TargetMD 2012 (4 of 4) by Muscular Dystrophy UK

magazine

Target MD Issue 4 of 4 2012

Technology Read of the difference technology makes to so many lives

Feature

Paralympic sport All inside

Updates from London 2012

Campaigning news – Research updates – Sports latest – Airlines report – Fundraising events – Trailblazers news

The new Avantgarde3 Living ahead!

31 year old Nina is a model, mother, wife and rugby player. She lives her dreams and enjoys life to the full. When posing before the camera Nina emits passion, beauty and radiance that even her wheelchair cannot distract – quite the reverse!

‘I would like to make a difference and hope my actions inspire others with a similar disability, to have the courage to live their dreams’. Following a car accident that changed her life leaving her a quadriplegic, with the assistance and support of family and friends Nina energetically fought her way to regain her old (new) life back. ‘Most important is a healthy self being and feeling of value, whether disabled or not. I have learned to live with change and have become extremely disciplined’ states Nina. ‘Obviously my family and modeling career keep me extremely busy, however, during 2008 I commenced a new hobby and actively and enthusiastically play wheelchair rugby defense for the Maple Panthers. Rugby is like playing chess, only more complicated since the figures move considerably faster!’ Ottobock

0845 600 7664 · www.ottobock.co.uk

www.muscular-dystrophy.org

A word from the CEO Our thoughts may already be starting to turn to our friends and families and Christmas and New Year celebrations, although we can still look back with warmth to an amazing summer of sport! The Paralympics fortnight highlighted so much sporting talent and achievement from across the UK, and many viewers gained a fresh perspective on disability through the excellent television coverage. We are always thrilled to hear about the outstanding achievements of people with muscular dystrophy and related neuromuscular conditions in events such as Boccia and swimming. We are also delighted to work closely with the Wheelchair Football Association, and we will promote this exciting, fast-paced sport to our supporters and families wherever we can. Turning to research, we are focused on accelerating the pace towards the development of treatments for muscle-wasting conditions. Published data from early trials involving exon skipping as a potential treatment for Duchenne muscular dystrophy give hope and encouragement. Our newly-launched Duchenne Research Breakthrough Fund aims to build on these promising developments, and we are encouraged by the scientific view that exon skipping technology may offer a route to potential treatments for some other conditions too. Our Fund’s target of £1.6m over five years reflects our commitment to continue groundbreaking projects as well as to future research, ensuring clinical trial-readiness and support for our specialised role in ensuring regulators and commissioners are ready to meet the costs of what are likely to be expensive, though much-needed, treatments. While research remains a key priority, we are also pleased with the campaigning progress in improving specialist health services and, through the Trailblazers network, to removing barriers to a full and independent life. We launched the McCollum Report in Northern Ireland in July leading the Health Minister to agree to our call for critical gaps in service provision to be addressed. Our Trailblazers’ airlines investigation led to a strategic review of accessibility of air travel, and the All Party Parliamentary Group for Young Disabled People highlighted in Westminster the results of nine Trailblazers’ inquiries looking at issues affecting young disabled people. While we are encouraged by the progress we are making, we know there is much we still have to do. We depend on the vital and generous support of individuals and families as we receive no funds at all from the government. We do appreciate that these are not the easiest of times to raise funds and we are as determined as ever to ensure every pound is spent wisely and to the best effect. Please accept my best wishes for a lovely Christmas and a peaceful and prosperous 2013.

Robert Meadowcroft Chief Executive

page 3

page 4

www.muscular-dystrophy.org

Sports at the City Hall 22

Championing sports for young disabled people

Cover image: Martyn Sibley, disability activist and technology guru. See p14.

Contents 10

The appy corner - TalkMD members talk phone apps

Louiseâ&#x20AC;&#x2122;s rollercoaster review of her new headrest

Beccy and her gadgets

Daniel Baker: the NASA man

Anne Marie reviews an iPad stand

News

Meet our Presidentâ&#x20AC;&#x2122;s Award and Kite Award winners

Our new Duchenne Research Breakthrough Fund

Paralympics update from gold-medallist Ollie Hynd

Trailblazers airlines report causes turbulence

06 18

Features

Regular

Letters - write and tell us what you think

The best of the web

Fundraising news

www.muscular-dystrophy.org

Hello, Welcome to our fourth and final edition of Target MD for 2012. This edition is devoted to technology – a huge topic, which we could never do justice to in one single magazine! For some disabled people, technology offers a way into the world of work that might otherwise not be available; for others it offers the opportunity for entertainment, to unwind and de-stress at the end of a busy day, and for yet others, technology literally keeps them alive. Meet some great individuals, like Dan Baker, Sulaiman Khan and Beccy Oughton, and read the various other ways technology plays a part in the lives of so many of our supporters. If you have any ideas or suggestions to add, do get in touch. I’m keen to keep the conversation going. Over the past year, Target MD has introduced you to five incredible Paralympians within our community. Read on p27 about their experience of the London Games – the joys, heartaches and incredible memories. We bring you our regular update from the Wheelchair Football Association (p30), and introduce you to all of our Kite Award and President’s Award recipients for 2012 (p18) And, of course, our latest campaigning and research news, as well as some exciting fundraising events to get involved in. We’re growing our subscriber base for Target MD and Target Research, so if you don’t already subscribe, please look at our back cover and consider doing so. Your support of our vital work really does help us. If you have any comments about or ideas for the magazine, do get in touch. We always want to bring you the news and stories you want to read. The magazine for supporters of the Muscular Dystrophy Campaign, written and produced entirely in-house. Editor Ruth Martin Art director Deborah Waters targetmd@muscular-dystrophy.org

Festive greetings to you and yours, and we do hope to see you at our Spirit of Christmas concerts around the country. (See p25.) I’d love to hear from you.

Advertising enquiries: Richard Walters e: Richard.walters@cpl.co.uk t: 01223 477 428 Muscular Dystrophy Campaign 61 Southwark Street London SE1 0HL t: 020 7803 4800 e: info@muscular-dystrophy.org w: www.muscular-dystrophy.org Disclaimer While every effort has been made to ensure the information contained within TargetMD is accurate, Muscular Dystrophy Campaign accepts no responsibility or liability where errors or omissions are made. The Muscular Dystrophy Campaign does not necessarily endorse the products advertised and no responsibility can be accepted for claims made by the advertisers. The views expressed in this magazine are not necessarily those of the charity. ISSN 1663-4538

Registered Charity No. 205395 and Registered Scottish Charity No. SC039445 Printed on PEFC paper, produced at a mill that is certified with the ISO14001 environmental management standard Enclosed into a bio-degradeable polybag

Ruth Martin

Editor t: 020 7803 4836 e: r.martin@muscular-dystrophy.org tw: @RuthWriter

Interact with us and more than 8,700 fans on our Facebook page at: www.facebook.com/musculardystrophycampaign Join 4,400 others and follow us for regular updates on all areas of our work @TargetMD

About the Muscular Dystrophy Campaign

The Muscular Dystrophy Campaign is the leading UK charity focusing on muscular dystrophy and related neuromuscular conditions. We are dedicated to finding treatments and cures and improving the lives of the 70,000 adults and children affected by the conditions. We focus on funding world-class research, providing practical information, advice and support, campaigning to bring about change and raise awareness, awarding grants towards the cost of specialist equipment and providing specialist education and development for health professionals.

page 5

page 6

www.muscular-dystrophy.org

Letters What do you think? Write to us... Hello Thank you so much for the amazing self-management pack. We have a selfmanagement pack for general neuro conditions, but this is much better I think. I would love to use some of it and the ideas in it to improve our other pack. Alison Wiesner, Herts Community NHS Trust (email)

I’d just like to say a massive thank you for the article again, Ruth, it really helps knowing we have the support of so many people. Keep up the good work! Yours sincerely Gary Bennett [We featured the lovely Bennett family in Target MD, Issue 3 of 4, p16.] www.muscular-dystrophy.org

Abbi’s campaign –

one in a million

ary and Sarah Bennett started their own fundraising Abbi’s campaign – one committee: in a million. According to their Facebook page, their mission is ‘to raise awareness of the range of muscular dystrophies (of which there are 60) and to Muscular Dystrophy work alongside the Campaign to raise funds which are so vital for research and development the of potential treatments Muscular Dystrophy for the future. Without Campaign, the recent the breakthrough of exon for boys with Duchenne skipping muscular dystrophy would not have been possible.’

Sarah and Gary Bennett live in Birmingham with their family of four daughters: Ashleigh (12), Amber (6), Abbi (4) and Ava (2). Sarah is studying psychology and Gary works as a teaching assistant in a special needs school. Their first child together, Abbi, was born in February 2008. Everything seemed fine at first and Gary was overjoyed in becoming a dad for the first time. However, when Abbi was a few months old she wasn’t gaining weight as she should and by six months she wasn’t

crawling or pulling herself up as other babies do. Doctors were unable to tell them what was wrong and she was referred to the Birmingham Children’s Hospital. After various tests and a biopsy, Abbi was diagnosed in April 2011 with Ullrich congenital muscular dystrophy. “We were in total shock, mainly because nobody could really tell us about the condition or what we could expect for the future. Over the last two years, more information has become available and we know more about what we are dealing with, which makes it a little easier for us and for Abbi to accept and understand,” said Gary. “Abbi is a beautiful, happy, intelligent young lady who loves to sing. She continues to inspire us everyday.” Because so many people were fundraising in support of Abbi, Gary and Sarah decided to start their own fundraising committee to support the charity. Abbi’s

Abbi’s condition

Ullrich congenital muscular

On the web Abbi’s Facebook page: www.facebook.com/AbbiFaithBe nnett/info Follow Gary and Sarah on Twitter: @MrGB2909 and @mrssb1002

campaign got its name from the odds of being born with Ullrich congenital muscular dystrophy.

“Our goals are simple: to raise as much – and money –awareness as we can of muscular dystrophy and the impact it has on families in the UK and indeed the rest of the world,” said Sarah. Gary recently skydived, along with friend Lauren Ainge, for Team 100 in the Make today count fundraising initiative in February 2012, and in November 2011 he and Daniel Bacon dived with sharks at the Blue Planet Aquarium in Chester. One of their major fundraisers, Liam Barnes, is doing four runs for them and another, John Darby, has organised a quiz night.

With the help of Sarah’s mum, who has a photography business, the committee also produced their own version of a Calendar Girls’ calendar for 2012. The committee is also organising a race night to thank all their supporters and are looking for the next exciting challenge to take on. The committee is supported by Charlotte Allen their local Muscular Dystrophy Campaign Volunteer Fundraising

dystrophy:

The congenital muscular dystrophies are a group of conditions which presentation and a similar share early appearance of the muscle. and in congenital muscular Congenital means ‘from birth’ dystrophy the initial symptoms are present the first few months. Conge at birth or in nital muscular dystrophies of conditions and in are a very heterogeneous the last few years a lot group of effort has gone into separate entities and identifying the in locating the genes responsible for a number of these forms. Ullrich congenital muscular dystrophy is a form of congenital muscular with specific features: dystrophy • children are often double-jointed in their hands and feet in other joints such as but have some tightness elbows or hips • they have rigidity (stiﬀ ness) of the spine • children tend to develop respiratory problems, which infections and might result in frequent chest require ventilatory support at night.

Many thanks for the Boccia tickets – we are really looking forward to it. It was very kind of you to send them. Best wishes Anne and Andrew Duffy (letter) (Andrew won two tickets to a Paralympics Boccia event at the ExCel Centre.) It was a lovely day especially for Andy as he met up with Zoe [ParalympicsGB Boccia player] again. There were so many people in chairs and it was no issue as everything was sorted re ramps at St Pancras and Stratford, without even asking. DLR railway is brilliant. You could just get on with everything and people were lovely. So please pass on our thanks again. Peter, Andy’s brother (text)

Dear Editor

Feature

Hi there

www.muscular-dystrophy.org

Manager, who helps them with ideas, resources, and plenty of encouragement to keep up the good work.

“In fact, without meeting Charlotte, we probably wouldn’t have done half the things we have. A big thank you to her,” said Sarah. “Our main supporters at the moment are family, friends and work colleagues, all of whom have shown us a kind of generosity that we could only dream of. We keep them engaged through Facebook and Twitter with regular updates of what we are doing, where their money is going and what Abbi has been up to,” said Gary. Committees All across the country, supporters of the Muscular Dystrophy Campaign are coming together to form local fundraising teams and committees. Over the last two years about 50 groups have been established new raising about £200,000 by organising balls, walks, coffee mornings and collections, to name just a few. Those involved say they have enjoyed meeting new people, developing new skills and having a lot of fun along the way. If you’d like to help us in the fight against muscular dystrophy and related neuromuscular conditions, why not join your local fundraising committee or get together friends and family to establish your own group? Your local Volunteer Fundraising Manager is on hand to support you every step of the way. Call our fundraising hotline on 0845 872 9058

How we support our

volunteers

Our relationships with families we support arevolunteers, their local community, the access to a dedicated paramount. As a volunteer, you have Volunteer Fundraising team at our head office, as well as a Manager (VFM) in your support you in everything region, who will you do.

Charles Horton is our VFM for the North West and North Wales. He team of eight such is one of a managers who work all across the UK. Here’s the life of a VFM might what a week in look like:

Monday

Friday Phone calls, emails, thank you 8.30am: check letters; updating the website. Afternoon: through emails prepare for meetings next week, and telephone including two days in London at a VFM messages. national team meeting. 10am: weekly team Saturday Diving with sharks conference call. event at the Blue Planet Aquarium The rest of the day: mapping in Cheshire. out target Sunday - no events today. areas for prospective new fundraising committees, looking into the profile of “Sometimes a well-planned the area and opportunities diary changes completely Tuesday 9am: off to meet for events. to react to a new a new opportunity. Sometimes volunteer in Lancashire, it can feel like including a lot of things are being induction training. Lunch juggled at once, on the move. but I enjoy never quite Visit the Imperial War knowing what Museum North tomorrow might bring. in Salford to do a risk ” assessment for “It’s good to be part our Zipwire day in October. of a hard-working Emails; put and conscientious team info on to our database. who are all 7.30pm: Branch aware that what they meeting in Warrington; do makes a difference to the lives “It’s wonderful to have of people affected volunteers who by muscular dystrophy support our work in and related so many conditions. We all work Wednesday Working on ways.” towards raising our national enough funds to fight fundraising initiative, these conditions ‘Make every on all fronts, and it is birthday count’. 2.30pm: very satisfying meeting at a to know that many people Liverpool hotel venue want to about a Question volunteer or fundraise of Support. Check post, for us to help us reply achieve our goals.” Thursday 7.30am: leave forto emails. a meeting with my line manager in Penrith at If you’d like to volunteer 10am.12pm: catch-up for the Muscular meeting in Dystrophy Campaign, Rochdale with the Lead do get in touch Volunteer of with us on 0845 872 9058 the North Manchester or fundraising volunteer@muscular-dystrophy committee. .org

page 17

Hello t in touch with the where to turn. When I go I was distraught with no was fantastic! I finally paign advocacy team, it Muscular Dystrophy Cam caring for my son pe help. As an older rson for to n tur to y od eb found som someone that would s wonderful to speak to wa it y, ph tro dys lar scu with mu sionate way you for the caring and compas ul tef gra lly rna ete be l help. I wil helped me. depressive mood; to, it is easy to slip into a n tur to e -on no e hav When you to contact someone the cared for. To be able cts affe er car the cts what affe azing. who understands is am to people like me in tinue to offer this lifeline con to e abl are you pe I do ho in and again. . Thank you again and aga need of people like you Lillian Lancaster tee to Robert Ellis Mother, carer and appoin

Massive milestone in Winchester

The Winchester Branch of the Muscular Dystrophy Campaign will celebrate an important milestone this year: after 42 years of dedicated fundraising, they are close to having raised a whopping £250,000 for the Muscular Dystrophy Campaign. A group of volunteers who came together to fundraise after being approached by their local Volunteer Fundraising Manager, the Branch holds a number of successful fundraising events throughout the year, such as a

tennis tournament, a murder mystery evening, and collections at the local Tesco. They also boost their income by selling the charity’s Christmas cards and collecting goods for car-boot sales.

Janette Hull, Chair of the Winchester Branch, said they were really excited to have raised close to a quarter of a million pounds. “It has been a real team effort. We’d like to thank everyone who’s taken part in an event, put money in our collecting

tins or bought a Christmas card! It’s wonderful to have been able to make such a difference to people living with neuromuscular conditions.” Thank you to all our branches and fundraising committees who support the work of the Muscular Dystrophy Campaign. If you feel inspired to join your local branch or set up your own fundraising group, do get in touch with our fundraising team on 0845 872 9058.

Looking ahead In the next edition of Target MD, due out in January 2013, we’ll focus on travel and leisure. If you’d like to write in and tell us about your best and favourite places to visit, locally or abroad, or fun things you like to do in your local area, please do so – triedand-tested stories are always the best! As always, you’ll also be able to read our latest news, features and updates that keep you, our valued supporters, in the spotlight. People with muscular dystrophy and related neuromuscular conditions, together with their families and carers, are at the heart of everything we do.

Keep in touch with us... We’d love to hear from you and to fill this page with your letters. Send us your good news, your frustrations, your story ideas, as well as any news you’d like to share with our readers. Here’s how you can get in touch with us: via Twitter @TargetMD or @RuthWriter, write to us on our Facebook page or at TalkMD, or write to the Editor of TargetMD at 61 Southwark Street, London SE1 0HL or at targetmd@muscular-dystrophy.org

www.muscular-dystrophy.org page 6

www.muscular-dystrophy.org

What do you think?

Write to us...

Dear Sir Feature

Just a few lines to thank you for sending me copies of the Boccia edition of Target MD [Edition 1 of 2012], which I requested.

www.muscular-dystrophy.org

week, but enjoyed similar to himself mixing with children and taking activities, such part in extra as also introduced joining the Scouts. It him to Edinburgh, he lives today. where

“I believe that time set me up very well for the future,” Mark said.

Mark grew up at Paxton in the idyllic Berwickshire countryside in the Scottish Borders, the middle son of Donald and Janet and brother to Graeme and Stephen. When he went to primary school, his mum wasn’t keeping noticed he kept falling, up with his peers and was struggling to get himself up off Doctors said he was developing the floor. and told his slowly mum not to worry. After ‘a

So thank you again.

Have enclosed a cheque

Yours truly

After school, things Mark. He wished got very difficult for to study art/design at college in Edinburgh, but needed to find somewhere to live that provide the would support he needed. to access the necessary funding, Unable ended up back Mark at home with to do. His nothing parents helped him find suitable accommodation fight to access the and to support and appropriate Authority Local funding, and he finally moved into a shared flat in brand new supported, independent-living accommodation Edinburgh, in called Freespace Living there, Housing. with from a Communityextra support at college Service Volunteer, completed a Higher National he Illustration Diploma in and Media Design. Like students, Mark most had an active involving many social life pubs, clubs and parties.

Mark Chapman in Edinburgh. is a 41-year old man who lives He enjoys photography enjoyed a in and art, anda cosy bungalow in about 20two-week holiday in recently Duchenne years – he went intoSpain where – for the muscular dystrophy. the swimming first time pool. Mark has

hair of the Scottish Muscle Group and horrendous an active member time’ of being of the Cross made to feel like she was Party Group being for Muscular mum was given paranoid, Mark’s Dystrophy in the Scottish a Parliament, Professor Emery. referral for Mark to Mark leads a full, active see and independent has fought life. He hard for the “My parents independence and support then he enjoys today, diagnosis that received the shattering experience and this I had Duchenne drives him dystrophy to speak up muscular other people and were told for in similar situations. I would probably not live beyond adulthood. Mark said. I was only six,”

Since I spoke to you on the phone, my oldest grandson, Scott McCowan, has been picked for the Paralympics GB team which makes the magazine more precious. Sadly his younger brother [Jamie] just missed out.

“Fortunately, my brothers both tested negative.”

After college, Mark found his care needs were increasing. Recurring infections, chest headaches, low energy severe mood and changes led to many GP visits, and the discovery condition was that his seriously aff ecting respiratory function. He was told nothing more could be done. Mark knew However, of a school friend with same condition who – following the emergency an hospital given a tracheotomy admission – was and was now a ventilator. using His friend told him the procedure had ‘saved his life’. Mark discussed his options and family with friends (especially his lifelong and partner, friend Corinna, who living with he’d been for two years), before referred to the same specialist being Dr Ian Grant, consultant, who became consultant Mark’s for a number of years. Mark decided his best choice ahead with was to go a tracheotomy and use a ventilator. He knew there would be risks involved with the surgery, but also knew that he would need increased when he went support home. It took battle – which another he fought and won – to

At 10, Mark started and, after primary using a wheelchair school, he Graysmill went to School in Edinburgh for children with disabilities, – a school residential which had unit – where a he completed schooling in his 1988. He found being away from the family it difficult during the

access the funding to put in place vital fulltime, the one-on-one, 24/7 support he needed.

four times a year instead of That’s right! You will receive Target MD ‘slimline’ Target Research at the three, plus you will receive the new as you did previously. same time, rather than once a year

Thinning bones, menopausal women and muscular dystrophy and equipment grants.

please post your If you’d like to subscribe to the magazines, £18 made payable to details, together with a cheque for Target MD Subscriptions at 61 ‘Muscular Dystrophy Campaign’ to Southwark Street, London SE1 0HL:

Dear Editor

Target Research for one I wish to subscribe to Target MD and year, at a cost of £18. I wish to make a donation of £ __________

Gift Aid Declaration

back from the Inland pound you give, we are able to reclaim Using Gift Aid means that for every tick the box below: your donation to go further. Please Revenue the tax paid on it – helping made in the last four Campaign to treat all gifts that I have Yes I would like Muscular Dystrophy as Gift Aid donations. I make from the date of this declaration years and all future donations that no longer eligible. I will notify the charity if my gifts are

Target MD

School days MUST READ

my donations. No, please do not claim Gift Aid on Capital Gains Tax for each pay an amount of Income Tax and/or To be eligible for Gift Aid you must amount of tax that the the next) that is at least equal to the tax year (6 April one year to 5 April that tax year. charity will reclaim on your gifts for Date___________________________________________ a date this form is invalid. Thank you. Please include a date here, as without

Yes

us?

______________________ Title ______________ First name ____________________Surname

Choices and challenges in finding the best school for your child

Come and play Boccia JOIN IN

Meet the ParalympicsGB hopefuls

Trailblazers news Education, advocacy, fundraising and life stories ALL INSIDE

news • Get fit in 2012 • Campaigning Award • The President’s Awards Research news • Information Standard

Address _______________________________________________________________________

Phone ________________________________________________________________________

Email _________________________________________________________________________ Payment information: cheque Direct debit Credit card Method: below) to pay by credit card/debit card (details

hinning bones are a commonplace problem for menopausal and older women. Add instability and difficulty in to doing enough load-bearing exercise strengthen weakening bones, and you

Time to register

Target Research Issue 1 of 4 2012

A MUST READ

How patient registries are opening up opportunities for both patients and researchers

Speeding up recruitment to clinical trials

Improving care standards

Access to information

Clinical trial opportunities

With the right care, there is a good chance of preventing fractures. Preventative measures ought to save money, whereas reacting when the damage is already done is costly, as well as increasing the suffering of muscular dystrophy patients. Yet this kind of care seems to be a postcode lottery. My experience highlights this.

My mitochondrial myopathy restricts can my mobility and limits the exercise I do. I am also prone to falls. Furthermore, I am peri-menopausal (stage before menopause); a critical time for women when the risk of thinning bones increases

Name of cardholder: name ___________________ Title ______________ First name ____________________Family Access Debit Mastercard Visa Card type: (maestro only) Card No: Expiry Date: /

Start Date(if applicable) /

Issue No.(if applicable)

Security code (if applicable)

atgctttggtgggaagaagtagaggactgttatgaaagagaagatgttcaaaagaaaacattcacaaaatgggtaaatgcacaattttctaagtttgggaagcagcatattgagaa Crucial for clinical trial planning Patient’s link to the research community

Myotonic dystrophy CUTTING-EDGE

Our researchers are improving diagnosis and moving towards possible therapies

Point of View What’s it like to join a patient registry?

Also inside…experts answer your

questions and read about all the

latest research and clinical trial news

Registered Charity No. 205395 and

Registered Scottish Charity No. SC039445

Now I am on high dosage calcium and vitamin D tablets daily, and alendronic a acid tablets (to build up bone) once week, all for the foreseeable future.

Val’s condition

is a collective term for a group of diseases that particularly affect muscle, but which may also affect every other part of the body including the brain and the eye. (Please see our website for more details www.muscular-dystrophy.org)

Osteoporosis is a condition in which bone tissue is structurally altered, bone risk mass is low and there is an increased of breaking bones without significant injury, such as falling from standing height (so-called fragility fracture), for which increasing age and female gender are the most important risks. However, there are a number of important determinants of fracture risk, including family history, rheumatoid arthritis, glucocorticoid (steroids) treatment, smoking cigarettes and drinking alcohol.

is lower than normal).

put Several days later, the fracture clinic I me in plaster for four weeks. At least could hobble on this, but it was a long four weeks. Ironically, I felt more stable

Mitochondrial myopathy:

Date ___________________________ Signature _____________________________________ and subscribe online at or visit our website Alternatively, call us on 020 7803 4836 www.muscular-dystrophy.org/targetmdsubscribe

Terry Aspray, Consultant in Metabolic Bone Disease, Freeman Hospital, Newcastle upon Tyne

No-one in the medical profession that I met took account of my muscular dystrophy and tendency to fall, or of my age and being menopausal, when considering aftercare. I had already test decided that I needed a bone density and that I should increase my calcium this. intake, so I went to the GP to arrange After some debate, she agreed. The test showed I had Osteopenia, or thin bones (a condition where bone mineral density

Last September, I broke my ankle trying a to sit in a chair! After an x-ray, I had temporary plaster until I could attend the fracture clinic. It was a difficult experience at the best of times, never mind with muscular dystrophy.

in In complete contrast, I discovered that Newcastle your consultant would advise a bone density test for a menopausal woman to see if there is an increased can likelihood of fractures. If there is, this then be treated. Prevention must be better than cure. not Those in Newcastle can do it, so why elsewhere? This simple test could have prevented a fracture and all the physical and mental stress for me and my family, not to mention the huge cost to the NHS.

dystrophy and the menopause. It was interesting to read what consultant Terry Asprey said and the websites he mentioned could be very helpful to someone. I wish I’d known about them. Howeve r if this article helps just one person it will have been worth it!

page 31

Fractures risk and muscular dystrophy

with the plaster on, and more “legitimate” when out in my wheelchair.

dramatically.

______________________________________________________________________________

Postcode ______________________________________________________________________

Val Wintle, myopathy in 1996. My I was diagnosed with mitochondrial of the defective gene. It has daughter, who is 30, will be a carrier and now I am housebound, been a steady decline over the years husband, Mark, is my losing all my independence. My lovely we have travelled rock and does all the housework! Luckily now. All my hobbies in the past as it would be impossible and fatigue. Even have fallen away due to mobility problems due to eyesight problems. I’m into reading and watching TV is a chore but sometimes fail miserably. spirituality and I try to stay positive

have a recipe for disaster.

Issue 1 of 4 2012

Thank you for printing my article about muscular Would you like to receive updates from

51, is from Corfe Mullen, Dorset

they’re both now produced who really want to read them, and Campaign can free up fully in-house, the Muscular Dystrophy campaigning, support more funds to spend on further research,

of just £18. This will help And all for an annual subscription gift - while ensuring the same us cover our costs - even reduce them every issue of Target MD and editorial quality you’d expect from only go to people like you Target Research. And because they now

magazine

Letters

www.muscular-dystrophy.org

Target MD and Target Research

working hard to save money. In these harsh economic times, we’re penny of your donations Now more than ever, we rely on every and care for people to fund vital research and provide support conditions. With this in mind, with muscular dystrophy and related MD and Target Research – we‘ve launched our new-look Target a year. both to be delivered to you four times

My advice for menopausal women with muscular dystrophy who are still mobile is to badger your GP for a bone density the test. It could save you much pain and NHS a lot of money! It is good to know that the Muscular Dystrophy Campaign is campaigning nationally for better preventative services such from the NHS, which might prevent situations in the future.

www.muscular-dystrophy.org

Fragility fractures significantly increase the risk of further fracture. From April 2012, the government has directed GPs to assess patients who fracture for appropriate treatment to protect their bones. This may include a Dual Energy X-ray Absorptiometry (DXA) scan.

The magazine is excellent and up to its usual high standard.

Identifying patients at risk of fracture is (but who have not yet broken a bone) more challenging. The National Institute for Health and Clinical Excellence (NICE) guideline on assessing fragility fracture risk has been presented in draft form to stakeholders for consultation. Immobility and increased risk of falling are both important factors which should risk. prompt a clinician to assess fracture However, this may not need a DXA scan. Assessment tools such as FRAX and QFracture are both readily available online and can estimate 10-year risk of fracture, based on a number of characteristics such as family history of hip fracture and personal history of smoking, alcohol consumption or fracture. Patients should discuss fracture risk and agree on lifestyle changes and treatment and based on their estimated risk. Online easy-to-use fracture risk tools empower and patients to understand this condition will help with communication between

Excellent and moving article on “turning a house into a home”, good coverage of Jon Hastie and his magnifi cent new film, and details of Trailblazers campaign against disability hate crime. The first article included an in-depth guide to adapting your home to deal with progressive disability.

patients and clinicians.

On the web NICE guideline: www.guidance.nice.org.uk/CG/Wave25/2 FRAX: www.shef.ac.uk/FRAX/ QFracture: www.qfracture.org/

Even managed to read the thing on a mobile device. Technology is getting so good for MD people!

www.muscular-dystrophy.org page 27

So it was, then, at the age of 16 years ago 26 – nearly – that Mark had a successful tracheotomy and moved into the housing association flat he has a Self-Directedlives in today. He Support funding package to employ personal assistants, his team of five all specially in managing trained his ventilation. additional He receives support at the Ventilation from specialist nurses Unit Dr Grant Edinburgh’s set up at Western General Hospital.

“This package whole support

is is so precious reasons one of the main “Time for people Duchenne health and wellbeingmy Muscular Dystrophy.with have remained health can Your change so so good,” much in a time and every said Mark. short family will tell you that every day counts. Mark has volunteered support, advice, The correct assistance, for two disabilityled organisations: equipment physiotherapy and Inclusive Living the Lothian Centre can make a for and huge difference to the length Assistant Employers’ the Scottish Personal and quality of people’s This is why currently involved Network, and is lives. increasing care advisor is so important. in campaigning posts media work We simply and for the Muscular to wait around cannot afford Campaign. for these things Through social Dystrophy he said. to happen,” media, he keeps up with many other men Duchenne muscular dystrophy, with Mark has certainly of whom are a few not been even older around for than he is, learns of the things to happen. one to wait and struggles many hard to make He’s worked through. of them go sure he has what to live a full and independent he needs only does he life. Not have the job of managing own care, but his he still enjoys exhibitions art, visiting whenever creative, producing he can, and being on his computer. artwork and designs photographer, He is also a keen and has recently technology acquired that enables him to take photographs with the use of a blow-type switch.

Best wishes Val Wintle [page 31 Target MD Issue 2 of 2012]

The title of Jon Hastie’s article is “An Indomitable Will”. He gives us inspiration with Mahatma Gandhi’s quote :-

“When I realised how much were really other people struggling and not getting the point that to I had thinking something managed to, I started wasn’t right,” said. Mark “I decided to get involved with the Muscular Dystrophy Campaign people like because me can others in similar really speak out for go to Parliament situations. I am happy to and talk about going on and what is question why getting the people aren’t opportunities and services they should be getting.” Mark added his weight to the recent launch of the charity’s report: Save: improving Invest to services and costs in Scotland. reducing launched followingThe report was an investigation into the cost benefit of improving neuromuscular services in Scotland, in order to prevent emergency to hospital admissions for people with muscular dystrophy. Mark said things needed change. to

Last spring, Mark was interviewed Hastie’s soon-to-be-released for Jon worth living; film, A life the story of Jon’s journey to meet other adults muscular dystrophy with Duchenne who are living productive, creative and fulfilling lives. And then in the summer, Mark flew the first time for in many years on a two-week and went holiday to Las Piedras, Spanish resort a near Malaga right). The (pictured resort was fully and perfectly equipped for people with On the web disabilities Mark enjoyed and walks, drives, trips, having sightseeing LCIL: a swim and www.lothiancil.org.uk finding plenty opportunity of for landscape SPAEN: photography. www.spaen.co.uk A man of his Las Piedras: word, Mark certainly makes every day count www.laspiedras.co.uk

A life worth living: www.alifeworthliving.com

for £50 as a donation.

A McCowan

Dear Ruth Thank you for your recent letter and the Target MD magazine. We are pleased to be able to help you again and a cheque for £100 is enclosed. My great niece, Laura Bizzey, is a sufferer from muscular dystrophy. She has been chosen as an Olympic torchbearer in Suffolk and will be doing her ‘bit’ on 5 July.

Dear Editor Would you print our story? We fought for changes by ourselves at Great Ormond Street Hospital because of what happened with our brother Arvind, who had Duchenne muscular dystrophy. The result was the Arvind Jain Pathway; the engagement of another neuromuscula r nurse and many other changes. Most families know what happened as it was in the press but it would nice for them to know the outcome. Most people at the Muscular Dystrophy Campaign know about our story too. Kind regards

With best wishes

Shushma

Yours sincerely

[Read Shushma’s story

Geoffrey Boston Trustee Ludford Charitable Trust

Looking ahead In the next edition of Target MD, due out in October 2012, we’ll There are so many apps, focus on technology. devices, gadgets and widgets on the market easier and keep people to make life connected, so we thought we’d gather as much as we can about these information new technologies to share with you. If you’d and tell us about your like to write in best and favourite pieces of technology, please and-tested stories are do so – triedalways the best! As always, you’ll also be able to news, features and updates read our latest that keep you, our valued People with muscular supporters, in the spotlight. dystrophy and related neuromuscular conditions, with their families and together carers, are at the heart of everything we do.

“Strength does not come from physical capacity. It comes from an indomitable will.” Taungfox from North

Somerset

(via online forum, TalkMD)

page 22

Paralympics tickets

Boccia bonus

We have three pairs of tickets (for a wheelchair user plus a companion) to the Paralympics Boccia event at the ExCel Centre in London in September to give away. Tickets are for the afternoon event on 6 September, which will feature the men/women individual quarterfinals for all four categories. If you’d like to nominate yourself – or someone else – to win a pair of tickets to this exciting event, please send us a 100-word nomination and a photograph. The three winners will not only get the pair of Paralympics tickets, but will also be featured on our website. Please email us at targetmd@muscular-dystroph y.org with ‘Boccia tickets’ in the subject line, before 17 August 2012.

www.muscular-dystrophy.org

Sports news

A Trailblazer at Trafalgar In the last they are edition of Target Square MD, we Taz Virdee,involved in the Olympics invited readers 25, is a Trailblazer Ambassador or the to who has Paralympics tell us if for the Paralympics. been selected in London. as a London Taz applied

last May, the London on Ambassador website. He was invited an interview to in Ealing, London, West where applicants were put into small groups of three in order to work to test their as a London. knowledge team of

‘DASH (Disablement Association Hillingdon) is a charity of support, information that offers people with and disabilities advice to Borough of Hillingdon. in the London

Dear Ruth, England’ s most

Isuccessfu have fully read of 2011 l football and enjoyed team the latest Target MD magazine, it was packed with brilliant content and interesting stories. Thank you for including me in this issue as well, it looks really good and I am pleased with the outcome.

We have a cricket team team for people with and a football “At first the last disabilities. I thought year our In I knew a cricket London, trophies lot about since I live in competitionsteam won two here, but discovered a charity organised I soon there was called Cricket4Change, by wasn’t aware plenty of our football London team and I how much of, which got me FA PAN Disability won the Middlesex thinking: do I really League know?” Taz campaign. in the 2010-11 said. After the team games applicants and tests, We have each had the also interview a one-to-one educational recently developed and were projects some asked why wanted and writing to improve to be London they skills, actively reading Ambassadors. with disabled working adults. We “For me, working it was simple: have been with a-lifetime this is once-ininteractive local day centres opportunity to offer storytelling experience and with service users. sessions and passion my for their sports, I for disability just had the Paralympics. to get involved The new with reading This was role for me,” and writing which we the perfect Taz said. project, run at Uxbridge the opportunity Library, and to work A few months centres with day in Hillingdon, later, Taz been successful. found out new avenues have opened he’d opportunities for DASH; we have for our service “I was some of whom users, selectedreally happy to at our sports are now volunteering be sessions Londonas one of 80,000 and we at day centres hope Ambassadors,” get involved our volunteers will Taz said. storytelling with the interactive sessions “I will be communication, to improve based in their Trafalgar during the confidence speaking Square first week and public skills. games. My of the Paralympics duty is to questions answer In the last any that tourists 18 months, as: where may have, been delivering DASH has the also disability hotels, best nearest tube station such talks at local awareness restaurants, is; primary the stadiums, designed directions schools. These are to raise to to help peopleetc. Our main objective awareness anti-bullying of disability, who visit is have an of different and the understanding overall enjoyablethe games to disabilities. while in sessions experience We have London,” with Q&A Taz said. issues disabledspecial guests people face about basis and on a daily this many children.has been eye-opening for

Taz is a perfect candidate he tells us for this role; about a number and other of sports projects he’s involved DASH. with at

on p 22.]

For more information and their about DASH projects www.dash.org.uk please visit:

As the 2011/12 Wheelchair Association Football the closing (WFA) season Thunder enters PFC stages, it another After a great and Sporting Club great year has been Albion. season for football. for powerchair and Bolton Norwich If you would It’s City PFC Bullets in World Cup seen the 2011 they have the Championship, powerchair like more information FIPFA secured football, the WFA take place, the about year’s Premiership promotion or would a club in launch of Cup and to next your like to visit National the WFA’s division. org.uk, follow area, do visit www.thewfa. League biggest to date. @wfaenglandteam We now Twitter or have

The WFA England team finished runners up in as and became the World Cup in Paris, the most team of successful the year. England team (pictured To celebrate above) was this, the Wembley invited to and at half-time were presented on the during the game against recent Englandpitch Holland.

The new format proved highly National League has successful play for. and is all Aspire PFC still to lead the Premiership way in the as they look title, but to defend are being their chased by Northern

the country more than 30 clubs and have across to train in new Northampton, teams starting and Manchester. Middlesbrough

search ‘Wheelchair on Association’ Football on Facebook.

They’re carrying

Congratulations the torch! Saxmundham, to supporters Jack Franklin Carl Tilson of McIntyre Manchester, of Brough, of Stirling, Laura Michaela Zakia Begum Edmonds Hollywood Bizzey of of of Walsall, of Downpatrick, as Olympic Broadstairs and Alexander Pamela torchbearers Jordan of Paul Moffatt flame for Worcester, of London, 300m through for the London Cam 2012 Olympics. who have all their local been selected areas during Each of Also, watch them its 8,000 out for Ollie mile journey. will carry the Nottingham Hynde, 17-year-old four: Jacob who will be participating European Thomas swimming in the ParalympicsGB. of McGuire champion of Lanarkshire,Narberth, Scott from in the national McCowan of Ayrshire, And of course Boccia team. and Stephen the fab and Pete

In the future I hope to contribute some more articles about the project I am involved with for my charity and as a Trailblazer. Once again thank you and I look forward to catch up soon, Best wishes Taz [Virdee] [page 22: Target MD Issue 2 of 2012]

Hi there My name is Mahid Chowdhury, I am nine years old and I live in Bradford. I was diagnosed with Duchenne muscular dystrophy in 2008. With no history of muscle disease in my family, I was the first to have a muscle disease, which astounded my parents. I have always been interested in sports and I am currently taking part in many extra curricular activities in school - sports such as football and cricket. I am an enthusiastic being who takes pride in what I do and take my physical activity seriously. Since I have to come to know about the Paralympics I have been excited to watch them and to have an opportunity to watch them live would be a once-in-a-lifetime opportunity. I am an ambitious person and would love to be a Paralympian in the future, representing my country and the many people who have Duchenne muscular dystrophy. But for the time being I would love and be honoured to get tickets to watch the Paralympics and show my support for my country! Mahid Chowdhury

Hello Muscle Group team It was great to meet you in Southampton on Friday at the Muscle Group and to be with people similarly affected by a neuromuscular disease. Until now, I have felt somewhat isolated, but no longer. All your speakers exhibited great positivity and that in itself was very uplifting. In particular, the advocacy service was something that I know will be particularly useful as I face the prospect of re-applying for DLA/IB equivalent benefits. Please keep me in the loop for future meetings and any other events that you think might be of interest. With all best wishes Dr Judy Pellatt

page 7

While Mahid won a pair of tickets from us to a Boccia game at the Paralympics, he unfortunately fell ill and was unable to take up the opportunity. He made the most of having the tickets, though, and impressed everyone at his school by bringing them in to show at a school assembly. Mahid is interested in sport and has an interest in football and his mum, Nazma, said she’s steering him towards netball or basketball as he is good with his hands he can play in a wheelchair. “We stress to Mahid that his wheelchair does not mean being bound and life stops there. There are many hurdles and we have to be strong, to be recognised. Anyone who knows Mahid knows he is strong-willed, full of enthusiasm and ideas, he is very bright and alert. “He is also very fussy with fashion; he loves his designer gear and fragrances. At the moment he wears Gucci fragrance to school, can you believe it? He says life is beautiful,” said Nazma.

page 7

Feature

www.muscular-dystrophy.org

Tunein Radio Price: Free Immediate access to thousands of radio stations all around the world. Includes every radio station I have ever heard of and they are all in perfect quality. The thing has already learnt what music I like and is now suggesting other stations and programmes I will like. It works! One press of the screen and I was off to an R & B station in San Francisco, then to Brazil, then to easy listening in Turkey. Excellent.

Sleep Pillow

This is an appy corner T here’s been an ongoing discussion thread on the TalkMD forum about mobile phone apps. The discussion thread, aptly named ‘The Appy Corner’, encouraged vigorous discussion among a number of forum members, and they offered some suggestions of personal, can’t-live-without favourite apps. Have a look and see what you think … and do go and join in the discussion too if you have any of your favourites to add. www.bit.ly/appycorner

Taungfox’s favourites ITunes U Price: Free The iTunes U app gives you access to complete courses from leading universities and other schools — plus the world’s largest digital catalogue of free education content — right on your iPad, iPhone, or iPod touch. Whether you’re majoring in molecular biology at a university, taking Spanish in high

school, or just interested in European history, you now have a valuable tool to help you learn anytime, anywhere. Just amazing. Have been getting upto-date with my college subjects after a 25-year gap. There are courses on computers, iPods and even IOS5. Do it at whatever level you want. All free.

Price: Free ’The App that Helps You Sleep like a Baby’ A sleep and relaxation aid; the white noise machine. A suite of relaxing sounds: water, forest, fire, storms, animal sounds, whale song, amniotic sound, rain, baby, bird song. Have whichever one you want or any combination, and set the sleep timer for whatever length you want.

Kindle Price: Free Completely identical to the Kindle that thousands have just paid £89 for, except that Kindle has a six-inch screen, if you have an iPad you have a Kindle with a ten-inch screen. Download books either paid or increasing numbers of free ones from Amazon.

LogMeIn Price: Free Access your (switched on) computer from your iPod on the other side of the world. Amazing technology. How often have you been somewhere else and needed a file or letter from your computer? Very simple installation and the test has worked. Went next door and could access every single file, picture, letter on the computer.

www.muscular-dystrophy.org

In the publicity they quote a man who went to South Africa and was still able to do his work on the PC at home. They say this App was £69.99 just a short time ago. Suddenly a free version for the real people. To show how new it is my Norton told me that less than five people in the country had downloaded this file. Once again we are at the cutting edge of technology.

Santander Price: Free My bank has suddenly come up with a remote banking App. I thought online banking was good, but to do every single function on my little iPod while still in bed is just amazing. Even does instant money transfers free of charge. Check to see if your bank has a free App.

Poetry Price: Free Delightful poetry app. 2,500 great poems, including 150 audio ones. There is a superb “Spin” feature where you choose categories in pairs such as ‘frustration/despair’ or ‘love/optimism’ or ‘love/beauty’ and it comes up with the relevant poems. Great to lie in bed and have your iPod read poetry to you.

Ancestry Price: Free Fully-featured Family History App for all you genealogists at all levels. It very quickly imported all the 22,900 individuals in my tree from a simple gedcom file that all the software programmes give you. Very satisfying to navigate through 16 generations from the comfort of your sofa. It will save me the embarrassment of visiting relatives, when you suddenly realise you have forgotten the name of their latest rug rat.

Fluid Price: Free The amazing, soothing, relaxing and startling “Fluid”. Turn your wonderful new Retina Display touchscreen into a shimmering, moving, tactile and totally responsive liquid mass.

Criptic’s favourites I have hundreds - slightly obsessed. I’m writing this on my phone as we speak!

”Heart Rate” is nifty, where you put your finger over the lens of your phone and the light from the flash becomes a sensor, and picks up heart rate. No substitute for proper medical instruments but interesting.

Also loving the panorama apps at the moment - rather fond of the photography ones - very accessible for wobbly hands and fingers.

Sar78’s favourites I have recently acquired a few free ones:

Health apps I have tried and found useful:

Colorcal +

www.enatal.com/colorCal You create a topic such as ‘breathing’ and you can choose about five symbols and say what they mean, like ‘easy, difficult, used vent, puffy’ etc. You get a month calendar view (and other views) where you can quickly choose a symbol to represent things and make a short note as well. Your calendar then displays symbols so at a glance you can see how your month went. You can add as many topics as you want and even view a calendar which shows many topics. So for example, ladies can have a topic of fertility and another about how they feel - then at a glance you could choose a view which shows the merged data and see if you can see patterns forming (and you can print and email it).

My Medical www.mymedicalapp.com Available now on desktop and i-devices, this is very versatile - stores medical data (you can choose categories like CO2 levels or other things you don’t normally get in apps), photos (for example, meds, hospital letters and vent), store emergency data, details of doctors and how to contact them, you could store the Muscular Dystrophy Campaign’s factsheets, plot trends, synch doctor’s appointments with calendars ... the list is endless. Takes a while to enter the data but worth it.

myAllergies www.myhealthsoftware.com A bit tedious entering data but I like it because it spots trends (and you can enter food, symptoms, sleep quality, energy and your own things which you can scale from 0-10 on a scale so things like bloating, wobbly, puffy etc.)

Favourite sleep app: PZIZZ Sleep Simply because of the timer and voice which distracts and relaxes rather than just ‘noise’.

Pocket Piano

This lets me find the right notes when I do my singing homework and also learn tricky melodies. It has a record and playback function and a metronome. I find it really useful.

Sing friend Still on the singing theme, this app helps me warm up. It does all sorts of scales and you can choose different ranges.

Scramble/Chess/Words With Friends All the free versions. I am currently a bit addicted to these.

Chagrin’s favourites These are what I have found the most useful on my iPhone: • Skype and Viber and both excellent for calling people for free • WhatsApp is also popular for texting • Evernote is free and great for synching notes between people and devices • Dropbox is free and for synching files between people or devices.

Sybyllascarlett’s favourites I’ve got a solitaire app on my galaxy tablet. I used to know it as Patience [with playing cards]. That was free. The Google sky map is also free and very interesting if you like looking at the night sky. I downloaded loads of crossword puzzles for something like £1.99 from Teazel. They’ve proved to be worth the money.

Amgmod’s favourites I love this app – TVCatchUp. It turns your iPod/phone/pad into a Freeview TV, and what’s more, it has more of the +1 channels than a standard Freeview box. And what’s more, it’s FREE! One small advert when you first start up which can be skipped, able to full-screen the picture, lists ‘now and next’ on all the channels available. It’s awesome; I can snuggle in the bed and watch TV before just rolling over and going to sleep.

page 9

Feature

www.muscular-dystrophy.org

Woogy’s favourites Air Video Server Allows you to stream from your pc to your iPad.

Live Sport on TV Lists all live sport on TV, tells you the channel and time and it can allow you to add events to your schedule. You an also doctor it to only view the sports you like.

National Geographic Fotopedia There’s a few of these I have on my iPad that are constantly updating with more and more beautiful pics. That’s mostly what they are but, beautiful all the same. I love the ones of Above France and Wild Friends.

Team Viewer Allows me to try and assist my parents and siblings with their PCs remotely, when I can’t sit in front of my own.

Osmos for iPad If you’ve got an iPad and you use headphones, this is a must of a game. It’s not your average game and if you’re unsure, look it up on You Tube first. I love the chilled out sounds. If you like the Google earth app you may also like the Nasa app too.

Lyssie’s favourites WhatsApp It’s a messenger which is actually also available amongst Blackberry and android as well as the iPhone. It’s brilliant. I and my best friend (who has an HTC) use it. To me it doesn’t cost a thing as I get a text and web allowance when I top up so it goes onto my MB of net that I get so it’s not like I’m paying per day for the Internet.

Whale Trail It’s the brightest game I own on my iPhone. It’s rather addictive (for me anyway!)

My Pain Diary

Roller coaster review of my head rest Donna Louise Match

started wearing my new head rest from Rehabilitation Management Services (RMS) in Kent.

Quick review: the headrest was developed to stop head-roll under a standard headrest (i.e. rolling off the side and getting stuck underneath, which can be dangerous, especially in a vehicle).

We had a proper fitting and then my husband fitted it once ordered. You do have to get it in the right place - it’s meant to rest your orbital bone on at the back of the neck which is why it feels a bit different when leaning on it. It took quite a long time to tweak but we probably could have got it fitted by the rep again. The padded head rest is a log shape and has two arms which are adjustable and can be brought down when needed (they just swivel and stop at a position you choose). The arms rest over the shoulder, along the jaw line and stop my head banging around from side to side when on bumpy terrain or going round corners in the car. I do a good impression of an ant when going about daily life with my new antenna! It’s asking for two fluffy pompoms to balance on top. It cost over £400 and although my wheelchair clinic had heard of it, it wasn’t on their catalogue so it had to be a private purchase. I heard that in our area, they make people with muscular dystrophy use a collar before going in any local authority-funded transport,

ccy’s condition (Donna) Louise’s and Be

which is the cheaper option but carries with it problems with breathing and being so rigid that you can’t move at all or look out of the window. This headrest means you can still move a bit, doesn’t restrict breathing and can be put on and off in two seconds (and is always with you). It’s a small price to pay for greater independence, ease of use and the freedom it gives – well, in my opinion anyway! I’m not sure how comfortable it would be on a high-tilt in space recline but I found that if you fiddle with the position it made a big difference in terms of comfort (I had it too low down and into my neck at first). It is also worth noting that because it sits lower, we had to chop off the top of my back cushion as the back cushion comes up above the shoulders. My vent bits and pieces still fit fine and keep out of the way. The big test will be weaving down country roads and going round roundabouts or over cobbles! So far though, so good. Really good idea. In context: I have limb girdle muscular dystrophy, very little movement, 36, one PA, one hubby, started using a vent at night around March 2011.

On the web Twitter: @crip_tic Blog: http://bit.ly/cripticthoughts

Limb girdle muscular dystrophy Muscular dystrophy is the name given to a group of inherited conditions where there is a progressive wasting and weakening of muscle. The limb girdle group of muscular dystrophies is so called because they generally cause weakness in the shoulder and pelvic girdle, for example the big muscles around the top (proximal) part of the arms and legs (hip, thigh and shoulder muscles). Usually weakness of the legs is noticed before that of the arms, and usually the muscles of the face are unaffected.

Self explanatory. Limb girdle muscular dystrophies (LMGD) are rare conditions and they present differently in many people, even within the same family, with regard to age of onset, areas of muscle weakness, heart and respiratory involvement, rate of progression and severity. As the condition progresses, people can have problems with walking and, in time, may need to use a wheelchair. The involvement of shoulder and arm muscles can lead to difficulty in raising arms overhead and in lifting objects. In some types of LGMD, the heart and breathing muscles may be involved.

www.muscular-dystrophy.org

Beccy’s gadgets My name is Rebecca (Beccy) Oughton, I’m 36 years old and I live in Lancashire with my husband, Neil. We are foster carers and currently have a five-year-old little boy living with us on a permanent basis. I work full-time as a Personal Development Tutor at a Further Education College for young people with physical and learning disabilities and complex needs. I put together Personal Development programmes which teach young adults with disabilities life, work, communication and social skills. I set and monitor goals, which the learners work on across the whole of their programme, including helping them to develop these skills within their leisure time during evenings and weekends. I also work with the support staff to help them to teach the learners these skills during times of unplanned learning. I also teach Self-Advocacy and Relationships and Citizenship and Relationships as a formal taught programme. I have limb girdle muscular dystrophy and I now have to use a wheelchair all the time, following a fall – of which I have had plenty! I can no longer walk at all or even weight-bear. Technology in general has a hugely positive impact on my life and has meant

that I am able to maintain a lot of my independence. There is the obvious: technology in the form of my electric wheelchair, without which I would be bereft. As dramatic as this sounds, it’s completely true. I use a standard NHS wheelchair at home but at work I am lucky enough to have been provided with a Balder wheelchair through the government’s Access to Work scheme. This enables me to rise up to reach things and talk to people at different levels as well as helping to form part of my pain management programme through being able to change my seating position. Without the use of this wheelchair, it would be really difficult (if not impossible) to remain in employment.

It can be the difference between surviving and actually living and having a life of your own. Electric wheelchairs will always be my favourite piece of technology as they have enhanced my independence more than anything else ever has. We have also just had a hoist fitted in the boot of our Motability car, which enables us to take

my electric wheelchair with us wherever we go. This has made such a huge difference in my life. We have also installed new technology at home in the form of Lightwave RF, which has had a really positive impact on my life. I can now control the lights and lamps throughout the house from my smartphone, being able to turn the lights on or off at the touch of a button, rather than having to reach the light switches. Having the table and floor lamps on this system as well has also greatly aided my independence as you can imagine. I think this is my favourite ‘fun’ piece of technology! It is particularly entertaining to dim the lights or turn them on suddenly when we’re out and the babysitter is there! I am also able to control the Apple TV as well as check who is at the door through use of a My DLink camera, all using my mobile phone. There are other more mainstream items that we have bought that help towards my independence, such as a one-cup kettle which boils straight into a cup because I can no longer lift a standard kettle. We’ve been really keen to keep our house looking as modern as possible, without having to buy specialist equipment which looks ‘medical’ and I think that we have been really lucky with this so far. Of course there are certain items, for example ceiling tracking or the shower chair, that we’ve had to have, but this is still in the minority. I am really lucky in that my husband is a real technology geek and loves trying out new gadgets. This has meant that I have been made more aware of new items on the market and am quite up-to-date with new trends in technology. It can never be underestimated the impact that technology can have on the life of a disabled person. The difference that it can make can often not even be put into words. It can be the difference between surviving and actually living and having a life of your own.

page 11

Feature

www.muscular-dystrophy.org

“Technology enables disabled people not just to live, but actually to have a life. With all the amazing technology being created every day, it has become an essential part of life for people with many conditions. Even if technology solely allows people to communicate, which is fundamental to being human, it is exceptional,” he said.

Daniel:

the NASA man

aniel Baker, 38, has always used technology for a wide range of things. He’s used it to meet people from all around the world, to work for NASA, to take on the NHS and he’s even used it to do some good old blasting of aliens. Technology also enables him to breathe. Daniel has Duchenne muscular dystrophy and says that without technology, he simply wouldn’t be alive. Here’s what Daniel had to say. Can you tell me a bit about yourself? I have Duchenne muscular dystrophy and have been in a wheelchair since the age of about 10. I grew up in St Leonards-onSea in Hastings, with my grandparents and my mother. When I was 15, my mother and I moved to Cheltenham and we have lived there ever since. I have been addicted to technology and computers from an early age; I think I got my first real computer when I was about six and have had at least one ever since.

What technology do you use every day to make your life easier? I have quite a few pieces of technology to help me with my daily life, from essentials like my electric bed, hoist, water genie and BREAS ventilator, to things like my Possum primo, which allows me to turn plug sockets on and off, open my bedroom door and window, unlock the front door and activate intercoms/pagers to call my mum or carers. I also have the normal selection of gadgets and equipment like a plasma TV,

Xbox 360, Wii, DVD player, surround sound system and custom-built computer. Although I can’t physically build my own computers anymore, I have become pretty good at explaining where things go and instructing others how to do it step-bystep.

What is your favourite essential piece of technology? That would be my ventilator, simply because without it I wouldn’t be alive. But other than that, it would have to be my computer. Like most children of the 70s and 80s, I grew up playing computer games, but even in the 80s there were signs of bigger and better things to come: bulletin boards that you connected to by modem at very slow speeds allowed you to talk to people all over the world and share ideas, pictures and computer programmes. Once I went to university and had my first experience of the Internet, there was no turning back. The fact you could find information on practically anything was, and still is, amazing to me. I have used my Internet-connected computer to make friends all over the world. Some would say that as I haven’t physically met these people they can’t be true friends; I don’t believe that at all. I have worked and played with these people, cried when one of my best friends succumbed to cancer and recently been amazed by the generosity of people: I posted a link to a newspaper article on the trouble I was having raising funds for a new powered wheelchair, and these friends donated more than £1,000. My computer has truly been essential, allowing me to use email to fight the NHS and social services with policies and regulations found online (see article on p22), to communicate privately with friends and family, to write letters using an onscreen keyboard (I physically can’t do this with a pen anymore) and to read books and documents which I find very hard to handle nowadays. I can also connect my phone to my computer to

view the screen and remotely control the phone to send texts or ring someone in an emergency.

What is your favourite ‘fun’ piece of technology? That would be, without a doubt, my computer. I can surf the Internet and learn when I’m bored, I can play computer games, read e-books, watch movies and TV to escape real life, and sometimes I can just relieve stress by blasting aliens! I also enjoy Twitter, where I can talk to people online who I would never meet in real life – from tank drivers and professors to celebrities. One other thing I have been able to do, which some may not consider fun, is work. Admittedly it’s voluntary and I can’t be fired, but it’s something I can’t do in the real world: I have worked for NASA on their World Wind project, made computer animations for documentaries and helped map conflict and disaster areas for humanitarian missions performed by the UN and others. Being able to give something back to the world gives me a great sense of satisfaction, and being able to say I know and have worked with people from NASA, NOAA, the UN, Microsoft and other big names, is something not everyone can say! Having a degree in applied physics has come in handy for Daniel too!

Is there any technology that you would like to invent, or that’s not currently available, that would make a huge difference to your life? A robot! Well, kind of. I’d like a robotic assistant to do basic tasks such as pick things up, pass things, hold books and letters so I can read them, and get me drinks so I can be more independent. One thing that I believe is basically possible now is a telepresence system for visiting places you could not normally go; I imagine a pair of 3D glasses, with builtin eye-tracking, and a pair of headphones and a microphone. You would connect

www.muscular-dystrophy.org

this to your computer, which would receive and process information from a smartphone, which a friend or family member would be carrying with them. The smartphone would send two panoramic 720p video streams from special cameras and would also send a stereo audio signal to your PC; you could talk to your friends, look around and virtually be with them anywhere they went! The one major problem I see is bandwidth; it may work in Wi-Fi areas, but other than that we’d need a new technology. Oh one more thing I’d like to see, which is entirely possible, is an exoskeleton; not a full one, just two robotic arms fitted to the backrest of your wheelchair, and you would slip your arms into it and it would process signals from your muscles into movements of the exoskeleton, allowing you to lift and move your arms around, hold drinks and feed yourself.

How important, would you say, is technology to disabled people? For people with many conditions, technology is essential. It can enable people not just to live, but actually to have a life. Although I do wish the big companies and governments would adapt technology more quickly for us to use, I see so many things which, with just a few modifications, would be ideal for disabled people. I do also see some downsides: not everything is rose-coloured, but things like the Wii, Xbox kinect and touch screens may be good for some people but exclude severely disabled people; even simple things like cash machines are practically impossible for some disabled people to use – I can’t reach to put my card in or tap my PIN on the touch screen.

Daniel’s condition

Duchenne muscular dystrophy Is a serious muscle-wasting condition that causes muscles to weaken and waste over time, leading to increasingly severe disability. The condition affects not only the muscles in the limbs, but also those of the heart and lungs, leading to potentially life-threatening complications. It almost always affects boys, with most of those affected needing to use a wheelchair by the age of 12.

On the web Follow Daniel on Twitter: @Daniel___BSc Read Daniel’s blog: danielsemail.com

Assistive technologies for people with limited mobility

here is a wide range of assistive technologies available for people with limited mobility. Here are some of the most popular ones, as listed on the General Medical Council’s website. You can find a fuller range by using the useful links listed in the On the web section at the end of the article.

• Mouth stick – a device that enables users to control input through a stick that they manipulate with their mouth. • Head wand – head wands are very similar in function to mouth sticks, except in this case the stick is strapped to the head. • Single-switch access – for people with very limited mobility. For instance, if a person can move only the head, a switch could be placed to the side of the head that would allow the person to click it with head movements. This clicking would then be interpreted using special software. • Oversized trackball mouse – a trackball mouse has the rollerball on top rather than underneath the mouse. Instead of moving the mouse to control movement, you move the rollerball. Some users find this easier to control. It also works well in conjunction with other devices, for example, head wands or mouth sticks. • Adaptive keyboards – there is a wide range of alternative keyboards on the market to help users with limited mobility, including compact, expanded, ergonomic, onscreen, concept, rubber and ABC keyboards. • Eye tracking – eye tracking devices can be a powerful alternative for individuals with no control, or only limited control, over their hand movements. The device follows the movement of the eyes and allows the person to navigate through the web with only eye movements. • Voice recognition software – voice recognition programmes enable the user to enter text and, in some cases, carry out common computer tasks simply by speaking into a microphone, that is, without having to use a keyboard or a mouse. In case of text entry, the computer analyses the user's voice, tries to recognise the words, and types them as he or she speaks • "Sticky keys" – a method of typing where modifier keys, such as Shift, Control, Command, and Alt/Option, will "stick" down and apply to the next keystroke, so that only one key needs to be pressed at a time. This is extremely useful for people who have limited mobility, which can make it difficult to press combinations of keys. • "Slow keys" – a keyboard feature that prevents keystrokes from registering until a key has been held down for a certain period of time. This is extremely useful for people who might find it difficult to target keys accurately or that cause unpredictable motion.

On the web www.bit.ly/GMC-web – assistive technology information on website of the General Medical Council www.webaim.org – motor disabilities: Assistive technologies www.gateway2at.org – provides case studies of users with physical impairments and information about assistive technologies

page 13

Feature

www.muscular-dystrophy.org

Martyn on technology

y name is Martyn Sibley, I have been disabled since birth, with a condition called spinal muscular atrophy, and I run my own social enterprise for disabled people. My condition means I require an electric wheelchair for all mobility, full-time care support for all everyday tasks, an adapted Motability car, and have a range of other equipment to assist me. Despite having such a limiting condition I went to mainstream school, gained a masters degree, have travelled the world, and live and work in London independently. My social enterprise is my most proud achievement because I know how much it is assisting other disabled people with personal development. I want to share with you why and how technology has been so vital in my personal and professional story. It is impossible for me to imagine life without technology. I have been sharing my life as a disabled guy on my blog for three years and (assuming a blog still existed) I can see how very different the story would read without our relatively recent technological advancements. As a youngster, my parents would have ruined their backs trying to lift me everywhere; I would have been stuck in one place of the classroom with a normal chair and would have struggled to write an exam without a computer. In adulthood, I would struggle to shower, travel, work and socialise without these intrinsic pieces of equipment in my life. My use of technology is not just functional, but built into other areas of my life too. I remember, before mobile phones, going out to meet my friends in a local park to play football. Afterwards I headed home alone and encountered an area of gravel. Wheelchairs usually manage this, so I ploughed through the stones. Unfortunately this time the wheels were stuck and so was I. I sat there for 30 minutes (feeling like an eternity), powerless to move or use initiative. With no means of contact, I had to wait for a passer-by to help me out of this predicament. Now, I am never seen without my mobile; it is also my independence tool for calling my Personal Care Assistants day or night.

I can’t imagine life without technology Posted on 16 May 2012 by Big Society Network

On the web www.disabilityhorizons.com www.martynsibley.com/webinars www.thebigsociety.co.uk/blog

Technology has become an integral part of my working life. At the disability charity Scope where I worked for five years, I used many gadgets to support me in the office. In July 2009, I started my personal blog and opened up a new chapter of life and professional development. After learning how to share my positive experiences of being disabled and fulfilling personal goals, I used social media tools (such as Facebook and

www.muscular-dystrophy.org

Twitter) to reach out to more people and build a new community. Very quickly I could see an appetite for online learning products conveying a ‘can-do’ attitude. With the wonderful assistance of MisfitInc for web design, development and online tools, I set about starting ‘Sunnier Days’ – the umbrella name of my work. Since taking the risk of leaving my day job last year to establish this vision for e-learning and positive life experiences for disabled people, many things have happened. I launched a magazine with a good friend, Srin Madipalli, called Disability Horizons. This was featured in the Guardian recently and provides a platform for many other disabled people to share their own stories. I have been running monthly webinars (online seminars) with guest speakers, polls, Q&A time and general discussions on crucial everyday topics of living life with a disability.

In March 2012, I launched the first e-course of its kind on disability and employment – Inspiring Employment. There are many new plans on utilising technology in this way too. In parallel to my appreciation and acknowledgment of this technology, I also wonder about the future. In 20 years it may be possible for me to do a whole new range of things. In terms of using the online technology for my disability projects, I want to share the learnings and tactics of how to use technology in living life to the max. We all have dreams, we all have barriers, but we all have the power to find solutions too. Technology is one of the most powerful keys I have found in fulfilling my own life goals, hopes and dreams so far.

Martyn’s condition

Spinal muscular atrophy (SMA) Is an inherited neuromuscular condition that particularly affects nerve cells (lower motor neurons) that originate in the spinal cord. The gene for SMA is passed from parents to their children, but SMA can only affect a child if both parents carry a defective gene (this is called an autosomal recessive pattern). It is a rare disease that affects about one in 6,000 to 10,000.

Wheelchairs with Knobz on How can an electric wheelchair say something about your personality? Powerchair user Martyn Sibley checks out one possible solution. How often do you hear a powered wheelchair user say, “I’ve lost my knob”? For clarification, the knob is the bit of wood or plastic that goes at the end of the wheelchair’s joystick and I’ve been losing mine ever since I was at school. Until now, I’ve never seen a knob as a fashion statement but I’ve just been trying and testing eight new designs by Meru, a charity that makes what it calls ‘life-changing products for young disabled people’, and I’m changing my mind, although as a 27-year-old man, I may be sliding out of the target market for this product. The new designs, called Knobz with a z, allow a wheelchair user to drive a chair with style and panache. Aesthetically, I found the skull and the grenade the coolest; and the heart and glittery ones a bit girly. I’m not sure I’d feel comfortable using any of them manoeuvring around the office, but who knows on a night out? I did encounter a problem attaching them to the joystick but once my PA had helped me, I was able to roam around with each of the Knobz to see how they fared. In practical terms, the skull and the handle style were the easiest to grip. The key is feeling comfortable when bumping over rough terrain or driving for a long time. A knob has to be the right shape in the hand. I’m sure the style and usability will vary person to person, but I think the idea is a winner. I even suggested Tim Westwood do something like this, years ago on MTV. The only issue, for me as an older man, is the styling. Ten years ago, I’d definitely have used a couple of the Knobz. Today, I’d want something designed for a more adult audience. I might feel happier, for example, with a simple design, branded with my favourite band or football team. I could even have an office knob, a football knob, a music knob and a glow-in-the-dark knob. Should my knob fall off in a dark corner, I could find it easily and put it back on. There could even be a knob that opens bottles. The options are endless. Who wouldn’t want to pimp their ride?

On the web www.disabilitynow.org.uk This article was originally published in disability Now, and is reproduced with permission. www.meru.org.uk Meru raises money to provide custom-made equipment for children and young people with disabilities.

page 15

Feature

www.muscular-dystrophy.org

The Z3 iPad stand: an independent review

Anne Marie Groves

“The main USP is that it has height – it is fully adjustable from 40cm, right up to 137cm so you can use it while lying down, sitting, standing. It’s got swivel – its rotating iPad-specific cradle turns 360 degrees so the tablet can sit at any angle. It’s got tilt – a special joint means that you can look at it from any position. Finally, it folds into a neat bag in three simple steps, and is light and easy to carry at just 2.1kg.”

Anne Marie Groves is in her mid forties and has facioschapulohumeral muscular dystrophy, with significant muscle deterioration from eyelids to toes, affecting dexterity, agility, strength and mobility.

The stand arrived in a smaller than expected box. I set to manhandling and opening it up. Although weighing the equivalent of two bags of sugar, for someone with depleted muscle strength and ability, it was not straightforward. It came with a single sheet of pictured instructions in how to open and close the stand. I found the only way to do this was by turning the stand back to front, placing my feet on its feet and, with arms outstretched, heaving the upright bodily towards me [bear in mind I was seated]. It worked, but for many with muscular dystrophy it will require a third person to erect the device. Once upright, the stand felt sturdy, not something that could easily be knocked over or become top heavy and topple. The cradle that the iPad sits in, I felt, was a little too lightweight, especially if your iPad usage requires twisting from the portrait and landscape view. I would prefer the clasp to be a little bigger, and for the material of the cradle to be a little stronger, after all I am entrusting my £500 purchase to its care. The adjustable angle of the cradle was very good, no messy nuts or locks, an easy one-hand action [or two-handed for us, which means we don’t need a third hand]. An allen key is provided to enable maintenance to tighten the hinge. The greatest drawback I found, however, was that I could never get it to the height that was comfortable for me, the angle position in front of me and never comfortable. I had no way of supporting my arms/ elbows to competently use the iPad. As the upright angle [not the angle of the cradle holding the iPad] could not be altered, I found I could not get the iPad close enough to me for any typing or screen usage; even playing a simple game of cards became quite uncomfortable. Also, as the iPad needs to be viewed face-on, the stand itself needs to stand face-on, so wherever it stood, the upright was in between my knees and the legs beneath my feet. Now this could be because of my furniture but I was never able to slide the stand close enough to me if I was seated in the wheelchair, seated on the sofa or laying in bed. In fact it was impossible to use in bed unless I wanted to lie on my side with neck craned or completely re-organise the furniture so it could stand next to the bed at pillow end. While the simplicity of this stand, along with the adjustable height, are key features, sadly its lack of versatility meant for me it spent more time folded and stood behind the chair than erect in front of me. Often these things come down to what you use the item for. As a stand for watching films or videos, it does the job; as a stand to hold the iPad while you play music or listen to the radio, it does the job. However, if you use your iPad for emailing, social networking, photo/video editing, gaming, or anything that requires you to be comfortable at the keyboard for periods of time, then for me it didn’t do the job. If you are someone who uses the remote keyboard and mouse, then this is a good stand to hold the iPad.

Your iPad where you want it! RAT Stands brings you the Z3, an iPad stand unlike any other on the market. Designed to make viewing and using an iPad easier the Z3 is a product that will prove useful in any home. The Z3 is an iPad stand unlike any other on the market. The main USP is that it has height – it is fully adjustable from 40cm, right up to 137cm so you can use it while lying down, sitting, standing. It’s got swivel – its rotating iPad specific cradle turns 360 degrees so the tablet can sit at any angle. It’s got tilt – a special joint means that you can look at it from any position. Finally, it folds into a neat bag in three simple steps, and is light and easy to carry at just 2.1kg. Made by people with a background in designing and producing stands that last (they supply the Sydney Opera House), the Z3 boasts diecast aluminium legs with a super-tough scratch-proof coating. Coupled with an anodized aluminium, telescopic stem which is light and very easily adjustable yet extremely strong, the result is a stand that is sturdy but stylish and wouldn’t look out of place as a permanent fixture in your home. The Z3 costs £144 and can be purchased with a bag for an additional £18. Check the Internet for further details.

www.muscular-dystrophy.org

Technology, disability and movie-making dreams

ulaiman Khan is an award-winning Trailblazer, recent university graduate and future film-maker. He absolutely loves technology. He’s a self-confessed techno-geek for sure, but more importantly, technology keeps him actively involved in so many things.

Sulaiman, 27, has congenital muscular dystrophy. With very limited use and mobility of his hands, technology assures him of his independence, it helped him get his university degree in Advertising and Brand Communication, and it keeps him connected with his wide circle of friends and family across the world.

“Technology is hugely important to disabled people. It gives me access to social media and a connection to the world that I might otherwise not have had. It helps so much in education and in the workplace; in the past it was very difficult to do certain tasks, such as design work, which today you can do on the computer rather than using a pen and paper.

“Technology offers disabled people the opportunity to work independently and to live independently,” he said. “I use my iPhone every day – it’s very easy to use, with Siri the voice-activated feature. I also use a MacBook Pro laptop, as well as sometimes using my mum’s iPad,” said Sulaiman, who as a selfconfessed Apple man, appreciates the user-friendliness of Steve Jobs’ products. “I would also love to be able to use the latest infrared technology that, through the use of an infrared ‘dot’ on your spectacles or on your forehead, you can

activate programmes on your PC or laptop. Currently, I can’t use my computer from my wheelchair, and the infrared technology is way too expensive, but I hope that once I start working, I’ll be able to afford some of this technology to make my working life easier. “With this kind of technology in the workplace, it would enable me to be more productive and also, being able to work more smartly, I would get less tired and would need to take fewer days off work, as I get extremely fatigued due to the muscular dystrophy and the development of severe scoliosis,” he said. Freshly graduated from university, Sulaiman’s real passion is film. “I would love to make a film; I have a few ideas and it will take some time – and some help from a few collaborators – to bring everything together and make it coherent. I do have a subject for my first film … watch this space!” I asked Sulaiman what his life would have been like had he been born 40 years ago. Without hesitation, Sulaiman told me it would have been hugely different. “I wouldn’t have been able to live independently and go out independently. For example, I wouldn’t have had a powered wheelchair, which would have meant I would have had to depend on

someone to push my wheelchair for me and get me out and about. Technology has really changed my life for the better. “Being able to connect with others, through various forms of social media, has also kept me interested in so much of what is happening and has kept me involved and up-to-date with my friends’ lives. I use Skype on a regular basis; I have it on my phone and on my computer, and it means I can speak to people without having to have someone hold a phone next to my ear for me since I use headphones with a built-in mic. “Technology has kept me connected and has revolutionised my life. There are so many possibilities for me now, that wouldn’t have been there 40 years ago,” he said.

Sulaiman’s condition

Congenital muscular dystrophy Congenital muscular dystrophies are a group of muscle conditions which usually show symptoms at a very early age. These include Ullrich congenital muscular dystrophy, MDC1A and rigid spine syndrome. Congenital means ‘from birth’ and in the great majority of cases, the initial symptoms are present at birth or in the first few months. In some children who do not have contractures the first problems are only noted after a few months because of difficulties in holding the head or delay in learning how to sit unaided, stand or walk. A precise and recent study on the frequency of this disorder in the UK is not available, but it is estimated that one in every 20,000 to 50,000 babies is born with congenital muscular dystrophy.

page 17

page 18

www.muscular-dystrophy.org

2012 President’s Awards and Kite Awards Every year at our National and Scottish Conferences, we take the opportunity – as a charity – to recognise and celebrate the support and achievements of some of our many incredible supporters around the country. From companies who commit themselves to workplace fundraising for us, to others calling their local MPs to speak about equitable access to specialist services for people with muscle-wasting conditions, to those who talk in their schools about the impact on their families of muscular dystrophy and related neuromuscular conditions and those who take part in running or challenge events at home or abroad: we appreciate every one of you and what you do for the Muscular Dystrophy Campaign. Our work depends on it. Thank you for your support.

Kite Awards We were honoured to have one of the charity’s long-standing supporters and star of BBC’s River City, Eileen McCallum (pictured below (r) with Kite Award winners), to present the Kite Awards to our worthy recipients at the Scottish Conference in Glasgow on 6 October. Community Champion – Mackie’s Crisps Mackie’s Crisps, long-standing supporters of our Perth Branch, is a joint venture between Mackie’s of Scotland and Taypack Potatoes. In May, 13 members of the Mackie’s Crisps team took on the 82-mile Etape Caledonia cycle race in Perthshire, and aimed to raise £3,000. Several members cycled for the first time as they trained for the race and all 13 cyclists

finished in between four and six hours, and raised more than £5,000! In addition to the cycle challenge, Mackie’s Crisps also very kindly donated prizes for and took a table at the inaugural Edinburgh Question of Support sports quiz and dinner. Volunteers of the Year – the Martin family In a first for the Scottish Kite Awards, the Volunteer of the Year award goes to a whole family. Barbara, James, Tess and Robbie Martin from Coalburn have been involved with the charity for many years, since Robbie was diagnosed with Duchenne muscular dystrophy. Always keen to help in any way, the family gets involved in everything from fundraising to supporting our events,

featuring in press articles and helping to raise awareness of muscle-wasting conditions through arranging talks at Tess and Robbie’s school. In their biggest fundraising challenge to date, James and his son Dale cycled from John O’Groats to Lands End earlier this year. They also helped at the Scottish Conference’s fundraising workshop. Campaigner of the Year – Mark Chapman Mark has truly made a difference to the charity’s work in Scotland over a number of years. He has been involved in campaigning, has spoken many times in the Scottish Parliament, has worked closely with Jackie Bailie and her Cross Party Group and lobbied MSPs for better neuromuscular services. As Chair of the Scottish Muscle Group, Mark has met many people affected by musclewasting conditions and as a member of the Scottish Council, he helped plan and deliver one of the workshops at the Scottish Conference. One of his key goals is to impress upon health professionals the importance of offering individuals affected by Duchenne muscular dystrophy the best medical care, and at the same time providing effective social support with full choice and control. A strong advocate for independent living, Mark played a pivotal role in Jon Hastie’s film: A Life worth Living: Pushing the limits of Duchenne which has had a major impact on the lives of hundreds of young men across the UK. Lifetime Commitment – Jim O’Hagan Jim has been involved with the charity since the very beginning. In fact, Jim’s involvement pre-dates almost everyone else! Throughout this time, he has been a member of one of our local branches and he’s served on the Scottish Council for many years. Jim’s first connection with the charity was in 1973 after his first son, James, was diagnosed with Duchenne muscular dystrophy. Jim’s second son, Sean, 26 also has the condition. Jim chairs the Lanarkshire Branch, which has raised more than £100,000 for the Muscular Dystrophy Campaign. Together the group has organised a range of fundraising events, from inspiring staff at Rolls Royce, where Jim used to work, to rowing from Fort William to Inverness and raising an impressive £14,000.

www.muscular-dystrophy.org

President’s Awards It was a privilege to have our President, Sue Barker MBE, at the National Conference in Nottingham on Saturday 13 October to present these worthy recipients with their President’s Awards. Fundraiser of the Year – David Salt, Wolverhampton David has raised more than £19,000 for us, since organising his first charity golf day in 2010. His enthusiasm and modesty have inspired all those who cross his path, including his former colleagues who followed suit and arranged their own golf event raising a further £4,000 towards vital support. Fundraising Group of the Year – Kings Heath and Moseley Branch, Birmingham This Branch was set up 50 years ago by Joan Taylor and is now chaired by her daughter, Marion, with son-in-law, Muir, as treasurer. Through its fundraising efforts, the Branch has contributed over half a million pounds towards the work of the charity and also often provides information, support and advice for newly-diagnosed families. Inspiring Person of the Year – Sue Hardman, Preston, Lancashire Sue showed immense courage by speaking openly about the impact on her family of her son Charlie’s diagnosis of Duchenne muscular dystrophy at the age of four. With a dearth of support in Preston for the 30 families affected by this condition, Sue worked closely with our press team to raise awareness of the issue. NHS bosses sat up and took notice, and a new NHS specialist team is now in the pipeline for families like hers in Preston. Inspiring Young Person of the Year – Vivek Gohil, Leicester When 22-year-old Vivek, who has Duchenne muscular dystrophy, first became involved with the Muscular Dystrophy Campaign’s Trailblazers he found it difficult to express himself publicly or speak out on issues that affect him. He has since become one of the most active and dedicated campaigners, having taken a petition to No.10, delivered a speech to the All Party Parliamentary Group for Young Disabled People and played a leading part in all other Trailblazers campaigns.

Campaigners of the Year – Gerry and Geraldine McCollum, County Down Gerry and Geraldine’s son, Christopher, was diagnosed with Duchenne muscular dystrophy in 1989 at the age of five and sadly passed away in 2001. They have remained unselfishly committed to the charity’s efforts to secure service improvements in Northern Ireland. Following last year’s major inquiry on access to neuromuscular services, the Northern Ireland Assembly published the findings in The McCollum Report, named in memory of Christopher, and in recognition of the generous dedication of his parents. Corporate Partner of the Year – LGC Forensics The Muscular Dystrophy Campaign was thrilled to be chosen as LGC’s Charity of the Year for 2011/12, during which time the company raised more than £22,000 for the charity. The employees arranged cake sales, Christmas and summer fêtes and an innovative ‘dress the office orange’ day. LGC generously matched 100 percent of the funds raised by staff. Scientist of the Year – Professor Doug Turnbull Professor Doug Turnbull’s groundbreaking research at Newcastle University has been supported by the Muscular Dystrophy Campaign for the past 20 years with more than £1.2m in funding, and is now leading to pioneering treatments which could prevent the inheritance of mitochondrial myopathy from mother to child. Doug has recently been made Director of the brand new Wellcome Trust Centre for Mitochondrial Diseases, which will allow the researchers to take this revolutionary research forward. Health Professional of the Year – Dr Reghan Foley Justine McAlister met Dr Reghan Foley in 2011 at Great Ormond Street Hospital, where Reghan was on a two-year research fellowship, funded by the Muscular Dystrophy Campaign. The family had been searching for an answer about their four-year-old son, Benedict’s, condition for two years. In addition to helping diagnose Benedict’s condition, Dr Foley demonstrated that rare combination of empathy with her patients and application and understanding of the science and chemistry of the case.

Lifetime Achievement Award – Professor Alan Emery Professor Alan Emery qualified as a doctor in 1960, and developed an interest in muscular dystrophy while pursuing post-graduate research in Baltimore, USA. He went on to be the first to describe a form of muscular dystrophy, now known as Emery-Dreifuss muscular dystrophy, and also developed the creatine kinase test, still used today, to diagnose muscle disease. In 1989 he set up the European Neuromuscular Centre, which facilitates international collaboration and networking within the scientific community, and he has published some 400 articles and written or edited 26 books, almost all focusing on genetics and neuromuscular science. Professor Emery has devoted his career – and much of his life’s work – to the fight against muscular dystrophy and related neuromuscular conditions through his own research, which has advanced the boundaries of neuromuscular science, through the opportunities he has facilitated for others in his field, his passion for his work and his empathy for those affected by neuromuscular conditions.

page 19

page 20

www.muscular-dystrophy.org

Special Recognition Awards During the past year, the charity has received many communications from people who have been inspired by others around them. Many are so exceptional that we cannot let this year draw to a close without recognising their achievements and, at the 2012 National Conference, we introduced a Special Recognition Award. Leigh-on-Sea Striders Throughout 2012, this Essex-based running group has taken every opportunity to be involved in fundraising events and challenges. They have already raised more than £20,000 for the Muscular Dystrophy Campaign. Nottingham Fundraising Group Founded in 2010 by Robert Howes, who now chairs the group, the Nottingham Fundraising Group has to date raised £7,000 towards the charity’s work. Their energy is tireless and they are always on the look-out for new opportunities and fresh ideas. Tony and June Lewis, Broadstairs Tony chairs the South East Coast Muscle Group. Thanks to his and his wife June’s vigorous campaigning efforts, families in the area now have access to an essential Muscular Dystrophy Family Care Advisor. The Layton Family, Fareham – Stuart, Julie-Ann and Jack Whether grilling MPs in Parliament, representing the charity at corporate events, or spending all day waiting on a hot golf course to promote our Four Course Classic event, Stuart, Julie-Ann and Jack Layton have never turned down an opportunity to support the work of the Muscular Dystrophy Campaign. Charles Haynes, Cirencester After resolving to raise as much funding as possible for a treatment and despite having never ridden further than five miles before, Charles found the courage to take on the 480km London to Paris cycle challenge. His fiercely tenacious approach to fundraising is truly inspiring. Geoff Major, Yorkshire Geoff ’s commitment to the charity is resolute. Not content with just taking on the epic challenge of trekking to the North Pole to raise funds for the Muscular Dystrophy Campaign in April

this year, he is currently recruiting a group to trek the Sahara Desert next year. John Ashby, Surrey John has Duchenne muscular dystrophy. This has never stopped him from doing the things he enjoys, and using his talents to fundraise for the Muscular Dystrophy Campaign. From contributing his creative designs for fundraising programmes and posters to organising a charity concert, he is a dedicated fundraiser and a true inspiration to others. Katie Bizzey, Suffolk Katie has been a most committed fundraiser, having raised an incredible £30,000 for us over the last four years. Her daughter Laura, who has minicore myopathy muscular dystrophy, tells how Katie has given her the drive never to give up and to keep fighting her condition. Mathy Selvakumaran, Nottinghamshire Mathy led the Muscular Dystrophy Campaign Trailblazers’ accessible property investigation, raising awareness of the challenges faced by young disabled people wishing to live independently. Mathy has also played a leading part in our disability hate crime and airline campaigns. ‘Dick van Bike’ fundraising group, led by Bernard Finerty As if running 10k in the Muscular Dystrophy Campaign’s Oxford Town and Gown race weren’t enough, Bernard persuaded a team of cyclists to join him by rising at dawn and cycling 75km from London to Oxford, where they pulled on their running shoes to run the 10k course – all dressed as chimney sweeps or Mary Poppins. Parveen Arshad, Bristol Parveen juggles caring for her son Auzair, who has Duchenne muscular dystrophy, with playing a vital part in the Bristol and Bath fundraising team. She and her team

of family and volunteers cook all of the food for the committee’s now legendary annual Asian Banquet, and its Summer BBQ, creating meals for more than 200 people. Audrey Hatcher, Colchester Audrey set up the South Woodham Ferrers Shop for the Muscular Dystrophy Campaign 15 years ago, with the help of the Chelmsford Branch. Through Audrey’s hard work, the shop has become a real centre for the local community and raises £30,000 for the charity every year. Team Jed – Michael, Donna and Jed Thirkettle, Buckinghamshire Set up by Michael and Donna when their son Jed was diagnosed with Ullrich muscular dystrophy in 2008, Team Jed includes teachers and parents from Jed’s school, and even a clinician from Great Ormond Street Hospital. From persuading 31 people to do the Great North Run to skydiving for the Make today count campaign, they are a formidable fundraising force for the Muscular Dystrophy Campaign. Justine McAlister, West Sussex Soon after Justine took on a 10,000ft sponsored skydive for us, she helped us in a direct mail campaign. Through telling her family’s story, and that of her fiveyear-old son Benedict, who has Ullrich muscular dystrophy, Justine helped to raise more than £12,000 of vital funding.

www.muscular-dystrophy.org

Presenting Katie Razzall

– our new ambassador

We are delighted to announce that Channel 4 reporter and presenter Katie Razzall has joined the Muscular Dystrophy Campaign as an official ambassador. Katie won acclaim with her role in the news channel’s coverage of the Paralympics and has spearheaded the No Go Britain series on Channel 4 News, taking on social issues faced by disabled Britons. She first connected with our charity when she interviewed supporter, Dr Jon Hastie about his Life Worth Living: Pushing the Limits of Duchenne documentary for Channel 4. Katie also supported the charity at the BGC Charity Day in September, which raised more than £12m for charities worldwide in memory of employees of firm Cantor Fitzgerald who lost their lives in the 9/11 World Trade Centre attacks. Katie said she was thrilled about being an ambassador for the Muscular Dystrophy Campaign. “Meeting Jon Hastie was my way in to learning more about a cruel disease; but it was also my chance to talk to a man who doesn’t let himself be beaten by Duchenne muscular dystrophy. Jon opened my eyes to what is possible. “In our No Go Britain series at Channel 4 News, we’ve put disability at the centre of our coverage, and tried to shed light on subject matter and individuals often ignored by the media. I hope to continue with that aim with the Muscular Dystrophy Campaign.” Trailblazer member, Hannah-Lou Blackall worked with Katie when Channel 4 highlighted the issue of access to housing for young disabled people. “I am particularly excited that Katie is going to give her time to support the charity. Channel 4’s No Go Britain series has been an important platform for getting access issues for young people on the agenda. Having her involved will be of huge benefit to Trailblazers,” said Hannah.

News Here we bring you news, from all around the UK, of our work in leading the fight against muscular dystrophy and related neuromuscular conditions.

Breaking through Duchenne muscular dystrophy A Buckinghamshire family affected by Duchenne muscular dystrophy have become the first Ambassadors for the Muscular Dystrophy Campaign’s newly-launched Duchenne Research Breakthrough Fund. Gary and Louisa Hill from Chalfont St Peter in Buckinghamshire have two sons, Leyton and Archie. Two years ago, when Archie was four years old, he was diagnosed with Duchenne muscular dystrophy. “Our focus since Archie was diagnosed has been to remain positive and to do anything and everything we can to help. We are hopeful that treatments can be developed that will benefit Archie and other boys affected by Duchenne muscular dystrophy. Research is progressing and we are keen to help the researchers capitalise on the current momentum and build on the on the findings,” said Louisa. The Hill family have been active fundraisers, channelling all funds raised towards vital research work. They were recently involved in a golf day that raised a fantastic £8,000 towards the Fund, and did not hesitate to join the Duchenne Research Breakthrough Fund as Ambassadors. The Fund underlines the charity’s commitment to accelerating the

pace in development of effective treatments for the devastating musclewasting condition Duchenne muscular dystrophy. Thanks to the support of UK families and other donors, we have played a vital role in funding research and clinical evidence that have laid the foundations for the exon skipping technology now being taken forward by pharmaceutical companies into clinical trial. Our £1.2m target reflects existing research commitments to seven different projects and campaign activities for which £700k will be raised through our current fundraising activities, and a further £500k sought to meet future commitments and to fund new research projects to be completed in 2014/15. The Duchenne Breakthrough Research Fund has been launched at several venues around the country, and more are planned. If you’d like to find out more about the Fund, or to support it, do get in touch with our fundraising team on 0845 872 9058 or volunteerfundraising@musculardystrophy.org

On the web www.muscular-dystrophy.org/ duchennefund

page 21

page 22

www.muscular-dystrophy.org

Daniel’s fight to go outdoors For the last two years, technology has been not only Daniel Baker’s passion, but his only connection to the outside world (see article on p12). A seemingly routine wheelchair assessment became one of the longest and hardest struggles of his life. Two years ago, Daniel requested a wheelchair assessment as his current wheelchair was no longer meeting his needs. Wheelchair Services refused to provide a wheelchair that met Daniel’s needs and wanted to repossess his current wheelchair as they deemed it ‘unsafe’. Daniel refused as he did not want to be left bed-bound, which is exactly what ended up happening when his wheelchair was returned without batteries, following a routine service. Daniel had battled for a year and he contacted the Muscular Dystrophy Campaign’s advocacy service to ask for help. The team quickly got to work on his case, but it didn’t take long before they encountered similar barriers to those Daniel had already faced. Despite relentless pressure, it was difficult for the team to progress the case: Wheelchair Services would not provide an adequate wheelchair for Daniel and a new approach was needed. The team contacted a wheelchair dealer and found a wheelchair that would meet Daniel’s needs and give him a great level of independence. All that was needed was a voucher from Wheelchair Services so that Daniel could pay for it. The team gathered medical evidence from Daniel’s consultants and made contact with the head of services who reluctantly agreed to give Daniel a wheelchair voucher to pay for a wheelchair of his choice. Unfortunately the voucher was not enough to cover the costs of the wheelchair. Undeterred, Daniel took to fundraising to pay for the new wheelchair. He even roped in the support of England rugby star, Mike Tindall, and managed to raise enough money to pay for the wheelchair of his choice.

If you are struggling to get the care, support or equipment to which you are entitled, do get in touch with our advocacy team on 0800 652 6352 or info@muscular-dystrophy.org

fear of passing on a painful, debilitating condition to future children. However, open, thorough and transparent dialogue with the public about pro-nuclear IVF is critical,” she said.

If you’d like to support this work so we can help more individuals like Daniel, then do get in touch with our fundraising team on fundraising@muscular-dystrophy.org

The HFEA has expressed its commitment to ensuring the public are presented with the full facts. The Muscular Dystrophy Campaign is confident that this process will serve to broaden support for the technique and aid us in taking it forward with public backing.

Mitochondrial myopathy consultation launched by HFEA

The Human Fertilisation and Embryology Authority (HFEA) launched a consultation in September on a new in vitro fertilisation (IVF) technique that has the potential to stop mitochondrial myopathy being passed from mother to child. The technique, developed by Muscular Dystrophy Campaign-funded researchers led by Professor Doug Turnbull, uses IVF to fertilise an affected mother’s egg - containing ‘unhealthy’ mitochondria with the father’s sperm. The nucleus of the fertilised egg is then collected and transplanted into a donor egg containing healthy mitochondria, but with its own nucleus removed. A change to the law is required before the technique can enter clinical trial and the consultation aims to bring together members of the public, policy makers and scientists to discuss the social and ethical issues raised by the new technique. Sometimes sensationalised by misleading and inaccurate headlines as ‘three-parent IVF’, the technique means that more than 99 percent of the child’s genes – including all of the 23,000 that determine our physical and personal characteristics – would come from the mother and father. Only a tiny piece of DNA, containing 13 genes that affect only the mitochondria, would be inherited from the donor. Dr Marita Pohlschmidt, Director of Research at the Muscular Dystrophy Campaign, said that for women who live with mitochondrial disease, the prospect of bearing healthy children is of immeasurable value. “We believe this technique could open up the possibility of motherhood without the

If you’d like to find out more about the consultation, or how best to respond, do get in touch with our research team at research@muscular-dystrophy.org Advocacy service hits milestone Getting supporters the care, support and equipment to which they’re entitled is a key priority of the Muscular Dystrophy Campaign’s advocacy service. And the service is in strong demand. In September, the team hit the dizzying heights of half a million pounds worth of support for individuals with muscular dystrophy or a related neuromuscular condition. The achievement is a great success for the team and marks an immensely successful year to date. So far in 2012, the advocacy service has received 83 cases, 50 of which have been closed and 39 have been closed successfully. The team helps individuals who experience difficulties getting the benefits, housing, adaptations, care packages, education and wheelchairs they need and are entitled to. We at the Muscular Dystrophy Campaign are here to help you fight for your rights. We can take on cases on your behalf, or we can equip you with the information and written resources to fight your case yourself, with our much sought-after Advocacy pack. So, if you are experiencing difficulties getting the services you are entitled to, or would like a copy of our Advocacy pack, do get in touch with the information team on 020 7803 4808 or info@ muscular-dystrophy.org If you’d like to support the important and much-needed advocacy service that the charity provides, do get in touch with our fundraising team on 0845 872 9058

www.muscular-dystrophy.org

Charity Times honours Honorary Life President

Lord Walton of Detchant, Honorary Life President of the Muscular Dystrophy Campaign, won the ‘Outstanding Individual Achievement’ award at the Charity Times Awards 2012 at a ceremony in London in October. The award recognised that Lord Walton has dedicated almost his entire working life to improving the lives of people with muscular dystrophy and related neuromuscular conditions, in a medical and research capacity and also as a distinguished, highly-respected parliamentarian. As a founder of the Muscular Dystrophy Campaign, an internationally-renowned neurologist whose groundbreaking work in classifying muscle disease has led to a still-thriving research programme in Newcastle, and a life peer, Lord Walton’s respected clinician’s voice among parliamentarians has led to crucial improvements in access to specialist neuromuscular healthcare.

Desperate need to fill gaps in Northern Ireland specialist care

People from across Northern Ireland, affected by muscle-wasting conditions, joined forces with MLAs for the All Party Group on Muscular Dystrophy meeting in Northern Ireland in late September as the campaign for urgent improvements to specialist care gained momentum.

The All Party Group, chaired by Conall McDevitt MLA, held its first meeting since the launch of the McCollum Report* into access to specialist neuromuscular care in Northern Ireland in July. The group pledged to press the Northern Ireland Executive and Health and Social Care in Northern Ireland decision-makers for answers on the actions and timescale for implementation of the recommendations of the report. The Health, Social Services and Public Safety Committee in the Northern Ireland Assembly supported the McCollum Report through a debate in the Assembly in November, during which the Health Minister responded to calls for critical gaps in service provision to be addressed. The meeting also highlighted the urgent need to fill the gap in care advisor support in Northern Ireland. MLAs expressed their frustration at the continued delays in recruitment for this vital post which is currently being re-advertised by Belfast Health and Social Care Trust. The Muscular Dystrophy Campaign held a Muscle Group meeting before the All Party Group session, which focused on practical advice and support and emphasised the crucial importance of occupational therapy in providing care for people with muscle-wasting conditions. There are many examples of good practice in specialist healthcare across Northern Ireland, but significant improvements are required to ensure a consistent approach and expert knowledge for occupational therapy support.

Robert Meadowcroft, Chief Executive of the Muscular Dystrophy Campaign, said everyone connected with the charity was delighted.

The Muscular Dystrophy Campaign provides all the organisational support for the All Party Group in the Northern Ireland Assembly. For more information about the All Party Group and the Northern Ireland Muscle Group, please get in touch on 020 7803 4839 or email j.kingsley@muscular-dystrophy.org

“It is wonderful that Lord Walton’s outstanding contributions to the charity over more than 50 years, from his distinguished medical and research expertise in the neuromuscular field to leading the calls in Parliament for improving specialist neuromuscular care, have been recognised with this award.”

If you’d like to support the charity’s ongoing campaigning work and Muscle Groups, do get in touch with our fundraising team on 0845 872 9058.

The Muscular Dystrophy Campaign received four nominations at this year’s Charity Times Awards, reflecting the significant impact of Trailblazers, the charity’s advocacy service and fundraising initiatives including Make Today Count. It is also the second year in succession that the charity’s work has been acknowledged following the Campaigning Team of the Year award in 2011. This achievement of national recognition honours the outstanding dedication and commitment of our supporters across the UK.

*Gerry and Geraldine McCollum from Bangor (pictured above with Jim Wells MLA, a member of the All Party Group on Muscular Dystrophy) have been dedicated supporters of the Muscular Dystrophy Campaign for many years. (See p19 for more info about their President’s Award.)

page 23

News

www.muscular-dystrophy.org

Muscle Dreams and the Paralympics Friend of the Muscular Dystrophy Campaign and Chief Muscle Warrior/co-founder of The Muscle Help Foundation, Michael McGrath, took 75 boys and girls with muscular dystrophy to the Paralympic Games, where they were able to watch the incredible events and meet some of their athlete heroes and heroines. The 75 young beneficiaries, together with their families and carers, were able to witness the power of sport and human endeavour at the London 2012 Paralympic Games, over a period of six days. Highlights of the week included meeting celebrated Paralympian, Dame Tanni Grey-Thompson, as well as Mayor Boris Johnson and some of the athletes taking part in the Games. Karen Wallbridge wrote to thank The Muscle Help Foundation on behalf of her 14-year-old son, James. “Thank you for inviting James to such a wonderful event. He is absolutely buzzing and has come back home with a newfound confidence. The last two days have impacted him on so many levels. Until now, he has found it incredibly difficult to accept his disability, feeling embarrassed to be in his powerchair among his school friends. For years he has been the only one in his first and middle school to be affected by muscular dystrophy. “[At the Paralympics], he met others his own age in the same situation and he was able to see that they have the same, or

more difficult, hurdles to deal with and, more importantly, that nothing should stop him from having a go at whatever he wants to do. “Of course, these messages have always been given to him verbally by us, but the stories behind the Paralympics and the fact that he has physically witnessed the incredible swimmers and rugby players who have achieved their dream has been completely inspirational to him. “He came back wanting to try out wheelchair rugby and he wants to look at other wheelchair sports. David (his brother, who accompanied him as his carer) said the whole thing was absolutely fantastic.” Michael McGrath, who also took part in the Paralympic torch relay, was diagnosed with muscular dystrophy at the age of 18. He was delighted that his vision for the Paralympics, conceived just after London won the bid, had been realised. “All of the children witnessed and were inspired by the achievements of many Paralympic athletes; some 40 volunteers willingly assisted the charity and I know

that, for some, engagement with our families has had a deep positive impact. As for my core team, they’ve been awesome! This is one of those times when in the years to come, we’ll look back and say, we made a difference, we changed some lives!” Through a series of national and regional media interviews, the programme also raised awareness about muscular dystrophy. “It was also a massive honour to have carried the Paralympic flame: when my powerchair raised me up into the standing position, I was overcome as I hadn’t stood for over three years. I recall thrusting my left arm upwards and outwards and looking directly into the flame - I carried it as a symbol of hope, strength and joy for all of our charity’s Muscle Dream beneficiaries, past, present and future, as well as their families. I will never ever forget that moment,” said Michael. The Muscle Help Foundation is a UK registered family charity that delivers ‘Muscle Dreams’: amazing and unforgettable experiences to children and young people in the UK affected by muscular dystrophy.

On the web twitter.com/musclewarrior www.linkedin.com/company/2323415?trk=tyah www.facebook.com/TheMuscleHelpFoundation

www.muscular-dystrophy.org

Grassroots sports at City Hall Young disabled sports enthusiasts, accessible sports representatives and MPs gathered at City Hall in September for the launch of Game On, a nationwide campaign championing grassroots sports and fitness opportunities for young disabled people.

Trailblazers are leading the campaign, with the backing of London Mayor Boris Johnson. Members of the group, including Londoners Rikin Shah (22), a powerchair football coach and player from Northwood, and powerchair football and cricket coach Taz Virdee (25) from Hayes, spoke on how to encourage and support more young disabled people to get involved with grassroots sports. For the launch, they were joined by Culture, Media and Sports Select Committee member Gerry Sutcliffe MP, Deputy Mayor for Education and Culture, Munira Mirza, and Sam Bull, National Development Manager of the Wheelchair Football Association. Until the end of the year, sports enthusiasts from the Trailblazers group will showcase accessible local team sports and fitness activities, from powerchair football clubs and wheelchair basketball to Boccia training and wheelchair workouts. They will also audit the accessibility of local gyms, swimming pools, sports grounds and leisure centres, and investigate what obstacles disabled people encounter when getting involved in sport at a local level. For London Mayor Boris Johnson, there is no ‘them and us’ mentality when it comes to sport. “Every Londoner deserves to reap the positive legacy of our wonderful 2012 Games and that means inclusivity and accessibility is a key priority. This is

why every organisation funded through my Sports Participation Programme is required to adopt an Inclusive and Active action plan - and also why I continue to lobby for all providers of sport and physical activity to follow suit and make sure they are fully accessible to disabled people. I fully support the work of the Trailblazers and the Muscular Dystrophy Campaign in this area,” he said. Bobby Ancil, Project Manager of the Muscular Dystrophy Campaign Trailblazers, said the Game On campaign was an opportunity to highlight to businesses and local authorities how they can play their part to make sport and fitness activities accessible to young disabled people. “While the Paralympics proved to be a fantastic showcase for accessible sport, the reality is that problems accessing facilities, the cost of equipment, a lack of trained coaches and worries over the attitudes of others can all discourage young disabled people from getting involved. The Game On campaign is an opportunity for young disabled people who are already enjoying sport and fitness activities to demonstrate to peers how to overcome these obstacles.” Thanks to the hard work of our press office, Trailblazers were interviewed by Channel 4 News, BBC Radio 5 Live, BBC Radio London and ITV London Tonight, as part of our Game On campaign.

page 25

page 26

www.muscular-dystrophy.org

It all turned to gold for Ollie Ollie Hynd had an amazing Paralympic Games in London 2012. Not only did he win gold in the 200m Individual Medley in European record time, silver in the 400m freestyle and bronze in the 100m backstroke, but he also achieved a dream. “With a combination of hard work, dedication and belief, anything is possible,” said Ollie, whose dreams before the Paralympics were to keep improving, to do the best he could and to swim some personal bests.

“With a combination of hard work, dedication and belief, anything is possible,” said Ollie

His performances, all personal bests, represented an exceptional achievement for the 18-year-old from Kirkby-in-Ashfield, who has mitochondrial myopathy. Ollie and his older brother, Sam (21) shared the podium for the Individual Medley event (Sam won bronze), bringing pride and joy to this devoted Mansfield family who have committed so many years of their lives to swimming. Ollie also enjoyed splendid homecoming parades in London, Mansfield and Ashfield and has had a post box painted gold in his honour in Kirkby. Royal Mail’s 24th Paralympic stamp also features the teenage champion, who is now also a national hero. (We featured Ollie in Target MD Issue 3 of 4 2012 on p27.)

Photograph: courtesy of Mansfield Chad

www.muscular-dystrophy.org

A summer to remember GB Boccia did their country proud at the London Paralympics. Not only did the team walk away with a Paralympic bronze for the BC1/2 team match, and silver for David Smith in his individual BC1 match, but the sport found a new audience of fans. The media billed the sport as nothing short of ‘addictive’. Jacob Thomas (pictured bottom right) is 18 years old and has Duchenne muscular dystrophy. His dream came true when he represented ParalympicsGB in the Boccia at the London Games: he swept through the early rounds of his BC3 category, with his father Michael as his ramp assistant, and lost to gold-medallist, Grigorios Polychronidis in the round of 16. “Playing in the Paralympics has been one of the most amazing experiences in my life,” Jacob said. Scott McCowan (pictured top right), who has Duchenne muscular dystrophy, lost to top opposition in the second round of the individual BC3 event, however a 9-1 victory over Canada (world number five) was enough to see the BC3 Pairs (Jess Hunter, Scott and Jacob) finish a creditable equal fifth with Thailand and taste victory in front of a buoyant crowd. Scot Stephen McGuire (third from top), who represented Paralympics GB in both the individual and pairs competitions in the BC4 category, describes himself as ‘possibly the most unlucky athlete there, to have finished fourth in both the individual competition and the pairs competition’. The Paralympics proved not only to be a rollercoaster of emotion for him, but also the best experience of his life. “The Opening ceremony was something to savour. Walking into that cauldron of noise literally took my breath away. “A lot has been said of how friendly the Gamesmakers [volunteers] were and to be honest, they were exceptional. There was nothing too much trouble for them and they all made our life as athletes much easier,” he said. Stephen and his brother, Pete (pictured second from top) who both have an undiagnosed form of muscular dystrophy, lost 8-2 to Canada in the BC4 pairs bronze play-off. The Bellshill brothers then missed the final in the BC4 pairs event by 3mm against eventual winners Brazil. “We could not have been any closer to one of those fantastic medals. I’m extremely proud to have represented my country at the home games in London,” Stephen said.

“The way the general public turned out and got behind the Paralympics is something that will be difficult to match. There were 80,000 people packed into the Olympic stadium every day, and even the Boccia was full to capacity every time a GB athlete took to the courts.

“From my perspective, I hope that Boccia will grow in popularity in this country and it will leave a lasting legacy. Since returning from the Games, I’ve had overwhelming support and countless numbers of letters thanking me for making this summer something to remember.” According to GB Boccia, the Paralympic Games marked a significant step forward for GB Boccia and the Rio cycle begins with all three team and pairs in qualifying positions ( world top eight); and a collection of upwardly-mobile singles players.

We featured Stephen, Pete, Jacob and Scott in the Target MD Issue 1 of 4 2012 on p29 - 32. Photographs: courtesy of Claire Morrison at Scottish Disability Sport

page 27

page 28

www.muscular-dystrophy.org

Hello from Target Research I’m Neil, and I’m the research communications officer at the Muscular Dystrophy Campaign. I’ll be the editor of Target Research while Kristina is away on maternity leave in Australia. In this issue, our main feature is about magnetic resonance imaging (or MRI). Dr Tracey Willis, a former Muscular Dystrophy Campaign clinical fellow who now works in a muscle clinic, and her colleague Dr Kieran Hollingsworth answer your questions about the technology behind the scans. They explain how MRI works, what it can tell doctors, and how it can monitor disease progression in clinical trials. We also have an update on the exercise studies funded by the Muscular Dystrophy Campaign and, as always, research news from around the world. This time, we look at the HFEA consultation into IVF techniques that could stop mitochondrial disease being passed from mother to child and highlight research which might help doctors to predict disease prognosis in people with myotonic dystrophy. I do hope you enjoy my first edition of Target Research. If you have any research questions you’d like us to answer in the next one, please get in touch.

Neil Bennett Editor, Target Research t: 020 7803 4813 e: n.bennett@muscular-dystrophy.org tw: @NBennettMDC

Our conditions pa ges will include lin ks to relevant infor including trials, pu mation blications, grants and case studies

www.muscular-dystrophy.org

The best of the web Our

epage will new look hom

be simpler to

page 29

Hi everyone, I am the Muscular Dystrophy Campaign’s new Online Manager. I am really excited to have joined the charity and am getting stuck into improving the website and the way we communicate with you online. Based on your feedback, we’ve been busy making some big changes to our website. We hope these changes will make our website easier to use, and we’d love to hear your thoughts, so please do email me with your feedback. We also had fun live-streaming the National Conference in Nottingham last month. We had a good following on the day, and if you missed out and would like to catch up with any of the day’s events, do have a look at bit.ly/conferencelive . It was also a big day on Twitter for us. See the highlights here bit.ly/NatConf12 As always our supporters have been shouting about their fundraising activities, from buying our Christmas cards, to running marathons. We love hearing what you’re up to online so keep the tweets coming, keep commenting on Facebook and keep joining in the conversation on our TalkMD forum.

Helen Putnam Online Manager t: 020 7803 4833 e: h.putnam@muscular-dystrophy.org tw: @TargetMD

navigate

Our new fund raising landing page will high all fundraising light activities; prom ote key events share the latest and news.

page 30

www.muscular-dystrophy.org

A peak experience

A group of fabulous fundraising trekkers reached the top of Mount Kilimanjaro in October. They not only raised the flag for the Muscular Dystrophy Campaign at the summit, but they also raised vital funds for the work of the charity across the UK.

Julia Selby, Challenge Events Coordinator for the Muscular Dystrophy Campaign was one of the six-member group, who all reached the summit of Mount Kilimanjaro. “The final summit night was extremely tough, as we started at 10pm in the pitch black of -20 degrees. The mountain was extremely rocky and steep, and the porters were absolutely amazing; they sang Bob Marley and a Kilimanjaro song all the way up – it was incredible as it was hard for us to breathe. I would absolutely recommend doing the trip,” said Julia. If you’d like to climb to the top of Kilimanjaro, or take part in any other fundraising event for the Muscular Dystrophy Campaign, Julia would love to hear from you. Do get in touch on 020 7803 4828 or j.selby@musculardystrophy.org Pictured (back l to r): Julia Selby, Dean Robinson, Bharat Shah, Bharti Shah (front l to r) Hannah Weston, Hannah Flynn

Celebrities meet charity at Canary Wharf

A group of Muscular Dystrophy Campaign supporters teamed up with British Olympic gold medallists, Tim Baillie and Etienne Stott, Hollyoaks actress Kelly-Marie Stewart and Channel 4 presenter Katie Razzall at Canary Wharf on 11 September. They all came together to represent the charity at the annual BGC Charity Day and to help raise thousands of pounds towards our vital work. The charity day is an annual event held by international brokerage, BGC Partners, to raise millions of pounds for 100 charities worldwide. They do this in commemoration of the hundreds of employees they lost in the World Trade Centre attacks in New York in 2001. Our celebrity supporters and the likes of Mo Farah, Lewis Hamilton, Joan Collins, Alistair Campbell, Leona Lewis, Harry Redknapp and Sarah Ferguson all got involved on the trading room floor and had a go on the phones. Among our charity ambassadors were Donna and Jed Thirkettle, Stuart and Jack Layton, Justine and Benedict McAlister, Abbi and Sarah Bennett and Sulaiman Khan. Nura Makki, Corporate Fundraising Manager for the Muscular Dystrophy Campaign, said the charity was delighted to be one of just 25 charities invited to take part in the London event. “We felt honoured to have such fantastic representatives on the day; not only celebrities who showed their support, but also our friendly and eloquent ambassadors. We do not yet know the final fundraising total, but the BGC Charity Day is expected to have raised millions of pounds for UK charities. It will give a tremendous boost to our work in funding groundbreaking treatments for muscular dystrophy and related neuromuscular conditions, and in supporting the 70,000 families affected in the UK.”

Magical Microscope Ball Building on its success of raising more than £2m for the Muscular Dystrophy Campaign, this year’s Microscope Ball gave 750 guests from the property industry another wonderful evening’s entertainment. The 29th Microscope Ball took place on Thursday 18 October at a brand new venue this year – the Westminster Park Plaza. With a burlesque theme, guests were treated not only to champagne and a gourmet four-course dinner but they also enjoyed live music, burlesque performances and aerial acts throughout the evening. A key event in the property industry’s calendar, the Microscope Ball raises significant funds for the vital work of the Muscular Dystrophy Campaign. Robert Meadowcroft, the charity’s Chief Executive, said, “We had a fabulous Microscope Ball where guests had a great evening and supported our work generously. This is a flagship event for the Muscular Dystrophy Campaign and we depend on the Ball’s success to fund our important work, for which we are most grateful.”

www.muscular-dystrophy.org

Shop, run and sing with us this Christmas

Christmas can be a magical time of year and we would love it if you spent some time supporting the work of the Muscular Dystrophy Campaign. There are so many ways you can help our work for people living with muscle-wasting conditions and have plenty of fun along the way. Read (below) about the wonderful Christmas goodies you can buy from our online shop. And here’s a series of joyful concerts to get you really into the spirit of Christmas. Come and add your voice to the joyful sounds of our 2012 Spirit of Christmas carol concerts. Help welcome in Christmas with a magical evening of candlelit carols and festive readings. This year’s concerts include: Oxford - Christ Church Cathedral, Wednesday 5 December Glasgow - Hyndland Parish Church, Wednesday 5 December Gloucester – Gloucester Cathedral, Thursday 6 December Paisley - Paisley Abbey, Thursday 6 December Stoke Newington - St Matthias Church, Thursday 6 December Writtle - All Saints Church, Friday 7 December Bangor - Bangor Church of the Nazarene, Sunday 9 December Brighton - Sallis Benney Theatre, Wednesday 12 December

Bristol - Bristol Cathedral, Wednesday 12 December Henley - Christ Church Centre, Thursday 13 December Oldham - Springhead Congregational Church, Friday 14 December Cracking Christmas runs Stay fit, have fun, and support the vital work of the Muscular Dystrophy Campaign this Christmas. Whether you’re on the lookout for a fun run or are in the mood for something more challenging, we have just the event for you. This year’s series of Santa events are: Liverpool Santa Dash, Sunday 2 December London Santa Run, Sunday 9 December Glasgow Santa Dash, Sunday 9 December Lichfield Stowe Pool Santa Fun Run, Sunday 23 December

On the web www.muscular-dystrophy.org/shop

Christmas cards and gifts 2012

We have a wonderful choice of Christmas cards and gifts for you this year. When you buy any of these high-quality products from the Muscular Dystrophy Campaign, you help us to continue our vital work of fighting muscle-wasting conditions.

We also have a little extra stocking filler for you to buy this year. An extra donation of just £20 will go towards our Young scientists of the future programme to ensure not only that the groundbreaking research we fund continues, but also that there is a pool of specialist healthcare professionals focused on providing the best possible neuromuscular care across the UK, well into the future. If you’d like to support us with this additional gift, there’s just a box to tick. It’s very simple to place an order: • if you have our catalogue, please complete the order form and post it to the address shown, or • call our order line on 01736 33 33 12 (Monday to Friday, 9am to 5pm), or • visit our online shop at www.muscular-dystrophy.org/shop On behalf of the Muscular Dystrophy Campaign and all the individuals and families we support throughout the UK, thank you and best wishes to you and yours for a truly superb Christmas. Thank you for celebrating Christmas with us in this way.

page 31

page 32

www.muscular-dystrophy.org

Make Today Count 2013 Come and have fun with the Muscular Dystrophy Campaign! Join ‘Team 100’ and skydive for us in aid of our Duchenne Research Breakthrough Fund. On 1 and 2 March 2013, we’re looking to have 100 people take on a 10,000ft leap of faith for us, in recognition of the 100 boys in the UK each year who are diagnosed with Duchenne muscular dystrophy. All funds raised will be used to support the vital research projects the Muscular Dystrophy Campaign is funding. Last year, 100 brave supporters helped us make the day count, and together raised a whopping £84,000. For 2013, we plan to repeat that success. Anyone can get involved and support Make Today Count, whether it is by joining our Team 100 or, for those without a head for heights, by fundraising in their local community. If you’d like to join our Team 100, or would like to find out more about making the day count for Duchenne muscular dystrophy, then do get in touch with us on 020 7803 4826 or volunteerfundraising@muscular-dystrophy.org

On the web bit.ly/maketodaycount2013

Got to run

For all of you seasoned runners out there, fun runners and walkers, as well as those New Year’s resolution-ers hoping to get a brand new pair of trainers and running shorts for Christmas, we have a proper feast of running events lined up for you for 2013!

Take your pick from a range of events throughout the country and, if none of these events takes your fancy, you can always sign up to do an event of your choice and still fundraise for us. We’re here to give you guidance and support – every step of the way. • Is 2013 the year of the marathon for you? If so, we have places in the Belfast Marathon on 6 May, or the Edinburgh Marathon on 26 May. (Minimum sponsorship of £250: Belfast Marathon; minimum sponsorship of £400 and a registration fee of £49: Edinburgh Marathon.) • If you’d prefer a half-marathon, we have places for the Great North Run on 15 September 2013. It’s not only the biggest and most prestigious half-marathon in the world, but our runners always have loads of fun. Minimum sponsorship is £300, with an early bird registration fee of just £29. (This offer ends at the end of November, so do call us today!) • The Great South Run is a 10-mile road race that takes place on 27 October 2013. For this popular race there is a minimum sponsorship of £250 and a registration fee of £25. • The BUPA 10,000 is the UK’s most popular and sought–after 10km road race, which takes place through the hoor ay

hooray hooray

iconic heart of central London. It takes place on 27 May 2013; minimum sponsorship is £250 and the registration fee is £30. • Another popular 10k road race takes place in Manchester on 26 May 2013. The Great Manchester Run 10K requires a registration fee of £39 and a minimum sponsorship of £200. • Don’t forget our very own Muscular Dystrophy Campaign Town and Gown 10k series in 2013. Hugely popular, the 32nd Muscular Dystrophy Campaign Town and Gown 10k takes place in Oxford on 12 May 2013 and the second one in Cambridge in the autumn of 2013. If you’d like us to mail you when we launch, or would like more information, do please email us at townandgown10k@ muscular-dystrophy.org • If running’s not your thing, and you’d prefer putting one foot in front of the other in more of a walking way, then why not think about signing up for the London 2 Brighton walk on 25 and 26 May 2013? Ok, it’s not quite a walk in the park – it’s more of a 100km kind of walk. It’s tough; but rewarding. And you can walk it, or run it. The 100km route from city to coast takes you across varied terrain, through day and night,

Muscular Dystrophy Campaign

In cycles

clap

hooray

clap clap clap

We are also launching an exciting new cycling portfolio for 2013, including the popular London to Paris bike ride from 4 to 8 September, the ‘Moonriders’ challenge – a night cycle from London to Brighton on 29 June – and an overseas cycle from Vietnam to Cambodia from 5 to 16 October. Again, if you’d like a copy of our Cycling pack 2013, then do get in touch with Julia on 020 7803 4828 or events@muscular-dystrophy.org

www.muscular-dystrophy.org

and is seriously a challenge like no other. And for all of this, we ask a mere £80 registration fee and ask that you raise a minimum of £400. As with all of our events, our experienced team here at the Muscular Dystrophy Campaign will give you full support, advice and guidance. If you’d like a copy of our brilliant new Running pack 2013, which includes information about all of these events and more, as well as a comprehensive, helpful guide for your fundraising, then do get in touch with Hayley on 020 7803 4824 or h.gill@muscular-dystrophy.org

page 33

page 34

www.muscular-dystrophy.org

The power of football

re you suffering from post-Paralympic blues or have you been inspired to get involved in a disability sport? If so, let’s tell you a little more about powerchair football.

around 40 percent of the players have a muscle-wasting condition. The WFA also works closely with schools and teachers to support the sport, which is now available as a GCSE physical education (PE) subject.

There are now 36 powerchair football clubs throughout England and there are loads of ways you can get involved in this great sport. You may want to get out on to the pitch and learn to play, become a coach or a referee, volunteer to help at a club or just come and watch some of the action.

The WFA runs a coach and referee education programme in order to train more people to become involved in delivering powerchair football. We are also looking for journalists, photographers and event organisers to support the promotion of powerchair football.

All of our clubs hold regular training sessions and you can find out more by visiting the Wheelchair Football Association website (www.thewfa.org.uk) and finding out how to contact your local club. All clubs around the country are run by volunteers, so if you have some spare time – come along and get involved.

If you’d like to watch the best powerchair football teams in England playing, then you can always come along to a National League event in Nottingham. We have at least 10 matches being played each day, so you can be guaranteed of an actionpacked day. More details are on our website and I’m happy to share that the best thing is that it is FREE to come and watch too!

Billed as ‘the only active team participation sport for people in powerchairs’, powerchair football attracts a large number of individuals affected by muscular dystrophy and related neuromuscular conditions. Of the total number of people registered in England,

We hope to see you at a session or match soon and for the latest information, please look at the ‘On the web’ section below to see how you can follow us on Twitter or find us on Facebook.

The recently-established Middlesborough Powerchair Football Club is growing in strength and numbers. They recently attended the Evening Gazette’s Sport Wish Token presentation at the Riverside Stadium and picked up a cheque for £800. The Club came top after collecting 56,584 tokens, and the prize funds will buy the Club two more powerchair bumpers. The Club has also recently produced a short (90 second) video about powerchair football, to encourage members to sign up and join the Club and get involved in this amazing, action-packed sport. Do visit their website, watch their film – and get playing!

On the web Twitter: @WFAEnglandTeam Website: thewfa.org.uk Middlesborough Powerchair Football Club blog: boropfc.blogspot.co.uk

www.muscular-dystrophy.org

Trailblazers secure airline review Disabled passengers risk convoluted booking processes, humiliating scenes boarding flights, no access to toilets on long-haul journeys and a ‘questionable’ cap on compensation for severely damaged wheelchairs, according to a report published by the Trailblazers in October. Young disabled people told of humiliation, degradation and delays in their experiences of air travel. Many spoke of waiting hours on hold to premium rate telephone numbers, being physically hurt or humiliated during transfer to airline seats by poorly trained staff and even being forced to urinate in bottles owing to inaccessible aircraft toilets, during the study by the Trailblazers. The 400-strong group of disabled 16 to 30-yearolds, which campaigns on social issues affecting disabled people, found that degrading experiences onboard, coupled with the risk of holidays or business trips being ruined by damaged wheelchairs, had put some disabled people off flying entirely. The Up in the air report, documenting the air travel experiences of 100 young disabled people, found that: • nine out of ten wheelchair users are unable to use airline toilets and therefore have to avoid drinking before or during flights • six out of ten disabled passengers say their wheelchairs have been damaged when travelling with an airline • six out of ten disabled passengers say they feel unsafe when they transfer from a wheelchair to an airline seat • fifty percent have problems when booking airline tickets, because they have requirements relating to their disability. The report, which attracted around 140 pieces of regional and national media coverage, including Channel 4 News, Sky News and the Daily Mail, called on airlines to ‘clean up their act’ when it comes to flying disabled passengers. At the Parliamentary launch, Trailblazers met with MPs, representatives from Thomson Airways, Monarch Airways, British Airways, Boeing UK and the Civil Aviation Authority to discuss ways to move the industry forward. The meeting was chaired by Paul Maynard MP, and it was agreed that key airline stakeholders and Trailblazers will develop a short-term steering group to improve accessibility to air travel.

Tanvi Vyas, Trailblazers Campaigns Officer said the session was incredibly productive. “We are delighted that key stakeholders have agreed to form a working group with Trailblazers to tackle issues and come up with realistic recommendations to improve air travel for disabled people. Decisions about accessibility should involve people with real experience and this way, improving services will be beneficial for all concerned.” If you’d like to get involved with the Trailblazers network of young campaigners, do get in touch with us at trailblazers@muscular-dystrophy.org or 020 7803 4846. If you’d like to support the effective work of this group, do get in touch with our Fundraising team.

On the web www.muscular-dystrophy.org/trailblazers Up in the air report: www.mdctrailblazers.org/campaigns/1088 Follow Trailblazers on Twitter: @MDCTrailblazers

page 35

Target MD and Target Research

who really want to read them, and they’re both now produced fully in-house, the Muscular Dystrophy Campaign can free up more funds to spend on further research, campaigning, support and equipment grants.

In these harsh economic times, we’re working hard to save money. Now more than ever, we rely on every penny of your donations to fund vital research and provide support and care for people with muscular dystrophy and related conditions. With this in mind, we‘ve launched our new-look Target MD and Target Research – both to be delivered to you four times a year.

If you’d like to subscribe to the magazines, please post your details, together with a cheque for £18 made payable to ‘Muscular Dystrophy Campaign’ to Target MD Subscriptions at 61 Southwark Street, London SE1 0HL:

That’s right! You will receive Target MD four times a year instead of three, plus you will receive the new ‘slimline’ Target Research at the same time, rather than once a year as you did previously. And all for an annual subscription gift of just £18. This will help us cover our costs - even reduce them - while ensuring the same editorial quality you’d expect from every issue of Target MD and Target Research. And because they now only go to people like you

I wish to subscribe to Target MD and Target Research for one year, at a cost of £18. I wish to make a donation of £___________

Using Gift Aid means that for every pound you give, we are able to reclaim back from the Inland Revenue the tax paid on it – helping your donation to go further. Please tick the box below:

Target MD

magazine

Gift Aid Declaration

Issue 3 of 4 2012

Yes, I would like the Muscular Dystrophy Campaign to treat all gifts I have made in the past four years and all future gifts from the date of this declaration as Gift Aid donations. No, please do not claim Gift Aid on my donations.

I confirm I have paid or will pay an amount of Income Tax and/or Capital Gains Tax for the current tax year (6 April to 5 April) that is at least equal to the amount of tax that all the charities and Community Amateur Sports Clubs (CASCs) that I donate to will reclaim on my gifts for the current tax year. I understand that other taxes such as VAT and Council Tax do not qualify. I understand the charity will reclaim 25p of tax on every £1 that I have given.

MUST READ

A dedicated supporter – a fund in his name

Date____________________________________________ Please include a date here, as without a date this form is invalid. Thank you.

Would you like to receive updates from us?

Volunteering Read of some ways our valued volunteers support our work

Yes

FEATURE

Paralympic sport

ALL INSIDE

Meet some team members

Campaigning news – Research updates – Sports latest – Housing report – Fundraising events – Trailblazers news

Title_______________ First name_____________________Surname_______________________ Address________________________________________________________________________ _______________________________________________ Postcode_______________________ Phone_________________________________________________________________________ Email__________________________________________________________________________ Payment information: Method: Credit card Direct debit cheque to pay by credit card/debit card (details below) Name of cardholder: Title_______________ First name_____________________Family name____________________ Card type: Card No:

Visa

Expiry Date: /

Mastercard

Start Date(if applicable) /

Debit

Issue No.(if applicable)

Issue 3 of 4 2012

Bench to THOUGHT PROVOKING

bedside An update on cutting edge research from our conference A MUST READ

Clinical trials What’s happening right now?

Access

(maestro only)

Security code (if applicable)

Signature______________________________________ Date____________________________ Alternatively, call us on 020 7803 2867 or visit our website and subscribe online via Direct Debit or credit/debit card at www.muscular-dystrophy.org/targetmdsubscribe Registered Charity No. 205395 and Registered Scottish Charity No. SC039445

Target Research

Join the newly launched myotonic dystrophy registry

Also inside…read the latest research news from the UK and around the world and experts answer your questions