lars van middendorp cardiac dyssynchrony by lars van middendorp

CARDIAC DYSSYNCHRONY structural, functional, transcriptional and pharmacological aspects

thump thump

Lars B. van Middendorp

Cardiac Dyssynchrony structural, functional, transcriptional and pharmacological aspects

Proefschrift Ter verkrijging van de graad van doctor aan de Universiteit Maastricht, op gezag van de Rector Magnificus, Prof. Dr. L.L.G. Soete, volgens het besluit van het College van Decanen, in het openbaar te verdedigen op vrijdag 04 september 2015 om 12:00 uur door Laurent Boyd van Middendorp geboren op 23 augustus 1986 te Leusden, Nederland

UM UNIVERSITAIRE

PERS MAASTRICHT

Promotores: Prof. Dr. F.W. Prinzen Prof. Dr. J.G. Maessen Copromotor: Dr. F.A. van Nieuwenhoven Beoordelingscommissie: Prof. Dr. U. Schotten (voorzitter) Prof. Dr. J.M.T. de Bakker Prof. Dr. H.-P. Brunner La Rocca Prof. Dr. D.J. Duncker Prof. Dr. L. de Windt

Het verschijnen van dit proefschrift werd mede mogelijk gemaakt door de steun van de Nederlandse Hartstichting

Parts of the research described in this thesis were performed within the framework of CTMM, the Center for Translational Molecular Medicine (www.ctmm.nl), project COHFAR (grant 01C-203), and supported by the Dutch Heart Foundation and Medtronic.

Financial support for the publication of this thesis as provided by the following sponsers, is gratefully acknowledged.

www.relitech.nl

Reliable innovation driven technology

Questions of science, science and progress. Do not speak as loud as my heart. dedicated to Alicia

ISBN/EAN: 978-94-6159-452-5 Grahpic Design by Drunk on Dreams Published by Universitaire Pers Maastricht Printed by Datawyse 4

Table of contents Chapter 1

General introduction Background and outline of the thesis

Chapter 2

Dyssynchronous Heart Failure; From bench to bedside

Chapter 3

Animal models of dyssynchrony

Chapter 4

Newly developed chronic dyssynchronous heart failure model

Chapter 5

Local regulation of microRNA-133a and connective tissue growth factor in the asymmetrically hypertrophied dyssynchronous heart

Chapter 6

Interplay between local and global regulation of hypertrophy and fibrosis in the dyssynchronous failing heart

Chapter 7

Ex vivo and in vivo administration of fluorescent CNA35 specifically marks cardiac fibrosis

106

Chapter 8

Electrophysiological and hemodynamic effects of Vernakalant and Flecainide in dyssynchronous canine hearts

122

Chapter 9

Electrophysiological and hemodynamic effects of Vernakalant and Flecainide during cardiac resynchronization in dyssynchronous canine hearts

140

Chapter 10

General discussion

158

Summary

(samenvatting)

172

Valorisatie

182

Dankwoord

184

About the author

190

Publications

194 5

CHAPTER 1 general introduction

Chapter 1 General introduction background and outline of the thesis

Introduction The heart is a hollow muscular organ that pumps blood through the vascular system to provide the body with oxygen and nutrients, and to remove waste products from metabolism. Heart failure (HF) is the inability of the heart to meet the body demands. Essential for cardiac function is synchronous electrical activation and simultaneous contraction of the cardiomyocytes. Physiological activation starts in the sinus node, located in the right atrium, just below the vena cava superior. From there, activation spreads throughout both atria and passes the atrioventricular (AV) node. Subsequently, activation spreads rapidly via the His-Purkinje fibers. The bundle of His divides into a right and left bundle branch that run on the two respective sides of the ventricular septum. Each branch spreads and subdivides to finally become Purkinje fibers. The Purkinje fibers end in, or close to, the ventricular endocardium as Purkinje-myocardial junctions. From these Purkinje myocardial junctions the electrical activation wave spreads towards the regular cardiomyocytes, the â&#x20AC;&#x153;working myocardiumâ&#x20AC;?.1 The ventricles are thus activated from the endocardium to the epicardium.2, 3 The Purkinje fibers transmit action potentials at very high velocity (1.5 to 4.0m/s), which is four times faster than in ventricular muscle fibers. This enables an almost immediate and synchronous activation of both ventricles.3 The action potential triggers calcium (Ca2+) influx through L-type calcium channels into the cardiomyocytes, initiating Ca2+ induced Ca2+ release by the sarcoplasmatic reticulum (SR).4 The now abundant Ca2+ binds to troponin, causing tropomyosin to dislocate, by which it enables the myosin/actin cross-bridging of the sarcomere. In other words, the Ca2+ influx enables contraction of the muscle fibers.5 Thus, it is because of the specialized cardiac conduction system, that both ventricles start to contract at approximately the same time. Left bundle branch block In case of left bundle branch block (LBBB), transmission of the cardiac impulse through the left bundle branch is, as its name reveals, blocked or at least significantly slowed down. Instead of rapid activation via the fast Purkinje-network, the left ventricle (LV) is activated by slow cell-to-cell conduction via the ventricular muscle fibers (velocity 0.3 to 0.5m/s). The right side of the septum and right ventricular free wall are activated through the intact right bundle branch, from where activation spreads slowly through the septum to course around the LV endocardium to finally end at the epicardium of the left ventricular free wall (LVfw).6, 7 Hence, the right ventricle (RV) is activated earlier than the LV. These conduction abnormalities are reflected on the body surface ECG as 8

CHAPTER 1 general introduction

widening of the QRS complex and a specific QRS morphology. Strict criteria for complete LBBB are a QRS width ≥140ms in men and ≥130ms in women.8 LBBB morphology is characterized by a negative QRS complex in V1 and a broad positive QRS complex in the lateral leads, because the depolarization waves generated by the two ventricles appear sequentially and do not neutralize each other. Also, mid-QRS notching or slurring in the lateral leads (V5, V6, I and avL) seems to be an important indicator of LBBB on the ECG. In patients with HF, conduction can be further hampered by variable degrees of injury and disarray in different layers and regions, caused by fibrosis, hypertrophy, cellular uncoupling or pathologic ion channel functioning. Cardiac dyssynchrony Recently the term dyssynchronous heart failure was introduced to describe the relation between HF and accompanying timing differences in electrical activation and/or contraction. However, the term dyssynchrony is not clearly defined. In many publications “asynchrony” refers to timing differences in electrical activation, whereas “dyssynchrony” often refers to mechanical timing differences. Nonetheless, this difference is not used consistently throughout literature. Therefore, “dyssynchrony” is used throughout this thesis for both electrical and mechanical timing differences. Dyssynchrony can be treated with cardiac resynchronization therapy (CRT). CRT resynchronizes the heart by pacing the latest activated region (in case of LBBB; the LVfw), simultaneous with the RV. Large clinical trials, like MIRACLE, COMPANION, MADIT-CRT and CARE-HF clearly showed an improvement of symptoms and quality of life while reducing complications of heart failure and reducing the risk of death.9-12 With the introduction of this therapy, it became clear that resynchronization markedly reduces the burden of HF, supporting the idea that dyssynchrony may at least contribute to the development of HF.

Aim of the thesis A major aim of the research presented in this thesis is to improve our understanding of cardiac dyssynchrony related remodeling processes in the broadest sense of the term. Dyssynchrony has a strong impact on local and global cardiac function and initiates many remodeling pathways at different levels. Some of these remodeling processes may initially be beneficial, but many are detrimental on the long run. We recognized that, while the information about remodeling induced solely by LBBB is increasing, it is poorly understood how this molecular remodeling behaves when heart failure develops on top of LBBB. To better investigate this, we developed a new animal model of chronic dyssynchrony in combination with volume overload. In studying the molecular basis of remodeling, we focused on recently discovered mediators of the transcriptional regulation: microRNAs (miRs).13, 14 MiRs are thought to regulate at least one third of the protein encoding genes. Therefore, we investigated the relation between miRs and hypertrophy in hearts with LBBB, all or not in combination with volume overload, and with or without CRT. A major hallmark of several cardiac diseases is a disproportionally increased production and/or decreased degradation of extracellular matrix (ECM), resulting in ECM accumulation and fibrosis. Collagen type 1 is the major cardiac ECM protein, but little is known about collagen deposition as a consequence of dyssynchrony. The limited capacity of current imaging techniques to detect collagen in vivo could be responsible for the knowledge gap. We sought for a better and potentially minimally invasive technique to measure collagen accumulation and fibrosis. A second major aim is to investigate influence of commonly used pharmacological agents, Flecainide and Vernakalant, on dyssynchronous electrical activation since they are known to lower the conduction velocity of myocardial depolarization. While slower conduction may be helpful in treating arrhythmia like atrial fibrillation (AF), it may have adverse effects in cases where impulse conduction is already slow, such as in LBBB. Flecainide and Vernakalant are used to treat AF.15, 16 AF is the most common cardiac arrhythmia and affects 1-2% of the general population.17, 18 Moreover, the prevalence of AF increases significantly with worsening heart failure.19 Flecainide is a Class Ic drug and primarily acts through blockade of the sodium channel, thus slowing myocardial conduction. Slowing myocardial conduction is desirable in order to prevent re-entry induced AF, however it may 10

CHAPTER 1 general introduction

increase the degree of dyssynchrony in the presence of a LBBB.20 Vernakalant, on the other hand, increases the atrial effective refractory period in a dose dependent manner through blockage of the potassium channels. Furthermore, its inhibition of the sodium current was shown to be rate- and voltage-dependent. Therefore Vernakalant may slow conduction more in fast fibrillating atria than in the slower beating ventricles.21-23

Outline of the thesis After this general introduction, chapter 2 reviews the pathophysiology of dyssynchrony in combination with the acute effects on cardiac function. Subsequently, the remodeling responses are discussed, including structural, electrical and contractile remodeling. Throughout the chapter we link the results obtained in bench research to daily clinical practice. Chapter 3 reviews the current animal models that aid in the understanding of dyssynchrony and that enable the translation to the human heart. In chapter 4 a new animal model of dyssynchrony in combination with volume overload is presented. We believe that this new model can help to improve our understanding of the chronic effects of dyssynchrony in combination with heart failure. Chapter 5 focusses on the transcriptional alterations during dyssynchrony and resynchronization. To this purpose local expression of miR-133a, miR-29c and miR-30c were related to local hypertrophy and ECM remodeling in the early- and late-activated regions in the canine LBBB model. MiR-133a and miR-30c were included because of their known relation with hypertrophy and ECM remodeling. In addition, connective tissue growth factor (CTGF) was analyzed since it is a key mediator of ECM production in pathological fibrotic conditions. Moreover, CTGF is strongly expressed in cardiomyocytes and has been associated with cardiac hypertrophy. MiR-29c was included because of the close relation with cardiac fibrosis. The reversibility of these changes was tested by applying CRT. Chapter 6 elaborates on the transcriptional changes found in animal models of compensated and decompensated dyssynchrony. MiR-133a, -29c, -30c, CTGF and collagen1A1 were analyzed for the same reasons as in chapter 5, but the subset of genes was extended with miR-146a, -146b, -155f, -199b, -222 and miR499 because of their known relation with hypertrophic remodeling during pressure overload. Chapter 7 describes the development of a tool for better detection of cardiac collagen. We tested the in vivo applicability of CNA35, a protein known to specifically bind to collagen. 11

We investigated whether it is applicable for cardiac collagen detection and whether it may be suitable as an injectable label allowing in vivo imaging of collagen deposition. Chapter 8 and 9 compare the effect of Vernakalant and Flecainide in electrically compromised hearts. Chapter 8 mainly focusses on the electrophysiological and hemodynamic effects of Vernakalant and Flecainide in hearts with minimal structural heart disease and dyssynchrony. In chapter 9 the potential interference of antiarrhythmic drugs with the positive inotropic effect elicited by CRT is investigated. The final chapter (chapter 10) will link the findings of the above mentioned studies and discuss them in a broader scientific perspective.

CHAPTER 1 general introduction

References 1. Massing GK, James TN. Anatomical configuration of the His bundle and bundle branches in the human heart. Circulation. 1976 Apr;53(4):609-21. PubMed PMID: 1253382. Epub 1976/04/01. eng. 2. Spach MS, Barr RC. Ventricular intramural and epicardial potential distributions during ventricular activation and repolarization in the intact dog. Circulation research. 1975 Aug;37(2):243-57. PubMed PMID: 1149199. Epub 1975/08/01. eng. 3. Durrer D, van Dam RT, Freud GE, Janse MJ, Meijler FL, Arzbaecher RC. Total excitation of the isolated human heart. Circulation. 1970 Jun;41(6):899-912. PubMed PMID: 5482907. Epub 1970/06/01. eng. 4. Johnson RG, Jr., Kranias EG. Cardiac sarcoplasmic reticulum function and regulation of contractility. Introduction. Ann N Y Acad Sci. 1998 Sep 16;853:xi-xvi. PubMed PMID: 10603930. Epub 1999/12/22. eng. 5. Prinzen FW, Augustijn CH, Allessie MA, Arts T, Delhaas T, Reneman RS. The time sequence of electrical and mechanical activation during spontaneous beating and ectopic stimulation. Eur Heart J. 1992 Apr;13(4):535-43. PubMed PMID: 1600995. Epub 1992/04/01. eng. 6. Auricchio A, Fantoni C, Regoli F, Carbucicchio C, Goette A, Geller C, et al. Characterization of left ventricular activation in patients with heart failure and left bundle-branch block. Circulation. 2004 Mar 9;109(9):1133-9. PubMed PMID: 14993135. Epub 2004/03/03. eng. 7. Vassallo JA, Cassidy DM, Marchlinski FE, Buxton AE, Waxman HL, Doherty JU, et al. Endocardial activation of left bundle branch block. Circulation. 1984 May;69(5):914-23. PubMed PMID: 6705167. Epub 1984/05/01. eng. 8. Strauss DG, Selvester RH, Lima JA, Arheden H, Miller JM, Gerstenblith G, et al. ECG quantification of myocardial scar in cardiomyopathy patients with or without conduction defects: correlation with cardiac magnetic resonance and arrhythmogenesis. Circ Arrhythm Electrophysiol. 2008 Dec;1(5):327-36. PubMed PMID: 19808427. Pubmed Central PMCID: 2748944. Epub 2009/10/08. eng. 9. Abraham WT, Young JB, Leon AR, Adler S, Bank AJ, Hall SA, et al. Effects of cardiac resynchronization on disease progression in patients with left ventricular systolic dysfunction, an indication for an implantable cardioverter-defibrillator, and mildly symptomatic chronic heart failure. Circulation. 2004 Nov 2;110(18):2864-8. PubMed PMID: 15505095. Epub 2004/10/27. eng. 10. Cleland JG, Daubert JC, Erdmann E, Freemantle N, Gras D, Kappenberger L, et al. The effect of cardiac resynchronization on morbidity and mortality in heart failure. N Engl J Med. 2005 Apr 14;352(15):1539-49. PubMed PMID: 15753115. Epub 2005/03/09. eng. 11. Bristow MR, Saxon LA, Boehmer J, Krueger S, Kass DA, De Marco T, et al. Cardiac-resynchronization therapy with or without an implantable defibrillator in advanced chronic heart failure. N Engl J Med. 2004 May 20;350(21):214050. PubMed PMID: 15152059. Epub 2004/05/21. eng. 12. Moss AJ, Brown MW, Cannom DS, Daubert JP, Estes M, Foster E, et al. Multicenter automatic defibrillator implantation trial-cardiac resynchronization therapy (MADIT-CRT): design and clinical protocol. Ann Noninvasive Electrocardiol. 2005 Oct;10(4 Suppl):34-43. PubMed PMID: 16274414. 13. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of novel genes coding for small expressed RNAs. Science. 2001 Oct 26;294(5543):853-8. PubMed PMID: 11679670. 14. Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993 Dec 3;75(5):843-54. PubMed PMID: 8252621. 15. Berns E, Rinkenberger RL, Jeang MK, Dougherty AH, Jenkins M, Naccarelli GV. Efficacy and safety of flecainide acetate for atrial tachycardia or fibrillation. Am J Cardiol. 1987 Jun 1;59(15):1337-41. PubMed PMID: 3109229. 16. Van Gelder IC, Crijns HJ, Van Gilst WH, Van Wijk LM, Hamer HP, Lie KI. Efficacy and safety of flecainide acetate in the maintenance of sinus rhythm after electrical cardioversion of chronic atrial fibrillation or atrial flutter. Am J Cardiol. 1989 Dec 1;64(19):1317-21. PubMed PMID: 2511744. 17. Go AS, Hylek EM, Phillips KA, Chang Y, Henault LE, Selby JV, et al. Prevalence of diagnosed atrial fibrillation in adults: national implications for rhythm management and stroke prevention: the AnTicoagulation and Risk Factors in Atrial Fibrillation (ATRIA) Study. JAMA : the journal of the American Medical Association. 2001 May 9;285(18):2370-5. PubMed PMID: 11343485. Epub 2001/05/10. eng. 13

18. Stewart S, Hart CL, Hole DJ, McMurray JJ. Population prevalence, incidence, and predictors of atrial fibrillation in the Renfrew/Paisley study. Heart. 2001 Nov;86(5):516-21. PubMed PMID: 11602543. Pubmed Central PMCID: 1729985. Epub 2001/10/17. eng. 19. Camm AJ, Kirchhof P, Lip GY, Schotten U, Savelieva I, Ernst S, et al. Guidelines for the management of atrial fibrillation: the Task Force for the Management of Atrial Fibrillation of the European Society of Cardiology (ESC). Europace : European pacing, arrhythmias, and cardiac electrophysiology : journal of the working groups on cardiac pacing, arrhythmias, and cardiac cellular electrophysiology of the European Society of Cardiology. 2010 Oct;12(10):1360420. PubMed PMID: 20876603. Epub 2010/09/30. eng. 20. Schilling RJ. Cardioversion of atrial fibrillation: the use of antiarrhythmic drugs. Heart. 2010 Mar;96(5):333-8. PubMed PMID: 19910286. Epub 2009/11/17. eng. 21. Buccelletti F, Iacomini P, Botta G, Marsiliani D, Carroccia A, Gentiloni Silveri N, et al. Efficacy and Safety of Vernakalant in Recent-Onset Atrial Fibrillation After the European Medicines Agency Approval: Systematic Review and Meta-Analysis. Journal of clinical pharmacology. 2011 Dec 13. PubMed PMID: 22167572. Epub 2011/12/15. Eng. 22. Camm AJ, Capucci A, Hohnloser SH, Torp-Pedersen C, Van Gelder IC, Mangal B, et al. A randomized active-controlled study comparing the efficacy and safety of vernakalant to amiodarone in recent-onset atrial fibrillation. Journal of the American College of Cardiology. 2011 Jan 18;57(3):313-21. PubMed PMID: 21232669. Epub 2011/01/15. eng. 23. Roy D, Pratt CM, Torp-Pedersen C, Wyse DG, Toft E, Juul-Moller S, et al. Vernakalant hydrochloride for rapid conversion of atrial fibrillation: a phase 3, randomized, placebo-controlled trial. Circulation. 2008 Mar 25;117(12):151825. PubMed PMID: 18332267. Epub 2008/03/12. eng.

CHAPTER 1 general introduction

Abstract chapter 2 Dyssynchronous heart failure (HF) has only recently been recognized as a specific entity of heart failure. It entails abnormal timing of electrical activation, which has a major impact on ventricular contraction, resulting in acute and chronic adaptations. In this chapter we first describe the pathophysiology of dyssynchrony in combination with the acute effects on heart function. Subsequently, the adaptive responses will be discussed, including structural, electrical and contractile remodeling. Throughout the chapter we will link the results obtained in bench research to clinical practice.

Future perspectives The deleterious effects of dyssynchrony only became acknowledged since the treatment of HF patients with CRT. Interestingly, treatment was started without fully understanding the pathophysiological background of dyssynchrony. Later bench research, especially in animal models of dyssynchrony, began to uncover the complex pathology of this disease. Molecular and genetic pathways are currently being revealed. Uncovering these pathways will hopefully lead to a better understanding of the disease and a better selection of patient who benefit from treatment. So dyssynchronous HF is quite unique in the sense that it has first become recognized and treated at the bedside, while mechanistic insight was improved by bench research, data from which are in the process of again being translated to the bedside.

CHAPTER 1 general introduction

Chapter 2 Dyssynchronous heart failure from bench to bedside

Lars B. van Middendorp*, Caroline J.M. van Deursen*, Frits W. Prinzen

Book; “Translational Approach to Heart Failure” Chapter 8; “Dyssynchronous heart failure: from bench to bedside” Jozef Bartunek (Author, Editor), Marc Vanderheyden (Author, Editor) * Authors contributed equally

Introduction Dyssynchronous heart failure is a recently introduced term and relates to the condition that heart failure is accompanied with timing differences in electrical activation and/or contraction. It is still not known whether dyssynchrony is caused by heart failure or the other way around. This lack of understanding is mainly due to the fact that most types of dyssynchrony, such as left bundle branch block (LBBB), develop silently and are accompanied by many comorbidities. However, since cardiac resynchronization therapy (CRT) was introduced in 2000, it became clear that resynchronization reduces the burden of heart failure, supporting the idea that dyssynchrony may at least contribute to the development of heart failure. Moreover, during the last decade animal models have been developed were dyssynchrony is induced. The results from these models shed interesting light on the pathogenesis of dyssynchronous heart failure. Hence, while CRT was applied in patients almost without any animal experiments, subsequent bench research has contributed significantly to the understanding of the underlying pathophysiology and helped to improve current treatment. Below we will discuss both clinical and experimental studies on dyssynchronous heart failure and CRT. Prevalence and prognosis The interest in individuals with a bundle branch block (BBB) has primarily focused on its role as a predictor of mortality in patients with cardiovascular diseases. Most epidemiological data is therefore derived from hospitalized patients.1-5 The prevalence of BBB depends on the population studied, ranging from approximately 1% in a general hospital population to as high as 24% in patients with symptomatic HF. Only a few large epidemiological studies for the prevalence of BBB have been conducted in a general healthy, non-hospitalized population. The results varied a little between these studies, mainly because of differences in age and health status of the subjects. However, they all show that the prevalence of isolated BBB is relatively low and affects approximately one in every 1.000 subjects.6-11 In healthy subjects right bundle branch block (RBBB) is more common than LBBB. The prevalence of a BBB markedly increases with age, from 0.1% under the age of 45 to more than 1.0% in the age group above 65 years.9 This is further emphasized in a cohort of healthy airline personnel, both pilots and ground personnel, of the United States Air Force where no case of isolated LBBB was found under the age of twenty-five, but where prevalence increased to 3 per 10.000 subjects over the age of 18

CHAPTER 2 dyssynchronous heart failure

thirty-five. The apparent rarity of LBBB in a group of subjects, that was declared medically healthy, indicates that LBBB is not an asymptomatic congenital abnormality but probably an acquired deficiency indicative of an underlying structural disease.10 Several studies showed that the patients with LBBB have a strikingly higher mortality rate and have a higher risk of HF compared to patients with RBBB or intraventricular conduction delay (IVCD).8, 12, 13 Surprisingly, the risk of death is approximately the same for HF patients with RBBB and IVCD as compared to HF patients without a BBB.12 These observations led to the conclusion that LBBB has a more deleterious effect on cardiac function than RBBB and/or IVCD. The importance of LBBB is further accentuated by the effect of CRT on patients with LBBB. CRT attempts to restore synchrony in the left ventricle, antagonizing the effect of LBBB. In the MADIT-CRT study patients with LBBB that received an implantable cardioverter defibrillator (ICD), which does not restore normal conduction, had a worse prognosis than patients with RBBB or IVCD. However this difference was completely reversed in the groups treated by CRT (figure 1).14 Figure 1 Probability of heart failure (HF) or death according to QRS morphology in the implantable cardioverter defibrillator (ICD) arm and cardiac resynchronization therapy with defibrillator (CRT-D) arm. Adapted from the Multicenter Automatic Defibrillator Implantation Trialâ&#x20AC;&#x201C;Cardiac Resynchronization Therapy (MADIT-CRT).14

Even though large clinical trials clearly show the efficacy of CRT at the population level, in this heterogeneous group of patients, approximately one third does not show evidence of a beneficial clinical or echocardiographic response after device implantation.15-17 In addition, the range of response is highly variable, raising the question whether CRT is optimally performed in every patient or whether each patient can benefit equally from CRT. The effect of conventional RV pacing on prognosis is clearly shown in a retrospective treatment comparison study of patients with sick sinus syndrome. A significantly higher incidence of permanent atrial fibrillation (AF) was found in patients treated with ventricular (VVI, pacing mode designation with RV pacing, RV sensing, inhibited) pacing compared to atrial (AAI, mode designation, right atrial pacing and sensing, inhibited) pacing (47% vs. 6.7%).18, 19 Moreover, congestive HF occurred significantly more 19

often in the VVI group than in the AAI group (37% vs. 15%). Even more important, overall mortality was significantly increased in the ventricular pacing group (23% vs. 8%) after an average follow-up period of 4 years. Likewise, in a prospective study with sick sinus syndrome patients randomized to either atrial or ventricular pacing, overall survival was significantly higher in atrial pacing (relative risk 0.66 [95% CI 0.44-0.99]) after a follow-up period of 8 years.20 Survival from cardiovascular death was also significantly higher in atrial pacing (0.47 [0.27-0.82]). Furthermore, atrial pacing was associated with less AF, lower NYHA functional class with less increase during follow-up, less use of diuretics and fewer thromboembolic complications than ventricular pacing.20, 21 Initially it was considered that single chamber ventricular pacing can interfere with AV synchrony. Dual-chamber pacing (DDDr, mode designation for atrial and right ventricular (RV) pacing, atrial and RV sensing, dual response and rate-adaptive) was developed three decades ago to restore AV synchronization. This led to an emphasis of AV synchronization in cardiac pacing, and DDDr was quickly adopted as the “physiologic” pacing mode. However, large randomized clinical trials in sinus or AV-nodal disease have reached a consensus that despite maintenance of AV synchrony, DDDr pacing does not reduce death compared with single-chamber ventricular pacing (VVIr) and has surprisingly modest or even negligible benefits for progression of HF and AF that emerge only after many years of follow-up.22-24 Clearly, the benefit of preserving AV synchrony is outweighed by the detrimental effects of ventricular dyssynchronization during single site RV pacing. This was demonstrated in the MOST trial that studied a large population of sick sinus syndrome patients. A strong association between the percentage of ventricular pacing and the development of HF and AF was found.25 Aside from this “dose” of dyssynchrony dependent risk, the risk of HF also increases with augmenting paced QRS duration.26 In perspective of the adverse effects of RV pacing, the DAVID trial showed even more detrimental effects on mortality and hospitalization for congestive HF. This was a randomized clinical trial where patients with an indication for ICD therapy and compromised left ventricular (LV) systolic function were assigned to have the ICDs programmed to ventricular backup pacing at 40/min (VVI-40) or dual-chamber rate responsive pacing at 70/min (DDDr-70). Dual-chamber pacing revealed a higher incidence of the combined endpoint of death or hospitalization for HF compared to ventricular backup pacing (26.7% vs. 16.1%) within 12 months.27 Moreover, the adverse effects of dual-chamber pacing 20

CHAPTER 2 dyssynchronous heart failure

were larger in this study performed in patients with compromised LV systolic function compared to the MOST trial where LV systolic function was not compromised in patients, indicating that poor cardiac function as a substrate intensifies the adverse effects of RV pacing. In conclusion, both morbidity and mortality are increased in patients with LBBB and long-term conventional RV pacing and the adverse effects seem to be larger when cardiac function is already compromised. Detrimental effects of LBBB and RV pacing are comparable, because the altered ventricular activation sequence that causes unidirectional wavefront propagation throughout the LV is similar in both conditions. Pathophysiology of dyssynchrony Dyssynchronous electrical activation of the ventricles, as during LBBB and RV pacing, is associated with dyssynchronous timing of contraction.28, 29 Quantification of the dyssynchrony as the timing differences in onset or peak of shortening was initially measured using M-mode (septum to posterior wall motion delay) or Tissue Doppler Imaging (peak velocity differences between two or more regions), later also using speckle tracking analysis.30-33 However, such â&#x20AC;&#x2DC;mechanical dyssynchronyâ&#x20AC;&#x2122; proved not uniformly useful in selecting patients for CRT.34 The explanation might be that there is an even more important effect of LBBB and RV pacing than just the shift in onset of contraction between various regions. Due to the mechanical interaction between the various regions in the ventricular wall, the shape of the contraction pattern also differs between regions. The early activated and contracting regions stretch the later activated ones, where after the latter show amplified and prolonged contraction.35, 36 As a consequence, dyssynchronous activation leads to discoordinate contraction. During LBBB and RV pacing, the septum starts to shorten early and vigorously because the LV cavity pressure is still low and all other muscle fibers are passive. The force generated by the septum pre-stretches the opposing LVfw, since it is not yet activated and contracting. The passive stretch in this area causes a lengthening of the myocardial fibers and as a consequence of the Frank-Starling mechanism, subsequent contraction of the LVfw is stronger.35-37 The contraction patterns in dyssynchronous hearts have been explored using Magnetic Resonance Imaging (MRI) tagging. Difference in circumferential strain patterns of the septum and the LVfw are relatively small during physiological activation.36 During LBBB on the other hand, septal regions show a rapid onset of shortening (negative strain) during the early systolic phase, which is followed by rebound stretch and a second phase of shortening. In posterolateral regions, considerable early systolic stretch is followed by pronounced shortening during the ejection phase. These different 21

strain patterns during LBBB change gradually when moving from the early (septal) to the late (LVfw) activated regions.36 Systolic stretch is not only a cause of delayed activation, it can also result from regional ischemia or excessive loading.38 However, stretching that occurs after initial early systolic shortening is highly specific for dyssynchronous activation and is referred to as systolic rebound stretch (figure 2).39 In case of LBBB, the majority of systolic rebound stretch occurs in the septum. Recently, it became clear that the measurement of septal systolic rebound stretch provides a better prediction of CRT response in terms of improvement in LV end-systolic volume than mechanical dyssynchrony.39 This emphasizes the importance of abnormal wall motion patterns (â&#x20AC;&#x153;discoordinationâ&#x20AC;?) in the pathophysiology of dyssynchronous HF. Do these abnormal locally different contraction patterns also result in regional differences in myocardial work within the LV wall? The answer came from a study that explored regional myocardial work by constructing fiber stress-strain loops by which the loop area represented myocardial work.36 Fiber stress was estimated using data on LV midwall deformation in combination with additional hemodynamic and structural data (LV cavity pressure and LV cavity to wall volume ratio). Myocardial strain as assessed with MRI tagging showed that during RV pacing in a canine heart, the pattern of the stress-strain loop differed between early and late activated myocardial segments. In early activated regions, contraction (fiber strain shortening) initially occurred at low fiber stress levels (the late activated region is not contracting yet), and subsequently, when the late activated regions are contracting, the fiber stress increases while fibers are being stretched, resulting in a figure-of-eight shaped loop. The net area of the stress-strain loop in early activated regions is almost zero, indicating low external work. In late activated regions, passive stretch in early systole (contraction of the early activated regions) generated increased stress before contraction, resulting in a wide loop with a large stress-strain loop area. So, besides a different pattern in stressstrain loop between early and late activated regions, myocardial work is reduced in early activated regions, whereas it is augmented to values twice as high as normal in late activated regions.36, 40 In HF patients, LV dilation could increase regional mechanical non-uniformity that results from discoordinated activation with the potential consequence of further impairment in cardiac function. In a computational model of ventricular electromechanics it was shown that LBBB combined with LV dilation synergistically increased non-uniformity in regional work and decreased regional cardiac function.41 A possible explanation is that in the dilated heart, stress levels are increased and a larger variability of strain is needed to maintain force equilibrium when electrical dyssyn22

CHAPTER 2 dyssynchronous heart failure

chrony is included.41 Regional differences in contraction patterns as a result of dyssynchronous activation can be corrected by ventricular resynchronization as obtained by CRT.39, 42-44 The paradoxical systolic rebound stretch of the septum in LBBB is almost completely abolished after induction of CRT with a subsequent gain in effective septal shortening during systole (figure 2). Figure 2 Typical examples of a local activation times (top) and strain patterns (bottom) during Left Bundle Branch Block (LBBB; left panels) and cardiac resynchronization therapy (CRT; right panels). In case of LBBB, the Right ventricle (RV) is activated first, with a slow progression of the wavefront towards the Left ventricular free wall (LVfw). As a consequence, the septum (dashed lines) pre-stretches the LVfw (solid lines, *). At the end of systole the septum is stretched by the LVfw, called septal rebound stretch (#). CRT reverses the activation pattern, activating the LV and RV almost simultaneously which results in the disappearance of both phenomena. Time of Aortic valve (Ao) opening and closing are depicted by the dashed vertical lines.

Patients with LBBB often suffer from additional cardiovascular disorders. In a typical dyssynchronous HF population, half of the patients have an underlying ischemic substrate.14 Coronary artery disease can cause perfusion defects which can be detected by non-invasive myocardial imaging. However, in patients with LBBB, septal perfusion defects are frequently found even in the absence of any significant coronary artery disease.45-49 The question is whether these differences can be explained by the abnormal contraction patterns. During sinus rhythm, in healthy canine hearts, blood flow is homogenous and equally distributed. In contrast, myocardial blood flow (MBF) in dyssynchronous hearts is heterogeneous, with a ~20% reduction in local MBF in the septum and a ~ 20% increase in the LVfw.35, 50-53 Closely related to MBF is myocardial oxygen consumption (MVO2). Not surprisingly, MVO2 shows a similar distribution as MBF during LBBB, where early activated regions show a reduction in MVO2, whereas a near normal oxygen consumption is observed in the latest activated regions.50, 53 Therefore, one theory is that the reduced perfusion in the septum of LBBB patients is due to redistribution of mechanical work and consequently reduced demands. This hypothesis is confirmed in a quantitative study of MBF and MVO2 in a group of HF patients with LBBB. Both MBF and MVO2 are globally reduced in patients with HF. Moreover, in patients with HF and LBBB, MVO2 is significantly higher in the lateral wall than in the septum.54 Another hypothesis says that the abnormal contraction may hamper blood 23

flow by prolonging the systolic phase. Such effect may be exaggerated when heart rate is higher, thereby becoming a possible explanation for exercise induced angina in these patients. The aforementioned changes in MBF and workload are paralleled by changes in metabolism. In dyssynchrony induced by RV pacing, glucose uptake in the septum is markedly reduced in a similar fashion as the redistribution of MBF.51 In patients with LBBB, comparable defects are observed in glucose metabolism assessed by fluorodeoxyglucose positron emission tomography (PET) imaging. PET images of metabolism in LBBB hearts display a relative reduction of glucose uptake in the septum. There are several hypotheses to explain the mechanism of reduced glucose uptake, but the underlying cause is still not well understood. In fact the hypotheses that are postulated for hampered glucose uptake in LBBB are probably also applicable to explain changes in MBF. It is speculated that glucose uptake is hampered by the abnormal depolarization or by a decrease in systolic function and augmented intramyocardial pressure during dyssynchrony.51, 55-57 A caveat here is that glucose uptake is often displayed in relative terms, so it is not clear whether glucose uptake deficit in septum is due to increase in glucose uptake in the lateral wall or reduced uptake in the septum. In line with a reduced metabolism in early activated regions, the genes that regulate metabolism are correspondingly downregulated, implying a reduction in local metabolic demand.58 Besides regional changes in metabolism, a recent study indicates that long-term dyssynchrony in canine hearts leads to changes in the mitochondrial proteome, globally across the LV. Eventually, this leads to a decreased function of mitochondria.59 Mitochondria are the major source of chemical energy in cells, but also play a role in apoptosis and cell differentiation. As stated above, resynchronization normalizes systolic strain patterns and workload. Likewise, resynchronization homogenizes myocardial glucose metabolism, oxygen consumption and perfusion.42, 60 The improvement in oxygen supply/demand ratio may improve contraction. Besides, CRT partially restores the mitochondrial proteome by altering posttranslational enzymes involved in the Krebs cycle, thereby increasing ATP production and fuel efficiency.59 This improvement in mitochondrial performance may be important in improving hemodynamics and cardiac function in dyssynchronous heart failure. Hemodynamic adjustments One can imagine that the wall motion abnormalities as observed in dyssynchronous activated hearts by LBBB or RV pacing can 24

CHAPTER 2 dyssynchronous heart failure

result in mechanical inefficiency. Contraction of the septal regions in early systole results in pre-stretch of the still inactive LVfw, rather than causing intracavitary pressure to rise and the mitral valve to close.61 The abnormal septal motion not only results in a diminished contribution of the septum to ejection, it also jeopardizes the contractile efficiency of the opposing wall. When the LVfw finally contracts in late systole, it leads to a corresponding stretch of the septum, instead of contributing to efficient stroke work. Contraction is not only discoordinated, but also prolonged, causing the isovolumic phase to last longer, thereby diminishing effective ejection time and decreasing cardiac output.62 Dyssynchrony also impairs the uniformity of the relaxation process, resulting in a delayed and prolonged relaxation process, which in turn decreases diastolic filling time.63 The result is a decrease in preload and length dependent activation, which, once again, reduces contractile force and cardiac output. In addition, the shorter effective diastole along with the prolonged systolic phase may hamper coronary perfusion, which may be especially relevant at higher heart rates. A further decline in cardiac pump function is generated by functional mitral regurgitation, caused by the delay in LV intracavitary pressure rise and discoordinate papillary muscle contraction (figure 3).64, 65 Figure 3 Schematic overview of the pathophysiology of dyssynchronous heart failure. Dyssynchronous activation has a tremendous effect on cardiac function via different pathways as visualized in this, most likely still incomplete, overview, for details please see text above.

When inducing LBBB in canine hearts, an immediate decrease in cardiac output without changes in LV end-diastolic pressure can be observed.42, 52 As described above, LV dP/dtmax, the maximal rate of LV pressure rise and a sensitive marker of systolic function in stable cardiac loading conditions, declines as well. Furthermore, LV dP/dtmin, the maximal rate of LV pressure decline and a marker for diastolic function simultaneously decreases. Reduction in contractility and relaxation is also observed after initiation of RV pacing in humans.63, 66 Thus, both systolic and diastolic LV function are compromised after induction of dyssynchronous activation as with LBBB and RV pacing. 25

In patients with dyssynchronous HF, CRT can accomplish a more coordinated contraction by pacing the LVfw, thereby restoring inter- and intraventricular coupling. As can be appreciated from the schematic overview of how dyssynchronous activation leads to reduced contractile force and cardiac output, one can understand the potential of CRT to reverse all the processes by restoring interand intraventricular coupling (figure 3). The result is an improvement in systolic as well as diastolic function and a reduction of functional mitral regurgitation.67-70 The improvement in systolic LV function by CRT is achieved at unchanged or even decreased filling pressures, denoting a true improvement of ventricular contractility through improved coordination of contraction.44 Furthermore, unlike the oxygen demanding inotropic effect of dobutamine, systolic augmentation with ventricular resynchronization increases LV dP/dtmax without increasing myocardial oxygen consumption.71 Restoring of AV synchrony can also be achieved by CRT, which may further improve diastolic performance and reduce functional mitral regurgitation. These acute beneficial hemodynamic effects of CRT may lead to even more beneficial long-term effects, because structural, electrical and contractile remodeling attributable to dyssynchronous activation appear to be partially reversible, as will be discussed in the next sections. Cardiac Remodeling Dyssynchrony has been shown to decrease global heart function and to exacerbate HF in a variety of ways. Beside the abovementioned electro-mechano-hemodynamical interactions, there are a large number of relevant changes at tissue, cellular and molecular levels that are induced by dyssynchrony. These â&#x20AC;&#x2DC;remodeling processesâ&#x20AC;&#x2122; can be divided into structural (hypertrophy and fibrosis), electrical (ion channels) and contractile remodeling. Some of the changes found in dyssynchronous hearts are controlled by up- or down-regulation at the messenger RNA or protein level throughout the ventricles, whereas others show clear local differences between early and late activated regions.58, 72 This implies a very complex regulatory mechanism of remodeling under the influence of both local and global regulatory pathways. Recent studies showed regional different gene expression patterns in animals driven into HF by rapid RV pacing. Rapid biventricular pacing improved cardiac function only to a limited extent. Still biventricular pacing substantially restores uniformity in gene expression.58 The genes involved are linked to important processes such as metabolism, extracellular matrix (ECM) remodeling and stress response. This indicates that local strain and work load are powerful regulators of local gene expression.58, 73 However, the regulatory steps in between the direct trigger and the cellular and molecular changes in the tissue are incompletely understood. 26

CHAPTER 1 general introduction

Cardiac fibroblasts are abundant in the heart and are essential in maintaining cardiac structure trough regulation and turnover of the ECM. Upon injury, cardiac fibroblasts undergo a transition into myofibroblasts, which increase the synthesis of ECM to repair and replace the damaged tissue.74, 75 They are very responsive to mechanical stress, which increases the production and secretion of various pro-inflammatory and pro-fibrotic cytokines, growth factors, and chemokines.76, 77 For instance connective tissue growth factor (CTGF) is a key mediator of ECM production in pathological fibrotic conditions. In addition, exposure of cardiomyocytes to CTGF has been shown to induce hypertrophy.78 Besides the classical view of cellular and molecular changes induced by gene expression changes and subsequent activation of cytokines, growth factors and chemokines a new level of organization by microRNA (miRs) has recently been revealed. MiRs were first described in the nineties and are increasingly recognized as important regulators of gene-expression in various physiological and pathophysiological processes.79, 80 They are thought to regulate at least one third of the protein encoding genes. Logically, several miRs are linked to cardiac remodeling, such as the pro-fibrotic miR-29c, prohypertrophic miR-199b and anti-hypertrophic miR-133a.81-83 However most research has been performed in rodents and focused on changes throughout the heart rather than on the local regulation.81, 84-86 Animal models of dyssynchrony may provide interesting opportunities to study the local regulation of remodeling by miRs and such information may be of prime importance for the diagnosis and therapy of dyssynchrony. The aforementioned local and global changes in expression of many genes, and possibly miRs, are likely responsible for the adaptation process of the ventricular wall to local work load by changing the ECM composition and hypertrophy. In a canine model of chronic dyssynchrony, induced by pacing the LVfw for six months, asymmetrical hypertrophy was present. The, in this case, late-activated septum showed an increase in wall thickness after six months of pacing. The thickness of the wall segment closest to the pacing location on the other hand, did not change significantly (figure 4).87 Comparable, but opposite, regional hypertrophy was found in dogs where LBBB was induced by ablating the left bundle branch. LBBB induces asymmetric hypertrophy with an increase in wall thickness in the latest activated regions the LVfw.52 The effect of dyssynchrony is further elucidated by inducing dyssynchrony in canine hearts with pressure overload induced concentric hypertrophy due to constriction of the aorta for six months. RV pacing suppresses the hypertrophic response in the early activated septum, while no additional hypertrophy is observed in the latest 27

activated regions.88 The observations made in these experimental models are readily translational to the human situation. In patients with LBBB the effect of dyssynchronous activation on regional hypertrophy was qualitatively comparable to that observed in canine models although less pronounced, possibly due to the large heterogeneity and confounding factors such as pre-existing hypertrophy.49, 89 The local changes in hypertrophy are probably related to the differences in contraction patterns. The more pronounced hypertrophy in the pre-stretched regions indicates that the local mechanical load is an important stimulus in the remodeling process. The potential of local mechanical load to induce hypertrophy is further supported by the fact that stretching of isolated myocytes induces a hypertrophic response.90 Figure 4 Asymmetric hypertrophy during dyssynchrony. The late activated septum (open circles) due to LVfw pacing (Note that this is opposite to the clinically more relevant LBBB or RV pacing) shows a significant increase in wall thickness over time. The LVfw (solid circles) slightly atrophies. (#p < 0.05; compared to baseline, $ p <0.05; ANOVA over time). Adopted from van Oosterhout et al.53

Such hypertrophic response may be opposed by increased apoptosis of cardiac myocytes, as associated with the development of HF. Increased apoptosis is found in patients with dyssynchronous HF and is considered to play an important role in structural remodeling. Apoptosis leads to a lower wall thickness to volume ratio and thereby increases local mechanical stress. Treatment of dyssynchrony by CRT reduces apoptosis and thereby may reduce wall stress.91, 92 Cardiac fibrosis plays a major role in the progression of HF. In pathophysiological conditions decompensatory remodeling takes place in collagen turnover, which ultimately leads to fibrosis.93 Several biomarkers reflecting collagen synthesis seem useful for risk stratification in HF patients. The heart primarily expresses Collagen type I and III.94 They are secreted as procollagens and form mature collagen fibrils by splitting off pro-peptides, releasing the amino-terminal (PINP and PIIINP) and carboxyterminal propeptides (PICP and PIIICP). Degradation of collagen type I forms the carboxyterminal telopeptide of type I collagen (ICTP). Breakdown of the ECM is controlled by proteases of which matrix metalloproteases (MMP) and its tissue inhibitors (TIMP) are the most extensively studied.93, 95-97 28

CHAPTER 2 dyssynchronous heart failure

In chronic dyssynchronous animal models no overt fibrosis has been observed.87 In patients very few data on tissue content of fibrosis is present, although studies with small populations show an increase in collagen content in patients with dyssynchronous HF.92, 98, 99 Resynchronization by CRT reduces the collagen volume fraction in HF patients.92 Furthermore, in patients with dyssynchronous HF treated by CRT the PICP/ICTP ratio in serum normalizes, thereby restoring the balance between collagen synthesis and degradation.95 MMP and TIMP levels did not change significantly to CRT.95, 96 However, MMPs are one of the main determinants of ECM degradation and play an important role in HF patients during adverse remodeling.100 Electrical remodeling Chronic dyssynchrony has been shown to change conduction velocity (CV) and action potential duration (APD), two hallmarks of myocardial electrophysiology. These changes have been observed using in vitro analysis of wedges from canine hearts. In these preparations conduction velocity was unchanged in wedges taken from the early activated regions of hearts with chronic LBBB. In contrast, the latest activated regions display a significant reduction in endocardial CV without apparent epicardial changes. At the same time connexin43 (Cx43), the main gap junction protein, is redistributed from the intercalated disks to the longitudinal membrane. In that way, Cx43 provides an etiological mechanism for the differences in conduction velocity. Interestingly, Cx43 redistribution is identical in endo- and epicardial tissue. Therefore, these alternations in cell-coupling cannot entirely explain the different changes in CV between endo- and epicardium.101 In vivo studies could not corroborate the findings on CV, since in chronic dyssynchronous hearts neither regional differences nor a reduction in endocardial CV was observed (figure 5).102 Figure 5 Conduction velocities (in m/s) of the epicardium and endocardium in anterior, lateral, and posterior regions in dogs with acute Left Bundle Branch Block (LBBB) and chronic LBBB+ heart failure (HF). #P<0.05 for epicardial versus endocardial. No difference in reduction in conduction velocity between early and late activated regions were observed. Adapted from Strik et al.102

A possible explanation could be alterations in myocyte connectivity, sodium current density or cellular architecture due to tissue preparation for in vitro assessment of CV. On the other hand, distances along the endocardium are hard to measure precisely in vivo, making the estimations of CV less accurate. Changes in APD are not consistent in dyssynchronous hearts.101, 103 In wedge preparations from canine hearts with chronic LBBB, APD is shorter in the latest activated regions at both endo- and epicardium. Precisely opposite effects are found in myocytes isolated from canine hearts with HF caused by rapid LV pacing. In this model APD is markedly increased in the latest activated regions, whereas no changes are observed in early activated regions compared to control.72, 104 Because prolongation of APD in the latest activated regions leads to pronounced dispersion of repolarization, the latter changes require further investigation. Certainly repolarization is different in isolated cells compared to in vivo measurements because electrotonic potentials are different in isolated versus coupled cells. Ion channels and currents are important to create an action potential and are thereby key regulators of cardiac electrical activity. Ion channel remodeling underlies many of the cellular electrophysiological changes in HF. Many changes are initially adaptive, for example increase in APD during bradycardia increases contractility. However, long term effect of these adaptations may be detrimental for cardiac function and make the heart more susceptible to arrhythmias.72, 103, 105 Potassium (K+) plays a key role in repolarization. A very consistent finding in human HF as well as in animal models of HF is down-regulation of K+ currents. The most constant observation is a decrease in transient outward current and a decrease in its related genes; Kv4.3 and KChIP2. The transient outward K+ current (Ito) is down-regulated homogeneously across the ventricles in HF.72, 103, 105, 106 Although Ito only transiently opens during the action potential, it is a major contributor to the ventricular APD and action potential shape.107 In HF less robust alterations of the inward rectifier current (Ik1) are found. Ik1 is important in maintaining the membrane resting potential and during phase 3 (late repolarization) of the action potential. In rabbits with HF induced by rapid pacing of the LV apex, no changes were found in Ik1 densities.108, 109 In contrast, canines with HF induced by rapid pacing of the RV apex, a small but significant difference can be found in Ik1 density.72, 106, 107 This difference is likely due to variability in duration and severity of the induced HF. The delayed rapid and slow rectifier currents (Ikr and Iks) are relevant for the repolarization phase. Ikr is not significantly altered during HF. Iks is consistently down-regulated in HF and possibly plays a role in the increased APD sometimes seen during HF.72, 105, 106, 110, 111 30

CHAPTER 2 dyssynchronous heart failure

In an animal model of dyssynchronous HF the potassium channels were uniformly affected across the LV. The distribution of Ito is not altered by treatment with CRT, whereas Ik1 and Iks adaptations are partially restored by CRT. This suggests that remodeling of potassium channels is not only related to mechanical stress caused by dyssynchronous activation, but also under the influence of neurohumoral and autonomic control.72

Contractile remodeling Calcium (Ca2+) plays an important role in excitation-contraction coupling, as described above. Ca2+ is removed from to the extracellular space through the sodium (Na+) - Ca2+ exchanger (NCX) and is simultaneously pumped back into the sarcoplasmic reticulum primarily via sarcoplasmic reticulum Ca2+ ATPase (SERCA2a).105 The changes in Ca2+ handling caused by HF have important consequences for contractility and arrhythmogeneity. SERCA2a is generally reduced in HF, which also has a direct effect on NCX and phospholamban (PLN), a small regulatory protein of SERCA2a. NCX is found to be up-regulated in HF, which may be explained by the fact that increased NCX activity compensates for depressed SERCA activity. The loss of SERCA function is further exacerbated by reduced phosphorylation of PLN. This further impairs SERCA2a function, decreasing the exchange of Ca2+ from the cytoplasm to the sarcoplasmic reticulum. The changes in NCX, SERCA2a and PLN ultimately lead to a lower and slower Ca2+ transients, and, as a consequence, weaker contraction accompanied by a prolonged action potential.72, 105, 112, 113 At the same time, during diastole, Ca2+ removal from the cytosol is impaired leading to a slower relaxation. This may ultimately lead to diastolic HF. SERCA2a messenger RNA is upregulated after treatment of HF by LV assist devices or beta-blocker therapy and is associated with improved contractility. In humans treated with CRT, SERCA2a/PLN and, SERCA2a/ NCX ratios are increased, suggesting that resynchronization may restore calcium handling and thereby improve contractility.114, 115 Contractility is generally reduced in HF, but remarkably, L-type calcium current (ICaL) density is not.116 Nevertheless, in failing canine hearts the number of ICaL channels is markedly reduced. To compensate for the loss of ICaL channels, channel opening times are considerably increased, so total ICaL density can be maintained.116, 117 Dyssynchrony causes regional changes in ICaL with a reduced density and slowed current decay in the late activated regions. In contrast, peak ICaL density is increased in the early activated regions. CRT partially restores these differences, eliminating the septal to lateral density gradient (figure 6).118 31

Figure 6 Regional heterogeneity of action potential and Ca2+ transient (CaT) in dyssynchronous HF (DHF) and its restoration by CRT in early (anterior) and late (lateral) activated regions. CRT abbreviates DHF-induced prolongation of APD and restores amplitude and decay of CaT in the lateral cells, thus reduced regional heterogeneity of repolarization and Ca2+ handling.

The molecular basis of the changes in Ca2+ handling are incompletely understood and often conflicting results are found. The complexity is emphasized by studies reporting isoform switching of the ICaL subunits, α1C and β2. In the end these alterations probably contribute to a decrease in contractility but further research is needed.119, 120 Furthermore, large changes occur in the sarcoplasmatic reticulum, the major storage location of calcium ions. In the LVfw of a dyssynchronous HF model induced by tachypacing the connection between the myocytes and the sarcoplasmatic reticulum is reduced while no apparent changes are observed in the earlier activated anterior regions. CRT restored the connection between the sarcoplasmatic reticulum implying an improvement in electro-mechanical coupling.121 Almost five decades ago it was believed that the β1-adrenergic receptor (β1-AR) was specific for cardiac tissue and that the β2-AR was only present in vascular and bronchial structures. Since then more and more of the cardiac β-adrenergic system was discovered, revealing a complex organization of not only β1 and β2-ARs in the heart but also β3 and possibly β4-ARs.122, 123 Stimulation of β1-AR activates the effector enzyme adenylyl cyclase, which in turn increases the cAMP levels augmenting the phosphorylation via cAMP dependent protein kinases of several Ca2+ regulating proteins, which has positive inotropic, chronotropic and lusitropic (relaxation) effects.124 β2-AR stimulation has many similarities with β1-AR stimulation, such as its inotropic and lusitropic function, but also has some unique features. Selective stimulation of β1-ARs with a β-agonist isoprenaline in knockout mice for β2-AR causes higher mortality and increases apoptosis of myocytes compared to wild-type mice. This suggests a cardiac protective anti-apoptotic effect of β2-AR stimulation, whereas β1AR promotes apoptosis.123, 125, 126 32

CHAPTER 2 dyssynchronous heart failure

In HF the sympathetic system is activated strongly and this stimulation is inversely correlated with survival. High catecholamine levels down-regulate β-ARs, in particular the β1-AR.124, 127 The mechanism behind this specific down-regulation of β1-AR remains elusive. Current therapies, such as β-blockade, angiotensin converting enzyme inhibition and assist devices, decrease the sympathetic drive. At first instance CRT does not seem to have a direct effect on neurohormones, as β-blockers do, or loading conditions of the heart, like an assist device does. Surprisingly, CRT improves the β-adrenergic reserve. This improvement is attributable to the effect of CRT on local contraction and indirectly local load. The changes in contraction could lead to activation of signaling pathways of β-AR and the up-regulation of β-AR density to near normal levels, thereby increasing contractility and decreasing apoptosis. In addition, CRT reduces sympathetic drive.128-130

References 1. Boyle DM, Fenton SS. Left bundle branch block. The Ulster medical journal. 1966;35(1):93-9. PubMed PMID: 5922878. Pubmed Central PMCID: 2384928. Epub 1966/01/01. eng. 2. Hawkins NM, Wang D, McMurray JJ, Pfeffer MA, Swedberg K, Granger CB, et al. Prevalence and prognostic impact of bundle branch block in patients with heart failure: evidence from the CHARM programme. European journal of heart failure. 2007 May;9(5):510-7. PubMed PMID: 17317308. Epub 2007/02/24. eng. 3. Johnson RP, Messer AL, Shreenivas, White PD. Prognosis in bundle branch block. II. Factors influencing the survival period in left bundle branch block. American heart journal. 1951 Feb;41(2):225-38. PubMed PMID: 14818935. Epub 1951/02/01. eng. 4. Smith S, Hayes WL. The Prognosis of Complete Left Bundle Branch Block. American heart journal. 1965 Aug;70:157-9. PubMed PMID: 14327999. Epub 1965/08/01. eng. 5. Sumner G, Salehian O, Yi Q, Healey J, Mathew J, Al-Merri K, et al. The prognostic significance of bundle branch block in high-risk chronic stable vascular disease patients: a report from the HOPE trial. Journal of cardiovascular electrophysiology. 2009 Jul;20(7):781-7. PubMed PMID: 19298567. Epub 2009/03/21. eng. 6. Dhingra R, Pencina MJ, Wang TJ, Nam BH, Benjamin EJ, Levy D, et al. Electrocardiographic QRS duration and the risk of congestive heart failure: the Framingham Heart Study. Hypertension. 2006 May;47(5):861-7. PubMed PMID: 16585411. Epub 2006/04/06. eng. 7. Eriksson P, Hansson PO, Eriksson H, Dellborg M. Bundle-branch block in a general male population: the study of men born 1913. Circulation. 1998 Dec 1;98(22):2494-500. PubMed PMID: 9832497. Epub 1998/12/01. eng. 8. Eriksson P, Wilhelmsen L, Rosengren A. Bundle-branch block in middle-aged men: risk of complications and death over 28 years. The Primary Prevention Study in Goteborg, Sweden. European heart journal. 2005 Nov;26(21):23006. PubMed PMID: 16214833. Epub 2005/10/11. eng. 9. Fahy GJ, Pinski SL, Miller DP, McCabe N, Pye C, Walsh MJ, et al. Natural history of isolated bundle branch block. The American journal of cardiology. 1996 Jun 1;77(14):1185-90. PubMed PMID: 8651093. Epub 1996/06/01. eng. 10. Hiss RG, Lamb LE. Electrocardiographic findings in 122,043 individuals. Circulation. 1962 Jun;25:947-61. PubMed PMID: 13907778. Epub 1962/06/01. eng. 11. Rotman M, Triebwasser JH. A clinical and follow-up study of right and left bundle branch block. Circulation. 1975 Mar;51(3):477-84. PubMed PMID: 1132086. Epub 1975/03/01. eng. 12. Baldasseroni S, Opasich C, Gorini M, Lucci D, Marchionni N, Marini M, et al. Left bundle-branch block is associated with increased 1-year sudden and total mortality rate in 5517 outpatients with congestive heart failure: a report from the Italian network on congestive heart failure. American heart journal. 2002 Mar;143(3):398-405. PubMed PMID: 11868043. Epub 2002/02/28. eng. 13. Schinkel AF, Elhendy A, van Domburg RT, Biagini E, Rizzello V, Veltman CE, et al. Prognostic significance of QRS duration in patients with suspected coronary artery disease referred for noninvasive evaluation of myocardial ischemia. The American journal of cardiology. 2009 Dec 1;104(11):1490-3. PubMed PMID: 19932780. Epub 2009/11/26. eng. 14. Zareba W, Klein H, Cygankiewicz I, Hall WJ, McNitt S, Brown M, et al. Effectiveness of Cardiac Resynchronization Therapy by QRS Morphology in the Multicenter Automatic Defibrillator Implantation Trial-Cardiac Resynchronization Therapy (MADIT-CRT). Circulation. 2011 Mar 15;123(10):1061-72. PubMed PMID: 21357819. Epub 2011/03/02. eng. 15. Abraham WT, Young JB, Leon AR, Adler S, Bank AJ, Hall SA, et al. Effects of cardiac resynchronization on disease progression in patients with left ventricular systolic dysfunction, an indication for an implantable cardioverter-defibrillator, and mildly symptomatic chronic heart failure. Circulation. 2004 Nov 2;110(18):2864-8. PubMed PMID: 15505095. Epub 2004/10/27. eng. 16. Cleland JG, Daubert JC, Erdmann E, Freemantle N, Gras D, Kappenberger L, et al. The effect of cardiac resynchronization on morbidity and mortality in heart failure. N Engl J Med. 2005 Apr 14;352(15):1539-49. PubMed PMID: 15753115. Epub 2005/03/09. eng.

CHAPTER 2 dyssynchronous heart failure 17. Bristow MR, Saxon LA, Boehmer J, Krueger S, Kass DA, De Marco T, et al. Cardiac-resynchronization therapy with or without an implantable defibrillator in advanced chronic heart failure. N Engl J Med. 2004 May 20;350(21):214050. PubMed PMID: 15152059. Epub 2004/05/21. eng. 18. Rosenqvist M, Brandt J, Schuller H. Atrial versus ventricular pacing in sinus node disease: a treatment comparison study. Am Heart J. 1986 Feb;111(2):292-7. PubMed PMID: 3946171. Epub 1986/02/01. eng. 19. Rosenqvist M, Brandt J, Schuller H. Long-term pacing in sinus node disease: effects of stimulation mode on cardiovascular morbidity and mortality. Am Heart J. 1988 Jul;116(1 Pt 1):16-22. PubMed PMID: 3394616. Epub 1988/07/01. eng. 20. Andersen HR, Nielsen JC, Thomsen PE, Thuesen L, Mortensen PT, Vesterlund T, et al. Long-term follow-up of patients from a randomised trial of atrial versus ventricular pacing for sick-sinus syndrome. Lancet. 1997 Oct 25;350(9086):1210-6. PubMed PMID: 9652562. Epub 1998/07/04. eng. 21. Nielsen JC, Andersen HR, Thomsen PE, Thuesen L, Mortensen PT, Vesterlund T, et al. Heart failure and echocardiographic changes during long-term follow-up of patients with sick sinus syndrome randomized to single-chamber atrial or ventricular pacing. Circulation. 1998 Mar 17;97(10):987-95. PubMed PMID: 9529267. Epub 1998/04/07. eng. 22. Connolly SJ, Kerr CR, Gent M, Roberts RS, Yusuf S, Gillis AM, et al. Effects of physiologic pacing versus ventricular pacing on the risk of stroke and death due to cardiovascular causes. Canadian Trial of Physiologic Pacing Investigators. The New England journal of medicine. 2000 May 11;342(19):1385-91. PubMed PMID: 10805823. Epub 2001/02/07. eng. 23. Lamas GA, Lee KL, Sweeney MO, Silverman R, Leon A, Yee R, et al. Ventricular pacing or dual-chamber pacing for sinus-node dysfunction. The New England journal of medicine. 2002 Jun 13;346(24):1854-62. PubMed PMID: 12063369. Epub 2002/06/14. eng. 24. Toff WD, Camm AJ, Skehan JD. Single-chamber versus dual-chamber pacing for high-grade atrioventricular block. The New England journal of medicine. 2005 Jul 14;353(2):145-55. PubMed PMID: 16014884. Epub 2005/07/15. eng. 25. Sweeney MO, Hellkamp AS, Ellenbogen KA, Greenspon AJ, Freedman RA, Lee KL, et al. Adverse effect of ventricular pacing on heart failure and atrial fibrillation among patients with normal baseline QRS duration in a clinical trial of pacemaker therapy for sinus node dysfunction. Circulation. 2003 Jun 17;107(23):2932-7. PubMed PMID: 12782566. Epub 2003/06/05. eng. 26. Sweeney MO, Hellkamp AS. Heart failure during cardiac pacing. Circulation. 2006 May 2;113(17):2082-8. PubMed PMID: 16636167. Epub 2006/04/26. eng. 27. Wilkoff BL, Cook JR, Epstein AE, Greene HL, Hallstrom AP, Hsia H, et al. Dual-chamber pacing or ventricular backup pacing in patients with an implantable defibrillator: the Dual Chamber and VVI Implantable Defibrillator (DAVID) Trial. JAMA. 2002 Dec 25;288(24):3115-23. PubMed PMID: 12495391. Epub 2003/01/03. eng. 28. Prinzen FW, Augustijn CH, Allessie MA, Arts T, Delhaas T, Reneman RS. The time sequence of electrical and mechanical activation during spontaneous beating and ectopic stimulation. Eur Heart J. 1992 Apr;13(4):535-43. PubMed PMID: 1600995. Epub 1992/04/01. eng. 29. Wyman BT, Hunter WC, Prinzen FW, McVeigh ER. Mapping propagation of mechanical activation in the paced heart with MRI tagging. Am J Physiol. 1999 Mar;276(3 Pt 2):H881-91. PubMed PMID: 10070071. Epub 1999/03/10. eng. 30. Pitzalis MV, Iacoviello M, Romito R, Massari F, Rizzon B, Luzzi G, et al. Cardiac resynchronization therapy tailored by echocardiographic evaluation of ventricular asynchrony. J Am Coll Cardiol. 2002 Nov 6;40(9):1615-22. PubMed PMID: 12427414. Epub 2002/11/13. eng. 31. Bax JJ, Bleeker GB, Marwick TH, Molhoek SG, Boersma E, Steendijk P, et al. Left ventricular dyssynchrony predicts response and prognosis after cardiac resynchronization therapy. J Am Coll Cardiol. 2004 Nov 2;44(9):1834-40. PubMed PMID: 15519016. Epub 2004/11/03. eng. 32. Yu CM, Fung JW, Zhang Q, Chan CK, Chan YS, Lin H, et al. Tissue Doppler imaging is superior to strain rate imaging and postsystolic shortening on the prediction of reverse remodeling in both ischemic and nonischemic heart failure after cardiac resynchronization therapy. Circulation. 2004 Jul 6;110(1):66-73. PubMed PMID: 15197148. Epub 2004/06/16. eng.

33. Gorcsan J, 3rd, Tanabe M, Bleeker GB, Suffoletto MS, Thomas NC, Saba S, et al. Combined longitudinal and radial dyssynchrony predicts ventricular response after resynchronization therapy. J Am Coll Cardiol. 2007 Oct 9;50(15):1476-83. PubMed PMID: 17919568. Epub 2007/10/09. eng. 34. Chung ES, Leon AR, Tavazzi L, Sun JP, Nihoyannopoulos P, Merlino J, et al. Results of the Predictors of Response to CRT (PROSPECT) trial. Circulation. 2008 May 20;117(20):2608-16. PubMed PMID: 18458170. Epub 2008/05/07. eng. 35. Prinzen FW, Augustijn CH, Arts T, Allessie MA, Reneman RS. Redistribution of myocardial fiber strain and blood flow by asynchronous activation. The American journal of physiology. 1990 Aug;259(2 Pt 2):H300-8. PubMed PMID: 2386214. Epub 1990/08/01. eng. 36. Prinzen FW, Hunter WC, Wyman BT, McVeigh ER. Mapping of regional myocardial strain and work during ventricular pacing: experimental study using magnetic resonance imaging tagging. Journal of the American College of Cardiology. 1999 May;33(6):1735-42. PubMed PMID: 10334450. Pubmed Central PMCID: 2041911. Epub 1999/05/20. eng. 37. Prinzen FW, Vernooy K, De Boeck BW, Delhaas T. Mechano-energetics of the asynchronous and resynchronized heart. Heart Fail Rev. May;16(3):215-24. PubMed PMID: 21103927. Pubmed Central PMCID: 3074058. Epub 2010/11/26. eng. 38. Leenders GE, Cramer MJ, Bogaard MD, Meine M, Doevendans PA, De Boeck BW. Echocardiographic prediction of outcome after cardiac resynchronization therapy: conventional methods and recent developments. Heart Fail Rev. May;16(3):235-50. PubMed PMID: 21104122. Pubmed Central PMCID: 3074077. Epub 2010/11/26. eng. 39. De Boeck BW, Teske AJ, Meine M, Leenders GE, Cramer MJ, Prinzen FW, et al. Septal rebound stretch reflects the functional substrate to cardiac resynchronization therapy and predicts volumetric and neurohormonal response. Eur J Heart Fail. 2009 Sep;11(9):863-71. PubMed PMID: 19696058. Epub 2009/08/22. eng. 40. Mills RW, Cornelussen RN, Mulligan LJ, Strik M, Rademakers LM, Skadsberg ND, et al. Left ventricular septal and left ventricular apical pacing chronically maintain cardiac contractile coordination, pump function and efficiency. Circ Arrhythm Electrophysiol. 2009 Oct;2(5):571-9. PubMed PMID: 19843926. Epub 2009/10/22. eng. 41. Kerckhoffs RC, Omens JH, McCulloch AD, Mulligan LJ. Ventricular dilation and electrical dyssynchrony synergistically increase regional mechanical nonuniformity but not mechanical dyssynchrony: a computational model. Circ Heart Fail. Jul 1;3(4):528-36. PubMed PMID: 20466849. Pubmed Central PMCID: 3050711. Epub 2010/05/15. eng. 42. Vernooy K, Cornelussen RN, Verbeek XA, Vanagt WY, van Hunnik A, Kuiper M, et al. Cardiac resynchronization therapy cures dyssynchronopathy in canine left bundle-branch block hearts. Eur Heart J. 2007 Sep;28(17):2148-55. PubMed PMID: 17611254. 43. Breithardt OA, Stellbrink C, Herbots L, Claus P, Sinha AM, Bijnens B, et al. Cardiac resynchronization therapy can reverse abnormal myocardial strain distribution in patients with heart failure and left bundle branch block. J Am Coll Cardiol. 2003 Aug 6;42(3):486-94. PubMed PMID: 12906978. Epub 2003/08/09. eng. 44. Klimusina J, De Boeck BW, Leenders GE, Faletra FF, Prinzen F, Averaimo M, et al. Redistribution of left ventricular strain by cardiac resynchronization therapy in heart failure patients. Eur J Heart Fail. Feb;13(2):186-94. PubMed PMID: 21106543. Epub 2010/11/26. eng. 45. Hirzel HO, Senn M, Nuesch K, Buettner C, Pfeiffer A, Hess OM, et al. Thallium-201 scintigraphy in complete left bundle branch block. The American journal of cardiology. 1984 Mar 1;53(6):764-9. PubMed PMID: 6702625. Epub 1984/03/01. eng. 46. Matzer L, Kiat H, Friedman JD, Van Train K, Maddahi J, Berman DS. A new approach to the assessment of tomographic thallium-201 scintigraphy in patients with left bundle branch block. Journal of the American College of Cardiology. 1991 May;17(6):1309-17. PubMed PMID: 2016448. Epub 1991/05/01. eng. 47. Hayat SA, Dwivedi G, Jacobsen A, Lim TK, Kinsey C, Senior R. Effects of left bundle-branch block on cardiac structure, function, perfusion, and perfusion reserve: implications for myocardial contrast echocardiography versus radionuclide perfusion imaging for the detection of coronary artery disease. Circulation. 2008 Apr 8;117(14):1832-41. PubMed PMID: 18378614. Epub 2008/04/02. eng. 48. Inanir S, Caymaz O, Okay T, Dede F, Oktay A, Deger M, et al. Tc-99m sestamibi gated SPECT in patients with left bundle branch block. Clinical nuclear medicine. 2001 Oct;26(10):840-6. PubMed PMID: 11564921. Epub 2001/09/21. eng. 36

CHAPTER 2 dyssynchronous heart failure 49. Masci PG, Marinelli M, Piacenti M, Lorenzoni V, Positano V, Lombardi M, et al. Myocardial structural, perfusion, and metabolic correlates of left bundle branch block mechanical derangement in patients with dilated cardiomyopathy: a tagged cardiac magnetic resonance and positron emission tomography study. Circulation Cardiovascular imaging. 2010 Jul 1;3(4):482-90. PubMed PMID: 20463209. Epub 2010/05/14. eng. 50. Delhaas T, Arts T, Prinzen FW, Reneman RS. Regional fibre stress-fibre strain area as an estimate of regional blood flow and oxygen demand in the canine heart. The Journal of physiology. 1994 Jun 15;477 ( Pt 3):481-96. PubMed PMID: 7932236. Pubmed Central PMCID: 1155612. Epub 1994/06/15. eng. 51. Ono S, Nohara R, Kambara H, Okuda K, Kawai C. Regional myocardial perfusion and glucose metabolism in experimental left bundle branch block. Circulation. 1992 Mar;85(3):1125-31. PubMed PMID: 1537110. Epub 1992/03/01. eng. 52. Vernooy K, Verbeek XA, Peschar M, Crijns HJ, Arts T, Cornelussen RN, et al. Left bundle branch block induces ventricular remodelling and functional septal hypoperfusion. European heart journal. 2005 Jan;26(1):91-8. PubMed PMID: 15615805. Epub 2004/12/24. eng. 53. van Oosterhout MF, Arts T, Bassingthwaighte JB, Reneman RS, Prinzen FW. Relation between local myocardial growth and blood flow during chronic ventricular pacing. Cardiovascular research. 2002 Mar;53(4):831-40. PubMed PMID: 11922893. Epub 2002/04/02. eng. 54. Lindner O, Vogt J, Baller D, Kammeier A, Wielepp P, Holzinger J, et al. Global and regional myocardial oxygen consumption and blood flow in severe cardiomyopathy with left bundle branch block. European journal of heart failure. 2005 Mar 2;7(2):225-30. PubMed PMID: 15701471. Epub 2005/02/11. eng. 55. Altehoefer C, vom Dahl J, Bares R, Stocklin GL, Bull U. Metabolic mismatch of septal beta-oxidation and glucose utilization in left bundle branch block assessed with PET. Journal of nuclear medicine : official publication, Society of Nuclear Medicine. 1995 Nov;36(11):2056-9. PubMed PMID: 7472598. Epub 1995/11/01. eng. 56. Neri G, Zanco P, Zanon F, Buchberger R. Effect of biventricular pacing on metabolism and perfusion in patients affected by dilated cardiomyopathy and left bundle branch block: evaluation by positron emission tomography. Europace : European pacing, arrhythmias, and cardiac electrophysiology : journal of the working groups on cardiac pacing, arrhythmias, and cardiac cellular electrophysiology of the European Society of Cardiology. 2003 Jan;5(1):111-5. PubMed PMID: 12504650. Epub 2002/12/31. eng. 57. Zanco P, Desideri A, Mobilia G, Cargnel S, Milan E, Celegon L, et al. Effects of left bundle branch block on myocardial FDG PET in patients without significant coronary artery stenoses. Journal of nuclear medicine : official publication, Society of Nuclear Medicine. 2000 Jun;41(6):973-7. PubMed PMID: 10855620. Epub 2000/06/16. eng. 58. Barth AS, Aiba T, Halperin V, DiSilvestre D, Chakir K, Colantuoni C, et al. Cardiac resynchronization therapy corrects dyssynchrony-induced regional gene expression changes on a genomic level. Circulation Cardiovascular genetics. 2009 Aug;2(4):371-8. PubMed PMID: 20031609. Pubmed Central PMCID: 2801868. Epub 2009/12/25. eng. 59. Agnetti G, Kaludercic N, Kane LA, Elliott ST, Guo Y, Chakir K, et al. Modulation of mitochondrial proteome and improved mitochondrial function by biventricular pacing of dyssynchronous failing hearts. Circ Cardiovasc Genet. Feb;3(1):78-87. PubMed PMID: 20160199. Pubmed Central PMCID: 2921909. Epub 2010/02/18. eng. 60. Nowak B, Sinha AM, Schaefer WM, Koch KC, Kaiser HJ, Hanrath P, et al. Cardiac resynchronization therapy homogenizes myocardial glucose metabolism and perfusion in dilated cardiomyopathy and left bundle branch block. J Am Coll Cardiol. 2003 May 7;41(9):1523-8. PubMed PMID: 12742293. Epub 2003/05/14. eng. 61. Spragg DD, Kass DA. Pathobiology of left ventricular dyssynchrony and resynchronization. Prog Cardiovasc Dis. 2006 Jul-Aug;49(1):26-41. PubMed PMID: 16867848. Epub 2006/07/27. eng. 62. Zhou Q, Henein M, Coats A, Gibson D. Different effects of abnormal activation and myocardial disease on left ventricular ejection and filling times. Heart. 2000 Sep;84(3):272-6. PubMed PMID: 10956289. Pubmed Central PMCID: 1760964. Epub 2000/08/24. eng. 63. Zile MR, Blaustein AS, Shimizu G, Gaasch WH. Right ventricular pacing reduces the rate of left ventricular relaxation and filling. J Am Coll Cardiol. 1987 Sep;10(3):702-9. PubMed PMID: 3624674. Epub 1987/09/01. eng. 64. Maurer G, Torres MA, Corday E, Haendchen RV, Meerbaum S. Two-dimensional echocardiographic contrast assessment of pacing-induced mitral regurgitation: relation to altered regional left ventricular function. J Am Coll Cardiol. 1984 Apr;3(4):986-91. PubMed PMID: 6707363. Epub 1984/04/01. eng.

65. Mark JB, Chetham PM. Ventricular pacing can induce hemodynamically significant mitral valve regurgitation. Anesthesiology. 1991 Feb;74(2):375-7. PubMed PMID: 1990916. Epub 1991/02/01. eng. 66. Nahlawi M, Waligora M, Spies SM, Bonow RO, Kadish AH, Goldberger JJ. Left ventricular function during and after right ventricular pacing. J Am Coll Cardiol. 2004 Nov 2;44(9):1883-8. PubMed PMID: 15519023. Epub 2004/11/03. eng. 67. Auricchio A, Stellbrink C, Block M, Sack S, Vogt J, Bakker P, et al. Effect of pacing chamber and atrioventricular delay on acute systolic function of paced patients with congestive heart failure. The Pacing Therapies for Congestive Heart Failure Study Group. The Guidant Congestive Heart Failure Research Group. Circulation. 1999 Jun 15;99(23):2993-3001. PubMed PMID: 10368116. Epub 1999/06/15. eng. 68. St John Sutton MG, Plappert T, Abraham WT, Smith AL, DeLurgio DB, Leon AR, et al. Effect of cardiac resynchronization therapy on left ventricular size and function in chronic heart failure. Circulation. 2003 Apr 22;107(15):1985-90. PubMed PMID: 12668512. Epub 2003/04/02. eng. 69. Breithardt OA, Sinha AM, Schwammenthal E, Bidaoui N, Markus KU, Franke A, et al. Acute effects of cardiac resynchronization therapy on functional mitral regurgitation in advanced systolic heart failure. J Am Coll Cardiol. 2003 Mar 5;41(5):765-70. PubMed PMID: 12628720. Epub 2003/03/12. eng. 70. Kass DA, Chen CH, Curry C, Talbot M, Berger R, Fetics B, et al. Improved left ventricular mechanics from acute VDD pacing in patients with dilated cardiomyopathy and ventricular conduction delay. Circulation. 1999 Mar 30;99(12):1567-73. PubMed PMID: 10096932. Epub 1999/03/30. eng. 71. Nelson GS, Berger RD, Fetics BJ, Talbot M, Spinelli JC, Hare JM, et al. Left ventricular or biventricular pacing improves cardiac function at diminished energy cost in patients with dilated cardiomyopathy and left bundle-branch block. Circulation. 2000 Dec 19;102(25):3053-9. PubMed PMID: 11120694. Epub 2000/01/11. eng. 72. Aiba T, Hesketh GG, Barth AS, Liu T, Daya S, Chakir K, et al. Electrophysiological consequences of dyssynchronous heart failure and its restoration by resynchronization therapy. Circulation. 2009 Mar 10;119(9):1220-30. PubMed PMID: 19237662. Pubmed Central PMCID: 2703676. Epub 2009/02/25. eng. 73. Kass DA. Pathobiology of cardiac dyssynchrony and resynchronization. Heart rhythm : the official journal of the Heart Rhythm Society. 2009 Nov;6(11):1660-5. PubMed PMID: 19879547. Epub 2009/11/03. eng. 74. Porter KE, Turner NA. Cardiac fibroblasts: at the heart of myocardial remodeling. Pharmacol Ther. 2009 Aug;123(2):255-78. PubMed PMID: 19460403. 75. van den Borne SW, Diez J, Blankesteijn WM, Verjans J, Hofstra L, Narula J. Myocardial remodeling after infarction: the role of myofibroblasts. Nat Rev Cardiol. 2010 Jan;7(1):30-7. PubMed PMID: 19949426. 76. Martin ML, Blaxall BC. Cardiac intercellular communication: are myocytes and fibroblasts fair-weather friends? J Cardiovasc Transl Res. 2012 Dec;5(6):768-82. PubMed PMID: 23015462. Pubmed Central PMCID: 3518575. 77. van Nieuwenhoven FA, Turner NA. The role of cardiac fibroblasts in the transition from inflammation to fibrosis following myocardial infarction. Vascul Pharmacol. 2013 Mar;58(3):182-8. PubMed PMID: 22885638. 78. Szabo Z, Magga J, Alakoski T, Ulvila J, Piuhola J, Vainio L, et al. Connective tissue growth factor inhibition attenuates left ventricular remodeling and dysfunction in pressure overload-induced heart failure. Hypertension. 2014 Jun;63(6):1235-40. PubMed PMID: 24688123. 79. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of novel genes coding for small expressed RNAs. Science. 2001 Oct 26;294(5543):853-8. PubMed PMID: 11679670. 80. Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993 Dec 3;75(5):843-54. PubMed PMID: 8252621. 81. Care A, Catalucci D, Felicetti F, Bonci D, Addario A, Gallo P, et al. MicroRNA-133 controls cardiac hypertrophy. Nat Med. 2007 May;13(5):613-8. PubMed PMID: 17468766. 82. da Costa Martins PA, Salic K, Gladka MM, Armand AS, Leptidis S, el Azzouzi H, et al. MicroRNA-199b targets the nuclear kinase Dyrk1a in an auto-amplification loop promoting calcineurin/NFAT signalling. Nat Cell Biol. 2010 Dec;12(12):1220-7. PubMed PMID: 21102440. 83. Lv LL, Cao YH, Ni HF, Xu M, Liu D, Liu H, et al. MicroRNA-29c in urinary exosome/microvesicle as a biomarker of renal fibrosis. Am J Physiol Renal Physiol. 2013 Oct 15;305(8):F1220-7. PubMed PMID: 23946286. 38

CHAPTER 2 dyssynchronous heart failure 84. Da Costa Martins PA, De Windt LJ. MicroRNAs in control of cardiac hypertrophy. Cardiovasc Res. 2012 Mar 15;93(4):563-72. PubMed PMID: 22266752. 85. Kumarswamy R, Thum T. Non-coding RNAs in cardiac remodeling and heart failure. Circ Res. 2013 Aug 30;113(6):676-89. PubMed PMID: 23989712. 86. van Rooij E, Sutherland LB, Liu N, Williams AH, McAnally J, Gerard RD, et al. A signature pattern of stress-responsive microRNAs that can evoke cardiac hypertrophy and heart failure. Proc Natl Acad Sci U S A. 2006 Nov 28;103(48):18255-60. PubMed PMID: 17108080. Pubmed Central PMCID: 1838739. 87. van Oosterhout MF, Prinzen FW, Arts T, Schreuder JJ, Vanagt WY, Cleutjens JP, et al. Asynchronous electrical activation induces asymmetrical hypertrophy of the left ventricular wall. Circulation. 1998 Aug 11;98(6):588-95. PubMed PMID: 9714117. Epub 1998/08/26. eng. 88. van Oosterhout MF, Arts T, Muijtjens AM, Reneman RS, Prinzen FW. Remodeling by ventricular pacing in hypertrophying dog hearts. Cardiovascular research. 2001 Mar;49(4):771-8. PubMed PMID: 11230976. Epub 2001/03/07. eng. 89. Prinzen FW, Cheriex EC, Delhaas T, van Oosterhout MF, Arts T, Wellens HJ, et al. Asymmetric thickness of the left ventricular wall resulting from asynchronous electric activation: a study in dogs with ventricular pacing and in patients with left bundle branch block. American heart journal. 1995 Nov;130(5):1045-53. PubMed PMID: 7484735. Epub 1995/11/01. eng. 90. Blaauw E, van Nieuwenhoven FA, Willemsen P, Delhaas T, Prinzen FW, Snoeckx LH, et al. Stretch-induced hypertrophy of isolated adult rabbit cardiomyocytes. American journal of physiology Heart and circulatory physiology. 2010 Sep;299(3):H780-7. PubMed PMID: 20639217. Epub 2010/07/20. eng. 91. Chakir K, Daya SK, Tunin RS, Helm RH, Byrne MJ, Dimaano VL, et al. Reversal of global apoptosis and regional stress kinase activation by cardiac resynchronization. Circulation. 2008 Mar 18;117(11):1369-77. PubMed PMID: 18316490. Epub 2008/03/05. eng. 92. Dâ&#x20AC;&#x2122;Ascia C, Cittadini A, Monti MG, Riccio G, Sacca L. Effects of biventricular pacing on interstitial remodelling, tumor necrosis factor-alpha expression, and apoptotic death in failing human myocardium. European heart journal. 2006 Jan;27(2):201-6. PubMed PMID: 16291773. Epub 2005/11/18. eng. 93. de Jong S, van Veen TA, de Bakker JM, Vos MA, van Rijen HV. Biomarkers of myocardial fibrosis. Journal of cardiovascular pharmacology. 2011 May;57(5):522-35. PubMed PMID: 21423029. Epub 2011/03/23. eng. 94. Weber KT, Janicki JS, Shroff SG, Pick R, Chen RM, Bashey RI. Collagen remodeling of the pressure-overloaded, hypertrophied nonhuman primate myocardium. Circ Res. 1988 Apr;62(4):757-65. PubMed PMID: 2964945. 95. Garcia-Bolao I, Lopez B, Macias A, Gavira JJ, Azcarate P, Diez J. Impact of collagen type I turnover on the longterm response to cardiac resynchronization therapy. European heart journal. 2008 Apr;29(7):898-906. PubMed PMID: 18334474. Epub 2008/03/13. eng. 96. Umar S, Bax JJ, Klok M, van Bommel RJ, Hessel MH, den Adel B, et al. Myocardial collagen metabolism in failing hearts before and during cardiac resynchronization therapy. European journal of heart failure. 2008 Sep;10(9):87883. PubMed PMID: 18768351. Epub 2008/09/05. eng. 97. Zile MR, Desantis SM, Baicu CF, Stroud RE, Thompson SB, McClure CD, et al. Plasma biomarkers that reflect determinants of matrix composition identify the presence of left ventricular hypertrophy and diastolic heart failure. Circulation Heart failure. 2011 May 1;4(3):246-56. PubMed PMID: 21350055. Epub 2011/02/26. eng. 98. Unverferth DV, Baker PB, Swift SE, Chaffee R, Fetters JK, Uretsky BF, et al. Extent of myocardial fibrosis and cellular hypertrophy in dilated cardiomyopathy. Am J Cardiol. 1986 Apr 1;57(10):816-20. PubMed PMID: 2938462. 99. Yamada T, Hirashiki A, Cheng XW, Okumura T, Shimazu S, Okamoto R, et al. Relationship of myocardial fibrosis to left ventricular and mitochondrial function in nonischemic dilated cardiomyopathy--a comparison of focal and interstitial fibrosis. J Card Fail. 2013 Aug;19(8):557-64. PubMed PMID: 23910585. 100. Spinale FG. Myocardial matrix remodeling and the matrix metalloproteinases: influence on cardiac form and function. Physiol Rev. 2007 Oct;87(4):1285-342. PubMed PMID: 17928585. 101. Spragg DD, Akar FG, Helm RH, Tunin RS, Tomaselli GF, Kass DA. Abnormal conduction and repolarization in late-activated myocardium of dyssynchronously contracting hearts. Cardiovascular research. 2005 Jul 1;67(1):77-86. PubMed PMID: 15885674. Epub 2005/05/12. eng. 39

102. Strik M, Rademakers LM, van Deursen CJ, van Hunnik A, Kuiper M, Klersy C, et al. Endocardial left ventricular pacing improves cardiac resynchronization therapy in chronic asynchronous infarction and heart failure models. Circ Arrhythm Electrophysiol. 2012 Feb;5(1):191-200. PubMed PMID: 22062796. 103. Tomaselli GF, Zipes DP. What causes sudden death in heart failure? Circulation research. 2004 Oct 15;95(8):754-63. PubMed PMID: 15486322. Epub 2004/10/16. eng. 104. Jeyaraj D, Wilson LD, Zhong J, Flask C, Saffitz JE, Deschenes I, et al. Mechanoelectrical feedback as novel mechanism of cardiac electrical remodeling. Circulation. 2007 Jun 26;115(25):3145-55. PubMed PMID: 17562957. Epub 2007/06/15. eng. 105. Nattel S, Maguy A, Le Bouter S, Yeh YH. Arrhythmogenic ion-channel remodeling in the heart: heart failure, myocardial infarction, and atrial fibrillation. Physiological reviews. 2007 Apr;87(2):425-56. PubMed PMID: 17429037. Epub 2007/04/13. eng. 106. Li GR, Lau CP, Ducharme A, Tardif JC, Nattel S. Transmural action potential and ionic current remodeling in ventricles of failing canine hearts. American journal of physiology Heart and circulatory physiology. 2002 Sep;283(3):H1031-41. PubMed PMID: 12181133. Epub 2002/08/16. eng. 107. Kaab S, Nuss HB, Chiamvimonvat N, O’Rourke B, Pak PH, Kass DA, et al. Ionic mechanism of action potential prolongation in ventricular myocytes from dogs with pacing-induced heart failure. Circulation research. 1996 Feb;78(2):262-73. PubMed PMID: 8575070. Epub 1996/02/01. eng. 108. Rozanski GJ, Xu Z, Whitney RT, Murakami H, Zucker IH. Electrophysiology of rabbit ventricular myocytes following sustained rapid ventricular pacing. Journal of molecular and cellular cardiology. 1997 Feb;29(2):721-32. PubMed PMID: 9140829. Epub 1997/02/01. eng. 109. Tsuji Y, Opthof T, Kamiya K, Yasui K, Liu W, Lu Z, et al. Pacing-induced heart failure causes a reduction of delayed rectifier potassium currents along with decreases in calcium and transient outward currents in rabbit ventricle. Cardiovascular research. 2000 Nov;48(2):300-9. PubMed PMID: 11054476. Epub 2000/10/31. eng. 110. Rose J, Armoundas AA, Tian Y, DiSilvestre D, Burysek M, Halperin V, et al. Molecular correlates of altered expression of potassium currents in failing rabbit myocardium. American journal of physiology Heart and circulatory physiology. 2005 May;288(5):H2077-87. PubMed PMID: 15637125. Pubmed Central PMCID: 2711868. Epub 2005/01/08. eng. 111. Tsuji Y, Zicha S, Qi XY, Kodama I, Nattel S. Potassium channel subunit remodeling in rabbits exposed to long-term bradycardia or tachycardia: discrete arrhythmogenic consequences related to differential delayed-rectifier changes. Circulation. 2006 Jan 24;113(3):345-55. PubMed PMID: 16432066. Epub 2006/01/25. eng. 112. Armoundas AA, Rose J, Aggarwal R, Stuyvers BD, O’Rourke B, Kass DA, et al. Cellular and molecular determinants of altered Ca2+ handling in the failing rabbit heart: primary defects in SR Ca2+ uptake and release mechanisms. American journal of physiology Heart and circulatory physiology. 2007 Mar;292(3):H1607-18. PubMed PMID: 17122195. Pubmed Central PMCID: 2711877. Epub 2006/11/24. eng. 113. Hobai IA, O’Rourke B. Enhanced Ca(2+)-activated Na(+)-Ca(2+) exchange activity in canine pacing-induced heart failure. Circulation research. 2000 Oct 13;87(8):690-8. PubMed PMID: 11029405. Epub 2000/10/13. eng. 114. Mullens W, Bartunek J, Wilson Tang WH, Delrue L, Herbots L, Willems R, et al. Early and late effects of cardiac resynchronization therapy on force-frequency relation and contractility regulating gene expression in heart failure patients. Heart rhythm : the official journal of the Heart Rhythm Society. 2008 Jan;5(1):52-9. PubMed PMID: 18082469. Epub 2007/12/18. eng. 115. Vanderheyden M, Mullens W, Delrue L, Goethals M, de Bruyne B, Wijns W, et al. Myocardial gene expression in heart failure patients treated with cardiac resynchronization therapy responders versus nonresponders. Journal of the American College of Cardiology. 2008 Jan 15;51(2):129-36. PubMed PMID: 18191736. Epub 2008/01/15. eng. 116. Chen X, Piacentino V, 3rd, Furukawa S, Goldman B, Margulies KB, Houser SR. L-type Ca2+ channel density and regulation are altered in failing human ventricular myocytes and recover after support with mechanical assist devices. Circulation research. 2002 Sep 20;91(6):517-24. PubMed PMID: 12242270. Epub 2002/09/21. eng. 117. He J, Conklin MW, Foell JD, Wolff MR, Haworth RA, Coronado R, et al. Reduction in density of transverse tubules and L-type Ca(2+) channels in canine tachycardia-induced heart failure. Cardiovascular research. 2001 Feb 1;49(2):298-307. PubMed PMID: 11164840. Epub 2001/02/13. eng.

CHAPTER 2 dyssynchronous heart failure 118. Aiba T, Tomaselli GF. Electrical remodeling in the failing heart. Current opinion in cardiology. 2010 Jan;25(1):2936. PubMed PMID: 19907317. Pubmed Central PMCID: 2855498. Epub 2009/11/13. eng. 119. Hullin R, Khan IF, Wirtz S, Mohacsi P, Varadi G, Schwartz A, et al. Cardiac L-type calcium channel beta-subunits expressed in human heart have differential effects on single channel characteristics. The Journal of biological chemistry. 2003 Jun 13;278(24):21623-30. PubMed PMID: 12606548. Epub 2003/02/28. eng. 120. Yang Y, Chen X, Margulies K, Jeevanandam V, Pollack P, Bailey BA, et al. L-type Ca2+ channel alpha 1c subunit isoform switching in failing human ventricular myocardium. Journal of molecular and cellular cardiology. 2000 Jun;32(6):973-84. PubMed PMID: 10888251. Epub 2000/07/11. eng. 121. Sachse FB, Torres NS, Savio-Galimberti E, Aiba T, Kass DA, Tomaselli GF, et al. Subcellular structures and function of myocytes impaired during heart failure are restored by cardiac resynchronization therapy. Circ Res. 2012 Feb 17;110(4):588-97. PubMed PMID: 22253411. Pubmed Central PMCID: 3299196. 122. Gauthier C, Tavernier G, Charpentier F, Langin D, Le Marec H. Functional beta3-adrenoceptor in the human heart. The Journal of clinical investigation. 1996 Jul 15;98(2):556-62. PubMed PMID: 8755668. Pubmed Central PMCID: 507461. Epub 1996/07/15. eng. 123. Zhu W, Zeng X, Zheng M, Xiao RP. The enigma of beta2-adrenergic receptor Gi signaling in the heart: the good, the bad, and the ugly. Circulation research. 2005 Sep 16;97(6):507-9. PubMed PMID: 16166560. Epub 2005/09/17. eng. 124. Post SR, Hammond HK, Insel PA. Beta-adrenergic receptors and receptor signaling in heart failure. Annual review of pharmacology and toxicology. 1999;39:343-60. PubMed PMID: 10331088. Epub 1999/05/20. eng. 125. Patterson AJ, Zhu W, Chow A, Agrawal R, Kosek J, Xiao RP, et al. Protecting the myocardium: a role for the beta2 adrenergic receptor in the heart. Critical care medicine. 2004 Apr;32(4):1041-8. PubMed PMID: 15071399. Epub 2004/04/09. eng. 126. Xiao RP, Zhu W, Zheng M, Chakir K, Bond R, Lakatta EG, et al. Subtype-specific beta-adrenoceptor signaling pathways in the heart and their potential clinical implications. Trends in pharmacological sciences. 2004 Jul;25(7):35865. PubMed PMID: 15219978. Epub 2004/06/29. eng. 127. Lohse MJ, Engelhardt S, Eschenhagen T. What is the role of beta-adrenergic signaling in heart failure? Circulation research. 2003 Nov 14;93(10):896-906. PubMed PMID: 14615493. Epub 2003/11/15. eng. 128. Chakir K, Daya SK, Aiba T, Tunin RS, Dimaano VL, Abraham TP, et al. Mechanisms of enhanced beta-adrenergic reserve from cardiac resynchronization therapy. Circulation. 2009 Mar 10;119(9):1231-40. PubMed PMID: 19237665. Pubmed Central PMCID: 2850078. Epub 2009/02/25. eng. 129. Najem B, Unger P, Preumont N, Jansens JL, Houssiere A, Pathak A, et al. Sympathetic control after cardiac resynchronization therapy: responders versus nonresponders. American journal of physiology Heart and circulatory physiology. 2006 Dec;291(6):H2647-52. PubMed PMID: 16844919. Epub 2006/07/18. eng. 130. Vanderheyden M, Mullens W, Delrue L, Goethals M, Verstreken S, Wijns W, et al. Endomyocardial upregulation of beta1 adrenoreceptor gene expression and myocardial contractile reserve following cardiac resynchronization therapy. Journal of cardiac failure. 2008 Mar;14(2):172-8. PubMed PMID: 18325466. Epub 2008/03/08. eng.

Abstract chapter 3 Cardiac resynchronization therapy (CRT) is an important therapy for patients with heart failure and conduction pathology but the benefits are heterogeneous between patients and approximately a third of patients do not show signs of clinical or echocardiographic response. This calls for a better understanding of the underlying conduction disease and mechanisms of resynchronization. In this review, we discuss to what extent established and novel animal models can help to better understand the pathophysiology of dyssynchrony and the benefits of CRT.

Conclusion Animal models are of great importance in understanding the events and consequences of dyssynchrony and resynchronization. Depending on the hypothesis to be tested, multiple well-established and novel animal models of dyssynchrony exist. Detailed animal experiments demonstrate that ventricular dyssynchrony is a complex disease, which can and needs to be treated in a better way than it is often performed today.

CHAPTER 1 general introduction

Chapter 3 Animal models of dyssynchrony

Marc Strik, Lars B. van Middendorp, Kevin Vernooy

J Cardiovasc Transl Res. 2012 Apr;5(2):135-45

Introduction To maintain a normal cardiac pump function, a near synchronous electrical activation sequence of both ventricles is imperative. This synchronous activation applies to multiple anatomic levels: within atria, between atria and ventricles, between ventricles, and especially within the left ventricle (LV). Right-sided pre-excitation, such as during left bundle branch block (LBBB) and right ventricular (RV) pacing, induces dyssynchrony, which instantly decreases cardiac pump function and is a risk factor for development of heart failure.1 Cardiac Resynchronization Therapy (CRT) attempts to treat dyssynchrony by simultaneous or sequential stimulation of both ventricles in patients with symptomatic heart failure, LV systolic dysfunction and increased QRS complex duration. Even though large clinical trials clearly show the efficacy of CRT at the population level, in this heterogeneous group of patients, approximately one third does not show evidence of clinical or echocardiographic response after device implantation.2-4 In addition, the range of response is highly variable, raising the question whether CRT is optimally performed in every patient or whether each patient can benefit equally from CRT. Therefore, a better understanding concerning the effects of dyssynchrony and resynchronization on cardiac pump function is required. The goal of the present chapter is to review how animal models of dyssynchrony can help clarify the pathophysiology of dyssynchrony and further improve the treatment of dyssynchrony by CRT.

Animal models of dyssynchrony Over one century ago, Eppinger and Tothberger discovered large and specific changes in QRS morphology after making a small incision in the left or right surface of the interventricular septum in canine hearts.5 The first dyssynchronous animal model was established and was in fact a dyssynchrony model by a proximal lesion of the bundle branches. Since then, LBBB has been described in humans but also in monkeys and pigs.6, 7 Investigating LBBB in other animals may apply less to the human situation, as there are inter-species differences in anatomy of the left bundle branch. For example in hearts from ox and sheep, the bundles are significantly thicker and their branches extend much more towards the epicardium.8 In rabbit hearts the left â&#x20AC;&#x2DC;bundleâ&#x20AC;&#x2122; is composed of groups of fine sheets covering the subendocardial tissue.9 Since the extent of electrical dyssynchrony in dogs is comparable to humans (where a doubling of QRS duration is seen) the canine heart is considered the most suitable animal model for investigating LBBB. In contrast, mimicking LBBB by RV pacing or genuine 44

CHAPTER 3 animal models

LBBB increases QRS duration by only 50% in pigs7 and even less in goats (unpublished observations).

Figure 1

For obvious reasons, animal experiments have presented more detailed information than clinical studies, but they suffer from limitations such as the fact that most animal studies are performed in (initially) young and healthy animals and that various preparations have been used, which differ from the clinical and intact human situation. Because an animal model based on intraventricular incisions was not suitable to investigate the hemodynamic effects of LBBB, later research focused on dyssynchrony based on ventricular pacing. In 1925, Wiggers described that artificial stimulation of the canine left ventricle I) slows down the rate and rise of intraventricular pressure, II) lengthens the isometric contraction phase, III) lowers the maximal systolic pressure and IV) increases the duration of systole.10 Even though it was clear that dyssynchrony has adverse effects on cardiac pump function, major interest in the pathophysiology of dyssynchrony developed only after these effects were revealed in large groups of patients who underwent permanent RV pacing.8 Similar to LBBB, RV pacing induces delays in transseptal and intraventricular conduction which explains why the hemodynamic effects of altered ventricular activation during RV pacing and LBBB are comparable. However, there are important differences between the two situations. RV apex pacing disturbs RV activation since pacing induces slow intramyocardial conduction instead of fast conduction through the Purkinje fibers. Secondly, the site of stimulation-induced breakthrough differs from the site of intrinsic breakthrough. Therefore, LV depolarization through the interventricular septum is also different from that during LBBB. To investigate the pathophysiology of LBBB and the effects of CRT, a LBBB model was developed in canine hearts.11-13 Through the aortic valve, an ablation catheter is positioned against the basal septum. Guided by the local endocardial electrogram derived from the tip of the catheter, the left bundle branch is located as evidenced by a sharp deflection between A-wave and V-wave and subsequently ablated (figure 1).13

Induction of LBBB based on the electrogram derived from a standard ablation catheter, introduced through the aortic valve into the LV. The left bundle branch potential (black arrows) is observed as a sharp deflection between the A-wave and V-wave in the local electrograms (bottom tracing). Subsequently, ablation is started at this location, which results in a proximal LBBB. The top tracing shows a simultaneously recorded surface electrocardiogram. 45

Electrical mapping during dyssynchronous activation helped enormous in understanding the effects of dyssynchrony and CRT. In short, in the healthy canine heart electrical activation is very synchronous but ablation of the proximal left bundle branch causes a severe delay in the electrical activation of the LV postero-lateral wall (figure 2). Figure 2 Typical examples of 3D electrical activation in canine hearts during normal conduction (left panel) and after creation of LBBB (right panel). Plotted activation times were derived from â&#x2030;&#x2C6;110 epicardial and endocardial contact electrodes and referenced to the onset of the Q wave. In the right panel, the ablation catheter is shown with the approximate location of ablation after which a LBBB pattern occurred.

As shown in figure 3, LBBB changes the morphology and duration of the QRS complex. In agreement to the observations of Wiggers, LBBB-induced dyssynchronous contraction causes reduction in ejection time and slows rates of rise and fall of LV and aortic pressure and increases duration of isovolumic contraction and relaxation.14, 15 Figure 3 Effects of synchronous (top) and dyssynchronous (bottom) ventricular activation. Dyssynchronous electromechanical activation induces increased QRS duration (A) mechanical interventricular assynchrony (B) Adapted with permission from Verbeek et al.

CHAPTER 3 animal models

Electromechanical delay Myocardial contraction does not immediately follow depolarization and the delay between local electrical activation and shortening, or electro-mechanical delay, was found to be approximately 30 milliseconds in normal canine hearts.16 More advanced measurements (MRI tagging) at many sites in dyssynchronous ventricles showed that timing differences in shortening are larger than in electrical activation.17 This larger mechanical dyssynchrony is presumably explained completely by its definition: the onset of shortening. Recent studies in canine hearts indicate that when the onset of active force generation rather than the onset of shortening is used to define mechanical activation, electro-mechanical delay is equal throughout the dyssynchronous heart and directly reflects the timing of electrical activation.18 This discrepancy between onset of active force generation and onset of shortening is explained by the fact that early activated regions can start to shorten immediately upon activation, because cavity pressure is low and all other muscle fibers are passive, while this is not valid for late activated regions. The prolonged electro-mechanical delay in the later activated region could not be explained by increased excitation-contraction coupling time or increased pressure at the time of local depolarization. However, the higher rate of rise of LV pressure (LV dP/dt) that late activated regions have to oppose prolongs the interval when force generation is above the load induced by early septal contraction, resulting in delayed onset of shortening.19 The early and decreased fiber shortening in early activated regions and pronounced shortening in late activated regions found in canine dyssynchrony models was also found in LBBB patients.19-21 Since LV dP/dt reflects LV function and contractility, the magnitude of mechanical dyssynchrony may vary over time in a given patients when there are changes in LV function.19

Cardiac resynchronization therapy in animal models Immediately upon inducing LBBB in the canine hearts, LV dP/dtmax decreases by ~20% and adverse effects as described in earlier animal models of pacing induced dyssynchrony are reproduced.22 Interestingly, biventricular pacing in the LBBB heart instantaneously causes an almost normalization of the strain pattern (figure 4) and increases LV dP/dtmax to ~85% of pre-LBBB followed by a slight further improvement to ~90% of pre-LBBB values after chronic CRT (8 weeks). The data from this animal study indicate that CRT clearly improves cardiac pump function in the LBBB hearts, but does not return it completely to pre-LBBB values. This is because the physiological sequence of activation is never completely restored during CRT and always remains less efficient than through 47

the Purkinje system.23 Asymmetric hypertrophy, as seen during chronic LV pacing, also applies to the situation of LBBB.24 Eight weeks after creation of LBBB, wall mass of the lateral wall and LV cavity size increased by â&#x2030;&#x2C6;30%, whereas mass of the septum barely changed.24 After 8 weeks of CRT, LV cavity size and regional differences in hypertrophy normalized to pre-LBBB levels. The observations made in these dog models are readily translatable to the human situation. In patients with LBBB the effect of asynchronous activation on regional hypertrophy was comparable to that observed in dogs. Nonetheless, the effects of CRT are less pronounced in patients possibly due to the large heterogeneity and confounding factors such as pre-existing hypertrophy, fibrosis, infarction and dilation that are so often present in these patient groups.25, 26 Figure 4 Typical example of myocardial circumferential shortening (%) tracings in eight regions along the mid-basal LV circumference. Please note the abnormal shortening patterns during LBBB and the normalization during CRT (LBBB+CRT).

These findings give rise to the notion that dyssynchronous ventricular activation by LBBB on its own is sufficient for CRT to be efficient. The described animal models contain dyssynchronous activation either by ventricular pacing or by proximal ablation of the left bundle branch and, unlike CRT candidates, these models do not suffer from co-morbidities complicating their conduction defect. It is important to understand the effects of additional factors such as LV systolic dysfunction for better selection of CRT candidates and to increase the response to treatment. In healthy canine hearts, isolated LBBB induces electrical and mechanical dyssynchrony that eventually will lead to loss of LV pump function and ventricular remodeling. In these hearts, CRT largely reversed global and regional function and structural abnormalities, indicating that LBBB as electrical substrate is sufficient for acute and long-term response to CRT.27 Recently, multiple clinical trials have indeed shown high CRT efficacy in heart failure patients who were not severely symptomatic (NYHA class I and II).2, 28-31 48

CHAPTER 3 animal models of dyssynchrony

Role of infarction in CRT While inclusion criteria for CRT are extended to patients without severe symptomatic heart failure, still a significant number of patients complying with the current guidelines do not respond beneficially to CRT. In this regard, most clinical studies show that the number of non-responders is highest in patients who suffer from ischemic cardiomyopathy (ICM). One possible mechanism is that there is insufficient viable tissue to allow an increase in contractility by CRT. Another possible mechanism lies in modification of the electrical substrate where the extent of resynchronization would be limited as a result of slow-conducting or non-conducting regions. This would imply that a good response to CRT in ICM patients not only requires clear conduction disease, but also the capability to properly resynchronize the heart. An important feature in this regard is the site of pacing, as pacing in the vicinity of scar tissue is considered to compromise conduction. To investigate this idea, an animal model was developed where dyssynchronous activation by proximal left bundle branch ablation was combined with myocardial infarction.32 Transmural myocardial infarction was created by embolization of the left anterior descending (LAD) or circumflex (LCX) artery using a suspension of polyvinyl alcohol foam particles. Four weeks later LBBB was induced and another week later measurements on electrical activation and hemodynamics were performed. TTC staining showed that all infarctions were transmural with an infarct size of 19.9Âą6.0% (range 14-32%) of LV mass (see typical example in figure 5).32 Figure 5 Short-axis slice at the mid-level of left ventricle. TTC staining, demonstrating transmural myocardial infarction of the canine LV lateral wall in the LBBB infarction model (for details see text).

In LBBB hearts with myocardial infarction, pacing remote from the infarcted regions resulted in a similar CRT response as in non-infarcted canine LBBB hearts. Achieving the maximal benefit in infarcted dyssynchronous hearts, however, required accurate positioning of the LV pacing lead and more precise timing of LV stimulation. In infarcted hearts, the optimal pacing site did not coincide with the region of latest activation but rather a region distant from the infarction and more basal or apical than the preferred pacing site in non-infarcted hearts. The optimal LV pacing position in infarcted dyssynchronous hearts appears to be determined by the fastest possible pathway of activation wavefront from LV and RV electrodes.32 This study indicated that in hearts with LAD occlusion, the infarction is located apically and basal pacing allows the activation wavefront to bypass the infarcted area. In contrast, the mid-lateral position is best in case of LCX infarctions since the activation wavefront can easily propagate over the lateral wall and apex. The preclinical data indicate that it is important to know the location of the infarction but in many CRT candidates, this is not known since scar imaging before device implantation is not regularly performed. Even if scar imaging is not feasible, acute hemodynamic or electrocardiographic testing during pacemaker implantation could potentially help to optimize CRT response in patients with underlying ischemic disease. Role of dilation on benefit of (endocardial) CRT Besides ventricular conduction delay and possibly myocardial infarction, many CRT candidates suffer from dilated cardiomyopathy. Even though dyssynchrony alone is sufficient for CRT to be successful, inducing heart failure in addition to electrical dyssynchrony can be essential to test certain hypotheses. For example it was found that in canine hearts with isolated LBBB, endocardial LV pacing during CRT consistently improved systolic LV pump function, reduced electrical dyssynchrony and decreased dispersion of repolarization, as compared to epicardial LV pacing at the same site.33 Three possible mechanisms explaining the more rapid electrical activation during endocardial CRT in this model were proposed: I) shorter path length of conduction, II) faster endocardial than epicardial conduction as well as III) faster conduction from endocardium to epicardium than vice versa. While all three factors may contribute in the setting of LBBB in otherwise healthy canine hearts, ventricular dilation and wall thinning would reduce the difference in conduction path length between endo- and epicardium, potentially reducing the advantages of endocardial CRT in patients with dilated cardiomyopathy. Better understanding of the various factors determining the benefits of endocardial CRT in animal models with compromised hearts can 50

CHAPTER 3 animal models

also be used to propose explanations to ambivalent results reported from the few small clinical studies on endocardial CRT.34-36 For this purpose, a study to investigate the efficacy of endocardial CRT in canine LBBB hearts combined with dilated cardiomyopathy was performed.37 The results were compared with endocardial CRT in dogs with acute LBBB and in dogs with chronic LBBB and infarction (model as described above). To obtain dilated cardiomyopathy, the apex of the right ventricle was paced at a rate of 220 beats per minute for 4 weeks, as described earlier.38, 39 As compared to the acute LBBB group, LV function was depressed in the myocardial infarction group as indicated by decreased stroke work and elevated LV and RV end-diastolic pressures. Echocardiographically, LV end-diastolic diameter remained equal while wall thickness increased. The ratio of LV end-diastolic radius including the myocardium (outer) to LV end-diastolic radius (inner) signifies the type of remodeling and this ratio was higher in the infarcted dyssynchronous hearts as compared with the acute LBBB hearts (1.88 versus 1.61, respectively) indicating hypertrophic remodeling. In the failing LBBB group, four weeks of rapid pacing induced an increase in LV end-diastolic diameter and a decrease in LV wall thickness. In this model, the ratio of outer LV radius and inner LV radius decreased to 1.36, reflecting dilation, which was accompanied by severe systolic dysfunction as evidenced by an LV ejection fraction of â&#x2030;&#x2C6;15% in combination with â&#x2030;&#x2C6;50% reduction of LV dP/dtmax and elevation of LV EDP. The differences in path length between various dyssynchrony models indeed influenced the effect of (conventional) epicardial or endocardial CRT on electrical resynchronization (as determined by LV electrical mapping). The added benefit of endocardial over epicardial CRT on electrical resynchronization was greater in hypertrophied than in dilated hearts. (figure 6) Figure 6 Percent change in LV electrical dyssynchrony during epicardial versus endocardial CRT as a function of the ratio of outer LV radius to inner LV radius in the three experimental groups. P-values signify a statistical significant difference in ENDO-EPI CRT between groups.

It was interesting to observe that despite these differences between the three models, CRT resulted in a similar absolute increase in LV dP/dtmax (â&#x2030;&#x2C6;150 mmHg/s with epicardial CRT and â&#x2030;&#x2C6;250 mmHg/s with endocardial CRT). Because baseline LV dP/dtmax was considerably lower in the failing LBBB group, this translated to higher relative increases in LV dP/dtmax during CRT, relative increases that are similar to those found in patients.40 Therefore the extent of additional electrical resynchronization by endocardial CRT depends on cardiac remodeling but the functional response is not, which could be related to higher subendocardial conduction velocities, faster transmural depolarization and a shorter path length towards the various wall regions. These data further emphasize the benefits of endocardial LV stimulation in CRT patients. Table 1 shows an overview of canine models of dyssynchrony and their effects on left ventricular characteristics.

Table 1, Canine models Heartrate

Table 1 Hypertrophy

Dilatation

EF% LV dP/dtmax

LV pacing41,42

septal wall

=/+

=/-

LBBB / RV pacing24,43

lateral wall

added AoS44

added MI32,45

added atrial tachypacing46

Conclusion Animal models are of great importance in understanding the events and consequences of dyssynchrony and resynchronization. Depending on the hypothesis to be tested, multiple wellestablished and novel animal models of dyssynchrony exist. Detailed animal experiments demonstrate that ventricular dyssynchrony is a complex disease, which can and needs to be treated in a better way than it is often performed today. 52

Canine models of dyssynchrony and associated left ventricular changes in hypertrophy, dilatation, ejection fraction and LV dP/dtmax. LBBB; left bundle branch block, AoS; Aortic Stenosis, MI; Myocardial Infarction; ejection fraction (EF%);

CHAPTER 3 animal models

References 1. Sweeney MO, Prinzen FW. A new paradigm for physiologic ventricular pacing. J Am Coll Cardiol. 2006 Jan 17;47(2):282-8. PubMed PMID: 16412848. Epub 2006/01/18. eng. 2. Abraham WT, Young JB, Leon AR, Adler S, Bank AJ, Hall SA, et al. Effects of cardiac resynchronization on disease progression in patients with left ventricular systolic dysfunction, an indication for an implantable cardioverter-defibrillator, and mildly symptomatic chronic heart failure. Circulation. 2004 Nov 2;110(18):2864-8. PubMed PMID: 15505095. Epub 2004/10/27. eng. 3. Cleland JG, Daubert JC, Erdmann E, Freemantle N, Gras D, Kappenberger L, et al. The effect of cardiac resynchronization on morbidity and mortality in heart failure. N Engl J Med. 2005 Apr 14;352(15):1539-49. PubMed PMID: 15753115. Epub 2005/03/09. eng. 4. Bristow MR, Saxon LA, Boehmer J, Krueger S, Kass DA, De Marco T, et al. Cardiac-resynchronization therapy with or without an implantable defibrillator in advanced chronic heart failure. N Engl J Med. 2004 May 20;350(21):214050. PubMed PMID: 15152059. Epub 2004/05/21. eng. 5. Eppinger H, Rothberger J. Ueber die Folgen der Durchschneidung der Tawaraschen Schenkel des Reizleitungssystems,. Ztsch Klin Med 1910;70:1. 6. Roberts GH, Crawford JH, Abramson DI. Experimental Bundle Branch Block in the Monkey. J Clin Invest. 1935 Nov;14(6):867-70. PubMed PMID: 16694358. Pubmed Central PMCID: 424740. Epub 1935/11/01. eng. 7. Marrouche NF, Pavia SV, Zhuang S, Kim YJ, Tabata T, Wallick D, et al. Nonexcitatory stimulus delivery improves left ventricular function in hearts with left bundle branch block. J Cardiovasc Electrophysiol. 2002 Jul;13(7):691-5. PubMed PMID: 12139294. Epub 2002/07/26. eng. 8. Prinzen FW, Peschar M. Relation between the pacing induced sequence of activation and left ventricular pump function in animals. Pacing Clin Electrophysiol. 2002 Apr;25(4 Pt 1):484-98. PubMed PMID: 11991375. Epub 2002/05/07. eng. 9. Bojsen-Moller F, Tranum-Jensen J. Rabbit heart nodal tissue, sinuatrial ring bundle and atrioventricular connexions indentified as a neuromuscular system. J Anat. 1972 Sep;112(Pt 3):367-82. PubMed PMID: 4636795. Pubmed Central PMCID: 1271178. Epub 1972/09/01. eng. 10. Wiggers CJ. The muscular reactions of the mammalian ventricles to artificial surface stimuli. American Journal of Physiology -- Legacy Content. 1925 July 1, 1925;73(2):346-78. 11. Verbeek XA, Vernooy K, Peschar M, Van Der Nagel T, Van Hunnik A, Prinzen FW. Quantification of interventricular asynchrony during LBBB and ventricular pacing. Am J Physiol Heart Circ Physiol. 2002 Oct;283(4):H1370-8. PubMed PMID: 12234787. 12. Liu L, Tockman B, Girouard S, Pastore J, Walcott G, KenKnight B, et al. Left ventricular resynchronization therapy in a canine model of left bundle branch block. Am J Physiol Heart Circ Physiol. 2002 Jun;282(6):H2238-44. PubMed PMID: 12003833. Epub 2002/05/11. eng. 13. Verbeek XA, Vernooy K, Peschar M, Cornelussen RN, Prinzen FW. Intra-ventricular resynchronization for optimal left ventricular function during pacing in experimental left bundle branch block. J Am Coll Cardiol. 2003 Aug 6;42(3):558-67. PubMed PMID: 12906989. 14. Prinzen FW, Van Oosterhout MF, Vanagt WY, Storm C, Reneman RS. Optimization of ventricular function by improving the activation sequence during ventricular pacing. Pacing Clin Electrophysiol. 1998 Nov;21(11 Pt 2):2256-60. PubMed PMID: 9825329. Epub 1998/11/24. eng. 15. Zile MR, Blaustein AS, Shimizu G, Gaasch WH. Right ventricular pacing reduces the rate of left ventricular relaxation and filling. J Am Coll Cardiol. 1987 Sep;10(3):702-9. PubMed PMID: 3624674. Epub 1987/09/01. eng. 16. Prinzen FW, Augustijn CH, Allessie MA, Arts T, Delhaas T, Reneman RS. The time sequence of electrical and mechanical activation during spontaneous beating and ectopic stimulation. Eur Heart J. 1992 Apr;13(4):535-43. PubMed PMID: 1600995. Epub 1992/04/01. eng. 17. Wyman BT, Hunter WC, Prinzen FW, McVeigh ER. Mapping propagation of mechanical activation in the paced heart with MRI tagging. Am J Physiol. 1999 Mar;276(3 Pt 2):H881-91. PubMed PMID: 10070071. Epub 1999/03/10. eng. 53

18. Russell K, Opdahl A, Remme EW, Gjesdal O, Skulstad H, Kongsgaard E, et al. Evaluation of left ventricular dyssynchrony by onset of active myocardial force generation: a novel method that differentiates between electrical and mechanical etiologies. Circ Cardiovasc Imaging. 2010 Jul 1;3(4):405-14. PubMed PMID: 20494943. Epub 2010/05/25. eng. 19. Russell K, Smiseth OA, Gjesdal O, Qvigstad E, Norseng PA, Sjaastad I, et al. Mechanism of Prolonged Electro-Mechanical Delay in Late Activated Myocardium during Left Bundle Branch Block. American Journal of Physiology. 2011. 20. Prinzen FW, Augustijn CH, Arts T, Allessie MA, Reneman RS. Redistribution of myocardial fiber strain and blood flow by asynchronous activation. Am J Physiol. 1990 Aug;259(2 Pt 2):H300-8. PubMed PMID: 2386214. Epub 1990/08/01. eng. 21. Breithardt OA, Stellbrink C, Herbots L, Claus P, Sinha AM, Bijnens B, et al. Cardiac resynchronization therapy can reverse abnormal myocardial strain distribution in patients with heart failure and left bundle branch block. J Am Coll Cardiol. 2003 Aug 6;42(3):486-94. PubMed PMID: 12906978. Epub 2003/08/09. eng. 22. Vernooy K, Cornelussen RN, Verbeek XA, Vanagt WY, van Hunnik A, Kuiper M, et al. Cardiac resynchronization therapy cures dyssynchronopathy in canine left bundle-branch block hearts. Eur Heart J. 2007 Sep;28(17):2148-55. PubMed PMID: 17611254. 23. Wyman BT, Hunter WC, Prinzen FW, Faris OP, McVeigh ER. Effects of single- and biventricular pacing on temporal and spatial dynamics of ventricular contraction. Am J Physiol Heart Circ Physiol. 2002 Jan;282(1):H372-9. PubMed PMID: 11748084. Epub 2001/12/19. eng. 24. Vernooy K, Verbeek XA, Peschar M, Crijns HJ, Arts T, Cornelussen RN, et al. Left bundle branch block induces ventricular remodelling and functional septal hypoperfusion. Eur Heart J. 2005 Jan;26(1):91-8. PubMed PMID: 15615805. 25. Prinzen FW, Cheriex EC, Delhaas T, van Oosterhout MF, Arts T, Wellens HJ, et al. Asymmetric thickness of the left ventricular wall resulting from asynchronous electric activation: a study in dogs with ventricular pacing and in patients with left bundle branch block. Am Heart J. 1995 Nov;130(5):1045-53. PubMed PMID: 7484735. 26. Masci PG, Marinelli M, Piacenti M, Lorenzoni V, Positano V, Lombardi M, et al. Myocardial structural, perfusion, and metabolic correlates of left bundle branch block mechanical derangement in patients with dilated cardiomyopathy: a tagged cardiac magnetic resonance and positron emission tomography study. Circulation Cardiovascular imaging. 2010 Jul 1;3(4):482-90. PubMed PMID: 20463209. Epub 2010/05/14. eng. 27. Strik M, Ploux S, Vernooy K, Prinzen FW. Cardiac resynchronization therapy: refocus on the electrical substrate. Circ J. 2011 May 25;75(6):1297-304. PubMed PMID: 21532178. Epub 2011/05/03. eng. 28. Linde C, Abraham WT, Gold MR, St John Sutton M, Ghio S, Daubert C. Randomized trial of cardiac resynchronization in mildly symptomatic heart failure patients and in asymptomatic patients with left ventricular dysfunction and previous heart failure symptoms. J Am Coll Cardiol. 2008 Dec 2;52(23):1834-43. PubMed PMID: 19038680. Epub 2008/11/29. eng. 29. Tang AS, Wells GA, Talajic M, Arnold MO, Sheldon R, Connolly S, et al. Cardiac-Resynchronization Therapy for Mild-to-Moderate Heart Failure. N Engl J Med. 2010 Nov 14. PubMed PMID: 21073365. Epub 2010/11/16. Eng. 30. Solomon SD, Foster E, Bourgoun M, Shah A, Viloria E, Brown MW, et al. Effect of cardiac resynchronization therapy on reverse remodeling and relation to outcome: multicenter automatic defibrillator implantation trial: cardiac resynchronization therapy. Circulation. 2010 Sep 7;122(10):985-92. PubMed PMID: 20733097. Epub 2010/08/25. eng. 31. van Geldorp IE, Vernooy K, Delhaas T, Prins MH, Crijns HJ, Prinzen FW, et al. Beneficial effects of biventricular pacing in chronically right ventricular paced patients with mild cardiomyopathy. Europace. 2010 Feb;12(2):223-9. PubMed PMID: 19966323. Epub 2009/12/08. eng. 32. Rademakers LM, van Kerckhoven R, van Deursen CJ, Strik M, van Hunnik A, Kuiper M, et al. Myocardial infarction does not preclude electrical and hemodynamic benefits of cardiac resynchronization therapy in dyssynchronous canine hearts. Circ Arrhythm Electrophysiol. 2010 Aug 1;3(4):361-8. PubMed PMID: 20495014. Epub 2010/05/25. eng. 33. van Deursen C, van Geldorp IE, Rademakers LM, van Hunnik A, Kuiper M, Klersy C, et al. Left ventricular endocardial pacing improves resynchronization therapy in canine left bundle-branch hearts. Circ Arrhythm Electrophysiol. 2009 Oct;2(5):580-7. PubMed PMID: 19843927. Epub 2009/10/22. eng. 54

CHAPTER 3 animal models 34. Derval N, Steendijk P, Gula LJ, Deplagne A, Laborderie J, Sacher F, et al. Optimizing hemodynamics in heart failure patients by systematic screening of left ventricular pacing sites: the lateral left ventricular wall and the coronary sinus are rarely the best sites. J Am Coll Cardiol. 2010 Feb 9;55(6):566-75. PubMed PMID: 19931364. Epub 2009/11/26. eng. 35. Spragg DD, Dong J, Fetics BJ, Helm R, Marine JE, Cheng A, et al. Optimal Left Ventricular Endocardial Pacing Sites for Cardiac Resynchronization Therapy in Patients With Ischemic Cardiomyopathy. J Am Coll Cardiol. 2010 August 31, 2010;56(10):774-81. 36. Ginks MR, Lambiase PD, Duckett SG, Bostock J, Chinchapatnam P, Rhode K, et al. A Simultaneous X-MRI and Non Contact Mapping Study of the Acute Hemodynamic Effect of Left Ventricular Endocardial and Epicardial Cardiac Resynchronization Therapy in Humans. Circ Heart Fail. 2011 Mar 1;4(2):170-9. PubMed PMID: 21216832. Epub 2011/01/11. Eng. 37. Strik M, Rademakers LM, van Deursen CJ, van Hunnik A, Kuiper M, Klersy C, et al. Endocardial Left Ventricular Pacing Improves Cardiac Resynchronization Therapy in Chronic Asynchronous Infarction and Heart Failure Models. Circulation Arrhythmia and electrophysiology. 2011 Nov 7. PubMed PMID: 22062796. Epub 2011/11/09. Eng. 38. Helm RH, Byrne M, Helm PA, Daya SK, Osman NF, Tunin R, et al. Three-dimensional mapping of optimal left ventricular pacing site for cardiac resynchronization. Circulation. 2007 Feb 27;115(8):953-61. PubMed PMID: 17296857. Epub 2007/02/14. eng. 39. Prabhu SD, Freeman GL. Effect of tachycardia heart failure on the restitution of left ventricular function in closedchest dogs. Circulation. 1995 Jan 1;91(1):176-85. PubMed PMID: 7805200. Epub 1995/01/01. eng. 40. Bogaard MD, Houthuizen P, Bracke FA, Doevendans PA, Prinzen FW, Meine M, et al. Baseline left ventricular dP/ dtmax rather than the acute improvement in dP/dtmax predicts clinical outcome in patients with cardiac resynchronization therapy. Eur J Heart Fail. 2011 Oct;13(10):1126-32. PubMed PMID: 21791536. Epub 2011/07/28. eng. 41. Mills RW, Cornelussen RN, Mulligan LJ, Strik M, Rademakers LM, Skadsberg ND, et al. Left ventricular septal and left ventricular apical pacing chronically maintain cardiac contractile coordination, pump function and efficiency. Circ Arrhythm Electrophysiol. 2009 Oct;2(5):571-9. PubMed PMID: 19843926. Epub 2009/10/22. eng. 42. van Oosterhout MF, Prinzen FW, Arts T, Schreuder JJ, Vanagt WY, Cleutjens JP, et al. Asynchronous electrical activation induces asymmetrical hypertrophy of the left ventricular wall. Circulation. 1998 Aug 11;98(6):588-95. PubMed PMID: 9714117. 43. van Oosterhout MF, Arts T, Muijtjens AM, Reneman RS, Prinzen FW. Remodeling by ventricular pacing in hypertrophying dog hearts. Cardiovascular research. 2001 Mar;49(4):771-8. PubMed PMID: 11230976. Epub 2001/03/07. eng. 44. Hori Y, Tsubaki M, Katou A, Ono Y, Yonezawa T, Li X, et al. Evaluation of NT-pro BNP and CT-ANP as markers of concentric hypertrophy in dogs with a model of compensated aortic stenosis. J Vet Intern Med. 2008 SepOct;22(5):1118-23. PubMed PMID: 18681918. Epub 2008/08/07. eng. 45. Mathieu M, El Oumeiri B, Touihri K, Hadad I, Mahmoudabady M, Thoma P, et al. Ventricular-arterial uncoupling in heart failure with preserved ejection fraction after myocardial infarction in dogs - invasive versus echocardiographic evaluation. BMC Cardiovasc Disord. 2010;10:32. PubMed PMID: 20587034. Pubmed Central PMCID: 2902405. Epub 2010/07/01. eng. 46. Barth AS, Aiba T, Halperin V, DiSilvestre D, Chakir K, Colantuoni C, et al. Cardiac resynchronization therapy corrects dyssynchrony-induced regional gene expression changes on a genomic level. Circulation Cardiovascular genetics. 2009 Aug;2(4):371-8. PubMed PMID: 20031609. Pubmed Central PMCID: 2801868. Epub 2009/12/25. eng.

Abstract chapter 4

To be able to study the complete spectrum of the consequences of chronic dyssynchronous heart failure at a physiological heart rate, we developed a new experimental model. The model is a combination of chronic dyssynchrony and volume overload. Volume overload was induced by creating moderate to severe mitral regurgitation (MR), as has been used to investigate atrial fibrillation.

Conclusion The newly developed model of MR+LBBB, provides the unique possibility to study the effect of severe chronic volume overload in the dyssynchronous dog heart at physiological heart rates. The data also show that MR and LBBB have additive effects on cardiac overload. The preliminary results of CRT in these animals are promising. More detailed measurements are needed to distinguish between effects of CRT on dyssynchrony and on mitral regurgitation in this model.

CHAPTER 1 general introduction

Chapter 4 Newly developed chronic dyssynchronous heart failure model

Lars B. van Middendorp, Marc Strik, Patrick Houthuizen, Marion Kuiper, and Frits W. Prinzen 57

Introduction Studies on heart failure are often performed using animal models of pacing induced tachycardia.1, 2 While rapid atrial pacing creates a physiological activation pattern, rapid right ventricular (RV) pacing is more commonly used and leads to dyssynchrony.3-5 The latter has become especially popular, as the interest in dyssynchrony grew larger and larger in the last two decades. Within a month, rapid ventricular pacing leads to dilatation of the left ventricle (LV) and decreases LV systolic function to levels similar to those found in heart failure patients.6 This model is favored since several major characteristics of heart failure (dilatation, increased filling pressures) develop relatively quickly, without major complications or side effects. However, rapid pacing models fail to manifest the complete spectrum of heart failure. Especially structural remodeling is less pronounced than observed during myocardial ischemia or volume overload. Furthermore, evaluating chronic effects is only possible when tachycardia is maintained because the heart recovers when rapid pacing is ceased. Resynchronizing the heart with cardiac resynchronization therapy (CRT) is therefore only possible using non-physiologically high heart rates. This has been performed by several investigators and provided interesting results.7, 8 However, if anything, this would only approach the clinical practice in CRT patients with undertreated atrial fibrillation and high ventricular rates. To be able to study the complete spectrum of the consequences of chronic dyssynchronous heart failure at a physiological heart rate, we developed a new experimental model. The model is a combination of chronic dyssynchrony and volume overload. Volume overload was induced by creating moderate to severe mitral regurgitation (MR), as has been used to investigate atrial fibrillation.9

CHAPTER 4 mitral regurgitation model

All experiments were performed under general anesthesia. Animals were intravenously induced with thiopental (300mg), while anesthesia was maintained by continuous infusion of midazolam (0.25mg/kg/h) and sufentanil (3Îźg/kg/h). During each surgical procedure and at the final day of the experimental protocol electro-hemodynamic measurements were performed.10 RV and LV pressure were measured by a 7-Fr catheter tip manometer (CD-Leycom, Zoetermeer, the Netherlands). Mechanical interventricular dyssynchrony (MIVD) was assessed from the time difference of the upslope of LV and RV pressures.11 Dogs underwent echocardiographic exams at week -4 (prior to MR), week 0 (prior to LBBB), week 8 and week 16. Total stroke volume (SV) was determined echocardiographically, as the difference of end diastolic 59

and end systolic volume (total SV = EDV â&#x20AC;&#x201C; ESV). A Swan-Ganz catheter was placed in the pulmonary artery for thermodilution based cardiac output measurements and calculate forward stroke output 12 volume through the pulmonary valve (forward SV = cardiac ). heart rate The regurgitant volume through the mitral valve was then calculatSV ed as fraction of total SV (regurgitant fraction = forward total SV ), assuming that SV trough the pulmonary valve is in equilibrium with the SV trough the aortic valve. Mitral regurgitation was induced using a customized electrophysiology catheter with a hook at the distal tip. The catheter was inserted into the carotid artery and introduced into the left ventricle via the aortic valve. After grasping one or more chorda(e), the hook was withdrawn into a sheet and cauterized to partially obliterate the mitral suspension. This process was repeated until echocardiographic and fluoroscopic evaluation indicated moderate-severe mitral regurgitation. On average two to three repeats were necessary. Figure 2 shows typical examples of mitral regurgitation on echocardiography, fluoroscopy and cardiac MRI. Figure 2 Imaging of mitral regurgitation with typical examples of echocardiography, fluoroscopy and cardiac MRI in canine hearts from the control and mitral regurgitation group. The cardiac MRI was performed 4 months after creating mitral regurgitation. Arrows point to the regurgitative blood.

LBBB was induced by radiofrequency ablation of the left bundle branch. In the LBBB+CRT and MR+LBBB+CRT dogs, a CRT device (Consulta CRT-P, Medtronic, Minneapolis, MN, USA) was implanted during the LBBB procedure. All leads were placed endovascularly under fluoroscopic guidance. The LV lead was preferably placed in a (postero-)lateral vein. The RV lead was positioned in the RV apex and an atrial lead was placed in the right atrial auricle. The CRT device was initially set to sensing only (ODO). Two months after LBBB induction, the biventricular pacemaker was programmed to DDD, using a relatively short AV-delay to ensure complete capture by LV and RV pacing.

CHAPTER 4 mitral regurgitation model

Results Despite echocardiography and fluoroscopy guided ablation of the chordae tendinae, MR grade ranged from mild to severe within the 26 animals where this intervention was applied. 12 animals, including the animals that died intra-operative, did not complete the five-month protocol because of sudden cardiac death or they were euthanized because of unacceptable and untreatable heart failure. Interestingly, most drop-outs occurred within the first 2 weeks after MR induction (n=3) or within 1-2 weeks after LBBB induction (n=3), (figure 3). The latter supports the idea that the overload of MR and LBBB are additive for the heart. There were no drop-outs in the LBBB or LBBB+CRT group. Figure 3 Protocol of the MR and MR+LBBB and MR+LBBB+CRT groups. * animal died either due to untreatable heart failure or sudden cardiac death. Most drop-outs occurred directly after MR creation, probably due to massive MR, or within the first week following LBBB induction indicating that the additional overload by dyssynchrony is too much for hearts with an already comprised function.

MR modestly increased LV end-diastolic pressure (EDP) accompanied by a decrease in maximal LV pressure (table 1). LV dP/dtmax , as marker of contractility, decreased by ~20%. Both RV end systolic pressure (ESP) and RV EDP hardly changed. Furthermore, no changes in QRS width or MIVD were noted, indicating stable synchronous activation. In the MR+LBBB group, QRS width doubled together with a more negative MIVD, indicating dyssynchronous activation. The addition of LBBB after MR, led to a further increase in LV EDP, concomitant with a rise in RV EDP and RV ESP. Furthermore, LV dP/dtmax decreased more than in the MR group, and was ultimately decreased to ~60% of baseline (table 1). QRS duration in MR+LBBB animals was longer than in LBBB animals (table 1 and 2). Echocardiography derived left ventricular internal dimension in diastole (LVIDd), significantly increased after MR induction. The addition of LBBB further increased LVIDd, ultimately leading to an increase of ~70% above baseline (figure 4). Ejection fraction (EF%) was on average 50% in the LBBB group and was with 52% very similar in the MR+LBBB group.

62 1862 [1504-2023] -2118 [-1882- -2630] 102 [97-112] 7 [4-9] 18 [17-19] 6 [5-8] -7 [-5- -9]

LV dP/dtmax (mmHg/s)

LV dP/dtmin (mmHg/s)

LV end systolic pressure (mmHg)

LV end diastolic pressure (mmHg)

RV end systolic pressure (mmHg)

RV end diastolic pressure (mmHg)

Mechanical interventricular dyssynchrony (ms)

54 [51-59] 362 [345-380]

QRS width (ms)

QT width (ms) 342 [238-368]

53 [44-78]

138 [83-157]

349 [338-366]

352 [346-381]

335 [302-346]

-2 [-7-3]

-46 [-37- -50]

-7 [-3- -9]

-3 [-4- -10]

53 [48-67]

4 [3-8]

5 [4-5]

4 [2-4]

5 [4-5]

100 [97-106]

24 [18-29]

25 [24-27]

23 [20-24]

20 [12-26]

51 [48-59]

7 [5-110]]

6 [5-11]

6 [3-7]

8 [6-10]

121 [116-130]$

102 [87-113]

89 [87-108]

102 [95-112]

82 [76-100]

167 [137-191]

-2192 [-1968- -2321]

-1569 [-1373- -1715]

-1989 [-1673- -2162]

-1254 [-941- -1737]

133 [125-155]

2192 [1813-2233]$

1097 [1009-1282]

1713 [1502-1863]

1453 [11088-1706]

97 [75-102]

373 [333-381]

56 [48-69]

140 [122-156]

0 [-6-3]

5 [4-7]

26 [19-35]*

12 [8-17]â&#x20AC;

104 [83-111]

-2085 [-958- -2245]

1773 [1561-2138]

100 [86-111]

409 [382-436]

116 [103-122]

136 [101-145]

-36 [-28- -46]

8 [8-11]

34 [28-41]

11 [6-20]]

101 [80-115]

-1543 [-832- -1767]

1330 [826-1487]

100 [99-100]

Week 16 (n=8)

MR+LBBB

Week -4 (n=12) Week 0 (n=11)

100 [96-110]

Week 16 (n=8)

LBBB

84 [70-102]

100 [96-122]

Table 1; short overview of the electro-hemodynamic effects of MR, LBBB and MR+LBBB

140 [110-177]

PQ time (ms)

ECG

98 [86-102]

Week 0 (n=8)

MR Week 16 (n=5)

Week 0

Heart rate (bpm)

Hemodynamics

Table 1

CHAPTER 4 mitral regurgitation model

In addition, left atrial dilation and pericardial fluid are seen on the cardiac MRI (figure 1). Furthermore, these dogs suffered from the same clinical signs and symptoms as seen in patients with heart failure. Figure 4 Echocardiographic left ventricular internal dimension-diastole (LVIDd, diamonds) relative to baseline values in the MR+LBBB group. Presented are median values and 75th percentile. ยง p<0.05 vs week -4; * p<0.05 vs week 0.

Table 2 summarizes the hemodynamic effects of CRT in the MR+LBBB+CRT group and compares this with those in the LBBB group. In the latter group the well-known hemodynamic improvements, increase in LV dP/dtmax, less negative MIVD and reduced QRS width) were observed.13, 14 This preliminary data in MR+LBBB+CRT hearts indicates that CRT has similar electrohemodynamic effects in this group as in the LBBB group. The increase in LV dP/dtmax even appears higher in the MR+LBBB than in the LBBB group.

64 1249 [1038-1591] -1649[-1558- -1744] 91 [87-95] 6 [5-8] 27 [25-30] 5 [4-6] -42 [-30- -43]

LV dP/dtmax (mmHg/s)

LV dP/dtmin (mmHg/s)

LV end systolic pressure (mmHg)

LV end diastolic pressure (mmHg)

RV end systolic pressure (mmHg)

RV end diastolic pressure (mmHg)

Mechanical interventricular dyssynchrony (ms)

150 [133-180] 102 [98-110] 382 [370-385]

PQ time (ms)

QRS width (ms)

QT width (ms)

ECG

100 [100-100]

-25 [-24- -27]

-41 [-35- -42]

367 [351-377]

89 [85-94]

67 [62-71]

-26 [-19- -33]

367 [367-402]

6 [3-7]

4 [3-9]

4 [4-6]

421 [370-454]

25 [24-28]

27 [27-30]

26 [24-29]

100 [99-105]

5 [2-13]

7 [3-19]

5 [3-7]

127 [106-127]

76 [65-87]

71[65-78]

90 [87-95]

69 [46-70]

-1554[-1393- -1896]

-1446 [-1145- -1717]

-1820[-1599- -1987]

166 [71-170]

1510 [1028-1527]

1147 [1058-1383]

1411 [1107-1735]

100 [100-100]

CRT- on

MR+LBBB+CRT (n=4) CRT- off

100 [60-101]

100 [100-100]

CRT- on

LBBB+CRT (n=10) CRT- off

Heart rate (bpm)

Hemodynamics

Table 2

Electro-hemodynamic effects of chronic cardiac resynchronization therapy (CRT) in canines with LBBB+CRT and MR+LBBB. In both groups, the CRT device was turned on two months after LBBB induction and was temporarily switched of (CRT-off) during the electro-hemodynamic measurements at week 16. CRT does reduce electro-mechanical dyssynchrony as evidenced by a reduction in QRS width and increase in mechanical interventricular delay. It thereby restores contractility and relaxation (LV dP/dtmax and LV dP/dtmin, respectively).

Table 2

CHAPTER 4 mitral regurgitation model

Discussion The model of MR+LBBB provides the unique possibility to study the effect of volume overload in large animals at a physiological heart rate. In addition, the fact that mitral regurgitation is also frequently occurring in heart failure patients is another argument that the MR+LBBB model has a higher translational value than the tachypacing model. In the MR model the increase in LV cavity size is also larger than that in the tachypacing model (~70% vs ~30%, respectively) much better approaching clinical values.2, 15, 16 The data also indicate that MR and LBBB are additive as far as volume overload is concerned (LV diameter, LV EDP). A drawback of the model is that titration of the severity of MR turned out to be technically challenging. Regardless of the difficulties in analyzing and interpreting the data that this variability in MR grade generates, the wide range of heart failure burden does provide the opportunity to directly relate cardiac function to the remodeling processes that are taking place (chapter 6). Value of ejection fraction An interesting problem in this MR animal model is a suitable quantification of the severity of heart failure. End-diastolic RV and LV pressures are elevated in MR+LBBB, yet echocardiographically assessed ejection fraction (EF%) remained misleadingly stable. This may appear trivial, because echocardiography (and also magnetic resonance imaging (MRI)) does not distinguish between antegrade flow into the aorta and retrograde flow into the left atrium. However, this confounding effect of MR on the value of EF% is hardly taken into account. One way to better assess LV function in such MR models is LV pressure-volume analysis. Often end systolic and end diastolic volumes are enlarged volume at similar end-systolic pressure, which indicate worsened LV function (figure 5). Figure 5 Left ventricular (LV) end diastolic volume (EDV) and end systolic volume (ESV) plotted against LV ESP as individual datapoint for control, LBBB and MR+LBBB animals. MR+LBBB animals often show end systolic and end diastolic volumes at similar end-systolic pressures.

A clinical study supports this idea by showing that in patients with MR and normal EF%, LV function is often depressed, as evidenced by a lower end systolic pressure at the same end systolic volume.17 Reliable assessment of forward stroke volume may aid in the early detection of a reduction in LV function. Echocardiographically, MR severity is graded semi quantitatively, based on the effective regurgitant orifice area (EROA), but this does not provide quantitative information.18 Antegrade flow may be determined by comparing (invasive) thermodilution measurements of stroke volume via a Swan-Ganz catheter with echocardiography- or MRIderived (total) stroke volume. This provides an estimate of regurgitant fraction, as we reported in chapter 6. A reliable measurement of the regurgitant fraction is technically challenging, and operator experience is important to ensure reproducibility.19, 20 In our hands the measurement error of regurgitant fraction was maximally 20%, based on the outcomes in the LBBB group who echocardiographically are free from MR. Nonetheless, with the 20% measurement error in mind, the regurgitant fraction in the MR+LBBB dogs remained severe. In the clinical situation this method is only feasible in patients already having a Swan-Ganz catheter.19, 20 A completely non-invasive alternative approach is measuring total flow across the aortic valve and mitral valve by assessing the velocity time integral (VTI) and areas of both valves.18, 21 However, this method is not commonly used in daily clinical practice. With the limitations of EF% in mind, we recommend that estimation of the regurgitant fraction should be made in order to properly evaluate LV function.

CRT effect in the presence of mitral regurgitation It was interesting to observe that despite the presence of volume overload, CRT resulted in a similar increase in LV dP/dtmax in the MR+LBBB as in the LBBB dogs. This observation connects our experience in the animal model of isolated LBBB (in the absence of heart failure) and the experience in patients with heart failure and LBBB. The QRS duration in MR+LBBB dogs was ~15% longer than in LBBB dogs, presumably due to the longer pathlength caused by the ventricular dilatation. Yet, the electrical (QRS reduction) and mechanical (MIVD reduction) resynchronization in these larger hearts is at least as good as observed in the LBBB group. An additional aspect is the potential interaction between the MR and CRT. Dyssynchrony may cause functional MR, due to imbalance of closing and tethering forces in the valvular apparatus. However, also other components of the heart failure etiology, like ischemia and ventricular dilatation may elicit MR. In patients, mild-to-moderate MR has been associated with good CRT 66

CHAPTER 4 mitral regurgitation model

response while severe MR often coincides with non-response, as measured using clinical parameters such as mortality, hospitalization and 6-minute walk test.22,23 This complicated relation between MR and CRT response may be due to the fact that CRT may correct (part of) the functional MR, while other factors, potentially more prevalent in severe MR, may not be affected by CRT and simply reflect poor baseline condition. In the present animal model the MR was clearly of anatomic origin, which is not likely to be corrected by CRT. However, CRT may improve coordination of contraction around the (remaining) mitral valve apparatus. The present preliminary data only address the acute hemodynamic effect, which appears to support the at least equivalent increase in LV contractility induced by CRT in the MR+LBBB and LBBB groups. Future studies in larger groups should also address longer-term follow-up and mitral valve behavior to better understand as to whether CRT can influence anatomical MR.

References 1. Strik M, van Middendorp LB, Vernooy K. Animal models of dyssynchrony. J Cardiovasc Transl Res. 2012 Apr;5(2):135-45. PubMed PMID: 22130900. Pubmed Central PMCID: 3306020. 2. Strik M, Rademakers LM, van Deursen CJ, van Hunnik A, Kuiper M, Klersy C, et al. Endocardial Left Ventricular Pacing Improves Cardiac Resynchronization Therapy in Chronic Asynchronous Infarction and Heart Failure Models. Circulation Arrhythmia and electrophysiology. 2011 Nov 7. PubMed PMID: 22062796. Epub 2011/11/09. Eng. 3. Strik M, van Deursen CJ, van Middendorp LB, van Hunnik A, Kuiper M, Auricchio A, et al. Transseptal conduction as an important determinant for cardiac resynchronization therapy, as revealed by extensive electrical mapping in the dyssynchronous canine heart. Circ Arrhythm Electrophysiol. 2013 Aug;6(4):682-9. PubMed PMID: 23873141. 4. Spragg DD, Leclercq C, Loghmani M, Faris OP, Tunin RS, DiSilvestre D, et al. Regional alterations in protein expression in the dyssynchronous failing heart. Circulation. 2003 Aug 26;108(8):929-32. PubMed PMID: 12925451. 5. Akar FG, Wu RC, Juang GJ, Tian Y, Burysek M, Disilvestre D, et al. Molecular mechanisms underlying K+ current downregulation in canine tachycardia-induced heart failure. Am J Physiol Heart Circ Physiol. 2005 Jun;288(6):H2887-96. PubMed PMID: 15681701. 6. Dixon JA, Spinale FG. Large animal models of heart failure: a critical link in the translation of basic science to clinical practice. Circ Heart Fail. 2009 May;2(3):262-71. PubMed PMID: 19808348. Pubmed Central PMCID: 2762217. 7. Chakir K, Daya SK, Tunin RS, Helm RH, Byrne MJ, Dimaano VL, et al. Reversal of global apoptosis and regional stress kinase activation by cardiac resynchronization. Circulation. 2008 Mar 18;117(11):1369-77. PubMed PMID: 18316490. 8. Barth AS, Aiba T, Halperin V, DiSilvestre D, Chakir K, Colantuoni C, et al. Cardiac resynchronization therapy corrects dyssynchrony-induced regional gene expression changes on a genomic level. Circ Cardiovasc Genet. 2009 Aug;2(4):371-8. PubMed PMID: 20031609. Pubmed Central PMCID: 2801868. 9. Verheule S, Wilson E, Everett Tt, Shanbhag S, Golden C, Olgin J. Alterations in atrial electrophysiology and tissue structure in a canine model of chronic atrial dilatation due to mitral regurgitation. Circulation. 2003 May 27;107(20):2615-22. PubMed PMID: 12732604. Pubmed Central PMCID: 1995672. Epub 2003/05/07. eng. 10. Verbeek XA, Vernooy K, Peschar M, Van Der Nagel T, Van Hunnik A, Prinzen FW. Quantification of interventricular asynchrony during LBBB and ventricular pacing. Am J Physiol Heart Circ Physiol. 2002 Oct;283(4):H1370-8. PubMed PMID: 12234787. 11. Verbeek XA, Vernooy K, Peschar M, Cornelussen RN, Prinzen FW. Intra-ventricular resynchronization for optimal left ventricular function during pacing in experimental left bundle branch block. Journal of the American College of Cardiology. 2003 Aug 6;42(3):558-67. PubMed PMID: 12906989. Epub 2003/08/09. eng. 12. Fegler G. Measurement of cardiac output in anaesthetized animals by a thermodilution method. Q J Exp Physiol Cogn Med Sci. 1954;39(3):153-64. PubMed PMID: 13194838. 13. Strik M, van Middendorp LB, Houthuizen P, Ploux S, van Hunnik A, Kuiper M, et al. Interplay of electrical wavefronts as determinant of the response to cardiac resynchronization therapy in dyssynchronous canine hearts. Circ Arrhythm Electrophysiol. 2013 Oct;6(5):924-31. PubMed PMID: 24047705. 14. Vernooy K, Cornelussen RN, Verbeek XA, Vanagt WY, van Hunnik A, Kuiper M, et al. Cardiac resynchronization therapy cures dyssynchronopathy in canine left bundle-branch block hearts. Eur Heart J. 2007 Sep;28(17):2148-55. PubMed PMID: 17611254. 15. Coleman HN, 3rd, Taylor RR, Pool PE, Whipple GH, Covell JW, Ross J, Jr., et al. Congestive heart failure following chronic tachycardia. Am Heart J. 1971 Jun;81(6):790-8. PubMed PMID: 5088355. 16. Tanaka R, Spinale FG, Crawford FA, Zile MR. Effect of chronic supraventricular tachycardia on left ventricular function and structure in newborn pigs. J Am Coll Cardiol. 1992 Dec;20(7):1650-60. PubMed PMID: 1452940. 17. Starling MR, Kirsh MM, Montgomery DG, Gross MD. Impaired left ventricular contractile function in patients with long-term mitral regurgitation and normal ejection fraction. J Am Coll Cardiol. 1993 Jul;22(1):239-50. PubMed PMID: 8509547. 68

CHAPTER 4 mitral regurgitation model 18. Lancellotti P, Troisfontaines P, Toussaint AC, Pierard LA. Prognostic importance of exercise-induced changes in mitral regurgitation in patients with chronic ischemic left ventricular dysfunction. Circulation. 2003 Oct 7;108(14):1713-7. PubMed PMID: 12975251. 19. Thavendiranathan P, Phelan D, Collier P, Thomas JD, Flamm SD, Marwick TH. Quantitative assessment of mitral regurgitation: how best to do it. JACC Cardiovasc Imaging. 2012 Nov;5(11):1161-75. PubMed PMID: 23153917. 20. Krayenbuehl HP, Ritter M, Hess OM, Hirzel H. The use of invasive techniques, angiography and indicator dilution, for quantification of valvular regurgitations. Eur Heart J. 1987 Aug;8 Suppl C:1-9. PubMed PMID: 3315666. 21. Buck T, Plicht B, Kahlert P, Schenk IM, Hunold P, Erbel R. Effect of dynamic flow rate and orifice area on mitral regurgitant stroke volume quantification using the proximal isovelocity surface area method. J Am Coll Cardiol. 2008 Aug 26;52(9):767-78. PubMed PMID: 18718427. 22. Diaz-Infante E, Mont L, Leal J, Garcia-Bolao I, Fernandez-Lozano I, Hernandez-Madrid A, et al. Predictors of lack of response to resynchronization therapy. Am J Cardiol. 2005 Jun 15;95(12):1436-40. PubMed PMID: 15950566. 23. Di Biase L, Auricchio A, Mohanty P, Bai R, Kautzner J, Pieragnoli P, et al. Impact of cardiac resynchronization therapy on the severity of mitral regurgitation. Europace. 2011 Jun;13(6):829-38. PubMed PMID: 21486916.

Abstract chapter 5 Left bundle branch block (LBBB) creates considerable regional differences in mechanical load and hypertrophy within the left ventricle (LV). We investigated expression of connective tissue growth factor (CTGF) and of microRNA-133a, -29c and -30c in relation to regional hypertrophy and collagen deposition in LBBB hearts and to the reversibility of these processes upon cardiac resynchronization therapy (CRT). Methods Eighteen dogs were followed for four months after induction of LBBB, ten of which received CRT after two months. Five additional dogs served as control. LV geometric changes were determined by echocardiography and myocardial strain by MRI tagging. Expression levels of CTGF, Collagen1A1, microRNAs as well as collagen deposition were measured in the septum and LV free wall (LVfw). Results In LBBB hearts, LVfw and septal systolic circumferential strain were 200% and 50% of control, respectively. This coincided with local hypertrophy, but not collagen deposition in the LVfw. CTGF expression was selectively increased in the LVfw (279% of control), which corresponded with a 26% reduction in local microRNA-133a expression. By contrast, microRNA-29c and -30c were up-regulated and Collagen1A1 mRNA was down-regulated uniformly in LBBB hearts. CRT normalized strain patterns and reversed CTGF and microRNA-133a expression to normal, while microRNA-29c, -30c and Collagen1A1 expression remained elevated.

Conclusion In the clinically relevant large animal model of LBBB a close relation exists between local strain, hypertrophy, microRNA-133a under-expression and CTGF over-expression. In contrast, systemic factors that are not reversible upon CRT appear to influence microRNA-29c, microRNA-30c and collagen expression.

CHAPTER 1 general introduction

Chapter 5 Local regulation of microRNA-133a and connective tissue growth factor in the asymmetrically hypertrophied dyssynchronous heart

Lars B. van Middendorp; Marion Kuiper; Chantal Munts; Philippe Wouters; Jos. G. Maessen; Frans A. van Nieuwenhoven; Frits W. Prinzen 71

Introduction Both mechanical and humoral triggers have been proposed to cause the hypertrophic and fibrotic response in cardiac muscle exposed to excessive load. However, in vivo, it is difficult to separate the contribution of (local) mechanical load and (systemic) neurohumoral activation, because global cardiac overload, as in hypertension and valvular disease, also leads to neurohumoral stimulation/activation. On the other hand, it has been shown that stretching isolated cardiomyocytes can affect gene expression, increase protein synthesis and induce hypertrophy.1 Similarly, stretching isolated fibroblasts increases expression of extracellular matrix (ECM) genes and proteins.2 In the process of cardiac hypertrophy and fibrosis several growth factors play an important role, one of them being connective tissue growth factor (CTGF).3, 4 CTGF is part of a large complex regulatory network, and its expression level is regulated by microRNAs (miRs).5-7 MiRs are small non-coding single-stranded RNA molecules of approximately 22 nucleotides long and are increasingly acknowledged as important regulators of gene-expression in various (patho)physiological processes.8, 9 Inverse relations between CTGF on the one hand and miR-133a and miR-30c on the other have been observed. This led to the conclusion that these miRs are negative regulators of cardiac fibrosis during concentric hypertrophy.5, 10-12 Another negative regulator of cardiac fibrosis, possibly independent from CTGF, is miR-29c.13, 14 However, it is unclear to what extent the expression of CTGF and the aforementioned miRs are regulated by local load or by systemic factors. Dyssynchronous electrical activation of the heart, such as during left bundle branch block (LBBB), creates discoordinate contraction of the left ventricle (LV). This discoordination leads to elevated mechanical load in the LV free wall (LVfw) and reduced load in the septum.15, 16 Animal studies have shown complex changes in myocardial tissue of dyssynchronous hearts, including extensive regional differences in tissue growth (hypertrophy) and in expression of hundreds of genes.15-17 Therefore, LBBB provides an interesting in vivo condition that allows to investigate the sequelae of different loading conditions within the same heart and to distill the effect of local load from that of the neurohumoral component that is presumably equal throughout the heart. Moreover, these abnormalities can be largely corrected by cardiac resynchronization therapy (CRT).18 It was the aim of the present study to investigate whether in hearts with LBBB the local changes in mechanical load and hypertrophy translate into regional differences in expression of CTGF, 72

CHAPTER 5 Local expression of miR-133a/CTGF

miR-133a, -29c and -30c as well as collagen deposition. Furthermore, the reversibility of dyssynchrony-induced structural and molecular changes were analyzed after normalization of local mechanical load by CRT.

Methods Animal handling was performed according to the Dutch Law on Animal Experimentation and the European Directive for the Protection of Vertebrate Animals used for Experimental and Other Scientific Purposes (86/609/EU). The protocol was approved by the Experimental Animal Committee of Maastricht University. Experimental Models Experiments were performed on 23 adult mongrel dogs of either sex, weighing approximately 20kg. Five dogs served as control. The other 18 dogs underwent a sterile closed-chest procedure. They were intravenously induced with thiopental (300mg) and anesthesia was maintained by continuous infusion of midazolam (0.25mg/kg/h) and sufentanil (3Îźg/kg/h). LBBB was induced by radiofrequency ablation as described in detail previously.19 In ten of these dogs a CRT device (Consulta CRT-P, Medtronic, Minneapolis, MN, USA) was implanted during the same procedure. All leads were placed endovascularly under fluoroscopic guidance. The LV lead was preferably placed in a (postero-)lateral vein. The right ventricular (RV) lead was positioned in the RV apex and an atrial lead was placed in the right atrial auricle. The CRT device was initially set to sensing only (ODO). Two months after LBBB induction, the biventricular pacemaker was programmed to DDD, using a relatively short AV-delay to ensure complete capture by LV and RV pacing. Dogs underwent awake echocardiography exams at baseline, after two months, just prior to switching on the CRT device and at sacrifice to assess wall thickness and end diastolic volume (EDV). A few days before sacrifice, cine MRI scans (Intera 1.5Tesla MRI, Philips, Amsterdam, The Netherlands) were made under anesthesia, to measure LV wall volume, end systolic volume (ESV) and EDV. The same anesthetic protocol was used as for induction of LBBB. Myocardial tissue tagging scans were made for calculation of circumferential strain using the Sinmod program.20 At the final day of the experimental protocol, four months after LBBB induction, extensive electro-hemodynamic measurements were performed as described in detail previously.21 Subsequently, the heart was rapidly excised and transmural tissue sections at the mid-level from the LVfw and septum were collected and snap-frozen in liquid nitrogen for further analysis. Part of the 73

tissue was preserved using formalin for histology. The five dogs that served as control were only subjected to a MRI scan and electro-hemodynamic measurements, before collecting the tissue. RNA analysis Total RNA was isolated from tissue using Qiagen miR mini easykit (Qiagen, Venlo, the Netherlands). Quantity and purity of RNA were assed using the ratio of absorbance at 260/280nm, by means of a nanodrop 2000c spectrophometer (Wilmington, DE, USA). RNA was reverse transcribed to cDNA using miScript Reverse transcription kit (Qiagen, Venlo, the Netherlands). MiR expression was analyzed using real-time quantitative polymerase chain reaction (qPCR) on an iCycler Real-Time PCR detection system using the iQ SYBR-green supermix (Bio-Rad, Veenendaal, the Netherlands). In order to put the change of miR-133a, miR-29c and miR-30c in perspective, the bioavailability and the magnitude of change in expression of two additional miRs related to hypertrophy were tested (miR-199b and miR-155f). Expression levels of CTGF, collagen type 1 (Col1A1) and brain natriuretic peptide (BNP) were analyzed using the same method. They were normalized using the housekeeping gene Cyclophilin-A as described previously.1 Relative expression was calculated using the comparative threshold cycle (Ct) method by calculating 2Î&#x201D;Ct (e.g. 2Cyclophilin Ct â&#x20AC;&#x201C; CTGF Ct 22 ). Since there is no housekeeping gene for miRs, values are expressed by using the Ct value multiplied by an arbitrary number for ease of use (e.g. 2-miR-133a Ct * 107). The sequences of the specific primers used, can be found in the supplemental materials (Supplemental Table 1). Collagen deposition The acid-soluble collagen content of frozen LV and septal transmural tissue samples was examined using the Sircol Collagen Assay (Biocolor Ltd., Belfast, UK). The degree of fibrosis was histologically determined in tissue sections stained with 0.1% Sirius Red.23, 24 Images were taken with a Leica DM3000 Microscope (Leica Mircosystems, Wetzlar, Germany). Custom made software within Matlab (MathWorks, Natick, MA, USA) was used to calculate percentage of collagen after manually selecting the region of interest and adjusting the threshold. Perivascular collagen was excluded from the analysis. For each dog, on average 8 tissue sections per cardiac wall segment were analyzed. Cardiomyocyte diameter at the level of the nucleus was determined using ImageJ (Research Services Branch, National Institute of Mental Health, MA, USA) in tissue sections after a modified azan staining. For each heart, on average 30 cardiomyocytes per cardiac wall segment were analyzed. 74

CHAPTER 5 Local expression of miR-133a/CTGF

Statistical analysis Data are presented as median [25th-75th percentile]. Statistical analysis was performed using Statistical Package for Social Sciences for Windows version 20.0 (IBM corp., Armonk, NY, USA). Differences between groups, temporal differences within a group and, when applicable, intracardiac differences were tested with a mix-effect analysis. This method is also known as multilevel analysis or linear mixed effect model and was used for gene expression levels, electro-hemodynamic parameters and imaging data. The least squared differences correction was used for post hoc comparison. A Pearson correlation linear regression analysis between expression levels of different mRNAs and miRs was performed. An observed probability-value < 0.05 was considered statistically significant.

Results Electro-hemodynamic characteristics Electro-hemodynamic measurements showed that LBBB caused a ~35% decrease in LV dP/dtmax together with an almost doubling of the QRS width (table 1). Mechanical interventricular dyssynchrony (MIVD), the time difference of the upslope of normalized LV and RV pressure,25 became more negative upon LBBB, indicating earlier contraction of the RV than of the LV. CRT reduced QRS width, increased LV dP/dtmax and MIVD to values in between control and LBBB (table 1). MRI measurements In the control group circumferential strain was equal between the septum and the LVfw. In the LBBB group circumferential strain in the LVfw was twice as high as in the control group, while strain in the septum was reduced by half. CRT restored the strain patterns to near normal levels (figure 1). Figure 1

MRI-derived EDV was slightly but significantly higher in the LBBB than in the control group, while EDV in the LBBB+CRT group was not significantly different from the control group. In the LBBB group, LV wall volume significantly increased by 41.7% with respect to the control group while this increase was less in the LBBB+CRT group (26.8% compared to control; figure 1). 76

MRI derived data. Panel A; End Diastolic Volume (EDV), panel B; Left Ventricular (LV) wall volume. Panels C - E; typical examples of strain patterns in Control (C); left bundle branch block (LBBB) (D) and LBBB + cardiac resynchronization therapy (CRT) (E). Septum (dashed lines) and LV free wall (LVfw; solid lines). Note the discoordinated contraction during LBBB with pre-stretch of the LVfw (1) and septal rebound stretch (2). Time of Aortic valve opening (AvO) and closure (AvC) are depicted by dashed vertical lines. Panel F; circumferential strain in the septum and LVfw as percentage of mean strain of the total LV. In panels A,B and F the line within each box indicates the median value, the upper and lower margins of the box the 25th-75th percentile and the bars the minimum and maximum value. * p < 0.05 vs. equivalent region in control; â&#x20AC; p < 0.05 vs. septum in same heart; â&#x20AC;Ą p < 0.05 vs. same region in LBBB group.

1713 [1502-1863] -1989 [-1673- -2162] 102 [95-112] 6 [3-7] 23 [20-24] 4 [2-4] -7 [-3- -9]

LV dP/dtmax (mmHg/s)

LV dP/dtmin (mmHg/s)

LV end systolic pressure (mmHg)

LV end diastolic pressure (mmHg)

RV end systolic pressure (mmHg)

RV end diastolic pressure (mmHg)

Mechanical interventricular dyssynchrony (ms)

335 [302-346]

51 [48-59]

QRS width (ms)

QT width (ms)

133 [125-155]

PQ time (ms)

ECG

84 [70-102]

352 [346-381]*

100 [97-106]*

167 [137-191]

-46 [-37- -50]*

5 [4-5]

25 [24-27]

6 [5-11]

89 [87-108]

-1569 [-1373- -1715]*

1097 [1009-1282]*

100 [96-110]*

Chronic

4 months LBBB Baseline

Heart rate (bpm)

Hemodynamics

Table 1

4 [4-6] -26 [-19- -33]*†$

5 [4-6] -42 [-30- -43]*

5 [2-12] -6 [-4- -11]

318 [309-330]

382 [370-385] *

367 [351-377]*

89 [85-94]*†$

26 [24-29] 27 [25-30] 28 [24-36]

102 [98-110] *

5 [3-7] 6 [5-8]

8 [4-11]

48 [47-51]

90 [87-95]* 91 [87-95]*

103 [99-110]

67 [62-71]*†$

-1820 [-1599- -1987]†$ -1649 [-1558- -1744]*

-1982 [-1912- -2277]

150 [133-180]

1411 [1107-1735]*† 1249 [1038-1591]*

134 [123-159]

100 [100-100] 100 [100-100]

Chronic, CRT-on

1954 [1622-2269]

Chronic, CRT-off

2 months LBBB > 2 months CRT

101 [99-102]$

Baseline

Table 1; Electro-hemodynamic parameters at baseline and after 4 months of remodeling (“chronic”). In case of the LBBB+CRT group the data at baseline and during CRT are shown as well as during CRT temporarily switched off. * P < 0.05 Chronic vs. Baseline; † P < 0.05 CRT-off vs CRT-on, $ P < 0.05 LBBB+CRT vs LBBB group.

CHAPTER 5 Local expression of miR-133a/CTGF

Chronic, CRT-on

Hypertrophy on echocardiography and histology In the LBBB group LVfw wall thickness increased by 17.5% within 4 months, while septal wall thickness did not significantly change. In the LBBB+CRT group, CRT equalized LVfw and septal wall thickness (figure 2). The ratio of wall thickness of the LVfw and septum, an index of asymmetry of hypertrophy, was 1.06 [0.98 - 1.11] at baseline, increased in LBBB hearts to 1.28 [1.15 - 1.36] and returned to 1.07 [0.95 - 1.11] after 2 months of CRT. Echo-derived EDV increased slightly after two months of LBBB in the LBBB and LBBB+CRT groups. In the LBBB group, EDV continued to increase and was, after four months, significantly larger than in the control group. In the LBBB+CRT group, no further increase in EDV was found after turning on the CRT device (figure 2). Figure 2

The increased wall thickness in the echocardiographic measurements in the LVfw of LBBB hearts was corroborated by the histologically measured cardiomyocyte diameter, which was significantly larger in the LVfw than in the septum (figure 3).

Geometric changes due to Left Bundle Branch Block (LBBB) and LBBB + Cardiac resynchronization therapy (CRT), expressed as percentage change from baseline. Left panel; wall thickness of the septum (circles) and Left ventricular free wall (LVfw, squares) in LBBB (black) and LBBB+CRT (white) dogs. Middle panel; LVfw divided by septal wall thickness (diamonds). Right panel, end diastolic volume, triangles. * p <0.05 vs. baseline (month 0); † p < 0.05 vs. month 2; ‡ p < 0.05 vs. LBBB. Presented are median values and 25th (downward bars) and 75th (upward bars) percentile. Figure 3 Left panels; representative examples of the modified azan staining in the septum and left ventricular free wall (LVfw) in the same heart of an LBBB dog (magnification is equal between the slices). Right panel; cardiomyocyte diameter (μm) of the septum and LVfw in the control, Left Bundle Branch Block (LBBB) and LBBB + Cardiac Resynchronization Therapy (CRT) group. * p < 0.05 vs. equivalent region in control; † p < 0.05vs. septum in the same heart.

CHAPTER 5 Local expression of miR-133a/CTGF

Similar as was found for wall thickness using echocardiography, the ratio of cardiomyocyte diameter of the LVfw and septum was 0.95 [0.90-1.03] in the control group, increased significantly to 1.08 [1.03-1.13] in the LBBB+CRT group and was 1.00 [0.881.09] in the LBBB+CRT group. Expression of CTGF and microRNA-133a In the hypertrophied LVfw of the LBBB group median CTGF expression was 279% of control, which was significantly higher than the expression in the septum (119% of control). In LBBB+CRT hearts, CTGF overexpression was more similar in the LVfw and septum (229% and 141% of control, respectively, figure 4). The CTGF LVfw/septum ratio tended to be higher in the LBBB (1.7 [1.2-2.5]) than in the control group (1.2 [0.7-1.4], p = 0.07), and the LBBB+CRT group (1.2 [1.1-2.4]). Figure 4 Left panel; change in microRNA (miR) expression of miR-133a in the septum and left ventricular free wall (LVfw). Right panel; change in connective tissue growth factor (CTGF) expression. * p < 0.05 vs. equivalent region in control; â&#x20AC; p < 0.05 vs. septum in the same heart.

In the LBBB group, expression of miR-133a was significantly reduced by 26% in the LVfw, while septal expression was similar to control. In the LBBB+CRT group, miR-133a values in both the LVfw and septum were close to control (figure 4). MiR-133a was by far the most abundantly expressed miR (table 2). Expression levels of two other miRs that have been associated with cardiac hypertrophy, miR-155f and miR-199b were much lower than that of miR-133a. MiR-155f showed significant up-regulation in the septum of the LBBB group, which was not reversible upon CRT. On the other hand, miR-199b expression levels in LBBB and LBBB+CRT hearts were not significantly different from control. BNP was hardly expressed in any of the groups and was not significantly different between the groups (table 2).

80 38.5 [29.6-47.4] 40.2 [33.5-57.2] 0.68 [0.65-0.75] 4.0 [3.6-4.9]

miR-29c

miR-30c

miR-155f

miR-199

0.09 [0.06-0.13] 1.44 [1.08-1.76]

BNP

Col1A1

LVfw

2.04 [1.71-2.39] †

0.09 [0.02-0.29]

0.71[0.48-1.14]

5.2 [4.7-6.6]

0.69 [0.64-0.93]

43.2 [34.1-46.7]

44.0 [39.1-49.2]

934 [811-979]

Control

LBBB+CRT

1.62 [0.99-2.63]* 0.05 [0.02-0.12] 1.08 [0.84-1.55]†

0.12 [0.06-0.23] 0.65 [0.41-0.80]*

0.08 [0.04-0.15] 0.83 [0.66-1.30]*†

0.05 [0.02-0.09] 0.67 [0.46-1.22]*

4.2 [3.5-5.0]

4.7 [4.3-5.2]

5.0 [4.2-5.8]

4.7 [4.3-5.1]

1.12 [0.58-1.64]

0.95 [0.79-1.15]

0.79 [0.70-0.92]

0.90 [0.75-1.16]

0.78 [0.73-1.02]*

1.97 [1.41-2.75]*†

53.0 [43.8-57.7]

53.9 [48.7-59.1]*

53.9 [48.7-59.1]

48.4 [42.4-49.8]

0.94 [0.81-1.99]

53.4 [51.6-60.8]

60.2 [55.8-63.0]*

56.4 [49.6-67.1]*

LVfw

56.4 [49.6-67.1]*

Septum

864 [678-939]

LVfw

937 [812-1209]

LBBB

691[651-729]*†

870 [757-952]

Septum

Table 1; Relative expression of tested microRNAs (miR) and CTGF, COL1A1 and BNP. Values are presented as median [25th -75th percentile]. * p < 0.05 vs control same region; † p < 0.05 vs septum of the same heart

0.79 [0.62-0.85]

CTGF

mRNA

1066 [739-1330]

Septum

miR-133a

MicroRNA

Table 2

Chronic, CRT-on

CHAPTER 5 Local expression of miR-133a/CTGF

Lack of increased collagen deposition The biochemical Sircol assay as well as the histological Sirius Red measurements indicated a tendency for a ~15% lower collagen concentration in the LVfw of the LBBB group (p = 0.06), while collagen was similar in all other investigated samples (figure 5). In both the LBBB and LBBB+CRT group, Col1A1 expression was significantly below control in both LV walls. MiR-29c showed significant overexpression in the septum of LBBB and of LBBB+CRT hearts without significant changes in the LVfw. Patterns of miR-30c expression were similar to those of miR-29c, but less pronounced and with only a significant increase in the septum of the LBBB+CRT group (figure 5). Figure 5 Top panels; from left to right; Expression of microRNA-29c (miR-29c), miR-30c and Collagen1A1 (Col1A1) in the septum and Left ventricular free wall (LVfw); Bottom panels; change in absolute collagen concentration based on the Sircol assay and on the histology of Sirius Red slices, with representative examples of septal and LVfw slices of a LBBB dog. For explanation of the symbols, see legend to figure 4.

Relation of microRNAs with CTGF and collagen expression Plotting the mRNA expression of CTGF and Col1A1 as a function of the three miRs showed a significant inverse correlation between miR-133a and CTGF on the one hand and inverse correlations between miR-29c and miR-30c with Col1A1 on the other hand (figure 6). Figure 6 Relation between expression of microRNAs (miRs), connective tissue growth factor (CTGF) and Collagen 1A1 (Col1A1). Squares: control, triangles: Left Bundle Branch Block (LBBB), diamonds: Cardiac Resynchronization therapy (CRT) group. Pearson r and p values are based on all the individual data points, for clarity only median values and 25th-75th percentiles (bars) are depicted. Solid symbols: Left ventricular free wall, open symbols: septum. 81

Discussion The large animal model of LBBB provides the unique opportunity to study the involvement of local mechanical load in processes related to hypertrophy and collagen expression. Development of local hypertrophy in the LVfw during LBBB coincided with local up-regulation of CTGF and down-regulation of miR-133a. Together with the observation that local hypertrophy, CTGF and miR-133a expression were reversible upon CRT, these data indicate that hypertrophy is regulated locally. By contrast, collagen gene expression level was reduced in the entire LV and this was associated with a uniform overexpression of miR-29c and miR30c that was not reversible upon CRT. These data suggest that miR-29c and miR-30c are either regulated by systemic factors or that they are sensitive to changes in strain patterns that are present in the septum and LVfw of LBBB and LBBB+CRT hearts. Irrespective of the underlying mechanisms, miR-29c and miR-30c inhibit collagen deposition. CTGF expression in asymmetric hypertrophy and its reversal Previously, the local hypertrophy in the late-activated regions of dyssynchronous hearts has been attributed to increased local strain and workload.16, 26 The coincidence of increased systolic strain, CTGF and hypertrophy in the LVfw of LBBB hearts supports this view as well as the role that CTGF plays during hypertrophy. In vitro studies already showed increased CTGF expression in isolated, stretched cardiomyocytes that developed a hypertrophic response.27 Moreover, in a rabbit model of eccentric hypertrophy, where strains and workload are expected to be high, CTGF was also found to be overexpressed.1, 27 The negative regulation of CTGF expression by miR-133a, suggested in studies in isolated cardiomyocytes,5 is corroborated by our observations that expression of miR-133a was lowest in the tissues with highest CTGF and that abnormal expressions of both CTGF and miR-133a were reversible upon CRT. MiR-133a is one of the most highly expressed miRs in cardiac tissue (table 2).28, 29 It is down-regulated during cardiac hypertrophy while overexpression markedly reduces the hypertrophic response.12, 14 The specificity of the relation between miR-133a, CTGF and asymmetric hypertrophy in LBBB hearts is further emphasized by the lack of overexpression of other miRs, like miR-199b and miR-155f, which are up-regulated during pressure overload and concentric hypertrophy.30, 31 These results from a clinically relevant large animal model support the concept that 82

CHAPTER 5 Local expression of miR-133a/CTGF

miR-133a plays an important role in the hypertrophic response of cardiomyocytes under conditions of increased myocardial strain. In addition, the hypertrophic response initiated by miR-133a is at least partly regulated via CTGF.12, 14 The lack of increased collagen deposition The finding that CTGF overexpression did not lead to collagen deposition in the in LBBB hearts is unusual, because in many studies CTGF overexpression is accompanied by increased levels of collagen and Col1A1 expression.32-36 This primarily holds for animal models and in patients with coronary artery disease or concentric hypertrophy, whereas a more volume overload type of hypertrophy led to CTGF increase without increased collagen levels.1, 27 Apparently, the type of load determines whether CTGF overexpression coincides with increased collagen deposition. One possible explanation for this phenomenon may be that hypertrophy is predominantly regulated by CTGF located in cardiomyocytes, whereas fibroblast-derived CTGF is important for collagen production. We showed previously that fibroblasts, exposed to cyclic stretch marginally increased their CTGF expression,1 whereas stretching of isolated cardiomyocytes increased CTGF in combination with hypertrophy.27 It is therefore tempting to state that the increase in CTGF observed in the LBBB model reflects the increase in cardiomyocyte expression of CTGF induced by local strain. A possible cause of the limited collagen expression during LBBB may be the up-regulation of miR-29c and miR-30c, both miRs that are predominantly expressed in fibroblast.5, 13 MiR-29c is a strong inhibitor of a wide range of genes involved in extracellular matrix remodeling.13 Similarly, miR-30c is significantly down regulated in patients with HF and in vitro inhibition of miR-30c also led to increased collagen expression.5 The strong relation of miR-30c with Col1A1 in the current study supports the idea that miR-30c may prevent excessive collagen deposition. Finally, the lower collagen content in the LVfw of LBBB hearts may be explained by â&#x20AC;&#x153;dilutionâ&#x20AC;? of collagen by the increased cardiomyocyte mass, as also shown in previous studies with chronic LV pacing.15, 16 A remarkable observation in the present study is that the reduction in collagen expression and the miR-29c and 30c did not occur locally, but occurred fairly uniform throughout the LV wall and that CRT did not reverse it. First of all, this emphasizes the completely different regulation of the processes of hypertrophy and collagen expression. Two explanations may be given. First of all, systemic factors may avert collagen deposition during LBBB, but in that case one should assume that these factors are not (completely) 83

reversible upon CRT. Such incomplete recovery at the total left ventricular level is also supported by the incomplete return of LV cavity and wall volume to baseline levels. MiR-29c, miR-30c and Col1A1 are not the only factors that do not show local differences in expression in the dyssynchronous heart and that do not recover upon CRT. Studies from the group of dr. Kass have shown that a number of proteins and genes behave similarly.17, 37 The incomplete recovery may simply indicate that CRT is to be preferred over the situation during LBBB, but that the electrical activation and local mechanical load is still inferior to that seen with intact ventricular conduction system. A second explanation may be that miR-29c and -30c expression is influenced by myocardial stretch in specific parts of the cardiac cycle, such as early systole. In that phase, both early- and late-activated regions may be stretched (figure1).38 Such forms of stretch may also persist during CRT, because CRT does not completely normalize myocardial strains. Limitations Local workload was not directly measured in the present study. However, in LBBB hearts systolic strain is a good indicator of local workload, since shortening against a (high, systolic) pressure determines external myocardial work18 and similar distribution of systolic strain and stress-strain loop area have been reported before.39 Only mRNA expression of CTGF was measured, not its protein expression. However, this is considerably more complicated, because a dog-specific antibody against this protein does not exist. However, for rabbits mRNA and protein expression was shown to correlate well.27

Conclusion These data from a clinically relevant large animal model, indicate a strong association between local cardiac mechanical load, down-regulation of miR-133a, up-regulation of CTGF and myocardial hypertrophy all of which are reversible by CRT. The lack of increased collagen deposition in the dyssynchronous hearts, despite overexpression of CTGF, may be explained by the up-regulation of miR 29c and miR-30c. The in vivo conditions of LBBB and CRT indicate that hypertrophy and collagen deposition are regulated by different triggers and along different pathways. 84

CHAPTER 5 Local expression of miR-133a/CTGF

References 1. Blaauw E, van Nieuwenhoven FA, Willemsen P, Delhaas T, Prinzen FW, Snoeckx LH, et al. Stretch-induced hypertrophy of isolated adult rabbit cardiomyocytes. Am J Physiol Heart Circ Physiol. 2010 Sep;299(3):H780-7. PubMed PMID: 20639217. 2. Chiquet M, Renedo AS, Huber F, Fluck M. How do fibroblasts translate mechanical signals into changes in extracellular matrix production? Matrix Biol. 2003 Mar;22(1):73-80. PubMed PMID: 12714044. 3. Daniels A, van Bilsen M, Goldschmeding R, van der Vusse GJ, van Nieuwenhoven FA. Connective tissue growth factor and cardiac fibrosis. Acta Physiol (Oxf). 2009 Mar;195(3):321-38. PubMed PMID: 19040711. 4. Perbal B. CCN proteins: multifunctional signalling regulators. Lancet. 2004 Jan 3;363(9402):62-4. PubMed PMID: 14723997. 5. Duisters RF, Tijsen AJ, Schroen B, Leenders JJ, Lentink V, van der Made I, et al. miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remodeling. Circ Res. 2009 Jan 30;104(2):170-8, 6p following 8. PubMed PMID: 19096030. 6. He Y, Huang C, Lin X, Li J. MicroRNA-29 family, a crucial therapeutic target for fibrosis diseases. Biochimie. 2013 Jul;95(7):1355-9. PubMed PMID: 23542596. 7. Xiao J, Meng XM, Huang XR, Chung AC, Feng YL, Hui DS, et al. miR-29 inhibits bleomycin-induced pulmonary fibrosis in mice. Mol Ther. 2012 Jun;20(6):1251-60. PubMed PMID: 22395530. Pubmed Central PMCID: 3369297. 8. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of novel genes coding for small expressed RNAs. Science. 2001 Oct 26;294(5543):853-8. PubMed PMID: 11679670. 9. Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993 Dec 3;75(5):843-54. PubMed PMID: 8252621. 10. Guo R, Hu N, Kandadi MR, Ren J. Facilitated ethanol metabolism promotes cardiomyocyte contractile dysfunction through autophagy in murine hearts. Autophagy. 2012 Apr;8(4):593-608. PubMed PMID: 22441020. Pubmed Central PMCID: 3405837. 11. Pan W, Zhong Y, Cheng C, Liu B, Wang L, Li A, et al. MiR-30-regulated autophagy mediates angiotensin II-induced myocardial hypertrophy. PLoS One. 2013;8(1):e53950. PubMed PMID: 23326547. Pubmed Central PMCID: 3541228. 12. Care A, Catalucci D, Felicetti F, Bonci D, Addario A, Gallo P, et al. MicroRNA-133 controls cardiac hypertrophy. Nat Med. 2007 May;13(5):613-8. PubMed PMID: 17468766. 13. van Rooij E, Sutherland LB, Thatcher JE, DiMaio JM, Naseem RH, Marshall WS, et al. Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis. Proc Natl Acad Sci U S A. 2008 Sep 2;105(35):13027-32. PubMed PMID: 18723672. Pubmed Central PMCID: 2529064. 14. Kumarswamy R, Thum T. Non-coding RNAs in cardiac remodeling and heart failure. Circ Res. 2013 Aug 30;113(6):676-89. PubMed PMID: 23989712. 15. van Oosterhout MF, Prinzen FW, Arts T, Schreuder JJ, Vanagt WY, Cleutjens JP, et al. Asynchronous electrical activation induces asymmetrical hypertrophy of the left ventricular wall. Circulation. 1998 Aug 11;98(6):588-95. PubMed PMID: 9714117. 16. Vernooy K, Verbeek XA, Peschar M, Crijns HJ, Arts T, Cornelussen RN, et al. Left bundle branch block induces ventricular remodelling and functional septal hypoperfusion. Eur Heart J. 2005 Jan;26(1):91-8. PubMed PMID: 15615805. 17. Barth AS, Aiba T, Halperin V, DiSilvestre D, Chakir K, Colantuoni C, et al. Cardiac resynchronization therapy corrects dyssynchrony-induced regional gene expression changes on a genomic level. Circ Cardiovasc Genet. 2009 Aug;2(4):371-8. PubMed PMID: 20031609. Pubmed Central PMCID: 2801868. 18. Russell K, Eriksen M, Aaberge L, Wilhelmsen N, Skulstad H, Gjesdal O, et al. Assessment of wasted myocardial work: a novel method to quantify energy loss due to uncoordinated left ventricular contractions. Am J Physiol Heart Circ Physiol. 2013 Oct 1;305(7):H996-1003. PubMed PMID: 23893165.

19. Verbeek XA, Vernooy K, Peschar M, Cornelussen RN, Prinzen FW. Intra-ventricular resynchronization for optimal left ventricular function during pacing in experimental left bundle branch block. J Am Coll Cardiol. 2003 Aug 6;42(3):558-67. PubMed PMID: 12906989. 20. Arts T, Prinzen FW, Delhaas T, Milles JR, Rossi AC, Clarysse P. Mapping displacement and deformation of the heart with local sine-wave modeling. IEEE Trans Med Imaging. 2010 May;29(5):1114-23. PubMed PMID: 20335094. 21. Verbeek XA, Vernooy K, Peschar M, Van Der Nagel T, Van Hunnik A, Prinzen FW. Quantification of interventricular asynchrony during LBBB and ventricular pacing. Am J Physiol Heart Circ Physiol. 2002 Oct;283(4):H1370-8. PubMed PMID: 12234787. 22. van Bilsen M, Daniels A, Brouwers O, Janssen BJ, Derks WJ, Brouns AE, et al. Hypertension is a conditional factor for the development of cardiac hypertrophy in type 2 diabetic mice. PLoS One. 2014;9(1):e85078. PubMed PMID: 24416343. Pubmed Central PMCID: 3887022. 23. de Jong S, van Middendorp LB, Hermans RH, de Bakker JM, Bierhuizen MF, Prinzen FW, et al. Ex Vivo and In Vivo Administration of Fluorescent CNA35 Specifically Marks Cardiac Fibrosis. Mol Imaging. 2014 Sep 1;13(0):1-9. PubMed PMID: 25249247. 24. Sweat F, Puchtler H, Rosenthal SI. Sirius Red F3ba as a Stain for Connective Tissue. Arch Pathol. 1964 Jul;78:6972. PubMed PMID: 14150734. 25. Verbeek XA, Vernooy K, Peschar M, Cornelussen RN, Prinzen FW. Intra-ventricular resynchronization for optimal left ventricular function during pacing in experimental left bundle branch block. Journal of the American College of Cardiology. 2003 Aug 6;42(3):558-67. PubMed PMID: 12906989. Epub 2003/08/09. eng. 26. Vernooy K, Cornelussen RN, Verbeek XA, Vanagt WY, van Hunnik A, Kuiper M, et al. Cardiac resynchronization therapy cures dyssynchronopathy in canine left bundle-branch block hearts. Eur Heart J. 2007 Sep;28(17):2148-55. PubMed PMID: 17611254. 27. Blaauw E, Lorenzen-Schmidt I, Babiker FA, Munts C, Prinzen FW, Snoeckx LH, et al. Stretch-induced upregulation of connective tissue growth factor in rabbit cardiomyocytes. J Cardiovasc Transl Res. 2013 Oct;6(5):861-9. PubMed PMID: 23835778. 28. Chen JF, Mandel EM, Thomson JM, Wu Q, Callis TE, Hammond SM, et al. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. Nat Genet. 2006 Feb;38(2):228-33. PubMed PMID: 16380711. Pubmed Central PMCID: 2538576. 29. Torella D, Iaconetti C, Catalucci D, Ellison GM, Leone A, Waring CD, et al. MicroRNA-133 controls vascular smooth muscle cell phenotypic switch in vitro and vascular remodeling in vivo. Circ Res. 2011 Sep 30;109(8):880-93. PubMed PMID: 21852550. 30. Heymans S, Corsten MF, Verhesen W, Carai P, van Leeuwen RE, Custers K, et al. Macrophage microRNA-155 promotes cardiac hypertrophy and failure. Circulation. 2013 Sep 24;128(13):1420-32. PubMed PMID: 23956210. 31. da Costa Martins PA, Salic K, Gladka MM, Armand AS, Leptidis S, el Azzouzi H, et al. MicroRNA-199b targets the nuclear kinase Dyrk1a in an auto-amplification loop promoting calcineurin/NFAT signalling. Nat Cell Biol. 2010 Dec;12(12):1220-7. PubMed PMID: 21102440. 32. Ahmed MS, Oie E, Vinge LE, Yndestad A, Oystein Andersen G, Andersson Y, et al. Connective tissue growth factor--a novel mediator of angiotensin II-stimulated cardiac fibroblast activation in heart failure in rats. J Mol Cell Cardiol. 2004 Mar;36(3):393-404. PubMed PMID: 15010278. 33. Dean RG, Balding LC, Candido R, Burns WC, Cao Z, Twigg SM, et al. Connective tissue growth factor and cardiac fibrosis after myocardial infarction. J Histochem Cytochem. 2005 Oct;53(10):1245-56. PubMed PMID: 15956033. 34. Chen MM, Lam A, Abraham JA, Schreiner GF, Joly AH. CTGF expression is induced by TGF- beta in cardiac fibroblasts and cardiac myocytes: a potential role in heart fibrosis. J Mol Cell Cardiol. 2000 Oct;32(10):1805-19. PubMed PMID: 11013125. 35. Finckenberg P, Inkinen K, Ahonen J, Merasto S, Louhelainen M, Vapaatalo H, et al. Angiotensin II induces connective tissue growth factor gene expression via calcineurin-dependent pathways. Am J Pathol. 2003 Jul;163(1):355-66. PubMed PMID: 12819040. Pubmed Central PMCID: 1868168. 36. Koitabashi N, Arai M, Kogure S, Niwano K, Watanabe A, Aoki Y, et al. Increased connective tissue growth factor relative to brain natriuretic peptide as a determinant of myocardial fibrosis. Hypertension. 2007 May;49(5):1120-7. PubMed PMID: 17372041. 86

CHAPTER 5 Local expression of miR-133a/CTGF 37. Chakir K, Daya SK, Tunin RS, Helm RH, Byrne MJ, Dimaano VL, et al. Reversal of global apoptosis and regional stress kinase activation by cardiac resynchronization. Circulation. 2008 Mar 18;117(11):1369-77. PubMed PMID: 18316490. 38. De Boeck BW, Kirn B, Teske AJ, Hummeling RW, Doevendans PA, Cramer MJ, et al. Three-dimensional mapping of mechanical activation patterns, contractile dyssynchrony and dyscoordination by two-dimensional strain echocardiography: rationale and design of a novel software toolbox. Cardiovasc Ultrasound. 2008;6:22. PubMed PMID: 18513412. Pubmed Central PMCID: 2429897. 39. Prinzen FW, Hunter WC, Wyman BT, McVeigh ER. Mapping of regional myocardial strain and work during ventricular pacing: experimental study using magnetic resonance imaging tagging. J Am Coll Cardiol. 1999 May;33(6):1735-42. PubMed PMID: 10334450. Pubmed Central PMCID: 2041911.

Supplemental material Supplemental table 1; Specific primers used for real time quantitative polymerase chain reaction. For CTGF, BNP and Col1A1 both forward (fw) and reverse (rv) primers were used from Sigma-Aldrich (St Louis, MO, USA). MicroRNA primers were obtained from Qiagen (Venlo, the Netherlands).

Supplemental tabel 1 Marker

Primer

miR-133a

TTTGGTCCCCTTCAACCAGCTG

miR-29c

TAGCACCATTTGAAATCGGTTA

miR-30c

TGTAAACATCCTACACTCTCAGC

miR-155

TTAATGCTAATCGTGATAGGGGT

miR-199b

ACAGTAGTCTGCACACATTGGTTA

CTGF (fw)

CACAGAGTGGAGCGCCTGTTC

CTGF (rv)

GATGCACTTTTTGCCCTTCTTAATG

Col1A1 (fw)

AGAGCATGACCGACGGATTC

Col1A1 (rv)

ACGCTGTTCTTGCAGTGGTA

BNP (fw)

TGCACAAGTCAGGGTGCTTT

BNP (rv)

CAGGGGGVTGCTGAAGAATC

Cyclophylin (fw)

CCCACCGTGTTCTTCGACAT

Cyclophylin (rv)

CCAGTGCTCAGAGCACGAAA

Abstract chapter 6 Dyssynchrony, caused by a left bundle branch block (LBBB), creates regional differences in mechanical load and hypertrophy within the left ventricle (LV). The aim of the present study is to investigate to what extent volume overload on top of LBBB influences the regulation of hypertrophy and collagen deposition. Particular in the involvement of microRNAs (miRs) and connective tissue growth factor (CTGF). Methods 20 dogs were followed for four months after induction of LBBB. In twelve dogs, mitral regurgitation (MR) was created 4 weeks prior to LBBB. Five additional dogs served as control. LV geometric changes were determined with echocardiography and myocardial strain with MRI tagging. Expression levels of selected miRs, CTGF, Collagen1A1, and Brain Natriuretic Peptide as well as cardiomyocyte diameter and collagen deposition were measured in the septum and LV free wall (LVfw). Results In LBBB hearts, LVfw and septal strain were 200% and 50% of control. This coincided with local hypertrophy in the LVfw. MR+LBBB hearts showed similar strain and hypertrophy patterns but accompanied by severe LV dilation and higher LV/body weight ratios. In the LVfw of the LBBB group, CTGF expression increased by 150% while miR-133a expression was reduced by ~25%, whereas no change was observed in the septum. MR+LBBB caused an even further increase in CTGF and decrease in miR-133a expression, but expression levels were not significantly different between the septum and LVfw. The collagen related miR-29c and miR-30c were significantly and uniformly down-regulated in the MR+LBBB group, while both were slightly elevated in LBBB hearts. In the LVfw, collagen expression and deposition tended to be higher in MR+LBBB than in LBBB hearts.

Conclusion MiR-133a and CTGF play an important role in the local and generalized hypertrophic response in hearts subjected to LBBB and volume overload. The intraventricular differences in expression of miRs disappear during volume overload, despite persistence of asymmetric hypertrophy. The weak increase in collagen deposition in the MR+LBBB hearts may be related to the loss of the protective effect of miR-29c and miR-30c expression as seen in LBBB hearts. 88

CHAPTER 1 general introduction

Chapter 6 Interplay between local and global regulation of hypertrophy and collagen in the dyssynchronous failing heart

Lars B. van Middendorp; Marion Kuiper; Chantal Munts; Philippe Wouters; Jos. G. Maessen; Frans A. van Nieuwenhoven; Frits W. Prinzen 89

Introduction Myocardial hypertrophy and fibrosis are part of structural adaptation of the heart to abnormal loading conditions and are important risk factors for morbidity and mortality.1 Both are initiated by activation of signaling cascades leading to altered expression of hundreds of genes.2-4 The type of hypertrophic and fibrotic response appear to depend on the specific kind of overload. While on one end of the spectrum pure volume overload is associated with eccentric hypertrophy, pressure overload predominantly causes concentric hypertrophy.5, 6 Gene expression profiles differ significantly between these two types of hypertrophy.7 Moreover, expression patterns change in the transition from compensated to decompensated hypertrophy.8-11 A special kind of hypertrophy is induced by left bundle branch block (LBBB). LBBB elicits discoordinate contraction in the left ventricle (LV), with low workload in the septum and increased load in the left ventricular free wall (LVfw). LBBB elicits asymmetric hypertrophy, indicating that local workload can trigger local hypertrophy.3, 4 Since the early years of this century Cardiac Resynchronization Therapy (CRT) is used to treat patients with dyssynchronous heart failure (heart failure in combination with LBBB). A few studies report complex molecular derangements in the hearts of these patients.12, 13 Similar changes are also observed in dog models of dyssynchronous heart failure created by tachypacing and LBBB.2, 14 The complexity of these derangements may stem from the fact that this kind of heart failure is the result of a combination of dyssynchrony and global cardiac overload. Local and systemic stimuli may interfere with each other, but it is unclear whether these two effects are simply additive or whether there are more complicated interactions. Recent studies demonstrated that microRNAs (miRs) are important regulators of hypertrophy and fibrosis.15,16 In a previous study we found that local expression of miR-133a and its target, connective tissue growth factor (CTGF), were closely related to local hypertrophy in canine hearts with isolated LBBB. While miRs related to extracellular matrix (ECM) remodeling, like miR-29c and miR-30c, were altered uniformly in the LV wall (chapter 5). The aim of the present study is to compare the changes in various miRs and CTGF in relation to hypertrophy and collagen deposition in canine hearts with isolated LBBB and during dyssynchronous heart failure, via a combination of LBBB and volume overload. Volume overload was induced by mitral regurgitation (MR). The hypertrophic response was assessed echocardiographically, 90

CHAPTER 6 MiR expression during heart failure

histologically and at the molecular level by measuring expression of a selected number of miRs known to be involved in myocardial hypertrophy and collagen deposition. Moreover, brain natriuretic peptide (BNP) mRNA was determined as molecular marker of cardiac hypertrophy and mRNA of Collagen 1A1 as refelction of collagen deposition.

Methods Animal handling was performed according to the Dutch Law on Animal Experimentation and the European Directive for the Protection of Vertebrate Animals used for Experimental and Other Scientific Purposes (86/609/EU). The protocol was approved by the Experimental Animal Committee of Maastricht University. Experimental Model of LBBB and MR Experiments were performed on 25 adult mongrel dogs of either sex, weighing approximately 20kg, 5 of them served as control. A sterile closed-chest procedure was performed in 20 dogs. They were intravenously induced with thiopental (300mg), while anesthesia was maintained by continuous infusion of midazolam (0.25mg/kg/h) and sufentanil (3Îźg/kg/h). LBBB was created by radiofrequency ablation as described in detail previously.17 Four weeks prior to LBBB induction, MR was created in twelve dogs using a customized ablation catheter with a hook at the distal tip.18 This catheter was introduced endovascular into the LV trough a sheet (Attain 50cm str., Medtronic, MAASTRICHT, The Netherlands). Under fluoroscopic guidance, one or several chordae tendinae were grasped. The potential severity of MR was estimated by pulling on these chordae while echocardiographically evaluating the effect. If estimated MR severity was judged sufficient, the hook was withdrawn into the sheet to safely ablate the chordae, without causing damage to surrounding structures. If echocardiography and fluoroscopy suggested only minor MR after the ablation, the whole process was repeated. Examples of per- and post-procedural evaluation of MR severity are depicted in figure 1. During each surgical procedure and at the final day of the experimental protocol electro-hemodynamic measurements were performed.19 Right ventricular (RV) and LV pressure were measured by a 7-Fr catheter tip manometer (CD-Leycom, Zoetermeer, the Netherlands). Mechanical interventricular dyssynchrony (MIVD) was assessed from the time difference of the upslope of LV and RV pressures. 20 A Swan-Ganz catheter was placed in the pulmonary artery for thermodilution based cardiac output measurements and calculate forward stroke volume through the pulmonary valve cardiac output (forward SV = heart rate ).21 Dogs underwent echocardiographic 91

exams at week -4 (prior to MR, only in MR+LBBB group), week 0 (prior to LBBB), week 8 and week 16. Total stroke volume (SV) was determined echocardiographically, as the difference of end diastolic and end systolic volume (total SV = EDV â&#x20AC;&#x201C; ESV).The regurgitant volume through the mitral valve was then calculated as SV fraction of total SV (regurgitant fraction = forward total SV ), assuming that SV trough the pulmonary valve is in equilibrium with the SV trough the aortic valve. A few days before sacrifice MRI myocardial tissue tagging scans were made for calculation of circumferential strain using the Sinmod program.22 Figure 1

After sacrifice, the heart was rapidly excised and transmural tissue sections at the mid-level of the septum and LVfw were collected and snap-frozen in liquid nitrogen. Part of the tissue was preserved using formalin, and embedded in paraffin for histology. The five dogs that served as control were only subjected to extensive electro-hemodynamic measurements, before collecting the tissue. Gene expression analysis Total RNA was isolated from tissue using Qiagen miR mini easykit (Qiagen, Venlo, the Netherlands). Quantity and purity of RNA were assessed using the ratio of absorbance at 260/280nm, measured on a nanodrop 2000c spectrophometer (Wilmington, DE, USA). Total RNA was reverse transcribed to cDNA using miScript Reverse transcription kit (Qiagen, Venlo, the Netherlands). The following set of miRs, reported to be involved in myocardial hypertrophy and collagen deposition, were included in our study; miR-133a, -146a, -146b, -155f, -199b, -222, -29c, -30c and -499.23 MiR expression was analyzed using real-time quantitative polymerase chain reaction (qPCR) on an iCycler Real-Time PCR detection system with the iQ SYBR-green supermix (Bio-Rad, Veenendaal, the Netherlands) using MiScript primers sets (Qia92

Evaluation of mitral regurgitation. Panel A + B; representative per-operative recordings of a dog in the LBBB group (top panels) and MR + LBBB group (bottom panels). Panel A; 4-chamber recording with color Doppler, showing a clear eccentric jet (white arrow) after ablation of chorda(e) in a MR+LBBB dog. Panel B; Fluoroscopic recording to illustrate MR severity, black arrow indicates regurgitant flow into the left atrium. Panel C; Postoperative short-axis recording at week 16 (images have the same scale). Red lines show a clear increase in left ventricular internal diameter in diastole.

CHAPTER 6 MiR expression during heart failure

gen). Expression levels of CTGF, Col1A1 and BNP were analyzed using the same method and normalized using the housekeeping gene Cyclophilin-A as described previously.24 Relative expression was calculated using the comparative threshold cycle (Ct) method by calculating 2ΔCt (e.g. 2Cyclophilin Ct – CTGF Ct).25 Since there is no housekeeping gene for miRs, values are expressed by using the Ct value multiplied by an arbitrary number for ease of use (e.g. 2 –miR-133a Ct * 107). Histological analysis of cardiomyocyte hypertrophy and collagen deposition Cardiac tissue sections were stained with either a modified Azan staining or 0.1% Sirius Red (Polysciences Inc., Warrington, PA, USA).26 Photos of the stained sections were taken with a Leica DM3000 Microscope (Leica Mircosystems, Wetzlar, Germany) with a 20x (Sirius Red) or 40x (Azan) magnification. All of these images were automatically randomized and blinded for reviewing purposes. Azan stained sections were used to determine cardiomyocyte diameter at the level of the nucleus with ImageJ (Research Services Branch, National Institute of Mental Health, MA, USA). Each cardiomyocyte was measured in duplo and on average 30 cardiomyocytes per wall segment per dog were analyzed. Custom made software within Matlab (MathWorks, Natick, MA, USA) was used to calculate percentage of collagen in the Sirius Red stained tissue sections. The region of interest and color threshold were manually selected and adjusted. Perivascular collagen was excluded from the analysis. To compensate for bias in thresholding, 8 sections per wall segment per dog were analyzed and averaged. Statistical analysis All data is presented as median [25th – 75th percentile]. Statistical analysis was performed using Statistical Package for Social Sciences for Windows version 20.0 (IBM corp., Armonk, NY, USA Differences between groups, temporal differences within a group and, when applicable, intracardiac differences were tested with a mix-effect analysis. This method is also known as multilevel analysis or linear mixed effect model and was used for gene expression levels, electro-hemodynamic parameters and imaging data. The least squared differences correction was used for post hoc comparison. A Pearson correlation linear regression analysis between miR expression and LV EDP was performed. An observed probability-value < 0.05 was considered statistically significant.

Results Four dogs in the MR+LBBB group died prematurely due to severe heart failure and were excluded from data analysis. After 4 weeks, MR severity ranged from mild (n=2), to moderate (n=4), to severe (n=2), while no trace of MR was present in the LBBB dogs. At week 16 still no trace of MR was noted in the LBBB group, but in the MR+LBBB group MR severity increased from moderate to severe in two dogs. The regurgitant fraction at 16 weeks was 0.66 [0.39-0.69] (table 1). Electrophysiological and hemodynamic effects of LBBB and LBBB+MR Four weeks of MR caused a 10.3% [0.2-27.8%] decrease in LV dP/dtmax , a significant increase in LV end diastolic pressure (EDP) and a trend towards increase in RV EDP (p=0.06; table 1). In both the LBBB and MR+LBBB groups, LBBB induced electrical and mechanical dyssynchrony between the LV and RV, as evidenced by a doubling of QRS width and a more negative MIVD. Notably, QRS duration was longer in MR+LBBB than in LBBB hearts, presumably due to the ventricular dilatation (see below). The dyssynchrony resulted in impaired contractility as well as relaxation (lower LV dP/dtmax and LV dP/dtmin, respectively). Over time, LV dP/dtmax and LV dP/dtmin were equally reduced in LBBB and MR+LBBB groups, but in the latter LV EDP, RV EDP and RV end systolic pressure (ESP) were significantly elevated (table 1). Cardiac geometric changes in LBBB and MR+LBBB Compared to a historical cohort of control dogs the LV weight/ body weight ratio in the LBBB group was increased (5.4 g/kg [5.0-5.9] vs. 4.9 g/kg [4.5-5.3]) and increased even further in the MR+LBBB group (6.3 g/kg [4.9-8.1]). The upper limits in the MR+LBBB group indicate some dogs with severe hypertrophy. In control animals, MRI-derived circumferential strain was virtually equal between the septum and the LVfw. LBBB almost doubled the strain in the LVfw while it was significantly reduced in the septum. Strain patterns in the MR+LBBB group were similar to those in the LBBB group, albeit with larger variability (figure 2). Echocardiographically determined wall thickness of the LVfw and septum did not change significantly during the first four weeks of MR. After two months of LBBB, LVfw thickness had increased significantly by approximately 10% in both the LBBB and MR+LBBB groups, while septal wall thickness hardly changed (figure 3).

329 [304-356]

43 [42-55]

QRS width (ms)

QT width (ms)

144 [121-157]

PQ time (ms)

335 [302-346]

352 [346-381]*

349 [338-366]

373 [333-381]

56 [48-69]

53 [48-67] 100 [97-106]*†

0 [-6-3]

-2 [-7-3] -46 [-37- -50]*†

-7 [-3- -9]

-7 [-2- -9]

Mechanical interventricular dyssynchrony (ms)

51 [48-59]

5 [4-7]

4 [3-8]

5 [4-5]

4 [2-4]

5 [3-7]

RV end diastolic pressure (mmHg)

140 [122-156]

34 [28-41]*$†

26 [19-35]* 24 [18-29]

25 [24-27]

23 [20-24]

26 [25-30]

RV end systolic pressure (mmHg)

121 [116-130]$

11 [6-20]$†

12 [8-17]† 7 [5-110]

6 [5-11]

6 [3-7]

7 [3-8]

LV end diastolic pressure (mmHg)

167 [137-191]

101 [80-115]

104 [83-111] 102 [87-113]

89[87-108]

102 [95-112]

99 [94-109]

LV end systolic pressure (mmHg)

133 [125-155]

-1543 [-832- -1767]*†

-2085 [-958- -2245] -2192 [-1968- -2321]

-1569 [-1373- -1715]*†

-1989 [-1673- -2162]

-2422 [-1854- -2576]

LV dP/dtmin (mmHg/s)

ECG

1330 [826-1487]*†

LV dP/dtmax (mmHg/s)

409 [382-436]*$†

116 [103-122]*†

136 [101-145]$

-36 [-28- -46]*†

8 [8-11]*$†

100 [99-100] 1773 [1561-2138]

2192 [1813-2233]$

1097 [1009-1282]*†

1713 [1502-1863]

2091 [1742-2251]

0.66 [0.39-0.69]

2/2/4

100 [86-111]

2/4/2

week 16

97 [75-102]

-/-/-

week 0

MR+LBBB (n=8)

100 [96-110]*

0.09 [-0.18-0.15]

-/-/-

week -4

84 [70-102]

-/-/-

week 16

LBBB (N=8) week 0

100 [99-101]

-/-/-

week 16

Control (N=5)

Chronic, CRT-on

Heart rate (bpm)

Hemodynamics

Regurgitant fraction

MR Grade mild/moderate/severe (n)

Table 1

Table 1; Electrophysiological and hemodynamic parameters at week -4 (MR), week 0 (LBBB) and after 16 weeks of LBBB. * P < 0.05 week 16 vs. week 0; † P < 0.05 Pre-LBBB (week -4) vs Baseline, $ P < 0.05 MR+LBBB vs LBBB group, † P < 0.05 vs control. Data are presented as median [25-75th percentile]

CHAPTER 6 MiR expression during heart failure

Figure 2 MRI derived circumferential strain in control (Ctrl), left bundle branch block (LBBB) and mitral regurgitation (MR) animals at the end of the protocol. Panel A; boxplots of strain of the septum and left ventricular free wall (LVfw) as percentage of mean strain. In each box the middle line indicates the median. The lower and upper margin of the boxes represent the 25th-75th percentile and the bars the minimum and maximum value. Panel B trough D; typical examples of strain patterns in the septum (dashed lines) and LVfw (solid lines). II typical sign of septal rebound stretch. * p < 0.05 vs similar wall in the control group; § p < 0.05 vs LVfw in the same group.

Figure 3

Accordingly, the LVfw/septum ratio, as marker of asymmetric hypertrophy, increased from 1.19 [1.16-1.26] to 1.35 [1.291.42] in the MR+LBBB group which was similar to that in the LBBB group (1.40 [1.27-1.54]). LV internal diastolic diameter (LVIDd) increased by ~20% in the LBBB group and by ~70% in the MR+LBBB group, indicating considerable LV dilation in the MR+LBBB animals. Cardiac hypertrophy In both the LBBB and MR+LBBB groups cardiomyocyte diameter was significantly (~20%) larger in the LVfw compared to the septum of the same heart and compared with the LVfw in the control group (figure 4). In the LVfw of the LBBB group CTGF expression increased ~2.5 times above control (p=0.01). 96

Echocardiographic changes relative to baseline values in the LBBB group (open symbols, dashed lines) and MR+LBBB group (solid symbols, solid line). Panel A; left ventricular free wall (LVfw) thickness (squares) and septal thickness (circles). Panel B; LVfw/septal wall thickness to express asymmetry of hypertrophy (triangles) and panel C; Left ventricular internal dimension-diastole (LVIDd, diamonds). Presented are median values and 25th or 75th percentile. § p<0.05 vs week -4; * p<0.05 vs week 0; and † p < 0.05 vs LBBB group.

CHAPTER 6 MiR expression during heart failure

This increase was significantly larger than that in the septum (~1.2 times; p=0.02). CTGF expression was even higher in the In MR+LBBB hearts (~4.1 times, p < 0.001, in the LVfw and ~2.1 times, p = 0.01 in the septum). These values were also higher than in the corresponding walls in the LBBB group (p = 0.03 for the LVfw and p=0.06 for the septum, figure 4) MiR-133a expression was lower in LBBB than in control hearts, its expression being significantly lower in the LVfw than in the septum. In the MR+LBBB group miR-133a expression was further depressed in both walls, but regional differences in miR-133a expression were not statistically significant any more (figure 4). Figure 4 Assessment of hypertrophic remodeling. Panel A; representative examples of the modified azan staining in the septum (sept) and left ventricular free wall (LVfw) in the same heart of an LBBB dog. Panel B; cardiomyocyte diameter (μm), septum and LVfw in the control, Left Bundle Branch Block (LBBB) and mitral regurgitation+LBBB (MR+LBBB) group. Panel C; Boxplots of the expression of connective tissue growth factor (CTGF). Panel D to F; boxplots of the expression of microRNAs (miRs) related to hypertrophy. Dark boxes represent the LVfw and light boxes the septum. * p < 0.05 vs. control; † p < 0.05 vs LBBB; § p < 0.05 vs septum.

MiR-199b and miR-499, regarded as pro-hypertrophic regulators, did not show any significant up-regulation in LBBB hearts and were even uniformly down-regulated in the MR+LBBB group (figure 4, table 2). MiR-222 was not significantly different between control, LBBB and MR+LBBB hearts. Expression levels of miR-146a, miR-146b and miR-155f were low and no significant differences were observed between control hearts and LBBB or MR+LBBB hearts (table 2). Cardiac collagen deposition Evaluation of cardiac collagen deposition using the Sirius Red staining in histological slices showed no intraventricular differences in any group. Collagen deposition did not differ between control hearts on the one hand and LBBB and MR+LBBB hearts on the other, but collagen content tended to be higher in the LVfw of the MR+LBBB group compared to the LBBB group (figure 5). Col1A1 97

mRNA expression was significantly lower in LBBB than in control hearts, but tended to return to control levels in the MR+LBBB group. Col1A1 expression was significantly higher in the LVfw of the MR+LBBB group than in the LVfw of the LBBB hearts. MiR-29c was significantly up-regulated in the septum of the LBBB group. In the MR+LBBB group miR-29c and miR-30c were both uniformly down-regulated by ~20% and ~60%, respectively (figure 5 and table 2). Figure 5 Assessment of extracellular matrix remodeling. Panel A; representative examples of Sirius Red slices from the septum (sept) and left ventricular free wall (LVfw) in the same heart of a Left Bundle Branch Block (LBBB) dog. Panel B; Boxplot of the percentage of Collagen in the septum and in the control, LBBB and mitral regurgitation+LBBB (MR+LBBB) group. Panel C; Boxplots of the expression of Collagen1A1 (Col1A1). Panel D and E; boxplots of the expression of microRNAs (miRs) related to the extracellular matrix. Dark boxes represent the Left Ventricle free wall (LVfw) and light boxes the septum (Sept). * p < 0.05 vs. control; â&#x20AC; p < 0.05 vs LBBB; Â§ p < 0.05 vs septum.

Relation with LV EDP Because within the MR+LBBB group a considerable variation in LV EDP was noted, we investigated the influence of the degree of cardiac congestion on expression of various miRs by plotting their expression as a function of LV EDP. Expression levels of miR-133a, miR-199b, miR-29c and miR-30c showed a clear inverse relation with LV EDP (figure 5). Despite the sometimes high LV EDP values in MR+LBBB hearts, myocardial BNP expression was not significantly increased.

Figure 6 Relation between expression of microRNAs (miRs) in the left ventricle (LV; both the left ventricular free wall and septum) and LV end diastolic pressure (EDP) as surrogate for severity of heart failure in the MR+LBBB (solid) group. Median control (light) and median Left Bundle Branch Block (LBBB, dark) values are depicted as reference, but are not included in the Pearson regression analysis.

0.44 [0.42-0.66]

0.48 [0.43-0.65]§

38.5 [29.6-47.4] 20.5 [19.1-23.9] 4.0 [3.6-4.9] 1.10 [1.07-1.41] 0.68 [0.65-0.75] 0.39 [0.38-0.44]

miR-29c

miR-222

miR-199b

miR-146a

miR-155f

miR-146b

0.79 [0.62-0.85]

0.09 [0.06-0.13]

BNP

CTGF

1.44 [1.08-1.76]

Col1A1

mRNA

0.78 [0.73-1.02]

0.69 [0.64-0.93]

40.2 [33.5-57.2]

0.71 [0.48-1.14]

0.09 [0.02-0.29]

2.04 [1.71-2.39]

1.27 [1.16-1.52]§

5.2 [4.7-6.6]$

21.2 [18.6-22.0]

44.0 [39.1-49.2]

43.2 [34.1-46.6]

0.94 [0.81-1.99]

0.05 [0.02-0.09]

0.67 [0.46-1.22]*

1.37 [1.29-1.41]

4.7 [4.3-5.1]

22.6 [20.1-31.0]

56.4 [49.6-67.1]*

48.4 [42.4-49.8]

77.6 [71.9-101.4]

miR-30c

73.2 [65.5-88.3]

76.8 [56.3-91.2]

miR-499

870 [757-952]

LVfw

1.97 [1.41-2.75]*$

0.08 [0.04-0.15]

0.83 [0.66-1.30]*

0.83 [0.63-1.20]

0.90 [0.75-1.16]

1.58 [1.45-1.85]§

5.0 [4.2-5.8]

22.9 [17.0-26.0]

53.0 [46.5-57.4]

51.3 [42.8-54.3]

104.2 [78-106.7]

691 [651-729]*$

LBBB (n=8) Septum

1066 [739-1330]

934 [811-979]

LVfw

Control (n=5) Septum

miR-133a

miR

Table 2

1.54 [1.51-3.38]*

0.12 [0.05-0.28]

0.89 [0.81-1.04]*

0.50 [0.42-0.56]

0.48 [0.45-0.63]

1.14 [1.02-1.33]†

3.1 [1.9-4.2]†

25.2 [21.7-27.5]

34.5 [26.3-43.6]†]

18.1 [10.9-25.6]*†

41.1 [30.1-65.1]*†

486 [364-885]*†

Septum

2.94[1.99-4.01]*†

0.06 [0.05-0.93]

1.69 [1.39-2.69]†

0.76 [0.54-1.27]

0.66 [0.61-0.88]

1.42 [1.32-1.77]

3.7 [2.8-5.9]*

24 [22.3-29.2]

33.9 [24.7-43.6]*†

17.4 [12.4-33.5]*†

51.5 [28.7-87.5]†

464 [362-612]*†

LVfw

LBBB+CRT (n=8)

Table 2; Relative expression levels of a selection of miRs and of mRNA levels of CTGF, COL1A1 and BNP. MiR Values are expressed as 2-CT * fixed value (107). mRNA expressed as 2(CyclophilinCT-CT). Values are presented as median [25 -75th percentile]. * p < 0.05 vs. control; † p < 0.05 vs LBBB; § p < 0.05 vs septum.

CHAPTER 6 MiR expression during heart failure

Discussion The present study in clinically relevant large animal models shows several novel aspects of the regulation of hypertrophy: I) LBBB induces asymmetric hypertrophy even when it is accompanied by volume overload and the resultant LV dilation, II) CTGF and miR-133a play an important role in local as well as global hypertrophy, III) The initial protective effect of miR-29c and miR-30c to prevent excessive collagen deposition is slightly attenuated by volume overload. These results indicate an intricate interaction between two (at least initially) different mechanical triggers in the transcriptional regulation of hypertrophy and collagen deposition. Asymmetric hypertrophy in LBBB and MR+LBBB The local hypertrophic response in LBBB hearts, with an increase in wall thickness and myocyte diameter selectively in the LVfw, corroborates previous studies.3, 4 The present study demonstrates that this asymmetric hypertrophy is also found in the MR+LBBB group, even despite a strong eccentric component of cardiac remodeling. It is likely that the asymmetric hypertrophy relates to the excessive amount of mechanical workload in the LVfw of LBBB hearts.4, 27 Moreover, the persistence of the asymmetry of hypertrophy in the MR+LBBB model, despite significant volume overload, indicates that the local workload continues to influence local growth. The fact that cardiomyocyte diameter was similarly increased in the LVfw of LBBB and MR+LBBB hearts, while a somewhat larger LV weight was found in the MR+LBBB hearts, may indicate that the volume overload increased cardiomyocyte length, as is often seen in other models of volume overload.28-31 MiR-133a and CTGF expression in relation to hypertrophy The present study shows that in different regions of the left ventricle as well as between hearts with different loading conditions, CTGF and miR-133a closely relate to the degree of hypertrophy. The close relationship between CTGF overexpression and miR-133a underexpression suggests a causal relationship, which is supported by studies by Duisters et al.. These investigators provided strong evidence that miR-133a is a negative regulator of CTGF.32 It appears that both factors already respond to moderate local mechanical overload, as is the case in the LVfw of LBBB hearts. In vitro, it has already been observed that stretching of isolated cardiomyocytes increases CTGF expression and leads to hypertrophic growth of these cells.24, 33 Volume overload on top of LBBB appears to have an additive effect on the down-regulation of miR-133a and up-regulation of CTGF. In a previous study it was observed that that miR-133a and CTGF expression are reversible 100

CHAPTER 6 MiR expression during heart failure

upon CRT, presumably related to the reversal to normal mechanical load within the LV wall (chapter 5). Together with the data from the present study, it seems that CTGF and miR-133a are important regulators of hypertrophy during both local mechanical and global volume overload. The latter relation is further indicated by the close inverse relation between LV EDP and miR-133a expression. It is a continuing debate as to whether the transition of hypertrophy towards heart failure is caused by more abnormal expression of genes already involved in hypertrophy or that new signaling pathways are activated.34 In the present study only the former appeared the case with respect to hypertrophy, as none of the other tested miRs were abnormally regulated in the MR+LBBB model, to the extent that they could explain the additional hypertrophic response. It was a remarkable finding that several reportedly pro-hypertrophic miRs, like miR-199b and miR-499, were not up-regulated. MiR-199b and miR-499 are known to be upregulated in animal models of pressure overload and in tissue from patients.35, 36 Differences in the pathways involved in eccentric and concentric hypertrophy have been reported but not yet for miR expression.7 However, the comparison between the aforementioned literature and the present study suggests that this may be the case as well. Relation between CTGF overexpression and collagen deposition In contrast to several other studies,37-41 CTGF up-regulation was not accompanied by overt collagen deposition. This discrepancy might be explained by difference in the cell type that overexpresses CTGF. Hypertrophy may be predominantly regulated by CTGF synthesized in cardiomyocytes and most of the observed CTGF overexpression may have occurred in cardiomyocytes. This idea is supported by the relation between the predominantly myocyte-expressed miR-133a and CTGF. In LBBB hearts, fibroblast-derived CTGF overexpression may have been suppressed by the overexpression of miR-29c and miR-30c, fibroblast-specific miRs that are known as negative regulators of extracellular matrix remodeling.32, 42 However, in the MR+LBBB animals these miRs are down-regulated, presumably due to the additional volume overload created by the MR, as the extent of down-regulation is well correlated to LV EDP. Therefore, it appears that the volume overload overrules the inhibition of collagen deposition in pure dyssynchrony, by converting up-regulation of miR-29c and miR-30c into down-regulation. This implies that at the transition of compensated to decompensated hypertrophy, collagen deposition pathways (i.e. down-regulation of miR-29c and miR-30c) are activated. 101

The MR+LBBB model The model of MR+LBBB is a newly developed model that provides the unique possibility to study the effect of volume overload in large animals. The fact that mitral regurgitation is also frequently occurring in heart failure patients, including those with LBBB, is another argument that the MR+LBBB model has a high translational value. The other, more frequently used animal model of dyssynchronous heart failure, is the tachypacing model. However, this model requires continuous high (>200 bpm) pacing. In addition, the increase in LV cavity size is better approaching clinical values in the MR model (~70% vs ~30%, MR vs tachypacing).43-45 The disadvantage of the model is its complexity and the severity of overload is less reproducible. Despite the control of MR induction by echo-Doppler, the severity of MR varied between dogs, also resulting in premature deaths in 25% of the animals. On the other hand, the variability in MR severity did provide the possibility to examine a range of severity in eccentric hypertrophy and heart failure. The best indications that the MR+LBBB model recapitulates clinical heart failure are that the clinical signs of heart failure observed in several dogs and the increase in both LV and RV EDP.

Conclusions The dyssynchrony-induced asymmetric hypertrophy is persistent even when dyssynchrony is accompanied by volume overload. CTGF and miR-133a play an important role in local as well as global hypertrophy. In the transition from compensated to decompensated hypertrophy, collagen deposition pathways are activated. These results indicate an intricate interaction between two (at least initially) different mechanical triggers in the transcriptional regulation of hypertrophy and collagen deposition.

102

CHAPTER 6 MiR expression during heart failure

References 1. Hunter JJ, Chien KR. Signaling pathways for cardiac hypertrophy and failure. N Engl J Med. 1999;341:1276-1283 2. Barth AS, Aiba T, Halperin V, DiSilvestre D, Chakir K, Colantuoni C, Tunin RS, Dimaano VL, Yu W, Abraham TP, Kass DA, Tomaselli GF. Cardiac resynchronization therapy corrects dyssynchrony-induced regional gene expression changes on a genomic level. Circ Cardiovasc Genet. 2009;2:371-378 3. van Oosterhout MF, Prinzen FW, Arts T, Schreuder JJ, Vanagt WY, Cleutjens JP, Reneman RS. Asynchronous electrical activation induces asymmetrical hypertrophy of the left ventricular wall. Circulation. 1998;98:588-595 4. Vernooy K, Verbeek XA, Peschar M, Crijns HJ, Arts T, Cornelussen RN, Prinzen FW. Left bundle branch block induces ventricular remodelling and functional septal hypoperfusion. Eur Heart J. 2005;26:91-98 5. Houser SR, Margulies KB, Murphy AM, Spinale FG, Francis GS, Prabhu SD, Rockman HA, Kass DA, Molkentin JD, Sussman MA, Koch WJ, American Heart Association Council on Basic Cardiovascular Sciences CoCC, Council on Functional G, Translational B. Animal models of heart failure: A scientific statement from the american heart association. Circ Res. 2012;111:131-150 6. Ryan TD, Rothstein EC, Aban I, Tallaj JA, Husain A, Lucchesi PA, Dell’Italia LJ. Left ventricular eccentric remodeling and matrix loss are mediated by bradykinin and precede cardiomyocyte elongation in rats with volume overload. J Am Coll Cardiol. 2007;49:811-821 7. Miyamoto T, Takeishi Y, Takahashi H, Shishido T, Arimoto T, Tomoike H, Kubota I. Activation of distinct signal transduction pathways in hypertrophied hearts by pressure and volume overload. Basic Res Cardiol. 2004;99:328-337 8. Liu Y, Dillon AR, Tillson M, Makarewich C, Nguyen V, Dell’Italia L, Sabri AK, Rizzo V, Tsai EJ. Volume overload induces differential spatiotemporal regulation of myocardial soluble guanylyl cyclase in eccentric hypertrophy and heart failure. J Mol Cell Cardiol. 2013;60:72-83 9. Andersen NM, Stansfield WE, Tang RH, Rojas M, Patterson C, Selzman CH. Recovery from decompensated heart failure is associated with a distinct, phase-dependent gene expression profile. J Surg Res. 2012;178:72-80 10. Li XM, Ma YT, Yang YN, Liu F, Chen BD, Han W, Zhang JF, Gao XM. Downregulation of survival signalling pathways and increased apoptosis in the transition of pressure overload-induced cardiac hypertrophy to heart failure. Clin Exp Pharmacol Physiol. 2009;36:1054-1061 11. Lai L, Leone TC, Keller MP, Martin OJ, Broman AT, Nigro J, Kapoor K, Koves TR, Stevens R, Ilkayeva OR, Vega RB, Attie AD, Muoio DM, Kelly DP. Energy metabolic reprogramming in the hypertrophied and early stage failing heart: A multisystems approach. Circ Heart Fail. 2014;7:1022-1031 12. D’Ascia C, Cittadini A, Monti MG, Riccio G, Sacca L. Effects of biventricular pacing on interstitial remodelling, tumor necrosis factor-alpha expression, and apoptotic death in failing human myocardium. European heart journal. 2006;27:201-206 13. Vanderheyden M, Mullens W, Delrue L, Goethals M, de Bruyne B, Wijns W, Geelen P, Verstreken S, Wellens F, Bartunek J. Myocardial gene expression in heart failure patients treated with cardiac resynchronization therapy responders versus nonresponders. Journal of the American College of Cardiology. 2008;51:129-136 14. Aiba T, Tomaselli GF. Electrical remodeling in the failing heart. Current opinion in cardiology. 2010;25:29-36 15. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of novel genes coding for small expressed rnas. Science. 2001;294:853-858 16. Lee RC, Feinbaum RL, Ambros V. The c. Elegans heterochronic gene lin-4 encodes small rnas with antisense complementarity to lin-14. Cell. 1993;75:843-854 17. Verbeek XA, Vernooy K, Peschar M, Cornelussen RN, Prinzen FW. Intra-ventricular resynchronization for optimal left ventricular function during pacing in experimental left bundle branch block. Journal of the American College of Cardiology. 2003;42:558-567 18. Strik M, van Middendorp LB, Vernooy K. Animal models of dyssynchrony. J Cardiovasc Transl Res. 2012;5:135-145 19. Verbeek XA, Vernooy K, Peschar M, Van Der Nagel T, Van Hunnik A, Prinzen FW. Quantification of interventricular asynchrony during lbbb and ventricular pacing. American journal of physiology. Heart and circulatory physiology. 2002;283:H1370-1378 103

20. Verbeek XA, Vernooy K, Peschar M, Cornelussen RN, Prinzen FW. Intra-ventricular resynchronization for optimal left ventricular function during pacing in experimental left bundle branch block. Journal of the American College of Cardiology. 2003;42:558-567 21. Fegler G. Measurement of cardiac output in anaesthetized animals by a thermodilution method. Q J Exp Physiol Cogn Med Sci. 1954;39:153-164 22. Arts T, Prinzen FW, Delhaas T, Milles JR, Rossi AC, Clarysse P. Mapping displacement and deformation of the heart with local sine-wave modeling. IEEE Trans Med Imaging. 2010;29:1114-1123 23. Da Costa Martins PA, De Windt LJ. Micrornas in control of cardiac hypertrophy. Cardiovascular research. 2012;93:563-572 24. Blaauw E, van Nieuwenhoven FA, Willemsen P, Delhaas T, Prinzen FW, Snoeckx LH, van Bilsen M, van der Vusse GJ. Stretch-induced hypertrophy of isolated adult rabbit cardiomyocytes. Am J Physiol Heart Circ Physiol. 2010;299:H780-787 25. van Bilsen M, Daniels A, Brouwers O, Janssen BJ, Derks WJ, Brouns AE, Munts C, Schalkwijk CG, van der Vusse GJ, van Nieuwenhoven FA. Hypertension is a conditional factor for the development of cardiac hypertrophy in type 2 diabetic mice. PLoS One. 2014;9:e85078 26. Sweat F, Puchtler H, Rosenthal SI. Sirius red f3ba as a stain for connective tissue. Arch Pathol. 1964;78:69-72 27. Prinzen FW, Hunter WC, Wyman BT, McVeigh ER. Mapping of regional myocardial strain and work during ventricular pacing: Experimental study using magnetic resonance imaging tagging. J Am Coll Cardiol. 1999;33:1735-1742 28. Liu Z, Hilbelink DR, Gerdes AM. Regional changes in hemodynamics and cardiac myocyte size in rats with aortocaval fistulas. 2. Long-term effects. Circ Res. 1991;69:59-65 29. Goktepe S, Abilez OJ, Parker KK, Kuhl E. A multiscale model for eccentric and concentric cardiac growth through sarcomerogenesis. J Theor Biol. 2010;265:433-442 30. Grossman W, Jones D, McLaurin LP. Wall stress and patterns of hypertrophy in the human left ventricle. J Clin Invest. 1975;56:56-64 31. Du Y, Plante E, Janicki JS, Brower GL. Temporal evaluation of cardiac myocyte hypertrophy and hyperplasia in male rats secondary to chronic volume overload. Am J Pathol. 2010;177:1155-1163 32. Duisters RF, Tijsen AJ, Schroen B, Leenders JJ, Lentink V, van der Made I, Herias V, van Leeuwen RE, Schellings MW, Barenbrug P, Maessen JG, Heymans S, Pinto YM, Creemers EE. Mir-133 and mir-30 regulate connective tissue growth factor: Implications for a role of micrornas in myocardial matrix remodeling. Circ Res. 2009;104:170-178, 176p following 178 33. Blaauw E, Lorenzen-Schmidt I, Babiker FA, Munts C, Prinzen FW, Snoeckx LH, van Bilsen M, van der Vusse GJ, van Nieuwenhoven FA. Stretch-induced upregulation of connective tissue growth factor in rabbit cardiomyocytes. J Cardiovasc Transl Res. 2013;6:861-869 34. Lips DJ, deWindt LJ, van Kraaij DJ, Doevendans PA. Molecular determinants of myocardial hypertrophy and failure: Alternative pathways for beneficial and maladaptive hypertrophy. Eur Heart J. 2003;24:883-896 35. da Costa Martins PA, Salic K, Gladka MM, Armand AS, Leptidis S, el Azzouzi H, Hansen A, Coenen-de Roo CJ, Bierhuizen MF, van der Nagel R, van Kuik J, de Weger R, de Bruin A, Condorelli G, Arbones ML, Eschenhagen T, De Windt LJ. Microrna-199b targets the nuclear kinase dyrk1a in an auto-amplification loop promoting calcineurin/nfat signalling. Nat Cell Biol. 2010;12:1220-1227 36. Matkovich SJ, Hu Y, Eschenbacher WH, Dorn LE, Dorn GW, 2nd. Direct and indirect involvement of microrna-499 in clinical and experimental cardiomyopathy. Circ Res. 2012;111:521-531 37. Ahmed MS, Oie E, Vinge LE, Yndestad A, Oystein Andersen G, Andersson Y, Attramadal T, Attramadal H. Connective tissue growth factor--a novel mediator of angiotensin ii-stimulated cardiac fibroblast activation in heart failure in rats. J Mol Cell Cardiol. 2004;36:393-404 38. Dean RG, Balding LC, Candido R, Burns WC, Cao Z, Twigg SM, Burrell LM. Connective tissue growth factor and cardiac fibrosis after myocardial infarction. J Histochem Cytochem. 2005;53:1245-1256 39. Chen MM, Lam A, Abraham JA, Schreiner GF, Joly AH. Ctgf expression is induced by tgfbeta in cardiac fibroblasts and cardiac myocytes: A potential role in heart fibrosis. J Mol Cell Cardiol. 2000;32:1805-1819 104

CHAPTER 6 MiR expression during heart failure 40. Finckenberg P, Inkinen K, Ahonen J, Merasto S, Louhelainen M, Vapaatalo H, Muller D, Ganten D, Luft F, Mervaala E. Angiotensin ii induces connective tissue growth factor gene expression via calcineurin-dependent pathways. Am J Pathol. 2003;163:355-366 41. Koitabashi N, Arai M, Kogure S, Niwano K, Watanabe A, Aoki Y, Maeno T, Nishida T, Kubota S, Takigawa M, Kurabayashi M. Increased connective tissue growth factor relative to brain natriuretic peptide as a determinant of myocardial fibrosis. Hypertension. 2007;49:1120-1127 42. van Rooij E, Sutherland LB, Thatcher JE, DiMaio JM, Naseem RH, Marshall WS, Hill JA, Olson EN. Dysregulation of micrornas after myocardial infarction reveals a role of mir-29 in cardiac fibrosis. Proc Natl Acad Sci U S A. 2008;105:13027-13032 43. Coleman HN, 3rd, Taylor RR, Pool PE, Whipple GH, Covell JW, Ross J, Jr., Braunwald E. Congestive heart failure following chronic tachycardia. American heart journal. 1971;81:790-798 44. Tanaka R, Spinale FG, Crawford FA, Zile MR. Effect of chronic supraventricular tachycardia on left ventricular function and structure in newborn pigs. J Am Coll Cardiol. 1992;20:1650-1660 45. Strik M, Rademakers LM, van Deursen CJ, van Hunnik A, Kuiper M, Klersy C, Auricchio A, Prinzen FW. Endocardial left ventricular pacing improves cardiac resynchronization therapy in chronic asynchronous infarction and heart failure models. Circulation. Arrhythmia and electrophysiology. 2011

105

Abstract chapter 7 Cardiac fibrosis is a major hallmark of cardiac diseases. For evaluation of cardiac fibrosis the development of highly specific and preferably non-invasive methods are desired. Our aim was to evaluate CNA35, a protein known to specifically bind to collagen, as a specific marker of cardiac fibrosis. Methods Fluorescently labeled CNA35 was applied ex vivo on tissue sections of fibrotic rat, mouse, and canine myocardium. After quantification of CNA35, sections were examined with Picrosirius red (PSR) and compared to CNA35. Furthermore, fluorescently labeled CNA35 was administered in vivo in mice. Hearts were isolated and CNA35 labeling was examined in tissue sections. Serial sections were histologically examined with PSR. Results Ex vivo application of CNA35 shows specific binding to collagen and a high correlation with PSR (Pearsonâ&#x20AC;&#x2122;s r=0.86 for mice/rats and r=0.98 for canine; both p<0.001). After in vivo administration, CNA35 labeling is observed around individual cardiomyocytes indicating its ability to cross the cardiac endothelium. High correlation is observed between CNA35 and PSR (r=0.91; p<0.001).

Conclusion CNA35 specifically binds to cardiac collagen, and can cross the endothelial barrier. Therefore, labeled CNA35 is useful to specifically detect collagen both ex vivo and in vivo and potentially can be converted to a non-invasive method to detect cardiac fibrosis.

106

CHAPTER 1 general introduction

Chapter 7 Ex vivo and in vivo administration of fluorescent CNA35 specifically marks cardiac fibrosis

Lars B. van Middendorp*, Sanne de Jong*, Robin H.A. Hermans, Jacques M.T. de Bakker, Marti F.A. Bierhuizen, Frits W. Prinzen, Harold V.M. van Rijen, Mario Losen, Marc A. Vos, Marc A.M.J. van Zandvoort Mol Imaging. 2014;13

* Authors contributed equally

107

Introduction Cardiomyocytes are imbedded in a network that is largely built from fibrillar collagens. Twenty-nine different types of collagen have been discovered up till now, but the heart primarily expresses type I (85%) and type III (11%).1 The collagen network provides tensile strength, preventing excessive dilatation, contributes to diastolic ventricular suction, and plays a role in intercellular communication by the connection with the intracellular cytoskeleton. However, disproportionally increased collagen deposition (fibrosis) is a major hallmark of several cardiac diseases, from scar formation after myocardial infarction to interstitial and patchy fibrosis observed in patients with various cardiomyopathies.2 The initially compensatory fibrotic response will, when not stopped, eventually lead to increased wall stiffness and diminish diastolic function. Additionally, increased collagen deposition is a potential substrate for arrhythmias.3-5 Currently, areas of fibrosis are frequently visualized non-invasively by MRI. This technique provides high-resolution images in any desired plane without radiation6 and offers a comprehensive overview of anatomy, function, and viability. The current gold standard, late gadolinium enhancement MRI (LGE-MRI), detects larger patches of scarred tissue. Especially in patients with ischemic heart disease, scar formation is clearly visible with LGE-MRI. Also in other cardiomyopathies, such as hypertrophic or dilated cardiomyopathy, patchy fibrosis can be picked up by LGE-MRI. Since detection of interstitial fibrosis by LGE-MRI is limited, new MRI techniques are currently developed to detect individual collagen strands. At current, T1 mapping is the most extensively studied MRI technique to detect diffuse fibrosis in patients with cardiac diseases,7-9 but this technique is not yet applicable in small animal models. Moreover, spatial resolution with current contrast agents is too low to visualize specific interstitial collagen strands. Thus, the amount of cardiac fibrosis could be under-diagnosed with LGEMRI as well as with T1 mapping.10 Furthermore, both techniques do not selectively and specifically image myocardial collagen and are merely a reflection of extracellular matrix expansion. Cardiac tissue can be histologically examined ex vivo, for fibrosis with dye stainings such as Picrosirius red (PSR) or with specific fluorescently labeled antibodies.11 Due to the highly noncentrosymmetric characteristics of fibrillar collagen, collagen can also be examined with second harmonic generation (SHG) microscopy.12 However, the acquirement of ventricular cardiac tissue in patients is not without risk and therefore histology or SHG imaging of biopsies is not preferred in the clinical setting to examine fibrosis. Nonetheless, in animal studies, histology is the most 108

CHAPTER 7 CNA35 marks cardiac fibrosis

commonly used technique for collagen detection in cardiac tissue. Due to the high clinical relevance of fibrosis formation and the limitations of the current techniques to detect collagen deposition, the development of new methods to specifically and unequivocally detect cardiac fibrosis, (preferably non-invasive) is desired. Recently Boerboom et al. developed a collagen-binding molecule, named CNA35.13 CNA35 is a 35 kDa bacterial binding protein domain of the Staphylococcus aureus bacterium that is easy to tag. CNA35 binds specifically to fibrillar collagen (Kd 10-7 to10-6M) with the strongest affinity for collagen type I and a relatively high affinity for collagen types II - IV.14 Previous studies have shown that fluorescently labeled CNA35 binds specifically to newly synthesized collagen in cultured fibroblasts,13 but also in the murine arterial wall both after ex vivo and in vivo administration of CNA35.13, 15 Ex vivo and in vitro imaging of small arterioles has shown that CNA35 is more specific and has a higher spatial resolution than other collagen visualizing techniques currently available.13 After intravenous administration of CNA35, collagen labeling is observed in the kidneys and liver.15 Based on these results, CNA35 is a promising candidate for highly specific collagen detection, and is of particular interest for translational research since CNA35 is easy to tag. However, the capability of CNA35 staining in the heart has not been properly addressed yet. The aim of the current study was to quantitatively and qualitatively assess myocardial collagen content after ex vivo and in vivo administration of fluorescently labeled CNA35.

109

Methods CNA35 (Maastricht University, Maastricht, the Netherlands) was obtained, purified, and labeled with the fluorescent dye FITC (Sigma-Aldrich, St Louis, MO, USA, 位excitation = 495 nm, 位em = 515 nm) or Alexa Fluor 568 (Invitrogen, Eugene, OR, USA, 位excitation = 568 nm, 位em = 580 nm) as described previously.14 Both CNA35FITC and CNA35-Alexa568 were diluted in saline-based buffer solutions. Animal models Animal handling was performed according to the Dutch Law on Animal Experimentation and the European Directive for the Protection of Vertebrate Animals used for Experimental and Other Scientific Purposes (86/609/EU). Mouse and rat experiments were approved by the Animal Experimental Committee of the University of Utrecht. Canine experiments were approved by the Animal Experimental Committee of Maastricht University. Ex vivo experiments were performed on slices of heart tissue from mice, rats, and canines. For murine tissue sections, mice were subjected to transverse aortic constriction (TAC, hereafter referred to as TAC mice), a model that leads to cardiac failure and marked ventricular interstitial fibrosis.16 Cardiac tissue sections were taken from rats with severe cardio-renal syndrome (CRS; hereafter referred to as CRS rats), since they are known to develop a combination of patchy and interstitial fibrosis.17 Cardiac biopsies were derived from canines with a left bundle branch block (LBBB) and mitral regurgitation (MR). MR was induced with a customized ablation catheter with a hook at the distal tip to grasp and ablate the chordae tendinae suspending the mitral leaflet. After four weeks of recovery, LBBB was induced as has been described previously.18 MR induces volume and pressure overload of the left atrium (LA), which induces severe fibrosis, initially of the LA, but when the disease progresses also in the right atrium (RA).19 The different animal models provide a variety of collagen deposition patterns and expression levels. In vivo experiments were carried out using calcineurin transgenic (MHC-CnA) mice and their wildtype (WT) littermates. The MHCCnA mouse model is a model in which a constitutively active form of calcineurin is overexpressed, specifically in the heart. This model has been characterized extensively.20, 21 In short, these mice develop cardiac hypertrophy already 18 days postnatal, which further progresses into heart failure and eventually can lead to sudden cardiac death. Moreover, this model shows high levels of interstitial myocardial fibrosis. 110

CHAPTER 7 CNA35 marks cardiac fibrosis

All the different animal models used for the ex vivo and in vivo experiments provide a wide range of fibrosis burden and distribution. Ex vivo labeling, imaging and quantification Frozen sections (10 μm) of biopsies of both ventricles and atria of two canines (n = 12 and n = 8 sections, respectively) with MR and LBBB and both atria of one control canine (n = 16 sections) were used to cover a wide variety of collagen expression levels. Frozen tissue sections (10 μm; 4-chamber view) from both CRS rats (n = 9 sections) and TAC mice (n = 4 sections) were used. Hoechst 33342 (16.2 mM; Invitrogen, OR, USA) and 2.5 μM CNA35FITC were used as specific fluorescent markers for DNA/RNA and collagen, respectively. CNA35-FITC in Hank’s Balanced Salt Solution buffer (HBSS buffer; Lonza, Verviers, Belgium) was combined in a ratio of 1:1 with a 250 times diluted stock concentration of Hoechst in HBSS buffer. Stained sections were imaged with an Olympus BX51WI spinning disk confocal fluorescence microscope coupled to a Hamamatsu EM-CCD C9100 digital camera. Stereo Investigator (MBF bioscience, Willistion, VT) was used to make high-resolution overview images of the tissue section. After imaging of CNA35-FITC the same tissue sections were stained with PSR. PSR served as a reference for fibrosis staining and was used for a head to head comparison of specificity of CNA35. PSR staining was performed as described previously.22 Briefly, slices were incubated in xylol for 30 minutes, and dehydrated in an ethanol series. Subsequently, slices were stained with 0.1% Sirius Red (Polysciences Inc., Warrington, PA, USA) in picric acid (Sigma-Aldrich Chemie GmbH, Steinheim, Germany), for one hour. PSR stained tissue was imaged using the same microscope, though using a QIcam color camera (Qimaging; Surrey, BC, Canada). ImageJ (Research Services Branch, National Institute of Mental Health, MA, USA) was used to calculate percentage of collagen by manually selecting the region of interest and adjusting the threshold. To compensate for bias in thresholding, the measurements were repeated three times per image and averaged to determine the collagen content per section. In vivo injection, ex vivo imaging and quantification Male MHC-CnA mice (> 8 weeks old)20 and their male WT littermates (> 8 weeks old) were used to determine the perfusion capability of CNA35 after in vivo administration of CNA35Alexa568. They were injected with two boluses of 200 μl 38 μM CNA35-Alexa568 (in phosphate buffered saline). To prevent fluid overload, a 15-minute interval between the two boluses was preserved. Just prior to sacrifice, 15 minutes after the second 111

dose, the mice were anesthetized with 4 % isoflurane in 40 % oxygen. Caprofen, 5 mg/kg (Pfizer inc., Capelle a/d Ijssel, the Netherlands) was administered subcutaneously as analgesic. Heparin (500 I.U.) was administered intraperitoneally as anti-coagulant to prevent clotting and accumulation of blood in the myocardium after sacrifice. Finally, the heart was excised, rinsed immediately and directly preserved in ice-cold saline. Qualitative examination of CNA35-Alexa568 labeling in MHC-CnA (n = 5) and WT hearts (n = 5) was performed within 5 hours using two-photon laser scanning microscopy (TPLSM). A Nikon E600FN microscope (Nikon, Tokyo, Japan), coupled to a standard BioRad 2100 multiphoton system (Bio-Rad, Hemel Hempstead, UK) was applied. A 150 fs-pulsed Ti:Sapphire laser (Spectra Physics Tsunami, Santa Clara, CA), tuned and mode-locked at 800 nm, was used as excitation source. A 60x magnification waterdipping lens was used to visualize individual myocytes embedded in the extracellular matrix. A HQ560LP filter was used to detect Alexa568. Wide-field fluorescence and transillumination microscopy on snap frozen tissue material was performed for a quantitative analysis of the CNA35-Alexa568 labeling. MHC-CnA (n = 4) and WT hearts (n = 4) were snap frozen and cut in 4-chamber view sections (10 μm slice thickness). CNA35 labeling was examined within 24 hours. Serial sections were used for PSR staining. CNA35 labeling and PSR staining were examined and quantified as described in the ex vivo section. Statistical analysis Data are presented as mean (± standard deviation). Statistical analysis was performed using Statistical Package for Social Sciences for Windows version 20.0 (IBM corp., NY, USA). A Pearson correlation linear regression analysis between CNA35 and PSR collagen percentages was performed. Bland-Altman analysis was performed to evaluate the accuracy of CNA35. A student’s t-test was performed to determine differences in fibrosis levels between two groups. A two-sided probability value p < 0.05 was considered a statistically significant difference.

112

CHAPTER 7 CNA35 marks cardiac fibrosis

Results Ex vivo labeling, imaging and quantification Ex vivo analysis of collagen labeling by CNA35-FITC showed that whole heart sections (mouse and rat) labeled with CNA35 corresponds to the PSR staining of serial sections (figure 1A-D). Average collagen concentration in mouse and rat heart sections was 9.6 ± 1.8 % and 20.2 ± 5.3 % respectively when determined with CNA35. When collagen concentration was determined with PSR comparable results were observed; 9.8 ± 1.6 % and 21.5 ± 4.2 % in mouse and rat sections, respectively. Paired analysis of CNA35-FITC and PSR in the mouse and rat heart sections resulted in a good correlation (r = 0.86, p < 0.001). Figure 1 Tissue sections stained with CNA35-FITC and PSR. Left panels: CNA35-FITC staining (green) and cell nuclei (blue) showing a clear demarcation of fibrous strands. Right panels: serial sections stained with Picrosirius red (PSR) (B and D) or the same section stained with PSR (F). A-B: Transverse aortic constriction mouse myocardium, C-D: Cardiorenal syndrome rat myocardium, E-F: atrial tissue from a canine with MR and LBBB. The dashed lines encompass the area of the magnification, which show that even the smallest collagen fibers are highlighted.

Ex vivo staining of canine biopsies collected from the atria and ventricles provided a wide range of fibrosis burden (2.8% - 24.0 %). Therefore CNA35 staining could be properly evaluated at low and high concentrations of collagen. Overall, there was a strong agreement between CNA35 and PSR labeling 113

of collagen, indicating the selective capacity of CNA35 to bind to myocardial collagen in canines. In the ventricular tissue, a collagen volume fraction of 4.7% ± 1.7% and 3.8 ± 1.1% was observed when determined with CNA35 and with PSR, respectively. Atrial tissue sections showed a collagen volume fraction of 7.9 ± 4.5% when determined with CNA35, which is comparable to the collagen volume fraction determined with PSR, 7.4 ± 4.5 %. The LA stained with CNA35 of canines with MR and LBBB had a significant higher collagen concentration than the RA (13.1 ± 5.4% vs. 8.2 ± 1.2%; respectively, p < 0.05). A representative picture of both CNA35 labeling and PSR staining of the canine atrium is shown in figure 1E and F. Quantification of paired CNA35 and PSR images showed a high correlation (r = 0.98 p < 0.001; figure 2). Bland-Altman analysis showed a minor but significant variability in collagen percentages measured by CNA35-FITC and PSR. CNA35-FITC estimated collagen concentration 0.67% higher than PSR (upper boundary 2.5% - lower boundary -1.2%; p < 0.05). Figure 2

In Vivo labeling, ex vivo imaging and quantification; Two-photon laser scanning microscopy After in vivo administration of CNA35-Alexa568, hearts from WT (n = 5) and MHC-CnA (n = 5) mice were isolated and visualized with TPLSM to observe CNA35-Alexa568 labeling in the viable tissue. The high tissue penetration depth and spatial resolution achieved using TPLSM makes it possible to visualize individual myocytes embedded in the extracellular matrix. Figure 3 clearly shows that CNA35-Alexa568 is able to pass the endothelial layer, penetrate the myocardial extracellular space, and bind to individual collagen strands. Both WT and MHC-CnA hearts showed CNA35 labeling surrounding the individual myocytes. Although quantification of the TPLSM images is not possible, the CNA35 labeling in the MHC-CnA hearts seems more intense than in the WT hearts.

114

Correlation between collagen examined with PSR and with CNA35 after ex vivo application in canine tissue. Left panel: correlation between the CNA35 and by Picrosirius red (PSR) in canine atrial (n=28) and ventricular tissue sections (n=8). The amount of collagen detected by CNA35-FITC is highly correlated with PSR (r=0.98, p<0.001). Right panel: Bland-Altman plot of collagen detection by CNA35 with respect to PSR. CNA35 detected a significant higher percentage of collagen than PSR staining (+0.67%; p<0.001).

CHAPTER 7 CNA35 marks cardiac fibrosis Figure 3 Two-photon laser scanning microscopy images of CNA35Alexa568 after in vivo administration. Panel A: representative TPLSM image of CNA35Alexa568 labeling (red) surrounding cardiomyocytes in a wildtype (WT) heart. Panel B: representative TPLSM image of a calcineurin transgenic (MHCCnA) heart with a similar view of cardiomyocytes surrounded with CNA35-Alexa568 (red). Although the CNA35 labeling has not been quantified, the MHC-CnA heart shows a more intense CNA35-Alexa568 signal compared to the WT heart. Both hearts are additionally stained with Syto41 (blue) to stain cell nuclei.

Quantitative analysis of CNA35-Alexa568 using histological slices After in vivo administration of CNA35-Alexa568, hearts from WT (n = 4) and MHC-CnA (n = 4) mice were isolated and sectioned. Collagen was determined with CNA35-Alexa568 labeling and compared to PSR. A representative picture from CNA35-Alexa568 and PSR is shown in figure 4.

Figure 4 MHC-CnA and WT heart stained with CNA35-Alexa568 after in vivo administration and with PSR. Top panels: whole tissue sections of a calcineurin transgenic (MHC-CnA) heart stained with CNA35-Alexa568 (A; red) and the serial section stained with Picrosirius red (PSR) (B). Lower panels: whole tissue sections of a wildtype (WT) heart stained with CNA35Alexa568 (C) and a serial section stained with PSR (D). Note the darker and less stained areas in the WT heart compared to the MHC-CnA heart. Magnification shows that even the smallest collagen fibers are highlighted, even in the WT mouse. The grey dashed lines show the areas of the magnification.

Cardiac collagen concentration determined with CNA35 in WT and MHC-CnA mice was 3.8 Âą 2.1 % and 9.3 Âą 3.6 %, respectively (p < 0.001). A strong correlation was observed between CNA35 and PSR (r = 0.91 p < 0.001; figure 5). This result confirms the 115

capability of CNA35-Alexa568 to pass the endothelial layer of the coronary arteries in both healthy and diseased mice and that CNA35 can be used to specifically visualize collagen in the myocardium. Bland-Altman analysis showed a minor but significant variability in collagen percentages measured after in vivo administration of CNA35-Alexa568 and PSR. CNA35-Alexa568 significantly estimated the collagen concentration 0.15% higher than PSR (upper boundary 3.5% lower boundary -3.2%; p<0.001) (figure 5). Figure 5

Altogether, these data show that there were no interspecies differences. Furthermore, the overall correlation between CNA35 and PSR was strong, even though there were large differences in degree and distribution of fibrosis between the animal models.

Discussion This study shows that 1) CNA35 specifically marks cardiac collagen in different species; 2) CNA35 is able to enter the myocardium after intravenous administration; and 3) CNA35 is able to specifically mark cardiac collagen after in vivo administration. The amount of collagen detected by the fluorescently labeled CNA35 is highly comparable with the amount of collagen determined by PSR, both after ex vivo and in vivo application. It has already been shown that CNA35 specifically binds to mouse, rat, bovine, and human fibrillar collagen types I-IV.7-9 The present study confirms the CNA35 binding to mouse and rat cardiac collagen and in addition we show specific collagen binding in canine myocardium. This supports the hypothesis that detection of collagen by CNA35 is species-independent. Furthermore, since the heart mainly expresses collagen type I and type III, CNA35 is a suitable candidate to evaluate cardiac fibrosis, but maybe less efficient for other pathologies throughout the body that are characterized by upregulation of other types of collagen. 116

Left panel: correlation plot of CNA35 against Picrosirius red (PSR) in wildtype and calcineurin transgenic (MHC-CnA) cardiac tissue sections (n=36). Especially hearts from MHCCnA mice show high levels of fibrosis. The amount of collagen detected by CNA35 is highly correlated with the amount of collagen stained with PSR (r=0.91, p<0.001). Right panel: Bland-Altman plot of collagen detection by CNA35 with respect to PSR. CNA35 detected a significant higher percentage of collagen than PSR staining (0.15%; p<0.001).

CHAPTER 7 CNA35 marks cardiac fibrosis

To confirm that CNA35 specifically labeled the cardiac collagen, PSR, a dye staining that is based on the acid dye Picrosirius red that strongly binds to the collagen, was used as a reference.22 In our ex vivo experiments we compared CNA35 labeling with PSR staining and observed a slightly higher CNA35 labeling compared to the collagen stained by PSR. Although the difference in the quantitative collagen detection is relatively low, it is statistically significant. The slightly, but significantly higher collagen detection by CNA35 might be caused by a difference in signal strength between fluorescent CNA35 confocal and bright field PSR confocal imaging. Indeed, small collagen fibers of PSR images generate a weaker signal that might be more difficult to quantify compared to fluorescent CNA35. Besides, the different animal models used indicate that CNA35 is capable of assessing collagen content in a wide variety of fibrosis burden and distribution. The amount of collagen marked with CNA35 in the different models in this study is comparable to the range of fibrosis that is measured in other studies. In LA tissue derived from MR dogs we observed a 1.8-fold increase in CNA35 labeling compared to the labeling in RA tissue. This result is in line with the 1.8-fold increase in LA fibrosis observed in patients with mitral valve disease compared to patients without mitral valve disease.19 Regarding the results after in vivo administration of CNA35-Alexa568 in mice, we observed a 2.4-fold increase in hearts from MHC-CnA mice compared to their WT littermates, which coincides with the study of Fontes et al., who observed a 2.8-fold increase in fibrosis in 4 weeks old MHC-CnA mice compared to WT littermates.23 To our knowledge, this is the first study that shows CNA35 labeling of individual cardiac collagen strands. Megens et al. have shown the binding of CNA35 labeled with Oregon Green 488 (OG488) in the collagenous part of the atherosclerotic plaques in mouse arteries, but no labeling in the healthy arteries after in vivo administration. In addition, they observed CNA35 labeling in the kidney, liver, and spleen after administration, but no CNA35 labeling in the heart. Based on these results they suggested that CNA35-OG488 enters tissue with a highly permeable endothelial phenotype.15 However, in our study we show that CNA35-Alexa568 can enter the myocardium, both in MHC-CnA and in WT mice, despite the tight endothelial barrier. This discrepancy might be caused by the different fluorophore that has been used. Although the molecular weight of OG488 is lower than that of Alexa568 (509 Da and 792 Da, respectively), other fluorophore characteristics, such as its chemical structure or charge, may influence the penetration of the endothelial barrier. Another explanation might be that cardiac collagen labeling by CNA35 was below their detection limit since Megens et al. studied mice with no known cardiac diseases and the collagen strands in the healthy myocardium 117

are small. Furthermore, the concentration of CNA35 used by Megens et al. was half the concentration we used. Mees et al. have labeled CNA35 with the radioactive agent (99m)Tc tricarbonyl and investigated the labeling of CNA35 to subendothelial collagen IV in tumor neovasculature.24 Also in this study, no CNA35 labeling in the healthy murine heart has been observed. However, the mice were imaged with a Îł-camera to detect tumors >10 mm in diameter. Therefore, the spatial resolution of the camera used in this study was too low to visualize collagen strands labeled with CNA35 in the healthy mouse heart. In a recent study by Danila et al. CNA35 labeled with gold nanoparticles has been studied as a new computed tomography (CT) contrast agent to detect myocardial scarring in mice. They have shown that labeled CNA35 in CT imaging detected large myocardial infarctions in the non-beating mouse heart.25 Although small patches of fibrosis were undetectable, these results together with the current study are promising to use labeled CNA35 for in vivo imaging of cardiac fibrosis. Altogether, the results support the hypothesis that fluorescently labeled CNA35 specifically marks cardiac fibrosis, both after ex vivo and in vivo administration. Although several techniques are already available to detect cardiac fibrosis in the experimental setting, the detection of cardiac collagen with CNA35 might have advantages compared to the current techniques. LGE-MRI is non-invasive, but only detects larger patches of fibrosis and is not capable of identifying diffuse fibrosis. T1 mapping, using gadolinium as a contrast agent can detect diffuse expansion of the extracellular matrix in the experimental setting. Still gadolinium is, as an extracellular contrast agent, not a specific marker. Not only fibrosis but also inflammation and edema can be picked up by T1 weighted mapping and an increase in signal is thus related to an increase in the extracellular volume and not increase in fibrosis per se.26 In contrast to dye stainings, CNA35 specifically binds to fibrillar collagen, whereas stainings such as PSR and Massonâ&#x20AC;&#x2122;s Trichrome are based on base/acid interactions and therefore may be not entirely collagen specific. In addition, in this study it has been shown that CNA35 can detect cardiac collagen after in vivo administration, which to our knowledge is not possible with other dyes. Regarding the collagen antibodies, CNA35 has the advantage that it can detect the various fibrillar types of collagen, whereas antibodies are only specific for one collagen type. In addition, antibodies are relatively large compared to CNA35, which makes it more difficult for them to penetrate the tissue.14 To examine collagen in viable tissue with CNA35 is therefore preferred above using antibodies. An additional advantage of CNA35 is that the binding to collagen is reversible. Unfortunately, details about the unbinding of CNA35 such as the half-life, the elimination pathway, and the toxicology of CNA35 118

CHAPTER 7 CNA35 marks cardiac fibrosis

are not known yet. More information about this unbinding process is a prerequisite to use CNA35 as an in vivo contrast agent in man to evaluate the process of fibrosis with either high-spatial resolution CT-scanning or MRI. Since CNA35 binding to collagen is not limited to the heart, the determination of collagen by CNA35 might also be of interest to detect the process of collagen formation in (viable) tissue in other diseases or in regenerative medical research. Study limitations Although this study shows the possibility of CNA35 to bind to cardiac collagen after in vivo administration, the used technique hampers direct translation of the current study to non-invasive imaging in the clinical setting, such as MRI or single-photon emission computed tomography (SPECT). Therefore, future experiments should further focus on CNA35 labeled with agents that can be used in these noninvasive imaging techniques that are suitable for the clinical setting. However, labeling of CNA35 with different agents, both fluorescent and other, might influence the permeability and binding affinity of CNA35. When experiments are conducted with a new agent, the binding capacity and permeability need to be re-assessed. This phenomenon should also be kept in mind when studies with different labeling agents are compared (i.a. OG488 versus Alexa568 labeling as discussed in the section above). Since the mice were sacrificed shortly after in vivo administration, information about the pharmacokinetic profile or any possible side effects of CNA35 is missing. At a first glance, the mice did not show any discomfort after CNA35 administration, but further pharmacological and pharmacokinetic investigation is necessary before it is safe to use in the clinical setting. Unfortunately, images from different hearts cannot be quantitatively compared with TPLSM. Indeed, imaging individual myocytes using TPLSM at high magnification forbids exact localization of the obtained images. Furthermore, laser light intensity differs depending on tissue depth and fluorescent binding. Nevertheless, the MHC-CnA hearts had a higher signal of CNA35 labeling than in the WT hearts. For exact quantification we therefore used histological slices.

Conclusion This study shows for the first time that CNA35 specifically binds to cardiac collagen strands, and that it crosses the cardiac endothelial barrier in both healthy and diseased myocardium. Therefore, labeled CNA35 can be used to specifically detect collagen in an ex vivo setup and after in vivo administration. 119

Acknowledgments The authors gratefully thank A.S. van der Sar for her assistance in the in vivo experiments. This research was performed within the framework of CTMM, the Center for Translational Molecular Medicine (www.ctmm.nl), project COHFAR (grant 01C-203), and supported by the Dutch Heart Foundation. Micrographs in this paper were taken with a confocal spinning disk microscope financed by The Netherlands Organisation for Scientific Research (NWO), grant number 911-06-003.

References 1. Weber KT, Janicki JS, Shroff SG, Pick R, Chen RM, Bashey RI. Collagen remodeling of the pressure-overloaded, hypertrophied nonhuman primate myocardium. Circ Res. 1988 Apr;62(4):757-65. PubMed PMID: 2964945. 2. Segura AM, Frazier OH, Buja LM. Fibrosis and heart failure. Heart Fail Rev. 2014 Mar;19(2):173-85. PubMed PMID: 23124941. 3. Partemi S, Batlle M, Berne P, Berruezo A, Campos B, Mont L, et al. Analysis of the arrhythmogenic substrate in human heart failure. Cardiovasc Pathol. 2013 Mar-Apr;22(2):133-40. PubMed PMID: 23036686. 4. Pogwizd SM. Focal mechanisms underlying ventricular tachycardia during prolonged ischemic cardiomyopathy. Circulation. 1994 Sep;90(3):1441-58. PubMed PMID: 7522134. 5. de Jong S, van Veen TA, van Rijen HV, de Bakker JM. Fibrosis and cardiac arrhythmias. J Cardiovasc Pharmacol. 2011 Jun;57(6):630-8. PubMed PMID: 21150449. Epub 2010/12/15. eng. 6. Mahrholdt H, Wagner A, Judd RM, Sechtem U, Kim RJ. Delayed enhancement cardiovascular magnetic resonance assessment of non-ischaemic cardiomyopathies. Eur Heart J. 2005 Aug;26(15):1461-74. PubMed PMID: 15831557. 7. White SK, Sado DM, Fontana M, Banypersad SM, Maestrini V, Flett AS, et al. T1 mapping for myocardial extracellular volume measurement by CMR: bolus only versus primed infusion technique. JACC Cardiovasc Imaging. 2013 Sep;6(9):95562. PubMed PMID: 23582361. 8. Liu CY, Liu YC, Wu C, Armstrong A, Volpe GJ, van der Geest RJ, et al. Evaluation of age-related interstitial myocardial fibrosis with cardiac magnetic resonance contrast-enhanced T1 mapping: MESA (Multi-Ethnic Study of Atherosclerosis). J Am Coll Cardiol. 2013 Oct 1;62(14):1280-7. PubMed PMID: 23871886. Pubmed Central PMCID: 3807823. 9. Iles L, Pfluger H, Phrommintikul A, Cherayath J, Aksit P, Gupta SN, et al. Evaluation of diffuse myocardial fibrosis in heart failure with cardiac magnetic resonance contrast-enhanced T1 mapping. J Am Coll Cardiol. 2008 Nov 4;52(19):1574-80. PubMed PMID: 19007595. 10. Karamitsos TD, Francis JM, Myerson S, Selvanayagam JB, Neubauer S. The role of cardiovascular magnetic resonance imaging in heart failure. J Am Coll Cardiol. 2009 Oct 6;54(15):1407-24. PubMed PMID: 19796734. 11. de Jong S, van Veen TA, de Bakker JM, van Rijen HV. Monitoring cardiac fibrosis: a technical challenge. Neth Heart J. 2012 Jan;20(1):44-8. PubMed PMID: 22161127. Pubmed Central PMCID: 3247628. Epub 2011/12/14. eng. 12. Williams RM, Zipfel WR, Webb WW. Interpreting second-harmonic generation images of collagen I fibrils. Biophys J. 2005 Feb;88(2):1377-86. PubMed PMID: 15533922. Pubmed Central PMCID: 1305140. Epub 2004/11/10. eng. 13. Boerboom RA, Krahn KN, Megens RT, van Zandvoort MA, Merkx M, Bouten CV. High resolution imaging of collagen organisation and synthesis using a versatile collagen specific probe. J Struct Biol. 2007 Sep;159(3):392-9. PubMed PMID: 17572104. 14. Krahn KN, Bouten CV, van Tuijl S, van Zandvoort MA, Merkx M. Fluorescently labeled collagen binding proteins allow specific visualization of collagen in tissues and live cell culture. Anal Biochem. 2006 Mar 15;350(2):177-85. PubMed PMID: 16476406. 15. Megens RT, Oude Egbrink MG, Cleutjens JP, Kuijpers MJ, Schiffers PH, Merkx M, et al. Imaging collagen in intact viable healthy and atherosclerotic arteries using fluorescently labeled CNA35 and two-photon laser scanning microscopy. Mol Imaging. 2007 Jul-Aug;6(4):247-60. PubMed PMID: 17711780. Epub 2007/08/23. eng. 120

CHAPTER 7 CNA35 marks cardiac fibrosis 16. Boulaksil M, Noorman M, Engelen MA, van Veen TA, Vos MA, de Bakker JM, et al. Longitudinal arrhythmogenic remodelling in a mouse model of longstanding pressure overload. Neth Heart J. 2010 Oct;18(10):509-15. PubMed PMID: 20978597. Pubmed Central PMCID: 2954305. Epub 2010/10/28. eng. 17. Bongartz LG, Braam B, Verhaar MC, Cramer MJ, Goldschmeding R, Gaillard CA, et al. Transient nitric oxide reduction induces permanent cardiac systolic dysfunction and worsens kidney damage in rats with chronic kidney disease. Am J Physiol Regul Integr Comp Physiol. 2010 Mar;298(3):R815-23. PubMed PMID: 20032261. 18. Verbeek XA, Vernooy K, Peschar M, Cornelussen RN, Prinzen FW. Intra-ventricular resynchronization for optimal left ventricular function during pacing in experimental left bundle branch block. J Am Coll Cardiol. 2003 Aug 6;42(3):558-67. PubMed PMID: 12906989. 19. Anne W, Willems R, Roskams T, Sergeant P, Herijgers P, Holemans P, et al. Matrix metalloproteinases and atrial remodeling in patients with mitral valve disease and atrial fibrillation. Cardiovasc Res. 2005 Sep 1;67(4):655-66. PubMed PMID: 15913581. Epub 2005/05/26. eng. 20. Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J, et al. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell. 1998 Apr 17;93(2):215-28. PubMed PMID: 9568714. Epub 1998/05/06. eng. 21. Bierhuizen MF, Boulaksil M, van Stuijvenberg L, van der Nagel R, Jansen AT, Mutsaers NA, et al. In calcineurin-induced cardiac hypertrophy expression of Nav1.5, Cx40 and Cx43 is reduced by different mechanisms. J Mol Cell Cardiol. 2008 Sep;45(3):373-84. PubMed PMID: 18662696. Epub 2008/07/30. eng. 22. Sweat F, Puchtler H, Rosenthal SI. Sirius Red F3ba as a Stain for Connective Tissue. Arch Pathol. 1964 Jul;78:69-72. PubMed PMID: 14150734. 23. Fontes MS, Raaijmakers AJ, van Doorn T, Kok B, Nieuwenhuis S, van der Nagel R, et al. Changes in Cx43 and NaV1.5 expression precede the occurrence of substantial fibrosis in calcineurin-induced murine cardiac hypertrophy. PLoS One. 2014;9(1):e87226. PubMed PMID: 24498049. Pubmed Central PMCID: 3909068. 24. Mees G, Dierckx R, Mertens K, Vermeire S, Van Steenkiste M, Reutelingsperger C, et al. 99mTc-labeled tricarbonyl hisCNA35 as an imaging agent for the detection of tumor vasculature. J Nucl Med. 2012 Mar;53(3):464-71. PubMed PMID: 22331218. Epub 2012/02/15. eng. 25. Danila D, Johnson E, Kee P. CT imaging of myocardial scars with collagen-targeting gold nanoparticles. Nanomedicine. 2013 Apr 3. PubMed PMID: 23563046. 26. Hwang SH, Choi BW. Advanced Cardiac MR Imaging for Myocardial Characterization and Quantification: T1 Mapping. Korean Circ J. 2013 Jan;43(1):1-6. PubMed PMID: 23408722. Pubmed Central PMCID: 3569561.

121

Abstract chapter 8 About one third of patients with mild dyssynchronous heart failure suffer from atrial fibrillation. Drugs that convert atrial fibrillation to sinus rhythm may further slowdown ventricular conduction. We aimed to investigate the electrophysiological and hemodynamic effects of Vernakalant and Flecainide in a canine model of chronic left bundle branch block (LBBB). Methods LBBB was induced in twelve canines. Four months later Vernakalant or Flecainide were administered using a regime, designed to achieve clinically used plasma concentrations of the drugs, n=6 for each drug. Results Epicardial electrical contact mapping showed that both drugs uniformly prolonged myocardial conduction time. Vernakalant increased QRS width significantly less than Flecainide (17Âą13% vs. 34Âą15% respectively). Nevertheless, both drugs equally decreased LV dP/dtmax by ~15%, LV dP/dtmin by ~10% and LV systolic blood pressure by ~5% (p=n.s. between drugs).

Conclusion Vernakalant prolongs ventricular conduction less than Flecainide, but both drugs had a similar, moderate negative effect on ventricular contractility and relaxation. Part of these reductions seem to be related to the increase in dyssynchrony.

122

CHAPTER 1 general introduction

Chapter 8 Electrophysiological and hemodynamic effects of Vernakalant and Flecainide in dyssynchronous canine hearts

Lars B. van Middendorp, Marc Strik, Patrick Houthuizen, Marion Kuiper, Jos G. Maessen, Angelo Auricchio and Frits W. Prinzen

Europace. 2014 Aug;16(8):1249-56

123

Introduction Atrial fibrillation (AF) is the most common cardiac arrhythmia and affects 1-2% of the general population.1,2 The prevalence is probably closer to 2% since AF can remain â&#x20AC;&#x2DC;silentâ&#x20AC;&#x2122; for a long time and many of these patients will never present to a hospital.3 Moreover, the prevalence of AF increases significantly with worsening heart failure.4 AF is a serious independent risk factor for cardiovascular complications or death.5 Several drugs are capable of converting recent-onset AF into sinus rhythm (SR). Flecainide is one of the most successful drugs used for pharmacological conversion of AF and can be used to prevent episodes of paroxysmal AF after direct current cardioversion.6,7 It is a Class Ic drug and primarily acts through blockade of the sodium channel, thus slowing myocardial conduction.8 In search of a more atrial-specific drug, Vernakalant was developed. The electrophysiological characteristics and mechanism of action of Vernakalant have been recently reviewed.9 Vernakalant blocks the potassium currents IKur, IKACh, Ikr and Ito and the sodium channel INa, but it has little effect on IK1 and IKs.10 Vernakalant increases the atrial effective refractory period in a dose dependent manner through blockage of the potassium channels. Furthermore, the inhibition of the sodium current was shown to be rate- and voltage-dependent, accordingly Vernakalant may slow conduction more in fast fibrillating atria than in the slower beating ventricles.11-13 Current EU guidelines contraindicate the use of Flecainide and Vernakalant in patients with NYHA class III and IV because of increased risks for arrhythmia and hypotension.14,15 Further evidence is scarce since these patients are often excluded in clinical trials. However, the guidelines do recommend pharmacological conversion of AF in patients with recent onset AF and no or minimal structural heart disease.16 Interestingly, the guidelines do not mention the presence of ventricular conduction abnormalities, such as left bundle branch block (LBBB), as a potential contraindication for the use of these drugs, even though several studies indicate conduction slowing by Vernakalant and Flecainide in hearts with a narrow QRS complex.17,18 A large percentage of patients with mild HF also have abnormal ventricular impulse conduction, for instance LBBB. The electrophysiological and hemodynamic effects of Vernakalant and Flecainide in hearts with minimal structural heart disease and dyssynchrony, is not yet known. In the current study the effect of Vernakalant and Flecainide on ventricular function and conduction was investigated in an established canine model of chronic dyssynchrony with mild cardiac dysfunction.19 124

CHAPTER 8 Vernakalant, Flecainide during LBBB

Methods Animal handling was performed according to the Dutch Law on Animal Experimentation and the European Directive for the Protection of Vertebrate Animals used for Experimental and Other Scientific Purposes (86/609/EU). The protocol was approved by the Experimental Animal Committee of Maastricht University. Experimental Models The experiments were performed on 12 adult mongrel dogs of either sex, weighing 21.7Âą4.4 kg. After induction with pentothal, anesthesia was maintained by continuous infusion of midazolam (0.25mg/kg/h) and sufentanil (3Îźg/kg/h). During a sterile closed-chest procedure, LBBB was induced by radiofrequency ablation as described in detail previously.20 Final experiments were performed 16-18 weeks after onset of LBBB. At that time the animals were induced using the same anesthesia as used for the first procedure. Experimental materials RV and LV pressure were measured by a 7-Fr catheter tip manometer (CD-Leycom, Zoetermeer, the Netherlands). A RF Marinr catheter (Medtronic, Heerlen, the Netherlands) was advanced into the right atrium for atrial pacing. Surface ECG was derived from the limb leads. After opening the fifth left intercostal space, two multi-electrode arrays containing 102 contact electrodes were placed around the base and mid-level of the heart to measure local RV and LV electrograms. Apical electrograms were measured by a small array of 4 electrodes. Infusion protocol Dogs were arbitrarily assigned to receive Vernakalant (n=6) (MSD, West Point, PA) or Flecainide (n=6) (Meda Pharma B.V., Amstelveen, The Netherlands). Both drugs were administered in a two-stage regime. The first stage of Vernakalant consisted of a slow IV infusion of 5.7 mg/kg in 15 minutes, followed by an interval of 15 minutes before the second infusion. The second infusion contained 2.3 mg/kg and was given in the same way over a 15 minute period. The aim of the split infusion regimen was to achieve a high, clinical used, plasma concentration. To verify whether the concentration levels of Vernakalant were within the designated range, plasma was collected. Plasma samples were analyzed for concentration of Vernakalant at Cardiome Pharma Corp (Vancouver, Canada). Similarly, Flecainide was administered in two stages. In the first stage, 1.5 mg/kg of Flecainide was 125

administered intravenously over a ten minute period. The second infusion of 2.5 mg/kg was given after a 15-minute interval. Based on earlier canine experiments, this dosage was expected to reach a plasma concentration of 5.0 Îźg/ml, which has comparable effects in canines as the highest clinically used plasma concentrations in patients.21 To take hemodynamic alterations due to changes in heart rate into account, the entire experiment was performed with atrial pacing approximately ten percent above the intrinsic rhythm present at baseline. This heart rate was kept constant throughout the protocol. Hemodynamic status was continuously monitored throughout the protocol. Electrical activation maps were recorded once every minute during infusion and after infusion. Data from historical controls (n=5) was used to take changes over time into account. These data were derived from previous experiments testing different ways of ventricular pacing, interspersed with control, no ventricular pacing, intervals.22 Data analysis Depolarization times were calculated for each individual epicardial electrode as the difference between earliest activation (earliest onset of Q-wave in all electrograms) and time of steepest deflection in the individual electrogram (-dV/dt). Based upon those depolarization times, total activation time (AT) was defined as maximal depolarization time difference.22 Electrocardiographic parameters were derived from the limb leads of the surface electrocardiogram. While QRS width and total AT reflect overall electrical dyssynchrony they do not express the spatial progression of the electrical wave front. For that purpose AT vectors were calculated. For each electrode a sub-vector was calculated using the depolarization time as amplitude and anatomical location, with the LV center as reference, for direction. The sub-vectors were summed to construct a mean epicardial mapping vector. Dyssynchrony can then be expressed by the contact mapping vector amplitude (VA-CM) while the main direction of conduction was expressed by the contact mapping vector direction (VD-CM).23 VD-CM was measured as angle from the reference to the RV free wall (0o) anterior LV (90o) and LV free wall (180o) with the aid of custom MATLAB software (MathWorks, Natick, MA).24 LV conduction velocity (CV) was determined by pacing an antero-lateral electrode in the epicardial electrode array at ~50% above the threshold and calculating the time between the pace artifact and the time of depolarization from four electrodes, two on both sides of the paced electrode. These times were divided by the known distances between paced and recording electrodes (1 and 2 cm, since interelectrode distance from the array is 1 cm). The average 126

CHAPTER 8 Vernakalant, Flecainide during LBBB

value of these four measurements was taken as CV. Mechanical interventricular dyssynchrony (MIVD) was assessed from the time difference of the upslope of LV and RV pressures.20 Hemodynamic data was analyzed as described previously with the aid of custom MATLAB software.25 LV dP/dtmax, the maximal first derivative of LV pressure, is a common index of contractility. Statistical analysis Data are presented as mean±standard deviation. Statistical analysis was performed using Statistical Package for Social Sciences for Windows version 20.0 (SPSS Inc., Chicago, IL). During infusion electrical activation maps and hemodynamic status were sampled every minute. Baseline electrical and hemodynamic data was obtained just prior to infusion. Final data was obtained within the first two minutes after the respective drug was entirely administered. These data was analyzed using linear mixed effect models for Vernakalant, Flecainide and the historical control group. This method is also known as multilevel analysis or mixed-effect analysis. The random intercept corrects for the correlation between repeated measurements. A two-sided probability value of p≤0.05 was considered statistically significant. The least squared differences correction was used for post hoc comparisons. Pearson’s r was calculated for the correlation between contractility and dyssynchrony.

127

Results Eleven of the twelve canines completed the protocol allowing evaluation of the hemodynamic and electrophysiological effect at baseline and after each of the two different doses. One dog in the Flecainide group died during the second stage of infusion due to cardiogenic shock. Data during the first stage of infusion from this dog are included in figure 3. Data from the historical control animals indicated that in the animal preparation used, all electrical and hemodynamic variables are essentially constant over the 45-minute duration of the protocol, except for a small but significant increase in heart rate (table 1). Plasma levels of Vernakalant reached values of 3.7Âą0.8 Îźg/ml at the end of the infusion protocol. Electrophysiological effects The electrical maps in the left panels of figure 1 show a typical LBBB type electrical activation pattern, which starts in the RV and then progresses around the LV wall towards the basal LV free lateral wall. The right panels show activation maps after administration of Flecainide and Vernakalant. While the sequence of activation remains similar, as can be deducted from the regular distribution of isochrones lines, the crowding of the isochrone lines and the increase in the number of colors indicate that both drugs slow down ventricular conduction. This was objectified by a tendency of a decrease in conduction velocity by Vernakalant and a significant decrease in conduction velocity by Flecainide. (table 1) Figure 1 Activation maps derived from the two epicardial electrode arrays, around the base and mid level of the heart, with a total of 102 electrodes and the apical electrode array of four electrodes, plotted on a 3D model of the LV and RV epicardium as previously reported.22 Both drugs show an increase in activation time after infusion as is reflected by crowding of isochrone lines and blue colors. Dashed lines resemble the level of the septum.

128

90±10# 0.85±0.10

82±17 N/A

-37±13

79±12 4±3 1214±142 -1277±303 39±4

141±35 355±17 80±16 N/A 178±8 59±1 -38±13

78±16 3±3 1187±212 -1199±320 41±5 23±12 8±5

QTc (ms)

Total AT (ms)

Conduction Velocity (m/s)

VD-CM (deg)

VA-CM (ms)

MIVD (ms)

LV systolic pressure (mmHg)

LV diastolic pressure (mmHg)

LV dP/dtmax (mmHg/s)

LV dP/dtmin (mmHg/s)

Tau (ms)

RV systolic pressure (mmHg)

RV diastolic pressure (mmHg)

8±4

26±13

57±2

179±10

353±19

137±32

11±5

48±14#

35±15

-1494±404

1360±300

8±1

86±15

-18±1#

63±10

190±19

350±10

126±27

92±11

PQ time (ms)

96±15

147±3#

12±8

43±11

37±16

-1236±433*#

1125±281*#

9±2#

82±16

-22±3

69±10

191±18

0.79±0.12

96±3*#

361±9

141±27

103±10*#

1147±3#

Vernakalant

Vernakalant Baseline

97±12

144±15*

Placebo

QRS width (ms)

Control

136±11

Baseline

Heart rate (bpm)

Table 1

7±8

36±8

39±9

-1333±454

1215±285

13±5

77±6#

-30±9#

57±5

197±14

0.83±0.28

87±11

358±29

148±35

94±11

144±8#

Baseline

9±8

33±7

41±6

-1134±272*#

978±231*#

14±4

72±6*§#

-37±15*

78±11*#

196±16

0.63±0.12*

117±20*#

394±25

163±53*

126±19*§#

150±4#

Flecainide

Table 1; Hemodynamic and electrical activation data at baseline and after infusion of Vernakalant and Flecainide. *P<0.05 Compared with own baseline, § P<0.05 Flecainide compared with Vernakalant at the time interval, # P<0.05 compared with control at the same time interval. Mean values and S.D. are presented.

CHAPTER 8 Vernakalant, Flecainide during LBBB

129

Both drugs significantly increased the duration of depolarization (QRS width) and the duration of atrial / atrioventricular conduction (PQ time), but no significant effect on repolarization time (QTc interval) was observed. (table 1) Flecainide increased QRS width and total AT significantly more than Vernakalant. On average QRS width increased by 13±5% vs. 34±15% for Vernakalant and Flecainide, respectively. Along with QRS width, total AT was prolonged by a similar extent (12±6% vs. 32±5%, respectively). (table 2) The VD-CM, a marker for the main direction of ventricular conduction, was ~200°, reflecting a direction of conduction predominantly from the RV to the LV free wall. (table 1, figure 2) VD-CM practically did not change during the protocol, indicating a stable main direction of conduction for both drugs. VA-CM, the amplitude of the conduction vector, tended to increase after infusion with Vernakalant and increased significantly after Flecainide, indicating an increase in unidirectional electrical dyssynchrony by Flecainide. Figure 2 left panel: Example of a 3D representation of cardiac activation, the ring of dots representing the location of the electrodes from which the short axis maps in the other panels are derived. The short axis views depict the activation times in a Vernakalant and a Flecainide experiment (colors) and the size and amplitude of the activation vector (arrow). The VA-CM values below the figures refer to the mean values and SD of the groups of animals.

Hemodynamic effects Baseline MIVD values were significantly lower in the Vernakalant group compared to the other two groups, despite equality in all other related variables. Flecainide, increased MIVD significantly, while the increase by Vernakalant did not reach the level of significance. (table 1) At the end of the infusion protocol LV systolic pressure was mildly (~5%) reduced by both drugs, but this decrease was only significant for Flecainide. 130

CHAPTER 8 Vernakalant, Flecainide during LBBB

LV dP/dtmax decreased significantly after Vernakalant by 17±4% which is similar to the 15±9% decrease of LV dP/dtmax by Flecainide. (table 2) The difference in relative decrease of LV dP/dtmax between the two drugs was not statistically significant. Both drugs also reduced LV dP/dtmin, an index of LV isovolumic relaxation. The drugs did not cause a significant change in tau, the time constant of decay of LV pressure in early diastole. Effects of both drugs on RV pressure were small. (table 1) Table 2; changes of electrophysiological and hemodynamic parameters, relative to their own baseline values. Data are expressed as % of baseline. *P<0.05 Compared with own baseline, § P<0.05 Flecainide compared with Vernakalant at the same dosage level

Table 2

Vernakalant

Flecainide

Heart rate

100±3

104±6

QRS width

113±5*

134±15*§

PQ time

113±13*

117±15*

QTc

103±2

106±6

Total AT

112±6*

132±5*

Conduction Velocity

90±4

81±10*

VD-CM

99±1

99±3

VA-CM

113±5

130±2*

MIVD

118±16

122±25*§

LV systolic pressure

95±6

94±5*

LV diastolic pressure

102±16*

110±19

LV dP/dtmax

83±4*

85±9*

LV dP/dtmin

89±12*

90±13*

RV systolic pressure

94±9*

94±10

RV diastolic pressure

112±37

113±48

Tau

111±6

111±27

In order to evaluate the relation between QRS widening and change in LV dP/dtmax during administration of the two drugs a time course of these variables during the infusion protocol was reconstructed and is depicted in figure 3. Flecainide caused a steady increase in QRS width, in parallel with a decrease in contractility during the first and second stage of infusion. This resulted in a significant correlation between QRS duration and LV dP/dtmax (r=0.66±0.22; p<0.01 and 0.65±0.23; p<0.01 for the first and second dose, respectively). A similarly high correlation coefficient was found during the first infusion stage of Vernakalant (r=0.79±0.20 p<0.01). However, during the second stage of Vernakalant infusion, contractility decreased without an 131

increase in QRS width, resulting in a lack of correlation between these parameters (r=0.25Âą0.22; p=0.57). The mean slope of the QRS duration â&#x20AC;&#x201C; LV dP/dtmax relation was -10-5 mmHg/s2 for both Vernakalant and Flecainide. Figure 3 Time course of QRS width (grey) and LV dP/dtmax (black) during infusion of Vernakalant (top) and Flecainide (bottom). Mean values and SD are presented. X-axis represents time in minutes.

132

CHAPTER 8 Vernakalant, Flecainide during LBBB

Discussion In the established model of chronic canine LBBB, with moderately depressed cardiac function, Vernakalant and Flecainide slow down ventricular conduction in a uniform manner, but Vernakalant does so significantly less than Flecainide. Both drugs equally reduced LV contractility, relaxation and systolic blood pressure. Therefore, hemodynamic side effects appear to be comparable for both drugs. Electrophysiological effects In the canine model of proximal LBBB the impulse conduction in the LV is entirely dependent on slow cell-to-cell conduction within the “working myocardium” rather than the rapid Purkinje system. Hence, the present data indicate that both drugs delay the slow cell-to-cell conduction, albeit this delay is more pronounced for Flecainide than for Vernakalant. The slower conduction results in a greater electrical dyssynchrony, as indicated by increased VACM and QRS width. In combination with an unchanged VD-CM of 200° this indicates a greater spatial imbalance between LV and RV activation. The lack of change in the main direction of conduction after the drugs certifies that the increased dyssynchrony is a result of uniform slowing of cell-to-cell conduction within both ventricles and is not a result of change in the direction of the activation wave front. In line with these observations is the increase in MIVD; increasing significantly after Flecainide and missing the 0.05 level of significance for Vernakalant. The relatively large effect of Flecainide on ventricular conduction is well established, notwithstanding that most data has been derived from hearts with a normal conduction system.18, 26 The increases in QRS width ranging from 11 up to 27% found in these studies are similar to the increase we observed in our dyssynchronous hearts of 34±15%. The increase in QRS width by Vernakalant in the present study appears comparable to the observations in human hearts by Dorian et al., who reported an increase in QRS width of 11±11% (15ms) during RV pacing, which creates a similar conduction pattern as LBBB.17 These investigators also noted a trend towards a similar relative increase in QRS width during atrial pacing, when ventricular impulse conduction uses the rapid Purkinje system instead of the slow cell-to-cell conduction. An approximately 10% increase in QRS width was also found in a phase II trial of Vernakalant in patients without HF or conduction disturbances and in rat hearts.27, 28

133

The reduction in myocardial conduction velocity by Vernakalant can be caused by a partial or less potent blockage of the fast sodium channel. The cardiac sodium channel is responsible for the fast upstroke of the cardiac action potential (phase 0) initiating cellular depolarization and propagation of the action potential.29 As shown by Fedida et al., the blockade of the sodium channel is, among others, rate dependent.10 The electrophysiological effects in the present study may be somewhat pronounced, due to the relatively high heart rate (150bpm), a result of the design to keep the heart rate constant although this heart rate is equal to the shortest cycle length (400ms) used by Dorian et al.17 In addition, it is not uncommon that the ventricular rate exceeds 150bpm in a patient with untreated AF. Flecainide has a 10-fold more potent INa blocking capacity than Vernakalant. Vernakalant is difficult to fit into the Vaughn-Williams classification since it is atrial selective. Furthermore its capacity to both block early activated potassium channels as well as sodium channels makes it possible to group Vernakalant both in class I and class III.28 The disparity in effects on CV, QRS width and total AT between Vernakalant and Flecainide in the present study reflects these known differences in binding kinetics and relative potency on sodium channel activity. Blockage of ventricular potassium channels by Vernakalant could theoretically prolong QTc but this was not observed. The lack of significant increase in repolarization time caused by Vernakalant can potentially be attributed to concomitant blockage of sodium currents. The minor effects of Vernakalant and Flecainide on QTc are comparable to findings in previous studies and appears in line with the absence of ventricular arrhythmias in earlier studies13, 30, 31 and in the present study. Hemodynamic effects An important and interesting finding, in this model with at most mild cardiac dysfunction, is the relation between dyssynchrony (QRS width) and contractility (LV dP/dtmax). This implies that the negative inotropic effect of these drugs is related to their decrease in conduction velocity. This is especially strong during the first stage of infusion of the drugs. This relationship fits with the known adverse effect of any dyssynchrony on cardiac pump function, such as LBBB and RV pacing.32, 33 However, the QRS width LV dP/dtmax relation may also be secondary to reduced calcium loading as a consequence of the drug-induced sodium channel blockade. This latter idea seems supported by the disappearance of this correlation during the second stage of infusion of Vernakalant. 134

CHAPTER 8 Vernakalant, Flecainide during LBBB

The increase in dyssynchrony seems not only to affect LV systolic function but also relaxation, as reflected by an increase in LV dP/dtmin. These data indicate that special attention seems warranted in patients with atrial fibrillation in NYHA class I or II and a conduction disorder, since myocardial conduction may be even slower than in our animal model. Vernakalant and Flecainide both caused a mild reduction in blood pressure. The hypotensive effect of Flecainide is also known from previous studies,28 and could be related to the decrease in LV dP/dtmax. Flecainide is known to induce hypotension in almost a quarter of the patients.15 The present study suggests that special attention may be warranted for patients with wide QRS complex in this regard. The mild hypotension induced by Vernakalant was, in our model, preceded by a brief hypertensive phase (data not shown). Such increase in LV systolic pressure has been observed earlier in a human study where a slight increase in blood pressure of 3 mmHg was found at a plasma concentration of 3Îźg/ml,31 the plasma level also reached in our study. Correspondingly, Vernakalant increased mean arterial pressure in conscious Beagle dogs by as much as 10%, although this increase did not reach the level of significance.30 Such rise in blood pressure may partly be due to peripheral vasoconstriction that was observed in an in vivo rat hind limb model.28 Furthermore, it appears that this vasoconstrictive effect fades out at higher plasma concentrations28, as was also shown by others.17, 27, 31 The present study indicates that also a reduction in contractility may contribute to the transition from slightly elevated to slightly reduced LV systolic pressure. Comments on the experimental model In the animal model used in the present study LV function is reduced by 20-30% as compared to normal canine hearts under the same conditions, but no overt heart failure is present, based on relatively low end diastolic pressures.34 Cardiac dysfunction and conduction may therefore approach those of patients with NYHA class I and a wide QRS complex. This is a specific subset of patients in which both drugs are not contra-indicated but these patients potentially are more susceptible to the negative effects described above. Besides the specific subset of patients, this model sets a baseline dyssynchrony condition, concealing the effect on the Purkinje system. We specifically paced at a fixed atrial rate to ascertain that the observed hemodynamic and electrical changes were not influenced by changes in heart rate. The constant heart rate during the protocol also resulted in low variability between doses and 135

protocols, so any electrical or hemodynamic changes cannot be attributed to differences in heart rate. It is also important to consider that these data have been acquired in anesthetized animals. It is not known as to whether midazolam / sufentanil anesthesia modulates the effects reported here or whether the effects are reproducible in awake animals. On the other hand, many factors not present in isolated cell or isolated muscle models can be taken into account in the canine LBBB model. In that regard it is interesting that a recent study in isolated trabeculae from explanted human hearts did not find a negative inotropic effect of Vernakalant.35 An important difference between isolated papillary muscle preparations and our in vivo model is that the muscles are field stimulated and, therefore, are not dependent on cell-to-cell conduction. Therefore, the slower impulse conduction, as reported here for Vernakalant in the present study, would not influence contraction in the isolated muscle preparation. In addition, isolated preparations are not connected to the peripheral circulation and to feed-back systems in the body, such as the autonomic nervous system. In contrast, the current in vivo model gives a closer approximation of the clinical situation, especially for patients with LBBB. Clearly the results of the present in vivo animal study warrant confirmation in patients in order to properly judge their clinical relevance. CV was calculated using the pace electrode as reference for time of activation. However that approach creates two uncertainties. First there is an unknown delay between the stimulus and actual depolarization of cells underneath the pace-electrode. Second, the size of the first activated area depends upon the pulse strength. While these factors influence the absolute value of CV, their effect is systematic, so that a change in CV by a drug still is reliably observed.

Conclusions From the current data we conclude that Flecainide and Vernakalant cause a uniform slowing of ventricular impulse conduction, as reflected by increases in QRS width and epicardial AT and unchanged vector direction, but that this effect is significantly smaller for Vernakalant. Both drugs similarly reduce contractility, which should be taken into account when using these drugs for treatment of atrial fibrillation in patients with mild HF and a conduction disorder. 136

CHAPTER 8 Vernakalant, Flecainide during LBBB

Acknowledgments The authors are very grateful to Dr. Jeffery Wheeler and Ms. Heather Cain (Cardiome Pharma Corp, Vancouver, Canada) for the determination of plasma Vernakalant concentrations.

References 1. Go AS, Hylek EM, Phillips KA, Chang Y, Henault LE, Selby JV, et al. Prevalence of diagnosed atrial fibrillation in adults: national implications for rhythm management and stroke prevention: the AnTicoagulation and Risk Factors in Atrial Fibrillation (ATRIA) Study. JAMA : the journal of the American Medical Association. 2001 May 9;285(18):2370-5. PubMed PMID: 11343485. Epub 2001/05/10. eng. 2. Stewart S, Hart CL, Hole DJ, McMurray JJ. Population prevalence, incidence, and predictors of atrial fibrillation in the Renfrew/Paisley study. Heart. 2001 Nov;86(5):516-21. PubMed PMID: 11602543. Pubmed Central PMCID: 1729985. Epub 2001/10/17. eng. 3. Aliot E, Capucci A, Crijns HJ, Goette A, Tamargo J. Twenty-five years in the making: flecainide is safe and effective for the management of atrial fibrillation. Europace. 2011 Feb;13(2):161-73. PubMed PMID: 21138930. Pubmed Central PMCID: 3024037. 4. Camm AJ, Kirchhof P, Lip GY, Schotten U, Savelieva I, Ernst S, et al. Guidelines for the management of atrial fibrillation: the Task Force for the Management of Atrial Fibrillation of the European Society of Cardiology (ESC). Europace : European pacing, arrhythmias, and cardiac electrophysiology : journal of the working groups on cardiac pacing, arrhythmias, and cardiac cellular electrophysiology of the European Society of Cardiology. 2010 Oct;12(10):1360-420. PubMed PMID: 20876603. Epub 2010/09/30. eng. 5. Stewart S, Hart CL, Hole DJ, McMurray JJ. A population-based study of the long-term risks associated with atrial fibrillation: 20-year follow-up of the Renfrew/Paisley study. The American journal of medicine. 2002 Oct 1;113(5):359-64. PubMed PMID: 12401529. Epub 2002/10/29. eng. 6. Berns E, Rinkenberger RL, Jeang MK, Dougherty AH, Jenkins M, Naccarelli GV. Efficacy and safety of flecainide acetate for atrial tachycardia or fibrillation. Am J Cardiol. 1987 Jun 1;59(15):1337-41. PubMed PMID: 3109229. 7. Van Gelder IC, Crijns HJ, Van Gilst WH, Van Wijk LM, Hamer HP, Lie KI. Efficacy and safety of flecainide acetate in the maintenance of sinus rhythm after electrical cardioversion of chronic atrial fibrillation or atrial flutter. Am J Cardiol. 1989 Dec 1;64(19):1317-21. PubMed PMID: 2511744. 8. Schilling RJ. Cardioversion of atrial fibrillation: the use of antiarrhythmic drugs. Heart. 2010 Mar;96(5):333-8. PubMed PMID: 19910286. Epub 2009/11/17. eng. 9. Savelieva I, Graydon R, Camm AJ. Pharmacological cardioversion of atrial fibrillation with vernakalant: evidence in support of the ESC Guidelines. Europace. 2013 Oct 9. PubMed PMID: 24108230. 10. Fedida D, Orth PM, Chen JY, Lin S, Plouvier B, Jung G, et al. The mechanism of atrial antiarrhythmic action of RSD1235. Journal of cardiovascular electrophysiology. 2005 Nov;16(11):1227-38. PubMed PMID: 16302909. Epub 2005/11/24. eng. 11. Buccelletti F, Iacomini P, Botta G, Marsiliani D, Carroccia A, Gentiloni Silveri N, et al. Efficacy and Safety of Vernakalant in Recent-Onset Atrial Fibrillation After the European Medicines Agency Approval: Systematic Review and Meta-Analysis. Journal of clinical pharmacology. 2011 Dec 13. PubMed PMID: 22167572. Epub 2011/12/15. Eng. 12. Camm AJ, Capucci A, Hohnloser SH, Torp-Pedersen C, Van Gelder IC, Mangal B, et al. A randomized active-controlled study comparing the efficacy and safety of vernakalant to amiodarone in recent-onset atrial fibrillation. Journal of the American College of Cardiology. 2011 Jan 18;57(3):313-21. PubMed PMID: 21232669. Epub 2011/01/15. eng. 13. Roy D, Pratt CM, Torp-Pedersen C, Wyse DG, Toft E, Juul-Moller S, et al. Vernakalant hydrochloride for rapid conversion of atrial fibrillation: a phase 3, randomized, placebo-controlled trial. Circulation. 2008 Mar 25;117(12):1518-25. PubMed PMID: 18332267. Epub 2008/03/12. eng. 14. Hallstrom AP, Anderson JL, Carlson M, Davies R, Greene HL, Kammerling JM, et al. Time to arrhythmic, ischemic, and heart failure events: exploratory analyses to elucidate mechanisms of adverse drug effects in the Cardiac Arrhythmia Suppression Trial. Am Heart J. 1995 Jul;130(1):71-9. PubMed PMID: 7611126. 137

15. Bash LD, Buono JL, Davies GM, Martin A, Fahrbach K, Phatak H, et al. Systematic review and meta-analysis of the efficacy of cardioversion by vernakalant and comparators in patients with atrial fibrillation. Cardiovasc Drugs Ther. 2012 Apr;26(2):167-79. PubMed PMID: 22418856. Epub 2012/03/16. eng. 16. Camm AJ, Lip GY, De Caterina R, Savelieva I, Atar D, Hohnloser SH, et al. 2012 focused update of the ESC Guidelines for the management of atrial fibrillation: an update of the 2010 ESC Guidelines for the management of atrial fibrillation. Developed with the special contribution of the European Heart Rhythm Association. Eur Heart J. 2012 Nov;33(21):2719-47. PubMed PMID: 22922413. 17. Dorian P, Pinter A, Mangat I, Korley V, Cvitkovic SS, Beatch GN. The effect of vernakalant (RSD1235), an investigational antiarrhythmic agent, on atrial electrophysiology in humans. Journal of cardiovascular pharmacology. 2007 Jul;50(1):35-40. PubMed PMID: 17666913. Epub 2007/08/02. eng. 18. Mehta D, Camm AJ, Ward DE. Clinical electrophysiologic effects of flecainide acetate. Cardiovascular drugs and therapy / sponsored by the International Society of Cardiovascular Pharmacotherapy. 1988 Mar;1(6):599-603. PubMed PMID: 3155304. Epub 1988/03/01. eng. 19. Strik M, van Middendorp LB, Vernooy K. Animal models of dyssynchrony. Journal of cardiovascular translational research. 2012 Apr;5(2):135-45. PubMed PMID: 22130900. Pubmed Central PMCID: 3306020. Epub 2011/12/02. eng. 20. Verbeek XA, Vernooy K, Peschar M, Cornelussen RN, Prinzen FW. Intra-ventricular resynchronization for optimal left ventricular function during pacing in experimental left bundle branch block. Journal of the American College of Cardiology. 2003 Aug 6;42(3):558-67. PubMed PMID: 12906989. Epub 2003/08/09. eng. 21. Ranger S, Nattel S. Determinants and mechanisms of flecainide-induced promotion of ventricular tachycardia in anesthetized dogs. Circulation. 1995 Sep 1;92(5):1300-11. PubMed PMID: 7648679. 22. Strik M, Rademakers LM, van Deursen CJ, van Hunnik A, Kuiper M, Klersy C, et al. Endocardial left ventricular pacing improves cardiac resynchronization therapy in chronic asynchronous infarction and heart failure models. Circulation Arrhythmia and electrophysiology. 2012 Feb;5(1):191-200. PubMed PMID: 22062796. Epub 2011/11/09. eng. 23. Wyman BT, Hunter WC, Prinzen FW, Faris OP, McVeigh ER. Effects of single- and biventricular pacing on temporal and spatial dynamics of ventricular contraction. American journal of physiology Heart and circulatory physiology. 2002 Jan;282(1):H372-9. PubMed PMID: 11748084. Epub 2001/12/19. eng. 24. van Deursen CJ, Strik M, Rademakers LM, van Hunnik A, Kuiper M, Wecke L, et al. Vectorcardiography as a tool for easy optimization of cardiac resynchronization therapy in canine left bundle branch block hearts. Circulation Arrhythmia and electrophysiology. 2012 Jun 1;5(3):544-52. PubMed PMID: 22534251. Epub 2012/04/27. eng. 25. Verbeek XA, Vernooy K, Peschar M, Van Der Nagel T, Van Hunnik A, Prinzen FW. Quantification of interventricular asynchrony during LBBB and ventricular pacing. American journal of physiology Heart and circulatory physiology. 2002 Oct;283(4):H1370-8. PubMed PMID: 12234787. Epub 2002/09/18. eng. 26. Tamargo J, Capucci A, Mabo P. Safety of flecainide. Drug safety : an international journal of medical toxicology and drug experience. 2012 Apr 1;35(4):273-89. PubMed PMID: 22435343. Epub 2012/03/23. eng. 27. Roy D, Rowe BH, Stiell IG, Coutu B, Ip JH, Phaneuf D, et al. A randomized, controlled trial of RSD1235, a novel anti-arrhythmic agent, in the treatment of recent onset atrial fibrillation. Journal of the American College of Cardiology. 2004 Dec 21;44(12):2355-61. PubMed PMID: 15607398. Epub 2004/12/21. eng. 28. Allison B, Yang Y, Pourrier M, Gibson JK. Comparison of the in vivo hemodynamic effects of the antiarrhythmic agents vernakalant and flecainide in a rat hindlimb perfusion model. J Cardiovasc Pharmacol. 2011 Apr;57(4):463-8. PubMed PMID: 21283020. Epub 2011/02/02. eng. 29. Harmer AR, Valentin JP, Pollard CE. On the relationship between block of the cardiac Na(+) channel and drug-induced prolongation of the QRS complex. British journal of pharmacology. 2011 Sep;164(2):260-73. PubMed PMID: 21480866. Pubmed Central PMCID: 3174407. Epub 2011/04/13. eng. 30. Bechard J, Pourrier M. Atrial selective effects of intravenously administered vernakalant in conscious beagle dogs. Journal of cardiovascular pharmacology. 2011 Jul;58(1):49-55. PubMed PMID: 21753258. Epub 2011/07/15. eng. 31. Mao Z, Wheeler JJ, Townsend R, Gao Y, Kshirsagar S, Keirns JJ. Population pharmacokinetic-pharmacodynamic analysis of vernakalant hydrochloride injection (RSD1235) in atrial fibrillation or atrial flutter. Journal of pharmacokinetics and pharmacodynamics. 2011 Oct;38(5):541-62. PubMed PMID: 21786177. Epub 2011/07/26. eng. 32. Vernooy K, Cornelussen RN, Verbeek XA, Vanagt WY, van Hunnik A, Kuiper M, et al. Cardiac resynchronization therapy 138

CHAPTER 8 Vernakalant, Flecainide during LBBB cures dyssynchronopathy in canine left bundle-branch block hearts. Eur Heart J. 2007 Sep;28(17):2148-55. PubMed PMID: 17611254. 33. Peschar M, de Swart H, Michels KJ, Reneman RS, Prinzen FW. Left ventricular septal and apex pacing for optimal pump function in canine hearts. J Am Coll Cardiol. 2003 Apr 2;41(7):1218-26. PubMed PMID: 12679225. 34. Vernooy K, Verbeek XA, Peschar M, Crijns HJ, Arts T, Cornelussen RN, et al. Left bundle branch block induces ventricular remodelling and functional septal hypoperfusion. Eur Heart J. 2005 Jan;26(1):91-8. PubMed PMID: 15615805. 35. Lynch JJ, Jr., Regan CP, Beatch GN, Gleim GW, Morabito CJ. Comparison of the Intrinsic Vasorelaxant and Inotropic Effects of the Antiarrhythmic Agents Vernakalant and Flecainide in Human Isolated Vascular and Cardiac Tissues. J Cardiovasc Pharmacol. 2012 Nov 22. PubMed PMID: 23188129.

139

Abstract chapter 9 Patients with heart failure and left bundle branch block (LBBB) are frequently treated with biventricular pacing (BiVP). Approximately one third of them suffer from atrial fibrillation (AF). Pharmacological conversion of AF is performed with drugs that slow ventricular conduction, but the effect of these drugs on the benefit of BiVP is poorly understood. Methods Experiments were performed in dogs with chronic LBBB, investigating the effect of Vernakalant and Flecainide (n=6 each) on hemodynamics and electrophysiology during epicardial and endocardial BiVP. The degree of dyssynchrony and conduction slowing were quantified using QRS width and epicardial electrical mapping. Results Compared with LBBB, epicardial and endocardial BiVP reduced QRS duration by 7±9%* and 20±13%*#, respectively (*p<0.05 compared with LBBB; #p<0.05 between modes). During BiVP the administration of Vernakalant and Flecainide increased QRS duration by 20±14%† and 34±10%†‡ (†p<0.05 compared with pre-drug BiVP, ‡p<0.05 between drugs). LV dP/dtmax decreased by 16±8%† during Vernakalant and by 14±15%† during Flecainide. The drugs did not affect the relative changes in QRS width and LV dP/dtmax induced by BiVP.

Conclusion Vernakalant and Flecainide decrease contractility, slow myocardial conduction velocity and increase activation time. The electrical and hemodynamic benefit of BiVP is not altered by the drugs.

140

CHAPTER 1 general introduction

Chapter 9 Electrophysiological and hemodynamic effects of Vernakalant and Flecainide during cardiac resynchronization in dyssynchronous canine hearts

Lars B. van Middendorp, Marc Strik, Patrick Houthuizen, Marion Kuiper, Jos G. Maessen, Angelo Auricchio and Frits W. Prinzen

J Cardiovasc Pharmacol. 2014 Jan;63(1):25-32 141

Introduction Cardiac resynchronization therapy (CRT) has been shown to reduce morbidity and mortality in patients with mild to severe heart failure (HF) and dyssynchrony.2 Despite CRTâ&#x20AC;&#x2122;s improvement in symptoms and left ventricular ejection fraction (LVEF), the risk of developing paroxysmal or persistent atrial fibrillation (AF) remains high.3 This encompasses the clinical dilemma whether patients who show increase in LVEF and a reduction in ventricular volumes (in some cases even normalization) may be treated with antiarrhythmic drugs such as Flecainide or Vernakalant for pharmacological cardioversion, since both are contraindicated in HF.4, 5 Both drugs are indeed capable of rapidly converting recentonset AF into sinus rhythm (SR) 6 whereas Flecainide can also be used to prevent episodes of paroxysmal AF after direct current cardioversion.7, 8 Compared to Flecainide, Vernakalant is relatively atrial selective; it acts on all phases of the action potential by blocking the potassium currents IKur, IKACh, Ikr and Ito and the sodium channel INa, but it has little effect on the IK1 and IKs receptors.9 Thus, at least in theory, Vernakalant may be preferred to Flecainide in patients with moderate LV dysfunction. Clinical evidence about interference of Vernakalant and Flecainide with CRT is not available since these patients are commonly excluded in AF studies. Therefore, it is clinically relevant to test, in a pre-clinical model, the potential interference of antiarrhythmic drugs with the positive inotropic effect elicited by CRT. In the present study we investigated the effect of Vernakalant and Flecainide, during acute biventricular pacing (BiVP), on ventricular function and conduction in an established canine model of chronic dyssynchrony presenting with moderately depressed left ventricular systolic function.10 Extensive electrical mapping and hemodynamic measurements were performed before and after infusion of either Vernakalant or Flecainide during conventional epicardial (EPI) and novel endocardial (ENDO) BiVP. We tested both pacing modalities because our previous studies showed that ENDO BiVP activates the LV in a more physiological manner and further improves LV function when compared with EPI BiVP.1, 11

142

CHAPTER 9 Vernakalant, Flecainide during CRT

Methods Animal handling was performed according to the Dutch Law on Animal Experimentation and the European Directive for the Protection of Vertebrate Animals used for Experimental and Other Scientific Purposes (86/609/EU). The protocol was approved by the Experimental Animal Committee of Maastricht University. Experimental Models The experiments were performed on 12 adult mongrel dogs of either sex, weighing 21.7Âą4.4kg. After induction with sodium thiopental, anesthesia was maintained by continuous infusion of midazolam (0.25mg/kg/h) and sufentanil (3Îźg/kg/h). During a sterile closedchest procedure, left bundle branch block (LBBB) was induced by radiofrequency ablation as described in detail previously.12 Final experiments were performed 16-18 weeks after onset of LBBB. At that time the animals were given the same anesthesia as used during the first procedure. Experimental Methods RV and LV pressure were measured by a 7-Fr catheter tip manometer (CD-Leycom, Zoetermeer, the Netherlands). A RF Marinr catheter (Medtronic, Heerlen, the Netherlands) was advanced into the right atrium to pace at a fixed atrial rate (AAI pacing) at approximately ten beats per minute above the intrinsic rhythm. Surface ECG was derived from the limb leads. After a thoracotomy, two multi-electrode arrays containing 102 electrodes were placed epicardially. The first array was placed around the base of the heart, the second was placed around the mid-level. Both arrays were used to measure local RV and LV electrograms. One of the electrodes positioned at the mid-level of the LV free wall was used as epicardial pacing electrode. Its four neighboring electrodes were used to calculate conduction velocity. In addition an endocardial plunge electrode was placed at the mid LV lateral wall for endocardial pacing. Apical electrograms were measured by a small array of 4 electrodes. A multi-electrode catheter (Daig Livewire TC, Minnetonka, MN) was positioned in the RV to record septal electrograms and simultaneously pace the RV apex. Infusion protocol Dogs were arbitrarily assigned to receive Vernakalant (n=6) (MSD, West Point, PA) or Flecainide (n=6) (Meda Pharma B.V., Amstelveen, the Netherlands). Both drugs were given in a two-dose regime. The first dose of Vernakalant was given using slow infusion of 5.7 mg/kg in 15 minutes, followed by an interval of 15 minutes before the second 143

dose. The second dose contained 2.3 mg/kg and was similarly given over a 15 minute period. The aim of the split dosing regimen was to achieve the target dose within 15 minutes and maintain this target for the next 45 minutes. To verify concentration levels of Vernakalant plasma samples were collected right after the first and second dose and analyzed at Cardiome Pharma Corp (Vancouver, Canada). The first dose of Flecainide, 1.5 mg/kg, was administered over a ten minute period. The second dose, 2.5 mg/kg, was given correspondingly, after a 15-minute interval. These doses are comparable to previous used concentrations of Flecainide in canine experimental models and are expected to reach a concentration of 1.8 * 10-5 mM.13, 14 Hemodynamic status was continuously monitored throughout the protocol. Five minutes prior to administration of both drugs and within five minutes after final administration, hemodynamic and electrophysiological effects of BiVP were assessed and compared with LBBB (AAI pacing). BiVP was performed by pacing the RV apex either in combination with an epicardial electrode on the LV mid lateral wall (EPI BiVP) or in combination with the LV endocardial electrode (ENDO BiVP). A fixed short AV-delay (80-100ms) was chosen to ensure full capture. VV-interval was set to 0ms. ENDO BiVP and EPI BiVP were randomly assigned. Each pacing modality was allowed to stabilize for a minute before hemodynamic and electrophysiological measurements were started. Data analysis Depolarization times were calculated for each individual electrode as the difference between onset of activation (ventricular pacing artifact during BiVP or Q wave during AAI pacing) and time of steepest negative deflection in the electrogram (-dV/dt). Total activation time (AT) was defined as the difference between the shortest and longest depolarization time. Electrocardiographic parameters were extracted from the surface electrocardiogram. While QRS width and total AT reflect overall electrical dyssynchrony they do not express the spatial progression of the electrical wave front. For that purpose AT vectors (ATV) were calculated in a short-axis circumference using the values of the depolarization times of all electrodes.15 The degree of dyssynchrony was expressed as the ATV amplitude (ms) and the main direction of conduction as the ATV angle (째). Angles were measured from the reference vector between the RV free wall (0째) anterior LV (90째) and LV free wall (180째) with the aid of custom MATLAB software (MathWorks, Natick, MA). During EPI BiVP conduction velocity could be estimated by averaging the dividend of the activation times of four neighboring electrodes and their known fixed distances.1 Mechanical interventricular dyssynchrony (MIVD) was assessed from the time difference of the upslope of normalized LV and RV pressures.12 Hemodynamic data was analyzed as described previously with the 144

CHAPTER 9 Vernakalant, Flecainide during CRT

aid of custom MATLAB software.16 LV dP/dtmax, the maximal first derivative of LV pressure, is a common index of contractility. Statistical analysis Data are presented as mean±standard deviation. Statistical analysis was performed using Statistical Package for Social Sciences for Windows version 20.0 (SPSS Inc., Chicago, IL). The effect of EPI and ENDO BiVP after Vernakalant or Flecainide was analyzed using linear mixed effect models. This method is also known as multilevel analysis or mixed-effect analysis. The random intercept corrects for the correlation between repeated measurements. The least squared differences correction was used for post hoc comparisons. A paired sample t-test was used for a head-tohead comparison between ENDO and EPI BiVP neglecting drug or dose. A two-sided probability value of p≤0.05 was considered statistically significant. Table 1; Hemodynamic and electrical activation data during forty-five minutes in a historical control group undergoing various pacing settings. # p<0.05 compared with T = 0 min

Table 1

Control AAI pacing T = 0 min

T = 45 min

Heart rate (bpm)

136±11

144±15#

QRS width (ms)

97±12

96±15

PQ time (ms)

141±35

137±32

QTc (ms)

355±17

353±19

Total AT (ms)

80±16

82±17

LV systolic pressure (mmHg)

78±16

79±12

LV diastolic pressure (mmHg)

3±3

4±3

LV dP/dtmax (mmHg/s)

1187±212

1214±142

LV dP/dtmin (mmHg/s)

-1199±320

-1277±303

RV systolic pressure (mmHg)

23±12

26±13

RV diastolic pressure (mmHg)

8±5

8±4

145

Results Data from a previous study showed that in the animal preparation used all electrical and hemodynamic variables are essentially constant over a 45-minute duration of the protocol (table 1).15 No statistical differences were noted in baseline values between the Vernakalant or Flecainide group. In eleven of the twelve experiments the effect of ENDO and EPI BiVP was evaluated at baseline and after the second dose of the drugs. One dog in the Flecainide group died during the infusion of the second dose due to cardiogenic shock. Plasma levels of Vernakalant reached the desired exposure target of 3μg/ml, (3.7±0.8 μg/ml). This concentration is equal to 1.1-5mM. There was no significant difference between plasma concentrations after the first and second dose. Electrophysiological effects The electrical activation map in the left panel of figure 1 shows a typical LBBB-type activation pattern, which starts in the RV and then progresses, through to septum, around the LV finally activating the LV lateral basal wall. ENDO and EPI BiVP reverse this conduction pattern by early activation of the LV lateral wall from which activation spreads towards the septum colliding with the activation wave front originating from the RV apex electrode (middle and right panel). Figure 1

During AAI pacing both drugs significantly increased QRS width (by 17±13% vs. 34±15% for Vernakalant vs. Flecainide) (table 2). During BiVP the drugs caused a similar relative increase in QRS width (20±14% vs. 34±10%; Vernakalant vs. Flecainide) when compared with pre-drug BiVP (figure 2, lower panel). Still, BiVP caused a similar and constant reduction in QRS width as compared to AAI pacing (figure 3, lower panel). ENDO BiVP reduced dyssynchrony significantly more than EPI BiVP (p< 0.05). Conduction velocity, calculated during EPI BiVP, was significantly 146

Activation maps derived from the Epicardial electrode arrays and plotted on a 3D model of the LV and RV Epicardium as previously reported.1 Dotted circles represent the epicardial electrode arrays. Typical examples are shown of a dyssynchronous activation pattern during LBBB (left panel) and a more synchronous activation pattern during EPI BiVP (middle panel) and ENDO BiVP (right panel) at baseline.

CHAPTER 9 Vernakalant, Flecainide during CRT

reduced by Flecainide, but only a trend towards reduction was seen after Vernakalant administration (table 2). Figure 2 LV dP/dtmax (top) and QRS width (bottom) during intrinsic ventricular conduction (AAI pacing), EPI and ENDO BiVP for both Vernakalant and Flecainide. Since the smallest QRS width goes hand in hand with the highest contractility the arrangement of plotting is reversed between the top and bottom panel. Standard deviations are mentioned in Table 1. # p<0.05 compared with pre-drug, â&#x20AC; p<0.05 Flecainide compared with Vernakalant at the same dosage level. * p<0.05 Endocardial compared with Epicardial pacing

Figure 3 Relative increase in LV dP/dtmax (top) and QRS width (bottom) during EPI and ENDO BiVP for both Vernakalant and Flecainide with respect to left bundle branch block (AAI pacing). Standard deviations are mentioned in Table 2. # p<0.05 compared with AAI.

During AAI pacing the ATV angle pointed towards the LV lateral wall (180Â°). The ATV angle did not change significantly after infusion of either drug, but the ATV amplitude tended to increase after Vernakalant and increased significantly after Flecainide. BiVP 147

changed the ATV angle towards an angle between the RV wall (0°) and the anterior LV wall (90°), indicating a main direction of conduction from the LV towards the RV. Besides a change in ATV angle, ATV amplitude decreased considerably upon BiVP, reflecting a more synchronous activation pattern. After infusion of both Vernakalant and Flecainide no significant changes were observed in either ATV angle or amplitude during BiVP (table 2, figure 4). Both drugs prolonged intrinsic PQ-time by approximately 17%. During BiVP PQ time remained equal because a fixed AV-delay was used. During AAI pacing as well as during BiVP no significant effect on QTc interval was observed, nor were any arrhythmias detected. Figure 4 Color coded activation sequence in a short-axis section at the level of the epicardial electrode arrays as depicted in Figure 2. Data are represented as bulls-eye plots, the most basal regions being represented in the most outward layer. 0° and 180° indicate the lateral wall of the RV and LV, respectively, 90° the anterior wall. Arrows represent the vector direction and amplitude, as calculated from the activation times. Activation time vector (ATV) amplitude values are mean± standard deviations of the averages of the entire groups.

Hemodynamic effects Associated with the slower electrical conduction induced by the drugs, MIVD increased significantly after Flecainide and tended to increase after Vernakalant. Conversely, BiVP lowered MIVD, indicating mechanical resynchronization. This mechanical resynchronization was more pronounced for ENDO BiVP than for EPI BiVP (table 2). During AAI pacing Vernakalant and Flecainide decreased LV dP/dtmax by 17±4% and 15±9%, respectively. Similar relative reductions in LV dP/dtmax were noted during EPI and ENDO BiVP, with decreases of 16±8% in the Vernakalant group and 14±15% in the Flecainide group (table 3, figure 2). BiVP increased 148

CHAPTER 9 Vernakalant, Flecainide during CRT

LV dP/dtmax by approximately 15%, independent of the presence, dose and kind of drug (figure 3). The absolute increase being 127Âą26 mmHg/s during EPI BiVP and 161Âą44 mmHg/s during ENDO BiVP. Combining data collected during administration of both drugs LV dP/dtmax increased significantly more during ENDO than during EPI BiVP (p<0.05). EPI and ENDO BiVP had no significant influence on LV systolic pressure (table 3). Vernakalant decreased LV systolic pressure to levels slightly, but non-significantly, below pre-drug values whereas Flecainide did decreased LV systolic pressure significantly below pre-drug values. Nevertheless, even for Flecainide the reduction in LV systolic pressure was modest with an average decrease of 5 mmHg (table 2). Both drugs reduced LV dP/dtmin and Tau, an index of LV isovolumic relaxation, but this was hardly affected by ENDO or EPI BiVP (table 3). Effects of both drugs on RV pressure were small.(table1) EPI and ENDO BiVP caused an insignificant reduction in RV systolic pressure (table 2). Relation between electrical dyssynchrony and pump function The various conditions that influence electrical dyssynchrony (drugs that slow impulse conduction to a variable amount, BiVP in two different modes, and the combination with each other) offer the opportunity to evaluate the relation between electrical dyssynchrony and pump function over a wide range of conditions. Figure 5 depicts a close relation between QRS width and LV dP/dtmax, regardless of the way this QRS width is achieved. For example, similar LV dP/dtmax values were observed in the Vernakalant group during baseline LBBB and ENDO BiVP after drug administration. Figure 5 LV dP/dtmax plotted as a function of QRS width for both Vernakalant (Solid lines) and Flecainide (dashed lines). For each dose the effect of EPI BiVP (squares) and ENDO BiVP (diamonds) is linked with the baseline values during AAI pacing (circles). Solid lines are linking pre-drug BiVP effects while dashed lines link the BiVP effect after the drug . Standard deviations are mentioned in Table 1.

149

150 96±3#

82±16

9±2# 1054 ±336# -1236 ±433# 43±11#

90±10

N/A

178±8

63±10

-18±1

86±15

8±1

1257 ±373

-1494 ±404

48±14

Total AT (ms)

Conduction Velocity (m/s)

ATV angle (deg)

ATV amplitude (ms)

MIVD (ms)

LV systolic pressure (mmHg)

LV diastolic pressure (mmHg)

LV dP/dtmax (mmHg/s)

LV dP/dtmin (mmHg/s)

RV systolic pressure (mmHg)

Tau (ms)

35±15

RV diastolic pressure (mmHg) 11±5

361±9

350±10

QTc (ms)

37±6

12±8

-22±3

69±10

179±10

N/A

103±10#

89±3

QRS width (ms)

147±3

drug

147±3

pre-drug

AAI pacing

Heart rate (bpm)

Table 2

38±3

8±4

40±7

-1359 ±420

1346 ±257

8±4

81±14

-12±8

35±21

84±62

0.85±0.10

73±8

360±16

84±12

147±3

pre-drug

41±5

8±3

37±6#

-1224 ±460#

1208 ±218#

8±3

77±16#

-15±11

39±25

87±68

0.79±0.12

81±12

372±10

94±12#

149±5

drug

Epicardial BivP

Vernakalant

36±3

9±5

38±7

-1363 ±417

1414 ±493

7±3

82±14

-8±3

27±16

60±58

N/A

70±18

350±20

76±13

148±3

pre-drug

40±5

10±5

36±6#

-1238 ±453#

1249 ±234#

7±2

79±18#

-1±3*

24±15

43±50

N/A

65±9

369±24

87±10#

145±9

drug

Endocardial BiVP

37±11

8±9

36±7

-1382 ±444

1224 ±323

13±5

77±6

-32±9

58±6

194±18

N/A

87±12

358±30

96±13

151±15

pre-drug

41±6

9±8

33±7

-1134 ±272#

978 ±231#

14±4

72±6#†

-37±15#

78±11#

196±16

N/A

117±20#

394±25

126±19#†

150±4

drug

AAI pacing

40±13

11±8

33±6

-1386 ±465

1400 ±400

9±7

78±4

-17±5

23±8

31±23

0.85±0.25

70±23

350±27

82±13

151±16

pre-drug

47±6

12±8

30±7

-1205 ±372#

1123 ±303#

10±8

74±6#

-17±6

31±19

34±23

0.63±0.12*

88±16#

364±16

114±7#†

149±4

drug

Epicardial BiVP

Flecainide

40±12

10±7

32±6

-1379 ±454

1443 ±389

8±6

78±4

-13±9

24±20

39±35

N/A

65±19

339±24

74±11

151±16

pre-drug

48±9

11±7

30±6

-1191 ±387#

1131 ±319#

9±8

75±5#

-16±12†

19±13

19±17

N/A

74±14#

365±13

102±7*#

150±3

drug

Endocardial BiVP

Table 2; Hemodynamic and electrical activation data during ENDO and EPI BiVP after infusion of Vernakalant and Flecainide. * p<0.05 Endocardial compared with Epicardial pacing, # p<0.05 compared with pre-drug † p<0.05 Flecainide compared with Vernakalant at the same dosage level.

52±47 51±24

-1±1#

110±8 98±4 93±5 92±33

103±4 81±8# 47±37 56±20 7±10 102±5 1±3

110±6# 99±4 93±5 91±30

QTc

Total AT

VD-CM

VA-CM

MIVD

LV systolic pressure

LV diastolic pressure

LV dP/dtmax

LV dP/dtmin

RV systolic pressure

RV diastolic pressure

99±2

7±9

83±11*#

103±3

94±10#

94±12

QRS width

101±2

drug

100±0

pre-drug

Epicardial BivP

Heart rate

Table 3

110±18

89±8

99±4

112±9

1±3

102±6

13±10

38±29

34±43

71±13#

99±5

81±14#

100±0

pre-drug

103±51

90±7

100±7

114±7#

-1±1#

100±2

20±7

26±15

27±35

67±9#

102±7

87±10#

101±2

drug

Endocardial BiVP

Vernakalant

113±34

92±6

100±4

114±5#

-1±1

101±2

16±5

24±16

16±11

69±18#

99±7

88±16#

100±0

pre-drug

110±28

90±8

106±12

114±16

0±1

103±5

21±12

31±25

18±12

77±20*#

99±8

93±9

99±2

drug

Epicardial BivP

101±20

89±10

100±6

118±2#

-1±1

101±3

19±6

30±23

21±20

67±17#

97±6

80±13#

100±0

pre-drug

108±29

90±10

105±16

115±13#

0±1

103±5

24±14

22±13

10±9

64±12#

99±10

80±10#

100±0

drug

Endocardial BiVP

Flecainide

Table 3; Percentage difference from LBBB (AAI pacing), MIVD and LV end diastolic pressure are expressed as absolute difference. # P<0.05 compared with AAI, * P<0.05 versus endo BiVP.

CHAPTER 9 Vernakalant, Flecainide during CRT

151

Discussion The present study shows that, in BiV paced ventricles, Vernakalant and Flecainide slow down myocardial conduction, prolong electrical activation and concordantly decrease LV contractility. However, the beneficial effect of both EPI and ENDO BiVP is preserved during administration of these drugs. In all these conditions ENDO BiVP reduces dyssynchrony more than EPI BiVP. Electrophysiological effects In this canine model of proximal LBBB the impulse conduction in the LV is entirely dependent on slow cell-to-cell conduction within the â&#x20AC;&#x153;working myocardiumâ&#x20AC;? rather than the rapid Purkinje system. This is true for the condition of proximal LBBB but even more for BiVP, where relatively slow cell-to-cell conduction in the working myocardium activates both the RV and the LV. The decrease in conduction velocity observed for both drugs is in line with the increase in total AT, ATV amplitude and QRS width, whereas the unaltered ATV angle indicates that this conduction slowing occurs uniformly. The observation that neither drug significantly changed ATV amplitude during BiVP implicates that both EPI and ENDO BiVP reduce electrical dyssynchrony to a similar extent for the entire range of conduction velocities investigated. The similar relative changes in the aforementioned variables during EPI and ENDO BiVP is interesting, because a previous study demonstrated that during ENDO BiVP a considerable part of ventricular activation occurs through early involvement of conduction through more rapidly conducting endocardial LV layers.1 Accordingly, the data from the present study indicate that both drugs slow conduction in all layers in the LV wall to a similar extent. This implicates that Vernakalant also has a potent effect on sodium currents, which is in line with a recent study form Wettwer et al. that strongly suggest that the main mode of action of Vernakalant is through the blockage of sodium channels instead of the assumed more potent and atrial selective blockage of IKur.17 The importance of a small ATV amplitude has been described in earlier studies of our group and is linked to optimal hemodynamic response.15,18 The present study also supports our earlier data that ENDO BiVP is to be favored over conventionally applied EPI BiVP with respect to indices of electrical dyssynchrony and pump function.1 The relative increase in QRS width by Vernakalant and Flecainide observed in the present study is comparable to that in previously reported studies that have predominantly been performed in 152

CHAPTER 9 Vernakalant, Flecainide during CRT

patients with normal ventricular conduction.19, 20 This similarity may be explained by a similar reduction in conduction velocity of the rapid Purkinje-system and the working myocardium.21 Yet, the slower conduction is likely to have stronger implications in hearts with abnormal conduction, such as during LBBB and likewise during BiVP. Hemodynamic effects In the present study two factors modify the electrical activation in the LBBB heart; BiVP and both drugs. It is well known that BiVP resynchronizes the heart and that this is associated with improved ventricular contractile function. The opposite holds true for Vernakalant and Flecainide, since they slow down ventricular conduction and thus effectively desynchronize the ventricles, which is associated with reduced contractility. On the other hand, sodium channel blockers may directly act negative inotrope and the observed decrease in contractility is potentially not related to the decrease in conduction velocity. In that regard it is interesting that a recent study in isolated trabeculae from explanted human hearts did not find a negative inotropic effect of Vernakalant. 22 An important difference between isolated papillary muscle preparations and our in vivo model is that the muscles are field stimulated and, therefore, are not dependent on conduction. Nevertheless, BiVP can be considered to counteract the reduction in contractility that is caused by the drugs irrespective of the mechanism through which contractility is decreased. An important and interesting observation in this study is that the relative increase in LV dP/dtmax due to BiVP was not influenced by administration of the drugs. This implies that during BiVP the tolerance for the negative effects of both drugs on dyssynchronous failing hearts may be larger. This observation is important because episodes of hypotension have been described for HF patients receiving Vernakalant and Flecainide.23, 24 An important side observation is the effects of uniformly slowed conduction velocity on paced ventricles. While this slow conduction is created pharmacologically, it may also help to improve our insight in the effect of CRT in hearts with slow conduction by other mechanisms, such as (uniform) fibrosis or reduced expression of gap junctions. While drug-induced increased activation times coincide with proportional reduction in contractility, the two modes of BiVP provide two â&#x20AC;&#x153;dosesâ&#x20AC;? of resynchronization that proportionally oppose the conduction slowing effects. One of the implications of this data may be that hearts with wider QRS complexes may require better resynchronization in order to achieve a good pump function and in these hearts endocardial CRT may thus be indicated. The other implication is that for a given mode of 153

resynchronization the effect is proportional to the degree of resynchronization, independent of the prevailing conduction velocity. Comments on the experimental model The chronic LBBB dog model shows moderately reduced left ventricular function and hypertrophy, but is not associated with clinical symptoms of heart failure. This however best reflects the clinical situation of patients who significantly improved after CRT. On the other hand, it may explain why the drugs affect blood pressure only to a minimal amount, since cardiac reserve and autonomic reflexes may compensate drug-induced hypotension. We specifically paced at a fixed atrial rate to ascertain that the observed hemodynamic and electrical changes were not influenced by alterations in heart rate. It is also important to consider that these data have been acquired in anesthetized animals. It is not known as to whether midazolam / sufentanil anesthesia modulates the effects reported here or whether the effects are reproducible in awake animals. Of course the results of the present in vivo animal study require confirmation in patients in order to properly judge their clinical relevance. Furthermore, the effects of BiVP presented here are acute effects and serve as surrogate for the long-term alterations achieved in patients who are chronically treated with CRT.

Conclusion Vernakalant and Flecainide decrease contractility, slow myocardial conduction velocity and increase activation time. However, the electrical and hemodynamic benefit of BiVP is not altered by the drugs, the effect being more pronounced for ENDO BiVP than for EPI BiVP.

154

CHAPTER 9 Vernakalant, Flecainide during CRT

Acknowledgments This study was financially supported in part by MSD. The authors are grateful to Dr. Jeffery Wheeler and Ms. Heather Cain (Cardiome Pharma Corp., Vancouver, Canada) for the determination of plasma Vernakalant concentrations.

References 1. Strik M, Rademakers LM, van Deursen CJ, van Hunnik A, Kuiper M, Klersy C, et al. Endocardial left ventricular pacing improves cardiac resynchronization therapy in chronic asynchronous infarction and heart failure models. Circulation Arrhythmia and electrophysiology. 2012 Feb;5(1):191-200. PubMed PMID: 22062796. Epub 2011/11/09. eng. 2. Leclercq C, Behar N, Mabo P, Daubert JC. Expanding indications for resynchronization therapy. Curr Cardiol Rep. 2012 Oct;14(5):540-6. PubMed PMID: 22843449. 3. Marijon E, Jacob S, Mouton E, Defaye P, Piot O, Delarche N, et al. Frequency of atrial tachyarrhythmias in patients treated by cardiac resynchronization (from the Prospective, Multicenter Mona Lisa Study). Am J Cardiol. 2010 Sep 1;106(5):688-93. PubMed PMID: 20723647. 4. Hallstrom AP, Anderson JL, Carlson M, Davies R, Greene HL, Kammerling JM, et al. Time to arrhythmic, ischemic, and heart failure events: exploratory analyses to elucidate mechanisms of adverse drug effects in the Cardiac Arrhythmia Suppression Trial. Am Heart J. 1995 Jul;130(1):71-9. PubMed PMID: 7611126. 5. Heldal M, Atar D. Pharmacological conversion of recent-onset atrial fibrillation: A systematic review. Scand Cardiovasc J. 2013 Feb;47(1):2-10. PubMed PMID: 23067130. 6. Schilling RJ. Cardioversion of atrial fibrillation: the use of antiarrhythmic drugs. Heart. 2010 Mar;96(5):333-8. PubMed PMID: 19910286. Epub 2009/11/17. eng. 7. Berns E, Rinkenberger RL, Jeang MK, Dougherty AH, Jenkins M, Naccarelli GV. Efficacy and safety of flecainide acetate for atrial tachycardia or fibrillation. Am J Cardiol. 1987 Jun 1;59(15):1337-41. PubMed PMID: 3109229. 8. Van Gelder IC, Crijns HJ, Van Gilst WH, Van Wijk LM, Hamer HP, Lie KI. Efficacy and safety of flecainide acetate in the maintenance of sinus rhythm after electrical cardioversion of chronic atrial fibrillation or atrial flutter. Am J Cardiol. 1989 Dec 1;64(19):1317-21. PubMed PMID: 2511744. 9. Fedida D, Orth PM, Chen JY, Lin S, Plouvier B, Jung G, et al. The mechanism of atrial antiarrhythmic action of RSD1235. Journal of cardiovascular electrophysiology. 2005 Nov;16(11):1227-38. PubMed PMID: 16302909. Epub 2005/11/24. eng. 10. Strik M, van Middendorp LB, Vernooy K. Animal models of dyssynchrony. Journal of cardiovascular translational research. 2012 Apr;5(2):135-45. PubMed PMID: 22130900. Pubmed Central PMCID: 3306020. Epub 2011/12/02. eng. 11. van Deursen C, van Geldorp IE, Rademakers LM, van Hunnik A, Kuiper M, Klersy C, et al. Left ventricular endocardial pacing improves resynchronization therapy in canine left bundle-branch hearts. Circ Arrhythm Electrophysiol. 2009 Oct;2(5):5807. PubMed PMID: 19843927. 12. Verbeek XA, Vernooy K, Peschar M, Cornelussen RN, Prinzen FW. Intra-ventricular resynchronization for optimal left ventricular function during pacing in experimental left bundle branch block. Journal of the American College of Cardiology. 2003 Aug 6;42(3):558-67. PubMed PMID: 12906989. Epub 2003/08/09. eng. 13. Sato S, Imagawa N. Effects of lidocaine and mexiletine on defibrillation energy requirements in animals treated with flecainide. Resuscitation. 1998 Mar;36(3):175-80. PubMed PMID: 9627068. 14. Salerno DM, Murakami MM, Johnston RB, Keyler DE, Pentel PR. Reversal of flecainide-induced ventricular arrhythmia by hypertonic sodium bicarbonate in dogs. Am J Emerg Med. 1995 May;13(3):285-93. PubMed PMID: 7755819. 15. Strik M, van Deursen CJ, van Middendorp LB, van Hunnik A, Kuiper M, Auricchio A, et al. Transseptal Conduction as an Important Determinant for Cardiac Resynchronization Therapy, as Revealed by Extensive Electrical Mapping in the Dyssynchronous Canine Heart. Circ Arrhythm Electrophysiol. 2013 Jul 19. PubMed PMID: 23873141. 16. Verbeek XA, Vernooy K, Peschar M, Van Der Nagel T, Van Hunnik A, Prinzen FW. Quantification of interventricular asynchrony during LBBB and ventricular pacing. American journal of physiology Heart and circulatory physiology. 2002 Oct;283(4):H1370-8. PubMed PMID: 12234787. Epub 2002/09/18. eng. 155

17. Wettwer E, Christ T, Endig S, Rozmaritsa N, Matschke K, Lynch JJ, et al. The new antiarrhythmic drug vernakalant: ex vivo study of human atrial tissue from sinus rhythm and chronic atrial fibrillation. Cardiovasc Res. 2013 Apr 1;98(1):145-54. PubMed PMID: 23341576. 18. van Deursen CJ, Strik M, Rademakers LM, van Hunnik A, Kuiper M, Wecke L, et al. Vectorcardiography as a tool for easy optimization of cardiac resynchronization therapy in canine left bundle branch block hearts. Circ Arrhythm Electrophysiol. 2012 Jun 1;5(3):544-52. PubMed PMID: 22534251. 19. Dorian P, Pinter A, Mangat I, Korley V, Cvitkovic SS, Beatch GN. The effect of vernakalant (RSD1235), an investigational antiarrhythmic agent, on atrial electrophysiology in humans. Journal of cardiovascular pharmacology. 2007 Jul;50(1):35-40. PubMed PMID: 17666913. Epub 2007/08/02. eng. 20. Roy D, Rowe BH, Stiell IG, Coutu B, Ip JH, Phaneuf D, et al. A randomized, controlled trial of RSD1235, a novel anti-arrhythmic agent, in the treatment of recent onset atrial fibrillation. Journal of the American College of Cardiology. 2004 Dec 21;44(12):2355-61. PubMed PMID: 15607398. Epub 2004/12/21. eng. 21. Roy D, Pratt CM, Torp-Pedersen C, Wyse DG, Toft E, Juul-Moller S, et al. Vernakalant hydrochloride for rapid conversion of atrial fibrillation: a phase 3, randomized, placebo-controlled trial. Circulation. 2008 Mar 25;117(12):1518-25. PubMed PMID: 18332267. Epub 2008/03/12. eng. 22. Lynch JJ, Jr., Regan CP, Beatch GN, Gleim GW, Morabito CJ. Comparison of the Intrinsic Vasorelaxant and Inotropic Effects of the Antiarrhythmic Agents Vernakalant and Flecainide in Human Isolated Vascular and Cardiac Tissues. J Cardiovasc Pharmacol. 2012 Nov 22. PubMed PMID: 23188129. 23. Bash LD, Buono JL, Davies GM, Martin A, Fahrbach K, Phatak H, et al. Systematic review and meta-analysis of the efficacy of cardioversion by vernakalant and comparators in patients with atrial fibrillation. Cardiovasc Drugs Ther. 2012 Apr;26(2):167-79. PubMed PMID: 22418856. Epub 2012/03/16. eng. 24. Crozier IG, Ikram H, Kenealy M, Levy L. Flecainide acetate for conversion of acute supraventricular tachycardia to sinus rhythm. Am J Cardiol. 1987 Mar 1;59(6):607-9. PubMed PMID: 3103410.

156

CHAPTER 9 Vernakalant, Flecainide during CRT

157

158

CHAPTER 1 general introduction

Chapter 10 General Discussion

159

Introduction The aim of the current thesis was to extend our knowledge on the structural, functional as well as the transcriptional changes that are taking place in the dyssynchronous hearts of clinically relevant animal models (chapters 5 till 7). A major emphasis was on the role of microRNAs. MicroRNA (miR)-133a proved to be an important player in the structural remodeling processes in hearts with LBBB all or not in combination with volume overload or cardiac resynchronization therapy (CRT). Especially the newly developed model of mitral regurgitation (MR) combined with LBBB (chapter 4), shed interesting lights on the interaction of local mechanical stimuli in LBBB and global volume overload (chapter 6). In chapters 8 and 9 we studied the impact of drugs that slow down cardiac impulse conduction on dyssynchronously activated hearts. This is important because a large percentage of patients with mild heart failure and LBBB also have atrial fibrillation (AF) that may be treated with these drugs. In this general discussion we will first discuss the structural remodeling in cardiac dyssynchrony, together with the functional and transcriptional changes and finally the pharmacological aspects of the dyssynchronous heart. Distinction between the effects of mechanical load and neurohumoral factors There are still important gaps in our knowledge about the nature of the triggers that induce cardiac hypertrophy, extracellular matrix (ECM) remodeling, or their interaction. Experimental models are important tools to fill these gaps. However, understanding the exact mechanisms of hypertrophy and fibrosis in most in vivo models is hampered by the fact that changes in hemodynamic load are often accompanied by changes in plasma levels of neurohumoral and growth factors. Isolated cardiac cells may be used to elucidate the role of these various factors.1 However, in vitro, cells are in an artificial environment that lacks interaction with neighboring cells and the ECM. The animal models of dyssynchrony provide a unique opportunity, because, in the in vivo situation they create regional differences in myocardial mechanical loading within a presumably similar neurohumoral environment in those regions. Thereby these models enable differentiation between consequences of local mechanical load and global neurohumoral factors that initiate the hypertrophic response. Canines are considered as the most suitable species for investigating the effects of LBBB, since the electro-physiological characteristics and the degree of dyssynchrony are comparable to that seen in humans with LBBB.2,3 Therefore, while cardiac dyssynchrony might be 160

CHAPTER 10 general discussion

induced in other species, the canine model is especially suited to differentiate between roles of local workload and global factors on cardiac remodeling. (chapter 3) We have investigated remodeling at the macroscopic (echocardiography, MRI), tissue (histology) and molecular level (Connective Tissue Growth Factor (CTGF), Collagen1A1 (Col1A1), Brain natriuretic peptide (BNP) and several miRs). A short description of the function of these factors can be found in chapter 2. Local mechanical load and hypertrophy LBBB leads to structural changes in the heart, with local hypertrophy in the latest activated regions.4, 5 We replicated these earlier findings and found that the ~20% increase in wall thickness on the echocardiographic measurements could almost completely be explained by the increase in histologically measured cardiomyocyte diameter. Increase in wall thickness due to extracellular matrix expansion is unlikely, since no change in collagen fraction or fibrosis was found. (chapter 5)6 The local hypertrophic response in the LVfw of LBBB hearts, coincides with local up-regulation of CTGF and down-regulation of miR-133a. CRT restores homogeneous CTGF expression and almost completely normalizes miR-133a expression (chapter 5). This data provides strong evidence for a local regulation of miR133a and CTGF, presumably as part of the regulation of local mechanical load-induced hypertrophy. Data from other studies have already shown that down-regulation of miR-133a leads to increased CTGF expression.7 The interaction of down-regulation of miR-133a and over-expression of CTGF may be partly responsible for the observed hypertrophy during LBBB. This interaction has already been suggested previously.1, 8 Heterogeneity in expression between the early (low mechanical load) and late (high mechanical load) activated regions during LBBB, is almost completely abolished by CRT. If, as suggested, local mechanical load initiates regional adaptations, it is not surprising that CRT can almost completely homogenize many molecular and genetic changes, since it virtually equalizes the mechanical load between the LVfw and septum.9 Other studies indicated that LBBB induces local changes in activity and expression of stress-related kinases10, tumor necrosis factor-Îą (TNF- Îą), L-type calcium channel density and connexin-43, all of which can be directly linked to hypertrophy, contractile function and conduction.10, 11 These molecular changes go hand in hand with numerous regional alterations in gene expression between the early and late activated regions which are involved in metabolic pathways, ECM remodeling and myocardial stress responses.11 161

An important question is, as to whether the gene expression pattern seen in the animal model of isolated LBBB is representative of patients with LBBB. After all, in patients with heart failure the heart is often dilated and it is not known how the remodeling processes due to volume overload and LBBB interfere. By combining significant volume overload with dyssynchrony, as in the MR+LBBB model, we were able to show that the patterns of locally different down-regulation of miR-133a and concomitant up-regulation of CTGF during LBBB, were less outspoken by the effect of MR. The close inverse relation between severity of heart failure, expressed as LV end diastolic pressure, and miR-133a expression indicate the strong effect of volume overload. On the other hand, asymmetric hypertrophy was certainly present in the MR+LBBB dogs despite the absence of regional difference in expression of CTGF or miR-133a, suggesting that not only these factors play a role in the response to local mechanical load. Factors that we did not come upon in chapter 5 or 6. Altogether these changes demonstrate the complicated processes involved in cardiac remodeling in dyssynchronous heart failure. Figure 1 depicts a concept diagram of the proposed interaction between the effects of local mechanical load and altered volume overload by MR on hypertrophy and collagen deposition. Local mechanical load, such as in isolated LBBB, induces local hypertrophy by down-regulation of miR-133a and subsequent upregulation of CTGF in the cardiomyocytes. Reduction of local mechanical load by CRT, normalizes miR-133a and CTGF expression to near normal levels and reverses the asymmetric hypertrophic response. In the MR+LBBB group, global overload further inhibits cardiomyocyte miR-133a expression and thus further upregulates CTGF. The strong effect of volume overload, conceals the statistical significant difference between the miR-133a and CTGF expression between the LVfw and septum induced by LBBB. Nonetheless, asymmetric hypertrophy is still present in MR+LBBB hearts. Figure 1 conceptual overview of the interaction between mechanical load and hemodynamic load affected by left bundle branch block (LBBB) and mitral regurgitation (MR) in the myocyte (left) and fibroblast (right). The strong effects of volume overload (thick white lines) conceals the effects on miR-133a and CTGF expression by local mechanical load (thin black lines) induced by LBBB. Grey line, mutual interaction between collagen deposition and hypertrophy. For further details, see text. 162

CHAPTER 10 general discussion

Neurohumoral based extracellular matrix remodeling Collagen deposition in control, LBBB and MR+LBBB hearts were comparable (chapter 5 and 6). The apparent absence of manifest fibrosis in MR+LBBB hearts corresponds with the minimal fibrosis observed in rat, rabbit and canine models of volume overload.6, 8, 12, 13 Even in patients with severely dilated hearts, the extent of fibrosis is low and comparable to what is found in these animal models.14 Nonetheless, post-mortem data revealed extensive fibrosis in hearts of patients with eccentric hypertrophy as the cause of death.15 This probably indicates that overt fibrosis only develops late in the course of the disease. The hint towards increased fibrotic remodeling, as evidenced by a higher collagen content in the LVfw of MR+LBBB hearts on Sirius red coupes and normalized Col1A1 expression, might be explained by the fact that some animals progressed had severe dilated hearts. In several animal models and in patients with cardiac disease, the expression of CTGF is commonly linked to fibrosis and collagen deposition.16-20 However, it is becoming increasingly recognized that CTGF is also involved in cardiac hypertrophy.8, 21, 22 This is especially the case when CTGF is induced by stretch- or volume overload. The dual function of CTGF could be explained by its multi-cellular source. It is tempting to suggest that CTGF expressed by cardiomyocytes is part of the hypertrophic response, whereas fibroblast-derived CTGF is related to fibrosis as also indicated by figure 1. The high CTGF levels found in dyssynchronous dogs without any sign of fibrosis could be explained by a predominant increase of CTGF originating from cardiomyocytes (chapter 5). In order to evaluate a possible role of CTGF changes in fibroblasts in our animal model, in situ hybridization in tissue sections would be required. A possible pro-fibrotic effect of CTGF in the LBBB hearts may have been overruled by overexpression of the anti-fibrotic miR-29c and miR-30c (figure 1). This hypothesis is further supported by the fact that in the MR+LBBB model, a tendency towards increased collagen deposition was found with a significant down-regulation of both miR-29c and miR-30c and even greater increase in CTGF. This could well be a fibroblast effect, since miR-30c is mainly expressed by fibroblast and inhibition of miR-30c also increases fibroblast CTGF expression.7 Not excluding other (not measured) factors we therefore favor the hypothesis that the increase in CTGF in LBBB (all or not in combination with MR) is predominantly restricted to cardiac myocytes and is related to hypertrophy. The down-regulation of miR-30c, miR-29c and possibly fibroblast based CTGF expression are responsible for the modest changes in collagen expression and fibrosis. (chapter 6) 163

In contrast to miR-133a, the response to CRT of miR-29c and miR-30c was not significant. Therefore, expression of these factors seems to be independent from local mechanical load and are perhaps regulated via systemic factors or specific contraction abnormalities still occurring in CRT (figure 1). Such factors may be produced by the heart as a consequence of the overall decrease in systolic and diastolic function.23-25 This situation, may, at the cellular level, lead to biomechanical stress that leads to production of circulating neuro-hormones, cytokines and reactive oxygen species that on their turn can activate signaling molecules within cardiac cells and alter gene transcription.26 The depressed cardiac function can also create systemic reactions, such as elevated sympathetic tone, activation of the renin-angiotensin-aldosterone system (RAAS) and a decreased responsiveness of the arterial baroreflex.27, 28 LBBB depresses cardiac function to roughly 70% of normal. Although superior to LBBB, CRT can only restore cardiac function to ~85% of a healthy heart with an intact conduction system.9 This incomplete recovery of cardiac function by CRT may thus sustain the biomechanical stress status and still activate global cardiac gene transcription. The lack of regional difference in miR-29c and miR-30c and their unresponsiveness to CRT may be explained by the ongoing biomechanical stress status and a possible low threshold for activation of these pathways. Imaging of cardiac collagen Human data about absolute collagen content in the heart are scarce since this requires invasive myocardial biopsies and usually only the septum is biopsied to minimize the risk. New imaging techniques could help us to specifically detect cardiac fibrosis throughout the heart. Currently non-invasive imaging of fibrosis is performed using MRI. This provides high-resolution images without radiation.29 Late gadolinium enhancement MRI (LGE-MRI), detects parts of the tissue where the infused gadolinium is retained relatively long. This may indicate fibrosis, but could also be acutely infarcted tissue or even edematous tissue. The current LGE-MRI technique is able to detect larger patches of late-enhanced tissue, making it especially suitable for patients with ischemic cardiac disease, although also in non-ischemic cardiomyopathies â&#x20AC;&#x153;scarsâ&#x20AC;? are detectable.30 Quantification of diffuse interstitial fibrosis is beyond the level of detection of LGE-MRI. T1 mapping is a promising, yet still incompletely validated, MRI technique capable of detecting diffuse fibrosis.31-34 The amount of cardiac fibrosis could be under-diagnosed with LGE-MRI and T1 mapping due to a too low spatial resolution for detection of single collagen strands.35 Furthermore, this technique does not selectively and specifically image collagen. 164

CHAPTER 10 general discussion

For this reason we explored the possibility to use CNA35 for specific collagen imaging to selectively and unequivocally measure myocardial collagen content (chapter 7). Ex vivo and in vitro imaging has shown that CNA35 is more specific and has a higher spatial resolution than any other collagen visualizing technique currently available.36 An important observation we made is that CNA35 is able to cross the cardiac endothelial barrier and specifically binds to cardiac collagen after injection in vivo. This opens the possibility to employ labeled CNA35 as a marker for fibrosis imaging. In chapter 7 we used CNA35 labeled with fluorescent probes. In vivo imaging of collagen requires a different kind of labeling. A logical next step was to double label CNA35 with gadolinium and the fluorescent probe Alexa-568. As proof op principle we performed an in vivo pilot study to test the capacity of CNA35 to detect myocardial collagen with current MRI techniques and correlate it with histological coupes (figure 2). Figure 2 Histological tissue sections of the remote (top) and infarct zone (bottom) of the pilot study using CNA35-gadolinium-Alexa-568 as contrast agent. CNA35 was unable to penetrate the infarct area (red X), despite clear demarcation on the Sirius red sections. MRI was unable to detect diffuse fibrosis. X denotes the location of the infarct area.

We used a myocardial infarction rat model to have the highest chance of detecting any collagen deposition with CNA35gadolinium. To our surprise CNA35-gadolinum-Alexa-568 was unable to infiltrate the infarcted area, despite clear staining of collagen throughout the non-infarcted areas. Logically, we were therefore unable to detect the infarct area using T1 weighted MRI with CNA35-gadolinum as contrast. Nor were we able to detect diffuse fibrosis with MRI since images with PBS as contrast agent were similar to those with CNA35-gadolinum as contrast agent. Possible explanations for not detecting diffuse fibrosis are I) CNA35-gadolinium contains too little gadolinium ions per CNA35 molecule, II) MRI resolution still too low. Although our pilot study was unsuccessful, CNA35 has a great potential as in vivo contrast agent in man to evaluate the process of diffuse fibrosis. Possibly high-spatial resolution CT-scanning with CNA35 yields greater success. Since CNA35 binding to collagen is not 165

limited to the heart, the determination of collagen by CNA35 might also be of interest to detect the process of collagen formation in (viable) tissue in other diseases or in regenerative medical research. As alternative to MRI imaging can be SPECT for what purpose CNA35 is bound to Technetium. Promising in vivo results have been achieved by labeling CNA35 labeled with 99mTc-(C0)3 (technetium) to detect collagen in tumor vasculature.37 Unfortunately, SPECT has a lower spatial resolution than MRI. Combining this technique with CT imaging could potentially overcome these problems. Although speculative, combining CNA35 with Fluor (18F)-positron emission tomography (F-PET) can potentially even further enhance imaging capacity, since it is more accurate than technetium in myocardial scar imaging.38 Interference of conduction slowing drugs with cardiac dyssynchrony and resynchronization About one third of patients with heart failure and LBBB (CRT candidates) suffer also from atrial fibrillation. Flecainide and Vernakalant are routinely used for cardio-pharmacological cardioversion of atrial fibrillation (AF).39 Current guidelines do not contraindicate LBBB for any of the cardio-pharmacological drugs used for conversion of AF. The only exception to this rule applies to Flecainide. Flecainide is contra-indicated in patients with a right bundle branch block combined with a partial LBBB (left anterior hemiblock),40 because its conduction slowing properties may lead to third-degree atrioventricular block. The interference of dyssynchronous electrical activation with the action of anti-arrhythmic drugs is an aspect that is hardly studied.41, 42 Theoretically, drugs that slow impulse conduction in ventricular tissue would also worsen dyssynchrony, but this has not yet been investigated. We demonstrated that Vernakalant as well as Flecainide worsen dyssynchrony (increase QRS width) and that the lower conduction velocity can be directly related to the negative inotropic effects (decrease in LV dP/dtmax) of these drugs (chapter 8, figure 3). Interestingly, figure 3 illustrates that there seems to be a common relation between (change of) QRS width and contractility, regardless of the cause of the change in QRS width (LBBB-, pacing- or pharmacologically-induced). In the era of increased attention for dyssynchrony, due to the rise of CRT, these data emphasize the importance of attention for conduction slowing as an important side effect of these drugs. At least in dyssynchronous hearts. Moreover these observations may also help to improve our insight in the effect of slow conduction by other mechanisms, such as (uniform) fibrosis or reduced expression of gap junctions. 166

CHAPTER 10 general discussion Figure 3 recapitulatory figure of chapter 5 and 6, showing an inverse relation between dyssynchrony (QRS width) and contractility (LV dP/dtmax) during (black dots) and after infusion of Vernakalant and Flecainide. Pre- and post-drug endo- and epicardial cardiac resynchronization was applied, showing that CRT can counteract the negative chrono- and inotropic effects of both drugs. r = -0.91, p < 0.001.

An atrial-selective drug could overcome these negative ventricular effects.43 Vernakalant has been marketed as such an atrial selective drug that only targets the ultra-rapidly activation potassium current (IKUr). However, our study demonstrated that the effects of Vernakalant and Flecainide are quite comparable (chapter 8). These findings have been recently supported by other studies showing that Vernakalant does not solely block the IKUr channel, but also IKACh, Ikr and Ito and the sodium channel INa.44, 45 Furthermore, Van Hunnik et al (submitted) have elegantly shown that Vernakalant primarily exhibits class Ic antiarrhythmic effects in the atrium, quite similar to Flecainide. The main effect of Vernakalant is thus through inhibition of sodium channels (INa) in both atria and ventricles. Not surprisingly, similar negative chronotropic effects for Vernakalant and Flecainide have been shown in hearts with a normal conduction system. The ~10% increase in QRS width in hearts with a normal conduction,41, 42, 46 has less impact on pump function than the same 10% increase in hearts with ventricular conduction disturbance, as we have shown in chapter 8. In this regard, one should be aware that the negative inotropic effect of both drugs is potentially dangerous in patients with mild heart failure and LBBB, a specific sub-group that falls outside the current exclusion criteria. Unfortunately, heart failure is an exclusion criterion in almost all clinical trials evaluating the effect of Vernakalant. The study that approximates heart failure patients closest, was performed in intensive care patients post cardiac surgery. In this study Vernakalant has been issued as safe in the critical postoperative phase.47 But it is noteworthy that still 83% of the eligible patients were excluded due to hypotension, and that ejection fraction in the remaining 17% was on average ~55%. In the patients that were 167

treated with Vernakalant, still one third suffered from hypotension sometimes even requiring inotropic support. Thus application of either Vernakalant or Flecainide in patients with mild heart failure, should be done with great care and under continuous hemodynamic monitoring. As shown in chapters 5 and 9 and in many other studies, CRT increases contractility and decreases QRS width.9, 24, 48, 49 In other words, CRT is positive inotropic due to better synchronized electrical activation. This raises the question if CRT treated patients, typically patients with moderate to severe heart failure, are protected against the negative chrono- and inotropic effects of Vernakalant and Flecainide. We demonstrated that this is indeed the case, the relative positive inotropic effect of CRT is independent of the presence, dose and kind of drug (chapter 9, figure 3). This means that patients treated with CRT are more resistant to the negative effects of these cardio-pharmacological agents and that, at least in theory, it is safer to administer the drugs to CRT treated patients. Logically, this requires confirmation in patients, in order to properly judge the clinical applicability.

Concluding remarks Our ultimate goal was to extend our knowledge about the impact of cardiac dyssynchrony on the heart, from gene expression, to structural remodeling and eventually assess the impact on the cardiac function. Dyssynchrony has a tremendous effect on any of these strongly interacting levels. The main new findings are summarized in figure 4. 168

Figure 4 overview of the main findings in this thesis regarding the structural, functional, transcriptional and pharmacological aspects of cardiac dyssynchrony. There is a strong interaction back and forward between these levels (long black arrows on the left). At the transcriptional level, the high workload in the LVfw of LBBB hearts inhibits the anti-hypertrophic miR133a, which, via increased expression of CTGF, leads to cardiomyocyte hypertrophy. On the other side in LBBB hearts the anti-fibrotic miR-29c and miR-30c are uniformly induced and can be related to the lack of fibrosis. CRT normalizes local mechanical load and miR-133a and CTGF expression, but has limited effect miR-29c and miR-30c. Mitral regurgitation (MR) leads to severe eccentric hypertrophy accompanied by a strong inhibition of miR-133a, miR-29c and miR-30c. Effects of LBBB and MR are additive in that there is also asymmetric hypertrophy in MR+LBBB hearts. Despite severely depressed expression of miR-29c and miR30c, no overt fibrosis is found in these animal models. Maybe new imaging techniques as addressed in chapter 7 can aid in the detection of diffuse fibrosis. CNA35 is a promising candidate in that regard, since it specifically detects collagen. Conduction slowing drugs have direct negative inotropic effect. CRT can counteract these negative effects and is in that regard an anti-dote for the negative effects of the conduction slowing drugs (chapter 8 and 9). Roman numbers in the lower right corners depict chapter numbers.

CHAPTER 10 general discussion

References 1. Blaauw E, van Nieuwenhoven FA, Willemsen P, Delhaas T, Prinzen FW, Snoeckx LH, et al. Stretch-induced hypertrophy of isolated adult rabbit cardiomyocytes. Am J Physiol Heart Circ Physiol. 2010 Sep;299(3):H780-7. PubMed PMID: 20639217. 2. Strik M, van Middendorp LB, Vernooy K. Animal models of dyssynchrony. J Cardiovasc Transl Res. 2012 Apr;5(2):135-45. PubMed PMID: 22130900. Pubmed Central PMCID: 3306020. 3. Allison JS, Qin H, Dosdall DJ, Huang J, Newton JC, Allred JD, et al. The transmural activation sequence in porcine and canine left ventricle is markedly different during long-duration ventricular fibrillation. J Cardiovasc Electrophysiol. 2007 Dec;18(12):1306-12. PubMed PMID: 17916154. 4. Prinzen FW, Cheriex EC, Delhaas T, van Oosterhout MF, Arts T, Wellens HJ, et al. Asymmetric thickness of the left ventricular wall resulting from asynchronous electric activation: a study in dogs with ventricular pacing and in patients with left bundle branch block. American heart journal. 1995 Nov;130(5):1045-53. PubMed PMID: 7484735. Epub 1995/11/01. eng. 5. Vernooy K, Verbeek XA, Peschar M, Crijns HJ, Arts T, Cornelussen RN, et al. Left bundle branch block induces ventricular remodelling and functional septal hypoperfusion. Eur Heart J. 2005 Jan;26(1):91-8. PubMed PMID: 15615805. 6. van Oosterhout MF, Prinzen FW, Arts T, Schreuder JJ, Vanagt WY, Cleutjens JP, et al. Asynchronous electrical activation induces asymmetrical hypertrophy of the left ventricular wall. Circulation. 1998 Aug 11;98(6):588-95. PubMed PMID: 9714117. 7. Duisters RF, Tijsen AJ, Schroen B, Leenders JJ, Lentink V, van der Made I, et al. miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remodeling. Circ Res. 2009 Jan 30;104(2):1708, 6p following 8. PubMed PMID: 19096030. 8. Blaauw E, Lorenzen-Schmidt I, Babiker FA, Munts C, Prinzen FW, Snoeckx LH, et al. Stretch-induced upregulation of connective tissue growth factor in rabbit cardiomyocytes. J Cardiovasc Transl Res. 2013 Oct;6(5):861-9. PubMed PMID: 23835778. 9. Vernooy K, Cornelussen RN, Verbeek XA, Vanagt WY, van Hunnik A, Kuiper M, et al. Cardiac resynchronization therapy cures dyssynchronopathy in canine left bundle-branch block hearts. Eur Heart J. 2007 Sep;28(17):2148-55. PubMed PMID: 17611254. 10. Chakir K, Daya SK, Tunin RS, Helm RH, Byrne MJ, Dimaano VL, et al. Reversal of global apoptosis and regional stress kinase activation by cardiac resynchronization. Circulation. 2008 Mar 18;117(11):1369-77. PubMed PMID: 18316490. 11. Barth AS, Aiba T, Halperin V, DiSilvestre D, Chakir K, Colantuoni C, et al. Cardiac resynchronization therapy corrects dyssynchrony-induced regional gene expression changes on a genomic level. Circ Cardiovasc Genet. 2009 Aug;2(4):371-8. PubMed PMID: 20031609. Pubmed Central PMCID: 2801868. 12. Akar FG, Spragg DD, Tunin RS, Kass DA, Tomaselli GF. Mechanisms underlying conduction slowing and arrhythmogenesis in nonischemic dilated cardiomyopathy. Circ Res. 2004 Oct 1;95(7):717-25. PubMed PMID: 15345654. 13. Kim KH, Kim YJ, Lee SP, Kim HK, Seo JW, Sohn DW, et al. Survival, exercise capacity, and left ventricular remodeling in a rat model of chronic mitral regurgitation: serial echocardiography and pressure-volume analysis. Korean Circ J. 2011 Oct;41(10):603-11. PubMed PMID: 22125560. Pubmed Central PMCID: 3221903. 14. Yamada T, Hirashiki A, Cheng XW, Okumura T, Shimazu S, Okamoto R, et al. Relationship of myocardial fibrosis to left ventricular and mitochondrial function in nonischemic dilated cardiomyopathy--a comparison of focal and interstitial fibrosis. J Card Fail. 2013 Aug;19(8):557-64. PubMed PMID: 23910585. 15. Unverferth DV, Baker PB, Swift SE, Chaffee R, Fetters JK, Uretsky BF, et al. Extent of myocardial fibrosis and cellular hypertrophy in dilated cardiomyopathy. Am J Cardiol. 1986 Apr 1;57(10):816-20. PubMed PMID: 2938462. 16. Ahmed MS, Oie E, Vinge LE, Yndestad A, Oystein Andersen G, Andersson Y, et al. Connective tissue growth factor--a novel mediator of angiotensin II-stimulated cardiac fibroblast activation in heart failure in rats. J Mol Cell Cardiol. 2004 Mar;36(3):393-404. PubMed PMID: 15010278. 17. Dean RG, Balding LC, Candido R, Burns WC, Cao Z, Twigg SM, et al. Connective tissue growth factor and cardiac fibrosis after myocardial infarction. J Histochem Cytochem. 2005 Oct;53(10):1245-56. PubMed PMID: 15956033.

169

18. Chen MM, Lam A, Abraham JA, Schreiner GF, Joly AH. CTGF expression is induced by TGF- beta in cardiac fibroblasts and cardiac myocytes: a potential role in heart fibrosis. J Mol Cell Cardiol. 2000 Oct;32(10):1805-19. PubMed PMID: 11013125. 19. Finckenberg P, Inkinen K, Ahonen J, Merasto S, Louhelainen M, Vapaatalo H, et al. Angiotensin II induces connective tissue growth factor gene expression via calcineurin-dependent pathways. Am J Pathol. 2003 Jul;163(1):355-66. PubMed PMID: 12819040. Pubmed Central PMCID: 1868168. 20. Koitabashi N, Arai M, Kogure S, Niwano K, Watanabe A, Aoki Y, et al. Increased connective tissue growth factor relative to brain natriuretic peptide as a determinant of myocardial fibrosis. Hypertension. 2007 May;49(5):1120-7. PubMed PMID: 17372041. 21. Hayata N, Fujio Y, Yamamoto Y, Iwakura T, Obana M, Takai M, et al. Connective tissue growth factor induces cardiac hypertrophy through Akt signaling. Biochem Biophys Res Commun. 2008 May 30;370(2):274-8. PubMed PMID: 18375200. 22. Leask A. Potential therapeutic targets for cardiac fibrosis: TGFbeta, angiotensin, endothelin, CCN2, and PDGF, partners in fibroblast activation. Circ Res. 2010 Jun 11;106(11):1675-80. PubMed PMID: 20538689. 23. Wiggers CJ. The muscular reactions of the mammalian ventricles to artificial surface stimuli. American Journal of Physiology -- Legacy Content. 1925 July 1, 1925;73(2):346-78. 24. Prinzen FW, Van Oosterhout MF, Vanagt WY, Storm C, Reneman RS. Optimization of ventricular function by improving the activation sequence during ventricular pacing. Pacing Clin Electrophysiol. 1998 Nov;21(11 Pt 2):2256-60. PubMed PMID: 9825329. 25. Zile MR, Blaustein AS, Shimizu G, Gaasch WH. Right ventricular pacing reduces the rate of left ventricular relaxation and filling. J Am Coll Cardiol. 1987 Sep;10(3):702-9. PubMed PMID: 3624674. 26. Dirkx E, da Costa Martins PA, De Windt LJ. Regulation of fetal gene expression in heart failure. Biochim Biophys Acta. 2013 Dec;1832(12):2414-24. PubMed PMID: 24036209. 27. Gademan MG, van Bommel RJ, Borleffs CJ, Man S, Haest JC, Schalij MJ, et al. Biventricular pacing-induced acute response in baroreflex sensitivity has predictive value for midterm response to cardiac resynchronization therapy. Am J Physiol Heart Circ Physiol. 2009 Jul;297(1):H233-7. PubMed PMID: 19395556. 28. Tarquini R, Guerra CT, Porciani MC, Michelucci A, Padeletti M, Ricciardi G, et al. Effects of cardiac resynchronization therapy on systemic inflammation and neurohormonal pathways in heart failure. Cardiol J. 2009;16(6):545-52. PubMed PMID: 19950091. 29. Mahrholdt H, Wagner A, Judd RM, Sechtem U, Kim RJ. Delayed enhancement cardiovascular magnetic resonance assessment of non-ischaemic cardiomyopathies. Eur Heart J. 2005 Aug;26(15):1461-74. PubMed PMID: 15831557. 30. Leyva F, Taylor RJ, Foley PW, Umar F, Mulligan LJ, Patel K, et al. Left ventricular midwall fibrosis as a predictor of mortality and morbidity after cardiac resynchronization therapy in patients with nonischemic cardiomyopathy. J Am Coll Cardiol. 2012 Oct 23;60(17):1659-67. PubMed PMID: 23021326. 31. White SK, Sado DM, Fontana M, Banypersad SM, Maestrini V, Flett AS, et al. T1 mapping for myocardial extracellular volume measurement by CMR: bolus only versus primed infusion technique. JACC Cardiovasc Imaging. 2013 Sep;6(9):95562. PubMed PMID: 23582361. 32. Liu CY, Liu YC, Wu C, Armstrong A, Volpe GJ, van der Geest RJ, et al. Evaluation of age-related interstitial myocardial fibrosis with cardiac magnetic resonance contrast-enhanced T1 mapping: MESA (Multi-Ethnic Study of Atherosclerosis). J Am Coll Cardiol. 2013 Oct 1;62(14):1280-7. PubMed PMID: 23871886. Pubmed Central PMCID: 3807823. 33. Iles L, Pfluger H, Phrommintikul A, Cherayath J, Aksit P, Gupta SN, et al. Evaluation of diffuse myocardial fibrosis in heart failure with cardiac magnetic resonance contrast-enhanced T1 mapping. J Am Coll Cardiol. 2008 Nov 4;52(19):1574-80. PubMed PMID: 19007595. 34. Abdullah OM, Drakos SG, Diakos NA, Wever-Pinzon O, Kfoury AG, Stehlik J, et al. Characterization of diffuse fibrosis in the failing human heart via diffusion tensor imaging and quantitative histological validation. NMR Biomed. 2014 Nov;27(11):1378-86. PubMed PMID: 25200106. Pubmed Central PMCID: 4215542. 35. Karamitsos TD, Francis JM, Myerson S, Selvanayagam JB, Neubauer S. The role of cardiovascular magnetic resonance imaging in heart failure. J Am Coll Cardiol. 2009 Oct 6;54(15):1407-24. PubMed PMID: 19796734.

170

CHAPTER 10 general discussion 36. Boerboom RA, Krahn KN, Megens RT, van Zandvoort MA, Merkx M, Bouten CV. High resolution imaging of collagen organisation and synthesis using a versatile collagen specific probe. J Struct Biol. 2007 Sep;159(3):392-9. PubMed PMID: 17572104. 37. Mees G, Dierckx R, Mertens K, Vermeire S, Van Steenkiste M, Reutelingsperger C, et al. 99mTc-labeled tricarbonyl hisCNA35 as an imaging agent for the detection of tumor vasculature. J Nucl Med. 2012 Mar;53(3):464-71. PubMed PMID: 22331218. 38. Fuchs TA, Ghadri JR, Stehli J, Gebhard C, Kazakauskaite E, Klaeser B, et al. Hypodense regions in unenhanced CT identify nonviable myocardium: validation versus 18F-FDG PET. Eur J Nucl Med Mol Imaging. 2012 Dec;39(12):1920-6. PubMed PMID: 22926710. 39. Hernandez-Madrid A, Svendsen JH, Lip GY, Van Gelder IC, Dobreanu D, Blomstrom-Lundqvist C, et al. Cardioversion for atrial fibrillation in current European practice: results of the European Heart Rhythm Association survey. Europace. 2013 Jun;15(6):915-8. PubMed PMID: 23709570. 40. Farmacotherapeutisch kompas. 2014 [updated Oktober 2014; cited 2014 23-12-2014]; http://www.farmacotherapeutischkompas.nl/preparaatteksten/f/fleca%C3%AFnide.asp]. 41. Dorian P, Pinter A, Mangat I, Korley V, Cvitkovic SS, Beatch GN. The effect of vernakalant (RSD1235), an investigational antiarrhythmic agent, on atrial electrophysiology in humans. Journal of cardiovascular pharmacology. 2007 Jul;50(1):35-40. PubMed PMID: 17666913. Epub 2007/08/02. eng. 42. Mehta D, Camm AJ, Ward DE. Clinical electrophysiologic effects of flecainide acetate. Cardiovascular drugs and therapy / sponsored by the International Society of Cardiovascular Pharmacotherapy. 1988 Mar;1(6):599-603. PubMed PMID: 3155304. Epub 1988/03/01. eng. 43. Christ T. Atrial-selective antiarrhythmic activity by vernakalant fact or fiction? J Cardiovasc Pharmacol. 2014 Jan;63(1):234. PubMed PMID: 24084225. 44. Fedida D, Orth PM, Chen JY, Lin S, Plouvier B, Jung G, et al. The mechanism of atrial antiarrhythmic action of RSD1235. Journal of cardiovascular electrophysiology. 2005 Nov;16(11):1227-38. PubMed PMID: 16302909. Epub 2005/11/24. eng. 45. Savelieva I, Graydon R, Camm AJ. Pharmacological cardioversion of atrial fibrillation with vernakalant: evidence in support of the ESC Guidelines. Europace. 2013 Oct 9. PubMed PMID: 24108230. 46. Varkevisser R, van der Heyden MA, Tieland RG, Beekman JD, Vos MA. Vernakalant is devoid of proarrhythmic effects in the complete AV block dog model. Eur J Pharmacol. 2013 Nov 15;720(1-3):49-54. PubMed PMID: 24211677. 47. Rudiger A, Breitenstein A, Arrigo M, Salzberg SP, Bettex D. Suitability, efficacy, and safety of vernakalant for new onset atrial fibrillation in critically ill patients. Crit Care Res Pract. 2014;2014:826286. PubMed PMID: 24900920. Pubmed Central PMCID: 4036718. 48. Strik M, van Deursen CJ, van Middendorp LB, van Hunnik A, Kuiper M, Auricchio A, et al. Transseptal conduction as an important determinant for cardiac resynchronization therapy, as revealed by extensive electrical mapping in the dyssynchronous canine heart. Circ Arrhythm Electrophysiol. 2013 Aug;6(4):682-9. PubMed PMID: 23873141. 49. Strik M, van Middendorp LB, Houthuizen P, Ploux S, van Hunnik A, Kuiper M, et al. Interplay of electrical wavefronts as determinant of the response to cardiac resynchronization therapy in dyssynchronous canine hearts. Circ Arrhythm Electrophysiol. 2013 Oct;6(5):924-31. PubMed PMID: 24047705.

171

172

CHAPTER 1 general introduction

Summary samenvatting

173

Under physiological conditions, ventricular activation is very fast and nearly synchronous. This kind of activation is an indispensable prerequisite for a good cardiac function and contraction. Ventricular conduction disturbances induce dyssynchronous activation and contraction. For example, left bundle branch block (LBBB) leads to a slowly conducted activation wavefront that starts from the right ventricle, moves through the septum to finally activate the left ventricular free wall (LVfw). This dyssynchronous activation leads to discoordinated contraction, including elevated mechanical load in the LVfw and low load in the septum. Dyssynchrony impairs cardiac function, induces all kinds of molecular and cellular adaptations in the cardiac tissue (“remodeling”) and increases the risk of heart failure. Cardiac resynchronization therapy (CRT) aims, as its name suggests, to restore the synchronous activation of the heart and thereby “curing” all adverse effects of LBBB. Even though the efficacy of CRT at the population level has been proven extensively, understanding of the pathophysiology of LBBB and CRT is incomplete. This is, among others, expressed by the lack of clear beneficial response, clinically and/or echocardiographically, in approximately one third of CRT-treated patients. The overall goal of this thesis is to better understand the impact of dyssynchrony and resynchronization on the heart. As discussed in chapter 3, animal models of cardiac dyssynchrony help to clarify the pathophysiology and already greatly improved our understanding of the impact of cardiac dyssynchrony on cardiac function. We specifically focused on remodeling induced by heart failure in combination with LBBB, since it is poorly understood how these two interact. In the course of this PhD study we developed a model of chronic dyssynchronous heart failure (Mitral Regurgitation (MR)+LBBB) that provides the unique possibility to study the interaction of LBBB and volume overload in large animals at a physiological heart rate. Changes in left ventricular dimensions closely approximated those seen in patients. Furthermore, the fact that MR is also frequently present in heart failure patients is another argument that the MR+LBBB model has a high translational value (chapter 4). Mechanical triggers have been linked to remodeling processes in the heart. In vivo it is difficult to separate the contribution of (local) mechanical load from systemic factors, such as neurohumoral activation. In that regard, LBBB provides a unique in vivo model of different loading conditions within the same heart. This allows to discriminate between the effect of local mechanical load and other contributing factors, which are presumably equally distributed throughout the heart. We focused on the changes induced in expression of microRNA-133a (miR-133a), miR-29c, miR-30c and connective tissue growth factor (CTGF) in hearts with LBBB 174

CHAPTER summary - samenvatting

and CRT. MiR-133a is one of the highest expressed cardiac miRs and all three miRs are related to hypertrophic and fibrotic remodeling processes. In the LVfw of LBBB hearts down-regulation of miR-133a coincided with an up-regulation of CTGF and local hypertrophy. CRT normalizes the distribution of mechanical load, reverses the local hypertrophic response and redistributes the expression of CTGF and miR-133a to near normal levels. This data provides strong evidence that miR-133a and CTGF are regulated locally by mechanical load. The high CTGF levels were not accompanied by fibrosis, which may be explained by overexpression of the anti-fibrotic miR-29c and miR-30c. In addition, both miR-29c and miR-30c were not affected by CRT, supporting the idea that collagen expression and fibrosis are regulated by different triggers and along different pathways than hypertrophy (chapter 5). Remarkably thereto is that CTGF overexpression has been linked to increased fibrosis in several other studies. A possible explanation for this discrepancy is that hypertrophy is predominantly regulated by CTGF located in myocytes, whereas fibroblast-based CTGF is important for fibrosis. Chapter 6 contains a study on miR changes in the MR+LBBB model. MR+LBBB showed strain and hypertrophy patterns similar to those seen in the LBBB model, but in combination with severe LV dilation. Furthermore, MR+LBBB caused an even greater increase in CTGF and decrease in miR-133a expression but to the same extent in septum and LVfw. This indicates that miR-133a and CTGF play an important role in the local and generalized hypertrophic response in hearts subjected to LBBB and volume overload. The anti-fibrotic miR-29c and miR-30c were significantly and uniformly down-regulated in the MR+LBBB group. Collagen expression and deposition tended to be higher in the LVfw of the MR+LBBB than in the LVfw of LBBB dogs. This could be explained by the high CTGF levels in combination with a loss of the protective antifibrotic effects of miR-29c and miR-30c. This indicates an intricate interaction between two (at least initially) different mechanical triggers in the transcriptional regulation of hypertrophy and fibrosis. The miR expression pattern found in this volume overload model is completely different from that described in the literature for pressure overload hypertrophy and ischemic cardiomyopathy. In the process of structural remodeling, fibrosis is considered one of the most deleterious processes for the heart, because it increases stiffness and slows electrical conduction. In vivo, late enhancement Magnetic Resonance Imaging (MRI) is used to quantify the size of the area of fibrosis, scar, but diffuse fibrosis cannot be visualized. Moreover, the contrast medium used, Gadolinum, is not specific for fibrosis but rather indicates the size of the extracellular space. CNA35, a protein known to specifically bind to collagen, 175

is a specific marker of cardiac fibrosis. Ex vivo and in vitro imaging has shown that CNA35 binds specifically to collagen. We were the first to apply CNA35 in vivo in the heart, and showed that CNA35 is able to cross the endothelial barrier and enter the myocardium where it specifically detects cardiac collagen (chapter 7). However, analyses of collagen data was still performed histologically, ex vivo. We performed a pilot study aiming at the feasibility of in vivo analysis by using CNA35 labeled with gadolinium to detect diffuse fibrosis as well as a large infarcted area with MRI. This pilot study was negative, indicating that MRI based in vivo analyses may be suboptimal and other imaging techniques such as SPECT should be investigated (chapter 10). About one third of patients with mild dyssynchronous heart failure suffer from atrial fibrillation. Drugs that convert atrial fibrillation to sinus rhythm often slowdown ventricular conduction. Chapter 8 aimed to investigate the electrophysiological and hemodynamic effects of Vernakalant and Flecainide. Flecainide is one of the most successful drugs used for pharmacological conversion of atrial fibrillation. It is a Class Ic drug that acts through blockade of the sodium channel, thus slowing myocardial conduction velocity. Because this effect of Flecainide also occurs in the ventricles, this drug increases the degree of dyssynchrony in LBBB hearts and further worsens cardiac function. Vernakalant is a supposedly atrial specific drug. However, in comparing the effect of Flecainide and Vernakalant in our experimental LBBB models we showed that Vernakalant and Flecainide worsen dyssynchrony and contractility (LV dP/dtmax) to a similar extent, (chapter 8). In chapter 9 we show that the positive effect of CRT is maintained during administration of Vernakalant and Flecainide, irrespective of the dosage used. This means that patients treated with CRT are more resilient to the negative effects of these cardio-pharmacological agents and that, at least in theory, they may be administered safe(r) in LBBB patients with CRT on than in the absence of CRT. This observation is important because episodes of hypotension have been described for HF patients receiving Vernakalant and Flecainide. Overall, this thesis shows that cardiac dyssynchrony has a major impact on gene expression, post-translational modifications and structural adaptations which are directly reflected in cardiac function.

176

CHAPTER summary - samenvatting

177

Samenvatting Onder normale omstandigheden wordt het hart vrijwel synchroon elektrisch geactiveerd. Dit zorgt voor een sterke contractie en goede pomp functie. Geleidingstoornissen in de kamers van het hart veroorzaken een abnormaal ongelijktijdig (“dyssynchroon”) activatie patroon en dyssynchrone contractie van het hart. Bijvoorbeeld, bij een linkerbundeltakblok (LBTB) wordt de rechter kamer normaal geactiveerd, terwijl de linker kamer traag geactiveerd wordt. Geleiding loopt dan vanuit de rechterkamer door het septum (tussenschot) om vervolgens de rest van de linker kamer te activeren. De vroege activatie van het septum zorgt er ook voor dat deze minder mechanische arbeid verricht, terwijl de vrije wand van de linker kamer juist harder moet werken. Deze lokale verhoging van de mechanische belasting veroorzaakt allerlei veranderingen in het hart, van gen niveau tot zichtbare anatomische aanpassing zoals groei van de hartspier (hypertrofie). Initieel zijn deze aanpassingen gunstig om een stabiele hartfunctie te behouden, maar op de lange termijn wordt het risico op hartfalen groter. Cardiale resynchronisatie therapie (CRT) is, zoals al uit de naam blijkt, een pacemaker therapie die het hart weer synchroniseert en daarmee de negatieve effecten van een LBTB tegen gaat. Deze pacemakertherapie heeft zich in meerdere grote studies bewezen als een zeer goede therapie voor patiënten met dyssynchrone activatie. Desondanks zorgt CRT bij 30-50% van de patiënten niet tot duidelijke verbeteringen. Daarom is het doel van deze thesis om terug te gaan naar de basis en op die manier een beter begrip te krijgen de effecten van een LBTB op het hart. Uit hoofdstuk 3 wordt duidelijk dat proefdiermodellen hebben bijgedragen aan onze kennis over het effect van een LBTB op het hart. Aangezien er nog weinig bekend is over de interactie van hartfalen en LBTB, was dit een belangrijk aandachtspunt van ons onderzoek. Eerst is er een proefdier model ontwikkeld dat bestaat uit de combinatie van hartfalen en een LBTB. Hartfalen werd geïnduceerd door het lek maken van de mitralisklep (MitralisklepInsufficiëntie, MI). Dit is de klep tussen de linker boezem en linker kamer. De veranderingen die optreden in dit diermodel, kwamen goed overeen met de veranderingen die gezien worden bij patiënten met dit klepgebrek (hoofdstuk 4). Mechanische belasting leidt tot aanpassing (adaptatie) in het hart. In het levende lichaam is het echter moeilijk om een onderscheid te maken tussen directe en indirecte effecten van mechanische belasting op de adaptatie. De indirecte effecten ontstaan doordat zwaardere belasting van het hart ook allerlei veranderingen kan geven in het hormoon en zenuwstelsel (neurohumorale stelsel). Een hart met een LBTB 178

CHAPTER summary - samenvatting

is in dat opzicht uniek, omdat binnen het hart de mechanische belasting verschilt tussen het septum en de vrije wand van de linker kamer, terwijl beide gebieden blootgesteld worden aan dezelfde neurohumorale belasting. Dit maakt het mogelijk om een onderscheid te maken tussen de directe en indirecte effecten van mechanische belasting op hypertrofie. Wij hebben ons vooral gericht op de veranderingen in microRNAs (miRs) en Connective Tissue Growth Factor (CTGF). MiRs zijn kleine stukjes genetisch materiaal, die verantwoordelijk zijn voor de regulatie van eiwit aanmaak. MiR-133a is een van de meest voorkomende miRs in het hart en wordt vaak gerelateerd aan hypertrofie, een toename van de spierdikte. In de vrije wanden van de linker kamer bij harten met een LBTB vonden we een daling van miR-133a, wat gepaard ging met een verhoging van CTGF en lokale hypertrofie. CRT nivelleerde de mechanische belasting van het hart, deed de lokale hypertrofie teniet, alsook de abnormale CTGF en miR-133a expressie. Op lokaal niveau bestaat er dus een sterke relatie bestaat tussen miR-133a, CTGF en lokale hypertrofie, welke zeer waarschijnlijk gereguleerd worden door de mechanische belasting. Ondanks hoge CTGF levels was er geen sprake van fibrose (verlittekening) in het hart. Dit kan mogelijk verklaard worden door een gelijktijdige verhoging van de anti-fibrotische miR-29c en miR-30c. CRT had weinig invloed op miR-29c en miR-30c, wat suggereert dat fibrose niet wordt veroorzaakt door mechanische belasting, maar eerder door neurohumorale veranderingen (hoofdstuk 5). Hoofdstuk 6 beschrijft een studie naar miR veranderingen in dieren met een mitralisklep insufficiĂŤntie in combinatie met een LBTB (MI+LBTB), het dier model dat in hoofdstuk 4 beschreven is. MI+LBTB harten hadden een ernstig vergrote linker kamer ten opzichte van harten met alleen een LBTB of controle harten. Desondanks waren de verschillen in dikte tussen het septum en vrije wand van de linker kamer overeenkomstig met het verschil in dikte zoals we dat gezien hebben in LBTB harten. CTGF nam verder toe in MI+LBTB harten terwijl miR-133a verder afnam ten opzichte van LBTB harten. Deze resultaten impliceren dat zowel miR-133a als CTGF een belangrijke rol spelen in zowel de lokale als in de gegeneraliseerde hypertrofe respons. Terwijl in LBTB miR-29c en -30c verhoogd waren, waren deze anti-fibrotische miRs significant verlaagd in de MI+LBTB groep. Dit ging gepaard met een tendens tot toename van collageen, een belangrijk eiwit voor bindweefsel en verlittekening. Wederom wijst dit erop dat er een groot verschil bestaat tussen de regulatie van hypertrofie en fibrose.

179

Tijdens de ontwikkeling van hartfalen wordt fibrose gezien als zeer schadelijk, omdat fibrose het hart stijver maakt en de elektrische impuls geleiding vertraagt. Grote gebieden van fibrose kunnen in levende lichaam worden aangetoond met behulp van een MRI met een intraveneus contrastmiddel. Kleinere gebieden en diffuse fibrose kunnen echter niet worden waargenomen. Tevens is het contrastmiddel dat doorgaans gebruikt wordt niet specifiek voor fibrose. CNA35 is een eiwit dat een specifieke binding aangaat met collageen. Tot op heden is CNA35 in geval van het hart alleen nog gebruikt buiten het lichaam. Hoofdstuk 7 beschrijft experimenten in muizen/ratten waar CNA35 in het levende dier is ingespoten om fibrose in het hart te detecteren. Door gebruik te maken van een fluorescerend label konden we, na verwijderen van het hart uit het dier, aantonen dat CNA35 aanwezig was op plaatsen waar met klassieke histologische technieken collageen aanwezig was. Deze bevindingen laten daarmee zien dat CNA35 in staat is om de barrière van de bloedvatwand te passeren. In een pilot studie hebben we vervolgens onderzocht of CNA35 (gebonden aan het MRI contrastmiddel gadolinium) gebruikt kan worden om fibrose in het hart met de MRI scanner zichtbaar te maken. Deze pilot was negatief, wat aangeeft dat er andere benaderingen gebruikt moeten worden (hoofdstuk 10). Ongeveer een derde van de patiënten met mild dyssynchroon hartfalen heeft last van atriumfibrilleren (boezemfibrilleren). Medicijnen die gebruikt worden om atriumfibrillatie naar een normaal sinusritme te converteren hebben vaak ook een effect op de geleiding in de kamers. Hoofdstuk 8 had als doel om elektrofysiologische (geleiding) en hemodynamische (hartfunctie en bloeddruk) effecten van Vernakalant en Flecainide te onderzoeken. Flecainide is een van de meest gebruikte en succesvolste medicijnen voor de behandeling van atriumfibrilleren. Van Flecainide is het bekend dat het de geleidingssnelheid in het hele hart vertraagt, dus ook van de kamers. In dyssynchrone harten, dus harten met LBTB, zou Flecainide de dyssynchronie erger kunnen maken. Vernakalant is op de markt gebracht als een “ atriaal specifiek” medicijn, dus met het effect alleen op de boezems en niet de op de kamers. Met het vergelijken van het effect van Flecainide en Vernakalant in onze LBTB harten toonden we echter aan dat Vernakalant en Flecainide in dezelfde mate de dyssynchronie verergerden en de contractiliteit van het hart verminderden. In hoofdstuk 9 tonen we aan dat het positieve effect van CRT behouden blijft tijdens toediening van Vernakalant en Flecainide. Dit betekent dat de patiënten die behandeld worden met CRT beter bestand zijn tegen de negatieve effecten van deze cardio-farmacologische middelen. Deze conclusie is van belang omdat episodes van hypotensie zijn beschreven in patiënten met hartfalen die behandeld werden met Vernakalant en Flecainide. 180

CHAPTER summary - samenvatting

Al met al laat dit proefschrift zien dat cardiale dyssynchronie een grote invloed heeft op de genexpressie, structurele aanpassingen en dat deze direct worden weerspiegeld door de hartfunctie.

181

Valorisatie Op dit moment lijden in Nederland 150.000 mensen aan hartfalen. Dit heeft een grote maatschappelijk impact aangezien dit gepaard gaat met ongeveer 70.000 ziekenhuisopnames en 6500 sterfgevallen per jaar. De jaarlijkse kosten werden in 2007 reeds op 455 miljoen euro geschat. Het is daarmee een van de belangrijkste doodsoorzaken in Nederland. Deze aantallen zullen in de komende jaren verder stijgen als gevolg van de vergrijzing en door betere behandeling van acute cardiale ziektes, zoals hartinfarcten. (bron Nederlandse Hartstichting). Van alle patiënten met hartfalen heeft ongeveer een kwart een geleidingsstoornis. Deze geleidingsstoornis geeft een dyssynchrone (ongelijktijdige) elektrische activatie en contractie van het hart, wat uiteindelijk als gevolg heeft dat het hart minder goed contraheert en de hartfunctie vermindert. De behandeling van deze geleidingsstoornis is sterk verbeterd met de komst van cardiale resynchronisatie therapie (CRT). Deze specifieke pacemaker therapie verbetert de prognose en vermindert de klachten van patiënten met dyssynchroon hartfalen. Momenteel worden er per jaar ongeveer 3000 CRT pacemakers geïmplanteerd. Echter uit meerdere studies blijkt dat nog steeds een derde tot de helft van de ontvangers van een CRT pacemaker niet of onvoldoende reageert op deze therapie. Naast de niet onaanzienlijke kosten aspect van deze pacemakers, is het van belang om te realiseren dat de patiënten wel aan de risico’s van het implanteren worden blootgesteld en aan eventuele complicaties van het hebben van een pacemaker, zoals infecties bij de pacemaker of de electroden. Een betere begrip van het onderliggende ziektebeeld en betere diagnose zijn dus van wezenlijk belang voor een optimalisatie van de behandeling. In dit proefschrift gaat het vooral om het betere begrip van het ziektebeeld. Om dit begrip te verbeteren is gebruik gemaakt van proefdieren, waarbij de meeste resultaten zijn voortgekomen uit een honden model. Het onderzoek kon niet in mensen worden uitgevoerd omdat veel metingen uitgebreid en invasief zijn (katheters en andere apparatuur worden in het lichaam gebracht). Daarnaast zijn ook een groot aantal weefselmonsters van het hart genomen zijn. We zijn ons bewust van de maatschappelijk implicaties van het gebruik van grote proefdieren voor onderzoek. We hebben ook uitvoerig gediscussieerd of er alternatieven zijn voor het gebruik van honden. Echter, het geleidingsysteem van andere diersoorten is dermate anders dan die van de hond en de mens dat in verscheidene studies gebleken is dat een geleidingsstoornis in andere diersoorten niet te vergelijken is met die in de mens of hond. Om de translationele waarde van het onderzoek zo 182

CHAPTER valorisatie

groot mogelijk te laten zijn is daarom voor de hond als proefdier gekozen. Daarnaast hebben we altijd getracht om de aantallen te reduceren en de proeven te verfijnen ter vermindering van het ongerief. Het onderzoek, zoals dat in dit proefschrift beschreven is, valt onder een groter, overkoepelend project genaamd â&#x20AC;&#x153;Biomarkers to predict cardiac failure, arrhythmias and success of treatment (COHFAR)â&#x20AC;?. Dit project valt onder CTMM (Center for Translational Molecular Medicine), een publiek-privaat samenwerkingsverband voor translationeel onderzoek. Het COFHAR project heeft in de afgelopen vijf jaar goede resultaten opgeleverd. De belangrijkste mogelijk translationele resultaten van dit promotie onderzoek worden hier besproken. Allereerst bleken de recent ontdekte microRNAs sterk en volgens een vast patroon te veranderen in harten met dyssynchroon hartfalen. Deze gegevens hebben bijgedragen tot een beter begrip van het proces van hypertrofie en fibrose in de hartspier. Toekomstig onderzoek zal moeten uitwijzen of deze microRNAs gebruikt kunnen worden als biomarker ter voorspelling van het effect van CRT en/of ingezet kunnen worden voor de behandeling van dyssynchroon hartfalen. Vervolgens heeft een nauwe samenwerking met de Universiteit van Utrecht geresulteerd in de publicatie van hoofdstuk 7 dat het mogelijk nut van CNA35 als biomarker voor myocardiale fibrose beschrijft. Tenslotte heeft dit onderzoek aangetoond dat anti-aritmische geneesmiddelen nog voorzichtiger gebruikt moeten worden in harten met dyssynchroon hartfalen dan in normale harten, omdat ze de elektrische geleiding nog verder vertragen. Tevens bleek dat het aanvankelijk positief beoordeelde nieuwe geneesmiddel Vernakalant de mate van dyssynchronie en de pompfunctie evenveel verslechterde als het conventionele Flecainide.

183

â&#x20AC;&#x153;Ik heb in mijn werk veel geleerd van de fouten die ik gemaakt heb, ik denk dat ik er nog een paar ga maken.â&#x20AC;?

184

- Henk van Middendorp -

CHAPTER dankwoord

Dankwoord Dankwoord, misschien wel het meest gelezen stukje tekst van ieder proefschrift. Waarschijnlijk ook het moeilijkst om te schrijven, voor mij in ieder geval wel. Bij iedere extra naam ben je bang er meer te vergeten. Dus, bij deze alvast een bedankje aan iedereen die heeft bijgedragen aan alle mooie, leuke en, natuurlijk niet te vergeten, wetenschappelijke momenten van mijn promotie. Allereerst wil ik mijn promotoren bedanken voor alle steun en begeleiding die jullie gaven tijdens mijn promotietraject. Beste Frits, jou nimmer aflatend enthousiasme voor onderzoek en wetenschap hebben me geïnspireerd om steeds dat stapje meer te doen. Af en toe was het best frustrerend als je bij ieder resultaat waarmee ik kwam, zo weer tien nieuwe vragen kon verzinnen en je standaard zei: “kijk er ook nog maar eens op die manier naar”. Je stond altijd klaar als er wat was en ik kijk met plezier terug op de periode waarin wij hebben samengewerkt. Beste Pro.f Maessen, beste Jos, bedankt voor je betrokkenheid en de kritische blik op mijn manuscripten. Bovenal besef ik me dat ik een unieke mogelijkheid heb gekregen om mijn promotietraject te combineren met klinisch werk. Ik hoop dat deze mogelijkheid ook nog in de toekomst blijft bestaan, aangezien ik geloof dat het bijdraagt aan je algehele vorming als arts en onderzoeker. Mijn co-promotor, Frans van Nieuwenhoven, ook al kwam ik er een beetje laat achter dat jij mijn co-promotor bent. Ondanks dat heb je gedurende het gehele traject een frisse en relativerende blik op mijn onderzoek gehad. Zeker tijdens de laatste loodjes van mijn promotie heb je enorm bijgedragen om de zogezegde “puntjes op de i te zetten.” Voorzitter en leden van de beoordelingscommissie, Prof. Dr. U. Schotten, Prof. Dr. J.M.T. de Bakker, Prof. Dr. H-P. Brunner La Rocca, Prof. Dr. D.J. Duncker en Prof. Dr. L. de Windt, hartelijk bedankt voor de tijd en moeite die jullie gestoken hebben in de beoordeling van mijn proefschrift. Gezien de maatschappelijk implicaties van het gebruik van grote proefdieren voor onderzoek, wil ik dit als herinnering gebruiken aan de honden die dit onderzoek hebben mogelijk gemaakt. Uit de publicaties van mijn voorgangers en de huidige thesis blijkt dat zij van grootte wetenschappelijke waarde zijn en dat het zeker heeft bijgedragen aan de verdere ontwikkeling van CRT en de kennis van dyssynchroon hartfalen in het algemeen. Bij de vakgroep Fysiologie heb ik altijd met veel plezier gewerkt. Zeker de groep van Frits wil ik van harte bedanken voor alle steun. Marion, bedankt voor je altijd nuchtere blik en sarcasme. 185

Dit kwam de experimenten altijd ten goede, zowel wetenschappelijk als voor het gemak en plezier waarmee we samenwerkten. Ook bedankt voor alle tips en tricks op de OK, wat niet alleen voor het onderzoek handig was, maar ook voor mijn klinisch werk. Arne, ook al behoor je niet meer tot de groep van Frits, in het begin heb je enorm bijgedragen om mijn elektrofysiologische kennis op te vijzelen en zonder jou hadden we nooit onze experimentele pacemakers aan de gang gekregen. Af en toe voelde we ons net MacGyver, maar uiteindelijk functioneerde het altijd. Chantal, bedankt voor alle analyses, ik weet hoeveel tijd en energie ze moeten hebben gekost. Zonder deze hulp was ik zeker niet zover gekomen. Marc, nog nooit heb ik een geneeskunde student gezien die zo IT gericht was. Bedankt voor het mij wegwijs maken binnen het onderzoek, maar zeker ook binnen Matlab en de diepere krochten van Excel en PowerPoint. Ik heb nooit geweten dat je daar zoveel mee kon. Je was een hele fijne kamergenoot en ik wens je nog veel succes met je opleiding tot Cardioloog. Rob, bedankt voor het overnemen van de experimenten in de laatste periode van mijn promotie, door jou heb ik de tijd gekregen die ik nodig had om het allemaal af te kunnen ronden. Alle collega’s van de CTC, bedankt voor jullie gezelligheid, steun en begrip tijdens mijn promotie traject. Prof. Mochtar, helaas gaat u bijna bij ons weg. Graag had ik gebruik gemaakt van al u tips en wijsheiden gedurende mijn opleiding. In ieder geval kunt u nu genieten van u welverdiende pensioen. Dr. Kats, u kunt zich niet voorstellen hoe blij ik was toen u vorig jaar samen met prof. Maessen mij de toezegging gaf voor de opleiding. Hartelijk dank voor het vertrouwen dat je in mij hebt. Met u als opleider zal het zeker goed komen. Dr. Sardari Nia, de mogelijkheden van de 3D-scans blijken eindeloos. Zelfs retrospectief kunnen we er een patente ductus arteriosus mee aantonen, wat geresulteerd heeft in een leuke case-report. Hopelijk kunnen we deze fijne samenwerking voortzetten tijdens de opleiding. Dr Geskes, wat een ongelofelijke reizen heeft u gemaakt, na mijn klim-avonturen in Nepal en Bolivia begrijp ik u drive om de onbereikbare plekken te bereiken. Dr. Barenbrug, Dr Khargi, Dr. Callens, Dr. Zandbergen, Dr. Hossien, bedankt voor jullie support en goede samenwerking. Alle Collega’s binnen de CTC. Het is het erg gezellig om weer full-time terug te zijn en ik ben blij me nu te kunnen richten op mijn opleidingstraject. Met veel plezier blik ik alvast vooruit om de komende zes jaar met jullie samen te werken. Opa, ik kan u natuurlijk nooit genoeg bedanken voor alle financiële steun die u mij heeft gegeven om mijn studie te voltooien en al helemaal niet voor de sponsoring van dit boekje. Bovenal wil ik u bedanken voor de ontzettend fijne jeugd die ik gehad 186

CHAPTER dankwoord

heb. Vanaf het moment dat u mij nog in één hand kon houden bent u er voor mij geweest en heeft u me veel geleerd, zoals dat er geen haringen in Duitse rivieren zwemmen, maar dit toch echt forellen zijn. De vele fiets- en wandeluitjes, vakanties naar het schöne Limburg zullen me voor altijd bij staan. Ik denk hier nog altijd aan als ik langs het schweibergerhöfke of langs Cottesse kom met de racefiets. Beste Richard, een betere paranimf kan ik mij niet wensen, ook al heb je bijzonder weinig bijgedragen aan de totstandkoming van mijn boekje. Misschien heb je me juist daarmee enorm geholpen. De “ontspanning” van alle wielrenrondjes gaven mij de mogelijkheid om mijn hoofd leeg te maken en weer met een frisse blik verder te gaan. Ook alle gezellige etentjes met Vanessa en Alicia hebben hier zeker aan bijgedragen. Ons jaarlijkse fietsweekendje blijft een topper. Wij zijn blij dat we altijd bij jullie terecht kunnen. Heel veel succes in Nieuw-Zeeland en hopelijk kunnen wij daar nog ‘even’ op visite komen. Lieve Christel, paranimf, wat is dat? Voor mij staat er in ieder geval een hele geweldige zus naast me. Ook al zeg ik altijd gekscherend dat je maar een beetje aan het knippen en plakken bent, dit boekje laat zien dat je knip en plakwerk van een zeer hoog niveau zijn. Ik ben trots op je wat je allemaal zelfstandig binnen je werk bereikt hebt ook al blijf ik er weinig van snappen. Bovenal waardeer ik wat je allemaal belangeloos doet voor anderen, wat je voor opa en mama en papa doet is echt top. Ben en Astrid, het schoon kunnen we eigenlijk wel weg laten voor schoonouders. Ik kom dan ook al weer een heel tijdje bij jullie over de vloer. Ik heb me direct vanaf het begin al welkom gevoeld bij jullie en dit is niet meer veranderd. Alicia en ik zijn altijd erg blij geweest me de steun die jullie hebben gegeven. Nogmaals sorry voor alle zware klussen en verhuizingen. Volgens mij zullen jullie in ieder geval niet snel alle trappen in onze studentenkamers en appartement vergeten. Lieve Mama en Papa, bedankt voor alle steun al die jaren. Jullie hebben het voor mij altijd mogelijk gemaakt om te doen wat ik wilde en altijd achter mij gestaan. Ook al hadden jullie graag gezien dat ik af en toe wat harder mijn best deed, denk ik toch dat alles op zijn pootjes terecht is gekomen. Dankzij jullie ben ik diegene geworden die ik nu ben. Daarom vind ik het dan ook ontzettend leuk om te zien dat de rollen een klein beetje zijn omgedraaid en ik jullie een klein beetje kan ‘opvoeden’. Zoals het plezier in het maken van verre reizen en de waardering voor luxe etentjes. Mama jouw onvoorwaardelijke liefde en trots voor Christel en mij is buitengewoon. Het is meer dan terecht dat je na al die jaren van hard werken nu eindelijk de rust voor hebt om daar echt 187

van te genieten. Papa, ik ken niemand die zou eerlijk en integer is als jij. Dit en je nimmer aflatende werkethos zijn de manier hoe ik ook mijn werk en mijn leven wil leiden. Last but definitely not least, sorry dat het in het Engels is, maar in het Nederlands klinkt het niet. Alicia, wat had ik zonder jou gemoeten. Ook al heb ik vaak gezegd dat je me van mijn werk afhield, denk ik dat het soms zeker nodig was. Je was er altijd om mij te steunen en als ik dacht dat ik het weer eens te druk had, om dit enigszins te relativeren. Daarbij hielpen onze etentjes en vrijdagavond borrels voor de nodige ontspanning en de mogelijkheid om frustraties te uiten. De mooie reizen die we gemaakt hebben gaven me altijd weer de energie en de nodige frisse blik om vol goede moed verder te gaan. Zeker in de laatste paar maanden van mijn promotie heb jij ontzettend je best gedaan om alles voor mij mogelijk te maken. Ik weet dat ik in de periode niet altijd even gezellig was, maar ik heb je hulp enorm gewaardeerd en zonder jou inzet zou het boekje nu nog lang niet af geweest zijn. â&#x20AC;&#x153;True Love stories never have endingsâ&#x20AC;? zoals blijkt uit ons kleine wormpje in jouw buik.

188

CHAPTER dankwoord

189

Het is beter ĂŠĂŠn mijl te reizen dan om duizend boeken te lezen.

190

~ Confucius ~

CHAPTER about the author

About the author Lars van Middendorp was born on August 23, 1986 in Achterveld, the Netherlands. From 1998 till 2004 he attended secondary education at “stedelijk gymnasium, Johan van Oldenbarnevelt” in Amersfoort where he obtained his gymnasium diploma. In 2004 he started his medical training at the Faculty of Health, Medicine and Life Sciences at Maastricht University. In his final year the interest for cardiothoracic surgery began to grow, with a clinical internship at the cardiothoracic surgery department, under the supervision of Prof. Dr. Jos Maessen. This was followed by a research internship entitled “Circulating Cells” at the cardiology department under the supervision of Prof. Dr. Johannes Waltenberger. The research focused on monocyte function in patients with coronary artery disease. In August 2010 he graduated as medical doctor. At the same time he started as an intern at the cardiothoracic surgery department at Maastricht University Medical Centre. From November 2010 he combined his clinical work with a PhD track at Maastricht University under the supervision of Prof. Dr. Frits Prinzen, Prof. Dr. Jos Maessen and Dr. Frans van Nieuwenhoven. His research project focused on the improvement our understanding of cardiac dyssynchrony related remodeling processes in the broadest sense of the term. From January 2016 he will start his residency at the department of cardiothoracic surgery under the supervision of Prof. Dr. Jos Maessen and Dr. Suzanne Kats.

191

De auteur Lars B. van Middendorp is geboren op 23 augustus 1986 te Achterveld. In 2004 behaalde hij zijn gymnasium diploma aan het stedelijk gymnasium, Johan van Oldenbarnevelt te Amersfoort. Direct na het behalen van zijn diploma is hij gestart met de studie Geneeskunde aan de Universiteit van Maastricht, waar hij in 2007 zijn bachelor diploma behaalde. Vanuit de bachelor-opleiding is hij doorgestroomd naar de master Geneeskunde. Tijdens zijn ‘GESP’ stage op de afdeling cardiothoracale chirurgie (CTC) van het MUMC, onder supervisie van Prof. Dr. Jos Maessen, ontstond de interesse voor dit vakgebied. Deze stage werd opgevolgd door een onderzoeksstage (‘WESP’) binnen de afdeling cardiologie van ditzelfde ziekenhuis. Het onderzoek met de onderzoekstitel ‘Circulating Cells’ werd gesuperviseerd door Prof. Dr. Johannes Waltenberger, en richtte zich op de monocyt functie van patiënten met coronair vaatlijden. In augustus 2010 werd de master afgerond, waarna hij direct werd aangesteld als AGNIO op de afdeling cardiothoracale chirurgie van het MUMC te Maastricht. Vanaf november 2010 werd het klinische werk gecombineerd met dit PhD traject aan de universiteit van Maastricht, onder supervisie van Prof. Dr. Frits Prinzen, Prof. Dr. Jos Maessen en Dr. Frans van Nieuwenhoven. Zijn onderzoek was gericht op het verbeteren van het inzicht in de processen die geïnduceerd worden door cardiale dyssynchronie. In januari 2016 zal hij starten met zijn opleiding tot cardiothoracaal chirurg in het MUMC onder supervisie van Prof. Dr. Jos Maessen en Dr. Suzanne Kats.

192

CHAPTER about the author

193

List of publications Strik M, van Middendorp LB, Vernooy K. Animal models of dyssynchrony. J Cardiovasc Transl Res. 2012;5:135-145 van Middendorp LB, Carolin JM v Deursen, Frits W. Prinzen Dyssynchronous heart failure from bench to bedside. Springer; 2013. van Middendorp LB. Electrophysiological and hemodynamic effects of vernakalant and flecainide in dyssynchronous canine hearts. Europace. 2013 Strik M, van Deursen CJ, van Middendorp LB, van Hunnik A, Kuiper M, Auricchio A, Prinzen FW. Transseptal conduction as an important determinant for cardiac resynchronization therapy, as revealed by extensive electrical mapping in the dyssynchronous canine heart. Circ Arrhythm Electrophysiol. 2013;6:682-689 Strik M, van Middendorp LB, Houthuizen P, Ploux S, van Hunnik A, Kuiper M, Auricchio A, Prinzen FW. Interplay of electrical wavefronts as determinant of the response to cardiac resynchronization therapy in dyssynchronous canine hearts. Circ Arrhythm Electrophysiol. 2013;6:924-931 van Middendorp LB, Strik M, Houthuizen P, Kuiper M, Maessen JG, Auricchio A, Prinzen FW. Electrophysiological and hemodynamic effects of vernakalant and flecainide during cardiac resynchronization in dyssynchronous canine hearts. J Cardiovasc Pharmacol. 2013 van Middendorp LB, de Jong S, Hermans RH, de Bakker JM, Bierhuizen MF, Prinzen FW, van Rijen HV, Losen M, Vos MA, van Zandvoort MA. Ex vivo and in vivo administration of fluorescent cna35 specifically marks cardiac fibrosis. Mol Imaging. 2014;13 Ploux S, Strik M, van Hunnik A, van Middendorp LB, Kuiper M, Prinzen FW. Acute electrical and hemodynamic effects of multisite left ventricular pacing for cardiac resynchronization therapy in the dyssynchronous canine heart. Heart Rhythm. 2014;11:119125 van Middendorp LB, Maessen JG, Sardari Nia P. A patent ductus arteriosus complicating cardiopulmonary bypass for combined coronary artery bypass grafting and aortic valve replacement only discovered by computed tomography 3d reconstruction. Interact Cardiovasc Thorac Surg. 2014;19:1071-1073

194

CHAPTER list of publications

195

CARDIAC DYSSYNCHRONY structural, functional, transcriptional and pharmacological aspects Our ultimate goal was to extend our knowledge about the impact of cardiac dyssynchrony on the heart, from gene expression, to structural remodeling and eventually assess the impact on the cardiac function. Dyssynchrony has a tremendous effect on any of these strongly interacting levels. Our ultimate goal was to extend our knowledge about the impact of cardiac dyssynchrony on the heart, from gene expression, to structural remodeling and eventually assess the impact on the cardiac function. Dyssynchrony has a tremendous effect on any of these strongly interacting levels.