Expression and localization of gene encoding biomineralization in magnetotactic bacteria by SSR-IIJLS JOURNAL

Int. J. Life. Sci. Scienti. Res.

January 2018

RESEARCH

ARTICLE

Expression and Localization of Gene encoding Biomineralization in Magnetotactic Bacteria 1

Renu Singh1*, Tanzeel Ahmad2 PhD Scholar, School of Biotechnology, IFTM University, Moradabad, India 2 Head, School of Biotechnology, IFTM University, Moradabad, India

Address for Correspondence: Ms. Renu Singh, PhD Scholar, School of Biotechnology, IFTM University, Moradabad, India Received: 27 Oct 2017/Revised: 28 Nov 2017/Accepted: 30 Dec 2017

ABSTRACT- The magnetosome is organelles of prokaryotic bacteria having a magnetic property, they are Magnetotactic Bacteria. MTB consisting of phospholipids bilayer bounded a magnetite crystal that contains the different set of proteins and functionally different. The magnetosome particles are potentially useful in the number of applications as a magnetic nanoparticle. In this work, we studied the localization and expression of proteins play an essential role in magnetosome biomineralization process by fluorescence microscopy and biochemical analysis in microaerophilic Magnetospirillum gryphiswaldense R3/S1. Although optimum conditions were mutually exclusive for high fluorescence and magnetite synthesis through this study, oxygen-limited growth conditions were established, which enhance magnetite biomineralization, growth, and formation of GFP fluorophore at reasonable rates. Through fluorescence microscopy and immunoblotting technique, we were studied that the subcellular localization and expression of magnetosome proteins i.e. GFP-tagged. Among MamC, MamF, and MamG magnetosome proteins fused to GFP, the strongest expression, and fluorescence displayed by MamC-GFP. The magnetosome tagged to MamC-GFP purified from cells shows strong fluorescence, shows stability towards wide temperature range and salt concentration however sensitive towards detergent. Our research exhibited the utilization of MamC as an anchor for magnetosomespecific display for fusions of the heterologous gene. Key-words- Magnetotactic Bacteria, Gene cloning, Fluorescent Microscopy, Immunoblotting, Biomineralization

INTRODUCTION The MTBâ&#x20AC;&#x2122;s magnetosomes are specific organelles for magnetic orientation of magnetosomes that comprise of magnetic iron mineral crystal enveloped within membrane [1-2]. Magnetosomes are synthesized by magnetite (Fe3O4) precipitation inside particular vesicles framed by the magnetosome membrane (MM) in strains of Magnetospirillum, which inhaled from the cytoplasm membrane and contains various particular proteins that are involved in functional magnetosome particles synthesis [3-6]. Huge increment in interdisciplinary research is aimed to understand the mechanism magnetotactic bacteria through which they achieve their exceptional control over the properties of the crystals of magnetic minerals and association of highly ordered chain-like structure [7-8]. Magnetotactic bacteria have emerged as effective models for the investigation and study of cell biology and formation of organelle in prokaryotes, as magnetosomes show numerous features that are also shown in organelles of eukaryotes [8]. Access this article online Quick Response Code

Website: www.ijlssr.com

DOI: 10.21276/ijlssr.2018.4.1.10

Furthermore, the uniform sizes of magnetosome, their crystal habits and magnetic property made them interesting for utilizing them as magnetic nanoparticles with extremely extraordinary properties [9-10], and various potential applications i.e. magnetic separation, analyses detection use in MRI as contrast agent, & use as magnetic nanoparticles in magnetic hyperthermia treatment [11-14]. Most of these applications require functional magnetosome particles, e.g. by the magnetosome-specific display of the functional moieties, for example, antibody binding protein, enzyme, oligonucleotides as protein tags [14] . Mostly, this has been achieved by coupling specific ligands chemically to lipids or proteins of MM [15-18]. On the other hand, the integral magnetosome membrane proteins (MMPs) utilized as an anchor for magnetosome specific display of fused heterologous proteins [10,19-20]. For instance, luciferase was utilized as a reporter for expression of genetic fusion of Mms 13 protein of M. magneticum that is magnetosome directed [21]. Green fluorescent protein (GFP) is another protein that is useful as a reporter for expression and intracellular localization of magnetosome proteins. To subcellular organization and membrane targeting in bacteria, for example, Escherichia coli, Bacillus subtilis and Caulobacter crescentus, has been revolutionized by using GFP [22-23]. Various studies have already been conducting however still the subcellular localization of several magnetosome proteins is under research. The GFP-assisted fluorescent microscopy was already used to study the magnetosome

Page 1567

Int. J. Life. Sci. Scienti. Res.

protein’s subcellular localization in M. magneticum. The protein which was investigated includes MamA Protein, which is probably required in magnetosome activation where as the intracellular assembly of magnetosome chain controlled by acidic MamJ protein and the actin-like MamK protein. In spite of the fact that these examples previously verified its principal utility in MTB, the GFP expression can be problematic if used as an intracellular marker of magnetosome localization. The formation of magnetite crystal with in microaerophilic organisms required very low oxygen concentration that is underneath 10 mbar (×100 pas) [24], subsequently maturation of proteins needs molecular oxygen during last step of fluorophore maturation, thus the use of GFP at micro-or anaerobic is limited [25-26]. Likewise, it has been seen that intensity of fluorescence and fluorescent cell proportion were rather low and different under microoxic growth condition [26]. This research paper was intended to explore the expression of GFP fused protein in the microaerophilic M. gryphiswaldense R3/S1 at different oxygen levels by using fluorescence microscopy. Optimum cultivation condition was estimated regarding growth, magnetite crystal biomineralization and maximum expression of GFP fused proteins and fluorophore formation. We were additionally analyzed the subcellular localization of magnetosome proteins i.e GFP-tagged are MamC, MamF, and MamG, by fluorescence microscopy and immunoblotting. These proteins were also involved in controlling the size of growing magnetite crystal [27]. The GFP modified fluorescent magnetic nanoparticles were isolated and purified from bacterial cells and studied in vitro condition for identifying the stability of expression and fluorescence of MamC-GFP labeled magnetosomes.

January 2018

in 1 liter flask under aerobic and microaerobic condition. The cell was incubated in free gas exchange with air for aerobic cultivation and for microaerobic cultivation, flasks was sealed with butyl rubber stopper before autoclaving under microaerobic gas mixture containing 1% O2 in 99% N2 [24]. The inoculation of microaerobic culture was done by injection through rubber stopper. During cultivation, the temperature was mentioned at 28°C and pH 7. All culture grown in incubator shaker for 24-48h and agitated at 100 rpm. For isolation of the gene of interest, standard DNA procedure was employed [29]. The primers sequences of gene cloning and fusion constructs were purchased from GENETIC. The primer sequences are analyzed previously [28]. Primer sequences are listed in Table 1. Table 1: Primers used in this research [28] Primer Name

Target gene

Sequence*

egfp

catatgggaggcggaggcggtggcggaggtggcg gagtgagcaagggcgaggag

CL2

egfp

gtggatccttacttgtacagctcgtc

CL3

mamF

ctcgagagggcaaagcaatggccgagac

CL4

mamF

catatggatcagggcgactacatggctg

CL5

mamC

ctcgagaggacaacagcgatgagctttc

CL6

mamC

catatgggccaattcttccctcag

CL7

mamG

ctcgagggagatcagatgatcaagggcatc

CL8

mamG

catatgagcaggctcggcggaggc

MATERIALS AND METHODS A prospective experimental study was designed and performed in department of Biotechnology, IFTM University, Moradabad, Uttar Pradesh, India in the year 2013 to 2017. For cloning E. coli strain DH5α and Top 10 strain, DH5 were used as a host (Top 10 Chemically Competent Cells) and for conjugation Experiments E. coli strain S17-1 was used [28]. These strains were grown on medium Luria-Bertani (LB) which was supplemented with 50ul/ml of kanamycin and ampicilline, and incubate at 37°C for 24 hrs. “M. gryphiswaldense R3/S1” the mutant of “M. gryphiswaldense MSR-1” were used in this study. The “M. gryphiswaldense R3/S1”was resistant to rifampicin and streptomycin. The strain was grown in modified FSM medium microaerobically at 28°C under moderate shaking at 100rpm by using carbon source “27 mM pyruvate” [28]. R3/S1 was cultured in FSM (Flask standard medium) [24]. It contains KH2PO4, 0.15g MgSO4.7H2O, 2.38g Hepes, 0.34g NaNO3, 0.1g yeast extract, 3g soybean peptone, and 1 ml EDTA chelated trace element mixture [24] for carbon source 27 mM potassium L-lactate was added to the medium as an iron source, just before autoclave firstly pH was adjusted to 7.0 with NaOH [24]. All chemical was purchased from SIGMA-ALDRIC. Cultivation of R3/S1 was carried out

*Restriction sites are indicated into the primers indicated in bold, Glycine-linker encoding sequence is in italic front

The GFP-fusion proteins were constructed by using variant of GFPmut1 or termed EGFP (enhancer GFP) was used [30]. By using CL1 forward primar, egfp gene was PCR amplified from plasmid pEGFPN-1 (BD Biotech) .CL1 forward primer adds to 10 glycine linker and NdeI restriction site to 5’end of CL2 reverse primer and egfp gene. To yield pCL1, the PCR product was cloned into pGEMT-Easy. The amplification of mamC, mamF and mamG genes was carried out with pairs of corresponding primers and thus M. gryphiswaldense R3/S1 genomic cDNA taken as template. The pCL2-4 was generated by cloning PCR product into pGEMT-Easy and then transformed into DH5α. The subcloning of egfp gene was done from pCL1 to pBBRMCS-2 plasmid at EcoRI site to yield pCL5 plasmid [31-32]. The screening of plasmid containing egfp in similar orientation as promoter Plac was done by colony PCR technique. For generating the plasmids pL2, pL3 and pL4, translational fusion of mamC, mamF, and mamG were constructed with egfp

Page 1568

Int. J. Life. Sci. Scienti. Res.

January 2018

connected via 10 glycine linker by ligating the mam gene from pL6, pL7, and pL8 into NdeI and XhoI sites of the pL5 Vector [10,28]. List of the plasmids used in this study were listed in the Table 2 [28]. The transformation of plasmid from E. coli S17-1, harboring mam-egfp fusions were performed by conjugation to M. gryphiswaldense R3/S1. Table 2: Plasmids used in cloning and expression of genes [28] Plasmid name

Description

Source or References

pEGFPN-1

GFP expression vector, Ap

BD Biotech

pGEMT-Easy

Cloning vector, Ap

Promega

pCL1

pGEMT-Easy + 10 glycine linker + egfp

Lang and Schuler [28]

pCL2

pGEMT-Easy + mamC

pCL3

pBBR1-MCS2 + 10Gegfp from pCL1 pCL5 + mamC from pCL1

Lang and Schuler [28] Lang and Schuler [28]

mobilizable broad host range vector, Km pCL5 + mamF from pCL1

Lang and Schuler [28] Lang and Schuler [28]

pCL4

pBBR1-MCS2 pCL5

Lang and Schuler [28]

The transformed M. gryphiswaldense R3/S1 strain bearing plasmid pCL5-pCL8 was growing in 15 ml tube of polypropylene, which is sealed with a screw cap. The tube consists of the culture of about 11ml Ref. [28]. At final Concentration of 1-5uM, the membranes stain FM4-64 were used to stain cell membrane and then immobilized on agarose pads to get imaged with an Olympus BX61 microscope equipped with a 100X UPLSAP0100X0 Objective [18,28]. Images were captured and analyzed using software Image 1.36b and Olympus cellM [28]. The microscopy of fluorescent magnetosomes was done by spooling the suspension of approximately 15 µl of magnetosomes with magnetosomes concentration corresponding to an iron concentration of 10mM [4]. The bar magnet was placed next to the microscopic slide were image using Zeiss LSM510 Microscope equipped with l0x objective and a photometric Coolsnap HQ Camera [28]. The best method was employed to analysis the localization of MamC, MamF, and MamG-GFF through immunoblotting. It was performed by applying SDS PAGE and western blot analysis. For PAGE, the protocols described by ‘Laemmli’ were followed [32-33]. Here the protein samples obtained from various Cellular fractions were allowed to mix in electrophoresis sample

buffer. The buffer was prepared from 0.1M DTT, 62.5mM Tris-HCl, 1.6% SDS, 0.0002% bromophenol blue and 5% glycerol. The sample with buffer was then allowed to denature at 100°C for 5mim [28,33]. The gels were loaded with 15 microgram protein for analyses of MM protein fraction through SDS PAGE [28]. The separated of MMP were performed on 15% (wt/vol) gels and visualization of protein was done by staining it with coomassie brilliant blue. Western blot analyses were done by using 10% (wt/vol) gels. The blotting technique was performed to transfer electrophoresis protein onto nitrocellulose membranes [8]. The membranes were blocked at room temperature for 2hr [34]. The blocking solution along with an Anti-GFP antibody (1:1000 dilutions) or an Anti-MamC (1:500 dilution) antibody was allowed to incubate at room temperature for 1h. The washed of membrane was done with Tween Tris-buffered saline and Tris-buffered saline (TBS) for several times and then alkaline phosphates labeled goat anti-rabbit IgG antibody was added to TBA (1:1000 dilution) [4]. The membrane was washed with TBS and BCIP (5-brono-4chloro-3-indolyl phosphate or nitroblue tetrazolium) after incubation at room temperature for 45min, detection was done using detection reagent [35].

RESULTS AND DISCUSSION Here, we studied the expression and subcellular localization of protein tagged to GFP, are MamC, MamF, and MamG as they play an essential role in MM formation. Fluorescence microscopy was done while magnetosome is synthesizing, to analyze the expression and subcellular localization of GFP-tagged Mam-C, MamF, and MamG protein. The typical linear signal of fluorescence was observed at midline along cell axis where usually the magnetosome chain located (Fig. 1). The signal was appeared either as 0.5 to 2µm straight, as punctuated lines or less frequent predominantly with the fusions. The concave side of the cells either reflexes the linear signal or either observed at the shortest connection from one turn to the next. The signal was consistent with localization along axis twist of helical cell. The single bright fluorescent spot was occasionally observed at midcell in MamC-GFP expressing cells. The cytoplasm of cell expressing MamF-GFP and MamG-GFP detected with some fluorescence, that is, approximately 100% and 50% above medium background fluorescence, whereas almost negligible fluorescence display from cytoplasm of the cell expressing MamC-GFP fusions, that is less than 10% above background. The even distribution of fluorescence was observed over the cytoplasm from ‘control cell’ expressing unfused GFP (Fig. 1).

Page 1569

Int. J. Life. Sci. Scienti. Res.

January 2018

Fig. 1: Fluorescence micrograph of M. gryphiswaldense R3/s1 strain expressing MamC-GFP (pCL4), MamF-GFP (pCL5), MamG-GFP (pCL6) or (pCL3) [28] *Scale bars= 3µm Subcellular localization of magnetosome proteins in microaerophilic magnetotactic bacteria has been possible by tagging GFP [5,35-37]. From all the fusion tested, only MamC-GFP fusion perform the highest fluorescence in vivo and on isolated magnetosomes and made consistent with the highest abundance of fusion and the unfused MamC protein, which showed the similar level of expression. By using Coomassie, MamF-GFP and MamG-GFP fusions were detected below in MM preparation. The proteolysis degradation product of MamF-and MamG-GFP fusions indicates the less stability of proteins by immuno-detection. The unfused counter parts of MamF and MamG have expressed strongly then GFP fusions. This could be specified either by an inclination in targeting to the MM, or by a generally low expression from the lac promoter which presents on the backbone of vector and thus making highly desirable study in future on expression of native and inducible promoters. The cell fractions which prepared from magnetic cell and fluorescent were studied by SDS-PAGE and immunodetected. The cell expressing MamC-GFP, an additional protein band of MamC-GFP fusion, of 40 Kda was detected in magnetosome by coomassie stain (Fig. 2A). The coomassie were noticeable by further band stain also detects bands of corresponding fusion proteins, that is, MamF-GFP of about 40.1KDa and MamG-GFP of about 35.5 kDa. However, they recognize alone with an anti-GFP antibody (Fig. 2B). Other then the above identified band an additional band was immunodetected, of 20 kDa from all GFP fractions. The product of proteolytic cleavage was noticeable by further bands; indicate the partial degradation of fusions in a cell which were visible in MM from MamF-GFP and MamG-GFP (Fig. 2B).

A: Detection of GFP combination proteins on separated magnetosomes. SDS-PAGE of MMPs purified from the M. gryphiswaldense R3/S1 strain, and subordinates harboring the plasmids pCL5 (GFP), pCL6 (MamC-GFP), pCL7 (MamF-GFP) and pCL8 (MamG-GFP). The MamC-GFP signal is shown by an arrow sign

B: Immunoblotting of a similar gel as appeared in the upper panal treated with an anti-GFP antibody. Other than the MamC-GFP signal (←), signals for MamFGFP (■) and MamG-GFP (□) are seen. Moreover a putatively non-specific signal (*) is identified at a size of 20 kDa in the fraction of magnetosome division of MamC-GFP, MamF-GFP and MamG-GFP expressing cells

Page 1570

Int. J. Life. Sci. Scienti. Res.

C: Immundetection of MamC (•) and MamC-GFP (←) in various cell fraction of R3/S1 (pCL6) (MamCGFP) and in the magnetosome layer parts of R3/S1 (pCL5) (GFP) and R3/S1 with an anti-MamC antibody

D: Immunodetection of GFP (○) in various cell fraction of R3/S1 (pCL5) (GFP) with an anti-GFP antibody. Secluded magnetosomes communicating GFP combinations to MamC, MamF and MamG show stable fluorescence in vitro condition Fig. 2: Detection of GFP combination proteins in separated magnetosomes and other cell parts The strongest signal in MMP fraction was reveled from immune-detection of MamC-GFP fusion protein by utilizing Antibody “Anti-Mam-C”. The weak band of the same size was observed in the CL, the NF, and the MP but probably not in the SP (Fig 2C). Anti-MamC antibody recognizes the band of unfused MamC which was of 12.5 KDa. It shows a subcellular distribution similar or identical to MamC-GFP. The magnetosome Membrane probably causes the low level of MamC and MamC-GFP in NF and MP; thus eventually the separation procedure depends on magnetism such as immature Magnetite crystal containing vesicles empty magnetosome vesicles and MMs and thus disconnected during purification. The MamC-GFP band has approximately 80% intensity than that of the MamC band, showing that native protein and fusion both are expressed in comparable quantity. Exclusively weak bands of MamF-GFP and MamG-GFP were detected only in MMP fraction, however in other subcellular fractions were below detection including entire CL, which indicates the presence of MamF-GEP and MamG-GFP in small amount, either due to poor expression or strong degradation. Anti-GFP antibody was employed to recognized unfused GFP at the expected size of about 27 KDa in the CL, the NF, and the SP, but not in MP and MMP (Fig 2D). The MamC-GFP, MamF-GFP, and MamG-GFP perform similar localization pattern and length and position of magnetosome chain correlating the linear fluorescence

January 2018

signal [4]. The outcomes of localization studies are agreement with Mam12 immunogold labeling studies that is ortholog to MamC in M. magnetotacticum [4]. But the experiment was not reaching any conclusion regarding Mam12 intracellular localization due to weak immunogold signal [38]. In contrast, the bright dot at midcell observed during MamC-GFP localization shows the variable intracellular localization of MamC protein along the chain and may differ over the cell cycle. The presence of weak fluorescence and immunosignals obtained from immunodetection of different compartments of cells, which expressing GFP fusions to either MamC, MamF or MamG, shows the exclusive targeting of these hydrophobic proteins to the MM. in contrast to other magnetosome protein, they are hydrophilic and showed some different and variable subcellular localization. For instance, MamA-GFP fusion in M. magneticum, which was supposed to play role in activation of Magnetic precipitation and Magnetosome chain length regulation, shows the localization pattern that is depends on growth stage. During exponential phase of growth, a filamentous structure was observed, which come from pole to pole and more punctuated signs were displayed at midcell stationary cells [35]. GFP fused to MamK, is an actin-like protein which forms cytoskeletal magnetosome filament and localization as straight lines that spread out through the most cell [5]. MamJ protein fused to M. gryphiswaldense just Like MamK and MamA and predicted to attach magnetosome filament and magnetosome vesicles together and localized from pole to pole as long filaments [36]. While the length of magnetosome chains extended by the position of a chain of magnetite crystals seems too confined by the linear fluorescent signal which is corresponding to fusion MamGFC-GFP. Cytoplasmic membranes (CM) were not remarkably associated to MamGFC-GFP proteins although hydrophobic proteins were represented by MamGFP with localization in the CM. Hence, our data show the inclusion of highly specific mechanism for targeting MamC, MamF, and MamG to the MM and thus seems different from MMPs involves, MamA, MamJ and MamK. It might be possible that the localization pattern of MamC, MamF and MamG is different from MamA, MamJ and MamK because they are attached with magnetosome filaments but MamC, MamF and MamG are associated predominantly with mature magnetosomes.

CONCLUSIONS The results agreement, the GFP-MamC shows stable and strong fluorescence in-vivo condition. MamC represents the universal anchor for magnetosome display of other protein because MamC tightly attached to Magnetite crystal surface due to which resistant is created to proteolysis and chemical stress. It is expressed as highly and most abundant protein of Magnetosome. MamC does not have functional interference with additional moiety because of small size and hydrophilic C-terminal, which is accessible for fusion protein expression. Conversely, it is unexpected that MamC fusions with heterologous protein interfere formation of magnetosome, as it has

Page 1571

Int. J. Life. Sci. Scienti. Res.

been observed that, due to the deletion of Mam only minute or minor effect was displayed while synthesis of magnetosome.

ACKNOWLEDGMENT The present manuscript is piece of Ph.D. work. The Author is grateful to Prof. Dr. A. Tanzeel and Dr. N. Prakesh for generous help and time-to-time inspiration during preparation of the present manuscript.

REFERENCES [1] Bazylinski DA, and Frankel RB. Magnetosome formation in prokaryotes. Nat. Rev. Microbiol, 2004; 2:217-230. [2] Schuler D. Molecular analysis of a subcellular compartment: The magnetosome membrane in Magnetospirillum gryphiswaldense. Arch. Microbiol, 2004; 181:1-7. [3] Gorby YA, Beveridge TJ, and Blakemore R. Characterization of the bacterial magnetosome membrane. J. Bacteriol, 1988; 170:834-841. [4] Grunberg K, Muller EC, Otto A, Reszka R, Linder D, Kube M, Reinhardt R, and Schuler D. Biochemical and proteomic analysis of the magnetosome membrane in Magnetospirillum gryphiswaldense. Appl. Environ. Microbiol, 2004; 70:1040-1050. [5] Komeili A, Li Z, Newman DK, and Jensen GJ. Magnetosomes are cell membrane invaginations organized by the actin-like protein MamK. Science, 2006; 311: 242-245. [6] Tanaka M, Okamura Y, Arakaki A, Tanaka T, Takeyama H, and Matsunaga T. Origin of magnetosome membrane: proteomic analysis of magnetosome membrane and comparison with cytoplasmic membrane. Proteomics, 2006; 6:5234-5247. [7] Bazylinski DA, and Schubbe S. Controlled biomineralization by and applications of magnetotactic bacteria. Adv. Appl. Microbiol, 2007; 62:21-62. [8] Komeili A. Molecular mechanisms of magnetosome formation. Annu. Rev. Biochem, 2007; 76:351-366. [9] Lang C, and Schüler D. Biogenic nanoparticles: production, characterization and application of bacterial magnetosome. J. Phys. Condens. Matter, 2006; 18: S2815-S2828. [10] Lang C, Schuler D, and Faivre D. Synthesis of magnetite nanoparticles for bio- and nanotechnology: Genetic engineering and biomimetics of bacterial magnetosomes. Macromol. Biosci, 2007; 7:144-151. [11] Hergt R, Hiergeist R, Zeisberger M, Schuler D, Heyen U, Hilger I, and Kaiser WA. Magnetic properties of bacterial magnetosomes as diagnostic and therapeutic tools. J. Magn. Magn. Mat, 2005; 293:80-86. [12] Lisy MR, Hartung A, Lang C, Schuler D, Richter W, Reichenbach JR, Kaiser WA, and Hilger I. Fluorescent bacterial magnetic nanoparticles as bimodal contrast agents. Invest. Radiol, 2007; 42:235-241. [13] Yoshino T, Kato F, Takeyama T, Nakai K, Yakabe Y, and Matsunaga T. Development of a novel method for screening of estrogenic compounds using nano-sized bacterial magnetic particles displaying estrogen receptor. Analyt. Chim. Acta, 2005; 532:105-111. [14] Yoza B, Arakaki A, and Matsunaga T. DNA extraction using bacterial magnetic particles modified with hyperbranched polyamidoamine dendrimer. J. Biotechnol, 2003; 101:219-228.

January 2018 [15] Ceyhan B, Alhorn P, Lang C, Schuler D, and Niemeyer CM. Semisynthetic biogenic magnetosome nanoparticles for the detection of proteins and nucleic acids. Small, 2006; 2:1251. [16] Matsunaga T, Nakayama H, Okochi M, and Takeyama H. Fluorescent detection of cyanobacterial DNA using bacterial magnetic particles on a MAG-micro array. Biotechnol Bioeng, 2001; 73(5):400-405. [17] Tanaka T, Yamasaki H, Tsujimura N, Nakamura N, and Matsunaga T. Magnetic control of bacterial magnetite-myosin conjugate movement on actin cables. Mater. Sci. Eng.C, 1997; 5:121-124. [18] Wacker R, Ceyhan B, Alhorn P, Schüler D, Lang C, and Niemeyer CM. Magneto-Immuno PCR: A homogeneous immunoassay based on biogenic magnetosome nanoparticles. Biochem. Biophys. Res. Commun, 2007; 357: 391-396. [19] Yoshino T, and Matsunaga T. Efficient and stable display of functional proteins on bacterial magnetic particles using Mms13 as a novel anchor molecule. Appl. Environ. Microbiol, 2006; 72:465-471. [20] Yoshino T, Takahashi M, Takeyama H, Okamura Y, Kato F, and Matsunaga T. Assembly of G protein-coupled receptors onto nanosized bacterial magnetic particles using Mms16 as an anchor molecule. Appl. Environ. Microbiol, 2004; 70:2880-2885. [21] Matsunaga T, Suzuki T, Tanaka M, and Arakaki A. Molecular analysis of magnetotactic bacteria and development of functional bacterial magnetic particles for nano-biotechnology. Trends Biotechnol, 2004; 25:182-188. [22] Margolin W. FtsZ and the division of prokaryotic cells and organelles. Nat. Rev. Mol. Cell Biol, 2005; 6:862-871. [23] Southward CM, and Surette MG. The dynamic microbe: green fluorescent protein brings bacteria to light. Mol. Microbiol, 2002; 45:1191-1196. [24] Heyen U, and Schuler D. Growth and magnetosome formation by microaerophilic Magnetospirillum strains in an oxygen-controlled fermentor. Appl. Microbiol. Biotechnol, 2003; 61:536-544. [25] Heim R, Prasher DC, and Tsien RY. Wavelength mutations and posttranslational autooxidation of green fluorescent protein. Proc. Natl. Acad. Sci. USA, 1994; 91:12501-12504. [26] Reid BG, and Flynn GF. Chromophore formation in green fluorescent protein. Biochemistry, 1997; 36:6786-6791. [27] Scheffel A, Gardes A, Grünberg K, Wanner G, and Schuler D. The major magnetosome proteins MamGFDC are not essential for magnetite biomineralization in Magnetospirillum gryphiswaldense, but regulate the size of magnetosome crystals. J. Bacteriol, 2007; 190:377-386. [28] Lang C and Schuler D. Expression of green fluorescent protein fused to magnetosome proteins in microaerophilic magnetotactic bacteria. Applied and Environmental Microbiology, 2008; 74: 4944-4953. [29] Sambrook J, and Russel WD. Molecular cloning: A laboratory manual (3rd edn.). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 2001. [30] Larrainzar E, O'Gara F, and Morrissey JP. Applications of autofluorescent proteins for in situ studies in microbial ecology. Annu. Rev. Microbiol, 2005; 59:257-277. [31] Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM 2nd, and Peterson KM. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene, 1995; 166:175-176.

Page 1572

Int. J. Life. Sci. Scienti. Res. [32] Grunberg K. Biochemical and molecular-biological examination of the magnetosome membrane of Magnetospirillum gryphiswaldense. Doctoral thesis. University, Bremen, 2005. [33] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 1970; 227:680-685. [34] Grunberg K, Müller EC, Otto A, Reszka R, Linder D, Kube M, Reinhardt R and Schüler D. Biochemical and proteomic analysis of the magnetosome membrane in Magnetospirillum gryphiswaldense. Appl. Environ. Microbiol, 2004; 70:1040–1050. [35] Komeili A, Vali H, Beveridge TJ, and Newman D. Magnetosome vesicles are present prior to magnetite formation and MamA is required for their activation. Proc. Natl. Acad. Sci. U.S.A, 2004; 101:3839-3844. [36] Scheffel A, Gruska M, Faivre D, Linaroudis A, Plitzko JM, and Schuler D. An acidic protein aligns magnetosomes along a filamentous structure in magnetotactic bacteria. Nature, 2006; 440:110–114.

January 2018 [37] Schultheiss D, Handrick R, Jendrossek D, Hanzlik M, and Schuler D. The presumptive magnetosome protein Mms 16 is a PHB-granule bounded protein (phasin) in Magnetospirilum gryphiswaldense. J. Bacteriol, 2005; 187:2416-2425. [38] Taoka A, Asada R, Sasaki H, Anzawa K, Wu LF, and Fukumori Y. Spatial localizations of Mam22 and Mam12 in the magnetosomes of Magnetospirillum magnetotacticum. J. Bacteriol, 2006; 188:3805-3812. International Journal of Life Sciences Scientific Research (IJLSSR) Open Access Policy Authors/Contributors are responsible for originality, contents, correct references, and ethical issues. IJLSSR publishes all articles under Creative Commons Attribution- Non-Commercial 4.0 International License (CC BY-NC). https://creativecommons.org/licenses/by-nc/4.0/legalcode

How to cite this article: Singh R, Ahmad T. Expression and Localization of Gene encoding Biomineralization in Magnetotactic Bacteria. Int. J. Life. Sci. Scienti. Res., 2018; 4(1):1567-1573. DOI:10.21276/ijlssr.2018.4.1.10 Source of Financial Support: Nil, Conflict of interest: Nil

Page 1573