into or out of the cell. Since the membrane has a non-polar layer in its centre and two polar layers on either side, it is very difficult for both polar and non-polar molecules to pass through both layers. However, every cell needs to exchange materials with its environment and molecules need to enter and leave the cell. This is one of the functions of proteins that are found in between the phospholipid molecules. Due to the fluid structure of the phospholipid bilayer, the membrane proteins can move “sideways” unless they are anchored to a structure inside the cell. Figure 131 shows a diagram of the fluid mosaic

model of membrane structure.

Figure 130 Membranes in a cell

Membranes are found all through the eukaryotic cell. Examples of membrane structures of a eukaryotic cell are found in Figure 130.

phospholipid bilayer

OUTSIDE

glycoprotein carbohydrate

Answers to Figure 124 EMs Figure 124 (a) Rough ER Figure 124 (b) Lysosome Figure 124 (c) Golgi body Figure 124 (d) Mitochondria

INSIDE proteins embedded in lipid layer pore protein forming a passage through the bilayer

cholesterol integral protein spanning the bilayer carbohydrate

Figure 124 (e) Nucleus Figure 124 (f) A liver cell showing

several organelles glycoprotein

peripheral protein

Figure 131 Membrane structure

CORE

1.3 Membrane structure

LICATI

132

CORE

shows an electron micrograph of a neuromuscular junction in a roundworm. The arrows point to the two layers of lipid tails of the phospholipids that make the membrane.

1.3.2

AND

Figure

S • ON

Drawing the fluid mosaic model

• APP

Chapter 1

IL LS

Membrane proteins are diverse in terms of structure, position in the membrane and function © IBO 2014

Structure Some proteins have a carbohydrate group attached to them. They are then called glycoproteins. They play an important role in cell recognition. Figure 132

If you were to build a membrane, you would start with a phospholipid molecule which consists of a polar “head” containing phosphate which is hydrophilic (“water loving”) and 2 fatty acid tails that are non-polar and hydrophobic (“water fearing”). This arrangement is shown in Figure 133 (a). A molecule which has both a hydrophilic and a hydrophobic is said to be amphipatic.

Other membrane proteins are lipoproteins. They are molecules which contain both proteins and lipids which are attached to the protein. Examples are the transmembrane proteins of mitochondria and chloroplasts. A diagram of a possible structure of a lipoprotein is found below. Figure 135 shows Lipoprotein structure (chylomicron),

The following key has been used: ApoA, ApoB, ApoC, ApoE (apolipo-proteins); green (phospholipids). ApoE

ApoB

ApoA

ApoB (a)

(b)

(c)

Figure 133 Components of the cell membrane

You would then combine the phospholipids to form a bilayer. The hydrophilic phosphate heads would be on the outside of the layer because they can interact with water (hydrophilic). The hydrophobic fatty acid tails will be away from the water on the inside of the bilayer. This arrangement is shown in Figure 133 (b). The phospholipid bilayer could form the outside of a sphere, similar to a thin layer of soapy water forming a bubble. If the layer of soap represents the membrane, then the air inside the bubble represents the cytoplasm. This arrangement is shown in Figure 133 (c). Figure 134 shows a similar bilayer structure in a lipid vesicle. This arrangement is quite stable because any change in the relative positions of the phospholipid molecules decreases the interactions between polar parts of Figure 134 molecules and increase interactions between hydrophobic groups and water. This can be compared to mixing oil and water. When left alone, the hydrophobic lipid molecules in the oil will form one layer and the water molecules will form another layer.

ApoC

ApoB

Figure 135 Lipoprotein structure

As membrane proteins are still proteins, there are two common tertiary structures (see 2.4) : α helix and β sheet. Both can be found in integral proteins (see below). 1. and 2. are different arrangements of a helix molecules and 3. is known as a β barrel. The amino acids of the chain which are interacting with the lipid bilayer should be hydrophobic for the structure to be stable. These structures are shown in Figure 136.

Figure 136 Types of protein structures

Cell biology Position There are two kinds of membrane proteins Integral proteins are those in which most of the protein molecule is found in between the phospholipid molecules of the membrane; they interact with the cytoplasm on one side, with external molecules outside the cell and with the hydrophilic section of the membrane in between.

K+ ATP

Peripheral proteins are mostly found outside the phospholipid bilayer in the cytoplasm but interact with the phosphate heads or with the surface of an integral protein; they may not be permanently associated with the membrane.

Na+

Figure 138 Some membrane proteins are pumps

Function Membrane proteins carry out different functions. They include • Hormone binding sites - hormones transported by the blood will only act on cells that have the appropriate protein receptor on the outside of their membrane. • Immobilised enzymes (also called membrane-bound enzymes) - enzymes arranged into systems in order to make it easier for a sequence of reactions to occur. A good example is the electron transport chain on the cristae of the mitochondrion.

1.3.3

Cholesterol is a component of animal cell membranes. © IBO 2014

Last but not least, plasma membranes contain cholesterol. Figure 139 shows that cholesterol is quite a large molecule. It is usually positioned between the fatty acid tails of the phospholipids and reduces fluidity and permeability. (Note; The IBO syllabus does NOT require students to memorise the structure of cholesterol.)

• Cell adhesion - integral proteins can stick out and bind to specific protein molecules in adjacent cells or they can bind to an extracellular matrix.

• Cell to cell communication - either via direct contact between the membrane proteins of adjacent cells or via signals such as hormones or neurotransmitters. • Channels for passive transport - they are often small proteins where the outside is hydrophobic and the inside of the hollow tube is hydrophilic, allowing polar molecules to enter the cell as shown in Figure 137. hydrophobic

CORE

ADP

hydrophilic

H H

HO Figure 139 The structure of cholesterol

Membranes have varying amounts of cholesterol. If a membrane has a lot of cholesterol, it will be very stable and not very permeable. Membranes of intracellular organelles such as mitochondria have less cholesterol. They are more fluid and more permeable. Cholesterol in mammalian membranes reduces membrane fluidity and permeability to some solutes.

In summary integral protein

phospholipid bilayer

Fig 137 Types of membrane proteins

• Pumps for active transport - e.g. Na+/K+ pump in nerve cells, using ATP to transport Na ions back outside the axon and K ions back in. This is illustrated in Figure 138.

• the main component of membranes is a phospholipid bilayer • membranes also contain integral and peripheral proteins • some of these proteins are glycoproteins (proteins with a carbohydrate attached) • membranes contain cholesterol

Chapter 1 Models of the cell membrane Sequence of events related to the development of the fluid mosaic model for membrane structure.

1888 : Quincke : thin lipid film surrounds cells. 1915 : membranes consisted of lipids and proteins. This did give the components of the membrane, but not the structure. 1925 : Gorter and Grendel: phospholipid bilayer The problem was that this model did not explain how the membrane was permeable to some compounds and much less to others. Danielle observed and measured the surface tension of membranes and lipid bilayers and thought to explain the difference by suggesting a trilayered structure 1935 : Davson and Danielli : phospholipid bilayer between two layers of globular protein (sometimes called the sandwich model) Protein

10 μm Figure 141 An EM of two adjacent membranes

There were a number of problems with the DavsonDanielli model : • It would not allow for the fluidity that membranes are known to have, without breaking bonds between the proteins. • When artificial membranes were made from phospholipids (without protein), they still showed the three layers under EM. • Different protein/lipid ratios are found in different membranes. • These proteins had large hydrophobic sections which would have been chemically unstable if they had been situation between water and the polar head of the phospholipid. • In 1966, the “freeze-fracture method” was applied to cell membranes : they were frozen and split apart and showed the inner face of the phospholipid bilayer : a smooth area with protruding bumps (the proteins). The protein showed up in the middle of the phospholipid bilayer but according to Davson and Danielli, the proteins were on the outside.

Phospholipid Bilayer

Protein

Figure 140 An early model of membrane structure

They added the protein layer on either side of the phospholipid bilayer to explain the energy needed to cross the membrane (this energy is just needed to cross the hydrophobic core of the membrane). The use of the electron microscope in the late 1950’s seemed to confirm the tri-layered structure. Refer to Figure 141.

So further research occurred: 1970 : Frye and Edidin: membranes are fluid and molecules (e.g. dye) can move laterally. 1972 : Singer and Nicholson : fluid mosaic model : a phospholipid bilayer, hydrophilic on either side and hydrophobic in the centre, interspersed with proteins which can move laterally, so called ‘fluid mosaic’. Protein

Carbohydrate

Cholesterol

Phospholipid Bilayer

CORE

1870’s : plant membranes are permeable to water but not to some chemicals e.g. sucrose

Fig 144 The current model of membrane structure

Cell biology

You may wish to do some research on the history of the light and electron microscopes. You could try searching about, resolution or Anton Van Leeuwenhoek

LED

•

CORE

The natural sciences use the scientific method to explain the physical and living world. The scientific method begins with observations. These observations are used to develop a possible explanation, or hypothesis. The hypothesis is tested through further observations or experiments. Each observation or experimental result is compared to the hypothesis to determine if the hypothesis is valid. If the hypothesis is supported repeatedly it can be confirmed if not then it should be discarded and another may be tried. The philosopher Karl Popper argued that a hypothesis is not scientific if it cannot be shown to be false. This concept of a case where the hypothesis is not supported leads scientists to modify or change their hypothesis in the light of data generated. This criterion is helpful in determining the difference between science and pseudoscience and in the progression of Scientific knowledge. In the case of models of membrane structure, falsification was a powerful tool used in the Singer-Nicholson fluid mosaic model of membranes superseding the Davson-Danielli sandwich model, which had been accepted for more than thirty years. This is discussed more fully elsewhere in this sub-Topic.

Theories and Laws

•

Specimens prepared for viewing with an electron microscope must be specially treated so that the microscope examines an artefact rather than the specimen itself. Electron micrographs are routinely colourised. Colourisation often hides the scope of the difference between images from an electron micrographs compared with images from a light microscope. Some would argue that colourisation is done to reduce awareness of the numerous filters that electron microscopes bring to bear on our perception of the microscopic world. Regardless, the improvements in technology have led to a deeper understanding of the nature of cells and the structural and functional nature of life itself

LED

Knowledge claims made from sense perception are filtered through the limitations of sense receptors and subsequent processing in the brain. An obvious limitation is the inability of the human eye to resolve anything smaller than 200 μm. Observations assisted by technology usually flow through other ‘filters’. Almost all cells, and everything sub-cellular, must be viewed through a microscope of some sort or another as they are smaller than the eye’s limit of resolution. A monocular light microscope produces a two dimensional image of a specimen whereas a binocular microscope may reveal more of the three dimension nature of a specimen. In most cases light microscope specimens are so small and thin that the detail of their contents are very difficult to see so they are treated with stains to allow observation of key cellular features.

EORY TH KN

Hypotheses

•

EORY TH KN

Making accurate observations

Scientific theories, laws and models are the result of the thorough testing of hypotheses in a wide range of circumstances. The term theory in a scientific sense means that the hypothesis is supported by a large body of evidence and is the best explanation that scientists agree upon. For example, the cell theory flowed from several related hypotheses that were tested over many years. It was confirmed as a theory after many observations and experiments made by a large number of scientists. If new evidence comes to light that contradicts or does not fit the explanations made by a theory, the theory will need to be re-examined to determine if it is still valid. The theory may be modified or rejected altogether if it cannot account for the new observations. From your present knowledge of the natural sciences make a list of ‘Theories’ and ‘Laws’, compare this list with classmates.

Chapter 1

1.4 Membrane transport Membranes control the composition of cells by active and passive transport Particles move across membranes by simple diffusion, facilitated diffusion, osmosis and active transport © IBO 2014

Diffusion

Osmosis Osmosis is the passive movement, or diffusion of water molecules, across a partially permeable membrane, from a region of lower solute concentration to a region of higher solute concentration. The nett result is to tend to equalize solute concentrations on either side of the membrane. Two solutions which have the same concentration of dissolved particles are said to be isotonic. When they are separated by a selectively permeable membrane, water molecules will move between them but the net movement will be zero. When they have different concentrations of dissolved particles (and therefore different concentrations of water), there will be a net movement across the selectively permeable membrane from the solution with the least dissolved particles and therefore the most water (the hypotonic solution) to the solution with the most dissolved particles and therefore the least water (the hypertonic solution).

H2O

Isotonic

Hypotonic

As a result, the red blood cells would start to take up water by osmosis and would burst. Haemoglobin does not work well outside the red blood cells and the patient could die. For the same reason, tissues or organs, e.g. for transplantation, must be bathed in an isotonic solution to prevent their cells from either taking up water and bursting (in a hypotonic solution like water) or losing water and shrivelling up (in a hypertonic solution concentrated salt solution). Refer to Figure 150.

Hypertonic

Figure 150 Osmosis with red blood cells

Kidney dialysis

LICATI AND

IL LS

One way that this principle is utilized is with kidney dialysis which artificially mimics the function of the human kidney by using appropriate membranes and diffusion gradients. Our kidneys remove waste and surplus water and minerals from our blood. Without this function we die. Fortunately, dialysis is a process available to people without (fully) functioning kidneys. Refer to Figures 151 and 152 below. Line artery to vein pump

Tubing made of a selectively permeable membrane

Dialysing solution Line from apparatus to vein

Use of osmosis with tissues and organs In order to prevent osmosis, tissues or organs to be used in medical procedures must be bathed in a solution which is isotonic. In the medical field, osmosis is a very powerful mechanism that should not be underestimated. Dehydrated patients are given fluids by IV. If this IV fluid were water, it would increase the concentration of water in the blood.

H2O

S • ON

Diffusion is the passive movement of particles from a region of high concentration to a region of low concentration.

H2O

• APP

CORE

1.4.1

Fresh dialysing solution

Used dialysing solution (with urea and excess salts)

In dialysis, a patient’s blood is passed over a selectively permeable membrane. On the other side of the membrane is a solution of water, glucose and salts. Waste (e.g. urea) and surplus minerals from the blood will diffuse through the membrane (since their concentration will be lower in the dialysis fluid), leaving the patient’s blood clean. Red blood cells and large molecules (e.g. proteins) are too large to diffuse through the membrane. Clean blood (at the right temperature) is returned to the patient’s vein. Urea Urea diffuses out of blood

Glucose

Dialysis fluid moves this way No net movement of glucose

Blood moves this way Dialysis membrane

Cell biology

The same can be done with an unknown solution. Use dialysis tubing to create the required number of bag, containing the same amount of unknown solution. Place in known concentrations and continue as above. Even slight errors will seriously upset your results which brings to mind the accuracy of your equipment. If you only have kitchen scales available, using large pieces of potato (20 g or more) will work better than using pieces that are 2 g or less because the inaccuracy of your equipment will be a smaller proportion of your results.

It is important to remember that both simple diffusion and facilitated diffusion are passive transport. This means that they do not require energy but it also means that the direction of the diffusion is down the concentration gradient. Simple diffusion is possible for small, non-polar molecules such as oxygen. They can diffuse across the membrane without additional assistance. However, for polar molecules (ions), the membrane forms a barrier that is difficult to cross without help. One of the possible methods is facilitated diffusion.

Extracellular space

CORE

It is easy to do simple experiments with osmosis in school or at home. You can create a number of similar pieces of potato or carrot (avoid using the skin), weigh them and place them in a range of solutions of known salt concentration. After time (2-24 hrs), take them out, pat dry with a tissue and reweigh. Calculate percentage gain or loss and plot a graph. When the piece of potato or carrot did not gain or lose mass, it was in an isotonic solution.

carries the glucose molecules across the membrane and releases it inside the cell. The transport protein goes back to its original shape and is ready to move the next glucose molecule into the cell. Refer to Figure 153.

Protein channel Cell membrane Carrier proteins Intracellular space

Figure 153 Mechanisms of facilitated diffusion

A difference in simple diffusion and facilitated diffusion can be found in the rate of diffusion when the difference in concentration between the inside and outside of a membrane increases. In simple diffusion, the rate of diffusion will be directly proportional to the difference in concentration while in facilitated diffusion, the number of protein channels or the number of transport proteins becomes the limiting factor and the increase in the rate of diffusion is no longer directly proportional to the increase in concentration difference. Refer to Figure 154.

Simple Diffusion Transport Rate

Investigating Osmosis

Facilitated Diffusion Saturation Level

Facilitated Diffusion Substrate Concentration Figure 154 Rates of diffusion

Facilitated diffusion

Active transport

There are two possibilities for facilitated diffusion, both using proteins in the membrane. They are channel proteins and transport proteins and both are passive transport.

Active transport requires energy. It will not take place unless ATP is available. Active transport often moves particles against the concentration gradient, that is from low to high concentration. An example is the sodiumpotassium pump. Refer back to Figure 138.

Channel proteins create a hydrophilic pore in the membrane through which small polar molecules (e.g chloride ions Cl-) can diffuse into the cell. These channels can be opened or closed so there is control over the amount of particles that move. They are also specific to which ion can pass through. Transport proteins can help move substances such as glucose or amino acids into the cell. The transport protein has a binding site specific for glucose. Once glucose binds, there will be a change in the structure of the protein which

The proteins involved in active transport are often also referred to as carrier proteins. The process is not very different from facilitated diffusion but remember that active transport requires energy (ATP) and may go against the concentration gradient.

Chapter 1

CORE

Nerve transmission Carrier proteins or membrane pumps include e.g. the sodium-potassium pump. A protein in the plasma membrane can move sodium out of the cell and potassium into it even though the concentration of sodium outside is higher than inside and vice versa for potassium. This is important in the functioning of nerve cells. The proteins involved in this process are selective. The structure of the sodium-potassium pump is slightly more complex than the diagram about its function suggests. As you can see below, several subunits work together to move 3 Na+ into the cell while taking out 2 K+, using the energy of one ATP molecule. Refer to Figure 155.

Cytosol 3 Na+ ADP + Pi

Figure 155 The sodium-potassium pump

This makes the concentration of potassium ions (K+) inside the cell higher (20 times higher in a squidâ&#x20AC;&#x2122;s giant axons) than outside the cell and the concentration of Na+ higher outside the cell than inside (10 times higher). There are proteins in the membranes of axons which will allow facilitated diffusion of K+ and Na+. This passive transport is down the concentration gradient, so the K+ ions will leave the cell and Na+ would want to enter. However, the membrane is more permeable to K+ leaving than to Na+ entering so the resting potential of this axon is caused mainly by the movement of the K+ ions. Figures 156 (a) and (b) represent the combination of active transport and facilitated diffusion. K+ Channel K

Na+

K Ion too large for pore

Energetically unfavourable to shed water shell

Figures 156 (a) Active transport and (b) Facilitated diffusion

Glucose transport across membranes

When glucose is absorbed from the lumen of the small intestine into the epithelial cells of the intestine, the process used is active transport while glucose is absorbed into red blood cells by facilitated diffusion.

FXYD2

Na+ Channel

Ions are charged and therefore connect with polar water molecules. This cluster of the ion with its water molecules will be too large to go through a channel. Therefore the ion will break its electrostatic positive-negative forces with its water molecules by forming new, more energetically favourable, connections with the channel protein. It can then travel through the channel and reconnect with new water molecules on the other side. Sodium cannot use this channel as the ion is too small to form the connections to lose its water molecules.

Glucose can move across membranes via facilitated diffusion or via active transport.

Extracellular

ATP

The structure of the potassium channel protein is such that it allows passage of K+ but prevents the (smaller) Na+ or other ions from passing. Refer to Figure 156 (a) and (b).

The reason for this most likely lies in the variation in concentration of glucose in the small intestine. After a meal, the concentration of glucose in the small intestine can be quite high, which would make facilitated diffusion for the uptake of glucose a good option. However, several hours later, the concentration of glucose in the lumen of the gut would be very low. If facilitated diffusion were in place, it would then move glucose out of the cell, into the lumen of the digestive tract where it could move on to be egested and be lost to the organism. As active transport only works in one direction, this is the method used to absorb glucose from the small intestine. When glucose is used for energy inside a red blood cell, the concentration drops and glucose is absorbed from the blood via facilitated diffusion. Since the red blood cell has no way of producing glucose, the concentration will never be higher than that of the blood plasma around so facilitated diffusion in this case will never go into the other direction.

Cell biology The fluidity of membranes allows materials to be taken into cells by endocytosis or released by exocytosis. Vesicles move materials within cells © IBO 2014

From the fluid mosaic model, it can be seen that membranes are not static structures. The molecules making up the membrane can move in the plane of the membrane. Also this structure has some flexibility so that small amounts of membrane can be added or removed without tearing the membrane (this is called endocytosis and exocytosis). Endocytosis is an active process of taking up materials. The cell membrane will engulf the matter that is to be take up as can be seen in Figure 157. Unicellular organisms such as Paramecium will feed this way and some white blood cells will take up foreign cells (e.g. bacteria) this way, which will stop them causing infection. Exocytosis is the reverse process. This can also be seen in Figure 158. particle

receptor

nucleus

plasma membrane

Figure 157 The process of endocytosis

Since the structure of the plasma membrane is essentially the same as that of the nuclear envelope, the endoplasmic reticulum (ER) and the Golgi apparatus, it is possible to exchange membrane sections between them, within the cell. As Figure 158 illustrates, intracellular transport often involves the use of vesicles for transport within the cell and subsequent exocytosis. nuclear pore

Golgi apparatus

apparatus is to prepare substances for exocytosis. This may involve modifying the protein before wrapping the substance in a section of membrane from the Golgi apparatus. This membrane then joins the cell surface membrane in the process of exocytosis. Many of the substances which the cell ‘exports’ are proteins and hence the following organelles and processes are involved: • The nucleus which contains chromosomes that, in turn contain genes coding for proteins. Messenger RNA (mRNA) is then made by transcription and passes from the nucleus into the cytoplasm. • The rough ER which contains the ribosomes which make proteins, intended for export, by translation, using the information from mRNA. • The protein then goes into the lumen of the RER and is surrounded by membrane. • It moves to and fuses with the Golgi apparatus for processing before it is wrapped up again in membrane and leaves through the cell surface membrane by exocytosis. There is no continuous connection between the rough ER and Golgi apparatus. There is, however, an indirect connection made by membrane-bound secretory vesicles, which bud off from the ER and move to the Golgi apparatus, where the membranous components fuse and the contents of the vesicles are delivered for modification within the Golgi apparatus. In turn, secretory vesicles from the Golgi can leave the cell via exocytosis at the plasma membrane, where again fusion of membrane components occurs. Refer again to Figure 158. Figure 159 shows a very brief summary of 2 aspects of

membrane transport. Process

ATP required

Diffusion Facilitated diffusion Osmosis Active transport with carrier proteins Endocytosis

no no no yes yes

Concentration gradient down down down against is possible against is possible

Figure 159 How materials can enter a cell nucleus

rough ER

transport vesicles

secretory vesicle

Figure 158 Vesicle formation for exocytosis

The nucleus produces mRNA which codes for a specific protein, e.g. a digestive enzyme that needs to go into the digestive tract. The RER produces the proteins that are intended for export and the function of the Golgi

CORE

1.4.2

Chapter 1 Organ donation It is important for students to become critically aware, as global citizens, of the ethical implications of using science and technology.

CORE

Organ donation raises some interesting ethical issues, including the altruistic nature of organ donation and concerns about sale of human organs.

Information, considerations and questions These could be used to start class discussions.

•

Organs are often donated by (relatives of ) people who die in an accident but sometimes living donors are possible. Examples would be kidney donors (you can live with one kidney) or bone marrow.

•

In most countries, there are long waiting lists for organs, i.e. there are more potential recipients than donors. Patients die due to a lack of organs available for transplantation.

•

Should the law be reversed and everyone become a donor? (unless carrying a card which states you do not wish this).

•

In many places, organs will only be harvested with the relatives permission, even if the deceased carries a donor card. The living relatives can cause problems for a hospital, the deceased donor cannot.

•

In almost all countries, it is illegal to sell or buy organs, either from a deceased relative or from a living donor. However, medical tourism (usually involving kidney transplants) can involve the (illegal) sale of a kidney of a living donor which will be transplanted into the tourist. It could be argued that the donor gains financially and the recipient gains the needed organ. The amount of money involved is often substantial to the donor.

•

Given the shortage of organs, should alcoholics, drug addicts, etc be treated the same as recipients with a healthy lifestyle?

LICATI AND

There is an unbroken chain of life from the first cells on Earth to all cells in organisms alive today.

IL LS

Cells can only be formed by division of pre-existing cells © IBO 2014

CORE

1.5.1

• APP

Pasteur’s Experiments (cont.)

S • ON

1.5 The origin of cells

Cell biology

As stated in section 1.1, the cell theory includes the following elements: • All living organisms are composed of cells, and the products of cells (e.g. nails, hair and scales). • Cells are the smallest units of life. • Cells only come from pre-existing cells.

LICATI

S • ON

Pasteur’s Experiments

• APP

The last point of the cell theory is valid under circumstances today. Pasteur’s experiment in 1859 confirmed that living cells do not arise from non-living matter. AND

IL LS

Pasteur prepared a solution that he knew would spoil quickly under normal circumstances. Sources vary but this could have been a broth or a solution of yeast and sugar. He divided the liquid in two identical flasks as shown in Figure 160 (a), brought it to a boil and then allowed it cool down and left it for several days. The top flask remained clear whereas the bottom flask became cloudy, showing bacterial growth. The long thin tube allowing access to air but trapped any particles (bacteria) which could have caused it to spoil. The bottom flask was exposed to the air when the stem was broken. Refer to Figure 160 (a).

Wait

Boil

FIgure 160 (b) Pasteur at work

Pasteur’s experiments were designed carefully. He carried out two experiments at the same time. They were different in only one variable: something from the air could not fall into one of his solutions but it could into the other. Since the experiments were sitting side by side, all other variables were the same. This meant that any difference between their results had to be caused by the one thing that was different. The second experiment (without the long tube) could be called the control: confirming that the solution used was likely to spoil. Pasteur proved that, under the circumstances of his experiment, spontaneous generation does not occur and all cells come from cells. This leads to the following question: ‘Where did the first cell come from’? Read on.

No growth Wait

Boil

Break stem

Microbial growth

FIgure 160 (a) Pasteur’s experiment

Chapter 1

CORE

1.5.2

The first cells must have arisen from non-living material ÂŠ IBO 2014

A variety of Scientific evidence strongly suggests that the Earth was formed about five thousand million years ago from a cloud of dust particles surrounding the Sun. As the mass of the developing planet increased, heat generated by the force of gravity and radioactive decay caused the interior to melt, producing a dense metallic core, composed of iron and nickel. This was surrounded by a cooler liquid mantle. On top of the mantle is the crust which has solidified and formed the continents and the sea floor. During the cooling of the crust gases from the hot interior escaped through volcanoes, forming an atmosphere that probably contained hydrogen, water vapour, methane, ammonia, nitrogen and hydrogen sulfide. This mixture of gases lacked oxygen and was termed a reducing atmosphere. The term reducing atmosphere refers to the atmospheric condition on Earth prior to the origin of life when molecular oxygen was absent and reducing agents (hydrogen containing compounds) were present. Refer to Figure 161. gases escape from hot interior of planet through volcanoes to form reducing atmosphere CRUST forms land masses and ocean floors

condensed water vapour forms oceans

MANTLE

CORE molten mixture of mainly iron and nickel Fig 161 Structure of the planet Earth

The following four processes are needed for the spontaneous origin of life on Earth 1. The non-living synthesis of simple organic molecules The early Earth is presumed to have provided all of the elements and chemical compounds needed for life to begin. It was believed that the early oceans contained a mixture of simple inorganic molecules that were converted into simple organic molecules. The organic chemicals may have been generated on the Earth or introduced from space.

2. The assembly of these molecules into polymers The simple organic molecules present in the oceans would have needed to undergo a process of polymerisation to form the larger more complex organic chemicals needed by cells. A variety of different environments, both hot and cold, have been proposed where this may have occurred. 3. The origin of self-replicating molecules made inheritance possible Self-replicating molecules are molecules that are able to undergo replication, that is, act as a template for copies of themselves to be made. The only biological molecules capable of self-replication are DNA and RNA. DNA can only replicate in the presence of protein enzymes, but certain RNA sequences are capable of self-replication: it can catalyse its formation from nucleotides in the absence of proteins. This is an example of an RNA-based catalyst or ribozyme. Only self replicating molecules are capable of undergoing evolution by natural selection. 4. The packaging of these molecules into membranes with an internal chemistry different from their surroundings The formation of closed membranes is believed to be an early and important event in the origin of cellular life. Closed membrane vesicles form spontaneously from lipids and can maintain different chemical compositions between the intracellular compartment and the extra cellular compartment (surroundings). This allowed for the development of an internal cellular metabolism. After Pasteur showed in 1859 that spontaneous generation was not possible under conditions as they currently are on Earth, Miller and Urey showed in 1953 that under conditions that they thought existed on primitive Earth, it was possible to form some organic compound that would have been needed for life to start. In 2007, analysis of the vessels sealed after the experiment showed a greater diversity of amino acids then originally found. In addition, it is now thought that the atmosphere of primitive Earth had a different composition of gases than Miller and Urey had suggested. Repeat experiments with this different atmosphere created an even greater diversity in organic molecules.

Cell biology Miller and Urey’s experiment Many of the chemicals needed as monomers for the synthesis of biological molecules are thought to have been formed in the shallow waters of the oceans as the products of chemical reactions between simple inorganic compounds present in the atmosphere and water. This mixture of chemicals believed to be present in the oceans is known as primeval soup or simply ‘chemical soup’.

CORE

Miller and Urey’s experiments conducted in 1953 simulated the conditions, believed at the time, to be present on the early Earth. They attempted to establish whether chemical evolution could occur in primeval soup. Chemical evolution refers to the pre-biological changes that transformed simple atoms and molecules into the more complex chemicals needed for the origin of life. Refer to Figure 162.

electrode

electric spark Inlet for gas mixture Condenser

boiling liquid

trap

Figure 162 Miller and Urey’s apparatus

The experiments used water, H2O, methane, CH4, ammonia, NH3 and hydrogen, H2. The chemicals were sealed inside sterile glass tubes and flasks connected together in a loop, with one flask containing water and another with a pair of electrodes. The water was heated to produce steam and sparks were produced between the electrodes to simulate lightning. The mixture was cooled so that the water could condense and trickle back into the first flask in a continuous cycle. At the end of a week of continuous operation Miller and Urey observed that up to fifteen percent of the carbon was present in the form of organic compounds. Thirteen of the twenty naturally occurring amino acids were detected. Later other researchers found that amino acids could be synthesised from hydrogen cyanide, HCN. They also detected a high concentration of the nucleotide base, adenine.

Chapter 1

CORE

1.5.3

The origin of eukaryotic cells can be explained by the endosymbiotic theory © IBO 2014

The differences between eukaryotes and prokaryotes were discussed in Topic 1.2. Eukaryotes have a considerably more complex structure and appear much later in the fossil record than prokaryotes. However, despite structural differences they share many biochemical pathways, for example, glycolysis (see topic 2.8 and 8.2) and the light reactions of photosynthesis (see topic 2.9 and 8.3). The endosymbiotic theory suggests that chloroplasts and mitochondria are derived from free living prokaryote ancestors. They were engulfed by larger prokaryotes but survived inside the cytoplasm and gradually evolved into the chloroplast and mitochondrion. The 64 codons in the genetic code have the same meanings in virtually all organisms, but that there are some minor variations that are likely to have occurred since the common origin of life on Earth. Mitochondria are believed to have evolved from proteobacteria and chloroplasts from cyanobacteria. See Figure 163. Plasma membrane

Cytoplasm

Endoplasmic reticulum

Nucleus

Ancestral prokaryote

Heterotrophic prokaryote

INFOLDING OF MEMBRANE

Chloroplast

Photosynthetic membrane prokaryote

Mitochondrion

ENDOSYMBIOSIS

Fig 163 The endosymbiosis theory

• DNA sequence analysis suggests that plant nuclear DNA contains genes that had previously been part of the chloroplast. • The ribosomes of the organelles closely resemble those found in bacteria (70S). Figure 164 shows the summary of the major events that

may have occurred during the origin of life on Earth and Figure 165 shows the geological time scale. Atmosphere of carbon dioxide, methane, hydrogen, ammonia and water on the Earth soon after its formation. Lighter gases, for example, hydrogen are gradually lost. Simple organic molecules such as amino acids, adenine and ribose are formed by chemical synthesis The primordial ‘soup’ of organic molecules floating on the oceans is concentrated in various possible locations, for example, hydrothermal vents Simple organic molecules are polymerised and coacervates and microspheres are formed Enzymes catalyse further polymerisation and coacervates increase in size, and then break up into smaller coacervates Lipid layers form around coacervates which contain self-replicating molecules, initially RNA and then later DNA. Protein synthesis develops. Primitive anaerobic prokaryotic cells evolve

Listed below is the main evidence that supports the endosymbiotic theory:

Oxygen producing anaerobic autotrophs evolve; the ozone layer forms and chemical evolution ceases

• Both organelles contain DNA that is different from the nucleus and is similar to bacteria.

Aerobic prokaryotic cells develop

• Both organelles are surrounded by two membranes which resemble the composition of a prokaryote cell. • New organelles are formed by a process that resembles bacterial binary fission (see topic 1.1 and 1.2) • The internal structure and biochemistry of chloroplasts is very similar to that of cyanobacteria. • Some proteins encoded in the nucleus are transported to the two organelles. The two organelles have smaller genomes than bacteria. This is consistent with an increased dependence on the eukaryotic host after forming an endosymbiosis. The majority of genes on the genomes of the chloroplast and mitochondria have been lost or transferred to the nucleus. Most of the proteins that comprise these organelles are encoded by genes in the nucleus.

Eukaryotic cells develop via a process of endosymbiosis Colonial forms, for example, slime moulds develop Multicellular organisms evolve from colonial organisms Adaptive radiation gives rise to numerous different species including some capable of colonising land Figure 164 Summary of major events

Cell biology Age / years × 106

Animal groups

Origin of humans

Plant groups

Adaptive radiation of mammals Dominance of flowering plants (angiosperms)

195

Dinosaurs dominant; origin of birds and mammals; insects abundant

Origin of flowering plants

225

Dinosaurs appear; adaptive radiation of reptiles

Abundance of conifers and cycads

280

Adaptive radiation of reptiles; extinction of trilobites

Origin of conifers

350

Origin of reptiles and insects; adaptive radiation of amphibians

Ferns, club mosses and horsetails

400

Origin of amphibians; spiders appear, adaptive radiation of fish (bony and cartilaginous eg sharks)

Earliest mosses and ferns

440

Origin of jawed fish; earliest coral reefs

Earliest spore-bearing plants with vascular tissue

500

Origin of vertebrates, jawless fish, trilobites abundant, adaptive radiation of molluscs

570

Origin of all non-vertebrate phyla

1000

Primitive sponges

2000

Primitive eukaryotes

3000

Blue-green bacteria, eubacteria

3500

Origin of life

5000

Origin of Earth

CORE

Extinction of dinosaurs; origin of modern fish and placental mammals

Figure 165 Geological time scale and history of life

•

EORY TH KN

Emergent properties

LED

From a natural science perspective, the levels of life may be considered to be emergent properties, that is, each level emerges from a level below. For example, at the simplest level, the pumping action of the heart emerges from the interaction of the physical action of the various tissues that form it with the chemicals and nerve impulses entering the tissues. Looking at life in terms of its emergent properties is helpful in developing an understanding of the complexity of life and the interaction of its various components. One of the limitations of taking this reductionist approach to life is that to look at biological processes individually means that we miss the immense level of interaction integral to all living systems. By looking at a process, tissue or organ in isolation we will understand how it functions, but lose a sense of the organism it is part of. In fact, this can lead to a loss of understanding what life is. A heart can continue to pump outside of the body for some time given appropriate conditions. Is it still alive? Looking at life as an emergent property may be seen to imply that life is just a series of chemical and physical interactions without any sense of purpose. Indigenous and Religious knowledge systems take the opposite view – that all life has a deep sense of purpose and value. You might like to consider current examples of such personal and social issues in your culture and, compare to the issues in other cultures.

Chapter 1

1.6 Cell division

INTERPHASE

Growth ( G1Phase )

Cy to k in

Growth & preparation for division ( G2 Phase)

se pha Ana

Once again, we come back to the cell theory and again to the aspect that “all cells arise from pre-existing cells” which leads us to investigate cell division.

es is

Growth & DNA replication ( S phase )

Telophase

CORE

Cell division is essential but must be controlled

Prop h

There are some important terms that need to be understood:

ase

SIS MITO

Interphase is the stage were no activity can be seen through the microscope although a lot is happening Mitosis refers to the process of nuclear division. Cytokinesis occurs after mitosis and is the actual physical division of the cell and is therefore not included in mitosis.

Fig 170 The cell cycle

Only mitosis and cytokinesis are visible under the microscope.

As described above, replication of DNA takes place during the S phase of interphase.

The number of mitochondria and chloroplasts in the cell increases mostly during G2 phase. All through interphase, the chloroplasts and mitochondria absorb material from the cell and grow in size.

Stages G1, S and G2 together are called interphase. Rather than being a ‘resting phase’ as once thought, Interphase is a very active period in the life of a cell, where many biochemical reactions, DNA transcription and translation and DNA replication occur.

The duration of the cell cycle varies greatly between different cells. The cell cycle of bacteria is 20 minutes, beans take 19 hours and mouse fibroblasts take 22 hours. Also the different stages in interphase can last for different amounts of time. However, generally interphase lasts longer than mitosis. The cell division times quoted above are under ideal conditions. Refer to Figure 171.

In order for the cell to function properly, the right reactions must take place at the right time. Within a cell, chemical reactions usually only take place in the presence of the correct enzyme. Enzymes are proteins and are produced by the process of transcription and translation (topic 2.7). State

Name and abbreviation

Interphase Gap 1(G 1) Synthesis (S)

Gap 2 (G 2) cell division

Mitosis (M) cytokinesis

Events

Comments

cell growth,increase in number of cell organelles it starts with DNA replication and finishes when each chromosome consists of two identical sister chromatids attached by a centromere, centriole duplicates cell continues to grow. DNA replication is checked for errors and repaired where needed sister chromatids are separated and divided over 2 nuclei

preparation for cell division process of DNA replication is semiconservative

cell divides, each daughter cell receives one nucleus and half the organelles

Figure 171 The process of cell division

preparation for cell division nuclear division results in two identical daughter nuclei

Cell biology Mitosis is division of the nucleus into two genetically identical daughter nuclei © IBO 2014

Mitosis is a continuous process but people distinguish 4 different phases. The behaviour of the chromosomes in each of the four phases is described below. The purpose of mitosis is to increase the number of cells without changing the genetic material, i.e. the daughter cells are identical to the parent cell in the number of chromosomes, the genes and alleles. Mitosis can occur in haploid, diploid or polyploid cells. The 4 phases of mitosis are

Metaphase • Spindle microtubules attach to the centromeres. • Spindle fibres align chromosomes along the equator (or metaphase plate)

Anaphase • Centromeres separate. • Chromatids separate and move to opposite poles they are now called chromosomes.

Telophase • Chromosomes have arrived at poles. • Spindle disappears.

• Prophase

• Centrioles replicate (in animal cells).

• Metaphase

• Nuclear membranes reappears.

• Anaphase

• Nucleolus becomes visible.

• Telophase When a nucleus is not dividing it can be said that the cell is in interphase. It is important to stress again that nuclear division is a continuous process although it is usually discussed as consisting of four stages. It is more important to know what typically happens in each stage than to be able to determine the stage of every cell in a microscope slide as there obviously are grey areas when the cell is in transition between stages.

• Chromosomes become chromatin. These headings correspond to the stages shown in Figure 172. INTERPHASE

Centrioles Chromatin Nuclear envelope Plasma membrane Nucleolus

PROPHASE

Interphase

Early mitotic spindle

• DNA replication occurs.

Centromere

• At this stage, the genetic material is in the form of chromatin: long strands of DNA with associated proteins.

Chromosome consisting of two sister chromatids METAPHASE

Prophase

Equator

• Chromatin condenses and chromosomes become visible (supercoiling). • Centrioles move to opposite poles and form the aster (animal cells only; plants do not have centrioles) (see diagram below)

ANAPHASE Daughter chromosomes

• Spindle formation. • Nucleolus becomes invisible.

TELOPHASE

• Nuclear membrane disappears.

Nuclear envelope forming

• Proteins attach to kinetochore • Microtubules attach to the chromosomes begin moving

Daughter chromosomes

kinetochore

and

At this stage, each chromosome consists of two identical sister chromatids, held together by a centromere as shown in Figure 173.

Nucleolus forming Cleavage furrow

Figure 172 Stages of cell division

CORE

1.6.1

Chapter 1 Cytokinesis is sometimes included as the last stage of LICATI • APP

AND

CORE

Figures 173 a,b,c,d Stages of mitosis in Whitefish blastula

Figure 174 a,b,c,d,e Allium root tips. part of mitosis.

S • ON

Identifying phases of mitosis telophase; strictly speaking, however, cytokinesis is not a IL LS

Cell biology Phases of Mitosis

Some terms to understand Centriole - cylinder made of microtubules, organise the spindle, found only in animal cells

CORE

Centrosome - consists of two centrioles , oriented at right angles to each other, surrounded many different proteins, plant cells have centrosome without centrioles (IB does not usually use the term centrosome) Centromere - part of the chromosome that links sister chromatids, it ensures that sister chromatids separate and a copy of each goes to each daughter nucleus Kinetochore - the protein complex assembled at each centromere, attachment site for spindle microtubules (IB does not usually use the term kinetochore) Histones - proteins associated with DNA (see Topic 2.6 and 7.1), made from a lot of basic amino acids, organised into histone cores of 8 histone molecules Chromatin - unwound DNA with histones, not visible with light microscope, is actively transcribed and translated, present in interphase Chromatids - DNA with protein, identical copies of the original parent chromosome, connected at the centromere and together called chromosome, when they separate in Anaphase, they are each called chromosome, present after DNA replication in S-phase of interphase until Anaphase Chromosome - supercoiled DNA with protein, visible with light microscope, no transcription, present during mitosis (and meiosis)

For details on DNA structure , see Topic 2.6 and 7.1.

See Figures 175 a-e Stages of mitosis in animal cells using fluorescence.

Chapter 1 The number of chromosomes is not related to evolution or the Kingdom to which the organism belongs. Some examples are given in Figure 178. Species

CORE

Mosquito Gypsy moth Swamp wallaby Aquatic rat Field horsetail (plant, related to ferns) Slime mold (a fungus)

Diploid number of chromosomes 2n = 6 62 10 92 216 12

Due to the absence of centrioles in plant cells, the spindle is less focussed at the poles as can be seen in Figure 180. The mitotic index of a group of cells will tell you how much they are dividing. It is the ratio of mitotic cells to all cells. The mitotic index is an important prognostic tool for predicting the response of cancer cells to chemotherapy. Mitotic index = Number of cells with visible chromosomes Total number of cells in the group studied For example, in plant roots, the cells nearest to the root cap are most likely to divide as the graph below shows where the value has been multiplied by 100 to give a percentage.

Figure 178 How many chromosomes

Differences between mitosis in plant and animal cells can be seen in Figures 173 and 174 and are explained in Figure 179.

Centrosome Aster Cytokineses

Plant usually square

Animal usually round but any shape is possible no centrioles pair of centrioles absent present cell plate forms, pinching in of cell building up of membrane cell wall from centre

Mitotic Index

Shape of the cell

12 8 6 4 2 0

0.5

1.5

Distance from root cap (mm) Figure 182 Where mitosis occurs

LICATI AND

Figure 180 Calculating the mitotic index

S • ON

• APP

Figure 179 Comparing plant and animal cells

IL LS

AND

IL LS

a: Interphase – the lower of the two labelled cells has just completed mitosis but cytokinesis has not yet occurred. b: Prophase c: Anaphase – chromosomes move to opposite poles d: (late) Anaphase – chromosomes have arrived at opposite poles

e: (late) Telophase – 2 daughter nuclei have been formed Number of cells with visible chromosomes Mitotic index = Total number of cells in the group studied There are 31 cells without visible chromosomes and 9 with visible chromosomes so the Mitotic index = 9/40 = 0.225 Sometimes the mitotic index is given as the number of cells in mitosis in a field of vision of the microscope, using a specified magnification.

1.6.2

Chromosomes condense by supercoiling during mitosis

During a large part of the cell cycle, DNA is in the form of chromatin so it can be transcribed. The structure of this chromatin is described in detail in Topic 2.6 and 7.1. The process of supercoiling is necessary for mitosis to avoid the chromatin getting tangled. Without supercoiling, it would be like trying to move several balls of wool through water without getting them tangled. Uncoiled DNA of one human nucleus would be about 1.8 m long. With the DNA organised around the histones, the length has been brought back to 90μm. (= 0.000 090 m). It is recommended to read about DNA structure from Topic 2.6 and 7.1 before reading the next section. Supercoiling depends on the tightness of the double helix in DNA, this is very similar to what happens to a telephone cord. See Figure 185.

Use Figure 180 to name the labelled stages (a-e) of mitosis drawn and then calculate the mitotic index. See Information Box. Coil

Mitosis can be summarised as • the dispersing of the nuclear material, • t he movement of centrioles (if present) to opposite ends, • microtubules developing into a spindle, • the supercoiling of chromatin, • i ts attachment to the spindle fibres at the centromere region, and • t he separation and movement of chromatids to opposite poles of the cell. The result of mitosis is two identical daughter nuclei, each also identical to the original parent nucleus.

Supercoil

Figure 185 Coils and supercoils in a telephone cord.

The elastic band or the telephone cord could be considered the DNA double helix as drawn here. In relaxed DNA, there are 10 basepairs (A-T or C-G) per complete turn of the helix. This is the twist of the helix. Supercoiling occurs when the number of basepairs per link is increased. This will result in some stress in the structure (as it does in the elastic band if you keep twisting it) and as a result, it will fold back on itself, just as the elastic band does. This is called supercoiling. These folds can be called wriths.

CORE

LICATI

S • ON

Calculating the mitotic index

• APP

Cell biology

Chapter 1 Figure 186 shows how the DNA double helix depends on

hydrogen bonding between specific base pairs.

Figure 187 (a) shows how the DNA is arranged around the histones and Figure 187 (b) shows how, subsequently

the histones are folded together into a thicker fibre of solenoids.

CORE

G C C

DNA

G T

H1 Histone

A C

T G

Nucleosome C A

Core of 8 Histone Molecules

T T

C helix G 186 The DNA double Figure

Figure 187 (a) How DNA and Histones are arranged

T G

30nm

C A

G T

Octameric histone core A

T G

C A T

A C

G C

DNA

T T

H1 histone

Nucleosome G C Figure 187 (b) How histones form solenoids

G C

Cell biology 1.6.3

Cytokinesis occurs after mitosis and is different in plant and animal cells

ÂŠ IBO 2014

CORE

Cytokinesis is the process of dividing the cell after nuclear division has been completed. In animal cells, the cell membrane pinches in from the side. In zygotes, the division is cleavage (no cell growth) so it is called a cleavage furrow. When the sides of the membrane meet, they fuse and the two daughter cells are created. In plant cells, material is deposited in the area where the equator was (the middle of the old cell) which forms the cell plate. The cell plate becomes the new cell wall (with membrane) separating the two daughter cells. Refer to Figures 188 and 189.

Figure 188 Photographs of cytokinesis

Vesicles forming cell plate

Cleavage Furrow

Contractile ring of microfilaments

Daughter cells

(a) Cleavage of an animal cell (SEM)

Wall of parent cell New cell wall

Cell plate

Daughter cells

(b) Cell plate formation in a plant cell (TEM)

Figure 189 Matching diagrams of cytokinesis

Chapter 1 Interphase is a very active phase of the cell cycle with many processes occurring in the nucleus and cytoplasm © IBO 2014

Only a small part of the cell’s life cycle is in mitosis, which is the division of the nucleus. Cytokinesis is the division of the cell and follows immediately after mitosis. It can even start before the last phase of mitosis is completely finished. Most of the time in the cell cycle, the cell is in interphase. Stages G1, S and G2 together are called interphase. Rather than being a ‘resting phase’ as once thought, Interphase is a very active period in the life of a cell, where many biochemical reactions, DNA transcription and translation and DNA replication occur. In order for the cell to function properly, the right reactions must take place at the right time. Within a cell, chemical reactions usually only take place in the presence of the correct enzyme. Enzymes are proteins and are produced by the process of transcription and translation (see Topic 2.7).

1.6.5

Cyclins are involved in the control of the cell cycle © IBO 2014

A process as complex as the cell cycle needs careful regulation. This occurs at specific checkpoints during the cell cycle. Some of the proteins involved in this process are called cyclins. Cyclins are proteins which are synthesized and then break down quite rapidly. This causes their levels to go up and down significantly in a dividing cells, a pattern which gave them their name. In the process of regulating the cell cycle, cyclins bind to enzymes called cyclin dependent kinases (CDK). CDKs are activated when attached to cyclin but they still require specific phosphorylation where some sites are phosphorylated but others are not. The process of phosphoryation is controlled by yet another set of enzymes. Refer to Figure 190 (a) and (b).

cyclin MPF

As described above, replication of DNA takes place during the S phase of interphase.

Cdk

combine to form MPF which promotes mitosis

The number of mitochondria and chloroplasts in the cell increases mostly during G2 phase. All through interphase, the chloroplasts and mitochondria absorb material from the cell and grow in size. The duration of the cell cycle varies greatly between different cells. The cell cycle of bacteria is 20 minutes, beans take 19 hours and mouse fibroblasts take 22 hours. Also the different stages in interphase can last for different amounts of time. However, generally interphase lasts longer than mitosis. The cell division times quoted above are under ideal conditions.

Figure 190 (a) How cyclins act

MPF

Molecule concentration

CORE

1.6.4

CYCLIN

Figure 190 (b) Concentration of Cyclins and MPFs

The activated CDKs will then phosphorylate their substrate by transferring a phosphate group from ATP to the substrate which activates them. Two examples may clarify the above: 1. At the beginning of S phase of the cell cycle, S-CDKs are activated by the appropriate cyclin. The activated S-CDKs catalyse the reaction where the proteins are phosphorylated (hence activated) which initiate DNA replication. 2. During mitosis, cyclins activate M-CDKs which phosphorylate (hence activate) several proteins including those which regulate microtubule behaviour and this way create the mitotic spindle.

Cell biology

This does not damage the cell but makes it possible to see which proteins are made with them using autoradiography. The developing embryo took up the amino acids and made large amounts of 3 different proteins. When the procedure was repeated with an unfertilised oocyte these 3 proteins were absent or present in small amounts.

•

LED

The power of the scientific method is seen in the ability to explain and predict what happens in the physical world as a result of thorough testing of a hypothesis. The scientific method is a constructivist approach to the world in that it assumes that knowledge of the material world is a human construction, limited only by the tools of observation and the ability to accurately interpret the data they deliver.

CORE

Cyclins were discovered in 1982 by Timothy Hunt. It was known that there were differences in protein synthesis just after fertilisation compared to what happened in the two cells after the first cytokinesis. Hunt provided the 2 cell embryo of a surf clam which had completed its first cleavage division with amino acids containing a radioactive isotope. See Figure 191.

EORY TH KN

Scientific discoveries

•

The ‘accidental’ discovery of cyclins

Many hypotheses derive from observation, but many others derive from intuition, accident or some might say ‘luck’. Serendipity occurred in the discovery of penicillin by Alexander Fleming and other examples in the pharmaceutical industry. The famous French Scientist, Louis Pasteur is quoted as saying that ’chance favours the prepared mind’. The ‘accidental’ discovery of Cyclins is covered elsewhere in this sub-Topic.

1.6.6 Hunt’s coworker Ruderman repeated the experiment with Asteria, a starfish, she found a similar result. Hunt then used sea urchins to do a similar experiment but this time he took samples of the cell content of the oocyte and the 2-cell embryo at 10 minute intervals.

Mutagens, oncogenes and metastasis are involved in the development of primary and secondary tumours

Cancer is a condition where the patient has one or more malignant tumours. A tumour is an abnormal growth in the tissue which may be malignant, pre-malignant, benign or have no potential to grow into a cancer. Primary tumours are the result of uncontrolled mitotic divisions (proliferation) caused by damage to a cell’s DNA.

Figure 191 Examples of the organisms used

This showed the changing level of specific proteins in the embryo but not in the oocyte. Hunt called the proteins cyclins because they go through a cycle of synthesis and breakdown and then realised that the timing of the cycle was similar to that of the cell cycle and eventually realised they acted as regulators of this process. Since this initial discovery much has been learned about their vital role in regulating cell division.

Secondary tumours are the result of metastasis which is the spreading of cancer cells. Cells from the primary tumour may move to another site in the body and cause a secondary tumour there. Mutagens are factors (chemicals, viruses and radiation) which increase the rate of mutation in a cell. Many mutations cause cancer. Oncogenes have the ability to cause cancer. They turn a normal cell into a (primary) tumour cell. They are often mutated from the original gene (the proto-onco gene). Refer to Figure 194.

Chapter 1 connective tissue

carcinoma of the intestine

muscle cells

Smoking and cancers (cont.)

metastatic cells

• APP

tumour blood vessel

LICATI

S • ON

epithelial cells cancer cells

lymph vessel

AND

IL LS

CORE

The number of patients with lung cancer greatly increases when smoking becomes more popular and unfortunately this trend continues in many countries today. See Figure 196 Relative risk of lung cancer according to duration and intensity of smoking, men Multiplication of cancerous cells

Metastasized cells

10 cigarettes per day 10-19 20+

Healthy cells with on cell cancer

A well known example of a cancer gene is p53. It normally detects damage to DNA and stops the cell cycle until the damage is repaired or causes the cell to die. A mutation which damages p53 seriously reduces the suppression of tumours. Mutations in p53 seems to often result in a higher than usual replication of centrosomes.

40 35 30 25 20 15 10 5 0

Relative risk (%)

Figure 194 Stages of a cancer

Smoking

Pyrene* Naphtylamine* Methanol

Urethane*

(lethal poison)

(solvent)

(used as rocket fuel)

Dibenzacridine* Naphtalene

(used as a herbicide and insecticide)

Cyanhydric acid

Nicotine

Carbon monoxide (found in exhaust fumes)

Polonium 210* (a radioactive element)

(moth repellent)

(was used in gas chambers)

Vinyl chloride

(used in plastic materials)

Ammoniac (detergent)

Toluene

(industrial solvent)

Cadmium*

(used in batteries)

DDT

(insecticide) *Known carcinogenic substances

STOP SMOKING! Figure 195 Chemicals in cigarette smoke

0 1900

ce r an

1000

2000

ath s

0 1925

1950

1975

2000

among men in the United States, Age adjusted to the 2000 US population

Acetone

80 3000

Lung cancer deaths per 100,000

Arsenic

100

4000

Lu n

DANGER POISON

120

5000

More than 30 carcinogenic chemicals have been identified in cigarette smoke. Some are indicated in Figure 195.

It also obvious that it is very common to develop lung cancer approximately 20 years after the patient starts smoking. See Figure 197.

tte

IL LS

50+

40-49

Figure 196 Smoking and lung cancers

cig are

AND

30-39

Years of smoking

Per capita cigarette consumption

LICATI

S • ON

Smoking and cancers

• APP

Although it is difficult to establish the cause of lung cancer in any one person, statistically 93% of people with lung cancer are smokers. Please note that this is not the same as saying that 93% of smokers develop lung cancer as this percentage is much lower. It is also important to note that smoking also has adverse effects on heart and blood vessels and that this kills more smokers than lung cancer.

20-29

Year Figure 197 The delayed onset of cancer

Many countries now have laws about where people are allowed to smoke and how cigarettes must be packaged with health warnings. (Figure 198) Whoever and wherever you are in the world, please understand and remember that, in any language, ‘smoking is a dying habit’.

Figure 198 Health warnings

Cell biology

Multiple Choice questions 1.

The resolving power of a light microscope refers to the smallest distance between two separate lines or points where, using the microscope, you can still see them as separate. If the distance is smaller than the resolving power of the microscope, you will see them as one (blurred) line or dot.

The resolving power of a light microscope is closest to: A

20 nm

200 nm

2000 nm

2 mm

If it was desired to observe the true colour of a coral polyp of diameter 0.02 mm it would be best to use: A

the unaided eye

a light microscope with staining

a light microscope without staining

an electron microscope

Which of the following is NOT part of the cell theory?

only I

II and IV

I and II

all are correct

If a structure increases in size, how does the ratio of surface area over volume develop? A

The volume increases faster than the surface area so the ratio becomes bigger

The volume increases faster than the surface area so the ratio becomes smaller

The ratio remains the same

There is not enough information to answer this question.

The membrane-bound structures eukaryotic a cell are known as: A

cytoplasm

nuclei

granules

organelles

The size of the nucleus of a typical cell is about: A

10 - 20 micrometer

All cells come from pre-existing cells,

50 - 70 micrometer

Cells are the smallest unit of life.

100 - 200 micrometer

All living organisms are made of cells.

10 - 20 mm

All cells have one nucleus

Which of the following statements are correct?

Two cubes have side lengths in the ratio 1:3. Their surface areas are in the ratio:

Eukaryotic DNA is surrounded by a membrane

1:3

1:6

Prokaryotic cells have 70S ribosomes while eukaryotic cells have 80S ribosomes

1:9

1:27

III

Both prokarytic and eukaryotic cells have mitochondria to release energy.

Prokaryotic cells contain associated with protein

within

DNA

CORE

Chapter 1 Revision Questions

Chapter 1 Large fish need to have gills because:

the process by which the cell takes up a substance by surrounding it with membrane

Their bodies have a small surface area compared with their volume. Gills provide additional surface area through which they can exchange gases with the surrounding water.

the process by which the cell takes up a substance by osmosis

the process by which the cell takes up a substance by diffusion

a disease of single celled animals

11.

12.

13.

Endocytosis is:

Their bodies have a large surface area through which they can exchange gases with the surrounding water.

10.

14.

CORE

Their bodies have a small surface area through which they can exchange gases with the surrounding water.

15.

They use them to adjust their buoyancy.

The DNA in the nucleus of eukaryotic cells is: A

linear but not contained in the nucleus

linear and contained in the nucleus

circular but not contained in the nucleus

circular and contained in the nucleus

16.

The largest cell organelle is generally the: A

Golgi apparatus

rough endoplasmic reticulum

nucleus

ribosome

The main reserve food for animal cells is:

17.

In the cell cycle, the interphase is: A

a passive phase between two active phases

an active phase during which DNA replication and many other processes occur

a period when mitosis occurs

a period when cytokinesis occurs

Replicated DNA molecules (chromosomes) are moved to opposite ends of the cell by: A

diffusion

osmosis

the nucleus

spindle fibres

One of the functions of the Golgi apparatus is to:

glycogen

prepare substances for exocytosis

DNA

excrete waste

starch

synthesise proteins.

RNA

respire

What is an important part of the structure of a cell membrane? A

a phospholipid layer

a phospholipid bilayer

a protein bilayer

protein layer

18.

The passive movement of water molecules, across a partially-permeable membrane from a region of lower solute concentration to a region of higher solute concentration is known as: A

diffusion

osmosis

dilution

extraction

Cell biology

20.

21.

The nuclear membrane disappears during the: A

prophase

telophase

anaphase

interphase

The heart, liver and kidneys are examples of: A

organelles

organs

systems

single tissues

Differentiation results in cells: A

transcribing some of their DNA

using all of their DNA during replication

changing type when they replicate

mutating

22. Which of the following is correct? I

23.

24.

The rate of diffusion is affected by the concentration gradient

25.

The development of the EM seemed to support Davsonâ&#x20AC;&#x2122;s and Danielliâ&#x20AC;&#x2122;s membrane model of a phospholipid bilayer with a layer of protein on either side. What was the main reason for this error? A

The proteins in the membrane are not globular as Davson and Danielli predicted

They were observing the membranes of adjacent cells

They did not realise that the phophate heads show up darker in an electron micrograph while the lipid tails in the centre show up lighter.

Different membranes have different protein/lipid ratios.

two

Which of the following statement is correct? I

The sodium-potassium pump is an example of active transport.

Carrier proteins are involved in active transport.

III

Active transport moves particles down the concentration gradient.

Active transport moves particles across the membrane

Diffusion is a passive process

III

Osmosis is a special kind of diffusion

I, II, III and IV

Active transport and endocytosis are processes that use ATP

I, II and IV

II and III

all statements are correct

IV only

none of the statements are correct

statement III is correct

statement I, II and IV are correct

Phospholipids are amphipatic molecules. Why is this a useful property? A

Because it increases the stabibility of the membrane.

Because it allows the membrane more control over the type of molecules that pass through

Because this way they interact with the hydrophobic and hydrophilic sections of integral proteins

All of the above

CORE

19.

Chapter 1 Short answer questions 26.

Arrange the following by size. Start with the largest.

CORE

atom, cell, organelle, DNA double helix, eukaryotic cell, prokaryotic cell, thickness of membranes 27.

A chihuahua (small dog) was gently wrapped in a paper cylinder. Her surface area was estimated to be approximately 0.13 m2. The volume was estimated (using a clay model) at 2 dm3.

The same method was used to estimate the surface area and volume of a child. The child was estimated to have a surface area of 0.9 m2 and a volume of 24 dm3.

28.

29.

(a)

State which organism has the largest surface area.

(b)

Calculate the surface area over volume ratio for the dog and the child.

(c)

Predict which organism would need the most food per kg bodyweight? Explain your answer.

(a)

Draw and label a diagram of a prokaryotic cell as seen with the electron microscope.

(b)

Draw and label a diagram of a eukaryotic cell as seen with the electron microscope.

(c)

List the cell organelles found in eukaryotic cells but not in prokaryotic cells and outline their structure and functions.

(a) Describe the structure of a membrane according to the fluid mosaic model. Use a diagram to illustrate your answer. (b)

30.

Explain why intrinsic proteins in the membrane are arranged so that their non polar amino acids are in the middle of the protein molecule.

Identify during which stage of the cell cycle (Interphase or Mitosis) each of the following occurs. (a)

creation of two genetically identical nuclei

(b)

biochemical reactions

(c)

separation of sister chromatids

(d)

DNA replication

(e)

chromosomes moving to the equator

(f)

protein synthesis

31.

Mitosis is used in several different processes. List as many as you can.

32.

Explain why does the surface area to volume ratio decreases as a cell gets bigger? Outline why this causes problems for the cell.

33.

A light microscope is used to take a photograph of a cell, using a magnification of 400 times. In the photograph, the nucleus measures 8 mm. Calculate the actual (real) size of the nucleus?

13. Biotechnology & bioinformatics 13.1

Microbiology: organisms in industry

13.2

Biotechnology in agriculture

13.3

Environmental protection

13.4

Medicine

13.5

Bioinformatics

Chapter 13

B.1 Microbiology: organisms in industry Microorganisms can be used and modified to perform industrial processes

Microorganisms A microorganism is an organism which is too small to be seen without using a microscope. Microorganisms are single-celled and found in a range of classification groups. Microorganisms include bacteria (prokaryotes), protozoa (for example, paramecium), unicellular algae and the fungi, for example, the yeasts and filamentous moulds, for example, Penicillium. Viruses may also be regarded as microorganisms, but they lack a cellular structure and depend on other cells for their replication. The effect of viruses on other organisms is usually harmful, often leading to disease and death. However, some viral infections of plants seem to have little effect.

Classification of cellular organisms In Topic 1 Cell Biology, cells were divided into two fundamental types: eukaryotes and prokaryotes (Figure 1301). Eukaryotes include protists (unicellular organisms and algae), fungi, plants and animals. The grouping of all bacteria as prokaryotes was based on microscopic observations. Prokaryotes Eubacteria

Archaeans Thermophiles

Gram positive bacteria

Halophiles

Green sulfur bacteria

Cyanobacteria (blue-green bacteria)

Methanogens

Purple sulfur bacteria Spirochetes

Non-photosynthetic gram positive bacteria

OPTIONS

Figure 1301 Classification of bacteria

However, it is agreed by many Biologists that there are three distinct types or domains (see Topic 5, Evolution and Classification) of cellular organisms: the eukaryotes, the eubacteria (‘true bacteria’) and the archaeans (from archaios, meaning ancient). Archaeans are similar to other prokaryotes in most aspects of cell structure and metabolism. However, their transcription and replication do not show many typical bacterial features, and are in many ways similar to those of eukaryotes.

146

Many strains of archaeans are extremophiles and live at high temperatures, but others live in very cold habitats or in highly saline (salty water) or acidic water. However, other archaeans are mesophiles and have been found in marshland, sewage, soil and sea water. They are also found in the intestines of cows, termites and humans. Archaeans (refer Figure 1302) are not known to cause any disease.

Figure 1302 Archaeoglobus fulgidus

Biotechnology Biotechnology can be defined as the application of biological organisms or processes to the manufacturing industry. The agents involved are either microorganisms or enzymes. It is an important part of a wide range of industries, including food stuffs, medical products, fuels, waste treatment and chemicals. The more recent advances result from understanding cell metabolism and its regulation and genetic engineering techniques. Biotechnology has the potential to help solve the problems of an over-populated planet, including shortages of food and energy. Economically, the fermentation industry is the most important area of biotechnology. The term ‘fermentation’ refers to all production of metabolites by cultures of microorganisms, both aerobic and anaerobic. The products include bread, wine, beer, cheese, yoghurt as well as antibiotics, biofuels, hormones (e.g., insulin), enzymes and food additives. Stone-washed denim jeans (Figure 1303) provide a good example of biotechnology. Traditionally the jeans were washed with pumice stones. However, the quality of the abrasion process is difficult to control: too little will not give the desired result and too much can damage the fabric of the jeans. The process is also non-selective and the metal

Figure 1303 Stone washed jeans

Biotechnology and bioinformatics

A biotechnology technique, known as bio-stoning, was introduced in 1989 and widely adopted. Bio-stoning relies on the action of cellullase enzymes to selectively modify the fabric surface. Cellulases digest cellulose, the main component of cotton and other natural plant fibres. The gene for the cellulase enzyme was first isolated from the fungus Trichoderma reesei and then inserted using genetic engineering techniques into bacteria for mass production. Bio-stoning is by far the most economical and environmentally friendly way to treat denim.

B.1.1

Microorganisms are metabolically diverse © IBO 2014

Microbial metabolism Microbial metabolism is how a microorganism obtains the energy and nutrients it needs to live and reproduce. Microorganisms are metabolically diverse and use many different types of metabolic strategies. Species of microorganisms can often be distinguished by their metabolic characteristics. The specific metabolic properties are the major factors that determine its ecological niche and allow that microorganism to be used in various industrial processes.

Eubacteria Photoautotrophs are bacteria that carry out a form of photosynthesis according to the following equation: CO2 + 2H2X → (CH2O) + H2O + 2X where H2X represents a hydrogen donor and (CH2O) represents carbohydrate.

Energy source Types

In the green sulfur bacteria (only found in oxygenfree environments) and the purple sulfur bacteria it is hydrogen sulfide. In the purple non-sulfur bacteria it is an organic compound, e.g., pyruvic acid. Photosynthetic bacteria contain bacteriochlorophyll which absorbs light in the extreme ultra violet. Infra-red Cyanobacteria (‘blue-green algae’) contain chlorophyll and live in fresh water, seas, soil and lichen, and have a plant-like photosynthesis that uses water as a hydrogen donor and releases oxygen as a by-product. Certain bacteria are photoheterotrophs and can absorb energy from light, but are not capable of reducing carbon dioxide. These bacteria must decompose the remains of other organisms to obtain their reduced-carbon compounds. Chemoautotrophs are bacteria that use carbon dioxide as a carbon source but obtain their energy from chemical reactions. The bacteria obtain energy from substances such as hydrogen, hydrogen sulfide, iron(II) ions, ammonia and nitrite ions. They are widespread in soils and water. Nitrifying bacteria, for example, Nitrobacter and Nitrosomonas, involved in the nitrogen cycle, are also examples of chemautotrophic bacteria. Chemoheterotrophs use preformed organic compounds as their source of carbon and energy. Chemoheterotrophs show two basic methods of energy production: respiration and fermentation. Many chemoheterotrophic bacteria are saprotrophic, feeding on dead organic material by releasing enzymes and absorbing the soluble products of enzyme action. They play an important role as decomposers in the nitrogen cycle (see C.6). Some bacteria are aerobic, using molecular oxygen in respiration and releasing carbon dioxide. Anaerobic bacteria use nitrate or sulfate ions, instead of oxygen. Fermenters are examples of anaerobic bacteria. They break down glucose to pyruvate which is then converted into lactic acid, ethanol or other compounds. Fermenters grow in mud, animal intestines and dead tissues. Figure 1304 summarises the four nutritional characteristics

of eubacteria.

Photoautotrophic

Chemoautotrophic

Light

Chemical – from the oxidation Light of inorganic substances during respiration

Green bacteria, cyanobacteria Nitrifying and sulfur bacteria (blue-green bacteria), sulfur bacteria and some purple nonsulfur bacteria

Photoheterotrophic

Purple non-sulfur bacteria (very few)

Chemoheterotrophic Chemical – from the oxidation of inorganic substances during respiration Most bacteria – saprotrophs, parasites and mutualists

Figure 1304 The four nutritional characteristics of eubacteria

147

OPTIONS

buttons and rivets on the jeans, as well as the drum of the washing machine are damaged. This substantially reduces the quality of the jeans and the life of the equipment and increases production costs. Acid washing jeans avoids some of these problems, but add expenses and causes pollution. Treating the waste water and disposing of the sludge (i.e. used pumice or neutralised acid) adds to the production costs.

Chapter 13 Archaeans Archaeans often live in extreme environments and carry out unusual metabolic processes. The archaeans are classified into three groups: • Methanogens are anaerobic and are rapidly killed by the presence of oxygen. Some strains termed hydrotropic, use carbon dioxide as a source of carbon and hydrogen as a reducing agent). Some of the carbon dioxide is reacted with the hydrogen to produce methane, which produces a proton motive force across a membrane to generate ATP. They are common in wetlands, where they are responsible for marsh gas, and in the intestines of cows where they are responsible for wind. They are also common in soils in which the oxygen has been depleted. Others are extremophiles and live in hot springs and hydrothermal vents under the sea. • Extreme halophiles or haloarchaea are found in salt lakes, inland seas, and evaporating lakes of seawater, such as the Dead Sea. They require sodium chloride for growth. They are heterotrophs and respire aerobically. • Thermophiles have been found in hot and deep sea hydrothermal vents. Thermophiles contain enzymes that can function at high temperature. Some of these enzymes are used in molecular biology, for example, heat-stable DNA polymerases for the polymerase chain reaction (PCR), and in biological washing powders.

B.1.2

Microorganisms are used in industry because they are small and have a fast growth rate © IBO 2014

Growth of microorganisms

OPTIONS

Microorganisms are used in the biotechnology industry because their cells are small and they have a high growth rate due to their large surface area to volume ratio. They grow on a wide range of substrates (cheap and often waste substrates) and their small size means they can be easily dispersed into a medium. Each species or stain of microorganism has its own optimum conditions of nutrients, temperature, pH, light (if photosynthetic) and oxygen (if required) within which it grows best. Bacteria can show exponential growth rates under optimal conditions. Bacteria reproduce by binary fission and one bacterial cell is capable of producing 4 × 1023 cells in 24 hours. Bacteria and yeast have simple genetics which can be modified (see B.1.3). Microorganisms have relatively nutritional requirements and their growth conditions can be controlled precisely

148

in fermenters (see B.1.5). A variety of complex chemicals (metabolites) can be manufactured, for example, hormones and antibiotics. Electron microscopy has revealed the nature of the differences in cell wall structure and these are summarised in Figure 1307 and illustrated in Figure 1306. Feature Overall thickness Thickness of peptidoglycan layer Outer membrane with lipoprotein and protein lipo-polysaccharides Protein channels spanning outer membrane (porins) Space between cell membrane and cell wall (periplasmic space)

Gram positive bacteria

Gram negative bacteria

Yes

Sometimes present

Always present

20 to 80 nm 20 to 80 nm

8 to 11 nm 1 to 2 nm

Figure 1307 Differences in cell wall structure

Porins are integral proteins which act as a pore through which molecules can diffuse. Unlike other membrane transport proteins, porins are large enough to allow passive diffusion.

B.1.3

Pathway engineering optimises genetic and regulatory processes within microorganisms © IBO 2014

Pathway engineering Metabolism (Topic 8, Metabolism. Cell Respiration and Photosynthesis) refers to all the enzyme-controlled chemical reactions taking place in cells. It consists of hundreds of linked chemical reactions that form metabolic pathways, such as the oxidation of glucose to produce carbon dioxide and water. Other metabolic pathways include the series of reactions involved in the synthesis of urea in the liver and in the synthesis of cellulose from glucose in flowering plants (angiosperms). These reactions take place in a series of small chemical steps, rather than in one overall chemical reaction. The following simple equation represents a simple linear metabolic pathway, where each letter represents one substance in the pathway. A + B→C →D → E + F In this pathway, A and B represent the reactants and E and F are referred to as the products. Substances C and D are

Biotechnology and bioinformatics • APP

LICATI

The Gram stain, which depends on differences in bacterial cell wall structure (Figure 1305), is an important staining technique used for the classification of eubacteria. It also provides a quick way of identifying pathogenic species which cause disease. Gram staining is not used to classify archaeans, since these microorganisms give very variable responses.

Gram Positive

S • ON

Gram-staining of bacteria

IL LS

Gram Negative Fixation

Crystal violet

Gram positive bacteria have thick peptidoglycan cell walls (Figure 1306) which keep the crystal violet stain when washed with ethanol (alcohol). Gram positive bacteria are more susceptible to both antibiotics and lysozyme than gram negative bacteria. Since gram negative cells no longer have colour, they need to be counter-stained with safranin so that the cell can be made visible. Safranin usually gives the cell a pink colour.

Iodine treatment

Decolorization

Counter stain safranin

Figure 1305 The Gram stain Gram negative bacteria have thinner cell walls with less peptidoglycan. Washing with ethanol removes the crystal violet dye from the peptidoglycan layer. In Gram negative bacteria, the outer membrane forms an extra barrier, making them resistant to disinfectants and dyes, although ethanol can dissolve the lipids.

outer membrane periplasmic space plasma membrane gram positive wall phospholipid

gram negative wall membrane protein

peptidoglycan

lipopolysaccharide

Figure 1306 The structures of gram positive and gram negative cell walls in bacteria

The products of a metabolic pathway may exert control on the overall pathway. For example, ATP produced in respiration acts as an inhibitor for one of the enzymes involved in respiration, so that ATP controls its own production. This is an example of end-product inhibition. Metabolic pathways include • catabolism - the breakdown of complex molecules into simple molecules; for example, cell respiration • anabolism - the synthesis of complex molecules from simple molecules; for example, photosynthesis and

the condensation of amino acids together to form a polypeptide in a ribosome. Catabolism results in the production of ATP and ATP is used as an energy source in anabolism. Pathway engineering (Figure 1308) is defined as the improvement of metabolic pathways by the manipulation of the enzyme and regulatory functions of the cell using recombinant DNA technology. It may also involve bioinformatics (see B.5). Pathway engineering has the potential to produce from simple, readily available, cheap starting materials, a large number of chemicals that are currently derived from nonrenewable resources or limited natural resources.

149

OPTIONS

intermediates. Each reaction in the sequence is catalysed by a specific enzyme so the product of one step provides the substrate for the enzyme that catalyses the next step.

Chapter 13 A simple example of pathway engineering is the introduction of a new metabolite by inserting a new gene into a microorganism. For example, 1,3-propanediol a useful intermediate in the synthesis of polyurethanes and polyesters, is now being produced from glucose by E. coli engineered with genes from S. cerevisiae. Cellulosic biomass Starch Sucrose

6-C sugars 5-C sugars

Metabolism Bulk chemicals

Common targets are glycolysis (Topic 8, Metabolism, cell respiration and photosynthesis), Krebs cycle and amino acid biosynthesis. The target molecules are usually at major branch points within these metabolic pathways. The main goals of pathway engineering are: improvement of yield of a metabolite, a product of a metabolic pathway; extension of enzyme substrate range; reduction of byproduct formation and introduction of pathways leading to new metabolites. Pathway engineering has been carried out in a range of bacteria and yeasts (see Figure 1309). In yeast, pathway engineering has been used to develop yeast strains that can ferment xylose (a breakdown product of cellulose) anaerobically. These new strains can ferment hydrolysed cellulose as a feedstock, which is available in large amounts. The new strain of yeast has a new gene for xylose metabolism introduced by genetic engineering techniques. cell wall nucleus glycogen granule

vacuole

Fine chemicals Drugs Fuels ER

Golgi body

Figure 1308 A summary of pathway engineering

Another simple example of pathway engineering would be to introduce a strong promoter near to the gene coding for a specific enzyme. The promoter would increase transcription of the gene and higher levels of the enzyme would be present in the cell. Higher levels of the product of the enzyme-controlled reaction may then result. DNA microarrays (see B.4) are used to study the transcriptional responses of an organism to genetic and environmental changes.

OPTIONS

B.1.4

Pathway engineering is used industrially to produce metabolites of interest ÂŠ IBO 2014

Production of metabolites by pathway engineering Pathway engineering (or metabolic engineering) is a powerful technique that uses genetic engineering to improve and to introduce new cellular processes into microorganisms.

150

mitochondrion polyphosphate granule

Figure 1309 Structure of a yeast cell in cross section

Recent advances in pathway and protein engineering have made it possible to produce microorganisms which can make hydrocarbons with properties similar to those of petroleum-derived fuels and thus compatible with our existing transportation infrastructure. Linear hydrocarbons (alkanes, alkenes, and esters) typical of diesel and jet fuel can be produced by the fatty acid biosynthetic pathway

B.1.5

Fermenters allow large scale production of metabolites by microorganisms

ÂŠ IBO 2014

Metabolites Microorganisms use small molecules known as metabolites, to regulate their own growth and development, to cooperate in quorum sensing (see B.3) and suppress organisms that are harmful.

Biotechnology and bioinformatics To control competitors, microorganisms produce antibiotics, such as penicillin, antifungals, and herbicides.Â To reduce predation by larger organisms they produce chemicals that act as natural insecticides and to encourage plants and animals they produce growth stimulants and metabolites that inhibit pathogens. Primary metabolites are considered essential to microorganisms for proper growth. Secondary metabolites do not play a role in growth, development, and reproduction, and are formed during the end, or near the stationary phase, of growth.

Use of fermenters Microorganisms may be grown on a large scale to produce a range of primary or secondary metabolites that are useful products to humans, such as antibiotics (for example, penicillins), enzymes, food additives (for example, citric acid) and ethanol (for alcoholic drinks). Fermenters (Figure 1310) are vessels used for the growth of microorganisms in liquid media and allow for large scale production of metabolites by microorganisms. Most of the microorganisms grown are aerobic and hence it is necessary to ensure a supply of molecular oxygen to maintain aerobic conditions. Two main systems are used for culturing microorganisms: batch culture and continuous culture. The larger sizes, thicker cell walls, better growth at low pH, less nutritional requirements, and greater resistance to contamination give yeasts advantages over bacteria for commercial fermentations.

B.1.6

Fermentation is carried out by batch or continuous culture ÂŠ IBO 2014

Batch culture and continuous culture In batch culture, growth of the microorganism occurs in a fixed volume of culture medium and, apart from oxygen gas, substances are not normally added. The microorganism continues to grow in the medium until conditions becomes unfavourable. The growth of microorganism in fermenters is often limited by their own excretory waste products. In continuous culture, fresh medium is added to the fermenter at a constant rate and used or spent medium, together with the cells of the microorganism, is removed at the same rate. The number of cells and the composition of the medium therefore remains constant. The simple fermenter shown in Figure 1311 can be used in a school laboratory to show the principles of microbial fermentation. Before use, the syringes are removed and a suitable culture medium is added. The ends of the tubes are then sealed and the apparatus is sterilised by autoclaving (pressure cooker). The fermenter can be kept at a constant temperature by means of a thermostatted water bath. Filter-sterilised air is supplied by means of a pump and waste gases are passed through another filter. The small syringe at the top of the apparatus is used to introduce (inoculate) the medium with a culture of the microorganism to be grown. Samples of the cells may be removed using the syringe at the side.

filter

attached to pump

filter

OPTIONS

syringe

culture Figure 1311 A simple school fermenter Figure 1310 Small-scale laboratory fermenters

151

Chapter 13 Figure 1312 shows an industrial fermenter and illustrates

how the simple laboratory fermenter is scaled up. Industrial fermenters are often made of stainless steel, which can be sterilised by passing high pressure steam through the apparatus. Cold water is passed through a cooling jacket to remove excess heat produced by the metabolism of the microorganisms. The contents of the fermenter have to be aerated. This is achieved using a sparger, which breaks the stream of air into small bubbles. An impeller is used to stir the contents of the fermenter. The stirring of air bubbles into the medium helps the oxygen gas to dissolve and ensures that the microorganisms remain mixed with the medium. This means that access to the nutrients is maintained, thereby maintaining conditions at optimal growth levels. There are systems, involving probes, that measure and monitor the growth of the culture, control the pH (by the addition of buffers) and for removing the products when the growth of the microorganisms is completed. ph controller pH

stearo

A microorganism moving upwards may pass from a high pH and lower temperature to a lower pH and higher temperature as it passes through different points in its growth cycle. All three designs can be used as batch fermenters, but only the air-lift fermenter is used for batch fermentation. exhaust gases

air in

exhaust gases

exhaust gases (Co2 etc)

acid-base reservoir and pump

cooling water out

cooling jacket

culture broth

cooling water in

sterile air steam product-harvest

Figure 1312 An industrial fermenter

OPTIONS

In the deep-tank fermenter, the principle is similar, but the air is introduced at the top. This results in even more delivery of the oxygen to the microorganisms. The bubblecolumn fermenter has horizontal divisions which allows conditions in each section to be maintained at different levels if necessary.

exhaust

impeller

Fermenter Design The stirred-tank industrial fermenter is used extensively in the fermentation industry. However, it is costly to run due to the energy needed to drive the impeller and introduce the compressed air. Alternative designs exist (Figure 1313) where the air forced into the vessel circulates the contents, which means an impeller is not needed. In the air-lift fermenter the air is

152

introduced centrally at the bottom making the medium less dense. It will therefore rise through a central column in the vessel to the top where it escapes. The denser medium falls down the sides of the fermenter to complete the cycle. The higher pressure at the bottom of the vessel increases the solubility of oxygen, while the lower pressure at the top decreases the solubility of the carbon dioxide (which bubbles out of solution).

air in

air in (O2)

Figure 1313 Types of fermenter

Penicillins and many other antibiotics are produced using deep-tank batch industrial fermenters. The strain Penicillium chrysogenum is commonly used. The fungus is grown in the laboratory on a small scale which is then used to inoculate the fermenter. The culture medium for the production of penicillin often contains corn-steep liquor, a by-product of maize starch production. This contains the nitrogen source, amino acids, and other growth factors. The production of penicillin is stimulated by the addition of a low concentration of phenylethanoic acid (C6H5-CH2-COOH).

The penicillium cells are grown using a technique called fed-batch culture, in which the fungal cells are constantly subjected to stress which is required for penicillin production. Penicillin is excreted into the medium and dissolves in the solution with many other chemicals. The process of extraction, purification and chemical modification of penicillin is referred to as down stream processing (Figure 1314). The penicillin is extracted by evaporation, which separates the insoluble fungal material from the medium. Solvent extraction (using an organic solvent then a buffered aqueous solution) is then used to isolate and then crystallize the penicillin.

AND

IL LS

Experiments can be done showing zone of inhibition of bacterial growth by bactericides in sterile bacterial cultures. A particular colony of bacterium may be transferred onto a petri dish with fresh agar with nutrients. Discs of filter paper, soaked in penicillins or other antibiotics, are placed on the culture before inoculation, but not on the control. Antibiotics are antimicrobial agents produced by microorganisms that kill or inhibit other microorganisms. Antibiotics are low molecular mass (non-protein) molecules produced mainly by microorganisms that live in the soil. Among the moulds the most important antibiotic producers are Penicillium and Cephalosporium, which are the main source of penicillins and cephalosporins. Penicillins and cephalosporins inhibit the formation of the bacterial cell wall but other antibiotics, for example, erythromycin inhibits bacterial protein synthesis by binding to ribosomes. Clear zones indicate no bacterial growth, that is, the antibiotic is effective against that strain of bacterium (Figure 1315). Antibiotics 1 and 2 are effective against the bacterium, but antibiotics 3 and 4 are not effective. The size of the zone of inhibition by the antibiotic is dependent upon the concentration of the test substance, its potency, and the rate of diffusion in the medium.

A culture of Penicillium chrysogenum is grown on solid agar medium

Then pencillium is grown in a broth mediumto produce a large volume of inoculum. This may involve a series of seed stages’with increasing volume of broth medium at each stage

Clear zones, therefore antibiotics effective

Bacteria growing The inoculum is then transfered to an industrial fermenter and the pure culture of Penicllium allowed to grow under carefullycontrolled, aerobic conditions

1 Control

2 4

Ineffective antibiotics

Figure 1315 Testing for antibiotics Medicine

Figure 1314 Industrial production of penicillin

It is common practice in most hospital microbiology labs to test bacteria isolated from infections against a number of different antibiotics so that the most effective antibiotics against bacteria are used.

OPTIONS

The antibiotic, penicillin, is extracted from the medium and purigied. Penicillin may be chemically converted to produce a range of semi-synthetic penicillin, such as ampicillin. The process of extraction, purification and modification are referred to as downstream processing

LICATI

IL LS

The production of penicillin requires the presence of oxygen and lactose. Glucose inhibits penicillin production. The pH and the levels of amino acids, phosphate and oxygen of the batches must be carefully controlled.

• APP

Bacteriocides and Antibiotics

AND

S • ON

LICATI

S • ON

Commercial production of penicillins

• APP

Biotechnology and bioinformatics

153

Chapter 13

B.1.7

•

EORY TH KN

Penicillin and serendipity

LED

The discovery of Penicillin by Alexander Fleming in 1928 happened by chance. Fleming was working on anti-bacterial agents and had discovered the enzyme lysozyme. He noticed by chance that there was a bacterial colony growing on one of his plates of staphylococci with a ring surrounding it (later identified as a ’zone of exclusion’) where the bacteria was not present. Fleming identified the fungi as coming from the Penicillin family (Penicillium notatum). See Figure 1319. Fleming’s findings were reported in 1929, but it was not until 1935 that another scientist, Ernst Chain, who was working in a team led by Howard Florey came across Fleming’s paper and drew it to the attention of Florey. Florey experimented further and demonstrated that Penicillin could cure bacterial infections in humans. A combination of inquiry, chance, open-mindedness and effective communication led to the potential of Penicillin as an anti-bacterial agent being unlocked in the final stages of the Second World War. How important is open-mindedness in investigation in the Natural Sciences?

Microorganisms in fermenters become limited by their own waste products © IBO 2014

Limitations of microbial growth Microorganisms become limited by their own excretory waste products. These build-up during metabolism. For example, yeast is a facultative anaerobe, meaning that it can participate in aerobic respiration when possible, but when this is impossible, it respires anaerobically. Overall, the final equation for glycolysis plus fermentation would be: C6H12O6→ 2CO2 + 2C2H5OH with 2 ATP molecules also produced. The ethanol is a toxic waste product, killing the yeast cells when it reaches a concentration between 14-18%. This is why the percentage of alcohol in wine and beer does not exceed approximately 16%. In order to produce beverages with higher concentrations of alcohol (liquors), the fermented products must be distilled.

B.1.8

Probes are used to monitor conditions within fermenters

Use of probes in fermenters It is important to keep temperature, pH and dissolved oxygen levels at optimum conditions inside fermenters. These variables are monitored by probes and are used to indicate when adjustments to these factors are necessary. There may also be probes to detect the formation of a foam.

OPTIONS

pH control is usually achieved by adding acid or alkali to the fermenter. In smaller scale fermenters, these are often liquids which are added using pumps. On larger scale fermenters, ammonia (alkali) or carbon dioxide (acidic) gases may be introduced to change the pH. Temperature control is usually achieved by the use of heat injection by steam or circulation of cooling water in coils. The control of dissolved oxygen is achieved usually by changing the air flow rate and the stirrer rate. Figure 1319 Penicillium notatum

154

The probes are often computer controlled and the information is fed to a computer for analysis. The optimum conditions may change due the fermentation process. For example, the temperature of the medium may need to be increased initially by piping steam through it. However, once fermentation begins the heat generated by the microorganisms may require continuous cooling by a water jacket around the vessel.

Biotechnology and bioinformatics

Optimal growth of microorganisms Most microorganisms grow best within the range 20 - 45 °C and are able to tolerate a wider range of pH than plant and animal cells. Many microorganisms are aerobic, requiring molecular oxygen for growth at all times: obligate aerobes. Some, while growing better in the presence of oxygen, can survive in its absence. These are called facultative anaerobes, for example, yeasts. Some microorganisms are obligate anaerobes and cannot grow in the presence of oxygen. Photosynthetic microorganisms require an adequate supply of light for growth.

LICATI

S • ON

Production of citric acid

• APP

Many archaeans are extremophiles and require extreme conditions for growth.For example, thermophiles have optimum growth temperatures above 45 °C. These cells have enzymes that enzymes evolved not to denature at high temperatures. Acidophiles can grow in very alkaline conditions (pH 9) or very acidic conditions (pH 2.5). Most microorganisms cannot grow in high salt conditions because they will lose water via osmosis. However, halophiles only grow in high salt conditions. AND

IL LS

Citric acid can be produced in a continuous fermenter by Aspergillus niger and then used as a preservative and flavouring. Aspergillus niger is a soil-based fungus and causes black mould on certain fruits and vegetables. Aspergillus niger (Figure 1316) is cultured for the production of many substances including citric acid which is a used as a food preservative (by killing bacteria) and flavouring agent. Aspergillus niger grows well in a nutrient medium that has a high concentration of sugar and mineral salts and an initial pH of 2.5–3.5. While growing, these strains will excrete large amounts of citric acid. This is a cheaper method of producing citric acid than the traditional extraction from lemons.

Production of biogas

• APP

Conditions are maintained at optimal levels for the growth of the microorganisms being cultured © IBO 2014

LICATI

S • ON

AND

IL LS

Biogas is produced by bacteria and archaeans from organic matter in fermenters. Biogas is a mixture of gases produced by the breakdown of organic matter in the absence of oxygen. Biogas is produced by the anaerobic digestion with anaerobic bacteria or the fermentation of biodegradable materials such as manure (animal faeces), sewage, household waste, plant material and crops. Biogas consists of methane. (CH4) and carbon dioxide (CO2) and may have small amounts of hydrogen sulfide (H2S). Biogas can be combusted (burnt) and the heat energy released allows biogas to be used as fuel. During the fermentation process aerobic bacteria initially hydrolyse any carbohydrate, lipids and protein to sugars, fatty acids, glycerol and amino acids. As the available oxygen is used up, acetogenic bacteria convert the sugars to short chain fatty acids, especially ethanoate ions (acetate), together with some carbon dioxide and hydrogen. This stage is termed acetogenesis. The final stage is methanogenesis which is carried out in anaerobic conditions by methanogenic bacteria. It involves the conversion of ethanoate and other acids to methane. Methanogenic bacteria are obligate anaerobes and are only active in the absence of oxygen. They are chemoautotrophs and members of the archaeans. Examples include Methanococcus jannaschii and Methanobacterium thermoautotrophicum. CH3COOH → CH4 + CO2 Successful biogas production depends on a temperature of between 30 to 40 degrees Celsius being maintained. Biogas production is often performed in an enclosed tank called a digester (Figure 1317). These can be found in countries like China, Nepal and India. In developed countries they are used to dispose of large quantities of animal waste from intensive farming and generate fuel gases for local use. Inlet

Concrete cover

Concrete collar Ground level

OPTIONS

B.1.9

Strengthening Outlet

Concrete inlet pipe

4m Cement and lime plaster

Soil

Cement and sand plaster 3m

Figure 1316 Aspergillus niger

Figure 1317 Production of biogas

155

LICATI

S • ON

Production of biogas in a small-scale fermenter

• APP

Chapter 13 AND

IL LS

Biogas can be readily generated in a small-scale fermenter using local organic waste. For example, in Thailand cassava tubers may be used as the raw material for biogas production. Seed cultures can be prepared by mixing animal manure and liquid waste from an anaerobic pond located at a cassava factory. The bacterial culture can be kept in a closed container at room temperature with regular adding of a small amount of cassava starch for three months before inoculating the biogas production digester (Figure 1318). Gas outlet sampling port Liquid

Digestion vessel

Gas sampling port 1L 2 3 4 5

Gas collector Figure 1318 Single-state digester

The volume of biogas produced in the digester can be measured by the displacement of water in the gas holder compartment. The pH of water in this holder is adjusted to 2 to avoid carbon dioxide dissolving and reacting with the water. Analytical techniques, such as gas chromatography, can be used to determine the composition of the biogas.

OPTIONS

WARNING: Bacteria must not be cultured except under the approval and supervision of a teacher. These notes are not intended as practical instructions.

156

Microorganisms will require nutrients for growth. Macronutrients include substances, such as and sugars, and micronutrients (trace elements), include, for example, metals such as manganese, cobalt, molybendum and iron. A further group of chemicals, known as growth factors are also needed. These include vitamins, amino acids and purines and pyrimidines (DNA synthesis). Up to a point, the more concentrated a nutrient, the greater the rate of growth, but as other factors become limiting (see B.1.7) the addition of nutrients has no effect on growth. The correct balance of nutrients, a suitable pH and a suitable medium are essential to growth of microorganisms. The medium may be a liquid (broth) or solid – usually based on agar, a seaweed extract. It is metabolically inert and dissolves in hot water, but solidifies upon cooling. The greater the concentration of agar the more solid is the resulting jelly. A medium designed to meet the demands for a single species of microorganism is called a minimal medium. A medium which provides the nutrients for a small group of microorganisms with similar requirements, for example, acidophiles, is known as a narrow spectrum medium. However, a medium designed to grow a range of microorganisms is known as a broad spectrum medium. It is possible to select for the growth of specific types of microorganisms by using a selective medium which allows the growth of only a single species.

Biotechnology and bioinformatics

B.2 Biotechnology in agriculture Crops can be modified to increase yields and obtain novel products B.2.1

Transgenic organisms produce proteins that were not previously part of that species’ proteome © IBO 2014

Plant scientists, for example, developed transgenic tomatoes (Figure 1321) using interference RNA technology. They were known as the Flavr Savr tomato and were genetically altered to have lower levels of polygalacturonase, an enzyme responsible of softening of the cell walls. This allowed the tomatoes to be shipped over greater distances and be on store shelves for longer. It was the first commercially grown genetically engineered food to be granted a license for human consumption.

Transgenic organisms Transgenic organisms are usually organisms that have had foreign DNA introduced into their genome. They produce proteins that were not previously part of their species’ proteome. A wide range of transgenic animals and transgenic plants have been produced and used commercially. Any organism whose genome has been altered using molecular techniques is termed a genetically modified organism (GMO).

RNA interference (RNAi) is a system within cells that helps to control which genes are active and how active they are. These small RNAi molecules can bind to specific other RNAs and either increase or decrease their activity, for example, by preventing a messenger RNA from producing a protein. RNA interference has an important role in defending cells against viruses, but also in directing development as well as gene expression in general. Transgenic plants are becoming increasingly important and currently more than 80% of the United State’s corn and soya bean crops are transgenic. Corn syrup and soy protein are important in many processed foods. The ability to produce transgenic plants has allowed researchers to isolate receptors for plant hormones and to analyse plant development and gene expression in plants. These techniques allow the development of transgenic plants that will benefit both farmers and consumers.

Figure 1321 Flavr Savr tomatoes

Plants have certain features that make them very suited to recombinant DNA methods. In nature, plant cells often live in close association with certain bacteria, which are a convenient vector for introducing cloned DNA into plants (see B.2.10). Another very useful feature of plants is the ability of cultured plant cells to give rise to mature plants. Meristematic (growing) cells from dissected tips or shoots or cells will grow in a culture (sterile medium) to form callus tissue, an undifferentiated mass of cells. Under the influence of plant growth hormones, different plant parts (roots, stems, and leaves) develop from the callus and eventually grow into a whole plant (clone). The use of genetically engineered crops for food and as energy is an emotive issue raising both environmental and ethical concerns. Balanced against such concerns are the pressures on the world’s environment from increasing use of fossil fuels, and destruction of rain forests. There is a rapidly expanding human population which is predicted to reach ten billion by the middle of the 21st century. To feed this population at current nutritional standards means continuing improvements in agricultural efficiency and productivity.

157

OPTIONS

However, it should be noted that some transgenic organisms simply produce a novel RNA molecule that does not encode a protein. Such RNAi constructs are now being used to produce flowers with novel colours e.g. a blue carnation, apples with reduced browning and maize with improved resistance to nematode parasites.

Chapter 13 B2.2

Genetic modification can be used to overcome environmental resistance to increase crop yields ÂŠ IBO 2014

Genetic modification to increase crop yields Recombinant DNA technology has been used to alter the ratio of lipid, starch and protein in seeds, introduce herbicide tolerance, insect and viral resistance and pathogen resistance into crop plants. These are often termed GM (genetically modified) crops. in an effort to increase crop yields (Figure 1322) and to reduce costs, for example, less spraying. All of these areas are under active research and some are commercialised. Feature in genetically modified plant

Improve efficiency of uptake of mineral salts Improve ability to withstand drought or high salt Improve resistance to herbicides Improve resistance to disease Improve frost resistance Control ripening of fruits

Possible benefits Reduced fertiliser output GM crop can be cultivated (grown) on land where climate is unfavourable to most plants GM crop better able to survive application of herbicides to control weed growth Reduce pesticide input, crop losses reduced Growing and harvest season increased Losses after harvesting reduced

Figure 1322 Some current areas of research

Bioinformatics

OPTIONS

A number of plant genomes have been sequenced, including rice (Figure 1323) and the potato. Researchers are also analysing gene expression patterns in crops, such as barley and soybean, in order to determine the function of genes involved in the resistance of plants to environmental stress. Once the genes responsible for certain plant traits are known, scientists can identify the basis for disease resistance and stress tolerance, and then design methods by which plants can be made hardier and more resilient. Scientists also use bioinformatics to help them design plants with higher quality fruit, or with the ability to survive in extreme environmental conditions.

158

Figure 1323 Rice growing in Thailand

To identify the genes involved in fruit ripening, researchers study expressed sequence tags (EST) (see B.5) of the fruitâ&#x20AC;&#x2122;s genome. ESTs are short DNA sequences of expressed genes which have been used as a tool for rapid gene discovery. Researchers are able to locate genes that are highly expressed during the ripening process; once these genes are localised, scientists can produce fruits which may ripen later, or taste better. By knowing which plants are closely related in evolutionary terms, scientists can deduce which sexually compatible species of plants have desirable characteristics, such as longer stalks for rice plants, or larger grains for wheat. The undomesticated relatives of todayâ&#x20AC;&#x2122;s plants may be sources of crop improvement genes. With an increasing amount of DNA microarray data online, scientists can exchange data about differences in gene expression. They can also test plants for differences in gene expression or protein profiles under different conditions of drought, disease, or insect infestation. If certain genes are highly expressed during these stress conditions, then they may be used to improve other plants that may not have the same gene.

Genetically modified crop plants can be used to produce novel products © IBO 2014

Genetic modification to produce novel products The ability to introduce genes from any source, including animals, into plants opens up the possibility of using farming methods to produce totally new products. In some parts of the world, intensive farming has led to local excesses of farm produce.

GM Potatoes

LICATI

S • ON

B.2.3

• APP

Biotechnology and bioinformatics AND

IL LS

GM Amflora potatoes (Solanum tuberosum) can be produced for paper and adhesive industries.

The Amflora potato (Figure 1325) (Solanum tuberosum) is a genetically modified potato that produces pure amylopectin starch that is processed to waxy potato starch. This is used in the paper and adhesive industries. The Amflora potato optimises the processing of starch and saves energy and water.

Biosynthesis of novel and valuable products, such as pharmaceuticals, vaccines and antibiotics, in existing crop species may become an alternative use for some agricultural land. However, following problems of such products entering the food and feed chain, these products are likely to be restricted to plants grown under very confined conditions, or indeed in plant cells in fermenters (see B.1) rather than in field crops. The first approved ‘Pharma’ product for human use is Elelyso produced in carrot cells. This is a drug used to treat a rare genetic disorder known as Glaucher disease. A genetically modified rice plant has been developed that synthesises beta-carotene, the precursor of vitamin A, which is essential for vision. If it replaced conventional rice, (Figure 1324) this ‘golden rice’, named because of its golden colour could help to prevent severe vitamin A deficiency in many countries of the world. Such deficiency causes blindness in many hundreds of thousands of children in developing countries each year.

Figure 1325 Amflora potato

Various environmental organisations, such as Greenpeace, disagreed with the introduction of the Amflora potato into the market. This followed after the European Commission were very slow to license the product suggesting political interference. After the Amflora was approved the European Green political parties criticised the approval. However, the European Food Safety Authority (EFSA) repeatedly concluded that Amflora is as safe for people, animals and the environment as any conventional starch potato.

Figure 1324 Golden rice and normal rice

Plants may also be genetically engineered to produce industrial products. For example, the polyester compound poly-hydroxybutyrate (PHB) is synthesised in many bacteria where it is a carbon storage compound. It can also be converted into a biodegradable plastic. Genes encoding two enzymes needed to convert acetoacetyl coenzyme A to PHB were isolated from bacteria and, when expressed in tobacco, switch grass and sugar cane, some plants accumulated PHB. The technology is being developed by Monsanto, though currently it has not been commercialised.

159

OPTIONS

However, this product has now been withdrawn from the market, following decision by many agricultural biotechnology companies to close their operations in Europe.

Chapter 13 B.2.4

Bioinformatics plays a role in identifying target genes

Finding genes by computer There are many hybridization based techniques using cDNA clones that can be used to detect genes in genomic DNA. However, cDNA clones cannot keep up with the increasing amount of genomic sequence data in databases.

The transgene promoter is a regulatory sequence that will determine in which cells and at what time the transgene is active. The promoter is usually derived from sequences of a mammalian gene upstream from the start site of transcription. A. Genetic construct

Promoter

Many computer programs have been developed to annotate genomic sequence data and to distinguish between genes (Figure 1326) and the surrounding DNA.

Gene

Terminator Protein

Plant recipient DNA (chromosome or chloroplast)

Transformed plant or transgenic plant

Translation stop

Translation start Introns

Transcription stop

inserted DNA = construct

Plant DNA

TATA

Figure 1327 Construction of a transgenic plant

Poly (A) tail

Regulatory sequences pre-mRNA

AAAA....

mGppp 5‘ untranslated region

3‘ untranslated region

B.2.6

mRNA AAAA.... Introns spliced out Start (AUG)

Stop (UAA,UAG,UGA)

Figure 1326 Structure of a typical plant gene Intron loop DNA These programs can find conserved sequences such as promoters (a control point for mRNA a gene), splice donor and acceptor sites (for the splicing of introns), start and stop codons and polyadenylation sites, which code for a poly A tail to increase the stability of mRNA.

The TATA box is an important part of the promoter and defines the direction of transcription and also indicates the DNA strand to be read. Proteins called transcription factors can bind to the TATA box and recruit RNA polymerase, which synthesizes RNA from DNA.

B.2.5

The target gene is linked to other sequences that control its expression © IBO 2014

An open reading frame is a significant length of DNA from a start codon to a stop codon © IBO 2014

Open Reading Frames (ORF) Protein encoding genes have an open reading frame (ORF) (Figure 1328), a long series of sense codons beginning with a start codon (usually ATG) and ending with a stop codon which will be TGA, TAG or TAA. In bacterial genomes, ORFs are generally easy to detect because they are not interrupted by introns. One reading frame may be used in translating a gene in eukaryotes and this is often the longest open reading frame (ORF). However, the reading frame is very often different in different exons. Once the open reading frame is known, the DNA sequence can be translated into its corresponding amino acid sequence. transcription termination signal promotor

DNA

OPTIONS

Control of target genes

Transcription

A transgene (Figure 1327) is an artificial gene or a gene from another organism, and the transgene design must have all the elements required for gene expression.

pre-mRNA

A transgene normally contains: a promoter, an intron, a protein coding sequence (termed the reporter), and a transcriptional stop sequence (terminator). These elements are often assembled in a bacterial plasmid.

mature-mRNA

exon A

intron B

exon C B

start 5‘UTR

Poly (A) tail

stop A

5‘cap

C ORF

3‘UTR

Figure 1328 The concept of an ORF

160

Intron splicing

LICATI

S • ON

Identification of an Open

• APP

Biotechnology and bioinformatics B.2.7

AND

IL LS

Reading Frame (ORF) The normal Bioinformatic procedure to identify an ORF is to carry out a six-frame translation (i.e. translation of the genomic sequence in all six possible reading frames, three forwards and three backwards) and identify the longest ORF in the six possible protein sequences. This guarantees that the correct protein product has been selected. Long ORFs do not occur by chance, so the existence of more than 300 base pairs of uninterrupted coding sequence in any one reading frame is good evidence for a gene. The ORF Finder (Open Reading Frame Finder) at http://www.ncbi.nlm.nih.gov/projects/gorf/ is a graphical analysis tool (Figure 1329) which finds all open reading frames of a selectable minimum size in a user’s sequence or in a sequence already in the database.

Marker genes are used to indicate successful uptake © IBO 2014

Marker genes A selectable marker gene (Figure 1330) is added to the transgene to identify plant cells or tissues that have successfully taken up and expressed the transgene. This is necessary because achieving uptake and expression of transgenes in plant cells is a rare event. It occurs in just a few percent of the targeted plant tissues or cells. Selectable marker genes allow gene expression to be confirmed.

Plants with new marker genes grow despite antibiotics

Cells without new marker genes are killed by antibiotics so plants do not grow

Agrobacterium plasmid for gene transfer: desired gene marker gene

Figure 1330 Marker genes in transgenic plants

For example, in the base sequence: 5’-ATCTAAAATGGGTGCC-3’, two out of three forward possible reading frames are entirely open, meaning that they do not contain a stop codon: 1....A TCT AAA ATG GGT GCC... 2....AT CTA AAA TGG GTG CC... 3....ATC TAA AAT GGG TGC C... Stop codons in DNA are UGA, UAA and UAG and therefore the last reading forward reading frame in this example contains a stop codon (TAA), unlike the first two. While this method is generally sound, some genes maybe overlooked completely or the boundaries incorrectly specified. This applies to genes that are shorter than 300 base pairs and genes that use rare variations of the genetic code.

Some selectable marker genes encode enzymes that allow the cell to grow on a carbon source that is usually not metabolized. A common example of this is the PMI gene that allows growth on mannose. This method is usually frequently. There is regulatory pressure to avoid the use of antibiotic marker genes.

B.2.8

Recombinant DNA must be inserted into the plant cell and taken up by its chromosome or chloroplast DNA © IBO 2014

Uptake of recombinant DNA Transgenic DNA can be inserted indirectly (via vectors, especially Agrobacterium) and a variety of direct chemical and physical techniques into plant cells. The transgenic DNA can be taken up by the plant chromosomes or chloroplast DNA.

161

OPTIONS

Figure 1329 An ORF Finder

Selectable marker genes encode proteins that provide resistance to agents that are normally toxic to plants, such as antibiotics or herbicides. Only plant cells that have incorporated the selectable marker gene will survive when grown on a medium containing the appropriate antibiotic or herbicide. As with other inserted genes, marker genes also require promoter and termination sequences for proper function.

Chapter 13 Physical techniques for introducing DNA include biolistics (use of a gun to shoot the DNA), microinjection and electroporation, the use of an electric field to alter the permeability of the plant cell plasma membrane. Chemical techniques for introducing DNA include calcium chloride, which increases the plasma membrane permeability and liposomes, closed vesicles composed of a bilayer.

few hours. Shoots are formed from the transformed cells of the discs after they have grown for several weeks in a culture medium. Agrobacterium methods are often used to infect plant embryos or even whole inflorescences (flowers): floral dip technique not just leaves.

Protoplasts

Despite the small size of chloroplast genome compared to the nuclear genome, chloroplast DNA makes up as much as 10-20% of the total cellular DNA and contains about 130 genes. Uptake of transgenes into the chloroplast genome is achieved via homologous recombination. This is a type of recombination in which nucleotide sequences are exchanged between two similar or identical DNA molecules.

Plant cells are usually protected by a rigid cell wall comprised of cellulose that provides structural support for the plant. The cell wall can be digested away by an enzyme mixture containing the enzyme cellulase, thus producing membrane-bound protoplasts.

B2.9

In addition, protoplasts isolated from different plants can be made to fuse together to form a hybrid which can then be regenerated into a whole plant. Hence, protoplast fusion allows useful traits from one plant to be incorporated into another plant despite large differences between the species. When either single or fused protoplasts are transferred to a culture growth medium, cell wall regeneration takes place, followed by cell division to form a callus which can form a plant.

Recombinant DNA can be introduced into whole plants, leaf discs or protoplasts ÂŠ IBO 2014

Introduction of recombinant DNA Recombinant DNA can be introduced into whole plants, leaf discs or protoplasts. There are a variety of different methods by which the recombinant DNA can be introduced.

Whole plant A DNA gun (Figure 1331) can be used to introduce transgenic DNA into the meristematic tissue of a whole plant as well as cells or callus. It has been especially useful in transforming monocot species like corn and rice. Biolistic Gene Gun

A variety of different transfection techniques, such as electroporation and microinjection, can then be used to deliver recombinant DNA plasmids into the protoplasts.

B.2.10 Recombinant DNA can be introduced by direct physical and chemical methods or indirectly by vectors ÂŠ IBO 2014

Introduction of recombinant DNA Physical Methods Pronuclear injection DNA can be introduced directly into an animal cell by microinjection. Multiple copies of the desired transgene are injected via a glass micropipette into a recently fertilized egg cell, which is then transferred to a surrogate mother.

OPTIONS

Figure 1331 A DNA gun

Leaf discs The soil bacterium Agrobacterium tumefaciens is frequently used as a vector to introduce recombinant DNA via the use of leaf discs. A leaf disc is the circular piece cut from the lamina of a leaf. This cutting is done with a metallic or glass tube with a sharp edge. These leaf discs are then incubated with the bacteria for a

162

Transgenic mice and livestock are produced in this way, but the process is inefficient only 2 - 3 % of eggs give rise to transgenic animals and only proportion of these animals express the added gene adequately. This method is used to produce sterile GM insects, of increasing interest in controlling insect borne diseases. Microinjection can also be used with plant cells but it is more difficult due to the presence of the cell wall.

Biotechnology and bioinformatics

This way of introducing foreign DNA into living tissue literally shoots it directly into the organism using a ‘gene gun’. Microscopic particles (1 µm) of gold or tungsten are coated with DNA. They are propelled by a burst of helium into the skin and organs of animals (e.g. rabbit, mouse, pig, fish etc.) and tissues of intact plants. The DNA is released within the cell and may integrate into the genome. Electroporation Electroporation (Figure 1332) is the use of high voltage to a mixture of DNA and cells in suspension. The cellDNA suspension is placed between two electrodes and an electrical pulse is applied. The DNA enters the cells through holes formed in the cell membrane during the electrical pulse. The DNA is trapped within the cytoplasm at the end of the electrical pulse. Best results have often been obtained from rapidly dividing cells. Electroporation of mammal cells is an inefficient technique since many cells do not survive the high voltage nature of this procedure but it is used with plant protoplasts. Before Pulse

During electric field

After Pulse

Cell membrane Introduce genes

Animal cell or plant protoplast

Cell “heals” with gene inside

Electric field induce a voltage across cell membrane

Figure 1332 The technique of electroporation

Chemical Methods Liposomes Liposomes (Figure 1333) are small spherical vesicles made of a single plasma membrane. When they are coated with appropriate surface molecules, they are attracted to a specific cell types in the body. Liposome inclusion (eg DNA)

Liposome

Outside of cell Cell membrane

DNA carried by the liposome can enter the cell by endocytosis. They can be used to deliver genes to these cells to result in a genetically modified plant cell or in an animal cell to correct defective or missing genes, providing gene therapy (see B.4). However, liposomes are not commonly used in plant systems. Calcium chloride The technique relies on precipitates of plasmid DNA formed by its interaction with calcium ions. It is a very cheap and simple technique to perform. Plasmid DNA is mixed in a solution of calcium chloride, and then is added to a phosphate-buffered solution. A fine precipitate forms in the solution, and this solution is then added directly to the cells in culture. Transfer efficiency, the number of cells which express the desired gene, is usually quite limited and only reaches levels greater than 10% with a few specific cell types. This technique is not of significance in plants.

Vectors Plasmid vectors Plasmids (Topic 3, Genetics) are usually transferred between closely related bacteria by cell to cell contact (conjugation). Simple chemical treatments can make mammal cells, yeast cells and some bacterial cells that do not naturally transfer DNA, able to take up external DNA. Agrobacterium tumefaciens (a bacterium) can insert part of its plasmid directly into plant cells. The soil bacterium Agrobacterium tumefaciens causes crown gall disease in dicot plants. The bacterium enters the plant through a wound and causes the production of a tumour, known as a gall, in the stem. The growth of the plant tumour tissue is due to the presence of the Ti plasmid (tumour-inducing plasmid) in the bacterium. A piece of this plasmid can become incorporated into the DNA of the host plant cells, where it replicates. It also causes the plant to release hormones which stimulate the rapid division of the cells, which subsequently form the plant tumour. The Ti plasmid can be isolated from the bacterium, its tumour inducing gene removed (by restriction enzymes) and new genes spliced in (by DNA ligase). The plasmid is then used as a vector to introduce the desirable genes into the dicot plant tissue. The callus (undifferentiated plant tissue) that forms can be grown into a transgenic plant (Figure 1334).

Inside of Cell

Figure 1333 Acceptance of a liposome into a cell

163

OPTIONS

Biolistics (‘gene gun’)

Add foreign DNA

Introduce into Agrobacterium tumefaciens

Leaf disk (+ herbicide)

LICATI AND

Soybeans

virulence region Ti plasmid

Applications of GM

S • ON

herbicide resistance gene

Transfer DNA region

• APP

Chapter 13

IL LS

Environmentalists are often concerned that herbicide resistant transgenic plants, such as glyphosphatetolerant soybeans, will lead to increased spraying of chemicals. Often the company selling the herbicide also has commercial rights to the herbicide resistant seeds. Refer Figure 1335. However, modern herbicides, such as glyphosate in Roundup, have low toxicity and do not accumulate in the environment. Hence the control of weeds may benefit agricultural production and the environment by reducing the ploughing of land which results in loss of top soil due to erosion. A more important concern is the possibility of herbicide resistance ‘escaping’ into the genomes of related plants to produce new weeds which may require the development of new herbicides.

Figure 1334 The formation of a transgenic plant

A tumour-inducing (Ti) plasmid of Agrobacterium tumefaciens can be used to introduce glyphosate resistance into soybean crops

OPTIONS

Soybeans (Figure 1335) are a food crop that has been genetically modified and widely used in an increasing number of food products. Soybeans (and many other crops, for example, maize and sugar beet) have been genetically modified using the Ti plasmid to be resistant to glyphosate, the active ingredient in an herbicide known as 'Roundup' widely used to kill weeds. The resistance to the herbicide was achieved through addition of an agrobacterium gene. The substituted gene is not sensitive to the herbicide glyphosate.

Tobacco mosaic virus Tobacco mosaic virus affects the tobacco family of plants. It produces large quantities of RNA and protein when it infects plant cells. The viruses also spread rapidly from cell to cell within the plant. This makes it a suitable vector for the production of a transgenic plant. This is sometimes referred to as a plant vaccine. Genetically modified tobacco plants have been developed that produce human Hepatitis B vaccine in their leaves.

Assessing risks and benefits

Transgenic herbicide resistant plant

Genes transferred into genetically modified plants could be transferred again into other organisms, by natural transfers. These natural transfers, which take place in existing agriculture, could include horizontal gene transmission in cross-species pollination in plants. This could result in a weed becoming genetically resistant to an herbicide. To avoid transfer via crosspollination, genes can be inserted into the DNA of the chloroplast genome.

Figure 1335 GM Soybeans

164

A genetically modified plant may have an unforeseen effect on its food web, affecting many other organisms, but there is no evidence for this currently.

Biotechnology and bioinformatics

B.3 Environmental protection Biotechnology can be used in the prevention and mitigation of contamination from industrial, agricultural and municipal wastes

Contamination of soils, groundwater, sediments, surface water, and air with hazardous and toxic chemicals is one of the major problems in many countries of the world. Bacteria can degrade many pollutants, such as heavy metals, acids and organic compounds, that are naturally present in soil and water. Using bacteria to degrade or metabolise pollutants is called bioremediation (Figure 1337). This process may be combined with chemical and physical procedures. Carbon dioxide pH

harmless products

Microbe Temperature

Fertilizer or nutrients

Water

Figure 1337 Bioremediation

The bacteria may be indigenous to a contaminated area or they may be isolated from another location and brought to the contaminated site. This is known as bioaugmentation, but if the naturally occurring bacteria are encouraged to grow by the addition of chemicals, this is called bio-stimulation. The advantage of microorganisms already living in contaminated environments is that they have become adapted to the harsh environmental conditions.

There are very few environments where bacteria are not able to survive and grow. Bacteria are able to use a wide range of chemicals (oxidizing and reducing agents) in their metabolism (see B1). Archaeabacteria are also used in bioremediation especially in very toxic environments. The ability of methanogens that thrive under anaerobic conditions means that they are ideally suited for use in the bioremediation of anoxic sludge which has no dissolved oxygen. Bioremediation of aromatic chemical pollutants, such as benzene, can be achieved by halophilic archaeabacteria isolated from a very salty (saline) environment, for example, Haloferax or Halobacterium. Bioremediation has a number of advantages over traditional chemical approaches. It is cost effective and the toxic chemicals are degraded or removed from the environment. Less energy and supervision is required, but it has the disadvantage of being relatively slow. Bioremediation has also been found to be unsuited for soils with low permeability (e.g. fine clays) as it prevents nutrients to reach the microorganisms already in the soil.

Degradation of oil by Pseudomonas

LICATI

S • ON

For example, bioremediation can be used to deal with oil spills, but it is often combined with emulsification, a purely physical procedure, which involves the dispersal of oil droplets by an emulsifying agent.

Bioremediation is a process that uses microorganisms, fungi, green plants or their enzymes to break down harmful chemicals and pollutants in order to return the environment to its original natural condition.

AND

IL LS

Oil pollution in the oceans, seas and rivers is a common and widespread problem in many parts of the world. This oil comes from spillages and ‘spent’ oil from vehicles and machinery. Oil is very resistant to decomposition and degradation by microorganisms. Some strains of the bacterium Pseudomonas, developed using recombinant DNA technology, are commercially used in cleaning up large oil spills.

OPTIONS

Bioremediation

Contaminant or pollutant

Use of microorganism in bioremediation

Oxygen

Microorganisms are used in bioremediation

• APP

B.3.1

B.3.2

Another means of dealing with oil pollution is to use emulsifiers to cause the oil to mix with water and disperse it and speed up its breakdown by microorganisms. One such emulsifier is a polysaccharide called Emulsan commercially produced by the bacterium Acinetobacter calcoaceticus.

165

Chapter 13 B.3.3

Metabolism of pollutants by microorganisms A bioremediation process is based on the activities of aerobic or anaerobic heterotrophic microorganisms. Microbial activity is affected by a number of physical and chemical variables. The factors important to bioremediation are energy sources (electron donors), electron acceptors, nutrients, pH, temperature, and the presence of inhibitors or metabolites.

Oil spills may be due to releases of crude oil from tankers (ships), offshore platforms, drilling rigs and wells. The spilt oil will affect the entire marine ecosystem. The cleanup and recovery from an oil spill depends on many factors, including the type of water (which affects evaporation and bioremediation) and the types of beaches and shore line involved. During a major oil spill (Figure 1338) scientists from different parts of the world may come together to protect the marine environment. Scientists may bring their expertise in different approaches to oil clean-up, which may include bioremediation, bioremediation accelerators, controlled burning, skimming, dredging, solidifying and the use of emulsifiers.

LICATI

S • ON

Useful microbes

• APP

The primary metabolism of an organic compound is the use of the substrate as a source of carbon and energy. This substrate serves as an electron donor resulting in growth of the microorganism. Bacteria show a wide range of primary metabolism and hence there are strains of bacteria that can metabolise almost any organic compound.

Oil spills

AND

IL LS

Conversion by Pseudomonas of methyl mercury into elemental mercury

Mercury is present in discarded paint and fluorescent bulbs and can leach into soil and water from rubbish dumps. The bacterium Desulfovibrio desulfuricans makes the mercury more toxic converting it into methyl mercury. This is a highly toxic compound that can enter the food chain via plankton in ponds and marshes. However, some strains of Pseudomonas convert the highly toxic methyl mercury to methane and the less toxic mercury(II) ion: CH3-Hg → CH4 + Hg2+ Many bacteria can then convert the mercury(II) ions to the less harmful elemental form (mercury atoms). This enzyme controlled process involves the removal of electrons from hydrogen atoms: Hg2+ + 2H → Hg + 2H+ Degradation of benzene by halophilic bacteria such as Marinobacter

OPTIONS

Large volumes of oily and highly saline waste water are generated during the exploration and production of crude oil. Bioremediation of such water can be achieved using a halophilic archaea genus known as Marinobacter. These strains are capable of degrading a range of alkanes and aromatic hydrocarbons (such as benzene, a known carcinogen), which are present in crude oil. Carbon dioxide is the ultimate oxidation product of this enzyme-controlled process.

166

Figure 1338 Oil spill in 2006 in Australia

B.3.4

Quorum sensing and formation of biofilms Quorum sensing is the regulation of a bacterial process that depends on the density of the bacterial population. The process relies upon the bacteria producing and releasing signal molecules which diffuse outwards from the bacterium. This allows the bacteria population to communicate with each other and coordinate their behaviour when a certain population size is reached. (However, the size of the ‘quorum’ is not fixed but depends on the rate of production and loss of the signal molecules). Quorum sensing signalling molecules are often known as autoinducers. These are detected by specific proteins inside the cell or in the bacterial cell membrane. When the autoinducer binds to the receptor, it activates or represses transcription of target genes which often include those for

Biotechnology and bioinformatics OF

•

EORY TH KN

When the bacterial population is low, diffusion reduces the concentration of the autoinducer in the surroundings to almost zero. As the population increases, the concentration of the autoinducer rises to a threshold, gene expression occurs and more autoinducer is synthesised. This forms a positive feedback loop for autoinducer production and also induces the production of enzymes involved in different bacterial activities including biofilm production (Figure 1339).

Emergent Properties

•

autoinducer synthesis.

LED

The properties that emerge from the outcome of the interaction of the basic elements may be studied to allow an understanding of how the complex consists of simple foundations. However, as we have seen earlier, a reductionist approach which focusses on the foundations such as the chemical reactions and components of complex interactions and systems means that we may miss other key aspects in the system as a whole. An emergent property of the complex chemical interactions that comprise biofilms is the competitive advantage that some biofilms have over others in their resistance to anti-microbal agents. This is turn, will influence natural selection to the benefit of microbes. Biofilm communities are remarkably complex. Some biofilms appear to be cooperative and altruistic in nature, but others appear to ‘cheat’ (use resources without contributing to the community) and many are competitive!

B.3.5

Emergent properties of biofilms A biofilm is usually a surface-associated community of microorganisms characterised by the excretion of a protective and adhesive extracellular matrix. Biofilms can contain many different types of microorganism, for example, bacteria, archaens, protozoa and algae; each group cooperating and performing specialised metabolic functions. Biofilms show emergent properties in the biofilm community. Emergent properties of a biofilm are those that are not predicted from simply knowing about the individual components. (Refer to TOK Box this page) Biofilms have a distinct architecture, but other emergent properties include increased resistance to antibiotics, interaction with eukaryotic host cells and its virulence, degree of pathogenic nature.

B.3.6

Biofilm resistance The extracellular matrix protects the organisms against desiccation (drying out), oxidising bacteriocides (such as bleach), ultraviolet radiation, protozoans and some antibiotics. The matrix also acts as a ‘recycling centre’ keeping all the components of lysed cells available for assimilation. The matrix does not completely prevent the entry of antibiotics into the biofilm, but the slow metabolism of the bacteria in the biofilm accounts for their tolerance. The bacteria in the biofilm rarely divide and antibiotics, such as penicillin, are only effective against actively dividing cells. Penicillin interferes with bacterial cell wall synthesis. A very important stage in biofilm development (Figure 1340) is the dispersion of sessile (mobile) cells from the biofilms, which allows new biofilms to be produced. This dispersion of planktonic (free living) bacteria occurs in response to environmental changes, such as a lack of nutrients (nutrient starvation). It requires modification of the matrix secreted by enzymes from the bacteria.

167

OPTIONS

Figure 1339 Quorum sensing in Vibrio fischeri

Is it possible for the natural sciences to balance an understanding emergent properties of a system with their components?

Chapter 13 Profile: Dr Andrew Foreman In medicine, the traditional understanding of bacteria is that they exist as individual, free-floating organisms, capable of causing acute diseases such as pneumonia, skin infections and urinary tract infections. They cause disease by releasing toxins and inciting an inflammatory response in the patient. In this form, they are generally highly sensitive to antibiotic therapy. However, it is now known this is not the whole story. In fact more than 99% of bacteria exist in colonies known as biofilms, adopting a range of unique properties such as existing in a quiescent state with reduced metabolism, becoming resistant by transferring genetic information within the colony and preventing antibiotic penetration by surrounding themselves in a slime-like matrix. All of these factors result in biofilm bacteria being difficult to identify using standard culture-based methods and resistant to traditional antibiotic therapy. It is now understood that more than 65% of all human diseases are caused by bacterial biofilms. Hence we need to undertake a paradigm shift when thinking about diagnosing and treating a whole range of chronic diseases. Biofilm-mediated diseases typically have a chronic relapsing and remitting course, demonstrate variable culture rates along with extreme antibiotic resistance. Chronic ear infections, chronic sinus infections and chronic throat infections are amongst a range of diseases that demonstrate these hallmark features. Previously their causes were unknown but it is now recognized they are most likely to be biofilm-mediated diseases. My research has focused on chronic sinusitis- a common and often extremely troublesome disease characterized by Dr Andrew Foreman using a confocal microscope persistent inflammation of the nose and sinuses. This disease has all of the characteristic features of a biofilm-mediated disease discussed above. Since 2005, biofilms have been identified in the sinuses of patients with this disease using sophisticated microscopic techniques (see photos). Through my own research we have identified Staphylococcus aureus as the most common biofilm-forming organism in this disease, remember that these bacteria are difficult to culture so we need organism-specific microscopy techniques. We have also mapped the specific alterations in the patientâ&#x20AC;&#x2122;s local immune that correlate with the presence of S. aureus biofilms within the sinuses, giving insights into potential sites for novel treatments to target, remember that antibiotics donâ&#x20AC;&#x2122;t work well in these diseases. Patients with S. aureus biofilms have An image of a biofilm using a Scanning EM more severe disease than those without (i.e. patients with other biofilm-forming organisms in their sinuses), requiring more intensive medical treatment and more extensive surgery. We know itâ&#x20AC;&#x2122;s difficult to culture bacteria in this disease, so we have recently developed a non-culture based method to identify specific components of the S. aureus biofilm, bypassing the need for culture to make a diagnosis.

OPTIONS

By highlighting the role of S. aureus biofilms in chronic sinusitis we have identified a target to enable us to develop novel anti-biofilm treatments (i.e. not antibiotics) that might improve the outcomes of our patients who suffer this disease. Furthermore we hope we can provide insights into a broader range of biofilm-mediated diseases by applying the knowledge we have gained to other areas of medicine. Dr Foreman's Training and Career: 1. Bachelor of Physiotherapy at the University of South Australia, Adelaide, South Australia, 1999 2. Bachelor of Medicine, Bachelor of Surgery (with Honours) at Flinders University, Adelaide, South Australia, 2004 3. PhD at University of Adelaide, Adelaide, South Australia, 2010 4. Currently working as an Ear, Nose and Throat (ENT) Surgeon

168

Biotechnology and bioinformatics

planktonic bacteria absorption

extracellular polymoric substance (’slime’)

dispersion signal molecules (auto inducers)

irreversible attachment

chemoattraction mature microcolony formation signal molecules (auto inducers)

water channel

quorum sensing

growth and division

multispecies consortia

Figure 1340 Biofilm production

Quorum sensing in biofilms As bacterial mature into a biofilm, the expression of many genes increases or decreases compared to their planktonic (free living) form. Figure 1341 shows confocal laser scanning microscopy of Pseudomonas aeruginosa biofilms showing mushroom-like micro-colonies.

Biofilms are complex highly hydrated structures. Confocal laser scanning microscopy has played an important role in establishing the structural complexity within a biofilm. Confocal microscopy is an optical microscopy technique that allows reconstruction of three-dimensional structures that are obtained from still images. The confocal microscope uses point illumination and a pinhole to eliminate out-of-focus signal and only structures in the focal plane are visible. A laser is used to excite light to achieve high intensities. A detector is attached to a computer that constructs the image, one pixel at a time. Some advantages to confocal microscopy include controllable depth of field and ability to collect optical sections from thick specimens.

These bacteria engage in quorum sensing (see B3.4) which is necessary for the development of the biofilm. However, quorum sensing is not required for the earliest stages of biofilm development, for example, attachment.

Figure 1341 Pseudomonas aeruginosa biofilms

Biofilms have been found to be involved in a wide variety of bacterial infections in the body, for example, urinary tract infections, catheter infections, middle-ear infections, formation of dental plaque and coating contact lenses.

169

OPTIONS

Biofilms

B.3.7

Biofilms develop complex structures in which different cells occupy distinct environments. Many biofilms contain channels in which nutrients and oxygen can circulate. The cells on the outside of the biofilm have a very different metabolism from the cells on the inside. Levels of acidity (pH), dissolved oxygen and iron levels, vary widely through the film. This cell specialisation makes it difficult to develop a single treatment or drug to destroy a biofilm.

Chapter 13 Biofilms are also responsible for the following environmental problems: clogging and corrosions of pipes, transfer of micro-organisms in ballast water in ships and boats and contamination of surfaces in food production.

LICATI

S • ON

Some environmental problems caused by biofilms

• APP

Biofilms also benefit other organisms in nature. Underground, microorganisms will form a biofilm around the area between roots and soil, in plants. Chemical interactions in this symbiotic relationship give both organisms access to nutrients that would otherwise not be available. Many bacteria used in water treatment and bioremediation (see B3.1) are in the form of mats or biofilms. AND

IL LS

Biofouling is a major and widespread problem in the marine environment (sea). It is a natural process of colonisation of submerged surfaces by a wide range of organisms including bacteria. Biofouling is the unwanted accumulation of bacteria, plants and animals exposed to sea water. It is a major problem in the shipping industry. Biofilm formation is the critical step during marine biofouling. Antifouling is the preventing of the accumulation of fouling organisms. Until recently most antifouling techniques have relied on tributyltin or heavy metals (copper, zinc) based paints that are toxic to a wide range of marine organisms. However, these toxic compounds lead to serious environmental problems even at very low concentration. Their use is restricted due to their environmental damage. Natural Product Antifoulants have been suggested as one of the best replacement options for these compounds.

OPTIONS

Marine organisms are a rich source of biologically active metabolites (primary and secondary). More than 100 species of marine organisms including corals, sponges and marine bacteria have shown antimicrobial activity. Extracts from these organisms can be tested by using the agar well method in petri dishes. Clear zones after incubation with bio-film forming bacteria indicate anti-fouling activity.

170

Some medical applications of biofilms Pseudomonas aeruginosa is a motile Gram-negative, aerobic bacterium. It infects the urinary tract, burns and wounds. Cystic fibrosis patients suffer from P. aeruginosa infection of the lungs. Cystic fibrosis (Topic 3, Genetics) is a common genetic disorder that affects mainly the lungs and digestive system and results in early death without antibiotic therapy. Difficulty in breathing and excessive mucus production are common symptoms and result from chronic lung infections, involving large biofilm colonies of P. aeruginosa, which are resistant to antibiotics. P. aeruginosa controls the maturation of biofilms under the control of quorum sensing. The adoption of the biofilm lifestyle provides protection against antibiotics and host immune defences such as neutrophils and macrophages. These white blood cells, release tissue damaging enzymes as they cannot phagocytose the large biofilms colonies. This results in severe damage to the lung epithelium. Biologists hope that treatments will be developed that will degrade autoinducers or compete with the autoinducer and inhibit quorum sensing and prevent development of biofilms. Disrupting the signalling process in this way is called quorum quenching or quorum sensing blocking. Another approach to prevent biofilm formation is the use of a molecularly imprinted synthetic polymer that prevents bacterial quorum sensing by absorbing (sequestering) the signal molecule (Figure 1342). This polymer could be incorporated onto catheters, wound dressings, paints and lenses. Including the polymer in the growth medium had no effect on bacterial growth; which means mutation and the development of resistance is less likely. The polymer includes a molecule that was specifically designed (by computer modeling) to bind to the quorum sensing signal molecule. Figure 1342 shows a proposed mechanism for the

prevention of biofilm formation by sequestration of quorum signal molecules by a molecular imprinted polymer.

Biotechnology and bioinformatics Signal molecule Free living bacteria

Polymer with sequestered signal molecules

B.3.8

Bacteriophages are used in the disinfection of water systems

Use of bacteriophages in disinfection of water Bacteriophages (‘phages’) (Figure 1344) are viruses that use bacteria as their target cell to replicate. They infect and kill bacteria via lysis and are very abundant in water.

Mature biofilm with exopolysaccharide matrix

Inhibition biofilm

(a)

(b)

Fig 1342 How a biofilm forms

Biofilm formation in the presence or absence of polymers was studied using confocal scanning laser microscopy. Staining with crystal violet dye was used for measuring the biofilm formation.

Bacteriophages, when added to waste water, have the potential to reduce the risk of the spread of human pathogenic bacteria, such as hepatitis and gastro-enteritis viruses. They can also reduce foaming in activated carbon waste water plants. However, bacteriophages can pick up and transfer antibiotic resistant genes to other bacteria.

Figure 1343 shows that a significant reduction of the

biofilm growth was observed in the presence of MIP polymer (>80%), which was better than that of the resin prepared without, which in turn showed a reduction of 40% in comparison with biofilm, grown without the polymer. 0.8 0.7

O.D. 600nm

0.6

Figure 1344 Structure of a bacteriophage

0.5 0.4 0.3 0.2 0.1 0

PAO1

PAO1 + Blank polymer

PAO1 + MIP

Fig 1343 Effect of polymers Figure 1343 shows the effect of polymers on biofilm

OPTIONS

formation by P. aeruginosa grown for 24 hours on glass slides in the presence of 20 mg/mL of polymer. Surface distribution of biofilm in: (a) control; (b) the presence of blank polymer; and (c) the presence of MIP; scale bars: 50 μm

171

LICATI

S • ON

Biofilms in sewage treatment

• APP

Chapter 13 AND

IL LS

In a sewage filter bed (refer to Figure 1345) a large number of different microorganisms (micro-flora) in the form of a biofilm are immobilised on layers of coke (impure carbon) or stones. Openings in all sides of the filters, and the spaces between the ‘clinker’ maintain aerobic conditions. On the surface of the coke are mobile protozoa, for example, Vorticella, as well as fungi of the genus Fusarium. In the upper layer are Zoogloea, while Nitrosomonas, Nitrobacter and stalked protozoa are found lower down. As the waste water (effluent) trickles down the micro-organisms change the composition of the water. These microorganisms include the mobile protozoans as well as fungi and various strains of bacteria including, Pseudomonas and Bacillus, which oxidise the organic substances in the water. Domed Enclosure

Rotating influent Distributer

Biofilm

Air

Air Filter Effluent

influent Trickling Filter Treated Water

Clarifer Recycle

Sludge Pump

Figure 1345 A sewage filter bed

OPTIONS

Sludge digestion can be carried out either aerobically or anaerobically. In anaerobic digestion the sewage sludge is acted upon by Clostridium (an obligate anaerobe). The fermentation of the protein, polysaccharides and lipids results in the formation of ethanoic acid, carbon dioxide and hydrogen. These products are then acted upon by Methanobacterium which forms methane (biogas). Aerobic digestion uses a technique known as activated sludge which involves pumping air through it from the bottom. This allows aerobic microflora including Zoogloea and Nitrobacter and many other strains to oxidise the organic compounds.

172

Biotechnology and bioinformatics

B.4 Medicine

A pathogen must grow and reproduce within the human body to cause disease. It must replicate its own nucleic acid in order to cause a disease. This amplification of nucleic acid in infected tissue allows the pathogen to be detected using PCR.

Biotechnology can be used in the diagnosis and treatment of disease. Infection by a pathogen can be detected by the presence of its genetic material or by its antigens ÂŠ IBO 2014

A pathogen is any organism capable of causing a disease. Pathogens include bacteria, viruses, fungi and some single-celled organisms (protozoans). An antigen usually refers to the protein or glycoprotein on the surface of a cell (bacterium, fungus or virus) that the body recognises as a foreign substance and triggers the immune system into producing antibodies specific to that antigen.

Biochemical tests Serological methods are highly sensitive and specific tests used to identify pathogenic microorganisms. These tests are based upon the ability of a labelled antibody, in the test reagents, to interact and bind to a specific antigen. The antigen, that is usually a protein synthesised by the pathogen, is bound by the labelled antibody. This binding can then be detected in various ways, for example, a colour change dependent upon the particular test. For example, enzyme labelled immune-sorbent assay (acronym ELISA), in which the label is an enzyme and this can be used to convert a colourless substrate into a coloured product (see B.4.4).

Molecular markers are heritable DNA sequence differences (genetic polymorphisms). They have no effect on the human phenotype and are developmentally and environmentally stable. The most useful molecular markers are those that distinguish multiple alleles per locus (i.e. are highly polymorphic) and are co-dominant (each allele can be observed).

RFLP A RFLP (Restriction Fragment Length Polymorphism) is a site in a genome where the distance between two restriction sites varies among different individuals. Most RFLP markers are co-dominant and very locus-specific. These sites are identified by restriction enzyme digests of chromosomal DNA, and the use of a probe to identify the fragments (Figure 1346). A Southern blot is a technique used to transfer all the bands from the gel onto a blotting membrane. The membrane is then treated with a DNA probe which has been designed to have a sequence that is complementary to the RFLP; this allows the probe to hybridize, or bind, to a specific DNA fragment on the membrane. The probe has a label, which is typically a radioactive atom or a fluorescent dye. NORMAL

DISORDER NORMAL

DISORDER

NORMAL ENZYME RESTRICTION SITES

Enzyme digestion DISORDER Mutation removes one restriction side

Molecular diagnostics The polymerase chain reaction (PCR) is often used to identify a pathogen via the detection of its genetic material (DNA or RNA). This is a very common approach because nearly all of the important pathogens of the human population have been identified.

Predisposition to a genetic disease can be detected through the presence of markers ÂŠ IBO 2014

Molecular markers

Pathogens and antigens

The intensity of the coloured product is related to the concentration of original antigen. The intensity of colour, or signal of the patient samples, can be compared to that of standards allowing identification and measurement of the concentration of the target antigen.

B.4.2

Probed region

Gel electrophoresis

OPTIONS

B.4.1

Southern blot

Figure 1346 Detection of RFLP

173

Chapter 13 SSR

Disease markers

A SSR (simple sequence repeat) is a locus or region in the genome that contains many short tandem repeat sequences (micro-satellites). These sites are usually in the size range of 100-500 base pairs composed of dinucleotide and trinucleotide repeats. They are very polymorphic and scattered throughout the human genome. They are detected by PCR using primers flanking the repeats and then can be resolved on gels.

Many common diseases or disorders in humans are not caused by a variation within a single gene but are influenced by complex interactions among multiple genes as well as the environment. Environmental factors add significantly to the probability of developing a disease or disorder, but it is difficult to measure and evaluate their overall effect on a disease process. A person's genetic predisposition is their potential to develop a disease based on genetic factors. Genetic factors may also confer susceptibility or resistance to a disease and determine the severity or progression of a disease or disorder.

PCR amplification of an SSR locus: (CA)n In three diploid genotypes P1, P2 and the F1 of P1 x P2 Conserved PCR primer sites

P1 Parent

(CA)n (CA)n

Gel electrophoresis and visualization of PCR products via radioactivity or fluorescence

(CA)n (CA)n-2

Offspring

P2 Parent

(CA)n-2 (CA)n-2

Figure 1347 A simple sequence RFLP

EORY TH OF

Figure 1348 An example of a SNP

•

Human participation in research

A SNP (single nucleotide polymorphism) (Figure 1348) is a nucleotide sequence difference in the sequence of a gene or segment of the genome. There are tens of 1,000s of SNPs and there are a variety of methods for analysing them, including DNA sequencing, gel electrophporesis, and hybridization analysis. Short tandem repeats (STRs) are short sequences of DNA, normally of length 2-5 base pairs, that are repeated numerous times in a head-tail manner.

OPTIONS

Molecular markers were found by selecting a large random population for study (normal and disorder or disease) and extracting blood from the individuals. Molecular biology techniques were then used to study specific molecular markers in the population (normal and disorder or disease). A statistical comparison is then carried out of the frequency of the molecular marker in the normal population and those with the disorder or disease. KN

SNP

A number of diseases and disorders with a genetic predisposition have been investigated at the DNA level including insulin dependent and non-insulin dependent diabetes mellitus, coronary heart diseases, hypertension, colon, prostate and breast cancer and endometriosis, when cells from the lining of the uterus grow in other parts of the body.

using three genotypes, including two inbred parents and their offspring (F1). Parent 1 is homozygous for the (CA) n allele and Parent 2, the (CA)n-2 allele, where 'n' refers to an integer. The F1 is heterozygous and produces products corresponding to both alleles. Markers resulting from SSR length polymorphisms are put on genetic maps in relation to other molecular markers.

•

Figure 1347 shows the detection of SSR length polymorphism

LED

All medical procedures carry some risk. However, participation in research carries a greater risk, as it is, by its very nature, exploratory. There are many ethical considerations involved in such research. In most cases, those participating in gene therapy research are very ill and they or their guardians must make informed choices as to wether or not to participate in research, or continue with it as new information, comes to light. There has been at least one death as a consequence of a gene therapy trial. In another trial a number of children being treated for SCID (severe combined immunodeficiency disease) using gene therapy developed leukaemia, most likely as a result of the gene therapy itself. Other participants in the trial were informed and made decisions about continuation based on this outcome. Researchers learnt more about the mechanism of gene therapy, but some question whether the knowledge gained and future speculated benefits are worth the cost. What factors need to considered when making decisions regarding participation in research? What constitutes an ‘acceptable level’ of risk for humans involved in scientific research? Can this be quantified?

174

LICATI

S • ON

Use of PCR

• APP

Biotechnology and bioinformatics AND

IL LS

The polymerase chain reaction (PCR) can be used to detect different strains of influenza virus Infection of avian (bird) populations with certain subtypes of the avian influenza A virus is a global human public health risk. This is because of possible pandemic influenza strains that could spread rapidly by contact with infected birds or people. These viral strains are different from the human seasonal influenza viruses tested routinely in laboratories. Human infection with one of these highly pathogenic avian influenza A(H5N1) viruses, was first recognized during the 1997 outbreak in Hong Kong. Since 2003, outbreaks of HPAI A(H5N1) have occurred in chickens in Asia, Europe, and Africa and human infections with this subtype have continued to occur. PCR (Figure 1349) is used to detect and identify seasonal and newly evolved influenza A viruses in humans. PCR detects viral RNA present in either clinical specimens or virus cultures. It can be targeted at genes that are relatively conserved (unchanged) across all influenza A viruses (e.g. the matrix gene, which plays a vital role from virus entry and uncoating to assembly and budding of the virus particle) or to the haemagglutinin or neuraminidase genes which are subtype specific.

B.4.3

DNA microarrays Nucleic acids, DNA and RNA molecules can form doublestranded molecules by complementary base pairing. This is also known as hybridisation. A particular DNA or RNA molecule can be labelled with a radioactive or fluorescent tag to produce a probe. This can be used to isolate a complementary molecule from a very complex mixture of genomic or cellular DNA. A DNA microarray (DNA chip) is a grid of DNA elements (cells) arranged on a miniature support, such as a glass slide. Each cell represents a different gene. Spotted DNA microarrays involve robotic analysis and have a density of up to 500 cells per square centimetre. The array is hybridized with a complex RNA probe which is produced by labelling a complex mixture of RNA molecules derived from a particular type of cell (Figure 1350). The composition of the probe reflects the level of RNA molecules in its source cell. If hybridization is carried out the intensity of the signal for each cell represents the level of the corresponding RNA in the probe. This allows the relative expression levels of thousands of genes to be observed simultaneously. Prepare cDNA Probe Normal RNA

Prepare DNA Microarray

Tumor RNA

Real Time / PCR Label with Fluorescent Dyes cDNA Combine Equal Amounts of DNA Hybridize probe to microarray

SCAN and ANALYSE

OPTIONS

Figure 1350 DNA microarray analysis

Figure 1349 PCR machine

175

LICATI

S • ON

Analysis of a simple microarray

• APP

Chapter 13

IL LS

The interpretation of microarray experiments is carried out by grouping the data according to similar expression profiles. An expression profile is the expression measurement of a gene when placed in different conditions, for example, different tissues or healthy tissue versus cancerous tissue. This means reading along a row of data in the gene expression matrix (Figure 1351). In this example the intensity of shading is used to represent expression levels. The shading of each data point represents the level of gene expression, with darker colours representing higher gene expression levels. DNA microarray expression matrices usually report expression levels using colour: red, green and yellow.

C1 C2

G2 G3

Figure 1351 DNA microarray results

Figure 1351 shows a schematic diagram of a DNA microarray with the results of three experiments (where C represents a condition and G represents a gene). If we consider experimental conditions C1 and C2 then it can be concluded that G1 and G2 are functionally similar. They are both expressed to the same degree under the same conditions. However, G2 is functionally different since it has a different expression level under the same conditions, but if we include C3, this suggests a functional link between G1 and G3.

OPTIONS

B.4.4

AND

Metabolites in body fluids Thousands of different small molecules, known as metabolites, circulate in the blood; with some entering the urine. The presence and concentrations of some of these metabolites (‘metabolite signature’) are useful in assessing health or disease risks.

Blood Blood plasma contains a large quantity of proteins. They are made in the liver, circulate in the blood for a limited period, after which they are broken down in the liver. Each of the plasma proteins has a specific function, for example, fibrinogen is involved in blood clotting. A number of plasma proteins act as carriers of metabolites, for example, transferrin carries iron (see B.5.4). A number of hormones and vitamins are transported by proteins, for example, insulin is carried by α2-macroglobulin and vitamin B12 is carried by B12-binding protein. Enzyme levels in plasma can be used in the diagnosis of disease or organ injury. For example, creatine kinase occurs in cell cytoplasm or mitochondria. But small amounts are discharged into the plasma when minor damage to or changes in cell membranes occur. Other enzymes, such as alkaline phosphatase, are bound to membranes within cells. When a single event involving damage or diseases occurs, the level of an enzyme in plasma initially increases and then falls as it is removed from circulation. If the condition is prolonged or severe, the removal of the enzyme may not be as fast as its rate of leakage into the plasma. Blood tests allow a doctor to see a detailed analysis of any disease markers, the nutrients and waste products in your blood as well as how various organs (e.g., kidneys and liver) are functioning.

Glucose High levels of glucose in the body (after fasting) may indicate diabetes mellitus.

Calcium Calcium ions play an essential role in muscle contraction and synaptic transmission. Increased or decreased calcium levels may indicate a hormone imbalance with the kidneys, pancreas or bones.

Potassium and sodium Concentrations of the electrolytes are carefully controlled by the kidneys. Both are involved in the functioning of

176

Biotechnology and bioinformatics

Urea and creatine Urea and creatine are excretory products that are removed by a process of ultrafiltration in the kidneys. Increased concentrations may indicate a decrease in kidney function.

Alkaline phosphatase This enzyme is involved in liver, muscle and bone, so elevations may indicate problems with the liver or bonerelated disease, including bone cancer.

Low-density lipoprotein (LDL) It is also known as â&#x20AC;&#x2DC;bad cholesterolâ&#x20AC;&#x2122; and high levels clog arteries and is linked to heart disease.

Tumour markers Tumour markers are substances produced by a tumour or by the body as a response to cancer and released into the blood. They are usually proteins. Some tumour markers are only produced by one type of cancer, while others can be made by several cancer types. Some markers are found in non-cancerous conditions as well as cancer. They may confirm the presence of cancer or an increased risk of contracting cancer.

Metabolites in Urine Urinalysis can disclose evidence of diseases, even some that have not caused significant signs or symptoms. Therefore, a urinalysis along with a blood test is often a part of routine health screening.

Glucose Under normal conditions nearly all the glucose removed in the glomerulus is reabsorbed in the proximal convoluted tubule of the nephron. If the blood glucose level increases, as happens in diabetes mellitus, the capacity of the kidney to reabsorb glucose is exceeded. Glucose can then be detected in the urine by means of simple chemical tests.

Protein Normally there is no protein detectable on a urinalysis strip. Protein can indicate kidney damage, blood in the urine, or an infection, but up to 10% of children can have protein in their urine.

Bilirubin Bilirubin is not present in the urine of normal, healthy individuals. Bilirubin is a waste product that is produced by the liver from the hemoglobin of red blood cells that are removed from circulation. It becomes a component of

bile, a fluid that is secreted into the intestines to emulsify lipids. In conditions such as hepatitis, bilirubin leaks back into the blood stream and is excreted in urine. The presence of bilirubin in urine is an early indicator of liver disease and can occur before jaundice develops.

Ketones Ketones are not normally found in the urine. They are intermediate products of fat metabolism. Ketones in urine can give an early indication of insufficient insulin in a person who has diabetes.

Protein High urine protein levels are termed proteinuria and can be an early sign of kidney disease. Albumin is often the first protein that is detected in the urine when kidney dysfunction begins to develop. A cancerous condition known as multiple myeloma can also produce proteinuria.

Metabolomics Metabolomics is the study of chemical processes involving metabolites. The metabolome is the collection of all the metabolites in a cell, tissue, organ or organism. Such studies have found that minor metabolites in the blood or urine may be correlated with certain conditions or genetic predispositions, for example, high levels of the amino acid homocysteine are associated with a higher risk of heart disease. It is also hoped that the many minor metabolites present in urine will indicate the early sign of a disease or a predisposition towards a disorder. Sarcosine is an intermediate in glycine metabolism. Sarcosine is often found at increased levels in samples taken from patients with advanced prostate cancer but is present in lower levels in samples of healthy tissue. Studies scanning for sarcosine proved to be a more accurate method of cancer detection than scanning for the PSA protein (prostate specific antigen) which involves a blood test. The PSA test can be abnormal with benign enlargement and infection of the prostate gland. The development of monoclonal antibodies by hybridomas (Topic 11, Animal Physiology) greatly improved the ability to diagnose human diseases. Antibodies can be used to detect low levels of antigen or antibody present in the patient with a specific disease. The presence of antibodies is an indicator that the antigen (bacterium or virus) is present. One very useful test is the ELISA test which is described in the following Information Box.

177

OPTIONS

nerves and muscles. High sodium levels may be caused by heart disease and high potassium levels may be caused by kidney damage.

LICATI AND

IL LS

ELISA (Enzyme-Linked Immunosorbent Assay) is a powerful monoclonal antibody technique used to detect the presence of infections. ELISA is a method of detecting the formation of an immunocomplex, the binding or interaction between antibodies and antigens.

• APP

Malarial dipsticks

AND

S • ON

LICATI

S • ON

The ELISA diagnostic test

• APP

Chapter 13

IL LS

A more accurate approach to confirming malarial detection involves antigen detection using immunochromatographic methods in an ELISA approach. These are termed malaria dipsticks (Figure 1353). PRODCEDURAL STEPS

COLLECT BLOOD FROM FINGER

The ELISA test requires the following: •

a specific antibody to the specific antigen bonded to an inert plastic substrate

•

a sample of the patient’s blood containing the antigen

•

free antibody to the antigen: this one with a linked enzyme that will react with a coloured substrate.

In ELISA, the antibody is attached to a plastic well and will come into contact with all the antigens present in the patient’s blood (Figure 1352). This is then treated with the enzyme-linked antibody. The bound antigen will form a complex with this new antibody by binding the new antibody at a site other than the site binding the antibody fixed to the plastic wall. Excess enzyme-linked antibody is washed away. The remaining molecules form layers consisting of antibody/antigen/enzyme-linked antibody. This is treated with a substrate that the enzyme can digest, which results in a change in colour of the substrate.

Mix blood with lysis buffer and detection antibodies on dipstick Lysed blood and reagents move up strip

Antigen-antibody complexes bind to capture antibodies in detection lines Add washing buffer

Buffer move up strip,making detection lines visible EXAMPLE RESULTS

Enzyme Digested

Negative

Coloured Substrate

Enzyme

Non-falciparum malaria

Pure or mixed infection with P.falciparum

Figure 1353 ELISA based malarial dipsticks Antigen

Antibody (Immunoglobulin)

Microwell Plate

B.4.5

Tracking experiments are used to gain information about the localization and interaction of a desired protein

Tracking proteins

OPTIONS

Figure 1352 The principle of ELISA

Interpreting ELISA results Malaria can be tentatively identified by taking blood from the finger tip and viewing it under the microscope. But there are limitations: blood smear preparation, staining, and interpretation are time consuming and require a skilled technician. It may be difficult to identify infections when the number of malarial parasites is low.

178

Biologists have taken advantage of a variety of techniques to discover the pathways and mechanisms by which proteins are sorted and transported into and out of the cell and its organelles. The ultimate location of any protein synthesised in the cytoplasm depends on its amino acid sequence which may contain a sorting signal that directs the protein to a specific organelle. Proteins that lack signal sequences remain in the cytoplasm. Different sorting signals direct proteins to the nucleus, mitochondria, chloroplasts (in

Biotechnology and bioinformatics

1 TRANSPORT THROUGH PORES OF NUCLEAR MEMBRANE

chloroplast

lysosome

vesicle

LICATI AND

nucleus

mitochondrion

Tracking tumour cells

proteins made in cytoplasm

TRANSPORT ACROSS PLASMA MEMBRANES

3 TRANSPORT BY VESICLES

Golgi apparatus

Figure 1354 Transport of protein within cells

The most recently developed and widely used method for tracking a protein as it moves through a cell involves tagging the protein with green fluorescent protein (GFP) (Figure 1355). Green fluorescent protein is a protein extracted from jellyfish, which fluoresces green when placed under blue light.

S • ON

Proteins enter the nucleus via nuclear pores, but protein translocators are involved in transporting proteins (in an unfolded state) across membranes and into the chloroplast, mitochondrion or ER. Transport from the ER to the Golgi apparatus is via vesicle (Figure 1354).

The addition of GFP contiguously at the end of a protein does not usually alter a protein’s normal function or transport. Its position in the cell can be followed in real time by monitoring the living cell with a fluorescent microscope. GFP fusion-proteins are widely used to study the location and movement of proteins within the cell and their secretion from the cell. • APP

plants) and the endoplasmic reticulum (ER). The signal sequence is removed from the protein once it has been sorted.

IL LS

Tumour cells can be tracked using transferrin linked to luminescent probes. Transferrin is a protein that binds to iron(III) ions, Fe3+. It is involved in iron transport and binds to the transferrin receptor. It provides cells with iron for the synthesis of iron-containing proteins and also to prevent cell damage from free radicals. The iron transferrin complex enters the cell by receptormediated endocytosis. The low pH inside the vesicle triggers Fe3+ release and results in a recirculation of iron free transferrin. Dysfunction of transferrin transport across the brain-blood barriers leads to Parkinson’s disease and Alzheimer’s disease. Over-expression of transferrin is one of the characteristics of cancer cells and this property has been used to develop non-invasive and real time imaging of cancer cells. It is hoped that this approach can be used to detect small breast tumours. Transferrin is conjugated to a luminescent probe. Luminescence is the emission of light due to a chemical reaction. The covalent complex of probe and transferrin can then be taken up by a cell expressing the transferrin receptor on its surface and the result would be internalisation of the probe which could then be used to track the cell which has taken it up. One approach uses quantum dots bonded to transferrin as targeted luminescent probes. The quantum dot-transferrin nano-complexes can be viewed and followed using a confocal microscope.

OPTIONS

Quantum dots are nanoparticles, of a semiconductor material, such as cadmium or zinc sulfide, which range from 2 to 10 nanometres in diameter (about the width of 50 atoms). They undergo luminscence and the wavelength of light emitted depends on the number of atoms forming the quantum dot.

Figure 1355 Green fluorescent protein in jellyfish

179

Chapter 13 B.4.6

The genomes of many pathogens have been sequenced including the malarial parasite. It may be possible to genetically engineer disease vectors to make them unable to transmit organisms. Genetic resistance to infections, including HIV, is also being studied. Such data will be important for future vaccine development. Rapid diagnostic methods based on the polymerase chain reaction (PCR) technique are used to identify influenza and SARS viruses in blood (see B4.2). These approaches are being further improved for identifying organisms that exhibit drug resistance. Genomics will play a more important role in the control and treatment of cancer. DNA microarray technology (see B.4.3) provides valuable data for cancers of the breast and circulatory system. This technology will become an important part of cancer diagnostics in the future and the identification of high-risk individuals will become standard clinical practices.

Pharmacogenomics is another potential development from genomics. A lot of individual variability exists in the metabolism of drugs; hence, clinical medicine could involve every person’s genetic profile for the metabolism of common drugs being worked out in the future. This information will also be of considerable value to the pharmaceutical industry for designing more effective and safer drugs.

OPTIONS

Stem cell therapy or therapeutic cloning shows great promise, although most of the research has been done in the mouse. Transplant surgery has its limitations, and there is the possibility to replace diseased tissues, including the brain. Stem cells can be obtained from early embryos and from some adult and fetal tissues. There have been some very significant research results published recently (2013) about the effects of ‘acid-shock’ in converting somatic cells to stem cells.

180

Biopharming Many complete human proteins can only be synthesised correctly in higher organisms. Transgenic animals have been developed that secrete the desired human protein into their body fluids. Human proteins have been harvested from milk, blood and urine of transgenic mice, rabbits, pigs, sheep, goats and cows. This technique is known as biopharming. It is a cost-effective method of production and generates large volumes of the active protein. Transgenic plants, including rice, grains and potatoes, have also been developed that produce human proteins, such as medicines. Plant-made pharmaceuticals avoid the risks that come from animal-based pharmaceuticals, namely infectious diseases. Manufacturing resources required for plant-made pharmaceuticals are minimal when compared with the complex and labour-intensive mammalian cell culture methods.

Biopharming of antithrombin

LICATI

S • ON

Genomics is also being used to diagnose coronary heart disease and diabetes, which are the result of environmental factors combined with individual variation in several different genes. If these susceptibility genes can be identified, an analysis of their products will lead to a better understanding of these diseases and will lead to more effective treatments.

• APP

Technological innovation in medicine

AND

IL LS

Transgenic goats have been developed that secrete milk enriched with anti-thrombin-III. It is a protein made in the liver that inactivates several enzymes involved in blood clotting. This product has been approved by the FDA as an anti-coagulant for the prevention of clots before, during, or after surgery or birth in patients with an inherited anti-thrombin III deficiency.

A transgenic goat

Use of viral vectors

LICATI

S • ON

AND

IL LS

Viral vectors in gene therapy

Viral vectors can be used in the treatment of Severe Combined Immunodeficiency (SCID).

Gene therapy is the introduction of genes into a person’s cells and tissues to treat a genetic disease or disorder. Gene therapy aims to replace a defective mutant allele with a functional one.

SCID is a genetic disorder involving the lymphocytes of the immune system. SCID patients cannot produce an effective immune response to pathogens and have to live in a sterile environment free of bacteria. SCID displays an autosomal recessive pattern of inheritance.

In most gene therapy studies, a normal gene is inserted into the genome to replace a mutated disease-causing gene. A vector, usually a virus, is used to deliver the gene to the patient's target cells. Viruses have evolved a way of delivering their genes to specific human cells. Molecular Biologists have taken advantage of this capability and manipulated the virus genome via use of restriction enzymes to replace diseasecausing versions of genes with modified or repaired genes. Target cells are exposed to the vector. The virus then unloads its genetic material containing the modified human gene into the target cells. The generation of a functional protein product from the modified gene restores the target cell to a normal state. Adenoviruses are commonly used viral vectors and their genomes are composed of double-stranded DNA. They cause respiratory infections in humans. When these viruses infect a host cell, they introduce their DNA molecule into the host. The genome of the adenovirus is not incorporated into the host cell's genetic material. The DNA molecule is left free in the nucleus of the host cell, and this extra DNA molecule can be transcribed.

Genetically disabled retrovirus

T cells with non-funtional ADA gene isolated from SCID patient

Many SCID patients lack an active version of the enzyme adenosine deaminase (ADA), which is concerned with recycling the breakdown products of nucleic acids. The absence of ADA activity leads to the accumulation of metabolites that are toxic to lymphocyte development. ADA deficiency is suitable for gene therapy because bone marrow cells (which play an important role in the development of lymphocytes) or lymphocytes are suitable targets for the transfer of functional ADA gene sequences. Functioning genes have been introduced into the patients via use of retroviruses to restore the missing ADA enzyme activity and hence immune function (Figure 1356). Clinical trials have met with some success, but have been associated with high rates of leukemia in treated SCID patients. See Figure 1356.

Bacteria carrying plasmid with cloned normal human ADA gene

Cloned ADA gene is incorporated into retrovirus Genetically altered cells are reimplanted to produce ADA Retrovirus infected T cells, transfers ADA gene to bone marrow cells

OPTIONS

B.4.7

• APP

Biotechnology and bioinformatics

T Cells are grown in culture to ensure ADA gene is active

Figure 1356 Gene therapy for SCID

181

Chapter 13

B.5 Bioinformatics Bioinformatics is the use of computers to analyse sequence data in biological research Bioinformatics (Figure 1360) is an emerging field of biology which uses computer technology for the storage, retrieval, manipulation, distribution and especially the analysis of information related to biological data for DNA, RNA and proteins. There are enormous volumes of biological data, for example, thousands of complete genomes and many more of gene sequences. This is mainly due to new techniques in DNA sequencing. Bio

e nc

r te

ist

Molec

ular B

Data

ie Sc

n ch

Figure 1361 Part of an example sequence in Gen Bank format

The three databases exchange sequence data on a daily basis and each of these databases can be searched by sequence similarity. The SWISS-PROT database stores protein sequences (Figure 1362) in FASTA format where letters represent amino acids, for example, Q represents glutamine and K represents lysine.

m Co

ience

c ation S

iology

Imform Bioinformatics

Medic

sics Biophy

tic

tis sta

Bio

al Scie

Ph ar Scmac ien eu ce tic

nce

Applic ations al

Figure 1360 The discipline of Bioinformatics

B.5.1

Databases allow scientists easy access to information ÂŠ IBO 2014

Databases

OPTIONS

Bioinformatics involves the use of databases which store biological data in a digital form and tools which are pieces of software to perform various tasks such as searches and analysis. These databases, for example, allow biologists easy access to biological information and the amount of data stored in bioinformatics databases is increasing rapidly.

Figure 1362 Human insulin (B chain) data

Structure databases archive, annotate and distribute sets of atomic coordinates to visualise the three dimensional structure of proteins (Figure 1363). Structure databases contain specific information about like bond lengths and angles, X-ray crystal structures and NMR spectroscopic data. The best established database for biological macromolecular structures is the Protein Data Bank, also known as PDB. Figure 1363 shows the structure of a protein, chaperonin, which is involved in protein folding.

There are two basically different types of databases: archival databases and derived databases. The first carries the primary public data; the second uses or recombines these data to derive new properties and relations. The primary sequence databases store raw nucleotide sequence data and can be accessed via the Internet. These include GenBank (Figure 1361) (maintained by the National Centre for Biotechnology Information (NCBI)), the Nucleotide Sequence Database (maintained by the European Molecular Biology Laboratory (EMBL)) and the DNA Databank of Japan (DDBJ). Figure 1363 Structure of chaperonin

182

Exploring chromosome 21 in databases

• APP

LICATI

S • ON

Biotechnology and bioinformatics AND

IL LS

Chromosomes, for example human chromosome 21, can be explored in databases such as ‘Ensembl’. The Ensembl database (Figure 1364) was launched in 1999, shortly before the completion of the human genome project. It is aimed at molecular biologists studying the human genome and other vertebrates and model organisms, for example, Drosophila. Chromosome 21 in humans is the subject of intense research. Trisomy of chromosome 21 causes Down’s syndrome. Chromosome 21 is the smallest human chromosome representing about 1.5% of the total DNA in cells. It contains about 300 to 400 genes. A number of diseases are related to genes on chromosome 21, including Alzheimer’s disease and a number of syndromes and several types of leukemia. Ensembl is a genome browser and generates graphical views of the alignment of genes against a reference genome or reference chromosome (Figure 1365). These are shown as data tracks and allow the user to zoom to a region or move along the genome or chromosome. Pseudogenes are non-functional relatives of genes that have lost their protein-coding ability and are no longer expressed; long stretches of GC rich regions are often associated with genes. A non-coding mRNA does not result in a protein product but the resulting RNA may play an important gene regulatory function.

Figure 1364 the Ensembl database

International cooperation

On-line databases on the Internet and numerous international conferences allow scientists to access and share information related to DNA and protein sequences. Most of the on-line is open access and open to all users, but some data is only accessible by researchers.

OPTIONS

An important aspect to science is cooperation and collaboration between groups of scientists. This may involve scientists from different disciplines within the same institution, or may involve scientists from different institutions in different countries.

Figure 1365 Human chromosome 21 data

183

Chapter 13 B.5.2

Biological databases Biological databases play a central role in bioinformatics. They offer scientists the opportunity to access a wide variety of biologically relevant data, including the genomic sequences of an increasingly wide range of organisms. Making such databases accessible via open standards like the Web (the Internet) is very important since users of bioinformatics data use a range of computer platforms. The body of data stored in biological databases is increasing exponentially. For example, GenBank (Figure 1366), for example, now accommodates >1010 nucleotides of nucleic acid sequence data and continues to more than double in size every year.

Sequences are homologous only if they have evolved from a common ancestor. Homologous sequences often have similar biological functions. Computer programs can be used to calculate the best alignment of two DNA sequences. Figure 1367 shows an alignment of two short DNA sequences. Sequence 1:

AATTGATTGCGCATTTAAAGGG

Sequence 2:

AACTGA

CGCATCTTAAGGG

Figure 1367 Alignment of two short DNA sequences

When identical bases are aligned, it is assumed that these bases were part of the ancestral sequence and have remained unchanged. When non-identical bases are aligned, it is assumed that a mutation has occurred in one of the sequences. Unless the ancestral sequence is known, it is not possible to know in which sequence the mutation actually occurred. Gaps in DNA sequence alignment can be explained by insertions or deletions of bases in the sequence compared to the ancestral sequence. One simple measure of sequence alignment is the percentage of identically aligned bases. In Figure 1367 the number of identically residues is 16, and the length of the alignment is 22, so the percentage sequence identity is 73%. This measure is independent of the length of the alignment, but high percentage identities are more likely to reflect evolutionary relationships (homology) if they are present over long DNA sequences.

B.5.3

Figure 1366 Growth in use of GenBank

What is ‘BLAST’?

Sequence similarity searches of databases allows Biologists to extract sequences (outputs) that are similar to a query sequence (input). Information from these extracted sequences can be used to predict the structure or function of the query sequence. Prediction based on similarity is a powerful and important concept in bioinformatics.

BLAST (Figure 1368), is an acronym for the ‘Basic Local Alignment Search Tool’, it was designed to search nucleotide and protein databases. It takes your query (DNA or protein sequence) and searches either DNA or protein databases for levels of identity that range from perfect matches to very low similarity. Using statistics, the software reports what it finds, in order of decreasing significance, and in the form of graphics, tables, and alignments.

Any random pair of DNA sequences will show some degree of similarity. Sequence alignment is used to distinguish between similarity arising by chance and real biological relationships based on common ancestors. Alignment shows the differences between DNA sequences as changes (mutations), insertions or deletions (gaps) and can be understood in terms of evolutionary relationships.

BLAST can accept the following forms of data: a gene name, a protein accession number (e.g. NP_005537, involucrin a human protein), a nucleotide accession number (e.g. NM_001126), a nucleotide sequence or a protein sequence. It will identify similar sequences in closely related organisms. These closely related genes are known as homologues.

Sequence searching and sequence alignment

OPTIONS

184

Biotechnology and bioinformatics

Figure 1368 BLAST (screen shot)

BLAST can provide answers to the following types of research questions 1. Where does the DNA that I have sequenced originate from? 2. What other genes code for proteins that have structures similar to the one I have determined? 3. What are the likely functions of the gene or protein that I have sequenced?

How BLAST works Millions of DNA sequences from many different organisms have been collected in databases and are available for online database searching. To carry out sequence-based queries with BLAST, databases must be of a special format. The annotation associated with these files must be removed leaving just the sequences. Annotation refers to information, such as which sequences are expressed, splicing patterns, timing of expression in an organism, and mutations linked to diseases. A DNA annotation is the process of identifying the locations of genes and all of the coding regions in a genome and determining what those genes do. Links to the annotation are kept so the identities of these sequences are not lost. Each sequence in the database is then broken into short sequences (words) for comparison to the query.

When a search is submitted, BLAST takes the query DNA sequence and breaks it into sequences or ‘words’ that are quite short (11 nucleotides). It then compares these ‘words’ to those in the database. As BLAST has to compare many millions of ‘words’ in this manner, and the steps can take time, BLAST looks for two adjacent word pairs and, if their similarities and distance between words are acceptable, only those pass to the next set of calculations. Starting with this local similarity, BLAST then tries to extend the similarity in either direction (Figure 1369).

Figure 1369 How BLAST works

Using the sequence immediately up and down of the ‘word’ in the original query, BLAST keeps track of the consequences of lengthening the alignment between the query and the sequence in the database. If it is still matching then the significance score increases. If mismatches are found then penalty points accumulate until the cost outweighs the benefit and BLAST stops extending. All the alignments between the query and the database subjects, or ‘high-scoring subject pairs’, are then ranked based on length and significance. The best hits are kept and presented in the forms of a graphic, a table, and alignments between the query and the hits. BLAST performs local alignment of sequences and this is an important issue. The following example will illustrate this process: Imagine, as a researcher, you have three proteins. The first one has two domains (A and B), the second protein has only one A domain, and the third protein has only B domain. To simplify, the three protein sequences can be written like this: Protein sequence 1:

AAAAAAABBBBBBB

Protein sequence 2:

AAAAAAA

Protein sequence 3:

BBBBBBB

185

OPTIONS

The two main types of BLAST algorithm are BLASTn which allows nucleotide sequence alignment and BLASTp which allows protein alignment. BLASTn compares a DNA query sequence against a DBNA database and BLASTp compares a protein query against a protein database. Both algorithms allows for gaps in the sequences.

Chapter 13 Now if you run BLAST with sequence 1 as a query, you will get a good hit with sequence 2 (because of the presence of domain A) and a good hit with sequence 3 (because of the presence of domain B). The E values of both of these hits may be very high if domains A and B are long and well conserved. The E value is a measure of the reliability of the S score, which is a measure of the similarity of the query (protein or DNA sequence) to the target sequence. The E value is the probability due to chance, that there is another alignment greater than the given S score. If you conclude that sequence 1 is homologous to sequence 2 and 3, that is acceptable, provided you remember that sequence 1 is not homologous over its entire length to sequence 2 or 3. However, you may forget to look at the alignments, and conclude that sequences 2 and 3 are similar to one another because they are both similar to sequence 1. This would, of course, be an incorrect conclusion. When examining a BLAST output do not assume that all the reported hits belong to the same large protein family.

B.5.4

Model organisms A model organism is a non-human species that is studied to understand a process or phenomenon, based on the assumption that discoveries made in the organism will provide knowledge into other organisms. Model organisms are widely used to research human disease when human experimentation is not feasible or unethical. This approach is possible because of the common descent of all living organisms and the conservation of metabolic and developmental pathways during evolution. Important model organisms include: the bacterium E. coli, the baker’s yeast, Saccharomyces cerevisiae, the fruit fly, Drosophilia melanogaster and the round worm C. elegans (Figure 1370).

There are more advanced software tools like PSI-BLAST which compares multiple sequences and thus is able to recognise much more distant relationships.

•

EORY TH KN

Reliability of sources

LED

Shared databases in bioinformatics allow scientists easy access to biological data. This is especially useful in analysing DNA sequences, allowing searches, comparison and modelling. Such databases raise new knowledge questions regarding the reliability of knowledge claims developed from processes originally devised for purposes unrelated to the data analysis for which they are now used. The databases are constantly expanding, allowing new possibilities in data analysis in the future.

OPTIONS

How do technological developments such as these change the nature of knowledge?

186

Figure 1370 Caenorhabditis elegans

The cell cycle in yeast is very similar to the cell cycle in humans and is regulated by homologous proteins transcribed by genes that have similar sequences to human proteins. Yeast was the first eukaryote organisms to have its genome sequenced and remains an important model organism because it is quick and easy to grow. Strains of Saccharomyces cerevisiae have both stable diploid and haploid states which makes it easy to isolate recessive mutations.

Biotechnology and bioinformatics B.5.5

B.5.6

Nucleotide and protein alignment with BLASTn and BLASTp

Homologous sequences show similarities because they have evolved from a common ancestor. Similar sequences are likely to have the same structure and biological function. A sequence can be used as a search query in order to find homologous sequences in a database.

Two forms of BLAST exist that deal with protein sequences: BLASTp, which compares your protein with other proteins contained in protein databases, and BLASTn which compares your protein with DNA sequences translated into their six possible reading frames (three on each DNA strand). BLASTn automatically converts any DNA sequence into six proteins. Protein query sequences for BLAST must be N-terminus to C-terminus and DNA sequences must be 5’ to 3’.

LICATI

S • ON

Using software to align two proteins

• APP

Sequence alignment using data from different organisms

AND

IL LS

Sequence alignment software, such as BLAST, can be used to compare sequences from different organisms. For example, aligning the two amino acid sequences of the globins: human hemoglobin and Sperm whale myoglobin is shown in Figure 1371. Each letter represents a particular amino acid. Human Hemoglobin: V L S P A D K T N V K A AWG K V G A H A G Y E G

Sperm Whale Myoglobin: V L S E G E WQ L V L H V W A K V E A D V A G H G Figure 1371 Human and sperm whale myoglobin

BLASTp is used if a researcher wants to find out about the function of a protein and BLASTn is used if a researcher wants to discover new genes encoding proteins. DNA sequences can also be BLASTed, but it is faster and more accurate to BLAST proteins (using BLASTp), rather than nucleotides. If researchers know the reading frame in the sequence they will translate the sequence and BLAST the protein sequence. Though this, of course, only applies to DNA sequences that are translated into protein. The work of a scientist who does this sort of research is shown on the following page.

These two partial amino acid sequences can be aligned with no gaps (Figure 1372) and with gaps (Figure 1373). V L S P A D K T N V K A AWG K V G A H A G Y E G | | | | | | | | V L S E G E WQ L V L H V W A K V E A D V A G H G Figure 1372 Sequence alignment with no gaps (percent identity: 36 and percent similarity 40) V L S P A D K T N V K A AWG K V G A H A G Y E G | | | | | | | | | V L S E G E WQ L V L H V W A K V E A D V A G H G

OPTIONS

Figure 1373 Sequence alignment with gaps (2) (percent identity: 46 and percent similarity 54)

187

Chapter 13 Profile: Dr Donald Gardiner My work aims to understand how a group of the most devastating fungal pathogens of wheat invades their host plant. The pathogens are called Fusarium graminearum and its close relative, Fusarium pseudograminearum. During infection they produce a toxin, called deoxynivalenol, which both assists with invasion of the plant and also contaminates any grain that is harvested from the crop. This toxin is highly harmful to humans and animals that may eat the grain. By understanding the mechanisms a pathogen uses to cause disease, we hope to be able to implement better control strategies that will assist the farmer to protect their crops and deliver safer food to consumers. In modern molecular biology, having a genome sequence for your organism of interest is highly advantageous. With new DNA sequencing technology, obtaining genomes for fungi is relatively straight forward. However, the way the genome sequence is obtained means it remains in literally millions of pieces that need to be put back together and this can be a challenging task. With advanced software and high performance computing, we can now put most of these pieces back together. For our Fusarium species ,when this is done we typically end up with genomes in about 500 pieces.

Dr Donald Gardiner at work

Each of these pieces will contain hundreds of different genes. By predicting the genes that are encoded by the genomes we can begin to understand how the pathogen has evolved and the mechanisms that it uses to invade its host. This is done by comparing all of the genes encoded by a pathogens genome with those of both closely and distantly related organisms. The general term for approaches like this is “comparative genomics”. One of the most fundamental components of comparative genomics is the ability to compare the sequence of the genes or proteins encoded by an organism’s genome. One tool that is extensively used is BLAST; basic local alignment search tool. I have previously used BLAST to compare the entire gene set of many different genomes of fungi all at once. These comparisons can be used to identify highly conserved genes, that might be important for basic cellular functions such as energy generation or DNA replication, and genes that are less well conserved or only present in a few species. It is this latter group that might contain genes involved in virulence on a particular plant host. Using this approach we recently discovered genes in the genome of Fusarium pseudograminearum that had been horizontally transferred between distantly related fungi that all shared a common plant host (Gardiner, McDonald et al. 2012). In some example genes were also shown to be transferred between bacteria and fungi. To test the hypothesis that these genes (shared exclusively between pathogens with a common host) are involved in virulence, mutant strains of the fungus are created and compared to the wild type strain in plant infection assays. This is done by replacement of the gene with an antibiotic resistance gene using homologous recombination. This creates a mutant organism that, apart from the deleted gene and antibiotic resistance is identical to the original pathogen. These strains are then compared for their ability to infect the host plant in a controlled environment room. Through this process we can begin to understand how these fungi cause disease on wheat. Education and career

OPTIONS

I studied a Bachelor of Biotechnology (honours) at the Flinders University of South Australia and completed a PhD in molecular plant pathology at Melbourne University where I researched the interaction between canola and a fungal pathogen. After a brief post doctoral fellow at the University of Queensland, undertaking research in mammalian genomics, I joined the Australian Commonwealth Scientific and Industrial Research Organisation in 2005, where I have been researching Fusarium incited diseases of a number of crop plants ever since. Gardiner, D. M., M. C. McDonald, et al. (2012). “Comparative pathogenomics reveals horizontally acquired novel virulence genes in fungi infecting cereal hosts.” PLoS Pathog 8(9): e1002952.

188

Biotechnology and bioinformatics B.5.7

Databases can be searched to compare newly identified sequences with sequences of known function in other organisms ÂŠ IBO 2014

BLASTing protein sequences BLASTp compares a protein sequence with a protein database. It will find similar protein sequences in a sequence database. For example, BLASTp can be used to answer the following question: are there any proteins similar to the Xenopus nucleolin (a nuclear protein) in the protein database SWISSPROT? There are two ways to send a sequence to the BLASTp server. An accession number can be used, for example, Q06459, is the accession number for Xenopus nucleolin. This can be entered in the sequence box of the BLASTp home page (see Figure 1375.) Alternatively it can be entered in FASTA format, which uses a set of letters to represent the amino acids and is written from the N terminus to the C terminus. The sequence given to BLASTp is the query sequence and sequences similar to the query that BLASTp returns are the hits or matches. The database being searched is the target database, in this case, SWISS-PROT, managed by the Swiss Bioinformatics Institute.

Figure 1375 The BLASTp server at NCBI

Understanding the BLAST output 1.

A graphic display: shows where your query in similar to other sequences.

A hit list: the same sequences similar to your query, ranked by similarity.

The alignments: every alignment between your query and the reported hits.

The graphic display

The display in Figure 1376 helps researchers to visualize their results. The query sequence is on the top. Each bar represents the portion of another sequence similar to the query sequence and the region of the sequence where this similarity occurs. The blue and the black bars indicate the matches that have the worse scores. Red is the best and pink and green matches are usually the good ones. Black hits are the bad hits: proteins that have so little in common with the query sequence that their alignment probably means nothing biologically. The display in Figure 1376 also shows researchers that some matches do not extend over the complete length of the protein sequence. BLASTp is a useful tool to discover protein domains. In Figure 1377 the top hits are proteins homologous to the Xenopus nucleolin. Near the bottom, the shorter hits corresponds to the domain in the nucleolin protein that binds RNA. These hits indicate proteins that also contain this RNA binding domain but are unrelated to the nucleolin.

189

OPTIONS

You will find four sections in the output of most BLAST servers. These sections always appear in the same order and include

Chapter 13

Figure 1376 The NCBI BLAST graphic display

The hit list

A hit list shown in Figure 1377 immediately tells the researcher whether the sequence resembles one already in the SWISSPROT database and whether or not it can be trusted as a good hit. Each line contains four important features.

OPTIONS

Figure 1377 The NCBI BLAST hit list

The sequence accession number and the name: a hyperlink will take the user to the database entry that contains this sequence. In this entry is important annotated information describing the sequence. It is a combination of comments, notations, references and citations describing all the experimental information about a gene or protein. Description: A description that comes from the annotation. The bit score: A measure of the statistical significance of the alignment. The higher the bit score, the more similar the two sequences. Matches below 50 bits are very unreliable. The E-value (expectation value): the lower the E-value, the more similar the sequences and the more confidence a Bioinformatics researcher can have that this hit is homologous to their query sequence. A common â&#x20AC;&#x2DC;rule of thumbâ&#x20AC;&#x2122; (for proteins more than 100 amino acids long) is that if more than 25% of the amino acid sequences are present in a pair of proteins they are homologous. A similar 70% rule is applied to nucleotide sequences.

190

Biotechnology and bioinformatics 3.

The alignments

BLAST displays the alignments for a BLAST search just below the hit list, as shown in Figure 1378. The first item is the name. Sometimes there is more than one sequence name; this happens when several sequences align identically to those in the query. The identity is the number of identical residues divided by the number of matched residues - gaps are simply ignored. The Positives field gives you a measure of the fraction of residues that are either identical or similar, represented with a + on the actual alignment. The Gaps field shows residues that were not aligned.

Figure 1378 Pairwise alignment reported by BLAST (screen shot)

Multiple sequence alignment is used in the study of phylogenetics ÂŠ IBO 2014

Multiple alignment Protein, DNA and RNA molecules form families and their inter-relationships can be shown by multiple alignment of the sequences. These are like the pair-wise sequence alignment described earlier for BLAST, but involve more than two sequences. Multiple alignment often gives more knowledge than pair-wise alignment because it gives information about evolutionary conservation. For example, two identical amino acids residues may be aligned between two protein sequences, but the fact that these have not mutated may be just chance. However, if an amino acid residue is conserved in a family of sequences that are otherwise quite different from each other, then this indicates that the amino acid residue might play a critical structural or functional role, often in the active site of an enzyme.

An example of multiple alignment of serine proteases is shown in Figure 1379. This is a section of multiple alignment of serine protease sequences, the top one is human thrombin (THRB-HUMAN) an enzyme involved in blood clotting. FA-9 is a serine protease antibody present in blood. 'B' indicates beta sheet and 'A' indicates alpha helix.

Figure 1379 Comparing protein sequences.

Serine proteases are a family of proteases, including the digestive enzyme trypsin whose active site contains the amino acid serine. Figure 1380 shows a computer generated image and illustrates the tertiary structure of trypsin (a serine protease).

191

OPTIONS

B.5.8

Chapter 13

Figure 1380 A computer generated image of trypsin

The alignments in Figure 1376 show that there are two reasons for conservation within the family of amino acid residues, or residue properties in proteins: to preserve function and to preserve structure. Serine proteases break peptide bonds using a serine (S) reside that is activated by histidine (H) and aspartic acid (H) residues. These three residues (known as a catalytic triad) are essential to the function of serine proteases. Because they are essential to the functioning of the enzymes, they are conserved in each member of the serine protease family. The conserved histidine is the sixth amino acid residue from the right hand side of the alignment in Figure 1376, and it is conserved in all the alignment sequences.

OPTIONS

Maintaining a stable three-dimensional protein structure is another reason for residue conservation in protein families, such as the serine proteases. There is a strong link between the amino acid conservation patterns seen in multiple sequence alignments and the underlying tertiary structure of the protein. Two conserved structural features in Figure 1377 are the two conserved cysteine residues (which are bonded by a disulfide bridge to each other) and the strong tendency to conserve hydrophobic amino acids in the beta-sheet sections. Clustal Omega (Figure 1381) is the most commonly used software for making multiple sequence alignment. Clustal Omega uses a progressive method to build its alignments. Instead of aligning all the sequences at the same time, it adds them one by one. Clustal Omega accepts sequence data in a variety of formats including FASTA and SWISSPROT formats.

192

Figure 1381 The Clustal Omega server

Phylogenetics Living organisms are classified into groups based on observed similarities and differences (Topic 5, Evolution and Biodiversity). A general principle of natural classification systems is that the more closely related species ‘X’ is to species ‘Y’ the more likely they shared a recent common ancestor. In this way similarities and differences, including molecular differences, between organisms can be used to establish phylogenies (evolutionary relationships). The branch of biology that deals with finding the evolutionary relationships among organisms is phylogenetics. Phylogenetics can be studied using cladistics, where species are grouped only with those that share derived characters, that is, characters that were not present in their distant ancestors. Cladistics (Figure 1382) is the best method for phylogenetic analysis because it is based on the widely accepted concept that speciation occurs by bifurcation (cladogenesis). This is the splitting of a population into two species. Archebacteria

Fermenting Bacteria

Photosynthetic Bacteria

Earliest Bacteria

Aerobic Bacteria use oxygen and kerbs cycle to produce 30ATP

Protein glucose by photosynthesis (oxygen is produced) Consume glucose from environment and break it down by glycolysis to produce 2ATP (produce a little more energy) Break down 2H to produce ATP (does not produce much energy)

Consume ATP from the environment

Figure 1382 Cladogram showing evolutionary relationships of bacteria

Biotechnology and bioinformatics

The principle behind the phylogenetic analysis of protein and DNA sequences is that the greater the similarity between two sequences, the fewer mutations are required to convert one sequence into the other. Hence, the more recently they shared a common ancestor. The evolutionary relationships established from this type of analysis assume a constant mutation rate.

Phylogenetic trees and cladograms Phylogeny groups can be used to classify living organisms according to their level of similarity. The assumption is the more similar two species are, the closer they are in evolutionary terms to their common ancestor. Phylogenetics relies on the comparison of equivalent genes coming from several species for reconstructing the evolutionary tree of these species. Phylogenetic trees are used to show evolutionary relationships. Phylogenetics is important in Bioinformatics. For example, determining the closest related species of the species under study. If you are studying a new bacterium, its ribosomal RNA can be placed on phylogenetic tree and compared with all known bacterial ribosomal RNA molecules. This gives a good indication of the nature of the bacterium. Phylogenetics can also be used to discover the function of a gene. A researcher studying a gene can use phylogenetic trees to ensure that the gene they are interested in is orthologous to another well-known gene in another species. Orthologs (Figure 1380) are homologous genes separated by speciation. An example would be the betahemoglobin genes of human and chimpanzee. Paralogs are homologous proteins separated by a duplication event. Paralogs (Figure 1383) will have different but related functions. An example would be the human alpha and beta-hemoglobin genes. A Gene Duplication

B Speciation

Divergence

Phylogenetics can also be used to retrace the origin of a gene. Sometimes individual genes may â&#x20AC;&#x2DC;jumpâ&#x20AC;&#x2122; from one species to another, for example, during a viral infection. These are known as xenologues. Phylogenetic trees reveal such events, known as horizontal or lateral gene transfers. This is the primary reason for bacterial antibiotic resistance and in the evolution of virulence in pathogenic bacteria. Genetic engineering is an artificial form of lateral gene transfer. In phylogenetic tree diagrams, the nodes represent different organisms and links are used to show lines of descent (evolutionary relationships). As an example, consider the phylogenetic relationship between the organisms C (chimpanzee), G (gorilla), H (human), O (orangutan) and the last common ancestor of all the species (X). Figure 1384 indicates a phylogenetic tree diagram or cladogram showing the relationship between four species.

Fig 1384 A simple cladogram

There are two types of nodes: the ancestral node (represented by boxes) produces branches. This may link to other ancestral nodes or may link to terminal nodes or leaves (shown as names followed by letters). They represent known species and mark the end of an evolutionary pathway. This rooted phylogenetic tree diagram is binary which means that no ancestral nodes have more than two branches. Thus, the evolution of species is represented as a series of bifurcations (speciations) which agrees with cladistics. Hence, the phylogenetic trees are also known as cladograms. The lengths of the branches may be used to indicate the actual evolutionary distances between organisms. A cladogram which shows a sense of evolutionary time or distance using branch lengths may be called a phylogram (Figure 1385). They usually represent differences between DNA or protein sequences.

Figure 1383 Orthology and paralogy

193

OPTIONS

Protein and DNA sequences are particularly useful for comparison because they are a large set of data, which extends across all organisms. This allows the comparison of both closely related and distantly related taxa (classification groups). The evolutionary relatedness between sequences can be quantified using sequence alignment algorithms.

C G O Figure 1385 A simple phylogram

Phylogenetic trees are constructed from either similarity tables (where the numbers show the percentage of matches) or distance tables (where the numbers shows percentage differences or distances), which show the resemblance among organisms for a given set of DNA, RNA or protein sequences (Figure 1386). If sequences are used, they are compared initially using multiple sequence alignment tools, such as Clustal Omega.

LICATI

S • ON

Using computer software

• APP

Chapter 13 AND

IL LS

Software can be used to construct simple cladograms and phylograms of related organisms using DNA sequences. Clustal Omega is a general purpose global multiple sequence alignment program for DNA, RNA or proteins. It produces multiple sequence alignments of divergent sequences. It calculates the best match for the selected sequences, and lines them up so that the identities, similarities and differences can be seen. Figure 1387 shows the result of a multiple sequence

alignment for the cytochrome c sequences from a wide range of organisms. The protein is shown in FASTA format, where the letters represent amino acids. Cytochrome c is a highly conserved protein across the spectrum of species, found in plants, animals, and many unicellular organisms. It is part of the electron transport chain in the inner mitochondrial membrane. You will see three different symbols below the aligned sequences: '*', this symbol is used for the amino acids that are completely conserved between all sequences,

Figure 1386 Difference table for two hominid nucleotide sequences

':' this symbol is used when there is a strong correlation across all of the sequences (many of the sequences have that amino acid),

OPTIONS

'.' this symbol is used when there is a weak correlation Few of the sequences have that amino acid, and in addition to these three symbols, some amino acids have no symbols associated with them, indicating that there is no correlation among the different sequences.

Figure 1387 A multiple sequence alignment of cytochrome c

194

Biotechnology and bioinformatics Clustal Omega is also capable of displaying phylogenetic trees: phylograms (Figure 1388) and cladograms (Figure 1389). The software routine will generate the most parsimonious Phylogram tree, or shortest tree that requires the fewest total evolutionary events, for example, substitutions.

Figure 1388 Phylogram of cytochrome c sequence evolution Hydrogenobacter neurospora YEAST candida_yeast WHEAT rice drosophila sheep_blowfly silkworm trumpethornworm tuna bull_frog prairie_rattlesnake Western_diamondback HUMAN Rhesus_monkey CHICKEN penguin snapping_turtle Kangroo Gray_whale SHEEP donkey zebra HORSE MOUSE RABBIT

Figure 1389 Cladogram of cytochrome c sequence evolution

B.5.9

Expressed sequence tag (EST) The time required to find and describe a gene is decreasing quickly due to Expressed Sequence Tag (Figure 1390), or ESTs. ESTs provide researchers with a cheap route for quickly discovering new genes, for getting data on gene expression and regulation, and for constructing genome maps.

Figure 1390 EST production

An EST is a small piece of DNA sequence (usually 200 to 500 bases long) that is generated by sequencing either one or both ends of an expressed gene. The idea is to sequence bits of DNA that represent genes expressed in certain cells, tissues, or organs from different organisms and use it to detect a gene out of a portion of chromosomal DNA by matching base pairs. Almost 100 million ESTs are available in on-line public databases, for example, GenBank (Figure 1391).

Figure 1391 Part of a human EST in FASTA format

Gene identification is difficult in humans, because most of the human genome is composed of introns with a small number of DNA coding sequences (genes). Isolating messenger RNA is critical to finding expressed genes in the human genome since messenger RNA does not contain introns. Messenger RNA is unstable outside of a cell; it is therefore converted to complementary DNA (cDNA) using reverse transcriptase. cDNA is more stable because it was generated from a mRNA in which the introns have been removed, cDNA represents only the expressed DNA sequence. Once cDNA representing an expressed gene has been isolated, Biologists can then sequence a few hundred nucleotides from the 5’ end of the molecule to create an EST. More recently RNAseq using 'next gen' sequencing and de novo assembly is the normal route to get mRNA sequences. Using ESTs, scientists have rapidly isolated some of the genes involved in Alzheimer’s disease and colon cancer.

195

OPTIONS

neurospora 0.15152 YEAST: 0.04537 candida_yeast: 0.12954 WHEAT: 0.04537 rice: 0.05372 drosophila: 0.16914 sheep_blowfly: 0.03758 silkmoth: 0.08392 trumpethornworm: 0.08184 tuna: 0.08992 bull_frog: 0.4600 prairie_rattlesnake: 0.00000 Western_diamondback: 0.00157 HUMAN: 0.00805 RHESUS_monkey: 0.00157 CHICKEN: 0.00817 penguin: 0.01106 snapping_turtle: 0.03942 Kangaroo: 0.03733 Gray_wale: 0.00720 SHEEP: 0.00353 donkey: 0.00000 zebra: 0.00000 HORSE: 0.00843 MOUSE: 0.00769 RABBIT: 0.01154

• APP

AND

Researchers can get an overview by visualising the data in the form of graphs, tables, networks, scatter plots and surfaces. However, a more important task is to analyse the data and extract new biological knowledge. Data mining (Figure 1392) is the process of automatic discovery of novel (new) and understandable models and patterns from large amounts of data. Data mining techniques draw from statistics (e.g. t test), machine learning (using rules), pattern recognition and database and optimisation techniques. Statistics are of two types, for example, descriptive statistics which describes data, for example, standard deviation and inductive statistics, which makes forecast and inferences. Machine learning methods are computer programs that make use of sampled data or past experience information to provide solutions to a given problem. Transformation Prepocessed

Target data

Machine Learning

Transformed data

(Artificial Intelligence)

Models

Interpretation Selection

Evaluation

Data Knowledge

Figure 1392 Data mining

OPTIONS

Types of expected data mining and analysis results include discovering relationships, for example, the expression level of gene A is correlated with the expression level of gene B under varying treatment conditions. Genes A and B are part of the same pathway. BLAST based searches of ESTs combined with protein domain identification software has allowed researchers to quickly identify a number of new human genes.

196

LICATI AND

IL LS

Recent developments in biotechnology, such as DNA sequencing and DNA microarrays, have allowed high-throughput data generation from genomes and biological samples. In other words, there is a large amount of biological data including genomics (DNA), proteomics (proteins), metabolomics (metabolites) and transcriptomics (RNA).

Preprocessing

‘Gene knockout’ technology

S • ON

LICATI

S • ON

Discovery of genes by EST data mining

• APP

Chapter 13

IL LS

‘Gene knockout’ technology can be used in mice APPLICATION to determine gene function. A gene knockout is a genetically engineered organism that carries a gene in its chromosomes that has been made nonUsefunctional, of knockout technology in mice to determine gene usually by a large deletion has been function ‘knocked out’ (refer to Figure 1393) of the organism. A gene knockout isNORMAL a genetically engineered organism GENE that carries a gene in its chromosomes that has been made non-functional, usually by a large deletion (has been ‘knocked out’ (Figure 1393) of the organism). GENE REPLACEMENT

GENE REPLACEMENT

GENE ADDITION

Also known as knockout organisms or simply knockouts, only mutant gene is active no mutant gene present genes are expressed they are used in learning about a both gene that has been sequenced, Figure but which has an unknown or incompletely 1393 Gene knockout principle known function. Biologists learn about the action of the normal from difference between the Also gene known as the 'knockout organisms' or knockout simply organism and normal individuals. 'knockouts', they are used in learning about a gene that has been sequenced, but which has an unknown or incompletely known function. INSERT Figure 1393 Genethe knockout Biologists learn about action of the normal gene from the difference between the knockout organism and normal individuals. Transgenic knock out mice have been produced that lack Transgenic knock out mice have been produced DNA helicase which is concerned with transcription and that lack DNA helicase which is concerned with DNA repair. These knock out mice are infertile, show transcription and DNA repair. These knock out many of the symptoms of premature aging and reduced mice are infertile, show many of the symptoms of life span. premature aging and have a reduced life span. These knock out mice (refer Figure 1394 next page) are produced fragment embryonic These knockintroducing out micea DNA (Figure 1394into ) are produced mouse stem cells grown in culture. In a few cases the introducing a DNA fragment into embryonic mouse stem embryonic cellsInwill have theirthe normal helicase cells grown instem culture. a few cases embryonic stem genes replaced the helicase mutant genes helicase gene by (bythe cells will have their by normal replaced recombination or (by crossing over). These stem cells mutant helicase gene recombination or crossing over). can then be selected and grown to form a colony. These stem cells can then be selected and grown to form These altered embryonic cells arecells injected into a very a colony. These altered embryonic are injected into a early mouse embryo. very early mouse embryo. A mouse that develops from such an embryo will have some somatic (body) cells that carry the altered A helicase mouse that develops from such an embryo will have gene. Some of these transgenic mice may some somatic cells(that thatlead thattocarry the altered contain germ(body) line cells production of helicase of these transgenic mice may ova or gene. sperm)Some that carry the altered helicase gene. contain germ line cells (that lead to production of Breeding these transgenic mice with normal (wildova or type) sperm) thatwill carry the altered helicase Breeding mice produce some mice thatgene. contain the these transgenic mice withinnormal (wild type) mice will mutated helicase gene all of their cells. produce some mice that contain the mutated helicase Knockouts often appear to have no effect because of ‘redundancy’, that is, more than one gene product can more or less carry out the same biological function.

Biotechnology and bioinformatics • APP

LICATI AND

(A)

ES cells growing in tissue culture

altered version of target gene constructed by genetic engineering

(B)

introduce a recombinant DNA fragment containing altered gene into many cells let each cell grow to form a colony

S • ON

‘Gene knockout’ technology (continued)

IL LS

female mouse

MATE AND WAIT 3 DAYS isolated early embryo (blastocyst)

inject ES cells into early embryo

early embryo partly formed from ES cells test for the rare colony in the DNA fragment copy of the normal gene introduce early embryo into a recipient mouse ES cells with one copy of target gene replaced by mutant gene birth

OPTIONS

somatic cells of offspring tested for presence of altered gene, and selected mice bred to test for gene in germ-line cells

transgenic mouse with one copy of target gene replaced by altered gene in germ line Figure 1394 An example of ‘genetic knockout’ in mice

197

Chapter 13

Chapter 13 Revision Questions Section A Multiple Choice Questions

OPTIONS

Work in progress

198

Biotechnology and bioinformatics

OPTIONS

Section B Short Answer Questions

199

OPTIONS

Chapter 13

200

OPTIONS

Biotechnology and bioinformatics

201