Ebola 2014 - Informe Final, actualizacion 8a

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ July 31 2014 El brote de Ébola está revistiendo un cariz espeluznante Obviamente creo que es intencional, y que esta nueva variante ha sido genéticamente modificada. Cualquiera que sea el trasfondo sobre el tema, si termina desmandándose a nivel mundial, no deberías acudir buscando ayuda a NINGÚN tipo de autoridad, porque aunque a nivel local probablemente sean bien intencionadas, pero el centro de control principal en la cúspide es completamente diabólico y todos conocemos las intenciones de la agenda 211 y si no las conoces, nunca es tarde para informarse. Y si eres de los que piensan que todo esto es una locura insana quizá un botón de muestra te abra los ojos. En 2006 el Dr. Eric R. Planka tras su ponencia durante el Congreso celebrado en Academia de Ciencias de Texas le, mereció el galardón de “Científico Tejano Distinguido” mientras el centro de congresos casi de derrumba por los aplausos. Uno de los temas que abordó en su discurso fue “la eliminación del 90% de la población mundial mediante el virus ébola”. ¡¡¡Esto ocurría en 2006!!!

Hay mucha gente dando consejos sobre cómo tratar el ébola, y en su mayor parte es pura basura Para empezar y para acabar, la plata coloidal tiene CERO efecto sobre los virus. La plata coloidal actúa contra bacterias. Las bacterias tienen procesos metabólicos que son interferidos por la plata coloidal, que bloquea la capacidad de las bacterias para tomar oxígeno. Así es como funciona coloidal plata. Pero los virus no tienen procesos metabólicos a los que afecte la plata coloidal, técnicamente ni siquiera están vivos y se parecen más a máquinas que entregan órdenes a las células para producir más virus hasta que éstas mueren por sobreactividad generada produciendo virus.

El componente activo de Noni detiene muchos virus Pero no salgas corriendo a comprar jugo de Noni, hay un trillón de “estafas Noni” en las tiendas, virtuales o no, y una manera fácil de hacerte con sus propiedades es: la Piña. La piña contiene el mismo ingrediente activo que se encuentra en el Noni, concentrado en una proporción de 1/10 .Como la mayoría de los proveedores de Noni te dicen que tomes 28 grms cada vez, puedes o bien tomarte esos 28 grms de jugo o simplemente beber 283 grms de jugo de piña. El componente activo de Noni sobrevive enlatado, pasteurizado, y a todos los demás procesos de la piña.

1

.- Muchos escritores han hablado de los planes intencionales por parte de cierta élite para reducir la población mundial; es un tema recurrente entre los llamados teóricos de la conspiración. Hay frecuentes referencias a "bocas inútiles", que incluye a la mayor parte de la humanidad. La mayoría, al oír de las tramas para despoblar el planeta, simplemente dicen en voz baja: "Sí, claro, y qué más" o más a menudo, mientras agitan la cabeza, "Estás loco". Pero cuando hay un examen cuidadoso de los escritos de autores prominentes de este siglo, las piezas del rompecabezas sin duda caen en su lugar - piezas que soportan la afirmación de que hay ciertos individuos, si no gobiernos enteros, que han implementado un programa de genocidio mundial en un esfuerzo por rescatar y arrinconar "recursos". Lo que va a estar leyendo en esta serie sobre la despoblación de un planeta son selectas obras de una amplia muestra representativa de puntos de vista y orientaciones políticas. Voy a estar utilizando "sus" propios documentos, con sus propias palabras, para tejer una tela que, al final, será un tapiz de claridad indiscutible para aquellos que tienen ojos para ver. (N. de los T.)

1.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Aunque obviamente no hay estudios sobre hasta que punto serían eficaces los principios activos del Noni o Piña contra el ébola, es una opción mucho mejor que la plata coloidal2, ya que ésta le dará ninguna oportunidad. Y añadiendo obviamente vitamina C a la mezcla, ayudará contra cualquier virus. Aunque los diferentes virus actúan de forma diferente ante los diversos hábitos alimentarios (Alimenta un resfriado y haz pasar hambre una fiebre) no hay mucha información sobre el Ébola sobre este particular.

Y debo decir que no soy ningún tipo de experto en Ébola, pero tengo muy claro lo que haría y a QUIENES evitaría. La enfermedad en sí fácilmente podría estar contenida en la vacuna que se anunciaría como protección contra el virus.

Enlaces: - Bill Gates Dice Que Las Vacunas Pueden Ayudar a Reducir La Población Mundial - Bill Gates (Microsoft) Admite en TED La Necesidad de Eliminar Población - El Instrumento Del Hambre y El Control de La Población - Bunge & Born Hirsch, Cartel Global de Los Alimentos

- Los Planes de Nuestros Gobernantes para Exterminar a la Humanidad Sobrante - Matando Gente Lentamente Usando Alimentos Tóxicos, Agua Tóxica y Vacunas Tóxicas - Del Control de Natalidad al Genocidio 2

.- En gran cantidad de webs leerás sobre la plata coloidal y su acción 'viricida' aunque esto no sea cierto.

Muchas fuentes sobre salud incluidas las alternativas comentan como la plata coloidal destruye los virus; aunque esto no sea cierto. Curiosamente otra fuente con frecuencia desinformativa como lo es wikipedia, no hace la más mínima alusión a la plata coloidal como remedio contra los virus con fecha 12/08/14. (ver) pero si una eficaz solución bactericida y fungicida (N. de los T.)

2.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ Jim Stone, August 1, 2014 August 1 2014 Ha sido enviado a este sitio web el tratamiento para el ébola, acompañado del MOA 3.

Este artículo es muy largo, NO LO LEAS SUPERFICIALMENTE. Sigue a continuación el tratamiento actual para el ébola, que prácticamente eliminará las muertes, según declaraciones de un médico que ha trabajado con este virus.

Considera esto: La élite nunca lanzaría una plaga sin una cura fácil, y junto con este brote de ébola una compañía estadounidense especializada en guerra biológica ha estado trabajando en Sierra Leona durante los últimos cinco años. Búscalo en Google. De hecho, el gobierno de Sierra Leona los ha identificado como los autores de este brote y los ha echado del país.

No hay absolutamente ninguna duda de que este brote fue causado intencionalmente por el departamento de guerra de Estados Unidos.

Y si es intencional, se conoce una cura. Sencillamente, no habría otra manera de hacer negocios.

Aquí está el tratamiento, completado con el MOA. Esto es un tratamiento, no una cura, su sistema inmunológico elimina el virus, y el tratamiento da tiempo a su sistema inmunológico para hacerlo. Esto es lo que hace Ébola que resulta fatal: Provoca la eliminación completa de toda la vitamina C del cuerpo. En realidad, nadie sabe qué mecanismo está implicado para llevarlo a cabo, que no sea algún tipo de malfuncionamiento que no es permanentemente destructivo o cualquiera que sea el desencadenante que suprime toda la vitamina C del organismo. Todos los investigadores saben que la vitamina C cae a cero y todos los síntomas del ébola son consistentes con una pérdida completa de la vitamina C. ¿Cómo puedo saber esto? Un médico que prefiere permanecer en el anonimato “por cuestiones de salud” y que ha trabajado con víctimas de ébola descubrió este mecanismo y lo envió a este sitio web, en el último minuto esta búsqueda no puede comprobarse en Google que confirma este médico no hizo un “copiado-pegado”, por lo tanto, publícalo TODAS PARTES; SÁCALO A LA CALLE, SE CONOCE EL TRATAMIENTO CONTRA EL EBOLA QUE EVITA LA MUERTE Y ESTA ES UNA SOLICITUD DE EMERGENCIA PARA MIS LECTORES PARA QUE DIFUNDAN ESTA INFORMACIÓN Y DETENER ESTE ATAQUE EBOLA EN SUS COMIENZOS. De un médico anónimo: 3

.- 'Method of Action' – Método de Acción

3.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Resumen: "Los primeros síntomas del ébola son exactamente los mismos del escorbuto, que está causado por insuficiencia de vitamina C. Aunque el escorbuto rara vez resulta fatal como condición primaria, el escorbuto también representa sólo una deficiencia parcial de vitamina C, en estas condiciones el cuerpo todavía mantiene un montón de vitamina C en comparación a cero, y esto es lo que provoca el ébola. En ausencia de vitamina C, las paredes de los vasos sanguíneos se vuelven muy débiles y comienzan a perder sangre, y las plaquetas se vuelven ineficaces e incapaces de desencadenar la formación de coágulos. Así la muerte por ébola está causada por una hemorragia interna masiva y la consiguiente pérdida de sangre, que puede ser detenida simplemente tomando enormes dosis de vitamina C hasta que el sistema inmune tenga éxito matando el virus ".

Comienza el texto: El ébola es probablemente el más conocido de una clase de virus conocidos como virus de la fiebre hemorrágica. De hecho, el virus Ébola fue reconocido inicialmente en 1976 Otros síndromes virales relacionados pero menos conocidos incluyen la fiebre amarilla, la fiebre hemorrágica del dengue, la fiebre del Valle del Rift, la fiebre hemorrágica de Crimea-Congo, la enfermedad del Selva Kyasanur, la fiebre hemorrágica de Omsk, la fiebre hemorrágica con síndrome renal, El síndrome pulmonar por hantavirus, la fiebre hemorrágica venezolana, la fiebre hemorrágica de Brasil, la fiebre hemorrágica argentina, la fiebre hemorrágica boliviana, y la fiebre de Lassa.

La infección por el virus del Ébola, también conocida como fiebre hemorrágica africana, tiene la distinción de tener la tasa de mortalidad más alta de las infecciones virales mencionadas anteriormente, que van desde 53% al 88% Estos síndromes de fiebre hemorrágica viral comparten ciertas características clínicas. El Cecil Textbook of Medicine señala que estas enfermedades se caracterizan por la fragilidad capilar, lo que se traduce a un sangrado fácil, que con frecuencia puede llevar a un shock grave y la muerte. Estas enfermedades también tienden a consumir y/o destruir las plaquetas, las cuales juegan un papel integral en la coagulación de la sangre. La presentación clínica de estas enfermedades virales es similar al escorbuto, que también se caracteriza por la fragilidad capilar y una tendencia a sangrar con facilidad. Se desarrollan lesiones cutáneas características, que son en realidad múltiples pequeñas áreas de sangrado dentro de la piel que rodea los folículos pilosos. algunos casos incluso incluyen sangrado en cicatrices ya curadas.

4.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

En la forma clásica de escorbuto que evoluciona muy lentamente desde el agotamiento gradual de la vitamina C de las reservas corporales, el sistema inmunológico estará lo suficientemente comprometido para dar paso a infecciones que reclamar la vida del paciente antes de la extensa hemorragia que se produce después de que todas las reservas de vitamina C han sido completamente agotadas. El virus Ébola y otras fiebres hemorrágicas virales son mucho más propensos a causar hemorragias antes de que cualquier otra infección mortal tenga la oportunidad de establecerse. Esto es debido a que el virus de manera rápida metaboliza y consume totalmente todos los disponibles de la vitamina C en los cuerpos de las víctimas, síntomas que solo aparecen en una etapa muy avanzada de escorbuto, literalmente, a los pocos días de la enfermedad.

El escorbuto es tan completo que los vasos sanguíneos en general, no pueden controlar una hemorragia durante el tiempo suficiente como para evitar que se desarrolle una complicación infecciosa. Además, las fiebres hemorrágicas virales normalmente sólo se agarran y alcanzan proporciones epidémicas en esas poblaciones que ya se espera que tengan bajas reservas corporales de vitamina C, como se encuentran en muchos de los africanos con desnutrición severa crónica. En estos individuos, una infección por virus hemorrágico a menudo acabará con cualquier resto de reservas de vitamina C antes de que los sistemas inmunes pueden tomar la delantera e iniciar la recuperación. Cuando los depósitos de vitamina C se agotan rápidamente por grandes dosis infecciosas de un virus agresivo, el sistema inmune de manera similar se agota y queda comprometido.

Sin embargo, este punto es en gran parte académico después de haber comenzado la hemorragia en todo el cuerpo.

Hasta la fecha, no hay infección viral que haya demostrado ser resistente a la dosificación adecuada de vitamina C como quedó clásicamente demostrado por Klenner. Sin embargo, no todos los virus han sido tratados con las dosis de vitamina C de Klenner, o al menos no se han publicado los resultados. La infección viral de Ébola y otras fiebres hemorrágicas virales agudas parecen ser enfermedades que entran en esta categoría. Debido a la capacidad aparentemente excepcional de estos virus a agotar rápidamente los depósitos de vitamina C, probablemente serían necesarias dosis aún más grandes de vitamina C con el fin de revertir eficazmente y eventualmente curar infecciones causadas por estos virus.

Cathcart (1981), que introdujo el concepto de la tolerancia intestinal de la vitamina C se señaló anteriormente, la hipótesis de que el Ébola y otras fiebres hemorrágicas virales agudas bien podrían requerir también 500,000 mg de vitamina C al día para alcanzar la tolerancia intestinal! Si esta estimación es correcta, parece claro como lo demuestran las manifestaciones clínicas tipo-escorbuto de estas infecciones que la dosificación de vitamina C debe ser vigorosa y administrada en dosis extremadamente altas. Si la enfermedad parece estar ganando, entonces se debe dar incluso más vitamina C hasta que los síntomas comiencen a disminuir. Obviamente, se trata de enfermedades virales que absolutamente requieren altas dosis de 5.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

vitamina C por vía intravenosa como tratamiento inicial. La administración oral debe comenzar simultáneamente, pero la vía intravenosa no debe ser abandonada hasta que la respuesta clínica se ha completado. La muerte se produce demasiado rápido con las fiebres hemorrágicas como para ser conservador a la hora de dosificar vitamina C (de la vitamina C, Enfermedades Infecciosas, y Toxinas: Curando lo Incurable por Thomas E. Levy MD JD) MI COMENTARIO: Puede que no sea médico, pero soy terriblemente bueno con temas médicos, y esto suena 100% verdad, es el MOA que si se combina con algunos de mis conocimientos médicos, como por ejemplo el hecho de que el brócoli es absolutamente excelente para ayudar a la coagulación de la sangre, que el componente activo de Noni (que se encuentra en el jugo de piña) es fuertemente anti viral, y que las curas como la plata coloidal, mientras que buena para las infecciones bacterianas no hace nada contra virus; combinar un conocimiento real con lo que este médico dice y es muy probable que el Ébola pueda revestir tanta importancia como un caso leve de escorbuto.

Tenga cuidado con la corriente psy-op4 y la Plata Coloidal, la cura efectiva para el Ébola ha sido dada a este sitio web.

La plata coloidal es algo extraordinario, y yo he hecho montones de litros a partir de una barrita de plata de 28 grms. Funciona muy bien para curar infecciones bacterianas y haciendo que el agua sea segura para beber sin el desagradable sabor a yodo o cloro. SIN EMBARGO, LA PLATA COLOIDAL NO HARÁ NADA CONTRA LOS VIRUS, mientras tanto MENTIRAS ENORMES ESTÁN SURGIENDO POR TODAS PARTES AHORA MISMO para desviar a la gente hacia una falsa cura contra el ébola y simultáneamente LOS MEDIOS DE COMUNICACIÓN ALTERNATIVOS HACEN LO QUE SEA POR SEGUIR SIENDO EL FOCO CENTRAL ESCRIBIENDO SOBRE LA PLATA COLOIDAL PARA COMBATIR EL ÉBOLA. Todos los agentes curativos tienen un Modo de Acción, o MOA. Y si cualquier persona que publique curas médicas no conoce el MOA, es que no tiene ni idea de lo que está hablando. La plata coloidal tiene un MOA que se conoce desde hace muchas décadas, pero recientemente Google ha sido modificado para poder enterrarlo con sólo los artículos que indican "el MOA se está estudiando y creemos que es ___ (sigue desinformación)" y tiene que haber una razón ¿por qué se está haciendo esto en este momento, en este punto del tiempo con el Ébola corriendo frenéticamente.

4

.- Término de Agencias de Inteligencia político-militar para "operaciones psicológicas". Un gobierno u operación corporativa patrocinada, que por lo general reviste la forma de un "ataque terrorista" o de "pistolero enloquecido tras una juerga", con la intención de sembrar el pánico entre el público para que éste, bovinamente, exija más policía y leyes que inhiben la libertad. Las psyops suelen llevarse a cabo tras drogar a un civil o un grupo de civiles con psicofármacos o psicotrópicos que estimulan la agresión, también tras un tratamiento psicológico disociativo, después se los arma y son enviados a provocar el caos por medio de atrocidades de sangre. Tras el brote la víctima o bien se suicida o cae abatida por la policía y en las raras ocasiones en que sobrevive, ésta no se acuerda de nada. Por extensión se aplica al terrorismo patrocinado por cualquier gobierno. Ver también: camisas negras, conspiración. Se recomienda visionar “El mensajero del miedo”. (N. de los T.)

6.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Así es como la plata coloidal trabaja realmente (su MOA), con el primer ejemplo: La plata coloidal es a para las bacterias lo que cianuro para todos los organismos de sangre roja. En los organismos de sangre de color rojo, el cianuro se une con la hemoglobina en lugar de oxígeno, y hace imposible que la sangre transporte oxígeno. Con suficiente cianuro, la falta de oxígeno a vía cianuro unido hemoglobina causa la muerte.

La plata coloidal hace lo mismo para las bacterias, se une con los transportadores de oxígeno en las bacterias de forma permanente, haciendo que las bacterias mueran rápidamente por falta de oxígeno. Este es el MOA para la plata coloidal, que ha sido claramente conocido prácticamente siempre.

LOS VIRUS NO TIENEN procesos metabólicos que requieran un portador de oxígeno, POR LO TANTO LA COLLOIDAL PLATA será completamente ineficaz contra el ébola, de ningún modo permitas que los desinformados de los medios alternativos te vuelvan tonto diciendo plata coloidal es eficaz contra los virus, la plata coloidal es sólo útil para el tratamiento de infecciones bacterianas secundarias que se mueven en después de una infección viral precedente y en el caso del ébola, no hay tiempo suficiente para que se desmarque una diferencia.

Es muy importante tener en cuenta que una psy-op DE ENORMES PROPORCIONES está en marcha para falsificar la plata coloidal como una cura para el virus y tiene que haber una razón, no caigas en la trampa.

LOS VIRUS NO TIENEN procesos metabólicos que requieran un portador de oxígeno, POR LO TANTO LA COLLOIDAL PLATA será completamente ineficaz contra el ébola Pregunta: ¿Tienen metabolismo los virus?

Respuesta: Le hicimos esta pregunta a Chris Smith

Chris - Esto es interesante en términos de biomimética Porque la gente está hablando sobre el uso de los virus y su capacidad para infectar células e inyectar su ADN y ARN en las células para la terapia génica de modo que es una pregunta importante. Y la respuesta es no. Los virus no están vivos no tienen un metabolismo, que son nada más que una bolsa infecciosa de genes que son capaces de poner esos genes en una célula y hacer que la célula produzca únicamente productos virales para hacer más virus. Eso es todo lo que hacen.

7.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 2 2014 Se ha publicado un post sobre el ébola con el potencial de salvar el mundo con fecha de 1 de agosto (ver pg 11) No tengo mucho tiempo para publicar en este momento, pero han entrado una gran cantidad de mails sobre la vitamina C y el ébola. Voy a dar una opinión, y es sólo una opinión en base a lo que dijo el doctor. El médico dijo que la mala nutrición conduce a la falta de vitamina C que es la causa una mayor tasa de mortandad en los países africanos de lo que se ve en otros lugares del resto del mundo, que obtienen más vitamina C. Así, la lógica que tendría esto es que las dosis de 500.000 miligramo y su administración intravenosa podrían ser excesivas. No he estudiado cuánto es demasiado. Pero en mi opinión, eso suena como que estaría mucho más allá de cualquier necesidad.

Mi conjetura? Dado que la cantidad preexistente de vitamina C de una dieta normal hace una gran diferencia, si Ebola despega y se convierte en una amenaza global, yo personalmente compraría una bote con 500 tabletas de 1000 miligramos de ácido ascórbico genérico económico en Sams Club o en Wal Mart, tomaría 20 tabletas diarias y me parecería bien. En tanto que es amargo y no la dulce basura sintética, va a estar bien. Eso es lo que yo personalmente haría, pero esto sólo una opinión.

Lo que creo que es un post sobre Ébola con el potencial de salvar mundo está en páginas previas, creo que un doctor con una autorización de seguridad fue pícaro e hizo lo correcto, ARCHIVA Y PUBLICA! Esto se quedará donde está, en la parte superior, hasta el lunes a las 15:00 h. Las actualizaciones de este sitio web se publicarán por debajo.

8.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ Jim Stone, Freelance Journalist, Feb 4 2012 REPETICIÓN DE LA ADVERTENCIA: La plata coloidal es para patógenos metabólicos, NI VIRUS NI ÉBOLA Estafadores sin escrúpulos están utilizando la amenaza de ébola para amontonarlo con plata coloidal, que funciona muy bien contra las bacterias pero no tiene en absoluto ningún efecto sobre los virus. Incluso aunque fueran "publicados informes por autoridades médicas", alegando que la plata coloidal cura el ébola, no dejarán de ser mentiras descaradas y desinformación.

Cuidado: Una inmensa psy-op está en marcha para impulsar la plata coloidal como una cura para el ébola, y te ruego que empieces a preguntarte por qué. ¿POR QUÉ AHORA? Creo que es (al menos en parte) para canalizar incautos desprevenidos hacia una cura falsa así que lo que se planea con este brote de ébola causado intencionalmente continua hacia su resultado final previsto y amenazador. ¿Por qué funciona la plata coloidal contra las bacterias, pero no funciona en absoluto contra los virus?

Los virus no tienen procesos metabólicos, y las bacterias sí. Todo esto está vinculado a continuación en los siguientes posts. Con los virus que carecen de procesos metabólicos, no hay absolutamente nada para la plata coloidal para que pueda interferir y matar a los virus. Sin embargo, todo el mundo sabe la vitamina C ayuda con los resfriados que son causados por virus, y como resultado, es lo detendrá al ébola en sus inicios y prácticamente asegurar tu supervivencia en caso de suceda un brote.

Estoy absolutamente asustado por el nivel de desinformación que está siendo lanzado en estos momentos por los estafadores y, probablemente, por el departamento de guerra, alegando públicamente que la plata coloidal machaca el ébola. Y está siendo acompañada por informes-estafa afirmando que la plata coloidal funciona contra todos los virus, cuando en realidad, no tiene ningún efecto sobre VIRUS DE NINGÚN TIPO. La biología está completamente equivocada, por ejemplo, se puede tomar plata coloidal con seguridad, pero solo mata bacterias. Eso se debe a que no utilizas —tu organismo— el mismo transportador de oxígeno que las bacterias, las bacterias no tienen hemoglobina. Tu diseño es completamente diferente que el de las bacterias. Y los virus, aunque microscópicos, su diseño también es completamente diferente del de las bacterias, y como resultado, no se ven afectados por las mismas cosas que atacan a las bacterias y no son tocados por la plata coloidal la misma manera que las personas no se ven afectadas por la plata coloidal.

Si ebola despega en tu país, esto es lo que debes hacer: Ahorra tu dinero, vete al Sams Club o Wal Mart y compra una botella gigante de la agria y desagradable vitamina C (no los preparados dulces, que siempre son basura). La vitamina C es ÁCIDO ASCORBICO y los ácidos son agrios. No son dulces, por lo que para asegurarte que compras un producto veraz que realmente va a funcionar como se dijo anteriormente, asegúrese de que su vitamina C es agria. Yo iría a por el ácido ascórbico super barato, aunque la vitamina C con Escaramujo (fruto de Rosa canina) probablemente 9.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

salga mejor por unidad de volumen. El problema es, sin embargo, que vas a necesitar cantidades enormes si el ébola se extiende, y la basura genérica super barata de 1000 miligramos por comprimido que es casi siempre ácido ascórbico puro proporcionará una protección mucho mejor por euro gastado. Y querrás tener un montón. ¿Cuánto dinero saco yo al deciros que vayáis a vuestro super de precios reducidos a comprar ácido ascórbico genérico? ¿Es que acaso estoy promocionando un producto aquí? ¿Cuánto más va a hacer un mentiroso sin escrúpulos vendiéndote una botella de plata coloidal contra el virus del ébola, cuando sólo es efectivo contra las bacterias?

Piensa en eso.

10.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 4 2014 Aquí está, la patente de la versión actual del EBOLA No tengo tiempo de leer todo esto, pero parece ser una patente para el virus y la vacuna para curarlo.

DOCTOR INCONFORMISTA PUBLICA UNA CURA PARA EL EBOLA ACCESIBLE Y SIMPLE, ESTE ARTÍCULO SE HA PUBLICADO CON FECHA 01 de agosto o haga clic aquí ¿Por qué un médico iría por libre y publicaría esto? ¿Tal vez porque no estaba de acuerdo con el plan? ACTUALIZACIÓN: Una segunda cura está disponible por ahí fuera: las transfusiones de sangre tomadas de los sobrevivientes al ébola también funcionan para detenerlo, sin embargo yo no llamaría a eso una cura "accesible", esto sólo demuestra que "ellos" conocen más de una manera de curar el ébola, y definitivamente, “ellos” no se pondrán una vacuna.

-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-o-oOCR pasado directamente del documento de la patente del virus ébola.

Idioma: Inglés De interés para investigadores y conocedores del tema

11.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Claims(30) 1. An isolated hEbola virus comprising a nucleic acid molecule comprising a nucleotide sequence of: a) a nucleotide sequence set forth in SEQ ID NOS: 1 or 10; b) a nucleotide sequence hybridizing under stringent conditions to SEQ ID NOS: 1 or 10; or c) a nucleotide sequence of at least 70%99% identity to the SEQ ID NOS: 1 or 10.

2. An isolated hEbola virus having Centers for Disease Control Deposit Accession No. 200706291.

Publication number Publication type Application number PCT number Publication date Filing date Priority date (¿?)

Also published as Inventors

3. The hEbola virus of any one of claims 1 or 2 which is killed.

4. The hEbola virus of claim 1 which is an attenuated hEbola virus.

5. The virus of claim 4 wherein at least one property of the attenuated hEbola virus is reduced from among infectivity, replication ability, protein synthesis ability, assembling ability or cytopathic effect.

6. An isolated nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOS: 1 or 10 or a complement thereof.

Applicant

Export Citation Classifications (21)

CA2741523 A1 Application CA 2741523 PCT/US2009/062079 Apr 29, 2010 Oct 26, 2009 Oct 24, 2008 EP2350270A2, EP2350270A4, US20120251502, WO2010048615A2, WO2010048615A3, Jonathan S. Towner, Stuart T. Nichol, James A. Comer, Thomas G. Ksiazek, Pierre E. Rollin Jonathan S. Towner, Stuart T. Nichol, James A. Comer, Thomas G. Ksiazek , Pierre E. Rollin, The Government Of The United States Of America As Represented

By The Sec Retary, Department Of Health & Human Services, Center For Disease Contro, BiBTeX, EndNote, RefMan

E x t e r n a l L i n k s : C I P O, E s p a c e n e t (¿?) The priority date is an assumption and is not legal conclusion.

Google has not performed a legal analysis and makes no representation as to the accuracy of the data listed

7. An isolated nucleic acid molecule comprising a nucleotide sequence of between 4 and 4900 contiguous nucleotides of the nucleotide sequence of SEQ ID NOS: 1 or 10, or a complement thereof; with the proviso that said nucleotide sequence is not comprised by the nucleotide sequence set forth in SEQ ID NO: 20; or between 5500 and 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOS: 1 or 10, or a complement thereof.

8. An isolated nucleic acid molecule comprising a nucleotide sequence that encodes the amino acid sequence of SEQ ID NO: 29, 59, or SEQ ID NO: 11-19 or a complement of said nucleotide sequence.

9. An isolated RNA or DNA nucleic acid molecule which hybridizes under stringent conditions to a nucleic acid molecule having the nucleotide sequence of SEQ ID NOS: 1 or 10 or a complement thereof.

10. An isolated polypeptide encoded by the nucleic acid molecule of any one of claims 7-9.

11. An isolated polypeptide comprising the amino acid of: a) an amino acid sequence set forth in any of SEQ ID NOS: 2-19, or 59; or b) an amino acid sequence that has 70% - 99% homology to the amino acid sequence of (a).

12. An isolated polypeptide comprising the amino acid sequence having to 250 contiguous amino acid residues of the amino acid sequence of SEQ ID NOS: 5 or 18 (VP24); 5 to 280 contiguous residues of the amino acid sequence of SEQ ID NOS: 6 or 17 (VP30); 5 to 320 contiguous residues of the amino acid sequence of SEQ ID NOS: 8 or 13 (VP40); 5 to 340 contiguous residues of the amino acid sequence of SEQ ID NOS: 7 or 12 (VP35); 5 to 370 contiguous residues of the amino acid sequence of SEQ ID NOS: 4 or 15 (SGP); 5 to 370 contiguous residues of the amino acid sequence of SEQ ID NOS: 59 or 16 (SSGP); 5 to 670 contiguous residues of the amino acid sequence of SEQ ID NOS: 9 or 14 (GP); 5 to 730 contiguous residues of the amino acid sequence of SEQ ID NOS: 3 or 11 (NP); or 5 to 2200 contiguous residues of the amino acid sequence of SEQ ID NOS: 2 or 19 (L).

13. An isolated antibody or an antigen-binding fragment thereof which immunospecifically binds to the hEbola virus of any one of claims 1or 2 or neutralizes the virus.

12.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 14. An isolated antibody or an antigen-binding fragment thereof which immunospecifically binds to the polypeptide of any one of claims 11 or 12 or neutralizes an hEbola virus.

15. A method for detecting the presence of a the hEbola virus or a nucleic acid molecule derived therefrom of claim 1 in a biological sample, said method comprising: (a) contacting the sample with an agent that selectively binds to the virus or the nucleic acid molecule derived therefrom; and (b) detecting whether the compound binds to the virus or the nucleic acid molecule derived therefrom in the sample.

16. The method of claim 15, wherein the agent is an antibody.

17. The method of claim 15, wherein the agent is a nucleic acid molecule comprising a nucleotide sequence having between 4 and 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOS: 1 or 10, or a complement thereof.

18. A method for detecting the presence of the polypeptide of claim 11 in a biological sample, said method comprising: (a) contacting the biological sample with an agent that selectively binds to said polypeptide; and (b) detecting whether the compound binds to said polypeptide in the sample.

19. The method of claim 18, wherein the agent is an antibody or an antigen-binding fragment thereof.

20. A formulation comprising the hEbola virus of any one of claims 3 or 4, and a pharmaceutically acceptable carrier.

21. A formulation comprising an amount of a protein extract of the hEbola virus of claim 3 or 4 or a subunit thereof, and a pharmaceutically acceptable carrier.

22. A formulation comprising an amount of a nucleic acid molecule of the nucleotide sequence of SEQ ID NOS: 1 or 10 or a complement thereof, and a pharmaceutically acceptable carrier.

23. A formulation comprising an immunogenically effective amount of the nucleic acid molecule of claim 9 or a complement thereof, and a pharmaceutically acceptable carrier.

24. A vaccine formulation comprising a therapeutically or prophylactically effective amount of the hEbola virus of claim 3 or 4 or a protein extract therefrom, and a pharmaceutically acceptable carrier.

25. A vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule SEQ ID NOS: 1 or 10 or a complement thereof, and a pharmaceutically acceptable carrier.

26. A vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule of claim 9 or a complement thereof, and a pharmaceutically acceptable carrier.

27. A pharmaceutical composition comprising a prophylactically or therapeutically effective amount of an anti-hEbola agent of an antibody or an antigen-binding fragment thereof which immunospecifically binds to the hEbola virus of Deposit Accession No. 200706291, or polypeptides or protein derived therefrom and optionally has the nucleotide sequence of SEQ ID NOS: 1 or 10, or a fragment thereof.

28. A kit comprising a container containing the formulation of any one of claims 24-26.

29. A method for identifying a subject infected with the virus of claim 1 or 2, comprising: (a) obtaining total RNA from a biological sample obtained from the subject; (b) reverse transcribing the total RNA to obtain cDNA; and (c) amplifying the cDNA using a set of primers derived from a nucleotide sequence of the virus of claim 1 or 2.

30. A primer that has the nucleotide sequence of one of SEQ ID NOS: 24-57.

Human ebola virus species and compositions and methods thereof CA 2741523 A1 Abstract Compositions and methods including and related to the Ebola Bundibugyo virus (EboBun) are provided.

Compositions are provided that are operable as immunogens to elicit and immune response or protection from EboBun 13.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 challenge in a subject such as a primate. Inventive methods are directed to detection and treatment of EboBun infection.

Description (OCR text may contain errors) (el resultado del OCR puede contener errores) HUMAN EBOLA VIRUS SPECIES AND COMPOSITIONS AND METHODS THEREOF DEPOSIT STATEMENT [0001] The invention provides the isolated human Ebola (hEbola) viruses denoted as Bundibugyo (EboBun) deposited with the Centers for Disease Control and Prevention ("CDC"; Atlanta, Georgia, United States of America) on November 26, 2007 and accorded an accession number 200706291. This deposit was not made to an International Depository Authority (IDA) as established under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure, and is a non-Budapest treaty deposit. The deposited organism is not acceptable by American Type Culture Collection (ATCC), Manassas, Virginia, an International Depository Authority (IDA) as established under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. Samples of the stated Deposit Accession No. 200706291 will be made available to approved facilities for thirty years from the date of deposit, and for the lifetime of the patent issuing from, or claiming priority to this application.

RELATED APPLICATIONS [0002] This application claims priority benefit of U.S. Provisional Application 61/108,175 filed 24 October 2008; the contents of which are hereby incorporated by reference.

FIELD OF THE INVENTION [0003] The invention is related to compositions and methods directed to a novel species of human Ebola (hEbola) virus.

BACKGROUND OF THE INVENTION [0004] The family Filoviridae consists of two genera, Marburgvirus and Ebolavirus, which have likely evolved from a common ancestor'. The genus Ebolavirus includes four species: Zaire, Sudan, Reston and Cote d'Ivoire (Ivory Coast) ebolaviruses, which have, with the exception of Reston and Cote d'Ivoire ebolaviruses, been associated with large hemorrhagic fever (HF) outbreaks in Africa with high case fatality (53-90%)2.

[0005] Viruses of each species have genomes that are at least 30-40% divergent from one another, a level of diversity that presumably reflects differences in the ecologic niche they occupy and in their evolutionary history. Identification of the natural reservoir of ebolaviruses remains somewhat elusive, although recent PCR and antibody data suggest that three species of arboreal fruit bats may be carriers of Zaire ebolavirus3. No data has yet been published to suggest reservoirs for the Sudan, Reston and Cote d'Ivoire ebolavirus species. However, a cave-dwelling fruit bat has been recently implicated as a natural host for marburgvirus4' s, supporting the hypothesis that different bat species may be the reservoir hosts for the various filoviruses.

[0006] Filovirus outbreaks are sporadic, sometimes interspersed by years or even decades of no apparent disease activity. The last new species of ebolavirus was discovered 14 years ago (1994), in Cote d'Ivoire (Ivory Coast), and involved a single nonfatal case, a veterinarian who performed an autopsy on an infected chimpanzee found in the Tai Forest6. No further disease reports have been associated with Cote d'Ivoire ebolavirus, in contrast to Zaire and Sudan ebolaviruses which have each caused multiple large outbreaks over the same time period.

[0007] In late November 2007, HF cases were reported in the townships of Bundibugyo and Kikyo in Bundibugyo District, Western Uganda. The outbreak continued through January 2008, and resulted in approximately 149 cases and 37 deaths.

Laboratory investigation of the initial 29 suspect-case blood specimens by classic methods (antigen capture, IgM and IgG ELISA) and a recently developed random-primed pyrosequencing approach identified this to be an Ebola HF outbreak associated with a new discovered ebolavirus species. These specimens were negative when initially tested with highly sensitive real-time RT-PCR assays specific for all known Zaire and Sudan ebolaviruses and Marburg viruses. This new species is referred to herein as "the Bundibugyo species", abbreviated "EboBun".

[0008] Accordingly, compositions and methods directed to the new Ebola virus species are described herein and the most closely related Ebola Ivory Coast species, which compositions and methods are useful for diagnosis and prevention of human Ebola virus infection; including related vaccine development, and prevention of hemorrhagic fever in a human population.

SUMMARY OF THE INVENTION [0009] The present invention is based upon the isolation and identification of a new human Ebola virus species, EboBun. EboBun was isolated from the patients suffering from hemorrhagic fever in a recent outbreak in Uganda. The isolated virus is a member of the Filoviridae family, a family of negative sense RNA viruses. Accordingly, the invention relates to the isolated EboBun virus that morphologically and phylogenetically relates to known members filoviridae.

14.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 [0010] In one aspect, the invention provides the isolated EboBun virus deposited with the Centers for Disease Control and Prevention ("CDC"; Atlanta, Georgia, United States of America) on November 26, 2007 and accorded an accession number 200706291, as stated in the paragraph entitled "DEPOSIT STATEMENT" supra.

[0011] In another aspect, the invention provides an isolated hEbola EboBun virus comprising a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: a) a nucleotide sequence set forth in SEQ ID NO: 1; b) a nucleotide sequence that hybridizes to the sequence set forth in SEQ ID NO: 1 under stringent conditions; and c) a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the SEQ ID NO: 1. In another aspect, the invention provides the complete genomic sequence of the hEbola virus EboBun. [0012] In a related aspect, the invention provides nucleic acid molecules isolated from EboBun, or fragments thereof.

[0013] In another aspect, the invention provides proteins or polypeptides that are isolated from the EboBun, including viral proteins isolated from cells infected with the virus but not present in comparable uninfected cells; or fragments thereof. In one embodiment of the present invention, the amino acid sequences of the proteins or polypeptides are set forth in SEQ ID NOS: 2-9 and 59, or fragments thereof.

[0014] In a related aspect, the invention provides an isolated polypeptide encoded by the nucleic acid molecule of the inventive hEbola EboIC (Sequence ID No. 10) virus described above.

[0015] In another aspect, the invention provides an isolated hEbola EboIC virus comprising a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: a) a nucleotide sequence set forth in SEQ ID NO: 10; b) a nucleotide sequence that hybridizes to the sequence set forth in SEQ ID NO: 10 under stringent conditions; and c) a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the SEQ ID NO: 10. In another aspect, the invention provides the complete genomic sequence of the hEbola virus EboIC. [0016] In a related aspect, the invention provides nucleic acid molecules isolated from EboIC, or fragments thereof.

[0017] In another aspect, the invention provides proteins or polypeptides that are isolated from the EboIC, including viral proteins isolated from cells infected with the virus but not present in comparable uninfected cells; or fragments thereof. In one embodiment of the present invention, the amino acid sequences of the proteins or polypeptides are set forth in SEQ ID NOs: 11-19, or fragments thereof.

[0018] In a related aspect, the invention provides an isolated polypeptide encoded by the nucleic acid molecule of the inventive hEbola EboIC virus described above.

[0019] In other aspects, the invention relates to the use of the isolated hEbola virus for diagnostic and therapeutic methods based on EbBun, EboIC, or a combination thereof. In one embodiment, the invention provides a method of detecting in a biological sample an antibody immunospecific for the genus of West Afrin Ebola Species constituting hEbola EbBun and EboIC virus using at least one the inventive isolated hEbola virus described herein, or any of the inventive proteins or polypeptides as described herein. In another specific embodiment, the invention provides a method of screening for an antibody which immunospecifically binds and neutralizes hEbola EboBun. Such an antibody is useful for a passive immunization or immunotherapy of a subject infected with hEbola.

[0020] In another aspect, the invention provides an isolated antibody or an antigen-binding fragment thereof which immunospecifically binds to the hEbola virus of the invention described above.

[0021] In other aspects, the invention provides methods for detecting the presence, activity or expression of the Glade of Bundibungyo-Ivory Coast hEbola virus in a biological material, such as cells, blood, saliva, urine, feces and so forth; and specifically at least one of EbBun or EboIC. [0022] In a related aspect, the invention provides a method for detecting the presence of the inventive hEbola virus described above in a biological sample, the method includes (a) contacting the sample with an agent that selectively binds to a West African hEbola virus; and (b) detecting whether the compound binds to the West African hEbola virus in the sample.

[0023] In another aspect, the invention provides a method for detecting the presence of the inventive polypeptide described above, in a biological sample, said method includes (a) contacting the biological sample with an agent that selectively binds to the polypeptide; and (b) detecting whether the agent binds to the polypeptide in the sample. In another aspect, the invention provides a method for detecting the presence of a first nucleic acid molecule derived from the inventive hEbola virus described above in a biological sample, the method comprising: (a) contacting the biological sample with an agent that selectively binds to the polypeptide; and (b) detecting whether the agent binds to the polypeptide in the sample.

15.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 [0024] In another aspect, the invention provides a method for propagating the hEbola virus in host cells comprising infecting the host cells with the inventive isolated hEbola virus described above, culturing the host cells to allow the virus to multiply, and harvesting the resulting virions.

Also provided by the present invention are host cells infected with the inventive hEbola virus 5 described above.

[0025] In another aspect, the invention provides a method of detecting in a biological sample the presence of an antibody that immunospecifically binds hEbola virus, the method comprising: (a) contacting the biological sample with the inventive host cell host described above; and (b) detecting the antibody bound to the cell.

[0026] In another aspect, the invention provides vaccine preparations, comprising the inventive hEbola virus, including recombinant and chimeric forms of the virus, nucleic acid molecules comprised by the virus, or protein subunits of the virus.

The invention also provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier. In one embodiment, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the inventive hEbola virus described above, or a subunit thereof; and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of inventive the nucleotide sequences as described above, or a complement thereof, and a pharmaceutically acceptable carrier.

[0027] In a related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a protein extract of the inventive hEbola virus described above or a subunit thereof, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the inventive nucleotide sequence as described above or a complement thereof, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of any of the inventive polypeptides described above.

[0028] In another aspect, the present invention provides pharmaceutical compositions comprising antiviral agents of the present invention and a pharmaceutically acceptable carrier. In a specific embodiment, the antiviral agent of the invention is an antibody that immunospecifically binds hEbola virus or any hEbola epitope. In another specific embodiment, the antiviral agent is a polypeptide or protein of the present invention or nucleic acid molecule of the invention.

[0029] In a related aspect, the invention provides a pharmaceutical composition comprising a prophylactically or therapeutically effective amount of an anti-hEbola EboBun agent and a pharmaceutically acceptable carrier.

[0030] The invention also provides kits containing compositions and formulations of the present invention. Thus, in another aspect, the invention provides a kit comprising a container containing the inventive immunogenic formulation described above.

In another aspect, the invention provides a kit comprising a container containing the inventive vaccine formulation described above. In another, the invention provides a kit comprising a container containing the inventive pharmaceutical composition described above. In another, the invention provides a kit comprising a container containing the inventive vaccine formulation described above. In another, the invention provides a method for identifying a subject infected with the inventive hEbola virus described above, comprising: (a) obtaining total RNA from a biological sample obtained from the subject; (b) reverse transcribing the total RNA to obtain cDNA; and (c) amplifying the cDNA using a set of primers derived from a nucleotide sequence of the inventive hEbola virus described above.

[0031] The invention further relates to the use of the sequence information of the isolated virus for diagnostic and therapeutic methods.

[0032] In another aspect, the present invention provides methods for screening antiviral agents that inhibit the infectivity or replication of hEbola virus or variants thereof.

[0033] The invention further provides methods of preparing recombinant or chimeric forms of hEbola.

BRIEF DESCRIPTION OF THE DRAWINGS [0034] FIG. 1 represents a Phylogenetic tree comparing full-length genomes of Ebolavirus and Marburg virus by Bayesian analysis; [0035] FIG. 2 represents an alignment of genomes of novel hEbola EboBun (SEQ 16.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 ID NO: 1) referred to below as "Ebola Bundibugyo" or "EboBun", and hEbola Zaire (SEQ ID NO: 20); referred to below as "Ebola Zaire `76" or "EboZ" and hEbola Ivory Coast (SEQ ID NO: 10) also referred to below as "EboIC".

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS [0036] It is to be understood that the present invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0037] Due to the sequence divergence of EboBun relative to all previously recognized ebolaviruses, the present invention has utility in design of diagnostic assays to monitor Ebola HF disease in humans and animals, and develop effective antivirals and vaccines.

[0038] The EboBun virus of the present invention is genetically distinct, differing by more than 30% at the genome level from all other known ebolavirus species. The unique nature of this virus created challenges for traditional filovirus molecular based diagnostic assays and genome sequencing approaches. Instead, over 70% of the virus genome was sequenced using a recently developed random-primed pyrosequencing approach which allowed the rapid development of molecular detection assay which were deployed in the disease outbreak response. This random-primed pyrosequencing draft sequence allowed faster completion of the whole genome sequence using traditional primer walking approach and confirmation that the EboBun virus represented a new ebolavirus species.

Definitions [0039] The definitions herein provided are operative throughout the entire description of the invention set forth herein, including the Summary of the Invention.

[0040] The term "an antibody or an antibody fragment that immunospecifically binds a polypeptide of the invention" as used herein refers to an antibody or a fragment thereof that immunospecifically binds to the polypeptide encoded by the nucleotide sequence of SEQ ID NO: 1 (EboBun), or a fragment thereof, and does not non-specifically bind to other polypeptides. An antibody or a fragment thereof that immunospecifically binds to the polypeptide of the invention may cross-react with other antigens. Preferably, an antibody or a fragment thereof that immunospecifically binds to a polypeptide of the invention does not cross-react with other antigens.

An antibody or a fragment thereof that immunospecifically binds to the polypeptide of the invention can be identified by, for example, immunoassays or other techniques known to those skilled in the art, or otherwise as described herein.

[0041] An "isolated" or "purified" peptide or protein is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of a polypeptide/protein in which the polypeptide/protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, a polypeptide/protein that is substantially free of cellular material includes preparations of the polypeptide/protein having less than about 30%, 20%, 10%, 5%, 2.5%, or 1% (by dry weight) of contaminating protein. When the polypeptide/protein is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation.

When polypeptide/protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein.

Accordingly, such preparations of the polypeptide/protein have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than polypeptide/protein fragment of interest.

In a preferred embodiment of the present invention, polypeptides/proteins are isolated or purified.

[0042] An "isolated" nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule. Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In a preferred embodiment of the invention, nucleic acid molecules encoding polypeptides/proteins of the invention are isolated or purified. The term "isolated" nucleic acid molecule does not include a nucleic acid that is a member of a library that has not been purified away from other library clones containing other nucleic acid molecules.

[0043] The term "portion" or "fragment" as used herein includes the specified fragment lengths, and all integers in between, inclusive of the specified end points in a specified range, and inclusive of any length up to the full length of a protein, polypeptide, or nucleic acid.

[0044] The term "having a biological activity of the protein" or "having biological activities of the polypeptides of the invention" refers to the characteristics of the polypeptides or proteins having a common biological activity, similar or identical structural domain, and/or having sufficient amino acid identity to the polypeptide encoded by the nucleotide sequence of SEQ ID NO: 1 (EboBun).

17.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 Such common biological activities of the polypeptides of the invention include antigenicity and immunogenicity.

[0045] The term "under stringent condition" refers to hybridization and washing conditions under which nucleotide sequences having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to each other remain hybridized to each other. Such hybridization conditions are described in, for example but not limited to, Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6.; Basic Methods in Molecular Biology, Elsevier Science Publishing Co., Inc., NY (1986), pp. 75-78, and 84-87; and Molecular Cloning, Cold Spring Harbor Laboratory, NY (1982), pp.

387-389, and are well known to those skilled in the art. A preferred, non-limiting example of stringent hybridization conditions is hybridization in 6 x sodium chloride/sodium citrate (SSC), 0.5% SDS at about 68 C followed by one or more washes in 2 x SSC, 0.5% SDS at room temperature. Another preferred, non-limiting example of stringent hybridization conditions is hybridization in 6 x SSC at about 45 C, followed by one or more washes in 0.2 x SSC, 0.1% SDS at about 50-65 C. [0046] The term "variant" as used herein refers either to a naturally occurring genetic mutant of hEbola EboBun, or hEbola EboIC, or a recombinantly prepared variation of these hEbola species, each of which contain one or more mutations in its genome compared to the hEbola of SEQ ID NO: 1 or 10. The term "variant" may also refer either to a naturally occurring variation of a given peptide or a recombinantly prepared variation of a given peptide or protein in which one or more amino acid residues have been modified by amino acid substitution, addition, or deletion.

[0047] "Homology" refers to sequence similarity or, alternatively, sequence identity, between two or more polynucleotide sequences or two or more polypeptide sequences.

[0048] The terms "percent identity" and "% identity," as applied to polynucleotide sequences, refer to the percentage of identical nucleotide matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences, and therefore achieve a more meaningful comparison of the two sequences.

[0049] Percent identity between polynucleotide sequences may be determined using one or more computer algorithms or programs known in the art or described herein. For example, percent 5 identity can be determined using the default parameters of the CLUSTAL V algorithm as incorporated into the MEGALIGN version 3.12e sequence alignment program. This program is part of the LASERGENE software package, a suite of molecular biological analysis programs (DNASTAR, Madison, Wis.). CLUSTAL V is described in Higgins, D. G. and P. M. Sharp (1989; CABIOS 5:151-153) and in Higgins, D. G. et al. (1992; CABIOS 8:189-191). For pairwise 10 alignments of polynucleotide sequences, the default parameters are set as follows: Ktuple=2, gap penalty=5, window=4, and "diagonals saved"=4. The "weighted" residue weight table is selected as the default.

[0050] Alternatively, a suite of commonly used and freely available sequence comparison algorithms which can be used is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al.

(1990) J. Mol. Biol.

215:403-410), which is available from several sources, including the NCBI, Bethesda, Md., and on the NCBI World Wide Web site available on the Internet. The BLAST software suite includes various sequence analysis programs including "blastn," that is used to align a known polynucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called "BLAST 2 Sequences" that is used for direct pairwise comparison of two nucleotide sequences. "BLAST 2 Sequences" can be accessed and used interactively on the Internet via the NCBI World Wide Web site as well. The "BLAST 2 Sequences" tool can be used for both blastn and blastp (discussed below). BLAST programs are commonly used with gap and other parameters set to default settings. For example, to compare two nucleotide sequences, one may use blastn with the "BLAST 2 Sequences" tool Version 2Ă˜12 (Apr. 21, 2000) set at default parameters. Such default parameters may be, for example: Matrix:BLOSUM62; Reward for match: 1; Penalty for mismatch: -2; Open Gap: 5 and Extension Gap: 2 penalties; Gap x drop-off: 50; Expect: 10; Word Size: 11; Filter: on.

[0051] Percent identity may be measured over the length of an entire defined sequence, for example, as defined by a particular SEQ ID number, or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined sequence, for instance, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 contiguous nucleotides. Such lengths are exemplary only, and it is understood that any fragment length supported by the sequences shown herein, in the tables, figures, or sequence listing, may be used to describe a length over which percentage identity may be measured.

[0052] The phrases "percent identity" and "% identity", as applied to polypeptide sequences, refer to the percentage of identical residue matches between at least two polypeptide sequences aligned using a standardized algorithm. Methods of polypeptide sequence alignment are well known. Some alignment methods take into account conservative amino acid substitutions. Such conservative substitutions, explained in more detail above, generally preserve the charge and hydrophobicity at the site of 18.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 substitution, thus preserving the structure (and therefore function) of the polypeptide. The phrases "percent similarity" and "% similarity", as applied to polypeptide sequences, refer to the percentage of residue matches, including identical residue matches and conservative substitutions, between at least two polypeptide sequences aligned using a standardized algorithm. In contrast, conservative substitutions are not included in the calculation of percent identity between polypeptide sequences.

[0053] Percent identity between polypeptide sequences may be determined using the default parameters of the CLUSTAL V algorithm as incorporated into the MEGALIGN version 3.12e sequence alignment program (described and referenced above). For pairwise alignments of polypeptide sequences using CLUSTAL V, the default parameters are set as follows: Ktuple=l, gap penalty=3, window=5, and "diagonals saved"=5.

The PAM250 matrix is selected as the default residue weight table.

[0054] Alternatively the NCBI BLAST software suite may be used. For example, for a pairwise comparison of two polypeptide sequences, one may use the "BLAST 2 Sequences" tool Version 2Ă˜12 (Apr. 21, 2000) with blastp set at default parameters. Such default parameters may be, for example: Matrix: BLOSUM62; Open Gap: 11 and Extension Gap: 1 penalties; Gap x drop-off: 50; Expect: 10; Word Size: 3; Filter: on.

[0055] Percent identity may be measured over the length of an entire defined polypeptide sequence, for example, as defined by a particular SEQ ID number, or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined polypeptide sequence, for instance, a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 70 or at least 150 contiguous residues. Such lengths are exemplary only, and it is understood that any fragment length supported by the sequences shown herein, in the tables, figures or sequence listing, may be used to describe a length over which percentage identity may be measured.

[0056] The term "agent" encompasses any chemical, biochemical, or biological molecule; such as small molecules, proteins, polypeptides, antibodies, nucleic acid molecules including DNA or RNA, and the like.

Methods and compositions related to the inventive hEbola [0057] The present invention is based upon the isolation and identification of a new human Ebola virus species, EboBun and the sequencing of the only other known West African Ebola species EboIC. EboBun was isolated from the patients suffering from hemorrhagic fever in a recent outbreak in Uganda. The isolated virus is a member of the Filoviridae family, a family of negative sense RNA viruses. Accordingly, the invention relates to the isolated EboBun or EBOIC virus that morphologically and phylogenetically relates to known members filoviridae.

[0058] In another aspect, the invention provides an isolated hEbola virus including a nucleic acid molecule with a nucleotide sequence that is preferably: a) a nucleotide sequence set forth in SEQ ID NO: 1; b) a nucleotide sequence that hybridizes to the sequence set forth in SEQ ID NO: 1 under stringent conditions; or c) a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the SEQ ID NO: 1. In one embodiment of the present invention, the hEbola virus is killed. In another, the virus is attenuated. In another, the infectivity of the attenuated hEbola virus is reduced. In another, the infectivity is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, or 10,000-fold. In another, the replication ability of the attenuated hEbola virus is reduced. In another, the replication ability of the attenuated virus is educed by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold. In another, the protein synthesis ability of the attenuated virus is reduced. In another, the protein synthesis ability is reduced by at least 5fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold. In another, the assembling ability of the attenuated hEbola virus is reduced. In another, the assembling ability of the attenuated virus is reduced by at least 5-fold, 10fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold. In another, the cytopathic effect of the attenuated hEbola virus is reduced. In another, the cytopathic effect is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold.

[0059] In another aspect, the invention provides the complete genomic sequence of the hEbola virus EboBun or EboIC. In a specific embodiment, the virus includes a nucleotide sequence of SEQ ID NOs: 1 or 10, respectively.

[0060] In a related aspect, the invention provides nucleic acid molecules isolated from EboBun, EboIC, or fragments thereof. In one embodiment of the present invention, the isolated nucleic acid molecule includes the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof. In another, the nucleic acid molecule includes a nucleotide sequence having at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, or 4900 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 1, or a complement thereof; with the proviso that the nucleotide sequence is not comprised by the nucleotide sequence set forth in SEQ ID NO: 20 (Ebola Zaire nucleotide sequence); or at least 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, or 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof. In another embodiment, the isolated nucleic acid molecule includes a nucleotide sequence that encodes the EboBun amino acid sequence of SEQ ID NOs: 2-9 or 59, the EboIC amino acid sequence of SEQ ID NOs: 11-19, or a complement of the nucleotide sequence that encodes the EboBun amino acid sequences of SEQ ID NOs: 2-9 or 59 or the EboIC amino acid sequences of SEQ ID NOs: 11-19. In another, the isolated nucleic acid molecule hybridizes under stringent conditions to a nucleic acid molecule having the nucleotide sequence of SEQ ID NOs: 1 or 10 or a 19.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 complement thereof, wherein the nucleic acid molecule encodes an amino acid sequence which has a biological activity exhibited by a polypeptide encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10. In another, nucleic acid molecule is RNA. In another, nucleic acid molecule is DNA. [0061] In another aspect, the invention provides proteins or polypeptides that are isolated from the EboBun, including viral proteins isolated from cells infected with the virus but not present in comparable uninfected cells. In one embodiment of the present invention, the amino acid sequences of the proteins or polypeptides are set forth in SEQ ID NOs: 2-9, 59, or 11-19, or fragments thereof.

In one embodiment, polypeptides or proteins of the present invention have a biological activity of the protein (including antigenicity and/or immunogenicity) encoded by the sequence of SEQ ID NOs: 1 or 10. In another, the polypeptides or the proteins of the present invention have a biological activity of at least one protein having the amino acid sequence (including antigenicity and/or immunogenicity) set forth in SEQ ID NOS: 2-9, 59, or 11-19, or a fragment thereof.

[0062] In a related aspect, the invention provides an isolated polypeptide encoded by the nucleic acid molecule of the invention described above. In one embodiment of the present invention, the isolated polypeptide includes the amino acid sequence selected from the group consisting of: a) an amino acid sequence set forth in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, or 9; 11, 12, 13, 14, 15, 16, 17, 18 or 19; and b) an amino acid sequence that has 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology to the amino acid sequence according to a). In another, the isolated polypeptide comprises the amino acid sequence having at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 210, 220, 230, 240 or 250 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 5 or 18 (VP24); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 210, 220, 230, 240, 250, 260, 270, 280 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 6 or 17 (VP30); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, or 320 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 8 or 13 (VP40); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, or 340 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 7 or 12 (VP35); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 360, or 370 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 4 or 15 (SGP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 360, or 370 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 59 or 16 (SSGP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 610, 620, 630, 640, 650, 660, or 670 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 9 or 14 (GP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 650, 700, 710, 720, or 730 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 3 or 11 (NP); or 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2160, 2170, 2180, 2190, or 2200 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 2 or 19 (L).

[0063] In other aspects, the invention relates to the use of an isolated West African hEbola virus for diagnostic and therapeutic methods. In one embodiment, the invention provides a method of detecting in a biological sample an antibody immunospecific for the hEbola virus using the inventive isolated hEbola virus described herein, or any of the inventive proteins or polypeptides as described herein. In another specific embodiment, the invention provides a method of screening for an antibody which immunospecifically binds and neutralizes hEbola EboBun or EboIC or a combination thereof. Such an antibody is useful for a passive immunization or immunotherapy of a subject infected with hEbola.

[0064] In another aspect, the invention provides an isolated antibody or an antigen-binding fragment thereof which immunospecifically binds to a West African genus hEbola virus of the 5 invention described above, and illustratively including EboBun or EboIC. In one embodiment of the present invention, the isolated antibody or an antigen-binding fragment thereof neutralizes a West African genus hEbola virus. In another, the isolated antibody or an antigen-binding fragment thereof immunospecifically binds to the inventive polypeptide described above. The invention further provides antibodies that specifically bind a polypeptide of the invention encoded by the nucleotide 10 sequence of SEQ ID NOs: 1 (EboBun) or 10 (EboIC), a fragment thereof, or encoded by a nucleic acid comprising a nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NOs: 1 (EboBun) or 10 (EboIC) and/or any hEbola EboBun epitope, having one or more biological activities of a polypeptide of the invention. These polypeptides include those shown in SEQ ID NOs: 29, 59, and 11-19. Such antibodies include, but are not limited to, 15 polyclonal, monoclonal, bi-specific, multi-specific, human, humanized, chimeric antibodies, single chain antibodies, Fab fragments, F(ab')2 fragments, disulfide-linked Fvs, intrabodies and fragments containing either a VL or VH domain or even a complementary determining region (CDR) that specifically binds to a polypeptide of the invention.

[0065] In other aspects, the invention provides methods for detecting the presence, activity or expression of the hEbola virus of the invention in a biological material, such as cells, blood, saliva, urine, and so forth. The increased or decreased activity or expression of the hEbola virus in a sample relative to a control sample can be determined by contacting the biological material with an agent which can detect directly or indirectly the presence, activity or expression of the hEbola virus.

20.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 In one embodiment of the present invention, the detecting agents are the antibodies or nucleic acid molecules of the present invention. Antibodies of the invention can also be used to treat hemorrhagic fever.

[0066] In a related aspect, the invention provides a method for detecting the presence of the inventive hEbola virus described above in a biological sample, the method comprising: (a) contacting the sample with an agent that selectively binds to the hEbola virus; and (b) detecting whether the compound binds to the hEbola virus in the sample. In one embodiment of the present invention, the biological sample is selected from the group consisting of cells; blood; serum; plasma; feces; rectal, vaginal and conjunctival swabs In another, the agent that binds to the virus is an antibody. In another, the agent that binds to the virus is a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof. In another, the agent that binds to the virus is a nucleic acid molecule comprising a nucleotide sequence having at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, or 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof.

[0067] In another aspect, the invention provides a method for detecting the presence of the inventive polypeptide described above, in a biological sample, the method comprising: (a) contacting the biological sample with an agent that selectively binds to the polypeptide; and (b) detecting whether the agent binds to the polypeptide in the sample. In one embodiment of the present invention, the biological sample is selected from the group consisting of cells; blood; serum; plasma; feces; rectal, vaginal and conjunctival swabs. In another, the agent that binds to the polypeptide is an antibody or an antigen-binding fragment thereof.

[0068] In another aspect, the invention provides a method for detecting the presence of a first nucleic acid molecule derived from the inventive hEbola virus described above in a biological sample, the method includes (a) contacting the biological sample with an agent that selectively binds to the nucleic acid; and (b) detecting whether the agent binds to the nucleotide in the sample. In one embodiment of the present invention, the agent that binds to the first nucleic acid molecule is a second nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof. In another, the second nucleic acid molecule comprises at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, or 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof.

[0069] In another aspect, the invention provides a method for propagating the hEbola virus in host cells comprising infecting the host cells with an inventive isolated West African hEbola virus described above, culturing the host cells to allow the virus to multiply, and harvesting the resulting virions. Also provided by the present invention are host cells infected with the inventive hEbola virus described above. In one embodiment of the present invention, the host cell is a primate cell.

[0070] In another aspect, the invention provides a method of detecting in a biological sample the presence of an antibody that immunospecifically binds hEbola virus, the method includes: (a) contacting the biological sample with the inventive host cell described above; and (b) detecting the antibody bound to the cell.

[0071] In another aspect, the invention provides vaccine preparations, including the inventive hEbola virus, including recombinant and chimeric forms of the virus, nucleic acid molecules comprised by the virus, or protein subunits of the virus. In one embodiment, the vaccine preparations of the present invention includes live but attenuated hEbola virus with or without pharmaceutically acceptable carriers, including adjuvants. In another, the vaccine preparations of the invention comprise an inactivated or killed hEbola EboBun virus, EboIC virus, or a combination thereof, with or without pharmaceutically acceptable carriers, including adjuvants. Such attenuated or inactivated viruses may be prepared by a series of passages of the virus through the host cells or by preparing recombinant or chimeric forms of virus. Accordingly, the present invention further provides methods of preparing recombinant or chimeric forms of the inventive hEbola viruses described herein.

[0072] In another specific embodiment, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the inventive hEbola virus described above, or a subunit thereof; and a pharmaceutically acceptable carrier. In another aspect, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of inventive the nucleotide sequences as described above, or a complement thereof, and a pharmaceutically acceptable carrier. In another aspect, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the inventive hEbola virus described above, or a subunit thereof; and a pharmaceutically acceptable 21.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 carrier. In another aspect, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of inventive the nucleotide sequences as described above, or a complement thereof, and a pharmaceutically acceptable carrier.

[0073] In yet another specific embodiment, the vaccine preparations of the present invention comprise a nucleic acid or fragment of the hEbola virus, e.g., the virus having Accession No. 200706291, or nucleic acid molecules having the sequence of SEQ ID NOs: 1 or 10, or a fragment thereof. In another, the vaccine preparations comprise a polypeptide of the invention encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10 or a fragment thereof. In a specific embodiment, the vaccine preparations comprise polypeptides of the invention as shown in SEQ ID NOs: 2-9, 59, or 11-19, or encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10, or a fragment thereof.

[0074] Furthermore, the present invention provides methods for treating, ameliorating, managing or preventing hemorrhagic fever by administering the vaccine preparations or antibodies of the present invention alone or in combination with adjuvants, or other pharmaceutically acceptable excipients. Furthermore, the present invention provides methods for treating, ameliorating, managing, or preventing hemorrhagic fever by administering the inventive compositions and formulations including the vaccine preparations or antibodies of the present invention alone or in combination with antivirals [e.g., amantadine, rimantadine, gancyclovir, acyclovir, ribavirin, penciclovir, oseltamivir, foscamet zidovudine (AZT), didanosine (ddl), lamivudine (3TC), zalcitabine (ddC), stavudine (d4T), nevirapine, delavirdine, indinavir, ritonavir, vidarabine, nelfinavir, saquinavir, relenza, tamiflu, pleconaril, interferons, etc.], steroids and corticosteroids such as prednisone, cortisone, fluticasone and glucocorticoid, antibiotics, analgesics, bronchodilators, or other treatments for respiratory and/or viral infections.

[0075] In a related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier.

[0076] In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a protein extract of the inventive hEbola virus described above or a subunit thereof, and a pharmaceutically acceptable carrier.

[0077] In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1, 10, a combination thereof, or a complement thereof, and a pharmaceutically acceptable carrier.

[0078] In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the inventive nucleotide sequence as described above or a complement thereof, and a pharmaceutically acceptable carrier.

[0079] In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of any of the inventive polypeptides described above.

[0080] In another aspect, the present invention provides pharmaceutical compositions comprising antiviral agents of the present invention and a pharmaceutically acceptable carrier. In a specific embodiment, the antiviral agent of the invention is an antibody that immunospecifically binds hEbola virus or any hEbola epitope. In another specific embodiment, the antiviral agent is a polypeptide or protein of the present invention or nucleic acid molecule of the invention.

[0081] In a related aspect, the invention provides a pharmaceutical composition comprising a prophylactically or therapeutically effective amount of an anti-hEbola EboBun agent and a pharmaceutically acceptable carrier. In one embodiment of the present invention, the anti-hEbola EboBun agent is an antibody or an antigen-binding fragment thereof which immunospecifically binds to the hEbola virus of Deposit Accession No. 200706291, or polypeptides or protein derived therefrom. In another, the anti-hEbola agent is a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1, 10, a combination thereof, or a fragment thereof.

In another, the anti-hEbola agent is a polypeptide encoded by a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1, 10, a combination thereof, or a fragment thereof having a biological activity of the polypeptide.

[0082] The invention also provides kits containing compositions and formulations of the present invention. Thus, in another aspect, the invention provides a kit comprising a container containing the inventive immunogenic formulation described above.

[0083] In another aspect, the invention provides a kit includes a container containing the inventive vaccine formulation described above.

[0084] In another aspect, the invention provides a kit including a container containing the inventive pharmaceutical composition described above.

22.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 [0085] In another aspect, the invention provides a kit including a container containing the inventive vaccine formulation described above.

[0086] In another aspect, the invention provides a method for identifying a subject infected with the inventive hEbola virus described above, including: (a) obtaining total RNA from a biological sample obtained from the subject; (b) reverse transcribing the total RNA to obtain cDNA; and (c) amplifying the cDNA using a set of primers derived from a nucleotide sequence of the inventive 5 hEbola virus described above.

[0087] In one embodiment of the present invention, the set of primers are derived from the nucleotide sequence of the genome of the hEbola virus of Deposit Accession No. 200706291. In another, the set of primers are derived from the nucleotide sequence of SEQ ID NOs: 1 or 10 or any of the inventive nucleotide sequences as described above, or a complement thereof.

10 [0088] The invention further relates to the use of the sequence information of the isolated virus for diagnostic and therapeutic methods. In a specific embodiment, the invention provides nucleic acid molecules which are suitable for use as primers consisting of or including the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof, or at least a portion of the nucleotide sequence thereof. In another specific embodiment, the invention provides nucleic acid molecules 15 which are suitable for hybridization to the inventive hEbola nucleic acid; including, but not limited to PCR primers, Reverse Transcriptase primers, probes for Southern analysis or other nucleic acid hybridization analysis for the detection of hEbola nucleic acids, e.g., consisting of or including the nucleotide sequence of SEQ ID NOs: 1, 10 a combination thereof, a complement thereof, or a portion thereof. The invention further encompasses chimeric or recombinant viruses encoded in 20 whole or in part by the nucleotide sequences.

[0089] In another aspect, the present invention provides methods for screening antiviral agents that inhibit the infectivity or replication of hEbola virus or variants thereof.

[0090] The invention further provides methods of preparing recombinant or chimeric forms of hEbola.

[0091] In another aspect, the invention provides vaccine preparations including the hEbola virus, including recombinant and chimeric forms of the virus, or subunits of the virus. The present invention encompasses recombinant or chimeric viruses encoded by viral vectors derived from the genome of the inventive hEbola virus described herein or natural variants thereof. In a specific embodiment, a recombinant virus is one derived from the hEbola virus of Deposit Accession No. 200706291. It is recognized that natural variants of the inventive hEbola viruses described herein comprise one or more mutations, including, but not limited to, point mutations, rearrangements, insertions, deletions etc., to the genomic sequence. It is recognized that the mutations may or may not result in a phenotypic change.

[0092] In another specific embodiment, a chimeric virus of the invention is a recombinant hEbola EboBun or EboIC virus which further comprises a heterologous nucleotide sequence. In accordance with the invention, a chimeric virus may be encoded by a nucleotide sequence in which heterologous nucleotide sequences have been added to the genome or in which endogenous or native nucleotide sequences have been replaced with heterologous nucleotide sequences.

[0093] According to the present invention, the chimeric viruses are encoded by the viral vectors of the invention which further comprise a heterologous nucleotide sequence. In accordance with the present invention a chimeric virus is encoded by a viral vector that may or may not include nucleic acids that are non-native to the viral genome. In accordance with the invention a chimeric virus is encoded by a viral vector to which heterologous nucleotide sequences have been added, inserted or substituted for native or non-native sequences. In accordance with the present invention, the chimeric virus may be encoded by nucleotide sequences derived from different species or variants of hEbola virus. In particular, the chimeric virus is encoded by nucleotide sequences that encode antigenic polypeptides derived from different species or variants of hEbola virus.

[0094] A chimeric virus may be of particular use for the generation of recombinant vaccines protecting against two or more viruses (Tao et al., J. Virol. 72, 2955-2961; Durbin et al., 2000, J. Virol. 74, 6821-6831; Skiadopoulos et al., 1998, J. Virol. 72, 1762-1768 (1998); Teng et al., 2000, J. Virol. 74, 9317-9321). For example, it can be envisaged that a virus vector derived from the hEbola virus expressing one or more proteins of variants of hEbola virus including hEbola EboBun, or vice versa, will protect a subject vaccinated with such vector against infections by both the native hEbola and the variant. Attenuated and replication-defective viruses may be of use for vaccination purposes with live vaccines as has been suggested for other viruses. (See, for example, PCT WO 02/057302, at pp. 6 and 23; and United States Patent Application Publication 2008/0069838 incorporated by reference herein).

[0095] In accordance with the present invention the heterologous sequence to be incorporated into the viral vectors encoding the recombinant or chimeric viruses of the invention include sequences obtained or derived from different species or variants of hEbola.

[0096] In certain embodiments, the chimeric or recombinant viruses of the invention are encoded by viral vectors derived from viral genomes wherein one or more sequences, intergenic regions, termini sequences, or portions or entire ORF have been substituted with a heterologous or non-native sequence. In certain embodiments of the invention, the chimeric viruses of the invention are encoded by viral vectors derived from viral genomes wherein one or more heterologous sequences have been inserted or added to the vector.

[0097] The selection of the viral vector may depend on the species of the subject that is to be treated or protected from a viral infection. If the subject is human, then an attenuated hEbola virus can be used to provide the antigenic sequences.

[0098] In accordance with the present invention, the viral vectors can be engineered to provide antigenic sequences which confer protection against infection by the inventive hEbola and natural variants thereof. The viral vectors may be engineered to provide one, two, three or more antigenic sequences. In accordance with the present invention the antigenic sequences may be derived from the same virus, from different species or variants of the same type of virus, or from different viruses.

23.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 [0099] The expression products and/or recombinant or chimeric virions obtained in accordance with the invention may advantageously be utilized in vaccine formulations. The expression products and chimeric virions of the present invention may be engineered to create vaccines against a broad range of pathogens, including viral and bacterial antigens, tumor antigens, allergen antigens, and auto antigens involved in autoimmune disorders. One way to achieve this goal involves modifying existing hEbola genes to contain foreign sequences in their respective external domains. Where the heterologous sequences are epitopes or antigens of pathogens, these chimeric viruses may be used to induce a protective immune response against the disease agent from which these determinants are derived. In particular, the chimeric virions of the present invention may be engineered to create vaccines for the protection of a subject from infections with hEbola virus and variants thereof.

[00100] Thus, the present invention further relates to the use of viral vectors and recombinant or chimeric viruses to formulate vaccines against a broad range of viruses and/or antigens. The present invention also encompasses recombinant viruses including a viral vector derived from the hEbola or variants thereof which contains sequences which result in a virus having a phenotype more suitable for use in vaccine formulations, e.g., attenuated phenotype or enhanced antigenicity. The mutations and modifications can be in coding regions, in intergenic regions and in the leader and trailer sequences of the virus.

[00101] The invention provides a host cell including a nucleic acid or a vector according to the invention. Plasmid or viral vectors containing the polymerase components of hEbola virus are generated in prokaryotic cells for the expression of the components in relevant cell types (bacteria, insect cells, eukaryotic cells). Plasmid or viral vectors containing full-length or partial copies of the hEbola genome will be generated in prokaryotic cells for the expression of viral nucleic acids in vitro or in vivo. The latter vectors optionally contain other viral sequences for the generation of chimeric viruses or chimeric virus proteins, optionally lack parts of the viral genome for the generation of replication defective virus, and optionally contain mutations, deletions or insertions for the generation of attenuated viruses. In addition, the present invention provides a host cell infected with hEbola virus of Deposit Accession No. 200706291, [00102] Infectious copies of West African hEbola (being wild type, attenuated, replication-defective or chimeric) are optionally produced upon co-expression of the polymerase components according to the state-of-the-art technologies described above.

[0100] In addition, eukaryotic cells, transiently or stably expressing one or more full-length or partial hEbola proteins are optionally used. Such cells are preferably made by transfection (proteins or nucleic acid vectors), infection (viral vectors) or transduction (viral vectors) and are useful for complementation of mentioned wild type, attenuated, replication-defective or chimeric viruses.

[0101] The viral vectors and chimeric viruses of the present invention optionally modulate a subject's immune system by stimulating a humoral immune response, a cellular immune response or by stimulating tolerance to an antigen. As used herein, a subject means: humans, primates, horses, cows, sheep, pigs, goats, dogs, cats, avian species and rodents.

Formulation of Vaccines and Antivirals [0102] In a preferred embodiment, the invention provides a proteinaceous molecule or hEbola virus specific viral protein or functional fragment thereof encoded by a nucleic acid according to the invention. Useful proteinaceous molecules are for example derived from any of the genes or genomic fragments derivable from the virus according to the invention, preferably the GP, L, NP, sGP, VP24, VP30, VP35, and VP 40 proteins described herein. Such molecules, or antigenic fragments thereof, as provided herein, are for example useful in diagnostic methods or kits and in pharmaceutical compositions such as subunit vaccines. Particularly useful are polypeptides encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10; or antigenic fragments thereof for inclusion as antigen or subunit immunogen, but inactivated whole virus can also be used.

Particularly useful are also those proteinaceous substances that are encoded by recombinant nucleic acid fragments of the hEbola genome, of course preferred are those that are within the preferred bounds and metes of ORFs, in particular, for eliciting hEbola specific antibody or T cell responses, whether in vivo (e.g. for protective or therapeutic purposes or for providing diagnostic antibodies) or in vitro (e.g. by phage display technology or another technique useful for generating synthetic antibodies).

[0103] It is recognized that numerous variants, analogues, or homologues of EboBun polypeptides are within the scope of the present invention including amino acid substitutions, alterations, modifications, or other amino acid changes that increase, decrease, or do not alter the function or immunogenic propensity of the inventive immunogen or vaccine.

Several post-translational modifications are similarly envisioned as within the scope of the present invention illustratively including incorporation of a non-naturally occurring amino acid(s), phosphorylation, glycosylation, sulfation, and addition of pendent groups such as biotynlation, fluorophores, lumiphores, radioactive groups, antigens, or other molecules.

[0104] Methods of expressing and purifying natural or recombinant peptides and proteins are well known in the art.

Illustratively, peptides and proteins are recombinantly expressed in eukaryotic cells. Exemplary eukaryotic cells include yeast, HeLa cells, 293 cells, COS cells, Chinese hamster ovary cells (CHO), and many other cell types known in the art.

Both eukaryotic and prokaryotic expression systems and cells are available illustratively from Invitrogen Corp., Carlsbad, CA. It is appreciated that cell-free expression systems are similarly operable.

[0105] In a preferred embodiment an immunogenic polypeptide is a full length EboBun protein.

Preferably, an immunogen is a full length EboBun protein of SEQ ID NOs: 2-9 or 59, or EboIC SEQ ID NOs: 11-19, or a fragment thereof as described herein. Preferably, an immunogen is has a minimum of 5 amino acids. As used herein an immunogen is preferably a polypeptide. In the context of an immunogenic polypeptide the terms immunogen, polypeptide, and antigen are used interchangeably.

[0106] Modifications and changes can be made in the structure of the inventive immunogens that are the subject of the application and still obtain a molecule having similar or improved characteristics as the wild-type sequence (e.g., a conservative amino acid substitution). For example, certain amino acids are optionally substituted for other amino acids in a sequence 24.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 without appreciable loss of immunogenic activity. Because it is the interactive capacity and nature of a polypeptide that defines that polypeptide's biological functional activity, certain amino acid sequence substitutions can be made in a polypeptide sequence and nevertheless obtain a polypeptide with like or improved properties. Optionally, a polypeptide is used that has less or more immunogenic activity compared to the wild-type sequence.

[0107] In making such changes, the hydropathic index of amino acids is preferably considered.

The importance of the hydropathic amino acid index in conferring interactive biologic function on a polypeptide is generally understood in the art. It is known that certain amino acids can be substituted for other amino acids having a similar hydropathic index or score and still result in a 5 polypeptide with similar biological activity. Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics. Those indices are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); 10 lysine (-3.9); and arginine (-4.5).

[0108] It is believed that the relative hydropathic character of the amino acid determines the secondary structure of the resultant polypeptide, which in turn defines the interaction of the polypeptide with other molecules, such as enzymes, substrates, receptors, antibodies, antigens, and the like. It is known in the art that an amino acid can be substituted by another amino acid having a 15 similar hydropathic index and still obtain a functionally equivalent immunogen. In such changes, the substitution of amino acids whose hydropathic indices are within 2 is preferred, those within 1 are particularly preferred, and those within 0.5 are even more particularly preferred.

[0109] As outlined above, amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, 20 size, and the like. Exemplary substitutions that take various of the foregoing characteristics into consideration are well known to those of skill in the art and include (original residue: exemplary substitution): (Ala: Gly, Ser), (Arg: Lys), (Asn: Gln, His), (Asp: Glu, Cys, Ser), (Gln: Asn), (Glu: Asp), (Gly: Ala), (His: Asn, Gln), (Ile: Leu, Val), (Leu: Ile, Val), (Lys: Arg), (Met: Leu, Tyr), (Ser: Thr), (Thr: Ser), (Tip: Tyr), (Tyr: Trp, Phe), and (Val: Ile, Leu).

Embodiments of this disclosure 25 thus contemplate functional or biological equivalents of a polypeptide and immunogen as set forth above. In particular, embodiments of the polypeptides and immunogens optionally include variants having about 50%, 60%, 70%, 80%, 90%, and 95% sequence identity to the polypeptide of interest.

[0110] The invention provides vaccine formulations for the prevention and treatment of infections with hEbola virus. In certain embodiments, the vaccine of the invention comprises recombinant and chimeric viruses of the hEbola virus. In certain embodiments, the virus is attenuated.

[0111] In another embodiment of this aspect of the invention, inactivated vaccine formulations are prepared using conventional techniques to "kill" the chimeric viruses.

Inactivated vaccines are "dead" in the sense that their infectivity has been destroyed. Ideally, the infectivity of the virus is destroyed without affecting its immunogenicity. In order to prepare inactivated vaccines, the chimeric virus may be grown in cell culture or in the allantois of the chick embryo, purified by zonal ultracentrifugation, inactivated by formaldehyde or (3propiolactone, and pooled. The resulting vaccine is usually inoculated intramuscularly or intranasally.

[0112] Inactivated viruses are optionally formulated with a suitable adjuvant in order to enhance the immunological response.

Such adjuvants illustratively include but are not limited to mineral gels, e.g., aluminum hydroxide; surface active substances such as lysolecithin, pluronic polyols, polyanions; peptides; oil emulsions; and potentially useful human adjuvants such as BCG and Corynebacterium parvum.

[0113] In another aspect, the present invention also provides DNA vaccine formulations including a nucleic acid or fragment of the inventive hEbola virus, e.g., the virus having Accession No. 200706291, or nucleic acid molecules having the sequence of SEQ ID NOs: 1 or 10, or a fragment thereof. In another specific embodiment, the DNA vaccine formulations of the present invention comprise a nucleic acid or fragment thereof encoding the antibodies which immunospecifically bind hEbola viruses.

In DNA vaccine formulations, a vaccine DNA comprises a viral vector, such as that derived from the hEbola virus, bacterial plasmid, or other expression vector, bearing an insert including a nucleic acid molecule of the present invention operably linked to one or more control elements, thereby allowing expression of the vaccinating proteins encoded by the nucleic acid molecule in a vaccinated subject. Such vectors can be prepared by recombinant DNA technology as recombinant or chimeric viral vectors carrying a nucleic acid molecule of the present invention.

[0114] A nucleic acid as used herein refers to single- or double-stranded molecules which are optionally DNA, including the nucleotide bases A, T, C and G, or RNA, including the bases A, U (substitutes for T), C, and G. The nucleic acid may represent a coding strand or its complement.

Nucleic acids are optionally identical in sequence to the sequence which is naturally occurring or include alternative codons which encode the same amino acid as that which is found in the naturally occurring sequence. Furthermore, nucleic acids optionally include codons which represent conservative substitutions of amino acids as are well known in the art.

[0115] As used herein, the term "isolated nucleic acid" means a nucleic acid separated or substantially free from at least some of the other components of the naturally occurring organism, for example, the cell structural components commonly found associated with nucleic acids in a cellular environment and/or other nucleic acids. The isolation of nucleic acids is illustratively 25.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 accomplished by techniques such as cell lysis followed by phenol plus chloroform extraction, followed by ethanol precipitation of the nucleic acids. The nucleic acids of this invention are illustratively isolated from cells according to methods well known in the art for isolating nucleic acids. Alternatively, the nucleic acids of the present invention are optionally synthesized according to standard protocols well described in the literature for synthesizing nucleic acids. Modifications to the nucleic acids of the invention are also contemplated, provided that the essential structure and function of the peptide or polypeptide encoded by the nucleic acid are maintained.

[0116] The nucleic acid encoding the peptide or polypeptide of this invention is optionally part of a recombinant nucleic acid construct comprising any combination of restriction sites and/or functional elements as are well known in the art which facilitate molecular cloning and other recombinant DNA manipulations. Thus, the present invention further provides a recombinant nucleic acid construct including a nucleic acid encoding a polypeptide of this invention.

[0117] Generally, it may be more convenient to employ as the recombinant polynucleotide a cDNA version of the polynucleotide. It is believed that the use of a cDNA version will provide advantages in that the size of the gene will generally be much smaller and more readily employed to transfect the targeted cell than will a genomic gene, which will typically be up to an order of magnitude larger than the cDNA gene. However, the inventor does not exclude the possibility of employing a genomic version of a particular gene where desired.

[0118] As used herein, the terms "engineered" and "recombinant" cells are synonymous with "host" cells and are intended to refer to a cell into which an exogenous DNA segment or gene, such as a cDNA or gene has been introduced. Therefore, engineered cells are distinguishable from naturally occurring cells which do not contain a recombinantly introduced exogenous DNA segment or gene. A host cell is optionally a naturally occurring cell that is transformed with an exogenous DNA segment or gene or a cell that is not modified. A host cell preferably does not possess a naturally occurring gene encoding RSV G protein. Engineered cells are, thus, cells having a gene or genes introduced through the hand of man. Recombinant cells illustratively include those having an introduced cDNA or genomic DNA, and also include genes positioned adjacent to a promoter not naturally associated with the particular introduced gene.

[0119] To express a recombinant encoded polypeptide in accordance with the present invention one optionally prepares an expression vector that comprises a polynucleotide under the control of one or more promoters. To bring a coding sequence "under the control of' a promoter, one positions the 5' end of the translational initiation site of the reading frame generally between about 1 and 50 nucleotides "downstream" of (i.e., 3' of) the chosen promoter. The "upstream" promoter stimulates transcription of the inserted DNA and promotes expression of the encoded recombinant protein.

This is the meaning of "recombinant expression" in the context used here.

[0120] Many standard techniques are available to construct expression vectors containing the appropriate nucleic acids and transcriptional/translational control sequences in order to achieve protein or peptide expression in a variety of host-expression systems. Cell types available for expression include, but are not limited to, bacteria, such as E. coli and B. subtilis transformed with recombinant phage DNA, plasmid DNA or cosmid DNA expression vectors.

[0121] Certain examples of prokaryotic hosts illustratively include E. coli strain RR1, E. coli LE392, E. coli B, E. coli 1776 (ATCC No. 31537) as well as E. coli W3110 (F-, lambda-, prototrophic, ATCC No. 273325); bacilli such as Bacillus subtilis; and other enterobacteria such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas species.

[0122] In general, plasmid vectors containing replicon and control sequences that are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication site, as well as marking sequences that are capable of providing phenotypic selection in transformed cells. For example, E. coli is often transformed using pBR322, a plasmid derived from an E. coli species. Plasmid pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The pBR322 plasmid, or other microbial plasmid or phage may also contain, or be modified to contain, promoters that can be used by the microbial organism for expression of its own proteins.

[0123] In addition, phage vectors containing replicon and control sequences that are compatible with the host microorganism are optionally used as transforming vectors in connection with these hosts. For example, the phage lambda is optionally utilized in making a recombinant phage vector that can be used to transform host cells, such as E. coli LE392.

[0124] Further useful vectors include pIN vectors and pGEX vectors, for use in generating glutathione S-transferase (GST) soluble fusion proteins for later purification and separation or cleavage. Other suitable fusion proteins are those with (3galactosidase, ubiquitin, or the like.

[0125] Promoters that are most commonly used in recombinant DNA construction include the (3-lactamase (penicillinase), lactose and tryptophan (trp) promoter systems.

While these are the most commonly used, other microbial promoters have been discovered and utilized, and details concerning their nucleotide sequences have been published, enabling those of skill in the art to ligate them functionally with plasmid vectors.

[0126] For expression in Saccharomyces, the plasmid YRp7, for example, is commonly used.

This plasmid contains the trpl gene, which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1. The presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.

[0127] Suitable promoting sequences in yeast vectors illustratively include the promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. In constructing suitable expression plasmids, the termination sequences associated 26.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 with these genes are also preferably ligated into the expression vector 3' of the sequence desired to be expressed to provide polyadenylation of the mRNA and termination.

[0128] Other suitable promoters, which have the additional advantage of transcription controlled by growth conditions, illustratively include the promoter region for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization.

[0129] In addition to microorganisms, cultures of cells derived from multicellular organisms are also operable as hosts. In principle, any such cell culture is operable, whether from vertebrate or invertebrate culture. In addition to mammalian cells, these include insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus); and plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing one or more coding sequences.

[0130] In a useful insect system, Autographica californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The isolated nucleic acid coding sequences are cloned into nonessential regions (for example the polyhedron gene) of the virus and placed under control of an AcNPV promoter (for example, the polyhedron promoter). Successful insertion of the coding sequences results in the inactivation of the polyhedron gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedron gene).

These recombinant viruses are then used to 5 infect Spodoptera frugiperda cells in which the inserted gene is expressed (e.g., U.S. Patent No. 4,215,051).

[0131] Examples of useful mammalian host cell lines include VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, W138, BHK, COS-7, 293, HepG2, NIH3T3, RIN and MDCK cell lines. In addition, a host cell is preferably chosen that modulates the expression of the inserted 10 sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the encoded protein.

[0132] Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cell lines or host systems are 15 preferably chosen to ensure the correct modification and processing of the foreign protein expressed.

Expression vectors for use in mammalian cells ordinarily include an origin of replication (as necessary), a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation site, and transcriptional terminator sequences. The origin of replication is preferably provided either by construction of the vector to 20 include an exogenous origin, such as may be derived from SV40 or other viral (e.g., Polyoma, Adeno, VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.

[0133] The promoters are optionally derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the 25 vaccinia virus 7.5K promoter). Further, it is also possible, and may be desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell systems.

[0134] A number of viral based expression systems are operable herein, for example, commonly used promoters are derived from polyoma, Adenovirus 2, Adenovirus 5, cytomegalovirus and 30 Simian Virus 40 (SV40). The early and late promoters of SV40 virus are useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication.

Smaller or larger SV40 fragments are also operable, particularly when there is included the approximately 250 bp sequence extending from the HindIll site toward the Bgll site located in the viral origin of replication.

[0135] In cases where an adenovirus is used as an expression vector, the coding sequences are preferably ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene is then optionally inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing proteins in infected hosts.

[0136] Specific initiation signals may also be required for efficient translation of the claimed isolated nucleic acid coding sequences. These signals include the ATG initiation codon and adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may additionally need to be provided. One of ordinary skill in the art would readily be capable of determining this need and providing the necessary signals. It is well known that the initiation codon must be in-frame (or in-phase) with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons are optionally of a variety of origins, both natural and synthetic. The efficiency of expression is optionally enhanced by the inclusion of appropriate transcription enhancer elements or transcription terminators.

[0137] In eukaryotic expression, one will also typically desire to incorporate into the transcriptional unit an appropriate polyadenylation site if one was not contained within the original cloned segment. Typically, the poly A addition site is placed about 30 to 2000 nucleotides "downstream" of the termination site of the protein at a position prior to transcription termination.

[0138] For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines that stably express constructs encoding proteins are engineered.

Rather than using expression vectors that contain viral origins of replication, host cells are preferably transformed with vectors controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.

27.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 Following the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched medium, and then are switched to a selective medium. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci, which in turn can be cloned and expanded into cell lines.

[0139] A number of selection systems are illustratively used, including, but not limited, to the herpes simplex virus thymidine kinase, hypoxanthine-guanine phosphoribosyltransferase and adenine phosphoribosyltransferase genes, in tk-, hgprt- or aprtcells, respectively. Also, antimetabolite resistance is optionally used as the basis of selection for dhfr, which confers resistance to methotrexate; gpt, which confers resistance to mycophenolic acid; neo, which confers resistance to the aminoglycoside G418; and hygro, which confers resistance to hygromycin. It is appreciated that numerous other selection systems are known in the art that are similarly operable in the present invention.

[0140] The nucleic acids encoding the peptides and polypeptides of this invention are optionally administered as nucleic acid vaccines. For the purposes of vaccine delivery, a nucleic acid encoding a peptide or polypeptide of this invention is preferably in an expression vector that includes viral nucleic acid including, but not limited to, vaccinia virus, adenovirus, retrovirus and/or adeno-associated virus nucleic acid. The nucleic acid or vector of this invention is optoinally in a liposome or a delivery vehicle which can be taken up by a cell via receptor-mediated or other type of endocytosis. The nucleic acid vaccines of this invention are preferably in a pharmaceutically acceptable carrier or administered with an adjuvant. The nucleic acids encoding the peptides and polypeptides of this invention can also be administered to cells in vivo or ex vivo.

[0141] It is contemplated that the isolated nucleic acids of the disclosure are optionally "overexpressed", i.e., expressed in increased levels relative to its natural expression in cells of its indigenous organism, or even relative to the expression of other proteins in the recombinant host cell. Such overexpression is assessed by a variety of methods illustratively including radiolabeling and/or protein purification. However, simple and direct methods are preferred, for example, those involving SDS/PAGE and protein staining or immunoblotting, followed by quantitative analyses, such as densitometric scanning of the resultant gel or blot. A specific increase in the level of the recombinant protein or peptide in comparison to the level in natural in transfected cells is indicative of overexpression, as is a relative abundance of the specific protein in relation to the other proteins produced by the host cell and, e.g., visible on a gel.

[0142] Various heterologous vectors are described for DNA vaccinations against viral infections. For example, the vectors described in the following references, incorporated herein by reference, may be used to express hEbola sequences instead of the sequences of the viruses or other pathogens described; in particular, vectors described for hepatitis B virus (Michel, M. L. et al., 1995, DAN-mediated immunization to the hepatitis B surface antigen in mice: Aspects of the humoral response mimic hepatitis B viral infection in humans, Proc. Natl. Aca. Sci. USA 92:5307-5311; Davis, H. L. et al., 1993, DNA-based immunization induces continuous secretion of hepatitis B surface antigen and high levels of circulating antibody, Human Molec. Genetics 2:1847-1851), HIV virus (Wang, B. et al., 1993, Gene inoculation generates immune responses against human immunodeficiency virus type 1, Proc. Natl. Acad. Sci. USA 90:4156-4160; Lu, S. et al., 1996, Simian immunodeficiency virus DNA vaccine trial in Macques, J. Virol. 70:3978-3991; Letvin, N. L. et al., 1997, Potent, protective anti-HIV immune responses generated by bimodal HIV envelope DNA plus protein vaccination, Proc Natl Acad Sci USA. 94(17):9378-83), and influenza viruses (Robinson, H L et al., 1993, Protection against a lethal influenza virus challenge by immunization with a haemagglutinin-expressing plasmid DNA, Vaccine 11:957-960; Ulmer, J. B. et al., Heterologous protection against influenza by injection of DNA encoding a viral protein, Science 259:1745-1749), as well as bacterial infections, such as tuberculosis (Tascon, R. E. et al., 1996, Vaccination against tuberculosis by DNA injection, Nature Med. 2:888-892; Huygen, K. et al., 1996, Immunogenicity and protective efficacy of a tuberculosis DNA vaccine, Nature Med., 2:893-898), and parasitic infection, such as malaria (Sedegah, M., 1994, Protection against malaria by immunization with plasmid DNA encoding circumsporozoite protein, Proc. Natl.

Acad. Sci. USA 91:9866-9870; Doolan, D. L. et al., 1996, Circumventing genetic restriction of protection against malaria with multigene DNA immunization: CD8+T cell-interferon .delta., and nitric oxide-dependent immunity, J. Exper. Med., 1183:1739-1746).

[0143] Many methods are optionally used to introduce the vaccine formulations described above. These include, but are not limited to, oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, and intranasal routes. Alternatively, in a preferred embodiment the chimeric virus vaccine formulation is introduced via the natural route of infection of the pathogen for which the vaccine is designed. The DNA vaccines of the present invention are optionally administered in saline solutions by injections into muscle or skin using a syringe and needle (Wolff J. A. et al., 1990, Direct gene transfer into mouse muscle in vivo, Science 247:1465-1468; Raz, E., 1994, Intradermal gene immunization: The possible role of DNA uptake in the induction of cellular immunity to viruses, c. Natl. Acd. Sci. USA 91:9519-9523). Another way to administer DNA vaccines operable herein is called the "gene gun" method, whereby microscopic gold beads coated with the DNA molecules of interest is fired into cells (Tang, D. et al., 1992, Genetic immunization is a simple method for eliciting an immune response, Nature 356:152-154). For general reviews of the methods for DNA vaccines, see Robinson, H. L., 1999, DNA vaccines: basic mechanism and immune responses (Review), Int. J. Mol. Med. 4(5):549-555; Barber, B., 1997, Introduction: Emerging vaccine strategies, Seminars in Immunology 9(5):269-270; and Robinson, H. L. et al., 1997, DNA vaccines, Seminars in Immunology 9(5):271-283.

Attenuation of hEbola Virus or Variants Thereof [0144] The hEbola virus or variants thereof of the invention are optionally 28.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 genetically engineered to exhibit an attenuated phenotype. In particular, the viruses of the invention exhibit an attenuated phenotype in a subject to which the virus is administered as a vaccine. Attenuation can be achieved by any method known to a skilled artisan. Without being bound by theory, the attenuated phenotype of the viruses of the invention is caused, e.g., by using a virus that naturally does not replicate well in an intended host species, for example, by reduced replication of the viral genome, by reduced ability of the virus to infect a host cell, or by reduced ability of the viral proteins to assemble to an infectious viral particle relative to the wild type species of the virus.

[0145] The attenuated phenotypes of hEbola virus or variants thereof are optionally tested by any method known to the artisan.

A candidate virus, for example, is optionally tested for its ability to infect a host or for the rate of replication in a cell culture system. In certain embodiments, growth curves at different temperatures are used to test the attenuated phenotype of the virus.

For example, an attenuated virus is able to grow at 35 C, but not at 39 C or 40 C. In certain embodiments, different cell lines are used to evaluate the attenuated phenotype of the virus. For example, an attenuated virus may only be able to grow in monkey cell lines but not the human cell lines, or the achievable virus titers in different cell lines are different for the attenuated virus. In certain embodiments, viral replication in the respiratory tract of a small animal model, including but not limited to, hamsters, cotton rats, mice and guinea pigs, is used to evaluate the attenuated phenotypes of the virus. In other embodiments, the immune response induced by the virus, including but not limited to, the antibody titers (e.g., assayed by plaque reduction neutralization assay or ELISA) is used to evaluate the attenuated phenotypes of the virus. In a specific embodiment, the plaque reduction neutralization assay or ELISA is carried out at a low dose. In certain embodiments, the ability of the hEbola virus to elicit pathological symptoms in an animal model is tested. A reduced ability of the virus to elicit pathological symptoms in an animal model system is indicative of its attenuated phenotype. In a specific embodiment, the candidate viruses are tested in a monkey model for nasal infection, indicated by mucus production.

[0146] The viruses of the invention are optionally attenuated such that one or more of the functional characteristics of the virus are impaired. In certain embodiments, attenuation is measured in comparison to the wild type species of the virus from which the attenuated virus is derived. In other embodiments, attenuation is determined by comparing the growth of an attenuated virus in 5 different host systems. Thus, for a non-limiting example, hEbola virus or a variant thereof is attenuated when grown in a human host if the growth of the hEbola or variant thereof in the human host is reduced compared to the non-attenuated hEbola or variant thereof.

[0147] In certain embodiments, the attenuated virus of the invention is capable of infecting a host, is capable of replicating in a host such that infectious viral particles are produced. In 10 comparison to the wild type species, however, the attenuated species grows to lower titers or grows more slowly. Any technique known to the skilled artisan can be used to determine the growth curve of the attenuated virus and compare it to the growth curve of the wild type virus.

[0148] In certain embodiments, the attenuated virus of the invention (e.g., a recombinant or chimeric hEbola) cannot replicate in human cells as well as the wild type virus (e.g., wild type 15 hEbola) does. However, the attenuated virus can replicate well in a cell line that lacks interferon functions, such as Vero cells.

[0149] In other embodiments, the attenuated virus of the invention is capable of infecting a host, of replicating in the host, and of causing proteins of the virus of the invention to be inserted into the cytoplasmic membrane, but the attenuated virus does not cause the host to produce new infectious 20 viral particles. In certain embodiments, the attenuated virus infects the host, replicates in the host, and causes viral proteins to be inserted in the cytoplasmic membrane of the host with the same efficiency as the wild type hEbola. In other embodiments, the ability of the attenuated virus to cause viral proteins to be inserted into the cytoplasmic membrane into the host cell is reduced compared to the wild type virus. In certain embodiments, the ability of the attenuated hEbola virus to replicate in 25 the host is reduced compared to the wild type virus. Any technique known to the skilled artisan can be used to determine whether a virus is capable of infecting a mammalian cell, of replicating within the host, and of causing viral proteins to be inserted into the cytoplasmic membrane of the host.

[0150] In certain embodiments, the attenuated virus of the invention is capable of infecting a host. In contrast to the wild type hEbola, however, the attenuated hEbola cannot be replicated in the 30 host. In a specific embodiment, the attenuated hEbola virus can infect a host and can cause the host to insert viral proteins in its cytoplasmic membranes, but the attenuated virus is incapable of being replicated in the host. Any method known to the skilled artisan can be used to test whether the attenuated hEbola has infected the host and has caused the host to insert viral proteins in its cytoplasmic membranes.

[0151] In certain embodiments, the ability of the attenuated virus to infect a host is reduced compared to the ability of the wild type virus to infect the same host. Any technique known to the skilled artisan can be used to determine whether a virus is capable of infecting a host.

[0152] In certain embodiments, mutations (e.g., missense mutations) are introduced into the genome of the virus, for example, into the sequence of SEQ ID NOs: 1 or 10, or to generate a virus with an attenuated phenotype. Mutations (e.g., missense mutations) can be introduced into the structural genes and/or regulatory genes of the hEbola. Mutations are optionally additions, substitutions, deletions, or combinations thereof. Such variant of hEbola can be screened for a predicted functionality, such as infectivity, replication ability, protein synthesis ability, assembling ability, as well as cytopathic effect in cell cultures. In a specific embodiment, the missense mutation is a cold-sensitive mutation. In another embodiment, the missense mutation is a heat-sensitive mutation. In another embodiment, the missense mutation prevents a normal processing or cleavage of the viral proteins.

[0153] In other embodiments, deletions are introduced into the genome of the hEbola virus, which result in the attenuation of the virus.

[0154] In certain embodiments, attenuation of the virus is achieved by replacing a gene of the wild type virus with a gene of a virus of a different species, of a different subgroup, or of a different variant. In another aspect, attenuation of the virus is achieved by replacing one or more specific domains of a protein of the wild type virus with domains derived from the corresponding protein of a virus of a different species. In certain other embodiments, attenuation of the virus is achieved by 29.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 deleting one or more specific domains of a protein of the wild type virus.

[0155] When a live attenuated vaccine is used, its safety should also be considered. The vaccine preferably does not cause disease. Any techniques known in the art for improving vaccine safety are operable in the present invention. In addition to attenuation techniques, other techniques are optionally be used. One non-limiting example is to use a soluble heterologous gene that cannot be incorporated into the virion membrane. For example, a single copy of the soluble version of a viral transmembrane protein lacking the transmembrane and cytosolic domains thereof is used.

[0156] Various assays are optionally used to test the safety of a vaccine. For example, sucrose gradients and neutralization assays are used to test the safety. A sucrose gradient assay is optionally used to determine whether a heterologous protein is inserted in a virion. If the heterologous protein is inserted in the virion, the virion is preferably tested for its ability to cause symptoms in an appropriate animal model since the virus may have acquired new, possibly pathological, properties.

5.4 Adjuvants and Carrier Molecules [0157] hEbola-associated antigens are administered with one or more adjuvants.

In one embodiment, the hEbola-associated antigen is administered together with a mineral salt adjuvants or mineral salt gel adjuvant. Such mineral salt and mineral salt gel adjuvants include, but are not limited to, aluminum hydroxide (ALHYDROGEL, REHYDRAGEL), aluminum phosphate gel, aluminum hydroxyphosphate (ADJU-PHOS), and calcium phosphate.

[0158] In another embodiment, hEbola-associated antigen is administered with an immunostimulatory adjuvant. Such class of adjuvants include, but are not limited to, cytokines (e.g., interleukin-2, interleukin-7, interleukin-12, granulocyte-macrophage colony stimulating factor (GM-CSF), interferon-y interleukin-1(3 (IL-1 (3), and IL-1 0 peptide or Sclavo Peptide), cytokinecontaining liposomes, triterpenoid glycosides or saponins (e.g., QuilA and QS-21, also sold under the trademark STIMULON, ISCOPREP), Muramyl Dipeptide (MDP) derivatives, such as N-acetyl-muramyl-L-threonyl-D-isoglutamine (Threonyl-MDP, sold under the trademark TERMURTIDE), GMDP, N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine, N-acetylmuramyl-Lalanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-s- n-glycero-3-hydroxy phosphoryloxy)-ethylamine, muramyl tripeptide phosphatidylethanolamine (MTP-PE), unmethylated CpG dinucleotides and oligonucleotides, such as bacterial DNA and fragments thereof, LPS, monophosphoryl Lipid A (3D-MLA sold under the trademark MPL), and polyphosphazenes.

[0159] In another embodiment, the adjuvant used is a particular adjuvant, including, but not limited to, emulsions, e.g., Freund's Complete Adjuvant, Freund's Incomplete Adjuvant, squalene or squalane oil-in-water adjuvant formulations, such as SAF and MF59, e.g., prepared with block-copolymers, such as L-121 (polyoxypropylene/polyoxyetheylene) sold under the trademark PLURONIC L-121, Liposomes, Virosomes, cochleates, and immune stimulating complex, which is sold under the trademark ISCOM. [0160] In another embodiment, a microparticular adjuvant is used.

Microparticular adjuvants include, but are not limited to, biodegradable and biocompatible polyesters, homo- and copolymers of lactic acid (PLA) and glycolic acid (PGA), poly(lactide-co-glycolides) (PLGA) microparticles, polymers that self-associate into particulates (poloxamer particles), soluble polymers (polyphosphazenes), and virus-like particles (VLPs) such as recombinant protein particulates, e.g., hepatitis B surface antigen (HbsAg).

[0161] Yet another class of adjuvants that are optionally used include mucosal adjuvants, including but not limited to heat-labile enterotoxin from Escherichia coli (LT), cholera holotoxin (CT) and cholera Toxin B Subunit (CTB) from Vibrio cholerae, mutant toxins (e.g., LTK63 and LTR72), microparticles, and polymerized liposomes.

[0162] In other embodiments, any of the above classes of adjuvants are optionally used in combination with each other or with other adjuvants. For example, non-limiting examples of combination adjuvant preparations used to administer the hEbolaassociated antigens of the invention include liposomes containing immunostimulatory protein, cytokines, T-cell and/or B-cell peptides, or microbes with or without entrapped IL-2 or microparticles containing enterotoxin.

Other adjuvants known in the art are also included within the scope of the invention (see Vaccine Design: The Subunit and Adjuvant Approach, Chap. 7, Michael F. Powell and Mark J. Newman (eds.), Plenum Press, New York, 1995, which is incorporated herein in its entirety).

[0163] The effectiveness of an adjuvant is illustratively determined by measuring the induction of antibodies directed against an immunogenic polypeptide containing a hEbola polypeptide epitope, the antibodies resulting from administration of this polypeptide in vaccines which are also comprised of the various adjuvants.

[0164] The polypeptides are optionally formulated into the vaccine as neutral or salt forms.

Pharmaceutically acceptable salts include the acid additional salts (formed with free amino groups of the peptide) and which are formed with inorganic acids, such as, for example, hydrochloric or phosphoric acids, or organic acids such as acetic, oxalic, tartaric, maleic, and the like. Salts formed with free carboxyl groups are optionally derived from inorganic bases, such as, for example, sodium potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like.

[0165] The vaccines of the invention are preferably multivalent or univalent.

Multivalent vaccines are made from recombinant viruses that direct the expression of more than one antigen.

[0166] Many methods are operable herein to introduce the vaccine formulations of the invention; these include but are not limited to oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal routes, and via scarification (scratching through the top layers of skin, e.g., using a bifurcated needle).

[0167] The patient to which the vaccine is administered is preferably a mammal, most preferably a human, but is also optionally a non-human animal including but not limited to lower primates, cows, horses, sheep, pigs, fowl (e.g., chickens), goats, cats, dogs, hamsters, mice and rats.

Preparation of Antibodies [0168] Antibodies that specifically recognize a polypeptide of the invention, such as, but not limited 30.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 to, polypeptides including the sequence of SEQ ID NOs: 2-9, 59, or 11-19 and other polypeptides as described herein, or hEbola epitope or antigen-binding fragments thereof are used in a preferred embodiment for detecting, screening, and isolating the polypeptide of the invention or fragments thereof, or similar sequences that might encode similar enzymes from the other organisms. For example, in one specific embodiment, an antibody which immunospecifically binds hEbola epitope, or a fragment thereof, is used for various in vitro detection assays, including enzyme-linked immunosorbent assays (ELISA), radioimmunoassays, western blot, etc., for the detection of a polypeptide of the invention or, preferably, hEbola, in samples, for example, a biological material, including cells, cell culture media (e.g., bacterial cell culture media, mammalian cell culture media, insect cell culture media, yeast cell culture media, etc.), blood, plasma, serum, tissues, sputum, naseopharyngeal aspirates, etc.

[0169] Antibodies specific for a polypeptide of the invention or any epitope of hEbola are optionally generated by any suitable method known in the art. Polyclonal antibodies to an antigen of interest, for example, the hEbola virus from Deposit Accession No. 200706291, or including a nucleotide sequence of SEQ ID NOs: 1 or 10, are optionally produced by various procedures well known in the art. For example, an antigen is optionally administered to various host animals including, but not limited to, rabbits, mice, rats, etc., to induce the production of antisera containing polyclonal antibodies specific for the antigen. Various adjuvants are optionally used to increase the immunological response, depending on the host species, and include but are not limited to, Freund's (complete and incomplete) adjuvant, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful adjuvants for humans such as BCG (Bacille Calmette-Guerin) and Corynebacterium parvum. Such adjuvants are also well known in the art.

[0170] Monoclonal antibodies are optionally prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. In one example, monoclonal antibodies are produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas, pp. 563-681 (Elsevier, N.Y., 1981) (both of which are incorporated by reference in their entireties). The term "monoclonal antibody" as used herein is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody" refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.

5 [0171] Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in the art. In a non-limiting example, mice are immunized with an antigen of interest or a cell expressing such an antigen. Once an immune response is detected, e.g., antibodies specific for the antigen are detected in the mouse serum, the mouse spleen is harvested and splenocytes isolated. The splenocytes are then fused by well known techniques to 10 any suitable myeloma cells.

Hybridomas are selected and cloned by limiting dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding the antigen. Ascites fluid, which generally contains high levels of antibodies, is optionally generated by inoculating mice intraperitoneally with positive hybridoma clones.

[0172] Antibody fragments which recognize specific epitopes are optionally generated by 15 known techniques. For example, Fab and F(ab')2 fragments are illustratively produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments). F(ab')2 fragments preferably contain the complete light chain, and the variable region, the CH1 region and the hinge region of the heavy chain.

[0173] The antibodies of the invention or fragments thereof are optionally produced by any 20 method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques.

[0174] The nucleotide sequence encoding an antibody is obtained from any information available to those skilled in the art (i.e., from Genbank, the literature, or by routine cloning and sequence analysis). If a clone containing a nucleic acid encoding a particular antibody or an epitope-25 binding fragment thereof is not available, but the sequence of the antibody molecule or epitope-binding fragment thereof is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+RNA, isolated from any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody) by PCR amplification using 30 synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR are optionally then cloned into replicable cloning vectors using any method known in the art.

[0175] Once the nucleotide sequence of the antibody is determined, the nucleotide sequence of the antibody is optionally manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., supra;, and Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both incorporated by reference herein in their entireties), to generate antibodies having a different amino acid sequence by, for example, introducing amino acid substitutions, deletions, and/or insertions into the epitope-binding domain regions of the antibodies or any portion of antibodies which may enhance or reduce biological activities of the antibodies.

[0176] Recombinant expression of an antibody requires construction of an expression vector containing a nucleotide sequence that encodes the antibody. Once a nucleotide sequence encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof has been obtained, the vector for the production of the antibody molecule is optionally produced by recombinant DNA technology using techniques known in the art as discussed in the previous sections. Methods which are known to those skilled 31.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 in the art are optionally used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. The nucleotide sequence encoding the heavy-chain variable region, light-chain variable region, both the heavy-chain and light-chain variable regions, an epitope-binding fragment of the heavyand/or light-chain variable region, or one or more complementarity determining regions (CDRs) of an antibody are optionally cloned into such a vector for expression.

Thus, prepared expression vector is optionally then introduced into appropriate host cells for the expression of the antibody.

Accordingly, the invention includes host cells containing a polynucleotide encoding an antibody specific for the polypeptides of the invention or fragments thereof.

[0177] The host cell is optionally co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors illustratively contain identical selectable markers which enable equal expression of heavy and light chain polypeptides or different selectable markers to ensure maintenance of both plasmids. Alternatively, a single vector is optionally used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature, 322:52, 1986; and Kohler, Proc. Natl. Acad. Sci. USA, 77:2 197, 1980). The coding sequences for the heavy and light chains optionally include cDNA or genomic DNA. [0178] In another embodiment, antibodies are generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In a particular embodiment, such phage is utilized to display antigen binding domains, such as Fab and Fv or disulfide-bond stabilized Fv, expressed from a repertoire or combinatorial antibody library (e.g., human or murine).

Phage expressing an antigen binding domain that binds the antigen of interest is optionally selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Phages used in these methods are typically filamentous phage, including fd and M13. The antigen binding domains are expressed as a recombinantly fused protein to either the phage gene III or gene VIII protein. Examples of phage display methods that can be used to make the immunoglobulins, or fragments thereof, of the present invention include those disclosed in Brinkman et al., J. Immunol. Methods, 182:41-50, 1995; Ames et al., J. Immunol.

Methods, 184:177-186, 1995; Kettleborough et al., Eur. J. Immunol., 24:952-958, 1994; Persic et al., Gene, 187:9-18, 1997; Burton et al., Advances in Immunology, 57:191-280, 1994; PCT application No. PCT/GB91/01134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is incorporated herein by reference in its entirety.

[0179] As described in the above references, after phage selection, the antibody coding regions from the phage is optionally isolated and used to generate whole antibodies, including human antibodies, or any other desired fragments, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below. For example, techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments are optionally employed using methods known in the art such as those disclosed in PCT publication WO 92/22324; Mullinax et al., BioTechniques, 12(6):864-869, 1992; and Sawai et al., AJRI, 34:26-34, 1995; and Better et al., Science, 240:1041-1043, 1988 (each of which is incorporated by reference in its entirety). Examples of techniques operable to produce single-chain Fvs and antibodies include those described in U.S. Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in Enzymology, 203:46-88, 1991; Shu et al., PNAS, 90:7995-7999, 1993; and Skerra et al., Science, 240:1038-1040, 1988.

[0180] Once an antibody molecule of the invention has been produced by any methods described above, or otherwise known in the art, it is then optionally purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A or Protein G purification, and sizing column chromatography), centrifligation, differential solubility, or by any other standard technique(s) for the purification of proteins. Further, the antibodies of the present invention or fragments thereof are optionally fused to heterologous polypeptide sequences described herein or otherwise known in the art to facilitate purification. Illustrative examples include 6xHis tag, FLAG tag, biotin, avidin, or other system.

[0181] For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it is preferable to use chimeric, humanized, or human antibodies. A chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a constant region derived from a human immunoglobulin. Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, Science, 229:1202, 1985; Oi et al., BioTechniques, 4:214 1986; Gillies et al., J. Immunol. Methods, 125:191-202, 1989; U.S. Pat. Nos. 5,807,715; 4,816,567; and 4,816,397, which are incorporated herein by reference in their entireties.

Humanized antibodies are antibody molecules from non-human species that bind the desired antigen having one or more complementarity determining regions (CDRs) from the non-human species and framework regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding. These framework 32.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. See, e.g., Queen et al., U.S. Pat. No. 5,585,089; Riechmann et al., Nature, 332:323, 1988, which are incorporated herein by reference in their entireties. Antibodies are humanized using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101 and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology, 28(4/5):489-498, 1991; Studnicka et al., Protein Engineering, 7(6):805-814, 1994; Roguska et al., Proc Natl. Acad. Sci. USA, 91:969-973, 1994), and chain shuffling (U.S. Pat. No. 5,565,332), all of which are hereby incorporated by reference in their entireties.

[0182] Completely human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies are made by a variety of methods known in the art illustratively including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645; WO 98/50433; WO 98/24893; WO 98/16654; WO 96/34096; WO 96/33735; and WO 91/10741, each of which is incorporated herein by reference in its entirety.

[0183] Human antibodies are also illustratively produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes. For an overview of this technology for producing human antibodies, see Lonberg and Huszar, Int. Rev. Immunol., 13:65-93, 1995. For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; and 5,939,598, which are incorporated by reference herein in their entireties. In addition, companies such as Abgenix, Inc. (Fremont, Calif.), Medarex (NJ) and Genpharm (San Jose, Calif.) can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above.

[0184] Completely human antibodies which recognize a selected epitope are optionally generated using a technique referred to as "guided selection." In this approach a selected non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope. (Jespers et al., Bio/technology, 12:899-903, 1988).

[0185] Antibodies fused or conjugated to heterologous polypeptides are optionally used in in vitro immunoassays and in purification methods (e.g., affinity chromatography) known in the art.

See e.g., PCT publication No. WO 93/21232; EP 439,095; Naramura et al., Immunol. Lett., 39:91-99, 1994; U.S. Pat. No. 5,474,981; Gillies et al., PNAS, 89:1428-1432, 1992; and Fell et al., J. Immunol., 146:2446-2452, 1991, which are incorporated herein by reference in their entireties.

[0186] Antibodies may also be illustratively attached to solid supports, which are particularly useful for immunoassays or purification of the polypeptides of the invention or fragments, derivatives, analogs, or variants thereof, or similar molecules having the similar enzymatic activities as the polypeptide of the invention. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.

Pharmaceutical Compositions and Kits 5 [0187] The present invention encompasses pharmaceutical compositions including antiviral agents of the present invention. In a specific embodiment, the antiviral agent is preferably an antibody which immunospecifically binds and neutralizes the hEbola virus or variants thereof, or any proteins derived therefrom. In another specific embodiment, the antiviral agent is a polypeptide or nucleic acid molecule of the invention. The pharmaceutical compositions have utility as an 10 antiviral prophylactic agent are illustratively administered to a subject where the subject has been exposed or is expected to be exposed to a virus.

[0188] Various delivery systems are known and operable to administer the pharmaceutical composition of the invention, illustratively, encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the mutant viruses, and receptor mediated 15 endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429 4432).

Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compounds may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and optionally administered together 20 with other biologically active agents. Administration is systemic or local.

In a preferred embodiment, it is desirable to introduce the pharmaceutical compositions of the invention into the lungs by any suitable route. Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.

[0189] In a specific embodiment, it is desirable to administer the pharmaceutical compositions 25 of the invention locally to the area in need of treatment. This administration may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, by means of nasal spray, or by means of an implant, the implant being of a porous, nonporous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. In one 30 embodiment, 33.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 administration can be by direct injection at the site (or former site) infected tissues.

[0190] In another embodiment, the pharmaceutical composition is delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez Berestein and Fidler (eds.), Liss, New York, pp.

353-365 (1989); Lopez-Berestein, ibid. , pp. 317-327; see generally ibid.).

[0191] In yet another embodiment, the pharmaceutical composition is delivered in a controlled release system. In one embodiment, a pump is used (see Langer, supra; Sefton, 1987, CRC Crit.

Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507; and Saudek et al., 1989, N. Engl.

J. Med. 321:574). In another embodiment, polymeric materials are used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989, J. Neurosurg. 71:105). In yet another embodiment, a controlled release system is placed in proximity of the composition's target, i.e., the lung, thus, requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).

[0192] Other controlled release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)) the contents of which are incorporated herein by reference.

[0193] The pharmaceutical compositions of the present invention illustratively include a therapeutically effective amount of a live attenuated, inactivated or killed West African hEbola virus, or recombinant or chimeric hEbola virus, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. Such pharmaceutical carriers are illustratively sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions are optionally employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, also contains wetting or emulsifying agents, or pH buffering agents. These compositions optionally take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained release formulations and the like. The composition is optionally formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation illustratively includes standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E. W. Martin. The formulation should suit the mode of administration.

[0194] In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. The composition also includes an optional solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline is optionally provided so that the ingredients may be mixed prior to administration.

[0195] The pharmaceutical compositions of the invention are illustratively formulated as neutral or salt forms. Pharmaceutically acceptable salts illustratively include those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2 ethylamino ethanol, histidine, procaine, etc.

[0196] The amount of the pharmaceutical composition of the invention which will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. In addition, in vitro assays are optionally employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. However, suitable dosage ranges for intravenous administration are generally about 20 to 500 micrograms of active compound per kilogram body weight.

Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body weight to 1 mg/kg body weight.

Effective doses may be extrapolated from dose response curves derived from in vitro or animal model test systems.

[0197] Suppositories generally contain active ingredient in the range of 0.5% to 10% by weight; oral formulations preferably contain 10% to 95% active ingredient.

[0198] The invention also provides a pharmaceutical pack or kit including one or more containers filled with one or more of the 34.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 ingredients of the pharmaceutical compositions of the invention. Optionally associated with such container(s) is a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In a preferred embodiment, the kit contains an antiviral agent of the invention, e.g., an antibody specific for the polypeptides encoded by a nucleotide sequence of SEQ ID NOs: 1 or 10, or as shown in SEQ ID NOs: 2-9, 59, or 11-19, or any hEbola epitope, or a polypeptide or protein of the present invention, or a nucleic acid molecule of the invention, alone or in combination with adjuvants, antivirals, antibiotics, analgesic, bronchodilators, or other pharmaceutically acceptable excipients.

[0199] The present invention further encompasses kits including a container containing a pharmaceutical composition of the present invention and instructions for use.

Detection Assays [0200] The present invention provides a method for detecting an antibody, which immunospecifically binds to the hEbola virus, in a biological sample, including for example blood, serum, plasma, saliva, urine, feces, etc., from a patient suffering from hEbola infection, and/or hemorrhagic fever. In a specific embodiment, the method including contacting the sample with the hEbola virus, for example, of Deposit Accession No. 200706291, or having a genomic nucleic acid sequence of SEQ ID NOs: 1 or 10, directly immobilized on a substrate and detecting the virus-bound antibody directly or indirectly by a labeled heterologous anti-isotype antibody. In another specific embodiment, the sample is contacted with a host cell which is infected by the hEbola virus, for example, of Deposit Accession No. 200706291, or having a genomic nucleic acid sequence of SEQ ID NOs: 1 or 10, and the bound antibody is optionally detected by immunofluorescent assay.

[0201] An exemplary method for detecting the presence or absence of a polypeptide or nucleic acid of the invention in a biological sample involves obtaining a biological sample from various sources and contacting the sample with a compound or an agent capable of detecting an epitope or nucleic acid (e.g., mRNA, genomic DNA) of the hEbola virus such that the presence of the hEbola virus is detected in the sample. A preferred agent for detecting hEbola mRNA or genomic RNA of the invention is a labeled nucleic acid probe capable of hybridizing to mRNA or genomic RNA encoding a polypeptide of the invention. The nucleic acid probe is, for example, a nucleic acid molecule including the nucleotide sequence of SEQ ID NOs: 1 or 10, a complement thereof, or a portion thereof, such as an oligonucleotide of at least 15, 20, 25, 30, 50, 100, 250, 500, 750, 1000 or more contiguous nucleotides in length and sufficient to specifically hybridize under stringent conditions to a hEbola mRNA or genomic RNA. [0202] As used herein, the term "stringent conditions" describes conditions for hybridization and washing under which nucleotide sequences having at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity to each other typically remain hybridized to each other. Such hybridization conditions are described in, for example but not limited to, Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1 6.3.6.; Basic Methods in Molecular Biology, Elsevier Science Publishing Co., Inc., N.Y. (1986), pp.75 78, and 84 87; and Molecular Cloning, Cold Spring Harbor Laboratory, N.Y. (1982), pp.387 389, and are well known to those skilled in the art. A preferred, non-limiting example of stringent hybridization conditions is hybridization in 6x sodium chloride/sodium citrate (SSC), 0.5% SDS at about 68 C followed by one or more washes in 2xSSC, 0.5% SDS at room temperature. Another preferred, non-limiting example of stringent hybridization conditions is hybridization in 6x SSC at about 45 C followed by one or more washes in 0.2x SSC, 0.1% SDS at 50 to 65 C. [0203] A nucleic acid probe, polynucleotide, oligonucleotide, or other nucleic acid is preferably purified. An "isolated" or "purified" nucleotide sequence is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the nucleotide is derived, or is substantially free of chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of a nucleotide/oligonucleotide in which the nucleotide/oligonucleotide is separated from cellular components of the cells from which it is isolated or produced.

Thus, a nucleotide/oligonucleotide that is substantially free of cellular material includes preparations of the nucleotide having less than about 30%, 20%, 10%, 5%, 2.5%, or 1%, (by dry weight) of contaminating material. When nucleotide/oligonucleotide is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly, such preparations of the nucleotide/oligonucleotide have less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or compounds other than the nucleotide/oligonucleotide of interest.

In a preferred embodiment of the present invention, the nucleotide/oligonucleotide is isolated or purified.

[0204] In another preferred specific embodiment, the presence of hEbola virus is detected in the 5 sample by a reverse transcription polymerase chain reaction (RT-PCR) using the primers that are constructed based on a partial nucleotide sequence of the genome of hEbola virus, for example, that of Deposit Accession No. 200706291, or having a genomic nucleic acid sequence of SEQ ID NOs: 1 or 10. In a non-limiting specific embodiment, preferred primers to be used in a RT-PCR method are the primers are described in detail herein.

10 [0205] In more preferred specific embodiment, the present invention provides a real-time quantitative PCR assay to detect the presence of hEbola virus in a biological sample by subjecting the cDNA obtained by reverse transcription of the extracted total RNA from the sample to PCR reactions using the specific primers described in detail herein, and a fluorescence dye, such as SYBR Green I, which fluoresces when bound nonspecifically to double-stranded DNA. The 15 fluorescence signals from these reactions are captured at the end of extension steps as PCR product is generated over a range of the thermal cycles, thereby allowing the quantitative determination of the viral load in the sample based on an amplification plot.

[0206] A preferred agent for detecting hEbola is an antibody that specifically binds a polypeptide of the invention or any hEbola epitope, preferably an antibody with a detectable label.

35.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 20 Antibodies are illustratively polyclonal, or more preferably, monoclonal.

An intact antibody, or a fragment thereof (e.g., Fab or F(ab')2) is operable herein.

[0207] The term "labeled", with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, optionally via a linker, as well as indirect labeling of the probe or antibody by 25 reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it is detectable with fluorescently labeled streptavidin. The detection method of the invention is optionally used to detect mRNA, protein (or any epitope), or genomic RNA in a sample in vitro as well as in vivo. Exemplary in vitro techniques for detection of 30 mRNA include northern hybridizations, in situ hybridizations, RT-PCR, and RNase protection. In vitro techniques for detection of an epitope of hEbola illustratively include enzyme linked immunosorbent assays (ELISAs), western blots, immunoprecipitations and immunofluorescence. In vitro techniques for detection of genomic RNA include northern hybridizations, RT-PCT, and RNase protection. Furthermore, in vivo techniques for detection of hEbola include introducing into a subject organism a labeled antibody directed against the polypeptide. In one embodiment, the antibody is labeled with a radioactive marker whose presence and location in the subject organism is detected by standard imaging techniques, including autoradiography.

[0208] In a specific embodiment, the methods further involve obtaining a control sample from a control subject, contacting the control sample with a compound or agent capable of detecting hEbola, e.g., a polypeptide of the invention or mRNA or genomic RNA encoding a polypeptide of the invention, such that the presence of hEbola or the polypeptide or mRNA or genomic RNA encoding the polypeptide is detected in the sample, and comparing the absence of hEbola or the polypeptide or mRNA or genomic RNA encoding the polypeptide in the control sample with the presence of hEbola, or the polypeptide or mRNA or genomic DNA encoding the polypeptide in the test sample.

[0209] The invention also encompasses kits for detecting the presence of hEbola or a polypeptide or nucleic acid of the invention in a test sample. The kit illustratively includes a labeled compound or agent capable of detecting hEbola or the polypeptide or a nucleic acid molecule encoding the polypeptide in a test sample and, in certain embodiments, a means for determining the amount of the polypeptide or mRNA in the sample (e.g., an antibody which binds the polypeptide or an oligonucleotide probe which binds to DNA or mRNA encoding the polypeptide).

Kits optionally include instructions for use.

[0210] For antibody-based kits, the kit illustratively includes: (1) a first antibody (e.g., attached to a solid support) which binds to a polypeptide of the invention or hEbola epitope; and, optionally, (2) a second, different antibody which binds to either the polypeptide or the first antibody and is preferably conjugated to a detectable agent.

[0211] For oligonucleotide-based kits, the kit illustratively includes: (1) an oligonucleotide, e.g., a detectably labeled oligonucleotide, which hybridizes to a nucleic acid sequence encoding a polypeptide of the invention or to a sequence within the hEbola genome; or (2) a pair of primers useful for amplifying a nucleic acid molecule containing an hEbola sequence.

The kit optionally includes a buffering agent, a preservative, or a protein stabilizing agent.

The kit optionally includes components necessary for detecting the detectable agent (e.g., an enzyme or a substrate). The kit optionally contains a control sample or a series of control samples which can be assayed and compared to the test sample contained. Each component of the kit is usually enclosed within an individual container and all of the various containers are within a single package along with instructions for use.

Screening Assays to Identify Antiviral Agents [0212] The invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to infect a host or a host cell. In certain embodiments, the invention provides methods for the identification of a compound that reduces the ability of hEbola virus to replicate in a host or a host cell. Any technique well known to the skilled artisan is illustratively used to screen for a compound useful to abolish or reduce the ability of hEbola virus to infect a host and/or to replicate in a host or a host cell.

[0213] In certain embodiments, the invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to replicate in a mammal or a mammalian cell.

More specifically, the invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to infect a mammal or a mammalian cell. In certain embodiments, the invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to replicate in a mammalian cell. In a specific embodiment, the mammalian cell is a human cell.

[0214] In another embodiment, a cell is contacted with a test compound and infected with the hEbola virus. In certain embodiments, a control culture is infected with the hEbola virus in the absence of a test compound. The cell is optionally contacted with a test compound before, concurrently with, or subsequent to the infection with the hEbola virus. In a specific embodiment, the cell is a mammalian cell. In an even more specific embodiment, the cell is a human cell. In certain embodiments, the cell is incubated with the test compound for at least 1 minute, at least 5 minutes, at least 15 minutes, at least 30 minutes, at least 1 hour, at least 2 hours, at least 5 hours, at least 12 hours, or at least 1 day. The titer of the virus is optionally measured at any time during the assay. In certain embodiments, a time course of viral growth in the culture is determined. If the viral growth is inhibited or reduced in the presence of the test compound, the test compound is identified as being effective in inhibiting or reducing the growth or infection of the hEbola virus. In a specific embodiment, the compound that inhibits or reduces the growth of the hEbola virus is tested for its ability to inhibit or reduce the growth rate of other viruses to test its specificity for the hEbola virus.

[0215] In one embodiment, a test compound is administered to a model animal and the model animal is infected with the hEbola virus. In certain embodiments, a control model animal is infected with the hEbola virus without the administration of a 36.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 test compound. The test compound is optionally administered before, concurrently with, or subsequent to the infection with the hEbola virus. In a specific embodiment, the model animal is a mammal. In an even more specific embodiment, the model animal is, but is not limited to, a cotton rat, a mouse, or a monkey. The titer of the virus in the model animal is optionally measured at any time during the assay. In certain embodiments, a time course of viral growth in the culture is determined. If the viral growth is inhibited or reduced in the presence of the test compound, the test compound is identified as being effective in inhibiting or reducing the growth or infection of the hEbola virus. In a specific embodiment, the compound that inhibits or reduces the growth of the hEbola in the model animal is tested for its ability to inhibit or reduce the growth rate of other viruses to test its specificity for the hEbola virus.

[0216] According to the method of the invention, a human or an animal is optionally treated for for EboBun or EboIC, other viral infection or bacterial infection by administering an effective amount of an inventive therapeutic composition. Preferably, a vaccine is administered prophylactically. An "effective amount" is an amount that will induce an immune response in a subject.

Illustratively, an effective amount of the compositions of this invention ranges from nanogram/kg to milligram/kg amounts for young children and adults. Equivalent dosages for lighter or heavier body weights can readily be determined. The dose should be adjusted to suit the individual to whom the composition is administered and will vary with age, weight and metabolism of the individual. The exact amount of the composition required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the particular peptide or polypeptide used, its mode of administration and the like.

An appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein. One skilled in the art will realize that dosages are best optimized by the practicing physician or veterinarian and methods for determining dose amounts and regimens and preparing dosage forms are described, for example, in Remington's Pharmaceutical Sciences, (Martin, E. W., ed., latest edition), Mack Publishing Co., Easton, PA. Preferably, a single administration is operable to induce an immune response.

[0217] Methods involving conventional biological techniques are described herein. Such techniques are generally known in the art and are described in detail in methodology treatises such as Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed.

Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; and Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992 (with periodic updates). Immunological methods (e.g., preparation of antigen-specific antibodies, immunoprecipitation, and immunoblotting) are described, e.g., in Current Protocols in Immunology, ed. Coligan et al., John Wiley & Sons, New York, 1991; and Methods of Immunological Analysis, ed. Masseyeff et al., John Wiley & Sons, New York, 1992.

[0218] Embodiments of inventive compositions and methods are illustrated in the following detailed examples. These examples are provided for illustrative purposes and are not considered limitations on the scope of inventive compositions and methods.

EXAMPLES Example 1: Newly discovered Ebola virus associated with hemorrhagic fever outbreak in Bundibugyo, Uganda [0219] In late November 2007 HF cases were reported in the townships of Bundibugyo and Kikyo in Bundibugyo District, Western Uganda (Figure 1A).

These samples were assayed as described by Towner, JS, et al., PLoS Pathog, 2008 November; 4(11): e1000212, the contents of which are incorporated herein by reference for methods, results, reagents, and all other aspects of the publication. A total of 29 blood samples were initially collected from suspect cases and showed evidence of acute ebolavirus infection in eight specimens using a broadly reactive ebolavirus antigen capture assay known to cross-react with the different ebolavirus species and an IgM capture assay based on Zaire ebolavirus reagents (Table 1). These specimens were negative when initially tested with highly sensitive real-time RT-PCR assays specific for all known Zaire and Sudan ebolaviruses and marburgviruses. However, further evidence of acute ebolavirus infection was obtained using a traditionally less sensitive (relative to the real-time RT-PCR assays) but more broadly reactive filovirus L gene-specific RT-PCR assay (1 specimen) (Table 1). Sequence analysis of the PCR fragment (400 bp of the virus L gene) revealed the reason for the initial failure of the real-time RT-PCR assays, as the sequence was distinct from that of the 4 known species of ebolavirus, although distantly related to Cote d'Ivoire ebolavirus. In total, 9 of 29 specimens showed evidence of ebolavirus infection, and all tests were negative for marburgvirus (data not shown).

[0220] Approximately 70% of the virus genome was rapidly sequenced from total RNA extracted from a patient serum (#200706291) using a newly established metagenomics pyrosequencing method (454 Life Sciences) which involves successive rounds of random DNA amplification8. Using the newly derived draft sequence, a real-time RT-PCR assay specific for the 5 NP gene of this virus was quickly developed and evaluated. The assay was shown to have excellent sensitivity (Table 1), finding positive all the initial six samples that tested positive by either virus antigen capture (five specimens) or virus isolation assays (four specimens).

The antigen-capture, IgM, IgG and newly designed real-time PCR assays were quickly transferred to the Uganda Virus Research Institute during the course of the outbreak to facilitate rapid identification and isolation of 10 Ebola cases in the affected area for efficient control of the outbreak. The outbreak continued through late December 2007, and resulted in 149 suspected cases and 37 deaths9.

[0221] Table 1. Ebolavirus diagnostic results of initial 29 specimens obtained from Bundibugyo District with numerical specimen numbers assigned. RT-PCR refers to results obtained from conventional PCR using the broadly reactive Filo A/B primers 13. Ag, IgM, and IgG refer to 15 results from ELISA-based assaysio' 11 with Zaire ebolavirus reagents while virus isolation refers to culture attempts on Vero E6 cells12. Q-RT-PCR refers to results obtained using the optimized Bundibugyo ebolavirus specific real-time RT-PCR assay with cycle threshold (Ct) values of positive (Pos) samples indicated in the far right column. * Specimen #200706291 is the clinical sample from which prototype isolate #811250 was obtained.

37.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 Table 1 ............................................................................... ............................................................................... ..................................... .

Sample No. RT-PCR Arc Virus Isolation Q RT PCR Ct ......... .........

200706288 neg neg neg neg neg neg 40 200706289 neg neg neg neg neg neg 40 200706290....:...... n eg......>....neg.......n eg.......n eg. _............neg ............................ n eg.....................

40.......

200706291.......... Pos......:.... Pos.......n eg neg Pos ............................ Pos..................23.64...> 200706292..........neg..........!?.eg.......!?...9.......11e9. _............!?.eg ............. ..............neg.............. .......40....... !?.eg .............. .............. neg..............

200706293........... eg...... ....!?.eg.......!?...9........ neg. ............. .......40.......

200706294 neg neg neg neg neg neg 40 ................................. .................................................................. ....................................... .................................... .....................

200706295 neg neg neg neg neg neg 40 200706296 neg neg Pos Pos neg neg 40 200706297 neg neg Pos Pos neg neg 40 200706298 neg Pos Pos Pos neg Pos 34.83 200706299 neg neg Pos Pos neg neg 40 200706300............neg........... neg..... ne..... neg.. .............neg............................ neg.....................40 200706301 ne. neg ne neg neg ne. 40 .................................;.............................. .............;.......... .................. ................................... ...................................

200706302 neg Pos Pos neg neg Pos 35.01 ................................:.....................:........................ .................... ........................................................................:...... ...............

200706303 neg neg neg neg neg neg 40 200706304 neg neg neg neg Pos Pos 38.18 200706305....:...... neg......>....neg.......neg.......ne9 _............neg ............................ neg.....................40.......> 200706306..........neg......>....neg.......neg......ne9 _............neg ............................neg.....................40.......

200706307..........neg......>....!?eg.......neg......ne9_ _............neg ............................neg.....................40.......

200706320.... .......ND.......>....Pos.......neg.......neg. .............Pos Pos 30.24 ......................................... ..:..

200706321 ND neg neg neg neg neg 40 ................................. ................................................................... ....................................... ..........................................................

200706322 ND neg neg neg neg neg 40 200706323 ND neg neg neg neg neg 40 200706324 ND neg neg neg neg neg 40 200706325 ND neg neg..... neg...... neg neg ..... 40 200706326 ND neg neg neg neg neg 40 200706327 ND Pos neg neg Pos Pos 34.41 200706328 ND neg...... neg......neg, neg ne9...... 40 [0222] The entire genome sequence of this virus was completed using a classic primer walking sequencing approach on RNA. The complete genome of the Eb ebolavirus was not available, so it too was derived by a similar combination of random primed pyrosequencing and primer walking approaches. Acquisition of these sequences allowed for the first time the phylogenetic analysis of the complete genomes of representatives of all known species of Ebola and Marburg viruses. The analysis revealed that the newly discovered virus differed from the four existing ebolavirus species (Figure 1), with approximately 32% nucleotide difference from even the closest relative, EboIC (Table 2). Similar complete genome divergence (35-45%) is seen between the previously characterized ebolavirus species.

[0223] Table 2. Identity matrix based on comparisons of full-length genome sequences of Zaire ebolaviruses 1976 (Genbank accession number NC_002549) and 1995 (Genbank accession number AY354458), Sudan ebolavirus 2000 (Genbank accession number NC_006432), Cote d'Ivoire ebolavirus 1994 (SEQ ID NO: 10), Reston ebolavirus 1989 (Genbank accession number NC_004161), and Bundibugyo ebolavirus 2007 (SEQ ID NO: 1).

Table 2 Zaire `95 Sudan `00 EboIC `94 EboBun `07 Reston `89 Zaire `76 .988 .577 .630 .632 .581 Zaire `95 .577 .631 .633 .581 Sudan `00 .577 .577 .609 EboIC `94 .683 .575 EboBun `07 .576 [0224] The material and information obtained from the discovery of the new unique virus EboBun and the realization that together with EboIC these viruses represent a Glade of Bundibungyo-Ivory Coast Ebola virus species is valuable, and makes possible the development of clinical, diagnostic and research tools directed to human hEbola infection.

Material and Methods [0225] Ebolavirus detection and virus isolation. Several diagnostic techniques were used for each sample: (i) antigen capture, IgG, and IgM assays were performed as previously described" (ii) virus isolation attempts were performed on Vero E6 cells12 and monitored for 14 days; (iii) RNA was extracted and tested for Zaire16 and Sudan ebolavirus and marburgvirus4 using real-time quantitative RT-PCR assays designed to detect all known species of each respective virus species the primers/probe for the Sudan ebolavirus assay were EboSudBMG 1(+) 5'-GCC ATG GIT TCA GGT 38.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 TTG AG-3' (SEQ ID NO: 21), EboSudBMG 1(-) 5'-GGT IAC ATT GGG CAA CAA TTC A-3' (SEQ ID NO: 22) and Ebola Sudan BMG Probe 5'FAM-AC GGT GCA CAT TCT CCT TTT CTC GGA-BHQ1 (SEQ ID NO: 23)]; (iv) the conventional RT-PCR was performed with the filo A/B primer set as previously described16 using Superscript III (Invitrogen) according to the manufacturer's instructions. The specimen 200706291 was selected as the reference sample for further sequence analysis.

[0226] Genome sequencing. Pyrosequencing was carried out utilizing the approach developed by 454 Life Sciences, and the method described by Cox-Foster et al. 8 Subsequent virus whole genome primer walking was performed as previously described17 but using the primers specific for Bundibugyo ebolavirus RT-PCR amplification. In total, the entire virus genome was amplified in six overlapping RT-PCR fragments (all primers listed 5' to 3'): fragment A (predicted size 2.7 kb) was amplified using forward-GTGAGACAAAGAATCATTCCTG (SEQ ID NO: 24) with reverseCATCAATTGCTCAGAGATCCACC (SEQ ID NO: 25); fragment B (predicted size 3.0 kb) was amplified using forwardCCAACAACACTGCATGTAAGT (SEQ ID NO: 26) with reverse-AGGTCGCGTTAATCTTCATC (SEQ ID NO: 27); fragment C (predicted size 3.5 kb) was amplified using forward-GATGGTTGAGTTACTTTCCGG (SEQ ID NO: 28) with reverse-GTCTTGAGTCATCAATGCCC (SEQ ID NO: 29); fragment D (predicted size 3.1 kb) was amplified using forwardCCACCAGCACCAAAGGAC (SEQ ID NO: 30) with reverse-CTATCGGCAATGTAACTATTGG (SEQ ID NO: 31); fragment E (predicted size 3.4 kb) was amplified using forward-GCCGTTGTAGAGGACACAC (SEQ ID NO: 32) with reverseCACATTAAATTGTTCTAACATGCAAG (SEQ ID NO: 33) and fragment F (predicted size 3.5 kb) was amplified using forward-CCTAGGTTATTTAGAAGGGACTA (SEQ ID NO: 34) with reverse-GGT AGA TGT ATT GAC AGC AAT ATC (SEQ ID NO: 35).

[0227] The exact 5' and 3' ends of Bundibugyo ebolavirus were determined by 3' RACE from virus RNA extracted from virus infected Vero E6 cell monolayers using TriPure isolation reagent.

RNAs were then polyadenylated in vitro using A-Plus poly(A) polymerase tailing kit (Epicenter Biotechnologies) following the manufacturer's instructions and then purified using an RNeasy kit (Qiagen) following standard protocols. Ten microliters of in vitro polyadenylated RNA were added as template in RT--PCR reactions, using SuperScript III One--Step R'I'-PCR system with Platinum Tack High Fidelity (Invitrogen) following the manufacturer's protocol. Two parallel RT-PCR reactions using the oligo(dT)-containing 3'RACf-AP primer (Invitrogen) mixed with I of 2 viral specific primers, Ebo-U 692(-) ACAAAAAGCTATCTGCACTAT (SEQ ID NO: 36) and Ebo-U18269(+) CTCAGAAGCAAAATTAATGG (SEQ ID NO: 37), generated -700 nt long fragments containing the 3' ends of either genomic and antigenomic RNAs. The resulting RT-PCR products were analyzed by agarose electrophoresis, and DNA bands of the correct sizes were purified using QlAquick Gel Extraction Kit (Qiagen) and sequenced using standard protocols (ABI).

[0228] The nucleotide sequence of the Cote d'Ivoire ebolavirus (EboIC) isolate RNA was initially determined using the exact same pyrosequencing strategy as that used for Bundibugyo ebolavirus described above. This method generated sequence for approximately 70% of the entire genome. This draft sequence was then used to design a whole genome primer walking strategy for filling any gaps and confirming the initial sequence. The following Cote d'Ivoire ebolavirus-specific primers were used to generate RT-PCR fragments, designated A-F, as follows: Fragment A (predicted size 3.0 kb) was amplified using forward-GTGTGCGAATAACTATGAGGAAG (SEQ ID NO: 38) and reverse-GTCTGTGCAATGTTGATGAAGG (SEQ ID NO: 39); Fragment B (predicted size 3.2 kb) was amplified using forward-CATGAAAACCACACTCAACAAC (SEQ ID NO: 40) and reverse-GTTGCCTTAATCTTCATCAAGTTC (SEQ ID NO: 41); Fragment C (predicted size 3.0 kb) was amplified using forward-GGCTATAATGAATTTCCTCCAG (SEQ ID NO: 42) and reverse-CAAGTGTATTTGTGGTCCTAGC (SEQ ID NO: 43); fragment D (predicted size 3.5 kb) was amplified using forward-GCTGGAATAGGAATCACAGG (SEQ ID NO: 44) and reverseCGGTAGTCTACAGTTCTTTAG (SEQ ID NO: 45); fragment E (predicted size 4.0 kb) was amplified using forwardGACAAAGAGATTAGATTAGCTATAG (SEQ ID NO: 46) and reverse-GTAATGAGAAGGTGTCATTTGG (SEQ ID NO: 47); fragment F (predicted size 2.9 kb) was amplified using forward-CACGACTTAGTTGGACAATTGG (SEQ ID NO: 48) and reverse-CAGACACTAATTAGATCTGGAAG (SEQ ID NO: 49); fragment G (predicted size 1.3 kb) was amplified using forward-CGGACACACAAAAAGAAWRAA (SEQ ID NO: 50) and reverse-CGTTCTTGACCTTAGCAGTTC (SEQ ID NO: 51); and fragment H (predicted size 2.5 kb) was amplified using forward-GCACTATAAGCTCGATGAAGTC (SEQ ID NO: 52) and reverse-TGGACACACAAAAARGARAA (SEQ ID NO: 53). A gap in the sequence contig was located between fragments C and D and this was resolved using the following primers to generate a predicted fragment of 1.5 kb: forwardCTGAGAGGATCCAGAAGAAAG (SEQ ID NO: 54) and reverse-GTGTAAGCGTTGATATACCTCC (SEQ ID NO: 55). The terminal -20 nucleotides of the sequence were not experimentally determined but were inferred by comparing with the other known Ebola genome sequences.

[0229] Bundibugyo ebolavirus real-time RT-PCR assay. The primers and probe used in the Bundibugyo ebolavirus specific QRT-PCR assay were as follows: EboU965( +): 5'-GAGAAAAGGCCTGTCTGGAGAA-3' (SEQ ID NO: 56), EboU1039(-): 5'TCGGGTATTGAATCAGACCTTGTT-3' (SEQ ID NO: 57) and EboU989 Prb: 5'FamTTCAACGACAAATCCAAGTGCACGCA-3'BHQ1 (SEQ ID NO 58). Q-RT-PCR reactions were set up using Superscript III One-Step Q-RT-PCR (Invitrogen) according to the manufacturer's instructions and run for 40 cycles with a 58 C annealing temperature.

[0230] Phylogenetic analysis. Modeltest 3.718 was used to examine 56 models of nucleotide substitution to determine the model most appropriate for the data. The General Time Reversible model incorporating invariant sites and a gamma distribution 39.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 (GTR+I+G) was selected using the Akaike Information Criterion (AIC). Nucleotide frequencies were A = 0.3278, C = 0.2101, G = 0.1832, T = 0.2789, the proportion of invariant sites = 0.1412, and the gamma shape parameter = 1.0593. A maximum likelihood analysis was subsequently performed in PAUP*4.ObIO19 using the GTR+I+G model parameters. Bootstrap support values were used to assess topological support and were calculated based on 1,000 pseudoreplicates20.

[0231] In addition, a Bayesian phylogenetic analysis was conducted in MrBayes 3.221 using the 5 GTR+I+G model of nucleotide substitution. Two simultaneous analyses, each with four Markov chains, were run for 5,000,000 generations sampling every 100 generations.

Prior to termination of the run, the AWTY module was used to assess Markov Chain Monte Carlo convergence to ensure that the length of the analysis was sufficient22. Trees generated before the stabilization of the likelihood scores were discarded (burn in = 40), and the remaining trees were used to construct a 10 consensus tree. Nodal support was assessed by posterior probability values (> 95 = statistical support).

Example 2 [0232] Immunization against EboBun: 15 [0233] To determine the capability of immunogens to elict an immune response in non-human primates (NHP), 12 cynomolgus macaques, of which 10 are immunized with VSVAG/EboBunGP either orally (OR; n = 4), intranasally (IN; n = 4) or intramuscularly (IM; n = 2) in accordance with all animal control and safety guidelines and essentially as described by Qiu, X, et al., PLoS ONE. 2009; 4(5): e5547. The remaining 2 control animals are vaccinated intramuscularly with 20 VSVAG/MARVGP. VSVAG/MARVGP does not provide heterologous protection against EboBun, therefore these NHPs succumb to EboBun infection. Animals are acclimatized for 14 days prior to infection. Animals are fed and monitored twice daily (pre- and post-infection) and fed commercial monkey chow, treats and fruit. Husbandry enrichment consists of commercial toys and visual stimulation.

25 [0234] The recombinant VSVAG/EboBun vaccines are synthesized expressing the EboBun glycoprotein (GP) (SEQ ID NO: 9), soluble glycoprotein (sGP) (SEQ ID NO: 4), or nucleoprotein (NP) (SEQ ID NO: 3). Control VSVAG/MARVGP vaccines represent the analogous proteins from Lake victoria marburgvirus (MARV) (strain Musoke). The following results for GP are similar for sGP and NP. Vaccines are generated using VSV (Indiana serotype) as described previously.

30 Garbutt, M, et al., J Virol, 2004; 78(10):5458-5465; Schnell, MJ, et al., PNAS USA, 1996; 93(21):11359-11365. EboBun challenge virus is passaged in Vero E6 cells prior to challenge, as described previously Jones, SM, et al., Nat Med, 2005; 11(7):786-790; Jahrling, PB, et al., J Infect Dis, 1999; 179(Suppl 1):S224-34. An EboBun immunogen peptide pool consisting of 15mers with 11 amino acid overlaps (Sigma-Genosys) spanning the entire sequence of the EboBun immunogens and strain Mayinga 1976 GP are used.

[0235] Twelve filovirus naive cynomolgus monkeys randomized into four groups receive 2 ml of lx107 PFU/ml of vaccine in Dulbecco's modified Eagle's medium (DMEM).

Animals in the three experimental groups are vaccinated with either: 1) 2 ml orally (OR) (n = 4); 2) 1 ml dripped into each nostril, intranasally (IN) (n = 4); or 3) 1 ml each into two sites intramuscularly (IM) (n = 2).

The two controls are injected intramuscularly with 2 ml of lx107 PFU/ml of VSVAG/MARVGP. All animals are challenged intramuscularly 28 days later with 1,000 PFU of EboBun. [0236] Routine examination is conducted on 0, 2, 4, 6, 10, 14 and 21 days post-vaccination, then 0, 3, 6, 10, 14, 19, 26 days, 6 and 9 months after the EboBun challenge.

For the examinations animals are anaesthetized by intramuscular injection with 10 mg/kg of ketaset (Ayerst).

Examinations include haematological analysis, monitoring temperature (rectal), respiration rate, lymph nodes, weight, hydration, discharges and mucous membranes. Also, swabs (throat, oral, nasal, rectal, vaginal) and blood samples are collected (4 ml from femoral vein, 1 ml in EDTA vacutainer tube; 3 ml in serum separator vacutainer tube). Cynomolgus monkey PBMCs are isolated using BD CPT sodium citrate Vacutainers (Becton Dickinson) as per manufacturer's protocol.

[0237] All VSVAG/EboBunGP immunized animals are protected from high dose challenge.

These animals show no evidence of clinical illness after vaccination or EboBun challenge. Both control animals demonstrate typical symptoms associated with EboBun HF including fever, macular rashes, lethargy, and unresponsiveness. Continued infection requires euthanization. Hematology analyses at each examination date demonstrate increases in the platelet-crit in the OR and IN groups post-challenge, however, no significant changes are observed in any NHPs post-immunization or in the VSVAG/EboBunGP immunized NHPs postchallenge.

[0238] EboBun antibody production from humoral antibody response to vaccination and challenge is examined by a virus like particle (VLP) based ELISA assay.

Generation of EboBun VLPs is performed by the protocol for ZEBOV as described by Wahl-Jensen, V., et al., J Virol, 2005; 79(4):2413-2419. ELISA is performed by the protocol described by Qiu, X, et al., PLoS ONE. 2009; 4(5): e5547.

[0239] The VSVAG/MARVGP immunized animals do not develop a detectable antibody response to EboBun. In contrast, potent antibody responses are detected in all VSVAG/EboBunGP immunized animals independent of immunization route. Between days 14 and 21 post-vaccination, all VSVAG/EboBunGP immunized NHPs develop high levels of IgA, IgM, and IgG against EboBunGP. After challenge the IgM titres do not exceed the post-vaccination levels, however, IgG 40.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 and IgA antibody titres are increased peaking 14 days post-challenge then slowly decreasing before maintaining a relatively high antibody titre up to 9 months.

[0240] The level of neutralization antibodies is detected by a EboBun-GFP flow cytometric neutralization assay in serum collected at days 0 and 21 post-vaccination.

Samples are assayed in duplicate for their ability to neutralize an infection with EboBun-GFP in VeroE6 cells. Serially diluted serum samples are incubated with an equal volume of EboBun-GFP in DMEM, at 37 C, 5% CO2 for 1 hr followed by addition of 150 l per well of a confluent 12 well plate of VeroE6 cells (MOI = 0.0005). After 2 hours at 37 C, 5% C02, 1 ml of DMEM, 2% fetal bovine serym (FBS), 100 U/ml penicillin, 100 g/ml streptomycin is added per well and incubated for 5 days. Cells are harvested by removing the culture supernatant, washing with 1 ml PBS, 0.04% EDTA, then adding 800 l of PBS 0.04% EDTA for 5 minutes at 37 C before adding 8 ml PBS, 4% paraformaldehyde (PFA) and overnight incubation. The cells are acquired (10,000 events) and analyzed with CellQuest Pro v3.3 on a Becton Dickinson FACSCalibur flow cytometer.

[0241] The OR and IN routes produce EboBunGP-specific neutralizing antibodies with the OR route producing the highest titres post-vaccination. The IM immunization produces detectable levels of neutralizing antibody. In comparison, 3/4 NHPs in the OR group demonstrate a 50% reduction in EboBun-GFP positive cells at a titre of 1:40. Similarly, the IN route results in a reduction of EboBun-GFP positive cells at the 1:40 dilution.

[0242] EboBunGP-specific effector cellular immune responses are determined using IL-2 and IFN-y ELISPOT assays as described by Qin, X, et al., PLoS ONE. 2009; 4(5): e5547 to determine the number of IL-2 and IFN-y secreting lymphocytes. Prior to challenge on days 10 to 14 post-vaccination there is a detectable EboBun immunogen-specific IFN-y response in all immunized animals. The IM route is the most potent, inducing approximately 2-fold more IFN-y secreting cells than OR (p<0.001) or IN (p = 0.043) routes. A strong post-challenge secondary IFN-y response is induced in all VSVAG/EboBun immunized animals with the IM route producing the most IFN-y cells at day 6. By day 10 the OR group demonstrates a stronger response. The IFN-y in the IN group rises steadily, peaking at day 26 post-challenge with 4.3 and 2 fold more EboBun specific IFN-y secreting cells than the IM (p = 0.003) and OR (p = 0.075) group, respectively. All three routes produce strong EboBun-specific IFN-y responses.

[0243] Post-vaccination, the IM group also has more EboBunGP-specific IL-2 secreting cells than either of the mucosally immunized groups. Post-challenge, the IM route continues to dominate early after challenge peaking on day 10. This difference shows a trend when compared to the IN group (p = 0.067) and is significant when compared to the OR group (p<0.001).

Additionally, the IN group has more IL-2 producing cells than the OR group (p = 0.090) on day 10 post-challenge. By day 26 post-challenge all three routes continue to produce a EboBunGP-specific IL-2 response, however, the IN group response is strongest. At day 26 post-challenge the IN group has the most potent IFN-y and IL-2 responses, as well as the highest IgA and IgG antibody titre, indicating this immunization route, followed by a EboBun challenge, results in the development of potent and sustained effector responses.

[0244] Absolute lymphocyte numbers for CD3+, CD4+, and CD8+ (CD3+4-) T cell populations are determined by flow cytometry. No decrease is observed in the lymphocyte populations for any of the VSVAG/EboBunGP vaccinated NHPs. In contrast, control animals who are not protected from EboBun show lymphocyte numbers decreased by 28-57%.

[0245] Macrophage numbers are slightly increased in control animals. However, the number of CD14+ cells is greater in the VSVAG/EboBunGP vaccinated groups with the IM route showing the most significant increases.

[0246] In order to determine the long term immune response after challenge, EboBunGP-specific CD4+ and CD8+ memory Tlymphocytes are examined for their ability to proliferate (CFSE-) or produce IFN-y in response to EboBunGP peptides at 6 months post-vaccination.

EboBunGP-specific memory responses are observed as a result of vaccination followed by a ZEBOV challenge. These responses persist for at least 6 months. The memory populations in OR and IN inoculation routes demonstrate the greatest potential for proliferation and IFN-y production post-challenge.

[0247] Any patents or publications mentioned in this specification are incorporated herein by reference to the same extent as if each individual publication is specifically and individually indicated to be incorporated by reference.

[0248] The compositions and methods described herein are presently representative of preferred embodiments, exemplary, and not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art.

Such changes and other uses can be made without departing from the scope of the invention as set forth in the claims. All numerical ranges are inclusive of the whole integers and decimals between the endpoints, and inclusive of the endpoints.

References 1. Suzuki, Y., and Gojobori, T., (1997) The origin and evolution of Ebola and Marburg viruses. Mol Bio Evol, 14(8): 800-806.

2. Sanchez, A., Geisbert, T.W., Feldmann, H. in Fields Virology (ed. Knipe, D. M., Howley, P.M.) 1409 - 1448 (Lippincott Williams and Wilkins, Philadelphia, 2007).

310 Leroy, E.M. et al., (2005) Fruit bats as reservoirs of Ebola virus.

Nature, 438, 575-6.

4. Towner, J.S. et al., (2007) Marburg virus infection detected in a common African bat. PLoS ONE, 2(8), e764.

5. Swanepoel, R. et al., (2007) Studies of reservoir hosts for Marburg virus.

Emerg Infect Dis, 13(12), 1847-51.

615 Le Guenno, B. et al., (1995) Isolation and partial characterization of a new species of Ebola virus.

41.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21 Lancet, 345(8960), 1271-4.

7. Ksiazek, T. G. et al. (1999) Clinical virology of Ebola hemorrhagic fever (EHF): virus, virus antigen, IgG and IgM antibody findings among EHF patients in Kikwit, 1995. J. Infect Dis 179 (suppl 1), S177-S187.

820 Cox-Foster, D. L. et al. (2007) A metagenomic survey of microbes in honey bee colony collapse disorder. Science 318, 283-7.

9. World Health Organization (2008) Ebola outbreak contained in Uganda.

Features, 22 February, www.who.int/features/2008/ebola-outbreak/en/.

10. Sullivan, N. J., Sanchez, A., Rollin, P. E., Yang, Z.-Y. & Nabel, G. J. (2000) Development of a 25 preventive vaccine for Ebola virus infection in primates. Nature 408, 605-609.

11. Ksiazek, T. G., West, C. P., Rollin, P. E., Jahrling, P. B. & Peters, C. J. (1999) ELISA for the detection of antibodies to Ebola viruses. J. Infect Dis 179 (suppl 1), S191-S198.

12. Rodriguez, L. et al. (1999) Persistence and genetic stability of Ebola virus during the outbreak in Kikwit, Zaire 1995. J. Infect Dis 179 (suppl 1), S170-S176.

130 Sanchez, A. et al. Detection and molecular characterization of Ebola viruses causing disease in human and nonhuman primates. J. Infect Dis 179 (suppl 1), S164-S169 (1999).

14. Jones, S. M. et al. (2005) Live attenuated recombinant vaccine protects nonhuman primates against Ebola and Marburg viruses. Nat Med 11, 786-90.

15. Geisbert, T. W. et al. (2008) Recombinant vesicular stomatitis virus vector mediates postexposure protection against Sudan Ebola hemorrhagic fever in nonhuman primates. J Virol 82, 5664-8.

165 Towner, J. S., Sealy, T. K., Ksiazek, T. & Nichol, S. T. (2007) High-throughput molecular detection of hemorrhagic fever virus threats with applications for outbreak settings. J. Inf Dis 196 (suppl 2), S205-212.

17. Towner, J. S. et al. (2006) Marburgvirus genomics and association with a large hemorrhagic fever outbreak in Angola. J Virol 80, 6497-516.

1$0 Posada, D. & Crandall, K. A. (1998) MODELTEST: testing the model of DNA substitution.

Bioinformatics 14, 817-818.

19. Swofford, D. L. (2002) PAUP*: phylogenetic analysis using parsimony (*and other methods) version 4.0blO. Sinauer Assoc., Sunderland, Mass.

20. Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 15 39, 783-791.

21. Ronquist, F. & Huelsenbeck, J. P. (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models.

Bioinformatics 19, 1572-1574.

22. Nylander, J. A. A., Wilgenbusch, J. C., Warren, D. L. & Swofford, D. L. (2008) AWTY (are we there yet?): a system for graphical exploration of MCMC convergence in Bayesian phylogenetics.

20 Bioinformatics 24, 581-583.

Classifications International Classification A61K39/12, C07K14/08, C07K16/10, C12N7/01, C12N15/40, G01N33/68 Cooperative Classification C07K16/10, C12N2760/14145, C07K2316/96, A61K2039/5256, C12N2810/6072, A61K2039/53, A61K39/12, C12N2760/14143, G01N2333/08, G01N33/56983, C12N7/00 European Classification C07K16/10, C12N7/00, G01N33/569K, A61K39/12

42.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 7 2014 Además, hoy se ha publicado (ver más adelante) una gran sección sobre el Ébola.

Hay un bloque informativo bastante PATENTE US20120251502 A1 extenso sobre el ébola en el día de hoy y en este sitio EBOLA ¿Por qué Gobierno de Estados Unidos tiene web, y sí que pienso que es algo para preocuparse. No los derechos de patente sobre el virus creo que esta cepa sea natural como la enfermera dice Ebola? más adelante, creo que es intencional Debido a que esta Sat 02 Aug 2014 05:23:47 No.33337239 "mutación" en particular es demasiado perfecta y By: >>33337347 >>33337481 coincide perfectamente con una firma de biotecnología Quoted >>33338049 >>33338220 >>33338809 estadounidense que ha estado "estudiando" el ébola en >>33338828 >>33339842 >>33340193 Sierra Leona, y que ha surgido una patente tanto sobre el >>33341119 >>33344048 >>33344754 virus como sobre la cura para y que está en Google en el >>33345169 >>33348745 >>33348967 apartado patentes de Google (que simplemente se hace >>33352832 >>33358528 >>33358920 >>33359366 >>33360784 >>33362287 eco de la oficina de patentes.) Normalmente a esto lo >>33362357 >>33369659 >>33373832 llamaría patraña, pero el hecho de que surgiera la patente y fuera publicada por una fuente legítima es francamente espeluznante, ¿y peor?

Está fechada en 2007 que se ajusta como anillo al dedo con el trabajo de la empresa de biotecnología en Sierra Leona.

Prepara sin dilación un stock de vitamina C, consigue al menos 1 kg por cada persona que deseas proteger (esto se puede hacer por tan poco como $ 20 USD — €15,00— si se compra correctamente) y tenerlo a mano, sin usar, hasta que este brote de ébola se desinfle o que realmente haya que usarla. En este caso, un KG de prevención ahorrará una tonelada de pena si realmente acaba siendo necesaria.

COMPRA UNA RADIO DE ONDA CIUDADANA O CB, puede ser lo único que funcione después de un cierre generalizado de servicios e instalaciones.

Ahora sería un buen momento para ir a buscar una radio CB. Estos aparatos todavía se venden en las paradas de camiones —en los E.E.U.U. Recomiendo conseguir una unidad de mano. Pueden conseguirse por tan solo $ 40 —€30,00. Las unidades portátiles tienen un rango horrible, pero permiten portabilidad total y a pesar de todo alcanzar las dos millas —algo más de 3 klms. Si el enemigo realmente está controlando el gobierno norteamericano, no contéis con móviles ni Internet, caso de que las cosas se desmadren por completo. El mejor apoyo y respaldo a nivel de comunicación será la radio CB y eso es todo lo que hay, no hay nada mejor por ahí fuera.

43.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

El pequeño espectro propagación (no CB) en radios portátiles que puedes comprar en Wal Mart serán de poco uso en un escenario de emergencia, porque lo único que pueden hacer es conectarse a otros dispositivos dentro del mismo paquete, o como se ajusten los interruptores. Eso funciona muy bien para privacidad, pero es inútil para conectar con la gente a gran escala, CB sigue siendo el camino a seguir, HASTA EL FINAL. He tenido radios instaladas en el coche que permitían hablar con claridad hasta más de 24 kilómetros de distancia, así que si quieres última gama tenlo en cuenta, y recuerda que cualquier tipo de antena CB real va a ser enorme y espantosa, si hay algo novedoso por ahí que se asemeje a una pequeña de unos 60 cms de longitud tipo látigo, será una basura a pesar de lo que digan las especificaciones de la caja a menos que sea dipolo, lo que sería perfecto (un dipolo sería ideal para una unidad de mano). Pero probablemente únicamente transmitiría bien; recibir es igual de importante. Consigue una gran antena si tienes la unidad montada en tu coche.

Una radio —emisor/receptor— económica por $ 50 —€40,00— y $ 20 —€15,00— por la antena y no tendrás ningún problema.

RECUERDA QUE SI AFINAS UNA CB SIN ACOPLAR UNA ANTENA, FUNDIRÁS LA ETAPA DE SALIDA RF Y ENTONCES NO TENDRÁS NADA, USA SIEMPRE UNA ANTENA.

44.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Ebola, tasa de propagación con la tendencia actual Mar, Abr, May, Jun, Jul, Ago, Sep, Oct, Nov, Dic, Ene, Feb, Mar, Abr, May, Jun, Jul, Ago, Sep, Oct, Nov, Dic, Ene, Feb, Mar, Abr, May, Jun, Jul, Ago,

2014 2014 2014 2014 2014 2014 2014 2014 2014 2014 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2016 2016 2016 2016 2016 2016 2016 2016

-

Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados:

104 Muertos: 62 194 Muertos: 116 360 Muertos: 216 670 Muertos: 402 1,247 Muertos: 748 2,319 Muertos: 1,391 4,313 Muertos: 2,588 8,022 Muertos: 4,813 14,921 Muertos: 8,953 27,753 Muertos: 16,652 51,621 Muertos: 30,973 96,016 Muertos: 57,610 178,590 Muertos: 107,154 332,177 Muertos: 199,306 617,849 Muertos: 370,709 1,149,199 Muertos: 689,519 2,137,510 Muertos: 1,282,506 3,975,768 Muertos: 2,385,461 7,394,928 Muertos: 4,436,957 13,754,567 Muertos: 8,252,740 25,583,494 Muertos: 15,350,096 47,585,299 Muertos: 28,551,179 88,508,656 Muertos: 53,105,193 164,626,099 Muertos: 98,775,660 306,204,545 Muertos: 183,722,727 569,540,453 Muertos: 341,724,272 1,059,345,243 Muertos: 635,607,146 1,970,382,153 Muertos: 1,182,229,292 3,664,910,804 Muertos: 2,198,946,482 6,816,734,096 Muertos: 4,090,040,457

No sería una mala idea en absoluto conseguir una gran botella de 500 tabletas de 1000 miligramos de vitamina C AHORA, aunque es dudoso que esta tendencia ébola continúe al ritmo actual, la VITAMINA C ES BARATA Y DE CUALQUIER MODO, ES BUENO TENERLA A MANO. No puedo dejar de pensar en los muchos países que han tratado de prohibir la venta de vitaminas sin receta puedan haber sido convencidos para hacerlo como preparación para este “suceso”, en cualquier país donde se haya implementado esto como ley, la población estará condenada si la vitamina C es realmente el tratamiento o uno —el más barato— de los tratamientos definitivos contra el ébola.

Una vez más, creo que no serán necesarias dosis ultra altas. Es muy probable que el máximo beneficio se alcance con 12 gramos diarios, tomando cada tableta de 1.000 miligramos a intervalos de dos horas, y unos pocos más por la mañana (todos los que se han saltado mientras se duerme). Probablemente es inútil tomar más que eso con fines preventivos (pero, obviamente, al menos doble de esa cantidad si resultas infectado con ébola).

45.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Un enfermero anónima publicó lo siguiente en un foro: “La población humana de este mundo siempre se ha mantenido a raya por los virus, o algún otro método de pura destrucción. La gripe, la poliomielitis, la viruela, lo que sea, estas cosas tienen un propósito en la naturaleza. Mantienen las poblaciones bajo control.

“Desde los albores de la era industrial fue cuando empezamos a ser más astutos que todos ellos. Nos vacunamos contra la gripe, hemos erradicado la poliomielitis en el país. Habíamos derrotado a nuestros enemigos cerca de sumisión, y como resultado, la población mundial se ha disparado. Pero nuestro Genius está empezando a ponerse al día con nosotros. Bacterias resistentes a los anti-bióticos están en aumento, la gripe está ideando nuevas formas de contraatacar nuestras defensas. Y Ebola, bueno, digamos que está haciendo lo que hacen todos los virus.

Está tratando de sobrevivir, está tratando de encontrar una manera de utilizar nuestro propio sistema inmune en contra de nosotros. Piense en esto por un minuto ...

“La gripe le infecta, su cuerpo entra en modo defensivo, al darse cuenta de que debe expulsar al invasor. Por lo que su propio cuerpo llena los pulmones de mucosidad y líquido, lo que le obliga a toser.

Este es el verdadero genio de la gripe. En realidad, depende de su respuesta inmune a propagarse. Y no tiene mucho tiempo para hacerlo bien. Debido a que su cuerpo comienza a aumentar su propia temperatura. Sí, tener fiebre es una respuesta inmune, no causada por la gripe, sino que es, literalmente, su cuerpo tratando de hacer que usted esté tan caliente que la capa de proteína de protección del virus de la gripe se rompa, permitiendo que sus glóbulos blancos pasen a atacar.

“Esto es lo que hacen todos los virus. TODOS ellos. Ellos encuentran una manera de explotar sus respuestas inmunes naturales para propagarse.

“Ebola .... una vez fue tan sólo una fiebre hemorrágica con esteroides, ahora es una amenaza de buena fe. Yo trabajo en el laboratorio de un hospital, uno muy importante dentro de una importante área metropolitana. Mi esposa trabaja como microbióloga clínica para la misma empresa. Estoy muy bien versado en casi todo lo que un laboratorio STAT5 de un hospital puede, y de hecho hace. Mi esposa, por otra parte, en realidad se especializó en microbiología, con énfasis en virología. Así que quería que todos sepan algunas cosas acerca de este brote que se hizo evidente para nosotros, ya que comenzó a difundirse.

“Nº 1. Algo ha cambiado. Este virus acostumbraba a tener un período de incubación mucho más corto. Y mataría en cuestión de una semana.

La tasa de mortalidad fue mucho más alta en otro tiempo. Sin embargo, este ya no es el caso. Basado en el gran número de infectados, el 5

.- Laboratorio especializado en plazos de entrega breves. (N. de los T.)

46.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

virus parece, podría haber encontrado una manera de transmitirse con más facilidad. Normalmente, cuando un virus "evoluciona" gana en un área, mientras que cede terreno en otra. Para mí tiene sentido que el Ébola cediera gran parte de su faceta mortífera, por su capacidad para propagarse más fácilmente, e incubar durante un periodo mucho, mucho más largo.

“Nº 2. África es un caos. No hay forma de saber cuántos están infectados. En un tiempo anterior el Ébola golpearía un pueblo y lo barrería por completo, y eso sería todo. Mataría tan rápido que no podría extenderse fuera de la zona de riesgo. Debido a lo que he dicho anteriormente este ya no el caso. En un continente donde las fronteras todavía significan muy poco para la población nativa, es una mezcla explosiva. Incluso si el CDC o la OMS quisieran obtener números exactos, sería imposible debido a que estos serían, sencillamente, desconocidos y/o debido al número de personas que desconfían de la medicina occidental, se niegan a recibir ayuda, o vagan de pueblo en pueblo. La infraestructura simplemente no tiene las mismas capacidades que en el oeste.

“Nº 3. Ni siquiera en los Estados Unidos, de entre todos los diversos hospitales en los que he trabajado, no hay esperanza alguna de contener algo como esto. Uno de los hospitales más grandes en los que trabajé sólo tenían dos habitaciones de aislamiento de flujo inverso.

TWO, vamos que se hunden en un minuto. Si esta cosa va tan mal como algunos piensan que será, estamos, literalmente, jodidos. Los pacientes sólo aparecen en el hospital una vez que presentan síntomas. Así que para cuando llegan allí, ya han infectado a toda su familia, su grupo de trabajo, y cualquier persona que se encontrara a unos pocos pasos de camino al hospital. Cuando llegan allí las enfermeras ER lo tratarían bien como la gripe, o una infección sin determinar aún. Pero durante todo el tiempo el paciente los está infectando a todos. Y todos, a su vez, comienza a infectar a todos los demás exactamente de la misma manera. Si esto es tan virulento como piensa la OMS que podría ser, durante el tiempo que transcurre hasta que las personas se dan cuenta de lo que está pasando, habría tanta gente enferma que no habría camas disponibles en todos los hospitales combinados de los EE.UU. “Nº 4. Un análisis de sangre para cualquier cosa no es tan simple como mirar a través de un microscopio. Y los laboratorios de los hospitales no están preparados para virología exótica. Funcionamos bajo químicos básicos, enzimas cardíacas, hemogramas, tasas de sedimentación, niveles de medicamentos, cultivos bacterianos, y todas las cosas básicas de mierda. El tipo de cosas que las personas de edad por lo general presentan, pérdida de sangre, infección y eventos cardíacos. Cualquier cosa exótica se descarta. A veces, para el laboratorio estatal, la mayoría de las veces los especímenes se envían por todo el país para rellenar Cuestionarios de Diagnósticos, o a otras organizaciones actualmente preparadas para ello. Su hospital promedio de ciudad está lastimosamente, ridículamente, no preparado para cualquier cosa de esta naturaleza. Claro, la ejecución de un CBC —recuento sanguíneo completo— puede indicar si usted está deshidratado, si está perdiendo sangre, si está luchando contra 47.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

"algo". Simplemente no puede decir de qué se trata. Una tasa de sedimentación puede determinar si usted tiene exceso de inflamación, pero no puedo decir por qué. A nivel de ácido láctico puede indicar sepsis —infección—, pero no puede decir por qué. El punto es, en las primeras etapas de un brote, la gente va a recibir un tratamiento completamente rutinario y mediocre. Porque nada que un hospital pueda probar inmediatamente será capaz de decirle a nadie que usted está llevando la fiebre hemorrágica más letal conocida actualmente.

Honestamente, si una persona entró en una atestada Sala de Emergencia con una fiebre, la enfermera 'triage' —que evalúa y da prioridad a los pacientes— lo pondría en la Sala de Espera hasta que la Sala para casos no Urgentes se abra en la parte posterior. Sencillamente no tienen forma de saber quién está llevando lo que quiera que sea.

“No estoy diciendo que vamos a morir todos. Esta cosa podría esfumarse. Y todo podría estar bien. Lo que estoy tratando de ilustrar aquí es que, sólo porque exista un laboratorio en un hospital, no significa que puedan decirle todo lo que pasa. Hay algoritmos de 'triage'6 que funcionan para cada campo de la medicina todos los días, pero nada para un brote. Pensar que vivir en una nación desarrollada frenará la propagación es ridículo. En todo caso, lo hace peor. Nuestro desplazamiento diario al trabajo, nuestros lugares de trabajo, nuestros hogares, nuestros métodos de entretenimiento, todas esas cosas que nos gustan tanto sobre la vida en el oeste, son las cosas de las que dependen los virus para propagarse.

“Si este virus realmente ha encontrado un modo de transmisión más fácil, el Sistema de Atención a la Salud estaría completamente sobrecargado con algo que simplemente no pueden gestionar.

“De todos modos, no que la gente puede contención de los hospital, y el hecho no podría manejar un

estoy tratando de ser realista en hospitales, las de que el Sistema brote masivo.

asustar a nadie, sólo espero cuanto a las capacidades de pruebas de laboratorio del Sanitario, en cualquier país,

“Así que no esperes milagros del personal del hospital de primera línea, que no tienen las herramientas, y desde luego no tenemos la mano de obra. Pregunte a cualquier persona en el campo médico cuánto tiempo extra podrían trabajar si les diera la gana; ni siquiera me refiero a lo ténuemente que mucha gente podría estar vinculada con la industria médico-hospitalaria. Aunque supongo que si esto se convierta en “algo”, eso se pondrá de manifiesto muy, muy rápido.

“Buena suerte, no se asuste, lávese las manos, esté preparado, abrace a sus hijos.

Eso es todo.”

6

.- “Triage" es una palabra francesa que significa selección,clasificación. En el ámbito sanitario se entiende por triage la función de clasificar a los enfermos antes de que reciban la prestación asistencial que precisan. Esta función de clasificar se establece en los lugares donde existe un número considerable de pacientes. Es por eso que fue la Sanidad Militar la primera institución en implantar un sistema de triage en los campos de batalla de los grandes conflictos bélicos. En la Sanidad Civil, el triage se lleva a cabo en los Desastres y en los accidentes con múltiples víctimas. (N. de los T.)

48.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 8 2014 No hay casos de ébola en México Ayer por la noche la prensa mexicana realizó un enorme espacio informativo sobre el brote de ébola, y declaró con firmeza que absolutamente ningún caso o supuestos casos de ébola se encuentran en México. Así que me gustaría tener los informes sobre "casos de ébola primero confirmado de México" y tirarlos a la basura, no son de fiar.

49.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 10 2014 Las Muertes por Ébola ha alcanzado la cifra de 1.000 que en mi opinión hace que sea un brote real, y encaja perfectamente con el ritmo de expansión previamente calculada de 1.83 mensual

50.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 11 2014 E N L A C E

E X T E R N O

Una impactante brecha en la seguridad de contención en un laboratorio para el ébola de categoría BSL 4 ha sido señalado por Unhived Mind, ésto es siniestro.

Ebola Se incumplen en España los procedimientos BSL de categoría 4. Brecha en la seguridad.

By - The Unhived Mind - 11 de agosto 2014

51.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21 Ebola. Se incumplen en España los procedimientos BSL de categoría 4. Brecha en la seguridad.

By - The Unhived Mind - 11 de agosto 2014

ENLACE VÍDEO o ARCHIVO DE VÍDEO (MP4/11MB).-. Click botón derecho, Guardar como …

Actualización 12 de agosto 2012; Miguel Pajares muere de ébola en un Hospital Español Echa un vistazo a los vídeos y fotos de abajo y te sorprenderás una vez más del incumplimiento absoluto de las normas de seguridad contra una enfermedad infecciosa peligrosa con un BSL de categoría 4. Lo primero que debería notarse es que dos de los tripulantes de la Fuerza Aérea Española no tenían equipo de protección de seguridad en absoluto y ayudaron para abrir las puertas de la aeronave.

52.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21 Lo siguiente que vemos es un equipo enfundado trajes naranja de apariencia barata sin protecciones para el cuello inadecuados para un nivel BSL 4. Observe cómo estos tripulantes del traje naranja tienen expuesta la piel del rostro entre su máscara facial médica básica (inútiles máscaras del tipo para polvo) y sus frentes. Uno de los hombres que parece tener algún grado autoridad, incluso tiene su traje abierto casi hasta la mitad del torso y además no lleva capucha exponiendo así toda la cabeza y cabello. A continuación termina quitándose el guante derecho y dejando expuesta la mano desnuda en contacto con el aire. Estos guantes deben dobles utilizando dos colores con el fin de asegurarse de que si uno se rasga, pueda verse el otro color para que sepas que ha habido una rotura.

Ahora observa asombrado cómo esta tripulación naranja pasa la víctima del Ébola a otro equipo vestido con un traje blanco que parece más profesional, pero que además llevan toda la cara cubierta con máscaras respiratorias, no sólo las máscarillas anti-polvo básicas como está usando la tripulación de naranja.

53.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21 Advierta que los trajes blancos han fijado con cinta adhesiva a los bajos de los pantalones y todos llevan botas, excepto uno. Cuando los EE.UU. requirieron de nuevo los servicios del Dr. Kent Brantly ni uno solo de los miembros del equipo de biocontención llevaba ningún tipo de calzado para proteger sus trajes de cualquier desgarro causado por las irregularidades del suelo luego caminaron sobre un firme pedregoso potencialmente peligroso. Ahora, dime por favor ¿Por qué los integrantes del equipo original de naranja pueden sencillamente no llevar nada pero el siguiente equipo blanco está usando equipo que se parece un poco más a lo que cabría esperar? ¿Hemos de creer que la tripulación de naranja original no regresará a sus hogares con sus hijos y la sociedad, mientras que el equipo blanco sí lo hará? ¿Te diste cuenta que había tres víctimas de Ébola y no sólo uno? ¿Por qué no hay un túnel de biocontención de nivel 4 desde el avión a las ambulancias? ¡Esto refleja una vez más las mismas brechas en la seguridad en los Estados Unidos! ¿Por qué tienen que utilizar las ambulancias que se desplazarían entre las calles de España? ¿No sería mucho más seguro utilizar un helicóptero si es que realmente tienen que traer a estas víctimas de nuevo a Occidente?

54.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21 ¿Te diste cuenta de cómo las ambulancias no son vehículos especialmente diseñados sino que son ambulancias estándar, simplemente normales con una envoltura de plástico transparente improvisada fijada mediante cinta de precintar marrón, la barata?

55.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21 El maquillaje de las ambulancias también me recuerda el interior de la aeronave de la Fuerza Aérea Española, donde los militares simplemente pusieron bolsas de plástico en los respaldos de las asientos.

La Fuerza Aérea española ni siquiera cubría la parte inferior de los asientos, ni siquiera los utilizados para apoyar la camilla especial de la víctima Ebola en los respaldos, estaban cubiertos en su base, donde uno apoya las posaderas. Si estos son aviones normales aviones comerciales españoles y no de la Fuerza Aérea Española, entonces no me subo a un avión español durante meses hasta que supiera que han sido desinfectados. Si yo estuviera en la Fuerza Aérea, igualmente me quedaría bien lejos de estos aviones.

Simplemente Usted no puede confiar en estas organizaciones de “la palmadita en la espalda” que están abriendo una brecha en la seguridad biológica y obviamente violando todos los procedimientos de seguridad pública, incumpliendo los protocolos BSL de nivel 4 y por tanto, exponiendo potencialmente a millones de personas en Occidente a una cepa del virus Ébola. Le dejan en un estado dualidad, por un lado el temor al Ebola y al mismo hacen que se sienta seguro sabiendo que su Gobierno podría salvarte con una nueva droga milagrosa llamada Mzapp. Que perfecto es que una nueva cepa de Ebola más concisamente, una versión de ingeniería genética de los Estados Unidos llegue y de repente ya hay una cura en camino, cuando en un momento dado la esperanza para el Ébola en su estado natural era “cero”. El Gremio de los Boticarios y El Gremio de Barberos pronto podrán desplumar al público una vez más a través de su imperio farmacéutico de charlatanería pseudo-ilusoria.

56.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

De haber sido el Ébola natural, original, de ninguna manera se habrían permitido estas infracciones directas, estas brechas en la bio-contención y ya puedes estar seguro de que jamás hubieran sido trasladadas víctimas naturales de Ébola a tierra firme en Occidente. Esta es una versión genéticamente modificada de Ebola con antídotos disponibles que por ahora están un tanto ocultos a la opinión pública. Si no hubiera antídotos disponibles entonces el cartel piratas comerciantes que están detrás de la movida como Bill Gates (Bill y Melinda Gates) y George Soros (Soros Foundation) [tienen fundaciones sólo para reducir impuestos] nunca se atreverían a traer el Ebola a las costas occidentales por temor a su propia seguridad. Así que hagan lo que hagan será sacar un antídoto del Ébola por ingeniería genetica o simplemente repartir falsos comunicados sobre el Ebola a través de su red de medios de propaganda como una operación psicológica masiva asistida previamente por películas previas de conclusión predecible como 'Estallido'. Yo no estoy tan seguro de que sea una coincidencia, pero pienso en el hecho de que la gripe de 1918 se originó en los Estados Unidos, en los campamentos militares de Estados Unidos y luego se extendió por las tropas estadounidenses en Europa, donde finalmente se la llamó la gripe española por la simple cuestión de que como la prensa Española de la época no estaba sujeta a censura como la de los países beligerantes publicaba este tipo de noticias. ¿Podríamos estar viendo cómo sale información simbólica afirmando que este podría ser el próximo gran evento como la gripe de 1918 lo fue en día o al menos se va a fabricar para convertirse en el próximo gran tema de discusión por medios de comunicación utilizando mentiras y estafas viejas y nuevos? Piensa en ello mientras echas un vistazo a mis artículos anteriores sobre el Ébola y su tratamiento.

MIGUEL PAJARES : THE BIGGEST BREACH OF BIO-SECURITY REGULATIONS IN SPANISH HISTORY MULTIPLE VIOLATIONS OF BIO-SECURITY LEVEL 4 PROCEDURES OCCURRED DURING THE TRANSIT AND HOSPITALIZATION OF PAJARES MASSIVE VIOLATION OF SPECIAL AGENT AND TOXINS REGULATIONS SPANISH PEOPLE EXPOSED TO EBOLA UNNECESSARILY FAR MORE SERIOUS THAN THE U.S. CDC ANTHRAX LAB SCARE SPANISH POLICE MUST INVESTIGATE IMMEDIATELY 57.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21 MARIANO RAJOY SHOULD RESIGN OVER BIOLOGICAL NINE ELEVEN FALSE FLAG CDC SPOKESWOMAN LIES TO THE PUBLIC BIOLOGISTS AND VIROLOGISTS MUST CHALLENGE OFFICIAL NARRATIVE SPANISH GOVERNMENT LOSES ALL CREDIBILITY, CANNOT BE TRUSTED TO MANAGE ANY ASPECT OF EBOLA QUARANTINING INCLUDING EBOLA TESTING KITS MOST SERIOUS BREACH OF BIO-SECURITY REGULATIONS SINCE BAXTER CONTAMINATED 72 KILOS OF SEASONAL FLU WITH BIRD FLU IN 2009 AND NEARLY TRIGGERED A GLOBAL PANDEMIC

https://www.youtube.com/watch? feature=player_detailpage&v=pHdTgfjGW0E https://www.youtube.com/watch? feature=player_detailpage&v=2eHr5sroQZ4

https://www.youtube.com/watch? feature=player_detailpage&v=7tjRNwTwPPs

58.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

C O M P L E M E N T O

-

O T R A

F U E N T E

La bandera del terror mediático con frecuencia “agita” la expresión “armas de destrucción masiva” la cual a su vez se subdivide en otras categorías. Nos atañe en este artículo la amenaza biológica. El grado de seguridad de los laboratorios donde se “juega” con virus y microorganismos viene certificada (E.E.U.U.) con las siglas BSL (Biosafety level – Nivel de seguridad biológica). Oficialmente se reconoce la existencia de niveles de 1 a 4 (BSL-1, BSL-2, BSL-3, BSL-4) y “oficialmente” no se reconoce el BSL-5 a pesar de que se encuentra en wikipedia ¿ … ?. Recientemente el gobierno norteamericano lo ha “sobreescrito” con otro “BSL-5” dedicado a las plagas agrícolas. Por lo que el incertidumbre del BSL-5 original persiste. Este trataría sobre virus u otros tipos de microorganismos extraterrestres hallados al parecer en meteoritos y hay quien no descarta otras procedencias un poco más fantásticas pero no increíbles.

59.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

BSL 1 y 2 se consideran inofensivos o poco preocupantes para la salud.

BSL-3 está designando un nivel conteniendo agentes que pueden provocar enfermedades muy serias o letales por contacto o inhalación; estos incluyen los arbovirus y arenavirus. Si los requerimientos para la construcción de instalaciones BSL-1 y BSL-2 son de por sí complejas y costosas, ver pg. 283 de 368 - Fuentes: http://www.librevacunacion.com.ar y otras “El lado oculto de las vacunas – Agenda mundial para la eugenesia.v.2.5” lo que implica que de ordinario no están al alcance del “bolsillo” de los supuestos terroristas de opereta que ensombrecen el paisaje mediático, ... ... otra cosa cosa muy diferente son los BSL-3.

Solo con tecnología punta pueden construirse. Solo con auténticos expertos en microbiología pueden ponerse en funcionamiento. Así, ¿Como es posible esperar “ataques terroristas con bioagentes”? ¿O es que alguien en sus sano juicio y con perspectiva no demasiado empañada por las noticias va a admitir que un grupo de agitadores excitados, fanáticos políticoreligiosos y semi-analfabetos han aislado, recreado y/o recombinado tal o cual virus escondidos en un “zulo” o en una cueva del Caúcaso? Hay un dicho para conocer el origen del dinero: “Siguelo”. Hay otro dicho de antropólogos y expertos en lenguas muertas cuando intentan descubrir el idioma primigenio: “Síguelo”. Y lo mismo se aplicaría en el supuesto caso en el que un grupo “terrorista” liberara un agente muy infeccioso y éste provocara una situación social crítica. Lo que estaría fuera de lugar sería enfocar la investigación hacia estas posibilidades: a) los terroristas consiguieron en cilindro de acero sellado, criogenizado y repleto con virus en un cupón de rasque-y-gane; b) fue un regalo de una ancianita a quien ayudaron a sacar la basura; c) estaba abandonado sobre el banco de un parque donde juegan niños y pasean las mamás; d) comprado rebajado el el mercadillo semanal de Tordera; e) no se sabe.

De modo que como quiera hay menos BSL-3 que churrerías no resultaría muy difícil descubrir el origen de tal o cual virus tras un atentado bioterrorista prefabricado.

Lo que nos llevaría, “siguiendo al virus” a las más altas autoridades del planeta; entiéndase los psicopatas invertidos del N.W.O. Para concluir: quedaría el BSL-4. ¿Habéis visto “12 monos”? Eso es todo.

F I N

C O M P L E M E N T O

60.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 13 2014 El virus Ebola sigue con la curva de expansión mensual 1.83 Creo firmemente este brote es intencional. También creo que está en al menos 100 países, pero que aún no se sabe nada. Es lógico que este sea el caso. Esto se debe a que en las primeras etapas es totalmente contagioso y no puede ser detectado durante semanas, hasta que de repente explota como un verdadero y obvio caso de ébola.

Así es como los planificadores de la Agenda 21 lo tendrían preparado, una enfermedad tan seria que fuera imposible de detener para la que los controles de temperatura en los aeropuertos solo serían una broma. No significan nada en absoluto. No detienen de nada en absoluto. Si no se establece una cuarentena total sobre África, probablemente el mundo está jodido (¡Oh!, espera, ya está jodido porque una cuarentena total contra esta cepa tendría que haber sido puesta en marcha HACE MESES).

Como medida de precaución, ahora estoy tomando diariamente un gramo de vitamina C. Esto pondrá mi cuerpo al máximo al máximo de sus posibilidades ante una situación pre-ébola (punto en el que comienza el “volcado” de vitamina C) ¿Y por qué creo que la vitamina C es una protección legítima? Debido a que el médico que tenía ésta, su investigación, terminó en mi buzón de correo, un trabajo que no he podido encontrar en Internet después de búsquedas cruzadas, así que no procede de un blog de alguna parte, dijo también que había otra cura conocida —que la sangre de un superviviente ebola ebola cura si se recibe a través de transfusión. Y el MOA incluido tenía perfecto sentido médico, puedo no ser médico, pero al menos puedo filtrar la mayor parte de la desinformación que circula como verz y sé de jerga médica legítima lo suficiente como para detectar un estafador. No había nada que indicara una estafa en el mensaje del doctor.

Así que una vez más voy a sacar a la palestra el consejo médico completo, condensado por mí añadiendo primero propio conocimiento, seguido por el mensaje original del médico.

Como medida de precaución, sal a comprar un gran bote vitamina C, ya sabes, barato y de sabor agrio, si es acidulado sabes funcionará (las preparados dulces probablemente que sean basura.) Para ahorrar dinero no te molestes con el que lleva escaramujo en vitamina C si el precio es un problema, la clave está en contar con una buena cantidad. Tomar por lo menos un gramo diario, y hasta cuatro gramos si lo deseas durante el tiempo que este brote de ébola se mantenga por debajo del millón de muertes. Una vez que esta cifra se sobrepase, empezar a ingerir más cantidad porque hay una alta probabilidad estadística de que ya hayas contraído ébola. Yo recomendaría una dosificación de choque a razón de 12 gramos diarios si tus reservas no han caído por debajo de 500 gramos. Si realmente contraes el ébola, es probable que haya ninguna razón para “despilfarrar” tus reservas tomando más 24 gramos por día.

El médico mismo dijo que las dosificaciones de 500 gramos al día eran extremas y probablemente no serían necesarias, pero en última instancia, quizá si. Pero la único que la vitamina C hace es ayudar a detener los síntomas del escorbuto como resultado 61.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

de la pérdida masiva de vitamina C (que el ébola agota) y la pérdida completa de vitamina C provoca una hemorragia interna masiva por debilitamiento extremo de las paredes arteriales, que es así como mata el ébola. Como 24 gramos son 23,5 gramos está más allá de lo que su organismo podría requerir en una situación normal para evitar el escorbuto, es probable que sea un máximo seguro. Más, probablemente sería un desperdicio.

La vitamina C no mata el ebola, simplemente detiene el escorbuto causado indirectamente por el ebola y evita que llegue a suceder el modo —hemorragia interna— en que el ébola mata. En ausencia de esta característica del ébola, sería una infección inofensiva y un sistema inmune normal acabaría él. La vitamina C frena el daño durante el tiempo suficiente como para permitir que el sistema inmunitario responda.

Y ahora mi exposición lógica, basada en el sólido conocimiento que ya tengo: Evitar el ajo, los chiles, el ginseng y nada picante porque estos elementos diluyen la sangre, lo que empeoraría los síntomas del ébola aumentando hemorragia interna a pesar del hecho de que estas especias ayudan contra muchas otras enfermedades.

Come montones de brócoli y espinacas, porque esos dos alimentos ayudan a la coagulación de la sangre y reducen el sangrado interno. Quédate en cama para reducir el estrés relacionado con la rotura de vasos sanguíneos, y bebe una gran cantidad de jugo de piña o jugo noni de sabor natural sin endulzar porque Noni contiene una potente sustancia antiviral, y si tienes que ir a lo barato, la piña contiene el mismo ingrediente en una concentración 1/10 (o sea, que en lugar de beber 28 grms de jugo de noni, beber 10 veces más de jugo de piña y el jugo va a funcionar; la pasteurización no destruye el componente activo del noni. Con un litro de jugo de piña consumido diariamente debería darte el máximo beneficio.

En última instancia, no puedo confirmar al 100% no haber sido burlado por este médico, pero todo esto se aclara con lógica y por lo que ya sé; no podría obtenerse beneficio alguno por ningún estafador on-line con todo esto, y yo ya estoy tomando vitamina C como precaución y te sugiero que al menos empieces en serio tu mismo ahora mismo.

Mensaje original del médico sigue: (volver a la pg 4)

62.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 15 2014 (comentario de un lector) Una aclaración necesaria sobre la vitamina C y el ébola Brad escribió: Jim, Acabo de encontrar su sitio web, y lo leo todos los días. Trato de ser un tipo sensato y siempre estoy buscando la verdad. Desde que vi Zeitgeist hace 6 años, me he convertido en una persona más consciente. En la búsqueda de la verdad que he aprendido a perfeccionar mis habilidades "detector de mierda '. Como dice la película, cuando se aprende la verdad, empiezas a ver mentiras en todas partes. Creo que usted y lo que hace está más cerca de la verdad que el 90% de los otros por ahí. Como acotación al margen, me gustaría saber lo que piensa de David Hodges, leí su sitio también.

Debido a lo que ha escrito acerca de la situación del Ébola, acabo de comprar 10 libras. de ácido ascórbico para mí y mi hijo de 9 años.

Y al hacer más investigación, empecé a buscar en la Red sobre cuanto podría ser 'demasiado' diariamente, para mí y para mi hijo.

De acuerdo con los 3 mejores búsquedas de Google se dice que el cuerpo no puede utilizar más de 250 mg/día para mí, y alrededor de 45 mg/día para mi hijo.

Esto es mucho menos de lo que usted afirma que usted piensa que puede ser necesario, y solo quiero saber si usted desea comentar acerca de esto?

Si tomo 24 gramos al día, y mi hijo necesita 12, tengo un suministro de 4 meses.

Gracias por todo lo que están haciendo.

Brad Hendricks --Mi respuesta: Los números que tienes son exactos. Sin embargo, la vitamina C tiene un umbral de toxicidad tan alto que sería racionalmente imposible que alguien pueda comer lo suficiente para envenenarse.

Mi consejo? Si las botes que compraste tienen comprimidos de 500 mg, toma uno por día mientras el ébola no se haya expandido en la zona donde usted vive. Si tiene comprimidos de 1000 mg, toma también uno por día, a menos que quiera tomarse la molestia de partir los comprimidos en dos.

Si ébola se expande peligrosamente en su área, dosaje de choque de al menos 65.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

cinco gramos por día, porque eso no le hará daño y si usted se viene abajo con el ébola, su cuerpo va a necesitar mucho más que las cantidades requeridas oficialmente establecidas y sería mejor tener, de entrada, un buen comienzo sobre ciertas cosas. Incluso un resfriado incrementaría sus necesidades hasta varios gramos por día. 250 mg es para condiciones normales y es cierto que su cuerpo va a tirar o desperdiciar cualquier cantidad por encima de esas necesidades 'normales'. Así que mantenga sus 4,5 kgrs disponibles conservándolo hasta que haga falta, esa cantidad salvará a toda una familia. Buena compra, e incluso si el ébola nunca arranca he descubierto que la vitamina C tiene una duración prácticamente indefinida si se mantiene perfectamente seco y no se calienta nunca. Los índices de rotura guardan relación con las condiciones, no es un valor establecido.

Zeitgeist era bueno. Un verdadero abridor de ojos. Un poco antirreligioso para mí, pero aún así una buena pieza.

No presto atención a otros sitios hasta que atacan el mio, citaré los artículos buenos, pero soy un fan de nadie porque eso puede causar ceguera. Si David Hodges es atacado por gente como Rense, eso sería una luz verde, que es probablemente bueno. David no ha atacado este sitio. Así que nunca me llamó la atención de una manera negativa.

Gracias por escribir, esto va en la primera página de aclarar la cuestión de la vitamina C. --algunos enlaces para la vitamina C http://lpi.oregonstate.edu/es/centroinfo/vitaminas/vitaminaC/ http://www.institutobiologico.com/seminarios/linus%20pauling.htm http://www.dsalud.com/index.php?pagina=articulo&c=579

Linus Pauling, 2 veces ganador del Premio Nobel de Medicina Todas la webs desinformadoras sobre Linus Pauling y sus afirmaciones sobre la vitamina C se parecen a esta <http://www.quackwatch.com/01QuackeryRelatedTopics/pauling.html> ya sea en Inglés, Castellano u otro idioma. En algún punto de la Red hay una “web '0'” y a partir de aquí todas son clones. Lo curioso es que “solo unos pocos” increpaban a Linus mientras vivía; una vez fallecido aparecieron “todos” los desinformadores, envidiosos, médicos-mercenarios a sueldo del cartel farmaceútico y demás resentidos y frustrados. Desde luego ni uno de ellos ostentaba los méritos que le llevan a uno a recibir el preciado galardón del Nobel. Hay que aclarar que aquéllos que inútilmente intentaban refutar la validez de los trabajos de Linus en torno a la vitamina C como el más potente anti-cancerígeno eran y siguen siéndolo médicos mercenarios a sueldo de la lucrativa industria del cáncer. Todos los informes presentados por éstos estaban falseados de uno u otro modo y su único objetivo es y era crear confusión a través de los medios.

66.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ On 2014-08-18 Mi buzón está saturado con correos de los desinformadores de la vitamina C Y a eso es lo que yo llamo mentiras descaradas y eso sólo significa que el informe Ébola es más que probable haya dado en el clavo.

Hoy me dijeron (varias personas) que los preparados baratos vitamina C no funcionan y que únicamente lo hace la plata coloidal, así que POR FAVOR, COMPRAD NUESTRO SISTEMA DE PLATA COLOIDAL AUNQUE SEA MUY CARO. Dios no lo quiera que vayas a Sams Club o Wal Mart, y te gastes € 6,00 en un gran bote de vitamina C barata y acabes por ignorar todo lo demás, esperamos.

Aquí está la exclusiva, gente ••• Cualquiera que diga el ácido ascórbico no funciona contra el escorbuto (que te diga la razón) es un tonto o un charlatán, y puedo dar fe de manera asertiva. A lo largo de mi vida, a veces, he sobrevivido a base de Pringles, Puffs de queso y Doritos. ¡Ya! Yo soy uno de esos tipos. De cualquier forma, esto conllevaba, en ocasiones, ligeros síntomas de escorbuto, y el tema es que dos o tres comprimidos de ácido ascórbico barato siempre me han funcionado MEJOR QUE COMER UNA BOLSA ENTERA DE 2,5 KGRS DE NARANJAS; así que llamo mentirosos a los estafadores que tratan de vender ridículamente caros artículos especializados, no hay ningún secreto en todo este tema.

Las pruebas complementarias están ahí fuera precisamente en los alimentos para los conejillos de indias. Igual que la gente, los conejillos de indias necesitan vitamina C, y si alguna vez lees la etiqueta de ingredientes de una bolsa de comida para cobayas nunca dirá "tenemos una mezcla especialmente seleccionada de brotes de abeto y escaramujo rosa" NO, SIMPLEMENTE DIRÁ ácido ascórbico PORQUE CUMPLIRÁ CON SU FUNCIÓN; no caiga en cualquiera de las muchas estafas que hay por ahí. Hay tanto fraude sobre este asunto circulando en estos momentos que pone los pelos de punta, y sin duda alguna, significa que algo está pasando. Y si nada estuviera pasando, ¿a quién rayos le iba a importar que anduviera por aquí dando consejos sobre cómo y dónde comprar barato el producto ilustrado en las imágenes de esta página? Si siempre funcionó, ¿cuál es el problema ahora?

Creo que la cuestión es que el brote de ébola es altamente probable que sea real, man-made, y con una agenda. Puedo convencer fácilmente a la gente para que se gasten 7 u 8 € a modo de seguro contra esta agenda, pero si esta misma gente de repente cree que todo está envuelto 67.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

en un halo de misterio, pocos se prepararán y la orden del día —La Agenda 21— se iniciará.

Mi principal objetivo es detener la progresión del mal, no obtener beneficio alguno o tratar de disipar absurdos misterios, y que podría ser más sencillo, fácil y barato que ir al Wal Mart, donde de todos (probablemente) vas a ir esta semana? Y si no, el Wal Mart, Kmart, Target, Shopko, etc.

Y no caigáis en la trampa de la plata coloidal, es mi opinión que los distribuidores de plata coloidal son engatusadores vendiendo un producto que lleva 0,15 céntimos de € de plata y lo venden por € 30,00, a estos tipos lo que menos les importa es el futuro de tu salud; es más, no les importa ninguno de los dos. La plata coloidal es legítima como antibiótico; los métodos de venta y afirmaciones antivirales no lo son.

La plata coloidal es barata, muy barata, TAN BARATA QUE PUEDE PREPARARSE UNA BOTELLA DE ½ LT COMPLETAMENTE EFECTIVA POR MENOS DEL COSTO DE LA BOTELLA (0,40 céntimos de €), y no hay ningún secreto para ello; NO HAY MÉTODOS ESPECIALES; NADA. Tu puedes preparar una estupenda plata coloidal GRAN con sólo, alambre de plata barata, o una barrita de plata de 28 grms, unas pocas pilas medio gastadas AA que aún tengan cada una al menos un voltio y un soporte barato para las pilas que puedes comprar en Radio Shack —en España en cualquier tienda de componentes electrónicos—. Hice la mía con un soporte para 8 pilas, asegurándome que podría utilizar baterías completamente gastadas (en apariencia). Y esto echaría fuera cualquier infección —bacteriana—, así que ¿por hilar tan fino con las diferentes formas de hacer plata coloidal por tu cuenta si es tan fácil?

Y así, la plata coloidal hace NADA contra los virus, lo único que la plata coloidal hará en una situación de infección vírarica es prevenir infecciones bacterianas secundarias que pueden presentarse si están presentes bacterias oportunistas y se desarrollan allí donde virus hizo daño. Eso es todo, coged las afirmaciones de la plata coloidal "¡CURA ÉBOLA!" sin importar lo convincentes que suenen y tiradlas a la basura; todo es un montón de tonterías urdidas por especuladores que no darán un pimiento por ti o cualquier otra persona. Ten plata coloidal a mano; está bien para otras cosas, NO PARA ÉBOLA. Así que para resumir, creo que una combinación de especuladores y los tipos del Nuevo Orden Mundial están ahí fuera con meticuloso un orden del día, 1º para hacer un montón de dinero en efectivo a costa de la ignorancia, y 2º para llevar a cabo varias objetivos con un brote de ébola que les permitirá proceder sin inhibiciones.

68.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 19 2014 Se acelera la expansión del ébola Hace aproximadamente un mes, publiqué la tasa de expansión del ébola, estaba en 1.83 mensual, y presenté los cálculos que mostrarían lo que ocurriría, en este caso, cuatro mil millones fallecidos a mediados de 2016; en ese momento esperaba que el ritmo de expansión decrecería, sin embargo se ha acelerado de forma espectacular Ahora, con una tasa de expansión de 2,28 mensual, si continua esta tendencia, Ebola matará a 4 mil millones antes de finales de 2015.

Liberia ha instaurado un estilo de cuarentena común en el S.XIV consistente en disparar a matar a primera vista para ayudar a detener la propagación, pero su efecto será dudoso cuando ha llevado tanto tiempo empezar con una respuesta de esta naturaleza y mientras tanto tanta gente ha llegado y se ha ido a otros lugares en el mundo.

Además, Sierra Leona y Guinea tienen igualmente serios brotes y no han establecido una cuarentena similar.

Ahora mismo Berlín tiene un edificio sellado y en cuarentena con un caso sospechoso de Ébola, y si realmente se determina que es ébola, y la propagación del virus es aérea, todas las medidas de contención en África se han esfumado. Como quiera que esta cepa es contagiosa y permanece asintomática durante tres semanas, sería completamente posible tener miles de portadores corriendo por Europa sin tener ni idea de la posibilidad de que estén enfermos.

El mundo es diferente ahora de lo que era durante las plagas del pasado. En el pasado, la gente almacenaba grandes cantidades de alimentos lo que les permitía podían quedarse en casa solo si no quedaba otro remedio. Pero para la sociedad moderna no es lo mismo, la gente tiene que salir sólo para sobrevivir y eso hará muy difícil que se cumplan las cuarentenas. Si este virus se suelta en Europa, será lo más parecido a “game over” o fin del juego.

Creo que fue intencional Prácticamente todo el mundo sabe que esto ha sido un ensayo de armas biológicas, posiblemente no ha salido mal. Israel quiere desesperadamente al mundo distraído mientras le dan un impulso a Eretz-Israel, donde aniquilarán Palestina y posteriormente, para llevarlo a buen término Israel tiene que tomar la mayor parte de Arabia Saudita, toda Siria, Jordania y el Líbano, Irak y parte de Irán. ¿Qué mejor manera de hacer que el mundo permanezca al margen que teniendo a toda la humanidad corriendo por sus vidas? Es una apuesta segura que Israel tiene la cura y no se verá afectada.

69.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Además, ¿Qué mejor cosa podría haber para suprimir completamente a los Estados Unidos que una amenaza Ebola?

El Departamento de Seguridad Nacional tendría la oportunidad de vivir a la altura de sus intereses, y cualquier persona con una pizca de sentido común sabe que la agencia siempre ha estado ansioso por un momento así.

Finalmente, también América sería destruida por un brote de Ébola.

Además, La élite desprecia la raza negra. Este es un hecho simple. El odio racial no existe para un frente tormentoso ni con cualquier patético e impotente grupo del 'heavy metal'; el odio racial real existe en aquellos que están presionando para que la despoblación mundial como se describe en la “Agenda 21”. Y, simplemente, porque las vacunas anti-fertilidad y abortos no están funcionando lo suficientemente rápido.

Una cita de David Hodges (vinculada arriba) “En la década de 1980, la crisis de la población parecía haber terminado. La tasa de reemplazo de la población necesaria para mantenerla es de 2,1 hijos por mujer y en todo el planeta esa norma básicamente se mantuvo. Sin embargo, hubo una excepción importante y esa estaba en el África subsahariana.

“Expertos en población de las Naciones Unidas y políticos del mundo convocaron lo que ahora se describe como la primera conferencia de la Agenda 21 en el año 1994 en la que una evidente estrategia de despoblación fue reemplazada por una agenda centrada en otorgar poderes económico-sociales a las mujeres a través de la igualdad de oportunidades de empleo y por lo tanto retrasar el parto y la disminución de la tasa de natalidad. Además, la ONU y los líderes mundiales patrocinaron encubiertamente un mayor acceso al control de la natalidad y el aborto, por lo tanto, matar bebés no nacidos, en cumplimiento del deseo expresado por Margaret Sanger.

“En sus inicios estas estrategias de despoblación son benignas, incluso el azote del aborto, cuando se las compara con más agendas de proyectos negros que se realizaron al mismo tiempo. El problema con el uso de los diversos métodos de control de la natalidad es que son procesos multi-generacionales lentos y esta falta de progreso rápido no da a la élite lo que necesita y quiere que es despoblar el mundo rápidamente.

70.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

“Para lograr cambios espectaculares en la población, se necesita una agenda más radical.

Métodos más mortíferos que involucren guerra y enfermedad son preferibles a los ojos de los miembros de la élite gobernante que desean resultados rápidos, que son necesarios para salvar al planeta del cambio climático antropogénico. Esto es lo que sostengo y es exactamente lo que estamos empezando a ver”.

Y estoy totalmente de acuerdo. Ya que la élite fracasó al tener África bajo control con métodos decorosos, lanzaron allí una nueva cepa de Ébola para conseguir “resultados”, sus resultados, rápidamente. Es obvio, que el ébola fue originalmente un virus super estable que no habría cambiado durante milenios. ¿Qué provocó ese cambio radical para que ahora su transmisión fuera aérea? ¡¡¡Adivínalo!!!

Obviamente, la razón entera para despoblar el mundo —el cambio climático— es un montón de basura. La superpoblación también era un montón de estupideces, y nada sucedió. En el pico del 'boom' de la población, se calculó que si los recursos de Texas fueran optimizados con la tecnología actual, ese pedazo de tierra solo podría dar cobijo y alimentar a todos en la tierra. Obviamente, el mundo no puede 'encargarse' de billones de personas, pero de unos pocos millones, ¡SI QUE PUEDE! Entonces ¿por qué tienen tanta prisa los que presionan la sin lugar a dudas luciferina Agenda 21? La respuesta para mí es simple —Ellos saben muy bien que este mundo es un campo de pruebas, donde hemos sido enviados para ser probados y juzgados viviendo una vida y demostrando de que estamos hechos. Y hay miles de millones de almas que tienen que pasar por este proceso. Creo firmemente que los clanes luciferinos/Ashkenazi saben que se trata de la realidad subyacente, y están tratando de ralentizar el proceso mediante la eliminación de gente, ya que cuando este proceso ha terminado y todo el mundo ha tenido la prueba, ese será el día del juicio y cuando llegue ese día, ESTÁN ACABADOS. Tener unos mil millones de personas alrededor del mundo alumbrando nuevas vidas no es lo que quieren, eso llevaría a su desaparición antes de lo que desean. No hablo de la religión a menudo, pero con respecto a la agenda de despoblación, eso es exactamente lo que pienso.

71.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 20 2014 Actualizaciones del Ébola 4 casos sospechosos de ebola DETECTADOS AHORA EN BIRMANIA y si Ébola despega desde allí, … … GAME OVER – FIN DE JUEGO. Esta versión en Inglés de la historia podría ser más fácil de entender

¿Con un periodo de incubación de 21 días, bien, la Agenda 21? Quizás sólo sea una coincidencia, pero si se modifica genéticamente, tal vez no. Y con un período de incubación de 21 días antes de que aparezca algún síntoma significa que el ébola podría estar en cualquier lugar y en todas partes en este momento, sin ser detectado. ¿Cómo se diagnostica aquello que no presenta síntomas? Sólo a través de controles en la población se sabría quien lo tiene.

REALMENTE INTERESANTE El parvovirus7 es una forma de fiebre hemorrágica de los perros, tan letal para los cachorros como el ébola para los humanos. Y, el sustituto de Toti ha contraído parvo. Ayer, el sangrado fue grave, así que le administré alrededor de 100 miligramos de vitamina C. Esta mañana, había muy poca sangre, así que administré una dosis adicional de 150 miligramos de vitamina C. Será interesante ver cómo concluye todo esto, si la vitamina C detiene el sangrado, sin duda encajará en el tratamiento de Ébola 7

.- El parvovirus de la familia Parvoviridae, que afecta incluso a humanos —parvovirus B19, patógeno para el hombre—, es una de las enfermedades contagiosas más frecuentes en los perros. En algunos países es la enfermedad canina más común. El parvovirus está causado por un virus que lleva el mismo nombre. Esta enfermedad afecta el tracto digestivo de los perros y puede afectar el músculo cardíaco en cachorros muy jóvenes. El parvovirus fue identificado en 1978 y desde entonces se han encontrado cepas mutantes del virus.

Aunque existe una vacuna para prevenir la enfermedad, son muchos los perros vacunados que enferman. No obstante hasta no hace mucho, antes de la época de las mascotas domésticas idiotizadas desplazadas de su entorno natural, la mayoría de los perros que contraían virus 'caninos' como el paramixovirus, conocido vulgarmente como 'moquillo', de la familia Paramyxoviridae sobrevivían sin secuelas. (N. de los T.)

72.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Ahora bien, estoy seguro de que hay algunos estirados estudiosos universitarios que como tienen un título en medicina dicen, sé que no sabes “maestro de nada” porque el parvo no es el ébola por lo que ya puedes cerrar la boca y dejar de hablar del tema, hay tipos por ahí que van a abalanzarse sobre esto, y mi respuesta es: la universidad solía ser valiosa, porque sólo los mejores y más brillantes conseguían acabarla, por lo que la universidad era una prueba de fuego para probar que alguien se merecía una posición de confianza de alto nivel porque estaba garantizado que podrían desempeñarla si podían graduarse.

Hoy en día, la universidad es fácil y como resultado prácticamente todo el mundo tiene un título universitario por lo que tenerlo no significa necesariamente ser un “maestro en nada”. Los universitarios promedio y por debajo de la media andan por ahí con un pedazo de papel afirmando que son "expertos" a tiempo completo, cuando en realidad son los tontos incapaces pensar y ver lo obvio Incluso cuando 1/10 de un gradiente se sale fuera de lo que dicen los libros (si es que pueden recordar tanto) semejantes individuos son inútiles cuando las cosas se ponen difíciles o cuando hay una curva cerrada en la carretera, el tipo exacto de curva QUE UNA GENUINA EDUCACIÓN UNIVERSITARIA DEL PASADO ASEGURARÍA QUE CUALQUIER PERSONA QUE FUE “ENTITULADA” PODRÍA SEGUIR ACTUANDO ADECUADAMENTE. Hoy en día con frecuencia los colegios producen idiotas bien entrenados en masa, que, sobre el papel no sirven para nada, un agricultor podría darles 100 vueltas en cualquier momento debido a que tiene que pensar para mantener todo en marcha.

Esta diatriba se dirige a un veterinario bien capacitado, sobre el papel, que no podía entender por qué habría de darle agua del océano a mi perro (me dieron casi 4 lts de agua del océano cuando viajaba preparando el vídeo de tren) y mientras este veterinario tampoco entendía que sería perfecto para sustituir electrolitos, simultáneamente este mismo veterinario estaba diciéndo que tendría que darle electrolitos a mi perro. Y Pedialyte8 no era aceptable, ¡SOLO AGUA DE MAR! El veterinario tampoco podía entender por qué habría de darle al perro plata coloidal para prevenir infecciones digestivas secundarias, ¿POR QUÉ le daría sopa de pollo al perro (para forzarle a beber agua mientras come porque los cachorros con parvo a menudo no beben agua y se deshidratan hasta morir) y otras cosas. ¿Por qué estoy despotricando sobre un veterinario? Porque, si despega el ébola, estos médicos idiotas teóricamente bien entrenados con todos sus diplomas y títulos que hay por ahí a patadas serán incapaces de pensar; es más, ¡No, incluso peor! ¡Entrarán en negación!; TENDRÁS QUE MOVERTE POR TU CUENTA Y ESTARÁS MÁS SOLO QUE LA UNA. Te encontrarás tan desamparado como un cachorro con parvo.

Los médicos modernos sólo pueden prescribir productos, ya no conocen la medicina y no serán capaces de aceptar cualquier solución que no venga de un libro. Y se quedarán ahí sobre el pedestal de la arrogancia diciendo que vitamina C es charlatanería, simplemente quédate ahí y muere, no podemos ayudarte y ¡OH, NO TE MOLESTES EN TOMARLA!, Porque podría estresarte todavía más. ¡PANDA DE IDIOTAS! 8

.- Marca comercial de una solución de Rehidratación Oral

73.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Salí de la oficina del veterinario cabreado, un poco más tarde encontré a un veterinario diferente, un señor algo mayor, de la vieja escuela, y pensaba que la idea de darle a mi perro agua del océano para reemplazar electrolitos fue lo más acertado; que la sopa de pollo era lo más acertado, y que todo lo demás que hice fue perfecto, aunque nada de esto estaba en los libros. Y es que el veterano veterinario era capaz de pensar por si mismo.

Así que, si la vitamina C que le di al perrito resuelve el problema del sangrado, lo lógico sería que los síntomas de otro virus hemorrágico pudieran aliviarse con la vitamina C. De los resultados de esta mañana, tendría que decir que hasta ahora va bien, mantendré actualizado este punto.

Como quiera que tomar una tableta de vitamina C todos los días, es algo que mucha gente hace como algo natural, lo recomiendo encarecidamente como un paso preliminar a modo de medida preventiva. ¿Qué podría ser más sencillo, barato y corriente que eso? Empieza con un comprimido diario hasta que las cosas se pongan difíciles, luego, … … … …

74.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 21 2014 Mi experiencia personal con mi perrito Ebola, parvo y Vitamina C - ¿Es que tiene el Parvo la respuesta?

Jim Stone, 21 de agosto 2014 La vitamina C detuvo inmediatamente la pérdida de sangre en un cachorro con parvo, lo que confirma que, con toda probabilidad, la vitamina C impide sin duda la pérdida de sangre causada por el ébola Parvo es una fiebre hemorrágica de los perros que tiene la misma tasa de mortandad en perros no tratados como ébola en las personas. Recientemente tomé un cachorro de la calle (después de que me quitaran el mio). Rápidamente Este perrito se vino abajo con Parvo. En un último esfuerzo para salvarle, le administraba vitamina C con una jeringa donde previamente la había disuelto y, como si fuera un chorrito de agua, la vaciaba directamente en garganta del cachorro y la mañana siguiente heces del cachorro estaban limpias de sangre y el animal volvió a comer normal al cabo de 12 horas; y su comportamiento fue completamente normal, propio de los cachorros, al cabo de 36 horas.

Decidí probar la vitamina C para detener la hemorragia interna, que se tornó lo suficientemente grave como para matar al cachorro con gran rapidez. La razón por la que pensé vitamina C podría funcionar es porque parvo es un tipo de fiebre hemorrágica que afecta a los perros, y SI el médico que escribió a este sitio web para decir que la vitamina C detiene la hemorragia y previene la muerte en los infectados de Ébola tenía razón sobre el tema, imaginé que podría funcionar igualmente para un perro con parvo. Lo hizo, y funcionó tan rápido Estaba absolutamente asombrado.

H i s t o r i a 1. Un cachorro abandonado en perfecto estado de salud (aparte de las pulgas) fue recogido de la carretera, llevado en casa y despulgado.

2. Al cabo tres días, el cachorro tenía sangre en las heces, fiebre alta, y dejó de comer 3. El cachorro fue llevado a 3 veterinarios diferentes, 2 de ellos afirmaron que se trataba de parvo, y un tercero dijo que serían necesarias un montón de pruebas para afirmarlo o desmentirlo, y ¡cómo no! que yo no sabía lo suficiente como para solucionarlo, lo que se traducía en que tendría que gastar un montón de dinero en la consulta de este veterinario que llevaría a cabo las pruebas necesarias. Así que me fui a otro lugar porque ya le estaba dando al perro sopa de pollo (lo único que iba a tomar) para mantenerlo hidratado. Los otros dos veteranos dijeron que eso era lo correcto a hacer aunque no había nada que pudiera hacer la sopa para detener la hemorragia, y tan solo sólo las medidas preventivas para detener las 75.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

infecciones secundarias y mantener al perro hidratado le darían una oportunidad.

Durante los primeros días, la hemorragia interna en las heces del perro no parecía lo suficientemente seria como para amenazar su vida. Pero al quinto día se puso muy serio; el perro se perdió una gran cantidad de sangre. Sabía que no había forma alguna de que el perro sobreviviera un día más si no se detenía la hemorragia. ASÍ QUE, ya que un médico me escribió diciendo que la vitamina C detiene hemorragias internas causadas por el ébola, y ya que Parvo es básicamente un ébola 'perruno', empecé a investigar en la Red para asegurarme de que la vitamina C no fuera a envenenar al perro.

Pues resulta que, los perros fabrican su propia vitamina C, y la necesitan. Pero durante las infecciones virales o ejercicio serio o intenso, la vitamina C de un perro puede bajar a cero porque no pueden sintetizarla lo suficientemente rápido, y su salud se resiente. Además, al igual que con la gente, no hay tal cosa como la posibilidad de envenenar a un perro con demasiada vitamina C. Así que con una ventana terapéutica infinita para trabajar, disolví una tableta 500 mg de vitamina C en agua, pasé unos 100 miligramos (contenido disuelto) a una jeringa de 3 cc y colé un chorrito en la garganta del perro. A la mañana siguiente solo había un poco de sangre 'vieja' en las heces. Esa mañana le eché al animal otro chorrito de 150 mg por la garganta. Esa noche la caca era normal, y el cachorro comenzó a comer normalmente.

Por la mañana (36 horas después de la primera administración de la vitamina C), el cachorro estaba animoso y juguetón, comiendo como un caballo y sus heces perfectamente normales.

Todos los detalles Los perritos con parvo mueren por la pérdida de sangre, anemia, deshidratación y falta de electrolitos. Así que, para dar al perro la nutrición que necesita, para reemplazar la sangre perdida, para reponer los electrolitos, y mantenerlo hidratado, hice sopa de pollo (auténtica, no de sobre) significativamente sobre hervida para extraer tantos nutrientes como fuera posible del de pollo y conseguir un caldo más enriquecido. El cachorro no quería beber agua pero sí el caldo de pollo, que era mejor que el agua. Para obtener los electrolitos necesarios en el caldo de pollo, añadí una taza de agua del océano porque me imaginé que tendría un buen equilibrio. Esto mantuvo el cachorro vivo con aporte de líquidos durante unos días, antes de que el sangrado fuera extremadamente grave.

En el quinto día, se presentó una situación de vida o muerte, en la que el cachorro comenzó a perder tanta sangre que la muerte era algo obvio, así que lo intenté con la vitamina C, que funcionó a la perfección. Lo siguiente perfila exactamente lo que se hizo.

Muy importante saber —esto equivale a un tratamiento experimental que no está documentado, por lo que es un posible avance para perritos y Parvo por lo que las implicaciones de la vitamina C y el ébola son obvias.

-0-0-0-0-0-0-0-0-0-0G A L E R Í A

D E

F O TO S

76.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

77.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 23 2014

El medicamento experimental ZMapp es un fracaso

El fármaco experimental ébola ya cuenta con un “histórico” coincidente con la estadística de fallecimientos promedio actual con relación a los infectados no tratados. Un español fue tratado con Zmapp y murió. Lo mismo ocurrió con un doctor de Liberia. Los dos estadounidenses a quienes se les administró este fármaco sobrevivieron, pero de cualquier forma coincide con el promedio estadístico (… ¿y si, una vez en los E.E.U.U., se corrió la voz y consiguieron acceder a la vitamina C?) En pocas palabras: Todavía no hay nada que funcione por ahí, pero yo fui capaz de detener con éxito el sangrado interno de un cachorro con parvo, el 'ébola' perruno, utilizando vitamina C a razón de 250 mg/kg por día, lo que implica fuertemente que el médico microbiólogo que escribió a este sitio web para declarar que la vitamina C es un tratamiento para el ébola no estaba mintiendo. Mantendré las actualizaciones y una gráfica on-line de este proceso a partir de mañana

78.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://investmentwatchblog.com/zmap-failure-liberia-doctor-given-experimental-ebola-drug-dies/

August 25th, 2014 ¡Fracaso del medicamento Zmapp! Liberia: Un doctor infectado de ébola muere tras serle administrado el fármaco experimental

MONROVIA, Liberia (AP) — Un médico de Liberia que fue uno de tres africanos en recibir un fármaco experimental contra el Ébola ha muerto, según anunció el ministerio de Información del país el lunes.

El Dr. Abraham Borbor, jefe médico adjunto en el hospital más grande del país, fue estuvo entre los tres liberianos, y primeros africanos, que recibieron el fármaco experimental ZMapp. Dos estadounidenses recibieron el fármaco no ensayado aún en seres humanos y sobrevivieron. Un español infectado con Ébola recibió el tratamiento, pero murió. No se ha proporcionado ninguna actualización sobre los otros dos liberianos que tomaron dosis de la droga.

Borbor "estaba mostrando signos de mejoría pero ayer tomó un giro inesperado y empeoró gravemente", según anunció el ministro de Información Lewis Brown a The Associated Press.

No estaba claro si murió la noche del domingo o el lunes.

Sólo cinco personas en el mundo, que se sepa, han recibido ZMapp. Se ha comunicado que la pequeña cantidad existente se ha agotado por completo, y se espera que transcurran meses antes de que pueda producirse por su fabricante estadounidense. http://hosted2.ap.org/APDEFAULT/cae69a7523db45408eeb2b3a98c0c9c5/Article_2014-08-25-Ebola/idef2e59630c674d50b0f0e23b1ec0e45a

79.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 27 2014 Fiasco en el CDC por Enterrar un enlace que relaciona las vacunas con el Autismo

NaturalNews realizó un informe sobre un correo electrónico interceptado al CDC, que levantó la tapa de la estafa de la vacuna para el autismo, lo demostrando así que el CDC encubrió el mencionado vínculo. Efectivamente, el informe al cual se refería el informe del CDC quedó censurado prácticamente al instante tras ser publicado por www.NaturalNews.com, pero yo lo tengo disponible aquí abajo. Tal vez este artículo ejercerá la suficiente presión sobre los censores para que el artículo esté disponible nuevamente.

-oEl texto original censurado en NaturalNews ya no tiene enlace a: http://www.translationalneurodegeneration.com/content/pdf/2047-9158-3-16.pdf (enlace censurado)

El estudio ha sido sustituido por el siguiente texto: “Este artículo ha sido eliminado del dominio público debido a serias preocupaciones sobre la validez de sus conclusiones. La revista y la editorial creen que su continua disponibilidad puede no ser de interés público. Medidas editoriales definitivas quedan pendientes a la espera de ulteriores investigaciónes.”

Correspondencia: Brian S Hooker bhooker@simpsonu.edu Publicado: 08 de agosto 2014 Antecedentes … … … (sigue informe médico) Documento original recuperado (en Inglés) dispnible aquí (6 pgs), enlace: https://mega.co.nz/#!tFB2SJ7b!eHXTKSJU4HEfW-Tb0hnxsRMm58xJvY4nSAsAP72grmI 80.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Y mi respuesta a todo esto es la siguiente (JimStone): Descargar y leer (anterior artículo de JimStone en formato .pdf): “Bacteriófago Nanobot T4 – La Agenda para el control de la Población” Enlace: https://mega.co.nz/#!9EpmGYzQ!R3dLU1X2J_vjvFEJ1P1LaGMlYc4PE-pxt477aYiYkGA -ohttp://www.mediafire.com/view/s02kt98iecomgxu/Nano.show.-.v.2.0.pdf

Complemento imperdible.

Descargar y leer: “El.lado.Oculto.de.las.Vacunas-Eugenesia.v.2.5” Enlace: http://www.mediafire.com/view/yae8zio3hkvgmv8/El.lado.Oculto.de.las.Vacunas-Eugenesia.v.2.5.pdf -ohttps://mega.co.nz/#!8ZIxCQBB!JeAwfSiawDMIIbEJmOD-AnzV59d23HWBF14XPuTImaE

… extractos … del artículo “T-4” paralelos y actualizados al brote de ébola “En realidad, no hay mucho que cuestionar. La respuesta aparentemente es obvia. Ahora la élite va a dar un enorme empujón para que el nanobot bacteriófago T4 y otros aditivos presentes en vacunas contaminadas sean inyectados en toda la población mundial vía mandato por ley inmediatamente. Y sospecho que van a utilizar falsos brotes de Ébola para asustar a la gente y que acepte de buen grado inyecciones contaminadas con nanobots T4, haciendo que todos la reciban la vacuna en un período de tiempo muy breve.

“Más que el vuelo MH370, la crisis de Ucrania, y otros temas, el cierre de los sitios web anti-vacunas precisamente en medio de un "brote de Ébola" es la coincidencia a la que todos deberíamos estar prestando atención, esta es la noticia, si lo pasamos por alto somos susceptibles de ser destruidos.

“EL brote de Ébola PODRÍA INCLUSO SER UN MONTAJE y una de sus finalidades prioritarias, sería engañarte al punto de exigir la vacuna con la única diferencia de que ésta, estaría contaminada con el virus Nanobot T-4 que acabaría por destruirte”.

81.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 28 2014 Confirmación completa: la recomendación de la Vitamina C como coadyuvante para contrarrestar el ébola no es un Sabotaje.

Hoy he recibido conocimientos médicos, aquí va:

la

confirmación

final

que

encaja

con

mis

La forma real como mata el ébola es provocando una severa descarga de citoquinas en las paredes de los vasos sanguíneos, que si ya están irritados por un ataque vírico, se romperán como resultado de la irritación causada por una fuerte liberación de citoquinas. Con respecto a ébola, la citoquina exacta se llama IL-6, que es inhibida hasta en un 41 por ciento con la suficiente presencia de vitamina C en el organismo. Esto quiere decir que, a partir de este modo de acción por sí solo, la vitamina C reducirá el impacto del ébola en un 41 por ciento. Si se combina esto con el hecho de que la vitamina C también fortalecerá las paredes de los vasos sanguíneos, los dos modos en que la vitamina C ayuda, funcionarán combinadas para prevenir la muerte por ébola; especialmente si para empezar, el ébola elimina toda la vitamina C debilitando las paredes arteriales tras la desaparición de ésta. Pero hay más de esto que de eso; la dieta puede jugar un papel muy importante y este será el informe principal de mañana, todavía estoy indagando y poniendo las cosas a punto.

La conclusión es que realmente parece que el ébola puede ser derrotado sólo por comer los alimentos correctos y aportando al organismo suficiente vitamina C (y ausentes los alimentos correctos, la vitamina C es más o menos como una bala mágica), pero la dieta también puede ayudar mucho.

82.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ August 29 2014 Actualización Ébola (hace tiempo que debería estar esto aquí) Durante el transcurso de prácticamente cualquier tipo de infección viral, las necesidades de vitamina C se incrementan, y en el caso de ébola, se van por las nubes. Tan altos son los requerimientos que toda la sabiduría convencional con respecto a la vitamina C es irrelevante. Las dosificaciones que tengo a continuación son los mínimos absolutos. Recuerde que durante el tiempo que el ébola no se encuentra en su área9, no pierda de vista su suministro de vitamina C y tome más de un comprimido al día. Si se trata de su área, como medida de precaución, tome 4 ó 5 gramos por día y si se presentan los síntomas, en este caso, aumente sin dilación la cantidad. Esta indicación es para que conserve su suministro hasta que sea realmente necesario.

Aquí están las dosificaciones.

Estas dosificaciones se basan en la observación prolongada de un cachorro con parvo, y cuánta vitamina C se necesita para detener el sangrado interno en un cachorro que tenía la versión “perruna” del ébola, (lo sé, el parvovirus estructuralmente ni siquiera se acerca al tema en cuestión, pero produce los mismos resultados —provoca una tasa de mortalidad del 90 por ciento en cachorros no tratados en el transcurso de los primeros 3 ó 4 días, con la muerte causada por hemorragia masiva) que no es sino un virus hemorrágico. Ya sé que habrá por ahí algunos mojigatos que dirán que esto no tiene sentido en relación con el ébola; OK, te he oído. Entonces no hagas nada y muere.

Si dosificaba al cachorro con 125 mg/kgr diario de ácido ascórbico, sí que se redujo el sangrado interno pero todavía era apreciable la hemorragia interna.

Dosificando, al cachorro, 125 mg/kgr diarios de vitamina C con escaramujo rojo, se detenía 9

.- Recuerda que la apreciación del comentario —área— se refiere a E.E.U.U. donde uno de sus estados tiene mayor superficie que España. Si se declarara un brote en cualquier país europeo, éste puede considerarse de facto “un área” (N. de los T.)

87.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

por completo el sangrado interno. De modo que la combinación de escaramujo rojo con vitamina C funciona mejor. Pero dosificando 175 mg/kgr díarios de ácido ascórbico, también se detenía todo el sangrado, por lo que, en última instancia, el ácido ascórbico resulta más barato a ese ritmo de consumo. Interrumpiendo la dosificación, reapareció el amenazador y mortal sangrado (y por supuesto regresando a la dosificación de 175 MG/kgr se detuvo inmediatamente el sangrado en el cachorro). Era como si la vitamina C accionara un interruptor entre la vida y la muerte para este cachorro. Ahora, dos semanas después (un largo periodo para el parvo) puedo saltar una dosificación y no sucede serio. Durante todo el tiempo, siempre y cuando el cachorro tomara la vitamina C, comía y bebía con normalidad, y sólo tenía síntomas leves de estar un poco enfermo. Antes de intentarlo con la vitamina C, (al final del segundo día y apenas al principio de la hemorragia) el cachorro estaba gravemente deshidratado y próximo a la muerte. La vitamina C causó una rápida reversión de este fenómeno.

Los veterinarios dicen que esto tiene que ser falso, porque los perros sintetizan su propia vitamina C. ¿Mi respuesta? Sí, a razón de 18 mg/kgr diarios, muy por debajo de lo que se necesita cuando una enfermedad grave se establece.

Así pues, ahora tenemos dos cosas —un método prácticamente asegurado para evitar que cualquier cachorro muera de parvo (un gran avance por sí mismo), y una posible y mínima referencia de dosificación para la vitamina C contra el ébola.

DOSIS MÍNIMAS ABSOLUTAS: 200 mg/kgr (82 mg/libra) para las personas. Esto significa que si usted pesa 10 libras (4,5 kgr), necesitará un gramo al día. Si usted pesa 100 libras (45 kgr), necesitará 8,2 gramos diarios. Una mujer de 50 kgr necesitará 10 gramos. Y estos son los mínimos, no le hará daño a nadie incrementar mucho, mucho, mucho las dosificaciones.

Experimenté con ese cachorro para saber exactamente donde estaba el umbral de resultados. Estaba en 175 ml (directamente en la garganta) todos los días, más 18 mg/kgr que el perro producía naturalmente por sí mismo, así que para simplificar sólo tienes que quedarte con 200 mg/kgr. ¿Cómo funciona la vitamina C para detener el daño causado por el ébola (aunque la vitamina C NO es una cura) En primer lugar, como cualquier persona que sabe sobre el escorbuto se puede afirmar, la vitamina C ayuda a paredes arteriales mantiendo su firmeza y elasticidad.

Pero hay algo mucho más serio en el juego con el ébola que impide la vitamina C. Algo aún más siniestro que el debilitamiento de los vasos sanguíneos sucede cuando el ébola agota TODA la vitamina C, y que es una muy acelerada y perniciosa liberación de citoquinas IL-6 en los vasos sanguíneos. Cualquier profesional médico será capaz de dar rápidamente con el hecho de que la vitamina C impide la liberación de citoquina IL-6 y que el ébola causa graves pérdidas por las paredes de los vasos sanguíneos. Una vez liberado en grandes cantidades, IL-6 irrita aún más las paredes de los vasos sanguíneos hasta el punto de que puede producir agujeros, y esto, combinado con la condición ya debilitada por la falta de vitamina C hará que muchos vasos revienten por la presión.

Resumiendo, la vitamina C es como un proyectil mágico contra el ébola que no sólo restringe la liberación de citocinas IL-6 que dañan los vasos sanguíneos, también, al mismo tiempo, hace que éstos vuelvan al menos a su fortaleza normal (y posiblemente mucho más allá con altas dosis) Estas dos funciones trabajando simultáneamente hacen a la vitamina C, la probable mejor primera línea de defensa posible contra el ébola.

88.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Pero hay que añadir más a esta historia Dado que IL-6 juega un papel muy importante en el deterioro los vasos sanguíneos, es importante detener su liberación inicial. Y hay algunos alimentos muy simples que pueden tomarse para facilitarlo. El primero es el té verde. El té verde puede reducir la liberación de citoquinas IL-6 en un 21 por ciento (que palidece en comparación con la vitamina C, pero sería un bono adicional). De valor similar son manzanas, canela, la mayoría de las bayas, cerezas, granadas, aceite de oliva, aceite de semillas de lino y aceite de pescado.

Debe evitar la cafeína y el chocolate, porque aunque ambos tienen el potencial de ayudar de alguna manera, también tienen el potencial de contrarrestar por completo cualquier beneficio aportado por todo lo comido previamente (pero hasta donde yo se, nadie ha estudiado esto a fondo en relación con el ébola); esto es sólo lo que dicen los médicos que conocen el tema mucho mejor que yo, que la interactuación química podría tener consecuencias muy negativas, así que para asegurarse, evita la cafeína y el chocolate.

Los alimentos mencionados anteriormente casi completan la lista por lo que yo sé, y jugar más con cosas como el ajo (que es ideal para prácticamente cualquier cosa) y los pimientos picantes, el ginseng y otros alimentos anticoagulantes probablemente serán perjudiciales con fiebre hemorrágica .

La conclusión es que si el ébola despegar, aquellos en posesión de los conocimientos adecuados no se sentarán a ver llegar la muerte y morir. La dieta y la vitamina C pueden fácilmente marcar la diferencia entre vivir prácticamente normal y pasar por ello, o morir.

Y UNA NOTA MUY IMPORTANTE: los estafadores sin escrúpulos que están por todas partes tratarán de venderte hasta heno de un viejo granero como la cura para el ébola; hay mucha maldad por ahí y te sugiero encarecidamente que la evites toda, lo que está expuesto aquí probablemente es lo Nº 1 por encima de cualquier otra esperanza (y no puedo sacar provecho de esto en absoluto).

Además, es muy importante destacar que el médico que me dio la pista sobre la vitamina C y el ébola me ha dicho en repetidas ocasiones que mis dosificaciones recomendadas anteriormente son demasiado bajas, por lo que asegúrate que tiene una gran cantidad de vitamina C por ahí caso de que que necesites ir mucho más allá de lo recomendado hasta aquí, y como siempre he dicho, mantén tu dosificación actual a no más de 1 tableta diaria en este momento, hasta que haya una muy buena razón para empezar a tomar grandes cantidades de vitamina C (para evitar malgastarla).

Ha habido unos pocos médicos por ahí que se han subido al carro de este tema, para aplastar la voz de que la vitamina C puede en realidad funcionar para prevenir la muerte por ébola. A ellos tengo que decirles, demostrad que estoy equivocado.

Puede que no sea médico, pero tampoco soy un analfabeto en temas médicos y reconozco el trabajo legítimo en cuanto lo veo, y todo lo anterior vine directamente de otros médicos que estaban intrigados, y dijeron LA QUÍMICA FIJO QUE SE ADAPTA. A la muchedumbre racional: ¿Es que $ 20 (€ 15,20 10) es demasiado para 10 .- Una empresa ofrece la mejor opción en algunos países de Europa (no todos): 1 kgr de ácido ascórbico [Vitamina C] de excelente calidad, aunque no lo parezca, a € 19,95. (N. de los T.)

89.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

gastar en una gran cantidad de vitamina C barata comprada de forma anticipada por si acaso? Y si por alguna oscura razón nadie lo calculó y termina por no funcionar, ¿QUÉ TE HA COSTADO? Recuerda, los mismos médicos que hablarán en contra de esto atiborrarán a tu bebé con timerosal mediante la administración de una vacuna o con otra similar un phago come-cerebros administrada por ingeniería genética sólo porque la etiqueta dice que hay que hacerlo así, ¿Qué &*#*@ saben realmente de todos modos?

El siguiente informe, procede de médicos honestos; ayuda a arrasar los mentirosos y añade un montón de detalles.

Crea a quien quiera, a mi o estos médicos, he salido al paso con todo lo expuesto independientemente del siguiente informe (y por lo tanto lo que digo más arriba varía ligeramente, pero salvo matices, viene a ser lo mismo). El siguiente informe añade un montón de detalles a lo que dije anteriormente. Si te sientes cómodo con una larga lectura, lo aquí expuesto es EXCELENTE Mis directrices siempre fueron: toma 1 comprimido de lo que sea que tomes diariamente, si el ébola irrumpe en tu área —para Europa, entiéndase 'país' aumenta esa cifra a 4 ó 5 gramos por día, y si enfermas, toma lo que sea necesario para sobrevivir. He vinculado el siguiente informe, simplemente porque su precisión es obvia, y entra en los pequeños detalles que no puedo escribir en el tiempo limitado que tengo.

Agradezco a estos médicos honestos para trazar los detalles tan amablemente.

--Comentario por Steve Hickey PhD, Hilary Roberts PhD, y Damien Downing MBBS, MSB. (OMNS 20 de agosto 2014) “Si hubiera un fármaco que funcionara con el Ebola debería usarlo. No lo hay. Sólo existe la vitamina C. Pero Ud tiene que ser muy cuidadoso con lo que crea, porque, como siempre lo fue, Internet está llena de locos peligrosos. En la actual década la OMNS ha informado sobre las terapias nutricionales; dejamos las políticas médicas a un lado y trabajamos a partir de hechos. Estos son los hechos sobre la vitamina C y el ébola.

“1. Tomar como un gramo diario de vitamina C no lo protegerá contra nada, excepto el escorbuto agudo; no importa si la vitamina es liposomal, nano-partículas, o incluso chapado en oro. Tenga cuidado con los sitios web, las empresas y los video-clips de Youtube haciendo afirmaciones disparatadas y sin fundamento acerca de la eficacia de la vitamina C. “2. Los informes clínicos sugieren que tomar vitamina C diariamente casi a la tolerancia intestinal (en dosis divididas) le ayudará a protegerse contra los virus. Los informes de los médicos independientes han sido consistentes durante décadas. Sin embargo, los médicos también estipularon muy enfáticamente que las dosis y la forma en que se tomen debe ser correcta —o no va a funcionar. No existe "evidencia" directa controlada por placebo de que dosis masivas de vitamina C funcionarán con el Ébola, y nadie se ofrecería voluntario para participar en dicho estudio. Pero se ha informado que dosis masivas, han ayudado contra todos los virus en cada ocasión que se ha puesto en práctica. Esto incluye Polio, Dengue y SIDA, y que incluso mejora el resultado de las vacunaciones. En la década de 1980 cuando no existía tratamiento alguno disponible se informó que el SIDA podía revertirse totalmente y el paciente recuperó un estado de salud razonable. [i, ii] “Bajo riesgo o preocupado sobre el Ébola? Esto es lo que debe hacer.

“La vitamina C 90.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

“La vitamina C es el antioxidante primario en la dieta. La mayoría de las personas no toman suficiente para estar saludable. Si bien esta es la realidad de muchos nutrientes, la vitamina C es un caso especial.

No haga caso de los gobiernos cuando le dice que sólo necesita alrededor de 100 mg al día y que puede obtener esta cantidad de alimentos. La cantidad necesaria de vitamina C varía su estado de salud. Un adulto normal en perfecto estado de salud puede necesitar sólo una pequeña ingesta, decir 500 mg por día, pero se necesita más cuando alguien simplemente no se encuentra bien. Del mismo modo, para prevenir la enfermedad, debe incrementarse la ingesta.

“La ingesta de una persona sana para tener una posibilidad razonable de evitar un resfriado común se halla en la región de los 10,8 gramos (8000 a 10000 mg) diarios. Esto es alrededor de diez veces de lo que la medicina corporativa ha puesto a prueba en sus ensayos sobre la vitamina C y el resfriado común.

Diez gramos (10000 mg) es la ingesta mínima farmacológica; puede ayudarle si usted tiene un dolor de garganta leve pero puede ser necesaria más (mucho más). Para deshacerse de un resfriado común, es posible que tenga necesidad de entre 20 a 60 gramos (60000 mg) diarios. Con la gripe la necesidad podría ser de 100 gramos (100.000 mg) diarios. Como quiera que varía de persona a persona, y de enfermedad a enfermedad, la única manera de averiguarlo es experimentar por ti mismo.

“Flujo dinámico “El problema con las ingestas orales es que la gente sana no absorbe adecuadamete la vitamina C debido a algo que el Dr. Robert Cathcart llama tolerancia intestinal. [iii] Tome demasiado de esta vitamina en una sola dosis y provocará heces blandas. En buen estado de salud, una persona puede ser capaz de tomar un par de gramos a la vez sin este problema. Extrañamente, cuando una persona enferma puede tomar mucho más sin este efecto secundario: tanto como 20 a 100 + gramos diarios, en dosis divididas. [iv] “Las dosis altas de vitamina C tienen una breve vida-media en el cuerpo. La vida-media es el tiempo para que los niveles en el plasma sanguíneo caigan nuevamente a la mitad de su concentración. Hasta hace poco tiempo, algunas personas afirmaron que la vida media de la vitamina C era de varias semanas.

Hemos demostrado que esta larga vida-media sólo se aplica a dosis muy bajas. [V] Por el contrario, la vida media de los niveles altos es sólo media hora. Esta breve vida-media significa que para altas dosis de vitamina C el período entre dosis debe ser corto —un par de horas a lo sumo.

“El objetivo es lograr un flujo dinámico, para lograr que la vitamina C fluya continuamente a través del cuerpo. El flujo dinámico requiere múltiples dosis altas tomadas durante todo el día. Cuando se separadas en el tiempo, cada dosis se absorbe de forma independiente. Dos dosis de 3 gramos, espaciadas 12 horas, se absorben mejor que 6 gramos tomados de una sola vez. Grandes dosis múltiples, digamos 3 gramos cuatro veces al día, producen un flujo constante de la vitamina en el intestino, en el torrente sanguíneo y por fuera, a través de la orina. Parte de la ingesta no se absorbe en la sangre y se queda en el intestino, como una reserva contra la aparición prematura de la enfermedad. Cuando comienza la enfermedad, el cuerpo extrae este "exceso" para ayudar a combatir el virus.

“La idea detrás de flujo dinámico es mantener el cuerpo en un estado (antioxidante) reducido, utilizando dosis elevadas. De esta forma siempre hay disponibilidad de vitamina C, para refrescar el cuerpo y otros antioxidantes. Cada molécula de vitamina C (ácido ascórbico) tiene dos electrones antioxidantes, que puede donar para proteger el cuerpo. Entonces se convierte de oxidado 11 a deshidroascorbato (DHA).

Esta molécula oxidada se excreta a continuación, por lo que el cuerpo ha ganado dos electrones antioxidantes. Los riñones reabsorben la vitamina C, pero no la DHA; la molécula de la vitamina C se absorbe, se agota, y luego la forma oxidada se arroja a la basura.

La efectividad de la vitamina C no es directamente proporcional a la dosis; es no-lineal. Hay un límite a partir del cual la vitamina C se convierte en altamente eficaz. Por debajo de este nivel, el efecto es 11 .- Oxidado, unido con oxígeno; que ha pasado por una reacción con oxígeno

91.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

pequeño; por encima de ella, el efecto es espectacular. El problema es que nadie puede decirle de antemano que ingesta de vitamina C necesita. La solución es tomar más —más de lo que cree necesario, más de lo que considere razonable. El mantra es la dosis, la dosis, la dosis.

Tipos de vitamina C Directamente, ácido ascórbico simple y económico es la forma preferida de suplemento. Los vendedores pueden tratar de venderle formulaciones de ''mejor absorción'' con minerales o sales como el sodio, el potasio o el ascorbato de calcio, y así sucesivamente. Estos son irrelevantes, cuando no contraproducentes, por su alto consumo.

Vale la pena señalar lo siguiente: La cadencia es más importante que la forma. Dos grandes dosis de ácido ascórbico tomadas separadas en el tiempo se absorben mejor que una sola dosis de ascorbato mineral.

Los ascorbatos minerales son sales y no llevan el mismo número de electrones antioxidantes. El ácido ascórbico tiene dos electrones para donar mientras que la sal tiene normalmente sólo uno. Con dosis altas, las formas "mejoradas" son, pues, sólo la mitad de eficaz. Esto es consistente con informes de que las formas minerales son correspondientemente ineficaces en la lucha contra la enfermedad.

El ácido ascórbico es un ácido débil, mucho más débil que el ácido clorhídrico en el estómago. Los ascorbatos minerales, pueden tolerarse mejor, ya que hacen al estómago más alcalino que ácido ascórbico. Sin embargo, un estómago alcalino no es una buena idea —hay motivos por las que el cuerpo secreta ácido clorhídrico en el estómago, incluyendo la prevención de infecciones. Por otra parte, si usted cae bajo una infección viral hemorrágica, una leve molestia no será motivo de gran preocupación.

Para consumos elevados, las cápsulas de ácido ascórbico son preferibles a las tabletas. Esto se debe a que las tabletas están llenas de materiales de relleno y no es aconsejable tomar dosis masivas de estos productos químicos. Revise los ingredientes —usted quiere tomar ácido ascórbico y muy poco más. Los bioflavonoides están bien, y las cápsulas pueden estar hechas con gelatina o un equivalente vegetariano.

La manera más barata de tomar ácido ascórbico es en forma de polvo, disuelto en agua. Si usted hace esto, utilice una pajita para evitar que entre en contacto con el esmalte de los dientes, ya que es ligeramente ácido. Necesitará un conjunto de balanzas electrónicas de precisión 12 para controlar la dosis.

Si no pesa con cuidado, será difícil mantenerse cerca de la tolerancia intestinal.

Intravenosa de vitamina C Idealmente, a las personas infectadas se les daría una (IV) infusión intravenosa continua con dosis masivas de vitamina C (ascorbato de sodio es preferible ya que ácido ascórbico es irritante para las venas).

Las personas que están lo suficientemente enfermas no van a ser capaces de tomar la vitamina C por vía oral.

IV ofrece los más altos niveles en sangre posibles IV significa goteo continuo, no una inyección (breve vida-media) A menos que usted sea un profesional médico que pueda tratarse a usted y su familia, o sean excepcionalmente ricos, el ascorbato IV no será una opción ante un brote de Ébola. [Inciso del Administrador —Y por lo tanto, abastecerse de ácido ascórbico económico en forma de tabletas o en polvo será lo que hay que hacer] 12 .- En España: las básculas de precisión de hasta 10/20/50x0,001 (pesada mínima 1 mg; pesada máxima 10/20/30/50 gm) se encuentran a.p. de € 13,00. No se ha consultado e-bay.

92.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Vitamina C por vía Rectal La administración rectal de ascorbato sódico es un método que puede utilizarse en situaciones de emergencia, y en el desarrollo de circunstancias mundiales, cuando IV no esté disponible o resulte inapropiado. Se puede entrenar rápidamente a las enfermeras para mezclar 15-30 gm de ascorbato de sodio en 250-500 ml de agua limpia (destilada), y aplicarlo por enema. Puede ser utilizado con seguridad y eficacia en niños. Un enema también elimina materiales peligrosos del intestino. Esto se ha llevado a cabo con éxito con los pueblos aborígenes del interior de Australia.

Los liposomas En las personas sanas, los liposomas ayudan a la absorción de la vitamina C por vía oral; en algunas circunstancias, esto también es cierto para personas enfermas. Sin embargo, tenemos que disipar algunos mitos populares.

En una persona sana, los niveles sanguíneos más altos (aproximadamente 600 microM/L) se puede lograr utilizando vitamina C liposomal en comparación con el ácido ascórbico estándar (alrededor de 250 microM/L). Fuimos los primeros en demostrar este hecho experimentalmente. [vi] Sin embargo, los dos métodos de absorción son diferentes y si ambos se utilizan juntos los niveles en plasma resultantes son aditivos (algo así como 600 + 250 = 850 microM/L). Dado que el ácido ascórbico es mucho más barato que la vitamina C liposomal, es más rentable para una persona sana para empezar con ácido ascórbico y completar con liposomas según se requiera.

Cuando una persona enferma puede absorber dosis masivas de ácido ascórbico estándar, utilizando el enfoque del flujo dinámico. Así que si usted está enfermo, tomar un gramo de vitamina C liposomal en lugar de un gramo de ácido ascórbico barato le proporcionará poco beneficio extra. Ambos se absorben bien, y el liposoma contiene ascorbato de sodio, que es menos eficaz. Los liposomas sólo proporcionan un beneficio adicional una vez que la persona enferma se ha acercado a los niveles de tolerancia intestinal, utilizando ácido ascórbico estándar.

La vitamina CLiposomal no es más eficaz que la IV para combatir las infecciones agudas. Esta sugerencia no es científica y no está apoyada por datos. Preferimos liposomas para las infecciones crónicas y el cáncer, pero esto no se extiende a enfermedades agudas. También hay un gran despliegue publicitario en torno al hecho de que los liposomas pueden ser absorbidos directamente en las células.

Muchos liposomas se absorben en el intestino y pasan al hígado, donde se almacenan y se libera vitamina C. Los liposomas también pueden flotar en el torrente sanguíneo, los ganglios linfáticos, y así sucesivamente, a la espera para liberar su contenido o ser absorbidos por las células. Pero las células que ocupan los liposomas no son necesariamente las que tienen mayor necesidad de vitamina C. Además, las células pueden sufrir efectos secundarios. Por otra parte; los liposomas son, básicamente, nanotecnología y comportan problemas teóricos adicionales.

Prevención Para tener una razonable oportunidad de evitar una infección viral grave, se necesita una ingesta diaria de al menos 10 gramos de ácido ascórbico. La idea es empezar con poco, tomando, digamos 500 - 1000 mg cuatro veces al día. Reforzando la ingesta próxima a la tolerancia intestinal; aparecerá un aumento de las ventosidades y grandes deposiciones blandas antes de la diarrea lo que señalará se ha superado la tolerancia intestinal. En esta etapa, disminuir un poco la dosis, a un nivel razonablemente cómodo.

[Inciso del Administador —esto va junto con mi asesoramiento inicial— Tome una tableta diaria hasta que el ébola se declare en su área (país), una vez declarado el brote aumentar esta cifra a 4 o 5 gramos diarios. Si deja de tener deposiciones blandas tras subir la dosis, significa que tiene un virus (debido a que su cuerpo va a 93.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

empezar a tomar la vitamina C). Entonces, empiece a tomar grandes cantidades].

Al primer indicio de infección —sensación de malestar, picor de garganta, fatiga, y así sucesivamente— tomar más ácido ascórbico. Si el indicio de enfermedad inminente es leve, tal vez tomar 5 gramos cada media hora o incluso con mayor frecuencia. Si es algo más que un indicio de infección, tome una dosis tan grande como sienta que podría ser tolerado y siga esto tomando 5 gramos cada media hora. La regla es tomar tanto como sea posible, sin pasarse del nivel tolerado: es probable que esté tomando muy poco, a pesar de que usted esté tratando enconadamente en tomar una dosis masiva.

Si usted ya ha entrado en flujo dinámico y desea protección adicional, a continuación, añada vitamina C liposomal. Tómelo a los mismos intervalos que el ácido ascórbico; es decir varias veces al día. El límite es una vez más la tolerancia intestinal —tome demasiado y se le dará diarrea. Esto proporcionará el efecto preventivo máximo, al menor costo.

[Inciso del Administrador —la defecaciones líquidas SON LA CLAVE. Si no se presentan síntomas de diarrea significa que necesitarás más vitamina C. Si ya tienes diarrea, CORTA LA DOSIFICACIÓN porque la estás desperdiciando].

Tratamiento Suponemos que usted no es un profesional de la medicina y no tiene acceso a ascorbato IV. Sin embargo, si el ascorbato sódico IV estuviera disponible, se debe administrar lentamente y lo más continuamente posible. Para los niños, los enemas pueden ser el método más práctico (esperamos publicar instrucciones prácticas para esto pronto). Los profesionales médicos pueden hacer frente a este tipo de cosas con poca dificultad, pero otros pueden hacer más daño que bien.

La primera cosa importante es iniciar el tratamiento prematuramente. Cuanto más tiempo espera la persona tras los síntomas iniciales, menos eficaz será el tratamiento. Además, si se permite que la enfermedad se desarrolle el enfermo puede llegar a ser incapaz de tomar nada por vía oral.

Una vez más, la idea es lograr que el flujo dinámico alcance la mayor nivel de tolerancia para el ácido ascórbico. En este caso, las dosis son enormes. Cinco a diez gramos cada media hora, a lo largo del día, proporcionará 120 a 240 gramos diarios. Incluso con este alto consumo, los niveles en plasma de sangre pueden ser bajos o no detectables; como máximo podrán alcanzarse 250 microM/L. Así que la pregunta es cuánta vitamina C liposomal adicional puede tolerar el paciente.

Un enfoque práctico sería comenzar con 5 gramos de ácido ascórbico y una cantidad similar de vitamina C liposomal en dosis muy frecuentes. Recuerde que la clave es la dosis, dosis, dosis. ¡Más vitamina C! Cómo funciona El mecanismo de la acción de la vitamina C en altas dosis es conocida y comprendida. En los tejidos sanos normales actúa como un antioxidante. En otros tejidos, se genera peróxido de hidrógeno, la sustancia química que las rubias platino utilizan para blanquear su cabello. Esto sucede en los tejidos enfermos e inflamados, por ejemplo en un tumor maligno. El proceso es típicamente una forma de reacción de Fenton, la generación de radicales libres. La oxidación y los radicales libres derivados de peróxido de hidrógeno mata las bacterias e inactiva los virus. En otras palabras, la vitamina C actúa como un blanqueante y antiséptico dirigido a la diana.

[Inserción del Administrador —la inhibición de citoquinas IL-6 a través de la vitamina C en relación con ébola, es específico del Ébola, y algo sobre lo que estos médicos no saben. Pero eso es en gran medida irrelevante, ya que, al menos, establecen claramente aquí y ahora que la vitamina C es la clave] 94.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

La vitamina C es única, ya que su toxicidad es tan baja que apenas se conocen casos de sobredosis salvo teóricamente y puede tomarse con total seguridad en cantidades enormes. Otros antioxidantes y suplementos no tendrán un efecto similar. No permita que le confundan y le hagan pensar que la equinácea, por ejemplo, le ayudará significativamente. Sí, puede haber suplementos y hierbas que proporcionen un poco de apoyo al sistema inmunológico, pero esto de lo que estamos hablando es el Ébola - ¡Aterrice!

Tenga en cuenta, la vitamina C no es una antitoxina mágica; esta idea es una metáfora. Una enfermedad como el Ebola no está causada por toxinas que son inactivadas por la vitamina C. Los radicales libres no son toxinas. Los oxidantes no son toxinas. La vitamina C actúa casi siempre mediante la transferencia de electrones, como un oxidante o antioxidante. Solo es química básica. Además, no importa si usted tiene una mala higiene dental, esto apenas afectaría a cómo las tomas masivas de vitamina C enfrentan una infección viral aguda.

Interacciones; el azúcar interfiere con la absorción de la vitamina C. Si utiliza vitamina C para combatir una infección viral no tome ni azúcar ni hidratos de carbono (azúcares de cadena larga) o la vitamina C no se absorberá correctamente. Hacemos hincapié en que esto significa, sin azúcar ni carbohidratos, en absoluto.

Fumar libera enormes cantidades de oxidantes y radicales libres en el torrente sanguíneo. La vitamina C se consumirá a sí misma, tratando de absorber los productos químicos del tabaco. No tenemos objeciones morales a que la gente fume: es una elección personal. Sin embargo, fumar obstaculizará incluso dosis masivas de vitamina C ante la prevención de la infección. Una vez infectados con Ébola, el tabaquismo colapsará la vitamina C en tu organismo y no podrá mantenerte vivo.

También es conveniente complementar con un poco de quelato de magnesio, tales como citrato de magnesio, que ayuda a superar (en gran parte teórico) el riesgo de cálculos renales.

La reacción que genera el peróxido de hidrógeno en los tejidos enfermos puede mejorarse un poco mediante la adopción de selenio con la vitamina C. Es necesario un poco de cautela ya que demasiado selenio puede causar diarrea, fatiga, aliento a ajo, y pérdida de pelo y uñas; una toxicidad severa puede tener efectos más graves, pero es difícil que se de semejante cuadro. La Metilselenocisteína es una forma menos tóxica y esta sería nuestra elección. La ingesta normal es quizás 100-200 microgramos 13 (0,1-0,2 mg) al día; podríamos tomar 400 microgramos al día durante una epidemia y subir a 1000 microgramos (un miligramo) por día, en el inicio de los síntomas. Es posible subir a 3 mg durante cortos períodos, con supervisión médica.

Otros suplementos pueden funcionar en sinergia con la vitamina C. Puede tomarse ácido alfa-lipoico a niveles razonablemente altos con un muy razonablemente alto margen de seguridad. Nos gustaría tomar hasta un gramo o dos al día (1,000-2,000 mg) a corto plazo. La vitamina K también ayuda con la coagulación de la sangre y es seguro en las cantidades recomendadas —tomaríamos la cantidad más alta disponible del suplemento K2. Advierta que la vitamina K está contraindicada en pacientes con enfermedades de coagulación o anticoagulantes como la warfarina.

Contraindicaciones Los únicos efectos secundarios establecidos de la terapia de ascorbato son las ventosidades, intestinos “flojos” (heces muy blandas) y una buena salud crónica. Hay algunas contraindicaciones; las personas con insuficiencia renal, enfermedades por exceso o deficiencia de hierro o de glucosa-6-fosfatasa no deben tomar de inmediato las altas dosis de vitamina C comentadas aquí. En el contexto de una epidemia puedan empezar como se recomienda, pero debemos aumentar con más cautela, con un seguimiento médico adecuado.

13 .- http://www.convertidorunidades.com/miligramos-a-microgramos

95.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

¿Por qué publicar ésto?

La gente necesita saber que la vitamina C es una opción para la lucha contra el Ébola, y cómo funciona.

Hay una gran cantidad de información errónea, sobre todo en Internet, tanto de los intereses creados como de los "locos". Además, en una epidemia de Ébola los suplementos de vitamina C pueden ser difíciles de conseguir.

Este informe es para adultos inteligentes, que pueden tomar sus propias decisiones racionales y asuman la responsabilidad de su salud. Promovemos fuertemente la idea de que la medicina debe basarse en pacientes racionales, en lugar de los médicos autoritarios. Los médicos están ahí para proporcionar la información a los pacientes, para ayudarles a elegir entre las opciones disponibles. Esto sólo es información —lo que decida hacer con ella depende de usted.

En nuestra opinión, el uso de la vitamina C en el ébola es una obviedad. Enferme y, se dice, que tiene a lo sumo una probabilidad del 50-50 de sobrevivir sin la terapia basada en la vitamina C. La medicina corporativa no tiene un tratamiento eficaz. Por otra parte, si estuviera disponible un medicamento, no estaría probado y es casi seguro que no estuviera disponible para ti, querido lector. La vitamina C se considera segura y no debería hacer daño alguno. El costo del tratamiento es bajo. Los informes clínicos de la vitamina C en casos de infecciones virales son que si recibe la dosis correcta, usted sobrevive.

Experimentalmente, se sabe que la vitamina C inactiva los virus. En caso de ..., esperamos que las personas tomen decisiones racionales.

--Si no te gusta este sitio web (pero márcalo de todos modos porque tienes una web y puedes obtener consejos desde aquí como Gordon Duff) y si no deseas vincular este sitio, AL MENOS enlaza al informe de estos médicos, que está tan próximo a lo que dije anteriormente que de todos modos puede considerarse al menos igualmente bueno. ●●●●●●●●●●●●●

96.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

97.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Extractos (webs varias)

Vitamina C (ácido ascórbico 100%) – 1 kgr - £ 11,95 – 19,95 € La mejor y más barata opción.

Otras firmas comercializan 1 kgr de producto (ácido ascórbico 100%) a más de 60,00 €

Recomendaciones a seguir en el supuesto de que los psicópatas genocidas invertidos del cabal logren extender el ébola a otros países Occidentales.

Las indicaciones se han extraído de algunos de los siguientes sitios web http://www.jimstonefreelance.com/ http://www.budgetcamerareview.com/forum/ http://whatreallyhappened.com/ http://theunhivedmind.com/UHM/ http://humansarefree.com/ http://therebel.org/en/forum Otras webs que merece la pena visitar al menos una vez por semana: http://www.whale.to/ http://spanish.larouchepac.com/ http://benjaminfulfordcastellano.wordpress.com/ http://www.mitosyfraudes.org/index.html http://beforeitsnews.com/ http://theextinctionprotocol.wordpress.com/ Hay como media docena más de webs cuyo contenido, artículos, posts e informes proceden de fuentes fiables pero a causa de la cantidad de trolls, debunkers y lammers posteando simultáneamente hay que filtrar mucho y resulta algo pesado. Por ejemplo: http://www.davidicke.com/forum/ http://www.abovetopsecret.com/forum/ http://www.godlikeproductions.com/forum1/pg1 98.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Observaciones básicas: Prepara un 'stock' de vitamina C para 3 meses. Las cantidades diarias si el ébola ha sido importado a tu país se han indicado más arriba. Bebe abundantes líquidos con electrolitos, caldos de verduras e infusiones antioxidantes hasta que mejoren los síntomas y el cuerpo haya tenido tiempo de preparar sus 'anti-cuerpos' y atacar al virus. Olvídate de bebidas comerciales edulcoradas isotónicas y otras similares; E LE C T R O L I TO S calcio magnesio fósforo Puedes conseguir estos minerales por separado o mezclados en seco y prepararlos en casa.

Junto con otros familiares o amigos, busca un mayorista de suplementos nutricionales y evita si puedes los caros productos de las tiendas de dietética. Recuerda que ellos viven de la moda del momento y la moda siempre es cara.

Si todavía eres de los que creen que una buena comida equilibrada es suficiente estás equivocado. No existe la comida “equilibrada” que aporte al organismo todos los nutrientes necesarios. Para satisfacer la demanda actual de todo tipo de alimentos constatamos que han desaparecido, a) la ventana de tiempo estacional y b) la producción regional. Ahora puede encontrarse cualquier producto hortícola o frutícola en cualquier época del año. Así tenemos entre una y tres cosechas anuales con ayuda de agroquímicos; forzadores de enraizamiento y crecimiento, hidropónicos (ya no hace falta tierra), empleo intensivo de túneles, recolecciones de frutícolas prematuras (en verde), plantas híbridas de crecimiento rápido de gran volumen y aspecto final lustroso y con un valor nutricional más que dudoso, que terminan en nuestro supermercado habitual.

Lo Bio es otra moda más del momento actual. Son productos muy caros y el abanico de disponibilidad es muy limitado.

Además, si se declarara un toque de queda o peor aún, un estado de cuarentena que afectara a comunidades autonómicas, provincias o ciudades, todos los servicios públicos quedarían reducidos al mínimo en ambos casos; se establecerían horarios para la venta/distribución de alimentos básicos como son arroz, legumbres, pasta, pan y patatas. No cuentes con cereales integrales. Frutas y verduras frescas podrían llegar a ser un lujo caso de prolongarse la situación. Agua; del grifo, con todos los químicos que lleva. Estudia tus posibilidades para adquirir una destiladora lo antes posible; las hay muy baratas (€125,00) y también muy caras (€290,00) aunque el resultado final sea el mismo. Calcula una provisión de agua a razón de 4 lts por persona/día En España no hay más de 4 ó 5 empresas que se dediquen a la elaboración, formulación, importación y/o distribución de suplementos nutricionales de alta calidad. Lo que no tiene una lo tiene la otra. Así de enojoso.

Finalmente y como dicen aquellos que tienen experiencia en desastres naturales o no y en las consecuencias que provocan los mismos: “Es mejor preparar y no necesitar que necesitar y no haber preparado”

99.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

100.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ September 2, 2014 ¿A ver si después de todo el brote de ébola va a resultar algún tipo de fraude con intenciones aún por desvelar?

Esto podría ser completamente cierto, y un ardid para conseguir que toda gente acepte de buen grado una vacuna contaminada. Como de costumbre, cada vez que publico algo, la regla es evitar todas las VACUNAS OBLIGATORIAS, especialmente cuando están asociados con un brote. En el pasado las vacunas han sido emitidas con la única intención de destruir pueblos y, milagrosamente, han sido interceptadas y detenidas durante su envío.

Un lote contaminado de la Baxter International Inc. con ¡¡¡72 kgrs de producto contaminado!!!, al que se hace referencia en el documento Pesadilla Envenenada que sigue en la pg 103 es un excelente ejemplo de un intento fallido por parte del equipo Rothchild/Agenda 21 para provocar una hecatombe en la población europea. De no haber sido interceptado por la compañía checa BioTest s.r.o., en el transcurso de unas pruebas aleatorias no programadas, habría habido incontables muertes en Europa y no estoy hablando de unos pocos miles. Así que, hay precedentes de que el clan zio ya ha intentado asesinar a millones de personas y el denominado "error" de la Baxter no pudo haber sido como se dijo, y puedes, apoyándote en la historia, confiar bastante en el hecho de que ninguna vacuna obligatoria nunca será como ha sido anunciada.

Los protocolos actuales en marcha para este "brote de ébola" no coinciden ni con la realidad de un brote genuino, ni con un verdadero esfuerzo de contención. Definitivamente aquí hay algo que apesta y eso es precisamente por lo que he dicho tan claramente que la gente debe comprar vitamina C, que es mega barata, fácil de preparar y con una alta probabilidad de que funcione si todo este asunto es real y si intencionadamente hacen que vaya a peor; y si finalmente todo es una artimaña, ¿qué has perdido? NADA; sólo gastaste unos € 20 más o menos para un suministro extra de vitamina C que no solo la tendrás a mano sino que te irá muy bien en los próximos 10 resfriados. No es una pérdida.

No les des lo que quieren con todo esto que han orquestado, de una forma u otra hay maldad detrás de algo así y para conseguir que sus planes funcionen necesitan tu miedo. miedo Consigue lo que necesites anticipadamente y si las cosas se ponen serias quédate en casa. Obviamente ten alimentos preparados para afrontar la situación, y serán 101.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

alimentos que consumirás haya desastre o no. Si el desastre es real e implementado con éxito, no tendrás de qué preocuparse. Después todo se reducirá a recoger las piezas, y habrá una gran cantidad de excedentes si en estos momentos provocan algún tipo de extinción.

En los países latinoamericanos y árabes/musulmanes será perfectamente posible evitar cualquier vacuna obligatoria tan solo quedándose en las casas porque son robustas y muy resistentes ante cualquier asalto, por lo que no es probable que haya un equipo de invasores de casas dando vueltas alrededor y pateando las puertas con el cometido de encontrar gente escondiéndose para evitar la vacuna. En Europa 14 y América, sin embargo, los hogares son cajas ornamentales finas como el papel que son fáciles de invadir, (diseñadas así ex-profeso) y si de alguna manera logras evitar que entre alguien, lo más probable es que acaben quemándola. Así que, molestar, podría ser un enfoque más adecuado al actual estado de cosas.

14 .- El material de construcción en Europa difiere por completo de su homónimo Norteamericano donde todo es madera y aglomerado fijado mediante pistolas de clavos y/o grapas. La base de materiales de construcción en Europa es: ladrillo, bloque pretensado, hormigones, morteros, viguetillas y bovedillas, cementos, tejas cerámicas, zunchos perimetrales de hormigón armado, corrugado de hierro y/o acero, etc. Todo esto cuando no nos encontramos pueblos enteros con casas de piedra y muros de entre 80 y 100 cms de espesor. Pero esto ya lo sabemos los Europeos. La única excepción, porque siempre la hay, son los “chalets” alpinos próximos a las estaciones de esquí —siempre en Europa— donde se encuentran viviendas de “madera sandwich” super-resistente, ignífuga y diseñada para soportar amplias variaciones térmicas. Aún con todo, estas edificaciones de alta montaña son mucho más resistentes que las casas de madera Norteamericanas.

Son irrelevantes las “casitas” prefabricadas de madera basadas en el moderno eco-desarrollo (N. de los T.)

102.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Lo más importante en toda esta esta historia será darse cuenta que cualquier tipo de vacuna será una trampa, lo intentaron con la gripe porcina y fracasaron. El ébola puede ser exactamente lo mismo, así que haz unos pocos preparativos baratos, espera y usa tu cabeza. La hora de largarse, obviamente, no sería ahora, espera a oír hablar de una inminente vacuna obligatoria, y luego haz lo necesario para evitarlo. Esta vez el problema no va a ser el escualeno 15, han tenido 6 años para volver con algo peor, lo más probable es que será el phago16.

Y ahora, en caso de que no lo hayas visto aún, el artículo siguiente superó todo lo publicado por este sitio web COMBINADO. --Fecha: Lunes 10 de agosto 2009, 3:58 AM Este artículo se movió de “boca-oreja” y alcanzó más de 300 millones lecturas, se tradujo a todos los idiomas, y provocó cambios de política en numerosos países. La conclusión es que resultó certero y sobrevivió a Lancet y Pub Med, y aunque es probable que ahora sea obsoleto el tema principal sigue siendo pertinente. Cinco años después de la publicación, todavía puede encontrarse on-line en muchos idiomas.

--P

E

S

A

D

I

L

L

A

C

O

N

T

A

M

I

N

A

D

A

Dr. Sarah Stone, Pharm-D Jim Stone, periodista independiente Russ Clarke, Editor “El programa de vacunación H1N1, cuando se sitúa en el mismo marco que el virus diseñado para ir incorporado, parece ser un claro esfuerzo por dividir a la humanidad en dos grupos: los que han perdido su intelecto, la salud y la sexualidad a través de una vacuna contaminada, y los que los conservan y lo por tanto son superiores”.

Me encontré con la historia sobre la gripe porcina con gran escepticismo; daba la impresión de ser el argumento para una película de clase 'B' —Los estudiantes van al extranjero para las vacaciones de primavera. Los estudiantes contraen el virus. Los estudiantes lo traen a 15 .- http://blogs.mercola.com/sites/vitalvotes/archive/2009/07/17/squalene-the-swine-flu-vaccines-dirty-littlesecret-exposed.aspx - http://vidasostenible.lacoctelera.net/post/2009/07/25/escualeno-pequeno-y-suciosecreto-la-vacuna-la (N. de los T.) 16 .- Bacteriófago Nanobot T4 –La Agenda para el Control de la Población– https://mega.co.nz/#!9EpmGYzQ! R3dLU1X2J_vjvFEJ1P1LaGMlYc4PE-pxt477aYiYkGA (N. de los T.)

103.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

casa. Y, comienza una pandemia en todo el mundo. La línea de la historia era increíble, y yo sabía desde el primer día que tampoco había ningún virus en absoluto que cumpliera estas características, y que sólo era un "menear menear al perro17", o que un brote manufacturado estaba en proceso de ser liberado intencionadamente.

Desafortunadamente esto último era cierto, y ahora tenemos un bicho completamente nuevo en nuestras manos. Nunca había sido visto con anterioridad, y con frecuencia se ha citado a virólogos exclamando: "De De dónde demonios haya conseguido todos estos genes — añadidos— nosotros no lo sabemos". sabemos Un extensivo análisis del virus ha revelado genes de la gripe original de 1918, la gripe aviar, y dos nuevos virus H3N2 de Eurasia. Toda la evidencia apunta al hecho de que la gripe porcina es de hecho un virus manipulado genéticamente.

Este artículo es el resultado de un esfuerzo en equipo destinado a explorar cual podría ser el motivo para liberarlo y para advertirle con antelación sobre lo que podría suceder.

El primer intento En febrero de 2009, Baxter, un importante fabricante de vacunas, envió las vacunas contra la gripe estacional a 18 países diferentes con el virus de la gripe aviar H5N1 vivo y sin atenuar. Cuando la empresa checa Biotest fue asignada para probar la vacuna en animales vivos para el gobierno checo, se dieron cuenta de que algo andaba mal cuando los animales de prueba murieron. La alarma se extendió a todos los demás —laboratorios— que la habían recibido, afortunadamente antes de que fuera administrada. Un examen de seguimiento de la vacuna reveló la existencia del virus, si nadie hubiera detectado y frenado las vacunas emponzoñadas de la Baxter, ahora estaríamos en medio de una pandemia con un número desorbitado de muertos.

La Baxter no fue juzgada ni condenada de ninguna manera por esto, a pesar de que sus protocolos operacionales BSL3 (nivel de bioseguridad 3) hubieran impedido que semejante contaminación fuera posible. Los protocolos de seguridad, combinados con la potencia y el volumen del virus en las vacunas muestran claramente que la contaminación fue intencional, y que un intento para matar a millones de personas simplemente fue detenido porque un país prestaba atención a lo que se estaba haciendo. Los protocolos hacían técnicamente imposible que el virus pudiera dar un salto desde el departamento de investigación hasta el departamento de fabricación de vacunas, que nunca podría haber dispuesto de muestras del H5N1 bajo ninguna otra razón que no fuera una intención deliberada.

Uno podría pensar que la Baxter tendría que sido apartada de negocio por cometer semejante "error", sin embargo lo cierto es que fue todo lo contrario, lo que plantea muchas preguntas, tales como ¿Cómo terminó el virus, activo, de la gripe aviar en millones de dosis de vacunas? ¿Por qué fueron formulados los ingredientes de la vacuna para permitir que el virus sobreviviera a plena potencia durante el trayecto? ¿Por qué no se procesó o sancionó a la Baxter de alguna manera? En lugar de votar en contra de la compañía con toda la razón del mundo, la Organización Mundial de la Salud ha premiado Baxter con un contrato para elaborar una gran parte de las vacunas de la "gripe porcina" listas para ser distribuidas en todo el mundo este otoño. ¿Cómo diablos puede ser eso?

El principal foco 17 .- En Inglés “wag the dog”, traducción literal “es la cola la que mueve al perro”. No hemos encontrado una equivalencia en castellano pero en este contexto vendría a significar: "Decir que este virus es el factor determinante para una pandemia mundial es como decir que la cola es la que mueve al perro". (N. de los T.)

104.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Vamos a cambiar a otro aspecto de las vacunas, el verdadero objetivo de este artículo, que consiste en el plan para destruir nuestro intelecto, nuestra salud y nuestra sexualidad a través de una amplia campaña de vacunación mundial masiva. Con el uso de aditivos especiales llamados adyuvantes, los fabricantes son capaces de aumentar el número de posibles dosis que pueden hacerse a tiempo para la temporada de la gripe otoñal. Pero aunque hay muchos adyuvantes seguros que pueden añadirse, están añadiendo uno — el escualeno, escualeno que ha demostrado causa una prolongada respuesta inmuno-sistémica contra el escualeno en sí, lo que se traduce en reducción de fertilidad, inteligencia y de la vida útil del individuo.

El escualeno es una molécula importante en el cuerpo. Es un precursor de muchos aceites y hormonas diferentes, y es necesario para la función apropiada del cerebro, la fertilidad y también juega un papel importante en la protección de las células contra el envejecimiento y la mutación. Cualquier cosa que afecte su escualeno natural puede tener un gran impacto negativo en su salud.

Debido a que el escualeno se inyecta en presencia de un patógeno durante la vacunación de la gripe H1N1, éste provocará una respuesta inmune no sólo contra el patógeno, sino al propio escualeno. escualeno El escualeno es una molécula precursora que es esencial para la producción de muchas hormonas, incluyendo todas las hormonas sexuales masculinas y femeninas. El escualeno es también un precursor de muchos de los receptores neuroquímicos que prevalecen en el sistema nervioso y cuando el sistema inmunológico está programado para atacar el escualeno, escualeno causa daño neuronal irreversible y neuromuscular que puede ir desde una pérdida de intelecto y el autismo a los trastornos más graves de la enfermedad y las enfermedades autoinmunes sistémicas y posiblemente tumores cerebrales Lou Gehrig.

En estudios independientes cuando se han inyectado vacunas envenenadas con escualeno en conejillos de indias, los trastornos autoinmunes resultantes mataron a 14 de los 15. Una prueba posterior, para verificar los resultados tuvieron las mismas consecuencias.

Cuando se inyectó por primera vez vía la vacuna contra el ántrax en la 1ª Guerra del Golfo, discapacitó permanente a muchos de los soldados que la recibieron, debido a los efectos colaterales que ahora se conocen como el Síndrome de la Guerra del Golfo. En el 95 por ciento de los soldados que recibieron la vacuna contra el ántrax se han encontrado anticuerpos contra el escualeno. escualeno Pocos de los soldados que recibieron la vacuna se mantienen saludables y no muestran los anticuerpos tanto si se activaron como si no.

Ninguno de los soldados no vacunados muestra los anticuerpos, incluso aquellos que lucharon en Irak. Muertes totales de relacionadas con anticuerpos de escualeno: escualeno 6,5 por ciento del grupo vacunado.

Los efectos secundarios tardan en manifestarse completamente aproximadamente un año porque ese es todo tiempo que transcurre antes de que el sistema nervioso y el cerebro agoten las reservas de escualeno que están fuera del alcance del sistema inmunológico y sólo después de que las reservas se han agotado es cuando comienzan las lesiones a nivel celular. Esto elimina la presión sobre los fabricantes de vacunas que niegan las acusaciones de mala praxis ante una respuesta tan retardada. Y con el Congreso aprobando una legislación que concede inmunidad a las corporaciones que causan daño con sus vacunas, el panorama es cada vez más oscuro.

Después de examinar los componentes de la vacuna contra la gripe H1N1, sólo podemos concluir que en absoluto está destinada a tratar la gripe, muy por el contrario, lo que se pretende es: 105.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

1º.2º.3º.4º.-

Reducir la inteligencia Reducir el tiempo de vida Reducir la fertilidad Provocar numerosas muertes

Por si se pretendía para cualquier otro propósito, más allá del alcance de este artículo el escualeno y otros adyuvantes no estarían presentes. Además, el alcance de este artículo sólo cubre el escualeno, escualeno y creemos que porque que hay tantas maneras de inducir respuestas autoinmunes igualmente devastadoras a través de otras formulaciones inyectables, emparejadas con el envío obviamente intencional de una pandemia por la Baxter, que la credibilidad de las vacunas está manchada para siempre y la confianza en la gran comunidad médica puede haber sido irreparablemente rota. La Baxter debería estar fuera del negocio, el hecho de que no lo esté es condenatorio.

La confianza se ha roto Por medio de una pandemia manufacturada y una vacuna perniciosa la Organización Mundial de la Salud junto con los principales fabricantes de la industria farmacéutica han demostrado una clara intención de perjudicar a toda la humanidad. Con qué fin es difícil de determinar, pero sería seguro asumir que estarán aquellos a quienes se les ha avisado y saben que es mejor evitar tomar una de estas vacunas contaminadas y, como resultado, serán superiores en inteligencia y salud puestos en perspectiva con aquellos que fueron vacunados. El programa de vacunación H1N1, cuando se pone en el mismo marco que el virus obviamente diseñado genéticamente para ser inyectados conjuntamente, parece ser un claro esfuerzo por dividir a la humanidad en dos grupos, los que han perdido su intelecto, la salud y la sexualidad a través de una vacuna contaminada, y aquellos que no, siendo por tanto, superiores. Ahora se puede razonar que ya no es seguro tomar cualquier vacuna por cualquier motivo; por favor, no dejes que lleguen a sus hijos. hijos --¡Si alguna vez ves un vídeo con las principales figuras políticas del país recibiendo su vacuna, ten en cuenta que no todas serán iguales para todos!

Referencias La referencia más valiosa de este artículo, fue con mucho, la Dr. Sarah Stone, Pharm-D. Muchas gracias, por sacar estos hechos de la ficción y haber hecho posible este artículo Newsmax.com "la vacuna puede ser más peligrosa que la gripe porcina" Mercola.com "escualeno: El Pequeño Sucio Secreto de la vacuna contra la gripe porcina al descubierto" Chiroweb.com "Las vacunas pueden estar vinculadas a Síndrome de la Guerra del Golfo" The Unify Coalición "Vacunas experimentales / adyuvantes / escualeno" Libertad Health Alliance Leer hasta el artículo 122, vuelve al Inglés a media página!

RENSE Este es un informe excelente sobre el Síndrome de la Guerra del Golfo y el autismo, por Neurosergeon Dr. Blaylock 106.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

LA FIEBRE PORCINA ES UNA FARSA

¡ P E R O L A VA C U N A P O D R Í A M ATA R T E ! ¡ D I N O A L A VA C U N A C I Ó N !

CARGOS CRIMINALES CONCERNIENTES A ACTOS DE BIOTERRORISMO Y GENOCIDIO

107.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Según la denuncia, tanto gobiernos como multitud de organismos internacionales están implicados en una trama de reducir la población mundial. Una periodista de investigación Austriaca alerta al mundo de que el mayor crimen en la historia de la humanidad está en marcha. Bárbara L. Minton, editora del popular sitio de divulgativo sobre salud, http://www.naturalnews.com/author358.html, presenta una investigación efectuada por la periodista Austriaca, Jane Bürgermeister, que denuncia a grandes laboratorios, la OMS y hasta al presidente de USA, Barack Obama, de formar parte de un plan de vacunación masiva contra la gripe porcina que tendría como finalidad real reducir significativamente la población mundial.

Jane Bürgermeister ha presentado ante el FBI cargos criminales contra de la Organización Mundial de la Salud (OMS), las Naciones Unidas (ONU), y funcionarios de Gobiernos y empresas en relación con al bioterrorismo e intento de genocidio orquestado. En julio del 2009 se espera que esté lista la vacuna de Baxter contra la gripe A/H1N1 que piensa ser empleada como “arma de destrucción masiva”. La denunciante también ha preparado un mandamiento judicial contra la vacunación que se está presentado en América. Se presentan cargos contra Baxter AG y Avir Green Hills Biotechnology de Austria por producir vacunas contra la gripe empleando para ello aves contaminadas, alegando que se trataba de un acto deliberado de provocar y sacar provecho de una pandemia.

Resumen de las reclamaciones y denuncias presentadas ante el FBI en Austria el 10 de junio, 2009. En su acusación, Bürgermeister presenta pruebas de los actos de bioterrorismo en violación de la ley de EE.UU, por un grupo que opera en los EE.UU bajo la dirección de los banqueros internacionales que controlan la Reserva Federal, así como la OMS, la ONU y la OTAN con el fin de llevar a cabo un genocidio en masa contra la población de los EE.UU. mediante el uso de la ingeniería genética desencadenando una pandemia de gripe del virus recombinado porcino/aviar con la intención de provocar la muerte a millones de personas. Este grupo ha elevado anexo de las oficinas gubernamentales en los EE.UU. …......(sigue documento original en Inglés a.p. —pg 110— de 173 pgs en word pasado a oOo)

108.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Fuente: http://www.bibliotecapleyades.net/ciencia/ciencia_influenza53.htm

MUY IMPORTANTE información sobre el peligro de las vacunas de la gripe A o H1N1 Jane Burgermeister, es una periodista de investigación sobre temas de salud austriaco-irlandesa, que descubrió que la farmacéutica Baxter International había enviado, a principios de 2009, material para vacunas contaminado con virus aviar vivo sin atenuar a 18 laboratorios en varios países europeos.

Este descubrimiento le llevó a comenzar una investigación en la que consiguió numerosas evidencias y pruebas para denunciar ante los tribunales a numerosas agencias e instituciones como la OMS, ONU, la farmacéutica Baxter Internacional, gobierno americano, banqueros ... por intento de genocidio y de reducción de la población a través de la vacunación de la gripe porcina.

Burgermeister fue despedida de su trabajo sin que se le dieran motivos y se embarcó entonces en una campaña de divulgación sobre todo este asunto. Comenzó también a recibir todo tipo de descalificaciones, se le acusó de no haber presentado realmente ningún cargo, se le intentó desprestigiar de muchas maneras e incluso se llegó a decir que ni siquiera existía, hasta que Proyecto Camelot realizó esta entrevista.

Podéis encontrar también todos los detalles y pruebas del caso en su Web en inglés. Si preferís en español, el amigo hackbogado se ha molestado en colgar la web de Jane traducida en gran parte al español.

Baxter Internacional está fabricando la forma comercializada de la vacuna bajo el nombre de CELVAPAN a través de su cultivo patentado Vero cell. CELVAPAN se produce a gran escala en la planta de Baxter en Bohumil, en la República Checa, y se envía a Viena, Austria, para su formulación final, llenado y envasado previos a la distribución18.

Entre todos tenemos que evitar que la gente se vacune e inicie una peligrosa pandemia letal.

18 .- Archivo desaparecido de la Red con fecha de composición del presente trabajo de traducción (09/09/14) (N. de los T.)

109.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Download the original attachment ° ° ° Criminal Charges concerning Bioterrorism Acts and Mass Murder.° ° ° ° ° °

Submitted: FBI OFFICER EMBASSY OF THE UNITED STATES Boltzmanngasse 16 A-1090 Vienna Austria ° ° Date: June 10, 2009° ° ° Contents° ° ° I. Introduction: Summary of Claims° II. Factual Background° III. Evidence the “swine flu“ vaccines are bioweapons° IV. Scientific evidence the “swine flu” virus is an artificial (genetically engineered) virus.° V. Scientific evidence the “swine flu” was bioengineered to resemble the Spanish flu killer virus of 1918.° VI. Genome sequence of the “swine flu”° VII. Evidence as to deliberate release of the “swine flu” virus in Mexico° VIII. Evidence as to the involvement of President Obama° IX. Evidence as to the role of Baxter and WHO in producing and releasing pandemic virus material in Austria.° X. Evidence Baxter is an element in a covert bioweapons network.° 110.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XI. Evidence Baxter has deliberately contamined drugs.° XII. Evidence Novartis is using vaccines as bioweapons.° XIII. Evidence as to the WHO’s role in the bioweapons program: supplier of the bird flu virus to Baxter.° XIV. Evidence as to WHO’s manipulation of disease data in order to justify declaring a Pandemic Level 6 in order to seize control of the USA.° XV. Evidence as to FDA’s role in covering up the bioweapons program.° XVI. Evidence as to the Canada’s National Microbiology Labs role in the bioweapons program.° XVI. Evidence of the involvement of scientists working for the UK’s NIBSC, and the CDC in engineering the swine flu.° XVII. Evidence vaccinations caused the Spanish killer flu of 1918.° XVIII. Precedents: the abandoned swine flu mass vaccination program of 1976.° XIX. Inadequate performance of the government in stopping the spread of the swine flu as cover for spreading a pandemic.° XX. Evidence as to manipulation of the legal framework to allow mass murder with impunity.° XXII. Constitutional issues: the legality v. Illegality of jeopardising the Life, health and “public good” by mass vaccinations.° XXI. The Issue of immunity and compensation as evidence of intent to commit a crime.° XXII. Evidence as to the use of chemtrails for population reduction.° XXIII. Evidence as to the existence of an international corporate crime syndicate.° XXIV. Evidence as to the existence of the “Illuminati”.° XXV. Evidence of the Illuminati’s involvement in the current collapse of the world’s financial system.° XXVI. Evidence as to the depopulation agenda of the Illuminati/Bilderbergs and their involvement in the engineering and release of the artificial “swine flu” virus.° XXVII. Evidence as to the Genocide Agenda by means of Weaponised Flu being discussed at the annual Bilderberg meeting in Athens from May 14-17, 2009.° XXVIII. Conclusion.° XXIX. Defendants.° XXX. Attachments.°

111.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

- Criminal Charges filed against Baxter and WHO i.a. in Austria - Criminal Charges filed against Baxter and WHO i.a. in Switzerland - Parliamentary answers to the Baxter incident - Excerpt: Biological Weapons Anti-Terrorism Act of 1989.° ° ° °

112.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

I. Introduction: Summary of Claims° ° ° I am presenting evidence of acts of bioterrorism that are in violation of criminal law of the United States by a group operating within the United States under foreign direction, specifically under the direction of international bankers who control, among other financial institutions, the Federal Reserve, as well as international government organizations, specifically the World Health Organization, the United Nations and NATO.° Evidence is presented to show that an international corporate criminal syndicate is intent on carrying out a mass genocide against the United States population by using an artificial (genetically) engineered flu pandemic virus to cause death and injury and having annexed high government offices in the United States.° Specifically, evidence is presented that Defendants President Barack Obama, President of the United States, David Nabarro, UN System Coordinator for Influenza, Margaret Chan, Director-General of World Health Organization, Kathleen Sibelius, Secretary of Department of Health and Human Services (HHS), Secretary Janet Napolitano, the Department of Homeland Security, David de Rotschild, banker, David Rockefeller, banker, George Soros, banker, Werner Faymann, Chancellor of Austria, Alois Stöger, Austrian Health Minister, among others, are part of this international corporate criminal syndicate which has developed, produced, stockpiled and employed biological weapons to eliminate the population of the United States and other countries for financial and political gain.° Evidence is presented for contending that the defandants did conspire with each other and with others to devise, fund and participate in the final phase of the implementation of a covert international bioweapons program involving, among other entities, the pharmaceutical companies Baxter and Novartis, by first bioenginneering and, then releasing lethal biological agents, specifically, first, the so-called “bird flu” virus and, second, the “so-called” swine flu virus, in order to have a pretext to implement a forced mass vaccination programme, which will be the means for the administration of a toxic biological agent using the delivery system of an injection, causing death and injury to the people of the United States in violation of the Biological Weapons Anti-Terrorism Act of 1989 (BWATA) passed into law in 1990, which extended the scope of bio-warfare materials regulation to include private individuals and non-state organizations, including corporations.° The dossier presents the evidence that Baxter AG, Austrian subsidiary of Baxter International, based in Deerfield, Ill, deliberately, wilfully and knowingly, sent out 72 kilos of live bird flu virus -supplied by the World Health Organisation, Geneva, Switzerland -- in the winter of 2009 to 16 laboratories in four countries. This evidence offer clear proof that the pharmaceutical companies and international government agencies themselves are actively engaged in producing, developing, manufacturing and distributing biological 113.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

agents classified as the most deadly bioweapon on the planet in order to trigger a pandemic and cause mass deaths.° Attachment (A) is a copy of the criminal charges filed against Baxter and other defendants at the Vienna City Prosecutor’s Office on April 8t, 2009, by Jane Bürgermeister, dual Irish/Austrian citizen, resident in Vienna, Austria.° The Austrian police are now investigating the incident involving the release of 72 kilos of live bird flu virus from Baxter’s lab Orth an der Donau this winter.° According to § 175 (a) of BWATA, there is extraterritorial Federal jurisdiction over an offense under this section committed by or against a national of the United States.° Attachment (B) is a copy of criminal charges filed against Baxter and WHO and other defendants via the Austrian police concerning an alleged case of bioterrorism in Switzerland in April, 2009.° Briefly, the charges detailed in Attachment (A) against Baxter note that Baxter’s lab in Orth an der Donau, one of the supposedly most secure biosecurity labs in the world, did not adhere to most basic and essential steps to stop 72 kilos of a pathogen classified as a bioweapon to be kept secure and separate from all other substance under stringent biosecurity level regulations, but allowed it to be mixed with the ordinary human flu virus and sent from its facilities in Orth in the Donau.° WHO, EU and Austrian health authorities did not investigate after a staff member at BioTest in the Czech Republic at the beginning of Feburary tested the material meant for candidate vaccines on ferrets, who then died. They did not investigate the content of the virus material. There is no data on the genetic sequence of the virus released.° In an answer to parliamentary questions on May 20th, 2009, the Austrian Health Minister, Alois Stöger, revealed that the incident had been handled not as a biosecurity lapse, as it should have been, but as an offence against the veterinary code and a vetinary doctor and a medical doctor had been sent to inspect the lab briefly.° Attachment (C) is a copy of the answers dated May 20th, 2009, of the Austrian Health Minister Alois Stöger to the parliamentary questions tabled by an MEP on March 20th, 2009, the Baxter incident, detailing the amount of live bird flu virus material involved – 72 kg – and the steps taken by the authorities to investigate.° The dossier shows that the release of the for triggering a pandemic that will allow Pandemic. The laws and decrees are listed WHO to take over the United States in the

virus is an essential step WHO to declare a Level 6 which will allow the UN and event of pandemic.°

Also, mandatory vaccinations will come into force in the United States in the event of a pandemic declaration.° The entire “swine flu” pandemic business is premised on a massive lie – that there is a natural virus out there that poses a threat to the population.° 114.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Scientific evidence is given for believing that the bird flu virus and swine flu virus have, in fact, been bioengineered in laboratories using funding supplied by WHO and other government agencies, among others. This “Swine flu” virus is a hybrid of part “swine flu”, part human flu and part bird flu. Something like that can only come from a laboratory, according to experts.° WHO claims that the swine flu is spreading and they must declare a pandemic ignores the fundamental causes. The viruses that were released were created and released by the help of WHO and WHO is overwhelmingly responsible for the pandemic in the first place b failing to introduce measures to limit the spread of the virus rapidly.° In addtion, the symptoms of supposed swine flu are indistinguishable from regular flu or from the common cold. It does not cause death anymore often than the regular flu causes death.° The figures for deaths reported for the “Swine Flu” are inconsistent and there is no clarity as to how the number of “deaths” has been documented.° There is no pandemic potential unless mass vaccinations are carried out to weaponise the flu under the guise of protecting the population.° There are reasonable grounds for believing that the mandatory vaccines will be purposely contaminated with diseases that are specifically designed to cause death.° A licenced Novartis bird flu vaccine killed at least 21 homeless people in Poland in the summer of 2008 and had as its “primary outcome measure”, an “adverse events rate”, thereby meeting the US government’s own definition of a bioweapon (a biological agent designed to cause an adverse events rate, i.e. death or injury) with a delivery system (injection).° The same complex of international pharmaceutical companies and international government agencies that have developed and released pandemic material have positioned themselves to profit from triggering the pandemic by sealing contracts to supply the vaccine and funding.° The pandemic will bring huge profits for the pharmaceutical industry from the potential sale of “swine flu” vaccines, government subsidies and funding.° The various media groups are controlled by the same group that is in charge of this “Swine Flu”° hoax and are spreading misinformation to lull the people of the United States into taking the dangerous vaccine.° In summary, the dossier presents evidence that the people of the United States will suffer substantial and irreparable injury if they are forced to take the unproven vaccine without their consent pursuant to the Model State Emergency Health Powers Act, National Emergency Act, NATIONAL SECURITY PRESIDENTIAL DIRECTIVE/NSPD 51 and HOMELAND SECURITY PRESIDENTIAL DIRECTIVE/HSPD-20, and the International Partnership on Avian and Pandemic Influenza.° 115.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Beginning in or about 2008 to the present, in the United States, Defendants have implemented new and/or accelerated the implementation of laws and regulations designed to strip the citizens of the United States of their lawful Constitutional rights to refuse an injection by creating or allowing provisions to remain in place that criminalise the refusal to take an injection against pandemic viruses and by imposing other excessive and cruel penalties such as imprisonment and/or quarantine in FEMA camps while barring the citizens of the United States from claiming compensation for injury or death from the above-mentioned forced injection, in violation of laws on federal corruption and the abuse of office and also of the Constitution and Bill of Rights so laying the legal groundwork for mass genocide.° The defandants have preplanned the mass murder of the US population by means of a forced vaccination, also by installing an extensive network of FEMA concentration camps and identifying mass graves and they have been involved in devising and implementing a scheme to hand power over the United States of America, using the swine flu or other pandemic as a pretext, to an international crime syndicate, that uses the United Nations and World Health Organisation as a front for the illegal racketeering influenced organised crime activities of the above-mentioned organisation, in violation of laws on Treason.° Evidence is presented that the complex of pharmaceutical companies of Baxter, Novartis and Sanofi Aventis are part of a foreign-based dual purpose bioweapons programme financed by the international criminal syndicate and designed to implement mass murder to reduce the world’s population by as much as 5 ½ billion in the next ten years, to spread terror, to justify forcing people to give up their rights and mass quarantine in FEMA camps.° Also, the assets – houses, companies, farms, stocks – of those who are killed will be up for grabs by the international crime syndicate.° By eliminating the poopulation of North America, international elite access to the region’s natural resources, such as water, and by eliminating the United States and its democratic constitution by subsuming it under a “North American Union” with an Amero currency, the international crime group will have total control of North America.° The pandemic has also engineered to distract the attention world from a devastating global economic crisis engineered same international crime group, which is leading the world crisis marked by poverty, economic collapse, war, the loss rights and the demise of State social programs.° ° °

116.-.de.-.300.-.www.jimstonefreelance.com

of the by the into a of civil

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

II. Factual Background° 1. Timeline and facts that establish probbale cause° ° A.The Model State Emergency Health Powers Act, the NATIONAL SECURITY PRESIDENTIAL DIRECTIVE/NSPD 51 and HOMELAND SECURITY PRESIDENTIAL DIRECTIVE/HSPD-20 and other laws. ° 1. The Model State Emergency Health Powers Act adopted in 38 States makes it a misdemeanor to a felony to refuse to take a vaccine mandated by the federal government and/or other affiliated bodies if the government officially declares a pandemic. Law enforcement officers are allowed to use deadly force against felony suspects.° For the specific versions of that Act enacted in each individual state.

2. The "Model State Emergency Heath Powers Act" allows the Government to seize and/or quarantine a town and all the people within it.° 3. Once a town is quarantined, the government is allowed to seize all property and seize the rights of the people to resist government i.e. confiscating all civilian owned firearms.° http://www.publicealthlaw.net/MSEHPA/MSEHPA%20Surveillance.pdf ° (Model State Emergency Health Powers Act) http://www.pandemicflu.gov/plan/states/stateplans.html° http://www.flu.gov/planning-preparedness/states/stateplans.html 4. People who suffer death or injury as a result of a governmentmandated vaccine will be barred from seeking compensation under provisions of the laws and acts.° 5. Section 63, Vaccination and Treatment of The Model State Emergency Health Powers Act, A Checklist of Issues, indicates those unwilling to submit to a vaccine will be subject to isolation or quarantine. http://www.ncsl.org/programs/health/modelact.pdf° 6. Mandatory vaccine simulation drills are planned for at least three states including Texas, Ohio and Alaska. (Maloney, County plans to deal with unthinkable, 2009) http://www.seguingazette.com/story.lasso?ewcd=7067c6003405a409° 7. The Massachusetts Legislature is fast-tracking legislation for Martial Law and mandatory vaccines in response to the current „swine flu outbreak“. (AP, 2009) http://news.bostonherald.com/news/politics/view/2009_04_28_Mass__Sena te_approves_pandemic_flu_prep_bill/° 8. Under the National Emergency Act, the President "may seize property, organize and control the means of production, seize commodities, assign military forces abroad, institute martial law, seize and control all transportation and communication, regulate the operation of private enterprise, restrict travel, and, in a variety of ways, control the lives of United States citizens."° 117.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

9. NSPD-51/ HSPD-20 have created the position of National Continuity Coordinator without any specific act of Congress authorizing the position.° 10. NSPD-51/ HSPD-20 appears to negate any a requirement that the President submit to Congress a determination that a national emergency exists, suggesting instead that the powers of the executive order can be implemented without any congressional approval or oversight. http://www.dhs.gov/xabout/laws/gc_1219263961449.shtm#1° 11. NATIONAL SECURITY PRESIDENTIAL DIRECTIVE/NSPD 51 and HOMELAND SECURITY PRESIDENTIAL DIRECTIVE/HSPD-20 allows the governors in each state to suspend the government and law and, among other things, confiscate and destroy facilities and resources in the interest of the public health without compensation to the owners, per Article IV Section 402(a). The State Legislatures are barred from intervening for a period of 60 days.° 12. Any physician or other health care provider who refuses to perform medical examination or vaccinations as directed shall be liable for delicensure and the inability to continue to practice in the State.° 13. the Act criminalizes refusal of medical treatment, making citizens liable for a misdemeanor if they refuse mandatory vaccines, per Article V Section 504(b). The Act gives the public health authority the right to isolate or quarantine a person on an ex parte court order, with no hearing for at least 72 hours. If the public health authority decides that an unvaccinated person is a risk to others, even if uninfected, he could be quarantined, per Article V Section 503(e).° 14. The Act removes the States accountability for harm or deaths resulting from mandatory vaccines citing the state immunity clause:° "Neither the State, its political subdivisions, nor, except in cases of gross negligence or willful misconduct, the Governor, the public health authority, or any other State official referenced in this Act, is liable for the death of or any injury to persons, or damage to property, as a result of complying with or attempting to comply with this Act or any rule or regulations promulgated pursuant to this Act," per Article VIII Section 804.° 15. President Bush announced a new International Partnership on Avian and Pandemic Influenza to a High-Level Plenary Meeting of the U.N. General Assembly, in New York on Sept. 14, 2005. The 2005 plan, operative until Bush announced the International Partnership on Avian and Pandemic Influenza, directed the State Department to work with the WHO and U.N.° http://www.hhs.gov/pandemicflu/plan/appendixh.html° 16. The Security and Prosperity Partnership of North America Summit in Canada released a plan that establishes U.N. law along with regulations by the World Trade Organization and World Health Organization as supreme over U.S. law during a pandemic and sets the stage for militarizing the management of continental health emergencies.° 17. the SPP plan gives primacy for avian and pandemic influenza 118.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

management to plans developed by the WHO, WTO, U.N. and NAFTA directives – not to decisions made by U.S. Agencies.° 18. the U.S. Northern Command, or NORTHCOM, has created a web page dedicated to avian flu and has been running exercises in preparation for the possible use of U.S. military forces in a continental domestic emergency involving avian flu or pandemic influenza.° ° 19. All 194 nation-states (members of U.N.) had until June 2007 to implement the WHO revised International Health Regulations (IHR) -revised in 2005,° which included passage of legislation empowering state surveillance and monitoring of their citizens under the guise of a potential worldwide pandemic (smallpox, polio, SARS or human cases of new strains of influenza). Stockpiling specific vaccines and anti-viral medications are part of compliance with IHR.° ° 20. The U.N.-WHO-WTO-NAFTA plan advanced by SPP features a prominent role for the U.N. system influenza coordinator as a central international director in the case of a North American avian flu or pandemic influenza outbreak.° ° 21. in Sept. 2005, Dr. David Nabarro was appointed the first U.N. system influenza coordinator, a position which also places him as a senior policy adviser to the U.N. director-general.° Nabarro joined the WHO in 1999 and was appointed WHO executive director of sustainable development and health environments in July 2002.° ° 22. In a Sept. 29, 2005, press conference at the U.N., Nabarro made clear that his job was to prepare for the H5N1 virus, known as the avian flu.°°He quantified the deaths he expected as follows: "I'm not, at the moment at liberty to give you a prediction on numbers, but I just want to stress, that, let's say, the range of deaths could be anything from 5 to 150 million."° 23. The National Security and Homeland Security Presidential Directive, signed on May 9, 2007 declares that in the event of a “catastrophic event”, George W. Bush can become what is best described as "a dictator":°° °° "The President shall lead the activities of the Federal Government for ensuring constitutional government."°° °° This directive gives the White House unprecedented dictatorial power over the government and the country, bypassing the US Congress and obliterating the separation of powers. The directive also placed the Secretary of Homeland Security in charge of domestic “security”.° “(1) this directive establishes a comprehensive national policy on the continuity of Federal Government structures and operations and a single National Continuity Coordinator responsible for coordinating the development and implementation of Federal continuity policies.

This policy establishes "National Essential Functions," prescribes continuity requirements for all executive departments and agencies, and provides guidance for State, local, territorial, and tribal governments, and private sector organizations in order to ensure a comprehensive and integrated national continuity program that will 119.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

enhance the credibility of our national security posture and enable a more rapid and effective response to and recovery from a national emergency.° 24.(b) "Catastrophic Emergency" means any incident, regardless of location, that results in extraordinary levels of mass casualties, damage, or disruption severely affecting the U.S. population, infrastructure, environment, economy, or government functions.“° ° B. World Health Organization (WHO) and U.N.° ° 25. The World Health Organization (WHO) is a specialized agency of the United Nations (UN) that acts as a coordinating authority on international public health. Established on 7 April 1948, and headquartered in Geneva, Switzerland, the agency inherited the mandate and resources of its predecessor, the Health Organization, which had been an agency of the League of Nations.° 26. The WHO's constitution states that its objective "is the attainment by all peoples of the highest possible level of health."° 27. The WHO and UN will become the controlling agencies in the US in the event of a declared pandemic level 6.° 28. The World Health Organization (WHO) has developed a global influenza preparedness plan, which defines the stages of a pandemic, outlines WHO's role and makes recommendations for national measures before and during a pandemic.°

120.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Phase WHO Pandemic Influenza Phases (2009)[80] Phase

Description

Phase 1

No animal influenza virus circulating among animals have been reported to cause infection in humans.

Phase 2

An animal influenza virus circulating in domesticated or wild animals is known to have caused infection in humans and is therefore considered a specific potential pandemic threat.

Phase 3

An animal or human-animal influenza reassortant virus has caused sporadic cases or small clusters of disease in people, but has not resulted in human-tohuman transmission sufficient to sustain communitylevel outbreaks.

Phase 4

Human to human transmission of an animal or humananimal influenza reassortant virus able to sustain community-level outbreaks has been verified.

Phase 5

Human-to-human spread of the virus in two or more countries in one WHO region.

Phase 6

In addition to the criteria defined in Phase 5, the same virus spreads from human-to-human in at least one other country in another WHO region.

Post peak period

Levels of pandemic influenza in most countries with adequate surveillance have dropped below peak levels.

Post pandemic period

Levels of influenza activity have returned to the levels seen for seasonal influenza in most countries with adequate surveillance.

29. "Efforts by the federal government to prepare for pandemic influenza at the national level include a $100 million DHHS initiative in 2003 to build U.S. vaccine production.° 30. Several agencies within Department of Health and Human Services (DHHS) — including the Office of the Secretary, the Food and Drug Administration (FDA), CDC, and the National Institute of Allergy and Infectious Diseases (NIAID) — are in the process of working with 121.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

vaccine manufacturers to facilitate production of pilot vaccine lots for both H5N1 and H9N2 strains as well as contracting for the manufacturing of 2 million doses of an H5N1 vaccine.° 31. On October 27, 2005, the Department of Health and Human Services awarded a $62.5 million contract to Chiron Corporation to manufacture an avian influenza vaccine designed to protect against the H5N1 influenza virus strain. This followed a previous awarded $100 million contract to sanofi pasteur, the vaccines business of the sanofiaventis Group, for avian flu vaccine.°

32. According to The New York Times as of March 2006, "governments worldwide have spent billions planning for a potential influenza pandemic: buying medicines, running disaster drills, [and] developing strategies for tighter border controls" due to the H5N1 threat.[83]° 33. In October 2005, President Bush urged bird flu vaccine manufacturers to increase their production.[94]° 34. On November 1, 2005 President Bush submitted a request to Congress for $7.1 billion to begin implementing the National Strategy To Safeguard Against The Danger of Pandemic Influenza. The request includes $251 million to detect and contain outbreaks before they spread around the world; $2.8 billion to accelerate development of cell-culture technology; $800 million for development of new treatments and vaccines; $1.519 billion for the Departments of Health and Human Services (HHS) and Defense to purchase influenza vaccines; $1.029 billion to stockpile antiviral medications; and $644 million to ensure that all levels of government are prepared to respond to a pandemic outbreak.[96]° 35. On 6 March 2006, Mike Leavitt, Secretary of Health and Human Services, said U.S. health agencies are continuing to develop vaccine alternatives that will protect against the evolving avian influenza virus.[97]° °

C. 2009 Swine flu outbreak ° 36. In March and April 2009, an outbreak of a new strain of influenza commonly referred to as "swine flu" infected many people in Mexico and other parts of the world.° 37. The new strain was first diagnosed in two children by the CDC, first on April 14 in San Diego County, California and a few days later in nearby Imperial County, California.[78] Neither child had been in contact with pigs.° 38. The outbreak was first detected in Mexico City, where surveillance began picking up a surge in cases of influenza-like illness (ILI) starting March 18.[80] ° 39. On April 18.[85].The Mexican cases were confirmed by the CDC and 122.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

the World Health Organization to be a new strain of H1N1.[80][86].° 40. Cases were also reported in the states of San Luis Potosí, Hidalgo, Querétaro and Mexico State.[87] Mexican Health Minister José Ángel Córdova on April 24, said "We’re dealing with a new flu virus that constitutes a respiratory epidemic that so far is controllable."[87] Mexican news media speculate that the outbreak may have started in February near a Smithfield Foods pig plant amid complaints about its intensive farming practices,[88][89] although no pigs in Mexico have tested positive for the virus.[citation needed] ° 41. The first death from swine flu occurred on April 13, when a diabetic woman from Oaxaca died from respiratory complications.[91] [92] The Mexican fatalities are alleged to be mainly young adults of 25 to 45.° 42. Although by late April there had been reports of 152 "probable deaths"[94] in Mexico, the WHO had received reports of only 7 confirmed deaths as of April 29 and explicitly denied the larger figure.[95][96] ° 43. Mexico's Health Secretary declared that around 100 early suspected deaths from swine flu could not be confirmed because samples were not taken.[5].° 44. Cases were first discovered in the U.S. and officials soon suspected a link between those incidents and an earlier outbreak of late-season flu cases in Mexico. Within days hundreds of suspected cases, some of them fatal, were discovered in Mexico, with yet more cases found in the U.S. and several other countries in the Northern Hemisphere. Soon thereafter, the U.N.'s World Health Organization (WHO), along with the U.S. Centers for Disease Control and Prevention (CDC), expressed concern that the A(H1N1) could become a worldwide flu pandemic, and WHO then raised its pandemic disease alert level to "Phase 5" out of the six maximum, as a "signal that a pandemic is at the imminent level".° 45. According to a Summary of latest H1N1 developments in the United States by Alexander S Jones May 19, 2009° A) H1N1 may have killed an infant in New York who developed cyanosis with rapid progression to death.° This is an ominous parallel to 1918.° This suggests viral pneumonia, but we have no confirmation.° Whether this is from the New York 'consensus strain' or a new recombinant, mutant, or reassortant is unknown at this time.° http://www.flutrackers.com/forum/showthread.php?t=105092 http://www.myfoxny.com/dpp/health/swine_flu/090519_second_possible_de ath_from_swine_flu_in_new_york_city° B) Dr. Niman has estimated there are currently 1 - 10 million infections in the United States. This matches my own assessment. With a case fatality rate of 0.1%, we can expect 1000 - 10000 deaths -although it has become clear at this point the authorities are covering up the spread of the virus.° With a case fatality rate of 0.4%, we can expect 4000 - 40000 deaths.° http://www.recombinomics.com/News/05180901/Swine_H1N1_Japan_6.html° 123.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

° C) H1N1 is rapidly spreading in schools.° The articles I have pasted below are only the tip of the iceberg -- this is across the country at this point.° Lowell had 123 students call in sick Monday and sent another 71 home with fevers and other flu-like symptoms, the representative said.° http://www.flutrackers.com/forum/showthread.php?t=105174 http://www.bizjournals.com/phoenix/stories/2009/05/18/daily24.html° The Dana Hall School in Wellesley has been shuttered for the next week after nearly 100 students and staff called in sick with fevers, sore throats, and other flu-like systems.° A spokeswoman for Dana Hall School in Wellesley said Tuesday there is no indication that swine flu is what prompted 90 students and eight faculty and staff members to call in sick on Monday, but the move was made after consulting with state and local public health officials.° A spokeswoman for the state Public Health Department says there are no confirmed swine flu cases at the school and no one associated with the school is being tested for the disease.° http://www.flutrackers.com/forum/showthread.php?p=235635#post235635 http://www.boston.com/yourtown/news/wellesley/2009/05/flu_closes_dana _hall_school_in.html http://www.bostonherald.com/news/regional/view/2009_05_19_Wellesley_s chool_closes_after_rash_of_illnesses/srvc=home&position=recent D) There has been a death from a possible lethal coinfection, a dangerous event suggesting worse is to come°-- see the case of the death from pneumonia of an oil platform worker who tested positive for multiple strains of the flu.° Possible Swine Flu Death in Little Rock° ° Reported by: KARK 4 News° Monday, May 18, 2009° The death of a 28-year-old man in a Little Rock hospital over the weekend could be linked to the H1N1 virus better known as Swine Flu.° That's according to Pulaski County Coroner Garland Camper , who tells KARK 4 that the man's autopsy revealed he had suffered from more than one strain of flu. Camper calls that "somewhat unusual."° Camper says the man was an offshore oil worker who had been in the hospital with flu-like symptoms, and had reportedly been ill for weeks.° http://arkansasmatters.com/content/fulltext/news/?cid=222431° E) Data has become available from case studies in California , from H1N1 hospitalizations.°° 124.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

15/25 patients have lung infiltrates, almost half have vomiting... this is somewhat disturbing.° The best predictive symptoms based on this data are:° 1) Fever (97%) 2) Cough (77%) 3) Lung infiltrates (60%) 4) Vomiting (46%) 5) Shortness of breath (43%)° #3 and #4 are unusual for influenza http://www.flutrackers.com/forum/showthread.php?p=235601#post235601° ° F) An article in Science from last week estimated the H1N1 case fatality rate is 0.4% -- four times higher than seasonal flu.° http://www.eurekalert.org/pub_releases/2009-05/icl-sfe051109.php G) The ER in New York has become overwhelmed with patients -- on Tuesday, seeing double the number of children who present with respiratory symptoms.° Alan D. Aviles, the president of the city’s Health and Hospitals Corporation, said that emergency admissions were running about 50 percent higher than usual for adults and “more than 100 percent above average” for children.° http://www.flutrackers.com/forum/showpost.php?p=235577&postcount=23 http://cityroom.blogs.nytimes.com/2009/05/19/toddlers-death-stokesflu-concerns/?hp° 46. "The first case was seen in Mexico on April 13. The outbreak coincided with the President Barack Obama’s trip to Mexico City on April 16. Obama was received at Mexico’s anthropology museum in Mexico City by Felipe Solis, a distinguished archeologist who died the following day from symptoms similar to flu, Reforma newspaper reported. The newspaper didn’t confirm if Solis had swine flu or not."° http://www.bloomberg.com/apps/news? pid=20601087&sid=aEsNownABJ6Q&refer=worldwide° 47. The Paris-based World Organization for Animal Health (OIE) said April 27th that virus currently circulating in Mexico and the United States and which has killed at least 20 people had never been found before in any animal and was completely new.° "The virus has not been isolated in animals to date. Therefore, it is not justified to name this disease swine flu," the OIE said in a press statement.° The virus "includes in its characteristics swine, avian and human virus components," the OIE said, and urged that it be called "North American influenza," after its geographic origin.° The OIE said it was "urgent" that scientific research be carried out to determine the susceptibility of animals to what it said was a "new 125.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

virus."° 48. The new strain is an apparent reassortment of four strains of influenza A virus subtype H1N1.[64] Analysis by the CDC identified the four component strains as one endemic in humans, one endemic in birds, and two endemic in pigs (swine).° 49. Alexander S Jones, former employee the NIH, has analyzed the genome sequence of the virus and concluded we “must seriously consider a laboratory origin for this virus”.

“BLAST sequence homology of 'swine flu' indicates both the Hemagglutinin (HA) surface protein as well as the Non-structural (NS1) interferon Inhibition proteins are novel recombinants previously unidentified in nature.

Both these influenza proteins, based on the genetic sequences released Friday May 1st by the U.S. Centers of Disease Control (CDC),° share their closest genetic identity with turkey (avian) and pig (swine) strains from multiple continents including North America as well as Asia. Even the closest matches indicate 5% previously unidentified genetic material.

I submit this evidence, coupled with the lack of the presence of this virus at the pig farm near the proposed CDC's "patient zero" (a 5 year old from La Gloria, 80km away from the pig farm in Perote, Mexico), shows that the origin of the flu outbreak remains unidentified at this time, and cannot be ascribed to Mexican or North American swine.

Furthermore, I submit that since 5% of both these influenza A RNA sequences share no known homology in any public databases (in addition to the avian/swine hybrid nature of both these critical genes), that we must seriously consider a laboratory origin for this virus.

Future research that may be promising includes identifying critical SNPs, especially in the PB2 and the NS1 coding regions which may be markers for evolution of pathogen virulence, and should be closely monitored.° The hemagglutinin protein should also be monitored for acquisition of a poly-basic amino acid site which would give the virus pantrophic properties as in the 1918 pandemic. “(Alexander S Jones) 50. The World Health Organization on May 11 said leading vaccine producers including Baxter, Novartis, GlaxoSmithKline and SanofiAventis had requested “wild type virus” samples of the A (H1N1) or swine flu° virus. MedImmune, which is now part of AstraZeneca, Baxter, CSL and Solvay are also being sent samples, as are smaller developers Microgen, Nobilon International, Omnivest Vaccines and Vivaldi. The WHO is co-coordinating scientific discussions over the virus, and has said that, within the next few weeks, it is likely to make a recommendation on whether and how to produce a pandemic vaccine.° 51. Latest Pandemic Time Estimates, based on Los Alamos Flu 126.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Simulation http://www.lanl.gov/news/images/bird4x3red.mov°

by Alexander S Jones° ° *using baseline U.S. zero day of April 20th, 2009° ° Monday April 20

Day·01

Monday April 27

Day·07

Monday May·· 04

Day·14

Monday May

11

Day·21

Monday May

18

Day 28

Monday May

25

Day 35

Monday June

01

Day 42

Monday June 08 Day 49º<--º WHO Declares Phase 6 aka by Friday June 12th) Monday June

15

(by Day 53,

Day 56

Monday June 22 Day 63º<-- Cases Go Exponentialºº (by Day 60, aka by Friday June 19th) Monday June

29

Day 70

Monday July

06

Day 77

Monday July

13

Day 84

Tuesda July

14

Day 85

Wednes July

15

Day 86

Thursd July 16 Day 87°<-- Wave 1 Outbreak Peaks° (by Day 87, aka by Thursday July 16th)° ° Wave 2 Outbreak Peaks° at +90 days, so approx mid-October° ° ° ° ° º

127.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

III. Evidence the “swine flu“ vaccines are bioweaponsº º º The “bird flu” has been classified by the United States government in its own export regulations as a biological weapon, and there are grounds for believing the “swine flu”, likewise, is a bioengineered virus and a component of a biological weapons system as defined by Section 175 (a) of BWATA designed, like the “bird flu”, to deliver toxins and microorganisms so as to deliberately inflict disease on death on people while being disguised as injections for prophylactic, protective, or other peaceful purposes.

Commerce Department regulations supplement listing pathogens whose vaccines are subject to export restrictions for countries classified as sponsors of terrorism (see pages 57-60, 70)º http://www.access.gpo.gov/bis/ear/pdf/ccl1.pdf The United States bars the export of vaccines for the bird flu, smallpox, yellow fever, and many other pathogens to five countries classified as sponsors of terrorism.

Under Department of Commerce rules, a long list of vaccines for viruses, bacteria, and biological toxins cannot be exported to Cuba, Iran, North Korea, Sudan, and Syria unless they obtain a special export license, which can take weeks.

The list of pathogens subject to the rules includes viruses that cause dengue fever, Ebola fever, Marburg fever, Rift Valley fever, and monkeypox. A list of animal pathogens covered by the restrictions includes highly pathogenic bird flu viruses. Bacterial pathogens on the restricted list include anthrax and the microbes that cause tularemia and plague. Not on the list are the causes of common vaccine-preventable diseases, such as measles, mumps, rubella, chickenpox, and seasonal influenza.

The Associated Press reported: “Deep inside the United States export regulations is a single sentence that bars U.S. exports of vaccines for avian bird flu and dozens of other viruses to five countries designated "state sponsors of terrorism."º http://news.yahoo.com/s/ap/20081011/ap_on_re_as/as_bird_flu_biologica l_warfare;_ylt=An9WoLAijbbjeNwhYV6N98Ws0NUE US controls bird flu vaccines over bioweapon fears

By ROBIN McDOWELL, Associated Press Writer Sat Oct 11, 7:14 AM ET When Indonesia's health minister stopped sending bird flu viruses to a research laboratory in the U.S. for fear Washington could use them to make biological weapons, Defense Secretary Robert Gates laughed and called it "the nuttiest thing" he'd ever heard.

Yet deep inside an 86-page supplement to United States export regulations is a single sentence that bars U.S. exports of vaccines for avian bird flu and dozens of other viruses to five countries designated "state sponsors of terrorism."º The reason: Fear that they will be used for biological warfare.º 128.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

So, the United States government views vaccines as tools of biological warfare, giving indirect confirmation to the fears of the Indonesian Health Minister.º Furthermore, Ex-HHS Secretary Mike O. Leavitt refused to provide BIRD FLU VACCINES created by contract with Sanofi-Pasteur to rogue "terrorist" nations like Iran, North Korea, and Syria solely because the VACCINE could be used as a "BIOLOGICAL WEAPON" by "terrorist nations". (See http://crooksandliars.com/node/23360/print)º Leavitt recently declared that a pandemic is "nature's terrorist".

(See http://news.yahoo.com/s/ap/20090509/ap_on_he_me/med_swine_flu_pivotal _moments) and http://www.federalnewsradio.com/?nid=35&sid=1670164.

Here we have ex-HHS secretary Leavitt, declaring that a pandemic is a useful form of "terrorism".º Since untested, untried, and potentially lethal "experimental vaccines" are restricted as "biological weapons" from distribution to "rogue nations", why even contemplate forcing the same "vaccine" onto American citizens?º The only purpose for forcing American citizens to take these vaccines can be to cause death and injury under the guise of employing them for peaceful purposes because these vaccines are according to the United States government’s own regulations so dangerous they have to be kept out of the hands of “terrorist nations” for fear they might use them in a terrorist attack.º Any group of American, dual- American citizens or citizens of other countries who knowingly develops, produces, stockpiles, transfers, acquires, retains, or possesses any biological agent, toxin, or delivery system for use as a weapon against the people of Anerica, or knowingly assists a foreign state or any organization to do so, also employing deceit and fraudulent misrepresentation violates BWATA (see Attachment 1).º “Section 175: Prohibitions with respect to biological weapons (a) IN GENERAL- Whoever knowingly develops, produces, stockpiles, transfers, acquires, retains, or possesses any biological agent, toxin, or delivery system for use as a weapon, or knowingly assists a foreign state or any organization to do so, shall be fined under this title or imprisoned for life or any term of years, or both. There is extraterritorial Federal jurisdiction over an offense under this section committed by or against a national of the United States.”

The Act broadly defines several terms related to biological warfare of vector, toxin, biological agent and delivery system.

The “swine flu” virus fits the BWATA definition of a biological agent to be classified as a bioweapon as: any micro-organism, virus, infectious substance, or biological product that may be engineered as a result of biotechnology, or any naturally occurring or bioengineered component of any such microorganism, virus, infectious substance, or biological product, capable of causing death, disease, or other biological malfunction in a human, an animal, a plant, or another living organism; 129.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

deterioration of food, water, equipment, supplies, or material of any kind or deleterious alteration of the environment The “swine flu” has killed and injured people in the United States alone and so meets the BWATA of a toxin:  “Toxin: "whatever its origin or method of production -- any poisonous substance produced by a living organism; or any poisonous isomer, homolog, or derivative of such a substance".

The forced injections of the population of toxins under guise of offering prophylactic treatment are the delivery system as defined by BWATA and the vaccination process itself will release a fully weaponized virus:  “Delivery system: "any apparatus, equipment, device, or means of delivery specifically designed to deliver or disseminate a biological agent, toxin, or vector".

Constituting the vector as defined by BWATA are the people of the United States who will be injected by force en masse with disease producing microorganisms, and so allow the virus to mutate and develop into more lethal strains.  “Vector: "a living organism capable of carrying a biological agent or toxin to a host".”

130.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

IV. Scientific evidence the “swine flu” virus is an artificial (genetic) virus.º º º Evidence comes from the Paris-based World Organization for Animal Health (OIE), which said on April 27th the virus currently circulating in Mexico and the United States and which has killed at least 20 people has never been found in any animal.º "The virus has not been isolated in animals to date. Therefore, it is not justified to name this disease swine flu," the OIE said in a press statement.ºº º The virus "includes in its characteristics swine, avian and human virus components," the OIE said, and urged that it be called "North American influenza," after its geographic origin.º º The OIE said it was "urgent" that scientific research be carried out to determine the susceptibility of animals to what it said was a "new virus."º Also, Adrian Gibbs, the Australian virologist, who was one of the first to analyse the genetic construction of the swine flu virus, and who was part of the team which developed anti-flu vaccines Tamiflu and Relenza, believes the disease - which has spread across the world in recent weeks – was made in laboratories.

Gibbs and two colleagues analyzed the publicly available sequences of hundreds of amino acids coded by each of the flu virus’s eight genes.

He said he aims to submit his three-page paper today for publication in a medical journal.

The World Health Organization is investigating a claim by an Australian researcher that the swine flu virus circling the globe may have been created as a result of human error., according to a repor on May 13 (Bloomberg) -http://www.bloomberg.com/apps/news?pid=20601124&sid=aShZig0Cig4g.

Andrew Rambaut, a viral geneticist at the University of Edinburgh, has said: “The new neuraminidase gene that came in from Eurasian swine is one we’ve never before seen circulating in humans.”º “This is what we call a reassortment between two currently circulating pig flu viruses,” he said. “Why it’s emerged in humans is anyone’s guess. It hasn’t been seen before in pigs as far as I know.” http://www.wired.co.uk/news/archive/2009-04/29/swine-flu-genes-frompigs-alone.aspx º º

131.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

V. Scientific evidence the “swine flu” was bioengineered to resemble the Spanish flu virus of 1918.º º Dr True Ott has reported that the published definition of the swine flu by the NCSL is identical to Jeffrey Taubenbergers 1997 initial findings concerning the 1918 killer virus which he successfully resurrected 6 years later.ºº It easiest to explain this highly improbable match between the two viruses by assuming the „swine flu“ virus was deliberately, and systematically engineered to resemble the 1918 Spanish killer flu virus.ºº Dr Ott explains that Taubenberger’s initial 1997 report identified the 1918 killer virus as a “novel” (new) swine flu that “recombined” avian (H5N1) as wellºas human (H3N2) virus fragments in its RNA structure.º º Taubenberger, so Dr Ott argues, then used a complex computer program to perfectly match the RNA and DNA structures, in order to replicate and “resurrect” the 1918 killer Spanish flu virus as a powerful biological weapon.

“SWINE FLU 2009” IS WEAPONIZED 1918 “SPANISH FLU”º º

By A. True Ott, PhD, NDº º “The "Spanish" influenza pandemic killed at least 20 million people in 1918-1919, making it the worst infectious pandemic in history.º *Understanding the origins of the 1918 virus and the basis for ist exceptional virulence may aid in the prediction of future influenza pandemics.* RNA from a victim of the 1918 pandemic was isolated from a formalin-fixed, paraffin-embedded, lung tissue sample. Nine fragments of viral RNA were sequenced from the coding regions of hemagglutinin, neuraminidase, nucleoprotein, matrix protein 1, and matrix proteinº */2. The sequences are consistent with a novel H1N1 influenza A virus that belongs to the subgroup of strains that infect humans and swine, not the avian subgroup.” /*º º */ /*º º SOURCE: Science Magazine Report, 21 March 1997, Dr. Jeffreyº Taubenberger et. al. Seeº http://www.sciencemag.org/cgi/content/abstract/275/5307/179º º º Taubenberger’s initial report identified the 1918 killer virus as a “novel” (new) swine flu that “recombined” avian (H5N1) as well as human (H3N2) virus fragments in its RNA structure. Taubenberger used a complex computer program to perfectly match theº RNA and DNA structures, and then successfully replicated andº “resurrected” the 1918 killer flu as a powerful biological weapon in 132.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

2003, 6 years later. Now, indeed as Taubenberger foresaw in 1997, evil and conspiring men in positions of high power can not only PREDICT FUTURE INFLUENZA PANDEMICS, but they can also UNLEASH THEM AT WILL from laboratory test tubes in order to achieve socio-economicº agendas.º º It should concern EVERY MAN, WOMAN, AND CHILD in America (as well as the entire world) that according to the World Health Organizationº (WHO) and the Centers for Disease Control (CDC) in Atlanta, Georgia, the so-called “Swine Flu” infecting and killing human beings in Mexico and North America this spring and summer, is *“a new subtype of the A/H1N1 not previously detected in swine or humans. This novel H1N1 influenza (swine flu) virus is a triple recombinant includingº gene segments of human, swine, and avian origin*.” Source:º http://www.ncsl.org/?tabid=17089º º(Interestingly, the National Council of State Legislatures (NCSL) is an unelected bureaucracy of policy-makers instigated and promulgatedº

by Utah’s Dixie Leavitt, the father of Mike O. Leavitt the PANDEMIC FLU GURU of the Bush administration.)º º This published definition by the NCSL is IDENTICAL to Taubenbergers 1997 initial findings concerning the 1918 killer virus which he successfully resurrected 6 years later. Is this just a bizarre, meaningless coincidence? You decide.º º The 1918 virus pandemic was the direct result of TYPHUS FEVER VACCINES injected into millions of soldiers during the Great War (WWº I). John D. Rockefeller labs and factories in China produced these Typhus vaccines in 1916 by harvesting pus from infected humans, injecting the infectious matter into pig hosts, then mixing the harvested contaminants into chicken egg albumin to be injected into human hosts as a “vaccine”.º º Rockefeller, always a shrewd businessman, supplied both sides,º (German as well as Allied armies) with his toxic and lethal vaccine brew. Immediately after vaccination, many soldiers fell ill with what was called at the time “Para-Typhoid” infection --- i.e. nausea, vomiting, diarrhea, and killing pneumonia. Subsequent waves spread across the globe, killing as many as 50 million innocent souls worldwide. (Source: The Horrors of Vaccination – Higgins, 1921)º Only much later did the world’s medical establishment wrongfully label and name the deadly recombinant virus accidentally spawned by Rockefeller’s vaccine the “1918 Spanish Flu”. Of course, Rockefeller’s multi-billion dollar pharmaceutical empire could notº afford to label it what it really was: “Vaccine-Induced Disease of 1918”.º º Today, the stage is set for eugenics and genocide on a truly massive scale. The Taubenberger Frankenstein monster has been released and hundreds of millions of 1918 influenza vaccine serums have been produced.º º It was an accident in 1918,—was it?— however the subsequent cover-up 133.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

is/was unconscionable. What is occurring now is inexcusable and criminal in the extreme.º º Mother Nature does not “naturally” recombine bird, swine and three human influenza viruses. (Birds do not exchange bodily fluids with pigs and humans in un-natural sexual liaisons --- only sick, warped scientists can create such a monstrosity.) º Mexico's top government epidemiologist said Wednesday that it is "highly improbable" that a farm in the Mexican state of Veracruz operated by Smithfield Foods Inc. is responsible for the nation's swine-flu outbreak.

Miguel Ángel Lezana, the government's chief epidemiologist, said in an interview that pigs at the farm are from North America, while the genetic material in the virus is from Europe and Asia. http://online.wsj.com/article/SB124105320874371313.html Dr Leonard Horowitz states in a 10.41 mins YouTube clip that the swine-bird-human flu strain in Mexico could have only come from Dr James S Robertson and colleagues because: "nobody else takes H5N1 Asian-flu infected chickens, brings them to Europe, extracts their DNA, combines their proteins with H1N1 viruses from the 1918 Spanish flu isolate, additionally mixes in some swine flu genes from pigs, then reverse engineers them to infect humans."º º http://www.youtube.com/watch?v=GBeKB7aKzOsº º In addition, Dr Horowitz indicates that there is hard evidence to show that Dr James Robertson believes it is OK to prime populations worldwide by releasing viruses he and his colleagues are creating in advance of a pandemic.º º Dr Horowitz mentions the involvement of Dr Rick Bright who has ties to the WHO, the CDC and Novovax Inc, and is involved in PATH Influenza Vaccine Project in the Vaccine Development Global Program. º º º º

134.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

VI. Genome sequence of the “swine flu”º º º An analysis of the “swine flu” genome sequence by Alexander S Jones indicates that 5% of both these influenza A RNA sequences share no known homology in any public databases (in addition to the avian/swine hybrid nature of both these critical genes), and so a laboratory origin for this virus must be seriously considered.º “Influenza A virus (A/Texas/04/2009(H1N1)) segment 8 nuclear export protein (NEP) and nonstructural protein 1 (NS1) genes, complete cds http://www.ncbi.nlm.nih.gov/nuccore/FJ981620 ============================================== HA ("hemaglutinin") protein BLAST sequence homology Accession ºººººº Description ºººººº Max score ºººººº Total score ºººººº Query coverage ºººººº E value ºººººº Max ident ºººººº Links FJ981615.1 Influenza A virus (A/Texas/04/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 3142

3142

100%

0.0

100%

FJ981612.1 Influenza A virus (A/Texas/04/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 3142

3142

100%

0.0

100%

FJ966982.1 Influenza A virus (A/Texas/04/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 3142

3142

100%

0.0

100%

FJ966959.1 Influenza A virus (A/Texas/05/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 135.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

3142

3142

100%

0.0

100%

CY039527.1 Influenza A virus (A/Netherlands/602/2009(H1N1)) segment 4 sequence 3125

3125

99%

0.0

99%

FJ969511.1 Influenza A virus (A/California/10/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 3125

3125

100%

0.0

99%

FJ966952.1 Influenza A virus (A/California/05/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 3125

3125

100%

0.0

99%

FJ969509.1 Influenza A virus (A/New York/19/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 3120

3120

100%

0.0

99%

FJ966960.1 Influenza A virus (A/California/06/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 3120

3120

100%

0.0

99%

FJ981613.1 Influenza A virus (A/California/07/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 3114

3114

100%

0.0

99%

FJ971076.1 Influenza A virus (A/California/08/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 3114

3114

100%

0.0

99%

FJ966974.1 Influenza A virus (A/California/07/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 3114

3114

100%

0.0

99%

FJ966082.1 136.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

Influenza A virus (A/California/04/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 3109

3109

100%

0.0

99%

FJ969540.1 Influenza A virus (A/California/07/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 3107

3107

100%

0.0

99%

FJ973557.1 Influenza A virus (A/Auckland/1/2009(H1N1)) segment 4 hemagglutinin (HA) gene, partial cds 2894

2894

92%

0.0

99%

AF455680.1 Influenza A virus (A/Swine/Indiana/P12439/00 (H1N2)) hemagglutinin (HA) gene, complete cds 2710

2710

100%

0.0

95%

AF250124.1 Influenza A virus (A/Swine/Indiana/9K035/99 (H1N2)) segment 4 hemagglutinin (HA) gene, complete cds 2699

2699

100%

0.0

95%

AY038014.1 Influenza A virus (A/Turkey/MO/24093/99(H1N2)) hemagglutinin (H1) gene, complete cds 2682

2682

100%

0.0

95%

EU139828.1 Influenza A virus (A/swine/Minnesota/1192/2001(H1N2)) hemagglutinin (HA) gene, complete cds 2676

2676

100%

0.0

95%

EF556201.1 Influenza A virus (A/swine/Guangxi/17/2005(H1N2)) hemagglutinin (HA) gene, complete cds 2665

2665

100%

0.0

94%

AF455675.1 Influenza A virus (A/Swine/Ohio/891/01(H1N2)) hemagglutinin (HA) gene, complete cds 2660

2660

100%

0.0

94%

137.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

FJ974021.1 Influenza A virus (A/Regensburg/Germany/01/2009(H1N1)) segment 4 hemagglutinin (HA) gene, partial cds 2656

2656

84%

0.0

99%

AY060047.1 Influenza A virus (A/SW/MN/23124-T/01(H1N2)) hemagglutinin (HA) gene, complete cds 2654

2654

100%

0.0

94%

AY060050.1 Influenza A virus (A/SW/MN/16419/01(H1N2)) hemagglutinin (HA) gene, complete cds 2643

2643

100%

0.0

94%

AY060048.1 Influenza A virus (A/SW/MN/23124-S/01(H1N2)) hemagglutinin (HA) gene, complete cds 2643

2643

100%

0.0

94%

AF455681.1 Influenza A virus (A/Swine/Illinois/100085A/01 (H1N2)) hemagglutinin (HA) gene, complete cds 2638

2638

100%

0.0

94%

EF556199.1 Influenza A virus (A/swine/Guangxi/13/2006(H1N2)) hemagglutinin (HA) gene, complete cds 2621

2621

100%

0.0

94%

AF455682.1 Influenza A virus (A/Swine/Illinois/100084/01 (H1N2)) hemagglutinin (HA) gene, complete cds 2621

2621

100%

0.0

94%

EU139830.1 Influenza A virus (A/swine/Minnesota/00194/2003(H1N2)) hemagglutinin (HA) gene, complete cds 2604

2604

100%

0.0

94%

EU139831.1 Influenza A virus (A/swine/Kansas/00246/2004(H1N2)) hemagglutinin (HA) gene, complete cds 2560

2560

100%

0.0

93%

138.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

EU604689.1 Influenza A virus (A/swine/OH/511445/2007(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds 2555

2555

100%

0.0

93%

AF455677.1 Influenza A virus (A/Swine/North Carolina/93523/01 (H1N2)) hemagglutinin (HA) gene, complete cds 2534

2534

100%

0.0

93%

DQ666933.1 Influenza A virus (A/swine/Korea/S11/2005(H1N2)) segment 4 hemagglutinin gene, complete cds 2518

2518

99%

0.0

93%

EU798780.1 Influenza A virus (A/swine/Korea/Hongsong2/2004(H1N2)) segment 4 hemagglutinin (HA) gene, complete cds 2488

2488

99%

0.0

93%

EU798781.1 Influenza A virus (A/swine/Korea/JL01/2005(H1N2)) segment 4 hemagglutinin (HA) gene, complete cds 2486

2486

99%

0.0

93%

EU798784.1 Influenza A virus (A/swine/Korea/Asan04/2006(H1N2)) segment 4 hemagglutinin (HA) gene, complete cds 2481

2481

99%

0.0

93%

NS1 ("non-structural") protein BLAST sequence homology Sequences producing significant alignments: (Click headers to sort columns) Accession coverage E value

Description

Max ident

Max score

Total score

Query

Links

FJ981620.1 Influenza A virus (A/Texas/04/2009(H1N1)) segment 8 nuclear export protein (NEP) and nonstructural protein 1 (NS1) genes, complete cds 1594

1594

100%

0.0

100%

FJ981611.1 Influenza A virus (A/Texas/05/2009(H1N1)) segment 8 nuclear export protein (NEP) and nonstructural protein 1 (NS1) genes, complete cds 139.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

1594

1594

100%

0.0

100%

FJ969538.1 Influenza A virus (A/California/07/2009(H1N1)) segment 8 nuclear export protein (NEP) and nonstructural protein 1 (NS1) genes, complete cds 1589

1589

100%

0.0

99%

FJ969533.1 Influenza A virus (A/California/08/2009(H1N1)) segment 8 nuclear export protein (NEP) and nonstructural protein 1 (NS1) genes, complete cds 1589

1589

100%

0.0

99%

FJ969528.1 Influenza A virus (A/California/07/2009(H1N1)) segment 8 nuclear export protein (NEP) and nonstructural protein 1 (NS1) genes, complete cds 1589

1589

100%

0.0

99%

FJ969519.1 Influenza A virus (A/California/08/2009(H1N1)) segment 8 nuclear export protein (NEP) and nonstructural protein 1 (NS1) genes, complete cds 1589

1589

100%

0.0

99%

FJ969514.1 Influenza A virus (A/California/04/2009(H1N1)) segment 8 nuclear export protein (NEP) and nonstructural protein 1 (NS1) genes, complete cds 1589

1589

100%

0.0

99%

FJ971074.1 Influenza A virus (A/California/06/2009(H1N1)) segment 8 nuclear export protein (NEP) and nonstructural protein 1 (NS1) genes, complete cds 1583

1583

100%

0.0

99%

FJ966966.1 Influenza A virus (A/Texas/05/2009(H1N1)) segment 8 nuclear export 140.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

protein (NEP) and nonstructural protein 1 (NS1) genes, complete cds 1559

1559

97%

0.0

100%

FJ966086.1 Influenza A virus (A/California/04/2009(H1N1)) segment 8 nuclear export protein (NEP) and nonstructural protein 1 (NS1) genes, complete cds 1543

1543

97%

0.0

99%

EU735822.1 Influenza A virus (A/turkey/OH/313053/2004(H3N2)) nonstructural protein 2 (NS2) and nonstructural protein 1 (NS1) genes, complete cds 1395

1395

100%

0.0

95%

EF551057.1 Influenza A virus (A/swine/North Carolina/2003(H3N2)) nonstructural protein 2 (NS2) and nonstructural protein 1 (NS1) genes, complete cds 1389

1389

100%

0.0

95%

EF551049.1 Influenza A virus (A/turkey/Illinois/2004(H3N2)) nonstructural protein 2 (NS2) and nonstructural protein 1 (NS1) genes, complete cds 1389

1389

100%

0.0

95%

DQ150437.1 Influenza A virus (A/swine/IN/PU542/04 (H3N1)) nonstructural protein (NS1) gene, complete cds 1389

1389

100%

0.0

95%

AF153262.1 Influenza A virus (A/Swine/Minnesota/9088-2/98 (H3N2)) segment 8 NS1 and NS2 genes, complete cds 1386

1386

97%

0.0

96%

AF153261.1 Influenza A virus (A/Swine/Texas/4199-2/98 (H3N2)) segment 8 NS1 and NS2 genes, complete cds 1386

1386

97%

0.0

96%

AF342817.1 Influenza A virus (A/Wisconsin/10/98 (H1N1)) nonstructural protein 1 and nonstructural protein 2 genes, complete cds 1384

1384

100%

0.0

95%

141.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

DQ335775.1 Influenza A virus (A/turkey/Ohio/313053/04(H3N2)) nonstructural protein (NS) gene, complete cds 1384

1384

100%

0.0

95%

AF153263.1 Influenza A virus (A/Swine/Iowa/8548-1/98) segment 8 NS1 and NS2 genes, complete cds 1380

1380

97%

0.0

96%

EU697208.1 Influenza A virus (A/turkey/Minnesota/366767/2005(H3N2)) nonstructural protein 2 (NS2) and nonstructural protein 1 (NS1) genes, complete cds 1378

1378

100%

0.0

95%

EU735830.1 Influenza A virus (A/turkey/NC/353568/2005(H3N2)) nonstructural protein 2 (NS2) and nonstructural protein 1 (NS1) genes, complete cds 1378

1378

100%

0.0

95%

DQ150429.1 Influenza A virus (A/swine/MI/PU243/04 (H3N1)) nonstructural protein (NS1) gene, complete cds 1378

1378

100%

0.0

95%

EU697213.1 Influenza A virus (A/turkey/North Carolina/353568/2005(H3N2)) nonstructural protein 2 (NS2) and nonstructural protein 1 (NS1) genes, complete cds 1373

1373

100%

0.0

95%

AF250128.1 Influenza A virus (A/Swine/Indiana/9K035/99 (H1N2)) NS1 and NS2 genes, complete cds 1369

1369

97%

0.0

96%

AY038021.1 Influenza A virus (A/Turkey/MO/24093/99(H1N2)) nonstructural protein (NS) gene, complete cds, alternatively spliced 1363

1363

98%

0.0

95%

EU798872.1 Influenza A virus (A/swine/Korea/CAS09/2006(H3N2)) segment 8 142.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

nonstructural protein 2 (NS2) and nonstructural protein 1 (NS1) genes, complete cds 1360

1360

97%

0.0

95%

AY060136.1 Influenza A virus (A/SW/IN/14810-S/01(H1N2)) nonstructural protein (NS) gene, complete cds 1360

1360

97%

0.0

95%

AY060135.1 Influenza A virus (A/SW/IN/14810-T/01(H1N2)) nonstructural protein (NS) gene, complete cds 1360

1360

97%

0.0

95%

AY060129.1 Influenza A virus (A/SW/MN/3327/00(H1N2)) nonstructural protein (NS) gene, complete cds 1360

1360

97%

0.0

95%

AF455710.1 Influenza A virus (A/Swine/Minnesota/5“ Alexander S Jones concluded “we must seriously consider a laboratory origin for this virus” because 5% of both these influenza A RNA sequences share no known homology in any public databases.

“BLAST sequence homology of 'swine flu' indicates both the Hemagglutinin (HA) surface protein as well as the Non-structural (NS1) interferon Inhibition proteins are novel recombinants previously unidentified in nature.

Both these influenza proteins, based on the genetic sequences released Friday May 1st by the U.S. Centers of Disease Control (CDC),º share their closest genetic identity with turkey (avian) and pig (swine) strains from multiple continents including North America as well as Asia. Even the closest matches indicate 5% previously unidentified genetic material.

I submit this evidence, coupled with the lack of the presence of this virus at the pig farm near the proposed CDC's "patient zero" (a 5 year old from La Gloria, 80km away from the pig farm in Perote, Mexico), shows that the origin of the flu outbreak remains unidentified at this time, and cannot be ascribed to Mexican or North American swine.

Furthermore, I submit that since 5% of both these influenza A RNA sequences share no known homology in any public databases (in addition to the avian/swine hybrid nature of both these critical genes), that we must seriously consider a laboratory origin for this virus.

143.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Future research that may be promising includes identifying critical SNPs, especially in the PB2 and the NS1 coding regions which may be markers for evolution of pathogen virulence, and should be closely monitored.º The hemagglutinin protein should also be monitored for acquisition of a poly-basic amino acid site which would give the virus pantrophic properties as in the 1918 pandemic. “(Alexander S Jones) º º º º

144.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

VII. Evidence as to deliberate release of the “swine flu” virus in Mexicoº º Virologist Adrian Gibbs said that the “swine flu” was leaked from a lab and, interestingly, Baxter has large-scale production and research facilities close to Mexico City, where the outbreak of the “swine flu” occurred.

The “mysterious origin” of the swine flu was underlined by the Mexico’s Chief Epidemiologist M.A. Lezana, who said that among the first mortalities was a Bangladeshi born street vendor in Mexico City who fell ill in early April. The man is said to have met his brother in Merida, Yucatan in early April and returned to Mexico City before he died. The assertion is that the brother, a Bangladeshi or a Pakistani, was also ill. (http://ahrcanum.wordpress.com/2009/05/05/baxter-pharmaceuticalplant-in-mexico-ground-zero-for-flu-outbreak/) Edgar Hernandez of La Gloria fell ill with a fever and headache in early April according to his mother Maria del Carmen Hernandez. His mom took him for healthcare, and he recovered swiftly. The Financial Times timeline says it was April 2.

Mexican officials confirm that Edgar Hernandez did carry the A/H1N1 virus, but they have not confirmed any other resident did or does. No one else in Edgar’s family got sick at all. A state public health doctor says, “We just don’t know how he (Edgar) got sick. Maybe it was a genetic accident of some kind.”

Also, the Financial Times timeline points to a La Gloria health official requesting assistance in February for an outbreak of an acute respiratory disease; and on April 6 there was a health alert in La Gloria with 400 seeking medical treatment.

How did Edgar Hernandez become positive if not for the pigs of La Gloria? And why cannot Smithfield find the A/H1N1 in one million pigs — all of whom will be slaughtered soon enough unless that Bangladeshi subplot fleshes out. More soon.

One thought from http://www.naturalnews.com/026141.htmlººnotes,” it is astonishing to realize, because for this to have been a natural combination of viral fragments, it means an infected bird from North Americaº would have had to infect pigs in Europe, then be re-infected by those same pigs with an unlikely cross-species mutation that allowed the bird to carry it again, then that bird would have had to fly to Asia and infect pigs there, and those Asian pigs then mutated the virus once again (while preserving the European swine and birdº elements) to become human transmittable, and then a human would have had to catch that virus from the Asian pigs — in Mexico! — And spread it to others in order to assist the World Health Organization in developing a new vaccine, reaping billions in the process.º”º Just 50 miles from the H1N1 ground zero outbreak in Mexico City, lies Baxter’s manufacturing plant in Cuernavaca, Mexico.º Itºwasºnamed one of the 10 Best Plants in North America for 2008 by Industry Weekº magazine.º 145.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.baxter.com/about_baxter/news_room/news_releases/2008/12_19 _08_industryweek.htmlº The plantºmanufactures, “Water for Injection, Devices Medical, Premixes Formulations,” according toºhttp://www.alibaba.com/member/juanbaxter/aboutus.html.º What else do they manufacture there?º What kind of water gets injected? ºGerm Warfare? Bio Hazards? Virus Mutations? Vaccines? Cures or Causes?

Baxter was also responsible for the mislabeled, recalled doses of Heparin.º Baxterºrecalled one lot of a product that hospitals use to treat burn victims and patients in shock after a test found a rare form of HIV in the plasma used to make the product.º HIV-2ºin plasma! ºº http://www.aegis.org/news/ct/2001/CT010716.html.ºBaxter also manufacturesºa vaccine against tick-borne encephalitis (TBE) and a vaccine against group C meningococcal meningitis.º http://www.baxtervaccines.com/?node_id=312º, in addition toºother pharmaceutical products, anesthetic’s, pumps, etc.ºº http://www.ecomm.baxter.com/ecatalog/browseCatalog.do? lid=10001&cid=10016 The National Autonomous University of Mexico (UNAM) has a satellite campus located in Cuernavaca, which is aimed at research and graduate studies. It also has an undergraduate program in genomics.º Cuernavaca is the home of the following research centers: Center for Genomic Sciences (UNAM),[3] the Institute of Biotechnology (UNAM),[4] the Institute of Physical Sciences (UNAM),[5] the Center for research in Energy (UNAM), the Institute of Mathematics (UNAM), the Center for Research in Engineering and Applied Sciences (UAEM),[6] and the National Institute of Public Health. Cuernavaca has the highest concentration of scientists and researchers in Latin America. -WIKI http://en.wikipedia.org/wiki/CuernavacaºCuernavaca is certainly a who’s who in genetics and research. º º º

146.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

VIII. Evidence as to the involvement of President Obamaº º º Since President Obamaº visited Mexico on April 16, the virulent flu has stricken more than 1,000 peeple, killing nearly 70 of them, including one person the President met at a museum.

Obama was received at Mexico’s anthropology museum in Mexico City by Felipe Solis, a distinguished archeologist who died the following day from symptoms similar to flu, Reforma newspaper reported. http://www.bloomberg.com/apps/news? pid=20601087&sid=aEsNownABJ6Q&refer=homeº A federal agent who traveled to Mexico with President Obama this month probably contracted swine flu and infected several members of his family in Anne Arundel County, prompting assurances yesterday from the White House that the president was safe. http://www.washingtonpost.com/wpdyn/content/article/2009/04/30/AR2009043001836.html "[President Obama’s} doctors have advised him that his trip to Mexico has not put his health in any danger," said spokesman Josh Earnest.

White House aides declined to discuss what steps the President's doctors have taken, such as testing for the illness or inocculations, but one suggested he has not been tested.

"I can tell you that the President doesn't have any symptoms, and his doctors advised that there was no need for him to be tested," the aide said.

That is likely because the swine flu has a short incubation period of less than three days, and the President would have shown symptoms even before he returned home if he had been infected.º (http://www.nydailynews.com/news/politics/2009/04/26/2009-0426_white_house_president_obama_does_not_have_swine_flu_from_recent_me xico_trip.html#ixzz0GnOgyRRk&B) I allege elements working for an international crime syndicate engineered, who have annexed high offices in the United States Government, under the color of an official government trip, unleashed the virus in Mexico, choosing a foreign country to distract attention from their own involvement, in order to profit politically and financially from a pandemic declaration.

The appearance of the swine flu coincided with President Obama’s visit. A high level museum official, who was healthy enough to meet the President in Mexico City, died the next day indicating he had received a lethal dose of a toxic virus. A federal agent who travelled with the President also contracted the disease. However, the President himself was not even tested for the swine flu. I contend that the key staff of the President saw no need to test the President because they knew he had been vaccinated in advance against the virus that the team helped release.

President Obama went into Mexico and left unscathed in spite of the growing “swine flu” emergency.

147.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

“Authorities canceled school at all levels in Mexico City and the state of Mexico until further notice, and the government has shut most public and government activities in the area. The emergency decree, published today in the state gazette, gives the president authority to take more action.” http://www.bloomberg.com/apps/news? pid=20601087&sid=aEsNownABJ6Q&refer=home “The federal government under my charge will not hesitate a moment to take all, all the measures necessary to respond with efficiency and opportunity to this respiratory epidemic,” Calderon said today during a speech to inaugurate a hospital in the southern state of Oaxaca.

At least 20 deaths in Mexico from the disease are confirmed, Health Minister Jose Cordova said yesterday. The strain is a variant of H1N1 swine influenza that has also sickened at least eight people in California and Texas. As many as 68 deaths may be attributed to the virus in Mexico, and about 1,000 people in the Mexico City area are showing symptoms of the illness, Cordoba said.”

In the event of aºlevel 6 pandemic level designation from the WHO, President Obama has the right to implement emergency measures: Americans would be subject toºcompulsory vaccinations and possible detention because of the Patriot Act I, Patriot II, BARDA, BioShield I, BioShield II,º BARDA,ºFederal or State Emergency Medical Powers Acts, FEMA and other laws, provisions and regulations.

Also, as the pressure increases on Obama to produce a valid Birth certificate, Obama and his international criminal syndicate backers are seeking to accelerate the declaration of a Pandemic Level 6 by WHO to avert the poliitical destablisation of their man.º Lawsuits have been filed contesting that Obama is ineligible to be President of the United States of America because he is not a natural-born citizen as defined by US law because, among other reasons, Hawaii, the birthplace ofº Obama’s mother was not a state. „Presidential office requires a natural-born citizen if the child was not born to two U.S. citizen parents. US Law very clearly stipulates: ".If only one parent was a U.S. citizen at the time of your birth, that parent must have resided in the United States for at least ten years, at least five of which had to be after the age of 16." Barack Obama's father was not a U.S. citizen and Obama's mother was only 18 when Obama was born, which means though she had been a U.S. citizen for 10 years, (or citizen perhaps because of Hawai'i being a territory) the mother fails the test for being so for at least 5 years **prior to** Barack Obama's birth, but *after* age 16. It doesn't matter *after*.

In essence, she was not old enough to qualify her son for automatic U.S. citizenship. At most, there were only 2 years elapsed since his mother turned 16 at the time of Barack Obama's birth when she was 18 in Hawai'i. His mother would have needed to have been 16+5= 21 years old, at the time of Barack Obama's birth for him to have been a natural-born citizen. As aformentioned, she was a young college student at the time and was not. Barack Obama was already 3 years old at that time his mother would have needed to have waited to have him as the only U.S. Cizen parent. Obama instead should have been naturalized, but even then, that would still disqualify him from 148.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

holding the office.“ So far, President Obama has not produced verifiable, unambiguous evidence that he meets the criteria of a natural born citizen.º We contend Obama is actually the member of a foreign-based crime gang that has used fraudulent means to get their member Barack Obama in office so they can use him as an instrument to take control of the economic, political and military structures of the USA. The plan is to give him the powers of a dictator under the pretext of implementing martial law to deal with a pandemic or a false flag nuclear attack or the consequences of hyperinflation that the same group have themselves engineered by manipulating the financial markets and creating debt.

Once martial law is declared, Homeland Security will be used to terrorize the population of the USA taking on a role similar to the Gestapo in Nazi Germany to enforce mass vaccinations, imprisonment in FEMA camps and quarantines in towns and cities. A wave of arrests is planned to arrest and kill all political opponents.

Further, a bill calling for an audit of the Federal Reserve, which is gathering steam in Congress, could reveal the extent of the financial crimes committed by the Federal Reserve Chairman and his international backers, a further reason for the crime elite to seek an excuse to declare martial law to destroy opponents and evidence of their crimes. º º º

149.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

IX. Evidence as to the role of Baxter and WHO in producing and releasing pandemic virus material in Austria.º º º Baxter Pharmaceutical http://www.baxter.com/ºhas been chosen by the WHO to lead the efforts in finding a vaccine cure for the swine flu H1N1 virus.º This in spite of the fact that Baxter AG, headquartered in Vienna, and the Austrian subsidiary of the pharmaceutical company Baxter International, headquartered in Deerfield, IL, USA, sent vaccine material contaminated with deadly live H5N1 bird flu virus to 16 laboratories in four countries in winter 2009 before a technician caught the mistake. (See Attachment (A) for criminal charges filed at the Vienna City Prosecutor’s office on April 8th, now being investigated by the police).

According to Austrian Health Minister Alois Stöger , 72 kilograms of vaccine material was contaminated. http://www.parlament.gv.at/PG/DE/XXIV/AB/AB_01457/fnameorig_158854.ht ml Parliamentary answers 1457/AB (XXIV. GP) May 20th, 2009, Fragen 14 und 15: Das für Forschungszwecke bestimmtes Material -72 kg waren als kontaminiert anzusehen - wurde in die Firmaº zurück geholt und kontrolliert vernichtet.“º It is still not clear how 72 kilograms of the world’s deadliest bioweapon can be sent by accident from a high biosecurity facilities, not irradiated and under a false label.

However, we know from Baxter itself that it produced the 72 kilograms contaminated material using aº wild type live bird flu virus obtained from the WHO reference center. http://www.promedmail.org/pls/otn/f? p=2400:1001:53103::NO::F2400_P1001_BACK_PAGE,F2400_P1001_PUB_MAIL_ID: 10001,76322 „A statement on behalf of Baxter ------------------------------I would like to provide the following update to a posting on ProMED dated 25 Feb 2009 (Avian influenza, accidental distribution - Czech Rep. ex Austria: RFI).º The H5N1 strain was the A/Vietnam/1203/2004 strain, received from a WHO reference center. All information concerning this incident hasº been provided to the involved national authorities and appropriateº international bodies such as ECDC and WHO.º -Christopher Bona 150.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Director, Global BioScience Communications Corporate Communications Baxter International Inc. One Baxter Parkway Deerfield, IL 60015 <christopher_bona@baxter.com> Also, Baxter is the only flu vaccine manufacturer to work with wild typeº flu viruses, felt to be more dangerous than the altered and attenuated (weakened) viruses other manufacturers use. http://chealth.canoe.ca/channel_health_news_details.asp? news_id=27436&news_channel_id=1020&channel_id=1020 The Austrian police have launched an investigation into the incident that almost triggered a global pandemic. The mixture of the deadly H5N1 virus with a mix of H3N2 seasonal flu viruses is classified as one of the most deadly bioweapons in the world with a mortality rate of 63 per cent.

So, with the Baxter incident in Austria, there is proof that Baxter not only created the disease producing microorganisms with help from WHO, but also distributed them in large quantities to trigger a pandemic, while positioning themselves to produce the vaccine allegedly to "protect" against the virus they created and released, but which,soº it is alleged, is actually a disguised way of spreading the biological agent and creating a pandemic.º In criminal charges filed against Baxter on April 8th, 2009 at the Viennaº City Prosecutor’s office, Landesgerichtstr 11, 1080 Vienna, Austria by Jane Burgermeister, a resident of Vienna, Austria, it was alleged that Baxter unlawfully, wilfully and knowingly, in the period between December 2008 and February 2009, employed manipulative and deceptive devices and contrivances in violation of national and international laws on the manufacturing, possession, release and dissemination of biological weapons of mass destruction and on organised crime, toºmanufacture andºdistribute a biological agent that is classified as a bioweapon among the population in order to profit from the pandemic.

First, Baxter manufactured influenza material contaminated with a bird flu virus in its biomedical research laboratories in Orth on the Danube in December 2008.

Baxter uses BSL 3 (Biosafety Level 3) precautions in its laboratories, a system for the safe-handling of toxic substances, which makes an accidental contamination of ordinary flu material with the dangerous bird flu virus virtually impossible.ºº The 72 kilograms of contaminated vaccine material contained a mixture of a seasonalºH3N2 human influenza virus and the deadly bird flu H5N1 virus. By adding a virus of the type H5N1 to an ordinaryºflu virus of the type H3N2,ºThe H5N1 virus is restricted in its human-to-human transmissibility, especially because it is less airborne. However, when it is combined with seasonal flu viruses, which are airborne and easily spread, a new bioweapon is created.º 151.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Second, Baxter distributed via Avir this contaminated vaccines using false concealment and a false label to 16 laboratories in Austria and in other countries at the end of January/beginning of February, potentially infecting at least 36-37 laboratory staff, who hadºhad to be treated preventively for bird flu and ordinary flu in hospital.

A total of 18 laboratory staff belonging to Avir had to undergo preventative treatment for the bird flu and ordinary flu at the Otto Wagner Hospital in Vienna on February, 9th, 2009, because of their exposure as part of their work to the highly pathogenic bird flu virus.

This indicates that, in the opinion of medical experts, there was a risk that the staff of Avir had contracted bird flu, and, unknowingly, acted as carriers of a pandemic virus into the population of a densely built up Vienna city district and in winter time.

The material was only discovered when staff working for Biotest (in Konarovice in the Czech Republic), tested the vaccination on ferrets, who then died.

Biotest was supposed to test anti-flu vaccination that should serve Europeans during the next flu season, and the labels on the material sent to them from Baxter via Avir gave no indication of the lethal contents.º The 13 BioTest staff were treated with Tamiflu and were placed in quarantine for fear they had been contaminated with the bird flu virus, which is on the list of the possible biological weapons and one of the most dangerous biological agents on the Earth with more than 60% death rate.º Subsequently the same problem of the Baxter vaccine contamination with H5N1 was found in the laboratories in Slovenia, Austria and Germany, who had received the material from Baxter.º º First the company Baxter evoked the 'trade secret" and refused to explain how exactly how a Level 3 biological warfare pathogen found its way into H3N2 material, regardless whether or not this experimental vaccine material was 'intended' for eventual use in humans or not.º Baxter representatives have said that the material sent to the Czech republic, Austria, Slovenia and Germany was in fact a pure H5N1 sent by accidentº - maybe to mask the previous assumption, that it was in fact an ordinary flu vaccine, which was contaminated. It is still not clear whether it was in fact the pure H5N1 or contaminated vaccine.º The Austrian Health Minister Alois Stöger confirmed on May 20th 2009º that the 72 kilograms of contaminated vaccine material has been destroyed, but no information has been released as to the genetic sequences of the contaminated material or what Clade was Baxter's H5N1 vaccine from, whether from Clade 1? Clade 2? Clade 3? Other?º Therefore, it is not possible to know whether H5N1 resembles the strains circulating in waterfowl.º Was the contaminated H5N1 strain geneticallyº engineered? If so, by 152.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

whom? Does the NS protein in Baxter's H5N1 material contain polymorphisms which suppress human interferonº production? Was Baxter's H5N1 a full set of influenza genes? Or was it just the hemaglutanin and neuraminidase? Did Baxter's H5N1 contain a polybasic cleavage site on the Hemaglutanin surface protein? Why were the samples of experimental vaccine material not irradiated?º Coinfection of H5N1 and H3N2 would not produce simple reassortment but a complex in vivo recombination of many competing strains in theº infected host. º Furthermore the complex coinfection of H5N1 and H3N2 in a human would produce natural selection pressure for maximum virulence. º The book "Evolutionary Dynamics" suggest that viral coinfection selects for both maximum virulence and infectivity.º How close the world came to a pandemic is underlined by the reaction of Panasonic Japan.º On February 9th – on the very same day as 18 employees of Avir were given preventative treatment forºthe bird flu in the Otto Wagner Hospital in Vienna – AFP reported that Panasonic Japan intended to bring back to Japan the families of many of its staff working around the world because of the threat of a bird flu pandemic.º “Panasonic to fly home workers’ families over bird flu fears Feb 9, 2009 TOKYO (AFP) — Panasonic Corp. has ordered Japanese employees in some foreign countries to send their families home to Japan in preparation for a possible bird flu pandemic, a spokesman said Tuesday.”

The firm decided to take the rare measure “well ahead of possible confusion at the outbreak of a global pandemic,” he said.

The Times of India reported on March 6th, 2009, that a pandemic was nearly triggered as a result of Baxter’s actions. http://timesofindia.indiatimes.com/Health--Science/Science/Virus-mixup-by-lab-could-have-resulted-in-pandemic/articleshow/4230882.cms “It's emerged that virulent H5N1 bird flu was sent out by accident from an Austrian lab last year and given to ferrets in the Czech Republic beforeº anyone realised. As well as the risk of it escaping into the wild, the H5N1 got mixed with a human strain, which might have spawned a hybrid that could unleash a pandemic.º º Last December, the Austrian branch of US vaccine company Baxter sent a batch of ordinary human H3N2 flu, altered so it couldn't replicate, to Avir Green Hills Biotechnology, also in Austria. In February, a lab in the Czech Republic working for Avir alerted Baxter that, unexpectedly, ferrets inoculated with the sample had died. It turned out the sample contained live H5N1, which Baxter uses to make vaccine. The two seem to have been mixed in error.º º 153.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Markus Reinhard of Baxter says no one was infected because the H3N2 was handled at a high level of containment. But Ab Osterhaus of Erasmus University in the Netherlands says: "We need to go to great lengths to make sure this kind of thing doesn't happen."º º Accidental release of a mixture of live H5N1 and H3N2 viruses could have resulted in dire consequences.“º It needs to be stressed that the bird flu virus was developed in US military laboratories from 1995 onwards by researchers who reconstructedºthe genetic code ofºthe Spanish Flu pandemic virus of 1918-1919.

It needs to be stressed that the bird flu virus was developed in US military laboratories from 1995 onwards by researchers who reconstructedºthe genetic code ofºthe Spanish Flu pandemic virus of 1918-1919.

So, using the argument that they need to find an antidote to the lethal bird flu virus, researchers have actually resurrected this lethal bird flu virus and created the danger in the first place, and with funds provided by organisations such as WHO. “Reviving the Spanish Flu virus is a recipe for a catastrophe. It could put any attack using anthrax or the plague in the shade, “ said Jan van Aken, head of the German section of the Sunshine Project.º In the summer of 2008, US researchers found that this newly reconstructed lethal bird flu virus could be mixed with ordinary human flu virus in laboratory conditions and so, in theory, could acquire easy human-to-human transmissibility.º It was precisely thisºvery virus, a mix of a lethal H5N1 bird flu virus and an ordinary human flu H3N2 virus that Baxter manufactured in its laboratory in Orth/Donau in December 2008, and then distributed via Avir to 16 laboratories in Austria and abroadºemploying fraudulent misrepresentation.º The Canadian Press explains the issue: “While H5N1 doesn’t easily infect people, H3N2 viruses do. If someone exposed to a mixture of the two had been simultaneously infected with both strains, he or she could have served as an incubator for a hybrid virus able to transmit easily to and among people.“ According to media reports, Dr Rebecca Carley maintained in March 2009 that this was a deliberate attempt to start a pandemic.ºº “Basically, they’re trying to cause the pandemic.º They have already stockpiled at least 250 million doses of the bird flu vaccine.º The shelf life of that vaccine has a certain amount of time by which they’ll have to throw it in the garbage.º So they have to start the pandemic so that they can give the vaccines, which will then cause the bird flu pandemic…In fact, this is an associated press article that says that our government is reluctant to give bird flu vaccine to some of the rogue nations for fear they will use the vaccine as biological warfare.º So when you actually look at what’s out there, folks, it becomes crystal clear.º This is genocide.º This is population reduction.º And it’s happening right now. “ºº 154.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

“Well, let me also state that this is very intentional because the H5N1 bird flu virus is not actually able to be picked up by humans in a regular scenario.º So by putting it with a regular human flu, they’re intentionally causing it to create a hybrid virus.º And this is how they’re going to make the bird flu virus be contracted by the people because it’s very virulent.º And basically, the scenario that it creates is very disturbing.º You actually bleed out into your lungs and suffocate on your own blood. “º º º

155.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

X. Evidence Baxter is an element in a covert bioweapons network.º º º There is evidence that the specific production system which Baxter has developed with help of US government bodies for producing a human vaccination to the bird flu — namely, the use of 1,200 liter bioreactors and vero cell technologyº – could meet the technical criteria to be classified as a secret dual purpose large-scale bioweapon production facility in as far as the production process would allow a huge amount of contaminated vaccine material to be produced rapidly.

Grounds for believing Baxter is involved in any "Special Access Programs" , as defined by Congress, including 'waived', 'unacknowledged' 'waived' Special Access Programs (also known as 'black programs'), include Baxter’s application for a patent for a bioengineered bird flu virus designed to be more lethal Application number: 10/547155, Publication number: US 2007/0134270.

Vero cells, a continuous cell line derived from epithelial cells of the African green monkey kidney used to make live polio vaccines and also to promote the spread of AIDS, can be used to grow huge amounts of virus in weeks, so allowing agents such as WHO andBaxter to grow 72 kilos o bird flu virus rapidly and easily for distribution.

Green monkeys are used in medical research.º º http://www.ncbi.nlm.nih.gov/entrez/query.fcgi? cmd=Retrieve&db=PubMed&list_uids=1... concerns viruses in African green monkeys.º º http://www.pubmedcentral.nih.gov/articlerender.fcgi? artid=190510&rendertype=abst... states that kidney cells of green monkeys can be used as hosts to cultivate influenza viruses.º º http://www.ippl.org/Jasmine.htm states that monkeys can carry diseases that can make humans sick or, at worse, can kill them.

Monkeys can catch most human diseases.º http://www.sfbr.org/pages/news_release_detail.php?id=47 concerns work

by Jonathan Allan to determine the link between African green monkeys and AIDS. Over 50% of the monkeys carry SIV – the simian version of HIV – yet never develop the disease.

If contaminated material were added to the 1,200 liter bioreactors, it would replicate and infect the entire batch of vaccine material in the 1,200 liter tank.

Contaminated material could be distributed among sections of the population using false labels and secretly marked batches and so infect millions of people in a way as to delay the reaction or over two doses.

Such vaccine material would kill thousands if not hundreds of thousands of people under the cover of a prophylactic measure against a pandemic created by, and spread, by Baxter.º 156.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Imagine the potential for disaster if even one batch was infected and distributed to thousands, if not hundreds of thousands of people, who would not only become ill themselves but also act as incubators of a new more lethal virus.º A forced vaccination of the entire population could mean death on a scale never seen before on Earth.º At the same syndicate – came from a in spite of

time, the media – controlled by the organised crime would so explain the story as to suggest that the deaths naturally occuring virulent virus and the deaths happened the injections.º

However, it has been alleged that the injections are the delivery system of the bioweapons program in which Baxter is involved.º Vaccinations are needed to upgrade the “swine flu” bridge virus to the more lethal “bird flu” virus if the international crime syndicate is to achieve its goal of a drastic reduction in the world population with a parellalº consolidation of geopolitcal power.º There is evidence the bioweapons programs are 'international' in scope with funding coming from the US government, WHO, the UN and also banks.º The nature and intent of these programs is to drastically reduce the world’s population, something that the financial and political elite believe will offer them the best chance of surviving in an environmentally stressed era while maintaining their revenue from oil and gas. A switch to solar, wind and geothermal energy, for example, would releive pressure on the environment but destroy their profit base.º There are reasonable grounds for believing there are financial and social connections with the incoming administration as Baxter because ist executives are based near Chicago, the political base of President Obama, and Baxter has contributed to political parties.º It is clear that Baxter stands to benefit financially from the outbreak of a pandemic through a contaminatedº season influenza vaccine in late 2009, and that the shareholders will profit directly from this boost.º º It has been reported that President Obama holds shares in Baxter.º Certainly, Baxter is guaranteed substantial direct profits from their triggering a bird flu pandemic from their contract sealed in 2006 with the Austrian Health Ministry, led by then Health Minister Maria Rauch-Kallat, to supply 16 million vaccine shots in the event of a bird flu pandemic being declared in Austria alone.º Baxter also has the contract to supply the swine flu vaccine for the Austrian government in spite of its role in releasing pandemic material this winter.º Baxter has contracts with WHO to supply huge quantities of vaccines.º However, upfront profits from sales of vaccines are just one part of the profit that the organized corporate crime syndicate, comprised also of banks, will obtain as mentioned.º 157.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

If millions, if not billions, of people were to die as a result of a pandemic virus and/or contaminated inoculations, then their assets, their savings, their houses, apartments, farms and companies would be easy to acquire by a crime syndicate that has infiltrated and annexed key government offices.º º º º º º

158.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XI. Evidence Baxter has deliberately contamined drugs. º º º That vaccine material has been deliberately contaminated causing death and injury has even been admitted by Baxter’s CEO Robert Parkinson.º Baxter is at the center of a lawsuit alleging that Baxter altered an ingredient in heparin that flowed through heparin syringes to patients, resulting in pain and suffering, and sometimes death, to those affected.º “Baxter International chief executive Robert Parkinson admitted to what looks to be the deliberate contamination of its heparin product which contributed to 81 deaths and prompted a product recall.º He said that a contaminating agent that is an altered form of chondroitin sulfate was purposely added to the material before it reached Baxter's supplier in China.“ (Sturgeon, 2009) http://network.nationalpost.com/np/blogs/fpposted/archive/2008/04/29/ baxter-ceo-personal-responsibility-over-drug-contamination.aspxºº “We're alarmed that one of our products was used in what appears to have been a deliberate scheme to adulterate a lifesaving medication,“ Baxter Chief Executive Officer Robert Parkinson told the House Energy and Commerce Committee's investigative subcommittee.º “It seems to us that it's an intentional act upstream in the supply chain“ said David Strunce, the chief executive officer of Waunakee, Wisconsin-based Scientific Protein, during the hearing. “We don't know specifically where.“º The drug's main ingredient was contaminated before reaching the Chinese factory of Baxter's supplier, Scientific Protein Laboratories, executives of both companies testified at a U.S. House hearing today.º The Food and Drug Administration suspects the contamination was deliberate, though there isn't proof, according to the agency.º Baxter recalled heparin, used to prevent blood clots, in January of this year after reports of harmful side effects. Since January 2007, 81 people have died after allergic reactions, the FDA said on April 21. Tainted heparin made by other drugmakers has been found in more than a dozen countries since Baxter's recall, and regulators have said they don't know how it was introduced.º Some samples of Baxter's heparin were found contaminated with a cheaper substance known as over-sulfated chondroitin sulfate, according to the company and the FDA.º In a class-action lawsuit filed filed January 5th 2009 by Joyce Ann Osteen at the St. Clair County Circuit Court for compensation for scores of patients harmed by tainted heparin, the claim is made that Baxter altered the profile of the drug, in an attempt to reduce costs.º The lawsuit accuses Baxter of using a more dangerous and unapproved ingredient, OSCS to dilute, or to substitute for the more costly, 159.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

natural ingredient in heparin to "reap greater profits as a result of utilizing cheap component parts."º º About 3500 pig intestines are required to produce 2.2 pounds of raw heparin. While the suit did not quantify heparin mass relative to value, it was alleged that it costs Baxter $900 to produce heparin the old-fashioned way.º º It is alleged, Baxter found a way to make that same amount of heparin for just $9. And the heparin mimic OSCS, according to the lawsuit, was the key.º The lawsuit notes that OSCS is not found in nature, and is not approved in the United States.º º "Un-approved APIs significantly increases the likelihood that exposed patients will experience adverse side effects and reactions that can result from the un-approved doses," the suit states. "In other words, an unapproved API enhances the risk and danger."º º As of April 8, there have been 103 reported deaths in patients who received tainted heparin since January 1st of 2007, the suit states.

Of those deaths, 91 were reported after January 1st of last year.º º "On or about July 30th, 2008 the (US Food and Drug Administration) conclusively linked the deaths of patients infused with heparin to specific lots made by Baxter," the suit states. "The specific lots of Baxter product tested positive for OSCS."º Heparin crude lots received in August 2006 are said to have included material from an unacceptable workshop vendor, according to the suit.

Raw material inventory records were incomplete, the control of material flow in the processing area was found to be inadequate, and a collection of outer foil bags containing heparin sodium were unlabeled. There was also no report or data to verify that the leachable for certain bags used for heparin sodium had been evaluated, according to the complaint.º Inspectors reported a breakdown in critical processing steps identified for heparin sodium USP process, a lack of an impurity profile established for heparin sodium, and a lack of evaluation for degradents. Manufacturing instructions were found to be incomplete, and there had been no verification performed for the reported USP test methods.º When even the CEO of Baxter has said that the contamination of Baxter’s blood-thinner heparin appears to have been deliberate and he has a “strong sense of personal responsibility“ for this “deliberate scheme“, how much more likely is a deliberate contamination of the “swine flu“ vaccine?

"We're alarmed that one of our products was used, in what appears to have been a deliberate scheme, to adulterate a life-saving medication, and that people have suffered as a result," Baxter Chief Executive Robert Parkinson said. http://www.reuters.com/article/topNews/idUSWAT00940720080429 160.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

"We deeply regret that this has happened, and I feel a strong sense of personal responsibility for these circumstances," he said.º Under the current set of regulations, acts and provisions, it would be possible for a bioterrorist organisation that has access to the production facilities or to the 1,200 liter bioreactors or that could influence the composition of vaccine material to kill all Americans by contaminating the vaccine material and forcing them to take it without adequate checks or face being shot.ºº Theoretically, the lethal effect of the vaccination could be delayed or triggered by a second substance.º º º º º º

161.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XII. Evidence Novartis is using vaccines as bioweapons.º º º The bird flu trials conducted by Novartis in 2008 offers evidence that companies are designing their trials of pandemic flu vaccines for adverse events, that is, for disease and death.

Novartis, one of the companies tasked with developing a “swine flu” vaccine by Defendant HHS, employed fraudulent misrepresentation and manipulated the vaccine licencing procedure to pass off a substance that is a bioweapon as a harmless vaccines for prophylactic, protective, and peaceful purposes when it tested a bird flu vaccine on homeless people in Poland.

Novartis’s trials of a FLUAD-H5N1 bird flu vaccine in Poland in the summer of 2008 resulted in the deaths of as many as 21 homeless people according to the Telegraph.º http://hygimia69.blogspot.com/2009/04/france-24-health-workers-ontrial-for.html “The medical staff, from the northern town of Grudziadz, is being investigated over medical trials on as many as 350 homeless and poor people last year, which prosecutors say involved an untried vaccine to the highly-contagious virus.

Authorities claim that the alleged victims received £1-2 to be tested with what they thought was a conventional flu vaccine but, according to investigators, was actually an anti bird-flu drug.

The director of a Grudziadz homeless centre, Mieczyslaw Waclawski, told a Polish newspaper that last year, 21 people from his centre died, a figure well above the average of about eight.”º http://www.telegraph.co.uk/news/worldnews/europe/poland/2235676/Homel ess-people-die-after-bird-flu-vaccine-trial-in-Poland.htmlº Other reports state three doctors and six nurses are on trial for testing the bird flu vaccine on nearly 200 patients without their knowledge.º http://hygimia69.blogspot.com/2009/04/france-24-health-workers-ontrial-for.htmlº Health workers on trial for vaccine scam in Poland Nine health workers went on trial in northern Poland Monday accused of having tested a vaccine against bird flu on nearly 200 patients without their knowledge, court officials said. º The accused -- three doctors and six nurses -- are charged with "fraud, creating false documents and delivering health care without authorisation" to 196 patients, judge Piotr Szadkowski of the Torun region told AFP.º º If found guilty, they risk up to 10 years in jail.º º All nine accused, some reportedly clad in wigs and sun glasses to 162.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

avoid being identified, pleaded not guilty.º º The medical personnel are charged with administering a vaccine banned in Poland against the deadly H5N1 strain of bird flu that can be transmitted to humans.º º The patients were paid for the vaccines, Polish news agency PAP reported.º º They allegedly led their patients, many of them poor and homeless, to believe they were being vaccinated against ordinary flu.º º Police discovered the scam by chance when they were called to break up a fight at a homeless shelter, PAP said.º The FLUAD-H5N1 drug being tested was approved for market in the European Union on May 2, 2007 before it was tested on the homeless in Poland and proved to be lethal.º This vaccine is for “government use in case of pandemic caused by Avian Influenza virus“ also for US government use. ”Novartis has also received contract from US DHHS to further develop MF59C.1 adjuvant technology to potentially extend vaccine supplies in case of Influenza pandemic outbreak“º ”Represents "mock-up vaccine", filedºas normal step for eventual accelerated approval of final vaccine once a pandemic has been declared; Initial preparations were made with viral strain H5N3 (1999) and H9N2 (2004); File submitted for approbation in 2006 was based on clinical trials conducted withºvarious strains of Avian Influenza virus, but more specifically with reverse geneticengineered strain H5N1 A/Vietnam/1194/2004, with adjuvant MF59C.1;ºº Vaccine will eventually contain pandemic Avian Influenza strain designated by WHO at the time of pandemic, along with adjuvant MF59. “º http://www.antiviralintelistrat.com/1/Database?prod=1737º Perhaps this lethal drug got a licence because the primary outcome listed for the study was “adverse events rate” after two doses. That is to say, its success was measured in terms of its capacity to cause injury and damage. That is why the drug no doubt got the licence because it proved to be very damaging indeed and so met the primary outcome desired by Novartis according to the official documents of the trial.º http://clinicaltrials.gov/ct2/show/NCT00434733º Immunogenicity, Safety and Tolerability of Two Doses of FLUAD-H5N1 Influenza Vaccine in Adult and Elderly Subjects This study has been completed.

First Received: February 12, 2007 º Last Updated: April 23, 2008 º History of Changes

163.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Sponsors and Collaborators:

Novartisº Novartis Vaccines

Information provided by:

Novartis

ClinicalTrials.gov Identifier: NCT00434733

º Purpose This study is designed to evaluate the immunogenicity, safety and tolerability of 2 doses of FLUAD-H5N1 vaccine compared to 2 doses of trivalent, interpandemic FLUAD, each administered 3 weeks apart. º Condition Intervention

Phase

Influenza Biological: Pandemic influenza vaccine

Phase III

º MedlinePlus related topics: BirdºFlu Flu Drug Information available for: Fluvirin InfluenzaºVaccines U.S. FDA Resources Study Type:

Interventional

Study Design:

Prevention, Randomized, Single Blind, Active Control, Parallel Assignment, Safety Study

Official Title:

A Phase III, Randomized, Controlled, Observer-Blind, Multicenter Study to Evaluate the Immunogenicity, Safety and Tolerability of Two Doses of FLUAD-H5N1 Influenza Vaccine in Adult and Elderly Subjects

º Further study details as provided by Novartis:º Primary Outcome Measures:  Adverse event rate http://clinicaltrials.gov/ct2/show/NCT00434733º Secondary Outcome Measures:  Seroconversion and seroprotection after two doses of H5N1 vaccine Estimated Enrollment: Study Start Date:

4400 January 2007

164.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

ºEligibility

Ages Eligible for Study: º

18 Years and older

Genders Eligible for Study: º

Both

Accepts Healthy Volunteers: º

Yes

Criteria Inclusion Criteria:  Healthy Subjects 18 years of age who signed the informed consent Exclusion Criteria:  Receipt of another investigational agent within 4 weeks  Receipt of influenza vaccination for current season 2006/2007.  any acute disease or infection, history of neurological symptoms or signs, known or suspected impairment of immune function, any serious disease, bleeding diathesis  fever (defined as axillary temperature ³38.0°C) within 3 days (prior to Visit 1)  Pregnant or breastfeeding or females of childbearing potential who refuse to use an acceptable method of birth control  Surgery planned during the study period  Hypersensitivity to eggs, chicken protein, chicken feathers, influenza viral protein, neomycin or polymyxin or any other component of the study vaccine  Receipt of another vaccine within 3 weeks prior to Visit 1 or planned vaccination within 3 weeks following the last study vaccination  History of (or current) drug or alcohol abuse  Any condition, which, in the opinion of the Investigator, might interfere with the evaluation of the study objectives. º Contacts and Locations Please refer to this study by its ClinicalTrials.gov identifier: NCT00434733º º Locations Poland Centrum Badań Farmakologii Klinicznej monipol

º

Kraków, Poland, 30-969 165.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Sponsors and Collaborators Novartis Novartis Vaccines Investigators Study Chair:

Novartis Vaccines and Novartis Vaccines and Diagnostics GmbH & Co KG Diagnostics GmbH & Co Novartis KG., Germany

º More Information

º No publications provided Study ID Numbers:

V87P4, 2006-005428-18

Study First Received:

February 12, 2007

Last Updated:

April 23, 2008

ClinicalTrials.gov Identifier: Health Authority:

NCT00434733 º º History of Changes Poland: Central Register of Clinical Trials (CEBK)

Keywords provided by Novartis: Influenza H5N1, pandemic º Study placed in the following topic categories: Virus Diseasesº Respiratory Tract Diseasesº Respiratory Tract Infections

Influenza, Humanº Influenza in Birdsº Orthomyxoviridae Infections

º Additional relevant Mesh terms: Virus Diseasesº RNA Virus Infectionsº Respiratory Tract Diseases

Respiratory Tract Infectionsº Influenza, Humanº Orthomyxoviridae Infections

º ClinicalTrials.gov processed this record on May 17, 2009 Back to top of Main Content 166.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

167.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

º U.S. National Library of Medicine,ºContact Help Deskº U.S. National Institutes of Health,ºU.S. Department of Health & Human Services,º º When damage and injury, however, are listed as the primary outcome, this is no longer medicine. This is murder.º Any vaccine for a pandemic influenza should have to be thoroughly evaluated through trials and research to prove its safety, efficiency, efficiency, quality and beneficial health effects if a government is going to be in compliance with its duty under normative justice to issue a licence for that vaccine.

Moreover, vaccines and drugs should have been tested for their beneficial health effects in several clinical phases for safety and efficacy before they can be released to the general public. This is a time consuming process often taking years to complete. There is no short cut to following these procedures when it comes to safety.

Any new vaccine has to be evaluated at many levels: Phase 1: safety, Phase 2: safety and immunogenicity, Phase 3: large- scale trials for efficacy and Phase 4: post- marketing surveillance.º It is criminal for a vaccine material that has as its stated primary desirable outcome “adverse events rate” after two doses rather than “positive events rate”, that is, beneficial effects on the health of the patient, to be injected into patients.º It is a crime to produce a vaccine whose overwhelming intention is to produce “adverse events” or damage to the people who are injected with the drug as the FLUAD-H5N1 does. It is a crime to approve that vaccine for the market on the basis of it producing “adverse events rate”.º If I make a drug saying its success is measured in terms of “adverse events” and to damage people, I am conspiring to commit pre-meditated assault or murder using a bioweapon and an injection as the delivery system. If I actually use that drug and kill people I have committed pre meditated murder using a bioweapon and an injection as a delivery system.º The doctors and nurses involved in the bird flu trials in Poland are now on trial for having withheld from their victims information about the drug, presenting it instead as a harmless, routine shot. In so far as they have violated the requirement to obtain informed consent, they have violated the medical law. In so far as their actions led to the deaths of others, they have violated criminal law.º Are the people of the United States going to be forced to take an unproven, untested vaccine such as the one produced by Novartis, fully licensed but licensed to cause adverse events, that is to say, to kill and injure?º Novartis along with Baxter is one of the two major companies with contracts to produce millions of doses of swine flu vaccines for a mass compulsory vaccination.

168.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

„Novartis has also received contract from US DHHS to further develop MF59C.1 adjuvant technology to potentially extend vaccine supplies in case of Influenza pandemic outbreak.“ http://www.antiviralintelistrat.com/1/Database?prod=1737º º “CompanyMarket Cap2009 P/E5-year Earnings GrowthTechnology Novartis (NVS)$85 B10x10%Cell-based vaccines Baxter (BAX)$30 B13x12%Cell-based vaccines Gilead (GILD)$40 B18x15%Anti-viral drugs Crucell (CRXL)$1.5 B50x30%Cell-based vaccinneº Gilead will receive royalties on every dose of Tamiflu sold by Swissbased Roche. The current efforts to beef up emergency stockpiles of Tamiflu could add $80 million to Gilead’s bottom line within two years.

Novartis, Baxter, and Crucell are each developing vaccine-production methods to replace our antiquated system (which uses chicken eggs).

From start to finish, each of the new approaches can generate an original vaccine within 12 to 16 weeks.

Novartis already has the genetic code of the current swine flu virus.

Now, it’s waiting for an actual sample of the virus to arrive in its labs. Baxter expects a sample, as well, in the next few days.” º º º º

169.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XIII. Evidence as to the WHO’s role in the bioweapons programº º º The World Health Organization (WHO) is a specialized agency of the United Nations (UN) that acts as a coordinating authority on international public health. Established on 7 April 1948, and headquartered in Geneva, Switzerland, the agency coordinating international efforts to monitor outbreaks of infectious diseases, such as SARS, malaria, and AIDS. WHO is currently working with Collaborating Center in Atlanta (The Centers for Disease Control and Prevention (CDC) in the United States of America) and vaccine companies such as Baxter and Novartis to develop “candidate vaccine viruses” for 4 billion people by autumn of the world’s population, enough to achieve an 80 per cent reduction in the world’s population.

There is evidence that WHO itself is playing a role in exposing the populations of the world to the risk of a pandemic virus that could kill billions of people.º º Though Dr Margarent Chan, the Director General of WHO, is technically a public servant and has the duty as part of her official capacity to act at all times in such a way as to safeguard the health of the world's population, there are grounds for believing WHO is abusing its administrative structures, personnel and services actually “misusing“ pandemic material and pandemic declarations to assist organisations, companies, government bodies or other entities intent on unleashing a pandemic virus and then carrying through a mass vaccination programme with contaminated material in order to gain political and economic advantages from mass murder.º º WHO supplied the the “wild” bird flu virus from its reference laboratory that Baxter AG in Austria then used to produce 72 kilograms of contaminated bioweapon material that nearly triggered a pandemic.º 195. Though Baxter was involved in a scandal involving vaccines tainted with deadly avian flu virus, WHO choseº Baxter head up efforts to produce a vaccine for the Mexican swine flu that has seemingly migrated into the U.S. and Europe.º º Baxter has confirmed it is working with the World Health Organization on a potential vaccine for swine flureports the Chicago Tribune.º º Baxter has previously worked with governments all over the globe to develop and produce vaccines to protect against infectious disease or potential threats from bioterrorism. After 9/11 Baxter helped supply stockpiles of a smallpox vaccine and in 2003 the company was contracted to develop a vaccine to combat the SARS virus. In 2006 the UK Government announced plans designed to inoculate every person in the country with Baxter’s vaccines in the event of a flu pandemic.º º Even though Czech newspapers immediately questioned whether the 170.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

events were part of a conspiracy to deliberately provoke a pandemic, there was no in depth investigation by WHO resulting in recommendations for the tightening of standards or for charges at Baxter made public.

Since the probability of mixing a live virus biological weapon with vaccine material by accident is virtually impossible, this leaves no other explanation than that the contamination was a deliberate attempt to weaponize the H5N1 virus and distribute it via conventional flu vaccines to the population who would then infect others to a devastating degree as the disease went airborne.º º Baxter has put the safety of the entire human race at risk together with WHO, and now, that same company, Baxter, is seeking a sample of the potentially lethal never before seen form of swine/avian/human flu virus and WHO has chosen it to develop a new vaccine, reaping billions in the process.º º Why should Baxter be entrusted with this task by WHO, when Baxter have already been proven to be at the very least criminally negligent, and at worst a prime suspect in attempting to carry off one of the most heinous crimes in the history of mankind unless WHO is involved?º So, under the guise of helping to coordinate the response to a pandemic, WHO is actually helping vaccine companies to develop and also release the pandemic viruses with impunity by providing funds, licences and authority.

Though Dr Margarent Chan, the Director General of WHO, is technically a public servant and has the duty as part of her official capacity to act at all times in such a way as to safeguard the health of the world's population, there are grounds for believing WHO is abusing its administrative structures, personnel and services actually “misusing“ pandemic material and pandemic declarations to assist organisations, companies, government bodies or other entities intent on unleashing a pandemic virus and then carrying through a mass vaccination programme with contaminated material in order to gain political and economic advantages from mass murder.º The World Health Organization, together with the UN, will be given authority over the US in the event of a pandemic under a decree issued by President George Bush in 2005.º When WHO sends such a "declaration" to President Obama, FEMA and the Department of Homeland Security "Pandemic Task Forces" will be deployed according to my information.º º Each State Governor will be notified that the provisions of the Model State Emergency Health Powers Act (MSEHPA) will be implemented.º This means that all Americans must consent to mass vaccinations, or be guilty of a FELONY crime.º º The legal situation is that anyone who refuses the vaccine, and/or resists forced relocation to a prepared "quarantine compound", can "legally" be shot and killed. (Justified "deadly force".)º º See http://www.forhealthfreedom.org/Pub...ModelState.htmlº 171.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

º On Friday April 24, following the „swine flu“ scare in Mexico, WHO ordered officers to man the "Pandemic Control Room" 24/7 for the first time and was reported to be about to declare a "pandemic".º º The WHO "Pandemic Control Room" is designed to map and track the spread of a pandemic virus, and is thus equipped with super-computers tied to all U.N. member government's security forces.º º This "control room" is where any declarations of "pandemic" will originate from.º WHO appeared to be ready to declare a pandemic prematurely as a pretext to rush through emergency laws and mass compulsory vaccination program with contaminated or faulty vaccine material that could result in death or injury to people as happened in the mass swine flu vaccination program of 1976.º WHO intentionally manipulated information on the swine flu outbreak to play up the danger of a pandemic in order to justify the declaration of a pandemic and the implementation of a mass vaccination programme while ignoring and suppressing information that indicates WHO’s drastic response is not proportionate to the risk, especially the evidence that many people have recovered from the „swine flu“ with just rest and hydration.º º WHO’s assessment of the dangers of this swine flu was by far the most pessimistic with the CDC recommending just customary precautions. º WHO identified about 80 fatalities at a time when the Mexican government itself confirmed only 16 from this new flu strain.º º The new strain of the so called „swine flu“º appeared in Mexico and America simultaneously, and under "mysterious circumstances" also indicating aº deliberate, planned and coordinated release of the synthetic laboratory engineered viruses.º But WHO only began investigating the "mysterious" incident after the Austrlian virologist Adrian Gibbs said in an interview he thought the virus had come from a lab. º It is WHO’s especial duty, given this precedent in 1976, to make sure no mass vaccination programme is implemented unless that causes injury to the general public is implemented under WHO’s auspices by WHO declaring a pandemic prematurely and without having adequate safeguards in place to ensure the high quality and safety of any vaccine material.º However, WHO immediately contracted Baxter, the very same company that nearly triggered a pandemic by releasing 72 kg of live bird flu material in winter to produce huge amounts of vaccine for the „mysterious“ swine flu.º º Again, it was the WHO reference center which provided Baxter with the particularly lethal wild type bird flu virus that ended up 172.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

contaminating ordinary human flu material and being distributed to 16 laboratories in Austria, the Czech Republic, Slovenia and Germany under a false label, so nearly sparking a bird flu pandemic this winter in the estimation of experts and the media.º º Virus mix-up by lab could have resulted in pandemic (6 Mar 2009)º http://timesofindia.indiatimes.com/articleshow/4230882.cmsº º In the Baxter case of this winter, there is therefore a clear, well documented link between WHO and the release of pandemic bird flu material in Europe this winter.º º The WHO is, according to reports, conducting an investigation into Baxter and Avir's role in producing and distributing this material, but has so far not made public the results of its investigation or made recommendations in respect of stricter biosecurity rules for laboratories working with the highly pathogenic bird flu virus.º Under the biosafety 3 regulations an accidental contamination of the deadly bird flu virus strain WHO sent from its reference center to Baxter with a human flu is virtually impossible.º WHO’s failure to conduct a full and detailed investigation into the „Baxter incident“, and to make those findings public or to make clear recommendations as to how to prevent a repeat of this incident is not merely a failure to perform their duty as a public health body, but evidence of their role in covering up the real origin of the pandemic virus, specifically, in WHO's own reference center.º º I contend that WHO and Baxter and other vaccine companies are working together to deliberately trigger a pandemic with the aim of profiting from it by sealing in advance lucrative contracts to supply a vaccination.º º I contend that high offices in organisations such as the WHO have been annexed by criminal elements who are actually helping to further a criminal agenda of committing murder with the motive of robbery albeit using covert bioweapons programmes.º º Given the fact that this Baxter incident happened only a few weeks ago and WHO is involved in it in as far as it supplied a) a lethal strain of the bird flu virus and b) is investigating the incident, it is surprising how quickly WHO gave Baxter a contract to work on the swine flu.º º Although many researchers and NGOs issued warnings that resurrecting this lethal Spanish flu virus was dangerous to the public, WHO has been one of the biggest supporters of continuing research into this bioengineered virus and into its "antidotes" spending millions, if not billions, of tax payers dollars on research or „creation“ and then on „vaccination“ and „prevention“ programmes.º º Jeffery K. Taubenberger of theº Department of Molecular Pathology, Armed Forces Institute of Pathology into the bird flu virus and specifically his reconstruction of the deadly strain of the bird flu 173.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

virus from the genetic material retrieved from victims of the Spanish flu pandemic of 1918-1919. º It was only in the summer of 2008 that researchers published evidence that showed that the bird flu can mix with the human flu virus to produce a pandemic virus in a laboratory situation.º º That same summer Novartis tested ist bird flu vaccine for „adverse events“ on homeless people in Poland, causing deaths and injury.º º There is therefore, plenty of evidence from the documents and reports even within the public domain to show that WHO and their allied pharmaceutical companies and other agents, including the European Union, are knowingly and intentionally creating pandemic virus material, testing it and releasing it.º º There is evidence from the pattern of WHO’s activities that, under the color of their office while purporting to act in an official capacity, members of the organisation are actually acting on behalf of hidden crime interests intent on igniting a pandemic and misusing a declaration of a pandemic to gain political and financial advantages, a group which designated in these charges as the Illuminati crime gang.º º The declaration of a pandemic by WHO has direct political and financial and other advantages to elements in the US government, especially elements belonging to the Illuminati/Bilderberg/ New World Order/CIA/Freemason crime gang.º For one thing, many high level associates of the Illuminati are now being considered for investigation for sanctioning torture in violation of the US and international law, specifically Donald Rumsfeld (who has financial connections with an anti bird flu Tamiflu producer), Richard Cheney and Alberto Gonzales.º º The imposition of martial law on the pretext of a pandemic will help those individuals suspected of violating laws to torture to avoid prosecution in the United States, although a case is being pursued in Spain.º Furthermore, elements of the Illuminati have knowingly and intentionally manipulated the financial system for their financial gain, first by sucking in huge amounts of money, and then by imploding the system.º º WHO is knowingly and intentionally, helping the Illuminati achieve their political goals of controlling the millions of newly impoverished Americans by giving the government a pretext to declare martial law and implement a mandatory vaccination program.º º Further evidence of WHO’s role in facilitating the covert bioweapons program by the Illuminati against the people of the United States comes from the recent case of VICL In spite of the fact that WHO has said on its own website that the 174.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

vaccine candidate viruses would only be available by mid May, Vical Incorporated (VICL 2.13, -0.12, -5.33%) announced on May 21stº that in the two weeks since launching its program to develop a vaccine against H1N1 influenza (swine flu), the company has completed development of a prototype H1 vaccine, produced an initial supply of research-grade material, and initiated immunogenicity testing in animals. http://www.who.int/csr/disease/swineflu/frequently_asked_questions/va ccine_preparedness/en/index.htmlº According to the WHO website: “A vaccine for the Influenza A(H1N1) virus will be produced using licensed influenza vaccine processes in which the vaccine viruses are grown either in eggs or cells.

Candidate vaccine strains have been identified and prepared by the WHO Collaborating Center in Atlanta (The Centers for Disease Control and Prevention (CDC) in the United States of America)1. These strains have now been received by the other WHO Collaborating Centers which have also started preparation of vaccine candidate viruses. Once developed, these strains will be distributed to all interested manufacturers on request. Availability is anticipated by mid-May.”º How can VICL have completed development of a prototype H1 vaccine, produced an initial supply of research-grade material, and initiated immunogenicity testing in animals even before the candidate vaccine was grown and released to companies unless VICL itself was involved in making the virus in the first place.º How can VICL have won a contract with the Navy for clinical testing of a vaccine when the candidate virus has not even been released by WHO? “The first doses of Influenza A(H1N1) vaccine could be available in five to six months from identification of the pandemic strain. The regulatory approval will be conducted in parallel with the manufacturing process. Regulatory authorities have put into place expedited processes that do not compromise on the quality and safety of the vaccine. Delays in production could result from poor growth of the virus strain used to make the vaccine,” WHO says on its website.

VICL is working to a very different time plan. „Assuming a successful outcome of this testing and a commitment for program-specific external funding, the company is ready to advance directly to large-scale cGMP manufacturing of vaccine for human clinical trials to be conducted by the U.S. Navy.

The company previously announced that it has entered into a Cooperative Research and Development Agreement (CRADA) with the U.S. Naval Medical Research Center (NMRC), a biomedical research organization within the U.S. Navy, to advance into clinical testing as quickly as possible a Vaxfectin(r)-formulated H1 DNA vaccine.

Vical and the NMRC are actively pursuing funding to support the program.“º Criminal charges have also been brought against WHO, Baxter and the Swiss National Influenza Laboratory in Geneva for their role in an alleged bioterrorist attack in Switzerland on April 27th. (see Attachment (B) for charges in German)º 175.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

A container with vials of swine flu virus exploded on a Swiss Intercity train at peak time, exposing 61 people to a potentially lethal virus.º (http://uk.reuters.com/article/worldNews/idUKTRE53R1PO20090428) The container appears to have come from a WHO and Baxter affiliated laboratory in Mexico City. It was destined for the National Influenza Laboratory of Switzerland in Geneva, but was apparently sent by plane to Zurich where it was picked up by a technician.º The container was faultily packaged. The dry ice meant to cool the vials was packed into the wrong part of the container and resulted in an explosion as the dry ice melted in the train compartment.º The allegation is that these groups were acting in unison to rlease a virulent strain of the virus among the Swiss population and cause panic in an attempt to justify triggering a pandemic level 6 declaration from which they would reap enormous financial and political profits, including, in the case of WHO and the affiliated UN, the right to assume control over key US infrastructure.

A virus of this sensitive nature should not have been sent in a high speed commuter train packed with people. It should have been classified as a hazardous material and sent by a third party.

Furthermore, it was alleged the container was not “faultily” packed as claimed, but deliberately designed to explode and spray out particles of the virus among passengers.

An Intercity train, a more or less enclosed, air conditioned space with constant variables such as temperature and packed with people, is an ideal place to launch a bioweapons attack.

It was contended that the container used for transporting the vials resembled a CO2 bomb. Dry ice packed into the middle ring of a hermetically sealed container evaporated when it melted, producing vapour. The vapour expanded and the growing pressure led to the explosion of the vials of Ǽswine flu and to the bursting of the container.

The blast was sufficient in force to injure the technician charged with transporting the package as well as a passenger.

Through this explosion, the virus was aerosolised and spread around the compartment. It can be assumed it went into someone’s lung, carried by the shockwave of the explosion outwards.

It was alleged that dry ice or solid carbon was chosen because most bomb sniffers - dog and electronic alike - look for sulfur and nitrogen compounds found in black powder, ANFO, etc.

Solid carbon or CO2 is in the air already, so detecting it and discriminating from natural background sources is harder.

The container used to transport the vials should have had a vent hole to allow the pressure building up from the melting dry ice to escape.

It should also have been made of plastic if it were the conventional type of container for carrying medical supplies.

Because the container had no such vent hole and was made of a robust 176.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

material, the evaporating CO2 pressurized the container, and the vials of swine flu.

Once the outer case burst, the inner vials underwent a similar explosive decompression, instantly vaporizing their contents as a mist filled with microrganisms.

It was alleged that the “organisers” of this bioterrorist act planted misleading information into the general public that the virus was harmless when it isn’t to spread the lethal Mexican pandemic strain by sending their agents from the National Influenza Laboratory in Geneva to the scene of the explosion to reassure the police that the virus was harmless.

In spite of the fact that the credibility of the laboratory staff was severely compromised by their decision to send the vials by train and by the faulty packaging of the container, the police did not carry out a forensic investigation.

As a result, the infected passengers were allowed to go home without any preventative treatment or plans for the monitoring of their health. º º º º

177.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XIV. Evidence as to WHO’s manipulation of disease data in order to justify declaring a Pandemic Level 6 in order to seize control of the USA.ºººº º º F. William Engdahl discusses the way WHO is seeking to amplify the dangers associated with the swine flu, which so far was has been so mild that it is indistinguishable from ordinary flu.ºº If the WHO does not call out Pandemic Level 6 when a severe flu wave kills thousands of people in the USA and the rest of the world, then why declare a Pandemic Level 6 now?ºº The explanation for WHO’s haste in seeking to declare a Pandemic Level & is because it triggers the hand over of power over the USA and other parts of the world to WHO and the UN, front agencies for the international global elite, who have financed the bioengineering of a pandemic virus and organised the vaccine companies into a secret bioweapons programme for political and financial gain.ºº In a report dated June 5th, (http://www.globalresearch.ca/index.php? context=va&aid=13856), F. William Engdahl takes a shot at the „flying pigs“ swine flu.ºº The WHO Plays with Pandemic Fire The Continuing Saga of the Flying Pigs Pandemic Flu ºº

by F. William Engdahlº º

.

Global Research, June 5, 2009 º According to information from within the World Health Organization in Geneva, the UN organization supposedly monitoring global health dangers, WHO Director-General Margaret Chan plans to declare a Phase 6 Official Pandemic Alert in the coming days. This bizarre act if declared would come at a time that the country which had to date reported far the latest number of suspected H1N1 cases, the USA, has simply arbitrarily stopped reporting new cases.

If you consider to let your family get scared into taking drugs like Tamiflu that not only do not prevent or even ameliorate symptoms of flu, but in some cases are so toxic they cause severe paralysis, breathing problems and even death, you should at least know the facts before.

The report that WHO may declare an official Pandemic global alert any time is all the more bizarre given the fact that the global wave of cases reported to date to WHO from around the 178.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

world reportedly have been so mild as to be indistinguishable from the symptoms of ordinary flu.

And the relatively small number of deaths alleged tied to swine flu as it originally was named, appear in no way definitely tied to to H1N1 causes. In a May 28 CDC press briefing, the CDC reported, ‘When we look at our deaths, we have information on 11 of the 12 deaths that have been reported to us so far.º And it appears that 10 of those fatalities occurred in people who had an underlying condition that put them at greater risk for severe complications of influenza.’º That is what epidemiologists call correlation not causality or ‘opportunistic infection’ deaths.

European epidemiologists privately believe that there is no proven link between supposed H1N1 Influenza A illness and the deaths, rather that the deaths are ‘coincidence’ or what health professionals term ‘opportunistic infections.’ The CDC report would seem to strengthen that argument.

US CDC stops regular reporting?

Even more bizarre for a supposed pandemic ‘threat to all mankind’ the official monitoring agency in the nation with so far the largest number of reported case counts, which notably include ‘probable’ ad well as ‘confirmed’ H1N1 cases, namely the United States, the CDC announced en passant, on that May 28 press briefing that, ‘beginning next week, we're going to shift to a different schedule.º We'll be updating our case count information less frequently.’ That statement came from Dr. Anne Schuchat, Deputy Director for Science and Public Health Program of the US Centers for Disease Control. She declined to say what ‘less frequently’ was or even why such a decision was reached at the same time the US Government is dedicating billion dollars fast track funds to drug makers to produce H1N1 vaccines.

Oops! Wait a minute. I thought we were teetering on the edge of declaring a global Pandemic Emergency, Phase 6 where travel restrictions, mandatory quarantine and other extreme steps would be implemented. Then the responsible national agency in the country with something like 67% of all reported cases of H1N1 Swine Flu decided casually not to report so often?ºº Another anomaly in the increasingly bizarre situation is the release of new WHO Pandemic guidelines on April 20, 2009, conveniently enough just in time to affect the current world pandemic scare. According to a WHO official responsible for the report, the revision of revised 2005 WHO Pandemic guidelines was begun ‘well before the Mexican flu cases were first reported.’ The official spoke off record.

Even more curious is the fact that the latest April 2009 WHO 179.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Pandemic response guidelines prescribe the exact same response for Phase 5 (sub-pandemic) and Phase 6 (so-called Pandemic), namely ‘implement actions as called for in their national plans.’ For that we need WHO? Drug giants gearing up The situation is becoming a golden harvest for the giant pharmaceutical makers as they receive samples from the CDC to begin producing possible vaccines as well as so-called antiviral drugs like Tamiflu.

The US government recently made available one billion dollars to help big vaccine makers like Sanofi-Aventis and GlaxoSmithKline ready production of new vaccines. Novartis leads the herd with $289 million in federal support, followed

by Sanofi Aventis with $191 million and GlaxoSmithKline, which gets $181 million. In addition the US Government had decided to ‘de-risk’ the vaccine production, presumably removing usual safeguards for new vaccines. The US Health and Human Services Department (HHS) is placing orders with manufacturers with which it already has contracts to produce a pandemic vaccine for the never-pandemic H5N1 avian flu. More than $3 billion in federal funds since 2005 have gone toward developing, building manufacturing and stockpiling a vaccine to fight that disease.

How long do such vaccines hold in stock?º Fittingly given the bizarre nature of the entire Flying Pigs panic being spread by WHO and CDC, the CDC reports that it expects the first H1N1 approved vaccines to be ready by Halloween. Trick or Treat?

In Australia the government has ordered 10 million doses of a new vaccine being developed by CSL. CSL plans to start producing a new vaccine in the next days that can be used for human testing. A vaccine based on the California strain of the virus is being tested in ferrets. China says that it will have samples of swine flu on hand by June and plans to start manufacturing a new A/H1N1 vaccine in July.

Many drugmakers are using techniques of genetic manipulation to produce their new vaccine offerings in a race to market. The Maryland drugmaker Novavax which reported severe annual income losses prior to the current Swine Flu scare, now is preparing a genetically modified vaccine they claim is suitable for H1N1 flu. º º º The 1976 Swine Flu fiasco Once WHO declares a Phase 6 Pandemic Alert, all hell could break loose with governments and population going into panic, 180.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

cancellation of international travel, severe domestic travel restrictions and other emergency measures resembling martial law.

In 1976 President Gerald Ford issued an Executive Order calling for every man woman and child in the USA to be vaccinated against a suspected outbreak of swine Flu at the Fort Dix US military base. Within months more than forty million unknowing Americans had been vaccinated, some 20% of the then total population despite the fact that no pandemic ever appeared. The flu was restricted to Fort Dix. Interestingly, aside from severe weather and crowded barrack conditions at Fort Dix, every recruit coming in had immediately been given multiple vaccinations as routine, similar to what US soldiers are given today before being shipped to Iraq or Afghanistan, or similar to what US and European soldiers were given in 1918 during the spread of the misnamed Spanish Influenza of 1918. Was the Fort Dix wave of illnesses and one death a consequence of the vaccinations? We may never know as no government agency was interested in pursuing the notion.º In that 1976 US swine flu panic, aided by a nervous President eager to win re-election, there were thirty deaths due to adverse vaccine reactions and dozens if not hundreds of cases of the rare Guillain-Barre syndrome which led to halting of a national vaccination that was being given for a non-existent pandemic.º Free from liability?

There was one very significant difference between 1976 and today however. In 1976 US insurance companies refused to insure vaccine manufacturers against lawsuits for vaccine-related illnesses or deaths. Today drugmakers need have little fear of damages from product liability lawsuits. They can unleash whatever substances the FDA lets them, and indications are that under Pandemic declaration safety standards would be dropped in the rush to stab the population as widely as possible with vaccines.

Under rulings made under the Bush Administration, vaccines can be labelled as “unavoidably unsafe” meaning that when a product is ‘carefully designed, manufactured and marketed, but is dangerous nonetheless,’ it is not a defective product, even though it might cause injury. Clear? It certainly is clear to the pharmaceutical industry which lobbied hard for the determination.

A decisive victory for the drug industry came in January 2006 when Bush Administration Health and Human Services Secretary Michael Leavitt announced a new ruling in defiance of established precedent and the expressed intent of Congress. The 181.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

new FDA rules pre-empted any state laws that allow citizens to sue drugmakers for producing unsafe drugs under the dubious claim that the FDA, an agency under HHS, had national responsibility for certification of drug safety and state lawsuits impinged on that national responsibility. As several Congressmen at the time pointed out the FDA track record for timely response to clear drug dangers as in the Vioxx cases was hardly to the benefit of the health and welfare of citizens suffering needless heart attacks and death as a side effect of the drug.ºº It would be relevant to ask if the Democratic Congress that protested the 2006 FDA liability-free ruling has plans to change that free ride for vaccine makers. That might do more than anything to reduce the effects of Swine Flu. Then people might realize where the real swine danger lies. º º º º º

182.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XV. Evidence as to FDA’s role in covering up the bioweapons programº º º There is evidence that the criminal activities of the vaccine corporation are covered up by complicit FDA offiials.º The FDA failed to complete an inspection of Baxter’s. Scientific Protein plant in China that should have been conducted in 2004 because regulators confused the plant with another with a similar name, according to the agency, thereby allowing the contamination of the heparin.º The FDA may have been able to have prevented contaminated heparin from reaching the U.S. if the agency had completed the 2004 inspection, said David Nelson, an investigator for the energy and commerce panel, who testified before the panel.º While there wasn't contamination at the time, Nelson said an inspection may have identified shortcomings, including procedures to ensure the ingredients it purchased were pure. The FDA failed to complete an inspection of the Scientific Protein plant in China that should have been conducted in 2004 because regulators confused the plant with another with a similar name, according to the agency.º Baxter inspected the plant in September and found no major deficiencies, said Nelson. In February, the FDA sent inspectors to the plant and uncovered ``significant deviations'' from standard practices, he said. He questioned whether the Baxter inspection was sufficient.

The inspections were done ``at different points in time'' for different reasons, Baxter's Parkinson said. The company's inspection was routine, while the FDA's was ``for cause'' after the recall. ``That leads to a very different type of inspection,'' Parkinson said.º ``Our investigations have revealed personnel, effective policies, and perform the duties entrusted to it people,'' said Representative John during the hearing.º

an FDA woefully lacking in the the will at the highest level to by the Congress and the American D. Dingell, a Michigan Democrat,

The FDA would need an additional $225 million annually to inspect overseas drugmakers every two years, said Janet Woodcock, head of the FDA's drug division. The agency plans to spend $11 million this year for overseas inspections, according to the Government Accountability Office, the investigative arm of Congress.

The FDA conducts annual inspections of about 7 percent of overseas drugmakers that ship to the U.S., a pattern suggesting it would take 13 years to visit them all, according to the GAO. Representative Michael Burgess, a Republican from Texas, also raised alarm that heparin appeared to have called the contamination ``thuggery'' and ``thievery'' and said it was an ``knife in the back'' of the American public.

183.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Bayer pharmaceutical company documents (from its Cutter Biological unit), made public during a lawsuit, revealed that in 1985,º Bayer and the FDA colluded by knowingly and deliberately putting thousands of hemophiliacs at risk of death by selling an AIDS-infected blood clotting drug in Asia and Latin America. See: http://www.ahrp.org/infomail/0503/22.phpº ºº The New York Times reported that FDA official, Dr. Harry Meyer, willingly helped Bayer cover up "one of the worst drug-related medical disasters in history." Meyer suggested that the issue should be "quietly solved without alerting the Congress, the medical community and the public."º º Attorney, Mike Papantonio http://www.ringoffireradio.com/mike_papantonio.asp, who with Robert Kennedy Jr, co-hosts, Ring of Fire, said in an interview with MSNBC's Joe Scarborough that this lethal product was also sold in Spain, France, and Japan, killing thousands--especially children.º º He stated emphatically that the internal documents show that Bayer "absolutely, positively knew [the product] was infected and would likely kill thousands of people" but that it set out to "profit by disaster." see video: http://www.youtube.com/watch? v=XS3mhjt7TrY&search=Bayerº º When the French government learned of it, company officials went to jail. In the US no pharmaceutical corporate criminals have ever been held accountable nor indictedº Bayer was one of the companies that issued contracts for unknown medical substances to be injected into Nazi concentration camp inmates during the second world war.

The FDA is a government body whose officials must act, therefore, in accordance with the mandate of the Preamble, Constitution and Bill of Rights to eliminate the risk of death and injury concerning vaccines and other medicines as the Preamble, Constitution and Code, from which all government bodies derive their legitimacy, requires.

“The Food and Drug Administration (FDA or USFDA) is an agency of the United States Department of Health and Human Services and is responsible for regulating and supervising the safety of foods, dietary supplements, drugs, vaccines, biological medical products, blood products, medical devices, radiation-emitting devices, veterinary products, and cosmetics.”

However, I contend the FDA is deliberately, willfully and knowingly failing to do its duty to inspect and control vaccine companies employing devices, schemes and artifices to subvert the regulations such as going to the wrong plant for the inspection out of “confusion” because key personnel within the FDA, including Defendant Dr Margaret Hamburg, are following instructions for a cover up from the very same international crime syndicate that is using those same vaccine companies to commit covert mass murder, and to profit from that mass murder.

190. The FDA Chief Andrew von Eschenbach, M.D. has committed perjury 184.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

before Congress after it was discovered that he gave misleading information about the fraud involved in the approval of the dangerous antibiotic drug Ketek made by Sanofi-Aventis.

“FDA Chief in Very Hot Water with Congress Thursday, February 14, 2008 - Byron J. Richards, CCN It now appears that the FDA Chief Andrew von Eschenbach, M.D. has committed perjury before Congress...

The FDA is now ignoring Congressional subpoenas of its records, setting up another showdown between Congress and the Bush Administration.º Unlike former showdowns, national security is not involved.º Will the Bush administration offer protection for a situation that involves needless deaths to Americans?º The Chinese sentenced to death the head of their FDA for far lesser misdoings.

The issue revolves around the fraud-riddled antibiotic Ketek which is made by Aventis, now Paris-based Sanofi-Aventis.º Sen. Charles Grassley, R-IA, has been holding the FDA’s feet to the coals on the Ketek issue for the past several years ever since an 18 year old boy from Iowa was killed by the antibiotic when being treated for a routine infection.º There are other deaths and many cases of liver failure.º The House Oversight and Investigations Subcommittee has been looking into the matter since early last year, shortly after von Eschenbach’s permanent appointment to head the FDA. The available evidence paints a picture of the FDA turning this deadly drug loose on children even though it knew of safety problems, a trail of evidence von Eschenbach has actively covered up.º In the face of Congressional scrutiny the FDA has since scaled back it’s approved use of Ketek, but has left it on the market to treat pneumonia. The FDA blames Aventis for the problems, who is also in hot water with Congress.º The FDA is refusing to hand over records showing what it knew and when.º Insider information indicates significant FDA wrongdoing.º We already know that a clinical trial involving the drug was forged by a weight loss clinic in Gadsden, Alabama.º The physician in charge, Dr. Maria Anne Kirkman-Campbell, is now serving five years in prison.º Congress has been trying to get to the bottom of the matter, seeking to establish what Sanofi-Aventis and the FDA knew.º Congress has hit a stone wall.º It appears they both knew plenty – and covered their tracks.

The House Subpoenas FDA Records Congress finally had enough.º On January 25, 2008 John Dingell and Bart Stupak of the House Oversight and Investigations Subcommittee sent a memorandum stating they intended to subpoena FDA investigators, a private contractor, and various FDA records, which they followed through on several days later.º On February 12, 2008 the House committee held hearings on the matter.º Douglas Loveland, a special agent at the FDA’s criminalinvestigation office, told the committee that Aventis should have known there was fraud and there was a “catastrophic failure” of their clinical trial systems.º They ignored “red flags” about the bogus 185.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

data, “they were loud signals…they were bright signals.”

The FDA even admits that it knew there were “serious protocol violations and regulatory noncompliance by multiple clinical investigators” and that it had no knowledge these problems were ever fixed before approving the drug.º However, the FDA is not forthcoming about information that may indicate a von Eschenbach cover-up.

Last March von Eschenbach provided written testimony to the committee on events surrounding the Ketek drug approval.º The committee subsequently learned from an FDA insider and those familiar with the approval that the testimony was not truthful.º The committee had recently subpoenaed the FDA records regarding the preparation of this testimony to learn why it was lied to.

On February 12, 2008 the committee was told by the parent of the FDA, the Health and Human Services Department, that these documents would not be provided because “The department has serious concerns about providing the kind of materials the committee has subpoenaed … such highly confidential and deliberative materials used to prepare witnesses testifying before Congress risks chilling the open exchange of views that is essential to the effective conduct of agency business.”º A more skeptical outsider like myself would interpret this to mean “that when people are killed the FDA is above the law and doesn’t need to disclose relevant information.”

Dingell is not taking the matter lying down: “What is in those briefing books that he does not want either my Republican colleagues or our side to see?º Is there evidence of perjury? Are there statements embarrassing to the administration?” He went on to say that “Neither Chairman Stupak nor I will tolerate such a perversion of Congressional powers to investigate and probe.”º His next step to get the von Eschenbach records may be to hold Michael Leavitt, the HHS Secretary, in contempt of Congress – setting up a major showdown with the Bush Administration.

FDA Whistleblower Dr. David Ross served as the FDA’s primary safety reviewer on Ketek.º He was concerned about liver damage as early as 2000 and was stunned by the fact that the U.S. clinical trial contained blatant fraud.º Back in 2003 he wanted to give this information to the FDA advisory panel that was deciding if Ketek was safe to use for the public.º FDA management prevented him from doing so and purposefully withheld information from the advisory panel about the ongoing criminal investigation.º Ross buckled to FDA management pressure and omitted the safety risks and his concerns about Ketek from his final report.º This all happened prior to von Eschenbach coming to the FDA.º Under von Eschenbach’s tenure as temporary head of the FDA the Ketek problems began to hit the fan.º Congress started actively looking into the matter and von Eschenbach went into damage control mode.º He called a meeting of 40 FDA employees regarding Ketek issues and mysteriously Ross was invited to this meeting (he no longer worked on the Ketek issue).

Ross has reported that during the meeting von Eschenbach likened the 186.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

workings of the FDA to a football locker room, where differing views can be vented but that once on the field the team speaks with one voice and any FDA staff who speaks differently will be warned the first time, benched the second time, and traded the third time.

In the face of such a blatant effort to suppress the truth of the situation Ross turned whistleblower. He has told Congress that the FDA approved Ketek “despite knowing that it could kill people from liver damage and that tens of millions of people would be exposed to it.”

Grassley Predicted the Unethical Behavior of von Eschenbach Back in February of 2007 Senator Grassley informed the House committee of the extensive nature of the FDA cover-up on Ketek as well as other issues, including FDA disregard for Congressional investigation.º Von Eschenbach is a cancer-industry insider who took the job at the FDA so he could get quick approval of new biotech drugs while using humans for cruel experiments in the name of “progress.”º His nomination as permanent head of the FDA took place during the 2006 lame duck session of Congress and was rubber stamped by Big Pharma friendly Senators.º Senator Grassley knew better, as he stated on the floor of the Senate during the confirmation hearings: “People ought to be ashamed of saying Dr. Andrew von Eschenbach has done a superb job in the position he is currently occupying [acting head of the FDA].…That is an insult….In my interactions with the Department of Health and Human Services and the FDA these last 8 months, I have seen a complete and utter disrespect for congressional authority and hence the law.… This body [the Senate] should not walk hand in hand with the executive branch and sit idly by as instances of abuse and fraud continue to endanger the health and safety of American people.”

As Grassley’s warning fell on deaf ears, Orrin Hatch (R-UT), a man whose pockets are lined with Big Pharma money, rose in defense of von Eschenbach: “To me it is simply unconscionable that the Food and Drug Administration, one of the best little agencies in Government, has gone leaderless for such a period of time…I know Dr. von Eschenbach well. He is a man of integrity….I urge my colleagues—no, I implore my colleagues—to do what is right and vote [for] this nomination….it is what the American people deserve.”

Indeed, as history notes, the American people got von Eschenbach – a drug company sales rep sitting in the hot seat atop the dysfunctional FDA, an organization of unelected bureaucrats who are certain they are above the rule of law and certain they have nice jobs waiting for them in the Big Pharma world.º º º º º 187.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XVI. Evidence as to the Canada’s National Microbiology Labs role in the bioweapons programº º º Canada's National Microbiology Laboratory, a public health reference laboratory that has a duty to provide scientific excellence and quality assurance, sequenced the first Mexican and Canadian flu samples said that the genetic sequence of the H1N1 flu virus from Mexico and Canada is the same.º However, other scientists have found three distinct strains.º Two polymorphisms are different between the virulent Mexican and mild Canadian strain of the swine flu. It is too early to tell if these polymorphisms will be of clinical significance or not. However, a national laboratory is required by law to supply accurate and comprehensive information on the genome sequences of the swine flu virus strains.º The lab should have provided a full and comprehensive analysis including the different in the polymorphisms because its analysis will be the basis for the development of a vaccine.º The wrong genome sequence analysis could lead to the wrong vaccination could potentially cause harm, loss of life.º “Mexican and Canadian Swine Flu -- Not The Same” º http://dc-chemical.us/?q=node/35 º Regarding the genetic analysis of Mexican Swine Flu vs. Canadian Swine Flu -- There are SNPs on PA and PB2 , which are ONLY present in the Mexican strain -- a sequence released by Dr. Plummer's own laboratory! The fact that this difference was in his own data should bring into question the credibility of government health labs' ability and will to protect the public interest.º º Suppose we use New York / Canada as the consensus strain. There are two unique polymorphisms found ONLY in Mexico (so far, anyway):º Whether or not these SNPs are clinically significant is another question entirely -- the fact is, they should have been addressed, rather than suppressed.”º If the Canadian laboratory falsely classifies the mild strain of swine flu as the lethal Mexican strain, it will have ramifications.º The Canadian government is entitled to use criminal law to deal with outbreaks of diseases. Clearly, the government would not be able to claim such a drastic mandate unless the public were led to believe the danger was great.

The analysis of the laboratory could also be the basis for the production of vaccine material. If the laboratory has got it wrong, then the vaccine companies are likely to get it wrong.º For that reason, the Canadian laboratory, flowing from its obligation 188.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

as a public health body established to provide scientific excellence and quality assurance, should, at the very least, have given the entire sequence, including the two different polymorphisms and made it clear that there was a difference between the Mexican and Canadian strain.º The laxity at the Canada's National Microbiology which contains some of the world's most deadliest pathogens was underlined when Canadian scientist was stopped at the U.S. border after authorities found 22 vials used in Ebola research in his car.

Konan Michel Yao, 42, was apprehended by U.S. officials as he attempted to enter the United States at the Pembina, N.D., border crossing from Manitoba on May 5, 2009.º Yao faces U.S. criminal charges for smuggling and is currently in the custody of the U.S. Marshals service.º Yao working at the agency's special pathogens laboratory on an Ebola vaccine project when his research term ended in January.

The head of the lab admitted that Yao vel 3 and 4 pathogens, such as the swine flu virus, HIV and Ebola virus and that "There was…genetic material from the Ebola virus in the material that he took off with.“º Canada's public health agency did not know the vials were missing until it was contacted by the RCMP, which had been alerted by U.S. border services, Plummer said.º The matter has also been referred to the Winnipeg Police Service, which has not yet decided whether to lay charges.º The National Laboratory did not inform the police about the missing vials.º º º º º º º

189.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XVI. Evidence of the involvement of scientists working for the UK’s NIBSC, and the CDC in engineering the swine flu.º º º Len Horowitz, expert on emerging diseases who worked at the research faculty at Harvard School of Dental Medicine, has alleged that there is a network of genetic engineers manipulating, mutating, and distributing viruses.ºº In an interview on the Alex Jones show, Dr. Horowitz urges an investigation of Dr. James S. Robertson, Englands leading bioengineer of flu viruses for the vaccine industry, and avid promoter of U.S. Government funding for lucrative biodefense contracts, along with collaborators at the US Centers for Disease Control and Prevention (CDC).ºº James Robertson is a scientist in the division of the National Biological Standards Board (NBSB) is a non-departmental public body (NDPB) of the UK government NIBSC, is working closely with the WHO and other international agencies in developing a candidate vaccine virus and associated reagents that are required by the vaccine manufacturing industry to produce swine flu vaccine.ºº It has been alleged that these suspects helped Novavax, Inc., in Bethesda, Maryland, produce genetically-modified recombinants of the avian, swine, and Spanish flu viruses, H5N1 and H1N1, nearly identical to the unprecedented Mexican virus that is allegedly spreading to the United States at the time of this posting.ºº „The outbreak was precisely timed to promote the company's new research and huge vaccine stockpiling contracts.

Scientists at the U.S. Centers for Disease Control (CDC) are implicated through collaborations and publications involving private contracts with Novavax, a company that obtains its biosimulars through CDC Influenza Branch director, Ruben O. Donis, and Dr. Rick Bright, previously working with Donis at the CDC, now Novavaxs Vice President of Global Influenza Programs.ºº Descriptions of this virus is pathognomonic, or diagnostic, of a virus that came from Robertsons circle of friends, Dr. Horowitz charges. No other group in the world takes H5N1 Asian flu infected chickens, brings them to Europe, extracts their DNA, combines their proteins with H1N1 viruses from the 1918 Spanish flu isolate, additionally mixes in swine flu genes from pigs, then reverse engineers them to infect humans. The end product could only have ended up in Mexico via the United States from Britain in care of the CDC. The CDC had to have sent them to Novavax, where Rick Brights team is now implicated in a conspiracy to commit genocide—the mass killing of Consider people for profit.“ºº http://involuntaryservant.blogspot.com/2009/04/dr-len-horowitz-namesspecific.html ºº º 190.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XVII. Evidence vaccinations caused the Spanish killer flu of 1918.º º º Biological weapons have a long history of use. In 1346, the invading Tartar army catapulted the bodies of plague victims into the Crimean Peninsula city of Kaffa and infected its citizens. In 1763, British troops under General Jeffrey Amherst gave the Delaware Indians blankets used by people with smallpox, possibly infecting the susceptible native population.

Medical historians have concluded that the Spanish flu “epidemic” of 1918, which killed an estimated 50 million people, was caused by the widespread use of vaccines. It was the first war in which vaccination was compulsory for all servicemen.

The Boston Herald reported that forty-seven soldiers had been killed by vaccination in one month. As a result, the military hospitals were filled, not with wounded combat casualties, but with casualties of the vaccine.

In 1948 Heinrich Mueller, the former head of Nazi Germany’s Gestapo, told his CIA Interrogator that the most devastating plague in human history was man-made.

He was referring to the influenza pandemic of 1918-1919 that infected 20% of the world’s population and killed between 60 and 100 million people. This is roughly 3 times as many as were killed and wounded in World War One, and is comparable to WWII losses, yet this modern plague has slipped down the memory hole. Mueller said the flu started as a US army bacteriological warfare weapon that somehow infected US army ranks at Camp Riley KS in March 1918, and spread around the world.

At a 1944 Nazi bacteriological warfare conference in Berlin, General Walter Schreiber, Chief of the Medical Corps of the German Army told Mueller that he had spent two months in the US in 1927 conferring with his counterparts. They told him that the “so-called double blow virus” (i.e. Spanish Flu) was developed and used during the 1914 war.

“But,” according to Mueller, “it got out of control and instead of killing the Germans who had surrendered by then, it turned back on you, and nearly everybody else.” (”Gestapo Chief: The 1948 CIA Interrogation of Heinrich Mueller” Vol. 2 by Gregory Douglas, p. 106) Actually the Armistice took place Aug 11, 1918. http://elliotlakenews.wordpress.com/2006/12/08/was-the-spanish-fluman-made/ According to Dr. Jerry Tennant, the widespread use of aspirin during the winter that followed the end of The Great War could have been one of the key factors that contributed to the earlier pandemic by suppressing the immune system and lowering body temperatures that allowed the flu virus to multiply. Like aspirin, modern-day antiviral drugs like Tamiflu® and Relenza® also lower body temperatures, and therefore can also be expected to contribute to the spread of a pandemic. „What is new about this virus is that it has a mixture of DNA from 191.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

animals, birds, and humans! Normally viruses are species specific.

Viruses that cause illnesses in hogs can rarely be transmitted to humans, but that virus usually cannot be transmitted human-to-human.

Although some express confusion about how this virus could have mutated in a way that a hog virus and a bird virus could mix with a human virus and cause human to human transfer, it is known that mixing of viral DNA has been done in laboratories.

Except for the fact that the DNA of this virus is suspect, we should not expect to have an epidemic that kills many people. One of the reasons is that viruses usually do not kill people—they just make you feel bad. What killed the majority of people in 1918 was that the flu allowed people to get bacterial pneumonia from Streptococcus. That is what kills you. We are much better able to deal with bacterial pneumonia now than they were in 1918.

However, the genetically altered viruses like the AIDS virus have killed many. That is the reason for current concerns.

In 1897, the German company Bayer patented aspirin. Their patent expired in 1917, just at the end of World War I. Many of the returning American soldiers brought it back to their families. It was the first time that there had been widespread use of aspirin with the flu. It is known that when a virus attaches to a cell, it cannot duplicate if there is a fever, but it will make a million copies of itself if the temperature is low. Thus lowering temperature with drugs allows viruses to multiply! It is also known that aspirin and drugs like it suppress the immune system making it easier for bacteria to grow. This makes it easier for pneumonia to occur. It is not clear how much aspirin contributed to the spread of the 1918 flu.

A current problem is that the antiviral drugs, Tamiflu® and Relenza® lower body temperature. It is not uncommon to see people get the flu and start one of these drugs. They feel better. Then a week later, they have pneumonia.

Since 2003, there have been multiple warnings that the H5N1 bird flu virus would kill millions of people. Only 257 people are known to have died from the bird flu! Over 1,000,000 people get malaria every year, but there are no dire warnings from the World Health Organization or President Obama about malaria!

Can there be other reasons that we are being frightened about a flu pandemic? The Bush administration bought $1.4 billion of Tamiflu® "to combat the bird flu". The Obama administration wants to buy enough to treat 25% of the American population. Other governments are stockpiling it as well. This is despite the fact that Tamiflu® doesn't work for the bird flu and is not likely to work for the swine flu either. "After following WHO protocols in treating 41 victims of the H5N1 bird flu virus (19% of the worldwide cases of bird flu reported to date), Nguyen Tuong Van, MD, who runs the intensive care unit of the Center for Tropical Diseases in Hanoi, Vietnam concluded that Tamiflu®, the drug most widely stockpiled around the world to combat a potential bird flu pandemic, is "useless". (Wikipedia) Thus, the American taxpayers paid billions of dollars for a drug to treat about 100 cases per year of the bird flu. Someone made a lot of money from a drug that does not work for an epidemic that never happened.

They are making even more money this year. If only we were using that 192.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

money for something useful like treating malaria!“ writes Tennant.

Scientists are opposing a plan in Japan to mass vaccinate against the “swine flu” on the grounds that the virus will re-assort itself into a hybrid H1N1/H5N1 strain or mutate into a new, more lethal H5N1 strain. The nightmare scenario is that the mutated virus may take on the characteristics of H5N1 or the avian flu http://www.rense.com/general85/a1.htmº „The AH1N1 virus has infected some 100 students in Kobe, Japan. Many of the students have no history of traveling abroad. There are plans underway to begin a mass vaccination against AH1N1. However, there are misgivings in the international research community about administering an AH1N1 vaccine.º The fear is that once a vaccination against AH1N1 is started, the virus will re-assort itself into a hybrid H1N1/H5N1 strain or mutate into a new H5N1 strain. The current AH1N1 strain, as previously reported by WMR, contains synthetically gene-spliced strains of two forms of human flu viruses, two forms of swine flu viruses, and a single form of avian flu virus.º What researchers have told us is that as long as the current AH1N1 can infect humans, it will not try to mutate. Even though there have been deaths from AH1N1, most of those infected are sick for up to four days, take Tamiflu or similar drugs, and recover with immunity from the hybrid or "novel" virus. The vaccination program will be a profit maker for such Big Pharma firms as Sanofi-Aventis, GlaxoSmithKline and Baxter International.º However, with vaccinations, the AH1N1 virus will, of course, be rejected by human hosts and cases around the world will decrease.

However, then, the virus will begin to mutate in order to successfully infect human hosts. And when that happens, the new, newly-mutated virus will become much more transmissible and more pathogenic.º The nightmare scenario is that the new, mutated virus may take on the characteristics of H5N1 or the avian flu. The vaccines administered for AH1N1 will be ineffective against the new strain of H5N1 and the world may face a more deadly pandemic then the current AH1N1 outbreak. There are scientists at WHO who are aware of this scenario but their alarm has been suppressed by political and economic considerations. „º º º º º º º º º 193.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XVIII. Precedents: the abandoned swine flu mass vaccination program of 1976º º º In 1976, a mild swine flu swept through the United States. President Gerald Ford mandated a mass vaccination programme -- which was carried out by the same vaccine companies as today -- that had to be abandoned because of the catastrophic results.

President Ford was acting on the advice of medical experts, who believed they were dealing with a virus potentially as deadly as the one that caused the 1918 Spanish influenza pandemic.

The virus surfaced in February 1976 at Fort Dix, New Jersey, where 19-year-old soldier, Pvt. David Lewis, told his drill instructor that he felt tired and weak, although not sick enough to skip a training hike. Lewis was dead with 24 hours.

The autopsy revealed that Lewis had been killed by "swine flu," an influenza virus originating in pigs. By then several other soldiers had been hospitalized with symptoms. Government doctors became alarmed when they discovered that at least 500 soldiers on the base were infected without becoming ill.

The incident recalled 1918, when infected soldiers returning from the trenches of World War I triggered a contagion that spread quickly around the world, killing at least 20 million people. The nation's health officials urged Ford to authorize a mass inoculation program aimed at reaching every man, woman and child.

Mass vaccinations started in October, but within weeks reports started coming in of people developing Guillain-Barré syndrome, a paralyzing nerve disease, right after taking the shot. Within two months, 500 people were affected, and more than 30 died. Amid a rising uproar and growing public reluctance to risk the shot, federal officials abruptly canceled the program Dec. 16.

In the end, 40 million Americans were inoculated, and there was no epidemic. A later, more technically advanced examination of the virus revealed that it was nowhere near as deadly as the 1918 influenza virus. The only recorded fatality from swine flu itself was the unfortunate Pvt. Lewis.

Healthy men, women and children went to receive the untested swine flu injection and died as a result of the injection. Others received permanent injuries.

The programme was stopped. An Australian doctor, Archie Kalokerinos, gave his account of his involvement in the 1976 swine flu pandemic: „In 1976 I was working in the far north of Australia amongst Aborigines. I observed, in one community of only a few hundred people, when they were given the flu vaccine (probably the Victorian strain but this detail does not really matter because nobody outside a few selected individuals really knows what is in any particular batch), six men died suddenly soon afterwards. They were not all 'old’. One was in his early twenties. A few weeks later, in another 194.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

community I found that individuals with heart or potential heart problems or diabetes were particularly likely to drop dead soon after being given the vaccine.º º Obviously, there was a problem with some batches of the flu vaccine.º º A few months later I was in America. President Ford had been told by his health advisers that there was going to be a huge epidemic of ‘swine flu’, that this could kill may thousands and the only way to prevent this catastrophe was to vaccinate the entire population of America – every man woman and child - with a specific vaccine.º º So the vaccine was manufactured and the biggest vaccination campaign in history was begun. I was concerned because the vaccine could not be properly tested in a short period. None of the recipients would know anything about what they were being injected with and the chances were that many would die suddenly. Furthermore, it was extremely unlikely that an epidemic of swine flu would occur. So I spoke out. At first the newspapers got hold of what I said and headlined, ‘Australian Physician Call It Mass Murder’. Then I appeared on Kathy Crosby’s television program.º º Watching that was a man in New York who did not like a gentleman named Gambino the Mafia boss. Gambino was about 70 years old and had a history of heart problems. It was a simple matter to get someone to persuade Gambino to have the flu shot and Gambino obliged by dropping dead. The newspapers got it right when they stated, ‘Mafia Flu Jab Conspiracy’.º º People were dropping dead in the buildings where they received their shots. Others became paralyzed. The whole program ground to a halt.º º President Ford decided to settle the matter quickly. In front of the whole world, on television, he rolled up his sleeve and ‘had his shot’. I claimed at the time that he was given a ‘dud’ shot and I am certain that this was actually done. Then President Ford invited all the news media men and women who were milling around to line up and have their shots. Only one man volunteered and he happened to be the White House press secretary. All the others refused the invitation.º º There was not a single case of swine flu. There never was going to be an epidemic of swine flu. How was it that the world’s most powerful man with the world's greatest department of health got it all so wrong? No one really knows the answer but what ever it is it is certainly not clean and tidy.º º Furthermore, as far as I know I was the only practicing doctor who spoke out against it and warned about almost certain consequences.

How was it that a doctor with only basic qualifications and not even the possessor of American citizenship stood out alone? There was at least one researcher, Anthony Morris, who did try to speak out but he was at the time censored and censored very hard.º º This, therefore, is a classical example of how only one man got it 195.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

right and everyone else got it wrong. This is an important consideration because, when the subject of vaccines is discussed the fact that the vast bulk of the medical establishment states that something is so it is not, in reality, necessarily so. If the establishment can get something so vast and important as the swine fiu vaccine campaign so wrong then it is logical to reason that they could also get a lot of other things wrong. At least it gives reasons to doubt what the establishment claims to be fact. If doctors and members of the general public considered this fewer errors would be made and fewer individuals would suffer unnecessarily.º http://webpages.netlink.co.nz/~ias/swine.htm“ Claims of over $1.3 billion came from victims of the vaccine that caused severe paralysis, Guillain-Barre Syndrome, and death of 25.º º º º º º º º º º º

196.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XIX Inadequate performance of the government in stopping the spread of the swine flu as cover for spreading a pandemicº º º The necessity for a mandatory vaccine or multiple mandatory vaccines could have been avoidedº by early curtailment of the virus' spread says an expert. Hong Kong virologist and SARS expert Yi Guan says the World Health Organization erred in not responding fast enough to the outbreak and thus contributed to more cases being spread rapidly. The fact that the borders were not closed and airplane flights were not halted into Mexico or departing from Mexico furthered the spread of the swine flu. (Stone, SARS Sleuth Tracks Swine Flu, Attacks WHO, 2009)º http://sciencenow.sciencemag.org/cgi/content/full/2009/504/1?etocº Americans for Legal Immigration PAC called on the Obama administration April 27 to immediately close the southern border to Mexico and restrict all inbound air and ground traffic from Mexico to emergencies and product delivery to protect American lives from the Mexican Swine Flu outbreak., but the borders were left open.º Conservative Caucus and Judicial Watch have uncovered evidence of a Canada/US/Mexico policy to leave Borders Open during Pandemics.º http://www.youtube.com/watch?v=9q9MSVYWLtAº In addition, the Department of Homeland Security would not allow Border Guards to wear protective masks to protect themselves and their families from further outbreaks.º Only intervention from Congressmen Bilbray (R-CA) and Burgess (R-TX) had Border Guards were finally allowed to wear masks.ºDenials by DHS that it hadn't prohibited mask wear by Border Guards.

The "Model State Emergency Heath Powers Act" allows the Government to seize and or quarantine a town and all the people within it.

But why does the government decide on such drastic measures when it comes to towns and cities while allowing the borders to remain open?

No one can expect the government to hold the citizens of the nation to a higher standard than it holds itself, and yet that is exactly what the current administration is doing.º When individuals take precautionary measures and their government does not - i.e. closing the borders, etc. - forced innoculations in the face of open borders and unrestricted air travel fly in the face of reason.

Quarantining towns and cities and injecting someone without consent must be viewed as a more servere response than a simple restriction of international or interstate travel.

Injection of an untested substance into one's body, without consent, is a violation of the sanctity of life upon which all of our laws are based, and in mechanics and effect, is tantamount to rape.º Were it not the government performing such a mass, forced inocculation then the perpetrator would surely face assault charges, 197.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

if not for unlawful imprisonment, abduction, and mutilation and possibly even murder or mass murder.º º º º º º º º º º º

198.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XX. Evidence as to manipulation of the legal framework to allow mass murder with impunityº º º Members of the international crime syndicate, who have annexed high ogvernment office and who are carrying out their criminal plans under color of their office, including President Obama and his predecessor President George Bush, have introduced legislation and executive orders that have stripped the civic rights of the people of the United States, specifically by criminalising their right to refuse a “swine flu” or other pandemic virus vaccine, and so paved the way for the implementation of a programme of mass murder by means of a virus and vaccine while giving themselves and their agents immunity.º Provisions in any Federal or State legislation that allow the government under any authority, including a presidential executive order, to compel the people of United States of America to take a vaccination for which there is verifiable scientific evidence for believing could be very dangerous to them, both individually and collectively, and which, also includes provisions, barring them from claiming any compensation for any injury or death while enforcing punishments so severe for refusing that it could cost people lives or result in imprisonment, are in violation of the Preamble, the Constitution and the Bill of Rights and the Laws of the land.º To accept the legal framework of the Patriot Act 1, and 2, The Model State Emergency Health Powers Act, the NATIONAL SECURITY PRESIDENTIAL DIRECTIVE/NSPD 51 and HOMELAND SECURITY PRESIDENTIAL DIRECTIVE/HSPD20 is to accept that the legal rights of the US citizen today in 2009 are no different from the prisoners of the Nazi German concentration camps when it comes to their right to refuse an unproven vaccine forced on them by agents claiming the authority of an official office that was, however, also outside the scope of the duties and offices mandated by the German Constitution.º The prisoners in the Nazi concentration camps had no right under law to refuse a vaccine or experimental drug just as the US citizens today have no right to refuse an unproven pandemic vaccine today. Any refusal to allow a vaccination by Nazi concentration camp inmates was met with severe punishment including shooting, beatings, and solitary confinement. And any refusal by US citizens today will be met by the same severe punishment including shooting and imprisonment because the government agents administrating the vaccines are authorised to use these punishments against criminals, and those who refuse the vaccination are classified as criminals.º Nazi concentration camp prisoners were barred from seeking compensation or any form of legal redress for any injuries and damages done to them by forced vaccination – if they survived, at all, and most did not. And the citizens of the United States of America are also to be barred from seeking compensation or any form of legal redress for any harm, including death, inflicted on them by the vaccinations.º The Nazi doctors who forced prisoners to take experimental substances 199.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

-- under contract often from pharmaceutical companies such as Bayer -- were condemned for their crimes by the US Military Tribunal at Nuremberg. In response to this barbarism, a new code of medical ethics was drawn up called the Nuremberg Code, which emphasises the importance of obtaining the individual consent and also adequate information before any vaccination is administered or any medical experiment performed.º The Preamble, Constitution and Bill of Rights which are the law of the land, and from which all government bodies derive their authority, make it clear that the citizens of the United States can never legally and constitutionally be stripped of all their rights in the same way that the Nazi prisoners of war were by any legislation or any Presidential executive order waiver, and they can never be forced to take an unproven vaccine under punishment of being shot or imprisoned as criminals and have their their right to compensation abolished by the government in advance without their consent.

Articles IV and VIII of the Amendments are two of the articles that give the people of the United States the legal right to refuse a vaccination or any medical experiment to be inflicted on their bodies by force.

Article IV. 'The right of the people to be secure in their persons . . . against unreasonable searches and seizures shall not be violated."

This Article makes it clear that provisions in the state and federal health emergency acts to go into houses and seize property if people refuse to accept an unproven vaccine are illegal.

Article VIII. "Excessive bail shall not be required, nor excessive fine's imposed, nor cruel and unusual punishments inflicted."

Article VIII makes it clear that “cruel and unusual punishments” cannot be inflicted on the citizens of United States, but that all punishments need to be in proportion to the offence.

The punishments envisaged for refusing a vaccine are not in proportion to the offence.

Isn’t shooting someone or imprisoning them as a criminal, as the federal government claims the right to do under its draconian emergency health powers, because they refuse to take a dangerous vaccine a cruel and unusual punishment, and therefore an extreme and flagrant violation of Article VIII? Isn’t putting someone in a “FEMA” camp for quarantine, that is to say, imprisoning them without right to a jury, just for refusing to have an unproven vaccine injected into their body without their consent an “excessive” and disproportionate punishment?

Isn’t abolishing the right of people to claim any compensation for any injury or damage inflicted on them by vaccination with an unproven substance a “cruel and unusual punishment?”

Again, it is clear from the Constitution that the government is prohibited from inflicting excessive and unreasonable punishments possible under criminal law and also military law for an action that is a right of every citizen of the United States of America, namely 200.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

the right to refuse to allow an unknown, potentially lethal substance, to be injected into their body, and any “immunity” that the government confers upon itself as it commits these acts is an illegal and unconstitutional “immunity”.º It is legally unconstitutional for the government to treat its citizens, free men, women and children and members of a free state, with rights and dignities that cannot be invaded, as "slaves," and “prisoners” to be subjected to military despotism or arbitrary medical dictates and compelled to take a vaccination on pain of death without recourse to the courts of law or compensation if they are injured as a result of this compulsory vaccination giving them the same legal status as the prisoners of the Nazi concentration camp, that is to say, no legal status and no legal rights.º The Nazi concentration camp doctor could force any vaccine into the helpless prisoner without being required to ask for the prisoner’s permission, but the Constitution of the United States prohibits doctors, nurses or other personal from injecting into citizens an untested substance by force and without full approval and consent of the patient.º The US Military Tribunal condemned the Nazi doctors at the Doctor’s Trial at Nuremberg of 1946 - 1947. http://www.law.umkc.edu/faculty/projects/ftrials/nuremberg/NurembergD octorTrial.htmlº In the Nazi concentration camps, prisoners were forced to allow camp personnel perform any operation they wished on their bodies, often barbaric operations, barbaric experiments with drugs and untested substances that resulted in the death in agony of those prisoners, often over a period of days or weeks.

But the United States citizen cannot be treated in the same way as a prisoner in a Nazi concentration camp and subjected to the same compulsory vaccinations by medical or military personnel because of the "unalienable" "retained" and "reserved" rights possessed by the People under the Preamble, Constitution and Bill of Rights, Laws and Statues of the land.

In Nazi Germany, doctors who refused to go along with the dictates of the totalitarian bureaucratic Nazi state were punished and had their licenses. But doctors who are citizens of the United States cannot legally and constitutionally be forced to go along with dangerous medical experiments on the entire population by threats of having their licence removed.

The rights of all citizens cannot be legally invaded or denied by any Government, and so it follows, that mandatory vaccination is always and without exception illegal, unconstitutional, and should be absolutely banned by any court in the US whose judges are themselves not guilty of abusing their office by upholding illegal laws.

Not only the Nazi German doctors, but also the Nazi German judges themselves were put on trial at Nuremberg for allowing German citizens in spite of the Constitution of the German Republic, which assigned solid civic rights to all citizens, to be systematically stripped of those rights.

201.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.law.umkc.edu/faculty/projects/ftrials/nuremberg/alstoetter .htmº That judges stretch the Constitution and laws to the point where they allow any crime and who have been involved in crimes against humanity perpetrated by “government agencies” and the medical establishment are not immune from prosecution is shown by the judgements of the Nuremberg Trial of 1947.º Flowing from the judgements against Nazi German functionaries involved in forced vaccinations handed down at the Nuremberg War Crime Trials, it follows that personnel belonging to government bodies, courts and private companies that force the US people to undergo mass vaccination with an unproven substance under threat of being punished as criminals if they do not, and even shot under provisions of criminal law, should be made, both collectively and individually, liable not just for paying damages for those harmed by the vaccine as was the case in 1976 when substantial damages were paid out to victims of the government-mandated swine flu vaccine programme, but also for charges of conspiracy to mass murder.º To sanction the narrowing down of the choice of a citizen of the United States, endowed with an extremely wide horizon in which to exercise their free will thanks to the provisions of the Preamble, Constitution and Bill of Rights, to only two options, namely the alternative of taking a dangerous, possibly lethal vaccine, or of being shot or imprisoned as a criminal, is, in effect, to sanction the murder of that individual. For if a person cannot choose except between death by a dangerous vaccine or death by a bullet, then the life of that person is being directly threatened by an outside agent and there is way out for them except death. That person cannot resist a dangerous vaccine by law and they cannot resist it by force.º If a government can so violate the basic freedoms of citizens of the United States as to force them to take an untested vaccine for a “swine flu” or other pandemic, then it can force them to do anything, such as, for example, not to drive a car, an activity which has been proven to be far more dangerous to people’s health than the swine flu, which has killed relatively few people so far in the USA.º On this logic, a government can force a mandatory reading program on its citizens on the grounds that this is good for the well being of the individual and the country, and shot or imprison anyone who does not participate without any right to compensation.º The right of the citizens of the United States to refuse a vaccination flows from the second article of the Declaration state that "all men" are endowed by their Creator with "certain" "unalienable rights" among which are "life" "liberty" and the "pursuit of happiness."

To force the people of America to take a dangerous vaccine which has a high possibility of causing death and injury and so robbing them of their “life”, “liberty” and “pursuit of happiness” is to violate their unalienable right to life, safety, liberty and happiness of the individual.

The right to "life" of course is stated first among all the rights 202.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

granted by the Constitution to a citizen of the United States of America because without life is the prerequisite of all other activities; and the right to "liberty" is stated second, because without reasonable scope to exercise our freedom to pursue our ideas of happiness in our own way, without infringing on the liberty or happiness of others, we enjoy a merely nominal notion of liberty that is useless and meaningless.

The right to freedom from dangerous vaccines and other biological agents is directly covered by the “right to life”, and is, therefore, an “unalienable right” of every American citizen today as yesterday that no government can invade.

The government’s mandatory “swine flu” vaccine programme is, therefore, not only illegal and unconstitutional, but it is also contrary to accepted norms of medical ethics, which reinforce the right of a patient to decide what operation is or is not to be performed on his own body and blood, including what vaccination to accept.

The President has no legal or constitutional right to issue decrees, executive orders or waivers that grant him or any other body, national or international, such as the United Nations or WHO, the right to abolish, limit or infringe on the civic rights of the citizens of the United States of America anchored in the Constitutional Charters of the United States.

The Constitution and Bill of Rights judge any President who acts in this way, to be acting illegally, for he is acting in opposition to the very body of laws from which he derives his own authority.

Presidential authority has no authority whatsoever when it authorises flagrant violation of the Constitution from which that president derives authority in the first place.

As the Preamble, Constitution and Bill of Rights makes clear, the people of United States of America are endowed originally and inherently with all necessary or unalienable rights for life, liberty and happiness, and their government exists simply or chiefly for the purpose of protecting and enforcing these rights. The government cannot grant or deny its citizens rights, which exist inalienably in the people themselves.

No President, no government has the authority to deny the citizens of the United States any of their constitutional rights.

Articles IX and X state: "The enumeration in the constitution of certain rights, shall not be construed to deny or disparage others retained by the people.

"The powers not delegated to the United States by the Constitution, nor prohibited by it to the States, are reserved to the States respectively, or to the people."

These Articles underline that the people of the United States are acknowledged to have specific "certain" "unalienable" "reserved" and "retained" rights, and that these rights are divinely conferred and naturally inherent and, therefore, cannot be restricted, limited or infringed upon by any government, in any way, but must be respected, 203.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

protected and enforced by all governments, and that governments exist for the chief purpose of defending and enforcing these rights.

The most basic, essential and obvious right is the right of American people to choose what happens to their own bodies and which treatments or vaccinations to accept and under what conditions, that is to say, the right to “life.”

Because the people of the United States of America have the right to decide what vaccination is injected into their bodies as part of their “right to life” and “liberty”, they can never be legally forced to accept an injection of an unproven substance under threat of a drastic punishment such as being shot as a criminal suspect, and without any recourse to compensation or any right to legal redress.

It follows from the above that any government personnel, police, military, doctors or nurses who are participating in such a forced mass vaccination programme are acting illegally and unconstitutionally and without exception, in every single case, with every single vaccination, violating the most fundamental and inalienable rights of the people of the United States.

The Declaration of Independence states that the right of the American people to “life” is “unalienable”, creating a rock-like legal basis for the right to refuse any vaccination.

"We hold these truths to be self-evident, that all men are created equal, that they are endowed by their Creator with certain unalienable Rights, that among these are Life, Liberty and the pursuit of Happiness. That to secure these rights, Governments are instituted among Men, deriving their just powers from the consent of the governed,—That whenever any Form of Government becomes destructive of these ends, it is the Right of the People to alter or to abolish it."

The rights of Americans are expanded on under THE FIVE ARTICLES OF THE DECLARATION OF RIGHTS, JULY 4, 1776.º First: All men are created equal.º Second: All men are endowed by their Creator with certain unalienable rights, among which are life, liberty, and the pursuit of happiness.º Third: Governments are instituted among men to secure these unalienable rights.º Fourth : Governments derive their just powers from the consent of the governed.º Fifth : Whenever any form of government becomes destructive of these ends, it is the right of the people to alter or to abolish it.

The Declaration states that there are "Natural" and "Divine" rights that human beings are endowed with, and that these exist before any human laws, charters or constitutions were ever written. These rights antedate, and therefore takes precedence over State and National laws and Constitutions, which, to be valid, must be based on the fundamental principles of inherent human and natural rights which are naturally and divinely and equally conferred upon all human kind.

The official title of this document is "The Unanimous Declaration of the Thirteen United States of America," which shows that it is the official statement or code of the foundation governing principles of 204.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

the New Nation issued by its first Congress and has, therefore, the full effect of a "Constitution," "Pre-Constitution" or "Bill of Rights."

It follows that no government, no president, in spite of any self proclaimed “state emergency” – a “state of emergency” was also the pretext that the Nazis and Nazi Judges used to destroy the German Constitutionº -- or any war on terrorism or disease can ever introduce regulations or laws that override these basic rights to life for they are anchored in foundation of the country itself, in the Constitution and its democratic code.

The implementation of emergency health powers and martial law will mean will mean the destruction of the Constitution and is therefore always, without exception illegal and unconstitutional.

The courts of the United States have handed down clear judgements against forced vaccinations. In 2004, U.S. District Court Judge Emmet G. Sullivanº issued a temporary injunction, saying the Pentagon’s compulsory vaccination of military personnel against anthrax was illegal.

Until proven otherwise by the Food and Drug Administration, U.S. District Court Judge Emmet G. Sullivan in his 34-page decision agreed with the contention of unidentified active duty National Guard and civilian defense employees that Anthrax Vaccine Absorbed was an unlicensed, investigative drug and being used for an unapproved purpose.º So concerned was Congress about the impact of vaccines that it passed a law amid fears that the use of such drugs may have led to unexplained illnesses among veterans of the 1991 Persian Gulf War, which have come to be known as Gulf War Syndrome.

The judgements against vaccinations go back for decades. In 1894 Judge Bartlett, of the New York Supreme Court, in the case of Walters, decided that: "To vaccinate a person against his will, without legal authority so to do, would be an assault."

So, to force someone to take a vaccine against their will is itself an assault or a criminal offence under this interpretation. If the person who is forced to take the vaccine then dies, it flows that not an assault but a murder has been committed. And when a murder has been committed, the US Justice system requires the perpetrators to be brought to justice even if they are government officials or government personnel.

Judge Gaynor also of the New York Supreme Court and also in the same year, 1894, in the case of Smith against Health Commissioner Emery of Brooklyn issued a ruling later confirmed by the New York Court of Appeals: "If the Commissioner [of Health] had the power to imprison an individual for refusing to submit to vaccination, I see no reason why he should not also imprison one for refusing to swallow a dose. But the Legislature has conferred no such power upon him, if, indeed, it has the power to do the like. ... If the Legislature desired to make 205.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

vaccination compulsory it would have so enacted. Whether it be within its power to do so, and if so, by what means it may enforce such an enactment, are not for discussion here."º º º º

206.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XVIII. Constitutional issues: the legality v. Illegality of jeopardising the Life, health and “public good” by mass vaccinationsº º º Flowing from the Preamble, Constitution and Bill of Rights, the purpose of the implementation of any Federal or State government swine flu or any other mass vaccination or medical programme has to be to promote and safeguard the Life, Liberty and Pursuit of Happiness including property and health of people of the United States of America.º There is, therefore, an absolute requirement for any vaccination’s beneficial effects for the people of the United States of America as a whole, not just individually but also collectively, to be proven according to generally accepted scientific principles be based on thorough tests and trials and documented in scientific literature and other sources of information.º The US government is legally and constitutionally obliged to be dedicated to the fulfilment of the duty to implement only those public health or vaccination programmes using appropriate policy and regulatory frameworks that are proven to be in the best interests of the health of the people of United States of America by the THE FIVE ARTICLES OF THE DECLARATION OF RIGHTS, JULY 4, 1776.º The Charters of the United State Constitution say that the government derives its power from the People and must exercise its authority only for measures that contribute to the Life, Liberty and Pursuit of Happiness the people, and cannot grant itself “immunity” by a special decree that exempts it from the duties for whose specific purpose it was founded in the first place.ºº Furthermore, the Preamble to the Constitution binds the government to ensure any activity or programme, including a vaccine programme, yields fruitful results in terms of Life, Liberty and Pursuit of Happiness for the People and with minimal risks and burdens, with the words, “We the People of the United States, in Order to form a more perfect Union, establish Justice, insure domestic Tranquillity, provide for the common defence, promote the general Welfare, and secure the Blessings of Liberty to ourselves and our Posterity, do ordain and establish this Constitution for the United States of America.“º “The Preamble to the United States Constitution is a brief introductory statement of the fundamental purposes and guiding principles which the Constitution is meant to serve. It expresses in general terms the intentions of its authors, is sometimes referred to by courts as reliable evidence of what the Founding Fathers thought the Constitution meant and what they hoped it would achieve,” http://en.wikipedia.org/wiki/Preamble_to_the_United_States_Constituti on The Preamble makes it clear what the ultimate and overriding purpose or goals -- the telos using a term of Aristoteles -- of the application and interpretation of Constitution, the Rules and Statues and also the Government are, namely, “to establish Justice, insure 207.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

domestic Tranquility, provide for the common defence,[1] promote the general Welfare, and secure the Blessings of Liberty to ourselves and our Posterity, do ordain and establish this Constitution for the United States of America.“ºº While the Preamble is not the Law of the Land, it has a binding character of a Law in as far as it sets aºclear direction, goal or objective to which activities of the constituent legal and governmental bodies, including the public health bodies of the United States when implementing vaccine programmes, must align themselves in order to have any legitimate authority whatsoever in the first place.

All the articles and amendments, laws and statutes must be read in conjunction with the constitution’s Preamble, which sets forth a normative structure in which the „general welfare“, „justice“, „liberty“ and domestic democracy have an inseparable relationship for „Posterity“. The Preamble’s normative meaning is given tangible form by the provisions in the Constitution and the Bill of Rights.

The Preamble, Constitution and Law or Code or Statues are inextricably and logically connected. The Preamble is the authority for the Constitution. For anything to have Force and Effect it must have authority.º Rules are similar to Regulations, which is how the Law or Code or Statutes are interpreted and enforced.º The Code is the Authority for the Rules.º The Constitution is the Authority for the Code.º The Preamble is the Authority for the Constitution. That means that the Preamble is the ultimate authority for the Constitution, the Code, the Rules or Statutes.º The Preamble can never, not in for Posterity, under any circumstances be detached from the Constitution and the government and its agencies cannot ever be detached from the Constitution and Preamble. This is because the causality between the Preamble, Constitution and Rules involves a logical and not a contingent necessity.º The philosopher David Hume in his A Treatise of Human Nature (1739– 1740) showed that the only necessity that links cause and effect is the logical necessity of a demonstrative argument. By contrast, when a sequence of events is observed in the physical world that is considered causal -- for example, an apple falling down from a tree onto the ground -- these are only impressions of the apple, its motion and its collision, but there is no logical necessity by which the cause brings about the effect. There might be an occasion when the apple does not fall downwards but upwards. We have observed apples falling to the ground every single time but there is no logical necessity for them to fall to the ground every single time.º There is, however, a logical necessity that two plus two always equals four and that logical necessity resides in the ideas of two and two and in the idea of addition of numbers.º Two plus two can never logically equal three.º Hume established that there effects in terms of powers, only causal necessity was a concepts of mathematics and

was no argument for linking causes and active forces, and so on but that the logical one such as found inherent in the language.º

Because the Preamble, Constitution and Bill of Rights are artefacts 208.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

of language and the words have logical relationships between each other that involve the idea of a necessary connection, the causal links between them cannot logically be broken apart.º The Preamble, Constitution and Bill of Rights have the same logical relationship between them as two plus two plus two equals six.º A whole can be divided into various parts just as an apple pie can be divided into slices. The Preamble, Constitution and Bill of Rights form one whole but can also be divided into parts for the sake of ease of use by persons seeking to apply the law to specific and concrete circumstances. Nevertheless, the meaning of any law is not contained in one isolated word or paragraphs but in conjunction with the other parts and the overriding intention expressed in the Preamble, the Constitution and the Bill of Rights, is the ultimate framework or vector for interpreting all the other laws.º Those goals that are in conflict with the goals laid down in the Preamble are, therefore, a priori logically and necessarily without any legal force inºUS law and government.ºº That laws when detached from a Constitution and normative justice can be administered in a way that is unjust is shown by the developments in Nazi Germany when legal manoeuvres were carried out to obstruct and destroy the basic purpose and provisions of the German Constitution, manoeuvres including the privatisation or corporatisation of German government functions, putting them into a „legal void“, referencing not the Constitution or normative justice, but the “performance targets” of their „corporate owners.“º That it was illegal and unconstitutional for the Nazis to use the manoeuvre of corporatising government functions and replacing laws with regulations is underlined by the judgements of the US Military Tribunal at Nuremberg.º Under the Federal Register Act of 1935, an attempt was made to detach the operation of government agencies from the goals laid out in the Preamble, Constitution and Code, binding by virtue of the logical necessity inherent in the ideas expressed in these Charters on all government activities, by assigning to those government functions the status of private corporations, and in a way that the constitutional mandates and goals of the Preamble did not attach to them.º º As a result, corporations under private law were created that appeared to be able to operated outside the Preamble and Constitution and Bill of Rights on a technicality.º In this way, members of the international crime syndicate, who have annexed high ogvernment office, were able to carry out their criminal plans under color of their office more easily.º The people working for the agencies were given the status of private sector employees and were no longer public officers with an Office bound to the Preamble and Constitution.º They were employed under contracts of corporate law that made no reference to the Preamble and Constitution, from which they derived their entire authority from in the first place.º They were given the status of simple mercenaries with some of them 209.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

armed and some of them unarmed, who worked for money and were required to perform certain duties laid down by their employers by and through "cooperative agreements", "performance of services contracts", "grants", "memorandums of understanding", "incentive programs" and on and on which are controlled by the Federal government.º However, the privatisation or corporatisation of the functions of government, including public health functions, is not logically and legally the same as the privatisation or corporatisation of the ideas and Charters underlying a government and its functions. The Preamble and Constitution remain the ultimate authority over these agencies because they are the original and sole cause or authority of all government activities, including the activities of privatised public health government agencies.º The limits of privatizing government functions and detaching them from the Constitution and allowing them to operate as “corporations” with employees accountable to no one except to their employer in a “law free” zone are shown by the Nuremberg Trials.º German government functions that were “privatised” or handed out to newly created corporate-like bodies charged with performing specific functions, for example, the Gestapo, charged with internal surveillance, and the “SS Totenkopf Verbände”, or death squads, charged with administrating the Nazi concentration camps, were still held accountable after the war for the “fruits” or “results” of their work.º A mere declaration by the “employees” of the SS and Gestapo that they were following orders from their “employer”, and working with utmost efficiency to reach performance targets, such as killing so and so many prisoners a day in the camps, was regarded as insufficient by the US Military Tribunal to absolve them of their responsibility before the law of their crimes.º The Nuremberg Trial judgements show that no government can privatise an essential government function in way that detaches from the activities of an agency from normative justice, the law or principles of a Constitution Republic.º Moving a government function into an entirelyº “law-free”º “corporate” economic zone where the only dictates that apply are those of efficiency, targets and performance and contracts without an reference to the ultimate “fruits” of those “efficient” activities is prohibited by law.º Murder is murder whether it is done efficiently by privatised government agencies or not. Torture is torture whether it is done efficiently by privatised government agencies or not.º Infringements on liberty are infringements whether they are done efficiently by corporations or not.º The regulations that these “corporations” produced to carry out their mass murder and surveillance were deemed illegal.º Regulations are not the same as the law. That is the judgement of Nuremberg. Corporate regulations do not confer authority and 210.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

legitimacy. Only the Constitution and the Law confer authority and legitimacy.º Presidential or Leader waivers and executive orders that gave an air of legitimacy to a criminal system were deemed illegal at the Nuremberg Trials if they were not in alignement with normative justice and the Constitution.º This, then, is the judgement of the Nuremberg Trials. No act of “privatisation” on the authority of the government can abolish normative justice and the essential mandate of the Constitution from which all government bodies derive their legitimacy. Privatised government agencies must, therefore, also act within the terms of the Preamble and Constitution no matter and corporate contracts cannot abolish this relationship.º Corporate contracts can only regulate the activities of the people working inside the corporation but not the legal relationship between the corporation and normative justice and the Constitution.º For the President by use of decrees or the government to create government bodies that are in total opposition to a Constitutional Republic where all people a right to Life, Liberty and Pursuit of Happiness including property is, therefore, illegal and unconstitutional.º Officials are always directly accountable back and though their Office to the Constitution, to the People by virtue of the obligations and legal relationships that flow from the Preamble, Constitution and Bill of Rights that subordinate all other activities to these.º Federal Law and Regulations prohibit the use of investigational new drugs, including unproven vaccines, without informed consent of recipients 51. 10 U.S.C. § 1107 (2000) provides that investigational new drugs or drugs unapproved for their intended uses may not be given to members of the Armed Forces without their prior consent except in the case of a waiver by the President of the United States.

However, Presidential decrees are not mandated by the US Preamble, Constitution and Bill of Rights with its democratic code.º Executive orders issued by Adolf Hitler, the de facto President of Nazi Germany (who won democratic elections in 1933) of German citizen’s constitutional rights was not considered adequate justification for violating those rights and the rules of normative justice by the US Military Tribunal at the Nuremberg Trials.º Therefore, the various government agencies created by the Federal Act of 1935 also have to be subordinated to th central overriding purpose and goals of the Preamble and Constitution, namely Life, Liberty and Pursuit of Happiness, irrespective of any corporate contracts.º Essential government functions, including public health functions and mass vaccination programmes, cannot be detached by an act of "privatisation" or “corporatisation” from the Preamble, Constitution and Law of the land and from the goals they mandate.º They cannot never legally and constitutionally be detached from or given a life independent of the Preamble and Constitution and Law 211.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

because this is the ultimate source of their authority in the first place.º The public agencies in United States of America cannot be turned into an apparatus for killing Americans by means of deliberately or accidentally contaminated and/or shoddily manufactured vaccinations under any law for the enrichment of pharmaceutical companies, the banks that own those companies or by any foreign powers that gain undue influence over the US government.º The abolition of the relationship between the Preamble and Constitution and the activities of the government agencies under the Federal Act of 1935 is a legal fiction.º Any judge who attempts to interpret laws in a way that is not alignment with the overwhelming intention of the Preamble, Constitution and the Bill of Rights, namely, to protect the Liberty, Life, Happiness, including health and property of the people of America, and to hold the government agencies, including the public health agencies, accountable for doing the same, has failed to understand the objective, logical necessity inherent in these documents.ºº As mentioned, there is a precedent for making judges accountable for failing to uphold the objective necessity of normative justice of the Preamble and Constitution and for allowing a tyrannical government to hollow out the rights of citizens.º That precedent is in the Nazi German Judges Trial conducted by US Military Tribunals at Nuremberg in 1947 when German judges and lawyers were held to account for their wilful, sophistic and perverse interpretation of the German Constitution, which, like the US constitution, assigned civil rights to individuals and limited the power of the government, thereby allowing the Nazi government to carry out the de facto abolition of all those civic rights and government limits with a veneer of legality.º The goals laid out in the Preamble are not law, but theyºstill have the absolute and binding character of a law, and that binding character extends to all courts and to all government functions, privatised or not.º The Preamble requires that the Constitution and laws and goals of courts and government agencies are always and without exception interpreted in such a way as to contribute to the goals laid down in the Preamble, including the continuation of the Constitution in perpetuity, so eliminating sophistry, which can be used to justify the opposite of the logical necessity inherent in the law by playing with words and semantics or taking elements of the law out of their context.º The US Constitution also mandated a tripartite government, a separation of powers, and these various powers cannot be combined altogether into the Administrative State, i.e. fourth branch, by an act of legislation, which detaches the Administrative States from the Preamble and Constitution by virtue of logical necessity.º The courts in the Administrative State cannot force out the Constitutional Courts and replace them with the other "jurisdictions" 212.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

such as Administrative, Equity, Maritime and so on.º They are the custard on the apple pie of the Preamble, Constitution and Statutes, to use a metaphor. The custard goes on top of the apple pie. It is not served instead of the apple pie. If you go to a diner and ask for apple pie and get only custard, the diner owners would be judged in breach of duty.º The existence of the various branches of Administrative law, such as Equity and Maritime law, cannot be used as an excuse to serve the American people custard when they have asked for, and, more importantly, when they have the legal and constitutional right to, apple pie.º The courts and government agencies derive their authority solely from the contribution they make towards creating a balanced, just and equitable society, that is to say solely from the Preamble and Constitution and Statues, and their adherence to the normative justice and end-goals or telos formalised in these documents.º Administrative courts were also at work in Germany during the totalitarian Nazi rule after the German Constitutional Courts were neutralised by the Dictator Adolf Hitler and his Nazi judges.

However, the mere functioning of the Administrative State churning out masses of regulations to create a totalitarian bureaucracy that disguised the total lawlessness during the entire existence of the Nazi rule was not enough for Nazi Germany to be spared the judgement of being a criminal state by the US Military Tribunal at Nuremberg.º º “For the good of the State”, the Nazi legal precept, was not considered to be the same as “For the good of the People.”º That the State itself can be found to be criminal is underlined by the judgement of the Nuremberg Trials. Government bodies that subordinate their functions to a state found to be acting criminal are also to be classified as part of that criminal enterprise.º The People and precepts of normative justice that serve the People must always remain primary under the Constitution, according to the judgement of the Nuremberg Trial.º A judge who in a wilful interpretation of the laws fights the interests of the pharmaceutical industry or the banking industry in some corner of Administrative law at the expense of the Constitution, the Preamble and the People, from which that judge alone derives any legitimate authority, for whatever reason a judge might be so inclined, is also a priori exercising his office illegally and unconstitutionally.º Even assuming the primacy of Administrative law over the Preamble and Constitution, a mass “swine flu” or other pandemic flu vaccination programme would still be illegal.ºº To reframe the argument for a mass swine flu vaccination in terms of equity law, for example, a mass flu vaccine programme must leave the American people in credit when it comes to their health, happiness and life in spite of the government asking them for a debit in terms of requiring them to take a vaccination and so accept a jab and a 213.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

disease into their bloodstream.ºº By contrast, a vaccine programme that leaves the majority of people of America overwhelming in deep debt, suffering a loss of health, life and property or in detention, and in a manner that prohibits them from seeking a legal or financial redress in the form of compensation, that is, suffering a damage that is irreparable, is illegal, and the profit of a tiny group from this is illegal.º It follows therefore not only from the Preamble, the Constitution and Bill of Rights but also from the application of the principles of Equity law that no mass vaccination programme should be conducted where there is an a priori reason to believe that death or injury will occur on a scale that far outweighs any benefits.º As part of their legal and binding obligation under the Preamble to ensure the health, justice and life of the people of America, the US government is prohibited from taking a reckless gamble with the very lives, health whose maintenance is the sole purpose and object of the Constitution by forcing on the People a random, unnecessary and unknown drug.º In the judgement of Jacobson v. Commonwealth of Massachusetts, 197 U.S. 11 (1905), the plaintiff was forced to take a small pox vaccination because, it was argued, such a vaccine helped to protect the whole community. A citizen has obligations to the state in which that citizen is embedded. Nevertheless, the protection of the whole was considered to be the legal justification for forcing an individual to take the vaccine.

The Supreme Court examined the issue of whether involuntary vaccination violated Jacobson's "'inherent right of every freeman to care for his own body and health in such way as seems to him best . . . " The Court bifurcated this question, first considering the right of the state to invade Jacobson's person by forcing him to submit to vaccination: This court has more than once recognized it as a fundamental principle that "persons and property are subjected to all kinds of restraints and burdens, in order to secure the general comfort, health, and prosperity of the State; of the perfect right of the legislature to do which no question ever was, or upon acknowledged general principles ever can be made, so far as natural persons are concerned."' (at 26) With this language, the Court stated the basic bargain of civilization: an individual must give up some personal freedom in exchange for the benefits of being in a civilized society. Jacobson sought to enjoy the benefit of his neighbors being vaccinated for smallpox without personally accepting the risks inherent in vaccination. The Court rejected Jacobson's claim, which it viewed as an attempt to be a free-rider on society. „ However, scientific advances have shown that vaccination itself can actually increase the virulence of a virus and so increase the danger to the community.º In view of all the evidence of adverse events from vaccinations recorded upon a mass of people with a range of genetics, no court can 214.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

nowadays argue that it is for the "public good" that people are vaccination. The idea that there is a "herd immunity" has been proven to be without any substance. Scientific advancement has shown that "herd immunity” is not only outdated but actually false.º It was the act of mass vaccinations in 1918 that actually caused the deadly Spanish flu pandemic, according to experts. [reference]º Therefore, the judgement of 1905 on vaccines based on outdated science cannot be the judgement of 2009. The courts must adjust to the new body of scientific evidence available and on the basis of this information, they are legally and constitutionally bound to make judgements to promote the health and well being of the American people.º º º º º º º º º º º

215.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XXI. The Issue of immunity and compensation as evidence of intent to commit a crimeº º º The US government has passed legislation giving them immunity in the event of vaccinations causing death or injury, specifically by barring people from seeking compensation.º Compensating patients who are harmed as a consequence of participation in a vaccination programme is a well established principle of US law.º The US federal government currently has a programme that gives compensation to victims of government mandated vaccinations.º Victims of the 1976 government-mandated swine flu mass vaccination programme won more than a billion dollars in damages for the injuries they suffered as a result of vaccines.º Compensation is a mechanism by which the vaccine companies have an incentive to act in the interests of the people, and not manufacture products that cut costs and are dangerous.º And yet this compensation is to be waived now under The Model State Emergency Health Powers Act, the National Emergency Act, NATIONAL SECURITY PRESIDENTIAL DIRECTIVE/NSPD 51 and HOMELAND SECURITY PRESIDENTIAL DIRECTIVE/HSPD-20.º So, just at the time when Americans are being asked to take upon themselves the greatest risk of a pandemic vaccine not proven, or rather proven to have killed people in Poland, they will not be able to claim no compensation.º For the US government to force the people of America to sign away their right to compensation, individually and collectively, for a vaccine that is classified as a bioweapon by that same government, and which they are being compelled to take at pain of death or imprisonment while not adequately regulating the vaccine manufacturers in spite of lapse after lapse is illegal and unconstitutional.º For the government of the USA is not mandated by the Preamble, Constitution and Bill of Rights to seek the Life, Liberty and Happiness of pharmaceutical companies and the banks that hold shares in vaccine companies by supplying them with a huge market of unwilling subjects to inject whatever substances they chose into those people.º The government of the USA only has legitimate authority in as far as it serves the People of the United States and their Life, Liberty and the Pursuit of Happiness.º Such a blanket enforced waiver is illegal and unconstitituional: only the invidivual can waive their own right to compensation and only after being adequately informed and giving their consent.º The principle that the patient must always consent of their free will to a vaccination was established at the Nuremberg Trials when Nazi 216.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

German doctors were held to account for injecting unknown substancesº into Nazi concentration camp inmates.

Just as Navy personnel are being forced to take vaccinations for human clinical trials for Vical, the concentration camp inmates of Nazi Germany were given substances for testing by companies like Bayer.

Members of the international crime syndicate, who have annexed high ogvernment office and who are carrying out their criminal plans under color of their office, now want to abolish the right of the entire nation not only to refuse but also to claim any compensation if they are injured.º What will happen when people are given a vaccine similar in lethality to the one in Poland, but cannot claim any compensation?º When the US government forces the people of America to take an uknown vaccine for which they are a priori banned from asking for compensation for death or injury, the government has moved beyond equity or administrative law and into criminal law with the government acting criminally.º When an American is forced at gunpoint under criminal law to take a vaccination but are barred from any form of legal or financial redress if they are injured or killed, then they have the same rights as the Nazi concentration camp inmates, who were also forced to allow unknown substances to be injected into their bloodstream at gunpoint and who were also barred from seeking any from of redress whether in the form of financial compensation or before the law courts because the Nazi government de facto waived their right to do so.º Furthermore, if the government absolishes the requirement to pay compensation to those injured or killed as a result of a swine flu vaccination, then the government is telling the vaccine companies it has a carte blanche to do what it wants. It doesn’t matter who dies or is injured as a result of shoddy vaccines. The companies will never be held to account.º The burden of risk or debt has to while the credit or profts in the share prices and better dividends companies and the banks that hold

be born entirely by the people form of revenue from sales, higher acrrue solely to the pharmaceutical stock.º

By waiving the right of the people of America to claim any compensation and offering blanekt immunity, companies have a financial incentive to sell as many vaccines as possible as expensively as possible while producing them as cheaply as possible by cutting quality control standards to maximise their companies.º Baxter, another key vaccine supplier, is currently facing lawsuits for adultering Helperin with cheaper ingredients to maximise profits resulting in death and injury.º If this is the way, Baxter is behaving when it can still be sued for killing and injuring people by putting in cheap and unapproved ingredients, how will it behave when it cannot be sued for damaging vaccines?º Are the people of America going to be forced to accept into their 217.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

blood an unproven, untested, toxic drug that cost about the minimum to produce irrespective of the danger?º The principle of compensation is there to ensure equity in a transaction over the long term. A buyer buys a product from a seller.

If the product proves to be wilfully and negligently faulty, the buyer can claim compensation. An American takes a vaccine from a manufacturer. If the vaccine proves to be wilfully and negligent faulty and to lead to death and injury, the person can claim compensationº The mechanism gives an incentive to companies to produce products of reasonable quality. What incentive to vaccine companies to ensure quality controls when they are given a blanket immunity from any damages they cause no matter how faulty their work?º Today, when people can claim compensation, companies are still producing shoddy products. What will the companies do when people can’t claim compensation? What right did the government have to waive the compensation of the American people?º The Preamble, Constitution and Bill of Rights prohibitts the government from forcing the people of America to take a shoddily made vaccine under gun point signing away their right to compensation collectively in advance.º If it is the intention of the government is to produce vaccines to the highest standards then the government should embarace the compensation mechanisms. Because damages is a mechanism to enforce high standards on companies and so act as a counterweight to the pure profit motive.º If the government has blocked damages, just how confident can they be of the safety and the quality of the vaccines?º The people of America are expected to bear all the risks or buy up all the debt, but have been told in advance that they will never be able to recover their losses. And whatever they do, their losses will be huge. If they take the vaccine from companies that have admitted to the deliberate contamination of their drugs, who have a record of causing death and injury and nearly triggering pandemics, they could lose their health, liberty and life and property will be confiscated from them.º If they do not take the vaccine, they will lose their liberty and possibly life and their property will be useless to them.º To confiscate property for refusing to take an unproven vaccine at gun point is actually theft and robbery.º If I refuse a vacine that will harm me and as a result my assets are taken by force by another, I am being held to gun point and robbed.º The US government cannot legally and constitutionally expect the citizens of the US to bear the entire risk and loss of the mass vaccination programme themselves while failing to hold the FDA to account for lapse after lapse.º These lapses go beyond negligence. They show a pattern of activity, a pattern of activity by key government bodies to protect the vaccine 218.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

companies at all costs.º Since the government has granted immunity to vaccine companies, every indidivual knows that no one will take care of them medically when the vaccine injurs them. Since the risk of injury and the emotional and financial burden of subsequent recovery is borne exclusively by the individual alone, the individual exclusively has the right to decide whether to obtain said innoculation and bear the risk, or to avoid the risks of an untested vaccine and to take normal precautionary measures. º º º º º º º º º

219.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XXII. Evidence as to the use of chemtrails for population reductionº º º Evidence as to the use of chemtrails for population reduction “The chemtrail conspiracy theory holds that some contrails are actually chemicals or biological agents deliberately sprayed at high altitudes for a purpose undisclosed to the general public,” according to Wikipedia.

However, contrails are visible in the skies throughout the USA and Europe and the Germany has admitted carrying out chemtrail operations.

German RTL television reported on the German air forces involvement in chemtrials. http://www.youtube.com/watch?v=BVjKg1JOjVY Chemtrials have been related to the U.S. Patent #: 5,003,186, titled `Stratospheric Welsbach Seeding for Reduction of Global Warming,"º and there is evidence they contain chemicals and biological agents that cause injury and harm to people and are part of the "biological war" being waged against the world's population by the elite.

Investigative reporter Jeff Ferrell writes about the chemtrials. (http://www.godlikeproductions.com/forum1/message470752/pg1) A scientist now confirms that the United States military funded research which led to a patent suspected of making so-called "chemtrails" in our skies. In this follow-up report, investigative reporter Jeff Ferrell also discovered a U.S. Air Force manual called "Owning the Weather in 2025," which describes the very same approach.

Ferrell's original report aired on KSLA News 12, the CBS-TV affiliate in Shreveport, Louisiana where he works as a reporter and anchor. The story attracted attention from hundreds of people across the country and Canada. They watched it on YouTube, Google Video and a host of other web sites that posted the story. In turn, those viewers began emailing and calling the station.

While Ferrell immediately began investigating for a follow-up report, the station's interest in the subject waned. So, here's what he found out in his independent research: ************* "I learned about U.S. Patent #: 5,003,186, titled `Stratospheric Welsbach Seeding for Reduction of Global Warming," better known by chemtrail researchers as "The Welsbach Patent."

The patent describes putting metallic particles like aluminum and barium into jet fuel. Then, exhaust from the jet engine seeds the stratosphere. In turn, those small metallic particles serve a dual purpose by: 1) reflecting incoming light back into space and 2.) helping convert the warmth below into infra-red waves, allowing them to escape from the earth's atmosphere.

220.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

"It turned out that it seemed to work and so that's why we had applied for a patent," said patent co-inventor David Chang. Chang confirmed that the U.S. military did fund that research while he worked at Hughes Aircraft, an aerospace giant at the time. It would later downsize considerably and evolve into Direct-TV, which required some of the very same kinds of research and development.

In fact, Chang described several other military-funded projects where jet engine exhaust dispersed metallic particles into the atmosphere.

"For instance, we were using it to develop targets for laser range finders," continued Chang.

I then learned about that U.S. Air Force document titled, "Owning the Weather in 2025." it details weather modification for war-fighting and describes putting carbon dust into jet fuel for dispersal as the quote, 'most convenient, safe and cost effective method," just as the Welsbach Patent explained. That method is described on page 15 of the Air Force report, originally written in 1996 as a study paper.

In September of 2002, then-Secretary of State Colin Powell even told a United Nations World Summit in South Africa quote, "we are committed to a billion-dollar program to develop and deploy advanced technologies to mitigate greenhouse-gas emissions." Powell never fully elaborated.

And few may remember that the U.S. military used covert weather modification in the past. During the Vietnam War a top secret mission called "Operation Popeye," seeded clouds over the Ho Chi Minh Trail to create floods and wash out the enemy's supply routes.

Reporter Jack Anderson is credited with breaking that story back in 1971.

A Discovery Channel program, which first aired in February 2007, investigated so-called Chemtrails, describing them as contrail formations that persist in the skies for hours after a jet passes.

But the military refused them access to jet fuel for testing.

"I suspect it may be some sort of weather control," said Stamps, Arkansas resident Bill Nichols in our first report on the subject, which aired on KSLA News 12. Nichols handed us a mason jar with a sample inside containing water and `other' material collected recently from his back yard. Independent testing at a Shreveport, LA lab did show high levels of barium, a hallmark of other chemtrail testing. Louisiana regulators described such a reading as unusual, but very difficult to prove its source.

Chemtrail skeptics argue barium is used very often commercially for everything from mining to oil drilling. But Chang told me that's 'exactly' why they considered such material safe to use in our skies as a welsbach particle.

But, no one has yet to officially confirm a direct connection between these alleged chemtrails and the U.S. military. Such a discovery is the 'Holy Grail' of chemtrail researchers. Such a revelation, if there is indeed such a covert program inexistence at all, would require someone to step forward and potentially risk court martial or legal action. Until then, the guessing and the waiting continue.Âş 221.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Story by Jeff Ferrell“º For more evidence of chemtrials, this report on www.rumormillnews from Canada.º Heads Up--Boost Your Immune System Now--What's Happening in Canada!?!! What To Do!!!

Posted By: CrystalRiver <Send E-Mail>º Date: Tuesday, 9-Jun-2009 09:17:05 In Response To: ARE THESE THE 'NEW' CHEMTRAILS OR MAYBE COUNTER MEASURE AGAINST THEM - INCREDIBLE VIDEO (Sandollar) Dear RM Agents and Readers, Just received these this morning; thought you should know: Hey All, Just want to report from Vancouver Canada. There is a very strange mix in the chemtrails today. In all my 10+ years of daily keeping track on all levels I have never felt this one before.

When I left the house this morning I noticed that instead of the usual milky white (chem) sky--there was a mist that went from cloud level to the ground---just a mist ---although it was hot and morning mist should have long been gone.

I have a long bus ride to the university where i study--so I usually do my reading on the way up on the bus---but today I found I couldn't focus my eyes (physically) It was very strange--I strained and I strained but could hardly get any reading done.º In class I found it difficult to stay awake---though it was only a two hour class.

Finally I get home thinking--well maybe I'm just overtired--but happened to glance in the mirror in the bathroom---and holy moly---my pupils were totally dilated---haven't seen that since the sixties...no wonder I couldn't focus....

Anyway---a new chemtrail mix in this neck of the woods as far as I can tell....

Peace and Loveº B -------------------------------------------------------º B, Not certain, but that sounds like sodium hexa-fluoride and possibly a 222.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

bromonated material.

The Mists are what was described in UK as habingers of everyone getting flu like symptoms...I'm certain the mists are the delivery sperandi for the Flu...Avian or Swine or the one other I heard about which contains a genitically utated form of e bola...years ago I saw the patents that describes a weaponized form of this monster...has a high fungal profile with e bola strains mutated in it.

Better get some form of Shikimic acid, Star Anise or Licorice Root and chew on them and eat with boiled eggs...that is a good source of Sulfur..same combo as Tami flu..but you just eat them...suck on the star anise and then chew and swallow...will not hurt you.

Lignite coal solutions such as Willard's water XXX can be used to neutralize sodium hexa fluoride...you can get off the Internet at Willards Water or CAW (Catalyst Altered water) Have also seen the patents where the US Air Farce uses Melanin powder in these sprays...you inhale and makes you super sleepy and tired.

Now, making people really sick, can't see...think you might die...then the Martial Law exercise in July makes a lot more sense...they will offer emergency vaccines...just as we always thought they would.....this is the front line in battling these damned Serpents!

Mike Castle º º Dilated pupils indicate sympathomimetic amines -- possibly cholinergic, serotonergic or dopaminergic. These three are the most common pharmaceutical classes which cause dilated pupils (mydriasis).º For example , an agent to ruin memory (anticholinergic) can have this effect.º I would bet on cholinergic in the chemtrails -- the military has been experimenting with these since the 50s.º They would be great for disrupting social memory.º The key to determining which class is to note other side effects (sweating, dry mouth, etc) and you can tell which class the pharmaceutical agent belongs.º º Sympathomimetic amines: Symptoms based on receptor systemº º 1) Serotonergic:º any of the following:º altered visual perception, visual fragmentation, synthesisia (crossing of senses), lack of emotion and/or unprovoked intense emotion, inability to coherently integrate emotions, altered perception of time and space, altered perception of self , 'self-in-world', or 'self-through-time', altered function of empathy, muscular tension, teeth grinding, altered visual processing and visual system integration, nausea, fragmentation of 'time-sense' coherency.º Examples include:º LSD, Prozac, Paxil, 223.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Zoloft, MDMA, Celexa, Remeron.º º 2) Dopaminergic: any of the following: increased heart rate, feelings of power or invincibility, increased pulse / blood pressure, confidence, altered perception of time, suppressed appetite, altered function of memory processing or integration, insomnia, suppression of slow wave sleep, induction of serum cortisol, altered immune system function, suppression of adaptive immune system, induction of neutrophil activity, possible dehydration.º Examples include: Amphetamine, Bupropion, Methylphenidate, Modafinil, Ephedrine, Epinephrine, etc.º º 3) Cholinergic: any of the following:º lack of sweating and/or profuse sweating,º lack of salivation or profuse salivation,º confusion, memory loss, muscle weakness, muscle tremor, profoundly real visual hallucinations, fragmentation of 'time-sense' coherency, disorientation, externally obvious psychosis, etc.º The biggest give away is profoundly increased or decreased salivation. Examples include: Chlorpheniramine, Brompheniramine, Diphenhydramine, Atropine, BZP, etc and of course nerve agents.º º º Most 'first-gen' military weapons (1950s) involvedº #3 but I am sure they have some complex mixes these days.ºº The vast majority of the spraying contains a military non-carbon based nanotech synthetic epigenetic parasite with synthetic erythrocytes -- but no doubt the luciferian NATO military are throwing drug aerosols in there too to make sure the sheeple stay brain-dead.º º http://en.wikipedia.org/wiki/3-quinuclidinyl_benzilateºº º º º º º º º º º º

224.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XXIII. Evidence as to the existence of an international corporate crime syndicateº º º President John F. Kennedy spoke about the existence of this syndicate in a speech given to the US press association on April 27, 1961.º º “For we are opposed around the world by a monolithic and ruthless conspiracy that relies primarily on covert means for expanding its sphere of influence--on infiltration instead of invasion, on subversion instead of elections, on intimidation instead of free choice, on guerrillas by night instead of armies by day. It is a system which has conscripted vast human and material resources into the building of a tightly knit, highly efficient machine that combines military, diplomatic, intelligence, economic, scientific and political operations. Its preparations are concealed, not published.

Its mistakes are buried, not headlined. Its dissenters are silenced, not praised. No expenditure is questioned, no rumor is printed, no secret is revealed. It conducts the Cold War, in short, with a wartime discipline no democracy would ever hope or wish to match.”º The „monolithic and ruthless conspiracy“ is behind the plans to cause genocide using an artificial virus after collapsing the financial system.º To the international organised corporate crime syndicate, which I contend, assassinated John F Kennedy when he began to oppose them, specifically, by returning the Federal Reserve to the People of America, belong the leaders of the oil and gas industry who have suppressed renewable energy technologies.º The Global Elite plan a New World Order with an enslaved “police state” culture. How might this be done? One way is the Patriot Act. Another could be the 800 FEMA detention camps fully constructed, staffed, and awaiting prisoners.º º There are reasons to believe that this foreign-based international corporate criminal organisation, commonly referred to in popular language as the „Illuminati“, which operates through various informal and formal organisations such as the „Bilderbergs“, the United Nations and the World Health Organisation, is conducting a secret biological war against the population of the United States, and the world, and has set up in covert and funded an elaborate dual purpiose bioweapons programme, involving vaccine companies and international government agencies such as the WHO to engineer and then release a pandemic virus to cause death and disease at least three times this year, first in Austria, second in Mexico, third in Switzerland for political and financial gain.º The creation of a pandemic will result in the implementation of a government mandated mass compulsory vaccination programs in the United States, and could lead to the death not only of hundreds of millions of Americans but billions of people around the world leaving a large proportion of the world’s natural resources and other assets 225.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

in the hands of the „Illuminati.“º I allege that this is part of a long term plan by the syndicate, who have built large numbers of FEMA concentration camps with incinerators and prepared mass graves in states such as Indiana and in New York to quarantine people and dispose of the bodies of the people who are killed by the bioweapons attack.º º º º º º º º º

226.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XXIV. Evidence as to the existence of the “Illuminati”º º º There is evidence that the „Illuminati“ are the inner core of the international crime syndicate planning genocide by means of an artificial virus. Memembers of the Illuminati include the Queen Beatrix of The Netherlands, David de Rothschild, Henry Kissinger, David Rockefeller. The Illuminati is a secret organization to overthrow the rule of all soveriegn nations and gain domination over the world’s poltiical and economic systems.º The Illuminati leadership is in the hands of a few families or groups, who like the mafia, pass the „Knowledge“ on from generation to generation, protecting their activities by a code of silence or Omerta towards outsiders as well as by the use of occult symbols.º The Illuminati operate through secret socieities such as the freemasons as well as through organisations such as the Bilderbergs, Trilateral Commission and Council of Foreign Relations.º The world’s first truly global crime syndidcate, they base themselves in off shore banking centers and employ international organisations such as the UN and WHO.º The Illuminati’s interactions with politics are dominated by expediency. Their aim is to use their money to get their candidates elected to implement legislation to achieve as total a control over the country’s economy as possible in order to maximise the private profits flowing to the Illuminati banks whether through „bailouts“ or through wars generating debts for which they can earn interest.º The Illuminati is distinguished by a strong anti human ideology, a conviction they belong to a superior „Bloodline“ and fascination for the Occult and rituals. The Illuminati believe there will be massive changes in the earth’s geomagentic sphere in 2012 and are anxious to surive what they perceive as a time of upheaval by decimating the world’s population rapidly, so leaving them more of the earth’s natural resources to use.º Because the Illuminati fund and control the western mainstream media, their existence is air-brushed out of the news as are any information that would give the general public an insight into their criminal activities, including the manipulation of financial stocks and oil prices as wel as their plans to commit genocide using artificially engineered viruses and vaccines containing toxins.º However, sometimes a glimpse of the Illuminati and their plans can be found in the mainstream media.º For example, the UK Telegraph ran a 'fictional' „slideshow“ story about a series of nuclear attacks and the formation of a foreigncontrolled, totalitarian government, called the UNA, after the dismantlement of the United States complete with scenes of vaccinations and chip implants called Black Jack this winter, which was replete with Illuminati Occult symbols.º http://www.telegraph.co.uk/culture/culturepicturegalleries/4220575/Bl 227.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

ackjack.htmlº There were five parts that were presented in the Culture secion without comment on consecutive weeks.º http://www.telegraph.co.uk/culture/culturepicturegalleries/4315740/Bl ackjack---Part-2.-A-slideshow-story.htmlº http://www.telegraph.co.uk/culture/4515126/Blackjack---Part-3.htmlº http://www.telegraph.co.uk/culture/4590866/Blackjack---Part-4.html http://www.telegraph.co.uk/culture/4613223/Blackjack---Part-5.htmlº º º The slide show story Blackjack was discussed in the media, also at www.infowars.com.º http://www.infowars.com/operation-blackjack-the-story-of-terroristnuclear-attacks-on-major-western-cities/

“Operation Blackjack: The Story of Terrorist Nuclear Attacks on Major Western Cities Cryptogonº January 13, 2009 This little curiosity comes to us from the Telegraph’s Culture Picture Galleries section.

As of now, there’s an entry called: Operation Blackjack: The Story of Terrorist Nuclear Attacks on Major Western Cities.

On the page, we read: Blackjack - A slide show story. The events portrayed in this slide show are entirely fictitious.

There is no author listed.

I didn’t spend too much time gazing at the chicken entrails, but there were a few howlers that were too good to pass up:

228.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Remember the Kingstar (controlled demolition company) van near the exploded bus on the 7/7 London bomings? That’s what came to mind for me.

Also, the ‘fictitious’ attack occurs during the Summer solstice.

What’s the name on the side of the van? New Dawn Presentations. And its logo? That’s right, the Sun.”º The sun Logo on the van is notably similar to that for the “Black Sun” (notorious Nazi occultic symbol), as it is depicted in the following Black Sun-themed page, for example…º http://www.myspace.com/blacksunrisingpylon And the “New Dawn…” company name on the van of course has the Luciferian/Venus-theme, coupled with Obama/Inauguration reference, ‘all over it’.

The name “Blackjack” here presumably derives from the game, which is also known as Twenty-one (the featured date).

There is a green snake on the van in Toronto.

The numerical dates featured in the story - 21st & 22nd - are the same as those mentioned by Colin Powell for the soon coming “Event” in the present month (January).

Symbolism: June 22nd. 22 from June 22nd. is a double 11. The time is 8:03:27, 8+0+3 from 8:03 is 11, and from the seconds 27, you have 2+7=9, so you have an 11:9, or a 9-11. Also if you take the 22 from June 22nd, you have a double 11, and you get a third 11 from 8:03 (8+3=11). So you have 3 11s, and in numerology, when you take a number 3 times over, you give it the highest power of that number.º Also in Part 5 The symbols and dates and numbers, codes used are intestersting. Date on the Press Representative ID card is 09-11-11.

The Operation to take over the USA by means of false flag operations is called Teardrop and the teardrop is a stylised visual element used in ancient Egyptian art to depict the peregrine falcon. º º º º º º º º º º º º

229.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XXV. Evidence of the Illuminati’s involvement in the current collapse of the world’s financial system.º º º There is evidence that the international corporate crime syndicate, which controls the western world’s banking system, deliberately crashed the economy to achieve certain objectives, including a new world government with the World Health Organisation as a new world health agency.º Former New York Governor Elliot Spitzer has only spoken of accounting fraud and the bailout as a pretext to transfer money from the taxpayers to banks controlled by the Illuminati.

“Spitzer had some pointed criticism for the way the Obama administration has been handling the bank bailouts. When Spitzer was attorney general of New York, he prosecuted AIG and other Wall Street banks, and Maddow asked him if he saw a connection between those prosecutions and what led to the current crisis.

Spitzer said "Absolutely," and while the specific instruments and mechanisms, derivatives and credit default swaps, may have changed, the "fundamental accounting fraud... the desperate desire to cook the books," is present in the current collapse.

Spitzer worries that despite the government spending trillions of dollars to bail these companies out, "not nearly enough is changing."

Essentially, we are not doing enough to combat the systemic problem of companies that are too big to fail: We are rebuilding the same edifice. We are re-establishing the primacy of the same companies. We are still building in a too-big-tofail structure so that so that we as taxpayers will be guarantors of companies that when they get into trouble again, we will bail them out. None of this is being confronted by the administration as they, and we through our tax dollars, resuscitate a broken system.

Spitzer also highlighted that one of the reasons for the massive scale of the current financial crisis is that our economy has been so over-leveraged and that what had to happen in order to right our economy was to de-leverage. However, Spitzer argues, we haven't deleveraged at all; we've simply transferred the obligation from the banks to the taxpayers, and the taxpayers have gotten a raw deal in the process. http://www.huffingtonpost.com/2009/05/12/rachel-maddow-eliotspitz_n_202725.htmlº Professor William Black has also touched on the theme.

“Associate Professor of Economics and Law at the University of Missouri-Kansas City School of Law. He was the Executive Director of the Institute for Fraud Prevention from 2005-2007. He previously taught at the LBJ School of Public Affairs at the University of Texas, and at Santa Clara University. He was litigation director for the Federal Home Loan Bank Board, deputy director of the FSLIC, SVP and the General Counsel of the Federal Home Loan Bank of San 230.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Francisco.[2]”º “On April 3, 2009 Black appeared on "Bill Moyers Journal" on PBS and provided some disturbing commentary on the current banking crisis.[3] In the interview with Bill Moyers,[4] Black asserted that our current banking crisis is essentially a big Ponzi scheme, that the "liar loans" and other financial tricks were essentially illegal frauds, and that the triple-A ratings given to these loans was part of a criminal cover up. He said that the "Prompt Corrective Action Law" passed after the Savings and Loan crisis mandated that ailing banks should be put into receivership. Black also stated that trying to hide how bad the situation is will simply prolong the problem, as happened in Japan's lost decade. Black stated that Timothy Geithner is engaged in a cover-up, and that the administration does not want people to understand what went wrong or how bad the banking situation is today.” http://en.wikipedia.org/wiki/William_K._Black The New York Times reported Yra Harris, a commodoties trader, alleging the Wall Street Banks see transparency about their operations as inimical to their profits. This is surely a pretty good definition of „crime.“ºº http://www.nytimes.com/2009/06/01/business/01lobby.html “The banks want to go back to business as usual — and then some. And they have a lot of audacity now that everyone has bailed them out,” said Yra Harris, an independent commodities trader who was involved in an effort to regulate derivatives nine years ago. “But we have to begin with the premise that Wall Street doesn’t want transparency, because more transparency means less immediate profits.” º º º º º º º º

231.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XXVI. Evidence as to the depopulation agenda of the Illuminati/Bilderbergs and their involvement in the engineering and release of the artificial “swine flu” virus º º On Dec. 10, 1974, the U.S. National Security Council under Henry Kissinger, an adviros to President Obama,º completed a classified 200-page study, “National Security Study Memorandum 200: Implications of Worldwide Population Growth for U.S. Security and Overseas Interests“ arguing that that population growth in the so-called Lesser Developed Countries (LDCs) was a grave threat to U.S. national security.º Adopted as official policy in 1975 by President Gerald Ford, NSSM 200 outlined a covert plan to reduce population growth in those countries through birth control, and also, implicitly, war and famine. Brent Scowcroft, who had by then replaced Kissinger as national security adviser (the same post Scowcroft was to hold in the Bush administration), was put in charge of implementing the plan. CIA Director George Bush was ordered to assist Scowcroft, as were the secretaries of state, treasury, defense, and agricultur. http://www.schillerinstitute.org/food_for_peace/kiss_nssm_jb_1995.htm lº In a study published in 1996, the he US Air Force proposed a pandemic in 2009º http://www.infowars.com/us-air-force-study-proposed-2009-influenzapandemic-in-1996/.º These are just some of the documents and materials available pointing to a depopulation agenda, but also of note are the State of New York Division of Cemeteries “Mass Fatality forms” sentº to cemeteries in that state to collect data about their ability to deal with the high volume of casualties that would occur if their were a flu pandemic or other disaster. The form letter that this office received was dated April 4, 2007, as reported in Infowars with a link to the pdf of the forms.º http://www.infowars.com/plans-for-mass-graves-confirmed-governmentsurveying-cemetery-readiness-for-flu-outbreak/º The biggest threat to the planet is PEOPLE: there are simply too many, doing too well economically and burning too much oil.”º -- Sir James Lovelock, BBC Interview.

“My three main goals would be to 1. reduce human 100 million worldwide, 2. destroy the industrial 3. have wilderness, with it’s full complement of throughout the world.” --- Dave Foreman, Club of and co-founder of Earth First!

population to about infrastructure and species, returning Rome, Bilderberger,

“A total population of 250-300 million people, a 95% decline from present levels, would be ideal.” ---Ted Turner, founder of CNN and major UN donor.

“------the resultant ideal sustainable population is hence more than 232.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

500 million but less than one billion.”º ------- Club of Rome publication titled “Goals for Mankind.”

“If I were re-incarnated I would wish to be returned to earth as a perfected killer virus to lower human population levels!”º --- Prince Philip, Duke of Edinburgh “I suspect that eradicating smallpox was wrong.º It played an important part in balancing ecosystems.”º --- John Davis, editor of Earth First! Journal “The extinction of the human species may not only be INEVITABLE, but a GOOD THING.” ---- Christopher Manes, Earth First!

“As in China, the act of childbearing should be a punishable crime against society, unless the parents hold a government license.º All potential parents should be required to use contraceptive chemicals, the government issuing antidotes to citizens chosen for childbearing.”º --- David Brower, first Executive Director of the Sierra Club.º The international crime corporate syndicate, including bankers such as David de Rotschild and George Soris, have provided the funds for the bioweapons programme by instructing their funds or banks to invest in pharmacuetical stock and by instructing their agents in government to channel public finance to covert biooweapons, vaccines programmes through a the complex web of financial instruments, also offshore.º º º º º º º º º

233.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XXVII. Evidence as to the Genocide Agenda by means of Weaponised Flu being discussed at the annual Bilderberg meeting in Athens from May 14-17, 2009ºººº º º Kevin Trudeau has recently said that he has personally spoken to Bilderberg members who have expressed their desire to see “two thirds of the dumb people” wiped off the planet, and suggested in an interview on the Alex Jones show that some of these conversations occurred in or aroundº the annual Bilderberg Group, which took place this year in Vouliagmeni, close to Athens, Greece, from 14-17th of May.ºº http://www.infowars.com/billionaire-elite-want-two-thirds-of-thedumb-people-wiped-off-the-planet/ºº The Greek Newspaper To Vima OnLine (http://www.tovima.gr/default.asp? pid=2&artid=268290&ct=32&dt=16/05/2009) and an official press release (http://info.kopp-verlag.de/fileadmin/user_upload/allgemein/200905/Bilderberger_PM.pdf) includes among the attendees David Rockefeller, Lawrence Summers, Paul Wolfowitz as well as Daniel Vasella, head of Novartis, the company that carried out the bird flu trials in summer 2008, resulting in the deaths of homeless people in Poland, and Werner Faymann the Chancellor of Austria, where Baxter’s subsidiary responsible for sending out 72 kilos of bird flu virus, originating from WHO, is located.ºº Another list indicating who did or did not turn up for the meeting by means of the use of a +/- symbol is available on the Swiss website Alles Schall und Rauch (http://allesschallundrauch.blogspot.com/2009/05/liste-der-teilnehmer-bilderberg2009.html).ºº The surname of the Austrian Chancellor is misspelled as Feymann in this list. The attendance of Werner Faymann is however, further, confirmed by a parliamentary question tabled by Austrian MP Martin Strutz (http://www.bzoeklub.at/Pressedienste/Mai_2009/17.05.2009_Strutz.html) to be addressed to the Faymann, requesting information about Faymann’s attendance at the Bilderberg meetings,º which were originally financed by the CIA, maintains Strutz.ºº The list of attendees given on Alles Schall und Rauch is as follows:ºº “Beatrix - Königin der Niederlandeº Sofia - Königin von Spanienº Konstantin - ehemaliger König von Griechenlandº Philipp - Prinz von Belgien, Mitglied des Club of Romeº Joseph Ackerman - Vorstandsvorsitzende der Deutschen Bankº Kieth Alexander - Direktor der US National Security Agency (NSA), grösster Geheimdienst der Weltº Georgios Alogoskoufis - ehemaliger Wirtschafts- und Finanzminister Griechenlandº Roger Altman - Vizefinanzminister unter Präsident Clintonº Efstratios-Georgios A. Arapoglou - Zentralbankchef Griechenlandº 234.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Ali Babacan - Aussenminister Türkei, Koordinator für die Beitrittsverhandlungen der Türkei mit der EUº Dora Bakoyannis - Aussenminister Griechenlandº +Jon Frederik Baksaas - Chef von Telenor Norwegenº Francisco Pinto Balsemão - Portugisischer Ministerpräsidentº Nicolas Baverez - Herausgeber Le Point Frankreichº Franco Bernabè - Chef von Telecom Italia, stellvertretender Vorsitzender von Rothschild Europeº -Xavier Bertrand - Generalsekretär der UMP Partei Frankreichº Nils Daniel Carl Bildt - Aussenminister Schwedenº Jan Arne Björklund - Bildungsminister, Parteivorsitzenden der Folkpartiet liberalerna Schwedenº Christoph Blocher - ehemaliger Bundesrat und ehemaliger Parteichef der SVPº Alexandre Bompard - Journalist Radio Europe 1 Frankreichº +Vendeline von Bredow - Wirtschaftsjournalist The Economistº +Oscar Bronner - Herausgeber Der Standard Österreichº +Max Boot - Autor, Berater, Historiker, Ober-Neocon und CFR Mitgliedº -Ana Botín - Tochter des Präsidenten der Banco de Santander Emilio Botínº +Henri de Castries - Chef der AXAº Juan Luis Cebrián - Chef er PRISA Group of Media Spanienº -W. Edmund Clark - Chef Toronto-Dominion Bank Kanadaº -Kenneth Harry Clarke - ex-Finanzminister Grossbritannienº Luc Coene - Chef der belgischen Nationalbankº +Timothy C. Collins - Chef von Ripplewood Holdingsº George David - Präsident CocaCola Griechenlandº Sir Richard Billing Dearlove - ex-Chef des britischen Geheimdienstes MI6º Anna Diamantopoulou - Parlamentsmitglied der PASOK Griechenlandº Mario Draghi - Chef der italienischen Zentralbankº +Nicolas N. Eberstadt - American Enterprise Instituteº Anders Eldrup - Chef und Präsident von DONG Energy Dänemarkº John Jacob Philip Elkann - Vizepräsident des Fiat-Konzernsº Thomas Enders - Chef Airbusº José Manuel Entrecanales - Chef des Baukonzerns Acciona Spanienº +Werner Feymann - Bundesparteivorsitzender der SPÖ österreichischer Bundeskanzlerº -Isidro Fainé Casas - Präsident der Caixa Bank und SEAT Beraterº Niall Ferguson - Professor für Wirtschaft an der Havard Business Schoolº -Timothy Franz Geithner - Finanzminister der USAº Dermot Gleeson - Berater der irischen Regierung und Geschäftsmannº Donald E. Graham - Chef der Washinton Postº -Alfred Gusenbauer - ex-Bundeskanzler Österreichº Victor Halberstadt - Professor für Wirtschaftswissenschaften Uni Leidenº Ernst Hirsch Ballin - Justizminister der Niederlandeº Richard Holbrooke - Sonderbeauftragter für Pakistan und Afghanistan für Obamaº +Jan H.M. Hommen - Vorsitzender ING Bankº Jaap de Hoop Scheffer - NATO-Generalsekretärº James Logan Jones Jr. - Sicherheitsberater von Präsident Obamaº Vernon Eulion Jordan - ehemaliger Sicherheitsberater von Präsident 235.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Clintonº -Robert Kagan - US-Regierungsberater für Sicherheitspolitik, Terrorismus und den Balkanº Jyrki Katainen - Finanzminister Finnlandº -Henry Alfred Kissinger - ex-US-Sicherheitsberater und USAussenminister, Chef von allesº +John M. Keane - SCP Partner, ex-US-Generalº +Muhtar Kent - Präsident der Coca Cola Companyº +John Kerr - Mitglied des House of Lords, Vizevorsitzender Royal Dutch Shellº +Eckart von Klaeden - MdB, Aussenpolitischer Sprecher der CDU/CSUº +Klaus Kleinfed - Präsident von Alcoa Inc.º Mustafa Koç - Vorsitzender der Koç Holding der grösste türkische Mischkonzernº Roland Koch - hessischer Ministerpräsidentº Sami Kohen - aussenpolitische Kolumnist der türkischen Zeitung Milliyetº Henry Kravis - Hudson Instituteº Marie-Josee Kravis - Hudson Instituteº Neelie Kroes - EU-Kommissar für Wettbewerbº Odysseas Kyriakopoulos - Präsident des Verbandes Griechischer Industrienº +Christine Lagarde - Ministerin für Wirtschaft, Industrie und Arbeit Frankreichº +Pascal Lamy - Generaldirektor Welthandelsorgansation WTOº Manuela Ferreira Leite - Chefin der portugiesischen Sozialdemokraten PSDº Bernardino León - spanische Staatssekretär für auswärtige Angelegenheitenº +Peter Löscher - Chef Siemens AGº +Peter Mandelson - Wirtschaftsminister GBº -Jessica Tuchman Mathews - Präsidentin der Carnegie Endowment for International Peace Denkfabrikº Philippe Maystadt - Präsident der Europäischen Investitionsbank (EIB)º +Edward McBride - Wirtschaftsredaktor The Economistº Frank McKenna - Vizevorsitzender der TD Bank Financial Groupº John Micklethwait - Wirtschaftsredakteur The Economistº Thierry Montbrial - President des l'Institut français des relations internationalesº Mario Monti - Präsident der Wirtschaftsuniversität Luigi Bocconiº Miguel Ángel Moratinos - Aussenminister Spanienº Craig Mundie - Chefstratege Microsoftº Egil Myklebust - ex-Vorsitzender der SAS, Norsk Hydro ASA, Mitglied des Weltwirtschaftsrat für Nachhaltige Entwicklungº Matthias Nass - Stellvertretender Herausgeber "Die Zeit"º +Juan Maria Nin Génova - Präsident la Caixa Bankº Denis Olivennes - Direktor Nouvel Observateur Frankreichº +Jorma Ollila - Vorsitzender Royal Dutch Shellº +George Osboren - Schatzkanzler GBº Frederic Oudea - Chef Societe General Bank Frankreichº -Cem Özdemir - Bundesvorsitzender der Partei Bündnis 90/Die Grünenº Tommaso Padoa-Schioppa - ex-Finanzminister Italienº +Alexis Papahelas - Journalist Kathimeriniº 236.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Dimitris Papalexopoulos - Chef Titan Cement Company S.A. Griechenlandº Jannos Papathanasiou - Wirtschafts- und Finanzminister Griechenlandº Richard Perle - Sicherheitsberater unter George W. Bush, Hauptverantwortliche für den Irakkriegº -David Petraeus - US-Viersternegeneral, Kommandeur des US Central Command, zuständig für den Nahen Osten und Zentralasienº Manuel Pinho - Minister für Wirtschaft und Inovation Portugalº +Jean Pisani-Ferry - Direktor von Bruegelº Robert S. Prichard - Chef der Zeitung Toronto Star Kanadaº Romano Prodi - ex-Ministerpräsident Italien, ex-Präsident der Europäischen Kommissionº +Hanna Rajalahti - Chefredakteur Talouselämäº -Olli Rehn - EU-Erweiterungskommissar Finnlandº Heather Reisman - Chefin Indigo Books & Music Inc Kanadaº Eivind Reiten - Generaldirektor des Petroleumskonzerns Norsk Hydroº Michael Ringier - Verwaltungsratspräsident der Ringier Holding AG, grösster Verlag der Schweizº David Rockefeller - Banker, Gründer der Council on Foreign Relations und Trilateralen Kommission, Capo di tutti Capiº -Dennis B. Ross - Direktor des Washington Institute for Near East Policy Denkfabrikº Barnett R. Rubin - Director of Studies and Senior Fellow Center of International Cooperationº -Alberto Ruiz-Gallardòn - Bürgermeister von Madridº Suzan Sabancı Dinçer - Chefin der Akbank Türkeiº Indira Samarasekera - Präsidentin der University of Albertaº Rudolf Scholten - Mitglied des Vorstandes Österreichische Kontrollbank AGº -Jürgen Schrempp - ex-Vorstandsvorsitzender der DaimlerChrysler AGº +Josette Sheeran - Diektor UNO Welternährungsprogrammº +Domenico Siniscalco - Vizevorsitzender Morgan Stanley Int.º Pedro Solbes Mira - ex-Wirtschafts- und Finanzminister Spanienº -Sampatzi Saraz - türkischer Bankerº -Sanata Seketa - Kanadaº +James B. Steinberg - US-Vizeaussenministerº +Björn Stigson - Präsident des Weltwirtschaftrats für Nachhaltige Entwicklung (WBCSD)º +Yannis Stournaras - Direktor bei der Foundation for Economic & Industrial Research (IOBE)º -Dominique Strauss-Kahn - Chef des Internationalen Währungsfondsº -Lawrence Summers - ex-Chefökonom der Weltbank, ex-Finanzminister unter Clinton, Wirtschaftsberater von Obamaº Peter Denis Sutherland - ex-EU-Wettbewerbskommissar, Vorsitzender von BP and Goldman Sachs Internationalº +Nobuo Tanaka - Direktor Organisation für wirtschaftliche Zusammenarbeit und Entwicklungº Martin Taylor - ex-Chef der Barclays Bank, Vorsitzender von Syngenta, ex-Generalsekretär der Bilderberg Groupº Peter Thiel - ex-Chef PayPal, Clarium Capital Managementº +Helle Thorning-Schmidt - Parteichef der Sozialdemokraten Dänemarkº +Thomas Thune Andersen - Chef Maersk Oil Dänemarkº +Andreas Treichl - Chef Erste Group Bank AG Österreichº Jean-Claude Trichet - Chef der Europäischen Zentralbankº 237.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

+Loukas Tsoukalis - Sonderberater von Kommissionspräsident Barroso, Chef der ELIAMEPº Agah Ugur - Chef Borusan Holding Türkeiº Matti Vanhanen - Premieminister Finnlandº Daniel Vasella - Chef von Novartisº Jeroen van der Veer - Chef Royal Dutch Shellº -Guy Verhofstadt - ehemaliger Premierminister Belgienº Paul Volcker - ehemaliger Fed Chef, Wirtschaftsberater von Barack Obamaº Jacob Wallenberg - Bankier und Grossindustrieller Schwedenº Marcus Wallenberg - Bankier und Grossindustrieller Schwedenº Nout Wellink - Chef der niederländischen Zentralbank, Mitglied der Europäischen Zentralbankº Gerardus Johannes Wijers - Chef von AkzoNobel, ex-Wirtschaftsminister der Niederlandeº Martin Wolf - Journalist der Financial Timesº James David Wolfensohn - ehemaliger Präsident der Weltbankº Paul Wolfowitz - ex-Präsident der Weltbank, Berater von George W. Bush, und stellvertretender ex-Verteidigungsminister der USA, OberNeocon und Hauptverantwortlicher für den Irakkriegº -Fareed Zakaria - Chefredakteur von Newsweek International und politischer Kommentator bei ABC News, New York Times, Wall Street Journal, New Yorker und CNNº Robert Zoellick - Präsident der Weltbank“ºº In an interview on the Alex Jones show, Trudeau acknowledged he had been in Greece around the time of the annual Bilderberg meeting in Athens and implied that he attended the Bilderberg Group meeting, stating that he personally knew many Bilderberg members who he “conversed with on a regular basis”, including Crown Prince Albert II of Monaco.ºº Trudeau expands on the conviction of the Bilderberg, a group associated with the Illuminati, that they are genetically superior to the rest of humanity.ºº Bilderberg attendees go on record playing down the content of the meetings, portraying them as a series of dry policy discussions.

However, their refusal to divulge the contents of their meetings is consistent with the contention that this is a group meeting in secret to plot financial and biological crimes against humanity.ºº According to Trudeau the elite, comprising the Illuminati and Bilderberg, openly talk about their desire for a massive global population reduction, something indirectly confirmed by elite insiders like Johnathan Porrit, UK government “green” advisor, calling for the population of the UK to be reduced in the Times to 30 million on March 22, 2009 in the interval between the release of the bird flu pandemic material in Austria and the swine flu pandemic material in Mexico.ºº (http://www.timesonline.co.uk/tol/news/politics/article5950442.ece):º º A week later on March 31st, an interview with Dr Nina Federoff, advisor to President Obama, appeared in the BBC, in which Dr Federoff stated there were too many people on the planet:ºº 238.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

„We need to continue to decrease the growth rate of the global population; the planet can't support many more people," Dr Fedoroff said, stressing the need for humans to become much better at managing "wild lands", and in particular water supplies.“ http://news.bbc.co.uk/2/hi/science/nature/7974995.stm ºº “Some of the conversations you have on the 200 foot yachts off the coast of Monaco - you can’t believe what really goes on behind closed doors,” said Trudeau, noting that Alex Jones had exposed such issues in his documentary films, notably Endgame. The billionaire said that he had recently spent time in Monaco with Crown Prince Albert II.ºº Trudeau stated that elitists he had talked to thought their plans were for the greater good of humanity but that they believed there were two classes of people on earth, the ruling elite and the “worker bees,” , and that the elite were defined not necessarily by money or power, but by their genetic ancestry.ºº Trudeau shockingly detailed conversations with elitists during which they brazenly admitted their desire for massive global population reduction.ºº “I’ve been sitting on the boats off the coast of Barbados with the guys who basically said we need to get two-thirds of the dumb people off the planet - I’ve been in the meetings,” said Trudeau, adding that such words were not spoken in an evil manner, but in a “matter of fact” way under the pretext that such a thing would be for the good of planet earth.ºº Revealingly, Trudeau said that elitists see Alex Jones as an annoyance but tolerate him because they believe Jones as well as Trudeau himself are, “desensitizing people to these realities,” which in a way works to their benefit.

“I’ve been told that’s why I still get invited on the yachts,” added Trudeau.ºº Trudeau aid that the elite was divided into two camps, one larger faction that, “Categorically believes they are genetically superior than the rest of the population,” and another smaller faction, mainly comprising of younger people, that are feeding Trudeau information who, “Have come to the conclusion that some people are smarter than others, some people are more talented than others, some people are more motivated to work….but everyone should be allowed to succeed or fail based on their own choices or initiative….and that’s where there’s a split and a division right now at the highest levels,” said Trudeau.ºº Also, among the Bilderberg attendees in Athens was John Kerr, of Royal Dutch Shell, underlining the financial connection between the Illuminati and Bilderbergs and oil companies. Queen Beatrix of The Netherlands, who also attended the meeting, is a leading Bilderberg member. Her father Prince Bernhard of the Netherlands, was a member of Nazi Germany’s SS and worked for IG Farben, helped organise the first Bilderberg meeting in 1954, and later served on more than 300 corporate boards.ºº Rather than relieving the pressure on the environment by switching 239.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

over to renewable energy sources, the financial elite have agreed in secret to reduce the world’s population and by means of the use of a huge secret bioweapons programme hidden from the general public under the guise of protecting the general public against a pandemic they created by using vaccines, and they discussed their plans for depopulation, so Kevin Trudeau has suggested, at the Bilderberg meeting in Athens.ºº Attending the meeting in Athens were key players in the bioweapons programme, including the CEO of Novartis, Daniel Vassella, and Werner Faymann, whose government has given cover to Baxter’s subsidiary in Austria in triggering a pandemic.ºº º º º º

240.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XXXVIII. Conclusionº º º There is evidence that there is an international criminal corporate crime syndicate, directed by a group called the Illuminati, who are planning the mass murder of the people of the USA by using an artitifical virus as a pretext to deliver a toxic vaccinations.º The pandemic flu vaccine is a) classed as a “bioweapon” according to the US government’s own documents (see Attachment 1), b) the vaccine companies tasked with producing the vaccine have been involved in the activities of the type typical of bioweapons, including developing weapnized viruses, releasing them into the general public, in deliberate contamination of vaccines resulting in death and injury and designing trials of vaccine to cause death and injury and there is a high probability the vaccines will be cause injury or death, and c) the government is acting unconstituutionally and illegally in compelling them to take an injection of a substance classified as bioweapon d) in criminalising a refusal, and e) in waiving people’s right to claim compensation in the event of injury or damage, and f) by misusing the US population as “vectors” to spread the pandemic because the act of mass vaccination, that is to say, of forced injections of of toxins under guise of offering prophylactic treatment is the very process by which the virus will be able to mutate and release a fully weaponized virus. º º º º º º º

241.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XXIX. Defendantsº The main defendants include:º º º PRESIDENT BARACK OBAMA THE WHITE HOUSE 20500 Washington, D.C.º DAVID NABARROº UNITED NATIONS 760 United Nations Plaza, New York, NY 10017º DR. MARGARET CHAN WORLD HEALTH ORGANISATION Avenue Appia 20º 1211 Geneva 27, Switzerlandº KATHLEEN SIBELIUS SECRETARY OF HEALTH AND HUMAN SERVICES 200 Independence Avenue, S.W. Washington, D.C. 20201,º JANET NAPOLITANO DEPARTMENT OF HOMELAND SECURITY 1000 Defense Pentagon Washington, D.C. 20301º DR. MARGARET HAMBURGº COMMISSIONER FOOD AND DRUG ADMINISTRATION 5600 Fishers Lane Rockville, Maryland 20857-0001º ROBERT PARKINSON CEO, BAXTER INT., Baxter International, headquartered in Deerfield, IL, USAº DANIEL VASSELLA CEO, NOVARTIS INTERNATIONAL AGº CH-4002 Basel, Switzerlandº CHRIS VIEHBACHER CEO SANOFI AVENTIS 242.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

160-180, avenue de France, 75008 Parisº Franceº ANDREW WITTY CEO GSK PLC One Franklin Plazaº Philadelphia PA 19101º RAHUL SINGHVI CEO NOVAVAX 9920 Belward Campus DriveRockville, MD 20850º DAVID DE ROTHSCHILD Managing Partner, Rothschild & Cie Banque Rothschild Inc, 1251 Avenue of the Americasº 51st floor, NY 10020º DAVID ROCKEFELLER Honorary North American Chairman TRILATERAL COMMISSION 1156 Fifteenth Street, NW, Washington, DC 20005º GEORGE W. BUSH 10141 Daria Place Dallas, TX 75229º GEORGE SOROS Chairman of Soros Fund Management, LLC 888 7th Ave., 33rd Fl. New York, NY 10106º WILLIAM HENRY GATES III BILL AND MELINDA GATES FOUNDATION PO Box 23350, Seattle, WA 98102ºº Michael O. Leavitt Former Secretary of Health and Human Services (2005-2009) 200 Independence Avenue, S.W. Washington, D.C. 20201ºº Jeffrey Taubenberger, NAID-Intramural branch 6610 Rockledge Drive, Room 4017, MSC 6606º Bethesda, MD 20892-6606ºº James Robertson National Institute for Biological Standards and Controlº Blanche Laneº South Mimmsº 243.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Potters Barº Hertfordshireº EN6 3QGºº Ruben O. Donis Centers for Disease Control and Prevention Mailstop E-03 1600 Clifton Roadº Atlanta, Georgia 30333º United Statesººº Rick A. Bright Centers for Disease Control and Prevention Mailstop E-03 1600 Clifton Roadº Atlanta, Georgia 30333º United Statesººº The above defendants have given support in the form of funds, logistics, skills, licences and cover to the covert programme of mass genocide using an artificial virus and mass vaccination with toxic vaccines.º Speicifically, Defendant President Barack Obama, who as part of his Office, will oversee the implementation of the International Partnership on Avian and Pandemic Influenza, which would give primacy to the World Health Organisation (WHO) and United Nations over US law and government agencies in the event of a pandemic being declared.

President Obama has also requested a $1.5 billion emergency appropriation to deal with swine flu, including development of a vaccine.º Defandant David Nabarro, who as Senior U.N. system influenza coordinator will implement an emergency response plan in the event of a declared pandemic on US territoriy operating through authorities under the WTO, North American Free Trade Agreement and the U.N. Food and Agriculture Organization, and taking precedence over US government agencies and law.

4. Defandant WHO, the organisation responsible for coordinating the global response, including the US response, to the „swine flu“ and other pandemics.º Defendant HHS is in the process of working with vaccine manufacturers to facilitate production of pilot vaccine lots for both H5N1 and H9N2 strains as well as contracting for the manufacturing of H5N1 vaccine.

The HHS recently awarded contracts to Novartis AG worth $289 million; Sanofi Aventis SA for $191 million, and GlaxoSmithKline PLC for $181 million to produce H1N1 vaccine ingredients. HHS said it is also talking to additional manufacturers to find more capacity.º Defendant DHS has prepared pandemic flu guidelines, including the National Strategy To Safeguard Against The Danger Of Pandemic Influenza (White House) and will coordinate between government officials and the public health, medical, veterinary, and law enforcement communities, as well as the private sector in the event of a declared pandemic.

Defendant Department of Health and Human Services (“HHS”) through its 244.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

agent, Defendant Food and Drug Administration (“FDA”), is the federal agency responsible for licensing and quality control of drugs and biologic products, such as „swine flu“ and other pandemic vaccines.º The FDA is responsible for promulgating federal regulations that describe what makes a drug or vaccine an “IND” and how a drug is placed in IND status.º Defendant Human Services Secretary Michael Leavitt introduced a new FDA rules in January 2006 that pre-empted any state laws that allow citizens to sue drugmakers for producing unsafe drugs under the dubious claim that the FDA, an agency under HHS, had national responsibility for certification of drug safety and state lawsuits impinged on that national responsibility.º º º º º

245.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

ATTACHMENTSº º º Attachment Dº º º Biological Weapons Anti-Terrorism Act of 1989 From Wikisource Jump to: navigation, search ←Public Law 101-297

Acts of the 101st United States Congress Public Law

by United States Congress 101-299→ Public Law 101-298:º Biological Weapons Anti-Terrorism Act

Pub.L. 101-298, enacted Mayº22, 1990. From en.wikipedia: The Biological Weapons Anti-Terrorism Act of 1989 (BWATA) was a piece of U.S. legislation that was passed into law in 1990. It provided for the implementation of the Biological Weapons Convention as well as criminal penalties for violation of its provisions. The law was amended in 1996 and has been used to prosecute several individuals.

101ST UNITED STATES CONGRESSº 2ND SESSION An Act To implement the Convention on the Prohibition of the Development, Production, and Stockpiling of Bacteriological (Biological) and Toxin Weapons and Their Destruction, by prohibiting certain conduct relating to biological weapons, and for other purposes.º Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, Contents [hide] 1 SECTION 1. SHORT TITLE 2 SECTION 2. PURPOSE AND INTENT 3 SECTION 3. TITLE 18 AMENDMENTS 4 See also

246.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

[edit] SECTION 1. SHORT TITLE This Act may be cited as the `Biological Weapons Anti-Terrorism Act of 1989'. [edit] SECTION 2. PURPOSE AND INTENT (a) PURPOSE- The purpose of this Act is to— (1) implement the Biological Weapons Convention, an international agreement unanimously ratified by the United States Senate in 1974 and signed by more than 100 other nations, including the Soviet Union; and (2) protect the United States against the threat of biological terrorism. (b) INTENT OF ACT- Nothing in this Act is intended to restrain or restrict peaceful scientific research or development. [edit] SECTION 3. TITLE 18 AMENDMENTS (a) IN GENERAL- Title 18, United States Code, is amended by inserting after chapter 9 the following: CHAPTER 10—BIOLOGICAL WEAPONS Sec. 175. Prohibitions with respect to biological weapons.

176. Seizure, forfeiture, and destruction.

177. Injunctions.

178. Definitions.

Section 175: Prohibitions with respect to biological weapons (a) IN GENERAL- Whoever knowingly develops, produces, stockpiles, transfers, acquires, retains, or possesses any biological agent, toxin, or delivery system for use as a weapon, or knowingly assists a foreign state or any organization to do so, shall be fined under this title or imprisoned for life or any term of years, or both. There is extraterritorial Federal jurisdiction over an offense under this section committed by or against a national of the United States. (b) DEFINITION- For purposes of this section, the term `for use as a weapon' does not include the development, production, transfer, acquisition, retention, or possession of any biological agent, toxin, or delivery system for prophylactic, protective, or other peaceful purposes.

Section 176: Seizure, forfeiture, and destruction (a) IN GENERAL- (1) Except as provided in paragraph (2), the Attorney General may request the issuance, in the same manner as provided for a search warrant, of a warrant authorizing the seizure of any biological agent, toxin, or delivery system that— (A) exists by reason of conduct prohibited under section 175 of this title; or (B) is of a type or in a quantity that under the circumstances has no apparent justification for prophylactic, protective, or other 247.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

peaceful purposes.

(2) In exigent circumstances, seizure and destruction of any biological agent, toxin, or delivery system described in subparagraphs (A) and (B) of paragraph (1) may be made upon probable cause without the necessity for a warrant. (b) PROCEDURE- Property seized pursuant to subsection (a) shall be forfeited to the United States after notice to potential claimants and an opportunity for a hearing. At such hearing, the government shall bear the burden of persuasion by a preponderance of the evidence. Except as inconsistent herewith, the same procedures and provisions of law relating to a forfeiture under the customs laws shall extend to a seizure or forfeiture under this section. The Attorney General may provide for the destruction or other appropriate disposition of any biological agent, toxin, or delivery system seized and forfeited pursuant to this section. (c) AFFIRMATIVE DEFENSE- It is an affirmative defense against a forfeiture under subsection (a)(1)(B) of this section that— (1) such biological agent, toxin, or delivery system is for a prophylactic, protective, or other peaceful purpose; and (2) such biological agent, toxin, or delivery system, is of a type and quantity reasonable for that purpose.

Section 177: Injunctions (a) IN GENERAL- The United States may obtain in a civil action an injunction against— (1) the conduct prohibited under section 175 of this title; (2) the preparation, solicitation, attempt, or conspiracy to engage in conduct prohibited under section 175 of this title; or (3) the development, production, stockpiling, transferring, acquisition, retention, or possession, or the attempted development, production, stockpiling, transferring, acquisition, retention, or possession of any biological agent, toxin, or delivery system of a type or in a quantity that under the circumstances has no apparent justification for prophylactic, protective, or other peaceful purposes. (b) AFFIRMATIVE DEFENSE- It is an affirmative defense against an injunction under subsection (a)(3) of this section that— (1) the conduct sought to be enjoined is for a prophylactic, protective, or other peaceful purpose; and (2) such biological agent, toxin, or delivery system is of a type and quantity reasonable for that purpose.

Section 178: Definitions As used in this chapter— (1) the term `biological agent' means any micro-organism, virus, or infectious substance, capable of causing— (A) death, disease, or other biological malfunction in a human, an animal, a plant, or another living organism;º 248.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

249.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

T R A D U C C I Ó N A L E S PA Ñ O L R E S U M E N D E D E L D O C U M E N TO – 3 0 P G S

250.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Cargos penales relativos a actos Bioterrorismo y Genocidio. º º º º º Enviado a: OFICIAL ADJUNTO DEL FBI EMBAJADA DE LOS ESTADOS UNIDOS Boltzmanngasse 16 A-1090 Viena Austria º º Fecha: 10 de junio de 2009 º º Índice º º I.Introducción: Resumen de las reivindicaciones.● II.Antecedentes de hecho.● III.Prueba de la gripe porcina, las vacunas son armas biológicas.● IV.Pruebas científicas el virus de la gripe porcina es artificial (ingeniería genética).● V.Pruebas científicas de que la “gripe porcina” fue recombinada genéticamente para asemejarse al virus asesino de la gripe española de 1918.● VI.Secuencia del genoma de la gripe porcina.● VII.Pruebas de liberación deliberada del virus de la gripe porcina en México.● VIII.Pruebas de la participación del Presidente Obama.● IX.Pruebas del papel de Baxter y la OMS en la producción y liberación de material vírico pandémico en Austria.● X.Prueba de que Baxter es un elemento más de armas biológicas que opera en una red encubierta.● XI.Prueba de que Baxter ha contaminado medicamentos deliberadamente.● XII.Prueba de que Novartis está utilizando las vacunas como armas biológicas.● XIII.Pruebas del papel de la OMS en el programa de armas biológicas: proveedor de los virus de la gripe aviar a Baxter.● XIV.Pruebas de que la OMS está manipulando los datos de las enfermedades con el fin de justificar la declaración de una Pandemia de Nivel 6 con el fin de tomar el control de los EE.UU.● XV.Pruebas del desempeño de la F.D.A. en la cobertura de programa de armas biológicas.● 251.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

XVI.Pruebas del papel que juegan los Laboratorios Nacionales de Microbiología de Canadá en el programa de armas biológicas.● Pruebas de la participación de los científicos que trabajan para el NIBSC del Reino Unido de y del CDC en la ingeniería de la gripe porcina.● XVII.Prueba de que las vacunas causaron la asesina gripe española de 1918.● XVIII.Precedentes: el programa de vacunación masiva contra la gripe porcina abandonado en 1976.● XIX.Desempeño insuficiente del gobierno para detener la propagación de la gripe porcina como cobertura para la difusión de una pandemia.● XX.Pruebas de la manipulación del marco jurídico para permitir el asesinato en masa con total impunidad.● XXI.Cuestiones constitucionales: la necesidad de actuar desde la legalidad para poner punto final a la ilegalidad de poner en peligro la vida, la salud y el “bienestar público” en un sistema indiscriminado de vacunaciones en masa.● XXII.El tema de la inmunidad y la indemnización como prueba de la intención de cometer un delito.● Pruebas de la utilización de Chemtrails como método para reducir la población.● XXIII.Pruebas de la existencia de un sindicato del crimen corporativo internacional a nivel mundial.● XXIV.Pruebas de la existencia de la organización llamada “Illuminati”.● XXV.Pruebas de la participación de los Illuminati en el actual colapso del sistema financiero mundial.● XXVI.Pruebas del Programa de “despoblación” a nivel mundial dentro de los objetivos del grupo Illuminati/Bilderbergers y su participación en la ingeniería y la liberación de virus artificiales de la gripe porcina.● XXVII.Pruebas del Programa de Genocidio transformando en armas los virus de la gripe como uno de los puntos de debate en la reunión anual de Bilderberger en Atenas de mayo (días del 14 al 17) de 2009.● XXVIII.Conclusión.● XXIX.Acusados.● XXX.Adjuntos.●

252.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

– Cargos penales presentadas contra Baxter y la OMS, entre otras cosas, en Austria – Cargos penales presentados contra Baxter y la OMS, entre otras cosas, en Suiza – Respuestas parlamentarias de Baxter al incidente- Extracto: sobre las armas biológicas, la Ley contra terrorismo de 1989

253.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

I.Introducción: Resumen de las Reclamaciones º º Presento las pruebas de las alegaciones de los actos de bioterrorismo en violación de la legislación penal de los Estados Unidos, llevados a cabo por un grupo que opera en los Estados Unidos, bajo la dirección de banqueros internacionales que controlan, entre otras cosas, las instituciones financieras, la Reserva Federal, así como las organizaciones gubernamentales internacionales, en particular la Organización Mundial de la Salud, las Naciones Unidas y la OTAN. Aquí se presentan las pruebas con objeto de demostrar que un sindicato internacional dedicado al crimen, que opera por medio de estas empresas, tiene la intención de llevar a cabo un genocidio en masa contra la población de los Estados Unidos mediante el uso de un producto biológico creado por medio de ingeniería genética.

Específicamente, las pruebas se presentan contra los siguientes Demandados : Presidente Barack Obama, Presidente de los Estados Unidos, David Nabarro, Coordinador del Sistema de las Naciones Unidas para la Gripe, Margaret Chan, Directora General de la Organización Mundial de la Salud, Kathleen Sibelius, Secretario del Departamento de Salud y Servicios Humanos (HHS ), Secretario, Janet Napolitano, el Departamento de Seguridad Interior, David de Rothschild, banquero, David Rockefeller, banquero, George Soros, el banquero, Werner Faymann, Canciller de Austria, Alois Stöger, Ministro de Salud de Austria Todas estas personas son parte de una organización criminal de empresas que ha desarrollado, producido, almacenado y empleado armas biológicas para eliminar la población de los Estados Unidos y de otros países con objeto de obtener beneficios políticos y financieros.

Se presentan pruebas de que los acusados conspiran entre sí, y con otros para diseñar, financiar y participar en la fase final de la ejecución de un programa encubierto de armas biológicas a nivel internacional que implica, entre otras entidades, a las empresas farmacéuticas Baxter y Novartis, quienes, por medio de bioingeniería y posterior liberación de agentes biológicos letales, en primer lugar, el llamado virus de la gripe aviar y, en segundo lugar, el llamado virus de la gripe porcina, pretenden poner en marcha un programa de vacunación masiva forzada, que será el medio para la administración de un agente biológico tóxico. Dicho agente causará muerte y lesiones a la población de los Estados Unidos al entrar en el organismo por medio de inyecciones; todo ello en un acto de violación de las Armas Biológicas Ley Antiterrorista de 1989 (BWATA), aprobada en 1990, que amplió el ámbito de los bio-materiales de guerra a fin de incluir en dicha regulación a particulares y organizaciones no estatales, incluidas las empresas del sector farmacéutico.

El expediente aportado presenta pruebas de que Baxter AG, filial austriaca de Baxter Internacional, con sede en Deerfield, III, deliberadamente, a sabiendas y voluntariamente, envió 72 kilos de virus activado, no atenuado, de la gripe aviar, suministrados por la Organización Mundial de la Salud, Ginebra, Suiza en el invierno de 2009 a 16 laboratorios en cuatro países. Estas pruebas ofrecen una prueba clara de que las empresas farmacéuticas internacionales y los organismos gubernamentales están participando activamente en la elaboración, desarrollo, fabricación y distribución de agentes biológicos como el más mortal arma biológica en el planeta con el fin de desencadenar una pandemia y causar muertes en masa.

Adjunto (A) es una copia de los cargos penales presentados contra Baxter y otros acusados en la ciudad de Viena, Oficina de la Fiscalía el 8 de abril de 2009, por Jane Bürgermeister, Ciudadana irlandesa/austriaca, residente en Viena, Austria.

254.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

La policía austríaca están investigando el incidente de la liberación de 72 kilos del virus activo de la gripe aviar procedente de los laboratorios Orth an der Donau de la Baxter este invierno.

SIGUE RESUMEN EN PG SIGUIENTE

Fuente: www.free-news.org/PDFs/Jane_Burgermeister-Dossier.pdf

255.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Jane Burgermeister y la despoblación programada ― Dossier (Recibido en francés vía Internet y traducido en agosto 2009) Una periodista austriaca de temas científicos avisa al mundo entero de que está en marcha el mayor crimen de la historia de la humanidad Resumen del artículo presentado en la pág. 3 Jane Burgermeister ha presentado recientemente una denuncia contra la OMS (Organización mundial de la Salud), la ONU, Barack Obama (Presidente de Estados Unidos), David de Rothschild (banquero), David Rockefeller (banquero), George Soros (banquero), Werner Faymann (Canciller de Austria)19, entre otros, acusándolos de querer cometer un genocidio en masa.

Previamente, en abril de 2009, la periodista inició un proceso judicial contra las sociedades farmacéuticas Baxter y Avir Green Hills Technology, a las que considera responsables de haber producido una vacuna contra la gripe aviar para provocar, deliberadamente, una pandemia y enriquecerse con ello.

Jane Burgermeister presenta pruebas de los actos de bioterrorismo en los que se encuentran implicados los organismos y personas citados. Les acusa de formar parte de un sindicato internacional de empresas criminales que ha puesto a punto, fabricado, almacenado y utilizado armas biológicas con el fin de eliminar la población de Estados Unidos y la de otros países20, obteniendo de paso beneficios políticos y económicos.

Utilizando la «gripe porcina» como pretexto, les acusa de haber planificado el asesinato en masa de la población americana por medio de la vacunación forzosa.

Tiene pruebas de que las vacunas serán contaminadas intencionadamente para provocar enfermedades mortales.

Semejante actuación es una violación directa de la Ley antiterrorista concerniente al empleo de armas biotecnológicas. Constituyen actos de terrorismo y de alta traición.

Al reanudar las actividades tras el periodo vacacional, la OMS tiene como programa lanzar la penúltima fase del genocidio, ¡que pretende eliminar a cinco mil millones de seres humanos a lo largo de los próximos 10 años!21 Esta afirmación, propia de un escenario de política-ficción, ¡se podría considerar delirio o paranoia! Nada de eso. Jane Burgermeister y otras muchas personalidades (científicos, políticos, investigadores y periodistas) confirman la existencia de un plan de despoblación programado, vía la pandemia de la gripe A/H1N1 y, sobre todo, a través de las vacunas, que estarán contaminadas.

Jane Burgermeister ha realizado un trabajo importantísimo. Sus revelaciones, apoyadas por pruebas, y las dos denuncias que ha presentado contra las más altas instancias dirigentes nos permiten hoy, cuando ya sólo faltan unas semanas para el «lanzamiento» de la pandemia, preparar nuestras propias armas, judiciales entre otras.

Su valor y su determinación nos dejan atónitos.

Los Estados del mundo se preparan a una despoblación programada.

A nosotros, miembros de la sociedad civil, nos incumbe preparar una fuerte resistencia contra la obligación de vacunarse, contraria a nuestros derechos más fundamentales (cf. «Organizar la resistencia», al final de este dossier). La Declaración 19 .- Jane Burguermaister acusa también, entre otros, a la Dra. Margaret Chan, Directora de la OMS, a Bill Gates y a George W. Bush.

20 .- ¡También concierne a Francia y a Europa en general! Cf. los artículos del dossier.

21 .- Cf. principalmente el artículo de Barbara Minton, así como el dossier que reúne las pruebas que permiten a Jane Burgermeister fundamentar sus acusaciones, dossier titulado «June 10th Action» y disponible (en inglés) en http://www.rense.com/general86/lat.htm

256.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Universal de los Derechos Humanos, de 1948, precisa que todo ser humano tiene derecho a su integridad. No se puede obligar a un individuo a someterse a un acto médico como es el de la vacunación. Si no fuera así, no estaríamos en un Estado de derecho sino en una dictadura…

Por encima del miedo que estas revelaciones puedan suscitar, creemos: ● que la verdad es el primer paso para liberarse de la opresión ● que una persona informada es mucho menos manipulable ● que estas informaciones favorecen la toma de conciencia necesaria para una transformación fundamental de nosotros mismos y de nuestra sociedad.

Por primera vez, ¡no podemos mirar hacia otro lado! Concierne al 99,90 % de la población aproximadamente. A nuestros hijos, padres, amigos y a nosotros mismos… Nos concierne a cada uno de nosotros.

«Hay que tomar medidas draconianas de reducción demográfica contra la voluntad de las poblaciones. Reducir la tasa de natalidad ha resultado imposible o insuficiente. Hay pues que aumentar la tasa de mortalidad. ¿Cómo?

Por medios naturales: el hambre y la enfermedad.» Robert Mc Namara22

CONTENIDO – En este dossier encontrará: ―

Un artículo sobre las denuncias presentadas por Jane Burgermeister y las revelaciones que realiza.

Este texto trata esencialmente de Estados Unidos. Pero, no nos engañemos. Es una imagen de lo que le espera al mundo en general y por lo tanto, evidentemente, a Francia.

El dossier que reúne las «pruebas» que permiten a Jane Burgermeister fundamentar sus acusaciones está disponible (en inglés) en http://rense.com/general89/lat.htm ― Varios extractos o artículos de temas relacionados con el programa de despoblación. Obtenidos en páginas de Internet, estos textos ―que conciernen especialmente a Francia― van acompañados a menudo de notas que permiten profundizar y precisar ciertos aspectos. ― Consejos para la movilización personal y la resistencia a la opresión.

Direcciones de páginas web en las que se puede encontrar información, medios para transmitirlas y comunicar.

Es evidente que las informaciones presentadas en este dossier deben ser tomadas con las precauciones habituales. Pero, ¿cómo no prestarles atención?

22 .- Robert Mc Namara: antiguo presidente del Banco Mundial, antiguo secretario de Estado de Estados Unidos, ordenó los bombardeos masivos de Vietnam. Es igualmente uno de los instigadores del P.E.V. (Programa amplio de vacunaciones) iniciado por la OMS en 1974 con el objetivo de vacunar al mayor número posible de niños en el mundo. La Comisión McNamara tambié llevó a cabo un memorable y casi desconocido estudio conocido como el “Informe Iron Mountain”, enlace: https://mega.co.nz/#!QMAmgbaa!

Ukp68jvphpB2021VOcol8m0TU18o06WXLcrJLEGCGMc

257.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Gripe porcina: Una periodista austriaca acusa a la ONU y a algunos responsables políticos de preparar un genocidio a nivel planetario Artículo de Barbara Minton23, publicado en Natural news

La fecha de salida de la nueva vacuna de la sociedad Baxter contra la pandemia de gripe A/H1N1 prevista para principios de julio, se acerca 24. Por eso, una periodista austriaca está advirtiendo al mundo de que está en marcha el mayor crimen de la historia de la humanidad.

Jane Burgermeister ha presentado recientemente una denuncia ante el FBI acusando a la Organización Mundial de la Salud (OMS), a la Organización de Naciones Unidas (ONU), a varios funcionarios de los más elevados rangos del gobierno y a algunas sociedades farmacéuticas, de bioterrorismo y de tratar de cometer un asesinato en masa.

Ha iniciado igualmente un proceso ante la Justicia contra la vacunación forzosa que se prepara en América25. Esos actos judiciales siguen a las denuncias presentadas en abril contra Baxter AG y AVIR Green Hills Biotechnologie (filial austriaca del grupo) concernientes a la producción de vacunas contaminadas de gripe aviar, como actos deliberados, con el fin de provocar la pandemia y beneficiarse de ella.

Resumen de las reivindicaciones y acusaciones presentadas ante el FBI en Austria el 10 de junio de 2009 En su dossier de inculpación, Burgermeister presenta pruebas de los actos de bioterrorismo ―que violan la ley americana― realizados por un grupo que opera desde Estados Unidos bajo la dirección de algunos banqueros internacionales que controlan la Reserva Federal, la OMS, la ONU y la OTAN. Este acto de bioterrorismo tiene por objeto realizar un genocidio en masa de la población norteamericana utilizando un virus de gripe genéticamente modificado con la intención de causar la muerte.

El grupo se ha infiltrado en los despachos de influyentes responsables de la administración en Estados Unidos. Concretamente, ha presentado pruebas que acusan a Barack Obama, Presidente de Estados Unidos; a David Nabarro, Coordinador del Sistema de las Naciones Unidas para la lucha contra la gripe; a Margaret Chan, directora general de la OMS; a Kathleen Sibelius, Secretaria del Departamento de la Salud y de los Servicios a las personas; a Janet Napolitano, Secretaria del Departamento de Seguridad interior («Homeland Security»); a David de Rothschild, banquero; a David Rockefeller, banquero; a George Soros, banquero; a Werner Faymann, Canciller de Austria; y a Alois Stoger, Ministra austriaca de Salud, entre otros, de formar parte de un sindicato internacional de empresas criminales que ha preparado, fabricado, almacenado y utilizado armas biológicas con el fin de eliminar la población de Estados Unidos y la de otros países, con el objetivo de obtener beneficios políticos y económicos.

La acusación sostiene que los acusados se han organizado ―entre sí y con otros― para concebir, financiar y participar en la fase final de la puesta en marcha de un programa secreto internacional de fabricación de armas biológicas en el que están implicadas las sociedades farmacéuticas Novartis y Baxter. Lo han conseguido mediante bio-ingeniería y difusión de agentes biológicos mortíferos, en particular a través del virus de la «gripe aviar» 23 .- Barbara Minton es profesora de psicología y autora de varios libros sobre las finanzas personales. Se ha curado de un cáncer de pecho recurriendo a medicinas alternativas. Es posible ponerse en contacto con ella a través de la página web http://naturalnews.com/z026503_pandemic_swine_flu_bioterrorism.html La versión original de su texto (en inglés) está disponible en esa misma página.

24 .- Este artículo fue publicado el 25 de junio de 2009.

25 .- Respecto a las vacunaciones forzosas en Francia, léanse los artículos del presente dossier.

258.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

y el virus de la «gripe porcina», con el fin de tener un pretexto para poner en marcha un programa de vacunación forzosa, que será el medio de administrar un agente biológico tóxico que causará daños irreversibles, incluso la muerte, a la población de Estados Unidos.

Esta acción es una violación directa de la Ley antiterrorista sobre armas biológicas («The Biological Weapons Antiterrorism Act»). Las acusaciones de Burgermeister van acompañadas de pruebas que atestiguan que Baxter AG, filial austriaca de Baxter International, ha enviado deliberadamente 72 kilos de virus vivos de «gripe aviar» proporcionados por la OMS, durante el invierno de 2008, a 16 laboratorios en 4 países.

Presenta pruebas que demuestran de forma evidente que las sociedades farmacéuticas y las agencias gubernamentales internacionales están activamente implicadas en la producción, desarrollo, fabricación y distribución de agentes biológicos, clasificados como armas biológicas de las más mortíferas del planeta, con el fin de desencadenar una pandemia y provocar la muerte de las masas.

En las acusaciones que presentó en el mes de abril, subraya el hecho de que el laboratorio Baxter en Austria ―que se supone es uno de los laboratorios más seguros del mundo en bioseguridad― no ha respetado los procedimientos más elementales y esenciales para mantener con toda seguridad y separados de las demás sustancias los 72 kilos de un agente patológico clasificado como arma biológica, sino que permitió que estuvieran mezclados con el virus de la gripe humana común y fueron expedidos posteriormente desde sus instalaciones ubicadas en Orth, en la región del Danubio.

En febrero, cuando un miembro del personal de BioTest, con base en la República Checa, utilizó un producto destinado a probar las vacunas en hurones, éstos murieron. A este incidente no siguió la menor investigación por parte de la OMS, ni de la Unión Europea, ni de Austria o de las autoridades de salud austriacas. No hubo investigación alguna sobre el impacto o alcance del virus, y no existen datos sobre la secuencia genética de los virus liberados. En respuesta a las preguntas parlamentarias del 20 de mayo, la Ministra austriaca de Salud, Alois Stoger, manifestó que el incidente en cuestión no había sido tratado ―como debía haberlo sido― como asunto de bioseguridad sino como una infracción del Código Veterinario. Enviaron al laboratorio a un veterinario para una breve inspección.

El dossier de Burgermeister revela que la difusión de los virus debía ser una etapa esencial para el detonante de una pandemia que permitiría a la OMS declarar el «Nivel 6» de alerta de pandemia26. Enumera la lista de leyes y decretos que permitirían a la ONU y a la OMS imponerse sobre el gobierno de Estados Unidos en el caso de que se declarara una pandemia. Además, la legislación impondría la obligación de someterse a la vacuna y entraría en vigor por la fuerza en Estados Unidos en el momento en que tuvieran lugar las condiciones de declaración de la pandemia. Presenta igualmente una acusación según la cual la pandemia de «gripe porcina», en su conjunto, se basa en enormes mentiras; no hay ningún virus natural que pueda constituir una amenaza para la población.

En efecto, presenta pruebas que demuestran que tanto el virus de la «gripe aviar» como el de la «gripe porcina» han sido creados en laboratorios mediante bio-ingeniería gracias a la financiación facilitada por la OMS y otros organismos gubernamentales. La «gripe porcina» es un híbrido formado por partes de gripe porcina, de gripe común y de gripe aviar, una mezcla que, según numerosos expertos27, no puede proceder más que de laboratorios.

26 .- La OMS declaró el «Nivel 6» de alerta mundial de pandemia el 11 de junio de 2009.

27 .- Cf. respecto a este tema el importante artículo de la Dra. Alma True Ott, que explica que el «cócktel mortal de la vacuna» tiene un enorme parecido con el suero inoculado a millones de soldados en 1918. Esa vacuna generó una epidemia que provocó la muerte de entre 20 y 50 millones de personas en todo el mundo. Cf. igualmente el artículo del Dr. Leonard Horowith que trata también, en parte, sobre este tema.

259.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

La OMS, que afirma en sus comunicados que la «gripe porcina» avanza y que, por ello, hay que declarar una pandemia, no habla de sus causas fundamentales. Los virus que se han difundido han sido creados y transmitidos con ayuda de la OMS; este organismo tiene una responsabilidad abrumadora y de primer orden en cuanto concierne a la pandemia.

Además, los síntomas de la supuesta «gripe porcina» no se distinguen de los de la gripe común o los de un simple catarro. La «gripe porcina» no provoca más muertes que otras gripes corrientes.

Burgermeister hace notar que el número de casos mortales de «gripe porcina» es contradictorio y que no hay ninguna claridad en cuanto a la manera como se contabiliza el número de fallecidos.

No hay riesgo potencial de pandemia, a menos que sean efectuadas vacunaciones masivas para hacer de la gripe un arma28, bajo la apariencia de protección de la población.

Existen motivos legítimos para creer que las vacunas obligatorias serán deliberadamente contaminadas para provocar a propósito enfermedades mortales. Hace referencia a una vacuna patentada por Novartis contra la «gripe aviar» que mató a 21 personas sin hogar, en Polonia, durante el verano de 2008. La principal consecuencia de este hecho consistió en catalogarlo entre los «efectos indeseables», respondiendo así a la definición misma de arma biológica, según Estados Unidos (sustancia biológica destinada a provocar «efectos indeseables», por ejemplo, la muerte o ciertas lesiones) al ser «administrada» de una determinada manera (inyección). Afirma también que ese mismo grupo de industrias farmacéuticas y agencias gubernamentales internacionales, que han elaborado y difundido los agentes que vehiculan la pandemia, se han situado en posición tal que los sustanciosos contratos relativos a la producción de las vacunas les permitirá, en definitiva, beneficiarse de la pandemia. El grupo que ha elaborado el plan de «gripe porcina» controla los medios de comunicación y estos últimos difunden falsas informaciones con el fin de adormecer la vigilancia de la población americana para que acepte esa vacuna peligrosa.

La población de Estados Unidos sufrirá importantes e irreparables daños y lesiones si se ve obligada a tomar una vacuna cuya eficacia no ha sido probada, es decir, si debe tomarla sin su consentimiento al ser aplicada la ley sobre el Estado de urgencia de salud llamada «Powers Act», del National Emergency Act29 (ley de Urgencia Nacional), de la Directiva presidencial de la Seguridad Nacional/NSPD-51, de la Directiva Homeland Security/HSPD-20 y la legislación de las restantes instituciones internacionales sobre la «gripe aviar» y la «gripe pandémica».

28 .- En ese caso, puede haber riesgo de recombinaciones y de mutaciones virales. «Los antivirales acentúan los procesos de mutación: La mutación es el paso del patrimonio genético de un virus muerto por antivirales a células sanas que, evidentemente, pueden reproducir entonces una forma viral mutante más virulenta. Este fenómeno es reconocido por un número cada vez mayor de médicos e investigadores. Al vacunar Y utilizar, por ejemplo, Tamiflu, tiene usted una fórmula explosiva que hace de su cuerpo una auténtica incubadora. El virus atenuado de la vacuna transmite su patrimonio genético a células sanas; esta mutación es acentuada por antivirales del tipo Tamiflu. Así pues, los remedios empleados son tan propicios a la mutación que producirán cepas mutantes no controladas y no controlables. Si se emplea ese tipo de “lucha” contra una gripe virulenta, se puede así pasar de una gripe A a una gripe B, etc., hasta la Z. La gripe A mata hoy en día 10 veces menos que una gripe común, pero con los métodos actuales, podría mutar convirtiéndose en una gripe mucho más dura. Los métodos de la OMS son homicidas, pues si se le deja actuar como lo está haciendo, debido a la mutación nos encontraremos con virus cada vez más asesinos.» Dr. Marc Vercoutère. Fuente: http://artemisia-college.org/Grippe_porcine__aviaire__humaine__mexicaine__A-00-03-01-0227-01.html 29 .- Extracto (traducido al francés) del dossier de pruebas de Jane Burgermeister «June 10th Action» (CAPIT. II, IA): «Con la National Emergency Act (ley de Urgencia Nacional), el Presidente puede confiscar propiedades, organizar y controlar los medios de producción, confiscar los bienes, enviar tropas militares al extranjero, implantar la Ley Marcial, apoderarse y controlar todos los medios de transporte y de comunicaciones, reglamentar las operaciones de las empresas privadas, restringir los viajes y, de innumerables maneras, controlar la vida de los ciudadanos norteamericanos.»

260.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Desde el 2008, Burgermeister acusa en Estados Unidos a todos aquéllos cuyos nombres han sido citados en sus acusaciones, de haber establecido nuevos procesos jurídicos y/o de haber acelerado la puesta en marcha de leyes y reglamentos 30 con el objetivo de privar a los ciudadanos de Estados Unidos de sus derechos constitucionales a rechazar la famosa inyección. Dichas personas han creado o autorizado unas directivas que convierten en criminal el acto de negarse a recibir una inyección contra el virus de la pandemia.

Han impuesto otras sanciones crueles y excesivas, tales como el encarcelamiento y/o la puesta en cuarentena en campos de internamiento de la FEMA 31, impidiendo al mismo tiempo a los ciudadanos de Estados Unidos pedir indemnizaciones en caso de lesiones o muerte a consecuencia de las inyecciones forzosas. Esas medidas constituyen una violación flagrante de las leyes federales sobre la corrupción y el abuso de poder, y violan también la Constitución y la Declaración de Derechos Humanos («Bill of Rights»). Mediante todas esas acciones, los acusados, cuyos nombres se han citado, han construido las bases de un verdadero genocidio en masa.

Utilizando la «gripe porcina» como pretexto, los acusados han planificado el asesinato en masa de la población americana por medio de la vacunación forzosa. Han preparado una amplia red de campos de concentración de la FEMA y han identificado los lugares que servirán de osarios. Están igualmente implicados en la elaboración y puesta en marcha de un plan destinado a que un sindicato internacional de empresas criminales ―que utiliza la ONU y la OMS como fachada para emprender actividades ilegales, criminales y de chantaje, violando las leyes que rigen la alta traición― tome el control de Estado Unidos.

Burgermeister se enfrenta también a los complejos farmacéuticos Baxter, Novartis y Sanofi Aventis, que forman parte de un programa de fabricación de armas biológicas situado en el extranjero ―con un doble objetivo― financiado por el mencionado sindicato internacional de empresas criminales y destinado a poner en marcha el asesinato masivo de civiles con el fin de reducir la población mundial en más de cinco mil millones de personas en los próximos diez años. Su plan consiste en sembrar el terror con el fin de justificar el hecho de obligar a la gente a renunciar a sus derechos y obligarles a ser puestos en cuarentena masivamente en campos de la FEMA. Las casas, las empresas, las propiedades y las tierras de las víctimas serán confiscadas por dicho sindicato. Una vez eliminada la población de América del Norte, esa élite internacional accederá a los recursos naturales de las regiones despobladas, como el 30 .- Se puede pensar, por ejemplo, en Patriot Act: «Al aprobar el Congreso de Estados Unidos el Patriot Act el 26 de octubre de 2001, y luego la Estrategia de Seguridad Nacional el 11 de septiembre de 2002, amplió considerablemente los poderes del gobierno central, lo que hace rechinar los dientes cada vez más incluso a algunos republicanos. […] Otro objetivo del gobierno federal es la vacunación forzosa de toda la población norteamericana contra la gripe común y contra la próxima pandemia, según permite la ley conocida bajo el nombre «The Model Emergency Health Powers Act». Recordemos que una campaña masiva de vacunación contra la «gripe porcina» fue lanzada en 1976 y tuvo que ser interrumpida varios meses después al constatarse que se producían numerosos casos de parálisis y de muertes. Además, mientras la Constitución protegía hasta ahora al ciudadano americano de toda intervención del ejército en territorio americano, el Gobierno federal puede, de ahora en adelante, utilizar las fuerzas armadas contra los propios ciudadanos norteamericanos que rechacen las vacunas, que serán, no lo dudemos, impuestas en el marco del bioterrorismo. La puesta en cuarentena de los insumisos será entonces controlada por el ejército.» Extraído de: http://groups.google.com/group/amessi/web/lepoids-de-lindustrie-agro-alimentaire 31 .- La FEMA ha puesto en marcha verdaderos campos de concentración modernos. En Estados Unidos se construyeron más de 600 campos de encarcelamiento bajo la administración Bush; todos ellos están plenamente operativos y preparados para recibir a los prisioneros. El personal de la dirección de los campos está ya en sus puestos, así como los vigilantes a tiempo completo. Rodeados de torres de observación, están destinados a ser utilizados por la FEMA (Federal Emergency Management Agency, la agencia federal encargada de gestionar las situaciones de urgencia) en el marco de una proclamación de la ley marcial. Cf. la pág. web http://www.mondialisation.ca/index.php?context=va&aid=1750

261.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

agua y las zonas petrolíferas todavía no explotadas 32. Y, después de haber eliminado a Estados Unidos, de haber suprimido su constitución democrática y de haber sometido el país a una Unión Norte-Americana33, el mencionado grupo de criminales internacionales tendrá el control total de América del Norte.

Hechos importantes contenidos en el dossier «June 10th Action» El dossier completo «June 10th Action» (Acción del 10 de junio) es un documento de 69 páginas34 en el que cada una de las acusaciones está apoyada con pruebas. Comprende: ― Un informe en el que presenta el calendario de hechos y actos objeto de la acusación, las definiciones y los papeles de la ONU y de la OMS, la relación de sucesos e incidentes desde el lanzamiento del foco de «gripe porcina» el mes de abril de 2009. ― La prueba de que las vacunas contra la «gripe porcina» deben ser consideradas como armas biológicas, tal como las describen los organismos gubernamentales que reglamentan restrictivamente las vacunas, y el temor de los países extranjeros de que la vacuna contra la «gripe porcina» sea utilizada con fines de guerra biológica. ― Las pruebas científicas de que el virus de la «gripe porcina» es un virus artificial (genético). ― Las pruebas científicas de que la «gripe porcina» ha sido elaborada por bioingeniería con el fin de que se parezca a la gripe española de 1918. El dossier presenta citas del texto Swine Flu 2009 is Weaponizes 1918 Spanisch Flu, de A. True Ott 35, Ph.D., ND, así como el informe del Dr. Jeffrey Taubenberger y otros, publicado en Science Magasine. ― La secuencia del genoma de la «gripe porcina». ― La prueba de la difusión deliberada de la «gripe porcina» en Méjico. ― La prueba de la participación del Presidente Obama, cuyo viaje a Méjico coincidió con la propagación reciente del foco de «gripe porcina» y con la muerte de varios funcionarios que le acompañaron en el viaje. Se afirmó que el Presidente no había sido afectado por la «gripe porcina» porque había sido vacunado previamente 36. ― La prueba del papel de Baxter y de la OMS en la producción y la liberación de material viral propicio a crear una pandemia, así como la declaración de un miembro del personal de la Soc. Baxter indicando que el virus H5N1, accidentalmente liberado en la República Checa, fue recibido por un centro asociado a la OMS. El dossier presenta las pruebas y acusaciones que Burgermeister presentó en abril, en Austria, y que en la actualidad se están estudiando. ― La prueba de que Baxter forma parte de una red clandestina de utilización de armas biológicas. ― La prueba de que Baxter ha contaminado deliberadamente la vacuna. ― La prueba de que Novartis utiliza vacunas como armas biológicas. ― La prueba del papel de la OMS en el programa de armas biológicas. ― La prueba de la manipulación realizada por la OMS respecto a los datos sobre la enfermedad con el fin de justificar la declaración de «Nivel 6» de pandemia con el objetivo de tener el control de Estados Unidos. ― La prueba de la implicación de la FDA 37 para enmascarar el programa de armas 32 .- ¡Ajá! ¡De eso se trata…! ¡Hábil engaño para apoderarse de un verdadero «botín de guerra…»

33 .- El dossier de pruebas (June 10th Action) de Jane Burgermeister, que ha servido de base a la redacción del presente artículo de Barbara Minton, precisa que América del Norte, una vez sometida, será obligada a utilizar la moneda prevista para sustituir al dólar (próximamente): el «Amero».

34 .- Ese mismo dossier, «June 10th Action», está disponible en inglés en http://www.rense.com/general86/lat.htm 35 .- Este importante artículo de la Dra. True Ott (traducido al francés) ha sido incluido en el presente dossier.

36 .- Se trata seguramente de otro cóctel de vacunas distinto al de la «Gripe Baxter». ¿Quién puede creer que Barack Obama se dejó inocular una mezcla mortal destinada al «pueblo llano»?

37 .- FDA (Food and Drug Administration): organismo norteamericano muy poderoso cuya función principal consiste en otorgar o rechazar las autorizaciones que permiten poner en el mercado los productos alimenticios

262.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

biológicas. ― La prueba del papel del Laboratorio Nacional Canadiense de Microbiología en el programa de armas biológicas. ― La prueba de la participación de algunos científicos que trabajan para el organismo británico NIBSC y para la CDC38 en la ingeniería de la «gripe porcina». ― La prueba de que la gripe española de 1918 fue causada por una vacunación masiva, incluyendo el informe del Dr. Jerry Tennant, convencido de que la utilización generalizada de la aspirina durante el invierno siguiente a la finalización de la Primera Guerra Mundial podría haber sido un factor que contribuyera a la proliferación de la pandemia en sus comienzos, al suprimir el sistema inmunitario y bajar la temperatura corporal, lo que permite al virus de la gripe multiplicarse. El Tamiflu y el Relenza bajan igualmente la temperatura corporal y, en consecuencia, pueden igualmente facilitar la propagación de una pandemia39. ― La prueba de las manipulaciones del marco reglamentario con el fin de permitir masacres masivas con toda impunidad. ― Cuestiones constitucionales concernientes a: ― La legalidad e ilegalidad de poner en peligro la vida, la salud y los bienes públicos por medio de vacunaciones en masa. ― Las cuestiones de inmunidad y de indemnización, como prueba de la intención de cometer un crimen. ― La prueba de la existencia de un sindicato internacional de empresas criminales. ― La prueba de la existencia de los «Illuminati»40. y farmacéuticos. «La FDA es el perro guardián de la industria farmacéutica, la protege de todo ataque y destruye a su concurrencia con el pretexto de proteger al público.» Dr. P. Carter MD, autor de “Racketeering in medicine, the suppressionof alternatives”. Cf. http://expovaccins.over-blog.com/article-32876226.html 38 .- CDC (Centres for Disease Control and Prevention): «Centros de control y de prevención de enfermedades», de Estados Unidos, cuyo cuartel general se encuentra en Atlanta (Georgia). En conjunto, constituyen la principal agencia de referencia gubernamental americana en materia de protección de la salud y de la seguridad pública. Es el organismo de referencia en la publicación de cifras americanas relativas a las personas infectadas par la gripe A(H1N1). Proporcionan información a la población y orientan las líneas de acción relacionadas con la salud, en colaboración con los departamentos de salud de diferentes Estados y otras organizaciones. NIBSC (National Institute for Biological Standard and Control): Instituto británico constituido por un pequeño grupo de centros de gripe alrededor del mundo. Es responsable, entre otros, de la producción, control y distribución de lotes de semillas virales y de los reactivos necesarios a las vacunas.

39 .- Respecto a esto, remítase a la nota nº 10.

40 .- Los Illuminati «son una élite dentro de la élite» que se reúne en el seno de una organización secreta fundada en su forma actual en el siglo XVII. En su origen, su proyecto era cambiar radicalmente el mundo, aniquilando el poder de los regímenes monárquicos que, en aquella época, obstaculizaba el progreso de la sociedad y de las ideas. La Revolución Francesa y la fundación de Estados Unidos surgieron como resultado de su estrategia. Para los Illuminatti, la democracia política era un medio y no un fin en sí. Según ellos, el pueblo es por naturaleza ignorante, estúpido y potencialmente violento. El mundo debe pues ser gobernado por una élite instruida. Con el tiempo, los miembros de ese grupo pasaron del estatuto de conspiradores subversivos al de dominadores implacables, cuyo objetivo esencial era conservar su poder. El término “Illuminati” significa literalmente “los iluminados” (del latín “illuminare”: iluminar, conocer, saber.) Su símbolo está presente en los billetes de 1 dólar: una pirámide, cuya cumbre (la Élite) está iluminada por el ojo de la consciencia, y domina una base ciega, hecha de ladrillos idénticos (la población). Las dos menciones en latín son muy significativas.

“NOVUS ORDO SECLORUM” significa “nuevo orden para los siglos”. En otras palabras: nuevo orden mundial. Y “ANNUIT COEPTIS” significa: “nuestro proyecto será coronado por el éxito”. Un proyecto hoy en día próximo a su realización final. Fuente: http://www.syti.net/Organisations.html Y también: Los Illuminati: «Hombres que han aceptado el plan luciferino. Este término deriva de la palabra Lucifer, que significa «Portador de Luz». Los Illuminati fueron creados y organizados con el fin de ejecutar las inspiraciones recibidas de Lucifer por los Grandes Sacerdotes durante la celebración de sus Ceremonias Cabalísticas. Ese término fue empleado por los maniqueos (los que creen que el bien y el mal son iguales y se oponen el uno al otro), y fue después retomado por los Rosa-Cruces. Los Illuminati fueron fundados el 1 de mayo de 1776 por un tal Weishaupt, que por entonces tenía 38 años y era profesor de Derecho en la universidad de Ingolstadt, en la región de Baviera, Alemania. Quería incorporar de la Masonería el Nuevo Orden Mundial, del que Lucifer sería el dueño.

Su filosofía fundamental era que había que destruir todas las religiones, toda la sociedad existente y abolir la propiedad para establecer un Nuevo Orden, una especie de paraíso en el que todos los hombres sería iguales y felices. Los Illuminati son miembros de las logias del Gran Oriente que han sido iniciados en «la Orden y la secta de los Illuminati». Son un pequeño pero poderoso grupo que se compone, en su cúpula, de banqueros internacionales, industriales, hombres de ciencia, dirigentes militares y políticos, educadores, economistas, etc. Fuente: http://marie.roca.over-blog.com/article-21648626.html

263.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

― La prueba de un programa de despoblación puesta en marcha por el grupo Illuminati/Bilderberg41 y la implicación de estos últimos en la ingeniería y la liberación de un virus artificial de «gripe porcina». ― La prueba de que las armas de diseminación de la gripe fueron objeto de debate durante la reunión anual de Bilderberg en Atenas, del 14 a 17 de mayo 2009, en el marco de su programa de genocidio, con la lista de participantes que, según una declaración realizada por Pierre Trudeau, se consideran genéticamente superiores al resto de la humanidad 42.

Barbara Minton Jane Burgermeister: Periodista de temas científicos, vive en Viena, Austria. Tiene la doble nacionalidad austriaca e irlandesa. Corresponsal europea de «Renewable Energy World.com» escribe también para la revista Nature, para el British Medical Journal y American Prospec’t, principalmente sobre el cambio climático, la biotecnología y la ecología. Como el control de los medios de comunicación por la élite en el poder ha permitido sumir a la mayoría de la población en la ignorancia de lo que ocurre realmente, al presentar una denuncia por asesinatos en masa trata de eludir el control de dichos medios a fin de que el asunto se haga público.

«Estamos al borde de una transformación global. Todo lo que necesitamos es una crisis importante, apropiada, y las naciones aceptarán el Nuevo Orden Mundial.»

David Rockefeller, el 23 de septiembre de 1994 «La crisis, como todas las crisis, cuando son provocadas tienen la ventaja de permitir que se voten leyes que, en un contexto de una paz relativa, jamás habrían sido votadas.»

Naomi Klein «La despoblación debería constituir la más alta prioridad de la política extranjera de Estados Unidos respecto al Tercer Mundo.»

Henri Kissinger, citado por Leuden Moret en http://www.rense.com/general59/Kissingereugenics.htm

41 .- El Grupo Bilderberg. «Una poderosa red de influencia: El Grupo Bilderberg fue fundado en 1954 en el hotel Bilderberg, en Osterbeek (Países Bajos) ―de ahí su nombre― por iniciativa del príncipe de Holanda Bernhard, antiguo oficial de las SS, y el riquísimo David Rockefeller. El Grupo Bilderberg, concebido en su origen como una «alianza anti-comunista oculta» sigue siendo una de las más poderosas redes secretas de influencia. Muy estructurado, el Grupo Bilderberg está, según ciertas fuentes, organizado en tres círculos concéntricos. El “círculo exterior” es bastante amplio y comprende el 80 % de los participantes en las reuniones. Los miembros de ese círculo no conocen más que una parte de las estrategias y de los objetivos fundamentales de la organización. El segundo círculo, mucho más cerrado, es el Steering Comité (Comité de Dirección). Está constituido por unos 35 miembros, exclusivamente europeos y norteamericanos. Conocen el 90 % de los objetivos y estrategias del Grupo. El círculo central es el Bilderberg Advisory Comité (Comité consultivo).

Comprende una decena de miembros, son los únicos que conocen íntegramente las estrategias y los objetivos concretos de la organización. Para los que investigan sobre las redes de poder, el Grupo Bilderberg es un verdadero «gobierno mundial en la sombra». En el curso de sus reuniones, se toman decisiones estratégicas esenciales al margen de las instituciones democráticas en los que esos debates deberían normalmente tener lugar.» Artículo aparecido en la página web de Initiative Citoyenneté Défense, julio de 2008. Disponible igualmente en http://www.reopen911.info/News/2008/12/02/groupe-debilderberg-une-elite-qui-se-cachepor-diriger-lemonde/ 42 .- Los Illuminati (cuyo origen hay que buscarlo en las diversas escuelas esotéricas creadas a partir del siglo XVI) no habrían sin duda renegado de esta declaración del Sr. Trudeau. Por otro lado, el Dr. Leonard Horowitz, en el artículo que aparece en este dossier, manifiesta lo siguiente: «John D. Rockefeller se unió a Prescott Bush (el abuelo de George W. Bush) y a la familia real inglesa para financiar las iniciativas «de mejora de la raza» que dieron nacimiento a los programas «eugenésicos» de Adolf Hitler.»

264.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Informaciones, anotaciones y extractos de textos Gripe aviar o porcina y «Nuevo Orden Mundial» Por el Dr. Leonard G. Horowitz43

Mientras las formas ordinarias de gripe matan alrededor de 40.000 norteamericanos cada año, si la gripe aviar (que ha causado hasta ahora menos de 100 muertos) se está convirtiendo realmente en una pandemia temible será debido a una deliberada voluntad política. El Dr. Leonard G. Horowitz (experto internacional en materia de salud pública, de ciencias del comportamiento, de enfermedades nuevas y de terrorismo bacteriológico, diplomado de Harvard) demuestra que un “bioterrorismo” de Estado es perfectamente compatible con una guerra bacteriológica llevada a cabo por un Estado y sus industrias afines, con ayuda de los medios de comunicación que ellos mismos controlan. Después de leer este artículo estaremos mejor informados respecto al próximo genocidio “médicamente asistido” que están tramando… ¿Gripe porcina o aviar? ¡El objetivo es meternos miedo y hacer que nos vacunemos! Léalo hasta el final.

Si la gripe aviar se convierte realmente en una pandemia temible será debido a una deliberada voluntad política. Este artículo ayudará a que estemos mejor informados respecto al próximo genocidio “médicamente asistido”, ¡y confiemos en que el Señor nos proteja! En abril de 2003 tuvimos conocimiento de la SARS (Severe Acute Respiratory Disease, SRAS en francés) o neumonía atípica. Esta enfermedad procedía igualmente de Asia y afectó a numerosas personas en la región de Toronto. Yo estuve allí durante casi todo el tiempo que duró la epidemia, que fue un anticipo de la gripe aviar actual. Se dijo entonces que la SARS era la última de toda una serie de enfermedades nuevas, provocadas por una serie de misteriosos “super-gérmenes” mutantes que afectarían a la humanidad.

Un estudio científico atento de las características médico-sociológicas y de los antecedentes de esta epidemia reveló algo mucho más insidioso que la SARS propiamente dicha. Yo consideré la reacción de los medios de comunicación como debe considerarlo cualquier diplomado de Harvard, experto en problemas de salud pública y en técnicas psicológicas de persuasión. Porque la epidemia tenía todas las características de una nueva experimentación social dirigida por “bioterroristas” de blusa blanca.

Me pareció claro que esa manipulación humana sin precedentes estaba destinada a adoctrinar a las masas y a manipularlas sutilmente para que apoyaran una política de salud pública absolutamente inadaptada a la llegada de una pandemia, a pesar de la legislación existente (1). A lo largo de toda la epidemia de “neumonía atípica”, los medios de comunicación no dejaron de referirse a unos “agentes bacteriológicos” nuevos que podrían provocar la desaparición de la tercera parte de la población mundial. Como había estudiado a fondo todo cuanto había sido publicado hasta el momento en materia de control de la población, así como los objetivos actuales de las principales sociedades industriales multinacionales, observé que esas “predicciones” se correspondían estrechamente con ciertos objetivos oficiales en materia de reducción de la población mundial (2).

En 2003, la lucha llevada a cabo en Canadá contra la SARS, por primera vez en la historia de ese país, fue dirigida directamente por las Naciones Unidas y por la Organización Mundial de la Salud (OMS). Dado que había descubierto los estrechos vínculos que existían ―en el aspecto financiero y administrativo― entre los organismos que se citan a continuación, constaté que la familia Rockefeller, la Fundación Carnegie y los principales dirigentes de la industria farmacéutica mundial controlaron la investigación canadiense y la 43 .- Este artículo fue escrito en 2005, cuando surgió el riesgo de epidemia de gripe aviar. Por desgracia, sigue estando de absoluta actualidad.

265.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

lucha llevada a cabo en Canadá contra esa epidemia.

Ninguna gran pandemia, o epidemia a escala mundial, ha podido nunca ser separada de su contexto económico y político. La epidemia de neumonía atípica hizo avanzar el programa político del Nuevo Orden Mundial mucho más deprisa que cualquier otro problema de salud pública. Si los responsables políticos de salud pública quisieran realmente prevenir las epidemias nuevas que se producen regularmente, o si quisieran verdaderamente tratarlas en su origen, no podrían dejar de observar que los agentes bacteriológicos devastadores aparecen siempre misteriosamente en el seno de estructuras secretas en las que se encuentran asociados ciertos medios militares, médicos y biotecnológicos. Basta estudiar la sociología médica, simplemente, para darse cuenta de ello.

Hace decenios que ciertos “expertos” nos predicen la llegada próxima de una superepidemia devastadora. Lo que suscitó sobre todo mis dudas, en lo que concierne a la neumonía atípica, fue el momento en que sobrevino. Sobrevino en el mismo momento en que fue lanzada la guerra total contra el terrorismo y la guerra angloamericana contra Irak.

Me pareció que se trataba de una ocasión ideal para “distraer” la opinión pública del hecho de que la administración Bush había acusado a Saddam Hussein de acumular un arsenal impresionante de armas bacteriológicas, entre ellas el ántrax y el virus del Nilo. La epidemia de neumonía atípica era pues característica de lo que yo ya había anunciado en uno de mis libros, de título profético, publicado antes de los ataques del 11 de septiembre (Death in the air: Globalism, Terrorism y Toxic Warfare, Tetrahedron Publishing Group, 2001. Muerte en el aire: Globalización, terrorismo y guerra química). Varios meses antes de esos ataques, los había anunciado presentando el análisis conceptual que nos permitía comprender la relación existente entre las nuevas epidemias y el Nuevo Orden Mundial. Para resumir lo esencial del libro, explicaba en él cómo una cierta forma de “bioterrorismo” de Estado era perfectamente compatible con una guerra bacteriológica oficialmente llevada a cabo por un Estado. El mismo Saddam Hussein había sometido a algunas poblaciones de Irak y de los Estados vecinos a los efectos destructores de las armas químicas y bacteriológicas. Para mí está claro que la neumonía atípica, como la gripe aviar actual, se han producido con el consentimiento y el apoyo de ciertos medios de las industrias médicas, farmacéuticas, petroquímicas y militares, operando de manera ilegal. Lo he podido demostrar en numerosas circunstancias. Dado que tuve ocasión de presentar mi testimonio ante el Congreso Americano, pude darme cuenta directamente de qué manera la industria farmacéutica influye y controla a nuestros representantes económicos y políticos a nivel del gobierno. Las epidemias emergentes completan los efectos de la guerra política contra el terrorismo y corresponden a nuestra cultura actual, influenciada por el bioterrorismo. Semejante programa secreto responde a dos objetivos esenciales: la búsqueda de beneficio económico y la reducción de la población mundial.

Realidad política contra los mitos transmitidos por los medios de comunicación La locura creciente del mundo que nos rodea va extrañamente a la par con las recomendaciones de los pensadores del Nuevo Orden Mundial, que favorecen los “desastres sin guerra”. ¿De qué se trata exactamente? Desde finales de los años 60, en los principales medios industriales, se empezó a reflexionar sobre “sustitutos económicos a la guerra clásica”. Comparados con los efectos de la Primera y Segunda Guerras Mundiales, los daños que podrían ser provocados por los desastres naturales, los super-huracanes, las epidemias o las guerras bacteriológica y genética, empezaron a aparecer como política y económicamente “rentables”. Los “desastres sin guerra” eran evidentemente mucho más “gestionables” políticamente y más “rentables” económicamente. Por esas razones, y en especial por su rentabilidad económica, los dirigentes políticos anglo-americanos del Nuevo Orden Mundial consideraron los “desastres sin guerra” como opciones de primera clase.

266.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Por ejemplo, el protegido de Nelson Rockefeller, Henry Kissinger, como Consejero de Seguridad Nacional en el gobierno de Richard Nixon, dirigió la política exterior de Estados Unidos considerando, de hecho, la reducción de la población mundial como una “necesidad” para Estados Unidos, Gran Bretaña y sus aliados. Es ese mismo Kissinger quien fue nombrado por George W. Bush para presidir el «Comité de encuestas sobre los acontecimientos del 11 de septiembre». Kissinger es, sin embargo, un criminal de guerra reconocido, que ordenó a la CIA desarrollar armas bacteriológicas, según aparece en los archivos del Congreso Americano de 1975. Entre esas armas bacteriológicas fabricadas por el hombre ¡existen gérmenes mucho más mortíferos que el de la gripe aviar!

Por ejemplo, antes de 1968, Kissinger ordenó una investigación concerniente a los agentes bacteriológicos sintéticos existentes que podrían ser utilizados en materia de guerra bacteriológica y de control de la población mundial. Pues bien, un equipo de investigadores (O’Conner, Steewart, Kinard, Rauscher y otros) acababan justo de fabricar en laboratorio nuevos virus mutantes de la gripe capaces de propagar ciertos tipos de cáncer (3). Con ocasión de ese programa, algunos virus de la gripe fueron combinados artificialmente con otros virus de leucemia aguda para fabricar, literalmente, nuevos gérmenes capaces de extender el cáncer a la velocidad de una epidemia de gripe por simple contacto directo con las personas infectadas. Esos mismos investigadores manipularon también algunos virus de cáncer de pollo, un sarcoma, para inocularlo en monos y en hombres con el fin de probar su capacidad para producir cáncer en estos últimos. Rauscher y otros emplearon también radiaciones para aumentar la potencia del virus del cáncer de pollo. Estos hechos científicos increíbles han sido oficialmente reconocidos, pero ampliamente ignorados por los principales medios de comunicación […]

Los “conflictos sin guerra” tales como la “guerra contra el SIDA”, “contra la droga”, “contra el terrorismo”, “contra el cáncer” y, actualmente, la “guerra contra la gripe aviar” requieren programas de propaganda muy sofisticados, que utilizan unas campañas cuyo objetivo es sembrar el temor en el seno de la opinión pública con el fin de que acepte y apoye unas leyes que supriman las libertades públicas. Esas operaciones psicológicas son necesarias para controlar los “conflictos sin guerra” y constituyen la característica esencial de la nueva “revolución militar” en curso.

La “revolución militar” en cuestión trata de instaurar una nueva forma de esclavitud humana, por medio de la cual las poblaciones ¡no se den siquiera cuenta de que están siendo sometidas a esclavitud! (2). La nueva “revolución militar” requiere, sin lugar a dudas, armas bacteriológicas y químicas muy potentes, que ponen en circulación los fabricantes de vacunas y de medicamentos, quienes, por su parte, obtienen de ello pingües beneficios.

Existe un ejemplo clásico: el de los pesticidas, muy tóxicos y cancerígenos, ampliamente utilizados en zonas habitadas con el pretexto de erradicar los mosquitos responsables de la “fiebre del Nilo”. Dichos productos no son directamente mortíferos, en términos militares, pero actúan a largo plazo provocando la muerte por envenenamiento crónico, lo cual genera aún más beneficios a las sociedades farmacéuticas encargadas de inventar nuevos medicamentos para luchar contra esas enfermedades. Las víctimas de las campañas de erradicación de los mosquitos mueren poco a poco de enfermedades crónicas que les debilitan progresivamente. Los consultorios y hospitales construidos para tratar a esos enfermos no son sino campos de concentración virtuales.

Entre las enfermedades nuevas provocadas artificialmente figura un gran número de las que afectan al sistema inmunitario, así como numerosos tipos de cáncer prácticamente desconocidos hace 50 años. Este simple hecho, por sí solo, basta para sugerir la existencia de un verdadero genocidio socio-económico programado por ciertas autoridades políticas.

267.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

¡Una gripe que proporciona pingües beneficios!

Ante la epidemia de neumonía atípica, Michael Fumento, investigador del Instituto Hudson de Washington, publicó en Toronto una tesis económica que se parece a la que desarrollo en este artículo. Fue publicada en el Canadian National Post. Se pidió a los canadienses que se pusieran ellos mismos en cuarentena, que llevaran mascarillas y que, en ciertos casos, se quedaran en casa. El Ministro de la Salud de Ontario decretó el “estado de urgencia sanitaria”, mientras los medios de comunicación hablaban de la “super-neumonía, esa asesina misteriosa”. No queriendo dejarse ganar por la histeria colectiva, Fumento planteó una cierto número de auténticas preguntas. ¿La epidemia era realmente tan mortal y tan contagiosa como se decía? Concluía en estos términos: “Las respuestas a estas preguntas no dejan lugar alguno para la excitación, y menos aún para el pánico”. Podría decirse otro tanto respecto a la nueva epidemia de gripe aviar (1). […] Con el fin de fabricar una vacuna específica contra un virus mutante transmisible al hombre, como el H5N1, en primer lugar tendría que existir dicho virus. Pues bien, actualmente no existe, excepto, tal vez, en algunos laboratorios del complejo militar-médico-farmacéutico. De hecho, según las informaciones de las que dispongo, eso es exactamente lo que se está preparando en secreto. Para preparar un virus transmisible al hombre, hay que cultivar el virus de la gripe aviar durante bastante tiempo, mezclándolo con cultivos de células humanas. Después hay que inyectarlo en monos, después en seres humanos para comprobar si esos sujetos atrapan el nuevo virus fabricado en laboratorio. Así que, ese nuevo virus que el mundo teme tanto • •

1) o bien se está fabricando en unos laboratorios financiados por industriales fuertemente motivados para dejar que se extienda “accidentalmente”, 2) o bien ya ha sido fabricado en esos mismos laboratorios previendo que, debido al pánico mundial creado, la lucha contra dicho virus aportará enormes beneficios.

Hay que saber que para que una vacuna sea realmente eficaz contra un virus, debe ser específica. Si las autoridades quisieran de verdad difundir el virus humano de la gripe aviar H5N1 en una futura fecha concreta, no tendrían ninguna garantía seria de que la vacuna producida en paralelo fuera eficaz en esa misma fecha, teniendo en cuenta las mutaciones virales posibles. En efecto, la rapidez de las mutaciones virales depende de lo nuevo que sea el virus. Los nuevos virus fabricados por el hombre y creados en laboratorio ―como los que se producen en la actualidad para preparar una vacuna― son mucho menos estables que los que han evolucionado naturalmente a lo largo de miles de años. Por esa razón, los esfuerzos actuales para preparar una vacuna son como echar arena a los ojos. Las verdaderas motivaciones permanecen ocultas.

Hay que saber también que la eficacia de una vacuna requiere años o, al menos, varios meses de controles y verificaciones en el seno de la población afectada. Durante ese periodo, se deben reunir cuidadosamente todas las informaciones sobre los efectos secundarios o los accidentes terapéuticos provocados por la vacuna, ¡con el fin de asegurarse de que no mata o no pone enfermas a más personas de las que pretende salvar! ¿Cree usted seriamente que el gobierno, o la industria farmacéutica, pueden reunir todas esas garantías en medio de la histeria provocada por la actual “pandemia”? ¡La desastrosa reacción de las autoridades frente al huracán Katrina parecerá buena comparada con el desastre sanitario, cierto, que provocará una vacuna mal probada y unas medidas de salud pública inadaptadas!

Hablo de desastre cierto porque tenemos precedentes. Es larga la lista de vacunas preparadas apresuradamente que, una vez en el mercado, han tenido consecuencias terribles para los seres humanos. Puedo citar la primera vacuna contra la peste porcina, las vacunas contra la polio, la vacuna contra la varicela, contra el ántrax, la vacuna contra la hepatitis B y, recientemente, la vacuna contra la enfermedad de Lyme, ¡que ha dejado con 268.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

minusvalías a casi 750.000 personas, en unos meses, antes de ser retirada del mercado por las autoridades!

La mayoría de la gente ignora que todas las vacunas contienen una serie de ingredientes que son perjudiciales para la salud, incluso mortales.

Entre esos ingredientes, se pueden citar los siguientes: productos químicos tóxicos, como mercurio, aluminio, formaldehído y formol (empleados para conservar los cadáveres), productos genéticos extraños al hombre, proteínas de alto riesgo procedentes de ciertas especies de bacterias, de virus o de animales, que han sido científicamente asociados al desencadenamiento de algunas enfermedades del sistema inmunitario o de determinados tipos de cáncer. Disponemos de hechos científicos cada vez más abundantes que tienden a demostrar que las vacunas son en gran parte responsables de numerosas enfermedades, como el autismo, la fatiga crónica, la fibromialgia, el lupus, la esclerosis en placas, la artritis reumatoide, el asma, la fiebre del heno, las infecciones crónicas de oído, la diabetes de tipo 1, y otras muchas enfermedades más. Son enfermedades crónicas, debilitantes, que necesitan tratamientos a largo plazo, los cuales entrañan a su vez numerosos efectos secundarios. De hecho, la principal causa de mortalidad en Norteamérica se debe a enfermedades iatrogénicas, es decir, a enfermedades producidas por el propio sistema médico, o contraídas en su seno. Eso significa que las vacunas, como otras muchas invenciones de la industria farmacéutica, producen lesiones y matan, literalmente, a millones de personas sin que el gobierno ni la industria intervengan para detener esa plaga.

Según lo que sabemos, son los gobiernos los que están fabricando una vacuna contra la gripe aviar cuyo efecto será precisamente extender la pandemia en el mundo entero con el fin de reducir la población mundial. ¿Le parece absurda esa hipótesis? Entonces, siga leyendo. Business Week cree que la acumulación de vacunas por parte de los gobiernos no puede sino beneficiar a las sociedades farmacéuticas, como Sanofi-Pasteur, Sanofi-Aventis o Chiron. Se considera que el Tamiflu, un antiviral fabricado por Roche, sería eficaz contra la gripe aviar. Estados Unidos posee ya 4,3 millones de dosis de Tamiflu y están en marcha otros encargos. He aquí, sin embargo, lo que no ha revelado Business Week: la eficacia y la inocuidad del Tamiflu no han sido probadas en la población que sufre enfermedades crónicas, que es el caso de una buena parte de la población norteamericana. Obsérvese también que ese medicamento provoca numerosos efectos secundarios: náuseas, vómitos, diarreas, bronquitis, dolores gástricos, aturdimiento, dolores de cabeza, etc.

En 1999, los laboratorios Roche (Hoffman-LaRoche) fueron reconocidos culpables de malversación en lo que concierne al suministro de vitaminas en el mercado mundial.

Roche pertenece a un cártel petroquímico y farmacéutico procedente del I.G. Farben, uno de los pilares industriales de la Alemania nazi (2) (6). Uno de los socios industriales de Sanofi-Aventis es la Sociedad Merck. Cuando se distribuyeron los despojos de la economía nazi al final de la Segunda Guerra Mundial, esta empresa recibió la parte del león. El volumen de negocio de la Sociedad Merck se redujo enormemente el año pasado, cuando tuvo que retirar del mercado uno de los medicamentos de la lucha contra la artritis, el Vioxx, de efectos devastadores. Según informes recientes, Merck y Sanofi-Aventis trabajan en la actualidad en la producción de la primera vacuna contra un cáncer sexualmente transmisible, vacuna destinada a las adolescentes (7). Merck es también tristemente célebre por haber producido la primera vacuna contra la hepatitis B, responsable del desencadenamiento de la epidemia de SIDA, según informes científicos que he publicado en uno de mis libros, que es actualmente un best-seller (3) (8).

A lo largo de las semanas y meses que siguieron a los ataques del 11 de septiembre en Estados Unidos, conseguí demostrar que los correos que contenían ántrax provenían de empresas que producían armas bacteriológicas, las cuales habían firmado contratos con la 269.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

CIA; y, también, que tenían vínculos con los servicios secretos ingleses y con el cártel angloamericano ya citado (9). Los correos cargados con ántrax provocaron en toda Norteamérica un vivo temor al terrorismo bacteriológico, de lo que se aprovecharon ampliamente los fabricantes de vacunas y de productos farmacéuticos, los mismos que están ahora asociados con los que se benefician de la gripe aviar (10). Ante tal temor, la mayoría de la gente no duda en renunciar a sus derechos civiles y a sus libertades individuales. Haber aprobado en Estados Unidos la escandalosa ley sobre Seguridad Nacional (Home Security Act), y una ley similar en Canadá, son ejemplos candentes de esa deriva social y de la manipulación a gran escala que conduce a una legislación coercitiva. ¿Por qué Asia?

En el momento en que las relaciones entre China, por un lado, y Gran Bretaña y Estados Unidos, por otro, son bastante tensas ―es lo menos que se puede decir―, resulta bastante oportuno que la gripe aviar provenga de Asia, lo mismo que la reciente neumonía atípica. Justo antes de que se presentaran los primeros casos de neumonía atípica, Estados Unidos tuvo que hacer frente a una escalada de agresiones en la península de Corea. La China comunista ―país declarado “socio comercial privilegiado” de Estados Unidos a pesar de todo―, está políticamente aliado con varios enemigos de Norteamérica, incluyendo algunos de los que, en aquella época, se suponía que disponían de armas de destrucción masiva, como Irak. ¿Simple coincidencia? Probablemente no. Basta tener en cuenta a la oligarquía anglo-americana, sus empresas multinacionales y sus “conflictos sin guerra” artificialmente provocados.

Considere también el hecho de que los principales medios de comunicación estaban fuertemente influenciados ―por no decir que totalmente controlados― por las multinacionales que los financiaban, y defendían los intereses de un número relativamente restringido de empresas y organismos multinacionales. No olvide tampoco que los que facilitan las noticias siguen las directrices de los servicios de información, según numerosos testimonios de respetables funcionarios y agentes de información retirados. Así que no estaría de más que usted se planteara las siguientes inteligentes preguntas, y que aportara a ellas una respuesta: ― ¿Por qué los altos responsables de la Defensa Norteamericana, a comenzar por William Cohen, Secretario de Defensa con Bill Clinton, dieron tanta publicidad a la pretendida vulnerabilidad de Estados Unidos en materia de terrorismo bacteriológico? ¿No es una forma de alta traición desvelar a la prensa “secretos de defensa” tan importantes, que podrían ser explotados por potenciales enemigos del país? ― ¿Por qué los principales medios de comunicación continúan prediciendo la llegada de una pandemia mundial causada por un virus gripal humano que provocará millones de muertos, como la llamada “gripe española” en 1918-1919? ― ¿Por qué esos mismos medios de comunicación no hablan de hechos indudables concernientes a los individuos, las organizaciones o los laboratorios que trabajan para producir esos agentes de destrucción masiva? ¡Incluso se ha hecho todo lo posible por “desterrar” el virus de la gripe española, supuestamente para estudiarlo y, eventualmente, expandirlo de nuevo44! ― ¿Por qué se dice que el virus de la gripe española apareció en el Tibet en 1917, según datos históricos oficiales? Se ha dicho que los periódicos españoles fueron los únicos que publicaron algunos artículos concernientes a esta gran epidemia debido a su neutralidad en el curso de la Primera Guerra Mundial. Sin embargo, las relaciones entre España y Estados Unidos en aquella época no eran mejores que las que existen hoy en día entre Estados Unidos y la China comunista. Se decidió bautizar aquella epidemia como “gripe española” después de dos decenios de disputas entre América y España a propósito de la colonización 44 .- Léase respecto a esto el artículo de la Dra. A. True Ott, en este mismo dosier.

270.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

del Caribe, Hawai y las Filipinas, después de la guerra hipano-americana, que terminó en 1902 con la pérdida de Filipinas. En realidad, la gripe española había empezado en los campos militares. ¿No se está repitiendo la Historia? ― ¿No está claro que Norteamérica está siendo manipulada y que es sin duda víctima de los planificadores del Nuevo Orden Mundial? ¡No olvide que una de las prioridades de esos planificadores es la reducción de la población mundial!

La gran pandemia anunciada Afirmo de nuevo que en el curso de los años 60 y 70, algunos laboratorios militares estrechamente vinculados con la industria farmacéutica fabricaron virus mutantes de la gripe y los combinaron con los virus de la leucemia aguda. En otras palabras, amontonaron cantidades considerables de virus de leucemia tan contagiosos como el de la gripe (3). Por otra parte, numerosos expertos en enfermedades infecciosas o altos responsables de la salud pública, aparentemente olvidadizos de esa realidad científica, afirman que la gripe aviar actual podría ser la “gran pandemia” predicha. Hace algunos días, las Naciones Unidas publicaron un informe en el que declaraban que, debido a la gripe aviar, podrían morir 150 millones de personas en todo el mundo. Emma Ross, periodista de la «Associated Press» había publicado unos artículos sobre la manera en que la OMS había lanzado su “plan de crisis para erradicar la epidemia de neumonía atípica”. Usted sabe sin duda que la OMS es una de las organizaciones que dependen de la ONU y que ha sido acusada de extender el SIDA en África bajo la apariencia de campañas de vacunación contra la hepatitis B y la poliomelitis. Existen hechos concretos que apoyan esta acusación (1).

Estremece saber que las Naciones Unidas están fuertemente influenciadas por ciertos miembros de la familia Rockefeller, que poseen intereses en las industrias petroquímicas y farmacéuticas. Se sabe que la sede de las Naciones Unidas en Nueva York fue construida gracias a la fortuna de Rockefeller. En el curso de la Segunda Guerra Mundial, fueron también los Rockefeller ―y su “Standard Oil Company”― los que apoyaron a Hitler mucho más que a los Aliados. Esto ha sido reconocido ante los tribunales. Un juez federal decidió que Rockefeller había cometido “traición” a Estados Unidos. Después de la Segunda Guerra Mundial, según el abogado John Loftus, investigador oficial sobre los crímenes nazis, Nelson Rockefeller convenció a las naciones suramericanas para que votaran a favor de la creación del Estado de Israel con el único objetivo de desviar la atención respecto al hecho de que él había apoyado a los nazis.

John D. Rockefeller se unió a Prescott Bush (el abuelo de George W. Bush) y a la familia real inglesa para financiar las iniciativas de “mejora de la raza” que dieron nacimiento a los programas eugenésicos de Adolf Hitler. En el curso de ese mismo período, la familia Rockefeller monopolizó prácticamente la industria farmacéutica norteamericana, así como los laboratorios de lucha contra el cáncer y de investigación genética (2) (3). Hoy en día, la familia Rockefeller, la Fundación Rockefeller, las Naciones Unidas y la OMS son responsables de “programas demográficos” que apuntan a reducir la población mundial a un nivel considerado más “aceptable”. Como escribió Foreign Affaire, un periódico político prestigioso publicado por el CFR (Council on Foreign Relations), dirigido por David Rockefeller, el objetivo sería reducir la población de Estados Unidos en un 50 % (2). David Heymann, de la OMS, declaró, a propósito de la neumonía atípica: “Nunca nos habíamos encontrado con una epidemia tan generalizada, a tan gran escala”.

El Dr. Klaus Stohr, virólogo de la OMS, encargado de la coordinación internacional de los laboratorios, añadió: “Es la primera vez que una red mundial de laboratorios intercambia así informaciones, muestras, extracciones de sangre e imágenes. Frente a la urgencia sanitaria mundial ya no hay secretos, ni envidias, ni competición. ¡Es una red colosal! (1) ¡Las redes de vigilancia de las enfermedades infecciosas están también controladas por los 271.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Rockefeller!

Dr. Leonard Horowitz •

• •

•

Este artículo está disponible en francés en: http://mecanopolis.wordpress.com/category/virus-de-la-leucemie Original, disponible en inglés, en: www.bbsradio.com/bbc/leonard_horowitz_radio/bird_flu_commentary.shtml

A propósito del autor: El Dr. Leonard Horowitz es un experto internacional en materia de salud pública, de ciencias del comportamiento, de enfermedades nuevas y de terrorismo bacteriológico. Diplomado por Harvard, es miembro del equipo de investigadores de dicha universidad. Es conocido por varios libros de éxito, entre ellos un best-seller: “Emerging Viruses: AIDS & Ebola – Nature, Accident or Intencional?” (Los virus emergentes, SIDA y Ébola – ¿Naturales, accidentales o intencionados?) Este libro permitió la apertura de una investigación oficial en Estados Unidos para comprobar las hipótesis adelantadas por el Dr. Horowitz.

Sus trabajos concernientes a los riesgos asociados a las vacunaciones han empujado al menos a tres países en vías de desarrollo a modificar sus políticas en materia de vacunación.

El Dr. Horowitz tuvo ocasión de prestar un testimonio clamoroso ante el Senado de Estados Unidos. Una semana antes de los atentados con ántrax, había advertido oficialmente al FBI de esta amenaza concreta, pero no fue escuchado. Tres meses antes de los ataques del 11 de septiembre, había publicado su decimotercer libro titulado, de forma profética: “Death in the Air: Globalism Terrorism and Toxic Warfare” (Muerte en el aire: Mundialización, Terrorismo y Guerra bacteriológica). En ese libro, la emprende con el “cártel petrolero y farmacéutico”, al que acusa de preparar un nuevo genocidio programado.

Notas: 1) Horowitz LG. SARS (Severe Acute Respiratory Syndrome): A Great Global Scam (Una gran burla). Disponible en inglés en: http://www.healingcelebrations.com/SARS.htm 2) Horowitz LG. Death in the Air: Globalism Terrorism and Toxic Warfare, Sandpoint, ID: Tetrahedron Publishing Group, 2001.

3) Horowitz LG. Emerging Viruses: AIDS & Ebola – Nature, Accident or Intencional. Sandpoint, ID: Tetrahedron Publishing Group, 2001.

4) The Institute of Science in Society, SARS and Genetic Enginnering? London, England.

Artículo disponible en inglés en: http://tetrahedron.org/articles/health_risks/sars_eng...

5) Knox N. Europe braces for avian flu, USA Today, 9 octubre 2005. Manning A Government to stock up on avian flu shots. USA today, 8 octubre 2005.

6) Wang P. Avian Flu: Inoculate Your Portfolio. BusinessWeek. Edición on-line, disponible en inglés en: http://wwwbusinessweek.com/investo...

7) CNNMoney. Merck shares jump on cancer drug vaccine, 6 octubre 2005. Disponible en inglés en http://money.cnn.com/2005/10/06/new...

8) Para más informaciones sobre la relación entre la vacuna de la hepatitis B y la epidemia de SIDA, véase: http://www.originofAIDS.com 9) Horowitz LG. The CIA’s Role in the Ántrax Mailings: Coud Our Spies be Agents for MilitaryIndustrial Sabotage, Terrorism, and Even Population Control? Informe especial. Artículo disponible en inglés en: http://www.tetrahedron.org/articles...

10) Horowitz LG. DNA: Pirates of the Sacred Spiral. Sandpoint, ID: Tetrahedron Publishing Group, 2004.

272.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

¡La gripe porcina de 2009 es la gripe española de 1918! ¿Un arma bacteriológica?

Por la Dra. Alma True Ott45, PhD, ND La pandemia de «gripe española» de 1918-1919, que mató a entre 20 y 50 millones de personas, fue la pandemia infecciosa más terrible de la historia de la humanidad. Comprender los orígenes del virus de 1918 y las razones de su excepcional virulencia puede ayudarnos a predecir lo que podrían ser las futuras pandemias.

El informe inicial de Taubenberger46 permitió determinar que el virus mortal de 1918 era un nuevo virus porcino que se había «recombinado» con fragmentos de virus aviar (H5N1) y humano (H3N2) en la estructura misma de sus ARN. Taubenberger utilizó un programa de ordenador muy complejo para permitir la combinación de las estructuras ADN y ARN. Así es como consiguió reproducir, «resucitar» y hacer del «asesino» de 1918 una potente arma biológica seis años después, en 2003. Y, como él mismo había previsto en 1997, efectivamente, algunos canallas conspiracionistas situados en elevada posición podrían no solamente predecir futuras pandemias de gripe sino también desencadenarlas a voluntad a partir de frascos de laboratorio, con el fin de llevar a cabo sus programas socio-económicos. A todos los hombres, mujeres y niños del mundo entero concierne el hecho de que la llamada «gripe porcina», que ha infectado y matado a seres humanos en Méjico y en América del Norte durante los últimos meses, es un nuevo sub-tipo del virus A/H1N1 que nunca había sido detectado en los cerdos, ni en los seres humanos, como han confirmado por otro lado la Organización Mundial de la Salud (OMS) y los Centros de control de las Enfermedades (CDC) de Atlanta, Georgia. Este nuevo virus de la gripe H1N1 es una triple recombinación que comprende segmentos de genes de origen humano, porcino y aviar.

(Fuente: http://www.ncsl.org/?tabid=17089)

La pandemia viral de 1918 fue el resultado directo de la vacunación contra el tifus de millones de soldados en el curso de la Primera Guerra Mundial.

Fueron los laboratorios Rockefeller y unas fábricas situadas en China las que produjeron las vacunas contra el tifus (=typhus abdominal) en 1916, tras haber recolectado pus de personas infectadas. Los elementos infecciosos fueron inyectados en cerdos y después mezclados con albúmina de huevos de gallina para ser finalmente inyectados en forma de vacuna en seres humanos.

45 .- Dra. Alma True Ott, médico naturópata (Ph.D, ND), es también doctora en filosofía, especializada en el campo de la nutrición (diplomada del American College, de Washington DC), realizadora del vídeo «The Bird Flu Hoax» (La burla de la gripe), Directora de la publicación “Health is your Wealth” (La salud es su riqueza), creadora de la página web «Mother Earth Minerals», autora de «Wellness Secrets for Life» (Los secretos del bienestar de la vida) y de otras dos obras y una decena de artículos sobre nutrición. Puede establecerse contacto con ella por correo dirigido a Mother Earth Minerals, 1260 S. 1200 W. #3, Orden, UT 84404 USA o por teléfono: (801)392-1635 o (866)989-9876. Pág. web: http://www.meminerals.com/ 46 .- Dr. Jeffery Taubenberger: Médico norteamericano que dirige el Instituto de patología de las fuerzas armadas, en Washington. En dos artículos, uno de ellos publicado en Science, el 7 de octubre de 2003 y el otro en Nature el 6 de octubre de 2003, describe de qué manera él y sus dos equipos de biólogos moleculares y virólogos consiguieron recrear en laboratorio el virus responsable de la pandemia de la gripe llamada “española”, y por qué ese virus, altamente patógeno para el hombre, era posiblemente de origen aviar. El Pentágono resucita el virus de la gripe española: «Un equipo del Instituto de patología del ejército americano, dirigido por Jeffrey Taubenberger ha conseguido recrear el virus de la gripe española. El equipo de Taubenberger está investigando desde hace más de 12 años con intención de reproducir ese virus a partir de fragmentos de ARN. Muy virulento, es responsable de al menos 20 millones de muertos en Europa entre 1918 y 1919. La publicación de la receta que permite traer a la vida al virus de la “gripe española” en los famosos Proceedings of the nacional academy of science (PNAS) ha hecho reaccionar a numerosos virólogos. La utilidad de esta investigación y los peligros que representa ha sido duramente criticados.» http://www.transfert.net/Le-Pentagone-ressuscite-le-virus

273.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Rockefeller, que ha sido siempre un astuto hombre de negocios, proporcionó a los dos campos (a los alemanes y al ejército aliado) su cóctel de vacuna tóxica y mortal.

Inmediatamente después de las vacunaciones, numerosos soldados cayeron enfermos.

Sufrían de una enfermedad bautizada en aquella época como infección para-tifoidea.

Padecían náuseas, vómitos, diarrea y neumonía mortales. La enfermedad se extendió después por el mundo entero matando prácticamente a 50 millones de inocentes. (Fuente: The horrors of vaccinations, Higgins, 1921). No fue hasta más tarde que el establishment médico bautizó falsamente como «gripe española» al virus recombinado mortal, extendido accidentalmente por la vacuna de Rockefeller de la gripe aviar de 1918. Es evidente que el imperio farmacéutico multimillonario de Rockefeller no podía permitirse etiquetar la pandemia por lo que era en realidad: «la enfermedad de las vacunas de 1918».

Hoy en día todo está preparado para unas medidas eugenésicas genocidas a gran escala. El monstruo Frenkenstein Taubenberger anda libre. De hecho, se han producido centenares de millones de dosis de suero de la gripe de 1918. Lo de entonces podría decirse que fue un accidente. Pero lo que se ha hecho y se hace actualmente en secreto es imperdonable. Lo que ocurre hoy en día es absolutamente inexcusable y criminal. La Madre Naturaleza no recombina jamás «naturalmente» virus de gripe aviar y porcina con 3 virus de gripe humana. (No existen intercambios de fluidos corporales entre los seres humanos, los cerdos y las aves en el curso de relaciones sexuales…) Sólo unos científicos enfermos, corrompidos y perversos pueden crear semejantes monstruosidades. (Fuente: Science Magazine Report, 21 de marzo de 1997, Dr. Jeffrey Taubenberger y otros).

A.Trae Ott47, PhD, ND http://educate-yourself.org/cn/ottswinefluweapoized1918spanishflu02jun09.shtml

¿Quién quiere reducir la población mundial?

Bajo el título «El Club de los millonarios trata de yugular el crecimiento demográfico», el Sunday Times del 24 de mayo de 2009 revelaba las líneas generales de una reunión secreta que dice mucho sobre la voluntad política de la oligarquía financiera. El encuentro, que tuvo lugar en Nueva York el pasado 5 de mayo; fue organizado por iniciativa de Bill Gates ―fundador del monopolio Microsoft, gran promotor de simuladores de asesinatos en juegos de ordenador y padrino de Facebook―, Warren Buffet ―especulador multimillonario y financiero de la Fundación Gates― y David Rockefeller.

Además, el pequeño guateque reunió a Michael Bloomberg, alcalde de Nueva York y fundador de la agencia de información financiera del mismo nombre; George Soros, especulador y padrino del lobby de la droga; Peter Peterson, fundador del grupo financiero Blackstone y gran abogado de la austeridad presupuestaria; Julian Robertson, patrón del fondo Tiger Management; John Morgridge, antiguo PDG de Cisco Systems; Eli Broad, especulador inmobiliario; David Rockefeller Jr, hijo del primero; Ted Turner, fundador de la CNN; y Oprah Winfrey, locutora estrella de la televisión norteamericana.

La reunión comenzó con la presentación por parte de los participantes de la causa que cada uno defendía, pero rápidamente, según el Sunday Times, las deliberaciones se transformaron, gracias al impulso de Bill Gates, en un consenso respecto a que la «superpoblación» era la causa primera, que englobaba a todas las demás. Otro participante confió que también habían llegado a un consenso para poner en marcha una estrategia «en la cual el crecimiento demográfico sería atacado como amenaza ecológica, social e industrial». Los participantes subrayaron su «necesidad de ser independientes de las agencias gubernamentales, que se muestran incapaces de afrontar el desastre que todos 47 .- El artículo original (del 2 de junio de 2009): «Swine Flu 2009 Is Weaponized 1918 “Spanish Flu”» está disponible en inglés. Se puede escribir a la autora: atrueott@msm.com

274.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

vemos venir». Están ya previstas próximas reuniones para organizar la puesta en marcha de esta estrategia.

La existencia de la citada reunión fue revelada por primera vez el 20 de mayo de 2009 por irishcentral.com y después por ABC News, el New York Times y el New York Post, pero ninguno de ellos informó de la voluntad de someter a la población a un plan de acción de consecuencias asesinas. Llama la atención el hecho de que todas esas personas sean grandes filántropos, en particular en cuanto a la conservación de la naturaleza, aunque también lo son en programas humanitarios, donde la caridad privada y la ayuda al desarrollo han sustituido a los grandes proyectos de infraestructuras y de transferencia tecnológica, que son el único camino de los pueblos y de las naciones hacia la independencia económica y la soberanía política.

26 de mayo de 2009 – Fuente: http://www.solidariteeprogres.org/article5470.html

El virus de la gripe A/H1N1 es artificial, según un experto ruso.

El virus de la gripe A/H1N1 ha sido creado de manera artificial para reducir la población de la Tierra, considera Leonid Ivachov, antiguo jefe de la Dirección de Cooperación Militar Internacional del Ministerio ruso de la Defensa y Presidente de la Academia de problemas geopolíticos. «Desde Desde mi punto de vista, la constante atención que se presta al problema nuclear permite desviar la opinión pública de las principales amenazas que son la epidemias», epidemias declaró a Ria Novosti el sr. Ivachov. Según él, todas las epidemias actuales han sido creadas en laboratorios. « Los médicos militares poseen la fórmula de la neumonía atípica que ha dado nacimiento al virus. La gripe aviar tiene asimismo origen artificial», Según informaciones norteamericanas, de artificial observa el experto. «Según aquí al 2015, unos tres mil millones de personas estarán “de más”, así que habrá una superpoblación del planeta. La “activación” de diversos virus susceptibles de causar la muerte de grandes masas es una estrategia global destinada a reducir la población», población» declaró el sr. Ivachov.

Moscú, 25 de mayo de 2009 – Ria Novosti.

Fuente: http://fr.rian.ru/world/20090525/121733869.html

Los intereses de Donald Rumsfeld En el número 116 de la revista Votre Santé, Santé de junio 2009, la periodista francesa Sylvie Simon revela algunas informaciones desconocidas o simplemente silenciadas por los medios de comunicación. Al parecer, Baxter International habría creado un virus pandémico.

Asimismo nos enteramos de que Donald Rumsfeld, que fue presidente de Golead entre 1988 y 2001, al convertirse en Ministro de Defensa americano seguía, y sigue, teniendo acciones por valor de varios millones de dólares de uno de los laboratorios que intervienen en la fabricación del Tamiflu, del que diversos gobiernos han encargado centenares de millones de dosis en previsión de una pandemia. Nos enteramos también, por otra parte, de que el Tamiflu no sólo no tiene las propiedades que se le suponen, sino que puede ser peligroso…

Adaptado de http://dominique.regards.free.fr/blog/index.php?2009/06/01/218-informations-complementairesgrippe

Audaz «New World Order» Cerca de trescientas personalidades a las que se mantiene cuidadosamente fuera de la escena internacional detentan el poder económico y financiero. Colaboran en el proyecto denominado Nuevo Orden Mundial, expresión empleada por primera vez por George Bush Sr. durante una conferencia pública en la época en que se libraba la primera guerra del Golfo. http://illusions-de-mouvements.over-blog.com/article-3084035.html 275.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

«Iremos Iremos juntos hacia el Nuevo Orden Mundial, y nadie, digo bien, nadie podrá impedirlo.» impedirlo.

Nicolas Sarkozy, el 16 de enero de 2009, en una recepción ofrecida a los cuerpos diplomáticos extranjeros. ¿Un replanteamiento prohibido sobre las vacunas a partir del 20 de septiembre?

Obligar en masa a la población a tomar la vacuna «anti-gripal» está en contradicción con todos los textos constitucionales relativos a la libertad e implica otras medidas represivas. Es decir, a la obligación seguirá la imposición de una multa y/o pena de prisión a toda persona o grupo que trate de informar a la población e incite a no vacunarse. ( A partir del próximo 20 de septiembre no se podrá acceder a la página web de nuestra asociación.

Por eso es muy importante enviar estos correos electrónicos mientras sea posible, salvaguardar los artículos publicados en nuestra página y hacer circular la información sin tardanza…) tardanza…

Adaptado de http://artemisia-college.org

Hacia una campaña de vacunaciones masivas y obligatorias en Francia Según el Journal du dimanche de este sábado, el gobierno contempla la posibilidad de lanzar este otoño una campaña de vacunaciones contra la gripe A (H1N1). Se han encargado un centenar de millones de dosis a GlaxoSmithKline, Sanofi y Novartis.

Normalmente cada año se vacunan contra la gripe común unos 9 millones de personas. El gobierno decidirá en otoño si hace obligatoria o no la vacunación en función de la evolución del virus en el país. El plan se apoyará en «tres pilares», según un portavoz del Ministerio de Salud citado en el JDD: «las mascarillas, los antivirales 48 y las vacunas».

30/05/09 – Adaptado de http://www.zonegrippeaviaire.com/showthread.php?p=39883

¿Hay obligación de vacunarse en Francia?

En Francia no puede existir obligación legal de vacunación. ✔ Obligar a vacunarse sería anticonstitucional. Art. 3 de la Declaración Universal de los Derechos Humanos, del 10-12-1948: «Todo Todo individuo tiene derecho a la vida, a la libertad y a la seguridad de su persona.» persona. ✔ Estaría en contradicción con el Código Civil que reconoce «el el principio del respeto a la integridad del cuerpo humano.» humano ✔ Estaría en contradicción con el art. 36 del Código Deontológico Médico, que precisa que «todo todo acto médico requiere el consentimiento libre de la persona, tras haber recibido información clara al respecto.» respecto. ✔ Estaría en contradicción con las Sentencias del Tribunal Supremo (Arrêts de la Cour) del 25 de febrero y del 14 de octubre de 1997, que explican lo siguiente.

«Información a los pacientes»: «Los Los facultativos deben estar en condiciones de demostrar que han proporcionado al paciente una información leal, clara, apropiada y exhaustiva, al menos respecto a los riesgos más importantes, y la más completa posible respecto a los riesgos más ligeros. Esta información tiene por objeto permitir al paciente rehusar la vacunación propuesta si estima que los riesgos son superiores a los beneficios esperados.» esperados. ✔ La obligación de vacunarse sería anulada de oficio por la ley del 4 de marzo de 2002, 48 .- Los antivirales son medicamentos de síntesis que perturban el ciclo de replicación de uno o varios virus, haciendo así que la infección viral sea más lenta y conseguir, en casos más raros, detenerla. Los antivirales utilizados en el marco de la «gripe porcina» son Tamiflu y Relenza, de los que se ha demostrado tanto su ineficacia como su nocividad (Cf. la nota nº 10 y el artículo del Dr. Marc Vercoutère).

276.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

nº 2002-303, art. 11, Capit. 1º, que modifica el art.L 1 111-4 del Capit. 1º del Título 1º del Libro 1º de la Primera Parte del Código de Salud Pública: «No se puede practicar ningún acto médico ni tratamiento sin el consentimiento libre de la persona, tras haber recibido información clara al respecto, y el consentimiento puede ser retirado en cualquier momento.»

Así que es asunto de cada uno el aceptar o rechazar libremente el acto médico―cuestionado por multitud de profesionales de la medicina 49― que es la vacunación.

La obligación de vacunarse permite recordar, a todos los que se oponen a ser envenenados, que pueden acogerse a los principios de «Resistencia a la Opresión» (derecho reconocido por la Constitución) y de «Legítima Defensa» (¡que no limita la elección de medios utilizables! http://membres.lycos.fr/acadefense/des%20vaccins%20obligatoires.htm

Gripe porcina: ¿vamos hacia la mayor vacunación de todos los tiempos? ¡Un cóctel de genes desconocidos y orígenes diversos! El virus contiene, al parecer, cepas de origen porcino, aviar y humano. Un aperitivo viral destinado a eliminar del planeta a gran número de habitantes gracias a una pandemia y una propaganda muy bien organizadas. Incluso los representantes de los veterinarios son escépticos: jamás se ha encontrado un caso de contaminación sin contacto con el cerdo.

Los campos de la FEMA en USA, campos actualmente vacíos construidos siguiendo el modelo de los campos de concentración (véase YouTube) ¿entrarán en actividad en el marco de una gigantesca vacunación? Los 500.000 féretros de plástico almacenados al aire libre cerca de Atlanta y los de Georgia que Bush instaló también al aire libre ¿encontrarán ocupantes en esta ocasión? Él se ha ido a su rancho de Uruguay (prueba de que allí no hay nada que temer) porque ese país no tiene acuerdos de extradición con USA. Además de matar a la gente y controlar a los supervivientes, la pandemia que se avecina tendrá otras ventajas, como la de imponer las actividades económicas que decidan autorizar y aniquilar las economías de los países que amenacen la hegemonía angloamericana. Después de la crisis bancaria, tenemos en ciernes la crisis sanitaria. El Nuevo Orden Mundial acabará por convencernos de que es necesario un gobierno global que gestione todos los problemas: tendremos tanto miedo… El miedo nos hace manipulables.

Golpe tras golpe, una Jerarquía invisible somete al planeta a un SHOCK tras otro para operar cambios imposibles de obtener por vía democrática…

Adaptado de http://infovitamine.com/wordpress/archives/tag/puce-rfid

¿Hacia una próxima dictadura mundial?

Más de 600 centros de internamiento de civiles, vacíos por el momento, han sido construidos en USA por los sucesivos gobiernos a lo largo de los últimos 12 años, miles de vagones para prisioneros… ¿Se prepara la élite de EEUU para poner en marcha la esclavitud del pueblo norteamericano según un plan bien estructurado que N. Sarkozy proseguiría en Europa a través de los centros de detención? ¿Vamos a caer en un Estado fascista a nivel planetario a través del nuevo “Orden” o “Gobierno” mundial que nuestros gobernantes parecen elogiar?

El choque de civilizaciones podría muy bien ser el que ellos tratan de imponernos y no el enfrentamiento Occidente-Musulmanes, que está ahí para desviar la atención… http://panier-de-crabes.over-blog.com/artcle-22469617.html

49 .- Cf. principalmente los artículos sobre los peligros de las vacunas del Dr. Horowitz, del Dr. Moulden y del Dr. Vercoutère.

277.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Codex Alimentarius: Alimentarius: 3 mil millones de muertos previstos (incluso sin gripe)…

El Codex alimentario entrará en vigor el 31 de diciembre de 2009, ¡y las poblaciones de los 175 países a los que afecta no han oído hablar nunca de él! No sirve a sus intereses ni a su salud, sino al interés de las multinacionales de las industrias agroalimentaria, química, biotecnológica, de farmacia y de medicina. Según sendos documentos de la FAO y de la OMS, cuando el Codex entre en vigor, las nuevas normas sobre las vitaminas ocasionarán tres mil millones de fallecimientos.

Entre otras cosas, autoriza el uso de siete de los peores pesticidas prohibidos actualmente en 176 países; exige que todo el ganado sea tratado con antibióticos y con la hormona de crecimiento comercializada por Monsanto; que los alimentos sean irradiados, salvo cuando sean crudos y consumidos localmente; y criminaliza los productos de salud naturales, las vitaminas ―a menos que su dosis sea muy baja― y las hierbas. Será ilegal proveer de galletas con alto contenido en nutrientes a los países que lo necesiten. Todo lo que no esté permitido por el Codex será ilegal.

27 de enero de 2009 – Extraído de http://diablogtime.free.fr/?p=728

Codex Alimentario: Alimentario: ¿ilegales los productos naturales a partir del 31 de diciembre de 2009?

Una nueva directiva de la Unión Europea debe entrar en vigor el 31 de diciembre de este año. Se trata de un “Codex Alimentarius” que, una vez aprobado 50, limitaría considerablemente las sustancias autorizadas en el campo de las medicinas alternativas y de los suplementos alimenticios. Esto tendría como efecto que las sustancias activas autorizadas en los remedios que compramos en la actualidad (homeopatía, flores de Bach, sales de Schlüssler, minerales y vitaminas) sería tan limitado que perderían su eficacia. Peor aún, podrían incluso desaparecer del mercado al no recibir autorización de venta por no ajustarse a los nuevos criterios, extremadamente restrictivos.

Esta información es tanto más alarmante cuanto que significaría para todos nosotros el fin de la libertad terapéutica y también el final de todas las profesiones que utilizan esas sustancias (naturópatas, fitoterapeutas, homeópatas, herboristas, y los laboratorios que producen esos remedios). En Gran Bretaña, los “Health Stores”, como “Boots”, están haciendo campaña en todo el país pidiendo a sus clientes que presionen a sus diputados para impedir la aprobación de esa directiva. El tema se debate oficial y públicamente. Por desgracia, los medios de comunicación de Francia y de Alemania apenas han publicado una información tan importante y que nos concierne a todos. Obsérvese, por otra parte, que los países que han tomado la iniciativa de esta nueva directiva son Italia, Alemania… y Francia.

Barbara Thielmann Association “Die Alternative” http://elections2009.pes.org/fr/posts/medicine-alternative

El plan secreto de Sarkozy respecto a la vacunación contra la gripe porcina Según ciertas filtraciones aparecidas en un periódico francés, el gobierno está a punto de poner en marcha un plan secreto para imponer al conjunto de la población 50 .- Esta Directiva (salvo algún imprevisto…) debería ser aplicada: «El 13 de marzo de 2002, los parlamentarios europeos adoptaron unas leyes a favor de la industria farmacéutica, fijadas por unas disposiciones del Codex Alimentarius, que apuntaban a la elaboración de una reglamentación restrictiva de las terapias naturales y de los suplementos alimenticios…, una manera más, esta vez indirecta, de neutralizar a la competencia que podría ocupar un cierto lugar en el mercado, porque la salud se vende y se compra. Una ola de peticiones por parte de la población inundó los correos electrónicos de los parlamentarios europeos, hasta el punto de que se bloquearon las comunicaciones internas. A pesar de los quinientos millones de peticiones, las directivas del Codex Alimentario fueron adoptadas. Aquel voto fue una absoluta falta de consideración con la democracia, y es de prever que en el futuro se la siga despreciando.»Violeta Bucur, febrero de 200 http://www.yogaesoteric.net/content.aspx?item=5670=FR

278.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

francesa una campaña de vacunación obligatoria, al parecer contra la eventual enfermedad de gripe porcina. Ese plan, sin precedentes, es contrario a las recomendaciones y normas de salud pública. Mientras la gripe porcina empuja hacia la militarización de la salud pública y al recurso ―inútil― de crear pánico en la población para hacer avanzar la orden del día, los gigantes farmacéuticos se benefician de esta medida. Según un artículo de la edición del 30 de mayo del diario francés Le Journal du Dimanche, el régimen de Sarkozy ha autorizado un gasto de alrededor de mil millones de euros para comprar vacunas, destinadas al parecer a luchar o a proteger contra el virus H1N1 de la gripe porcina. El único problema es que, a día de hoy, ni la OMS, ni el «Center for Diseases Control» (CDC) de Estados Unidos han conseguido aislar, ni fotografiar al microscopio electrónico, ni clasificar químicamente el virus Influenza A/H1N1. Tampoco hay evidencia alguna científica de que lo hayan hecho unos virólogos franceses. Establecer la obligación de consumir unos medicamentos contra una supuesta enfermedad que ni siquiera está caracterizada es, cuanto menos, dudoso.

Mucho más extraño es que la «Food & Drug Administration» (FDA) de Estados Unidos ―el organismo encargado de la salud y seguridad de sus ciudadanos―, haya reconocido que el «test» que autoriza la salida prematura de las vacunas contra el H1N1 ni siquiera ha demostrado su eficacia. Se sabe, además, que no existe ninguna prueba médico-legal de que los fallecimientos que se han presentado hasta el día de hoy como prueba científica de muerte atribuible al virus de gripe porcina H1N1 hayan sido debidos efectivamente a ese virus […]. Lo que sí sabemos con certeza es que muchas de las personas que han fallecido padecían con anterioridad enfermedades respiratorias, de naturaleza no divulgada. Cada día mueren muchas personas de enfermedades respiratorias. Solo en Estados Unidos, se registran cada año unos 36.000 fallecimientos relacionados con la gripe común, lo que hasta ahora no ha producido pánico ni terror excesivo. F. William Engdahl51.

Disponible en francés en: http://www.mondialisation.ca/index.php?context=va&aid=13850

Todas las vacunas entrañan lesiones graves, algunas incluso mortales Mediante tecnología de diagnóstico e imagen clásica y ultramoderna, el Dr. Moulden52, M.D., médico, experto en psiquiatría, neuro-psiquiatría y neurología del comportamiento, aporta pruebas en términos de fisiología y clínica médica de que TODAS las vacunas provocan directamente o a la larga diversos trastornos y enfermedades agudas o crónicas, permanentes o transitorias, susceptibles de afectar a todos los sistemas corporales. Ha preparado una nueva tecnología médica por imagen que pone al descubierto los trastornos y daños neurológicos que se producen tras las vacunaciones. Explica que las vacunas provocan una hiper-reactividad del sistema inmunitario, en el curso de la cual los leucocitos se precipitan para atacar los productos extraños inyectados en el flujo sanguíneo.

Dado que son demasiado gruesos para penetrar en los finísimos capilares donde se alojan esos productos, los leucocitos acaban por obstruirlos, bloquearlos y deteriorarlos. Se corta pues la ruta a los glóbulos rojos, más pequeños, que deben aportar oxígeno a los diferentes órganos vecinos a los capilares abarrotados de sustancias extrañas. Las partículas extrañas que alcanzan el cerebro, al alterar o impedir la circulación de la sangre, pueden provocar autismo, la muerte súbita del bebé u otras muchas enfermedades en el niño o en el adulto.

Al igual que ocurre en un ataque cardíaco, cuando los tejidos no reciben suficiente aporte de oxígeno puede producirse un ataque cerebral, o aparecer problemas de hígado, o de riñón. Se trata de un descubrimiento muy importante.

51 .- Artículo original en inglés: «Sarkozy’s Secret Plan for Mandatory Swine Flu Vaccination», 3 de junio de 2009. Traducción francesa de Pétrus Lombard. F.W. Engdahl es un colaborador habitual de «Mondialisation.ca».

52 .- El Dr. Andrew Moulden, M.D., PhD, BA, MA es canadiense. Ha recibido no menos de 27 premios como recompensa a sus investigaciones clínicas y biomédicas, a su enseñanza y su excelencia académica. Puede verse un video, en inglés, en http://brainguardmd.com/

279.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21 http://expovaccins.over-blog-com-33

Principales constituyentes habituales de las vacunas llamadas «antigripales» Por el Dr. Marc Vercoutère53

● Formaldehído (formol), necrosante y cancerígeno notorio ● Thiomersal, mercurotiolato sódico, a base de mercurio, veneno en el origen de (¿todos?) los casos de autismo ● Diversos antibióticos ● Otros diversos productos químicos ● Diferentes virus colocados ahí expresamente ● Diferentes virus o fracciones de virus indeseables relacionados con el proceso de preparación ● Además de todo lo… inconfesable… que «ellos» quieran poner, sobre todo para una vacunación en masa obligatoria…

«Tenemos pruebas de que el Tamiflu y el Relenza son ineficaces, origen de numerosas resistencias e incluso de mutaciones. Además, mientras que la vacuna contra la gripe estacional no es más eficaz que un placebo, la vacuna contra la “pandemia” requerirá con mucha probabilidad de un coadyuvante como el aluminio. A la más que insegura eficacia de esta vacuna se añade el hecho de que, como todas las vacunas, ocasionará un edema cerebral más o menos transitorio y un descenso, más o menos importante, de los linfocitos T4 y T8. Las vacunas y los antivirales pueden también favorecer la selección de virus más virulentos debido al constante fenómeno de mutación, además de que la presencia de aluminio favorecerá el que sobrevengan posteriormente miofascitis por macrófagos y aumente considerablemente la frecuencia de la enfermedad de Alzheimer, favorecidas por la exposición a las ondas de telefonía móvil… http://artemisia-college.org/Grippe_porcine_aviaire_humaine_mexicaine_A-00-03-01-0227-01.html

¿Las vacunas? ¡No sirven para nada!

Por la Dra. Lorraine Day54

«La gripe porcina ha sido una auténtica burla. En los años 70/80 se creó una nueva vacuna. Muchas personas fallecieron tras haberla recibido. Fue un engaño total. Esa enfermedad no ha existido nunca. Todo fue programado por las compañías farmacéuticas.

Para lanzar una vacuna, había que atemorizar primero a la población. Más de 800 personas desarrollaron la enfermedad de Guillain Barré. Las vacunas fueron fabricadas para aterrorizar a la gente. Las vacunas contienen conservantes, como el formaldehído. Las cepas de las vacunas provienen de células humanas o de animales que están a veces contaminados.

Las vacunas son pues peligrosas, pero suponen importantes dividendos para las compañías farmacéuticas. Algunas enfermedades son fabricadas totalmente por la propaganda; luego se sugiere a todo el mundo que se vacune, mientras los gobiernos financian la operación con el dinero de los contribuyentes. Esas tácticas permiten recaudar miles de millones. Las vacunas deterioran el sistema inmunitario, pero aportan enormes beneficios a la industria farmacéutica.»

53 .- El Dr. Marc Vercoutère es un médico homeópata francés. Miembro del comité editorial de Morphéus, es colaborador de la «Cellule de Crise Sanitaire» (cf. nota 39).

54 .- La Dra. Lorraine Day es norteamericana. Ha sido Cirujano Jefe del Gran Hospital de San Francisco.

Especialista de fama internacional en cirugía ortopédica, es también profesora de la Facultad de Medicina de la Universidad de California y autora de varios libros.

280.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21 Extraído de una entrevista realizada a la Dra. Day que aparece en un video, en inglés, presentado en YouTube: «Vaccines don’t work at all» http://www.youtube.com/watch?v=9_CdX-ZtdIw

La vacuna contra la gripe porcina contiene escualeno y gp120 Por el Dr. Russell Blaylock55

El análisis exhaustivo del virus muestra que contiene genes del virus H1N1, origen de la gripe de 1918, del virus de la gripe aviar y dos del nuevo virus H3N2 euroasiático.

Continúa el debate sobre la posibilidad de que estos virus se hayan reunido mediante ingeniería genética para crear el de la gripe porcina […] Las compañías farmacéuticas Baxter y Novartis tienen acuerdos con la Organización Mundial de la Salud para producir una vacuna contra la gripe pandémica. […] Lo aterrador es que esas vacunas contienen ingredientes llamados coadyuvantes inmunitarios, que muchos estudios han demostrado que están en el origen de desórdenes autoinmunes devastadores, como la artritis reumatoide, la esclerosis en placas y el lupus. ¿Cuál es esa sustancia mortal? Se llama escualeno 56, un tipo de petróleo. La sociedad Chiron, fabricante de la vacuna contra el ántrax mortal, fabrica un coadyuvante llamado MF-59 que contiene los dos principales ingredientes preocupantes: el escualeno y el gp120. Varios estudios han demostrado que el escualeno, una vez inyectado, puede desencadenar los desórdenes autoinmunes mencionados.» Dr. Russell Blaylock Fuente: www.alterinfo.net/Se-mefier-de-la-piqure-contre-la-grippe-porcine_a34632.html

¡Los canadienses serán vacunados tres veces!

«Los canadienses que acostumbran a vacunarse contra la gripe tendrán que subirse las mangas este otoño tres veces: una vez para la gripe “corriente” y dos para la gripe A(H1N1). El Dr. David Butler-Jones, director de la Agencia de salud pública de Canadá, afirmó el lunes que reunir las dos vacunas en una sola habría retardado la producción. Las dos dosis de la vacuna contra la gripe A(H1N1) deben ser inyectadas en el intervalo de un mes, ha precisado el Dr. Butler-Jones. http://www.nouvelordremondial.cc/2009/07/

¿Y en Francia? La OMS confirma que habrá dos inyecciones…

«Recordemos que una pandemia amenaza a la casi totalidad de la población mundial, lo que significa que la reserva de vacunas deberá ser de 6 mil millones de dosis (el número de seres humanos en el planeta), digamos incluso que de 12 mil millones, pues debido a que este virus es nuevo para el sistema inmunitario, la vacuna tendrá que inyectarse dos veces.

Países como Francia y Estados Unidos han encargado ya 50 y 600 millones, respectivamente, de vacunas contra el virus A/H1N1 y tendrán que doblar sus pedidos. En Francia, la “Célula de Crisis” ha elevado a 400 el número de establecimientos habilitados para acoger a los pacientes afectados.» Fuente: OMS, colgado online por Maurice Chevrier, Santé log, el 17 de junio de 2009. http://www.santelog.com/modules/connaissances/actualite-sante-grippe-ah1n1-l-australie-releve-son-niveau-dalerte-en-phase-%22protection%22_1305.htm

«Una población total de 200 a 300 millones, es decir, una reducción del 95 % de la actual sería lo ideal.»

Ted Turner, fundador de la cadena de televisión CNN 55 .- El Dr. Russell Blaylock es un neurocirujano norteamericano de la Universidad de Mississipi. Es autor de «Excitotoxins: the Taste That Kills», «Health & Nutrition Secrets to save your Life» y «Cancer Stategies». Cf. su pág. web www.russellblaylockmd.com 56 .- Hidrocarburo polietilénico. Se encuentra en el aceite de hígado de los peces elasmobranquios y está constituido por restos de isopreno. (N. de T.-2-)

281.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

¿Tiene este programa posibilidades de tener éxito?

NON… ¡en la medida en que nos neguemos, en masa, a la vacunación!

Si considera que es justo para usted, el primer paso que debe dar es hacer circular la información ― Manifieste su rechazo a una vacunación impuesta transmitiendo estas informaciones oralmente, mediante fotocopias o, mejor aún, por correo electrónico.

Reenvíe este mismo dossier a sus contactos y acompañe su correo con un texto adaptado a los destinatarios. Además de sus familiares, amistades, relaciones personales y profesionales, póngase en contacto ―si le es posible― con las personas y páginas web que puedan hacer circular estas informaciones, y con las que tienen una importancia estratégica en la cadena de pedidos de una vacunación impuesta, como son los responsables sanitarios (médicos, enfermeras, etc.); el ejército y la policía; los políticos (diputados, senadores, responsables de los partidos, etc.); directores de escuelas, colegios e Institutos; magistrados y profesionales de la Justicia (abogados, jueces, etc.); el «pueblo llano» y las personalidades; los bloggeurs comunicativos, los periodistas, etc.

Después, he aquí los pasos que se podrían seguir: ― Póngase en contacto con otras personas y/o grupos motivados para organizarse en red

Existen diferentes asociaciones o grupos, como la Cellule de Crise Sanitaire Citoyenne57, una iniciativa de Frédéric Morin, con el apoyo de Christian Cotten y la pericia del Dr. Vercoutère. Informamos en nota a pie de página de su propuesta de acción para la crisis. Su pág. web es: http://artemisia-college.org/Grippe_porcine_aviaire_humaine_mexicaine_A-00-03-01-0227-01.html

― Infórmese. No crea solamente lo que lea. Investigue y compruebe por sí mismo.

Busque información. Puede utilizar “buscadores” de Internet; basta teclear algunas palabras clave, por ejemplo: «gripe + Burgermeister» o bien «pandemia», o bien «despoblación», «Bilderberg», «bioingeniería», «Nuevo Orden Mundial», etc. ― Envíe palabras de apoyo a Jane Burgermeister No olvide que, gracias en parte a su valentía y a su trabajo, podemos alzarnos actualmente como ella y hacer frente. Para escribir: jmburgermeister@gmail.com 57 .- Cellule de Crise Sanitaire Citoyenne: «Buenos días a todos. Morphéus lanza una alerta concerniente a la posibilidad de que, al reanudar las actividades tras el periodo vacacional, se obligue a los franceses a ser vacunados, lo que podría resultar como corolario a las leyes de excepción que se han aprobado en agosto 2009. Saber lo que nuestros gobernantes quieren inyectarnos en las venas a la fuerza es urgente y prioritario.

Ante esta cuestión crucial, sugerimos lo siguiente: Proponemos el establecimiento de una Célula de Crisis Sanitaria, compuesta por científicos reunidos en la Asociación CRI-VIE, en torno al Dr. Marc Vercoutère, miembro del comité editorial de Morpheus. Esta célula tendría por función investigar todas las vacunas nuevas, de las que se diga que son obligatorias, y analizarlas.

Para este trabajo, recomendamos un riguroso pliego de condiciones: 1º) Investigación de todos los producto nanotecnológicos o cristales, de los que se tenga noticia, que “acostumbren” a alojarse en el cerebro. Este análisis requiere el uso del microscopio electrónico por un facultativo experto.

2º) Investigación de todo producto químico, metálico o genético potencialmente peligroso para la salud.

3º) Investigación de las cepas de los nuevos virus y de su composición genética, con el fin de determinar si su origen es natural o artificial.

Los resultados de los análisis de las muestras de las vacunas se transmitirán a los órganos de prensa dispuestos a informar sobre el tema. Creemos que, paralelamente, habría que enviar información a los servicios de la policía, la gendarmería, el ejército y a los servicios de protección del territorio nacional en el caso de que los análisis revelaran una nocividad concreta, o la presencia de productos nanotecnológicos que tienen la particularidad de modificar la actividad encefálica del portador. Para poner en marcha la célula de crisis ciudadana de prevención se necesitan algunos medios. Si usted desea ayudar, científicos, médicos, técnicos de laboratorio, simples ciudadanos, asociaciones, empresas de prensa, comerciantes o agentes de la Seguridad Nacional, son ustedes bienvenidos. Frédéric Morin, Director de la publicación Morphéus – Tf. 01 39 72 59 43

282.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Siga informándose por sí mismo consultando páginas web como las siguientes: En francés:

http://expovaccins.over-blog.com http://illusions-de-mouvements.over-blog.com/article-30842035.html http://pagesperso-orange.fr/thomiste/infointgm.htm http://www.syti.net/Topics.html http://lepovoirmondial.com/grippe-porcine-ou-aviaire/ http://mahamudras.blogspot.com/2009/07/la-pandemie-en-preparation.html

En inglés:

http://www.naturalnews.com/025760.html http://www.rense.com/

En español:

http://www.vacunacionlibre.org/nova/

No olvide que…

E s a h o r a c u a n d o h a y q u e a c t u a r, d e s d e e s t e v e r a n o .

Sobre todo, no espere al otoño, momento prev isto para la propagación de la gripe A/H1N1.

Entonces será demasiado tarde para rechazar las vacunas e invertir el proceso &&&&&&&&&&&&

283.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Dr. Marc Vercoutère – Tf. 05 47 41 50 22 Asociación CRI-VIE – 3 bis rue Henri Faisans 64000 Pau En francés:

http://expovaccins.over-blog.com http://illusions-de-mouvements.over-blog.com/article-30842035.html http://pagesperso-orange.fr/thomiste/infointgm.htm http://www.syti.net/Topics.html http://lepovoirmondial.com/grippe-porcine-ou-aviaire/ http://mahamudras.blogspot.com/2009/07/la-pandemie-en-preparation.html

En inglés:

http://www.naturalnews.com/025760.html http://www.rense.com/

Fin documento de Fuente: www.free-news.org/PDFs/Jane_Burgermeister-Dossier.pdf

284.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ebolanotnormal.html Artículo “Enlace permanente” de Septiembre 2014 Continuación del desarrollo y evolución de lo concerniente al brote de Ébola 58 Nueva vacuna contra el Ébola no tendrá ningún valor Con 368 mutaciones ya encontradas, no habrá vacuna que funcione.

Cualquier impulso de los laboratorios para desarrollar una vacuna contra el ébola será para cualquier otra cosa excepto proporcionar inmunidad contra este virus, y cualquiera que sea consciente del reciente desastre del C.D.C. que relaciona directamente el autismo con las vacunas, esa "otra" probablemente tampoco será buena.

Puede incluso que ya ni siquiera sea Ébola en absoluto, y es probable que en cambio sea alguna una especie de híbrido obtenido por ingeniería.

Antes de este brote, el Ébola tenía una muy alta estabilidad genética y se mantuvo sin cambios en el transcurso de múltiples brotes. De hecho, el Ébola ha sido tan estable que se le consideró extraordinario por esta misma razón. ¿Por qué entonces, con este brote, hay tantas mutaciones de este nuevo tipo, cuando en brotes anteriores NUNCA se advirtieron mutaciones de tipo alguno.

Además, este nuevo brote no tiene ninguna de las características de brotes anteriores Hay algo que falta en este brote de Ébola, y son ojos y oídos ensangrentados y sangrado a través de la piel. Esta vez toda la hemorragia es interna y no aparece nada exteriormente. Todas las fotos que hay en la web donde se ven víctimas con ampollas en la piel a modo de bolsas de sangre, son de brotes anteriores, con este cepa en particular, la gente, exteriormente parece normal hasta que mueren a causa de hemorragia interna, vómitos con sangre y deposiciones masivas con heces negras resultado de una masiva hemorragia interna. De esta manera, el nuevo Ébola está imitando el Parvovirus de los perros, y al menos en lo que a mi concierne, apostaría vagamente que el Ebola tradicional se ha fusionado en un laboratorio con un virus diferente, conocido por provocar solamente hemorragias internas, posiblemente parvo.

368 mutaciones en un virus previamente estable denuncia a gritos un BIO LAB Aquí es donde las cosas pueden ir mal. Anteriormente, el Ébola era un virus estable que podría haber tenido una cura predecible. La actual cepa muta tan rápidamente que si se suman todos los casos registrados y se dividen por el número de mutaciones, cada cepa mutada sólo habría infectado un promedio de 20 personas. Esa es una tasa de mutación fenomenal, lo que hará que cualquier intento de producir una vacuna resulte inútil.

58 .- Lo que empezó como una sencilla traducción de unas pocas pgs relativas a lo poco o mucho que iba llegando al correo electrónico de Jim Stone y, que éste articulista publicaba en su sitio web, ha ido adquiriendo un volumen en gravedad, importancia y datos disponibles que ha ido más allá de las expectativas de los Traductores. Este trabajo depende de la información que vaya llegando desde JimStoneFreelance.com, los enlaces que éste indique y otros complementarios aunque no por ello menos relevantes.

285.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

¿Y como podría haber ocurrido sino como un acto de premeditación? La respuesta es obvia —un laboratorio creó esta nueva cepa, ese laboratorio no tenía un suministro de gente a quien matar para demostrar su virus era estable así que lo “sueltan” para sus pruebas “en vivo”, en la naturaleza. Y debido a que no era estable, ahora tienen un monstruo mutante que anda suelto. Posiblemente esa es la mejor explicación disponible de por qué el Ébola, que se ha mantenido estable desde que se conservan los primeros registros históricos de laboratorio, de repente, va y se convirte en un camaleón. Este nuevo fiasco es un arma biológica inestable, posiblemente más inestable de lo que sus creadores pretendían.

Tenga cuidado con las reescrituras de la historia, ya que proporcionarán una negación plausible para quien o quienes hicieron esta chapuza Esté atento a cualquier noticia que anuncie cómo el Ébola muta continuamente pero que no mencione que antes de este brote de Ébola era muy estable, y pregunte enérgicamente POR QUÉ esta nueva cepa es tan diferente de las anteriores, a partir de los síntomas externos, a los tiempos de incubación, a las tasas de mutación; es todo demasiado diferente para que esto haya sucedido de forma natural en un virus anteriormente conocido por su consistente estabilidad. Alguien “lo hizo” y la pregunta ¿QUIÉN LO HIZO? debe mantenerse de frente y en el centro hasta que tengamos la respuesta.

Sabemos que una empresa de guerra biológica estadounidense estaba por esa zona "probando kits de detección de Ébola", le sugiero la gente que empiece por aquí.

Hay muy pocas fotos de personas infectadas con esta nueva cepa, y ninguna muestra el sangrado hemorrágico normal. ¿Por qué?

Echa un vistazo a una búsqueda de imágenes de Google con todas las fotos fechadas un año o más de antigüedad, y compáralas con una búsqueda de imágenes de google de fotografías fechadas dentro del marco temporal de este brote y observa que todo lo que hay PARA ESTE brote, reconocible como EBOLA, ES SOLO UNA REPETICIÓN DE LAS IMÁGENES DEL “VIEJO EBOLA”, simplemente con nada nuevo que mostrar a la gente; sin ni una sola ampolla hemorrágica.

Casi la totalidad de lo que estamos viendo son bolsas de cadáveres que no muestran nada, con el resto de imágenes que tampoco muestran ninguno de los síntomas clásicos. La imagen de arriba a la izquierda es un ejemplo típico, este hombre que al parecer es una víctima del Ébola no muestra nada en absoluto que indicara que hubiera tenido Ebola. ¿Por qué es tan diferente? La gente en África, sin duda podría publicar fotos en la web, ¿ entonces, por qué es todo lo que vemos son fotos de algo que, obviamente, no es el ébola normal? Las fotos fechadas antes de este brote muestran claramente qué es el ébola y que aspecto tan terrible tienen las víctimas; te reto a que localices cualquier foto de este nuevo brote que se parezca, aunque sea remotamente similar, al ébola tradicional.

Los síntomas lo dicen todo 286.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

✗ ✗ ✗ ✗ ✗ ✗ ✗ ✗

Estos son los síntomas de la cepa actual, Fiebre (mayor de 38,6 ° C o 101.5 ° F) Dolor de cabeza intenso Dolor muscular Debilidad Diarrea Vómitos Abdominal (estómago) Falta de apetito

En otras palabras, los síntomas actuales imitan la gripe (excepto por el sangrado interno observado en este brote). Ahora para los síntomas clásicos Ébola: "Después de 3-4 días de síntomas y signos inespecíficos, los pacientes típicamente experimentan un progresivo y severo dolor de garganta, el desarrolló una erupción cutánea59, dolor abdominal intratable, y comienzo de sangrado por varios sitios, principalmente el tracto gastrointestinal."

Y las imágenes de este brote actual demuestran que en esta ocasión lo que nos ocupa no es el clásico ébola. Lo más importante en común es la hemorragia gastrointestinal.

Los tiempos de recuperación también indican que este nuevo ébola es más como una gripe sobrealimentada que el Ébola Por lo general, con el ébola, la recuperación lleva meses y a veces nunca termina completamente porque hígado, riñones y otros órganos, como el cerebro quedan dañados. Sin embargo, vemos en las imágenes de los medios que los "supervivientes" del ébola que están andando de nuevo sólo dos semanas después de tenerlo. Esto no es posible con el ébola auténtico, este brote realmente parece más una mala gripe que cualquier otra cosa La conclusión es que los síntomas no son consistentes con el ébola clásico. Los tiempos de recuperación son demasiado rápidos, y la lista actual del CDC de los síntomas de los no coincide con la lista antigua, excepto cuando el CDC combina la nueva lista con la lista antigua al objeto de enturbiar las aguas. Algo anda mal con esto, y la nueva vacuna sólo puede ser falsa con tantas variantes mutadas. No hay forma de que una vacuna pueda ser real y eficaz, en esta ocasión estamos tratando con un arma biológica lo que la hace imposible, evita cualquier "vacuna" como si fuera la enfermedad en sí.

59 .- Erupción de la piel es una condición comúnmente observado que cambia la apariencia, el color y la textura de la piel. Uno puede observar erupciones en una cierta área localizada de la piel o en todo el cuerpo. Uno puede experimentar picazón, cambios en el color o la sequedad de la piel, con ampollas que es caliente al tacto y dolorosa después de desarrollar una erupción. Hay muchos tipos de erupciones en la piel que pueden indicar ciertas enfermedades. Uno de ellos es la erupción maculopapular y veremos más en detalle con respecto a esta condición de la piel en los párrafos siguientes.

287.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ebolanotnormal.html Artículo “Enlace permanente” de Septiembre 2014 – Actualización 12 Septiembre 2014 Continuación del desarrollo y evolución de lo concerniente al brote de Ébola ¿Por qué no hay fotos de afectados por Ebola?

Debe plantearse una pregunta seria sobre este brote actual - ¿por qué no hay fotos del clásico Ebola? Si este brote es real, y esto en absoluto es Ebola, ha sido tan radicalmente alterado a partir de sus características anteriores que, efectivamente, que para nada es el mismo bicho. Claramente, lo que estamos viendo con este brote no es el Ébola normal.

Haga una búsqueda en Google con fecha del brote de Ébola. Configura Google sólo para recopilar las imágenes de el último mes o así. Descubrirá que no hay una sola foto de Ebola perteneciente a este brote; resultando que todas las fotos reales Ebola pertenecen a brotes anteriores. Definitivamente, esto es más que suficiente para hacerme pensar que, o bien que no existe semejante brote, o que si lo hay, no es el Ébola normal del pasado. Si la gente está muriendo (el último número es de 2400) el clásico ébola no es el responsable. En cualquier caso, las tasas de mortalidad están tomando ahora una curva exponencial de acuerdo con la OMS, si es que todo esto es genuinamente verídico.

A la luz del hecho de que no hay fotos disponibles de este brote, me gustaría que considerarais algo a tener en cuenta.

Considere el hecho de que, incluso en África hay teléfonos celulares con cámara incorporada e internet. ¿Por qué no hay fotos de Ebola? De hecho, Liberia y Sierra Leona son países de habla inglesa, por lo que cualquier foto publicada constaría como Ébola, en Inglés, por lo que resultaría fácil encontrarlas en este idioma. ¿Por qué no estamos viendo NADA? Incluso las noticias publicadas por Al Jazeera de "Ébola, en imágenes" no muestra NADA, si realmente pusieron ALGO en imágenes, ALGO debería haber. Sin embargo, no hay NADA. El

hecho de que supuestamente se hayan establecido cuarentenas en las zonas afectadas no es impedimento para la falta de fotos, ya que un teléfono móvil puede enviar una imagen desde una zona de cuarentena. Ahora bien, Liberia es un país casi totalmente inalámbrico, casi el 70% de los liberianos tienen móviles y allí hay 4 empresas de telefonía celular. Aunque sólo el 7% de los liberianos tiene internet, el resto puede acceder a la web desde los ciber-cafés y sin duda alguna, debe haber algunos dentro de la zona de cuarentena, ¿ ENTONCES, POR QUÉ NO HAY FOTOS DE ÉBOLA? Si hubiera un desastre en curso puede apostar que ALGUIEN, cualquiera, incluso un médico estadounidense que trabajó allí, habría conseguido sacar una foto de Ebola, con los síntomas clásicos. Y Sierra Leona puede que no esté tan bien comunicada, pero aún con todo allí hay más de 2 millones de teléfonos celulares. Algo huele mal en todo esto, la realidad sobre el terreno, obviamente, no coincide con lo que dice la prensa.

288.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

Y hay otro problema para hacer frente a todo esto —y es que las personas en la zona afectada por Ebola no creen que haya tal epidemia. Uno podría pensar que si el Ébola fuera real, que en África, donde la gente todavía habla y los rumores se extienden por el “boca a boca” y donde casi el 70 por ciento de las personas tiene móvil en Liberia que, incluso un caso de Ébola, causaría semejante alboroto que no necesitarían a la OMS para decirles que algo malo está pasando. El hecho de que la gente de allí no crea que sea algo real, puede identificarse como una señal de alerta grave o bandera roja. roja Y ¿cómo se puede tener un brote, TAN GRANDE que no existen casos confirmados fuera de la zona roja? Francamente, las historias de los médicos estadounidenses curándose son mentiras, porque el Ebola arrasa con la gente durante meses si no años; porque el Ébola provoca serias lesiones en os órganos internos, y los médicos afectados ya están fuera de casa, jugando al tenis y golf. ¡No tenían Ebola!

Así que la pregunta es ... entonces, ¿Es este brote de Ébola tan sólo una puesta a punto de bandera falsa para el inicio de las vacunaciones forzosas?

Estoy cuestionándome seriamente si es este el caso. Millones de 289.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

cámaras de móviles liberianos sin duda lo sugieren. Todas las fotos de Ébola que se asocian con este brote muestran bolsas para cadáveres y salas de hospitales con personas que podrían estar allí desempeñando cualquier labor, no hay ojos ni oídos sangrantes, tampoco brazos llenos de ampollas sanguinolentas, no se está mostrando NADA en absoluto relacionado con este brote, que si fuera real debería haber sido el acontecimiento mejor documentado y publicado de todos. Ningún otro brote ha coincidido con éste en magnitud, y ningún otro brote ha ocurrido sin la presencia y capacidad mediatica de documentarlo. La falta de pruebas fotográficas en términos severos es condenatoria; lo que realmente parece, es que todo podría ser una treta.

290.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ Sep 12 2014

En estos momentos estoy indeciso sobre si el brote de ébola es real o un engaño. Pero este es un gran artículo, para compensar el que sigue. Ébola es mi principal tema de interés en este momento y estoy tratando de averiguar si es real o un engaño.

SI Ébola es real, está superando la tasa de expansión 1.83 mensual de la que hablé anteriormente.

Mar, de 2014 - Infectados: 104 muertos: 62 Abr, de 2014 - Infectados: 194 muertos: 116 May, de 2014 - Infectados: 360 muertos: 216 Jun, de 2014 - Infectados: 670 muertos: 402 Jul, de 2014 - Infectados: 1247 muertos: 748 Ago, de 2014 - Infectados: 2.319 muertos: 1.391 12 Sep, 2014: Ya por encima de los 5.000 infectados y 2.400 muertos —aquí se pone en evidencia que la curva ya no sigue la trayectoria prevista. Parece estar pasando al “palo de hockey”.

291.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21 Predicción previa para finales de septiembre, 2014 - Infectados: 4313. Muertos: 2588 (ya estamos aquí) Octubre de 2014 - Infectados: 8.022 muertos: 4.813 Nov, de 2014 - Infectados: 14.921 Muertos: 8.953 Dic, de 2014 - Infectados: 27.753 Muertos: 16.652 Ene, de 2015 - Infectados: 51.621 Muertos: 30.973 Feb, de 2015 - Infectados: 96.016 Muertos: 57.610 Mar, de 2015 - Infectados: 178590 Muertos: 107154 Abr, de 2015 - Infectados: 332177 Muertos: 199306 <<nuevo pronóstico AQUÍ Y AHORA60 de personas que trabajan con el virus: 1,2 millones de muertos llegados a este punto, lo que significa que si no es un engaño y esto es correcto, y si no está contenido en áfrica, la nueva tendencia se parecerá más a lo siguiente: May, Jun, Jul, Ago, Sep, Oct, Nov, Dic, Jul, Ene,

de de de de de de de de de de

2015 2015 2015 2015 2015 2015 2015 2015 2016 2016

-

Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados: Infectados:

3975768 Muertos: 2385461 7394928 Muertos: 4436957 25583494 Muertos: 15350096 47585299 Muertos: 28551179 164626099 Muertos: 98775660 306204545 Muertos: 183722727 1059345243 Muertos: 635607146 1970382153 Muertos: 1182229292 3664910804 Muertos: 2198946482 6816734096 Muertos: 4090040457

Los grandes saltos son de meses restados, (no recalculé la curva, solo me limité a retirar los meses que no estarán ahí si la tendencia continúa. Obviamente es probable que no se extienda a este ritmo (si si definitivamente es real), real esto es simplemente un cálculo en base a lo que está sucediendo ahora (si si es que es real). real Y tengo una buena manera de cuestionar la realidad de todo esta historia: ¿Por qué no hay fotos de Ebola Uno debe plantearse una pregunta bastante seria relacionada con este brote en curso —¿Por qué no hay fotos del clásico Ebola? Si este brote es real, y esto es Ebola después de todo, está tan radicalmente alterado de sus características previas que en absoluto es el mismo bicho. Claramente, lo que estamos viendo con este brote no es el Ébola normal.

60 .- traducción al Español en pg. 293

292.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://mobile.wnd.com/2014/09/1-2-million-ebola-deaths-projected-in-6-months/ WND EXCLUSIVE

1.2 million Ebola deaths projected in 6 months

Alarmed researcher presents econometric simulation model Jerome R. Corsi

NUEVA YORK - Un modelo de simulación econométrico basado en el supuesto de que la Organización Mundial de la Salud y otros estamentos sean incapaces de controlar el brote de Ébola en África Occidental predice que morirán 1,2 millones de personas a causa de la enfermedad en los próximos seis meses.

Seis meses es el tiempo mínimo necesario para que los proyectos de la OMS se vean en disposición de contener la epidemia.

En su análisis, el asistente de investigación de econometría, Francis Smart en la Universidad Estatal de Michigan se tomó en serio las conclusiones de investigadores canadienses cuando demostraron que la cepa de Ebola de la presente epidemia en África Occidental podría podría transmitirse por vía aérea.

Smart apunta que el virus del Ébola podría transmitirse entre los seres humanos a través de la respiración.

En el desarrollo del modelo, Smart comenzó con la declaración de la OMS de 28 de agosto que la epidemia de Ébola en África occidental podría afectar a más de 20.000 personas antes de ser puesto bajo control.

"Esto [la estimación de 20.000] asume el apoyo internacional completo para una intervención para el control del brote mortal", escribió. "El no apoyar el plan de la OMS, presumiblemente, podría causar que la enfermedad siga difundiéndose de manera similar a como lo está haciendo."

Smart continuó: "Al principio una cifra tan alta como 20.000 parece exagerada, especialmente cuando uno se fija en el número de 3.000 casos anunciados en el mismo día de la declaración.

Sin embargo, creo que esta estimación es muy muy conservadora, basada por completo en la expectativa de una misión de ayuda internacional eficaz y bien financiada ".

293.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21 Aplicando suposiciones opuestas, Smart llegó a una conclusión totalmente diferente.

"Usando una proyección de todos los informes de la OMS hasta la fecha (05 de septiembre), yo calculo que si la enfermedad continúa propagándose al ritmo actual es cuando tendremos más de 20.000 casos por el 24 de octubre. En el informe se afirma que probablemente se dispondrá de seis a nueve meses para detener la epidemia. Sin embargo, si nada cambia y la epidemia continúa haciendo estragos como lo hace actualmente, entonces mis proyecciones estiman que alrededor de 4,7 millones de personas se han infectado y 1,2 millones ya habrán muerto ".

Smart, argumenta la posibilidad de las proyecciones, teniendo en cuenta la población de Liberia que es de más de 4 millones, con 10 millones en Guinea y 6 millones en Sierra Leona.

Con estos números, sostiene que la verdadera pregunta es: "? ¿Pensamos en la capacidad de Liberia y las otras naciones afectadas para controlar la propagación del ébola, si aumentará, disminuirá o permanecerá igual en el tiempo" Analizando los datos, concluyó que Liberia está muy por detrás de Guinea, Sierra Leona y Nigeria en cuanto a capacidad para diagnosticar, aislar y tratar a las víctimas de Ébola.

"Esto y la conocida falta de servicios médicos me sugiere que a medida que la crisis se intensifique la capacidad de Liberia para mantener un sentido de orden y con ella cualquier esperanza de controlar la propagación de la enfermedad es propensa a la degradación", dijo.

"Si este es el caso, entonces es muy posible que incluso esta proyección horrible tan solo sea una subestimación del dolor y la carnicería que pueda derivarse de este brote."

El análisis de Smart es consecuente con la evaluación actual del brote de la Directora General de la OMS, Margaret Chan. En una teleconferencia Viernes conducida desde Ginebra, dijo que no quedaba ni una sola cama de hospital disponible en Liberia para los nuevos infectados con Ébola.

La falta de instalaciones condena a las nuevas víctimas infectadas con Ébola en Liberia a permanecer en las calles o regresar a sus comunidades de origen, aumentando dramáticamente la probabilidad de que más individuos adicionales se infecten a través del contacto físico.

El jueves, WND informó el Dr. Peter Piot, co-descubridor del virus del Ébola, en una editorial publicada en la revista Science, argumentó el brote de Ébola en África occidental ha creado una "tormenta perfecta". Señaló a los servicios de salud disfuncionales como resultado de décadas de guerra, la falta de confianza pública en el gobierno y en la medicina occidental, las creencias tradicionales, las negativas sobre la práctica o la existencia de las prácticas de virus y las costumbres de enterramiento que incluyen el contacto con cuerpos contaminados infectados por Ébola.

Piot fue muy crítico con la actual respuesta internacional al brote de Ébola en África Occidental. Acusó a los gobiernos locales y la comunidad internacional "han sido lentos en actuar de una manera acorde a una gran amenaza para la salud, la economía y la estabilidad de la sociedad."

Señaló que tomó casi cuatro meses después de que el primer paciente muriera en diciembre de 2013, antes de que el brote fuera confirmado como causadado por el virus del Ébola. La OMS y los gobiernos interesados esperaron hasta agosto antes de declarar la epidemia como una emergencia de salud pública, a pesar de las múltiples advertencias de Médecins Sans Frontières o Médicos Sin Fronteras.

Los cálculos de Smart le llevaron a instar a las autoridades de salud en todo el mundo a utilizar todos los recursos médicos disponibles para contener y limitar la propagación de la epidemia de Ebola en África Occidental.

294.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

"Es muy tonto pensar que nación alguna sea inmune a esta enfermedad. Hasta ahora, en toda la historia de los brotes de Ébola hasta la actualidad, menos de 10.000 personas han sido infectadas ", escribió.

"Sin embargo, si mis proyecciones están medianamente acertadas, entonces el número de personas infectadas van a ser mucho más elevado de lo que nunca haya ocurrido anteriormente. Esto creará muchos más hábitats en los que el virus pueda posiblemente mutar incorporando nuevos rasgos que podrían aumentar su velocidad de transmisión " En conclusión, dijo que la posibilidad de que el virus del Ébola pudiera ser llevado por el aire incrementaría significativamente su capacidad de transmisión.

Smart escribió, "La posibilidad de que pudiera transmitirse por el aire podría dar como resultado una propagación mundial de la enfermedad con el resultado de un número de fallecimientos sin precedentes en todo el mundo siendo más que prudente invertir fuertemente en el control del número de nuevos pacientes infectados por esta enfermedad".

También señaló que la enfermedad, incluso si no muta para propagarse por vía aérea, se ha transmitido rápidamente, incluso entre los trabajadores de la salud.

"Estos trabajadores de la salud deberían haber sabido controlar la propagación de la enfermedad y prevenir la infección. ¿Realmente podemos esperar que la población en general va a estar mejor preparada para protegerse, que los especialistas que ya han sido víctimas, si la enfermedad fuera a entrar en cualquier otra nación en la Tierra? " Su conclusión era alarmante.

"Por lo tanto, es imperativo que hagamos todo a nuestro alcance para controlar la propagación de esta terrible enfermedad", subrayó.

"Incluso si mi modelo sólo tiene una probabilidad del 10 por ciento de precisión en los próximos seis meses, que sería muy tonto como para arriesgarse no responder a este brote con todos los recursos y armándose con todo valor que la humanidad sea capaz"

295.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

http://www.jimstonefreelance.com/ Sep 13 2014 <correos recibidos>

--Las incertidumbres del Ébola Jim escribió: No hay 1 foto verificable de un paciente con signos o indicios de la enfermedad emergente en curso. Cualquier "imágen actuales" muestra lo que sólo parecen ser "personas" acostadas en una cama a las que se está cuidando. NO hay sudor visible, no se aprecian lesiones, tampoco una pérdida de peso espectacular … nada … además … la mitad de las imágenes de los técnicos que trabajan en los laboratorios de turno no llevan gafas o máscaras faciales … simplemente no es correcto.

El Huff PO ha publicado un extenso artículo compuesto de "imágenes" y, repáselo de arriba a abajo; no advertirá ni una sola fotografía comprobable de un paciente infectado o una en la que se aprecie que los médicos visten con el equipamiento adecuado para una situación de biocontención de Nivel 4 … PERO GSK ya está trabajando en una vacuna …

Cada año trae una vacuna a bombo y platillo … SARS, porcina, gripe en general, ahora ébola con síntomas completamente diferentes, duración y aparentemente el tiempo de recuperación … cualquiera con 1 año de la escuela de medicina sabe que esto está mal ...

Aquí está el artículo Huff PO … http://www.huffingtonpost.com/2014/07/29/ebola-brotewest-africa-fotos-virus_n_5631405.html Mi respuesta: Tiene razón, y yo mismo sospecho que todo puede ser sólo un engaño cuya finalidad es hacer que la gente se acceda a las vacunaciones forzosas. Sin embargo, si estoy equivocado en mis sospechas, y esta aún siendo real se trata de una versión modificada que no muestra los síntomas clásicos, y convenciera a la gente para que no hiciera nada, entonces estaría haciendo mucho daño. Así que, para ser responsable yo recomiendo que todas las personas se abastezcan de vitamina C. Siento que este es un punto medio perfecto. Si no es real, entonces no has perdido prácticamente nada consiguiendo esa vitamina C, y si lo tomas, no pierdes nada, pero tienes todas las de perder si aceptas una vacuna de un sistema en el que todos sabemos ahora que no se puede confiar después de que fuera puesto patas arriba en su totalidad por un informante del CDC. Estoy haciendo lo que puedo para proteger a las personas con la información correcta, lo mejor que puedo para llegar con la esperanza de conseguir que algunas personas increiblemente malas cancelen lo que han planeado con este "ébola", real o no, y si es real, arrancarlo del laboratorio que lo ha creado.

Para los archivos, el Ébola es un enorme virus que se ha encontrado en forma fósil. A partir de los fósiles, han podido deducir que las cinco cepas existentes no han mutado ni una sola vez en más de 50.000 años. Ébola era un virus estable, ¿por qué ahora ha este “nuevo” virus de acuerdo con la línea oficial, ha metamorfoseado más de 400 veces? ¿podría ser que un 296.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

laboratorio bio-genética hubiera liberado algo totalmente nuevo e inestable? Si este no es el caso, todo ha sido un engaño. De cualquier manera, el grupo de la “Agenda 21” ha sido DESCUBIERTO, DESTAPADO y NO HAY VACUNA QUE FUNCIONE contra un virus, real o no, que ha mutado más de 400 veces.

ACTUALIZACIÓN: ¡Bill Gates está financiando la vacuna del Ébola, y cualquiera que conozca las tendencias de Bill Gates y “sus” vacunas anti-fertilidad sabe lo que eso significa!

---

297.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21

indice July 31 2014.-. http://www.-.jimstonefreelance.-.com/ El brote de Ébola está revistiendo un cariz espeluznante

001

August 1, 2014.-. http://www.-.jimstonefreelance.-.com/ Ha sido enviado a este sitio web el tratamiento para el ébola, acompañado del MOA3.

003

August 2 2014.-. http://www.-.jimstonefreelance.-.com/ Se ha publicado un post sobre el ébola con el potencial de salvar el mundo con fecha de 1 de agosto (ver pg 11)

008

Feb 4 2012.-. http://www.-.jimstonefreelance.-.com/ REPETICIÓN DE LA ADVERTENCIA: La plata coloidal es para patógenos metabólicos, NI VIRUS NI ÉBOLA

009

August 4 2014.-. http://www.-.jimstonefreelance.-.com/ Aquí está, la patente de la versión actual del EBOLA (Inglés)

011

August 7 2014.-. http://www.-.jimstonefreelance.-.com/ Además, hoy se ha publicado (ver más adelante) una gran sección sobre el Ébola Un enfermero anónimo publicó lo siguiente en un foro

043 046

August 8 2014.-. http://www.-.jimstonefreelance.-.com/ No hay casos de ébola en México

049

August 10 2014.-. http://www.-.jimstonefreelance.-.com/ Las Muertes por Ébola ha alcanzado la cifra de 1.000 que en mi opinión hace que sea un brote real, y encaja perfectamente con el ritmo de expansión previamente calculada de 1.83 mensual

050

August 11 2014.-. http://www.-.jimstonefreelance.-.com/ ———> (ENLACE EXTERNO) http://.-.theunhivedmind.-.com/UHM/ebola-biosecurity-level-4-safety-procedures-now-breached-in-spain-2/ Ebola. Se incumplen en España los procedimientos BSL de categoría 4. Brecha en la seguridad.

By - The Unhived Mind - 11 de agosto 2014

051

August 11 2014.-. ———> (COMPLEMENTO PREPARADO POR LOS TRADUCTORES) Explicación Niveles de Bio Seguridad: BSL1 al BSL5

059

August 13 2014.-. http://www.-.jimstonefreelance.-.com/ El virus Ebola sigue con la curva de expansión mensual 1.83

061

August 15 2014.-. http://www.-.jimstonefreelance.-.com/ Una aclaración necesaria sobre la vitamina C y el ébola ((comentario de un lector))

065

On 2014-08-18.-. http://www.-.jimstonefreelance.-.com/ Mi buzón está saturado con correos de los desinformadores de la vitamina C

067

August 19 2014.-. http://www.-.jimstonefreelance.-.com/ Se acelera la expansión del ébola

069

August 20 2014.-. http://www.-.jimstonefreelance.-.com/ Actualizaciones del Ébola

072

August 21 2014.-. http://www.-.jimstonefreelance.-.com/ Ebola, parvovirus y Vitamina C - ¿Es que tiene el Parvo la respuesta?

075

August 23 2014.-. http://www.-.jimstonefreelance.-.com/ El medicamento experimental ZMapp es un fracaso

078

August 25th, 2014.-. http://www.-.jimstonefreelance.-.com/ ———> (ENLACE EXTERNO) http://.-.investmentwatchblog.-.com/zmap-failure-liberia-doctor-given-experimental-ebola-drug-dies/ ¡Fracaso del medicamento Zmapp! Liberia: Un doctor infectado de ébola muere tras serle administrado el fármaco experimental

079

298.-.de.-.300.-.www.jimstonefreelance.com

Brote de ébola .-. la agenda 21 .-. o .-. el programa 21 August 27 2014.-. http://www.-.jimstonefreelance.-.com/ Fiasco en el CDC por Enterrar un enlace que relaciona las vacunas con el Autismo

080

August 28 2014.-. http://www.-.jimstonefreelance.-.com/ Confirmación completa: la recomendación de la Vitamina C como coadyuvante para Contrarrestar el ébola no es un Sabotaje.

082

August 29 2014.-. http://www.-.jimstonefreelance.-.com/ Actualización Ébola (hace tiempo que debería estar esto aquí) Comentario por Steve Hickey PhD, Hilary Roberts PhD, y Damien Downing MBBS, MSB. (OMNS 20 de agosto 2014)

087 090

August 29 2014.-. ———> (COMPLEMENTO PARA ESPAÑA PREPARADO POR LOS TRADUCTORES) Vitamina C: 1 kg 19,95 € .-. Enlaces de interés .-. Observaciones básicas para un encierro prolongado

098

September 2, 2014.-. http://www.-.jimstonefreelance.-.com/ ¿A ver si después de todo el brote de ébola va a resultar algún tipo de fraude con intenciones aún por desvelar?

“PESADILLA CONTAMINADA” por: Dr. Sarah Stone, Pharm-D. Jim Stone, periodista independiente. Russ Clarke, Editor

101 103

September 2, 2014.-. ———> (COMPLEMENTO PARA ESPAÑA PREPARADO POR LOS TRADUCTORES) Núcleo del presente capítulo: LA DESPOBLACIÓN La fiebre porcina es una farsa - Jane Bürgermeister Cargos criminales concernientes a actos de bioterrorismo y genocidio.-. Resumen 1º ———> (ENLACE EXTERNO).-. http://www.bibliotecapleyades.net/ciencia/ciencia_influenza53.htm MUY IMPORTANTE información sobre el peligro de las vacunas de la gripe A o H1N1 Documento “A_June_10th“, en Inglés. 153 pgs. Descargar original aquí: https://mega.co.nz/#!wNRjCI6D!FyU9zERzHwZRsNT5OdJz5k5ZIVl49-KnbSgOZgVeUts http://www.mediafire.com/view/to0w7udtbvs9ew7/A_June_10th.pdf Traducción al Español. Resumen del documento 'A_June_10 th', 30 pgs. ———> (ENLACE EXTERNO) Fuente: www.-.free-news.-.org/PDFs/Jane_Burgermeister-Dossier.pdf Cargos penales relativos a actos Bioterrorismo y Genocidio.

Informaciones, anotaciones y extractos de textos. Gripe aviar o porcina y «Nuevo Orden Mundial» Por el Dr. Leonard G. Horowitz ¡La gripe porcina de 2009 es la gripe española de 1918! ¿Un arma bacteriológica? Por la Dra. Alma True Ott45, PhD, ND

108 109 110

250 265 273

Artículo “Enlace permanente” de Septiembre 2014.-.http://www.-.jimstonefreelance.-.com/ebolanotnormal.html Continuación del desarrollo y evolución de lo concerniente al brote de Ébola

285

Artículo “Enlace permanente” de Septiembre 2014 – Actualización 12 Septiembre 2014 http://www.-.jimstonefreelance.-.com/ebolanotnormal.html Continuación del desarrollo y evolución de lo concerniente al brote de Ébola

288

Sep 12 2014.-. http://www.-.jimstonefreelance.-.com/ En estos momentos estoy indeciso sobre si el brote de ébola es real o un engaño.

Pero este es un gran artículo, para compensar el que sigue. Ébola es mi principal tema de interés en este momento y estoy tratando de averiguar si es real o un fraude bien orquestado. Más de 400 modificaciones genéticas.

SI Ébola es real, está superando la tasa de expansión 1.83 mensual de la que hablé anteriormente.

291

Sep 12 2014.-. ———> (ENLACE EXTERNO) http://.-.mobile.wnd.-.com/2014/09/1-2-million-ebola-deaths-projected-in-6-months/ WND EXCLUSIVE.-.1.2 million Ebola deaths projected in 6 months Alarmed researcher presents econometric simulation model.-.Jerome R. Corsi

293

Sep 13 2014.-. http://www.-.jimstonefreelance.-.com/ <correos recibidos> --- Las incertidumbres del Ébola

296

299.-.de.-.300.-.www.jimstonefreelance.com

Brote de ĂŠbola .-. la agenda 21 .-. o .-. el programa 21

300.-.de.-.300.-.www.jimstonefreelance.com